Sample records for des emetteurs alpha

  1. Des-gamma-carboxy Prothrombin and Alpha fetoprotein as Biomarkers for the Early Detection of Hepatocellular Carcinoma

    PubMed Central

    Lok, Anna S.; Sterling, Richard K.; Everhart, James E.; Wright, Elizabeth C.; Hoefs, John C.; Di Bisceglie, Adrian M.; Morgan, Timothy R.; Kim, Hae-Young; Lee, William M.; Bonkovsky, Herbert L.; Dienstag, Jules L.

    2009-01-01

    Background and Aims: The outcome of patients with hepatocellular carcinoma (HCC) remains poor because of late diagnosis. The aim of this study was to compare the accuracy of alpha fetoprotein (AFP) and des-gamma-carboxy prothrombin (DCP) in the early diagnosis of HCC. Methods: Among 1031 patients randomized in the Hepatitis C Antiviral Long-Term Treatment against Cirrhosis (HALT-C) Trial, a nested case-control study of 39 HCC cases (24 early stage) and 77 matched controls was conducted to compare the performance of AFP and DCP. Testing was performed on sera from 12 months prior (month ?12) to the time of HCC diagnosis (month 0). Results: The sensitivity and specificity of DCP at month 0 was 74% and 86% at a cutoff of 40 mAU/mL and 43% and 100% at a cutoff of 150 mAU/mL. The sensitivity and specificity of AFP at month 0 was 61% and 81% at a cutoff of 20 ng/mL and 22% and 100% at a cutoff of 200 ng/mL. At month ?12, the sensitivity and specificity at the low cutoff was 43% and 94% for DCP and 47% and 75% for AFP. Combining both markers increased the sensitivity to 91% at month 0 and 73% at month 12 but the specificity decreased to 74% and 71%. Diagnosis of early HCC was triggered by surveillance ultrasound in 14, doubling of AFP in 5 and combination of tests in 5 patients. Conclusions: Biomarkers are needed to complement ultrasound in the detection of early HCC but neither DCP nor AFP is optimal. PMID:19852963

  2. PARCOURS DES ALPHA DE 4,5 MeV DANS L'URANIUM, L'OR, LE ZIRCONIUM ET LE SILICIUM. Par Mmes A. GARIN et H. FARAGGI,

    E-print Network

    Paris-Sud XI, Université de

    uranium alloys of known concentration in uranium it is possible to measure the range of 4,5 MeV 03B176. PARCOURS DES ALPHA DE 4,5 MeV DANS L'URANIUM, L'OR, LE ZIRCONIUM ET LE SILICIUM. Par Mmes A mesurant l'émission oc d'alliages d'uranium de différentes concentrations. Nous avons pu disposer d

  3. Sur la nature des absorbeurs dans l'interpretation transactionnelle de la mecanique quantique

    NASA Astrophysics Data System (ADS)

    Boisvert, Jean-Sebastien

    L'interpretation transactionnelle de la mecanique quantique est l'une des plus recentes propositions de description des phenomenes du microcosme. En accord avec les predictions de la mecanique quantique standard, l'interpretation transactionnelle propose une alternative a celle de Copenhague. Son principal avantage est qu'elle permet de visualiser les mecanismes sous-jacents a l'echange d'energie, de quantite de mouvement ou d'autres quantites quantiques entre un emetteur et un absorbeur. Ces echanges sont le resultat, a l'instar de la theorie de l'absorbeur de Wheeler et Feynman, de l'utilisation autant d'ondes avancees que retardees. Bien que l'interpretation transactionnelle n'ait pas attire la plus grande attention scientifique, plusieurs critiques lui ont ete adressees. Dans les annees 1990, differentes experiences a mesure sans interaction ont ete concues. Depuis, il a ete avance que la version originale de l'interpretation transactionnelle pouvait difficilement rendre compte de ce type d'experience et meme qu'elle n'est pas compatible avec le concept d'univers quadridimensionnel. La recherche de ce memoire par article consiste a montrer que lorsque l'on utilise systematiquement l'interpretation transactionnelle en considerant la configuration totale des absorbeurs (incluant l'absorbeur universel), il n'est pas necessaire de faire appel a une hierarchie de transactions comme certains l'ont propose.

  4. Alpha Thalassemia

    MedlinePLUS

    ... the anemia. Normal alpha globin genes found on chromosome 16 People who do not produce enough alpha ... by four genes, two on each strand of chromosome 16. Individuals who have one or two abnormal ...

  5. Alpha Particle

    Microsoft Academic Search

    P. Murdin

    2000-01-01

    Term that is sometimes used to describe a helium nucleus, a positively charged particle that consists of two protons and two neutrons, bound together. Alpha particles, which were discovered by Ernest Rutherford (1871-1937) in 1898, are emitted by atomic nuclei that are undergoing alpha radioactivity. During this process, an unstable heavy nucleus spontaneously emits an alpha particle and transmut...

  6. ALPHA OMEGA ALPHA National Honor Medical Society

    E-print Network

    12/7/2011 1 ALPHA OMEGA ALPHA National Honor Medical Society www.alphaomegaalpha.org AA and Leadership William Root The Alpha Omega Alpha honor medical society was initially organized in 1902/community service. AA and Medical Professionalism "Be Worthy to Serve the Suffering" #12;Alpha Omega Alpha Honor

  7. ALPHA OMEGA ALPHA National Honor Medical Society

    E-print Network

    12/6/2012 1 ALPHA OMEGA ALPHA National Honor Medical Society www.alphaomegaalpha.org AA and Leadership The Alpha Omega Alpha honor medical society was organized in 1902 to "recognize and perpetuate Omega Alpha Honor Medical Society Wisconsin beta Chapter All upcoming MCW seniors who are interested

  8. Alpha-1 Antitrypsin Deficiency

    MedlinePLUS

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  9. The $\\alpha-\\alpha$ fishbone potential revisited

    E-print Network

    Day, J P; Elhanafy, M; Smith, E; Woodhouse, R; Papp, Z

    2011-01-01

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the $\\alpha-\\alpha$ fishbone potential by simultaneously fitting to two-$\\alpha$ resonance energies, experimental phase shifts and three-$\\alpha$ binding energies. We found that essentially a simple gaussian can provide a good description of two-$\\alpha$ and three-$\\alpha$ experimental data without invoking three-body potentials.

  10. Alpha One Foundation

    MedlinePLUS

    ... Support Find Doctor 20th Anniversary What Is Alpha-1? Alpha-1 Antitrypsin Deficiency (Alpha-1) is a ... daily treatment for COPD More News Our Number One Goal: Find a cure for Alpha-1. Website ...

  11. Alpha-1 Antitrypsin Deficiency

    MedlinePLUS

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  12. Ab initio alpha-alpha scattering

    E-print Network

    Serdar Elhatisari; Dean Lee; Gautam Rupak; Evgeny Epelbaum; Hermann Krebs; Timo A. Lähde; Thomas Luu; Ulf-G. Meißner

    2015-06-11

    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  13. Ab initio alpha-alpha scattering

    E-print Network

    Elhatisari, Serdar; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-01-01

    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  14. Phenyl-/alpha/,/alpha/,/omega/-trihydropolyfluoroalkyliodonium fluoroborates

    SciTech Connect

    Mironova, A.A.; Soloshonok, I.V.; Maletina, I.I.; Orda, V.V.; Yagupol'skii, L.M.

    1988-08-20

    The reaction of difluoroiodo-/alpha/,/alpha/,/omega/-trihydrofluoroalkanes (I) with boron trifluoride and benzene gave phenyl-/alpha/,/alpha/,/omega/-trihydropolyfluoroalkyliodonium fluoroborates (II). It was established that the polyfluoroalkyl radical adds at the sulfur atom in reaction with p-chlorothiophenol, the N-polyfluoroalkylation product is formed with aniline, pyridine is polyfluoroalkylated at the nitrogen atom with the formation of a quaternary salt, and a mixture of products from polyfluoroalkylation at the nitrogen atom of the dimethylamino group and at the para position of the benzene ring is formed with dimethylaniline.

  15. Sociologie des prenoms... des chiens Baptiste Coulmont

    E-print Network

    Paris-Sud XI, Université de

    Sociologie des pr´enoms... des chiens Baptiste Coulmont 23 septembre 2011 Introduction L'´etude de donn´ees concernant plus de 10 millions de chiens (ann´ee de naissance, pr´enom, d´epartement de naissance, race), nous donne les infor- mations suivantes : 1. Les pr´enoms des chiens suivent des modes sp

  16. Des Moines.

    ERIC Educational Resources Information Center

    Gore, Deborah, Ed.

    1988-01-01

    This document, intended for elementary students, contains articles and activities designed to acquaint young people with the history of Des Moines, Iowa. The articles are short, and new or difficult words are highlighted and defined for young readers. "The Raccoon River Indian Agency" discusses the archeological exploration of the indian…

  17. LA REVUE DE L'EPI N 77 DES IMAGES, DES TROUS ET DES BOSSES DES IMAGES, DES TROUS ET DES BOSSES...

    E-print Network

    Paris-Sud XI, Université de

    images (fixes, car pour les images animées c'est encore une autre histoire, au format ".PCX", 320x200 en 256 couleurs). Qu'allons nous en faire ? Les idées ne manquent pas, car une fois numérisée l'image131 LA REVUE DE L'EPI N° 77 DES IMAGES, DES TROUS ET DES BOSSES DES IMAGES, DES TROUS ET DES BOSSES

  18. Event counting alpha detector

    DOEpatents

    Bolton, Richard D. (Los Alamos, NM); MacArthur, Duncan W. (Los Alamos, NM)

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  19. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  20. Reexamination of the {alpha}-{alpha}''fishbone'' potential

    SciTech Connect

    Day, J. P.; McEwen, J. E.; Elhanafy, M.; Smith, E.; Woodhouse, R.; Papp, Z. [Department of Physics and Astronomy, California State University Long Beach, Long Beach, California (United States)

    2011-09-15

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the {alpha}-{alpha} fishbone potential by simultaneously fitting to two-{alpha} resonance energies, experimental phase shifts, and three-{alpha} binding energies. We found that, essentially, a simple Gaussian can provide a good description of two-{alpha} and three-{alpha} experimental data without invoking three-body potentials.

  1. Facult des arts et des sciences Dpartement de communication

    E-print Network

    Parrott, Lael

    Faculté des arts et des sciences Département de communication Plans de cours cadre Cours des programmes de premier cycle en sciences de la communication Comité des études de premier cycle Adopté par l..................................................................................................................................3 COM 1150 Rédaction en communication 1

  2. Learning about Alpha-1 Antitrypsin Deficiency (AATD)

    MedlinePLUS

    ... terms used on this page Learning About Alpha-1 Antitrypsin Deficiency (AATD) What is alpha-1 antitrypsin ... for Alpha-1 Anttrypsin Deficiency What is alpha-1 antitrypsin defciency? Alpha-1 antitrypsin deficiency (AATD) is ...

  3. Archives participatives Au milieu des ralisations remarquables de mdiation numrique des bibliothques et des

    E-print Network

    Paris-Sud XI, Université de

    Archives participatives Au milieu des réalisations remarquables de médiation numérique des bibliothèques et des musées sur les médias sociaux, les services d'archives ont un positionnement relativement en revanche des projets ambitieux de crowdsourcing, d'« archives participatives » (voir encart

  4. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. (a) Chemical substance...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  5. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. (a) Chemical substance...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  6. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. (a) Chemical substance...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  7. Structure des ADN complmentaires des lactoprotines : application la recherche des gnes et leur localisation chromosomique

    E-print Network

    Paris-Sud XI, Université de

    Structure des ADN complémentaires des lactoprotéines : application à la recherche des gènes et à entrepris. 1) Construction de banques ovine et bovine d ADN complémentaires !ADNcJ. Sélection et identification des clones recombinants contenant les ADN complé- mentaires des ARNm des 6 principales

  8. Diethylstilbestrol (DES) and Cancer

    MedlinePLUS

    ... idiopathic thrombocytopenia purpura between DES-exposed and unexposed women ( 10 ). Studies examining the risk of depression among DES daughters ... statistically significant. Researchers will continue to follow these women to study the risk of infertility. Recent studies have found ...

  9. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  10. Varying-{alpha} monopoles

    SciTech Connect

    Menezes, J.; Avelino, P.P.; Santos, C. [Centro de Fisica do Porto e Departamento de Fisica da Faculdade de Ciencias da Universidade do Porto, Rua do Campo Alegre 687, 4169-007, Porto (Portugal)

    2005-11-15

    We study static magnetic monopoles in the context of varying-{alpha} theories and show that there is a group of models for which the 't Hooft-Polyakov solution is still valid. Nevertheless, in general static magnetic monopole solutions in varying-{alpha} theories depart from the classical 't Hooft-Polyakov solution with the electromagnetic energy concentrated inside the core seeding spatial variations of the fine-structure constant. We show that Equivalence Principle constraints impose tight limits on the allowed variations of {alpha} induced by magnetic monopoles which confirms the difficulty to generate significant spatial variation of the fine-structure constant found in previous works. This is true even in the most favorable case where magnetic monopoles are the source for these variations.

  11. Doubled \\alpha'-Geometry

    E-print Network

    Hohm, Olaf; Zwiebach, Barton

    2014-01-01

    We develop doubled-coordinate field theory to determine the \\alpha' corrections to the massless sector of oriented bosonic closed string theory. Our key tool is a string current algebra of free left-handed bosons that makes O(D,D) T-duality manifest. While T-dualities are unchanged, diffeomorphisms and b-field gauge transformations receive corrections, with a gauge algebra given by an \\alpha'-deformation of the duality-covariantized Courant bracket. The action is cubic in a double metric field, an unconstrained extension of the generalized metric that encodes the gravitational fields. Our approach provides a consistent truncation of string theory to massless fields with corrections that close at finite order in \\alpha'.

  12. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  13. Linguistique Des mots et Des hommes

    E-print Network

    Loewith, Robbie

    'applique en cas de conclusion d'un nouveau contrat ou de renouvellement de contrat pour un abonnement Orange éclairage nouveau. Des rubriques variées vous attendent, sur l'activité des chercheurs dans et hors les murs témoigne de cette catastrophe 6 Histoire de l'art A partir d'une vingtaine de toiles dont certains éléments

  14. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  15. Alpha Antihydrogen Experiment

    NASA Astrophysics Data System (ADS)

    Fujiwara, M. C.; Andresen, G. B.; Ashkezari, M. D.; Baquero-Ruiz, M.; Bertsche, W.; Bray, C. C.; Butler, E.; Cesar, C. L.; Chapman, S.; Charlton, M.; Cesar, C. L.; Fajans, J.; Friesen, T.; Gill, D. R.; Hangst, J. S.; Hardy, W. N.; Hayano, R. S.; Hayden, M. E.; Humphries, A. J.; Hydomako, R.; Jonsell, S.; Kurchaninov, L.; Lambo, R.; Madsen, N.; Menary, S.; Nolan, P.; Olchanski, K.; Olin, A.; Povilus, A.; Pusa, P.; Robicheaux, F.; Sarid, E.; Silveira, D. M.; So, C.; Storey, J. W.; Thompson, R. I.; van der Werf, D. P.; Wilding, D.; Wurtele, J. S.; Yamazaki, Y.

    2011-12-01

    ALPHA is an experiment at CERN, whose ultimate goal is to perform a precise test of CPT symmetry with trapped antihydrogen atoms. After reviewing the motivations, we discuss our recent progress toward the initial goal of stable trapping of antihydrogen, with some emphasis on particle detection techniques.

  16. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  17. [alpha-Neurotoxins and alpha-conotoxins--nicotinic cholinoreceptor blockers].

    PubMed

    Utkin, Iu N; Kasheverov, I E; Tsetlin, V I

    1999-11-01

    The review is devoted to the competitive blockers of different nicotinic acetylcholine receptors, alpha-neurotoxins from snake venoms, and alpha-conotoxins from marine snails of the Conidae family. The relationship between the structure and function of these toxins is discussed. Recent data on the mechanism of alpha-neurotoxin and alpha-conotoxin interaction with the nicotinic acetylcholine receptor are presented. PMID:10645484

  18. SURVEILLANCE ET CONTROLE DES ACTIVITES DES NAVIRES EN MER

    E-print Network

    Paris-Sud XI, Université de

    1 SURVEILLANCE ET CONTROLE DES ACTIVITES DES NAVIRES EN MER ScanMaris Michel MOREL (DCNS), Aldo administrations en mer. Toutefois, ils ne recueillent des informations que pour des zones maritimes ou des permanente, un recueil massif de données permettant de mieux gérer les situations en mer et les interventions

  19. ChemTeacher: Alpha Decay

    NSDL National Science Digital Library

    2011-01-01

    ChemTeacher compiles background information, videos, articles, demonstrations, worksheets and activities for high school teachers to use in their classrooms. The Alpha Decay page includes resources for teaching students about the discovery and applications of alpha decay.

  20. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  1. Triangle des vitesses Failles transformantes

    E-print Network

    Grigné, Cécile

    Triangle des vitesses ab Failles transformantes A B A B TD - UE Terre Profonde #12;Triangle des vitesses ab A B Dorsales A B TD - UE Terre Profonde #12;Triangle des vitesses ab B A B A Subduction TD - UE Terre Profonde #12;Triangle des vitesses B A A B C C TD - UE Terre Profonde #12;Triangle des vitesses B

  2. PGC-1alpha: turbocharging mitochondria.

    PubMed

    Houten, Sander M; Auwerx, Johan

    2004-10-01

    PGC-1alpha plays essential and diverse functions in the control of metabolism ranging from mitochondrial biogenesis and respiration to hepatic gluconeogenesis and muscle fiber-type switching. In a paper in this issue of Cell, the characterization of PGC-1alpha(-/-) mice illustrates these pleiotropic functions and reveals an unexpected role for PGC-1alpha in the brain. PMID:15454076

  3. CULTURE DES VIVRIERS. COMBINAISON DES SAVOIRS LOCAUX ET MODERNES. ANTHROPOLOGIE COMME CONSTRUCTION DES PONTS CULTURELS

    E-print Network

    Boyer, Edmond

    DES PONTS CULTURELS BAÏNILAGO L. ISDA 2010, Montpellier 28-30 Juin 2010 CULTURE DES VIVRIERS. COMBINAISON DES SAVOIRS LOCAUX ET MODERNES:ANTHROPOLOGIE COMME CONSTRUCTION DES PONTS CULTURELS LOUIS'anthropologie, construction des ponts culturels ABSTRACT : This paper tries to criticize the radical opposition established

  4. Expression des constantes de distorsion centrifuge des hexafluorures en fonction des frquences harmoniques.

    E-print Network

    Paris-Sud XI, Université de

    L-55 Expression des constantes de distorsion centrifuge des hexafluorures en fonction des de distorsion centrifuge des molécules XY6 en fonc- tion des fréquences harmoniques ; l for the centrifugal distortion constants as a function of harmonic frequencies ; application is made to SF6 and UF6. 4

  5. Médecine des voyages

    PubMed Central

    Aw, Brian; Boraston, Suni; Botten, David; Cherniwchan, Darin; Fazal, Hyder; Kelton, Timothy; Libman, Michael; Saldanha, Colin; Scappatura, Philip; Stowe, Brian

    2014-01-01

    Résumé Objectif Définir la pratique de la médecine des voyages, présenter les éléments fondamentaux d’une consultation complète préalable aux voyages à des voyageurs internationaux et aider à identifier les patients qu’il vaudrait mieux envoyer en consultation auprès de professionnels de la médecine des voyages. Sources des données Les lignes directrices et les recommandations sur la médecine des voyages et les maladies liées aux voyages publiées par les autorités sanitaires nationales et internationales ont fait l’objet d’un examen. Une recension des ouvrages connexes dans MEDLINE et EMBASE a aussi été effectuée. Message principal La médecine des voyages est une spécialité très dynamique qui se concentre sur les soins préventifs avant un voyage. Une évaluation exhaustive du risque pour chaque voyageur est essentielle pour mesurer avec exactitude les risques particuliers au voyageur, à son itinéraire et à sa destination et pour offrir des conseils sur les interventions les plus appropriées en gestion du risque afin de promouvoir la santé et prévenir les problèmes médicaux indésirables durant le voyage. Des vaccins peuvent aussi être nécessaires et doivent être personnalisés en fonction des antécédents d’immunisation du voyageur, de son itinéraire et du temps qu’il reste avant son départ. Conclusion La santé et la sécurité d’un voyageur dépendent du degré d’expertise du médecin qui offre le counseling préalable à son voyage et les vaccins, au besoin. On recommande à ceux qui donnent des conseils aux voyageurs d’être conscients de l’ampleur de cette responsabilité et de demander si possible une consultation auprès de professionnels de la médecine des voyages pour tous les voyageurs à risque élevé.

  6. Amputation des quatre membres

    PubMed Central

    Feruzi, Maruis Kitembo; Milindi, Cédrick Sangwa; Zabibu, Mireille Kakinga; Mulefu, Jules Panda; Katombe, Francois Tshilombo

    2014-01-01

    Les auteurs présentent les cas d'amputation des quatre membres réalisée chez trois patients différents. Ce sont des amputations réalisées pour chaque patient au cours d'une seule hospitalisation et en un seul temps opératoire. Deux patients pour gangrène sèche infectée et un pour amputation traumatique des quatre membres. L'amputation d'urgence a été pratiquée en premier temps suivie de remodelage des moignons d'amputation en second temps. L’évolution de tous les patients a été bonne. PMID:25469177

  7. Klinische Wertbestimmung des Convallatoxins

    Microsoft Academic Search

    Bruno Weicker

    1932-01-01

    Zusammenfassung Untersuchungen über die pharmakologische und klinische Auswertung des Convallatoxins, eines von Karrer aus der Convallaria majalis dargestellten kristallisierten Glykosids der Firma Hoffmann-La Roche erergeben:

  8. An alpha scintillation spectrometer

    E-print Network

    Yates, Ralph Aaron

    1952-01-01

    . Uranium 1'hick Uranium sources were tested to determine if any differences would exist between the oulse height distribution oi' thick Uranium and Thorium sources. Sources were prepared by placing small pieces of Uranium nitrate, UO2 (NO3)2 6H20, on a... phosphor covered light-piper. The ten different energy alpha particles that were emitted from the Uranium were blended into a continuous distribution, there being no apparent difference between this and the thick Thorium distribution. The same was true...

  9. An alpha scintillation spectrometer 

    E-print Network

    Yates, Ralph Aaron

    1952-01-01

    . Uranium 1'hick Uranium sources were tested to determine if any differences would exist between the oulse height distribution oi' thick Uranium and Thorium sources. Sources were prepared by placing small pieces of Uranium nitrate, UO2 (NO3)2 6H20, on a... phosphor covered light-piper. The ten different energy alpha particles that were emitted from the Uranium were blended into a continuous distribution, there being no apparent difference between this and the thick Thorium distribution. The same was true...

