These are representative sample records from related to your search topic.
For comprehensive and current results, perform a real-time search at

Alpha Thalassemia  


Alpha Thalassemia ? Physicians often mistake alpha thalassemia trait for iron deficiency anemia and incorrectly prescribe iron supplements that have no effect on the anemia. Normal alpha globin genes found on ...


Etude des phenomenes dynamiques ultrarapides et des caracteristiques impulsionnelles d'emission terahertz du supraconducteur YBCO  

NASA Astrophysics Data System (ADS)

Les premieres etudes d'antennes a base de supraconducteurs a haute temperature critique emettant une impulsion electromagnetique dont le contenu en frequence se situe dans le domaine terahertz remontent a 1996. Une antenne supraconductrice est formee d'un micro-pont d'une couche mince supraconductrice sur lequel un courant continu est applique. Un faisceau laser dans le visible est focalise sur le micro-pont et place le supraconducteur dans un etat hors-equilibre ou des paires sont brisees. Grace a la relaxation des quasiparticules en surplus et eventuellement de la reformation des paires supraconductrices, nous pouvons etudier la nature de la supraconductivite. L'analyse de la cinetique temporelle du champ electromagnetique emis par une telle antenne terahertz supraconductrice s'est averee utile pour decrire qualitativement les caracteristiques de celle-ci en fonction des parametres d'operation tels que le courant applique, la temperature et la puissance d'excitation. La comprehension de l'etat hors-equilibre est la cle pour comprendre le fonctionnement des antennes terahertz supraconductrices a haute temperature critique. Dans le but de comprendre ultimement cet etat hors-equilibre, nous avions besoin d'une methode et d'un modele pour extraire de facon plus systematique les proprietes intrinseques du materiau qui compose l'antenne terahertz a partir des caracteristiques d'emission de celle-ci. Nous avons developpe une procedure pour calibrer le spectrometre dans le domaine temporel en utilisant des antennes terahertz de GaAs bombarde aux protons H+ comme emetteur et detecteur. Une fois le montage calibre, nous y avons insere une antenne emettrice dipolaire de YBa 2Cu3O7-delta . Un modele avec des fonctions exponentielles de montee et de descente du signal est utilise pour lisser le spectre du champ electromagnetique de l'antenne de YBa 2Cu3O7-delta, ce qui nous permet d'extraire les proprietes intrinseques de ce dernier. Pour confirmer la validite du modele choisi, nous avons mesure les proprietes intrinseques du meme echantillon de YBa2Cu3O7- delta avec la technique pompe-visible et sonde-terahertz donnant, elle aussi, acces aux temps caracteristiques regissant l'evolution hors-equilibre de ce materiau. Dans le meilleur scenario, ces temps caracteristiques devraient correspondre a ceux evalues grace a la modelisation des antennes. Un bon controle des parametres de croissance des couches minces supraconductrices et de fabrication du dispositif nous a permis de realiser des antennes d'emission terahertz possedant d'excellentes caracteristiques en terme de largeur de bande d'emission (typiquement 3 THz) exploitables pour des applications de spectroscopie resolue dans le domaine temporel. Le modele developpe et retenu pour le lissage du spectre terahertz decrit bien les caracteristiques de l'antenne supraconductrice pour tous les parametres d'operation. Toutefois, le lien avec la technique pompe-sonde lors de la comparaison des proprietes intrinseques n'est pas direct malgre que les deux techniques montrent que le temps de relaxation des porteurs augmente pres de la temperature critique. Les donnees en pompe-sonde indiquent que la mesure du temps de relaxation depend de la frequence de la sonde, ce qui complique la correspondance des proprietes intrinseques entre les deux techniques. De meme, le temps de relaxation extrait a partir du spectre de l'antenne terahertz augmente en s'approchant de la temperature critique (T c) de YBa2Cu 3O7-delta. Le comportement en temperature du temps de relaxation correspond a une loi de puissance qui est fonction de l'inverse du gap supraconducteur avec un exposant 5 soit 1/Delta 5(T). Le travail presente dans cette these permet de mieux decrire les caracteristiques des antennes supraconductrices a haute temperature critique et de les relier aux proprietes intrinseques du materiau qui les compose. De plus, cette these presente les parametres a ajuster comme le courant applique, la puissance de la pompe, la temperature d'operation, etc, afin d'optimiser l'emission et les performances de ces

Savard, Stephane


A Fast New DES Implementation in Software  

Microsoft Academic Search

. In this paper we describe a fast new DES implementation. This implementation is about five times faster than the fastest known DES implementation on a (64-bit) Alpha computer, and about three times faster than than our new optimized DES implementation on 64-bit computers. This implementation uses a non-standard representation, and view the processor as a SIMD computer, i.e., as

Eli Biham



Direction des Ressources Humaines Gestion Prvisionnelle des  

E-print Network

et des plantes transgéniques (OGM). Contraintes / sujétions particulières du poste : Déplacements à l produits toxiques, des produits contaminants et des plantes transgéniques (OGM) CONNAISSANCES REQUISES #12

Sart, Remi


The Activity of Gamma Emitters as Measured by Ionization Chambers. The Determination of the Specific Gamma Emission Coefficient for Some Radioelements (thesis); MESURE DE L'ACTIVITE DES EMETTEURS GAMMA PAR CHAMBRES D'IONISATION. DETERMINATION DU COEFFICIENT SPECIFIQUE D'EMISSION GAMMA DE QUELQUES RADIOELEMENTS (thesis)  

Microsoft Academic Search

The object of this work is to study techniques of measurement using the ; gamma ionization chamber, making it possible either to measure the activities of ; radioactive sources, or to determine the specific emission coefficient gamma ; (or the coefficient K) of a given radio-element. The ionization chambers studied ; belong to two categories: graphite cavity-chambers, and 4 pi




Alpha College Today.  

ERIC Educational Resources Information Center

Presents a follow-up report on Alpha, an experimental unit of the College of DuPage in Illinois. Traces the postgraduation activities of Alpha graduates and describes new Alpha programs and projects. (CAM)

Leppert, William A.



Alpha-1 Antitrypsin Deficiency  


... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...



E-print Network

terbium, le thullium et l'or par des courbes de transmission avec mesures de courant. Les pertes d, terbium, thullium and gold by transmission curves with current measurements. Energy losses through a given des particules alpha dans le terbium et le thullium, ainsi que les pouvoirs d'arrêt; nous nous sommes

Paris-Sud XI, Université de


Alpha One Foundation  


... Tested Research Donate Upcoming events Alphas of Northern Illinois Support Group Meeting (3/21/2015 11:00 ... 00 AM - 2:00 PM Alphas of Northern Illinois Support Group Meeting Saturday, March 21st from 11: ...


Alpha Hydroxy Acids  


... page Home Cosmetics Products & Ingredients Ingredients Alpha Hydroxy Acids See also: Guidance for Industry: Labeling for Cosmetics Containing Alpha Hydroxy Acids The following information is intended to answer questions ...


Alpha Thalassemia (For Parents)  


Thalassemias Thalassemias are a group of blood disorders that affect the way the body makes hemoglobin, a ... results in that type of thalassemia. About Alpha Thalassemia Alpha thalassemia occurs when the gene that controls ...


The Alpha Centauri System.  

ERIC Educational Resources Information Center

Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

Soderblom, David R.




EPA Science Inventory

The determination of concentrations of natural radioactivity in public water supplies begins with the measurement of the gross alpha particle activity. The gross alpha activity measurement is used as a screening technique. The gross alpha particle activity measurement may be su...


Effet des innovations organisationnelles et des technologies de l'information sur le rendement des entreprises  

Microsoft Academic Search

Dans ce document, on vise a determiner si les investissements dans les technologies de l'information et des communications, combines a des changements organisationnels et aux competences des travailleurs, contribuent a ameliorer le rendement des entreprises canadiennes.

Wulong Gera Surendra Gu



Universit de Lausanne, Institut des sciences sociales des religions contemporaines cole Pratique des Hautes tudes, Section des sciences religieuses  

E-print Network

Université de Lausanne, Institut des sciences sociales des religions sciences des religions de l'Université de Lausanne (Suisse) pour l'obtention du Doctorat en Sciences des contemporaines ?cole Pratique des Hautes ?tudes, Section des sciences religieuses

Paris-Sud XI, Université de


Rheologie des Polymeres Charges  

NASA Astrophysics Data System (ADS)

Une etude des proprietes rheologiques en ecoulement oscillatoire et en ecoulement transitoire a ete realisee sur des suspensions de particules spheriques dans des solutions de polymere d'une part et dans des polymeres a l'etat fondu d'autre part. Une attention particuliere a ete portee sur l'influence des parametres suivants sur les proprietes en ecoulement de ces fluides complexes: nature du fluide suspendant, fraction volumique en particule, temperature. Apres analyse des resultats, de nouveaux modeles empiriques ont ete proposes afin de predire l'allure des courbes d'ecoulement de ces suspensions en cisaillement oscillatoire. Enfin, certaines analogies entre les proprietes visqueuses et viscoelastiques des suspensions dans les deux milieux mentionnes precedemment ont ete discutees.

Lepez, Olivier


Rossi Alpha Method  

SciTech Connect

The Rossi Alpha Method has proved to be valuable for the determination of prompt neutron lifetimes in fissile assemblies having known reproduction numbers at or near delayed critical. This workshop report emphasizes the pioneering applications of the method by Dr. John D. Orndoff to fast-neutron critical assemblies at Los Alamos. The value of the method appears to disappear for subcritical systems where the Rossi-..alpha.. is no longer an ..alpha..-eigenvalue.

Hansen, G.E.




E-print Network

DTERMINISME DE LA CONSTRUCTION DES CELLULES DE MALES ET DES CELLULES D'OUVRIRES CHEZ APIS-sur-Yvette Facult des Sciences Rennes I,e problme du dterminisme de construction des cellules mles et des cellules d'ouvrires chez APis Mellifica n'a pas t tudi jusqu' prsent par beaucoup d'auteurs. 1,e

Paris-Sud XI, Universit de


Triangle des vitesses Failles transformantes  

E-print Network

Triangle des vitesses ab Failles transformantes A B A B TD - UE Terre Profonde #12;Triangle des vitesses ab A B Dorsales A B TD - UE Terre Profonde #12;Triangle des vitesses ab B A B A Subduction TD - UE Terre Profonde #12;Triangle des vitesses B A A B C C TD - UE Terre Profonde #12;Triangle des vitesses B

Grigné, Cécile


Imaging alpha particle detector  


A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, D.F.



Event counting alpha detector  


An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

Bolton, R.D.; MacArthur, D.W.



Imaging alpha particle detector  


A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, David F. (Los Alamos, NM)



Alpha-particle diagnostics  

SciTech Connect

This paper will focus on the state of development of diagnostics which are expected to provide the information needed for {alpha}- physics studies in the future. Conventional measurement of detailed temporal and spatial profiles of background plasma properties in DT will be essential for such aspects as determining heating effectiveness, shaping of the plasma profiles and effects of MHD, but will not be addressed here. This paper will address (1) the measurement of the neutron source, and hence {alpha}-particle birth profile, (2) measurement of the escaping {alpha}-particles and (3) measurement of the confined {alpha}-particles over their full energy range. There will also be a brief discussion of (4) the concerns about instabilities being generated by {alpha}-particles and the methods necessary for measuring these effects. 51 refs., 10 figs.

Young, K.M.




E-print Network

UN DES ROLES DES CHAINES D'ABEILLES : LA TORSION DES RAYONS POUR LES RENDRE PARALLLES ENTRE EUX R rgissant le parall- lisme des rayons et dcrit la technique des Abeilles qui l'tablissent. Ces insectes utilisent en particulier deux mthodes pour rendre parallle un rayon plac anormalement : W Ils allongent

Paris-Sud XI, Universit de


Genetics Home Reference: Alpha thalassemia  


... Recent literature OMIM Genetic disorder catalog Conditions > Alpha thalassemia On this page: Description Genetic changes Inheritance Diagnosis ... Glossary definitions Reviewed August 2009 What is alpha thalassemia? Alpha thalassemia is a blood disorder that reduces ...


Mdecine des voyages  

PubMed Central

Rsum Objectif Dfinir la pratique de la mdecine des voyages, prsenter les lments fondamentaux dune consultation complte pralable aux voyages des voyageurs internationaux et aider identifier les patients quil vaudrait mieux envoyer en consultation auprs de professionnels de la mdecine des voyages. Sources des donnes Les lignes directrices et les recommandations sur la mdecine des voyages et les maladies lies aux voyages publies par les autorits sanitaires nationales et internationales ont fait lobjet dun examen. Une recension des ouvrages connexes dans MEDLINE et EMBASE a aussi t effectue. Message principal La mdecine des voyages est une spcialit trs dynamique qui se concentre sur les soins prventifs avant un voyage. Une valuation exhaustive du risque pour chaque voyageur est essentielle pour mesurer avec exactitude les risques particuliers au voyageur, son itinraire et sa destination et pour offrir des conseils sur les interventions les plus appropries en gestion du risque afin de promouvoir la sant et prvenir les problmes mdicaux indsirables durant le voyage. Des vaccins peuvent aussi tre ncessaires et doivent tre personnaliss en fonction des antcdents dimmunisation du voyageur, de son itinraire et du temps quil reste avant son dpart. Conclusion La sant et la scurit dun voyageur dpendent du degr dexpertise du mdecin qui offre le counseling pralable son voyage et les vaccins, au besoin. On recommande ceux qui donnent des conseils aux voyageurs dtre conscients de lampleur de cette responsabilit et de demander si possible une consultation auprs de professionnels de la mdecine des voyages pour tous les voyageurs risque lev.

Aw, Brian; Boraston, Suni; Botten, David; Cherniwchan, Darin; Fazal, Hyder; Kelton, Timothy; Libman, Michael; Saldanha, Colin; Scappatura, Philip; Stowe, Brian



Semiconductor polycrystalline alpha detectors  

Microsoft Academic Search

In order to check possible novel neutron detectors based on composite semiconductor detectors containing nuclides with large cross sections for neutron, we tested their response to alpha particles. In the present paper we describe results obtained with composite samples made of hexagonal Boron Nitride particles bound with Polystyrene or Nylon-6. The samples were tested under 5.5 MeV alpha particle radiation

M. Schieber; M. Roth; A. Zuck; G. Marom; O. Khakhan; Z. B. Alfassi




E-print Network

EVOLUTION DES OUTILS DE CONTRLE ET DES CRITERES DE PERFORMANCE, FACE AUX DEFIS DE CHANGEMENT communication tudie tout d'abord le nouveau contexte stratgique et organisationnel des entreprises contexte stratgique et organisationnel des entreprises en mutation interpelle les outils de contrle de

Paris-Sud XI, Universit de


Elimination des noeuds dans le probleme newtonien des quatre corps  

Microsoft Academic Search

Rsum Nous appliquons la mthode des transformations canoniques variables imposes la rduction du problme newtonien des quatre corps. L'limination du centre de gravit tant suppose faite, le problme est ramen celui des trois corps fictifs. Alors nous menons bien la rduction de aux intgrales des aires explicitement sous forme Hamiltonienne en tenant compte de l'aspect gomtrique

Franoise Boigey; M. Curie



Modelisation des interactions lors de la migration des cellules tumorales  

E-print Network

Mod´elisation des interactions lors de la migration des cellules tumorales Marine AUBERT IMNC% des tumeurs du syst`eme nerveux central. Elles d´erivent des cellules gliales (astrocytes par exemple. En effet, lorsque cette tumeur est diagnostiqu´ee, les cellules tumorales ont d´ej`a envahit une

Aubert, Marine


Politique de gestion des documents administratifs et des archives  

E-print Network

Politique de gestion des documents administratifs et des archives Préparation : Division de la gestion des documents administratifs et des archives Révision : Bureau du secrétaire général Entrée en vigueur : 15 février 2012 Approbation : (CA-2012-6) Cadre juridique : Loi sur les archives (L



E-print Network

MOUVEMENTS DES TROMPES ET PROGRESSION DES UFS CHEZ LA BREBIS S. WINTENBERGER, Jouy-en-Josas. SOMMAIRE Nous avons étudié la motilité des trompes utérines, et leur rôle dans la trompe étudiée soit des ovocytes colorés, soit des particules de matière plastique noire de même taille

Boyer, Edmond


Osmose lectrique des tissues et des cellules sur le vivant  

Microsoft Academic Search

Sommaire I.Sur des tissus vivants, en place sur l'animal, et normalement irrigus, on peut raliser soit travers les interstices cellulaires soit sur la cellule elle mme travers les interstices des micelles protoplasmiques des endosmoses et des exosmoses lectriques.II.Sur l'oeil du lapin ou du chat c'est travers des interstices que les cellules de la corne laissent entre-elles que

Pierre Girard




NSDL National Science Digital Library

AlphaGalileo is designed for science journalists, but anyone with an itch for breaking academic news will enjoy this research-rich site. Readers may browse by region, including Africa, Asia, Caribbean, Europe, Latin America, Middle East, North America, Oceania, and this Scout Editor??s favorite: Extraterrestrial. Next, try trawling the site by Science, Health, Society, Humanities, Arts, Applied Science, and Business for the latest illuminating research in each of these fields. AlphaGalileo also issues News Releases, usually five or six paragraphs long, that cover particularly interesting research findings. Best of all, since the Scout Report previously covered AlphaGalileo back in 2007, the site has dropped its membership requirements and visitors can browse more freely than ever.


Le Point sur la Pharmacologie des Agents Anesthesiques Chez le Brule Grave  

PubMed Central

Summary La pharmacologie des agents anesthsiques chez le brl est variable et imprvisible. Dans les premires 48 h, il y a une hypovolmie avec chute du dbit cardiaque et des fuites plasmatiques. Aprs 48 h, il y a une hypervolmie avec augmentation du dbit cardiaque, hypermtabolisme et la clearance des mdicaments est augmente. Parmi les facteurs de dsquilibre, on retrouve les variations des protines plasmatiques. Deux protines sont importantes chez le brl grave : l'albumine et l'alpha 1- glycoprotine. Leur taux varie beaucoup au cours de l'volution de la brlure. Les agents anesthsiques dont la liaison avec ces deux protines est prdominante verront leur pharmacocintique modifie. L'anesthsiste-ranimateur du service des brls va matriser ces notions pharmacologiques pour utiliser bon escient les agents anesthsiques. PMID:21991108

Siah, S.; Ababou, K.; Benziane, H.; El Jaoudi; Bensghir, M.; Bakali, H.; El Wali, A.; Ihrai, I.; Drissi, N.K.



Archives participatives Au milieu des ralisations remarquables de mdiation numrique des bibliothques et des  

E-print Network

Archives participatives Au milieu des réalisations remarquables de médiation numérique des bibliothèques et des musées sur les médias sociaux, les services d'archives ont un positionnement relativement en revanche des projets ambitieux de crowdsourcing, d'« archives participatives » (voir encart

Paris-Sud XI, Université de


Semiconductor polycrystalline alpha detectors  

NASA Astrophysics Data System (ADS)

In order to check possible novel neutron detectors based on composite semiconductor detectors containing nuclides with large cross sections for neutron, we tested their response to alpha particles. In the present paper we describe results obtained with composite samples made of hexagonal Boron Nitride particles bound with Polystyrene or Nylon-6. The samples were tested under 5.5 MeV alpha particle radiation emitted from 241Am source and 4.8MeV alpha particle of 226Ra source. Some of the responses of these composite detectors to thermal neutrons were already reported and here we shall show some newer results obtained with thermal neutrons, from a low intensity 241Am - 9Be and also from a medium intensity 252Cf source, which were thermalized using 10 cm thick paraffin. The Alpha detection experiments show that all the tested samples, regardless of the binder, show a well-defined peak around the 270 energy channel. There was very little polarization of the alpha radiation, since the amplitude of the alpha peak is reduced after ~ 2min from start of the irradiation, from 100% to 95% and it stayed stable at this level for another 10 minutes. The alpha spectrum detected from a PbI II single crystal is also shown for comparison. The neutron spectrum obtained by the composite BN samples showed an apparent peak around the 150 energy channel. The Signal to noise ratio for neutron detection from radionuclide shown here is about 2 only, whereas recent results to be published later, obtained with our composite BN detectors from a neutron beam of about 10 7 sec -1cm -2 is ~2 5. The 1.4 and 1.7 MeV alpha peaks resulting from the nuclear reaction of thermal neutrons with 10B of the boron nitride detector are not buried in the noise range. The capacitance noise requires small contact areas, therefore for large area detectors it is necessary to produce an electronic read-out device which can add up a multitude of small (less than pixilated contacts.

Schieber, M.; Roth, M.; Zuck, A.; Marom, G.; Khakhan, O.; Alfassi, Z. B.



Influence des tanins hydrolysables de chtaignier sur le mtabolisme azot des ovins et des caprins  

E-print Network

Influence des tanins hydrolysables de châtaignier sur le métabolisme azoté des ovins et des caprins Les tanins ont la propriété de se complexer aux protéines. Ceci peut conduire à l'insolubilisation de effets de l'ingestion de tanins sur le métabolisme azoté des ovins et caprins. Des tanins hydrolysables

Paris-Sud XI, Université de


Liver and Alpha-1  


... harm the liver are a virus, such as hepatitis B or C, or a chemical such as alcohol. There is no scientific evidence that carriers with the MS genes are at increased risk for liver disease. What Are Some Symptoms Of Alpha-1 Liver ...


[alpha]-Oxocarboxylic Acids  

ERIC Educational Resources Information Center

Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH

Kerber, Robert C.; Fernando, Marian S.




E-print Network

- tgral sont venus s'adjoindre de nombreux autres concepts et techniques mathmatiques- Mas les changes plusieurs phases : tude de leur cohrence, existence de so- lutions, comportement des solutions, rsolution

Pouyanne, Nicolas


Slectionner Des peuplements endmiques  

E-print Network

milieu naturel, comme pour la bche de mer. Peuplement naturel d'Araucaria columnaris slectionn. plantation exprimentale d'Araucaria columnaris, une des principales espces destines la fort cultive


Cramiques des vivants, cramiques des morts et des sites cultuels l'ge du Bronze en France.  

E-print Network

, European Societies in the Bronze Age, Cambridge, 2000, p. 308. [ ...] des lieux de culte, [...] desCramiques des vivants, cramiques des morts et des sites cultuels l'ge du Bronze en France disparues, ou de vaisselle pour leur consommation. Les cramiques des spultures de l'ge du Bronze halshs

Paris-Sud XI, Universit de


ChemTeacher: Alpha Decay  

NSDL National Science Digital Library

ChemTeacher compiles background information, videos, articles, demonstrations, worksheets and activities for high school teachers to use in their classrooms. The Alpha Decay page includes resources for teaching students about the discovery and applications of alpha decay.



Activation of Penile Proadipogenic Peroxisome Proliferator-Activated Receptor ? with an Estrogen: Interaction with Estrogen Receptor Alpha during Postnatal Development  

PubMed Central

Exposure to the estrogen receptor alpha (ER?) ligand diethylstilbesterol (DES) between neonatal days 2 to 12 induces penile adipogenesis and adult infertility in rats. The objective of this study was to investigate the in vivo interaction between DES-activated ER? and the proadipogenic transcription factor peroxisome proliferator-activated receptor gamma (PPAR?). Transcripts for PPARs ?, ?, and ? and ?1a splice variant were detected in Sprague-Dawley normal rat penis with PPAR? predominating. In addition, PPAR?1b and PPAR?2 were newly induced by DES. The PPAR? transcripts were significantly upregulated with DES and reduced by antiestrogen ICI 182, 780. At the cellular level, PPAR? protein was detected in urethral transitional epithelium and stromal, endothelial, neuronal, and smooth muscular cells. Treatment with DES activated ER? and induced adipocyte differentiation in corpus cavernosum penis. Those adipocytes exhibited strong nuclear PPAR? expression. These results suggest a biological overlap between PPAR? and ER? and highlight a mechanism for endocrine disruption. PMID:18769493

Mansour, Mahmoud M.; Goyal, Hari O.; Braden, Tim D.; Dennis, John C.; Schwartz, Dean D.; Judd, Robert L.; Bartol, Frank F.; Coleman, Elaine S.; Morrison, Edward E.



Damped Lyman alpha Systems  

E-print Network

Observations of damped Lyman alpha systems offer a unique window on the neutral-gas reservoirs that gave rise to galaxies at high redshifts. This review focuses on critical properties such as the H I and metal content of the gas and on independent evidence for star formation. Together, these provide an emerging picture of gravitationally bound objects in which accretion of gas from the IGM replenishes gas consumed by star formation. Other properties such as dust content, molecular content, ionized-gas content, gas kinematics, and galaxy identifications are also reviewed. These properties point to a multiphase ISM in which radiative and hydrodynamic feedback processes are present. Numerical simulations and other types of models used to describe damped Lyman alpha systems within the context of galaxy formation are also discussed.

Arthur M. Wolfe; Eric Gawiser; Jason X. Prochaska



The alpha 21264 microprocessor  

Microsoft Academic Search

The third generation Alpha microprocessor from Compaq Computer Corporation (formerly Digital Equipment) is the 21264. This microprocessor can execute 2.0-2.4 billion instructions per second with a 500-600 MHz cycle time in a 0.35 um CMOS process, resulting in the industry-leading performance of 30+ SPECint95 and 58+ SPECfp95 in early system offerings. This paper focuses on the overall 21264 architecture, as

Richard E. Kessler



Qualit des composts et des digestats Fabienne MULLER  

E-print Network

Qualit des composts et des digestats Fabienne MULLER Direction consommation durable et dchets organiques se construit, avec aujourd'hui le dveloppement important de la mthanisation. Les composts actuellement produits, peuvent l'tre avec des digestats ou non. Les quantits de compost produit ne cessent d

Boyer, Edmond


Bare alpha-alpha Potential and Implications on alpha-MATTER Properties  

Microsoft Academic Search

Double folding alpha - alpha potentials based on the density dependent n - n Gogny interactions are constrained to reproduce the l = 0 resonance in 8Be. Shallow potentials are obtained by successive supersymmetric transformations which eliminate the l = 0 Pauli forbidden states. Implication for the EOS of cold alpha-matter are discussed.

F. Carstoiu; S. Misicu; M. Rizea; M. Lassaut



The DES Story: Lessons Learned

Dr. Robert Hoover discusses the DES followup study, which follows diethylstilbestrol (DES) exposed and unexposed mothers, daughters and sons, and granddaughters for adverse health effects resulting from this exposure.


La biogense des mlanosomes  

PubMed Central

Les mlanocytes situs la base de lpiderme produisent des mlanosomes qui sont transfrs aux kratinocytes pour assurer la pigmentation de lpiderme et sa photoprotection contre les rayons ultraviolets. Les mlanosomes, organites apparents aux lysosomes, sont le lieu de synthse et de stockage dun pigment, la mlanine. Leur formation dpend de protines mlanosomales qui transitent par les voies de biosynthse et dendocytose et exploitent les mcanismes molculaires du trafic intracellulaire. Les acteurs molculaires impliqus dans le transport des protines mlanosomales et la biogense des mlanosomes sont la cible de mutations dans des maladies gntiques accompagnes dhypopigmentation comme lalbinisme et les maladies lysosomales. Les tudes menes sur les mlanocytes issus de souris modles de ces maladies permettent de comprendre certaines des tapes-cls de la mlanogense ainsi que les dysfonctionnements associs ces pathologies. De plus, dcrypter la mlanogense facilite galement la comprhension dautres processus physiologiques, comme lillustrent les similitudes inattendues avec lamylodogense dans les maladies neurodgnratives. PMID:21382323

Delevoye, Cdric; Giordano, Francesca; van Niel, Guillaume; Raposo, Graa



Surface alpha clustering  

SciTech Connect

The problem of alpha decay is discussed on the basis of a theory which describes discrete and continuous states in a unified manner. A formula for numerical calculations is given in which configurational mixing as well as channel coupling is taken into account. The R-matrix approximation is shown to be justified if the width is spread over a small number of decay channels. Generally, renormalization of the wave function is necessary if a factorization of the width is assumed. The importance of channel coupling for the case of a small reduced width is discussed.

Rotter, I.




PubMed Central

Alpha-mannosidosis is an inherited lysosomal storage disorder characterized by immune deficiency, facial and skeletal abnormalities, hearing impairment, and intellectual disability. It occurs in approximately 1 of 500,000 live births. The children are often born apparently normal, and their condition worsens progressively. Some children are born with ankle equinus or develop hydrocephalus in the first year of life. Main features are immune deficiency (manifested by recurrent infections, especially in the first decade of life), skeletal abnormalities (mild-to-moderate dysostosis multiplex, scoliosis and deformation of the sternum), hearing impairment (moderate-to-severe sensorineural hearing loss), gradual impairment of mental functions and speech, and often, periods of psychosis. Associated motor function disturbances include muscular weakness, joint abnormalities and ataxia. The facial trait include large head with prominent forehead, rounded eyebrows, flattened nasal bridge, macroglossia, widely spaced teeth, and prognathism. Slight strabismus is common. The clinical variability is significant, representing a continuum in severity. The disorder is caused by lysosomal alpha-mannosidase deficiency. Alpha-mannosidosis is inherited in an autosomal recessive fashion and is caused by mutations in the MAN2B1 gene located on chromosome 19 (19 p13.2-q12). Diagnosis is made by measuring acid alpha-mannosidase activity in leukocytes or other nucleated cells and can be confirmed by genetic testing. Elevated urinary secretion of mannose-rich oligosaccharides is suggestive, but not diagnostic. Differential diagnoses are mainly the other lysosomal storage diseases like the mucopolysaccharidoses. Genetic counseling should be given to explain the nature of the disease and to detect carriers. Antenatal diagnosis is possible, based on both biochemical and genetic methods. The management should be pro-active, preventing complications and treating manifestations. Infections must be treated frequently. Otolaryngological treatment of fluid in the middle ear is often required and use of hearing aids is invariably required. Early educational intervention for development of social skills is needed and physiotherapy is important to improve bodily function. Orthopedic surgery may be necessary. The long-term prognosis is poor. There is an insidiously slow progression of neuromuscular and skeletal deterioration over several decades, making most patients wheel-chair dependent. No patients manage to be completely socially independent. Many patients are over 50 years of age. PMID:18651971

Malm, Dag; Nilssen, ivind



Background canceling surface alpha detector  


A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

MacArthur, Duncan W. (Los Alamos, NM); Allander, Krag S. (Ojo Caliente, NM); Bounds, John A. (Los Alamos, NM)



Background canceling surface alpha detector  


A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

MacArthur, D.W.; Allander, K.S.; Bounds, J.A.



Long range alpha particle detector  


An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.



Long range alpha particle detector  


An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

MacArthur, Duncan W. (Los Alamos, NM); Wolf, Michael A. (Los Alamos, NM); McAtee, James L. (Los Alamos, NM); Unruh, Wesley P. (Los Alamos, NM); Cucchiara, Alfred L. (Los Alamos, NM); Huchton, Roger L. (Los Alamos, NM)



Conservation des Textiles  

E-print Network

Conservation des Textiles Les 22 et 23 mai 2013 Soit 2 jours - 14 heures OBJECTIFS DE LA FORMATION essentielles dans la gestion de collections textiles, depuis leur identification jusqu'à leur conservation conservation d'éléments et de collections textiles, et toutes personnes travaillant dans le domaine du

Brest, Université de


Fachprfungsordnung des Bachelorstudiengangs Geographie  

E-print Network

Fachprüfungsordnung des Bachelorstudiengangs Geographie an der Ernst Geographie: Inhaltsverzeichnis: § 1 Studium § 2 Zulassungsvoraussetzungen § 3 Module § 4 Berufsbezogenes Bachelorstudiengang Geographie. Ergänzend gilt die Gemeinsame Prüfungsordnung für Bachelor- und Masterstudiengänge

Greifswald, Ernst-Moritz-Arndt-Universität


Das Bandenspektrum des CO +  

Microsoft Academic Search

Zusammenfassung Es wird die Rotationsstruktur der s ? s Banden (1 ? 4, 2 ? 4, 2 ? 5, 3 ? 5, 3 ? 6, 4 ? 7) des CO+ analysiert und eine Nullinienformel fr diese Banden abgeleitet. Von denII ? s-Banden (5 ? 0, 6 ? 0, 7 ? 0, 8 ? 0) wird die Rotationsstruktur analysiert. Jede Bande

D. Coster; H. H. Brons; H. Bulthuis



Die Stoffwechselsituation des Reizleitungssystems  

Microsoft Academic Search

Zusammenfassung Die spezifische Muskulatur des Reizleitungssystems unterscheidet sich u. a. von der Arbeitsmuskulatur durch ein vermindertes Vorkommen von Sarkosomen, eine schwchere Bernsteinsuredehydrogenase-und Oxydasereaktion und einen geringeren Sauerstoffverbrauch. Wir schlieen daraus auf einen stoffwechselmigen Unterschied zwischen den beiden Muskelarten und stellen zur Diskussion, ob das Reizleitungssystem relativ unabhngig von der Sauerstoffversorgung ist. Das Reizleitungssystem weist auch unter Thyroxinbelastung einen zh festgehaltenen,

Th. H. Schiebler; M. Stark; R. Caesar



des sciences pharmaceutiques  

E-print Network

.-M. Scherrmann La facult de pharmacie de Paris est habilite percevoir 45 % du montant total de votre Taxe d pharmacie de paris en sera bnficiaire ! En indiquant prcisment lors de votre dclaration de versement de'Observatoire - 75006 Paris Diplme : docteur en pharmacie - Monsieur le doyen Facult des sciences pharmaceutiques et

Pellier, Damien



E-print Network

CHROMATOGRAPHIE EN PHASE GAZEUSE DES COMPOSS VOLATILS DES GLANDES A PHROMONES DES ABEILLES'introduction directe et en petit nombre des glances phromones l'entre d'une colonne chromatographie; le procd : chromatographie phase gazeuse, glande, phromone, substance d'alarme, abeille ouvrire. INTRODUCTION La vie des

Boyer, Edmond



E-print Network

TRANSFORMATION ET DEVENIR DES CELLULES ADIPEUSES AU COURS DE L'AMAIGRISSEMENT. TUDE environ 400 g, les transformations ultrastructurales des cellules adipeuses et leur devenir ont t. Le reste des cellules adipeuses des dpts, reprsentant environ 90 p. 100 de la totalit des

Paris-Sud XI, Universit de


fevrier 2012 Journes Francophones des Langages Applicatifs JFLA12 Separation des couleurs dans un -calcul bichrome  

E-print Network

AlligatorEggs3 cherche `a expliquer le -calcul `a des enfants. Pour cela il utilise la couleur pour relier des alligators affam´es et des oeufs afin de constituer des familles. La couleur sert `a expliciter les liaisons des variables dans les termes, des oeufs naissent de nouveaux alligators ou familles lors

Paris-Sud XI, Université de


Resting alpha activity predicts learning ability in alpha neurofeedback  

PubMed Central

Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho



[Microorganisms that produce alpha-galactosidase, alpha-mannosidase, alpha-fucosidase and beta-acetylglucosaminidase].  


The capacity to synthesize alpha-D-galactosidase (EC, alpha-D-mannosidase (EC, alpha-L-fucosidase (EC and beta-D-acetylglucose aminidase (EC was tested among 100 different cultures of soil microscopic fungi and actinomycetes. Two genera of micromycetes, viz. Scopulariopsis and Aposphaeria, which had not been known as producing alpha-D-galactosidase, were found, as well as several new species of the genus Penicillium: Pen. canescens, Pen. claviforme, Pen. cyclopium, Pen. daleae, Pen. frequentans, Pen. piscarum, Pen. simplicissimu, Pen. thomii. PMID:6248742

Ulezlo, I V; Zaprometova, O M; Ozerskaia, S M; Bezborodov, A M



[Alpha-glucosidase inhibitor].  


Alpha-glucosidase inhibitors (?-GI) have abdominal signs which are generally regarded as side-reaction. The abdominal signs are caused by generation of intestinal gas which contains hydrogen gas. The hydrogen gas absorbed in the body eliminates oxidant stress and consequently the abdominal signs may have beneficial effects preventing onset and progression of arteriosclerosis. Recently, it has been reported that the combination therapy of dipeptidyl peptidase-4 inhibitors with a-GI enhances glucagon like peptide-1 (GLP- 1) secretion and increases active GLP-1 concentration. Therefore, ?-GI is not only a matured and reliable oral anti-diabtic agent (OAD) but also a promising OAD which collaborates effectively with DPP-4 inhibitors or sodium-glucose cotransporter-2 inhibitors. PMID:25812363

Osonoi, Takeshi



Live! From 2-Alpha  

NSDL National Science Digital Library

This activity is one of several in which students are required to access and analyze actual data from NASA missions, including video "interviews" with real NASA scientists, to solve a mystery. In this mystery, students learn about the force of gravity and how scientists analyze data by studying the properties of different objects in space. Live! From 2-Alpha can be used to support instruction about forces and motion, origin and evolution of the universe, and the interaction of energy and matter. This activity is one of several in "Space Mysteries," a series of inquiry-driven, interactive Web explorations. Each Mystery in "Space Mysteries" is designed to teach at least one physical science concept (e.g. interactions of energy and matter, structures and properties of matter, energy, motion, or forces), and is accompanied by materials to be used by classroom teachers.


1984 - 1992 : alourdissement des loyers et des charges  

Microsoft Academic Search

[fre] 1984-1992 : alourdissement des loyers et . Au cours des annes 1984-1992 les loyers ont augment beaucoup plus rapidement que le niveau gnral des prix. Cette volution reflte la fois le cot plus lev que par le pass confr au droit d'usage du logement et l'amlioration du confort du parc locatif. Elle est nuancer suivant le secteur

Laure Pitrou



ORNL ALPHA MIS programmer's manual  

SciTech Connect

This manual is a reference tool for programmers who are responsible for the software maintenance of the ALPHA system user interface program, also called simply ALPHA. This ALPHA user program is a part of the overall ALPHA Management Information System (MIS), which is a general-purpose MIS. The ALPHA user interface program provides the ALPHA MIS with a user-friendly, interactive interface between the general user and the System 1022 (trademark of Software House) data base. Through this facility the general user is able to choose a data base, select records from the data base, sort those records, and display in a variety of ways useful information contained in those records. User friendliness is supported by an extensive HELP facility. This manual documents all source code necessary for the successful compilation of the ALPHA user program (version 3-A). Also included is documentation covering the external files and common blocks necessary for the successful compilation of this program as well as the system reference file, which drives the program after it is compiled. Data base external files and tables that may be accessed by the ALPHA user program are documented elsewhere.

Haese, R.L.; Smith, S.E.; Lovin, J.K.; Grubb, J.W.



EEG Alpha Power and Intelligence.  

ERIC Educational Resources Information Center

Tested whether alpha power in different sub-bands is selectively related to intelligence. For 74 Austrian subjects, the EEG was recorded during a resting session and 2 different intelligence tests were performed. Findings show a strong positive correlation between intelligence and alpha power. (SLD)

Doppelmayr, M.; Klimesch, W.; Stadler, W.; Pollhuber, D.; Heine, C.



Alpha particle emitters in medicine  

SciTech Connect

Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

Fisher, D.R.




Technology Transfer Automated Retrieval System (TEKTRAN)

Plant cells are unique in that they contain four species of alpha-ketoacid dehydrogenase complex: plastidial pyruvate dehydrogenase, mitochondrial pyruvate dehydrogenase, alpha-ketoglutarate (2-oxoglutarate) dehydrogenase, and branched-chain alpha-ketoacid dehydrogenase. All complexes include multi...