  10. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); Allander, Krag S. (Ojo Caliente, NM); Bounds, John A. (Los Alamos, NM)

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  11. Des Moines and Raccoon Rivers, Des Moines, Iowa

    E-print Network

    US Army Corps of Engineers

    Des Moines and Raccoon Rivers, Des Moines, Iowa 18 October 2006 Abstract: The recommended plan opportunities along the Des Moines and Raccoon Rivers in the areas of Birdland Park, Central Place and downtown Additional Information: Mississippi Valley Division Rock Island District Des Moines and Raccoon River Damage

  12. Politique de gestion des documents administratifs et des archives

    E-print Network

    Politique de gestion des documents administratifs et des archives Préparation : Division de la gestion des documents administratifs et des archives Révision : Bureau du secrétaire général Entrée en vigueur : 15 février 2012 Approbation : (CA-2012-6) Cadre juridique : Loi sur les archives (L

  13. Des pionniers autoconstructeurs aux cooprateurs : histoire des Castors en Aquitaine

    E-print Network

    Boyer, Edmond

    Des pionniers autoconstructeurs aux coopérateurs : histoire des Castors en Aquitaine Julie ­ Histoire des Castors en Aquitaine - 2010 2 Préambule Ce travail est un manuscrit en cours de travail. Il Castors en Aquitaine, des pionniers autoconstructeurs aux coopérateurs (1948-1970) initialement traité

  14. MITTEILUNGSBLATT DES REKTORS

    E-print Network

    Gertz, Michael

    Landeshochschulgebühren- gesetzes (LHGebG) vom 1. Januar 2005 (GBl. S. 1, 56 ff.), zuletzt geändert durch Artikel 6 des Dritten Hochschulrechtsänderungsgesetz vom 1. April 2014 (GBl. S. 99, 167) in Verbindung mit § 19 Abs. 1 Nr. 10 Landeshochschulgesetz vom 1. Januar 2005 (GBl. S. 1), zuletzt geändert durch Artikel 1 des

  15. Echte Lipome des Meniscus

    Microsoft Academic Search

    G. Stedtfeld

    1955-01-01

    Es werden 2 Fälle beschrieben, bei denen ein echtes Lipom des Meniscus gefunden wurde. Nach kurzer Wiedergabe der Krankengeschichten und Operationsberichte werden Lokalisation, Form und histologischer Aufbau der Geschwülste in 5 Abbildungen gezeigt. In der abschließenden Epikrise wird auf die diagnostischen Schwierigkeiten hingewiesen und die Entfernung des ganzen Meniscus angeraten.

  16. Name des Akademischen Lehrkrankenhauses

    E-print Network

    Gollisch, Tim

    -5 99947 Bad Langensalza Name der / des PJ Beauftragten Kontaktaufnahme Frau Prof. Dr. Borg-von Zepelin Unterkunft In Absprache mit der Klinik Ansprechpartner: Frau Eva Ackermann Tel.: 03601- 41 1132 e Kontaktaufnahme Frau Dr. Christiane Först Sekretariat: Frau Rochner Tel.: 0441 / 9615-240 Treffpunkt am 1.Tag des

  17. Le Point sur la Pharmacologie des Agents Anesthesiques Chez le Brule Grave

    PubMed Central

    Siah, S.; Ababou, K.; Benziane, H.; El Jaoudi; Bensghir, M.; Bakali, H.; El Wali, A.; Ihrai, I.; Drissi, N.K.

    2008-01-01

    Summary La pharmacologie des agents anesthésiques chez le brûlé est variable et imprévisible. Dans les premières 48 h, il y a une hypovolémie avec chute du débit cardiaque et des fuites plasmatiques. Après 48 h, il y a une hypervolémie avec augmentation du débit cardiaque, hypermétabolisme et la clearance des médicaments est augmentée. Parmi les facteurs de déséquilibre, on retrouve les variations des protéines plasmatiques. Deux protéines sont importantes chez le brûlé grave : l'albumine et l'alpha 1- glycoprotéine. Leur taux varie beaucoup au cours de l'évolution de la brûlure. Les agents anesthésiques dont la liaison avec ces deux protéines est prédominante verront leur pharmacocinétique modifiée. L'anesthésiste-réanimateur du service des brûlés va maîtriser ces notions pharmacologiques pour utiliser à bon escient les agents anesthésiques. PMID:21991108

  18. Eléments de comparaison internationale des patrimoines des ménages

    Microsoft Academic Search

    Dominique Strauss-Kahn

    1979-01-01

    [fre] A partir des bribes d'information existant sur les patrimoines de divers pays européens et des USA, une comparaison de la structure des patrimoines des inégalités de répartition et de leur évolution est tentée. Actifs financiers et actifs réels figurent de façon variable dans les patrimoines des différents pays. La Grande-Bretagne, avec une forte part d'actifs financiers, notamment de valeurs

  19. Alpha:2n:alpha molecular band in 10Be.

    PubMed

    Freer, M; Casarejos, E; Achouri, L; Angulo, C; Ashwood, N I; Curtis, N; Demaret, P; Harlin, C; Laurent, B; Milin, M; Orr, N A; Price, D; Raabe, R; Soi?, N; Ziman, V A

    2006-02-01

    The 10.15 MeV resonance in 10Be has been probed via resonant 6He+4He elastic scattering. It is demonstrated that it is the Jpi=4+ member of a rotational band built on the 6.18 MeV 0+ state. A Gammaalpha of 0.10-0.13 MeV and Gammaalpha/Gamma=0.35-0.46 were deduced. The corresponding reduced alpha width, gamma2alpha, indicates one of the largest alpha-cluster spectroscopic factors known. The deformation of the band, including the 7.54 MeV, 2+ member, is large (h2/2I=200 keV). Such a deformation and the significant degree of clusterization signals a well-developed alpha:2n:alpha molecular structure. PMID:16486811

  20. alpha_S and Power Corrections from JADE

    E-print Network

    Fernández, P A M

    2002-01-01

    Re-analysed JADE data were used to determine alpha_S at sqrt{s} = 14-44 GeV on the basis of resummed calculations for event shapes and hadronisation models tuned to LEP data. The combined result is alpha_S(M_Z) = 0.1194 +/- 0.0082/0.0068 which is consistent with the world average. Event shapes have also been used to test power corrections based on an analytical model and to verify the gauge structure of QCD. The only non-perturbative parameter alpha_0 of the model was measured to alpha_0(2GeV) = 0.503 +/- 0.066/0.045 and is found to be universal within the total errors.

  1. alpha_S and Power Corrections from JADE

    E-print Network

    P. A. Movilla Fernandez

    2002-09-13

    Re-analysed JADE data were used to determine alpha_S at sqrt{s} = 14-44 GeV on the basis of resummed calculations for event shapes and hadronisation models tuned to LEP data. The combined result is alpha_S(M_Z) = 0.1194 +/- 0.0082/0.0068 which is consistent with the world average. Event shapes have also been used to test power corrections based on an analytical model and to verify the gauge structure of QCD. The only non-perturbative parameter alpha_0 of the model was measured to alpha_0(2GeV) = 0.503 +/- 0.066/0.045 and is found to be universal within the total errors.

  2. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  3. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  4. Live! From 2-Alpha

    NSDL National Science Digital Library

    This activity is one of several in which students are required to access and analyze actual data from NASA missions, including video "interviews" with real NASA scientists, to solve a mystery. In this mystery, students learn about the force of gravity and how scientists analyze data by studying the properties of different objects in space. Live! From 2-Alpha can be used to support instruction about forces and motion, origin and evolution of the universe, and the interaction of energy and matter. This activity is one of several in "Space Mysteries," a series of inquiry-driven, interactive Web explorations. Each Mystery in "Space Mysteries" is designed to teach at least one physical science concept (e.g. interactions of energy and matter, structures and properties of matter, energy, motion, or forces), and is accompanied by materials to be used by classroom teachers.

  5. INFLAMMATION DES NUAGES DE POUSSIERES PAR DES ETINCELLES ET DES SURFACES CHAUFFEES

    E-print Network

    Paris-Sud XI, Université de

    2001-74 INFLAMMATION DES NUAGES DE POUSSIERES PAR DES ETINCELLES ET DES SURFACES CHAUFFEES C. PROUST - M. BOUDALAA INERIS-BP 2- F60550 Veraeuil-en-Halatte Résumé. Les trois types de sources d'inflammation utilisé. Pour des délais d'inflammation relativement longs (1 à 2 mn), le paramètre caractéristique de l'inflammation

  6. Quantum electrodynamics $m \\alpha^6$ and $m \\alpha^7 \\ln \\alpha$ corrections to the fine splitting in Li and Be$^+$

    E-print Network

    Puchalski, Mariusz

    2015-01-01

    We derive quantum electrodynamics corrections to the fine structure in three-electron atomic systems at $m \\alpha^6$ and $m \\alpha^7 \\ln \\alpha$ orders and present their numerical evaluations for the Li atom and Be$^+$ ion.

  7. Facult des arts et des sciences Sciences sociales et psychologie | Cartographie de la recherche 2012 TABLE DES MATIRES

    E-print Network

    Leclercq, Remi

    #12;Faculté des arts et des sciences ­ Sciences sociales et psychologie | Cartographie de la ..................................................................................................................................................................... 2 La Faculté des arts et des sciences (FAS), c'est....................................................................................... 3 Sciences sociales et psychologie

  8. THE COMPLEX FATE OF ALPHA-KETOACIDS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant cells are unique in that they contain four species of alpha-ketoacid dehydrogenase complex: plastidial pyruvate dehydrogenase, mitochondrial pyruvate dehydrogenase, alpha-ketoglutarate (2-oxoglutarate) dehydrogenase, and branched-chain alpha-ketoacid dehydrogenase. All complexes include multi...

  9. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610...Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes...

  10. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610...Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes...

  11. How Is Alpha-1 Antitrypsin Deficiency Diagnosed?

    MedlinePLUS

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Diagnosed? Alpha-1 antitrypsin (AAT) deficiency usually is diagnosed after you ... Rate This Content: NEXT >> October 11, 2011 Alpha-1 Antitrypsin Deficiency Clinical Trials Clinical trials are research ...

  12. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePLUS

    Alpha-1 Antitrypsin Deficiency Chronic obstructive pulmonary disease or COPD for short is a lung disease that affects millions ... The inherited form of emphysema is called Alpha-1 Antitrypsin Deficiency or " Alpha-1 " for short. People ...

  13. Le magazine Prsentation des

    E-print Network

    Le magazine Présentation des guides Abonnez-vous La lettre professionnelle Recevez la newsletter FINANCEMENT EUROPE ET MONDE FORMATION Innovation Online - L´actualité de l'économie de la croissance http://www.innovationonline.fr/articles-magazine

  14. Zur Pharmakologie des Cytisins

    Microsoft Academic Search

    J. Zachowski

    1938-01-01

    Zusammenfassung 1.Das goldregenalkaloid Cytisin bewirkt wie Nikotin Erregung der vegetativen Schaltganglien mit nachfolgender Lähmung. Die erregende Wirkung des Cytisins betrifft fast nur die sympathischen Schaltganglien.2.Vom Nikotin unterscheidet es sich wesentlich durch die bedeutend stärkere Erregung der sympathischen Schaltganglien und durch die stark abgeschwächte lähmende Wirkung.3.Die im Vergleich zu Nikotin vielfach stärkere adrenalinartige pressorische Wirkung des Cytisins beruht in erster Linie

  15. Alpha detection on moving surfaces

    SciTech Connect

    MacArthur, D. [Los Alamos National Lab., NM (United States); Orr, C.; Luff, C. [BNFL Instruments Ltd., Sellafield (United Kingdom)

    1998-12-01

    Both environmental restoration (ER) and decontamination and decommissioning (D and D) require characterization of large surface areas (walls, floors, in situ soil, soil and rubble on a conveyor belt, etc.) for radioactive contamination. Many facilities which have processed alpha active material such as plutonium or uranium require effective and efficient characterization for alpha contamination. Traditional methods for alpha surface characterization are limited by the short range and poor penetration of alpha particles. These probes are only sensitive to contamination located directly under the probe. Furthermore, the probe must be held close to the surface to be monitored in order to avoid excessive losses in the ambient air. The combination of proximity and thin detector windows can easily cause instrument damage unless extreme care is taken. The long-range alpha detection (LRAD) system addresses these problems by detecting the ions generated by alpha particles interacting with ambient air rather than the alpha particle directly. Thus, detectors based on LRAD overcome the limitations due to alpha particle range (the ions can travel many meters as opposed to the several-centimeter alpha particle range) and penetrating ability (an LRAD-based detector has no window). Unfortunately, all LRAD-based detectors described previously are static devices, i.e., these detectors cannot be used over surfaces which are continuously moving. In this paper, the authors report on the first tests of two techniques (the electrostatic ion seal and the gridded electrostatic LRAD detector) which extend the capabilities of LRAD surface monitors to use over moving surfaces. This dynamic surface monitoring system was developed jointly by Los Alamos National Laboratory and at BNFL Instruments. All testing was performed at the BNFL Instruments facility in the UK.

  16. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  17. Measurement of alpha_S in e+e- collisions at LEP and JADE

    E-print Network

    J. Schieck

    2006-10-06

    Data from e+e- annihilation into hadrons collected by the JADE, the L3 and the OPAL experiment at centre-of-mass energies between 14 GeV and 209 GeV are used to determine the strong coupling alpha_S. Observables in leading order sensitive to alpha_S as well as alpha_S**2 are used. The evolution of alpha_S with respect to the centre-of-mass energy as predicted by QCD is studied and confirmed with high precision. All measurements of alpha_S are consistent with the current world average.

  18. Measurement of alpha_S in e+e- collisions at LEP and JADE

    E-print Network

    Schieck, J

    2007-01-01

    Data from e+e- annihilation into hadrons collected by the JADE, the L3 and the OPAL experiment at centre-of-mass energies between 14 GeV and 209 GeV are used to determine the strong coupling alpha_S. Observables in leading order sensitive to alpha_S as well as alpha_S**2 are used. The evolution of alpha_S with respect to the centre-of-mass energy as predicted by QCD is studied and confirmed with high precision. All measurements of alpha_S are consistent with the current world average.

  19. PROPRITS MCANIQUES DES VERRES J. ZARZYCKI

    E-print Network

    Paris-Sud XI, Université de

    789 PROPRIÉTÉS MÉCANIQUES DES VERRES J. ZARZYCKI Université de Montpellier 2, Laboratoire des Verres du C. N. R. S., France Résumé. 2014 La résistance mécanique des verres usuels s'écarte très des propriétés mécaniques des verres. Après un brefrappel de la théorie des microfissures (Inglis

  20. Optimisation du dimensionnement des alimentations des machines rluctance variable

    E-print Network

    Paris-Sud XI, Université de

    qui minimisent le dimensionnement du convertisseur tant en courant qu'en tension. Après un rappel des dimensionnement des convertisseurs prenant en compte les valeurs efficaces ou maximales des courant et tension adjoindre un convertisseur d'alimentation à fréquences élevées (jusqu'à quelques kHz). En général, il est à

  1. Qualit des composts et des digestats Fabienne MULLER

    E-print Network

    Boyer, Edmond

    Qualité des composts et des digestats Fabienne MULLER Direction consommation durable et déchets organiques se construit, avec aujourd'hui le développement important de la méthanisation. Les composts actuellement produits, peuvent l'être avec des digestats ou non. Les quantités de compost produit ne cessent d

  2. Facult des arts et des sciences Dpartement de psychologie

    E-print Network

    Parrott, Lael

    ) L'étudiant choisit les cours du profil Enfants/adolescents (Axe 1), ou du profil Adultes (Axe 2). Cours Axe 1 : Évaluation enfants - adolescents Crédits Inscription Annulation Trimestre Année PSY7236;Faculté des arts et des sciences Département de psychologie Secrétariat des études supérieures Cours Axe 2

  3. SURVEILLANCE ET CONTROLE DES ACTIVITES DES NAVIRES EN MER

    E-print Network

    Boyer, Edmond

    1 SURVEILLANCE ET CONTROLE DES ACTIVITES DES NAVIRES EN MER ScanMaris Michel MOREL (DCNS), Aldo) «Quiconque est maître sur la mer a un grand pouvoir sur la terre» Cardinal de Richelieu Il est donc Surveillance et de Sauvetage), sémaphores, moyens nautiques et aériens des administrations en mer. Toutefois

  4. Septembre 2012 Paludisme : des moustiques

    E-print Network

    pulvérisations intra domiciliaires d'autres insecticides, les carbamates. Ces derniers agissent différemment au aux pyré- thrinoïdes et pulvérisé des carbamates à l'intérieur des habitations, les scientifiques ont

  5. The DES Story: Lessons Learned

    Cancer.gov

    Dr. Robert Hoover discusses the DES followup study, which follows diethylstilbestrol (DES) exposed and unexposed mothers, daughters and sons, and granddaughters for adverse health effects resulting from this exposure.

  6. Déviance et contrôle des comportements

    Microsoft Academic Search

    Lionel Honoré

    2006-01-01

    (VF)Quel rôle joue le contrôle des comportements et que devient la place de la déviance lorsque les règles s’écartent et que l’autonomie, l’initiative, le progrès constant, deviennent des principes du fonctionnement de l’entreprise et de l’organisation du travail ? Pour tenter d’apporter des éléments de réponses à cette question, nous l’étudions sous l’angle des théories de la déviance. L’objectif est,

  7. La biogenèse des mélanosomes

    PubMed Central

    Delevoye, Cédric; Giordano, Francesca; van Niel, Guillaume; Raposo, Graça

    2012-01-01

    Les mélanocytes situés à la base de l’épiderme produisent des mélanosomes qui sont transférés aux kératinocytes pour assurer la pigmentation de l’épiderme et sa photoprotection contre les rayons ultraviolets. Les mélanosomes, organites apparentés aux lysosomes, sont le lieu de synthèse et de stockage d’un pigment, la mélanine. Leur formation dépend de protéines mélanosomales qui transitent par les voies de biosynthèse et d’endocytose et exploitent les mécanismes moléculaires du trafic intracellulaire. Les acteurs moléculaires impliqués dans le transport des protéines mélanosomales et la biogenèse des mélanosomes sont la cible de mutations dans des maladies génétiques accompagnées d’hypopigmentation comme l’albinisme et les maladies lysosomales. Les études menées sur les mélanocytes issus de souris modèles de ces maladies permettent de comprendre certaines des étapes-clés de la mélanogenèse ainsi que les dysfonctionnements associés à ces pathologies. De plus, décrypter la mélanogenèse facilite également la compréhension d’autres processus physiologiques, comme l’illustrent les similitudes inattendues avec l’amyloïdogenèse dans les maladies neurodégénératives. PMID:21382323

  8. Inflaton decay in an alpha vacuum

    Microsoft Academic Search

    Siddartha Naidu; Richard Holman

    2005-01-01

    We study the alpha vacua of de Sitter space by considering the decay rate of the inflaton field coupled to a scalar field placed in an alpha vacuum. We find an alpha dependent Bose enhancement relative to the Bunch-Davies vacuum and, surprisingly, no nonrenormalizable divergences. We also consider a modified alpha dependent time-ordering prescription for the Feynman propagator and show

  9. alphaCertified Jonathan D. Hauenstein

    E-print Network

    Sottile, Frank

    Certified The program alphaCertified by Jonathan D. Hauenstein and Frank Sottile implements algorithms based on Smale's -theory to certify solutions to polynomial systems. This manual provides de- tailed instructions on how alphaCertified. 2 Compiling alphaCertified The program alphaCertified is written in C and uses the GMP[3

  10. NOTE TECHNIQUE RECHERCHE DES SALMONELLA

    E-print Network

    Paris-Sud XI, Université de

    NOTE TECHNIQUE RECHERCHE DES SALMONELLA PAR IMMUNOFLUORESCENCE M. CATSARAS J. ANANI Laboratoire Salmonella, 366 prélèvements, dans 125 boucheries, pour lesquels nous avons comparé les techniques d, dus à des coliformes. Ses avantages et ses inconvénients pour la recherche des Salmonella sont

  11. How S-DES Works

    Microsoft Academic Search

    Febiana Hanani; Indri Rahmayuni

    Data Encryption Standard (DES) is one of the most widely used symmetric key cryptography algorithm. Therefore, the susceptibility of DES to different kind of attacks has been a concern since the algorithm was first made public. The problem has escalated to the point that Electronic Frontier Foundation has now built a DES cracking machine, at a cost of less than

  12. Die pharmakologische Wirkung des Ephedrins

    Microsoft Academic Search

    H. Kreitmair

    1927-01-01

    Zusammenfassung 1.Die pharmakologische Wirkung des Ephedrins wurde zu analysieren versucht durch Studium der Beeinflussung des Blutdrucks, der Herzaktion und der Gefäße, des Effekts am Atemzentrum und an den Bronchien, der Wirkung auf die Pupillenweite, auf den Darm und den Uterus, auf die Sekretion verschiedener Drüsen und den Blutzuckerspiegel.2.Es wurden folgende Wirkungen gefunden: Der Blutdruck wird erhöht durch kleine Dosen, erniedrigt

  13. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  14. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent in reducing cell proliferation and the expression of the CD36 scavenger receptor than the un-phosphorylated alpha-tocopherol (alpha T). We have now assessed the effects of alpha T an...

  15. Alpha Chain Structures of ^{12}C

    E-print Network

    Suk-Ho Hong; Suk-Joon Lee

    1999-03-01

    N-\\alpha structures of light nuclei with axial symmetry are studied using relativistic Hartree approximation. Metastable excited states are searched in a configuration space which allows linear alpha chain structures. As a result, it is shown that ^{12}C has ^8Be + \\alpha resonance state at about 1 MeV above ^8Be-\\alpha threshold as an asymmetric 3-\\alpha linear-chain structure, which plays an important role in stellar nucleosynthesis.

  16. Alpha-factor structural gene mutations in Saccharomyces cerevisiae: effects on alpha-factor production and mating.

    PubMed Central

    Kurjan, J

    1985-01-01

    The role of alpha-factor structural genes MF alpha 1 and MF alpha 2 in alpha-factor production and mating has been investigated by the construction of mf alpha 1 and mf alpha 2 mutations that totally eliminate gene function. An mf alpha 1 mutant in which the entire coding region is deleted shows a considerable decrease in alpha-factor production and a 75% decrease in mating. Mutations in mf alpha 2 have little or no effect on alpha-factor production or mating. The mf alpha 1 mf alpha 2 double mutants are completely defective in mating and alpha-factor production. These results indicate that at least one alpha-factor structural gene product is required for mating in MAT alpha cells, that MF alpha 1 is responsible for the majority of alpha-factor production, and that MF alpha 1 and MF alpha 2 are the only active alpha-factor genes. Images PMID:3887136

  17. TIC et commerce lectronique : laboratoires de la libralisation des changes et des volutions des rgles

    E-print Network

    Paris-Sud XI, Université de

    1 TIC et commerce électronique : laboratoires de la libéralisation des échanges et des évolutions/Département Sciences Economiques et Sociales Les échanges internationaux de produits TIC et le commerce électroniques à terme à l'abolition des droits de douane pour les produits de la filière TIC et les échanges

  18. Gestion processuelle des rsultats : Une tude pr-et post-IFRS des dpenses de R&D des

    E-print Network

    1 « Gestion processuelle des résultats » : Une étude pré- et post-IFRS des dépenses de R&D des'adoption des normes IFRS n'a pas neutralisé la capitalisation discrétionnaire des dépenses de R&D, mais que, à. Then the paper focuses on how accounting standards used (PCG/IFRS) alter earnings management based on R

  19. Des Vents et des Jets Astrophysiques

    NASA Astrophysics Data System (ADS)

    Sauty, C.

    Plasma outflows from a central gravitating object are a widespread phenomenon in astrophysics. They include the solar and stellar winds, jets from Young Stellar Objects, jets from compact stellar objects and extra-galactic jets associated with Active Galactic Nuclei and quasars. Beyond this huge zoology, a common theoretical ground exists. The aim of this review is to present qualitatively the various theories of winds (Part 1) and how different astrophysical domains interplay. A more or less complete catalog of the ideas proposed for explaining the acceleration and the morphologies of winds and jets is intended. All this part avoids getting into any mathematical formalism. Some macroscopic properties of such outflows may be described by solving the time-independent and axisymmetric magnetohydrodynamic equations. This formalism, underlying most of the theories, is presented in Part 2. It helps to introduce quantitatively the free integrals that such systems possess. Those integrals play an important role in the basic physics of acceleration and collimation, in particular the mass loss rate, the angular momentum loss rate and the energy of the magnetic rotator. Most of the difficulty in modelling flows lies in the necessity to cross critical points, characteristic of non linear equations. The physical nature and the location of such critical points is debated because they are the clue towards the resolution. We thus introduce the notions of topology and critical points (Parts 3 and 4) from the simplest hydrodynamic and spherically symmetric case to the most sophisticated, MHD and axisymmetric cases. Particular attention is given to self-similar models which allows to give some general and simple ideas on the problem due to their semi-analytical treatment. With the use of these notions, a more quantitative comparison of the various models is given (Parts 3 and 4), especially on the shape of the flows. It is thus shown that magnetic collimation of winds into jets is a well expected result from the theory. Although, collimation may be conical, paraboloidal or cylindrical (Part 4), cylindrical collimation is the more likely to occur. The shape of outflows may then be used as a tool to predict physical conditions on the flows or on their source. L'éjection continue de plasma autour d'objets massifs est un phénomène largement répandu en astrophysique, que ce soit sous la forme du vent solaire, de vents stellaires, de jets d'étoiles en formation, de jets stellaires autour d'objets compacts ou de jets extra-galactiques. Cette zoologie diversifiée fait pourtant l'objet d'un commun effort de modélisation. Le but de cette revue est d'abord de présenter qualitativement le développement, depuis leur origine, des diverses théories de vents (Partie 1) et l'inter disciplinarité dans ce domaine. Il s'agit d'une énumération, plus ou moins exhaustive, des idées proposées pour expliquer l'accélération et la morphologie des vents et des jets, accompagnée d'une présentation sommaire des aspects observationnels. Cette partie s'abstient de tout aspect faisant appel au formalisme mathématique. Ces écoulements peuvent être décrits, au moins partiellement, en résolvant les équations magnétohydrodynamiques, axisymétriques et stationnaires. Ce formalisme, à la base de la plupart des théories, est exposé dans la Partie 2. Il permet d'introduire quantitativement les intégrales premières qu'un tel système possède. Ces dernières sont amenées à jouer un rôle important dans la compréhension des phénomènes d'accélération ou de collimation, en particulier le taux de perte de masse, le taux de perte de moment angulaire ou l'énergie du rotateur magnétique. La difficulté de modélisation réside dans l'existence de points critiques, propres aux équations non linéaires, qu'il faut franchir. La nature physique et la localisation de ces points critiques fait l'objet d'un débat important car ils sont la clef de voute de la résolution. Nous introduisons donc la notion de topologie des points critiques (Parties 3 et 4

  20. BULLITIONS NUIT DES SCIENCES

    E-print Network

    Gutkin, Boris

    partenariat avec TV5MONDE, Le Monde.fr, France culture Plus et l'Institut français, l'ENS a aussi souhaité de l'événement et des débats animés par Mohamed Kaci (TV5MONDE). Plusieurs thèmes seront abordés : la partager cette nuit avec le plus grand nombre, grâce à un plateau web-tv diffusé en direct dans le monde

  1. COMPORTEMENT SCURITAIRE DES

    E-print Network

    Paris-Sud XI, Université de

    , Robert Latour 1 Résumé Abstract Des données fournies par 109 utilisateurs de systèmes informatiques ont.., CA et Robert Latour L. SC. Com., C.S.E. stat., professeurs agrégés (avec la collaboration de Jacques-5633 Courrier électronique : andre.peres@hec.ca et robert.latour@hec.ca halshs-00587496,version1-20Apr2011

  2. Bilan des turbulences

    Microsoft Academic Search

    Françoise Milewski; Hervé Péléraux; Olivier Passet; Christine Rifflart; Jean-Marc Daniel

    1994-01-01

    [eng] Turbulences' check-up Département des diagnostics Western economies began their recovery one year ago, but it is still difficult to foresee jobs and capacities creations on the near term. National situations exhibit quite varied imprints of indebtedness and disindebtedness waves brought about by the deregulations and monetary policies. Continental Europe, Germany excepted, has achieved the curbing of corporate failures, but

  3. Alpha effects on TAE modes and alpha transport

    Microsoft Academic Search

    C. Z. Cheng; G. Y. Fu; H. E. Mynick; R. Budny; R. B. White; S. J. Zweben; C. T. Hsu; D. J. Sigmar; D. A. Spong; B. A. Carreras; C. L. Hedrick

    1992-01-01

    In a fusion reactor, any unanticipated loss of alpha power could result in serious wall damage, impurity influx, major operational control problems, and even a failure to sustain ignition. Neutral beam injection (NBI) experiments in large tokamaks have indicated that toroidicity-induced Alfven eigenmode (TAE) can be strongly unstable and cause the loss of about half of the fast beam ions.

  4. Assignments of Jpi in 58Ni via (alpha, alpha') and (6Li, d) reactions

    Microsoft Academic Search

    G. Guillaume; F. C. Jundt; H. W. Fulbright; J. C. D. Milton; C. L. Bennett

    1977-01-01

    Measurements of 58Ni(alpha, alpha')58Ni angular distributions have been extended to small angles and disagreements between Jpi assignments based on earlier (alpha, alpha'), and (6Li, d) measurements have been explained and resolved. NUCLEAR REACTIONS 58Ni(alpha, alpha'), Ealpha=30 MeV; measured dsigmadOmega, deduced Jpi for 5.59 and 6.02 MeV levels.

  5. Injectabilite des coulis de ciment dans des milieux fissures

    NASA Astrophysics Data System (ADS)

    Mnif, Thameur

    Le travail presente ici est un bilan du travaux de recherche effectues sur l'injectabilite des coulis de ciment dans lu milieux fissures. Un certain nombre de coulis a base de ciment Portland et microfin ont ete selectionnes afin de caracteriser leur capacite a penetrer des milieux fissures. Une partie des essais a ete menee en laboratoire. L'etude rheologique des differents melanges a permis de tester l'influence de l'ajout de superplastifiant et/ou de fumee de silice sur la distribution granulometrique des coulis et par consequent sur leur capacite a injecter des colonnes de sable simulant un milieu fissure donne. La classe granulometrique d'un coulis, sa stabilite et sa fluidite sont apparus comme les trois facteurs principaux pour la reussite d'une injection. Un facteur de finesse a ete defini au cours de cette etude: base sur la classe granulometrique du ciment et sa stabilite, il peut entrer dans la formulation theorique du debit d'injection avant application sur chantier. La deuxieme et derniere partie de l'etude presente les resultats de deux projets de recherche sur l'injection realises sur chantier. L'injection de dalles de beton fissurees a permis le suivi de l'evolution des pressions avec la distance au point d'injection. L'injection de murs de maconnerie a caractere historique a montre l'importance de la definition de criteres de performance des coulis a utiliser pour traiter un milieu donne et pour un objectif donne. Plusieurs melanges peuvent ainsi etre predefinis et mis a disposition sur le chantier. La complementarite des ciments traditionnels et des ciments microfins devient alors un atout important. Le choix d'utilisation de ces melanges est fonction du terrain rencontre. En conclusion, cette recherche etablit une methodologie pour la selection des coulis a base de ciment et des pressions d'injection en fonction de l'ouverture des fissures ou joints de construction.

  6. ECOLE DOCTORALE Savoirs scientifiques : pistmologie, histoire des

    E-print Network

    Paris-Sud XI, Université de

    1 ECOLE DOCTORALE Savoirs scientifiques : épistémologie, histoire des sciences, didactique des-DIDEROT, PARIS 7 & DOCTEUR DE L'UNIVERSITE VIRTUELLE DE TUNIS Spécialité : Didactique des mathématiques Présentée'enseignement sur les possibilités d'apprentissage des étudiants Cas des notions ensemblistes fonctionnelles dans la

  7. EVALUATION DES INTERFACES UTILISATEUR : TAXONOMIE ET RECOMMANDATIONS

    E-print Network

    Nigay, Laurence

    'Assurance Qualité se pratique à façon, en fonction des ressources et des objectifs. A chaque cas, sa méthode. Nous Méthodes candidates Résultats souhaités Figure 1 : Choix d'une méthode d'évaluation en fonction des coûts (appel à des experts pratiquant par exemple la technique structurée des ``cognitive walkthrough'' [LEWIS

  8. fevrier 2012 Journes Francophones des Langages Applicatifs JFLA12 Separation des couleurs dans un -calcul bichrome

    E-print Network

    Paris-Sud XI, Université de

    AlligatorEggs3 cherche `a expliquer le -calcul `a des enfants. Pour cela il utilise la couleur pour relier des alligators affam´es et des oeufs afin de constituer des familles. La couleur sert `a expliciter les liaisons des variables dans les termes, des oeufs naissent de nouveaux alligators ou familles lors

  9. Inflaton decay in an alpha vacuum

    SciTech Connect

    Naidu, S.; Holman, R. [Department of Physics, Carnegie Mellon University, Pittsburgh Pennsylvania 15213 (United States)

    2005-03-15

    We study the alpha vacua of de Sitter space by considering the decay rate of the inflaton field coupled to a scalar field placed in an alpha vacuum. We find an alpha dependent Bose enhancement relative to the Bunch-Davies vacuum and, surprisingly, no nonrenormalizable divergences. We also consider a modified alpha dependent time-ordering prescription for the Feynman propagator and show that it leads to an alpha independent result. This result suggests that it may be possible to calculate in any alpha vacuum if we employ the appropriate causality preserving prescription.

  10. Inflaton decay in an alpha vacuum

    NASA Astrophysics Data System (ADS)

    Naidu, S.; Holman, R.

    2005-03-01

    We study the alpha vacua of de Sitter space by considering the decay rate of the inflaton field coupled to a scalar field placed in an alpha vacuum. We find an alpha dependent Bose enhancement relative to the Bunch-Davies vacuum and, surprisingly, no nonrenormalizable divergences. We also consider a modified alpha dependent time-ordering prescription for the Feynman propagator and show that it leads to an alpha independent result. This result suggests that it may be possible to calculate in any alpha vacuum if we employ the appropriate causality preserving prescription.

  11. Experience with alpha track detectors

    Microsoft Academic Search

    R. A. Oswald; R. V. Wheeler; C. Yoder

    1988-01-01

    The heightened awareness of radon hazards have resulted in an increase in the use of alpha track detectors. Field and laboratory tests have been conducted over sufficiently long periods of time by enough different laboratories so that characteristics of these detectors are better understood. The paper compares common experiences of Terradex Radtrak and Type SF detectors. Both detectors employ the

  12. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  13. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  14. LAMBDA ALPHA GRADUATE RESEARCH GRANTS

    E-print Network

    Tennessee, University of

    ) for the National Executive Council of the following materials printed front-to-back and stapled, with NO covers to the National Office before the postmarked March 1st deadline 4 copies (one original and 3 copies). Please mail materials to: Lambda Alpha National Office c/o Mrs. Barbara Di Fabio Department

  15. Alpha Testing Escape from Diab

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha testing was conducted of sessions 2 and 3 from Diab to assess whether the activities worked as expected, and whether children in the target ages enjoyed it. Data include both RA observations of child performance while playing the games and cognitive interview responses from the players after t...

  16. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate in thp-1 monocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent than the un-phosphorylated alpha alpha-tocopherol (alphaT). We have now measured plasma levels of alphaTP and compared the cellular effects of alphaTP and gamma-tocopheryl phosphate ...

  17. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  18. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of the electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance...

  19. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of the electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance...

  20. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of the electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance...

  1. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  2. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePLUS

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  3. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePLUS

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  4. Genetics Home Reference: Alpha-1 antitrypsin deficiency

    MedlinePLUS

    ... Where can I find information about diagnosis or management of alpha-1 antitrypsin deficiency? These resources address the diagnosis or management of alpha-1 antitrypsin deficiency and may include ...

  5. CARACTRES CYTOLOGIQUES DES CELLULES GONADOTROPES, THYROTROPES, CORTICOTROPES,

    E-print Network

    Boyer, Edmond

    , LTH, ACTH) et les distinguant du groupe des cellules à contenu glycoprotidique (FSH, LH, TSH). b) Bleu distribution très hétérogène des cellules TSH, à l'abondance des cellules ACTH, ces trois dernières catégories

  6. Les mtiers des langues trangres

    E-print Network

    Jeanjean, Louis

    individuel, en groupe, en face à face ou à distance, par téléphone ou en ligne. Il doit être en mesure de s'adapter à des publics sans cesse renouvelé, il faut alors faire preuve de capacités de communication et d'adaptation enseigner les termes de la vie quotidienne à des migrants ou un français plus technique s'il s'adresse à des

  7. V-Durabilit des cramiques et des verres Ce chapitre se propose de traiter de la tenue long terme des cramiques et des verres.

    E-print Network

    V- Durabilité des céramiques et des verres Ce chapitre se propose de traiter de la tenue à long terme des céramiques et des verres. A partir d'exemples présentés dans une première partie, une démarche dans une démarche de conception fiabiliste de composants contenant des verres ou/et des céramiques. V.1

  8. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha

  9. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  10. cap alpha. Particle confinement in compact tori

    Microsoft Academic Search

    Bozhokin

    1986-01-01

    The motion of high-energy ..cap alpha.. particles in compact tori is studied. The classically accessible regions of motion of charged particles are found. The conditions are formulated under which the ..cap alpha.. particles produced in fusion reactions are absolutely confined. An ..cap alpha.. particle starting in a region enclosed by a ''critical'' surface will never, in the course of its

  11. Phi Alpha Theta Beta Iota Chapter

    E-print Network

    Martinez, Tony R.

    Phi Alpha Theta Beta Iota Chapter Membership Application If everyone can help in some capacity, Phi Alpha Theta will be a success! Check if you would like to help with the following: _____Activities:_________________ Attach a check for $45 made payable to Phi Alpha Theta and give to the History Department receptionist

  12. Nonsingular $\\alpha$-rigid maps: Short proof

    E-print Network

    Ageev, Oleg N

    2009-01-01

    It is shown that for every $\\alpha$, where $\\alpha\\in [0, 1/2]$, there exists an $\\alpha$-rigid transformation whose spectrum has Lebesgue component. This answers the question posed by Klemes and Reinhold in [7]. We apply a certain correspondence between weak limits of powers of a transformation and its skew products.

  13. Chemotherapie des metastasierten Nierenzellkarzinoms

    Microsoft Academic Search

    Hans-Joachim Beck; C. Huber

    1998-01-01

    Die Lebenserwartung des Patienten mit metastasiertem Nierenzellkarzinom (NZK) ist kurz, so liegt die 5-Jahresüberlebenszeit\\u000a im Stadium IV mit Fernmetastasen unter 10% [5]. Dennoch existiert eine kleine Gruppe von Patienten, die durch günstigeren\\u000a Spontanverlauf und lange Überlebenszeiten charakterisiert ist. Desweiteren kommt es beim NZK zu immer wieder beschriebenen\\u000a Spontanremissionen [12], die jedoch in den wenigen einschlägigen Studien mehrheitlich unter 1% liegen.  

  14. Seltene Tumoren des Integuments

    Microsoft Academic Search

    U. Hofmann; A. Stein; H. Helmbach; A. Philipp; D. Schadendorf

    1999-01-01

    An der Haut manifestieren sich die hufigsten Malignome des Menschen, die epidermalen Plattenepithel- und Basalzellkarzinome,\\u000a sowie auch maligne Melanome mit steigender Inzidenz. Darber hinausgehend sind eine betrchtliche Zahl weiterer, verschiedenartigster,\\u000a jedoch vergleichsweise seltener Tumore am Integument zu beobachten. Das vor allem histologisch bunte Bild resultiert aus Gewebsanteilen\\u000a meso- und ektodermalen Ursprungs, welche in ausgesprochener Differenzierungsvielfalt die Haut und Unterhaut konstituieren.

  15. Strukturanalyse des Hämoglobin Köln

    Microsoft Academic Search

    R. W. Carrell; H. Lehmann; W. Pribilla

    1967-01-01

    Zusammenfassung Obwohl das Hb Köln zuerst in Deutschland bei einer Familie aus Köln gefunden wurde, gelang die Aufklärung der molekularen Strukturanomalie erstmalig bei einer aus Glasgow stammenden Familie, die einige deutsche Vorfahren hat. Es konnte mit verschiedenen Methoden gezeigt werden, daß Hb Köln folgende Struktur hat: a2ß2 98 Val?Met. Die in dieser Arbeit dargestellten Untersuchungen zeigen, daß die Strukturanomalie des

  16. Refinement of the $n-\\alpha$ and $p-\\alpha$ fish-bone potential

    E-print Network

    Smith, E; Papp, Z

    2012-01-01

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the $n-\\alpha$ and $p-\\alpha$ fish-bone potential by simultaneously fitting to the experimental phase shifts. We found that with a double Gaussian parametrization of the local potential can describe the $n-\\alpha$ and $p-\\alpha$ phase shifts for all partial waves.

  17. 17Alpha Centauri Bb -a nearby extrasolar planet? Alpha Centauri is a binary

    E-print Network

    17Alpha Centauri Bb - a nearby extrasolar planet? Alpha Centauri is a binary star system located 4 at La Silla in Chile to detect the tell-tail motion of Alpha Centauri B caused by an earth-sized planet in close orbit around this star. The planet, called Alpha Centauri Bb, orbits at a distance of only six

  18. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha

  19. Effects of pre-equilibrium nucleon emission on excitation functions of various reactions in vanadium induced by alpha particles

    Microsoft Academic Search

    N L Singh; S Mukherjee; A V Mohan Rao; L Chaturvedi; P P Singh

    1995-01-01

    Excitation functions for the 51V(( alpha ,n), ( alpha ,3n), ( alpha ,p3n), ( alpha ,p6n), ( alpha , alpha 3n), ( alpha , alpha 2pn), ( alpha ,2 alpha ), ( alpha ,2 alpha n) and ( alpha ,2 alpha 3n)) reactions have been measured up to 120 MeV using the stacked foil technique with a view to improving

  20. {alpha}-particle spectrum in the reaction p + {sup 11}B {yields} {alpha} + {sup 8}Be* {yields} 3{alpha}

    SciTech Connect

    Dmitriev, V. F., E-mail: dmitriev@inp.nsk.s [Budker Institute of Nuclear Physics (Russian Federation)

    2009-07-15

    Using a simple phenomenological parametrization of the reaction amplitude we calculated {alpha}-particle spectrumin the reaction p + {sup 11}B {yields} {alpha} + {sup 8}Be* {yields} 3{alpha} at the resonance proton energy of 675 keV. The parametrization includes Breit-Wigner factor with an energy-dependent width for intermediate {sup 8}Be* state and the Coulomb and the centrifugal factors in {alpha}-particle-emission vertices. The shape of the spectrum consists of a well-defined peak corresponding to emission of the primary {alpha} and a flat shoulder going down to very low energy. We found that below 1.5MeV there are 17.5% of {alpha}'s and below 1MeV there are 11% of them.

  1. Alpha-plutonium's Grüneisen parameter.

    PubMed

    Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert

    2010-04-28

    Reported Grüneisen parameters ? of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grüneisen parameter uncertainty seldom exceeds ± 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grüneisen's rule, from Einstein model and Debye model fits to low-temperature ?V/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grüneisen relationship whereby ? is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend ? = 3.7 ± 0.4, slightly high compared with values for all elemental metals. PMID:21386421

  2. Adult chicken alpha-globin genes alpha A and alpha D: no anemic shock alpha-globin exists in domestic chickens.

    PubMed

    Dodgson, J B; McCune, K C; Rusling, D J; Krust, A; Engel, J D

    1981-10-01

    Three alpha-type globin genes have been identified in the alpha-globin linkage group of chickens. No other alpha-type genes hae been directly shown to be within 10 kilobase pairs of any of these three closely linked genes. These three genes have been conclusively identified by DNA sequence analysis. The gene at the 5' end of the linkage group is an embryonic alpha-type globin gene, pi or pi', and the central gene corresponds to the minor adult alpha- globin, alpha D. The 3'-terminal gene sequence corresponds to the sequence of cDNA clones previously described as "alpha S", presumed anemic shock-induced alpha-globin gene [Salser, W. A., Cummings, I., Liu, A., Strommer, J., Padayatty, J. & Clarke, P. (1979) in Cellular and Molecular Regulation of Hemoglobin Switching, eds. Stamatoyannopoulos, G. & Nienheis, A. (Grune and Stratton, New York), pp. 621-643; Richards, R. I. & Wells, J. R. E. (1980) J. Biol. Chem. 255, 9306-9311]. Several groups of workers have isolated alpha S-type cDNA clones but no one has identified a cDNA clone corresponding to the published amino acid sequence of the major chicken alpha-globin, alpha A. We have identified the alpha S-type sequence as the only abundant alpha-like globin sequence in cDNA clones made from reticulocyte mRNA isolated from nonanemic chickens. Therefore, we suggest that the alpha S-type sequence corresponds to the true alpha A-globin species. PMID:6273837

  3. Le temps des unes et le temps des autres

    E-print Network

    Paris-Sud XI, Université de

    Le temps des unes et le temps des autres ans une journée tout le monde dispose de vingt-quatre heures. De quelle manière le temps est-il compté, quantifié et analysé selon les institutions ? Les temps. Dans les couples, hommes et femmes se ressemblent dans leur usage du temps sauf dans deux

  4. Facult des arts et des sciences Dpartement de sciences biologiques

    E-print Network

    Parrott, Lael

    i Faculté des arts et des sciences Département de sciences biologiques Plan de cours Politique sur étudiants de déposer leur copie d'examen et de libérer la salle. Ex : examen d'une durée de 1h45 ou de 2h45 2014 2h45 B-442 Les examens comportent deux parties: une série de 30 questions objectives et 2

  5. Facult des arts et des sciences Dpartement de sciences biologiques

    E-print Network

    Parrott, Lael

    i Faculté des arts et des sciences Département de sciences biologiques Plan de cours Politique sur étudiants de déposer leur copie d'examen et de libérer la salle. Ex : examen d'une durée de 1h45 ou de 2h45 examens comportent deux parties: une série de 30 questions objectives et 2-3 questions de synthèse ou d

  6. Rles indirects des microtubules dans la morphogense nuclaire des spermatides

    E-print Network

    Paris-Sud XI, Université de

    Rôles indirects des microtubules dans la morphogenèse nucléaire des spermatides J.-L. COURTENS. Summary. The indirect roles of microtubules in the nuclear morphogenesis of spermatids. The depolymerization of the microtubules of the spermatid manchette was effective for 4 to 5 h in rat, starting 30 min

  7. Plan de cours Facult des arts et des sciences

    E-print Network

    Parrott, Lael

    'analyse phylogénétique. Les 3 domaines du vivant: Archées, Eubactéries et Eucaryotes. Origine évolutive des Eucaryotes leurs niches écologiques. Éléments de contenu : Chapitre 6 - Origine évolutive des Végétaux. Végétaux et al. 2005 et de Campbell et al. 2012) #12;CALENDRIER Date Local Pavillon Contenu Mer. 8 mai 1409 A

  8. Exploration des Ondelettes en Prtraitement des Documents Anciens Anis Kricha

    E-print Network

    Paris-Sud XI, Université de

    Exploration des Ondelettes en Prétraitement des Documents Anciens Anis Kricha 1 ­ Amina Ghardallou de numérisation posent un axe de recherche très récent particulièrement pour les documents anciens présente une étape incontournable pour la restauration et le nettoyage d'un document. Elle permet d

  9. FACULTE DES ARTS ET DES SCIENCES DEPARTEMENT DE PHYSIQUE

    E-print Network

    Parrott, Lael

    FACULT´E DES ARTS ET DES SCIENCES D´EPARTEMENT DE PHYSIQUE AUTOMNE 2013 PLAN DE COURS Sigle du cours: PHY 1234 Titre du cours: Introduction `a la physique num´erique Nombre de cr´edits: 3 Professeur est offert principalement aux ´etudiant(e)s inscrit(e)s au premier cycle en physique et au programme

  10. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew [Universite de Toulouse, UPS-OMP, IRAP, Toulouse (France); Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas [Department of Astronomy, Oskar Klein Centre, Stockholm University, AlbaNova University Centre, SE-106 91 Stockholm (Sweden); Schaerer, Daniel [CNRS, IRAP, 14, avenue Edouard Belin, F-31400 Toulouse (France); Verhamme, Anne; Orlitova, Ivana [Geneva Observatory, University of Geneva, 51 Chemin des Maillettes, CH-1290 Versoix (Switzerland); Mas-Hesse, J. Miguel; Oti-Floranes, Hector [Centro de Astrobiologia (CSIC-INTA), Departamento de Astrofisica, POB 78, 28691 Villanueva de la Canada (Spain); Adamo, Angela [Max Planck Institute for Astronomy, Koenigstuhl 17, D-69117 Heidelberg (Germany); Atek, Hakim [Laboratoire d'Astrophysique, Ecole Polytechnique Federale de Lausanne (EPFL), Observatoire, CH-1290 Sauverny (Switzerland); Cannon, John M. [Department of Physics and Astronomy, Macalester College, 1600 Grand Avenue, Saint Paul, MN 55105 (United States); Herenz, E. Christian [Leibniz-Institut fuer Astrophysik (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany); Kunth, Daniel [Institut d'Astrophysique de Paris, UMR 7095 CNRS and UPMC, 98 bis Bd Arago, F-75014 Paris (France); Laursen, Peter, E-mail: matthew@astro.su.se [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen (Denmark)

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  11. alpha-Tocopheryl phosphate – an active lipid mediator?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The vitamin E (alpha-tocopherol, alphaT) derivative, alpha-tocopheryl phosphate (alphaTP), is detectable in small amounts in plasma, tissues, and cultured cells. Studies done in vitro and in vivo suggest that alphaT can become phosphorylated and alphaTP dephosphorylated, suggesting the existence of ...