E-print Network

'offres PFE en laboratoire INSA de 49 jours (Peut avoir lieu en entreprise) Projets innovants Stage 20PLANNING DES STAGES Départements BIOSCIENCES : Filière Biochimie et Biotechnologies 3ère année 4ème année GENIE ENERGETIQUE ET ENVIRONNEMENT 3ère année 4ème année 5ème année Stage de 16 semaines Stage

Stouls, Nicolas


Bibliothek des indischen Parlaments  

Microsoft Academic Search

Kaum eine prestigetrchtigere Bauaufgabe konnte in den letzten 15 Jahren in Indien ausgeschrieben werden als ein Neubau in\\u000a der Nhe der Parlamentsbauten kolonialer Vergangenheit. Ebenso wie der Auftraggeber, die Regierung, war sich der Gewinner\\u000a des Wettbewerbs, Raj Rewal, einer historischen Aufgabe bewusst, die eine sowohl zeitgeme als auch den dominierenden Nachbarn\\u000a angemessene Lsung verlangte. Die Chance durfte nicht vertan werden,


Le Lait (1982), 62, 234-249 Etude comparative de l'action des mtalloprotases  

E-print Network

Le Lait (1982), 62, 234-249 Etude comparative de l'action des métalloprotéases de Penicillium caseicolum et Penicillium roqueforti sur les caséines alpha 51 et bêta par P. TRIEU-CUOT, Marie-José ARCHIERI-HAZE et J. C. GRIPüN* Rés u m é L'hydrolyse des caséines o.s, et B par les métalloprotéases de Penicillium

Paris-Sud XI, Université de


Animateur 2D/3D-Illustrateur 3D Rendu des couleurs, des textures, des  

E-print Network

spciaux d'un produit ou d'un site grce des logiciels d'animation en 2D ou en 3D. Ce mtier exige la presse et l'dition, le DA labore la charte graphique (choix des styles de caractres, taille des photos de rough (esquisse du projet) ou de story-board (scnario d'un film sous forme de BD). Il assure le

Jeanjean, Louis


Caractrisation des systmesCaractrisation des systmes industriels  

E-print Network

Chapitre 3 Caractrisation des systmesCaractrisation des systmes industriels Aymeric Histace 1 Plan 1. Performances d'un systme industriel 2. Etude temporelle 3. Etude frquentielleq Aymeric comment concrtement les prvoir ou les mesurer pratiquement pour un systme industriel donn. Aymeric

Histace, Aymeric


Facult des arts et des sciences Dpartement de science politique  

E-print Network

Facult des arts et des sciences Dpartement de science politique POL6523 - Diplomatie et affaires dpartement de science politique (responsable du cours) Nadja Pollaert, directrice gnrale, Fondation Paul System," in P. Kerr and G. Wiseman (dir) Diplomacy in a Globalizing World: Theories and Practices. New

Parrott, Lael


Modlisation multivarie des comportements risque des conducteurs d'automobile  

E-print Network

~ 1 ~ Modlisation multivarie des comportements risque des conducteurs d'automobile Mriem la probabilit de l'utilisation du tlphone portable au volant. Mots cls : Assurance automobile of phoning while driving. Key words: Car insurance, risky behavior, survey, trivariate probit model

Paris-Sud XI, Universit de


Expos de synthse Etude immunochimique des molcules du CMH des  

E-print Network

Exposé de synthèse Etude immunochimique des molécules du CMH des bovins (BoLA) D. Levy, J. Goyeneche C. Demeulemester M. Baquero INRA, Ecole Nationale Vétérinaire, laboratoire pathologie et'histocompatibilité - réunion scientifique - structure - fonction Bovine CMH (BoLA) molecules : immunochemical study major

Boyer, Edmond


Alpha--College for Exploring  

ERIC Educational Resources Information Center

Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

Leppert, William; Koenig, Joan




E-print Network

LABORATOIRE DE PHYSIQUE DES SOLIDES UMR 8502 Centre Universitaire, Bât. 510 91405 Orsay cedex) 212503. #12;LABORATOIRE DE PHYSIQUE DES SOLIDES UMR 8502 Centre Universitaire, Bât. 510 91405 Orsay cedex fundamental fine particle magnetism utilizing colloidal dispersions or ferrofluids as the medium for study

Paris-Sud 11, Université de



E-print Network

STRUCTURE ET D?FAUTS DES NANOTUBES Pascale Launois Laboratoire de Physique des Solides (UMR CNRS:// PLAN 1. Nanotubes de carbone Structure Défauts Arrangement Autres nanofilaments 2. Nanotubes hétéroatomiques #12

Paris-Sud 11, Université de


Ageismus Sprachliche Diskriminierung des Alters  

Microsoft Academic Search

Daniel Sanders, einer der bedeutendsten Lexikografen des 19. Jahrhunderts, wertete fr sein Wrterbuch Quellen seit der Lutherzeit aus und\\u000a vermerkt im Wrterbuchartikel zu alt eine bald lobende, bald tadelnde Bedeutung des Adjektivs. Sein Zeit- und Berufsgenosse Jacob Grimm benennt in seiner Rede ber das Alter die zeitgenssischen Synonyme zu alt und Alter: aus einheimischen schriftstellern liesze sich eine lange reihe

Undine Kramer



E-print Network

- portement par d´eformation des points du bord, les rev^etements stables. Il est fortement souhaitable de description heuristique des points du bord, et leur comportement par d´eformation. Par exemple, peut-on donner 2, on examine les probl`emes globaux, plus particuli`erement les interactions entre les obstructions

Di Girolami, Cristina


Fonctionnement et restauration des milieux  

E-print Network

préservation, la restauration et la valorisation des écosystèmes aquatiques ou à l'exercice des métiers de la fonctionnelle, biologie cellulaire et moléculaire, physiologie, écophysiologie, écologie), mais aussi de chimie

Sart, Remi


des doublcls ainsi forms devraient tre plus petites que la vitesse des rayons B, de mme celles des  

E-print Network

88 des doublcls ainsi forms devraient tre plus petites que la vitesse des rayons B, de mme celles des rayons secondaires qu'ils librent en se brisant. Ceci est en dsaccord avec les expriences des rayons B qui donnent naissance ces pulsations, La thorie du professeur Thomson supprime cette

Paris-Sud XI, Universit de


Comptes Rendus des JNC 16 Toulouse 2009 Essais et simulations des mes Nomex sous des sollicitations de type  

E-print Network

Comptes Rendus des JNC 16 Toulouse 2009 Essais et simulations des mes Nomex sous des sollicitations de type statique et fatigue Experimental tests and prediction of Nomex cores under statique en cisaillement hors plan des mes nids d'abeilles Nomex lors de sollicitations de fatigue. La

Paris-Sud XI, Universit de


Alpha decay in electron surrounding  

SciTech Connect

The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

Igashov, S. Yu. [All-Russia Research Institute of Automatics (FSUE VNIIA) (Russian Federation); Tchuvilsky, Yu. M. [Moscow State University, Skobeltsyn Institute of Nuclear Physics (Russian Federation)



Long-range alpha detection  

SciTech Connect

The detection and measurement of alpha contamination is not an easy task. An alpha particle`s characteristic high charge and large mass make it highly interactive with surrounding matter. The particle is often absorbed before its presence can be sensed with a detector. Los Alamos National Laboratory has studied this problem and has developed an improved process to detect alpha-emitting contaminants. The process is called long-range alpha detection (LRAD). The LRAD process focuses on the collection and measurement of ions created as a result of an alpha particle`s interaction with air. With only about 35 eV necessary to create an ion pair, a typical 5-MeV alpha particle, upon emission from its maternal nucleus, creates about 150,000 pairs of charged particles. In air these charged particles take several seconds to locate a mate and become electrically neutral. During this time, ions can be pulled away from the source, collected, and measured. Ions can be motivated to a collection device by using an electric field or by moving the air mass in which the ions are located. The collected charges create a small but discrete current that can give some useful information about the alpha-emitting source. In this article, two commercially available applications of the LRADS technology will be discussed. One of these, a device used primarily for pipe monitoring, is from BNFL Instruments, Inc. The other is a monitoring box of sorts from Eberline that will produce an alpha measurement on anything that is placed in the box.

Kasper, K.



Qualit germinative des semences de pois -I. Dveloppement de la gousse et des graines  

E-print Network

Qualit germinative des semences de pois - I. Dveloppement de la gousse et des graines : incidences sur la germination des semences avec ou sans schage Zohreh RACHIDIAN Yvon LE DEUNFF Institut tapes ; chacune peuvent tre asso- cis des vnements dans la croissance des graines. La germination

Paris-Sud XI, Universit de


Peste des petits ruminants.  


The peste des petits ruminants (PPR) is proving to be a disease which has an increasingly significant economic impact on a number of countries in Africa and the Middle East, and possibly also on the Indian sub-continent. The antigenic relationships which exist between the PPR and rinderpest viruses pose problems for diagnosis which complicates rinderpest control and eradication programmes. Progress has recently been made in regard to diagnosis (specific nucleic probes and monoclonal antibodies), as well as control (homologous vaccine). International legislation remains to be established and epidemiological surveys should be conducted in order to determine the exact geographical distribution of the disease. PMID:2132714

Lefvre, P C; Diallo, A



Des Moines Water Works  

NSDL National Science Digital Library

Users can access information about educational programs and materials for teachers and students, including tours, traveling exhibits and presentations by the staff of the Des Moines Water Works. "Water Trunks", which contain water-related literature, books, science experiments, videos, games, CD-ROMs, hands-on activities, picture cards, career information, and a teacher resource book, are available to order. There are also links to other water websites, a teachers' newsletter and pollution prevention tips for classroom use and for the general public.



Linkage of alpha G-Philadelphia to alpha-thalassemia in African-Americans .  

PubMed Central

We have studied the inheritance of the alpha-chain hemoglobin variant Hb G-Philadelphia (alpha 2(68 Asn leads to Lys)Beta 2) in two African-American families. Expression of the alpha-globin loci was monitored by the percentage of Hb G in these individuals. The variant represented approximately 33% of the total adult hemoglobin in some and 50% in others. alpha-Globin gene fragments were analyzed by using restricton endonucleases that cleave outside (EcoRI), within (HindIII), and between (Bgl II) the normal duplicated alpha-globin loci (alpha alpha/alpha alpha). Individuals having 33% variant lack one functioning alpha gene (alpha G/alpha alpha); those with 50% variant lack two genes, one missing on each chromosome (alpha G/alpha). Inheritance of alpha G was therefore linked to that of a chromosome with only one functional alpha-globin gene locus. This locus is probably the result of a nonhomologous crossover. Our results also suggest equal expression of the alpha-globin loci in humans because the percentages of the variant could be explained solely on the basis of the total number of alpha genes present. The percentages of Hb G as well as other hematologic data all were consistent with the number of alpha-globin genes identified by restriction endonuclease mapping. Gene mapping yields a more precise determination of the number of alpha-globin genes than does study of globin synthesis. Images PMID:6933536

Surrey, S; Ohene-Frempong, K; Rappaport, E; Atwater, J; Schwartz, E



La plaquette alpha dition 2012  

E-print Network

, Jessica et Martin pour leur relecture. Nous contacter Bekk: BDE: Bekk Morisseau, Michel Denancé, Proxima, Raphaël Yver Impression/fabrication Contacter le BDE Président: ?douard BDE: forum des admissibles: site de l

Godoy-Diana, Ramiro



E-print Network

1 NEUROMARKETING ET NEUROSCIENCES AU SERVICE DES PUBLICITAIRES : QUESTIONNEMENTS ETHIQUES Didier neuromarketing et des neurosciences au service des publicitaires soulève immanquablement des questions éthiques débats éthiques entre les personnes adeptes du neuromarketing (les "pro-neuromarketing") et les "anti-neuromarketing

Paris-Sud XI, Université de


Analyse thermographique du comportement des matriaux  

E-print Network

transfert et de traitement des images infrarouges, rendant plus conviviale l'utilisation des nouveaux de degr Celsius. L'intrt de la thermographie pour le mcanicien vient du fait que la dformation d traitement des donnes infrarouges. En effet, cette analyse s'appuie sur une mesure des effets (les

Boyer, Edmond


MINES ParisTech Centre des Matriaux  

E-print Network

instructions scientifiques, des conseils concrets, des encouragements et pour ´etaient tr`es patience et compr´eaires pour la r´ealisation de diff´erents ´equipements. Soumis `a une irradiation neutronique induite par le parti- culier l'apparition de d´efauts d'irradiation comme des boucles interstitielles, des amas

Paris-Sud XI, Université de



E-print Network

GERMANIUM PAR DIFFUSION D'ATOMES MARQUS Par MAREK BRAFMAN, OLGA KRUSZEWSKA, WALDEMAR WRONSKI et KAROL'exemple des monocristaux de germanium et comparaison des rsultats obtenus avec les mmes dterminations measurement of the density of the autoradio- grams. The method is illustrated by example of germanium

Boyer, Edmond


DPL ALPHA System and Codd's Cellular Space  

Microsoft Academic Search

DPL ALPHA differs from Codd's original DSL ALPHA only in one essential aspect, namely, that in Data Processing Language ALPHA primitive notions are mostly from predicate calculus (i.e., relation calculus without quantifiers). Boolean algebra and edge-notched card system rather than from relation calculus and relational algebra. ALPHA concepts then can be synthetized from these. [6

G. Fay



Circulating integrins: alpha 5 beta 1, alpha 6 beta 4 and Mac-1, but not alpha 3 beta 1, alpha 4 beta 1 or LFA-1.  

PubMed Central

The alpha 5 beta 1, alpha 6 beta 4 and Mac-1 integrins all participate in the endocytotic cycle. By contrast, alpha 3 beta 1, alpha 4 beta 1 and LFA-1 do so much more slowly, or not at all, in the cell lines examined. This indicates that the alpha-chains appear to determine whether an integrin cycles or not, and that alpha 5 beta 1, alpha 6 beta 4 and Mac-1 can be brought to the leading edge of a moving cell by endocytosis and recycling. Images PMID:1531629

Bretscher, M S



Scurit au-del des mythes et des croyances  


Prsentation orale en franais, support visuel en franais et en anglais. La pire des failles de scurit est l'impression de scurit. Le dcalage entre la comprhension que l?on a des technologies utilises, et leurs potentiels rels, ainsi que l'impact potentiellement ngatif qu'elles peuvent avoir sur nos vies, n'est pas toujours compris, ou pris en compte par la plupart d'entre-nous. On se contente de nos perceptions pour ne pas avoir se confronter la ralit... Alors qu'en est-il vraiment ? En matire de scurit qui de l'humain ou des technologies a le contrle ?




Scurit au-del des mythes et des croyances  

SciTech Connect

Prsentation orale en franais, support visuel en franais et en anglais. La pire des failles de scurit est l'impression de scurit. Le dcalage entre la comprhension que lon a des technologies utilises, et leurs potentiels rels, ainsi que l'impact potentiellement ngatif qu'elles peuvent avoir sur nos vies, n'est pas toujours compris, ou pris en compte par la plupart d'entre-nous. On se contente de nos perceptions pour ne pas avoir se confronter la ralit... Alors qu'en est-il vraiment ? En matire de scurit qui de l'humain ou des technologies a le contrle ?




Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane  

Technology Transfer Automated Retrieval System (TEKTRAN)

We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...


Scale Setting for $\\alpha_{s}$ Beyond Leading Order  

E-print Network

We present a general procedure for applying the scale-setting prescription of Brodsky, Lepage and Mackenzie to higher orders in the strong coupling constant $\\alphas$. In particular, we show how to apply this prescription when the leading coefficient or coefficients in a series in $\\alphas$ are anomalously small. We give a general method for computing an optimum scale numerically, within dimensional regularization, and in cases when the coefficients of a series are known. We find significant corrections to the scales for $R_{e^+ e^-}$, $\\Gamma(B \\to X_u e \\bar{\

Hornbostel, K; Morningstar, C J



Workshop on Precision Measurements of $\\alpha_s$  

SciTech Connect

These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

Bethke, Siegfried; /Munich, Max Planck Inst.; Hoang, Andre H.; /Vienna U.; Kluth, Stefan; /Munich, Max Planck Inst.; Schieck, Jochen; /Munich U.; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS



Facult des arts et des sciences Dpartement de science politique  

E-print Network

doivent tre effacs des langues modernes. Jean-Jacques Rousseau, mile, ou De l'ducation Premier article-huitime sicle : Machiavel, James Harrington, Montesquieu, Jean-Jacques Rousseau et Immanuel Kant. Puis, nous

Leclercq, Remi


Musee des Horreurs  

NSDL National Science Digital Library

What is this Musee des Horreurs? Visitors will find out soon enough: it is a remarkable collection of 52 hand-colored lithograph caricatures of individuals involved in the Dreyfus Affair in France. These lithographs were originally produced from 1899 to 1900 by an artist who used the pseudonym V. Lenepveu and they document the anti-Semitic upsurge brought about by this well-known event. Those represented in the caricatures include prominent members of the Jewish community, Dreyfus supporters, and Republican statesmen placed on grotesque animal bodies. Visitors with an interest in the subject may wish to use the images in a class on graphic design, illustration, European history, or cultural affairs.


Fiche technique Dtail des panneaux  

E-print Network

Panneau 23 - cabossage du cacao au Cameroun Panneau 24 - Culture du palmier huile au Bnin Panneau 25 capital humain, les outils et la production font partie intgrante du patrimoine familial. L'essentiel des


Die fermentative Spaltung des Acetylcholins  

Microsoft Academic Search

Zusammenfassung Es wird eine neue Methode zum Nachweis des Fermentes, das Acetylcholin in Cholin und Essigsure hydrolysiert, die Cholinesterase, beschrieben. Das Verfahren ist nach derWarburgschen Methode aufgebaut.

R. Ammon



EEG alpha power and alpha power asymmetry in sleep and wakefulness  

E-print Network

--Madison, USA Abstract Asymmetry of waking electroencephalography ~EEG! alpha power in frontal regions has been and sleeping are considered. Descriptors: Electroencephalography, Alpha, Sleep, REM sleep, Human Individual

Wisconsin at Madison, University of


Alcoholism, Alpha Production, and Biofeedback  

ERIC Educational Resources Information Center

Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater

Jones, Frances W.; Holmes, David S.



Alpha Testing Escape from Diab  

Technology Transfer Automated Retrieval System (TEKTRAN)

Alpha testing was conducted of sessions 2 and 3 from Diab to assess whether the activities worked as expected, and whether children in the target ages enjoyed it. Data include both RA observations of child performance while playing the games and cognitive interview responses from the players after t...


Alpha proton x ray spectrometer  

NASA Technical Reports Server (NTRS)

Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

Rieder, Rudi; Waeke, H.; Economou, T.



Alpha 1-adrenergic receptor structure  

SciTech Connect

The structure of the alpha 1-adrenergic receptor was investigated by comparing polypeptides identified by sodium dodecyl sulfate (NaDodSO4)-polyacrylamide gel electrophoresis with the size of the intact receptor in cell membranes as determined by target size analysis. The alpha 1-adrenergic receptor from rat liver membranes affinity-labeled with (/sup 3/H)phenoxybenzamine, a covalent affinity reagent, appeared as a single polypeptide with a molecular mass of 85,000 daltons (Da) on NaDodSO4-polyacrylamide gels. In the absence of protease inhibitors, smaller peptides of 58-62 kDa and 40-45 kDa, specifically labeled with (/sup 3/H)phenoxybenzamine, were also apparent on NaDodSO4 gels. In order to determine whether the 85-kDa protein represented all or only a portion of the alpha 1-receptor, radiation inactivation (target size analysis) was undertaken. Radiation-induced receptor inactivation was measured by the loss of specific (/sup 3/H)phenoxybenzamine and (/sup 3/H)prazosin binding and by the loss of affinity-labeled alpha 1-adrenergic receptors on NaDodSO4 gels. Target size analysis of rat liver alpha 1-receptors indicated that the intact membrane-bound receptor has an average molecular mass of 160,000 Da. These data suggest that the intact alpha-receptor may exist in the membrane as a dimer of two 85,000-Da subunits. The structure of the alpha 1-receptor was further studied by limited proteolysis of the 85-kDa protein isolated from NaDodSO4 gels. Trypsin, chymotrypsin, and papain produce smaller peptides similar to those produced during membrane isolation in the absence of protease inhibition. Limited proteolysis of the membrane-bound receptor produces water-soluble peptides, the largest of which is 45,000 Da. This peptide contains the ligand-binding domain and protrudes from the membrane into the extracellular space.

Venter, J.C.; Horne, P.; Eddy, B.; Greguski, R.; Fraser, C.M.



Orthopositronium Lifetime: Analytic Results in O({alpha}) and O({alpha}{sup 3}ln{alpha})  

SciTech Connect

We present the O({alpha}) and O({alpha}{sup 3}ln{alpha}) corrections to the total decay width of orthopositronium in closed analytic form, in terms of basic irrational numbers, which can be evaluated numerically to arbitrary precision.

Kniehl, Bernd A.; Kotikov, Anatoly V.; Veretin, Oleg L. [II. Institut fuer Theoretische Physik, Universitaet Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany)



Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be  

SciTech Connect

The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

Itagaki, N. [Department of Physics, University of Tokyo, Hongo, 113-0033 Tokyo (Japan); Ito, M. [RIKEN Nishina Center, Wako, 351-0198 Saitama (Japan); Milin, M. [Department of Physics, University of Zagreb, HR-10000 Zagreb (Croatia); Hashimoto, T.; Ishiyama, H.; Miyatake, H. [Tokai Radioactive Ion Accelerator Complex, High Energy Accelerator Research Organization (KEK), Tokai, 319-1105 Ibaraki (Japan)



How Is Alpha-1 Antitrypsin Deficiency Treated?  


... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...


What Causes Alpha-1 Antitrypsin Deficiency?  


... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...


Slow alpha variant during REM sleep.  


REM sleep resembles wakefulness or drowsiness. The pattern can be low-voltage, or else alpha-like. Alpha frequencies are present only during the tonic phases of REM sleep and, compared to wakefulness tracings, alpha activities are slightly slower by 1-2 Hz and are more monomorphic. The slow alpha-variant rhythm or subharmonic alpha pattern consists of rhythmic notched theta waves. It shares the same topography and reactivity with the alpha rhythm. We report its presence during the tonic phases of REM sleep without any modification in its morphology in the first case. In the second case, its morphology was similar to awakening but with slower amplitude. No alpha frequencies were found in REM sleep but only its slow alpha variant. This study provides evidence that REM sleep is a stage of sleep that contains rhythms similar to those seen during wakefulness and drowsiness. PMID:18329545

Gelisse, P; Crespel, A



Technique de prparation des minraux argileux en vue de l'analyse par diffraction des Rayons X  

E-print Network

des Rayons X et introduction l'interprtation des diagrammes Mdard Thiry Nolia Carrillo Christine argileux en vue de l'analyse par diffraction des Rayons X et introduction l'interprtation des diagrammes diffraction des Rayons X et introduction l'interprtation des diagrammes. Rapport Technique N RT131010MTHI

Boyer, Edmond


Evolution and seismology of alpha Centauri  

E-print Network

Solar-like oscillations detected in both components of the binary system alpha Centauri provide strong constraints on the fundamental parameters of the stellar system. We model alpha Centauri by means of a Levenberg-Marquardt minimization algorithm including seismic and classical constraints. Computations, that were perfomed decreasing significanly the weight of alpha Cen B seismic data in the calibration procedure, predict small separations in good agreement with new observations of solar-like oscillations in alpha Cen B by Bedding (these proceedings).

Josefina Montalban; Andrea Miglio



AlphaSort: a RISC machine sort  

Microsoft Academic Search

A new sort algorithm, called AlphaSort, demonstrates that commodity processors and disks can handle commercial batch workloads. Using Alpha AXP processors, commodity memory, and arrays of SCSI disks, AlphaSort runs the industry-standard sort benchmark in seven seconds. This beats the best published record on a 32-cpu 32-disk Hypercube by 8:1. On another benchmark, AlphaSort sorted more than a gigabyte in

Chris Nyberg; Tom Barclay; Zarka Cvetanovic; Jim Gray; Dave Lomet



Composition en acides amins des aliments et des rsidus de fermentation in vitro  

E-print Network

Composition en acides aminés des aliments et des résidus de fermentation in vitro M. ANTONGIOVANNI in vitro fermentation with rumen inoculum, and of the faeces relative to an in vivo digestibility trial run fermentation in vitro comme l'ont fait Dennison et Philips (1983) et des fèces. Pour des raisons de place, nous

Paris-Sud XI, Université de



E-print Network

caractristiques histolo- giques des muscles soleus, accessovius latissimi dovsi, extensor carpi vadialis longus et sont mesurs sur les4muscles. Les 2 derniers sont mesurs seulement sur les muscles soleus et accesso Communs. Le muscle soleus des produits des croisements prsente des caractres intermdiaires ou proches

Paris-Sud XI, Universit de



E-print Network

TUDE DES RAYONS DE RECUL RADIOACTIFS PAR LA MTHODE DES DTENTES DE WILSON Par F. JOLIOT. Institut'atomes radioactifs et les trajectoires des rayons de recul. Le parcours des rayons de recul de An et AeA a t mesur diminue tandis que son pouvoir ionisant augmente. Le rayon de recul lors d'un choc subit une dviation

Paris-Sud XI, Universit de


La nature des rayons 03B3 et des rayons X Par W. H. BRAGG  

E-print Network

213 La nature des rayons 03B3 et des rayons X Par W. H. BRAGG Universit d'Adlade. 2014 faites par le Dr Mad- sen et moi, sur lus proprits des rayons secondaires dus aux rayons y. Un travail travers de la matire, il apparat des rayons B qui se meuvent d'abord dans la mme direction que les

Paris-Sud XI, Universit de



E-print Network

11 LA SPECTROGRAPHIE DES PHNOMNES D'ABSORPTION DES RAYONS X1; Par M. DE BROGLIE. 1. A partir du moment o l'tude des rayons secondaires des rayons X a permis aux physiciens anglais, Barkla, Kaye rayons de qualit dfinie, il a t possible de parvenir aux rsultats d'ensemble suivants : . v , FIG. 1

Paris-Sud XI, Universit de



E-print Network

311. APPLICATION DE LA TOPOGRAPHIE PAR DIFFRACTION DES RAYONS X A L'TUDE DES MTAUX Par G On rappelle le principe des diffrentes mthodes de topographie par diffraction des rayons X : mthode de Berg amliorations apporter dans le cadre de l'appareillage : tubes rayons X plus puissants, intensificateurs d

Boyer, Edmond


Les limites de la couverture des risques en aquaculture : le cas des  

E-print Network

EA 4272 Les limites de la couverture des risques en aquaculture : le cas des conchyliculteurs en limites de la couverture des risques en aquaculture : le cas des conchyliculteurs en France Véronique Le in defining risks in aquaculture and we propose a classification that takes the specificities into account. We

Paris-Sud XI, Université de


La transmission des textes mathmatiques : l'exemple des lments d'Euclide Bernard VITRAC  

E-print Network

1 La transmission des textes mathmatiques : l'exemple des lments d'Euclide Bernard VITRAC Les'erreurs d'inattention par lassitude, facilit de corrections parfois abusives3. I. Les lments d'Euclide Le cas des lments d'Euclide, en treize Livres est, bien des gards, exemplaire : le trait a connu

Boyer, Edmond



E-print Network

Mathmatiques, btiment Fermat dpartement de Mathmatiques et applications Ecole Normale Suprieure InriaCAMPAGNE DE RECRUTEMENT DES ENSEIGNANTS-CHERCHEURS - SESSION SYNCHRONISEE 2014 - LISTE des MEMBRES des CDS POSTES DE MAITRES DE CONFERENCE Numro Poste Nature Concours Section(s) CNU Profil Labo d

Arleo, Angelo


Effectiveness of Alpha Biofeedback Therapy: Negative Results.  

ERIC Educational Resources Information Center

Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

Watson, Charles G.; Herder, Joseph



Recent Results on the CKM Angle Alpha  

SciTech Connect

The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

Mihalyi, A.; /Wisconsin U., Madison



Alpha 1 antitrypsin phenotypes and alcoholic pancreatitis  

Microsoft Academic Search

Altered frequencies of alpha 1 antitrypsin phenotypes have been reported in patients with chronic pancreatitis, suggesting a possible genetic basis for individual susceptibility to this disease. Alpha 1 antitrypsin phenotypes, with particular regard to alcoholic pancreatitis, were studied. Patients with alcoholic pancreatitis were compared with alcoholic control subjects with no history of pancreatic disease. Serum alpha 1 antitrypsin concentrations were

P S Haber; J S Wilson; B H McGarity; W Hall; M C Thomas; R C Pirola



Alpha 1-antitrypsin in acute myocardial infarction  

Microsoft Academic Search

Alpha 1-antitrypsin serum levels were measured in 48 patients with acute myocardial infarction and in 19 control patients either with coronary heart disease without necrosis, or with neither coronary disease nor inflammation. Alpha 1-antitrypsin was significantly raised in the group of patients with acute myocardial infarction. As some patients individually showed no change in alpha 1-antitrypsin levels, however, they were

H Gilutz; Y Siegel; E Paran; N Cristal; M R Quastel



Profiles of alpha-melanocyte-stimulating hormone in the Japanese flounder as revealed by a newly developed time-resolved fluoroimmunoassay and immunohistochemistry.  


Profiles of alpha-melanocyte-stimulating hormone (alpha-MSH) in the Japanese flounder were examined by a newly developed time-resolved fluoroimmunoassay (TR-FIA) and immunohistochemistry. A TR-FIA for alpha-MSH was newly developed, and its levels in the pituitary gland and plasma of Japanese flounder reared in a white or black tank for 5 months were compared. A competitive assay using two antibodies was performed among secondary antibodies in the solid phase, alpha-MSH antibodies, samples, and europium-labeled Des-Ac-alpha-MSH. The sensitivity of the assay, defined as twice the standard deviation at a zero dose, was 0.98 ng/ml (49 pg/well). The intra- and interassay coefficients of variation of the assay were 8.8% (n=8) and 17.3% (n=5), respectively, at about 50% binding. Cross-reactivities of Des-Ac-alpha-MSH and Di-Ac-alpha-MSH were about 100%. Cross-reactivities of adrenocorticotropic hormone, salmon gonadotropin-releasing hormone (sGnRH), and chicken GnRH-II were less than 0.2%, and that of melanin-concentrating hormone was less than 2.0% at 50% binding. Displacement curves of serially twofold-diluted hypothalamus extract, pituitary gland extract, and plasma extract of Japanese flounder with the assay buffer were parallel to the alpha-MSH standard curve. Moreover, displacement curves of serially twofold-diluted hypothalamus and/or pituitary gland extract of masu salmon, goldfish, red seabream, Japanese eel, tiger puffer, and barfin flounder with the assay buffer were also parallel to the alpha-MSH standard. In Japanese flounder, total immunoreactive (ir)-alpha-MSH levels in the pituitary gland were lower in the black tank, whereas those in the plasma tended to be higher in the black tank, suggesting that the synthesis and release of alpha-MSH are higher in the black tank. alpha-MSH-ir cells were detected in the pars intermedia and a small part of the pars distalis of the pituitary gland. alpha-MSH-ir cell bodies were located in the basal hypothalamus and alpha-MSH-ir fibers were distributed not only in the hypothalamus but also in the telencephalon, midbrain, cerebellum, and medulla oblongata, suggesting that alpha-MSH functions as a neuromodulator in the brain. PMID:17286977

Amiya, Noriko; Amano, Masafumi; Takahashi, Akiyoshi; Yamanome, Takeshi; Yamamori, Kunio




E-print Network


Pellier, Damien



E-print Network


Pellier, Damien


DES JUIFS LACS EN FRANCE Liliane Kuczynski  

E-print Network

familiaux. Des universitaires en vue, des crivains ont retrac le leur : Albert Memmi le premier, Edgar Morin plus tard. Celui-ci, dans un article qui fit grand bruit (1989), dfinit ces juifs laciss

Boyer, Edmond


Des Lacs River and Souris River  

USGS Multimedia Gallery

The Des Lacs River coming in to the Souris River. Des Lacs River is the darker water, which is sediment and the Souris River is the lighter water. >Photo taken by USGS personnel on a Civil Air Patrol flight....


Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume  

ERIC Educational Resources Information Center

Alpha circuits (8-12Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha

Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.



17Alpha Centauri Bb -a nearby extrasolar planet? Alpha Centauri is a binary  

E-print Network

17Alpha Centauri Bb - a nearby extrasolar planet? Alpha Centauri is a binary star system located 4 at La Silla in Chile to detect the tell-tail motion of Alpha Centauri B caused by an earth-sized planet in close orbit around this star. The planet, called Alpha Centauri Bb, orbits at a distance of only six


Archives de sciences sociales des religions  

E-print Network

Archives de sciences sociales des religions Numéro 131-132 (juillet - décembre 2005) Varia », Archives de sciences sociales des religions [En ligne], 131-132 | juillet - décembre 2005, mis en ligne le religions #12;Genèse des émotions au sein des Assemblées de Dieu polynésiennes 2 Archives de sciences

Paris-Sud XI, Université de



E-print Network

vivants se trouvent dans la partie terminale de la trompe au moment où l'oeuf est pondu. Pour que cette dans la partie terminale des trompes. On relève des contradictions analogues dans les résultats obtenus spermatozoïdes dans la partie supérieure des trompes de Fallope, 2 h 25 m. après le coït. C'est pourquoi nous

Boyer, Edmond


Rentre des tudiants UNIVERSIT BLAISE PASCAL  

E-print Network

Rentrée des étudiants étrangers UNIVERSIT? BLAISE PASCAL COMMUNIQU? DE PRESSE Accueil des étudiants étrangers de l'Université Blaise Pascal Les échanges internationaux, chaque année, l'université Blaise Pascal envoie des étudiants à l'étranger et accueille des étudiants d

Sart, Remi


March unique et dveloppement des changes  

Microsoft Academic Search

[fre] March unique et dveloppement des changes Contrairement la thorie classique du commerce international, la premire vague d'intgration europenne ne s'est pas traduite par un dveloppement du commerce inter-branche refltant une spcialisation accrue des pays . membres dans des produits pour lesquels ils dtenaient un avantage comparatif. En revanche, le dveloppement du commerce intra-branche reflte davantage une spcialisation des

Michael Freudenberg; Lionel Fontagn



[Anti alpha-herpesvirus drugs].  


Therapy for infectious diseases resulting from alpha-herpesvirus infections has been dramatically improved by the development of acyclovir (ACV). ACV is highly specific against herpes simplex virus type 1(HSV-1), herpes simplex virus type 2 (HSV-2) and varicella-zoster virus (VZV) as ACV is specifically phosphorylated by the thymidine kinases (TKs) of these viruses. These viral TKs are important enzymes for viral replication in vivo; therefore, the growth of TK-deficient mutants is impaired. ACV-resistant viruses are rarely isolated from immunocompetent patients but are frequently obtained from immunocompromised patients. Recently, other anti alpha-herpesvirus drugs, such as valacyclovir and famciclovir, have become available for use in Japan, but the need to develop new antiherpetic compounds with different mechanisms of action remains. PMID:22568134

Koshizuka, Tetsuo; Suzutani, Tatsuo



Spectroscopic analysis of alpha Andromedae  

NASA Astrophysics Data System (ADS)

Coude-spectrographic data for the visible and UV are employed to determine the atmospheric chemical composition of alpha And. Nothing that five previous observations of the star by other researchers failed to produce a consensus for the spectra, the present study considered only lines which were present in all the spectra obtained. The detected energy distribution indicated an effective temperature within 350 of 13850 K, a surface gravity around 3.85, and a microturbulence velocity of 2.5-3.5 km/sec. Normal C and Si abundances were present, along with overabundances of Mg, S, and Fe. Significant overabundances of P, Mn, Ga, Sr, Y, Zr, Eu, and Hg were detected. It is suggested that alpha And has a circumstellar envelope, indicating an unstable atmosphere and mass loss.

Derman, I. E.



Alpha-plutonium's Grneisen parameter  

NASA Astrophysics Data System (ADS)

Reported Grneisen parameters ? of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grneisen parameter uncertainty seldom exceeds 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grneisen's rule, from Einstein model and Debye model fits to low-temperature ?V/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grneisen relationship whereby ? is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend ? = 3.7 0.4, slightly high compared with values for all elemental metals.

Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert



Alpha-plutonium's Grneisen parameter.  


Reported Grneisen parameters ? of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grneisen parameter uncertainty seldom exceeds 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grneisen's rule, from Einstein model and Debye model fits to low-temperature ?V/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grneisen relationship whereby ? is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend ? = 3.7 0.4, slightly high compared with values for all elemental metals. PMID:21386421

Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert



ECOLE PRATIQUE DES HAUTES ETUDES Ecole doctorale sciences des religions et systmes de pense  

E-print Network

ECOLE PRATIQUE DES HAUTES ETUDES Ecole doctorale « sciences des religions et systèmes de pensée » Doctorat de sciences des religions et systèmes de pensée, sociologie Nadia GARNOUSSI DE NOUVELLES HAUTES ETUDES Ecole doctorale « sciences des religions et systèmes de pensée » Doctorat de sciences des

Paris-Sud XI, Université de


Voglibose: An Alpha Glucosidase Inhibitor  

PubMed Central

Diabetes Mellitus (DM) is a morbid disease worldwide, with increasing incidence as time passes. It has macro-vascular and micro-vascular complications. The main cause of these complications is poorly controlled postprandial hyperglycaemia. Alpha glucosidase inhibitors, namely acarbose, voglibose and miglitol, are available for therapy. Voglibose is well tolerated and effective in comparable doses among these drugs. This article highlights the important features of voglibose. PMID:24551718

Dabhi, Ajay S.; Bhatt, Nikita R.; Shah, Mohit J.



The Alpha 21264 microprocessor architecture  

Microsoft Academic Search

The 21264 is the third generation Alpha microprocessor from Compaq Computer (formerly Digital Equipment) Corporation. This microprocessor achieves the industry-leading performance levels of 30+ Specint95 and 50+ Specfp95. In addition to the aggressive 600 MHz cycle time in a 0.35 ?m CMOS process, there are also many architectural features that enable the outstanding performance level of the 21264. This paper

R. E. Kessler; E. J. McLellan; D. A. Webb



Master Management spcialit Management des relations humaines  

E-print Network

ressources humaines ; Acqurir des connaissances pointues en matire de gestion et de pilotage du changement organisationnel ; Acqurir des connaissances approfondies dans la gestion des relations sociales ; Acqurir les collectifs de travail ; Initier, accompagner et grer le changement dans l'organisation ; Matriser les

Jeanjean, Louis


Archives de sciences sociales des religions  

E-print Network

Archives de sciences sociales des religions Numéro 144 (octobre-décembre 2008) Varia de l'?tat chinois, 1900-2008 », Archives de sciences sociales des religions [En ligne], 144 sciences sociales des religions #12; #12; #12;#12; #12; #12; #12; #12; #12

Paris-Sud XI, Université de


Archives de sciences sociales des religions  

E-print Network

Archives de sciences sociales des religions Numéro 140 (octobre - décembre 2007) Varia) © Archives de sciences sociales des religions #12;Yves Déloye, Les voix de Dieu. Pour une autre histoire du suffrage électoral : le clergé (...) 2 Archives de sciences sociales des religions, 140 | octobre

Paris-Sud XI, Université de


Archives de sciences sociales des religions  

E-print Network

Archives de sciences sociales des religions 157 (janvier-mars 2012) Christianismes en Océanie). ................................................................................................................................................................................................................................................................................................ Référence électronique Yannick Fer, « Introduction », Archives de sciences sociales des religions [En ligne pour l'édition électronique ouverte) © Archives de sciences sociales des religions #12;Yannick Fer

Paris-Sud XI, Université de


Archives de sciences sociales des religions  

E-print Network

Archives de sciences sociales des religions 131-132 (juillet - décembre 2005) Varia guerre indo-pakistanaise de 1999 », Archives de sciences sociales des religions [En ligne], 131 de l'édition papier. © Archives de sciences sociales des religions #12;Rites publics et deuil

Boyer, Edmond


Archives de sciences sociales des religions  

E-print Network

Archives de sciences sociales des religions 157 (janvier-mars 2012) Christianismes en Océanie évangéliques », Archives de sciences sociales des religions [En ligne], 157 | janvier-mars 2012, mis en ligne pour l'édition électronique ouverte) © Archives de sciences sociales des religions #12;Yannick Fer Le

Paris-Sud XI, Université de


Efficient DNA sticker algorithms for DES  

Microsoft Academic Search

The data encryption standard (DES) is an algorithm with approximate 72 quadrillion possible keys. The security of the DES is based on the difficulty of picking out the right key after the 16-round nonlinear function operations. In this paper, we propose a concrete recursive sticker molecular algorithm to the DES. The molecular sticker algorithm includes three parts: initializing the key

Zhihua Chen; Xiutang Geng; Jin Xu



Facult des tudes suprieures et postdoctorales  

E-print Network

visiteurs de recherche. La FESP exerce donc un rôle de leader et de facilitateur tant dans la gestion desUr tant dans la gestion des dossiers coUrants qUe dans l'identiFication des grands enjeUx d'aUjoUrd'hUi et

Charette, André


Lipodystrophies : perceptions et souffrance des personnes atteintes,  

E-print Network

Lipodystrophies : perceptions et souffrance des personnes atteintes, rponses collectives 117 Alice Desclaux, Sokhna Boye 1. INTRODUCTION Les lipodystrophies sont dfinies par la mdecine comme des ailleurs il existe actuellement un dbat sur la prvalence des lipodystrophies dans les pays du Sud. Elles

Paris-Sud XI, Universit de



E-print Network


Boyer, Edmond


Bioclimatologie Utilisation des cellules au silicium amorphe  

E-print Network

Bioclimatologie Utilisation des cellules au silicium amorphe pour la mesure du rayonnement simulation et la confrontation exprimentale ccellules au silicium amorphe par rapport celles des capteurs existants montrent l'intrt des cellules au silicium amorphe pour la mesure du

Paris-Sud XI, Universit de



SciTech Connect

We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

Hayes, Matthew [Universite de Toulouse, UPS-OMP, IRAP, Toulouse (France); Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas [Department of Astronomy, Oskar Klein Centre, Stockholm University, AlbaNova University Centre, SE-106 91 Stockholm (Sweden); Schaerer, Daniel [CNRS, IRAP, 14, avenue Edouard Belin, F-31400 Toulouse (France); Verhamme, Anne; Orlitova, Ivana [Geneva Observatory, University of Geneva, 51 Chemin des Maillettes, CH-1290 Versoix (Switzerland); Mas-Hesse, J. Miguel; Oti-Floranes, Hector [Centro de Astrobiologia (CSIC-INTA), Departamento de Astrofisica, POB 78, 28691 Villanueva de la Canada (Spain); Adamo, Angela [Max Planck Institute for Astronomy, Koenigstuhl 17, D-69117 Heidelberg (Germany); Atek, Hakim [Laboratoire d'Astrophysique, Ecole Polytechnique Federale de Lausanne (EPFL), Observatoire, CH-1290 Sauverny (Switzerland); Cannon, John M. [Department of Physics and Astronomy, Macalester College, 1600 Grand Avenue, Saint Paul, MN 55105 (United States); Herenz, E. Christian [Leibniz-Institut fuer Astrophysik (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany); Kunth, Daniel [Institut d'Astrophysique de Paris, UMR 7095 CNRS and UPMC, 98 bis Bd Arago, F-75014 Paris (France); Laursen, Peter, E-mail: [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen (Denmark)



Alpha voltaic batteries and methods thereof  

NASA Technical Reports Server (NTRS)

An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)



Comptes Rendus des JNC 17 -Poitiers 2011 valuation des performances des modles d'homognisation pour des fibres alatoirement  

E-print Network

méthodes d'homogénéisation analytiques de Mori-Tanaka et auto-cohérente ont été utilisées pour évaluer les forme des fibres aléatoires. Les estimations du modèle de Mori-Tanaka sont légèrement plus rigides que que les résultats des méthodes éléments finis et Mori-Tanaka. Abstract Analytical homogenization

Paris-Sud XI, Université de


Resting-state alpha in autism spectrum disorder and alpha associations with thalamic volume.  


Alpha circuits (8-12Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha rhythms, associations between thalamic structure and alpha activity were examined. RS magnetoencephalography was obtained from 47 typically-developing children (TDC) and 41 children with ASD. RS alpha activity was measured using distributed source localization. Left and right thalamic volume measurements were also obtained. In both groups, the strongest alpha activity was observed in Calcarine Sulcus regions. In Calcarine regions, only TDC showed the expected association between age and alpha peak frequency. ASD had more alpha activity than TDC in regions bordering the Central Sulcus as well as parietal association cortices. In ASD, whereas greater left Central Sulcus relative alpha activity was associated with higher Social Responsiveness Scale (SRS) scores, greater Calcarine region relative alpha activity was associated with lower SRS scores. Although thalamic volume group differences were not observed, relationships between thalamic volume and Calcarine alpha power were unique to TDC. The present study also identified a failure to shift peak alpha frequency as a function of age in primary alpha-generating areas in children with ASD. Findings suggested that increased RS alpha activity in primary motor and somatosensory as well as parietal multimodal areas-with increased alpha thought to reflect greater inhibition-might impair the ability to identify or interpret social cues. Finally, to our knowledge, this is the first study to report associations between thalamic volume and alpha power, an association observed only in TDC. The lack of thalamic and alpha associations in ASD suggests thalamic contributions to RS alpha abnormalities in ASD. PMID:25231288

Edgar, J Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M; Qasmieh, Saba; Levy, Susan E; Schultz, Robert T; Roberts, Timothy P L



Further Precise Determinations of $\\alpha_s$ from Lattice QCD  

E-print Network

We present a new determination of the strong coupling constant from lattice QCD simulations. We use four different short-distance quantities to obtain the coupling, three different (infrared) meson splittings to tune the simulation parameters, and a wide range of lattice spacings, quark masses, and lattice volumes to test for systematic errors. Our final result consists of ten different determinations of $\\alpha^{(3)}_{P}(8.2 GeV)$, which agree well with each other and with our previous results. The most accurate of these, when evolved perturbatively to the $Z^0$ mass, gives obtained from other recent lattice simulations.

Davies, C T H; Lepage, G P; McCallum, P; Shigemitsu, J; Sloan, J



Paternit des articles et intrts concurrents : une analyse des recommandations aux auteurs des journaux traitant de pratique pharmaceutique  

PubMed Central

RSUM Contexte : La prsence dauteurs honorifiques et fantmes ainsi que les intrts concurrents reprsentent des difficults bien documentes, lies la publication darticles scientifiques. Il existe des lignes directrices encadrant la rdaction et la publication de manuscrits scientifiques, notamment celles de lInternational Committee of Medical Journal Editors (ICMJE). Objectifs : Lobjectif principal de cette tude descriptive et transversale visait recenser les instructions portant sur la paternit des articles et les intrts concurrents provenant des recommandations aux auteurs des journaux traitant de pratique pharmaceutique. Lobjectif secondaire visait dterminer des mesures correctrices pour une paternit des articles plus transparente. Mthode : La recherche a dbut par lidentification des journaux traitant de pratique pharmaceutique. La consultation des instructions aux auteurs des journaux a permis ensuite de recenser les recommandations destines viter les problmes de paternit des articles et dintrts concurrents. Finalement, les membres de lquipe de recherche se sont consults afin de dfinir des mesures correctrices possibles lintention des chercheurs. Rsultats : Des 232 journaux traitant de pharmacie, 33 ont t dfinis comme traitant de pratique pharmaceutique. Un total de 24 (73 %) journaux mentionnaient suivre la politique de lICMJE, 14 (42 %) demandaient aux auteurs de remplir un formulaire de dclaration dintrts concurrents au moment de la soumission de larticle, 17 (52 %) prsentaient une dfinition de la qualit dauteur et 5 (15 %) demandaient de dtailler les contributions de chaque auteur. Une grille de 40 critres a t labore pour dfinir lattribution du statut dauteur. Conclusion : Moins de la moiti des journaux demandait aux auteurs de transmettre un formulaire de dclaration des intrts concurrents au moment de la soumission dun article et seulement la moiti des journaux avait donn une dfinition de la qualit dauteur. La publication scientifique de travaux sur les pratiques pharmaceutiques nest pas labri des manques de transparence lis la publication. Lutilisation dune grille dcrivant la contribution de chaque auteur et la publication en ligne des travaux peuvent contribuer limiter ces risques. PMID:24970938

Courbon, ve; Tanguay, Cynthia; Lebel, Denis; Bussires, Jean-Franois



Annotation smantique pour des domaines spcialiss et des ontologies riches  

E-print Network

sur deux textes décrivant des réglementations métier. Notre approche obtient de bons résultats. En-measure in the label and position predictions with different settings. This suggests that human annotators can


Habilitation `a Diriger des Recherches "Simulation numerique des ecoulements  

E-print Network

: chromatographie ; · physique des plasmas : tokamak, vent solaire, relativit´e g´en´erale ; · autres : trafic principe de conservation de certaines quantit´es comme la masse, l'´energie, l'impul- sion ; · un principe

Franchi, Jacques



E-print Network

: Pour garantir aujourd'hui des conditions sécuritaires de passage dans les eaux territoriales et, clandestine immigrants, piracy, toxic waste pollution, accidents, etc.). Key words: Maritime border security fréquentent par an la Méditerranée et 50 millions de passagers sont transportés. La carte suivante (figure 1

Boyer, Edmond


Techniken & Sprachen des Semantic Web Techniken & Sprachen des Semantic Web  

E-print Network

World Wide Web (7) Tim Berners-Lee Proposal 1989: Hypertextsystem als Infrastrukturprinzp f Berners-Lee) 1989: An intriguing possibility, given a large hypertext database with typed links, Inst. fur KI, Uni Ulm 3 - 10 Techniken & Sprachen des Semantic Web Aber ... CERN Proposal, (Tim

Pfeifer, Holger


Facult des arts et des sciences Dpartement de science politique  

E-print Network

. 369-384. Weapons of Mass Destruction Commission (Hans Blix Commission), rapport final, «Weapons opérations de maintien de la paix, le contrôle de la prolifération des armes de destruction massive et les et A. Roth, « Nuclear Weapons in Neo-Realist Theory », International Studies Review, automne 2007, p

Parrott, Lael


Interferon Alpha-Induced Depression in Chronic Hepatitis C Patients: Comparison between Different Types of Interferon Alpha  

Microsoft Academic Search

IFN alpha treatment is able to produce dose-related side effects, such as depression, in the central nervous system. We assessed the effects on depression of four different types of IFN alpha (recombinant IFN alpha 2a, recombinant IFN alpha 2b, lymphoblastoid IFN alpha, leukocyte IFN alpha), administered at the same doses in four homogeneous groups of chronic hepatitis C patients (96

M. Malaguarnera; I. Di Fazio; S. Restuccia; G. Pistone; L. Ferlito; L. Rampello



Tests de rception des tours de rfrigration  

E-print Network

Dans le cadre du projet LHC, les premiers quipements de refroidissement installs, seront des tours de rfrigration de grande puissance. Contrairement d'autres matriels construits en grande srie, ces quipements, tours et stations de pompage associes sont crer sur mesure. Diffrentes normalisations permettent de concevoir, de construire et de tester ces ralisations. L'ensemble des tests de rception ne peut avoir lieu avant l'achvement complet de l'installation, de plus, ces essais sont rarement raliss charge nominale. Des dfaillances potentielles, lies aux tudes ou la ralisation, peuvent apparatre aprs la priode de garantie. Le but de ce document est de prsenter les diffrentes mthodes imposes par le CERN au niveau des cahiers des charges. Cela permettra la vrification des valeurs garanties par les constructeurs et de suivre l'volution des critres de performances long terme.

Pirollet, B



Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243  

E-print Network

Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

Forsberg, U; Andersson, L -L; Di Nitto, A; Dllmann, Ch E; Gates, J M; Golubev, P; Gregorich, K E; Gross, C J; Herzberg, R -D; Hessberger, F P; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Sarmiento, L G; Schdel, M; Yakushev, A; berg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Dobaczewski, J; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nazarewicz, W; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Shi, Y; Thrle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Trler, A; Ward, A; Ward, D E; Wiehl, N



Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243  

E-print Network

Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

U. Forsberg; D. Rudolph; L. -L. Andersson; A. Di Nitto; Ch. E. Dllmann; J. M. Gates; P. Golubev; K. E. Gregorich; C. J. Gross; R. -D. Herzberg; F. P. Hessberger; J. Khuyagbaatar; J. V. Kratz; K. Rykaczewski; L. G. Sarmiento; M. Schdel; A. Yakushev; S. berg; D. Ackermann; M. Block; H. Brand; B. G. Carlsson; D. Cox; X. Derkx; J. Dobaczewski; K. Eberhardt; J. Even; C. Fahlander; J. Gerl; E. Jger; B. Kindler; J. Krier; I. Kojouharov; N. Kurz; B. Lommel; A. Mistry; C. Mokry; W. Nazarewicz; H. Nitsche; J. P. Omtvedt; P. Papadakis; I. Ragnarsson; J. Runke; H. Schaffner; B. Schausten; Y. Shi; P. Thrle-Pospiech; T. Torres; T. Traut; N. Trautmann; A. Trler; A. Ward; D. E. Ward; N. Wiehl



Atypical alpha asymmetry in adults with ADHD*  

PubMed Central

Introduction A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8 12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha asymmetry has been associated with ADHD-like traits such as reduced reward responsiveness, a lack of inhibition toward aversive experience, and increased approach behaviors, and previous work has indicated increased rightward alpha asymmetry in children with ADHD. The current study explores whether increased rightward alpha asymmetry is also evident in adults with ADHD. Method We assessed low (8 10 Hz) and high (10 12 Hz) alpha asymmetry in adults with ADHD (n = 29) versus controls (n = 62) during baseline and cognitive activation conditions for nine homologous electrode pairs along the anteriorposterior axis. Result Seven results emerged (p < .05) showing increased rightward alpha asymmetry in adults with ADHD. This occurred in three specific electrode pairs across two testing conditions, and five of six results occurred in the lower alpha band. Finally, post hoc analysis indicated that increased rightward alpha asymmetry was generally associated with greater numbers of ADHD symptomswith a possible parietal association for inattentive and a fronto-temporal association for hyperactivity symptoms. Conclusions Increased rightward alpha asymmetry previously observed in children with ADHD appears to be a developmentally persistent feature of ADHD. PMID:19467358

Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.



Scale setting for alpha_s beyond leading order  

E-print Network

We present a general procedure for incorporating higher-order information into the scale-setting prescription of Brodsky, Lepage and Mackenzie. In particular, we show how to apply this prescription when the leading coefficient or coefficients in a series in the strong coupling alpha_s are anomalously small and the original prescription can give an unphysical scale. We give a general method for computing an optimum scale numerically, within dimensional regularization, and in cases when the coefficients of a series are known. We apply it to the heavy quark mass and energy renormalization in lattice NRQCD, and to a variety of known series. Among the latter, we find significant corrections to the scales for the ratio of e+e- to hadrons over muons, the ratio of the quark pole to MSbar mass, the semi-leptonic B-meson decay width, and the top decay width. Scales for the latter two decay widths, expressed in terms of MSbar masses, increase by factors of five and thirteen, respectively, substantially reducing the size...

Hornbostel, K; Morningstar, C J



High gas flow alpha detector  


An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.



Targeted alpha therapy for cancer  

NASA Astrophysics Data System (ADS)

Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1-1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 Ci in human patients are effective in regressing melanomas, with no concomitant complications. These results point to the application of local and systemic TAT in the management of secondary cancer. Results of the phase 1 clinical trial of TAT of subcutaneous, secondary melanoma indicate proof of the principle that TAT can make tumours in patients regress.

Allen, Barry J.; Raja, Chand; Rizvi, Syed; Li, Yong; Tsui, Wendy; Zhang, David; Song, Emma; Qu, Chang Fa; Kearsley, John; Graham, Peter; Thompson, John



The Cycles of Alpha Centauri  

NASA Astrophysics Data System (ADS)

The main AB pair of the nearby Alpha Centauri triple system has one of the most extensive X-ray records of any cosmic object, stretching over three decades. The primary, ? Cen A (G2V), is a near twin of the Sun, with a similarly soft (1-2 MK) corona. The secondary, ? Cen B (K1V), is more active than the Sun, with a generally harder coronal spectrum. Here, spatially resolved measurements of the pair by Chandra's High Resolution Camera are compared, on a common basis, with previous pointings from ROSAT and XMM-Newton.

Ayres, Thomas R.



Mathematisches Seminar des DFGSonderforschungsbereichs 393  

E-print Network

. Seiler (Mannheim) Thema: Vervollständigung Allgemeiner Systeme von Differentialgleichungen Unter der Vervollständigung eines Systems von Differentialgleichungen versteht man (etwas vereinfacht) die Konstruktion aller von Differentialgleichungen vorliegt, d.h. ein System, das nicht den Bedingungen des Cauchy

Chemnitz, Technische Universität


Thorie des ensembles 1. Motivation  

E-print Network

des ensembles. David Hilbert (1862-1943) écrivait de cette contribution «Que personne ne puisse nous Bologne en 1928 du langage formel de Peano, Hilbert disait que c'était un outil essentiel pour sa théorie

Dolecki, Szymon


Information -Communication Communication des entreprises  

E-print Network

Information - Communication 2 PARCOURS Communication des entreprises Communication et solidarité;2 Information - Communication UFR Langues Appliquées, Commerce et Communication PR?SENTATION Objectifs La Licence Information et communication est destinée aux étudiants qui souhaitent suivre un parcours

Sart, Remi


On Dennis Des Chene's Physiologia  

Microsoft Academic Search

Dennis Des Chene's Physiologia: Natural philosophy in late Aristotelian and Cartesian Though reconstructs the discourse of late scholastic natural philosophy, and assesses Descartes' agreements and disagreements. In a critical discussion, I offer a different interpretation of late scholastic theories of final causality and of God's concursus with created efficient causes. Fonseca's and Surez' conceptions of final causality in nature depend

Stephen Menn




E-print Network

, I of Aspevgillus terreus, and I of Penicillium urticae, isolated in ensilaged forages, is tested, Bysso- chlamys fulva, Paecilomyces varioti, Aspergillus clavatus, Aspergillus terreus, Penicillium Penicillium urticae isolées d'ensilages, lorsqu'elles sont cultivées in vitro sur milieu liquide dans des

Paris-Sud XI, Université de


La planification pralable des soins pour les patients en pdiatrie  

PubMed Central

RSUM Les progrs mdicaux et technologiques ont permis dac-crotre les taux de survie et damliorer la qualit de vie des nourrissons, des enfants et des adolescents ayant des maladies chroniques mettant la vie en danger. La planifi-cation pralable des soins inclut le processus reli aux discussions sur les traitements essentiels au maintien de la survie et la dtermination des objectifs des soins de longue dure. Les dispensateurs de soins pdiatriques ont lobligation thique dassimiler cet aspect des soins mdicaux. Le prsent document de principes vise aider les dispensateurs de soins discuter de la planification pralable des soins des patients pdiatriques dans diverses situations. La planification pralable des soins exige des communications efficaces afin de clarifier les objectifs des soins et de sentendre sur les traitements pertinents ou non pour raliser ces objectifs, y compris les mesures de ranimation et les mesures palliatives.



alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.  

PubMed Central

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L




E-print Network


Paris-Sud XI, Universit de


Diffusion des rayons X par un corps de structure  

E-print Network

Diffusion des rayons X par un corps de structure quelconque · Notion de cohérence · Approximation) · Approximation statique · Fréquences des rayons X : 1018 Hz · Fréquences des vibrations atomiques : 1012 Hz (THz système isotrope : mesurable par diffusion des rayons X ou des neutrons ( ) = = 1 + ( - 1) = 1 + - 1 sin

Paris-Sud 11, Université de


Beta/alpha continuous air monitor  


A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

Becker, G.K.; Martz, D.E.



Cluster Expansion of Cold Alpha Matter Energy  

Microsoft Academic Search

In the cluster expansion framework of Bose liquids we calculate analytical expressions of the two-body, three-body and four-body diagrams contributing to the g.s. energy of an infinite system of neutral alpha-particles at zero-temperature, interacting via the strong nuclear forces exclusively. This is analytically tractable by assuming a density dependent two-body correlation function of Gaussian type. For the alpha-alpha potential we

F. Carstoiu; S Misicu; V. Balanica; M. Lassaut



On alpha heating in toroidal devices  

Microsoft Academic Search

Studies of the alpha particle losses and heating profiles for an alpha-heated TFTR-sized tokamak and a small field-reversed mirror reactor (FRM) are presented. The slowing-down and drift of high-energy alpha particles, including detailed orbital effects, is approximated for tokamak geometry using the SYMALF multi-energy-angle code. Results of the calculation for a beam-driven TFTR-type plasma indicate that, except for the center

G. H. Miley



Beta/alpha continuous air monitor  


A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

Becker, Gregory K. (Idaho Falls, ID); Martz, Dowell E. (Grand Junction, CO)



Alpha-Fetoprotein-Producing Renal Cell Carcinoma  

Microsoft Academic Search

Renal cell carcinoma with increased serum alpha-fetoprotein is rare; only 13 such cases have been reported. Our patient, a 51-year-old man, had an increased serum alpha-fetoprotein level and a tumor in the lower pole of the right kidney; which was discovered incidentally with sonography. Two weeks after a partial nephrectomy, his serum alpha-fetoprotein level declined to within the normal range.

Chang-Min Lin; En Meng; Shang-Sen Lee; Sheng-Tang Wu; Ching-Jiunn Wu; Ann Chen; Dah-Shyong Yu; Sun-Yran Chang; Guang-Huan Sun


[Alpha-linolenic acid and cardiovascular diseases].  


IMPORTANCE AND METABOLISM OF ALPHA-LINOLENIC ACID: Alpha-linolenic acid is an essential fatty acid which cannot be produced in the body and must be taken by food. Both in animals and humans, alpha-linolenic acid is desaturated and elongated into eicosapentaenoic and docosahexaenoic acid. It is also incorporated into plasma and tissue lipids and its conversion is affected by levels of linoleic acid. POTENTIAL ROLE IN PATHOGENESIS OF CARDIOVASCULAR DISEASES: Diet enriched in n-3 fatty acids, especially alpha-linolenic acid, reduces the incidence of cardiac death. Studies have shown that alpha linolenic acid prevents ventricular fibrillation which is the main cause of cardiac death. Studies in rats suggest that alpha-linolenic acid may be more effective in preventing ventricular fibrillations than eicosapentaenoic and docosahexaenoic acid. Furthermore, alpha-linolenic acid is the main fatty acid decreasing platalet aggregation which is an important step in thrombosis i.e. non-fatal myocardial infarction and stroke. DIETARY SOURCES AND NUTRITION RECOMMENDATIONS: Dietary sources include flaxseed and flaxseed oil, canola oil, soybean and soybean oil, pumpkin seed and pumpkin oil, walnuts and walnut oil. Strong evidence supports beneficial effects of alpha-linolenic acid and its dietary sources should be incorporated into balanced diet for prevention of cardiovascular diseases. The recommended daily intake is 2 g with a ratio of 5/1 for linoleic/alpha-linolenic acid. PMID:15510909

Risti?-Medi?, Danijela; Risti?, Gordana; Tepsi?, Vesna



Prospects for alpha particle studies on TFTR  

SciTech Connect

TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

Zweben, S.J.



Socit Tarnaise de sciences Naturelles 2011 : 10-22. Contribution au catalogue des lichens  

E-print Network

Socit Tarnaise de sciences Naturelles 2011 : 10-22. - 1 - Contribution au catalogue des lichens des Cvennes ont permis de complter le catalogue des lichens, des champignons lichnicoles et des.) Fuckel.). Introduction Un inventaire des lichens et des champignons lichnicoles du Parc National des

Paris-Sud XI, Universit de


EEG alpha power and alpha power asymmetry in sleep and wakefulness.  


Asymmetry of waking electroencephalography (EEG) alpha power in frontal regions has been correlated with waking emotional reactivity and the emotional content of dream reports. Little is known regarding alpha asymmetry during sleep. The present study was performed to compare alpha power and alpha power asymmetry in various brain regions across states of sleep and wakefulness. Waking and sleep EEG were recorded in a group of patients undergoing polysomnographic evaluation for possible sleep disorders. Alpha EEG asymmetry in frontal and temporal regions was significantly correlated in waking versus sleep, particularly during rapid eye movement (REM) sleep. These results suggest that patterns of frontal alpha asymmetry are stable across sleep and waking and may be related to emotional reactivity during dreaming. During sleep, alpha power was highest during slow-wave sleep and lowest during REM sleep. Implications of these data for understanding the functional significance of alpha power during waking and sleeping are considered. PMID:10432792

Benca, R M; Obermeyer, W H; Larson, C L; Yun, B; Dolski, I; Kleist, K D; Weber, S M; Davidson, R J



Molecular basis of alpha-thalassemia in Portugal.  


We have estimated the incidence and molecular basis of alpha-thalassemia in a Portuguese population, mostly from the Greater Lisbon area. In a group of 100 consecutive cord blood samples, the gene frequency of the rightward deletion (-alpha 3.7) was 0.035, and the leftward deletion (-alpha 4.2) was 0.015. In this group, we have also found four heterozygotes for the triple alpha-globin gene rearrangement (alpha alpha alpha anti 3.7. gene frequency 0.020). We have characterized the subtypes of -alpha 3.7 and alpha alpha alpha anti 3.7 rearrangements. On the whole, these results give an incidence of 10% for deletional alpha-thalassemia carriers in the studied Portuguese population. In a group of 342 subjects presenting beta-thalassemia, or Hb S trait, beta-thalassemia major sickle cell disease or low red blood cell indices, the -alpha 3.7, -alpha 4.2, -SEA, -MED, (alpha alpha)MM, and alpha alpha alpha anti 3.7 haplotypes were found in different combinations. Only one nondeletional alpha-thalassemia determinant (a 5 nucleotide deletion in the alpha 2-globin gene in the second intervening sequence donor site) was detected, which might suggest a low incidence of these defects in the Portuguese population. PMID:8718693

Peres, M J; Romo, L; Carreiro, H; Picano, I; Batalha, L; Magalhes, H A; Martins, M C; Lavinha, J



La diffusion des sciences et des techniques l'Universit de Lige PriNtemPs des scieNces  

E-print Network

, 22 · Bât. I1 · 4020 Liège description Regroupés en bord de Meuse à l'Embarcadère du Savoir interactive ; · des travaux pratiques en laboratoire ; · des visites de laboratoires de recherche ; · des samedi 27/03 et dimanche 28/03/2010· L'exposition interactive sera accessible au grand public et aux

Liège, Université de


La gestion des mises en defns forestieres : Une reelle opportunite pour la reconstitution des forets des pays du Maghreb  

Microsoft Academic Search

Les forts des pays du Maghreb (Maroc, Algrie, Tunisie) souffrent de multi ples formes de surexploitation pastorale au point de compromettre la rgnration naturelle des formations forestires dans ces pays. Depuis plus de quarante annes, plusieurs actions techniques ont t entreprises en matire d'amnagement des espaces pastoraux (plantations d'arbustes fourragers, ensemencements, fertilisation, traitements sylvo-pastoraux..), dont l'impact est rest limit sur

Mohamed Benzyane; Mustapha Naggar; Bouchra Lahlou



Dialogue des droits et dialogues des traditions juridiques Jean-Michel Blanquer  

E-print Network

'une volution dialectique interne : Libert des anciens, libert des modernes. La tragdie d'Antigone nous met devoir de chacun d'obir la rgle commune. Notre sympathie va Antigone mais est-ce parce qu

Boyer, Edmond


Facult de Psychologie et des Sciences de l'Education Analyse critique des fondements de  

E-print Network

). Capital humain, niveau d'instruction et performances scolaires. Des concepts leur mesure. In Capital humain et croissance rgionale. Quatorzime Congrs des Economistes belges de Langue franaise. Charleroi

Paris-Sud XI, Universit de


DOCTEUR YVES GAUTHIER Spcialiste des maladies des yeux  

E-print Network

Médecins : 64 1 01509 4 / 0 20 2 TRAITEMENT DES MIGRAINES OPHTALMIQUES PAR L'UTILISATION DU R?FLEXE NYSTAGMOG?NE The nystagmogene reflexe used for the treatement of migraine Résumé : Cette publication présente une série d'ob- servations de cas de migraines ophtalmi- ques. Un traitement y est présenté. La

Boyer, Edmond


Direction des Ressources Humaines Service des Personnels Administratifs et  

E-print Network

logistique » CORPS : ATRF NATURE : AFFECTATION ETABLISSEMENT : Université Blaise Pascal ­ IUFM d'Auvergne, Université Blaise Pascal. Il est basé à Chamalières. La tâche principale sera d'assurer l'entretien des Responsable administrative de l'IUFM d'Auvergne, Université Blaise Pascal Tel : 04 73 31 71 52 #12;

Sart, Remi


Yvon PESQUEUX Professeur titulaire de la Chaire Dveloppement des Systmes  

E-print Network

norme. Un modle organisationnel repose sur des lments de discours qui prennent corps sur des'excitation pour un changement perptuel dans les catgories de l'organisation rseau en est aussi une des

Boyer, Edmond


Marie-Nolle Pons Laboratoire Ractions et Gnie des Procds  

E-print Network

: corrosion, adaptation des bactries en station d'puration des eaux rsiduaires Possible pour des les ou durs nergie ( optimiser) Membrane: colmatage Impact sur les cosystmes Pompage Rejet saumure

Canet, Lonie


Werkzeuge der Informatik Grundlagen und Werkzeuge des WWW (Teil 1)  

E-print Network

. Mller, 2011 Geschichte des WWW Anfnge des WWW Geschichte des Internet 1980: Tim Berners-Lee (CERN) schreibt Programm "ENQUIRE", das es erlaubt, Knoten im Internet zu verlinken 1989: Tim Berners-Lee: CERN

Zachmann, Gabriel


Partager : des technologies de pointe au service de la socit  


Mdecine, climatologie, mtrologie et informatique, les techniques utilises par le LHC trouvent dj des rpercussions dans d?autres domaines scientifiques. Utilisant des techniques indites, la physique des particules en fait bnficier la socit toute entire.




Valeur alimentaire des marcs de raisin. III. -Rle des tanins condenss dans la faible valeur nutritive  

E-print Network

Valeur alimentaire des marcs de raisin. III. - Rôle des tanins condensés dans la faible valeur Zootechnie El-Harrach (Algérie) Résumé Pour vérifier que les tanins des marcs de raisin (5 p. 100 de la M dosage des tanins est effectué. Il ressort que, au cours du nycthémère, la concentration du jus en tanins

Paris-Sud XI, Université de


Matching coefficients for alpha_s and m_b to O(alpha_s^2) in the MSSM  

E-print Network

We compute the exact two-loop matching coefficients for the strong coupling constant alpha_s and the bottom-quark mass m_b within the Minimal Supersymmetric Standard Model (MSSM), taking into account O(alpha_s^2) contributions from Supersymmetric Quantum Chromodynamics (SQCD). We find that the explicit mass pattern of the supersymmetric particles has a significant impact on the predictions of alpha_s and m_b at high energies. Further on, the three-loop corrections exceed the uncertainty due to the current experimental accuracy. In case of the the running bottom-quark mass, they can reach in the large tan(beta) regime up to 30% of the tree-level value.

A. Bauer; L. Mihaila; J. Salomon



Synthesis of regioisomeric methyl alpha-L-arabinofuranobiosides.  


The three regioisomers of methyl alpha-L-arabinofuranobioside, namely methyl O-alpha-L-arabinofuranosyl-(1-->2)-alpha-L-arabinofuranoside, methyl O-alpha-L-arabinofuranosyl-(1-->3)-alpha-L-arabinofuranoside, and methyl O-alpha-L-arabinofuranosyl-(1-->5)-alpha-L-arabinofuranoside, were synthesized for use as substrates in studies of the specificity of alpha-L-arabinofuranosidase. The regiospecifically protected precursors, namely methyl 3,5-di-O-benzoyl-alpha-L-arabinofuranoside, methyl 2,5-di-O-benzyl-alpha-L-arabinofuranoside, and methyl 2,3-di-O-benzoyl-alpha-L-arabinofuranoside, were prepared from 2,3,5-tri-O-benzoyl-alpha-L-arabinofuranosyl chloride (4) and methyl 5-O-trityl-alpha-L-arabinofuranoside, respectively, and glycosylated with 4 in the presence of silver trifluoromethanesulfonate and s-collidine. 1H and 13C NMR data for all compounds are presented. PMID:7697668

Kawabata, Y; Kaneko, S; Kusakabe, I; Gama, Y



Cross-talk between integrins {alpha}1{beta}1 and {alpha}2{beta}1 in renal epithelial cells  

SciTech Connect

The collagen-binding integrins {alpha}1{beta}1 and {alpha}2{beta}1 have profoundly different functions, yet they are often co-expressed in epithelial cells. When both integrins are expressed in the same cell, it has been suggested that {alpha}1{beta}1 negatively regulates integrin {alpha}2{beta}1-dependent functions. In this study we utilized murine ureteric bud (UB) epithelial cells, which express no functionally detectable levels of endogenous integrins {alpha}1{beta}1 and {alpha}2{beta}1, to determine the mechanism whereby this regulation occurs. We demonstrate that UB cells expressing integrin {alpha}2{beta}1, but not {alpha}1{beta}1 adhere, migrate and proliferate on collagen I as well as form cellular cords in 3D collagen I gels. Substitution of the transmembrane domain of the integrin {alpha}2 subunit with that of {alpha}1 results in decreased cell adhesion, migration and cord formation. In contrast, substitution of the integrin {alpha}2 cytoplasmic tail with that of {alpha}1, decreases cell migration and cord formation, but increases proliferation. When integrin {alpha}1 and {alpha}2 subunits are co-expressed in UB cells, the {alpha}1 subunit negatively regulates integrin {alpha}2{beta}1-dependent cord formation, adhesion and migration and this inhibition requires expression of both {alpha}1 and {alpha}2 tails. Thus, we provide evidence that the transmembrane and cytoplasmic domains of the {alpha}2 integrin subunit, as well as the {alpha}1 integrin subunit, regulate integrin {alpha}2{beta}1 cell function.

Abair, Tristin D. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Sundaramoorthy, Munirathinam; Chen, Dong [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Heino, Jyrki [Department of Biochemistry and Food Chemistry, University of Turku, Turku (Finland); Ivaska, Johanna [VTT Technical Research Centre of Finland, Medical Biotechnology, Turku (Finland); Hudson, Billy G. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Sanders, Charles R. [Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Pozzi, Ambra [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Zent, Roy [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 37232 (United States)], E-mail:



Contamination des mollusques bivalves par des phycotoxines : interactions entre niveaux de toxicit et rponses physiologiques  

E-print Network

1 Contamination des mollusques bivalves par des phycotoxines : interactions entre niveaux de principaux types de phycotoxines peuvent contaminer les mollusques bivalves : les toxines diarrhéiques (DSP nécessite de connaître au préalable les conditions initiales de contamination des mollusques ainsi que les

Boyer, Edmond


La nature des exsudats de raisins et leur rle dans la germination des conidies de Botrytis  

E-print Network

La nature des exsudats de raisins et leur rôle dans la germination des conidies de Botrytis cinerea mycélienne de Botrytis cinerea. Au cours de la maturation, le rapport sucres/acides des eaux de lavage évolue of the exudates of grape berries and their effect on germination of conidia of Botrytis cinerea. Washing water

Boyer, Edmond


Qualit germinative des semences de pois. II. Suivi conductimtrique des graines au cours de  

E-print Network

Qualit germinative des semences de pois. II. Suivi conductimtrique des graines au cours plantules, peut, au moins en partie, expliquer l'vo- lution de la capacit germinative des semences semences immatures, ralise temprature modre, permet une bonne germination ainsi que l'limination du

Paris-Sud XI, Universit de


Activit parasitaire des Trichoderma vis--vis des champignons sclrotes ; corrlation avec  

E-print Network

Activité parasitaire des Trichoderma vis-à-vis des champignons à sclérotes ; corrélation avec l Montpellier Cedex R?SUM?? Une vingtaine de clones de Trichoderma, comparés pour leur aptitude à détruire des saprophytique. SUMMARYY Parasitic activity of Trichoderma clones against sclerotial fungi ; correlation

Paris-Sud XI, Université de


Profil pidemio-clinique et radiologique des atteintes osto-articulaires des hmophiles Madagascar  

PubMed Central

Introduction Dterminer le profil pidmio-clinique et radiologique des atteintes osto-articulaires des hmophiles malagasy. Mthodes Une tude prospective, descriptive portant sur 25 patients hmophiles venant de tout Madagascar a t ralise. Des radiographies numrises des genoux, des chevilles et des coudes en incidence de face et de profil ainsi qu'une chographie des hanches, des genoux, des chevilles et des coudes ont t ralises chez ces patients. Le type et la svrit de la maladie ainsi que l'aspect de la cavit articulaire, la synoviale, les noyaux piphysaires et les surfaces articulaires ont t analyss. Rsultats Soixante-huit pourcent des patients taient hmophiles de type A et 32 % de type B. Quarante pourcent taient classs svres, 28 % modrs et 32 % mineurs. Les atteintes osto-articulaires ont t retrouves chez 56 % des patients. Il n'existait pas de prdominance d'atteinte selon le type ni la svrit de la maladie. Les plus jeunes taient les plus atteints et l'articulation du genou et de la cheville taient les plus touches. Conclusion Les complications osto-articulaire de l'hmophilie sont graves et ne dpendent pas du type ni de la svrit de l'affection. Elles touchent surtout les enfants d'ge scolaire. Le couple radiographie-chographie permet de diagnostiquer et de surveiller ces lsions.

Narindra, Lova Hasina Rajaonarison Ny Ony; Rabemanorintsoa, Feno Hasina; Randrianantenaina, Faralahy Ravelonarivo; Rakoto, Olivat Alson Aime; Ahmad, Ahmad



Electronique organique: Emission de lumire bleue dans des OLEDs via des excimres intramolculaires.  

E-print Network

Electronique organique: Emission de lumière bleue dans des OLEDs via des excimères ces nouvelles molécules comme couche active dans des diodes organiques électroluminescentes (OLEDs OLEDs. Ces travaux s'intègrent dans la thématique "Composés 3-2spiro pour l'électronique organique

Rennes, Université de



E-print Network

SUR LA DIFFRACTION DES RAYONS X PAR DES LIQUIDES (Deuxime communication). Par M. W. H. KEESOM et M. J. de SMEDT I. Introduction. - Toutes les expriences sur la diffraction des rayons X, dcrites dans'interfrence de rayons disperss par chaque atome dans la molcule, n'a t observ. Dans le cas de l'oxygne, par

Boyer, Edmond


Influence des hautes tempratures des racines sur la croissance de plants de diverses varits de melon  

E-print Network

Influence des hautes tempratures des racines sur la croissance de plants de diverses varits de melon (Cucumis melo L.). Aspects particuliers concernant la nutrition de la plante Georgette RISSER'Amlioration des Plantes marachres, Domaine Saint-Maurice. *LN.R.A., Station d'Agronomie, Domaine Saint

Paris-Sud XI, Universit de



E-print Network

PARASITES ORDINAIRES DES PORCS EN FRANCE DIAGNOSTIC ISOLEMENT DES SOUCHES POUR INFESTATIONS' - Amboise R?SUM? Un survol sur les parasites ordinaires des porcs en France est présenté en distinguant les'Oesophagos- tomum est présenté. SUMMARY ORDINARY PARASITES OF SWINE IN FRANCE ; DIAGNOSIS ; ISOLATION

Boyer, Edmond


Penser l'impensable. Cadrage cognitif des suicides lis au travail et pratiques des organisations  

E-print Network

Penser l'impensable. Cadrage cognitif des suicides lis au travail et pratiques des organisations travail particulirement polmique : les suicides lis au travail. Les trois cadres cognitifs identifis'acteurs en vue d'imposer leur vision particulire des suicides lis au travail, intgrant les prsupposs

Paris-Sud XI, Universit de



E-print Network

COLORIM?TRIE DES LED : INCERTITUDES ET INFLUENCE DU COURANT ?LECTRIQUE 17 N. POUSSET Colorimétrie des LED : incertitudes et influence du courant électrique LEDs colorimetry: uncertainties proximale, et indices de rendu des couleurs) de sources d'éclairage à LED, du LNE-INM/Cnam, est décrit. Les

Paris-Sud XI, Université de


Difficile convergence des archives ouvertes en SIC # Difficile convergence des archives ouvertes  

E-print Network

Difficile convergence des archives ouvertes en SIC # Difficile convergence des archives ouvertes en Paris R?SUM?. L'article rend compte d'un test de moissonnage pour quatre archives ouvertes sélectionnées'identification des archives ouvertes SIC sur le répertoire international OpenDOAR, est ensuite approfondie à partir

Paris-Sud XI, Université de


Aide aux doctorants pour la participation des Aide aux doctorants pour la participation des colloques  

E-print Network

Aide aux doctorants pour la participation à des colloques Aide aux doctorants pour la participation à des colloques retour Formation doctorale Aide aux doctorants pour la participation à des colloques aide vient compléter les financements déjà prévus par les laboratoires et les ?coles doctorales pour

Di Girolami, Cristina


Etude des Seuils de Poursuite et de Dmodulation des Signaux Galileo pour  

E-print Network

Etude des Seuils de Poursuite et de Dmodulation des Signaux Galileo pour l'Aviation Civile Lieu'utilisation de Galileo par l'aviation civile. D'autre part, dans le cadre de discussions bilatrales entre les signaux GPS et Galileo, et, en particulier, afin de s'assurer que la co-existence des signaux GPS et

Dobigeon, Nicolas


DIFFUSION DES ESSAIS DE MATRISE Procdure l'usage des facults  

E-print Network

DIFFUSION DES ESSAIS DE MATRISE Procdure l'usage des facults de l'Universit Laval (UL) ENTRE bonifi en ce qui concerne la diffusion des essais de matrise. Ce document prsente la procdure suivre pour dposer une demande de diffusion d'un essai. La diffusion d'un format lectronique rend les essais


Mobiliser des indicateurs pour valuer les effets propres des mesures agro-environnementales en France.  