  12. Rekonstruktion des Gesichts bei Verbrennungen

    Microsoft Academic Search

    Michael Steen

    2003-01-01

    Zusammenfassung Die Rekonstruktion des Gesichts bei Schwerbrandverletzten ist ein komplexer Bereich, bei dem schon die primäre Versorgung und Transplantationstechnik wesentlichen Einfluss auf das Endergebnis haben. Neben funktionellen Rekonstruktionen bei Narbenkontrakturen, Ektropion und inkomplettem Lidschluss, narbiger Begrenzung der Mundöffnung und Verlegungen des Naseneingangs finden heute auch Techniken Anwendung, welche vorrangig aus der ästhetischen Chirurgie bekannt sind. Beispiele dafür sind Haartransplantationen, Glättung

  13. Ageismus – Sprachliche Diskriminierung des Alters

    Microsoft Academic Search

    Undine Kramer

    Daniel Sanders, einer der bedeutendsten Lexikografen des 19. Jahrhunderts, wertete für sein Wörterbuch Quellen seit der Lutherzeit aus und\\u000a vermerkt im Wörterbuchartikel zu alt eine „bald lobende, bald tadelnde“ Bedeutung des Adjektivs. Sein Zeit- und Berufsgenosse Jacob Grimm benennt in seiner Rede über das Alter die zeitgenössischen Synonyme zu alt und Alter: „aus einheimischen schriftstellern liesze sich eine lange reihe

  14. HABILITATION `A DIRIGER DES RECHERCHES

    E-print Network

    Paris-Sud XI, Université de

    HABILITATION `A DIRIGER DES RECHERCHES PR´ESENT´EE `A L'UNIVERSIT´E CLAUDE BERNARD LYON I INSTITUT dilogarithme de Rogers . . . . . . . . . . . . . . . 19 2.4 Carquois et cat´egories d cambriens et ´equivalences d´eriv´ees . . . . . . . . . . . . 23 2.7 Cat´egorification des op

  15. Resting-state alpha in autism spectrum disorder and alpha associations with thalamic volume.

    PubMed

    Edgar, J Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M; Qasmieh, Saba; Levy, Susan E; Schultz, Robert T; Roberts, Timothy P L

    2015-03-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha rhythms, associations between thalamic structure and alpha activity were examined. RS magnetoencephalography was obtained from 47 typically-developing children (TDC) and 41 children with ASD. RS alpha activity was measured using distributed source localization. Left and right thalamic volume measurements were also obtained. In both groups, the strongest alpha activity was observed in Calcarine Sulcus regions. In Calcarine regions, only TDC showed the expected association between age and alpha peak frequency. ASD had more alpha activity than TDC in regions bordering the Central Sulcus as well as parietal association cortices. In ASD, whereas greater left Central Sulcus relative alpha activity was associated with higher Social Responsiveness Scale (SRS) scores, greater Calcarine region relative alpha activity was associated with lower SRS scores. Although thalamic volume group differences were not observed, relationships between thalamic volume and Calcarine alpha power were unique to TDC. The present study also identified a failure to shift peak alpha frequency as a function of age in primary alpha-generating areas in children with ASD. Findings suggested that increased RS alpha activity in primary motor and somatosensory as well as parietal multimodal areas-with increased alpha thought to reflect greater inhibition-might impair the ability to identify or interpret social cues. Finally, to our knowledge, this is the first study to report associations between thalamic volume and alpha power, an association observed only in TDC. The lack of thalamic and alpha associations in ASD suggests thalamic contributions to RS alpha abnormalities in ASD. PMID:25231288

  16. La pertinence informationnelle des chiffres comptables aprs l'adoption des Mise en vidence du rle des facteurs institutionnels

    E-print Network

    Paris-Sud XI, Université de

    1 La pertinence informationnelle des chiffres comptables après l'adoption des IFRS Mise en évidence informationnelle additionnelle des chiffres comptables due à l'adoption des IFRS. Les tests empiriques ont porté financière (Dyck et Zingales 2007) et les différences entre les normes locales et les IFRS (Bae et al. 2008

  17. POSTES DE GRAVURE HUMIDE MANUELS Ce sont des postes scuriss qui permettent le traitement manuel des plaquettes dans des rcipients

    E-print Network

    Ingrand, François

    POSTES DE GRAVURE HUMIDE MANUELS Ce sont des postes sécurisés qui permettent le traitement manuel des plaquettes dans des récipients contenant le réactif de gravure humide CARACTERISTIQUES PRINCIPALES conduire une gravure humide (attaque chimique) du matériau concerné dans des récipients adaptés posés sur

  18. Les marchs des investisseurs institutionnels sont-ils efficients : cas des fonds de pension et des unit trusts britanniques

    E-print Network

    Paris-Sud XI, Université de

    Les marchés des investisseurs institutionnels sont-ils efficients : cas des fonds de pension et des, nous proposons d'étudier la persistance de la performance de deux échantillons de fonds (de pension et long terme, et en investissant sur le marché des actions, les fonds de pension ne semblent pas avoir

  19. PHI 1901 : Pense rationnelle et argumentation Dpartement de philosophie, Facult des arts et des sciences

    E-print Network

    Parrott, Lael

    PHI 1901 : Pensée rationnelle et argumentation Département de philosophie, Faculté des arts et des rationalité et de l'importance de l'argumentation. Analyse du concept, de la définition et de la proposition, acceptabilité des prémisses, nécessité et suffisance. Étude des sophismes et des erreurs de raisonnements

  20. Evaluation des proprits thermiques de surface de la neige par assimilation des

    E-print Network

    Ribes, Aurélien

    simulations Crocus/forçage ERA-interim, les réanalyses ERA-interim et les données MODIS. #12;Plan I. Cycles, des simulations Crocus et des réanalyses ERA-interim IV. Conclusion et travaux envisagés #12;I. Cycles partir des données MODIS, des simulations Crocus et des réanalyses ERA-iterim #12;Cartes mensuelles de

  1. Gestion des terminologies riches : l'exemple des et Mathieu MANGEOT

    E-print Network

    Paris-Sud XI, Université de

    Gestion des terminologies riches : l'exemple des acronymes Ying ZHANG 1 et Mathieu MANGEOT 1 (1 ______________________________________________________________________________________________________________ La gestion des terminologies pose encore des problèmes, en particulier pour des constructions____________________________________________________________________________________________________________ Complex terminologies management ­ the case of acronyms Terminology management is still problematic

  2. The Ly-alpha/H-alpha ratio in high-redshift radio galaxies

    NASA Technical Reports Server (NTRS)

    Mccarthy, Patrick J.; Elston, Richard; Eisenhardt, Peter

    1992-01-01

    The first spectroscopic detection of H-alpha emission from radio galaxies at z greater than 2 are presented. Strong H-alpha emission is detected at z = 2.429 in B3 0731 + 438, and H-alpha is directed at z = 2.428 in 0406 - 244 at a significant level of greater than 6 sigma. The resulting Ly-alpha/H-alpha ratios for 0731 + 438 and 0406 - 244 are 3.9 and 3.2 with 3 sigma uncertainties of 1.5 for each. A range of possible extinctions is derived depending on the reddening-free Ly-alpha/H-alpha ratio assumed and the extinction curve employed. The most important result of this study is the demonstration that the Ly-alpha/H-alpha ratio in distant galaxies can now be measured with relative ease.

  3. Des Moines Water Works

    NSDL National Science Digital Library

    2001-01-01

    Users can access information about educational programs and materials for teachers and students, including tours, traveling exhibits and presentations by the staff of the Des Moines Water Works. "Water Trunks", which contain water-related literature, books, science experiments, videos, games, CD-ROMs, hands-on activities, picture cards, career information, and a teacher resource book, are available to order. There are also links to other water websites, a teachers' newsletter and pollution prevention tips for classroom use and for the general public.

  4. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    E-print Network

    U. Forsberg; D. Rudolph; L. -L. Andersson; A. Di Nitto; Ch. E. Düllmann; J. M. Gates; P. Golubev; K. E. Gregorich; C. J. Gross; R. -D. Herzberg; F. P. Hessberger; J. Khuyagbaatar; J. V. Kratz; K. Rykaczewski; L. G. Sarmiento; M. Schädel; A. Yakushev; S. Åberg; D. Ackermann; M. Block; H. Brand; B. G. Carlsson; D. Cox; X. Derkx; J. Dobaczewski; K. Eberhardt; J. Even; C. Fahlander; J. Gerl; E. Jäger; B. Kindler; J. Krier; I. Kojouharov; N. Kurz; B. Lommel; A. Mistry; C. Mokry; W. Nazarewicz; H. Nitsche; J. P. Omtvedt; P. Papadakis; I. Ragnarsson; J. Runke; H. Schaffner; B. Schausten; Y. Shi; P. Thörle-Pospiech; T. Torres; T. Traut; N. Trautmann; A. Türler; A. Ward; D. E. Ward; N. Wiehl

    2015-02-10

    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  5. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    E-print Network

    Forsberg, U; Andersson, L -L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Golubev, P; Gregorich, K E; Gross, C J; Herzberg, R -D; Hessberger, F P; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Sarmiento, L G; Schädel, M; Yakushev, A; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Dobaczewski, J; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nazarewicz, W; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Shi, Y; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N

    2015-01-01

    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  6. Formation et intgration Mise jour des dossiers

    E-print Network

    Spino, Claude

    Formation et intégration Mise à jour des dossiers du personnel Intégration des nouveaux employés les moyennes et grandes entreprises, ainsi que dans les domaines publics et de la consultation privée affaires permet aux étudiants d'acquérir des connaissances et des qualités propres au domaine de la gestion

  7. Gntique formelle des pigmentations humaines variations continues

    E-print Network

    Boyer, Edmond

    Génétique formelle des pigmentations humaines à variations continues : beaucoup d'hypothèses, peu et de mesures sont actuellement disponibles concer- nant la biochimie des pigments humains, leur génétique physiologique, les répartitions mondiales des pigmentations de la peau et des cheveux. La

  8. ACTION DES ANTIBIOTIQUES SUR PORCELETS ALLAITS

    E-print Network

    Boyer, Edmond

    VII. - ACTION DES ANTIBIOTIQUES SUR PORCELETS ALLAITÉS E. SALMON LEGAGNEUR M. MICHEL Station de. - Technique de distribution. C. - Animaux. D. - Dosage des antibiotiques. E. - Etude des flores intestinales : a) mortalité ; b) diarrhées ; c) régularité. D. - Étude des flores intestinales : a) Examen

  9. Absorptionsspektrum des Sehpurpurs und des Sehgelb. „Nachbleichung des Sehgelb im Dunkeln“

    Microsoft Academic Search

    Yuji Hosoya

    1934-01-01

    Zusammenfassung Eine photoelektrische Versuchsanordnung, die aus einer Selen-Sperrschichtphotozelle, einemMollschen Spiegelgalvanometer und einem Monochromator besteht, ist sehr geeignet das Absorptionsspektrum der photosensiblen Substanz der Netzhaut ohne die Gefahr der Bleichung während der Messung zu bestimmen. Mit diesen Meßgeräten wurde die spektrale Absorption des mit früheren, sowie neuerlich von mir benutzten Extraktionsmitteln hergestellten Sehpurpurs und des Sehgelb genauer und viel schneller als

  10. alpha,alpha-Difluoro-beta-aminodeoxystatine-containing renin inhibitory peptides.

    PubMed

    Thaisrivongs, S; Schostarez, H J; Pals, D T; Turner, S R

    1987-10-01

    The preparations of sodium 4(S)-[(tert-butyloxycarbonyl)amino]-2,2-difluoro-3(S)- and -3(R)-[(4-methoxyphenyl)amino]-6-methylheptanoates (7a and 7b) from sodium 4(S)-[(tert-butyloxycarbonyl)amino]-2,2-difluoro-3(R)- and -3(S)-hydroxy-6-methylheptanoates (1a and 1b) are described. The key step involves the stereospecific intramolecular displacement via a Mitsunobu reaction for the conversion of a beta-hydroxy hydroxamate to a beta-lactam ring. Compounds 7a and 7b are useful as synthetic intermediates for the preparation of enzyme inhibitors that contain 3(S),4(S)- and 3(R),4(S)-diamino-2,2-difluoro-6-methylheptanoic acid inserts. Angiotensinogen analogues VII and VIII that contain these novel amino analogues of difluorostatine were shown to be inhibitors of the enzyme renin. The alpha,alpha-difluoro-beta-aminodeoxystatine-containing compounds were shown to be weaker inhibitors than the corresponding difluorostatine-containing congeners. PMID:3309315

  11. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  12. Targeted alpha therapy for cancer

    NASA Astrophysics Data System (ADS)

    Allen, Barry J.; Raja, Chand; Rizvi, Syed; Li, Yong; Tsui, Wendy; Zhang, David; Song, Emma; Qu, Chang Fa; Kearsley, John; Graham, Peter; Thompson, John

    2004-08-01

    Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1-1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 µCi in human patients are effective in regressing melanomas, with no concomitant complications. These results point to the application of local and systemic TAT in the management of secondary cancer. Results of the phase 1 clinical trial of TAT of subcutaneous, secondary melanoma indicate proof of the principle that TAT can make tumours in patients regress.

  13. [Cardiovascular complications of alpha interferon].

    PubMed

    Le Corguillé, Monika; Pochmalicki, Gilbert; Eugène, Claude

    2007-12-01

    Interferon-alpha is a biological response modifier with antiviral and tumoral effect that is used in the treatment of chronic viral hepatitis. Cardiovascular complications occurred in clinical trials of interferon. The most common presentations of cardio toxicity were cardiac arrhythmia, dilated cardiomyopathy, atrial extrasystole and symptoms of ischemic heart disease, including myocardial infarction and other effects less common and dangerous: low-level conduction impairment or reversible hypertension. The physiopathology of this cardiotoxicity remains unknown, but rigorous cardiological monitoring of all patients receiving this treatment seems necessary. PMID:18176361

  14. Preferred conformation of peptides from C alpha,alpha- symmetrically disubstituted glycines: aromatic residues.

    PubMed

    Crisma, M; Valle, G; Bonora, G M; Toniolo, C; Lelj, F; Barone, V; Fraternali, F; Hardy, P M; Maia, H L

    1991-05-01

    The conformational preference of C(alpha,alpha-diphenylglycine (D-phi-g) and C(alpha,alpha)-dibenzylglycine (Dbz) residues was assessed in selected derivatives and small peptides by conformational energy computations, ir absorption, 1H-nmr, and x-ray diffraction. Conformational energy computations on the two monopeptides strongly support the view that these C(alpha,alpha)-symmetrically disubstituted glycines are conformationally restricted and that their minimum energy conformation falls in the fully extended (C5) region. The results of the theoretical analyses appear to be in agreement with the solution and crystal-state structural propensities of three derivatives and seven di- and tripeptides. PMID:1932563

  15. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  16. Sécurité au-delà des mythes et des croyances

    ScienceCinema

    None

    2011-10-06

    Présentation orale en français, support visuel en français et en anglais. La pire des failles de sécurité est l'impression de sécurité. Le décalage entre la compréhension que l?on a des technologies utilisées, et leurs potentiels réels, ainsi que l'impact potentiellement négatif qu'elles peuvent avoir sur nos vies, n'est pas toujours compris, ou pris en compte par la plupart d'entre-nous. On se contente de nos perceptions pour ne pas avoir à se confronter à la réalité... Alors qu'en est-il vraiment ? En matière de sécurité qui de l'humain ou des technologies a le contrôle ?

  17. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network. PMID:9030876

  18. Local varying-alpha theories

    NASA Astrophysics Data System (ADS)

    2015-06-01

    In a recent paper, we demonstrated how the simplest model for varying-alpha may be interpreted as the effect of a dielectric material, generalized to be consistent with Lorentz invariance. Unlike normal dielectrics, such a medium cannot change the speed of light, and its dynamics obey a Klein-Gordon equation. This work immediately suggests an extension of the standard theory, even if we require compliance with Lorentz invariance. Instead of a wave equation, the dynamics may satisfy a local algebraic relation involving the permittivity and the properties of the electromagnetic (EM) field, in analogy with more conventional dielectric (but still preserving Lorentz invariance). We develop the formalism for such theories and investigate some phenomenological implications. The problem of the divergence of the classical self-energy can be solved, or at least softened, in this framework. Some interesting new cosmological solutions for the very early universe are found, including the possibility of a bounce, inflation and expansion with a loitering phase, all of which are induced by early variations in alpha.

  19. Alpha decay properties of light einsteinium isotopes

    Microsoft Academic Search

    Hatsukawa Yuichi; Ohtsuki Tsutomu; Sueki Keisuke; Nakahara Hiromichi; Kohno Isao; Magara Masaaki; Shinohara Nobuo; Howard L. Hall; Roger A. Henderson; Carolyn M. Gannet; John A. Leyba; Robert B. Chadwick; Kenneth E. Gregorich; Diana Lee; Matti J. Nurmia; Darleane C. Hoffman

    1989-01-01

    The light einsteinium isotopes, with mass numbers 249, 248, 247, 246, 245 and 243, were produced by irradiating 249Cf with protons, 238U with 14N, 237Np with 12C and 233U with 14N, and have been studied by means of alpha-ray spectroscopy. An analysis of the complex alpha-peaks of the einsteinium isotopes gave new alpha-branchings. The tentative assignments of 7\\/2+ --> 7\\/2+,

  20. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  1. On alpha heating in toroidal devices

    Microsoft Academic Search

    G. H. Miley

    1979-01-01

    Studies of the alpha particle losses and heating profiles for an alpha-heated TFTR-sized tokamak and a small field-reversed mirror reactor (FRM) are presented. The slowing-down and drift of high-energy alpha particles, including detailed orbital effects, is approximated for tokamak geometry using the SYMALF multi-energy-angle code. Results of the calculation for a beam-driven TFTR-type plasma indicate that, except for the center

  2. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K. (Idaho Falls, ID); Martz, Dowell E. (Grand Junction, CO)

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  3. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  4. cap alpha. -Particle confinement in compact tori

    SciTech Connect

    Bozhokin, S.V.

    1986-11-01

    The motion of high-energy ..cap alpha.. particles in compact tori is studied. The classically accessible regions of motion of charged particles are found. The conditions are formulated under which the ..cap alpha.. particles produced in fusion reactions are absolutely confined. An ..cap alpha.. particle starting in a region enclosed by a ''critical'' surface will never, in the course of its motion, intersect the separatrix of a compact torus. These critical surfaces are constructed. The ratio of the volume of absolute ..cap alpha.. confinement to the total volume of a compact torus is calculated as a function of the magnetic field strength and the dimensions of the compact torus.

  5. Amlioration des plantes Evolution des caractristiques de la graine

    E-print Network

    Paris-Sud XI, Université de

    'évolution de l'humidité du capitule et des graines de 25 variétés de tournesol (Helianthus annuus L.), de la of 25 sunflower (Helianthus annuus L.) varieties were followed from flowering to maturity, the oil

  6. Structure des disques d'accretion autour des etoiles jeunes

    E-print Network

    `eme solaire et de la terre 98% du moment - 0.2% de la masse formation des exoplan`etes And = ´Etudier l`eles de disque stationnaires Couplage hydrostatique-rayonnement, sans B. multi- gris 2 couches 1 couche

  7. Introduction to DES Overview of the DES Algorithm

    E-print Network

    under influence of the National Security Agency (NSA), the design criteria for DES have not been of Standards and Technology (NIST) · Most popular block cipher for most of the last 30 years. · By far best

  8. Ecophysiologie Vitesse d'mission des feuilles des brins matres

    E-print Network

    Paris-Sud XI, Université de

    conditionnement initial des plantules. Hordeum vulgare L = orge / phyllochrone / altitude / type de tallage these fators seem to act through an initial conditioning of the seedlings. Hordeum vulgare L / leaf emergence

  9. EEG alpha power and alpha power asymmetry in sleep and wakefulness.

    PubMed

    Benca, R M; Obermeyer, W H; Larson, C L; Yun, B; Dolski, I; Kleist, K D; Weber, S M; Davidson, R J

    1999-07-01

    Asymmetry of waking electroencephalography (EEG) alpha power in frontal regions has been correlated with waking emotional reactivity and the emotional content of dream reports. Little is known regarding alpha asymmetry during sleep. The present study was performed to compare alpha power and alpha power asymmetry in various brain regions across states of sleep and wakefulness. Waking and sleep EEG were recorded in a group of patients undergoing polysomnographic evaluation for possible sleep disorders. Alpha EEG asymmetry in frontal and temporal regions was significantly correlated in waking versus sleep, particularly during rapid eye movement (REM) sleep. These results suggest that patterns of frontal alpha asymmetry are stable across sleep and waking and may be related to emotional reactivity during dreaming. During sleep, alpha power was highest during slow-wave sleep and lowest during REM sleep. Implications of these data for understanding the functional significance of alpha power during waking and sleeping are considered. PMID:10432792

  10. Factorisons la gestion des vnements des applications interactives !

    E-print Network

    , des périphériques d'entrée/sortie autre que le clavier ou la souris. Afin de pouvoir implémenter et plusieurs composants: un premier pour les éléments classiques d'interface graphique (e.g. Motif), un deuxième pour les éléments plus spécifiques (e.g. OpenGL), un troisième pour la communication avec des

  11. /sup 20/Ne(. cap alpha. ,2. cap alpha. )/sup 16/O reaction

    SciTech Connect

    Sharma, N.R.; Jain, B.K.; Shyam, R.