E-print Network

-1- Mobiliser des indicateurs pour valuer les effets propres des mesures agro-environnementales en propres, mesures agro-environnementales, indicateurs agro-environnementaux, eau, biodiversit, Keywords;-2- Rsum L'valuation ex-post des Mesures agro-environnementales (MAE) du Rglement de Dveloppement Rural

Paris-Sud XI, Universit de



E-print Network

Fibonacci (1175­1240). Théorème 3 (Fermat (1601­1665)). --- 1 n'est pas un nombre congruent. #12; 2 PIERRE COLMEZ C'est une des nombreuses utilisations que Fermat a trouvées pour sa méthode 2 de « la des­ centeLE PROBL?ME DES NOMBRES CONGRUENTS par Pierre Colmez Résumé. --- Ce texte est une introduction à la

Colmez, Pierre


Solution conformation of a neuronal nicotinic acetylcholine receptor antagonist {alpha}-conotoxin OmIA that discriminates {alpha}3 vs. {alpha}6 nAChR subtypes  

SciTech Connect

{alpha}-Conotoxin OmIA from Conus omaria is the only {alpha}-conotoxin that shows a {approx}20-fold higher affinity to the {alpha}3{beta}2 over the {alpha}6{beta}2 subtype of nicotinic acetylcholine receptor. We have determined a three-dimensional structure of {alpha}-conotoxin OmIA by nuclear magnetic resonance spectroscopy. {alpha}-Conotoxin OmIA has an '{omega}-shaped' overall topology with His{sup 5}-Asn{sup 12} forming an {alpha}-helix. Structural features of {alpha}-conotoxin OmIA responsible for its selectivity are suggested by comparing its surface characteristics with other functionally related {alpha}4/7 subfamily conotoxins. Reduced size of the hydrophilic area in {alpha}-conotoxin OmIA seems to be associated with the reduced affinity towards the {alpha}6{beta}2 nAChR subtype.

Chi, Seung-Wook [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of)]. E-mail:



The trypsin-inhibitory efficiency of human alpha 2-macroglobulin in the presence of alpha 1-proteinase inhibitor: evidence for the formation of an alpha 2-macroglobulin--alpha 1-proteinase inhibitor complex.  


The inhibition of bovine pancreatic trypsin was studied at pH 7, 25 degrees C, using mixtures of purified human alpha 2-macroglobulin (alpha 2M) and alpha 1-proteinase inhibitor (alpha 1 PI). The partitioning of the enzyme between the two inhibitors was determined by comparing control esterase activity, assayed with N-benzoyl-L-arginine ethyl ester as substrate, with that remaining after incubation with inhibitory mixtures. (At [I]0 > [E]0, remaining esteratic activity reflects the concentration of alpha 2M-associated enzyme (alpha 2M-E*) and the concentration of alpha 1PI-associated, inactive enzyme (alpha 1PI-E*) is given by the difference, [E]0-[alpha 2M-E*].) The pattern of product distribution was found to be incompatible with an inhibitory model involving parallel, second-order reactions of E with alpha 2M and alpha 1PI. The data pointed to complex formation between the two inhibitors, limiting the level of alpha 2M readily available for reaction with E. Analysis based on the binding equilibrium, alpha 2M (dimeric unit) + alpha 1PI reversible alpha 2M-alpha 1PI, yielded Kd = 2.1 +/- 0.3 microM. Complex formation between alpha 2M and alpha 1PI was verified by gel permeation experiments. alpha 2M was found to restrict the volume of distribution of alpha 1PI in Sephadex G200 beds. Kd, deduced from gel permeation behaviour, was 0.8 +/- 0.32 microM. Preliminary kinetic experiments with dialyzed plasma suggested that the alpha 2M-alpha 1PI interaction is effective also in vivo. Given Kd and the mean plasma levels of the two inhibitors ([alpha 2M] = 2 microM; [alpha 1PI] = 36 microM), it was estimated that > 90% of alpha 2M in human circulation must be complexed to alpha 1PI and lack immediate antiproteinase activity. PMID:10488249

Dejgaard, S; Ortapamuk, O; Ozer, I



Un modle fond sur l'analyse des activits et des besoins : application un entrept de ressources  

E-print Network

d'information stratgique, systme organisationnel, modlisation des acteurs, entrept de donnes universits qui ont fait merger des difficults relatives la conduite du changement et une implication des

Boyer, Edmond


Differential cardiovascular regulatory activities of the alpha 1B- and alpha 1D-adrenoceptor subtypes.  


The regulation of cardiac and vascular function by the alpha 1B- and alpha 1D-adrenoceptors (ARs) has been assessed in two lines of transgenic mice, one over-expressing a constitutively active alpha 1B-AR mutation (alpha 1B-ARC128F) and the other an alpha 1D-AR knockout line. The advantage of using mice expressing a constitutively active alpha 1B-AR is that the receptor is tonically active, thus avoiding the use of nonselective agonists that can activate all subtypes. In hearts from animals expressing alpha 1B-ARC128F, the activities of the mitogen-activated protein kinases, extracellular signal-regulated kinase, and c-Jun N-terminal kinase were significantly elevated compared with nontransgenic control animals. Mice over-expressing the alpha 1B-ARC128F had echocardiographic evidence of contractile dysfunction and increases in chamber dimensions. In isolated-perfused hearts or left ventricular slices from alpha 1B-ARC128F-expressing animals, the ability of isoproterenol to increase contractile force or increase cAMP levels was significantly decreased. In contrast to the prominent effects on the heart, constitutive activation of the alpha 1B-AR had little effect on the ability of phenylephrine to induce vascular smooth muscle contraction in the isolated aorta. The ability of phenylephrine to stimulate coronary vasoconstriction was diminished in alpha 1D-AR knockout mice. In alpha 1D-AR knockout animals, no negative effects on cardiac contractile function were noted. These results show that the alpha1-ARs regulate distinctly different physiologic processes. The alpha 1B-AR appears to be involved in the regulation of cardiac growth and contractile function, whereas the alpha 1D-AR is coupled to smooth muscle contraction and the regulation of systemic arterial blood pressure. PMID:12649302

Chalothorn, Dan; McCune, Dan F; Edelmann, Stephanie E; Tobita, Kimimasa; Keller, Bradley B; Lasley, Robert D; Perez, Dianne M; Tanoue, Akito; Tsujimoto, Gozoh; Post, Ginell R; Piascik, Michael T



Alpha labelings of straight simple polyominal caterpillars  

E-print Network

Alpha labelings of straight simple polyominal caterpillars Dalibor Froncek, O'Neill Kingston, Kyle. We introduce a related family of graphs called straight simple polyominal caterpillars and prove that they also admit an alpha labeling. This implies that every straight simple polyominal caterpillar with n

Froncek, Dalibor


Personal alpha contamination simulator and detector  

Microsoft Academic Search

A simulated radiation source and a compatible detector system are disclosed. The combination is useful in training for detecting alpha radiation contamination. A flexible, soft iron plate or first permanent magnet in the detector system responds to a second magnet that is employed to represent an alpha radiation source. Where the first permanent magnet is used, an iron member may

R. H. Insinger; A. H. Rodemann



Personal alpha contamination simulator and detector  

Microsoft Academic Search

A simulated radiation source and a compatible detector system are disclosed. The combination is useful in training for detecting alpha radiation contamination. A flexible, soft iron plate or first permanent magnet in the detector system responds to a second magnet that is employed to represent an alpha radiation source. Where the first permanent magnet is used, an iron member may

R. H. Insinger; A. H. Rodemann



Psychiatric Symptoms in Alpha-Mannosidosis  

ERIC Educational Resources Information Center

Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several

Malm, D.; Pantel, J.; Linaker, O. M.



A nuclear diagnostic for fast alpha particles  

Microsoft Academic Search

The authors investigate the possibility of seeding a fusion plasma with nuclei that can undergo nuclear reactions with energetic alpha particles to produce product nuclei that are radioactive. If a fraction of these product nuclei can be collected and measured, one can obtain information about the presence of fast alpha particles. It appears that a feasible diagnostic could be based

L. R. Grisham; J. M. Dawson; D. E. Post



Teaching Calculus with Wolfram|Alpha  

ERIC Educational Resources Information Center

This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to

Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne



Elementary Processes Underlying Alpha Channeling in Tokamaks  

SciTech Connect

Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

NM.J. Fisch



A Liquid Sodium alpha omega Dynamo Experiment  

Microsoft Academic Search

A Liquid Sodium alpha omega Dynamo Experiment; Stirling Colgate, Howard Beckley, Hui Li, Richard Sonnenfeld, Dave Westpfahl, Ian Bentley, Rocky Ginanni, Travis Mckinnly, and Valadimir Pariev, LANL, NMIMT, & Univ. of Rochester. A liquid sodium alpha omega dynamo experiment has been constructed at NMIMT to simulate MRI, dynamo gain, and feed back in liquid sodium (r1 = 15 cm,; r2

Stirling Colgate; Howard Beckley; Hui Li; Richard Sonnenfield; Dave Westpfahl; Ian Bentley; Rocky Ginanni; Travis McKinnly; Valadimir Pariev



Measurement of alpha particles on PLT  

SciTech Connect

The radial emission profile of the d(/sup 3/He,p)..cap alpha.. fusion reaction was measured on PLT by pitch angle resolution of the escaping 3.7-MeV alphas. The d-/sup 3/He reactions were produced by /sup 3/He minority ICRF and the emission was strongly peaked at the ICRF resonance layer.

Murphy, T.J.; Strachan, J.D.




E-print Network

intresss au changements organisationnels et notamment au degr d'intgration ou au processus d changements organisationnels concernent galement les systmes comptables1 des entits juridiques partie

Paris-Sud XI, Universit de


Christian Blanchette Responsable de la gestion des  

E-print Network

Doyen Christian Blanchette Responsable de la gestion des ressources humaines Lise Gervais Vice technopdagogique Justine Castonguay-Payant Coordonnateurs MICC Christiane Labelle Bernard Lvesque et Marco Moraes

Charette, Andr


Die Vereinigung der Freunde und Frderer des Instituts fr Physik  

E-print Network

Die Vereinigung der Freunde und Frderer des Instituts fr Physik der Humboldt-Universitt zu Geschftsfhrender Direktor des Instituts fr Physik Stellvertretender Vorstandsvorsitzender der Freunde und Frderer

Peters, Achim


ORNL ALPHA MIS data base manual  

SciTech Connect

ALPHA is a general-purpose Management Information System (MIS) sponsored and developed by the Finance and Materials Division of the Oak Ridge National Laboratory (ORNL). It allows users to access any System 1022 data base on ORNL's DECsystem-10 computer to obtain information for use in the process of management. As its name implies, ALPHA is the foundation of most of the business information systems sponsored by the Finance and Materials Division. The purpose of this manual is to aid the experienced ALPHA user in setting up a data base and the associated tables and files to use fully the capabilities of the ALPHA System in solving the routine and the more complex MIS problems. This manual is one of a series of reports documenting the ALPHA System. When completed, these manuals will provide complete systems documentation on ORNL's most versatile and useful MIS.

Grubb, J.W.; Lovin, J.K.; Haese, R.L.



Long-range alpha detector (LRAD)  

SciTech Connect

Historically, alpha detectors have been limited by the very short range of alpha particles in air and by relatively poor sensitivity, even if the particles are intercepted. Of necessity, these detectors are operated in a vacuum or in close proximity to the source if reasonable efficiency is desired. In our new long-range alpha detector (LRAD), alpha particles interact with the ambient air, producing ionization in the air at the rate of about 30,000 ion pairs per MeV of alpha energy. These charges can be transported over significant distances (several meters) in a moving current of air generated by a small fan. An ion chamber located in front of the fan measures the current carried by the moving ions. The LRAD-based monitor is more sensitive and more thorough than conventional monitors. We present current LRAD sensitivity limits and results, practical monitor designs, and proposed uses for LRAD monitors. 4 refs., 7 figs.

MacArthur, D.W.; McAtee, J.L.



Projet de cration d'un espace-mmoire pour des sites historiques l'aide des TIC  

Microsoft Academic Search

L'objectif de l'article est de confronter des hypothses sur les mthodes d'interprtation des espaces patrimoniaux, en s'appuyant sur la modlisation et la simulation numrique, les nouvelles mthodes de traitement des donnes et les TIC. travers des cas d'tudes probants, il s'agit d'analyser comment un ensemble patrimonial est la transposition architecturale des valeurs culturelles; de comprendre les consquences des occupations

Nada El-Khoury; lise Meyer; Giovanni De Paoli; Pierre Grussenmeyer


Relation entre les caractristiques des table-bancs et les mesures anthropomtriques des coliers au Benin  

PubMed Central

Introduction Le mobilier scolaire et la posture assise en classe sont souvent impliqus dans l'apparition des douleurs rachidiennes, influant de fait sur la qualit des tches ralises par les apprenants. Aucune tude n'a encore vrifi le degr d'adquation entre les caractristiques du mobilier et celles des coliers au Bnin. L'objectif de cette tude transversale est donc de dterminer la relation entre les dimensions des table-bancs utilises en classe et les mesures anthropomtriques des coliers au Bnin. Methods Elle a t ralise avec un chantillon probabiliste de 678 coliers, gs de 4 17 ans. Les mesures anthropomtriques des coliers et les mensurations relatives aux longueurs, largeurs et hauteurs des table-bancs ont t mesures, puis intgres aux quations proposes dans la littrature. Les pourcentages des valeurs situes hors des limitesacceptables, drives de l'application des quations ont t calculs. Results La largeur et la hauteur des table-bancs utilises par les coliers taient plus leves (p < 0,05) que les valeurs de rfrence recommandes par les structures officielles de contrle et de production des mobiliers scolaires au Bnin. Quel que soit le sexe, il y avait une inadquation entre la largeur du banc et la longueur fesse-poplit, puis entre la hauteur de la table et la distance coude-bancdes coliers. Conclusion Les rsultats suggrent de prendre en compte lvolution des mesures anthropomtriques des coliers dans la confection des table-bancs, afin de promouvoir de bonnes postures assises en classe et de rduire le risque de troubles du rachis. PMID:25317232

Falola, Stve Marjelin; Gouthon, Polycarpe; Falola, Jean-Marie; Fiogbe, Michel Armand; Nigan, Issiako Bio



Catalytic Mechanism of Human Alpha-galactosidase  

SciTech Connect

The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S



Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression  

SciTech Connect

Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J



Organization of the alpha-globin genes in the Chinese alpha-thalassemia syndromes.  

PubMed Central

The alpha-thalassemia syndromes are a group of inherited anemias, the clinical severity of which has been shown to increase with the number of alpha-globin structural genes deleted. Employing restriction endonuclease gene mapping, we defined the organization of the alpha-globin genes in cellular DNA from Chinese subjects with various alpha-thalassemia syndromes. The four alpha-globin genes of normals are at two loci located on a 23.0-kilobase pair (kb) Eco RI fragment. In deletion type hemoglobin-H disease the 5' alpha-globin locus is deleted and the single 3' alpha-globin locus is found on a 19.0-kb Eco RI fragment. In alpha-thalassemia-2 there are two alpha-globin genes on a 23.0-kb Eco RI fragment and one on a 19.0-kb fragment. In alpha-thalassemia-1 and the nondeletion type of hemoglobin-H disease the two alpha-globin genes are at two loci on one chromosome and none reside on the other chromosome. Images PMID:447845

Embury, S H; Lebo, R V; Dozy, A M; Kan, Y W



Sur l'cart quadratique moyen des diviseurs d'un entier normal  

NASA Astrophysics Data System (ADS)

Introduite par Hall [4] en 1979 et tudie de manire systmatique par Hall et Tenenbaum ([6, 7]), la fonctionformula hereest une mesure quadratique de la proximit des diviseurs.On a trivialement [tau](n)[less-than-or-eq, slant]T(n, [alpha])[less-than-or-eq, slant]T(n, 1)=[tau](n)2 pour tout [alpha], o, ici et dans la suite, [tau](n) dsigne le nombre de diviseurs d'un entier gnrique n: Le statut de l'ingalit de gauche pour presque tout entier n est une question difficile qui a inspir une conjecture d'Erdos (cf. [1]) assez connue. Convenons de dsigner par pp (presque partout) une relation valable sur un ensemble d'entiers de densit unit et posonsformula here(Cette fonction est mentionne dans [4], mais sa dfinition fait l'objet d'une coquille.)

Raouj, A.; Tenenbaum, G.



The fratricide of alpha-Omega dynamos by their alpha-squared siblings  

E-print Network

Context. Helically forced magneto-hydrodynamic shearing-sheet turbulence can support different large-scale dynamo modes, although the {\\alpha} - {\\Omega} mode is generally expected to dominate because it is the fastest growing. In an {\\alpha} - {\\Omega} dynamo, most of the field amplification is produced by the shear. As differential rotation is an ubiquitous source of shear in astrophysics, such dynamos are believed to be the source of most astrophysical large-scale magnetic fields. Aims. We study the stability of oscillatory migratory {\\alpha} - {\\Omega} type dynamos in turbulence simulations. Methods. We use shearing-sheet simulations of hydromagnetic turbulence that is helically forced at a wavenumber that is about three times larger than the lowest wavenumber in the domain so that both {\\alpha} - {\\Omega} and {\\alpha}2 dynamo action is possible. Results. After initial dominance and saturation, the {\\alpha} - {\\Omega} mode is found to be destroyed by an orthogonal {\\alpha}2 mode sustained by the helical t...

Hubbard, Alexander; Brandenburg, Axel



{alpha} ratio 2n ratio {alpha} Molecular Band in {sup 10}Be  

SciTech Connect

The 10.15 MeV resonance in {sup 10}Be has been probed via resonant {sup 6}He+{sup 4}He elastic scattering. It is demonstrated that it is the J{sup {pi}}=4{sup +} member of a rotational band built on the 6.18 MeV 0{sup +} state. A {gamma}{sub {alpha}} of 0.10-0.13 MeV and {gamma}{sub {alpha}}/{gamma}=0.35-0.46 were deduced. The corresponding reduced {alpha} width, {gamma}{sub {alpha}}{sup 2}, indicates one of the largest {alpha}-cluster spectroscopic factors known. The deformation of the band, including the 7.54 MeV, 2{sup +} member, is large (({Dirac_h}/2{pi}){sup 2}/2I=200 keV). Such a deformation and the significant degree of clusterization signals a well-developed {alpha} ratio 2n ratio {alpha} molecular structure.

Freer, M.; Ashwood, N.I.; Curtis, N.; Price, D.; Ziman, V.A. [School of Physics and Astronomy, University of Birmingham, Edgbaston, Birmingham, B15 2TT (United Kingdom); Casarejos, E.; Angulo, C.; Demaret, P. [CRC/LLN Centre de Recherches du Cyclotron, Universite catholique de Louvain, B-1348 Louvain-la-Neuve (Belgium); Achouri, L.; Laurent, B.; Orr, N.A. [Laboratoire de Physique Corpusculaire, ISMRA and Universite de Caen, IN2P3-CNRS, 14050 Caen Cedex (France); Harlin, C. [School of Electronics and Physical Sciences, University of Surrey, Guildford, Surrey, GU2 7XH (United Kingdom); Milin, M.; Soic, N. [Department of Experimental Physics, Rudjer Boskovic Institute, Bijenicka 54, HR-10000 Zagreb (Croatia); Raabe, R. [Instituut voor Kern- en Stralingsfysica, University of Leuven, B-3001 Leuven (Belgium)



Le traitement familial des enfants et des adolescents anorexiques : Des lignes directrices pour le mdecin communautaire  

PubMed Central

Lanorexie mentale (AM) est une maladie grave qui met la vie en danger et qui fait gnralement son apparition pendant ladolescence. Les donnes probantes au sujet du traitement optimal de lAM chez les enfants et les adolescents sont en croissance, mais il reste beaucoup apprendre. Mme si les dmarches thrapeutiques actuelles varient au Canada et ailleurs, les donnes jusqu prsent indiquent que le traitement familial (TF) est le plus efficace pour les enfants et les adolescents anorexiques. Un lment essentiel du modle de TF, cest que les parents sont investis de la responsabilit de rtablir la sant physique de leur enfant et de sassurer de la reprise complte de son poids. Le mdecin qui comprend les principes fondamentaux et la philosophie du TF peut mettre en place les lments de cette intervention fonde sur des faits probants auprs des jeunes patients anorexiques et de leur famille.

Findlay, S; Pinzon, J; Taddeo, D; Katzman, DK



Nonlinear interface dynamos with alpha -quenching  

NASA Astrophysics Data System (ADS)

There exist various mechanisms capable of limiting the magnitude of the (presumably) dynamo-generated, large-scale solar magnetic field. One such mechanism is the so-called ``alpha -quenching''. The underlying idea is that the Lorentz force associated with the dynamo-generated magnetic fields impedes the small scale, turbulent fluid motions giving rise to the so-called ``alpha -effect'' (the production of poloidal from toroidal fields in the framework of mean-field dynamo theory). In mean-field models, a popular ---yet essentially ad hoc--- prescription for alpha -quenching consists in replacing the coefficient (alpha ) of the alpha -effect source term in the dynamo equations by an expression of the form alpha -> alpha (B) =alpha_0 /(1+(|B|/B_eq)(2)) , where alpha_0 is a measure of the strength of the alpha -effect in the linear regime, and B_eq is the equipartition field strength, based on the kinetic energy of the turbulent, convective fluid motions (B_eq ~ 10(4) G at the base of the solar convection zone). In principle, such ``Weak Quenching'' allows the production of magnetic fields of roughly equipartition strength, as demonstrated by the numerous conventional mean-field dynamo models making use of eq. (1), or some close variant, published to date. Vainshtein & Cattaneo (1992, ApJ 393, 165) and Gruzinov & Diamond (1995, Phys. Plasmas 2, 1941) have argued, however, that alpha -quenching should be described by alpha -> alpha (B) =alpha_0 /(R_m(|B|/B_eq)(2)) where R_m is a magnetic Reynolds number based on the microscopic properties of the flow (R_m>> 1 for solar interior conditions). This now describes a much stronger form of alpha -quenching, and, with R_m>> 1, could be fatal to large-scale dynamo action, in the sense that the dynamo could only produce magnetic fields of strength << B_eq. This is in marked contradiction with the demands set by recent models of bipolar magnetic region emergence, which require field strengths of order 10x B_eq ~ 10(5) G for the observed latitudes and tilt of emergence to be adequately reproduced. In this contribution, we investigate the circumstances under which interface dynamos can avoid alpha -quenching, either in the ``Weak'' or ``Strong'' forms defined above. In interface dynamos the alpha -effect is assumed to operate within the solar convective envelope, while the strongest magnetic fields are generated by shearing below the core-envelope interface (Parker 1993, ApJ 408, 707; Charbonneau & MacGregor, submitted to ApJ). This spatial segregation of the alpha -effect source region is the key to avoiding alpha -quenching. This is illustrated using a few nonlinear, kinematic interface dynamo solutions applicable to the Sun.

Charbonneau, P.; MacGregor, K. B.



Analyse des impacts financiers, organisationnels et marketing des normes IFRS dans le secteur des assurances  

Microsoft Academic Search

Au dtour de confrences et selon les dires de la plupart des directeurs financiers de groupes dassurances confronts aux normes IFRS, leur implmentation est ou a t la relve dun vritable dfi. Outre le challenge li la comprhension et lapplication de ces normes, ladoption du rfrentiel international a gnr de nombreux cots et a engendr divers changements organisationnels.

Frdric Chandelle; Jacqueline Haverals



[Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].  


Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo



alpha-Crystallin can Function as a Molecular Chaperone  

Microsoft Academic Search

The alpha-crystallins (alphaA and alphaB) are major lens structural proteins of the vertebrate eye that are related to the small heat shock protein family. In addition, crystallins (especially alphaB) are found in many cells and organs outside the lens, and alphaB is overexpressed in several neurological disorders and in cell lines under stress conditions. Here I show that alpha-crystallin can

Joseph Horwitz



Alpha 1-blocker combination therapy for hypertension.  


Combination therapy is a cost-effective and rational approach to treatment of severe hypertension and of mild to moderate hypertension that is refractory to monotherapy. The method has several advantages, most notably improved tolerability and enhanced antihypertensive efficacy. Long-term prospective studies are needed to confirm that such agents as calcium channel blockers, ACE inhibitors, and alpha 1 blockers reduce end-organ damage more effectively than do older antihypertensive drugs. However, scientific evidence strongly suggests that reducing risk factors for end-organ damage reduces heart, brain, kidney, and large-artery injury. Alpha 1 blockers appear to be a particularly suitable choice for use in combination regimens. The only class of agents that should be avoided in combination with alpha 1 blockers is central alpha agonists; all other agents act in an additive or synergistic fashion. Unlike diuretics and beta blockers, alpha 1 blockers do not adversely affect serum lipid, glucose, or insulin levels. In fact, alpha 1 blockers may improve these measurements and also counteract the adverse effects of other antihypertensive agents on them. Alpha1-blocker therapy may bring about regression of LVH, and it does not have deleterious effects on disorders that often coexist with hypertension (e.g., gout, chronic obstructive lung disease, peripheral ischemia). PMID:9742910

Houston, M C



Lyman Alpha Spicule Observatory (LASO)  

NASA Technical Reports Server (NTRS)

The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

Chamberlin, Phillip C.



Prevalence of alpha-thalassemias in northern Thailand.  


The population of northern Thailand has one of the highest frequencies of alpha-thalassemia in the world. However, the available distributional data are controversial. In addition to deletional types of alpha-thalassemia Hb, type Constant Spring should also be taken into consideration in alpha-thalassemia population studies, because it causes clinical alpha-thalassemia in the homozygous state or when present with both alpha-globin genes deleted in trans. We have examined a sample of 215 healthy subjects from four rural districts of Chiang Mai province. Out of these, 77 exhibited anomalies of the alpha-globin genes (alpha alpha/-alpha 3.7 in 36; -alpha 3.7/-alpha 3.7 in 3; -SEA in 30; alpha alpha/alpha CS alpha in 5; alpha alpha alpha anti 3.7 in 3). Therefore, no fewer than 2% of the children in northern Thailand are expected to be born with HbH disease or thalassemic hydrops fetalis. The considerable public health problem of hemoglobinopaties and the increasing acceptance of family planning necessitates facilities for the pre- and postnatal diagnosis of these disorders at the DNA level. PMID:8707307

Lemmens-Zygulska, M; Eigel, A; Helbig, B; Sanguansermsri, T; Horst, J; Flatz, G



SUMOylation of ROR{alpha} potentiates transcriptional activation function  

SciTech Connect

SUMOylation regulates a variety of cellular processes, including control of transcriptional activities of nuclear receptors. Here, we present SUMOylation of orphan nuclear receptor, ROR{alpha} by both SUMO-1 and SUMO-2. SUMOylation of ROR{alpha} occurred on the 240th lysine residue at the hinge region of human protein. PIAS family members, PIASx{alpha}, PIAS3, and PIASy, increased SUMOylation of ROR{alpha}, whereas SENP2 specifically removed SUMO from ROR{alpha}. SUMOylation-defective mutant form of ROR{alpha} exhibited decreased transcriptional activity on ROR{alpha}-responsive promoters indicating that SUMOylation may positively regulate transcriptional function of ROR{alpha}.

Hwang, Eun Ju [Department of Biological Sciences, Research Center for Women's Disease, Sookmyung Women's University, 52 Hyochangwon-gil, Yongsan-gu, Seoul 140-742 (Korea, Republic of); Lee, Ji Min [Department of Biological Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Jeong, Jiyeong; Park, Joo Hyeon; Yang, Young; Lim, Jong-Seok [Department of Biological Sciences, Research Center for Women's Disease, Sookmyung Women's University, 52 Hyochangwon-gil, Yongsan-gu, Seoul 140-742 (Korea, Republic of); Kim, Jung Hwa [Department of Medical Sciences, Inha University, Incheon 402-751 (Korea, Republic of); Baek, Sung Hee [Department of Biological Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Keun Il [Department of Biological Sciences, Research Center for Women's Disease, Sookmyung Women's University, 52 Hyochangwon-gil, Yongsan-gu, Seoul 140-742 (Korea, Republic of)], E-mail:



Gestion des ressources humaines Dveloppement organisationnel  

E-print Network

Gestion des ressources humaines Dveloppement organisationnel laboration et valuation de stratgique Analyse de performance organisationnelle laboration et mise en oeuvre de stratgies de changement changement. l'intrieur de certains cours de cette session d'tude, les tudiants ralisent des mandats en

Spino, Claude


Archives de sciences sociales des religions  

E-print Network

Archives de sciences sociales des religions 115 (juillet-septembre 2001) Islam et politique dans religions #12;Quel islam en Bulgarie post-communiste ? 2 Archives de sciences sociales des religions, 115 vigueur en France. est un portail de revues en sciences humaines et sociales développé par le

Paris-Sud XI, Université de


Archives de sciences sociales des religions  

E-print Network

Archives de sciences sociales des religions Numéro 138 (avril - juin 2007) Varia:// Ce document est le fac-similé de l'édition papier. © Archives de sciences sociales des religions vigueur en France. est un portail de revues en sciences humaines et sociales développé par le

Paris-Sud XI, Université de



E-print Network

STAGE QUALITY-PARTNER CAHIER DES CHARGES ?LABORATION DE MODULES POUR UN FRAMEWORK (PHP/MYSQL) SUJET fluide du PHP littéral (l'écriture "objet" n'est pas suivie actuellement, PHP 5.4.x) Connaissance fluide" avec gestion des erreurs, transactions, réessais. o client SOAP (inclus dans PHP 5) --> rendre

Ernst, Damien



E-print Network

MESURE DE LA PERFORMANCE GLOBALE DES AGENCES BANCAIRES : UNE APPLICATION DE LA MTHODE DEA HUBRECHT'approche DEA nous mesurons la performance globale des agences bancaires et nous la dcomposons en efficience technique et en efficience prix. Mots cls : DEA, mesure de la performance globale, agences bancaires

Boyer, Edmond


Erweiterung des L^e-Saito-Theorems  

E-print Network

Erweiterung des L^e-Saito-Theorems Mathias Schulze Einf¨uhrung Eulers Formel Log. Felder & Formen Freie Divisoren Resultate Log. Residuum L^e-Saito-Theorem Faber-Vermutung Beweisfragmente Glatte Komponenten Gebrochene Ideale Pienes Theorem Eine Erweiterung des L^e-Saito-Theorems Mathias Schulze Oklahoma

Schulze, Mathias


Symposium 06 Dynamique des composes minraux,  

E-print Network

environnementaux variables tels que le pH, le Eh, le temps de residence, la temperature, la competition ionique ou environmental factors including pH, Eh, residence time, temperature, and competitive ions and ligands on various zones hydromorphes ; 1'action des acides humiques sur 1'adsorption des phosphates sur la goethite ; et 1

Sparks, Donald L.


Bureau des environnements numriques d'apprentissage  

E-print Network

Bureau des environnements numriques d'apprentissage Guide d'utilisation d' iTunes U pour les'utilisation pour les producteurs de contenus iTunes U Bienvenue iTunes U Universit de Montral iTunes U est une rubrique consacre au sein d'iTunes Store ( fr) proposant des contenus pdagogiques

Montral, Universit de


Die Abgrenzung beitragsbezogener Pensionsplane aus Sicht des  

E-print Network

Die Abgrenzung beitragsbezogener Pensionspl¨ane aus Sicht des Asset-Liability-Managements Andreas Wirtschaftswissenschaften UNIVERSIT¨AT ULM #12;Die Abgrenzung beitragsbezogener Pensionspl¨ane aus Sicht des Asset-Liability-Managements in Richtung eines Asset-Liability-Managements (ALM) von beitrags- bezogenen Pensionspl¨anen deutscher

Ulm, Universität


PREMIERE PARTIE Morphologie des surfaces vicinales.  

E-print Network

selon la nature des dipôles présents en bord de marches. I-B.1. Interaction entropique Les marches ne ( ) 2 1 .120 += nl . I-B. Interaction entre marches Sur la Figure I-1 la surface vicinale est fluctuation des marches. On observe alors la formation de crans en bord de marches, les fluctuations étant

Boyer, Edmond


Copernic: la piste des influences arabes  

Microsoft Academic Search

Copernic a-t-il connu le travail des astronomes du Moyen-Orient ? S'en est-il inspir pour laborer sa thorie de l'hliocentrisme ? C'est l'hypothse avance par certains historiens des sciences pour comprendre le gnie de celui qui, le premier, a plac le Soleil au centre du monde. Enqute.

A. Khalatbari; J. M. Bonnet-Bidaud



Tests de rception des tours de rfrigration  

Microsoft Academic Search

Dans le cadre du projet LHC, les premiers quipements de refroidissement installs, seront des tours de rfrigration de grande puissance. Contrairement d'autres matriels construits en grande srie, ces quipements, tours et stations de pompage associes sont crer sur mesure. Diffrentes normalisations permettent de concevoir, de construire et de tester ces ralisations. L'ensemble des tests de rception ne peut

B Pirollet



Theorie des langages Automates `a pile  

E-print Network

Th´eorie des langages Automates `a pile Elise Bonzon bonzon/ 1 / 62 Th´eorie des langages #12;Automates `a pile Automates `a pile Introduction Rappels sur les piles Automates `a pile : d´efinition Automates `a pile : configurations Les crit`eres d

Bonzon, Elise


Thorie des Jeux Et ses Applications  

E-print Network

relance »...) Importance de la théorie des probabilités #12;Un Peu d'Histoire John von Neumann (1903-1957 si cBJohn von Neumann (1944 économique et politique Quelques contributions de J. Von Neumann : Axiomatisation des mathématiques

Giraud, Olivier


Transductive kernel learning Apprentissage transductif des noyaux  

E-print Network

Transductive kernel learning Apprentissage transductif des noyaux Dinh-Phong Vo Hichem Sahbi mars Images 2012D003 #12;Transductive Kernel Learning Apprentissage Transductif des Noyaux Dinh-Phong Vo dinh-phong on the challenging VOC database. c 2012 Dinh-Phong Vo and Hichem Sahbi. #12;Dinh-Phong Vo and Hichem Sahbi R

Sahbi, Hichem


Epistasis of transcriptomes reveals synergism between transcriptional activators Hnf1alpha and Hnf4alpha.  


The transcription of individual genes is determined by combinatorial interactions between DNA-binding transcription factors. The current challenge is to understand how such combinatorial interactions regulate broad genetic programs that underlie cellular functions and disease. The transcription factors Hnf1alpha and Hnf4alpha control pancreatic islet beta-cell function and growth, and mutations in their genes cause closely related forms of diabetes. We have now exploited genetic epistasis to examine how Hnf1alpha and Hnf4alpha functionally interact in pancreatic islets. Expression profiling in islets from either Hnf1a(+/-) or pancreas-specific Hnf4a mutant mice showed that the two transcription factors regulate a strikingly similar set of genes. We integrated expression and genomic binding studies and show that the shared transcriptional phenotype of these two mutant models is linked to common direct targets, rather than to known effects of Hnf1alpha on Hnf4a gene transcription. Epistasis analysis with transcriptomes of single- and double-mutant islets revealed that Hnf1alpha and Hnf4alpha regulate common targets synergistically. Hnf1alpha binding in Hnf4a-deficient islets was decreased in selected targets, but remained unaltered in others, thus suggesting that the mechanisms for synergistic regulation are gene-specific. These findings provide an in vivo strategy to study combinatorial gene regulation and reveal how Hnf1alpha and Hnf4alpha control a common islet-cell regulatory program that is defective in human monogenic diabetes. PMID:20523905

Boj, Sylvia F; Petrov, Dimitri; Ferrer, Jorge



Interferon-alpha-associated presumed ocular sarcoidosis  

Microsoft Academic Search

BackgroundInterferon alpha, used in the treatment of different viral, autoimmune and malignant diseases, is known to induce a variety\\u000a of side effects. Recently, induction of sarcoidosis during interferon therapy has been reported. We analyzed patients for\\u000a uveitis, possibly induced by interferon alpha.\\u000a \\u000a \\u000a \\u000a MethodsWe report on three patients who had developed typical signs of ocular sarcoidosis under treatment with interferon alpha

Deshka Doycheva; Christoph Deuter; Nicole Stuebiger; Manfred Zierhut



Production of alpha 1-proteinase inhibitor (human).  


A method for large scale isolation of alpha 1-proteinase inhibitor (alpha 1-PI) is described. This method employs waste Cohn Fraction IV-1 as the starting material and involves fractional precipitation with polyethylene glycol followed by ion exchange chromatography on diethylaminoethanol (DEAE)-Sepharose. The process also incorporates a ten hour, at 60 degrees C, heat-treatment step to reduce or eliminate the risk of transmission of viral disease. The final product, having a purity of approximately 60%, is freeze-dried. This preparation behaves almost identically to the alpha 1-PI in plasma and is suitable for replacement therapy in hereditary emphysema. PMID:2340046

Hein, R H; Van Beveren, S M; Shearer, M A; Coan, M H; Brockway, W J



Alpha cluster structure in 56Ni  

NASA Astrophysics Data System (ADS)

The inelastic ?-scattering experiment on 56Ni in inverse kinematics was performed at an incident energy of 50 MeV/u at GANIL. A very high multiplicity for ?-particle emission was observed with our phase-space limited experimental set-up. The maximum observed multiplicity, which cannot be explained by means of the statistical decay model, amounted to seven. The ideal classical gas model at kT = 3 MeV fairly well reproduced the experimental momentum distribution and multiplicity of alpha particles. This result strongly suggests that an alpha-gas state in 56Ni may be excited via inelastic alpha scattering.

Akimune, H.; Fujiwara, M.; Gibelin, J.; Harakeh, M. N.; Achouri, L.; Bagchi, S.; Bastin, B.; Boretzky, K.; Bouzomita, H.; Caceres, L.; Damoy, S.; Delaunay, F.; Fernndez-Domnguez, B.; Caamano, M.; Garg, U.; Grinyer, G. F.; Kalantar-Nayestanaki, N.; Kamalou, O.; Khan, E.; Krasznahorkay, A.; Lhoutellier, G.; Lukyanov, S.; Mazurek, K.; Najafi, M.; Pancin, J.; Penionzkhevich, Y.; Perrot, L.; Raabe, R.; Rigollet, C. E.; Roger, T.; Sambi, S.; Savajols, H.; Senoville, M.; Stodel, C.; Suen, L.; Thomas, J. C.; van de Walle, J.; Vandebrouck, M.



Elevated Alpha Fetoprotein, No Hepatocellular Carcinoma  

PubMed Central

Alpha fetoprotein is a fetal specific glycoprotein which falls rapidly after birth. High level of alpha fetoprotein is suspicious of hepatocellular carcinoma but may be elevated in chronic viral hepatitis. A 35-year-old presented to us with jaundice for 7 days. He had chronic hepatitis B infection for last 12 months and was taking medicines irregularly for same. He had high alpha fetoprotein levels (740.9ng/ml) without evidence of hepatocellular carcinoma which reduced with antiviral therapy. Such elevation can be explained due to hepatic inflammation and viral replication.

Patil, Mallikarjun; Sheth, Keyur A.; Adarsh, Channagiri K.



Full orbit computations of ripple-induced fusion {alpha}-particle losses from burning tokamak plasmas  

SciTech Connect

A full orbit code is used to compute collisionless losses of fusion {alpha} particles from three proposed burning plasma tokamaks: the International Tokamak Experimental Reactor (ITER); a spherical tokamak power plant (STPP) [T. C. Hender, A. Bond, J. Edwards, P. J. Karditsas, K. G. McClements, J. Mustoe, D. V. Sherwood, G. M. Voss, and H. R. Wilson, Fusion Eng. Des. 48, 255 (2000)]; and a spherical tokamak components test facility (CTF) [H. R. Wilson, G. M. Voss, R. J. Akers, L. Appel, A. Dnestrovskij, O. Keating, T. C. Hender, M. J. Hole, G. Huysmans, A. Kirk, P. J. Knight, M. Loughlin, K. G. McClements, M. R. O'Brien, and D. Yu. Sychugov, Proceedings of the 20th IAEA Fusion Energy Conference, Invited Paper FT/3-1Ra]. It has been suggested that {alpha} particle transport could be enhanced due to cyclotron resonance with the toroidal magnetic field ripple. However, calculations for inductive operation in ITER yield a loss rate that appears to be broadly consistent with the predictions of guiding center theory, falling monotonically as the number of toroidal field coils N is increased (and hence the ripple amplitude is decreased). For STPP and CTF the loss rate does not decrease monotonically with N, but collisionless losses are generally low in absolute terms. As in the case of ITER, there is no evidence that finite Larmor radius effects would seriously degrade fusion {alpha}-particle confinement.

McClements, K.G. [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire OX14 3DB (United Kingdom)



Les implications du phnomne des mdecins hospitaliers  

PubMed Central

RSUM OBJECTIF valuer limpact de 2 systmes de soins hospitaliers par une revue de la littrature. QUALIT DES DONNES Il reste des zones nbuleuses car plusieurs des tudes sont opportunistes, signalant une exprience isole ou de simples avant-aprs. Peu sont vraiment exprimentales et toutes ont t menes dans des milieux universitaires, limitant ainsi leur validit externe. MESSAGE PRINCIPAL Les donnes supportent lutilisation de mdecins hospitaliers qui consacrent un minimum de 2 mois par anne ce travail et qui sont alors plein temps sur les tages. Les cots sont plus souvent quautrement rduits et lenseignement est amlior. Point de repre important de la qualit des soins, la mortalit est gale dans les 2 systmes de soins. CONCLUSION Certaines questions demeurent sans rponse dont le choix de la meilleure formation en vue de prparer les rsidents au travail hospitalier et la faon de maintenir les comptences acquises. PMID:18077751

Lehmann, Franois; Brunelle, Yvon; Dawes, Martin; Boul, Richard; Bergeron, Rnald



Innovation technologique, changements organisationnels et volution des comptences  

Microsoft Academic Search

[fre] Innovation technologique, changements organisationnels et volution des comptences . Une tude empirique sur l'industrie manufacturire . Innovation technologique, changements dans l'organisation de la production et volution des comptences sont fortement interdpendants. Pour dresser un tat des lieux de ces diffrents types de changements et analyser leurs relations, cet article exploite une source originale, l'enqute Changement organisationnel, mene auprs des

Nathalie Greenan



Erweiterung des Fermat Problems Matthias Monzel, Oksana Vogelsang, Patrick Hans  

E-print Network

Erweiterung des Fermat Problems Matthias Monzel, Oksana Vogelsang, Patrick Hans Sommersemester 2013 Matthias Monzel, Oksana Vogelsang, Patrick Hans Erweiterung des Fermat Problems #12;Inhaltsverzeichnis 1 Beweis zum Fermat-Punkt 2 Erweiterung des Problems auf vier Standorte 3 Erweiterung des Problems auf drei

Krumke, Sven O.


transmission intergnrationnelle: cas des familles htrognes Boubaker HLAIMI1  

E-print Network

interaction avec les problmes des ingalits de revenus et de capital humain avait suscit le dbat des capital humain dans une optique d'altruisme familial. En effet, on essaie de mesurer l'influence de la'ils intgrent le march de travail et ceux des parents. Les dotations en matire de capital humain des enfants

Paris-Sud XI, Universit de



E-print Network

AVIS DE POSTE VACANT DIRECTION DES RESSOURCES HUMAINES SYNDICAT DES EMPLOYS ET EMPLOYES DE LA capital financier et des investissements. A cet effet, il supervisera et coordonnera le dveloppement de dveloppement du projet afin d'obtenir un capital financier et des investissements; Aider dfinir les

Charette, Andr


Caractristiques spectrales de pigesjaunes utiliss pour la capture des aphides  

E-print Network

Caractéristiques spectrales de piègesjaunes utilisés pour la capture des aphides Charles BALDY Jean'atterrissage des aphides. La répartition spectrale et Transmittance, l'intensité des réflectances à des longueurs d Spectral characteristics of yellow water pans used for aphid trapping Visible spectrophotometry

Paris-Sud XI, Université de


High strength oxidation resistant alpha titanium alloy  

SciTech Connect

This patent describes alpha titanium alloys containing aluminum, hafnium and/or tantalum has been found to have improved creep and tensile strengths as well as oxidtion resistance at temperature up to about 700{degrees}C without embrittlement.

Gigliotti, F.X. Jr.; Rowe, R.G.; Wasielewski, G.E.



Genetics Home Reference: Alpha-mannosidosis  


... of sugar molecules (oligosaccharides) attached to certain proteins (glycoproteins). In particular, alpha-mannosidase helps break down oligosaccharides ... cataract ; cell ; deficiency ; depression ; disability ; enzyme ; fetus ; gene ; glycoproteins ; ... hepatosplenomegaly ; hydrocephalus ; inherited ; mannose ; molecule ; motor ; ...


Nuclear diagnostic for fast alpha particles  


This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.




SciTech Connect

Three new approaches to obtain information on the confined fast alphas in International Thermonuclear Experimental Reactor (ITER) are proposed. The first technique measures the energetic charge exchange (CX) neutrals that result from the alpha collision-induced knock-on fuel ion tails undergoing electron capture on the MeV D neutral beams planned for heating and current drive. The second technique measures the energetic knock-on neutron tail due to alphas using the lengths of the proton recoil tracks produced by neutron collisions in nuclear emulsions. The range of the 14 to 20 MeV recoil protons increases by {approx}140 microns per MeV. The third approach would measure the CX helium neutrals resulting from confined alphas capturing two electrons in the ablation cloud surrounding a dense gas jet that has been proposed for disruption mitigation in ITER.




Approaches to confined alpha diagnostics on ITER  

SciTech Connect

Three approaches to obtain information on the confined fast alphas in the International Thermonuclear Experimental Reactor (ITER) are proposed. The first technique measures the energetic charge exchange (CX) neutrals that result from the alpha collision-induced knock-on fuel ion tails undergoing electron capture on the MeV D neutral beams planned for heating and current drive. The second technique measures the energetic knock-on neutron tail due to alphas using the lengths of the proton recoil tracks produced by neutron collisions in nuclear emulsions. The range of the 14 to 20 MeV recoil protons increases by {approx}140 {mu}m per MeV. The third approach would measure the CX helium neutrals resulting from confined alphas capturing two electrons in the ablation cloud surrounding a dense gas jet that has been proposed for disruption mitigation in ITER.

Fisher, R.K. [General Atomics, PO Box 85608, San Diego, California 92186-5608 (United States)



High Frequency Electrochemical Nanopolishing of Alpha Titanium  

E-print Network

conducting material while holding close dimensional tolerances. This research develops a high frequency electrochemical nanopolishing technique for commercially pure alpha titanium. An alcohol and salt based electrolyte was used with direct current as well...

Kanchwala, Abbas M



Alpha-Driven Currents in Tokamak Reactors.  

NASA Astrophysics Data System (ADS)

The generation of a net toroidal plasma current in tokamak reactors by interaction of an input magnetosonic wave with the fusion product alpha particles is examined. The wave transfers momentum to the alpha particles by Landau damping and transit time damping and thereby modifies the alpha particle velocity distribution function in an anisotropic manner. The change in the alpha particle distribution function and the resulting toroidal current density and wave energy absorption is calculated for several assumed alpha particle velocity distribution functions. A Gaussian velocity distribution function to model a spread in the alpha particle birth energy due to kinematic effects as well as speed diffusion from collisions with the background plasma is evaluated and found to give identical results as a monoenergetic delta function velocity distribution in the proper limits. The physical processes producing the Gaussian distribution are shown to be small. A more realistic calculation with an alpha particle velocity distribution functions based on a Fokker-Planck model of slowing down against the background electrons is performed and numerical estimates obtained for a reference tokamak reactor design. It is shown, for the assumed parallel wave vector spectrum, that the transit time damping is the dominant process and that interaction of the wave with background electrons can be neglected. The efficiency of the process is found to be comparable to that of lower hybrid current drive and approaches values of 0.15 A/W at high electron temperatures. The magnitude of the induced current is found to be significantly less than that required for plasma confinement and equilibrium, although anomalously large values of the parallel wave magnetic field could produce the design current. Issues such as wave accessibility, absorption, and mode conversion are also examined and found to be favorable for the assumed wave frequency of about four times the cyclotron frequency of deuterium and parallel wave vectors constrained for resonance with the 3.52-MeV alpha particles.

Gouge, Michael Joseph


Measurement of the angle alpha at BABAR  

SciTech Connect

The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

Perez, A.; /Orsay, LAL



Transport of Radioactive Material by Alpha Recoil  

SciTech Connect

The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

Icenhour, A.S.



Alpha-emitters for medical therapy workshop  

SciTech Connect

A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

Feinendegen, L.E.; McClure, J.J.



Energy dependence of event shapes and of $\\\\alpha_s$ at LEP 2  

Microsoft Academic Search

Infrared and collinear safe event shape distributions and their mean values are determined using the data taken at ve di erent centre of mass energies above $M_Z$ with the DELPHI detector at LEP. From the event shapes, the strong coupling $\\\\alpha_s$ is extracted in $O(\\\\alpha^2_s)$, NLLA and a combined scheme using hadronisation corrections evaluated with fragmentation model generators as well

P. Abreu; W Adam; T Adye; P Adzic; Z Albrecht; T Alderweireld; G D Alekseev; R Alemany; T Allmendinger; P P Allport; S Almehed; Ugo Amaldi; N Amapane; S Amato; E G Anassontzis; P Andersson; A Andreazza; S Andringa; P Antilogus; W D Apel; Y Arnoud; B sman; J E Augustin; A Augustinus; Paul Baillon; P Bambade; F Baro; Guido Barbiellini; R Barbier; Dimitri Yuri Bardin; G Barker; A Baroncelli; Marco Battaglia; M Baubillier; K H Becks; M Begalli; A Behrmann; P Beillire; Yu A Belokopytov; K S Belous; N C Benekos; Alberto C Benvenuti; C Brat; M Berggren; D Bertini; D Bertrand; M Besanon; F Bianchi; M Bigi; S M Bilenky; M A Bizouard; D Bloch; H M Blom; M Bonesini; W Bonivento; M Boonekamp; P S L Booth; A W Borgland; G Borisov; C Bosio; O Botner; E Boudinov; B Bouquet; C Bourdarios; T J V Bowcock; I Boyko; I Bozovic; M Bozzo; P Branchini; T Brenke; R A Brenner; P Brckman; J M Brunet; L Bugge; T Buran; T Burgsmller; Brigitte Buschbeck; P Buschmann; S Cabrera; M Caccia; M Calvi; T Camporesi; V Canale; F Carena; L Carroll; Carlo Caso; M V Castillo-Gimenez; A Cattai; F R Cavallo; V Chabaud; M M Chapkin; P Charpentier; L Chaussard; P Checchia; G A Chelkov; R Chierici; P V Chliapnikov; P Chochula; V Chorowicz; J Chudoba; K Cieslik; P Collins; R Contri; E Cortina; G Cosme; F Cossutti; J H Cowell; H B Crawley; D J Crennell; S Crp; G Crosetti; J Cuevas-Maestro; S Czellar; Martyn Davenport; W Da Silva; A Deghorain; G Della Ricca; P A Delpierre; N Demaria; A De Angelis; Wim de Boer; C De Clercq; B De Lotto; A De Min; L S De Paula; H Dijkstra; Lucia Di Ciaccio; J Dolbeau; K Doroba; M Dracos; J Drees; M Dris; A Duperrin; J D Durand; G Eigen; T J C Ekelf; Gsta Ekspong; M Ellert; M Elsing; J P Engel; B Erzen; M C Espirito-Santo; E Falk; G K Fanourakis; D Fassouliotis; J Fayot; Michael Feindt; A Fenyuk; P Ferrari; A Ferrer; E Ferrer-Ribas; F Ferro; S Fichet; A Firestone; U Flagmeyer; H Fth; E Fokitis; F Fontanelli; B J Franek; A G Frodesen; R Frhwirth; F Fulda-Quenzer; J A Fuster; A Galloni; D Gamba; S Gamblin; M Gandelman; C Garca; C Gaspar; M Gaspar; U Gasparini; P Gavillet; E N Gazis; D Gel; N Ghodbane; I Gil; F Glege; R Gokieli; B Golob; G Gmez-Ceballos; P Gonalves; I Gonzlez-Caballero; Gian P Gopal; L Gorn; M Grski; Yu Guz; Valerio Gracco; J Grahl; E Graziani; C Green; H J Grimm; P Gris; G Grosdidier; K Grzelak; M Gnther; J Guy; F Hahn; S Hahn; S Haider; A Hallgren; K Hamacher; J Hansen; F J Harris; V Hedberg; S Heising; J J Hernndez; P Herquet; H Herr; T L Hessing; J M Heuser; E Hign; S O Holmgren; P J Holt; S Hoorelbeke; M A Houlden; Josef Hrubec; K Huet; G J Hughes; K Hultqvist; J N Jackson; R Jacobsson; P Jalocha; R Janik; C Jarlskog; G Jarlskog; P Jarry; B Jean-Marie; E K Johansson; P E Jnsson; C Joram; P Juillot; F Kapusta; K Karafasoulis; S Katsanevas; E C Katsoufis; R Kernen; Borut P Kersevan; B A Khomenko; N N Khovanskii; A P Kiiskinen; B J King; A Kinvig; N J Kjaer; O Klapp; H Klein; P M Kluit; P Kokkinias; M Koratzinos; V Kostyukhin; C Kourkoumelis; O Kuznetsov; Manfred Krammer; E Kriznic; J Krstic; Z Krumshtein; P Kubinec; J Kurowska; K L Kurvinen; J Lamsa; P Langefeld; V Lapin; J P Laugier; R Lauhakangas; Gerhard Leder; F Ledroit; V Lefbure; L Leinonen; A Leisos; R Leitner; J Lemonne; Georg Lenzen; V Lepeltier; T Lesiak; M Lethuillier; J Libby; D Liko; A Lipniacka; I Lippi; B Lrstad; J G Loken; J H Lopes; J M Lpez; R Lpez-Fernandez; D Loukas; P Lutz; L Lyons; J N MacNaughton; J R Mahon; A Maio; A Malek; T G M Malmgren; S Maltezos; V Malychev; F Mandl; J Marco; R P Marco; B Marchal; M Margoni; J C Marin; C Mariotti; A Markou; C Martnez-Rivero; F Martnez-Vidal; S Mart i Garca; N Mastroyiannopoulos; F Matorras; C Matteuzzi; Giorgio Matthiae; J Masik; F Mazzucato; M Mazzucato; M L McCubbin; R McKay; R McNulty; G McPherson; C Meroni; W T Meyer; E Migliore; L Mirabito; Winfried A Mitaroff; U Mjrnmark; T Moa; M Moch; R Mller; K Mnig; M R Monge; X Moreau; P Morettini; G A Morton; U Mller; K Mnich; M Mulders; C Mulet-Marquis; R Muresan; W J Murray; B Muryn; Gerald Myatt; T Myklebust; F Naraghi; M Nassiakou; Francesco Luigi Navarria; S Navas; K Nawrocki; P Negri; S Nmcek; N Neufeld; N Neumeister; R Nicolaidou; B S Nielsen; M Nikolenko; V P Nomokonov; Ainsley Normand; A Nygren; V F Obraztsov; A G Olshevskii; A Onofre; Risto Orava; G Orazi; K sterberg; A Ouraou; M Paganoni; S Paiano; R Pain; R Paiva; J Palacios; H Palka; T D Papadopoulou; K Papageorgiou; L Pape; C Parkes; F Parodi; U Parzefall; A Passeri; O Passon; M Pegoraro; L Peralta; Manfred Pernicka; A Perrotta; C Petridou; A Petrolini; H T Phillips; F Pierre; M Pimenta; E Piotto; T Podobnik; M E Pol; G Polok; P Poropat; V Pozdnyakov; P Privitera; N Pukhaeva; Antonio Pullia; D Radojicic; S Ragazzi; H Rahmani; P N Ratoff; A L Read; P Rebecchi; N G Redaelli; Meinhard Regler; D Reid



Alpha-Lipoic Acid and Diabetic Neuropathy  

PubMed Central

Diabetic neuropathy presents a major public health problem. It is defined by the symptoms and signs of peripheral nerve dysfunction in diabetic patients, in whom other causes of neuropathy have been excluded. Pathogenetic mechanisms that have been implicated in diabetic neuropathy are: a) increased flux through the polyol pathway, leading to accumulation of sorbitol, a reduction in myo-inositol, and an associated reduced Na+-K+-ATPase activity, and b) endoneurial microvascular damage and hypoxia due to nitric oxide inactivation by increased oxygen free radical activity. Alpha-lipoic acid seems to delay or reverse peripheral diabetic neuropathy through its multiple antioxidant properties. Treatment with alpha-lipoic acid increases reduced glutathione, an important endogenous antioxidant. In clinical trials, 600 mg alpha-lipoic acid has been shown to improve neuropathic deficits. This review focuses on the relationship of alpha-lipoic acid and auto-oxidative glycosylation. It discusses the impact of alpha-lipoic acid on hyperglycemia-induced oxidative stress, and examines the role of alpha-lipoic acid in preventing glycation process and nerve hypoxia. PMID:20043035

Vallianou, Natalia; Evangelopoulos, Angelos; Koutalas, Pavlos



Alpha particle analysis using PEARLS spectrometry  

SciTech Connect

Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.



{alpha}-states in de Sitter space  

SciTech Connect

Field theory in de Sitter space admits a one-parameter family of vacua determined by a superselection parameter {alpha}. Of these vacua, the Euclidean vacuum uniquely extrapolates to the vacuum of flat Minkowski space. States which resemble the {alpha}-vacua can be constructed as excitations above the Euclidean vacuum. Such states have modes {alpha}(k) which decay faster that k{sup (1-d)/2}. Fields in such states exhibit nonlocal correlations when examined from the perspective of fields in the Euclidean vacuum. The dynamics of such entangled states are fully consistent. If an {alpha}-state with properties that interpolate between an {alpha}-vacuum and the Euclidean vacuum were the initial condition for inflation, a signature for this may be found in a momentum dependent correction to the inflationary power spectrum. The functional formalism, which provides the tool for examining physics in an {alpha}-state, extends to fields of other spin. In particular, the extension to spin-2 may proffer a new class of infrared modifications to gravitational interactions. The implications of superselection sectors for the landscape of string vacua are briefly discussed.

Boer, Jan de [Instituut voor Theoretische Fysica, Valckenierstraat 65, 1018XE Amsterdam (Netherlands); Jejjala, Vishnu; Minic, Djordje [Institute for Particle Physics and Astrophysics, Physics Department, Robeson Hall, Virginia Tech, Blacksburg, Virginia 24061 (United States)



HETDEX: Evolution of Lyman Alpha Emitters  

NASA Astrophysics Data System (ADS)

The Hobby Eberly Telescope Dark Energy Experiment (HETDEX) will produce a sample of 800,000 Lyman Alpha Emitters (LAEs) over the 1.9Alpha photon escape fraction. Our results show a strong evolution in the Lyman Alpha escape fraction with redshift, most likely associated with the buildup of dust in the ISM. Dust is shown to be the main parameter setting the escape of Lyman Alpha photons. The observed relation between E(B-V) and the escape fraction indicates that radiative transfer effects in LAEs promote the escape of Lyman Alpha photons, but only up to the point of them suffering similar amounts of extinction as continuum photons. Enhancement of the Lyman Alpha EW (e.g. due to the presence of a clumpy medium) seems not to be a common process in these objects. We also discuss the potential of the full HETDEX sample to study the evolution of LAE properties.

Blanc, Guillermo A.; Gebhardt, K.; Hill, G. J.; Gronwall, C.; Ciardullo, R.; Finkelstein, S.; Gawiser, E.; HETDEX Collaboration



Folding model analysis of alpha radioactivity  

E-print Network

Radioactive decay of nuclei via emission of $\\alpha$ particles has been studied theoretically in the framework of a superasymmetric fission model using the double folding (DF) procedure for obtaining the $\\alpha$-nucleus interaction potential. The DF nuclear potential has been obtained by folding in the density distribution functions of the $\\alpha$ nucleus and the daughter nucleus with a realistic effective interaction. The M3Y effective interaction has been used for calculating the nuclear interaction potential which has been supplemented by a zero-range pseudo-potential for exchange along with the density dependence. The nuclear microscopic $\\alpha$-nucleus potential thus obtained has been used along with the Coulomb interaction potential to calculate the action integral within the WKB approximation. This subsequently yields microscopic calculations for the half lives of $\\alpha$ decays of nuclei. The density dependence and the exchange effects have not been found to be very significant. These calculations provide reasonable estimates for the lifetimes of $\\alpha$ radioactivity of nuclei.

D. N. Basu



Methods for the synthesis and polymerization of .alpha.,.alpha.'-dihalo-p-xylenes  


The present invention describes an improved method for the polymerization of .alpha.,.alpha.-dihalo-p-xylene's such as the .alpha.,.alpha.'-dihalo-2-methoxy-5-(2-ethylhexyloxy)-xylene's. The procedure for synthesis is based on the specific order of addition of reagents and the use of an anionic initiator that allows control of the molecular weight of the polymer. The molecular weight control allows processability of the polymer which is important for its utility in applications including in light-emitting-diodes, field effect transistors and photovoltaic devices.

Ferraris, John P. (Coppell, TX); Neef, Charles J. (Garland, TX)



Modlisation individuelle de la reproduction des vaches Holstein intgrant les effets de la production laitire et des rserves corporelles  

E-print Network

Modlisation individuelle de la reproduction des vaches Holstein intgrant les effets de la RSUM - La reproduction est un lment dterminant de la productivit et de la dmographie des troupeaux. La dgradation des performances de reproduction au cours des dernires dcennies a rduit la

Paris-Sud XI, Universit de


Etude des possibilits d'utilisation agronomique des composts d'ordures mnagres en milieu tropical (1)  

E-print Network

Etude des possibilits d'utilisation agronomique des composts d'ordures mnagres en milieu'avre ncessaire uniquement en saison sche pour obtenir un compost dont le rapport C/N se situe autour de Ordures les composts des paysompos age. industrialiss. La proportion quilibre des oligo-lments et la

Paris-Sud XI, Universit de


Cancer risk in DES daughters  

PubMed Central

Objective We examined long-term risk of cancer in women exposed to diethylstilbestrol (DES) in utero. Methods A total of 12,091 DES-exposed women in the Netherlands were followed prospectively from December 1992 till June 2008. Cancer incidence was assessed through linkage with the Dutch pathology database (PALGA) and the Netherlands Cancer Registry and compared with the Dutch female population. Results A total of 348 medically verified cancers occurred; median age at end of follow-up was 44.0years. No overall increased risk of cancer was found (standardized incidence ratio [SIR]=1.01; 95% confidence interval [CI]=0.91, 1.13). The risk of clear cell adenocarcinoma of the vagina and cervix (CCA) was statistically significantly increased (SIR=24.23; 95% CI=8.89, 52.74); the elevated risk persisted above 40years of age. The risk of melanoma diagnosed before age 40 was increased (SIR=1.59; 95% CI=1.08, 2.26). No excess risks were found for other sites, including breast cancer. Conclusions Except for an elevated risk of CCA, persisting at older ages, and an increased risk of melanoma at young ages, we found no increased risk of cancer. Longer follow-up is warranted to examine cancer risk at ages when cancer occurs more frequently. Electronic supplementary material The online version of this article (doi:10.1007/s10552-010-9526-5) contains supplementary material, which is available to authorized users. PMID:20204493

Verloop, Janneke; van Leeuwen, Flora E.; Helmerhorst, Theo J. M.; van Boven, Hester H.



desHisGlu?-glucagon-[mPEG] and desHisGlu?(Lys?PAL)-glucagon: long-acting peptide-based PEGylated and acylated glucagon receptor antagonists with potential antidiabetic activity.  


Glucagon is hormone secreted from the pancreatic alpha-cells that is involved in blood glucose regulation. As such, antagonism of glucagon receptor signalling represents an exciting approach for treating diabetes. To harness these beneficial metabolic effects, two novel glucagon analogues, desHisGlu?-glucagon-[mPEG] and desHisGlu?(Lys?PAL)-glucagon, has been evaluated for potential glucagon receptor antagonistic properties. Both novel peptides were completely resistant to enzymatic breakdown and significantly (P<0.05 to P<0.001) inhibited glucagon-mediated elevations of cAMP production in glucagon receptor transfected cells. Similarly, desHisGlu?-glucagon-[mPEG] and desHisGlu?(Lys?PAL)-glucagon effectively antagonised glucagon-induced increases of insulin secretion from BRIN BD11 cells. When administered acutely to normal, high fat fed or ob/ob mice, both analogues had no significant effects on overall blood glucose or plasma insulin levels when compared to saline treated controls. However, desHisGlu?-glucagon-[mPEG] significantly (P<0.05) annulled glucagon-induced increases in blood glucose and plasma insulin levels in normal mice and had similar non-significant tendencies in high fat and ob/ob mice. In addition, desHisGlu?(Lys?PAL)-glucagon effectively (P<0.05 to P<0.001) antagonised glucagon-mediated elevations of blood glucose levels in high fat fed and ob/ob mice, but was less efficacious in normal mice. Further studies confirmed the significant persistent glucagon receptor antagonistic properties of both novel enzyme-resistant analogues 4h post administration in normal mice. These studies emphasise the potential of longer-acting peptide-based glucagon receptor antagonists, and particularly acylated versions, for the treatment of diabetes. PMID:23562625

Irwin, Nigel; Franklin, Zara J; O'Harte, Finbarr P M



Alpha Com eclipse observing campaign  

NASA Astrophysics Data System (ADS)

Drs. Matthew W. Muterspaugh and Gregory W. Henry (Tennessee State University) have requested AAVSO observers' ssistance in monitoring the possible Algol-like binary star alpha Com before, during, and after the eclipse they have predicted for mid-to-late January 2015. The PIs will be using the Fairborn Observatory automated photometric telescopes on Mt. Hopkins, but they are requesting additional observations not only to supplement theirs but also specifically to have good coverage in the event of bad weather at Mt. Hopkins. Alf Com has a 26-year period and is 4.32V at maximum. The expected amplitude of the eclipse is about 0.8 magnitude and the duration somewhere between 28 and 45 hours. The eclipse is predicted for January 25 three days (JD 2457047 3). Muterspaugh at al. first calculated the possibility of a 2015 eclipse in 2010 (AJ). Muterspaugh and Henry recently published an article with updated information (arXiv 2014). V and/or R photometry (other bands welcome) is requested, with a minimal cadence of one measurement/2 hours, to make sure the eclipse is caught right as it begins and to ensure having multiple data points on any unseen objects that might eclipse as well. During eclipse, continuous observations are important. Infrared (H-band) observations could be interesting, should the CHARA array image the event. The precision photometry in the weeks before and after the eclipse is requested in order to catch possible evidence for planets or other materials around the eclipsing star. Updated astrometry from the current epoch would greatly improve the eclipse preductions. Charts with comparison star sequence for alf Com may be created using the AAVSO Variable Star Plotter ( The PIs recommend using the comparison stars HD 113848 (39 Com, HR 4946, HIP 63948, V=5.990, B-V=0.39, F4V) and HD 114520 (HIP 64312, V=6.820, B-V=0.46,F2II). Observations should be submitted to the AAVSO International Database. See AAVSO Alert Notice 506 for full details.

Waagen, Elizabeth O.



OzDES: 100 Nights of AAT Spectroscopy on DES Sources  

NASA Astrophysics Data System (ADS)

OzDES is a 5 year, 100 night spectroscopic program on AAT using 2dF/AAOmega that commenced in September 2013. A collaboration between the Dark Energy Survey (DES) and members of the Australian astronomical community, OzDES will efficiently obtain spectra for a wide variety of DES science programs thanks to the near perfect overlap between the Dark Energy Camera and 2dF fields of view. The driver for the program is the DES Supernova Survey, as redshifts for supernova host galaxies down to 24 can be measured through repeated integrations over the duration of the survey. In addition to supernova host galaxies and many live supernovae, OzDES will perform a study of reverberation mapping of AGN, target strong lenses, and obtain redshifts for photo-z calibration.

D'Andrea, Christopher; OzDES



Extremely alpha Enriched Globular Clusters in Early-Type Galaxies  

Microsoft Academic Search

We compare [alpha \\/Fe], metallicity, and age distributions of globular clusters in elliptical, lenticular, and spiral galaxies, which we derive from Lick line index measurements. We find a large number of globular clusters in elliptical galaxies that reach significantly higher [alpha \\/Fe] values ([alpha \\/Fe] >0.5) than clusters in lenticular and spiral galaxies. Most of these highly alpha -enriched globular

T. H. Puzia; M. Kissler-Patig; P. Goudfrooij



alpha-Adrenergic regulation of human renal function.  


Pharmacological and molecular cloning techniques have identified six human subtypes of alpha-adrenoceptors which are designated alpha 1A, alpha 1D, alpha 2A, and alpha 2C. At the protein level human kidney expresses predominantly alpha 2A-adrenoceptors while other alpha 2-adrenoceptor subtypes or alpha 1-adrenoceptors have not been detected consistently in radioligand binding studies. However, the presynaptic receptors, which inhibit noradrenaline release in the human kidney, appear to belong to the alpha 2C-subtype. Intrarenal infusion of the nonselective alpha-adrenoceptor antagonist, phentolamine, and of the selective alpha 2-adrenoceptor antagonist, yohimbine, but not of the selective alpha 1-adrenoceptor antagonist, doxazosin, increase renal blood flow and renin release in hypertensive patients undergoing diagnostic renal angiography. Thus, alpha 2- but not alpha 1-adrenoceptors appear to mediate a tonic renal vasoconstriction and inhibition of renin release. Effects of systemically given alpha 1-adrenoceptor agonists and antagonists are difficult to interpret on a mechanistic level since direct effects in the kidney and indirect effects due to baroreflex activation and peripheral presynaptic and central sympatholytic actions may at least partially offset each other. Moreover, some of these drugs may additionally act independent of alpha-adrenoceptors, for example, via imidazoline recognition sits. The net result in a given subject may depend on the endogenous sympatho-adrenal tone. Thus, for each target population of interest, effects have to be described empirically for each drug. PMID:8985718

Michel, M C; Rump, L C



Implication des lipides dans la variabilit gn-tique des caractristiques technologiques de la  

E-print Network

farine et du gluten de blé tendre Bernard LAIGNELET Catherine CANTIN LN.R.A., Laboratoire de Technologie viscoélastiques du gluten de farines de blé tendre et la quantité et la répartition des lipides dans le gluten entier ou des fractions de ce gluten. Pour cela 23 échantillons, choisis au hasard parmi des lignées en

Paris-Sud XI, Université de


Prdicteurs des pratiques parentales: cognitions sociales parentales et comportement des enfants TDAH  

Microsoft Academic Search

L'objectif de cette tude a t d'examiner le rle prdicteur des cognitions sociales des parents (attributions causales, sentiment d'auto-efficacit parental [SAEP]) et des caractristiques comportementales de l'enfant (sous-type TDAH, concomitance, symptmes d'opposition et d'anxit\\/gne) en lien avec les pratiques parentales utilises. Cent dix familles ont particip l'tude, lesquelles avaient un enfant ayant un TDAH (TDAH-M : n = 68,

Marie-Christine Beaulieu; Sylvie Normandeau



Overview of Suborbital Human Transportation Concept ALPHA  

NASA Astrophysics Data System (ADS)

Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched Phoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to their high cost, limited safety and toxicity, a low-cost, "green" and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was selected as baseline ALPHA propulsion. The general feasibility of hybrid propulsion for suborbital vehicle application with this propellant combination was already successfully demonstrated in the first reusable and privately-funded manned launch vehicle SpaceShipOne and consequently represents the solution with the lowest development risk for the investigated application. Due to the huge success of SpaceShipOne, the same type of hybrid propulsion is foreseen for Virgin Galactic's SpaceShipTwo. ALPHA vehicle guidance will preferably be fully autonomous during the entire mission flight profile. The required technology for autonomous vehicle guidance can be from the European RLV demonstrator Phoenix, which successfully demonstrated automated landing when it was dropped three times by a helicopter and landed precisely after a GPS-guided glide. This paper outlines the current status of the technology development work for ALPHA and has a special focus on aerodynamic and aerothermodynamic aspects of the concept.

Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steelant, J.; Mack, A.



Le nom des naksatrani en tibetain  

E-print Network

atteste ds les Vedas, peut-tre mme dans le ?gveda lui-mme (Achar 2000). Le systme chinois apparat de faon claire seulement la fin des Royaumes combattants et au dbut des Hn, dans des textes transmis tels que le L?sh Ch?nqi?, le Huinnz?, et... - phalgun? aryaman ? trjang ? *tra? 10 dbo sbo, khra, nyi mavi lha vi ldan, phyi mo uttara- phalgun? bhaga ? yik ? *l?k 11 me bzhi rig byed, bya ma vdon hasta savit? ? tsyinX ?*tin? 12 nag pa citr? indra ? kaewk ?*kkrok 13 sa ri rlung gi dbang phyug, rlung...

Jacques, Guillaume



Note sur le calcul des antennes charges  

Microsoft Academic Search

SommaireCette tude est tablie sr les hypothses classiques de la thorie des antennes, et naborde pas la discussion du mode vritable\\u000a de rayonnement, auquel ont t consacrs des travaux deSchelkunoff et dautres chercheurs, et dont limportance pratique est lie lutilisation des antennes pour ondes trs courtes.\\u000a \\u000a \\u000a Les bases techniques adoptes pour le travail ici expos sont les constatations suivantes:

Maxime Barroux



TNF alpha-induced down-regulation of estrogen receptor alpha in MCF-7 breast cancer cells.  


Estrogen-induced proliferation in estrogen receptor (ER)-positive breast cancer cells is primarily mediated through two distinct intracellular receptors, ER alpha and ER beta. Although tumor necrosis factor alpha (TNF alpha) and E2/ER alpha are known to exert opposing effects on cell proliferation in MCF-7 cells, the mechanism by which TNFalpha antagonizes E2/ER alpha-mediated cell proliferation is not well understood. The present study suggests that reduced cell survival in response to TNF alpha treatment in MCF-7 cells may be associated with the down-regulation of ER alpha protein. The decrease in ER alpha protein level was accompanied by an inhibition of ER alpha gene transcription. Cell viability was decreased synergistically by the combined treatment with ER alpha-siRNA and TNF alpha. Furthermore, pretreatment of cells with the PI3-kinase (PI3K)/Akt inhibitor, LY294002, markedly enhanced TNF alpha-induced down-regulation of the ER alpha protein, suggesting that the PI3K/Akt pathway might be involved in control of the ER alpha level. Moreover, down-regulation of ER alpha by TNF alpha was not inhibited in cells that were pretreated with the proteasome inhibitors, MG132 and MG152, which suggests that proteasome-dependent proteolysis does not significantly influence TNF alpha-induced down-regulation of ER alpha protein. In contrast, the effect of the PI3K/Akt inhibitor on ER alpha was blocked in cells that were treated with LY294002 in the presence of the proteasome inhibitors. Collectively, our findings show that the TNF alpha may partly regulate the growth of MCF-7 breast cancer cells through the down-regulation of ER alpha expression, which is primarily mediated by a PI3K/Akt signaling. PMID:18483465

Lee, Sang-Han; Nam, Hae-Seon



Initiation and Synergistic Fibrillization of Tau and Alpha-Synuclein  

Microsoft Academic Search

Alpha-synuclein (alpha-syn) and tau polymerize into amyloid fibrils and form intraneuronal filamentous inclusions characteristic of neurodegenerative diseases. We demonstrate that alpha-syn induces fibrillization of tau and that coincubation of tau and alpha-syn synergistically promotes fibrillization of both proteins. The in vivo relevance of these findings is grounded in the co-occurrence of alpha-syn and tau filamentous amyloid inclusions in humans, in

Benoit I. Giasson; Mark S. Forman; Makoto Higuchi; Lawrence I. Golbe; Charles L. Graves; Paul T. Kotzbauer; John Q. Trojanowski; Virginia M.-Y. Lee



Effect of alpha-tocopherol on bovine in vitro fertilization.  


The objectives of this work are to determine if exogenous supplementation with alpha-tocopherol increases the in vitro fertilization (IVF) rate of bovine oocytes and improves viability of selected spermatozoa after 'swim-up'. The percentage of fertilized oocytes was significantly but negatively correlated (r = -0.941, p < 0.01) with the concentration of alpha-tocopherol. The control resulted in 95% of fertilized oocytes, which decreased as follows: 25 microM alpha-tocopherol (alpha25) 86%, 50 microM alpha-tocopherol (alpha50) 74%, 100 microM alpha-tocopherol (alpha100) 66% and 200 microM alpha-tocopherol (alpha200) 56%. Relatively to sperm viability after 'swim-up' with alpha-tocopherol supplementation, this antioxidant proved to have a beneficial effect as its concentration increased up to alpha50, decreasing for the concentrations of alpha100 and alpha200. Control resulted in 83% of live cells and 16% of dead cells; alpha25 resulted in 88% of live cells and 12% of dead cells; alpha50 resulted in 91% of live cells and 9% of dead cells; alpha100 resulted in 67% of live cells and 33% of dead cells; and finally alpha200 resulted in 57% of live cells and 42% of dead cells. In summary, the present study allows to conclude that, in our conditions, supplementation with the antioxidant alpha-tocopherol in IVF of bovine oocytes has a detrimental effect on fertilization rates. Nevertheless, exogenous supplementation with alpha-tocopherol at a concentration of 50 mM in the sperm-TALP media during the 'swim-up' technique has a significant beneficial effect on the selected spermatozoa viability. PMID:20137061

Marques, A; Santos, P; Antunes, G; Chaveiro, A; Moreira da Silva, F



Experimental and Theoretical Electron Density Distribution of Alpha,Alpha-Trehalose Dihydrate  

Technology Transfer Automated Retrieval System (TEKTRAN)

Alpha,alpha-rehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as 13C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic...


Amyloid formation and disaggregation of {alpha}-synuclein and its tandem repeat ({alpha}-TR)  

SciTech Connect

Research highlights: {yields} Formation of the {alpha}-synuclein amyloid fibrils by [BIMbF{sub 3}Im]. {yields} Disaggregation of amyloid fibrils by epigallocatechin gallate (EGCG) and baicalein. {yields} Amyloid formation of {alpha}-synuclein tandem repeat ({alpha}-TR). -- Abstract: The aggregation of {alpha}-synuclein is clearly related to the pathogenesis of Parkinson's disease. Therefore, detailed understanding of the mechanism of fibril formation is highly valuable for the development of clinical treatment and also of the diagnostic tools. Here, we have investigated the interaction of {alpha}-synuclein with ionic liquids by using several biochemical techniques including Thioflavin T assays and transmission electron microscopy (TEM). Our data shows a rapid formation of {alpha}-synuclein amyloid fibrils was stimulated by 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide [BIMbF{sub 3}Im], and these fibrils could be disaggregated by polyphenols such as epigallocatechin gallate (EGCG) and baicalein. Furthermore, the effect of [BIMbF{sub 3}Im] on the {alpha}-synuclein tandem repeat ({alpha}-TR) in the aggregation process was studied.