    1988-02-01

    The /sup 20/Ne(..cap alpha..,2..cap alpha..)/sup 16/O reaction at 140 MeV incident energy is analyzed in the framework of the distorted-wave impulse approximation. The bound state ..cap alpha.. wave functions in /sup 20/Ne are generated using the orthogonal condition model. The predicted results agree with the experimental data. They are also in rough accord with the results obtained with the Woods-Saxon ..cap alpha.. wave function.

  12. Preparation of 9-alpha,11-xi-tritiated 17-alpha-ethynylestradiol, mestranol, estradiol-alpha-17-beta, and norethindrone.

    PubMed

    Rao, P N

    1971-08-01

    The preparation of 9alpha, 11xi-tritiated 17alpha-ethinyl estradiol, mestranol, estradiol-17beta, and norethindrone are described. Estrone-3-methyl ether was employed as starting material, and ethinylation with lithium acetylide-ethylene diamine resulted in 95% mestranol. Demethylation of mestranol with boron tribromide at 0 degrees resulted in 92% 17alpha-ethinyl estradiol. Dimethylsulfoxide was the choice of reagent for the condensation reaction which was complete at room temperature in about 4 hours. The usually less than 3% of unreacted 17-oxo product was removed by Girard separation. Demethylation of methyl ether with boran tribromide in methylene chloride resulted in an excellent yield of 17alpha-ethinyl estradiol-9alpha, 11xi-tritium. 3-methoxyestra-1,3,5-trien-17-one-9alpha, 11xi-tritium was reduced with sodium bis(2-methoxyethoxy) aluminum hydride to the 17beta-hydroxy compound and subsequent demethylation resulted in estradiol-9alpha, 11xi-tritium. The general method of Ringold et al was employed for the preparation of 17beta-hydroxy-17alpha-ethinylestr-4-en-3-one. Improvements for small scale radiosynthesis are also presented. PMID:5126820

  13. Fiche technique Dtail des panneaux

    E-print Network

    - Biodiversité des cultures Panneau 4 - Paysage à Madagascar Panneau 5 - Labour d'un champ au Maroc Panneau 6 9 - Récolte d'un essaim d'abeilles au Maroc Panneau 10 - L'innovation en marche Panneau 11

  14. Information -Communication Communication des entreprises

    E-print Network

    Sart, Remi

    Information - Communication 2 PARCOURS Communication des entreprises Communication et solidarité;2 Information - Communication UFR Langues Appliquées, Commerce et Communication PRÉSENTATION Objectifs La Licence Information et communication est destinée aux étudiants qui souhaitent suivre un parcours

  15. Die fermentative Spaltung des Acetylcholins

    Microsoft Academic Search

    R. Ammon

    1934-01-01

    Zusammenfassung Es wird eine neue Methode zum Nachweis des Fermentes, das Acetylcholin in Cholin und Essigsäure hydrolysiert, die Cholinesterase, beschrieben. Das Verfahren ist nach derWarburgschen Methode aufgebaut.

  16. PERFORMANCE DES ORGANISATIONS TRANSVERSALES HOSPITALIERES

    E-print Network

    Boyer, Edmond

    organizations, the Mobile Geriatrics Teams (MGTs). The findings draw on action research involving the 14 MGTs, Intangible Capital, Mobile Geriatrics Teams. Au cours des années 2000, le législateur a affirmé sa volonté d

  17. Thorie des ensembles 1. Motivation

    E-print Network

    Dolecki, Szymon

    , comme Georg Cantor (1845-1918), Giuseppe Peano (1858-1932), Bertrand Russell (1872-1970) et autres. Nous de la démonstration (2). Figure I.1. Georg Cantor, Giuseppe Peano et Bertrand Russell La plupart des

  18. Cross-talk between integrins {alpha}1{beta}1 and {alpha}2{beta}1 in renal epithelial cells

    SciTech Connect

    Abair, Tristin D. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Sundaramoorthy, Munirathinam; Chen, Dong [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Heino, Jyrki [Department of Biochemistry and Food Chemistry, University of Turku, Turku (Finland); Ivaska, Johanna [VTT Technical Research Centre of Finland, Medical Biotechnology, Turku (Finland); Hudson, Billy G. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Sanders, Charles R. [Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Pozzi, Ambra [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Zent, Roy [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 37232 (United States)], E-mail: roy.zent@vanderbilt.edu

    2008-11-15

    The collagen-binding integrins {alpha}1{beta}1 and {alpha}2{beta}1 have profoundly different functions, yet they are often co-expressed in epithelial cells. When both integrins are expressed in the same cell, it has been suggested that {alpha}1{beta}1 negatively regulates integrin {alpha}2{beta}1-dependent functions. In this study we utilized murine ureteric bud (UB) epithelial cells, which express no functionally detectable levels of endogenous integrins {alpha}1{beta}1 and {alpha}2{beta}1, to determine the mechanism whereby this regulation occurs. We demonstrate that UB cells expressing integrin {alpha}2{beta}1, but not {alpha}1{beta}1 adhere, migrate and proliferate on collagen I as well as form cellular cords in 3D collagen I gels. Substitution of the transmembrane domain of the integrin {alpha}2 subunit with that of {alpha}1 results in decreased cell adhesion, migration and cord formation. In contrast, substitution of the integrin {alpha}2 cytoplasmic tail with that of {alpha}1, decreases cell migration and cord formation, but increases proliferation. When integrin {alpha}1 and {alpha}2 subunits are co-expressed in UB cells, the {alpha}1 subunit negatively regulates integrin {alpha}2{beta}1-dependent cord formation, adhesion and migration and this inhibition requires expression of both {alpha}1 and {alpha}2 tails. Thus, we provide evidence that the transmembrane and cytoplasmic domains of the {alpha}2 integrin subunit, as well as the {alpha}1 integrin subunit, regulate integrin {alpha}2{beta}1 cell function.

  19. JUS 13331 (*,) THESE DE DOCTORATDEL 'ECOLENATIONALE DES PONTS ET CHAUSSEES

    E-print Network

    Paris-Sud XI, Université de

    JUS 13331 (*,) THESE DE DOCTORATDEL 'ECOLENATIONALE DES PONTS ET CHAUSSEES Spécialité Central des Ponts et Chaussées. Je remercie Monsieur Jean-François COSTE, Directeur du Laboratoire Central des Ponts et Chaussées, Monsieur Alain BONNET, Directeur des Actions Scientifiques et Techniques

  20. DTERMINATION DE LA TENEUR EN CIRE MICROCRISTALLINE DES MLANGES

    E-print Network

    Paris-Sud XI, Université de

    obtenus au cours des différentes opérations de raffinage des huiles lu- brifiantes de pétrole. Des microcristallines étant obtenues en grande partie au cours du raffinage des huiles, un contenu huileux subsiste avec

  1. Beiträge zur Geochemie des Kupfers

    Microsoft Academic Search

    K. H. Wedepohl

    1962-01-01

    Zusammenfassung  Das Cu kommt in häufigen Eruptivgesteinen nicht wie das Pb und Zn großenteils im Gitter der mineralischen Hauptbestandteile, sondern als Kupferkies vor (Proportionalität zwischen Cu- und S-Werten). Basaltische Gesteine haben wesentlich höhere Kupfergehalte (Mittel: 88 ppm = g\\/t Cu) als granitische (Mittel: 8 ppm Cu). Das Verhalten des Cu bei der Verwitterung und hydrothermalen Gesteinszersetzung und die Begrenzung des Transports

  2. Alpha-1 Antitrypsin Deficiency: It's All in the Family

    MedlinePLUS

    Alpha-1 Antitrypsin Deficiency: It’s All in the Family 1 ALPHA-1 FOUNDATION The Alpha-1 Foundation is committed to finding a cure for Alpha-1 Antitrypsin ... health choices. Be tested for Alpha-1: It’s all in the family. For more information, call the ...

  3. Solution conformation of a neuronal nicotinic acetylcholine receptor antagonist {alpha}-conotoxin OmIA that discriminates {alpha}3 vs. {alpha}6 nAChR subtypes

    SciTech Connect

    Chi, Seung-Wook [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of)]. E-mail: khhan600@kribb.re.kr

    2006-06-23

    {alpha}-Conotoxin OmIA from Conus omaria is the only {alpha}-conotoxin that shows a {approx}20-fold higher affinity to the {alpha}3{beta}2 over the {alpha}6{beta}2 subtype of nicotinic acetylcholine receptor. We have determined a three-dimensional structure of {alpha}-conotoxin OmIA by nuclear magnetic resonance spectroscopy. {alpha}-Conotoxin OmIA has an '{omega}-shaped' overall topology with His{sup 5}-Asn{sup 12} forming an {alpha}-helix. Structural features of {alpha}-conotoxin OmIA responsible for its selectivity are suggested by comparing its surface characteristics with other functionally related {alpha}4/7 subfamily conotoxins. Reduced size of the hydrophilic area in {alpha}-conotoxin OmIA seems to be associated with the reduced affinity towards the {alpha}6{beta}2 nAChR subtype.

  4. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  5. Plasma alpha natriuretic peptide in cardiac impairment

    Microsoft Academic Search

    A M Richards; J G Cleland; G Tonolo; G D McIntyre; B J Leckie; H J Dargie; S G Ball; J I Robertson

    1986-01-01

    Regional plasma alpha human atrial natriuretic peptide concentrations were measured, and their relation to intracardiac pressures assessed, in an unselected series of 45 patients undergoing diagnostic cardiac catheterisation. Arteriovenous gradients in plasma concentrations of alpha human atrial natriuretic peptide were consistent with its cardiac secretion and its clearance by the liver and kidneys. Plasma concentrations of the peptide in the

  6. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco...ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at 752mm...

  7. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco...ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at 752mm...

  8. Alpha high-power chemical laser program

    Microsoft Academic Search

    Richard Ackerman; David Callahan; Anthony J. Cordi; Henry Lurie; Matthew Thomson

    1995-01-01

    Alpha is a megawatt-class hydrogen fluoride, continuous wave, space based chemical laser brassboard which demonstrates and validates technology for space-based applications. It consists of a cylindrical gain generator that exhausts radially outward through circumferential nozzles forming an annular lasing media and an annular ring resonator, which extracts the laser energy. Technical innovations first demonstrated on Alpha include: (1) use of

  9. Search for Trapped Antihydrogen ALPHA Collaboration

    E-print Network

    Fajans, Joel

    Search for Trapped Antihydrogen ALPHA Collaboration G.B. Andresena , M.D. Ashkezarib , M. BaqueroDepartment of Physics, Swansea University, Swansea SA2 8PP, United Kingdom eInstituto de F´isica, Universidade Federal to search for trapped antihydrogen atoms with the ALPHA antihydrogen trap at the CERN Antiproton Decelerator

  10. Orbiting mechanism in alpha-40Ca scattering

    Microsoft Academic Search

    I. Parija; R. K. Satpathy; C. S. Shastry

    1984-01-01

    The large angle oscillations in several cases of alpha-40Ca scattering are examined in terms of orbital amplitude and the background amplitude interference using the approach developed recently to analyze 16O-28Si scattering. [NUCLEAR REACTIONS alpha-40Ca scattering, anomalous large angle scattering, orbiting phenomena.

  11. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  12. Meta-Analysis of Coefficient Alpha

    ERIC Educational Resources Information Center

    Rodriguez, Michael C.; Maeda, Yukiko

    2006-01-01

    The meta-analysis of coefficient alpha across many studies is becoming more common in psychology by a methodology labeled reliability generalization. Existing reliability generalization studies have not used the sampling distribution of coefficient alpha for precision weighting and other common meta-analytic procedures. A framework is provided for…

  13. TF ripple loss of fast alphas

    SciTech Connect

    Hively, L.M.

    1987-02-06

    Viewgraphs from this presentation are given. The topics covered included: (1) previous work on background plasma, fast ion transport - MeV alphas, neutral beam ions, and rf heated tail ion; (2) important results; (3) alpha loss calculations; and (4) unresolved issues. (MOW)

  14. Modlisation didactique et informatique des connaissances des lves en algbre Marie-Caroline Croset MMOIRE DE MASTER 2 RECHERCHE

    E-print Network

    Boyer, Edmond

    Modélisation didactique et informatique des connaissances des élèves en algèbre Marie-Caroline Croset MÉMOIRE DE MASTER 2 RECHERCHE ENVIRONNEMENTS INFORMATIQUES D'APPRENTISSAGE HUMAIN ET DIDACTIQUE UNIVERSITE JOSEPH FOURIER Modélisation didactique et informatique des connaissances des élèves en algèbre

  15. Microbial transformations of alpha-santonin.

    PubMed

    Ata, Athar; Nachtigall, Jason A

    2004-01-01

    Fungal biotransformations of alpha-santonin (1) were conducted with Mucor plumbeus (ATCC 4740), Cunninghamella bainieri (ATCC 9244), Cunninghamella echinulata (ATCC 9245), Curvularia lunata (ATCC 12017) and Rhizopus stolonifer (ATCC 10404). Rhizopus stolonifer (ATCC 10404) metabolized compound 1 to afford 3,4-epoxy-alpha-santonin (2) and 4,5-dihydro-alpha-santonin (3) while Cunninghamella bainieri (ATCC 9244), Cunninghamella echinulata (ATCC 9245) and Mucor plumbeus (ATCC 4740) were capable of metabolizing compound 1 to give a reported metabolite, 1,2-dihydro-alpha-santonin (4). The structures of these transformed metabolites were established with the aid of extensive spectroscopic studies. These fungi regiospecifically reduced the carbon-carbon double bond in ring A of alpha-santonin. PMID:15241928

  16. Altération des sulfures des granulats dans les chaussées

    NASA Astrophysics Data System (ADS)

    Jigorel, A.; Jauberthie, R.

    2002-07-01

    Sulfides present in hornsfeld aggregates, used in light pavanent construction in contact with humid air alter rapidly. Crystallisation of sulfates at the interface of bitumastic material and sub-base creates serious problems (intumescence and crazing) that can lead to a total reconstruction of the project (roads, sidewalks, sports areas, etc). The sulfides in the aggregates and the sulfates produced due to alteration are studied by SEM and XRD. The results show that the intensity of this phenomenon is linked to the nature and the crystallinity of the sulfides. The evolution of the sulfates formed during this alteration process is slow and complex. In new pavements (3 years) the sulfates have a pulverised appearance and consist mostly of epsomite, associated with pickeringite and halotrichite. In older pavements (20 years) the sulfates form a fibrous concretion consisting of pickeringite and small quantities of halotrichite. Les sulfures présents dans les granulats élaborés à partir de cornéen nes s'altèrent rapidement dans les chaussées légères en présence d'air humide. La cristallisation des sulfates à l'interface enrobé-couche de fondation crée des désordres si importants (intumescences, faiençage) qu'il est bien souvent nécessaire d'assurer la réfection totale des ouvrages (routes, trottoirs, plateaux sportifs...). Les sulfures des granulats et les sulfates issus du processus d'altération ont été étudiés par diffractométrie X et examen su Microscope Electronique à Balayage équipé de microanalyse X. Les résultats montrent que !intensité des désordres est liée à la nature et à la cristallinité des sulfures. Les sulfates formés évoluent su cours du processus d'altération qui est long et complexe. Dans les chaussées récentes (3 ans) ils ont un aspect pulvérulent et sont constitués d'epsomite dominante associée à de la pickeringite et à de l'halotrichite. Dans les chaussées plus anciennes (20 ans) ils forment des concrétions fibreuses constituées de pickeringite et d'une faible quantité d'halotrichite.

  17. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn [Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology, Emory University, School of Medicine, Atlanta, Georgia (United States)] [Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology, Emory University, School of Medicine, Atlanta, Georgia (United States); Stevens, Victoria L. [Epidemiology and Surveillance Research, American Cancer Society, Atlanta, Georgia (United States)] [Epidemiology and Surveillance Research, American Cancer Society, Atlanta, Georgia (United States); Owens, Timothy R. [Emory University, School of Medicine, Atlanta, Georgia (United States)] [Emory University, School of Medicine, Atlanta, Georgia (United States); Oyesiku, Nelson M., E-mail: noyesik@emory.edu [Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology, Emory University, School of Medicine, Atlanta, Georgia (United States)

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  18. Molecular modeling of the alpha9alpha10 nicotinic acetylcholine receptor subtype.

    PubMed

    Pérez, Edwin G; Cassels, Bruce K; Zapata-Torres, Gerald

    2009-01-01

    This study reports the comparative molecular modeling, docking and dynamic simulations of human alpha9alpha10 nicotinic acetylcholine receptors complexed with acetylcholine, nicotine and alpha-conotoxin RgIA, using as templates the crystal structures of Aplysia californica and Lymnaea stagnalis acetylcholine binding proteins. The molecular dynamics simulations showed that Arg112 in the complementary alpha10(-) subunit, is a determinant for recognition in the site that binds small ligands. However, Glu195 in the principal alpha9(+), and Asp114 in the complementary alpha10(-) subunit, might confer the potency and selectivity to alpha-conotoxin RgIA when interacting with Arg7 and Arg9 of this ligand. PMID:19013796

  19. What Does It Mean to Be an Alpha-1 Carrier?

    MedlinePLUS

    ... Alpha-1 link. RESOURCES Alpha-1 Foundation Toll Free: (877) 228-7321 • www.alpha1.org The not-for-profit Foundation provides resources, education, and information on testing and diagnosis for healthcare ...

  20. Local structure and vibrational properties of alpha-Pu, alpha-Uand the alpha-U charge density wave

    SciTech Connect

    Nelson, E.J.; Allen, P.G.; Blobaum, K.J.M.; Wall, W.A.; Booth, C.H.

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure a-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}{prime}-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}{prime}-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  1. Modélisation des boucles d'immunisation magnétique des navires

    NASA Astrophysics Data System (ADS)

    Le Dorze, F.; Bongiraud, J. P.; Coulomb, J. L.; Meunier, G.; Brunotte, X.

    1998-02-01

    This paper presents the problem of the three-dimensional modeling of degaussing coils in ships with a finite elements method. We show that these current coils are so close to the ferromagnetic sheets of the ship that they require a local very fine mesh which would be unrealistic for the whole complex structure of a real ship. We propose an alternative to the expensive mesh refinement called "reduced scalar potential jump”. The idea is to previously solve the local problem by another method and to use the result in the whole FEM modelling. We present the method of implementation in the FEM software FLUX3D and comparative results on a simple geometry. Cet article présente le problème de la modélisation en trois dimensions des boucles d'immunisation des navires par la méthode des éléments finis. Nous montrons que ces boucles de courant sont si proches des tôles ferromagnétiques du navire que leur modélisation requiert un maillage localement très fin, ce qui est irréaliste pour la structure complexe d'un navire réel. Nous proposons une alternative à ce coûteux affinage du maillage, appelée "saut de potentiel réduit”. L'idée est de résoudre au préalable le problème local par une autre méthode que les éléments finis et d'utiliser le résultat dans la modélisation globale. Nous présentons la méthode utilisée pour l'implantation de cette technique dans le logiciel d'éléments finis FLUX3D, et des résultats comparatifs sur une géométrie simple.

  2. Impact de l'augmentation de la volatilit des prix des commodits sur les coopratives Sabine TRGUER

    E-print Network

    Paris-Sud XI, Université de

    Impact de l'augmentation de la volatilité des prix des commodités sur les coopératives laitières Sabine TRÉGUER Janvier 2008 Résumé L'envolée actuelle des prix des matières premières agricoles a des, a augmenté de près de 70% en un an. Cette augmentation du prix des produits industriels laitiers, répercutée

  3. Belles captives : une histoire des zoos du ct des btes Eric Baratay

    E-print Network

    Boyer, Edmond

    Belles captives : une histoire des zoos du côté des bêtes Eric Baratay Les artistes ont beaucoup représenté les bêtes exposées dans les zoos, se passionnant pour leurs beautés, leurs formes (fig. 147'émergeaient des interrogations sur la légitimité des zoos. Max Slevogt (fig. 150) et Otto Dill (Tigres dans une

  4. Universit des sciences et technologies de Lille cole Doctorale des Sciences Pour l'Ingnieur

    E-print Network

    Paris-Sud XI, Université de

    Université des sciences et technologies de Lille École Doctorale des Sciences Pour l'Ingénieur Thèse pour obtenir le grade de Docteur de l'Université des sciences et technologies de Lille EN'université Droit et Santé de Lille (Lille II) M. Salah Maouche - Professeur à l'Université des Sciences et

  5. Structure, caractrisation et comportement mcanique des failles sismiques : Etude des pseudotachylites et gouges

    E-print Network

    Demouchy, Sylvie

    Structure, caractérisation et comportement mécanique des failles sismiques : Etude des pseudotachylites et gouges Résumé L'objectif de ce projet est de mieux caractériser la structure et la formation des processus de formation des failles actives en prenant comme objet d'étude les gouges de failles et

  6. L'Observatoire Jacques-Yves Cousteau des mers et des ctes du Mexique

    E-print Network

    L'Observatoire Jacques-Yves Cousteau des mers et des côtes du Mexique a été lancé en coopération Mer des Caraïbes, sur le Golfe du Mexique et sur le Pacifique. Son objectif est de valoriser les nécessaire pour: Identifier l'origine des changements opérés aux différentes échelles temporelles

  7. LA DIFFUSION DES NEUTRONS Physique des Solides, Universit Paris-Sud, 91405 Orsay, France

    E-print Network

    Boyer, Edmond

    82 LA DIFFUSION DES NEUTRONS A. GUINIER Physique des Solides, Université Paris-Sud, 91405 Orsay, France Résumé. 2014 On rappellera les bases physiques de la diffusion des neutrons en insistant sur les des neutrons liées à leur faible absorption dans la matière et leur interaction avec les moments

  8. Composition en acides amins des aliments et des rsidus de fermentation in vitro

    E-print Network

    Paris-Sud XI, Université de

    Composition en acides aminés des aliments et des résidus de fermentation in vitro M. ANTONGIOVANNI in vitro fermentation with rumen inoculum, and of the faeces relative to an in vivo digestibility trial run fermentation in vitro comme l'ont fait Dennison et Philips (1983) et des fèces. Pour des raisons de place, nous

  9. Les limites de la couverture des risques en aquaculture : le cas des

    E-print Network

    Paris-Sud XI, Université de

    EA 4272 Les limites de la couverture des risques en aquaculture : le cas des conchyliculteurs en limites de la couverture des risques en aquaculture : le cas des conchyliculteurs en France Véronique Le in defining risks in aquaculture and we propose a classification that takes the specificities into account. We

  10. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  11. Rollstuhlbasketball Rolling Devils vs. Promi-Team Im Rahmen des Sporttages des UNISPORT fand in den frhen Abendstunden des

    E-print Network

    Pinnau, René

    Rollstuhlbasketball Rolling Devils vs. Promi-Team Im Rahmen des Sporttages des UNISPORT fand in den Rolling Devils und ein Promi-Team im Rollstuhlbasketball gegenüber. Für das Team der Rolling Devils und der Erstligaspieler Viktor. Des Weiteren rollten Lukas Jung und Paul Nikolaus für die Devils an

  12. Serum TNF alpha inhibitor in mouse typhoid.

    PubMed

    Mastroeni, P; Villarreal, B; Demarco de Hormaeche, R; Hormaeche, C E

    1992-05-01

    Administration of anti-TNF alpha antiserum enhanced a sublethal infection with salmonellae of moderate virulence (Salmonella typhimurium M525) in innately susceptible (Ity(s)) BALB/c mice, indicating that TNF alpha is important in the early response which suppresses bacterial growth in the reticuloendothelial system (RES). However, only transient low levels of TNF alpha were detectable on day 3 in sera from some, but not all, sublethally infected mice. Conversely, on day 4 of the same infection, clear TNF alpha inhibitory activity was detected in some sera. Neither TNF alpha or any inhibitory activity were detected in sera of lethally infected BALB/c mice undergoing an acute, overwhelming Salmonella infection. In contrast, TNF alpha inhibitory activity, but not TNF alpha, was detected in sera of mice showing a cachectic syndrome induced by persistent high bacterial numbers following intravenous inoculation of a very high dose (2 x 10(7)) of the attenuated aro- S. typhimurium SL3261 strain. PMID:1501573

  13. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  14. Des Lacs River and Souris River

    USGS Multimedia Gallery

     The Des Lacs River coming in to the Souris River. Des Lacs River is the darker water, which is sediment and the Souris River is the lighter water. >Photo taken by USGS personnel on a Civil Air Patrol flight....