Bae, Song Yi; Kim, Seulgi; Hwang, Heejin; Kim, Hyun-Kyung; Yoon, Hyun C.; Kim, Jae Ho [Department of Molecular Science and Technology, Graduate School of Interdisciplinary Programs, Ajou University, Suwon 443-749 (Korea, Republic of)] [Department of Molecular Science and Technology, Graduate School of Interdisciplinary Programs, Ajou University, Suwon 443-749 (Korea, Republic of); Lee, SangYoon, E-mail: [Chronic Inflammatory Disease Research Center, School of Medicine, Ajou University, Suwon 443-749 (Korea, Republic of)] [Chronic Inflammatory Disease Research Center, School of Medicine, Ajou University, Suwon 443-749 (Korea, Republic of); Kim, T. Doohun, E-mail: [Department of Molecular Science and Technology, Graduate School of Interdisciplinary Programs, Ajou University, Suwon 443-749 (Korea, Republic of)



Alpha-particle sensitive test SRAMs  

NASA Technical Reports Server (NTRS)

A bench-level test is being developed to evaluate memory-cell upsets in a test SRAM designed with a cell offset voltage. This offset voltage controls the critical charge needed to upset the cell. The effect is demonstrated using a specially designed 2-micron n-well CMOS 4-kb test SRAM and a Po-208 5.1-MeV 0.61-LET alpha-particle source. This test SRAM has been made sensitive to alpha particles through the use of a cell offset voltage, and this has allowed a bench-level characterization in a laboratory setting. The experimental data are linked to a alpha-particle interaction physics and to SPICE circuit simulations through the alpha-particle collection depth. The collection depth is determined by two methods and found to be about 7 micron. In addition, alpha particles that struck outside the bloated drain were able to flip the SRAM cells. This lateral charge collection was observed to be more than 6 micron.

Buehler, M. G.; Blaes, B. R.



HIF-1alpha and cancer therapy.  


Most solid tumors develop regions of hypoxia as they grow and outstrip their blood supply. In order to survive in the stressful hypoxic environment, tumor cells have developed a coordinated set of responses orchestrating their adaptation to hypoxia. The outcomes of the cellular responses to hypoxia are aggressive disease, resistance to therapy, and decreased patient survival. A critical mediator of the hypoxic response is the transcription factor hypoxia-inducible factor 1 (HIF-1) that upregulates expression of proteins that promote angiogenesis, anaerobic metabolism, and many other survival pathways. Regulation of HIF-1alpha, a component of the HIF-1 heterodimer, occurs at multiple levels including translation, degradation, and transcriptional activation, and serves as a testimony to the central role of HIF-1. Studies demonstrating the importance of HIF-1alpha expression for tumor survival have made HIF-1alpha an attractive target for cancer therapy. The growing of pharmacological inhibitors of HIF-1 and their varied targets mirrors the complex molecular mechanisms controlling HIF-1. In this chapter, we summarize recent findings regarding the regulation of HIF-1alpha and the progress made in identifying new therapeutic agents that inhibit HIF-1alpha. PMID:20033376

Koh, Mei Yee; Spivak-Kroizman, Taly R; Powis, Garth



Theorie des langages Grammaires Hors-Contexte  

E-print Network

-procedure(liste-expressions) |goto etiquette |with liste-variables-record do instruction |etiquette : instruction 9 / 31 Th´eorie des-procedure(liste-expressions) |goto etiquette |with liste-variables-record do instruction |etiquette : instruction Symboles terminaux

Bonzon, Elise



E-print Network

plan économique :la Luzerne (Medicago sativa L.), le Trèfle violet (Trifolium pratense L.) et le Trèfle blanc (Trifolium repens L.). LINSLEY (1946) donne le premier inventaire des pollinisateurs de la Luzerne

Boyer, Edmond


Index des mots-cls Keywords index  

E-print Network

Index des mots-clés Keywords index A Abies, 823 Abies alba, 265 acacia, 93 Acacia cyanophylla Lindl., 335 Acacia mearnsii De Wild., 833 acclimation, 19 AFLP, 627 AFLP, SSR, EST markers, 637 Agrobacterium

Boyer, Edmond


Dynamique et volution des Bernard Dujon  

E-print Network

1 Dynamique et volution des gnomes Bernard Dujon Cours BIM 3 novembre 2009 Charles Robert Darwin avec carte HapMap CGH sur tiling-arrays --> dans la population humaine, chaque individu porte dans son

Carbone, Alessandra


The enhancement of existing DES Maplet interface  

NASA Astrophysics Data System (ADS)

This study pertains to the process of Data Encryption Standard, DES. DES consists of encryption and decryption processes linked with mathematical elements such as algebra and number theory. Preliminary, studies revealed that most of mathematics students face a problem in understanding the complicated process of DES. In modern learning methods, learning environment becomes more interesting with the use of computer and a variety of mathematical software packages. Several mathematical softwares such as Maple, Mathematica, Mathlab and Sage were developed in order to fulfill the specific calculation requirements. Correspondingly, motivated from that, this study incorporated with Maple to enhance the existing DES Maplet interface to be more interactive and user-friendly compared to the original version.

Abdullah, Nur Lina; Mutalip, Rasidah Abdull; Abdullah, Kamilah



HACK Patrice Les coulisses des assistances tlphoniques  

E-print Network

HACK Patrice 1 ________________________________________________________________ Les coulisses des Criminologie et de Police Technique et Scientifique LXV (2012) 110" #12;HACK Patrice 2 1 ­ Données et méthode

Paris-Sud XI, Université de


Habilitation diriger des recherches Prsente par  

E-print Network

$ chaleureusement. Merci James ROUDET pour m'avoir toujours soutenue dans le domaine de la recherche mme si les basses frquences Principe Formulations pour le calcul de L et M Prise en compte des pertes Joule

Paris-Sud XI, Universit de



E-print Network

Salvelinus fontinalis HENDERSON (1962) qualifie galement les cellules de la paroi des lobules de lobules'espace extralobulaire). Il s'agit de : Esox lucius, Salvelinus willughb et Labeo (MARSH!,r, et LOFTS, ig56 ; LOFTS et

Paris-Sud XI, Universit de



E-print Network

Mmoire doctoral prsent la Facult des tudes suprieures de l'Universit Laval dans le cadre du programme de doctorat en psychologie pour l'obtention du grade de Docteure en psychologie (D.Psy.)

Christine Drouin-maziade; Avec Ou; Sans Anxit; Universit Laval


La formation continue des chirurgiens dentistes  

E-print Network

La formation continue des chirurgiens dentistes et le Développement Professionnel Continu 2012 plus fréquents que le chirurgien-dentiste sera amené à prescrire ou à interpréter. Ensuite, nous nous

Maume-Deschamps, Véronique


Dalai Lama. Die Regeln des Glcks  

Microsoft Academic Search

Jeder Mensch hat das Recht auf Glck und kann es auch erreichen durch die positive Vernderung des Denkens. Davon ist der\\u000a XIV. Dalai Lama zutiefst berzeugt. Der Mensch strebt danach, glcklich zu sein, unabhngig davon, welchem Kulturkreis oder\\u000a welchem Glauben er angehrt. Dieses Streben ist der Sinn des Lebens. Allerdings ist Glcklichsein kein Geschenk, sondern muss\\u000a von jedem fr sich

Howard C. Cutler



E-print Network

'est pas un nombre congruent. #12;2 PIERRE COLMEZ C'est une des nombreuses utilisations que Fermat implique donc le théorème de Fermat3 pour l'exposant 4. Exemple 4 (Zagier). -- L'entier 157 est congruentLE PROBL?ME DES NOMBRES CONGRUENTS par Pierre Colmez Résumé. -- Ce texte est une introduction à la

Colmez, Pierre



E-print Network

?TUDE DE LA TRANSFERRINE DES HYBRIDES INTERSP?CIFIQUES GALLUS GALLUS x NUMIDA MELEAGRIS G. CROIZIER gel d'ami- don, des variations individuelles de la transferrine sérique. Après analyse étudiés ont hérité de l'allèle TfAou de l'allèle TfBde transferrine selon le génotype du Galdus parent. L

Paris-Sud XI, Université de


Prsentation clinique et volution des pancratites chroniques  

Microsoft Academic Search

Rsum頠La consommation dalcool importante et prolonge est une des raisons principales du dveloppement de la pancratite chronique.\\u000a La maladie se manifeste gnralement par des crises svres de douleurs abdominales qui se reproduisent par phases entrecoupes\\u000a dintervalles de longueur variable, sans douleur. Les autres symptmes caractristiques sont la perte de poids et la diarrhe.\\u000a Linsuffisance endocrine apparat un stade avanc

K. Pohl; J. Mssner



Die Erheblichkeit Des Humanismus In Durftiger Zeit  

E-print Network

Objekts wie ihn auch Auguste Comte verstanden hat. Die Kritik ist aber nicht stichhaltig gegenber dem Positivismus des sinnhaften Erlebnisses, den Edmund Husserl in seinem Entwurf der Phnomenologie hervorbringt. Daher sind wir zu dem Schlu gekommen... ganz deutlich in Masaryks Humanismus geussert, aber nicht nur dort. Der Grnder des modernen Positivismus, Auguste Com te, war auch derjenige Philosoph, der einen "Kult der Humanitt" vorgeschlagen hat. Der britische Empirizist John Locke hat die...

Kohak, Erazim


Thorie des Langages -TD 7 AUTOMATES PILE  

E-print Network

Théorie des Langages - TD 7 AUTOMATES ? PILE Exercice 1 - Donnez deux automates à pile (acceptation par pile vide ; par état final) qui reconnaissent chacun des langages suivants : 1. L1 = {anbm|n,m 0 l'automate à pile suivant reconnaissant le langage L par état final : 0 1 3 2 a, Z0/AZ0 , A/ a, A

Bonzon, Elise


des infrastructures de circulation interne, et  

E-print Network

des infrastructures de circulation interne, et bénéficient d'un renouveau des relations réformes économiques de 2002 qui favorisent les investissements extérieurs, le développement de zones CONSOMMATION Le modèle de développement de la Corée du Nord tend à privilégier l'industrie lourde et le chemin

Boyer, Edmond


Intermediate filaments in. cap alpha. -keratins  

SciTech Connect

Previous x-ray diffraction studies on the ..cap alpha..-keratins of hair and wool have revealed that the intermediate filaments (IF) have a helical structure rendered imperfect by a precisely defined dislocation. It has also been possible to deduce a surface lattice for the IF and to determine the number of IF molecules associated with each lattice point. In this work this information is combined with data on the ionic interactions between the coiled-coil rope segments of the IF molecules to provide a plausible model for the pattern of interactions that stabilize the framework of the IF in the hard ..cap alpha..-keratins. Similar interaction studies of the proteins from the IF in the so-called soft ..cap alpha..-keratin from the stratum corneum layer of the skin suggest that they are likely to have an essentially similar pattern.

Fraser, R.D.B.; MacRae, T.P.; Parry, D.A.D.; Suzuki, E.



Synthesis of peptide .alpha.-thioesters  


Disclosed herein is a new method for the solid phase peptide synthesis (SPPS) of C-terminal peptide .alpha. thioesters using Fmoc/t-Bu chemistry. This method is based on the use of an aryl hydrazine linker, which is totally stable to conditions required for Fmoc-SPPS. When the peptide synthesis has been completed, activation of the linker is achieved by mild oxidation. The oxidation step converts the acyl-hydrazine group into a highly reactive acyl-diazene intermediate which reacts with an .alpha.-amino acid alkylthioester (H-AA-SR) to yield the corresponding peptide .alpha.-thioester in good yield. A variety of peptide thioesters, cyclic peptides and a fully functional Src homology 3 (SH3) protein domain have been successfully prepared.

Camarero, Julio A. (Livermore, CA); Mitchell, Alexander R. (Livermore, CA); De Yoreo, James J. (Clayton, CA)



Alternating current long range alpha particle detector  


An alpha particle detector, utilizing alternating currents, which is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

MacArthur, D.W.; McAtee, J.L.



Cluster Expansion of Cold Alpha Matter Energy  

E-print Network

In the cluster expansion framework of Bose liquids we calculate analytical expressions of the two-body, three-body and four-body diagrams contributing to the g.s. energy of an infinite system of neutral alpha-particles at zero-temperature, interacting via the strong nuclear forces exclusively. This is analytically tractable by assuming a density dependent two-body correlation function of Gaussian type. For the alpha-alpha potential we adopt the phenomenological Ali-Bodmer interaction and semi-microscopic potentials obtained from the Gogny force parametrizations. We show that under such assumptions we achieve a rapid convergence in the cluster expansion, the four-body contributions to the energy being smaller than the two-body and three-body contributions by at least an order of magnitude.

F. Carstoiu; S Misicu; V. Balanica; M. Lassaut



Cluster Expansion of Cold Alpha Matter Energy  

E-print Network

In the cluster expansion framework of Bose liquids we calculate analytical expressions of the two-body, three-body and four-body diagrams contributing to the g.s. energy of an infinite system of neutral alpha-particles at zero-temperature, interacting via the strong nuclear forces exclusively. This is analytically tractable by assuming a density dependent two-body correlation function of Gaussian type. For the alpha-alpha potential we adopt the phenomenological Ali-Bodmer interaction and semi-microscopic potentials obtained from the Gogny force parametrizations. We show that under such assumptions we achieve a rapid convergence in the cluster expansion, the four-body contributions to the energy being smaller than the two-body and three-body contributions by at least an order of magnitude.

Carstoiu, F; Balanica, V; Lassaut, M



The status of alpha-particle diagnostics  

SciTech Connect

There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

Young, K.M.; Johnson, D.W.



The status of alpha-particle diagnostics  

SciTech Connect

There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

Young, K.M.; Johnson, D.W.



Alpha-decay of light protactinium isotopes  

SciTech Connect

Light protactinium isotopes have been produced with /sup 204/Pb (/sup 19/F,xn) reactions. ..cap alpha..-activities with E/sub ..cap alpha../ = 9.90(5) MeV, T/sub 1/2/ = 53(10) ns and E/sub ..cap alpha../ = 9.65(5) MeV, T/sub 1/2/ = 0.78(16) could be attributed to the previously unobserved nuclei /sup 219/Pa and /sup 220/Pa with the help of excitation functions. The peak cross sections for the 4n and 3n evaporation channels are on the order of 10 The decay energies as well as the halflives fit well into the systematics of these nuclei close to the magic neutron number N = 126. /sup 219/Pa is the shortest lived nuclide known with directly measured halflife.

Faestermann, T.; Gillitzer, A.; Hartel, K.; Henning, W.; Kienle, P.



Analysis of H-alpha flare spectra  

NASA Technical Reports Server (NTRS)

Spectrographs of the H-alpha line taken at 15 second intervals from the event of 5 Sept. 1973 were interpreted by comparison with synthetic profiles. A sequence of 27 high resolution H alpha profiles was obtained from the second brightest flare kernel. The profiles were generally self reversed with a maximum peak intensity of 1.16 x continuum and a maximum central intensity of .91 x continuum. The line characteristics such as red and violet peak intensities and positions, center shifts and wing intensities were tabulated. Synthetic H-alpha profiles were generated from a finite layer assuming simple parameteric forms for the source function and velocity field. The velocity chosen always decreased with optical depth and had the same sign. For absorption profiles, bisector shifts were calculated for a variety of velocities. The velocity field and source function were derived as a function of optical depth and time.

Kulander, J. L.



Nuclear diagnostic for fast alpha particles  


Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

Grisham, Larry R. (Lawrence Township, Mercer County, NJ); Post, Jr., Douglass E. (Belle Mead, NJ); Dawson, John M. (Pacific Palisades, CA)



Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors  

SciTech Connect

{alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, a kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.

Chi, Seung-Wook [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Lee, Si-Hyung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Kim, Jae-Sung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of)]. E-mail:



Deep H alpha images of interacting galaxies  

NASA Technical Reports Server (NTRS)

Gravitational interactions between galaxies are believed to increase star formation activity dramatically, and most of the brightest starburst galaxies show clear signs of recent interactions. However, it is still not known how interaction triggers star formation, nor are there models to relate the type or strength of interaction to the location or amount of star formation. We report on a series of deep H alpha images of interacting and post-interaction galaxies which we took with the purpose of finding the young stars and ionized gas in these objects. We were motivated in part by the hope that by studying the very recently formed stars we could see how the interaction process had affected the star formation. We observed the galaxies through 50 A-wide filters, one on the redshifted H alpha line and one off, and a standard R filter. Depending on the galaxy and conditions, images in the B, V, and I filters were also obtained. The images were recorded with a 4x7 ft. or 17 ft. diameter CCD at the 1-meter telescope of the Wise Observatory in Mitzpe Ramon. The H alpha and continuum images are used, together with observations at other wavelengths, to put together as complete a picture as possible of star formation and interactions in each galaxy. The complete observation set is not yet available for all the galaxies but certain results are already clear. There do not seem to be any correlations between H 1 and H alpha structures. In some H 1 plume galaxies H alpha extensions were seen on the other side of the galaxy from the H 1; in others extensive H alpha filaments have been found but not H 1. The preliminary results agree with the simplest model that interaction-induced star formation will be concentrated in the system center, since that is where the mass ends up.

Beck, S. C.; Kovo, O.



Calibrations of alpha Centauri A & B  

NASA Astrophysics Data System (ADS)

Detailed evolutionary models of the visual binary alpha Centauri, including pre main-sequence evolution, have been performed using the masses recently determined by Pourbaix et al. (\\cite{pnn99}). Models have been constructed using the CEFF equation of state, OPAL opacities, NACRE thermonuclear reaction rates and microscopic diffusion. A chi 2-minimization is performed to derive the most reliable set of modeling parameters wp = {talpha Cen,Yi,[frac {FeH]i},alphaA ,alphaB }, where talpha Cen is the age of the system, Yi the initial helium content, [frac {FeH]i} the initial metallicity and, alphaA and alphaB the convection parameters of the two components. Using the basic Bhm-Vitense (\\cite{b58}) mixing-length theory of convection, we derive wpBV =2710 Myr, 0.284,0.257,1.53,1.57. We obtain a noticeably smaller age than estimated previously, in agreement with Pourbaix et al. (\\cite{pnn99}), mainly because of the larger masses. If convective core overshoot is considered we get wpov =3530 Myr, 0.279,0.264,1.64,1.66\\. The use of Canuto & Mazitelli (\\cite{cm91,cm92}) convection theory leads to the set wpCM =4086 Myr, 0.271,0.264,0.964,0.986\\. Using the observational constraints adopted by Guenther & Demarque (\\cite{gd00}), and the basic mixing-length theory, we obtain wpGD =5640 Myr, 0.300,0.296,1.86,1.97 and surface lithium depletions close to their observed values. A seismological analysis of our calibrated models has been performed. The determination of large and small spacings between the frequencies of acoustic oscillations from seismic observations would help to discriminate between the models of alpha Cen computed with different masses and to confirm or rule out the new determination of masses.

Morel, P.; Provost, J.; Lebreton, Y.; Thvenin, F.; Berthomieu, G.



Dissociative symptoms reflect levels of tumor necrosis factor alpha in patients with unipolar depression  

PubMed Central

Recent evidence indicates that the nature of interactions between the nervous system and immune system is important in the pathogenesis of depression. Specifically, alterations in pro-inflammatory cytokines have been related to the development of several psychological and neurobiological manifestations of depressive disorder, as well as to stress exposure. A number of findings point to tumor necrosis factor alpha (TNF-?) as one of the central factors in these processes. Accordingly, in the present study, we test the hypothesis that specific influences of chronic stressors related to traumatic stress and dissociation are related to alterations in TNF-? levels. We performed psychometric measurement of depression (Beck Depression Inventory [BDI]-II), traumatic stress symptoms (Trauma Symptom Checklist [TSC]-40), and psychological and somatoform dissociation (Dissociative Experiences Scale [DES] and Somatoform Dissociation Questionnaire [SDQ]-20, respectively), and immunochemical measure of serum TNF-? in 66 inpatients with unipolar depression (mean age 43.1 7.3 years). The results show that TNF-? is significantly related to DES (Spearman R=?0.42, P<0.01), SDQ-20 (Spearman R=?0.38, P<0.01), and TSC-40 (Spearman R=?0.41, P<0.01), but not to BDI-II. Results of the present study suggest that TNF-? levels are related to dissociative symptoms and stress exposure in depressed patients. PMID:24851049

Bizik, Gustav; Bob, Petr; Raboch, Jiri; Pavlat, Josef; Uhrova, Jana; Benakova, Hana; Zima, Tomas



Dissociative symptoms reflect levels of tumor necrosis factor alpha in patients with unipolar depression.  


Recent evidence indicates that the nature of interactions between the nervous system and immune system is important in the pathogenesis of depression. Specifically, alterations in pro-inflammatory cytokines have been related to the development of several psychological and neurobiological manifestations of depressive disorder, as well as to stress exposure. A number of findings point to tumor necrosis factor alpha (TNF-?) as one of the central factors in these processes. Accordingly, in the present study, we test the hypothesis that specific influences of chronic stressors related to traumatic stress and dissociation are related to alterations in TNF-? levels. We performed psychometric measurement of depression (Beck Depression Inventory [BDI]-II), traumatic stress symptoms (Trauma Symptom Checklist [TSC]-40), and psychological and somatoform dissociation (Dissociative Experiences Scale [DES] and Somatoform Dissociation Questionnaire [SDQ]-20, respectively), and immunochemical measure of serum TNF-? in 66 inpatients with unipolar depression (mean age 43.1 7.3 years). The results show that TNF-? is significantly related to DES (Spearman R=-0.42, P<0.01), SDQ-20 (Spearman R=-0.38, P<0.01), and TSC-40 (Spearman R=-0.41, P<0.01), but not to BDI-II. Results of the present study suggest that TNF-? levels are related to dissociative symptoms and stress exposure in depressed patients. PMID:24851049

Bizik, Gustav; Bob, Petr; Raboch, Jiri; Pavlat, Josef; Uhrova, Jana; Benakova, Hana; Zima, Tomas



Fan-less long range alpha detector  


A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

MacArthur, Duncan W. (Los Alamos, NM); Bounds, John A. (Los Alamos, NM)



Parallel Genetic Algorithm for Alpha Spectra Fitting  

NASA Astrophysics Data System (ADS)

We present a performance study of alpha-particle spectra fitting using parallel Genetic Algorithm (GA). The method uses a two-step approach. In the first step we run parallel GA to find an initial solution for the second step, in which we use Levenberg-Marquardt (LM) method for a precise final fit. GA is a high resources-demanding method, so we use a Beowulf cluster for parallel simulation. The relationship between simulation time (and parallel efficiency) and processors number is studied using several alpha spectra, with the aim of obtaining a method to estimate the optimal processors number that must be used in a simulation.

Garca-Orellana, Carlos J.; Rubio-Montero, Pilar; Gonzlez-Velasco, Horacio



Fan-less long range alpha detector  


A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

MacArthur, D.W.; Bounds, J.A.



HETDEX: Diffuse Lyman-Alpha Emission  

NASA Astrophysics Data System (ADS)

The intermediate redshift universe probed by HETDEX, 1.8 < z < 3.0, holds a great deal of information about star formation and the evolution of galaxies. Although simulations reveal a regime active with gas accretion and feeding of galaxies via filaments, observational evidence for this accretion from the Intergalactic Medium (IGM) at any redshift has been very limited. Here we use data from VIRUS-P across several well-characterized fields to put limits on diffuse emission of Lyman-Alpha at the outskirts of galaxies. This work is done in preparation for a similar program with the full HETDEX sample of Lyman-Alpha Emitters (LAEs).

Tuttle, Sarah E.; Finkelstein, S.; Gebhardt, K.; HETDEX Collaboration



Lunar surface outgassing and alpha particle measurements  

SciTech Connect

The Lunar Prospector Alpha Particle Spectrometer (LP APS) searched for lunar surface gas release events and mapped their distribution by detecting alpha particle?; produced by the decay of gaseous radon-222 (5.5 MeV, 3.8 day half-life), solid polonium-2 18 (6.0 MeV, 3 minute half-life), and solid polonium-210 (5.3 MeV, 138 day half-life, but held up in production by the 21 year half-life of lead-210). These three nuclides are radioactive daughters from the decay of uranium-238.

Lawson, S. L. (Stefanie L.); Feldman, W. C. (William C.); Lawrence, David J. (David Jeffery),; Moore, K. R. (Kurt R.); Elphic, R. C. (Richard C.); Maurice, S. (Sylvestre); Belian, Richard D.; Binder, Alan B.



Radiological hazards of alpha-contaminated waste  

SciTech Connect

The radiological hazards of alpha-contaminated wastes are discussed in this overview in terms of two components of hazard: radiobiological hazard, and radioecological hazard. Radiobiological hazard refers to human uptake of alpha-emitters by inhalation and ingestion, and the resultant dose to critical organs of the body. Radioecological hazard refers to the processes of release from buried wastes, transport in the environment, and translocation to man through the food chain. Besides detailing the sources and magnitude of hazards, this brief review identifies the uncertainties in their estimation, and implications for the regulatory process.

Rodgers, J.C.



Conception distribue et conomie des comptences. Quels concepts pour une comprhension thorique des plateaux de conception ?  

Microsoft Academic Search

Partant du constat que les thories des contrats ne parviennent pas rendre compte de manire satisfaisante de l'interpntration des organisations et, de manire plus prcise, du dispositif de coordination particulier - repr au sein de certains rseaux verticaux d'entreprises - qu'est le plateau de conception, on s'intresse dans cette communication aux travaux mens au sein de l' \\

Yvan Renou



Fonction de transfert des systmesFonction de transfert des systmes Aymeric Histace 1  

E-print Network

Chapitre 2 Fonction de transfert des systmesFonction de transfert des systmes asservis Aymeric temps minimal fix. Aymeric Histace 2 #12;0. Introduction Objectifs Pour ce faire il va tre ncessaire abords Ce sont ces 3 points que nous allons maintenant abords. Aymeric Histace 3 Plan 1. Relation

Histace, Aymeric


Contrle pour des systmes gouverns par des quations aux drives partielles  

E-print Network

vapeurs (J. Watt en 1769), etc Voir l'article de James Clerk Maxwell dont l'article On governors), rgulation de vitesse des machines vapeurs (J. Watt en 1769), etc Voir l'article de James Clerk Maxwell vitesse des machines vapeurs (J. Watt en 1769), etc Voir l'article de James Clerk Maxwell dont l

Jeanjean, Louis


Fluorimetrische Bestimmung des Thiamins in Anwesenheit seiner Zerfallsprodukte und des Sulfaguanidins  

Microsoft Academic Search

Zusammenfassung Der Einflu des Sulfaguanidins auf die Zersetzung des Thiamins wurde im Modellgemisch erforscht. Die Thiaminbestimmung wurde parallel nach zwei Verfahren durchgefhrt, von denen das eine nach Dnnschichtchromatograhpie und das andere unmittelbar in der Probelsung vorgenommen wurde. Zur quantitativen Thiaminbestimmung wurde ein von den Verfassern frher ausgearbeitetes, modifiziertes, fluorimetrisches Verfahren angewandt10. Es wurde nachgewiesen, da die unmittelbar gewonnenen Ergebnisse nicht

Stefan B?czyk; Maria Lewandowska; Teresa Szwajca



L'adaptation des pratiques de communication orale aux missions des contrleurs de gestion  

E-print Network

1 L'adaptation des pratiques de communication orale aux missions des contrleurs de gestion logique du contrle de gestion, plus la pratique de techniques spcifiques de communication orale devrait of reality. This research aims at precising the required oral communication competencies through the study

Paris-Sud XI, Universit de


Doctrine des philosophes, doctrine des thologiens et Inquisition romaine au 17e aristotlisme, hliocentrisme, atomisme  

E-print Network

Doctrine des philosophes, doctrine des thologiens et Inquisition romaine au 17e sicle aux procs instruits par l'Inquisition romaine -- j'entends par l les Congrgations du Saint : celle de la mortalit de l'me, 1 Cf. mes tudes La Congrgation de l'Inquisition et la censure

Paris-Sud XI, Universit de



E-print Network

'avons pu tablir de modle structural prcis ; la structure trs symtrique propose par Malm et al. parat structure proposed by Malm et al. seems to be ruled out. LE JOURNAL DE PHYSIQUE TOME 29, AOUT-SEPTEMBRE 1968 pair avec de grandes valeurs des d6placements chimiques. Malm et al. [4] ont obtenu des petits

Paris-Sud XI, Universit de



E-print Network

CHROMATOGRAPHIE EN PHASE GAZEUSE DES OSES, DES DI- ET TRIHOLOSIDES DANS LES MILIEUX COMPLEXES J. Les modifications que nous avons apportes aux mthodes classiques de chromatographie en phase gazeuse chromatographie en phase gazeuse est une mthode rcente qui est plus spcifique, plus rapide et plus prcise que

Paris-Sud XI, Universit de


Facultdessciencesetdegnie Dpartement de gnie des mines, de la mtallurgie et des matriaux  

E-print Network

will be required i) to teach in the specialties of the department, at undergraduate and graduate level, ii coatings to improve the clinical performances of medical devices; and iii) design and development Paraszczak, ing., Ph.D., Head Département de génie des mines, de la métallurgie et des matériaux Université

Adams, Mark


Absorption des rayons 03B3 des substances radioactives Par A. S. EVE,  

E-print Network

136 Absorption des rayons 03B3 des substances radioactives Par A. S. EVE, Attach au Trinity College de Cambridge. Les recherches suivantes avaient pour but de d- cider si les rayons y peuvent tre donne. Il tait ncessaire de dcider d'abord si les rayons y de substances diffrentes sont galement

Boyer, Edmond


Vue artistique des composants d'une cellule - David Modlisation de la production des globules  

E-print Network

Vue artistique des composants d'une cellule - David Goodsell Modlisation de la production des globules rouges - EPI Dracula Alain Viari - 5/11/2012 De la bioinformatique la cellule numrique Les cellules vivantes sont le sige de nombreuses ractions biochimiques trs complexes, interagissent entre

Boyer, Edmond


Comptes Rendus des JNC 16 Toulouse 2009 Comportement mcanique de textiles tricots techniques pour des  

E-print Network

comportement des tricots. Abstract Knitted fabrics, due to their high deformability, are an interesting and few pour des applications composites Mechanical behaviour of technical knitted fabrics for composite oeuvre d'une modélisation du comportement de tricots jersey basée sur la théorie de l'élasticité a permis

Paris-Sud XI, Université de


MMOIRES ORIGINAUX 379 Etude du rle des micro-organismes et des enzymes  

E-print Network

des fromages III. :INFLUENCE DES MICRO-ORGANISMES (Streptococcus lactis, Penicillium caseicolum et P controlée sous l'action de la présure et d'une souche de Streptococcus lactis ou de Penicillium et de leur souche Pl de Penicillium caseicolum utilisée dans ce travail provient de la collection du Laboratoire de

Paris-Sud XI, Université de


Die physikalischen Effekte bei einer Schwerhrigkeit, verursacht durch gleichsinnige Erregung des runden und des ovalen Fensters  

Microsoft Academic Search

Zusammenfassung Bei Patienten ohne Gehrknchelchenkette trifft der Schall durchweg ungehindert auf die beiden Fensterchen. Dadurch ergibt sich eine zustzliche Interferenzschwerhrigkeit, die aber relativ leicht durch Abschattung, beispielsweise des runden Fensters, behoben werden kann. Dieser Hrgewinn durch Abschattung des runden Fensters wurde rechnerisch ermittelt und in einem Audiogramm die zu erwartenden Luftkurven vor und nach Abschattung eingezeichnet. Aufnahmen aus der Praxis

H. Kietz



Mapping High-velocity H-alpha and Lyman-alpha Emission from Supernova 1987A  

E-print Network

We present new {\\it Hubble Space Telescope} images of high-velocity H-$\\alpha$ and Lyman-$\\alpha$ emission in the outer debris of SN~1987A. The H-$\\alpha$ images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H$\\alpha$ imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals ($-$7,500~$<$~$V_{obs}$~$<$~$-$2,800 km s$^{-1}$) and (1,000~$<$~$V_{obs}$~$<$~7,500 km s$^{-1}$), $\\dot{M_{H}}$ = 1.2~$\\times$~10$^{-3}$ M$_{\\odot}$ yr$^{-1}$. We also present the first Lyman-$\\alpha$ imaging of the whole remnant and new $Chandra$ X-ray observations. Comparing the spatial distribution of the Lyman-$\\alpha$ and X-ray emission, we observe that the majority of the high-velocity Lyman-$\\alpha$ emission originates interior to the equatorial...

France, Kevin; Fransson, Claes; Larsson, Josefin; Frank, Kari A; Burrows, David N; Challis, Peter; Kirshner, Robert P; Chevalier, Roger A; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S; Lundqvist, Peter; Smith, Nathan; Sonneborn, George



Genomic organization of the bovine alpha-S1 casein gene.  

PubMed Central

We report the sequence of the complete bovine alpha-s1 casein gene eludicating for the first time the genomic organization of an alpha-s type casein gene. Extending over 17508 bp the gene is split into 19 exons, ranging in size from 24 bp to 385 bp. Except for the translational stop codon not a single coding triplet of the alpha-s1 reading frame is disrupted by any of the splice junctions, which all confirm to known splice consensus sequences. Nine out of 16 coding exons begin with a 'GAX' codon, specific for glutamate. Splicing of this codon from exon 10 to the preceding exon creates a major phosphorylation site. An intron-exon-intron stretch of 154 bp comprising exons 10 and 13 is found precisely duplicated. Associated with the gene, copies of 8 atriodactyla retroposons are found, 6 of which are interspersed into the sequences of the three longest introns. We discuss the possibility that three functional parts of the gene have been recruited and evolutionary conserved at a time before gene diversification gave rise to the separate evolution of alpha- and beta-type casein-genes. PMID:1658736

Koczan, D; Hobom, G; Seyfert, H M




E-print Network

augmentation du nombre des cellules de soutien, prcurseurs des cellules de Sertoli, avec le traitement FSH ds des cellules germinales primordiales, mais on observe la formation prcoce de spermatocytes de premier importante des cellules de soutien, prcurseurs des cellules de Sertoli, sans rponse des cellules germinales

Boyer, Edmond


L'analyse des relations dynamiques entre variables : une application au taux du march montaire franais  

Microsoft Academic Search

[fre] La dtection des relations dynamiques existant entre des variables pose un problme important en conomie. Des procdures statistiques, fondes sur l'tude des rsidus issus de filtres ARIMA de Box et Jenkins, ont t rcemment dveloppes. Ce texte prsente ces mthodes statistiques : dtermination des filtres ARIMA, tude des corrlogrammes entre rsidus, estimation de fonctions de transfert. Celles-ci sont ensuite

Gilbert Colletaz; William Marois



Determining the alpha dynamo parameter in incompressible homogeneous magnetohydrodynamic turbulence  

NASA Technical Reports Server (NTRS)

Alpha, an important parameter in dynamo theory, is proportional to either the kinetic, current, magnetic, or velocity helicity of the fluctuating magnetic field and fluctuating velocity field. The particular helicity to which alpha is proportional depends on the assumptions used in deriving the first order smoothed equations that describe the alpha effect. In two cases, when alpha is proportional to either the magnetic helicity or velocity helicity, alpha is determined experimentally from two point measurements of the fluctuating fields in incompressible, homogeneous turbulence having arbitrary symmetry. For the other two possibilities, alpha is determined if the turbulence is isotropic.

Matthaeus, W. H.; Goldstein, M. L.; Lantz, S. R.



The alpha-form of the hydroxides of bivalent metals  

NASA Technical Reports Server (NTRS)

X-ray analyses were made of the hydroxides of the bivalent metals. The freshly pptd. hydroxide is usually in the alpha-form, which on standing is converted to another form or other forms. The alpha and c grating dimensions of the alpha-form and the C6-type of Co, Zn, C, Co-Zn and Ni-Zn hydroxides are tabulated. Ni hydroxide does not exhibit an alpha-form. The alpha-Co(OH)2, the blue form, is stabilized by sugar or by the higher alcohols: these compounds do not stabilize alpha-Zn(OH)2.

Feitknecht, W.