  15. Pathologie vgtale Maladies des plantes dues Rhizoctonia

    E-print Network

    Paris-Sud XI, Université de

    Pathologie végétale Maladies des plantes dues à Rhizoctonia solani (Kühn) : stratégie et techniques; Plant diseases induced by Rhizoctonia solani (Kuhn) : strategy and methods of study. Results profession agricole demandant de résoudre des problèmes posés par Rhizoctonia solani ont notablement augmenté

  16. Funktionelle Kernspintomographie des Affengehirns Logothetis, Nikos

    E-print Network

    Funktionelle Kernspintomographie des Affengehirns Logothetis, Nikos Max-Planck-Institut für Korrespondierender Autor: Logothetis, Nikos E-Mail: nikos.logothetis@tuebingen.mpg.de Zusammenfassung Unsere hand, Tätigkeitsbericht 2003 Logothetis, Nikos | Funktionelle Kernspintomographie des Affengehirns 1

  17. Gomodlisation et Informatique : Formalisation des reprsentations et

    E-print Network

    Prié, Yannick

    -francois.rainaud@ifp.fr Laura S. Mastella Petrobras 330, Republica do Chile 20031 Rio de Janeiro Brésil laura.mastella@ petrobras.com.br RESUME Dans les projets d'ingénierie associant des experts métier et des informaticiens

  18. Jahresberichte 1992 und 1993 des Lehrstuhls

    E-print Network

    Weske, Mathias

    Jahresberichte 1992 und 1993 des Lehrstuhls ``Theoretische Informatik'' (Prof. Dr. sc. Christoph Meinel) Fachbereich IV -- Informatik Universit¨ at Trier Universit¨ atsring 15 D­54286 Trier #12; Jahresberichte 1992 und 1993 des Lehrstuhls ``Theoretische Informatik'' (Prof. Dr. sc. Christoph Meinel

  19. DPARTEMENT D'INFORMATIQUE Facult des sciences

    E-print Network

    Spino, Claude

    DÉPARTEMENT D'INFORMATIQUE Faculté des sciences GGuuiiddee ddeess ééttuuddeess ddee 22ee eett 33ee...............................................................................................................................3 1.1 Les études supérieures au Département d'informatique............................................................................................6 4 Gestion des études supérieures au Département d'informatique

  20. Glucosylation of alpha-butyl- and alpha-octyl-D-glucopyranosides by dextransucrase and alternansucrase from Leuconostoc mesenteroides.

    PubMed

    Richard, Gaëtan; Morel, Sandrine; Willemot, René-Marc; Monsan, Pierre; Remaud-Simeon, Magali

    2003-04-22

    For the first time, glucosylation of alpha-butyl- and alpha-octylglucopyranoside was achieved using dextransucrase (DS) of various specificities, and alternansucrase (AS) from Leuconostoc mesenteroides. All the glucansucrases (GS) tested used alpha-butylglucopyranoside as acceptor; in particular, DS produced alpha-D-glucopyranosyl-(1-->6)-O-butyl-alpha-D-glucopyranoside and alpha-D-glucopyranosyl-(1-->6)-alpha-D-glucopyranosyl-(1-->6)-O-butyl-alpha-D-glucopyranoside. In contrast, alpha-octylglucopyranoside was glucosylated only by AS which was shown to be the most efficient catalyst. The conversion rates, obtained with this enzyme at sucrose to acceptor molar ratio of 2:1 reached 81 and 61% for alpha-butylglucopyranoside and alpha-octylglucopyranoside, respectively. Analyses obtained from liquid chromatography coupled with mass spectrometry revealed that different series of alpha-alkylpolyglucopyranosides regioisomers of increasing polymerization degree can be formed depending on the specificity of the catalyst. PMID:12681910

  1. High precision {sup 89}Y({alpha},{alpha}){sup 89}Y scattering at low energies

    SciTech Connect

    Kiss, G. G.; Fueloep, Zs.; Gyuerky, Gy.; Elekes, Z.; Somorjai, E. [Institute of Nuclear Research (ATOMKI), H-4001 Debrecen (Hungary); Mohr, P. [Diakonie-Klinikum, D-74523 Schwaebisch Hall (Germany); Galaviz, D. [Instituto de Estructura de la Materia, CSIC, E-28006 Madrid (Spain); Kretschmer, A.; Sonnabend, K. [Institut fuer Kernphysik, Technische Universitaet Darmstadt, D-64289 Darmstadt (Germany); Zilges, A. [Institut fuer Kernphysik, Universitaet zu Koeln, D-50937 Koeln (Germany); Avrigeanu, M. [Horia Hulubei National Institute for Physics and Nuclear Engineering, RO-76900 Bucharest (Romania)

    2009-10-15

    Elastic scattering cross sections of the {sup 89}Y({alpha},{alpha}){sup 89}Y reaction have been measured at energies E{sub c.m.}=15.51 and 18.63 MeV. The high-precision data for the semimagic N=50 nucleus {sup 89}Y are used to derive a local potential and to evaluate the predictions of global and regional {alpha}-nucleus potentials. The variation of the elastic {alpha}-scattering cross sections along the N=50 isotonic chain is investigated by a study of the ratios of angular distributions for {sup 89}Y({alpha},{alpha}){sup 89}Y and {sup 92}Mo({alpha},{alpha}){sup 92}Mo at E{sub c.m.}{approx_equal}15.51 and 18.63 MeV. This ratio is a very sensitive probe at energies close to the Coulomb barrier, where scattering data alone is usually not enough to characterize the different potentials. Furthermore, {alpha}-cluster states in {sup 93}Nb={sup 89}Y x {alpha} are investigated.

  2. Über das sogenannte Bauchdeckenhämatom des vorgerückten Lebensalters

    Microsoft Academic Search

    K. Blond

    1924-01-01

    Ftir die subkutanen Rupturen der Artcria epigastric~ und ihrer Aste oder des Musculus rectus finder man in der Literatur keine einheitliche Nomenklatur. Der Symptomenkomplex ist unter den )\\/amen Spontanruptur des :Rectus abdominis, Ruptur der Arteria epigastric~ oder spontanes Bauehdeckenhs zusammengefa6t. Wohlgemuth nennt c[as Leiden subkutane Ruptur des Mttsculus rectus abdominis. Hilgenreiner spricht von dem spontanen Bauchdeckenh~tma~om des worgertickten Alters und

  3. Les attitudes des ménages : leur signification

    Microsoft Academic Search

    Philippe lHardy

    1976-01-01

    [fre] Les attitudes des ménages : leur signification - Instrument privilégié d'analyse conjoncturelle, l'enquête de l'INSEE sur les « attitudes et intentions d'achats des particuliers» cherche également à connaître l'opinion des ménages sur la situation économique française récente et future. A la lumière d'une expérience de plus de quinze années, l'auteur, rapprochant l'évolution observée des opinions émises, s'interroge sur la

  4. Histaminausschüttende und antiallergischen Wirkung des Insulinshocks

    Microsoft Academic Search

    Heinrich Bartelheimer; Theodor Afendulis

    1938-01-01

    Zusammenfassung  Nachdem von uns in früheren Versuchen festgestellt worden war, daß Insulinshocks den anaphylaktischen Shock des Meerschweinchens\\u000a aufheben oder ihn in hemmendem Sinne beeinflussen, ließ sich jetzt zeigen, daß diese antiallergische Wirkung nicht durch den\\u000a Eiweißcharakter des Insulins oder etwa vorhandene Begleitsubstanzen erfolgt. Auch eine hemmend wirkende Veränderung im Tonus\\u000a des vegetativen Nervensystems während des Insulinshocks konnte, wenigstens beim Meerschweinchen, unwahrscheinlich

  5. Rentre des tudiants UNIVERSIT BLAISE PASCAL

    E-print Network

    Sart, Remi

    Rentrée des étudiants étrangers UNIVERSIT� BLAISE PASCAL www.univ-bpclermont.fr COMMUNIQU� DE PRESSE Accueil des étudiants étrangers de l'Université Blaise Pascal Les échanges internationaux, chaque année, l'université Blaise Pascal envoie des étudiants à l'étranger et accueille des étudiants d

  6. Neurologie et neuropathologie des tigres en captivité

    Microsoft Academic Search

    Ludo Bogaert; Amico Bignami

    1964-01-01

    1.Chez un tigre adulte, on a observé des signes de néphrite avec crises d'épilepsie, peut être des hallucinations visuelles, des mouvements de manège, un nystagmus, un syndrome méningé à prédominance cervico-thoracique avec opisthotonos et finalement une paralysie de l'avant-train. Il existait un engainement des vaisseaux rétiniens sans exsudats. Evolution en dix semaines avec cachexie importante.2.A l'examen anatomique: méningoencéphalite avec épendymite

  7. The alpha decay of deformed superheavy elements

    E-print Network

    M. Kowal; Z. Lojewski

    2003-04-09

    The interaction potential between the alpha particle and the deformed parent nucleus was used for description of the decay of superheavy nuclei. It consists of centrifugal, nuclear and Coulomb parts suitably modified for deformed nuclei. The significant effect of various shapes of barriers obtained for deformed parent nuclei on calculated alpha half-life times were shown. The finally calculated half-life times due to the spontaneous alpha decay for superheavy elements were compared with the results obtained from other models and the experimental data.

  8. Le prix des attributs du logement

    Microsoft Academic Search

    Jean Cavailhès

    2005-01-01

    [fre] La méthode des « prix hédonistes » permet d'estimer le prix des différents attributs d'un logement (taille, confort, environnement proche ou lointain, etc.) à partir de son prix global. De tels prix ont été estimés pour 1996 pour le secteur locatif libre des villes, de leurs banlieue et de leurs couronnes périurbaines(« aires urbaines »). Ainsi, la surface habitable

  9. Remise des Prix du recteur 2013 Flicitations

    E-print Network

    Parrott, Lael

    Communiqué Remise des Prix du recteur 2013 Félicitations à Lorraine Vaillancourt, Prix Initiative, et à l'équipe de production des Affaires publiques, Prix Coup de coeur ! La direction, le corps de la Faculté qui ont été couronnés lors de la récente remise des Prix du recteur, tenue ce mercredi

  10. N. Gorse Oct. 2003 Gestion des Processus

    E-print Network

    Mignotte, Max

    N. Gorse ­ Oct. 2003 Gestion des Processus Introduction à UNIX N. Gorse ­ Oct. 2003Introduction à ordonnanceur N. Gorse ­ Oct. 2003Introduction à UNIX 71 Gestion des Processus Définitions Processus (job, tâche mémoire N. Gorse ­ Oct. 2003Introduction à UNIX 72 Gestion des Processus Définitions Composition de l

  11. 2. PERTURBATIONS ET RECUPERATION DES FONCTIONS COGNITIVES

    E-print Network

    Paris-Sud XI, Université de

    2. « PERTURBATIONS ET RECUPERATION DES FONCTIONS COGNITIVES CHEZ LE SUJET NORMAL ET CHEZ LE SUJET «Perturbations et récupération des fonctions cognitives chez le sujet normal et chez le sujet pathologique». Ce présenter des dysfonctionnements de la cognition en dehors de toute pathologie avérée. Ces

  12. CONSEIL GENERAL DES CTES D'ARMOR

    E-print Network

    Boyer, Edmond

    CONSEIL GENERAL DES CÔTES D'ARMOR LUTTE PREVENTIVE ET CURATIVE CONTRE LA PROLIFERATION DES MAREES-Michel-en-Grève (Côtes d'Armor) _________ GEOMER ­ LETG UMR 6554 C.N.R.S. Janvier 2005 hal-00271248,version1-12Aug2014 #12;Poche du Yar 2003-2004 ­ GEOMER-UMR 6554 CNRS -1- CONSEIL GENERAL DES COTES D'ARMOR LUTTE

  13. Hb Constant Spring [alpha 142, Term-->Gln (TAA>CAA in alpha2)] in the alpha-thalassemia of anemic patients in Myanmar.

    PubMed

    Ne-Win; Harano, Keiko; Harano, Teruo; Kyaw-Shwe; Aye-Aye-Myint; Khin-Thander-Aye; Okada, Shigeru

    2008-01-01

    Hb Constant Spring (Hb CS), the gene (alpha(CS)) of which arises from a point mutation in the termination codon of the alpha2-globin gene, is the most prevalent variety of nondeletional alpha-thalassemia (alpha-thal) in Asian populations. It is a major cause of Hb H disease in compound heterozygotes who have Hb CS combined with a duplicated alpha gene deletion (--/alpha(CS)alpha), and it tends to be more severe than Hb H disease which is caused by a triple alpha gene deletion (--/-alpha). Hb CS is often missed by routine electrophoresis but not by polymerase chain reaction (PCR) methods. During alpha-thal screening and genotyping of 235 patients diagnosed by laboratory tests hemoglobin (Hb), MCV, MCH and Hb H inclusion bodies] using the gap-PCR method, 175 patients were diagnosed to be carriers of an alpha-thal gene, genotypes of which were 133 alpha-thal-2, 34 alpha-thal-1 (including one only by laboratory test) and eight with Hb H disease. Detection of the alpha(CS) gene for the carriers of alpha-thal-1 and Hb H disease was done by the mismatched PCR-RFLP (restriction fragment length polymorphism) method and the alpha(CS) gene was found in the homozygous state in an alpha-thal-1 patient and a single gene form in two Hb H disease patients. These genotypes were characterized by the PCR-sequencing method. These patients clinically presented the aspects of Hb H disease and of a homozygote form of alpha-thal-1. The description of the alpha(CS) gene in Myanmar is of great value in the development of an effective procedure for prenatal diagnosis of Hb Bart's hydrops fetalis syndrome. PMID:18932070

  14. Alpha high-power chemical laser program

    NASA Astrophysics Data System (ADS)

    Ackerman, Richard A.; Callahan, David; Cordi, Anthony J.; Lurie, Henry; Thomson, Matthew

    1995-03-01

    Alpha is a megawatt-class hydrogen fluoride, continuous wave, space based chemical laser brassboard which demonstrates and validates technology for space-based applications. It consists of a cylindrical gain generator that exhausts radially outward through circumferential nozzles forming an annular lasing media and an annular ring resonator, which extracts the laser energy. Technical innovations first demonstrated on Alpha include: (1) use of extruded aluminum components, (2) diamond turned, annular optics made of molybdenum, (3) uncooled silicon mirrors, (4) light weight optical benches, and (5) active alignment. Alpha first lased in 1989, and has repeatably demonstrated megawatt-class power and excellent beam quality. Using Alpha, TRW has demonstrated the use of low weight uncooled mirrors in very high power lasers to reduce system jitter. They have performed flawlessly and beam jitter levels were significantly reduced.

  15. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  16. Radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    McDevitt, M R; Sgouros, G; Finn, R D; Humm, J L; Jurcic, J G; Larson, S M; Scheinberg, D A

    1998-09-01

    This review discusses the application of alpha particle-emitting radionuclides in targeted radioimmunotherapy. It will outline the production and chemistry of astatine-211, bismuth-212, lead-212, actinium-225, bismuth-213, fermium-255, radium-223 and terbium-149, which at present are the most promising alpha-emitting isotopes available for human clinical use. The selective cytotoxicity offered by alpha particle-emitting radioimmunoconstructs is due to the high linear energy transfer and short particle path length of these radionuclides. Based upon the pharmacokinetics of alpha particle-emitting radioimmunoconstructs, both stochastic and conventional dosimetric methodology is discussed, as is the preclinical and initial clinical use of these radionuclides conjugated to monoclonal antibodies for the treatment of human neoplasia. PMID:9724387

  17. Genetics Home Reference: Alpha-mannosidosis

    MedlinePLUS

    ... enzyme helps break down complexes of sugar molecules (oligosaccharides) attached to certain proteins (glycoproteins). In particular, alpha-mannosidase helps break down oligosaccharides containing a sugar molecule called mannose. Mutations in ...

  18. Etude des Abondances de MG et de fe dans la Composante Stellaire des Disques des Galaxies Spirales

    NASA Astrophysics Data System (ADS)

    Beauchamp, Dominique

    Je presente ici une technique d'observation par imagerie des disques stellaires des galaxies spirales. Je tente, a l'aide d'un modele evolutif multiphase, de determiner les abondances de fer et de magnesium dans les disques. Dans ce but, je mesure les indices Mg2 et Fe5270 du systeme de Lick. Ces elements representent un choix judicieux d'indicateurs car ils sont formes par des supernovae de deux types differents ayant des durees de vie differentes. Le rapport d'abondances de ces deux elements est un indicateur du taux de formation des populations stellaires. Je decris, en premier lieu, les observations, la technique de mesure, ainsi que son application. J'analyse ensuite les indices mesures. A partir du modele multiphase, j'explore differents parametres physiques des spirales comme le taux de formation stellaire, l'evolution des abondances, les effets possibles de la presence de la barre, etc.

  19. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  20. Measurement of the angle alpha at BABAR

    SciTech Connect

    Perez, A.; /Orsay, LAL

    2009-06-25

    The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

  1. Three-alpha structures in 12C

    Microsoft Academic Search

    R. Pichler; H. Oberhummer; Attila Csótó; S. A. Moszkowski

    1997-01-01

    We search for three-alpha resonances in 12C by using the complex scaling method in a microscopic cluster model. All experimentally known low-lying natural-parity states of 12C are localized. For the first time we unambiguously show in a microscopic model that the 0+2 state in 12C, which plays an important role in stellar nucleosynthesis, is a genuine three-alpha resonance.

  2. Three-alpha structures in 12C

    Microsoft Academic Search

    P. Pichler; H. Oberhummer; Attila Csótó; S. A. Moszkowski

    1997-01-01

    We search for three-alpha resonances in 12C by using the complex scaling method in a microscopic cluster model. All experimentally known low-lying natural-parity states of 12 are localized. For the first time we unambiguously show in a microscopic model that the 02+ state in 12C, which plays an important role in stellar nucleosynthesis, is a genuine three-alpha resonance.

  3. Energy dependence of event shapes and of $\\\\alpha_s$ at LEP 2

    Microsoft Academic Search

    P. Abreu; W Adam; T Adye; P Adzic; Z Albrecht; T Alderweireld; G D Alekseev; R Alemany; T Allmendinger; P P Allport; S Almehed; Ugo Amaldi; N Amapane; S Amato; E G Anassontzis; P Andersson; A Andreazza; S Andringa; P Antilogus; W D Apel; Y Arnoud; B Åsman; J E Augustin; A Augustinus; Paul Baillon; P Bambade; F Barão; Guido Barbiellini; R Barbier; Dimitri Yuri Bardin; G Barker; A Baroncelli; Marco Battaglia; M Baubillier; K H Becks; M Begalli; A Behrmann; P Beillière; Yu A Belokopytov; K S Belous; N C Benekos; Alberto C Benvenuti; C Bérat; M Berggren; D Bertini; D Bertrand; M Besançon; F Bianchi; M Bigi; S M Bilenky; M A Bizouard; D Bloch; H M Blom; M Bonesini; W Bonivento; M Boonekamp; P S L Booth; A W Borgland; G Borisov; C Bosio; O Botner; E Boudinov; B Bouquet; C Bourdarios; T J V Bowcock; I Boyko; I Bozovic; M Bozzo; P Branchini; T Brenke; R A Brenner; P Brückman; J M Brunet; L Bugge; T Buran; T Burgsmüller; Brigitte Buschbeck; P Buschmann; S Cabrera; M Caccia; M Calvi; T Camporesi; V Canale; F Carena; L Carroll; Carlo Caso; M V Castillo-Gimenez; A Cattai; F R Cavallo; V Chabaud; M M Chapkin; P Charpentier; L Chaussard; P Checchia; G A Chelkov; R Chierici; P V Chliapnikov; P Chochula; V Chorowicz; J Chudoba; K Cieslik; P Collins; R Contri; E Cortina; G Cosme; F Cossutti; J H Cowell; H B Crawley; D J Crennell; S Crépé; G Crosetti; J Cuevas-Maestro; S Czellar; Martyn Davenport; W Da Silva; A Deghorain; G Della Ricca; P A Delpierre; N Demaria; A De Angelis; Wim de Boer; C De Clercq; B De Lotto; A De Min; L S De Paula; H Dijkstra; Lucia Di Ciaccio; J Dolbeau; K Doroba; M Dracos; J Drees; M Dris; A Duperrin; J D Durand; G Eigen; T J C Ekelöf; Gösta Ekspong; M Ellert; M Elsing; J P Engel; B Erzen; M C Espirito-Santo; E Falk; G K Fanourakis; D Fassouliotis; J Fayot; Michael Feindt; A Fenyuk; P Ferrari; A Ferrer; E Ferrer-Ribas; F Ferro; S Fichet; A Firestone; U Flagmeyer; H Föth; E Fokitis; F Fontanelli; B J Franek; A G Frodesen; R Frühwirth; F Fulda-Quenzer; J A Fuster; A Galloni; D Gamba; S Gamblin; M Gandelman; C García; C Gaspar; M Gaspar; U Gasparini; P Gavillet; E N Gazis; D Gelé; N Ghodbane; I Gil; F Glege; R Gokieli; B Golob; G Gómez-Ceballos; P Gonçalves; I González-Caballero; Gian P Gopal; L Gorn; M Górski; Yu Guz; Valerio Gracco; J Grahl; E Graziani; C Green; H J Grimm; P Gris; G Grosdidier; K Grzelak; M Günther; J Guy; F Hahn; S Hahn; S Haider; A Hallgren; K Hamacher; J Hansen; F J Harris; V Hedberg; S Heising; J J Hernández; P Herquet; H Herr; T L Hessing; J M Heuser; E Higón; S O Holmgren; P J Holt; S Hoorelbeke; M A Houlden; Josef Hrubec; K Huet; G J Hughes; K Hultqvist; J N Jackson; R Jacobsson; P Jalocha; R Janik; C Jarlskog; G Jarlskog; P Jarry; B Jean-Marie; E K Johansson; P E Jönsson; C Joram; P Juillot; F Kapusta; K Karafasoulis; S Katsanevas; E C Katsoufis; R Keränen; Borut P Kersevan; B A Khomenko; N N Khovanskii; A P Kiiskinen; B J King; A Kinvig; N J Kjaer; O Klapp; H Klein; P M Kluit; P Kokkinias; M Koratzinos; V Kostyukhin; C Kourkoumelis; O Kuznetsov; Manfred Krammer; E Kriznic; J Krstic; Z Krumshtein; P Kubinec; J Kurowska; K L Kurvinen; J Lamsa; P Langefeld; V Lapin; J P Laugier; R Lauhakangas; Gerhard Leder; F Ledroit; V Lefébure; L Leinonen; A Leisos; R Leitner; J Lemonne; Georg Lenzen; V Lepeltier; T Lesiak; M Lethuillier; J Libby; D Liko; A Lipniacka; I Lippi; B Lörstad; J G Loken; J H Lopes; J M López; R López-Fernandez; D Loukas; P Lutz; L Lyons; J N MacNaughton; J R Mahon; A Maio; A Malek; T G M Malmgren; S Maltezos; V Malychev; F Mandl; J Marco; R P Marco; B Maréchal; M Margoni; J C Marin; C Mariotti; A Markou; C Martínez-Rivero; F Martínez-Vidal; S Martí i García; N Mastroyiannopoulos; F Matorras; C Matteuzzi; Giorgio Matthiae; J Masik; F Mazzucato; M Mazzucato; M L McCubbin; R McKay; R McNulty; G McPherson; C Meroni; W T Meyer; E Migliore; L Mirabito; Winfried A Mitaroff; U Mjörnmark; T Moa; M Moch; R Møller; K Mönig; M R Monge; X Moreau; P Morettini; G A Morton; U Müller; K Münich; M Mulders; C Mulet-Marquis; R Muresan; W J Murray; B Muryn; Gerald Myatt; T Myklebust; F Naraghi; M Nassiakou; Francesco Luigi Navarria; S Navas; K Nawrocki; P Negri; S Némécek; N Neufeld; N Neumeister; R Nicolaidou; B S Nielsen; M Nikolenko; V P Nomokonov; Ainsley Normand; A Nygren; V F Obraztsov; A G Olshevskii; A Onofre; Risto Orava; G Orazi; K Österberg; A Ouraou; M Paganoni; S Paiano; R Pain; R Paiva; J Palacios; H Palka; T D Papadopoulou; K Papageorgiou; L Pape; C Parkes; F Parodi; U Parzefall; A Passeri; O Passon; M Pegoraro; L Peralta; Manfred Pernicka; A Perrotta; C Petridou; A Petrolini; H T Phillips; F Pierre; M Pimenta; E Piotto; T Podobnik; M E Pol; G Polok; P Poropat; V Pozdnyakov; P Privitera; N Pukhaeva; Antonio Pullia; D Radojicic; S Ragazzi; H Rahmani; P N Ratoff; A L Read; P Rebecchi; N G Redaelli; Meinhard Regler; D Reid