{sup 144}Sm-{alpha} optical potential at astrophysically relevant energies derived from {sup 144}Sm({alpha},{alpha}){sup 144}Sm elastic scattering  

SciTech Connect

For the determination of the {sup 144}Sm-{alpha} optical potential we measured the angular distribution of {sup 144}Sm({alpha},{alpha}){sup 144}Sm scattering at the energy E{sub lab}=20 MeV with high accuracy. Using the known systematics of {alpha}-nucleus optical potentials we are able to derive the {sup 144}Sm-{alpha} optical potential at the astrophysically relevant energy E{sub c.m.}=9.5 MeV with very limited uncertainties. {copyright} {ital 1997} {ital The American Physical Society}

Mohr, P.; Rauscher, T.; Oberhummer, H. [Institut fuer Kernphysik, Technische Universitaet Wien, Wiedner Hauptstrae 8-10, A-1040 Wien (Austria)] [Institut fuer Kernphysik, Technische Universitaet Wien, Wiedner Hauptstrae 8-10, A-1040 Wien (Austria); Mate, Z.; Fueloep, Z.; Somorjai, E. [Institute of Nuclear Research of the Hungarian Academy of Sciences, P.O. Box 51, H-4001 Debrecen (Hungary)] [Institute of Nuclear Research of the Hungarian Academy of Sciences, P.O. Box 51, H-4001 Debrecen (Hungary); Jaeger, M.; Staudt, G. [Physikalisches Institut, Universitaet Tuebingen, D-72076 Tuebingen (Germany)] [Physikalisches Institut, Universitaet Tuebingen, D-72076 Tuebingen (Germany)



Developpement des betons semi autoplacants a rheologie adaptee pour des infrastructures  

NASA Astrophysics Data System (ADS)

Au cours des dernires dcennies, les infrastructures canadiennes et qubcoises comportent plusieurs structures en bton arm prsentant des problmes de durabilit dus aux conditions climatiques svres, la mauvaise conception des structures, la qualit des matriaux, aux types des btons choisis, aux systmes de construction ou l'existence d'vnements incontrlables. En ce qui concerne le choix du bton pour la construction des infrastructures, une vaste gamme de bton divise en deux principaux types peut tre utilise: le bton conventionnel vibr (BCV) et le bton autoplaant (BAP). Dans le cas d'un BCV, la consolidation inadquate par vibration a t un problme rcurrent, occasionnant des dommages structuraux. Ceci a conduit une rduction de la durabilit et une augmentation du cot d'entretien et de rparation des infrastructures. Rien que l'utilisation d'un BAP a des avantages tels que l'limination de la vibration, la rduction des cots de main d'oeuvre et l'amlioration de la qualit des structures, nanmoins, le cot initial d'un BAP par rapport un BCV ne permet pas encore de gnraliser son utilisation dans l'industrie de la construction. Ce mmoire prsente la conception d'une nouvelle gamme de bton semi-autoplaant pour la construction des infrastructures (BSAP-I) exigeant une vibration minimale. Il s'agit de trouver un quilibre optimal entre la rhologie et le cot initial du nouveau bton pour confrer une bonne performance structurale et conomique aux structures. Le programme exprimental tabli a premirement permis d'valuer la faisabilit d'utilisation des BSAP-I pour la mise en place des piliers d'une infrastructure de pont Sherbrooke. En plus, l'utilisation d'un plan d'expriences a permis l'valuation de trois paramtres de formulation sur les proprits des mlanges de BSAP-I l'tat frais et durci. Finalement, l'valuation de la performance des BSAP-I optimiss travers une caractrisation complte des proprits mcaniques et de la durabilit a t ralise. A la suite de cette tude, les rsultats obtenus nous permettent de conclure que : (1) L'utilisation d'un BSAP-I avec un gros granulat de 5 - 14 mm, des rapports E/L = 0,37 et S/G = 0,52 et une teneur en air de 6 9% a t possible en confrant un quilibre optimal fluidit / stabilit l'tat frais, ainsi qu'un niveau de thixotropie adquate au chantier permettant d'optimiser la conception du coffrage des piliers de pont et de confrer des qualits de surfaces trs acceptables de ces infrastructures. (2) La mthode adapte pour l'essai L-Box contenant 2 barres et une vibration de 5 secondes a permis de bien caractriser la capacit de remplissage d'un BSAP-I. (3) L'utilisation d'un plan factoriel 23 a permis d'obtenir des modles statistiques fiables, capables de prdire les proprits rhologiques l'tat frais et les rsistances en compression des BSAP-I avec des dosages en liant entre 370 et 420 kg/m3, des rapports E/L entre 0,34 et 0,40 et S/G entre 0,47 et 0,53. (4) Des mesures de vitesse d'coulement T40 d'un BSAP-I sont trs semblables celles d'un BAP. En plus, des valeurs T40 montrent une bonne corrlation linaire avec celles de T400 mesurs dans la bote L-Box. (5) la frontire du BAP et du BCV, une bande rhologique possdant un ?0 entre 30 et 320 Pa et un ? entre 10 et 140 Pa.s a t trouve pour la conception optimale des BSAP-I. (6) Les BSAP-I optimiss ont galement confr une trs bonne performance l'tat frais, en permettant maintenir un bon quilibre entre la rhologie et la stabilit dans le temps, lorsqu'on utilise une nergie de vibration minimale pour amorcer son coulement. (7) l'tat durci Les BSAP-I ont confr une bonne performance prsentant des rsistances mcaniques leves et des niveaux ngligeables de pntration aux ions chlores, de perte de masse par caillage et des attaques par le gel/dgel. (8) L'utilisation des cim

Sotomayor Cruz, Cristian Daniel


Characterization of a tumor necrosis factor. alpha. (TNF-. alpha. ) inhibitor: Evidence of immunological cross-reactivity with the TNF receptor  

SciTech Connect

Previous studies have shown that urine of febrile patients contains a tumor necrosis factor {alpha} inhibiting activity (TNF-{alpha} Inh) when tested in a cytotoxicity assay using the tumor necrosis factor {alpha} (TNF-{alpha})-susceptible cell line L929. In the present study, the authors investigated the relationship between the TNF-{alpha} Inh and a potential soluble form of the receptor, as the former has been shown to block TNF-{alpha} activities by binding to the ligand. They demonstrate that human TNF-{alpha} is affected to a greater extent than is murine TNF-{alpha}. This species specificity of the inhibitor correlates with the binding studies of TNF receptor interactions already reported. They raised a polyclonal antibody to TNF-{alpha} Inh that neutralizes its activity and does not recognize TNF-{alpha}. Solubilized cross-linked {sup 125}I-labeled TNF-{alpha} receptor complex could be immunoprecipitated by using either anti-TNF-{alpha} or anti-TNF-{alpha} Inh antibody, suggesting immunological cross-reactivity between the receptor and the inhibitor. By using fluorescein isothiocyanate-coupled TNF-{alpha}, it was possible to visualize by fluorescence-activated cell sorter analysis the TNF-{alpha} receptor on phytohemagglutinin/interleukin 2-activated T cells. A similar increase of immunofluorescence intensity of the activated T cells was observed by using anti-TNF-{alpha} Inh antibody revealed with a fluorescein isothiocyanate-coupled goat anti-rabbit IgG1 conjugate, suggesting that the TNF-{alpha} Inh is also expressed as a membrane protein. Taken together, their results suggest that the TNF-{alpha} Inh originally described might be a soluble form of the TNF receptor itself.

Seckinger, P.; Zhang, Jianhua; Hauptmann, B.; Dayer, J.M. (Hopital Cantonal Universitaire, Geneva (Switzerland))



Hematologic Features of Alpha Thalassemia Carriers  

PubMed Central

Alpha thalassemia (?-thal) is relatively common worldwide. Most carriers are defective in either one or two alpha globin genes out of four functional ones, with deletions being more common than point mutations. The hematologic features are very important for the selection of the appropriate molecular tests while determining the genotype. The aim of this study was to compare hematologic features of patients with various types of ? globin mutations. Hematological indices including red blood cells (RBC), hemoglobin concentration (Hb), mean cell volume (MCV), mean cell hemoglobin (MCH), Mean corpuscular hemoglobin concentration (MCHC) and percentage of Hemoglobin (HBA1, HBA2 and HBF) of seven-hundred and twenty two patients presenting ten different ?-thal genotypes were considered. All patients showed reduced MCV and/or MCH values.Moreover, MCV and MCH were lower in patients with two functional alpha globin genes in comparison to patients with one mutated alpha globin gene (P value<0.001). In conclusion, MCV and MCH valuescan be helpful for the selection of the appropriate molecular tests to determine the genotype of alphathalassemia carriers. PMID:24551772

Akhavan-Niaki, Haleh; Youssefi Kamangari, Reza; Banihashemi, Ali; Kholghi Oskooei, Vahid; Azizi, Mandana; Tamaddoni, Ahmad; Sedaghat, Sadegh; Vakili, Mohsen; Mahmoudi Nesheli, Hassan; Shabani, Soraya



Hematologic features of alpha thalassemia carriers.  


Alpha thalassemia (?-thal) is relatively common worldwide. Most carriers are defective in either one or two alpha globin genes out of four functional ones, with deletions being more common than point mutations. The hematologic features are very important for the selection of the appropriate molecular tests while determining the genotype. The aim of this study was to compare hematologic features of patients with various types of ? globin mutations. Hematological indices including red blood cells (RBC), hemoglobin concentration (Hb), mean cell volume (MCV), mean cell hemoglobin (MCH), Mean corpuscular hemoglobin concentration (MCHC) and percentage of Hemoglobin (HBA1, HBA2 and HBF) of seven-hundred and twenty two patients presenting ten different ?-thal genotypes were considered. All patients showed reduced MCV and/or MCH values.Moreover, MCV and MCH were lower in patients with two functional alpha globin genes in comparison to patients with one mutated alpha globin gene (P value<0.001). In conclusion, MCV and MCH valuescan be helpful for the selection of the appropriate molecular tests to determine the genotype of alphathalassemia carriers. PMID:24551772

Akhavan-Niaki, Haleh; Youssefi Kamangari, Reza; Banihashemi, Ali; Kholghi Oskooei, Vahid; Azizi, Mandana; Tamaddoni, Ahmad; Sedaghat, Sadegh; Vakili, Mohsen; Mahmoudi Nesheli, Hassan; Shabani, Soraya



Coefficient Alpha and Reliability of Scale Scores  

ERIC Educational Resources Information Center

The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw

Almehrizi, Rashid S.



Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"  

ERIC Educational Resources Information Center

It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact

Ritter, Nicola L.




Microsoft Academic Search

Interactive, efficient, methods of foreground extraction a nd alpha-matting are of increasing practical importance for digital image editing. Although several new approaches to this problem have recently been developed, many chal- lenges remain. We propose a new technique based on ran- dom walks that has the following advantages: First, by leveraging a recent technique from manifold learning the- ory, we

Leo Grady; Thomas Schiwietz; Shmuel Aharon; Rudiger Westermann



Alpha thalassaemia-mental retardation, X linked  

PubMed Central

X-linked alpha thalassaemia mental retardation (ATR-X) syndrome in males is associated with profound developmental delay, facial dysmorphism, genital abnormalities and alpha thalassaemia. Female carriers are usually physically and intellectually normal. So far, 168 patients have been reported. Language is usually very limited. Seizures occur in about one third of the cases. While many patients are affectionate with their caregivers, some exhibit autistic-like behaviour. Patients present with facial hypotonia and a characteristic mouth. Genital abnormalities are observed in 80% of children and range from undescended testes to ambiguous genitalia. Alpha-thalassaemia is not always present. This syndrome is X-linked recessive and results from mutations in the ATRX gene. This gene encodes the widely expressed ATRX protein. ATRX mutations cause diverse changes in the pattern of DNA methylation at heterochromatic loci but it is not yet known whether this is responsible for the clinical phenotype. The diagnosis can be established by detection of alpha thalassaemia, identification of ATRX gene mutations, ATRX protein studies and X-inactivation studies. Genetic counselling can be offered to families. Management is multidisciplinary: young children must be carefully monitored for gastro-oesophageal reflux as it may cause death. A number of individuals with ATR-X are fit and well in their 30s and 40s. PMID:16722615

Gibbons, Richard



Transformer Recharging with Alpha Channeling in Tokamaks  

SciTech Connect

Transformer recharging with lower hybrid waves in tokamaks can give low average auxiliary power if the resistivity is kept high enough during the radio frequency (rf) recharging stage. At the same time, operation in the hot ion mode via alpha channeling increases the effective fusion reactivity. This paper will address the extent to which these two large cost saving steps are compatible. __________________________________________________

N.J. Fisch



September 2000 ALPHA HELIX CRUISE HX235  

E-print Network

1 September 2000 ALPHA HELIX CRUISE HX235 Friday 25th August 2000 - Thursday 7th September 2000 BERING STRAIT CRUISE REPORT FUNDING SOURCE: NSF-OPP-9815707 (Kelly Falkner, OSU) CHIEF SCIENTIST: Rebecca PURPOSE: This cruise has two scientific goals. The first (and foremost) is the recovery and redeployment

Washington at Seattle, University of


Method of making nanocrystalline alpha alumina  


Method of making selected phases of nanocrystalline ceramic materials. Various methods of controlling the production of nanocrystalline alpha alumina and titanium oxygen phases are described. Control of the gas atmosphere and use of particular oxidation treatments give rise to the ability to control the particular phases provided in the aluminum/oxygen and titanium/oxygen system.

Siegel, Richard W. (Hinsdale, IL); Hahn, Horst (Champaign, IL); Eastman, Jeffrey A. (Woodridge, IL)



Radioluminescence yield of alpha particles in air  

NASA Astrophysics Data System (ADS)

Alpha particles can be detected by measuring the radioluminescence light which they induce when absorbed in air. The light is emitted in the near ultraviolet region by nitrogen molecules excited by secondary electrons. The accurate knowledge of the radioluminescence yield is of utmost importance for novel radiation detection applications utilizing this secondary effect. Here, the radioluminescence yield of an alpha particle is investigated as a function of energy loss in air for the first time. Also, the total radioluminescence yield of the particle is measured with a carefully calibrated ^{239}Pu emitter used in the experiments. The obtained results consistently indicate that alpha particles generate 193 photons per one MeV of energy released in air at normal pressure (temperature 22C, relative humidity 43%) and the dependence is found to be linear in the studied energy range from 0.3 MeV to 5.1 MeV. The determined radioluminescence yield is higher than previously reported for alpha particles and similar to the radioluminescence yield of electrons at comparable energies. This strengthens the evidence that the luminescence induced by charged particles is mostly proportional to the energy loss in the media and not very sensitive to the type of primary particle.

Sand, J.; Ihantola, S.; Perjrvi, K.; Toivonen, H.; Toivonen, J.



Continuous Wave Coherent Lyman alpha Radiation  

Microsoft Academic Search

We describe the first coherent generation of continuous wave radiation at 121.56 nm. A yield of 3108 photons\\/sec (0.5 nW) has been achieved by four-wave mixing in mercury vapor. This continuous Lyman- alpha source could be used for laser cooling and precision spectroscopy of both hydrogen and antihydrogen.

K. S. E. Eikema; J. Walz; T. W. Hnsch



EEG alpha power and creative ideation.  


Neuroscientific studies revealed first insights into neural mechanisms underlying creativity, but existing findings are highly variegated and often inconsistent. Despite the disappointing picture on the neuroscience of creativity drawn in recent reviews, there appears to be robust evidence that EEG alpha power is particularly sensitive to various creativity-related demands involved in creative ideation. Alpha power varies as a function of creativity-related task demands and the originality of ideas, is positively related to an individuals' creativity level, and has been observed to increase as a result of creativity interventions. Alpha increases during creative ideation could reflect more internally oriented attention that is characterized by the absence of external bottom-up stimulation and, thus, a form of top-down activity. Moreover, they could indicate the involvement of specific memory processes such as the efficient (re-)combination of unrelated semantic information. We conclude that increased alpha power during creative ideation is among the most consistent findings in neuroscientific research on creativity and discuss possible future directions to better understand the manifold brain mechanisms involved in creativity. PMID:23246442

Fink, Andreas; Benedek, Mathias



Systemic Targeted Alpha Radiotherapy for Cancer  

PubMed Central

Background: The fundamental principles of internal targeted alpha therapy forcancer were established many decades ago.The high linear energy transfer (LET) ofalpha radiation to the targeted cancer cellscauses double strand breaks in DNA. Atthe same time, the short range radiation spares adjacent normal tissues. This targeted approach complements conventional external beam radiotherapy and chemotherapy. Such therapies fail on several fronts, such as lack of control of some primary cancers (e.g. glioblastoma multiforme) and to inhibit the development of lethal metastaticcancer after successful treatment of the primary cancer. Objective: This review charts the developing role of systemic high LET, internalradiation therapy. Method: Targeted alpha therapy is a rapidly advancing experimental therapy thatholds promise to deliver high cytotoxicity to targeted cancer cells. Initially thoughtto be indicated for leukemia and micrometastases, there is now evidence that solidtumors can also be regressed. Results: Alpha therapy may be molecular or physiological in its targeting. Alphaemitting radioisotopes such as Bi-212, Bi-213, At-211 and Ac-225 are used to labelmonoclonal antibodies or proteins that target specific cancer cells. Alternatively, Radium-233 is used for palliative therapy of breast and prostate cancers because of its bone seeking properties. Conclusion: Preclinical studies and clinical trials of alpha therapy are discussedfor leukemia, lymphoma, melanoma, glioblastoma multiforme, bone metastases, ovarian cancer, pancreatic cancer and other cancers. PMID:25505750

Allen, BJ



Dual T cell receptor alpha chain T cells in autoimmunity  

PubMed Central

Allelic exclusion at the T cell receptor alpha locus TCR-alpha is incomplete, as demonstrated by the presence of a number of T lymphocyte clones carrying two expressed alpha chain products. Such dual alpha chain T cells have been proposed to play a role in autoimmunity, for example, because of a second TCR-alpha beta pair having bypassed negative selection by virtue of low expression. We examined this hypothesis by generating mice of various autoimmunity-prone strains carrying a hemizygous targeted disruption of the TCR-alpha locus, therefore unable to produce dual alpha chain T cells. Normal mice have a low but significant proportion of T cells expressing two cell-surface TCR-alpha chains that could be enumerated by comparison to TCR-alpha hemizygotes, which have none. Susceptibility to various autoimmune diseases was analyzed in TCR-alpha hemizygotes that had been backcrossed to disease-prone strains for several generations. The incidence of experimental allergic encephalomyelitis and of lupus is not affected by the absence of dual TCR-alpha cells. In contrast, nonobese diabetic (NOD) TCR alpha hemizygotes are significantly protected from cyclophosphamide-accelerated insulitis and diabetes. Thus, dual alpha T cells may play an important role in some but not all autoimmune diseases. Furthermore, since protected and susceptible NOD mice both show strong spontaneous responses to glutamic acid decarboxylase, responses to this antigen, if necessary for diabetetogenesis, are not sufficient. PMID:7561698



The effects of (+)-amphetamine, alpha-methyltyrosine, and alpha-methylphenylalanine on the concentrations of m-tyramine and alpha-methyl-m-tyramine in rat striatum.  

PubMed Central

The concentration in rat striatum of the meta and para isomers of tyramine and alpha-methyltyramine, after the administration of (+)-amphetamine, alpha-methyl-p-tyrosine (AMPT) and alpha-methylphenylalanine (AMPA) has been determined using chemical ionization gas chromatography mass spectrometry (c.i.g.c.m.s.). Twenty hours after the last of 7 daily injections of (+)-amphetamine (5 mg kg-1 i.p.) the concentration of alpha-methyl-p-tyramine in striatal tissue increased twofold compared to the concentration 20 h after a single injection. In contrast the concentration of alpha-methyl-m-tyramine did not change. alpha-Methyl-m-tyramine and alpha-methyldopamine were found in the striatum at concentrations of 42 ng g-1 and 13.5 ng g-1 respectively after treatment of rats 20 h before with AMPA (100 mg kg-1 i.p.). After treatment with AMPT (100 mg kg-1, 20 h before decapitation) only the para isomer of alpha-methyltyramine could be detected (13.7 ng g-1) although the striatal concentration of alpha-methyldopamine was 274 ng g-1, a level 20 times greater than that observed after AMPA treatment. The combined administration of both AMPT and AMPA (100 mg kg-1 each, 20 h) resulted in a reduction of the striatal concentration of alpha-methyl-m-tyramine but not alpha-methyl-p-tyramine. These data suggest that alpha-methyl-m-tyramine in rat striatum is formed by the enzyme tyrosine hydroxylase on substrate AMPA, rather than by ring dehydroxylation of alpha-methyldopa and alpha-methyldopamine. Significant reductions in the striatal concentrations of m-tyramine 2 h after the administration of AMPT, suggest that tyrosine hydroxylase is involved similarly in the production of m-tyramine. PMID:6652380

Dougan, D. F.; Duffield, A. M.; Duffield, P. H.; Wade, D. N.



Bombesin analogs containing alpha-amino-isobutyric acid with potent anticancer activity.  


Six octapeptide bombesin (BN) analogs were synthesized by substituting alpha-aminoisobutyric acid (Aib), in place of Ala9 or Gly11, or both, in the [D-Phe6, desMet14]-BN (6-14) sequence: D-Phe6-Gln7-Trp8-Ala9-Val10-Gly11-His12-Leu13-NH2 (P0). Additionally, Leu13 was replaced with isoleucine in two analogs and one of the analogs was butanoylated at the N-terminus. The antiproliferative activity of the analogs was tested in vitro on human pancreatic (MiaPaCa-2) and colon cancer (SW620, HT29 and PTC) cell lines using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The analogs demonstrated anticancer activity in the above cell lines at concentrations ranging from 0.01 nM to 1 microM. One of the analogs, P6, was evaluated for in vivo tumor regression in a xenograft model of human primary colon cancer in athymic nude mice and was found to cause significant reduction in tumor volume. NMR and molecular dynamics (MD) simulation studies for this analog revealed the presence of a mixed 3(10)/alpha-helical structure. This study demonstrates that the designed BN analogs retain their anticancer activity after the incorporation of the constrained amino acid, Aib, and are potential molecules for future use in cancer therapy and drug targeting. PMID:17031871

Prasad, Sudhanand; Mathur, Archna; Gupta, Neena; Jaggi, Manu; Singh, Anu T; Rajendran, Praveen; Sanna, Vinod K; Datta, Kakali; Mukherjee, Rama



Obamacare Hoffnung auf eine Reform des amerikanischen Gesundheitssystems?  

Microsoft Academic Search

Der Umbau des US-amerikanischen Gesundheitssystems ist eines der Vorhaben der gegenwrtigen US-Regierung. Der folgende Beitrag stellt die Organisation und die Leistungsfhigkeit des derzeitigen Gesundheitswesens vor und diskutiert die aktuellen Reformvorschlge.

Sven Neelsen; Michael Metzger




E-print Network

recherche 3 postes pourvoir Secteur de travail : Facult des Sciences Infirmires (FSI) Institut de : Rf. : FSX140817 Agent de recherche - FSI Direction des ressources humaines #12;2 Titre du fichier

Charette, Andr


33 CFR 117.439 - Des Allemands Bayou.  

Code of Federal Regulations, 2010 CFR

...Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Louisiana 117.439 Des Allemands Bayou. (a) The draw of the S631 bridge, mile 13.9 at Des Allemands, shall open...



33 CFR 117.439 - Des Allemands Bayou.  

Code of Federal Regulations, 2014 CFR

...Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Louisiana 117.439 Des Allemands Bayou. (a) The draw of the S631 bridge, mile 13.9 at Des Allemands, shall open...



Le contrle des infections au cabinet du pdiatre  

PubMed Central

RSUM La transmission des infections au cabinet du pdiatre est de plus en plus proccupante. Le prsent document expose les voies de transmission des infections et les principes sous-jacents aux mesures actuelles pour contrler les infections. Pour prvenir les infections, il faut bien concevoir le cabinet et adopter des politiques administratives et de triage convenables, de mme que des pratiques de base pour les soins de tous les patients (p. ex., hygine des mains, port de gants, de masques, de lunettes de protection et dune blouse dhpital pour des interventions prcises; nettoyage, dsinfection et strilisation convenables des surfaces et du matriel, y compris les jouets, et techniques dasepsie en cas dinterventions effractives) et des prcautions additionnelles en cas dinfections prcises. Le personnel doit avoir reu les vaccins pertinents, et les personnes infectes doivent respecter les politiques de restriction au travail.



Degradation of the potato glycoalkaloids--alpha-solanine and alpha-chaconine in groundwater.  


The potato glycoalkaloids alpha-chaconine and alpha-solanine are produced in high amounts in potato plants from where release to soil takes place. Degradation of the compounds in groundwater was investigated, as their fate in the terrestrial environment is unknown. Abiotic and microbial degradation were followed in groundwater sampled from below a potato field and spiked with the glycoalkaloids (115 nmol/l). Degradation was primarily microbial and the glycoalkaloids were degraded within 21-42 days. The metabolites beta(1)-solanine, gamma-solanine, and solanidine were formed from alpha-solanine, while beta-chaconine, gamma-chaconine and solanidine were detected from alpha-chaconine. Thus, indigenous groundwater microorganisms are capable of degrading the glycoalkaloids. PMID:19290452

Jensen, Pia H; Jacobsen, Ole S; Henriksen, Trine; Strobel, Bjarne W; Hansen, Hans Christian B



The L-alpha/H-alpha intensity ratio in PKS 0237-23. [quasar  

NASA Technical Reports Server (NTRS)

The ratio I(L-alpha)/I(H-alpha) has been measured to be 1.7 plus or minus 0.6 in the quasar PKS 0237-23. The measured ratio is similar to that measured in 3C 273 by Davidsen et al. and to that inferred by Baldwin from a study of a large number of quasars; it is a factor of 5 to 14 smaller than expected from recombination theory. If the L-alpha radiation is resonantly scattered and there are modest amounts of dust within the ionized region, the measured ratio may be interpreted in terms of recombination theory, with L-alpha being depleted by absorption by the dust.

Hyland, A. R.; Becklin, E. E.; Neugebauer, G.



The fratricide of alphaOmega dynamos by their alpha2 siblings  

Microsoft Academic Search

Context. Helically forced magneto-hydrodynamic shearing-sheet turbulence can support different large-scale dynamo modes, although the alphaOmega mode is generally expected to dominate because it is the fastest growing one. In an alphaOmega dynamo, most of the field amplification is produced by the shear. As differential rotation is an ubiquitous source of shear in astrophysics, such dynamos are believed to be the

A. Hubbard; M. Rheinhardt; A. Brandenburg



The fratricide of alpha-Omega dynamos by their alpha-squared siblings  

Microsoft Academic Search

Context. Helically forced magneto-hydrodynamic shearing-sheet turbulence can\\u000asupport different large-scale dynamo modes, although the {\\\\alpha} - {\\\\Omega}\\u000amode is generally expected to dominate because it is the fastest growing. In an\\u000a{\\\\alpha} - {\\\\Omega} dynamo, most of the field amplification is produced by the\\u000ashear. As differential rotation is an ubiquitous source of shear in\\u000aastrophysics, such dynamos are believed

Alexander Hubbard; Matthias Rheinhardt; Axel Brandenburg



Les dterminants individuels des absences au travail : une comparaison europenne  

Microsoft Academic Search

partir des donnes de lEuropean Community Household Panel (ECHP), on sintresse aux dterminants individuels des absences au travail dans les pays europens. Ltude porte sur lensemble des tats membres de lUE-15, lexception de la Sude. Les comportements dabsence des salaris, dans chacun de ces pays, sont analyss laide de deux modles sur donnes de panel : un

Sabine Chaupain-Guillot; Olivier Guillot



Antibody-mediated reduction of {alpha}-ketoamides  


Monoclonal antibodies raised against a 4-nitrophenyl phosphonate hapten catalyze the stereospecific reduction of an {alpha}-ketoamide to the corresponding {alpha}-hydroxyamide in the presence of an appropriate reducing agent.

Schultz, P.G.; Gallop, M.A.



Antibody-mediated reduction of .alpha.-ketoamides  


Monoclonal antibodies raised against a 4-nitrophenyl phosphonate hapten catalyze the stereospecific reduction of an .alpha.-ketoamide to the corresponding .alpha.-hydroxyamide in the presence of an appropriate reducing agent.

Schultz, Peter G. (Oakland, CA); Gallop, Mark A. (East Palo Alto, CA)



Study of alpha background in a dark matter detector  

E-print Network

Alpha background, specifically from radon and its progeny in the uranium and thorium chains, has been a major issue in dark matter detectors. This work focuses on alpha background presence in the DMTPC experiment by examining ...

Yegoryan, Hayk



Who Is at Risk for Alpha-1 Antitrypsin Deficiency?  


... on Twitter. Who Is at Risk for Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency occurs in all ethnic groups. ... it doesn't mean that you'll develop one of the diseases related to the condition. Some ...


The effects of alpha particle irradiation on stainless steel  

E-print Network

A Monte Carlo code was developed to calculate the alpha particle emission rate from WGPu. It yielded information pertaining to the alpha particle source strength at the WGPU and stainless steel interface as well as the damage production and He...

Shipp, John Douglas



On the formation of active region prominences (H alpha filaments)  

NASA Technical Reports Server (NTRS)

Analysis of sequential H alpha images of active region prominence formation suggests that simple large-scale photospheric mass-motions may play a key role in the formation of these long, thin, H alpha filaments.

Rompolt, Bogdan; Bogdan, Thomas



Nucleotide dependent differences between the {alpha}-skeletal and {alpha}-cardiac actin isoforms  

SciTech Connect

The thermodynamic properties of the actin filaments prepared from cardiomyocytes were investigated with differential scanning calorimetry. This method could distinguish between the {alpha}-cardiac and {alpha}-skeletal components of the actin filaments polymerised from ADP-actin monomers by their different melting temperatures (T{sub m}). Similar separation was not possible with filaments polymerised from ATP-actin monomers. Further analyses revealed that the activation energy (E{sub act}) was greater for filaments of {alpha}-skeletal actin than for {alpha}-cardiac actin monomers when the filaments were polymerised from ADP-actin monomers. These results showed that the {alpha}-cardiac actin filaments were thermodynamically less stable than the filaments of {alpha}-skeletal actin and their difference was nucleotide dependent. Based on these results and considering previous observations it was concluded that the existence of two actin isoforms and their nucleotide dependent conformational differences are part of the tuning regulatory mechanism by which the cardiac muscle cells can maintain their biological function under pathological conditions.

Orban, Jozsef; Lorinczy, Denes; Nyitrai, Miklos [University of Pecs, Faculty of Medicine, Department of Biophysics, Pecs, Szigeti Str. 12, H-7624 (Hungary); Hild, Gabor [University of Pecs, Faculty of Medicine, Department of Biophysics, Pecs, Szigeti Str. 12, H-7624 (Hungary)], E-mail:



Structural and electrochemical studies of alpha manganese dioxide ({alpha}-MnO{sub 2})  

SciTech Connect

The structural and electrochemical properties of alpha-MnO[sub 2], prepared by acid digestion of Mn[sub 2]O[sub 3], and its lithiated derivatives xLi[sub 2] O . MnO[sub 2] (where x is greater than or equal to zero and less than or equal to 0.25) have been investigated as insertion compounds in the search for new and viable cathode materials for rechargeable 3-V batteries. The alpha-MnO[sub 2] product fabricated by this technique contains water within the large (2x2) channels of the structure; the water can be removed from the alpha-MnO[sub 2] framework without degradation of the structure, and then at least partially replaced by Li[sub 2]O. The lithia-doped alpha-MnO[sub 2] electrodes, described generically as xLi[sub 2]O . Mno[sub 2], stabilize the structure and provide higher capacities on cycling than the parent material. The structures of these alpha- MnO[sub 2]-type electrode materials are described. and electrochemical data are presented for both liquid electrolyte and polymer electrolyte Li/alpha-MnO[sub 2] and Li/xLi[sub 2]O . MnO[sub 2] cells.

Johnson, C.S.; Dees, D.W.; Mansuetto, M.F.; Thackeray, M.M.; Vissers, D.R.; Argyriou, D.; Loong, C.-K. [Argonne National Lab., IL (United States); Christensen, L. [Minnesota Mining and Mfg. Co., St. Paul, MN (United States)



Chaperone-like activities of {alpha}-synuclein: {alpha}-Synuclein assists enzyme activities of esterases  

SciTech Connect

{alpha}-Synuclein, a major constituent of Lewy bodies (LBs), has been implicated to play a critical role in the pathogenesis of Parkinson's disease (PD), although the physiological function of {alpha}-synuclein has not yet been known. Here we have shown that {alpha}-synuclein, which has no well-defined secondary or tertiary structure, can protect the enzyme activity of microbial esterases against stress conditions such as heat, pH, and organic solvents. In particular, the flexibility of {alpha}-synuclein and its C-terminal region seems to be important for complex formation, but the structural integrity of the C-terminal region may not be required for stabilization of enzyme activity. In addition, atomic force microscopy (AFM) and in vivo enzyme assays showed highly specific interactions of esterases with {alpha}-synuclein. Our results indicate that {alpha}-synuclein not only protects the enzyme activity of microbial esterases in vitro, but also can stabilize the active conformation of microbial esterases in vivo.

Ahn, Misun [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of); Kim, SeungBum [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of); Kang, Mira [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of); Ryu, Yeonwoo [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of)]. E-mail:; Doohun Kim, T. [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of)]. E-mail:



Rsultats fonctionnels des lsions des tendons flchisseurs de la main: propos de 90 cas  

PubMed Central

Les auteurs rapportent une srie de 90 patients, prsentant une section tendineuse des flchisseurs de la main, et suivis avec un recul moyen de 8 mois (min: 2 mois; max: 13 mois). La lsion tait localise dans 12% des cas en zone I, 46% des cas en zone II, 2% en zone III et 25% des cas en zone IV et V. Pour le pouce (13 patients), 10 cas en zone T2 et 3 cas en zone T3. La technique opratoire utilise tait les sutures tendineuses en cadre de Kessler modifi, associe un surjet pitendineux. Nous avons obtenus 54% de trs bons rsultats, 34% de rsultats moyens et 12% de mauvais rsultats. Pour le pouce les rsultats semble moins bons avec un taux de rsultats mdiocre de 48%. Certes les chiffres de cette srie sont moins bons que ceux des autres sries publies dans la littrature. Les facteurs influenant les rsultats sont d'abord l'utilisation d'immobilisation postopratoire systmatique ainsi que le mcanisme d'agression, et la localisation la zone II et au pouce. Les complications mcaniques sont reprsentes par 7% de rupture, toutes au niveau de pouce, et 31% des adhrences tendineuses (soit 30 cas), dont 19 en zone II, l'infections (22%) et 4% des cas d'algodystrophies. PMID:23847698

Boussakri, Hassan; Azarkane, Mohamad; Elidrissi, Mohamad; Shimi, Mohamad; Elibrahimi, Abdelhalim; Elmrini, Abdelmajid



Profil epidemiologique des brulures d'enfants admis au Centre National des Brules, Maroc  

PubMed Central

Summary Ce travail rtrospectif analyse les particularits pidmiologiques de 543 cas de brlures d'enfants, reprsentant 45,7% des admissions de notre centre, en vue de dterminer les lments pouvant contribuer renforcer la prvention, qui reste le traitement de choix de cette pathologie. La moyenne d'ge est de 4,25 ans avec une prdilection pour la tranche d'ge d'un cinq ans, avec 42,5% des cas. Une atteinte masculine est retrouve dans 63,5% des cas. La brlure survient domicile dans 85,1% et accidentellement dans 95% des cas. Les brlures thermiques reprsentent 96,5% des causes domines par les liquides dans 69,3% des cas. La surface cutane brle est ? 20% dans 52,3%. La brlure intresse essentiellement les membres suprieurs (79,1%). 56,8% des enfants sont transfrs par d'autres hpitaux et le dlai de prise en charge hospitalire est suprieur 6 heures dans 65,5%. Le taux de mortalit a t de 13,2%. PMID:22639559

Zahid, A.; Atannaz, J.; Alaoui, M.; Rafik, A.; Ezzoubi, M.; Diouri, M.; Chlihi, A.; Bahechar, N.; Boukind, E.H.



Einflu des Sorbits auf die intestinale Vitaminsynthese bei der Ratte  

Microsoft Academic Search

1. In Versuchen an cellulosefrei ernhrten Ratten, in denen eine Koprophagie durch entsprechende Konstruktion der Stoffwechselkfige weitgehend verhindert war, wurde anhand des Wachstumsverlaufes und der Vitaminausscheidung im Harn gezeigt, da die intestinale Synthese von Thiamin, Vitamin B6, Pantothensure und Biotin durch orale Zufuhr von Sorbit signifikant erhht wird. Dieser Effekt des Sorbits erstreckt sich wahrscheinlich auf alle Komponenten des Vitamin

S. Hollmann; U. Herlyn; W. Schiek



Optimisation des relations entre transpiration et photosynthse. Observations propos  

E-print Network

Optimisation des relations entre transpiration et photosynthèse. Observations à propos des 1977 une théorie d'optimisation des relations entre transpiration et photosynthèse chez les végétaux transpiration, F! le taux de photosynthèse nette et g, la conductance stomatiquc pour le CO2. Les études

Paris-Sud XI, Université de


Zweite Satzung zur nderung der Fachprfungsordnung des Bachelorstudiengangs Geographie  

E-print Network

1 Zweite Satzung zur ?nderung der Fachprüfungsordnung des Bachelorstudiengangs Geographie an der-Moritz-Arndt-Universität Greifswald die folgende Satzung zur ?nderung von Fachprüfungsordnung des Bachelorstudiengangs Geographie: Artikel 1 Die Fachprüfungsordnung des Bachelorstudiengangs Geographie vom 26. November 2007 ( BM

Greifswald, Ernst-Moritz-Arndt-Universität


Les dterminants du jugement des salaris sur la RTT  

Microsoft Academic Search

[fre] Les dterminants du jugement des salaris sur la RTT . . Si de nombreux travaux ont dj t consacrs aux consquences conomiques des politiques de rduction du temps de travail (RTT), notamment sur lemploi, peu dtudes ont jusquici abord les effets de ces politiques sur les conditions de travail et les conditions de vie des salaris concerns. Plusieurs tudes

Gilbert Cette; Nicolas Dromel; Dominique Mda




E-print Network

galement tudi la variation thermique de l'aimantation spontane des ferrites de nickel, de cobalt et deAIMANTATION SPONTANE DES FERRITES Par REN PAUTHENET et L. BOCHIROL. Sommaire. 2014 Les auteurs ont tudi les variations de l'aimantation saturation des ferrites de magnsium et de cuivre en

Paris-Sud XI, Universit de


Digestion des glucides chez le monogastrique Martine CHAMP  

E-print Network

Digestion des glucides chez le monogastrique Martine CHAMP Laboratoire de Techno%gie des Aliments des Animaux, /. N. R.A., Rue de la Géraudière, 44072 Nantes Cedex. Summary. Carbohydrate digestion digested in the small intestine of monogastric animals by enzymes of the salivary glands, pancreas

Paris-Sud XI, Université de


, INRAAdaptation des Herbivores aux Theix 63122 Saint-Gens-Champanelle  

E-print Network

B. DUMONT , INRAAdaptation des Herbivores aux Milieux Theix 63122 Saint-Genès-Champanelle Déterminisme des choix alimentaires des herbivores au pâturage : principales théories Comment mieux gérer les zones agricoles en déprise ? Comment les herbivores peuvent-ils contribuer à entretenir ces espaces

Paris-Sud XI, Université de


Mesures couples de diffraction, fluorescence et absorption des rayons X  

E-print Network

Mesures couplées de diffraction, fluorescence et absorption des rayons X à l'échelle milli- et, orientation préférentielle ...) Principe des mesures Absorption des rayons X Mesure de transmission (I /I0 ~ e

Paris-Sud 11, Université de


Le support des rseaux mobiles dans IPv6 Thierry Ernst  

E-print Network

SYNTHESE Le support des rseaux mobiles dans IPv6 Thierry Ernst INRIA Rocquencourt, Domaine de, notamment Mobile IPv6, permettent aux stations mobiles prises individuellement de maintenir leurs sessions tour des travaux portant sur la mobilit des rseaux dans IPv6. Nous prsentons les usages, les besoins

Paris-Sud XI, Universit de


Localisation immunocytochimique et analyse quantitative des cellules gonadotropes et thyrotropes  

E-print Network

Localisation immunocytochimique et analyse quantitative des cellules gonadotropes et thyrotropes at different times of the cycle in the controls as well as in operated ducks. Introduction. Les cellules de l proposs d'tablir la typologie des cellules adnohy- pophysaires des espces parentes, et en premier lieu

Boyer, Edmond


Artisolierende Parameter des Revierrufs der Trkentaube (Streptopelia decaocto)  

Microsoft Academic Search

Zusammenfassung Die Analyse der artisolierenden Parameter in den Lautuerungen der Trkentaube (= TT) wurde in zahlreichen Versuchen durch Tonbandvorspiel einer Reihe von Klangattrappen durchgefhrt. Sonagramme des Prahl- und Revierrufes sowie des sog. Girrens werden erstmals verffentlicht und geben eine genaue Analyse dieser Lautuerungen. So zeigte sich z. B. im Gegensatz zum Revierruf ber dem Grundton des Girrens eine Vielzahl von

Wilfried Grtler



Un descripteur efficace pour la reconnaissance des symboles graphiques  

E-print Network

de Sherbrooke J1K 2R1, Sherbrooke (QC), Canada *** Dpt d description et la discrimination des formes planes est l'un des problèmes de la vision par ordinateur et de la d'une part sa grande capacité de discrimination de sorte qu'il puisse grouper des formes similaires

Paris-Sud XI, Université de


Luminescence des ions activateurs dans les matriaux inorganiques et applications  

E-print Network

689 Luminescence des ions activateurs dans les matriaux inorganiques et applications G. Boulon Laboratoire de Physico-Chimie des Matriaux Luminescents, Unit Associe au CNRS n 442, Universit Claude pompage et de l'mission de fluorescence des matriaux inorganiques luminescents et nous donnons la liste

Paris-Sud XI, Universit de


[EEG alpha band coherence analysis in healthy adults: preliminary results].  


We studied the occipital inter-hemispheric coherence of Electroencephalogram (electrodes O1-O2) for alpha band (alpha1--8.0 to 10.0 Hz and alpha2--10.1 to 12.5 Hz) in two groups of healthy individuals (young adults and subjects older than 50 years-old), to assess if there is significant difference between this two age groups. No significant difference in alpha band coherences was found between these two age groups. PMID:15830070

Anghinah, Renato; Caramelli, Paulo; Takahashi, Daniel Yassumasa; Nitrini, Ricardo; Sameshima, Koichi



Processing of tumour necrosis factor-alpha precursor by metalloproteinases  

Microsoft Academic Search

TUMOUR necrosis factor-alpha (TNF-alpha) is a potent pro-inflammatory and immunomodulatory cytokine implicated in inflammatory conditions such as rheumatoid arthritis, Crohn's disease, multiple sclerosis and the cachexia associated with cancer or human immunodeficiency virus infection1. TNF-alpha is initially expressed as a 233-amino-acid membrane-anchored precursor which is proteolytically processed to yield the mature, 157-amino-acid cytokine2. The processing enzyme(s) which cleave TNF-alpha are

A. J. H. Gearing; P. Beckett; M. Christodoulou; M. Churchill; J. Clements; A. H. Davidson; A. H. Drummond; W. A. Galloway; R. Gilbert; J. L. Gordon; T. M. Leber; M. Mangan; K. Miller; P. Nayee; K. Owen; S. Patel; W. Thomas; G. Wells; L. M. Wood; K. Woolley



Structure and stability of oligomer\\/alpha-cyclodextrin inclusion complexes  

Microsoft Academic Search

Cyclomaltohexaose (alpha-cyclodextrin, alpha-CD) can form inclusion complexes (ICs) with polymer molecules in the columnar crystal in which alpha-CD molecules stack to form a molecular tube. Complementary water vapor sorption and wide-angle X-ray diffractomery (WAXD) were performed on oligomer\\/alpha-CD ICs to probe their structures and stabilities. To discern the effect of guest molecule hydrophobicity on water adsorption isotherms, polyethylene glycol (PEG,

Marcus Hunt; Silvia Villar; Marian Gomez; Alan Tonelli; Maury Balik



Enzymatic synthesis of alpha-L-fucosyl-N-acetyllactosamines and 3'-O-alpha-L-fucosyllactose utilizing alpha-L-fucosidases.  