    1999-01-01

    Infrared and collinear safe event shape distributions and their mean values are determined using the data taken at ve di erent centre of mass energies above $M_Z$ with the DELPHI detector at LEP. From the event shapes, the strong coupling $\\\\alpha_s$ is extracted in $O(\\\\alpha^2_s)$, NLLA and a combined scheme using hadronisation corrections evaluated with fragmentation model generators as well

  4. Calculations of Alpha-Particle Trajectories for Long-Range Alpha Particles Emitted in Spontaneous Fission

    Microsoft Academic Search

    Y. Boneh; Z. Fraenkel; I. Nebenzahl

    1967-01-01

    Calculated angular and energy distributions of the alpha particles in long-range alpha-particle fission are presented. The distributions were obtained from calculated alpha-particle trajectories based on a three-point-charge model for the scissioning nucleus. The calculation is two dimensional, and spontaneous fission (no preferred direction) is assumed. This reduces the number of free variables of the system to seven (except for the

  5. Preparation and properties of (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl- (R)-(+)-alpha-hydroxy-alpha-(4-[125I]iodophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy-alpha- (4-[125I]iodophenyl)-alpha-phenyl acetate as potential radiopharmaceuticals.

    PubMed

    Cohen, V I; Rzeszotarski, W J; Gibson, R E; Fan, L H; Reba, R C

    1989-10-01

    rac-4-Nitrobenzilic acid was synthesized and resolved with quinidine and quinine to give the corresponding (R)- and (S)-salts. The resolved diastereomeric salts were converted to (R)- and (S)-4-nitrobenzilic acids and subsequent esterification gave their corresponding ethyl esters. Transesterification with (R)-(-)-3-quinuclidinol afforded (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(R)-(+)-alpha-hydroxy-alpha- (4-nitrophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy- alpha-(4-nitrophenyl)-alpha-phenyl acetate. After hydrogenation, the (R,R)- and (R,S)-amines were converted to the respective triazene derivatives. The triazene derivatives reacted with sodium [125I]iodide to give (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(R)-(+)- alpha-hydroxy-alpha-(4-[125I]iodophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy- alpha-(4-[125I]iodophenyl)-alpha-phenyl acetate. The evaluation of their affinities to muscarinic acetylcholine receptors (MAcChR) shows that (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy-alpha-(4- [125I]iodophenyl)-alpha-phenyl acetate exhibits an affinity for the MAcChR from corpus striatum that is approximately threefold lower than that of (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(R)-(+)-alpha-hydroxy-alpha-(4- [125I]iodophenyl)-alpha-phenyl acetate. PMID:2600789

  6. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.

    1984-01-01

    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  7. Enzymic conversion of alpha-oxyprotohaem IX into biliverdin IX alpha by haem oxygenase.

    PubMed Central

    Yoshinaga, T; Sudo, Y; Sano, S

    1990-01-01

    Conversion of four isomers of meso-oxyprotohaem IX into the corresponding biliverdin IX was attempted with a reconstituted haem oxygenase system in the presence of NADPH-cytochrome c reductase and NADPH. Only the alpha-isomer of meso-oxyprotohaem IX was converted effectively into biliverdin IX alpha, which was further reduced to bilirubin IX alpha by biliverdin reductase. Only trace amounts of biliverdins IX beta, IX gamma and IX delta were respectively formed from the incubation mixture of the corresponding oxyprotohaemin IX isomers with the complete haem oxygenase system under the same conditions. In a kinetic study, the Km for alpha-meso-oxyprotohaem IX was 3.6 microM, which was 2-fold higher than that for protohaem IX. The maximum velocity (Vmax.) of the conversion of alpha-meso-oxyprotohaem IX into biliverdin IX alpha was twice as fast as that of protohaem IX. These results demonstrate that alpha-meso-oxyprotohaem IX is an intermediate of haem degradation and it was converted stereospecifically into biliverdin IX alpha via verdohaem IX alpha. PMID:2122884

  8. Jet Physics at LEP and World Summary of $\\alpha_{s}$

    E-print Network

    Bethke, Siegfried

    1999-01-01

    Recent results on jet physics and tests of QCD from hadronic final states in $e^+e^-$ annihilation at PETRA and at LEP are reviewed, with special emphasis on hadronic event shapes, charged particle production rates, properties of quark and gluon jets and determinations of $\\alpha_s$. The data in the entire energy range from PETRA to LEP-2 are in broad agreement with the QCD predictions. The world summary of measurements of $\\alpha_s$ is updated and a detailed discussion of various methods to determine the overall error of uncertainties.

  9. Plan de cours Facult des arts et des sciences

    E-print Network

    Parrott, Lael

    ., Richard, D. Les Cordés: anatomie comparée des Vertébrés, 9e éd. (2009) Hildebrand, M. & Goslow, G. Analysis of Vertebrate Structure, 5th ed. (2001) Kardong, KV. Vertebrates: Comparative Anatomy, Function, Evolution, 5th Ed. McGraw Hill (2008) Liem, K., Bemis, W., Walker, WF., Grande, L. Functional Anatomy

  10. Plan de cours Facult des arts et des sciences

    E-print Network

    Parrott, Lael

    Cordés: anatomie comparée des Vertébrés, 9e éd. (2009) Hildebrand, M. & Goslow, G. Analysis of Vertebrate Structure, 5th ed. (2001) Kardong, KV. Vertebrates: Comparative Anatomy, Function, Evolution, 5th Ed. McGraw Hill (2008) Liem, K., Bemis, W., Walker, WF., Grande, L. Functional Anatomy of the Vertebrates

  11. UNIVERSIT DE NANTES FACULT DES SCIENCES ET DES TECHNIQUES

    E-print Network

    Paris-Sud XI, Université de

    naturelle sur la reconnaissance des roches par télédétection V-IR : application à la cartographie de l'ophiolite............................................................. 51 2.2 Contexte géologique de l'ophiolite d ..................................................................................................................................... 54 2.2.2 Formation de l'ophiolite et unités lithologiques affleurant dans les montagnes d

  12. VALUATION EMPIRIQUE DES IMPACTS DES VNEMENTS AYANT ABOUTI

    E-print Network

    Paris-Sud XI, Université de

    toujours été appliqués par les entreprises françaises, est l'utilisation de la juste valeur comme principal. Notamment celles examinant l'effet de la comptabilité en juste valeur (i.e. : Barth, Landsman & Whalen (1995'allait représenter la mise en oeuvre des normes IAS/IFRS et notamment IAS 39, celle qui a suscité le plus de

  13. Dpartement de communication Facult des arts et des sciences

    E-print Network

    Parrott, Lael

    'occasion de tester et d'évaluer ses connaissances acquises en communication au Département dans le cadre d'étudiant doit être en mesure : d'évaluer ses habilités et ses compétences personnelles en communication; d'estimer la portée de ses connaissances, de ses aptitudes et de ses compétences vis-à-vis des exigences du

  14. Dpartement de communication Facult des arts et des sciences

    E-print Network

    Parrott, Lael

    'évaluer ses connaissances acquises en communication au Département dans le cadre d'une expérience concrète en : · d'évaluer ses habilités et ses compétences personnelles en communication; · d'estimer la portée de ses connaissances, de ses aptitudes et de ses compétences vis-à-vis des exigences du milieu

  15. Facult des arts et des sciences Dpartement de science politique

    E-print Network

    Parrott, Lael

    politique et politique comparée. Chaque champ dispose, en principe, de ses objets et de ses angles d'analyse privilégiés. La politique comparée est un des champs de la science politique. Cependant, si elle a ses objets la science politique avec ses méthodes propres, ses objets d'analyse et ses auteurs de référence. C

  16. Dpartement de communication Facult des arts et des sciences

    E-print Network

    Parrott, Lael

    'évaluer ses connaissances acquises en communication au Département dans le cadre d'une expérience concrète en : d'évaluer ses habiletés et ses compétences personnelles en communication; d'estimer la portée de ses connaissances, de ses aptitudes et de ses compétences vis-à-vis des exigences du milieu

  17. Techniken & Sprachen des Semantic Web Techniken & Sprachen des Semantic Web

    E-print Network

    Pfeifer, Holger

    World Wide Web (7) Tim Berners-Lee Proposal 1989: Hypertextsystem als Infrastrukturprinzp f Berners-Lee) 1989: An intriguing possibility, given a large hypertext database with typed links, Inst. f¨ur KI, Uni Ulm 3 - 10 Techniken & Sprachen des Semantic Web Aber ... CERN Proposal, (Tim

  18. II. DIGESTION DES PROTINES ET ABSORPTION INTESTINALE DES ACIDES AMINS

    E-print Network

    Paris-Sud XI, Université de

    'influence de la flore du tube digestif du monogastrique a été mise en évidence depuis plusieurs années au Laboratoire des Métabolismes du C.N.R.Z. La flore intes- tinale peut en effet désaminer ou décarboxyler les la présente action concer- tée et, en conséquence, ne sont rappelées ici que pour mémoire (cf. MICHEL

  19. Plan de cours Facult des arts et des sciences

    E-print Network

    Parrott, Lael

    fonctions des molécules du vivant ; expliquer la relation ADN - ARN - protéine ; connaître l'historique de C. Acides nucléiques Acides désoxyribonucléiques [ADN] Acides ribonucléiques [ARN] Réplication de l'ADN D. Transcription et traduction : synthèse protéique Transcription de l'ADN en ARN Traduction

  20. Paternité des articles et intérêts concurrents : une analyse des recommandations aux auteurs des journaux traitant de pratique pharmaceutique

    PubMed Central

    Courbon, Ève; Tanguay, Cynthia; Lebel, Denis; Bussières, Jean-François

    2014-01-01

    RÉSUMÉ Contexte : La présence d’auteurs honorifiques et fantômes ainsi que les intérêts concurrents représentent des difficultés bien documentées, liées à la publication d’articles scientifiques. Il existe des lignes directrices encadrant la rédaction et la publication de manuscrits scientifiques, notamment celles de l’International Committee of Medical Journal Editors (ICMJE). Objectifs : L’objectif principal de cette étude descriptive et transversale visait à recenser les instructions portant sur la paternité des articles et les intérêts concurrents provenant des recommandations aux auteurs des journaux traitant de pratique pharmaceutique. L’objectif secondaire visait à déterminer des mesures correctrices pour une paternité des articles plus transparente. Méthode : La recherche a débuté par l’identification des journaux traitant de pratique pharmaceutique. La consultation des instructions aux auteurs des journaux a permis ensuite de recenser les recommandations destinées à éviter les problèmes de paternité des articles et d’intérêts concurrents. Finalement, les membres de l’équipe de recherche se sont consultés afin de définir des mesures correctrices possibles à l’intention des chercheurs. Résultats : Des 232 journaux traitant de pharmacie, 33 ont été définis comme traitant de pratique pharmaceutique. Un total de 24 (73 %) journaux mentionnaient suivre la politique de l’ICMJE, 14 (42 %) demandaient aux auteurs de remplir un formulaire de déclaration d’intérêts concurrents au moment de la soumission de l’article, 17 (52 %) présentaient une définition de la qualité d’auteur et 5 (15 %) demandaient de détailler les contributions de chaque auteur. Une grille de 40 critères a été élaborée pour définir l’attribution du statut d’auteur. Conclusion : Moins de la moitié des journaux demandait aux auteurs de transmettre un formulaire de déclaration des intérêts concurrents au moment de la soumission d’un article et seulement la moitié des journaux avait donné une définition de la qualité d’auteur. La publication scientifique de travaux sur les pratiques pharmaceutiques n’est pas à l’abri des manques de transparence liés à la publication. L’utilisation d’une grille décrivant la contribution de chaque auteur et la publication en ligne des travaux peuvent contribuer à limiter ces risques. PMID:24970938

  1. Overview of Suborbital Human Transportation Concept ALPHA

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steelant, J.; Mack, A.

    2011-08-01

    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched Phoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to their high cost, limited safety and toxicity, a low-cost, "green" and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was selected as baseline ALPHA propulsion. The general feasibility of hybrid propulsion for suborbital vehicle application with this propellant combination was already successfully demonstrated in the first reusable and privately-funded manned launch vehicle SpaceShipOne and consequently represents the solution with the lowest development risk for the investigated application. Due to the huge success of SpaceShipOne, the same type of hybrid propulsion is foreseen for Virgin Galactic's SpaceShipTwo. ALPHA vehicle guidance will preferably be fully autonomous during the entire mission flight profile. The required technology for autonomous vehicle guidance can be from the European RLV demonstrator Phoenix, which successfully demonstrated automated landing when it was dropped three times by a helicopter and landed precisely after a GPS-guided glide. This paper outlines the current status of the technology development work for ALPHA and has a special focus on aerodynamic and aerothermodynamic aspects of the concept.

  2. Conception des IHM Fabien Duchateau

    E-print Network

    Jean-Daubias, Stéphanie

    ) : confusion d'affichage des unités sur un cadran d'altimétrie Accident nucléaire de Three Mile Island (1979) : absence de prise en compte de la dimension humaine dans le processus de supervision http://en.wikipedia.org/wiki/Three_Mile_Island

  3. REVUE BIBLIOGRAPHIQUE EFFICACITE DES ANTIBIOTIQUES

    E-print Network

    Paris-Sud XI, Université de

    of the efficiency of antibiotics against bovine mastitis has been reviewed. Criteria for the choice of papersREVUE BIBLIOGRAPHIQUE EFFICACITE DES ANTIBIOTIQUES CONTRE LES MAMMITES BOVINES STAPHYLOCOCCIQUES ET. Introduction. De nombreux remèdes ont été essayés contre les mammites bovines depuis l'acide borique (Nocard et

  4. Die Macht des Krokodils1

    Microsoft Academic Search

    ANGELIKA LOHWASSER

    In der ägyptischen Mythologie hat das Krokodil einen höchst ambivalenten Charakter. Einerseits ist es das gefährliche Ungeheuer, das den Menschen im und am Nil tötet, andererseits wurde es in verschiedenen Regionen göttlich verehrt. Die Verehrung dürfte vor allem eine Besänftigung des Raubtieres zum Ziel haben - die Furcht vor dem todbringenden Wassertier bewirkte den Glauben an ein göttliches Wesen, dessen

  5. Journes Nationales des Cristaux pour

    E-print Network

    Canet, Léonie

    organisée par le Réseau CNRS-CMDO + « Cristaux Massifs, Micro-nano-structures et Dispositifs pour l nationales, les quatrièmes du genre, portent sur la méthodologie et la technologie dans les domaines de l'élaboration, de la mise en forme, de la micro-nano-structuration et de la caractérisation des cristaux pour l

  6. Habilitation Diriger des Recherches Prsente

    E-print Network

    Examinateur Colette Rolland Directeur tel-01003149,version1-10Jun2014 #12;tel-01003149,version1 celui des autres navires que j'ai pu croiser. Avant tout, je tiens à remercier le Professeur Colette ans, Colette m'a donné le modèle exceptionnel d'un esprit brillant, clairvoyant, dynamique, tenace. Sa

  7. DIVISION INFORMATIQUE Facult des lettres

    E-print Network

    Halazonetis, Thanos

    DIVISION INFORMATIQUE Faculté des lettres Inscriptions en ligne I E L 1/ aux cours et 2/ aux examens #12;DIVISION INFORMATIQUE 19.09.20112 · inscriptions aux cours dès la 2e (ou 3e) semaine du annoncées dès la rentrée sur le site de la Faculté Dates-clés #12;DIVISION INFORMATIQUE 19.09.20113 Le

  8. association des naturalistes de la

    E-print Network

    Paris-Sud XI, Université de

    du dimanche 25 avril 2004 Argiles kaoliniques et terres à foulon de la région de Provins : à la Lozère Calc. de Champigny Sable de Fontainebleau Calc. de St-Ouen Calcaire de Provins Sable d Argiles Plastiques de Provins du Sparnacien sont des dépôts continentaux de la base du Tertiaire, déposés

  9. Cancer radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel

    2005-05-01

    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  10. Alpha Channeling in Rotating Plasma with Stationary Waves

    SciTech Connect

    A. Fetterman and N.J. Fisch

    2010-02-15

    An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high n? can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

  11. LES PROPRITS ACOUSTIQUES DES VERRES ISOLANTS A BASSE TEMPRATURE

    E-print Network

    Paris-Sud XI, Université de

    809 LES PROPRIÉTÉS ACOUSTIQUES DES VERRES ISOLANTS A BASSE TEMPÉRATURE P. DOUSSINEAU Laboratoire d verres isolants présentent à basse température des propriétés différentes de celles des cristaux. La couplage mesurés, l'utilisation des ondes acous- tiques permet l'étude de certaines propriétés des verres

  12. AU NORD DES BORGIA LA FAMILLE JOUFFROY ET

    E-print Network

    Paris-Sud XI, Université de

    AU NORD DES BORGIA LA FAMILLE JOUFFROY ET L'INTRODUCTION DE L'ART ITALIEN DE LA RENAISSANCE DANS L'auteur des célèbres décorations des appartements Borgia au Vatican et l'un des maît- 1 n° 222 -- Été 2011 La pape Alexandre VI Borgia au Vatican (v. 1494) tant ils présentent des similitudes qui ne peuvent pas

  13. Atypical antipsychotics as noncompetitive inhibitors of alpha4beta2 and alpha7 neuronal nicotinic receptors.

    PubMed

    Grinevich, Vladimir P; Papke, Roger L; Lippiello, Patrick M; Bencherif, Merouane

    2009-08-01

    It has been suggested that the interaction of antipsychotic medications with neuronal nicotinic receptors may increase the cognitive dysfunction associated with schizophrenia and may explain why current therapies only partially address this core feature of the illness. In the present studies we compared the effects of the atypical antipsychotics quetiapine, clozapine and N-desmethylclozapine to those of the typical antipsychotics haloperidol and chlorpromazine on the alpha4beta2 and alpha7 nicotinic receptor subtypes. The binding of [(3)H]-nicotine to rat cortical alpha4beta2 receptors and [(3)H]-methyllycaconitine to rat hippocampal alpha7 receptors was not affected by any of the compounds tested. However, Rb(+) efflux evoked either by nicotine or the selective alpha4beta2 agonist TC-1827 from alpha4beta2 receptors expressed in SH-EP1 cells and nicotine-evoked [(3)H]-dopamine release from rat striatal synaptosomes were non-competitively inhibited by all of the antipsychotics. Similarly, alpha-bungarotoxin-sensitive epibatidine-evoked [(3)H]-norepinephrine release from rat hippocampal slices and acetylcholine-activated currents of alpha7 nicotinic receptors expressed in oocytes were inhibited by haloperidol, chlorpromazine, clozapine and N-desmethylclozapine. The inhibitory effects on nicotinic receptor function produced by the antipsychotics tested occurred at concentrations similar to plasma levels achieved in schizophrenia patients, suggesting that they may lead to clinically relevant effects on cognition. PMID:19481556

  14. Correcting Coefficient Alpha for Correlated Errors: Is [alpha][K]a Lower Bound to Reliability?

    ERIC Educational Resources Information Center

    Rae, Gordon

    2006-01-01

    When errors of measurement are positively correlated, coefficient alpha may overestimate the "true" reliability of a composite. To reduce this inflation bias, Komaroff (1997) has proposed an adjusted alpha coefficient, ak. This article shows that ak is only guaranteed to be a lower bound to reliability if the latter does not include correlated…

  15. {alpha}-nucleus potentials, {alpha}-decay half-lives, and shell closures for superheavy nuclei

    SciTech Connect

    Mohr, Peter [Diakoniekrankenhaus Schwaebisch Hall, D-74523 Schwaebisch Hall (Germany)

    2006-03-15

    Systematic {alpha}-nucleus folding potentials are used to analyze {alpha}-decay half-lives of superheavy nuclei. Preformation factors of about several percent are found for all nuclei under study. The systematic behavior of the preformation factors and the volume integrals of the potentials allows predictions of {alpha}-decay energies and half-lives for unknown nuclei. Shell closures can be determined from measured {alpha}-decay energies using the discontinuity of the volume integral at shell closures. For the first time a double shell closure is predicted for Z{sub magic}=132,N{sub magic}=194, and A{sub magic}=326 from the systematics of folding potentials. The calculated {alpha}-decay half-lives remain far below 1 ns for superheavy nuclei with double shell closure and masses A>300 independent of the precise knowledge of the magic proton and neutron numbers.