An alpha-L-fucosidase from porcine liver produced alpha-L-Fuc-(1-->2)-beta-D-Gal-(1-->4)-D-GlcNAc (2'-O-alpha-L-fucosyl-N-acetyllactosamine, 1) together with its isomers alpha-L-Fuc-(1-->3)-beta-D-Gal-(1-->4)-D-GlcNAc (2) and alpha-L-Fuc-(1-->6)-beta-D-Gal-(1-->4)-D-GlcNAc (3) through a transglycosylation reaction from p-nitrophenyl alpha-L-fucopyranoside and beta-D-Gal-(1-->4)-D-GlcNAc. The enzyme formed the trisaccharides 1-3 in 13% overall yield based on the donor, and in the ratio of 40:37:23. In contrast, transglycosylation by Alcaligenes sp. alpha-L-fucosidase led to the regioselective synthesis of trisaccharides containing a (1-->3)-linked alpha-L-fucosyl residue. When beta-D-Gal-(1-->4)-D-GlcNAc and lactose were acceptors, the enzyme formed regioselectively compound 2 and alpha-L-Fuc-(1-->3)-beta-D-Gal-(1-->4)-D-Glc (3'-O-alpha-L-fucosyllactose, 4), respectively, in 54 and 34% yields, based on the donor. PMID:10573857

Murata, T; Morimoto, S; Zeng, X; Watanabe, S; Usui, T



Some numerical reslts on best uniform polynomial approximation of. chi. sup. alpha. on (0,1)  

SciTech Connect

Let {alpha} be a positive number, and let E{sub n}(chi{sup {alpha}}; (0,1)) denote the error of best uniform approximation to {chi}{sup {alpha}}, by polynomials of degree at most n, on the interval (0,1). The Russian mathematician S.N. Bernstein established the existence of a nonnegative constant {Beta}({alpha}) such that {Beta}({alpha}):= {sub n{yields}{infinity}lim(2n){sup 2{alpha}}E{sub n}({chi}{sup {alpha}};(0.1)). In addition, Bernstein showed that {Beta}{alpha} < {Gamma}(2{alpha}){vert bar}sin(pi}{alpha}){vert bar}/{pi} ({alpha} > 0) and that {Gamma}(2{alpha}){vert bar}sin({pi}{alpha}){vert bar}/{pi} (1{minus}1/2{alpha}{minus}1) < {Beta}({alpha}) ({alpha} > {1/2}), so that the asymptotic behavior of {Beta}({alpha}) is known when {alpha}{yields}{infinity}. Still, the problem of trying to determine {Beta}({alpha}) more precisely, for all {alpha} > 0, is intriguing. To this end, we have rigorously determined the numbers for thirteen values of {alpha}, where these numbers were calculated with a precision of at least 200 significant digits. For each of these thirteen values of {alpha}, Richardson's extrapolation was applied to the products to obtain estimates of {Beta}({alpha}) to approximately 40 decimal places. Included are graphs of the points ({alpha},{Beta}({alpha})) for the thirteen values of {alpha} that we considered.

Carpenter, A.J.; Varga, R.S.



Intraepitheliale Neoplasien (PanIN) und intraduktale papillr-muzinse Neoplasien (IPMN) des Pankreas als Vorlufer des Pankreaskarzinoms  

Microsoft Academic Search

ZusammenfassungAufgrund der schlechten Prognose des Pankreaskarzinoms waren whrend der letzten Jahre Vorluferlsionen des invasiven Karzinoms Ziel vieler Studien. Als Vorlufer des duktalen Pankreaskarzinoms wurden intraepitheliale Neoplasien (PanIN) beschrieben, welche in unterschiedliche Stadien PanIN-1A, -1B, -2 und -3 unterteilt werden. Ergebnisse molekulargenetischer Untersuchungen untersttzen die Vorstellung eines Progressionsmodells, welches die Entstehung des invasiven Karzinoms aus Lsionen mit niedrigeren Neoplasiegraden

Claudia Ott; Ernst Heinmller; Andreas Gaumann; Jrgen Schlmerich; Frank Klebl



Utilisation des comptences des immigrants sur le march du travail au Canada: Rpercussions de la recherche sur le capital humain  

Microsoft Academic Search

Rsum頠La signification quantitative de la sous-utilisation des qualifications immigres peut tre value, quoique sans prcision,\\u000a dans l'analyse humain-capitale de revenus. Les dficits de revenus des immigrs peuvent surgir de: (a) la qualit immigre\\u000a infrieure de comptence, (b) sous-utilisation des qualifications immigres, et (c) injustices de salaire pour des immigrs\\u000a faisant la mme chose fonctionnent les Canadiens indignesoutenus. Conform aux nombreuses

Jeffrey G. Reitz



ALPHA PHI SIGMA The National Criminal Justice Honor Society  

E-print Network

ALPHA PHI SIGMA The National Criminal Justice Honor Society Copyright 2011 Alpha Phi Sigma, Pi and the profession. Connecting criminal justice majors, faculty, and practitioners together. Great Leadership Sigma- Pi Delta Chapter? Alpha Phi Sigma is the national hon- or society for criminal justice ma- jors

Carter, John


Prostate Cancer Prevention with 5 Alpha-Reductase Inhibitors  

Microsoft Academic Search

\\u000a Testosterone gets converted into the more potent 5-[alpha]-dihydrotestosterone by 5-[alpha]- reductase. dihydrotestosterone\\u000a (DHT) controls prostate mitotic activity and potentially prostate carcinogenesis. Interventions that inhibit 5-[alpha]-reductase\\u000a have potential as preventive agents for prostate cancer.

Dipen J. Parekh


Simultaneous EEG and fMRI of the alpha rhythm  

Microsoft Academic Search

The alpha rhythm in the EEG is 8-12 Hz activity present when a subject is awake with eyes closed. In this study, we used simultaneous EEG and fMRI to make maps of regions whose MRI signal changed reliably with modulation in posterior alpha activity. We scanned 11 subjects as they rested with eyes closed. We found that increased alpha power

Robin I. Goldman; John M. Stern; Jerome Engel Jr; Mark S. Cohen; Jr. J. Engel



Bayesian Statistical Inference for Coefficient Alpha. ACT Research Report Series.  

ERIC Educational Resources Information Center

Coefficient alpha is a simple and very useful index of test reliability that is widely used in educational and psychological measurement. Classical statistical inference for coefficient alpha is well developed. This paper presents two methods for Bayesian statistical inference for a single sample alpha coefficient. An approximate analytic method

Li, Jun Corser; Woodruff, David J.


The serotonin aldehyde, 5-HIAL, oligomerizes alpha-synuclein.  


In Parkinson's disease (PD) alpha-synuclein oligomers are thought to be pathogenic, and 3,4-dihydroxyphenylacetaldehyde (DOPAL), an obligate aldehyde intermediate in neuronal dopamine metabolism, potently oligomerizes alpha-synuclein. PD involves alpha-synuclein deposition in brainstem raphe nuclei; however, whether 5-hydroxyindoleacetaldehyde (5-HIAL), the aldehyde of serotonin, oligomerizes alpha-synuclein has been unknown. In this study we tested whether 5-HIAL oligomerizes alpha-synuclein in vitro and in PC12 cells conditionally over-expressing alpha-synuclein. Alpha-synuclein oligomers were quantified by western blotting after incubation of alpha-synuclein with serotonin and monoamine oxidase-A (MAO-A) to generate 5-HIAL or dopamine to generate DOPAL. Oligomerization of alpha-synuclein in PC12 cells over-expressing the protein was compared between vehicle-treated cells and cells incubated with levodopa to generate DOPAL or 5-hydroxytryptophan to generate 5-HIAL. Monoamine aldehyde mediation of the oligomerization was assessed using the MAO inhibitor, pargyline. Dopamine and serotonin incubated with MAO-A both strongly oligomerized alpha-synuclein (more than 10 times control); pargyline blocked the oligomerization. In synuclein overexpressing PC12 cells, levodopa and 5-hydroxytryptophan elicited pargyline-sensitive alpha-synuclein oligomerization. 5-HIAL oligomerizes alpha-synuclein both in vitro and in synuclein-overexpressing PC12 cells, in a manner similar to DOPAL. The findings may help explain loss of serotonergic neurons in PD. PMID:25637699

Jinsmaa, Yunden; Cooney, Adele; Sullivan, Patricia; Sharabi, Yehonatan; Goldstein, David S



Hematotoxic effects of 3,5-dinitro-4-chloro-alpha,alpha,alpha-trifluorotoluene, a water contaminant  

SciTech Connect

Three short-term studies of 7, 14, and 21 days, respectively, were made to investigate the nature of the anemia induced in rats by 3,5-dinitro-4-chloro-alpha,alpha,alpha-trifluorotoluene (DNCTT). This compound is an intermediate in the synthesis of dinitroaniline herbicides and was detected as a contaminant of a water-bearing stratum in northern Italy. DNCTT was mixed in a powdered rodent diet at a level of 2000 ppm and administered to Wistar-derived rats. DNCTT was shown to produce a hemolytic anemia of rapid onset; packed cell volume and hemoglobin concentration were decreased at all three treatment periods. Methemoglobin and reticulocyte count were increased in all the treated groups. The relative organ weights of the spleen and the liver were increased compared to those of the control groups. Spleen enlargement was also evident at the macroscopic examination, whereas the liver appearance was normal. Pearl's Prussian blue staining performed on the spleen and liver was highly positive in the spleen of treated rats, but no iron deposition was detected in the liver of treated rats.

Guastadisegni, C.; Hall, D.; Macri, A.



Astrophysical analysis of the measurement of (alpha,gamma) and (alpha,n) cross sections of 169Tm  

E-print Network

Reaction cross sections of 169Tm(alpha,gamma)173Lu and 169Tm(alpha,n)172Lu have been measured in the energy range 12.6ray counting. Improved shielding allowed to measure the (alpha,gamma) to lower energy than previously possible. The combination of (alpha,gamma) and (alpha,n) data made it possible to study the energy dependence of the alpha width. While absolute value and energy dependence are perfectly reproduced by theory at energies above 14 MeV, the observed change in energy dependence at energies below 14 MeV requires a modification of the predicted alpha width. Using an effective, energy-dependent, local optical alpha+nucleus potential it is possible to reproduce the data but the astrophysical rate is still not well constrained at gamma-process temperatures. The additional uncertainty stemming from a possible modification of the compound formation cross section i...

Rauscher, T; Sccs, T; Flp, Zs; Frhlich, C; Gyrky, Gy; Halsz, Z; Kertsz, Zs; Somorjai, E



Temps d'accs aux quipements au sein des bassins de vie des bourgs et petites villes  

Microsoft Academic Search

[fre] Hors des grandes agglomrations et de leur priphrie, la vie des Franais s'organise au sein de 1 745 bassins de vie anims par un bourg ou une petite ville. La population y trouve, des degrs divers, les emplois et les services ncessaires la vie courante. Entre 1980 et 1998, alors que les services publics se maintiennent sur

Mohamed Hilal



Les sous-units glutnines de haut poids mol-culaire des bls tendres et des bls durs cultivs  

E-print Network

cours des 20 dernires annes. Mots cls additionnels : Triticum aestivum, Triticum durum, protines the last 20 years. Additional key words : Triticum aestivum, Triticum durum, proteins, polymorphism ( Triticum aestivum) et des bls durs (T. durum) sont formes de 2 classes dfinies notamment par des

Paris-Sud XI, Universit de


The tryptophan synthase alpha 2 beta 2 complex. Cleavage of a flexible loop in the alpha subunit alters allosteric properties.  


This study explores the catalytic and allosteric roles of a flexible loop in tryptophan synthase. Trypsin is known to cleave the tryptophan synthase alpha 2 beta 2 complex in an alpha subunit loop at Arg-188. Cleavage yields an active "nicked" alpha 2 beta 2 derivative. The new results provide evidence that the alpha subunit loop serves two important roles: substrate binding and communicating the effects of substrate binding to the beta subunit. A role for the loop in substrate binding is supported by our finding that addition of a substrate analogue of the alpha subunit, alpha-glycerol 3-phosphate, decreases the rate of cleavage by trypsin. An allosteric role for the loop is supported by the finding although the native alpha 2 beta 2 complex is strongly inhibited by alpha-glycerol 3-phosphate, the nicked alpha 2 beta 2 complex is desensitized to this inhibition. The time course of proteolysis in the presence and absence of alpha-glycerol 3-phosphate is followed by sodium dodecyl sulfate-gel electrophoresis and by assays of activity in the presence and absence of alpha-glycerol 3-phosphate. We use spectroscopic measurements of the pyridoxal phosphate-L-tryptophan intermediates at the active site of the beta subunit to determine the affinity of the native and nicked enzymes for L-tryptophan and alpha-glycerol 3-phosphate. Although cleavage alters the equilibrium distribution of intermediates and reduces the affinity for alpha-glycerol 3-phosphate, it has little effect on the affinity for amino acids bound to the beta subunit. We conclude that the loop in the alpha subunit is important for ligand binding and for communicating the effects of ligand binding from the alpha subunit to the beta subunit in the alpha 2 beta 2 complex. PMID:1904055

Miles, E W



Neuromodulation des racines sacres : revue de littrature  

Microsoft Academic Search

Rsum頠La neuromodulation des racines sacres est une technique mini-invasive, qui consiste en limplantation dune lectrode au\\u000a contact de la troisime racine sacre, permettant une stimulation lectrique continue. Elle peut tre propose comme traitement\\u000a de deuxime ligne, aprs chec des traitements mdicamenteux et de la rducation, en cas dhyperactivit vsicale (pollakiurie\\u000a et\\/ou urgenturie) avec ou sans incontinence, de rtention urinaire sans

A. Even-Schneider; A. Schnitzler; E. Chartier-Kastler; P. Denys



Tape Management La Gestion des Volumes  

E-print Network

TMS Centre de Calcul de l¢IN2P3 28 novembre 1994 #12; TMS Préface La version originelle de TMS a été¢IN2P3. L¢équipe ²TMS² de l¢IN2P3, à l¢origine, était composée des ingénieurs suivants des équipes octobre 91. Le developpement de TMS. ii #12; TMS Résumé Le manuel utilisateur de TMS (Tape Management


Alpha-induced reactions in iridium  

SciTech Connect

The excitation function of ({alpha},{ital xn}) reactions on {sup 191}Ir (abundance 37.3%) and on {sup 193}Ir (abundance 62.7%) has been measured for the 17--55 MeV alpha-particle bombarding energy range. The stacked foil activation technique and {gamma}-ray spectroscopy were used to determine the cross sections. The experimental data were compared with calculated values obtained by means of a geometry-dependent hybrid model. The initial exciton number {ital n}{sub 0}=4 with {ital n}=2, {ital p}=2, and {ital h}=0 gives the best agreements with the presently measured results. To calculate the excitation function theoretically a computer code was used. This set of excitation functions provides a data basis for probing the validity of combined equilibrium and preequilibrium reaction models in a considerable energy range.

Bhardwaj, M.K.; Rizvi, I.A.; Chaubey, A.K. (Department of Physics, Aligarh Muslim University, Aligarh 202 002 (India))



Optical conductivity of alpha-Mn  

NASA Technical Reports Server (NTRS)

The optical constants were measured at room temperature in the photon-energy range 0.6-6.5 eV on evaporated thin films. Evaporation conditions were chosen that gave the alpha-Mn crystal structure with relatively large grains. The optical conductivity was separated into intraband and interband contributions by fitting to the Drude formula at low energies. The results are anomalous in comparison to other 3d transition metals: the free-electron lifetime is exceptionally short (in agreement with the large dc resistivity of Mn), and the interband transitions seem unusually weak at the lower energies. Possible explanations related to the complicated crystal structure of alpha-Mn with its loss of point symmetry at the atom sites are discussed.

Scoles, K. J.; Christy, R. W.



Vascular responses after alpha adrenergic receptor blockade  

PubMed Central

Experiments were done to test the hypothesis that alpha receptor blockers antagonize more effectively venous than arterial responses to norepinephrine in man. Systemic arterial blood pressure, venous pressure in the forearm, blood flow through the forearm, and the volume of the forearm at a venous pressure of 30 mm Hg were measured using pressure transducers and a mercury strain-gauge plethysmograph. Infusions of norepinephrine into the brachial artery reduced forearm blood flow and venous distensibility without changing arterial pressure. After intraarterial infusion of phentolamine the decrease in venous distensibility during administration of norepinephrine was blocked almost completely whereas the decrease in blood flow through the forearm was not altered. The results indicate that alpha adrenergic receptor blockade can antagonize constriction of capacitance vessels more effectively than constriction of resistance vessels. Images PMID:16695931

Abboud, Francois M.; Schmid, Phillip G.; Eckstein, John W.



The Ups and Downs of Alpha Centauri  

NASA Astrophysics Data System (ADS)

Nearby Alpha Centauri is destined for a pivotal chapter in human history, as first stop of future starfarers from Earth: 3x closer than the next nearest star; three very different objects to visit -- Alpha Cen A (G2V), B (K1V), and C (M6V); and B hosts an Earth-mass companion, albeit in a hot, lifeless orbit. For its part, Chandra has been keeping intent watch on the high-energy starspot cycles of AB, with semi-annual pointings over the past decade. Only HRC-I can separate AB as they plunge toward a close approach of 4" in 2016; and LETGS has countered that an abrupt 50x drop in XMM count rate of sun-like A in early 2005, ominously reported as the "darkening of the solar twin," simply is a soft sensitivity issue, not an unprecedented, inexplicable case of corona interrupta.

Ayres, Thomas



Optical conductivity of alpha-Mn  

NASA Technical Reports Server (NTRS)

The optical constants were measured at room temperature in the photon-energy range 0.6 to 6.5 eV on evaporated thin films. Evaporation conditions were chosen that gave the alpha-Mn crystal structure with reasonably large grains. The optical conductivity was separated into intraband and interband contributions by fitting to the Drude formula at low energies. The results are anomalous in comparison to other 3d transition metals. The free-electron lifetime is exceptionally sort (in agreement with the large dc resistivity of Mn), and the interband transitions seem unusually weak at the lower energies. Possible explanations related to the complicated crystal structure of alpha-Mn are discussed.

Scoles, K. J.; Christy, R. W.



Alpha-viscosity effects in slender tori  

E-print Network

We explore effects of the Shakura-Sunyaev alpha-viscosity on the dynamics and oscillations of slender tori. We start with a slow secular evolution of the torus. We show that the angular-momentum profile approaches the Keplerian one on the timescale longer than a dynamical one by a factor of the order of 1/\\alpha. Then we focus our attention on the oscillations of the torus. We discuss effects of various angular momentum distributions. Using a perturbation theory, we have found a rather general result that the high-order acoustic modes are damped by the viscosity, while the high-order inertial modes are enhanced. We calculate a viscous growth rates for the lowest-order modes and show that already lowest-order inertial mode is unstable for less steep angular momentum profiles or very close to the central gravitating object.

Horak, Jiri; Levin, Lina; Slapak, Rikard; Straub, Odele



The Quantum Liquid of Alpha Clusters  

E-print Network

Within the variational approach of Bose liquids we analyze the g.s. energy of charge neutral alpha matter at $T$=0. As a prerequisite for such calculation we take from the literature or propose new $\\alp-\\alp$ potentials that are particularly suitable for this task, i.e. posses a repulsive core and/or reproduce the low energy scattering data and the resonance properties of the $\\alp-\\alp$ system. The alpha matter EOS is then obtained with the HNC method using Pandharipande-Bethe correlation derived variationally in the lowest order expansion of the energy functional or a simple gaussian function with a healing range determined by the normalization of the radial distribution function in the lowest order. We show that saturation is achieved only via repulsive and shallow potentials that are not consistent with the scattering and resonance constraints.

Carstoiu, Florin



The Quantum Liquid of Alpha Clusters  

E-print Network

Within the variational approach of Bose liquids we analyze the g.s. energy of charge neutral alpha matter at $T$=0. As a prerequisite for such calculation we take from the literature or propose new $\\alp-\\alp$ potentials that are particularly suitable for this task, i.e. posses a repulsive core and/or reproduce the low energy scattering data and the resonance properties of the $\\alp-\\alp$ system. The alpha matter EOS is then obtained with the HNC method using Pandharipande-Bethe correlation derived variationally in the lowest order expansion of the energy functional or a simple gaussian function with a healing range determined by the normalization of the radial distribution function in the lowest order. We show that saturation is achieved only via repulsive and shallow potentials that are not consistent with the scattering and resonance constraints.

Florin Carstoiu; Serban Misicu



Low alpha experiments at the ALS  

SciTech Connect

The authors present a modified, low alpha lattice for the Advanced Light Source where the quadrupole field strengths have been detuned to allow the momentum compaction factor to be varied smoothly from positive to negative values. With this low alpha lattice the authors decrease the momentum compaction factor by a factor of 5 to 0.0003 over normal operation resulting in a measured bunch length reduction of 2. They also measure the size the second order momentum compaction factor as well as store beam in a negative momentum compaction lattice. Streak camera measurements at positive and negative momentum compaction operation show longitudinal beam profile distributions that are in agreement with simulations by Fang et al.

Robin, D.; Alvis, R.; Jackson, A. [Lawrence Berkeley Lab., CA (United States); Holtzapple, R.; Podobedov, B. [Stanford Linear Accelerator Center, Menlo Park, CA (United States)



Radioimmunotherapy with alpha-particle-emitting immunoconjugates  

SciTech Connect

Alpha particles are energetic short-range ions whose higher linear energy transfer produces extreme cytotoxicity. An ..cap alpha..-particle-emitting radioimmunoconjugate consisting of a bismuth-212-labeled monoclonal immunoglobulin M specific for the murine T cell/neuroectodermal surface antigen Thy 1.2 was prepared. Analysis in vitro showed that the radioimmunoconjugate was selectively cytotoxic to a Thy 1.2/sup +/ EL-4 murine tumor cell line. Approximately three bismuth-212-labeled immunoconjugates per target cell reduced the uptake of (/sup 3/H)thymidine by the EL-4 target cells to background levels. Mice inoculated intraperitoneally with EL-4 cells were cured of their ascites after intraperitoneal injection of 150 microcuries of the antigen-specific radioimmunoconjugate, suggesting a possible role for such conjugates in intracavitary cancer therapy. 18 references, 3 figures.

Macklis, R.M.; Kinsey, B.M.; Kassis, A.L.; Ferrara, J.L.M.; Atcher, R.W.; Hines, J.J.; Coleman, C.N.; Adelstein, S.J.; Burakoff, S.J.



Automatically processed alpha-track radon monitor  


An automatically processed alpha-track radon monitor is provided which includes a housing having an aperture allowing radon entry, and a filter that excludes the entry of radon daughters into the housing. A flexible track registration material is located within the housing that records alpha-particle emissions from the decay of radon and radon daughters inside the housing. The flexible track registration material is capable of being spliced such that the registration material from a plurality of monitors can be spliced into a single strip to facilitate automatic processing of the registration material from the plurality of monitors. A process for the automatic counting of radon registered by a radon monitor is also provided.

Langner, Jr., G. Harold (Mack, CO)



Automatically processed alpha-track radon monitor  


An automatically processed alpha-track radon monitor is provided which includes a housing having an aperture allowing radon entry, and a filter that excludes the entry of radon daughters into the housing. A flexible track registration material is located within the housing that records alpha-particle emissions from the decay of radon and radon daughters inside the housing. The flexible track registration material is capable of being spliced such that the registration material from a plurality of monitors can be spliced into a single strip to facilitate automatic processing of the registration material from the plurality of monitors. A process for the automatic counting of radon registered by a radon monitor is also provided.

Langner, G.H. Jr.



4-Norleucine, 7-D-phenylalanine-alpha-melanocyte-stimulating hormone: a highly potent alpha-melanotropin with ultralong biological activity.  

PubMed Central

alpha-Melanocyte-stimulating hormone (alpha-MSH) reversibly darkens frog skins by stimulating melanosome movement (dispersion) within melanophores. Heat-alkali treatment of alpha-MSH results in prolonged biological activity of the hormone. Quantitative gas chromatographic analysis of the hydrolyzed heat-alkali-treated peptide revealed partial racemization particularly at the 4(methionine) and 7(phenylalanine) positions. [Nle4]-alpha-MSH, a synthetic analogue of alpha-MSH, reversibly darkens frog skins and also exhibits prolonged activity after heat-alkali treatment. Synthesis of [Nle4, D-Phe7]-alpha-MSH provided an analogue with prolonged biological activity identical to that observed with heat-alkali-treated alpha-MSH or [Nle4]-alpha-MSH. [Nle4, D-Phe7]-alpha-MSH was resistant to enzymatic degradation by serum enzymes. In addition, this peptide exhibited dramatically increased biological activity as determined by frog skin bioassay, activation of mouse melanoma adenylate cyclase, and stimulation of mouse melanoma cell tyrosinase activity. This Nle4, D-Phe7 synthetic analogue of alpha-MSH is a very porent melanotropin, 26 times as potent as alpha-MSH in the adenylate cyclase assay. The resistance of the peptide to enzymatic degradation and its extraordinarily potent and prolonged biological activity should make this analogue of alpha-MSH an important molecular probe for studying the melanotropin receptors of both normal and abnormal (melanoma) melanocytes. PMID:6777774

Sawyer, T K; Sanfilippo, P J; Hruby, V J; Engel, M H; Heward, C B; Burnett, J B; Hadley, M E



Determination of gross alpha, plutonium, neptunium, and\\/or uranium by gross alpha counting on barium sulfate  

Microsoft Academic Search

Procedures are presented for rapid and specific separation of uranium, neptunium, and\\/or plutonium, either singly or sequentially by precipitation with barium sulfate under controlled oxidation conditions in a form suitable for direct ..cap alpha.. counting. If desired, all ..cap alpha.. emitters can be precipitated and counted simultaneously to permit a true gross ..cap alpha.. determination to be made. When isotopic

Claude W. Sill



Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha.  


Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway. PMID:17640976

Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas



Wolfphram|Alpha: a brief introduction.  


On May 18, 2009, British computer scientist Stephen Wolfram officially launched a new search product called Wolfram|Alpha (WA). This launch was preceded by months of speculation and hype online about exactly what WA would be and how it would compare to Google and other search engines. This article will explore the basic features of WA, show some example queries and results, and discuss the usefulness and limitations of this new tool. PMID:20391166

Hoy, Matthew B



Fourth High Alpha Conference, volume 2  

NASA Technical Reports Server (NTRS)

The goal of the Fourth High Alpha Conference, held at the NASA Dryden Flight Research Center on July 12-14, 1994, was to focus on the flight validation of high angle of attack technologies and provide an in-depth review of the latest high angle of attack activities. Areas that were covered include high angle of attack aerodynamics, propulsion and inlet dynamics, thrust vectoring, control laws and handling qualities, and tactical utility.



A rapid alpha-fetoprotein radioimmunoassay.  


A simple, reliable and inexpensive alpha-fetoprotein radioimmunoassay is described, in which polyethylene-glycol (PEG) is used as a precipitating agent of antibody-bound AFP. The concentrations of AFP found in amniotic fluid, newborn and maternal sera are in agreement with those reported by others. This assay fulfills the requirements of a screening test for fetal abnormalities and other clinical applications. PMID:67626

Malavasi, F; Boccazzi, C; Carbonara, A



Five Axioms of Alpha-Conversion  

Microsoft Academic Search

We present v e axioms of name-carrying lambda-terms iden- tied up to alpha-conversion|that is, up to renaming of bound variables. We assume constructors for constants, variables, application and lambda- abstraction. Other constants represent a function Fv that returns the set of free variables in a term and a function that substitutes a term for a variable free in another term.

Andrew D. Gordon; Thomas F. Melham



Diamond detector for alpha-particle spectrometry.  


An artificially grown high purity diamond was used as a detector for alpha-particle spectrometry. Diamond detectors can match the performance of silicon detectors employed in standard continuous air monitoring systems. Its radiation hardness and electronic properties make them ideal to work under extreme condition such as high temperature and ambient lights. A 50 ?m thickness single-crystal diamond detector has been compared with a 300 ?m passivated implanted planar silicon detector, under ambient conditions. PMID:24768983

Dueas, J A; de la Torre Prez, J; Martn Snchez, A; Martel, I



Fourth High Alpha Conference, volume 1  

NASA Technical Reports Server (NTRS)

The goal of the Fourth High Alpha Conference was to focus on the flight validation of high angle-of-attack technologies and provide an in-depth review of the latest high angle-of-attack activities. Areas that were covered include: high angle-of-attack aerodynamics, propulsion and inlet dynamics, thrust vectoring, control laws and handling qualities, tactical utility, and forebody controls.



The Quantum Liquid of Alpha Clusters  

Microsoft Academic Search

Within the variational approach of Bose liquids we analyze the g.s. energy of\\u000acharge neutral alpha matter at $T$=0. As a prerequisite for such calculation we\\u000atake from the literature or propose new $\\\\alp-\\\\alp$ potentials that are\\u000aparticularly suitable for this task, i.e. posses a repulsive core and\\/or\\u000areproduce the low energy scattering data and the resonance properties of the

Florin Carstoiu; Serban Misicu



Skeletal Muscle Alpha-Actin Diseases  

Microsoft Academic Search

Skeletal muscle ?-actin is the principal protein component of the adult skeletal muscle thin filament. The interaction between\\u000a skeletal, muscle ?-actin and the various myosin heavy chain proteins in the different muscle fibre types generates the force\\u000a of muscle contraction. Skeletal muscle ?-alpha actin is thus of fundamental importance to normal muscle contraction. To date\\u000a over 140 different disease-causing mutations

Kathryn N. North; Nigel G. Laing


Permanent magnet system of alpha magnetic spectrometer  

Microsoft Academic Search

Alpha magnetic spectrometer (AMS) is the first large magndtic spectrometer in space. Its precursor flioht was completed successfully\\u000a in June 1998. The key part of AMS is the permanent magnet system, which was built by the lnstitute of Electric Engineering,\\u000a the institute of High Energy Physics and the Chinese Academy of Launch Vehicle Technology. This system includes a permanent\\u000a magnet

Hesheng Chen



Alpha-particle-induced cancer in humans.  


Updated information is given on alpha-particle-induced cancer in persons internally exposed to 222Rn progeny, Thorotrast, long-lived 226Ra and 228Ra, and short-lived 224Ra. The lung cancer risk to persons breathing 222Rn progeny in the indoor air of offices, schools, and homes is of increasing concern. About half of the recent deaths among the German Thorotrast patients have been from liver cancer. Animal studies indicate that the liver cancer risk from Thorotrast is mainly from its radioactivity and that the risk coefficient for the Thorotrast patients can be used provisionally for other alpha emitters in the human liver. Six skeletal cancers have occurred in persons with average skeletal doses between 0.85 and 11.8 Gy from 226Ra and 228Ra. In the low-dose German 224Ra patients, two skeletal sarcomas have occurred at about 0.7 Gy compared to about six cases predicted by results from 224Ra patients at higher doses. The minimal appearance time for radiation-induced bone sarcomas in humans is about 4 y. Following brief irradiation, the vast majority of induced bone sarcomas are expressed by about 30 y. Recent evidence against the "practical threshold" hypothesis is given. With the downward revision of neutron doses to the atomic-bomb survivors, the follow-up of persons exposed to alpha particles may be the best opportunity to evaluate directly the effects of high LET radiation on humans. PMID:2844697

Mays, C W



The Alpha Dynamo Effects in Laboratory Plasmas  

SciTech Connect

A concise review of observations of the alpha dynamo effect in laboratory plasmas is given. Unlike many astrophysical systems, the laboratory pinch plasmas are driven magnetically. When the system is overdriven, the resultant instabilities cause magnetic and flow fields to fluctuate, and their correlation induces electromotive forces along the mean magnetic field. This alpha-effect drives mean parallel electric current, which, in turn, modifies the initial background mean magnetic structure towards the stable regime. This drive-and-relax cycle, or the so-called self-organization process, happens in magnetized plasmas in a timescale much shorter than resistive diffusion time, thus it is a fast and unquenched dynamo process. The observed alpha-effect redistributes magnetic helicity (a measure of twistedness and knottedness of magnetic field lines) but conserves its total value. It can be shown that fast and unquenched dynamos are natural consequences of a driven system where fluctuations are statistically either not stationary in time or not homogeneous in space, or both. Implications to astrophysical phenomena will be discussed.

Hantao Ji; Stewart C. Prager



Alpha Particle Physics Experiments in the Tokamak Fusion Test Reactor  

SciTech Connect

Alpha particle physics experiments were done on the Tokamak Fusion Test Reactor (TFTR) during its deuterium-tritium (DT) run from 1993-1997. These experiments utilized several new alpha particle diagnostics and hundreds of DT discharges to characterize the alpha particle confinement and wave-particle interactions. In general, the results from the alpha particle diagnostics agreed with the classical single-particle confinement model in magnetohydrodynamic (MHD) quiescent discharges. Also, the observed alpha particle interactions with sawteeth, toroidal Alfvn eigenmodes (TAE), and ion cyclotron resonant frequency (ICRF) waves were roughly consistent with theoretical modeling. This paper reviews what was learned and identifies what remains to be understood.

Budny, R.V.; Darrow, D.S.; Medley, S.S.; Nazikian, R.; Zweben, S.J.; et al.



Detection of alpha radiation in a beta radiation field  


An apparatus and method for detecting alpha particles in the presence of high activities of beta particles utilizing an alpha spectrometer. The apparatus of the present invention utilizes a magnetic field applied around the sample in an alpha spectrometer to deflect the beta particles from the sample prior to reaching the detector, thus permitting detection of low concentrations of alpha particles. In the method of the invention, the strength of magnetic field required to adequately deflect the beta particles and permit alpha particle detection is given by an algorithm that controls the field strength as a function of sample beta energy and the distance of the sample to the detector.

Mohagheghi, Amir H. (Albuquerque, NM); Reese, Robert P. (Edgewood, NM)



alpha-[(t-Butylamino)methyl]-4-hydroxy-m-xylene-alpha1, alpha3-diol (AH.3365): a Selective beta-Adrenergic Stimulant  

Microsoft Academic Search

alpha-[(t-Butylaraino)methyl]-4-hydroxy-m-xylene- alpha1, alpha3-diol (AH.3365), one of a new series of beta-adrenergic stimulants described in the preceding communication, when tested on animals has been found to have a considerably greater action on bronchial smooth muscle than on other smooth muscles affected by beta-stimulants. Relative potencies found for AH.3365, isoprenaline and orciprenaline in preventing bronchospasm induced by acetylcholine in guinea-pigs are given

R. T. Brittain; J. B. Farmer; D. Jack; L. E. Martin; W. T. Simpson



Laboratoire de Gologie et Gestion des Ressources Minrales et Energtiques (G2R) Facult des sciences & techniques 54500 Vandoeuvre ls Nancy France  

E-print Network

CARDON Datation Re-Os sur pyrite et traçage des sources des métaux dans des gisements de type porphyre et ubiquiste du système : la pyrite. L'application de cette méthodologie sur les pyrites des minéralisations'ébullition maximale. Une répartition similaire des teneurs en arsenic des pyrites a pu y être observée. Une

Paris-Sud XI, Université de


Biologie des pucerons des crales dans l'Ouest de la France. III. Action des hymnoptres parasites  

E-print Network

parasites sur les populations de Sitobion avenae F., Metopolo- phium dirhodum Wlk. et Rhopalosiphum padi L. Aphidius uzbekistanicus est le principal parasite primaire des 3 pucerons les plus importants ; A. ervi, A'attaquent à ces auxiliaires. Les populations de différents parasites primaires évoluent souvent de façon

Paris-Sud XI, Université de


Globin chain synthesis in the alpha thalassemia syndromes  

PubMed Central

Whole blood samples of patients with various forms of alpha thalassemia including hemoglobin H disease, alpha thalassemia trait, and the silent carrier state were incubated with leucine-14C for definition of relative rates of production of alpha and beta chains in these disorders. The chains were separated by carboxymethyl cellulose chromatography in the presence of 8 M urea and dithiothreitol. Their absorptions at 280 m? were determined and their radioactivities measured in a liquid scintillation spectrometer. After correction for differences in extinction coefficients, the specific activities of the widely separated alpha and beta peaks were determined. In 11 nonthalassemic individuals, the alpha/beta specific activity ratios were found to be 1.020.07; in nine patients with alpha thalassemia trait, 0.770.05; in six patients with hemoglobin H disease, 0.410.11; and in four silent carriers, 0.88 with a range of 0.82-0.95. The results show that in peripheral blood, alpha chain production relative to beta chain production is indeed limited in the alpha thalassemia syndromes. Hemoglobin H disease results from doubly heterozygous inheritance of a gene resulting in moderate depression of alpha chain production (alpha thalassemia trait) and a gene resulting in very mild depression of alpha chain production (the silent carrier syndrome. PMID:5775343

Kan, Yuet Wai; Schwartz, Elias; Nathan, David G.



Functional and Genomic Analyses of Alpha-Solenoid Proteins  

PubMed Central

Alpha-solenoids are flexible protein structural domains formed by ensembles of alpha-helical repeats (Armadillo and HEAT repeats among others). While homology can be used to detect many of these repeats, some alpha-solenoids have very little sequence homology to proteins of known structure and we expect that many remain undetected. We previously developed a method for detection of alpha-helical repeats based on a neural network trained on a dataset of protein structures. Here we improved the detection algorithm and updated the training dataset using recently solved structures of alpha-solenoids. Unexpectedly, we identified occurrences of alpha-solenoids in solved protein structures that escaped attention, for example within the core of the catalytic subunit of PI3KC. Our results expand the current set of known alpha-solenoids. Application of our tool to the protein universe allowed us to detect their significant enrichment in proteins interacting with many proteins, confirming that alpha-solenoids are generally involved in protein-protein interactions. We then studied the taxonomic distribution of alpha-solenoids to discuss an evolutionary scenario for the emergence of this type of domain, speculating that alpha-solenoids have emerged in multiple taxa in independent events by convergent evolution. We observe a higher rate of alpha-solenoids in eukaryotic genomes and in some prokaryotic families, such as Cyanobacteria and Planctomycetes, which could be associated to increased cellular complexity. The method is available at PMID:24278209

Fournier, David; Palidwor, Gareth A.; Shcherbinin, Sergey; Szengel, Angelika; Schaefer, Martin H.; Perez-Iratxeta, Carol; Andrade-Navarro, Miguel A.



Stabilising normal and mis-sense variant alpha-glucosidase.  


alpha-Glucosidase (EC is a lysosomal enzyme that hydrolyses alpha-1,4- and alpha-1,6-linkages of glycogen to produce free glucose. A deficiency in alpha-glucosidase activity results in glycogen storage disorder type II (GSD II), also called Pompe disease. Here, d-glucose was shown to be a competitive inhibitor of alpha-glucosidase and when added to culture medium at 6.0 g/L increased the production of this protein by CHO-K1 expression cells and stabilised the enzyme activity. D-Glucose also prevented alpha-glucosidase aggregation/precipitation and increased protein yield in a modified purification scheme. In fibroblast cells, from adult-onset GSD II patients, D-glucose increased the residual level of alpha-glucosidase activity, suggesting that a structural analogue of d-glucose may be used for enzyme enhancement therapy. PMID:16846599

Kakavanos, Revecca; Hopwood, John J; Lang, Debbie; Meikle, Peter J; Brooks, Doug A