  16. Benchmarking the External Surrogate Ratio Method using the (alpha,alpha' f) reaction at STARS

    SciTech Connect

    Lesher, S R; Bernstein, L A; Ai, H; Beausang, C W; Bleuel, D; Burke, J T; Clark, R M; Fallon, P; Gibelin, J; Lee, I Y; Lyles, B F; Macchiavelli, A O; McMahan, M A; Moody, K J; Norman, E B; Phair, L; Rodriguez-Vieitez, E; Wiedeking, M

    2008-01-09

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{prime}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n; f) and {sup 235}U(n; f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha}, {alpha}{prime}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  17. Benchmarking the External Surrogate Ratio Method using the ({alpha},{alpha}{sup '}f) reaction at STARS

    SciTech Connect

    Lesher, S. R. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Bernstein, L. A.; Bleuel, D.; Burke, J. T.; Lyles, B. F.; Moody, K. J.; Norman, E. B. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Ai, H. [Yale University, New Haven, Connecticut 06520 (United States); Beausang, C. W. [Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Clark, R. M.; Fallon, P.; Gibelin, J.; Lee, I. Y.; Macchiavelli, A. O.; McMahan, M. A.; Phair, L.; Rodriguez-Vieitez, E.; Wiedeking, M. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

    2008-04-17

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{sup '}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n,f) and {sup 235}U(n,f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha},{alpha}{sup '}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  18. ANALYSE DES DETERMINANTS DE LA GESTION DES RESULTATS : CAS DES FIRMES CANADIENNES FRANCAISES ET TUNISIENNES

    E-print Network

    Paris-Sud XI, Université de

    2011 Manuscrit auteur, publié dans "COMPTABILITE, CONTROLE, AUDIT ET INSTITUTION(S), Tunisie (2006 excessive est fortement déterminée par des motivations contextuelles rattachées à un marché financier to the Anglo-American and Euro-Continental accounting models. Canada and France, respectively, belong to those

  19. L'impact des normes IFRS sur la performance et le risque des compagnies d'assurance

    E-print Network

    Boyer, Edmond

    1 L'impact des normes IFRS sur la performance et le risque des compagnies d'assurance Jean IFRS, et en particuliers la comptabilisation des actifs à leur juste valeur et non plus au coût'impact de l'introduction des normes IFRS, notamment l'IAS 39, sur la performance financière et le risque des

  20. Le cycle des mares pourrait amplifier l'lvation du niveau des mers lie au rchauffement climatique

    E-print Network

    W Le cycle des marées pourrait amplifier l'élévation du niveau des mers liée au réchauffement climatique est l'élévation du niveau des mers liée à l'aug- mentation de la tem- pérature de l'océan, ce, le cycle des marées influence égale- ment la variation du ni- veau des mers. A partir d

  1. Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

    SciTech Connect

    Chi, Seung-Wook [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Lee, Si-Hyung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Kim, Jae-Sung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of)]. E-mail: khhan600@kribb.re.kr

    2005-12-30

    {alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, a kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.

  2. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R. (Lawrence Township, Mercer County, NJ); Post, Jr., Douglass E. (Belle Mead, NJ); Dawson, John M. (Pacific Palisades, CA)

    1986-01-01

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  3. ALPHA MIS: Reference manual. Revision 2

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  4. Performance of an Alpha-IPEM.

    SciTech Connect

    Doyle, Barney Lee (University of Padova and INFN, Padova, Italy); McDaniel, Floyd Del (University of North Texas, Denton, TX); Rossi, Paolo; Auzelyte, Vaida (Lund Technical University, Lund, Sweden); Mellon, Michael (Quantar Technology Incorporation, Santa Cruz, CA)

    2005-07-01

    The ion photon emission microscope, or IPEM, is the first device that allows scientists to microscopically study the effects of single ions in air on semiconductors, microchips and even biological cells without having to focus the beam. Reported here is a prototype, the size of a conventional optical microscope, developed at Sandia. The alpha-IPEM, that employs alpha particles from a radioactive source, represents the first example of IBA imaging without an accelerator. The IPEM resolution is currently limited to 10 {micro}m, but we also report a gridded-phosphor approach that could improve this resolution to that of the optical microscope, or {approx} 1 {micro}m. Finally, we propose that a simple adaptation of the alpha-IPEM could be the only way to maintain the high utility of radiation effects microscopy into the future.

  5. The status of alpha-particle diagnostics

    SciTech Connect

    Young, K.M.; Johnson, D.W.

    1992-08-01

    There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

  6. The status of alpha-particle diagnostics

    SciTech Connect

    Young, K.M.; Johnson, D.W.

    1992-01-01

    There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

  7. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; McAtee, J.L.

    1993-02-16

    An alpha particle detector, utilizing alternating currents, which is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  8. Microdosimetry for Targeted Alpha Therapy of Cancer

    PubMed Central

    Huang, Chen-Yu; Guatelli, Susanna; Oborn, Bradley M.; Allen, Barry J.

    2012-01-01

    Targeted alpha therapy (TAT) has the advantage of delivering therapeutic doses to individual cancer cells while reducing the dose to normal tissues. TAT applications relate to hematologic malignancies and now extend to solid tumors. Results from several clinical trials have shown efficacy with limited toxicity. However, the dosimetry for the labeled alpha particle is challenging because of the heterogeneous antigen expression among cancer cells and the nature of short-range, high-LET alpha radiation. This paper demonstrates that it is inappropriate to investigate the therapeutic efficacy of TAT by macrodosimetry. The objective of this work is to review the microdosimetry of TAT as a function of the cell geometry, source-target configuration, cell sensitivity, and biological factors. A detailed knowledge of each of these parameters is required for accurate microdosimetric calculations. PMID:22988479

  9. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); McAtee, James L. (Los Alamos, NM)

    1993-01-01

    An alpha particle detector, utilizing alternating currents, whcih is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  10. Cosmological Attractors from $\\alpha$-Scale Supergravity

    E-print Network

    Roest, Diederik

    2015-01-01

    The Planck value of the spectral index can be interpreted as $n_s = 1 - 2/N$ in terms of the number of e-foldings $N$. An appealing explanation for this phenomenological observation is provided by $\\alpha$-attractors: the inflationary predictions of these supergravity models are fully determined by the curvature of the Kahler manifold. We provide a novel formulation of $\\alpha$-attractors which only involves a single chiral superfield. Our construction involves a natural deformation of no-scale models, and employs these to construct a De Sitter plateau with an exponential fall-off. Finally, we show how analogous structures with a flat Kahler geometry arise as a singular limit of such $\\alpha$-scale models.

  11. Association Francophone de Comptabilit Tunis 2006 Raction des analystes financiers la publication des informations

    E-print Network

    Boyer, Edmond

    Association Francophone de Comptabilité Tunis 2006 1 Réaction des analystes financiers à la (2006)" #12;Association Francophone de Comptabilité Tunis 2006 2 Réaction des analystes financiers à la

  12. Morale et technique : la fin des Bruno Latour, CSI, Ecole des mines

    E-print Network

    Paris-Sud XI, Université de

    Morale et technique : la fin des moyens Bruno Latour, CSI, Ecole des mines Article préparé pour le et demi d'années (Latour et Lemonnier, 1994). On commence maintenant, après les travaux pionniers sur

  13. Direction des Ressources Humaines Service des Personnels Administratifs et

    E-print Network

    Sart, Remi

    logistique » CORPS : ATRF NATURE : AFFECTATION ETABLISSEMENT : Université Blaise Pascal ­ IUFM d'Auvergne, Université Blaise Pascal. Il est basé à Chamalières. La tâche principale sera d'assurer l'entretien des Responsable administrative de l'IUFM d'Auvergne, Université Blaise Pascal Tel : 04 73 31 71 52 #12;

  14. Deep H alpha images of interacting galaxies

    NASA Technical Reports Server (NTRS)

    Beck, S. C.; Kovo, O.

    1993-01-01

    Gravitational interactions between galaxies are believed to increase star formation activity dramatically, and most of the brightest starburst galaxies show clear signs of recent interactions. However, it is still not known how interaction triggers star formation, nor are there models to relate the type or strength of interaction to the location or amount of star formation. We report on a series of deep H alpha images of interacting and post-interaction galaxies which we took with the purpose of finding the young stars and ionized gas in these objects. We were motivated in part by the hope that by studying the very recently formed stars we could see how the interaction process had affected the star formation. We observed the galaxies through 50 A-wide filters, one on the redshifted H alpha line and one off, and a standard R filter. Depending on the galaxy and conditions, images in the B, V, and I filters were also obtained. The images were recorded with a 4x7 ft. or 17 ft. diameter CCD at the 1-meter telescope of the Wise Observatory in Mitzpe Ramon. The H alpha and continuum images are used, together with observations at other wavelengths, to put together as complete a picture as possible of star formation and interactions in each galaxy. The complete observation set is not yet available for all the galaxies but certain results are already clear. There do not seem to be any correlations between H 1 and H alpha structures. In some H 1 plume galaxies H alpha extensions were seen on the other side of the galaxy from the H 1; in others extensive H alpha filaments have been found but not H 1. The preliminary results agree with the simplest model that interaction-induced star formation will be concentrated in the system center, since that is where the mass ends up.

  15. Caractérisation des convertisseurs matriciels : II. Synthèse des fonctions de connexion

    NASA Astrophysics Data System (ADS)

    François, B.; Cambronne, J. P.; Hautier, J. P.

    1996-05-01

    Knowing the wished conversion levels (-1,0,1) of a power converter, this paper describes a particular method for setting the corresponding states of switches into the matrix converter. In a first step, a mathematical analysis establishes the relations linking the states of switches with the conversion functions. Afterwards, the presented method gives the inverse relations which constitute the sequential part of the converter control. The turn-on and the turn-off sequences are designed by considering the on-line wished level conversions. This general method enhances the idea that a converter functionnality must be defined by its structure and its control. Cet article propose une méthode originale pour définir la séquence de commande d'un convertisseur à partir de la fonction de conversion globalement souhaitée. Les auteurs procèdent d'abord à une analyse mathématique précise des relations qui existent entre les états des interrupteurs et les fonctions de conversion obtenues. À partir de cette analyse, la méthode developpée permet d'établir systématiquement les relations inverses qui constituent alors le module séquentiel de la commande rapprochée du convertisseur. Les ordres d'ouverture et de fermeture des interrupteurs sont élaborés en considérant à tout instant les niveaux de conversion souhaités pour les grandeurs électriques. Cette méthode générale renforce l'idée que la fonction remplie par un convertisseur moderne doit être définie à la fois par sa structure et sa commande.

  16. Evaluation des connaissances des parents sur les bronchiolites aiguës

    PubMed Central

    Gueddari, Widad; Tazi, Abderrahmane; Ouardi, Amine; Nani, Samira; Zineddine, Abdelhadi

    2014-01-01

    Les infections respiratoires (IR) constituent la deuxième cause de mortalité infantile au Maroc, dû en partie à l'absence d'information et de sensibilisation. Le but de ce travail était d’évaluer les connaissances des parents sur la bronchiolite aiguë, infection respiratoire très fréquente. Nous avons réalisé une enquête basée sur un questionnaire, auprès de parents de nourrissons consultants pour toux, avec ou sans gêne respiratoire. 180 parents ont été inclus dans l’étude. Les parents pensaient que l'infection respiratoire était secondaire au climat froid (96%); seuls 4% ont évoqué une origine infectieuse. Aucun des parents ne savait que le lavage des mains était un moyen de prévention de la transmission. Les parents ont majoritairement répondu que la kinésithérapie respiratoire ne servait à rien (65%), et qu'elle était nocive (24.5%). Ce manque de connaissances fondamentales en matière d'IR et de bronchiolite en particulier, devrait inciter à entreprendre un programme de sensibilisation PMID:25328606

  17. M2 OASC : Fiche de stage Titre du stage : Apport d'une simulation haute rsolution pour la description des tourbillons en mer des

    E-print Network

    description des tourbillons en mer des Salomon Nom et statut du (des) responsable (s) de stage : Gourdeau Sujet du stage : La mer des Salomon située dans le Pacifique sud ouest est le lieu de transit des courants de bord ouest lors de leur traversée de la mer des Salomon sont soumis à des contraintes

  18. Sur l'infimum des parties reelles des zeros des sommes partielles de la fonction z^eta de Riemann

    E-print Network

    Paris-Sud XI, Université de

    Sur l'infimum des parties r´eelles des z´eros des sommes partielles de la fonction z^eta de Riemann ) (on ne consid`ere ici que les z´eros r´eels). Observons d`es maintenant que k n,k est d´eries de Dirichlet ordinaires f(s) = m=1 a(m) ms et g(s) = m=1 b(m) ms sont dites ´equivalentes s

  19. Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling.

    PubMed Central

    Ruthardt, M; Testa, U; Nervi, C; Ferrucci, P F; Grignani, F; Puccetti, E; Grignani, F; Peschle, C; Pelicci, P G

    1997-01-01

    Fusion proteins involving the retinoic acid receptor alpha (RAR alpha) and the PML or PLZF nuclear protein are the genetic markers of acute promyelocytic leukemias (APLs). APLs with the PML-RAR alpha or the PLZF-RAR alpha fusion protein are phenotypically indistinguishable except that they differ in their sensitivity to retinoic acid (RA)-induced differentiation: PML-RAR alpha blasts are sensitive to RA and patients enter disease remission after RA treatment, while patients with PLZF-RAR alpha do not. We here report that (i) like PML-RAR alpha expression, PLZF-RAR alpha expression blocks terminal differentiation of hematopoietic precursor cell lines (U937 and HL-60) in response to different stimuli (vitamin D3, transforming growth factor beta1, and dimethyl sulfoxide); (ii) PML-RAR alpha, but not PLZF-RAR alpha, increases RA sensitivity of hematopoietic precursor cells and restores RA sensitivity of RA-resistant hematopoietic cells; (iii) PML-RAR alpha and PLZF-RAR alpha have similar RA binding affinities; and (iv) PML-RAR alpha enhances the RA response of RA target genes (those for RAR beta, RAR gamma, and transglutaminase type II [TGase]) in vivo, while PLZF-RAR alpha expression has either no effect (RAR beta) or an inhibitory activity (RAR gamma and type II TGase). These data demonstrate that PML-RAR alpha and PLZF-RAR alpha have similar (inhibitory) effects on RA-independent differentiation and opposite (stimulatory or inhibitory) effects on RA-dependent differentiation and that they behave in vivo as RA-dependent enhancers or inhibitors of RA-responsive genes, respectively. Their different activities on the RA signalling pathway might underlie the different responses of PML-RAR alpha and PLZF-RAR alpha APLs to RA treatment. The PLZF-RAR alpha fusion protein contains an approximately 120-amino-acid N-terminal motif (called the POZ domain), which is also found in a variety of zinc finger proteins and a group of poxvirus proteins and which mediates protein-protein interactions. Deletion of the PLZF POZ domain partially abrogated the inhibitory effect of PLZF-RAR alpha on RA-induced differentiation and on RA-mediated type II TGase up-regulation, suggesting that POZ-mediated protein interactions might be responsible for the inhibitory transcriptional activities of PLZF-RAR alpha. PMID:9234742

  20. Partager : des technologies de pointe au service de la société

    ScienceCinema

    None

    2011-10-06

    Médecine, climatologie, métrologie et informatique, les techniques utilisées par le LHC trouvent déjà des répercussions dans d?autres domaines scientifiques. Utilisant des techniques inédites, la physique des particules en fait bénéficier la société toute entière.

  1. Werkzeuge der Informatik Grundlagen und Werkzeuge des WWW (Teil 1)

    E-print Network

    Zachmann, Gabriel

    . Müller, 2011 Geschichte des WWW · Anfänge des WWW Geschichte des Internet · 1980: Tim Berners-Lee (CERN) schreibt Programm "ENQUIRE", das es erlaubt, Knoten im Internet zu verlinken · 1989: Tim Berners-Lee: CERN

  2. Partager : des technologies de pointe au service de la société

    SciTech Connect

    None

    2011-02-14

    Médecine, climatologie, métrologie et informatique, les techniques utilisées par le LHC trouvent déjà des répercussions dans d’autres domaines scientifiques. Utilisant des techniques inédites, la physique des particules en fait bénéficier la société toute entière.

  3. Répartitions modales urbaines, externalités et instauration de péages. Le cas des externalités de congestion et des \\

    Microsoft Academic Search

    François Mirabel

    1999-01-01

    [fre] Répartitions modales urbaines, externalités et instauration de péages. Le cas des externalités de congestion et des « externalités modales croisées ». . Cet article se propose d'analyser les répartitions des usagers entre l'automobile et les bus dans le cadre des déplacements urbains domicile-travail. Dans ce contexte, l'objectif de cet article est de mettre en lumière deux types d'externalités générées

  4. Fan-less long range alpha detector

    DOEpatents

    MacArthur, D.W.; Bounds, J.A.

    1994-05-10

    A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

  5. Fan-less long range alpha detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); Bounds, John A. (Los Alamos, NM)

    1994-01-01

    A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

  6. Monitoring airborne alpha-emitter contamination

    SciTech Connect

    Kerr, P.L.; Koster, J.E.; Conaway, J.G.; Bounds, J.A.; Whitley, C.W. [Los Alamos National Lab., NM (United States); Steadman, P.A. [National Center for Genome Resources, Santa Fe, NM (United States)

    1998-02-01

    Facilities that may produce airborne alpha emitter contamination require a continuous air monitoring (CAM) system. However, these traditional CAMs have difficulty in environments with large quantities of non-radioactive particulates such as dust and salt. Los Alamos has developed an airborne plutonium sensor (APS) for the REBOUND experiment at the Nevada Test Site which detects alpha contamination directly in the air, and so is less vulnerable to the problems associated with counting activity on a filter. In addition, radon compensation is built into the detector by the use of two measurement chambers.

  7. Radiological hazards of alpha-contaminated waste

    SciTech Connect

    Rodgers, J.C.

    1982-01-01

    The radiological hazards of alpha-contaminated wastes are discussed in this overview in terms of two components of hazard: radiobiological hazard, and radioecological hazard. Radiobiological hazard refers to human uptake of alpha-emitters by inhalation and ingestion, and the resultant dose to critical organs of the body. Radioecological hazard refers to the processes of release from buried wastes, transport in the environment, and translocation to man through the food chain. Besides detailing the sources and magnitude of hazards, this brief review identifies the uncertainties in their estimation, and implications for the regulatory process.

  8. Lyman Alpha Searches at Redshift Z>7

    NASA Astrophysics Data System (ADS)

    Willis, Jon

    2007-05-01

    The ZEN survey is a narrow J-band survey for Ly-alpha emitting galaxies at z > 7. I will briefly review the pros and cons of narrow band observations before summarising the ZEN1 and ZEN2 searches based upon deep ISAAC pointings. I will then present ZEN3, consisting of wide field, narrow band observations of two fields using the CFHT WIRCam facility. I will conclude by reviewing the current sample of candidates and what we have learned about the z > 7 Ly-alpha emitting population.

  9. Green Pea Galaxies Reveal Secrets of Ly$\\alpha$ Escape

    E-print Network

    Yang, Huan; Gronke, Max; Rhoads, James E; Jaskot, Anne; Zheng, Zhenya; Dijkstra, Mark

    2015-01-01

    Star-formation in galaxies generates a lot of Ly$\\alpha$ photons. Understanding the escape of Ly$\\alpha$ photons from galaxies is a key issue in studying high redshift galaxies and probing cosmic reionization with Ly$\\alpha$. To understand Ly$\\alpha$ escape, it is valuable to study analogs of high redshift Ly$\\alpha$ emitters in nearby universe. However, most nearby analogs have too small a Ly$\\alpha$ equivalent width and escape fraction compared to high redshift Ly$\\alpha$ emitters. One different group of nearby analogs are "Green Pea" galaxies, selected by their high equivalent width optical emission lines. Here we show that Green Pea galaxies have strong Ly$\\alpha$ emission lines and high Ly$\\alpha$ escape fraction (see also Henry et al. 2015), providing an opportunity to solve Ly$\\alpha$ escape problem. Green Peas have a Ly$\\alpha$ equivalent width distribution similar to high redshift Ly$\\alpha$ emitters. The Ly$\\alpha$ escape fraction correlates with many quantities of Ly$\\alpha$ profile, especially the...

  10. Environnement des Systèmes Binaires Jeunes

    NASA Astrophysics Data System (ADS)

    Duchene, Gaspard

    2000-07-01

    La fréquence élevée des systèmes binaires, tant parmi les étoiles de la séquence principale que dans les régions de formation stellaire, a été largement mise en évidence au cours des dix dernières années. Cette constatation soulève naturellement la question de la nature du processus responsable de la formation préférentielle de ces systèmes multiples. Par ailleurs, les phénomènes d'interaction entre un compagnon et l'environnement complexe d'une étoile T Tauri sont encore trèsmal compris. C'est dans ce cadre que se place le travail conduit durant cette thèse, dont les principaux objectifs sont: i) la détermination de la fraction de binaires dans différentes populations pré-séquence principale, ii) l'étude quantitative du phénomène d'accrétion dans les systèmes binaires T Tauri, et iii) l'observation directe et la modélisation de disques circumstellaires et circumbinaires. Dans le cadre d'une recherche de binaires visuelles à l'aide du système d'optique adaptative du Télescope Canada-France-Hawaii, j'ai pris part à l'observation de plusieurs centaines d'objets situés dans différents amas stellaires jeunes. Je détaille ici l'analyse et les résultats concernant deux amas âgés de moins de deux millions d'années. Lorsqu'on considère l'ensemble des populations étudiées jusqu'à présent, on constate que la proportion de binaires visuelles parmi les étoiles de type solaire est la même dans les amas stellaires que sur la séquence principale. De plus, cette propriété ne dépend pas de l'âge de l'amas, ce qui implique que la fraction de binaires n'évolue pas après le premier million d'années dans ces amas. A l'opposé, les zones de formation peu denses, qui sont toutes très jeunes, possèdent une proportion de binaires sensiblement plus élevée. Les modèles les plus à même de reproduire ces observations sont ceux selon lesquels la fraction de binaires qui résulte de l'effondrement gravitationnel est proche de 100%. Dans les amas les plus denses, cette fraction peut ensuite être rapidement réduite du fait des nombreuses interactions gravitationnelles destructrices entre systèmes proches. D'autres interprétations restent toutefois envisageables. Je m'intéresse ensuite au phénomène d'accrétion dans les binaires T Tauri par la spectroscopie visible des composantes de ces systèmes. Cette approche révèle que le phénomène d'accrétion perdure aussi longtemps sur les deux composantes d'une même binaire. De plus, la comparaison des luminosités émises dans la raie H? montre que le primaire présente généralement le taux d'accrétion le plus élevé. Une interprétation possible de ces observations est que ces binaires possèdent des réservoirs circumbinaires de matière, probablement sous la forme d'une vaste enveloppe, qui alimentent simultanément les deux disques circumstellaires. Enfin, je présente des images à haute résolution angulaire des disques circumbinaires de GG Tau et UY Aur et des disques circumstellaires de HK Tau B et HV Tau C. Ces observations, obtenues dans le visible, le proche infrarouge et le domaine radio, permettent une description fine de l'environnement de ces binaires. Je détaille également l'analyse de cartes de polarisation des deux disques circumbinaires obtenues à 1 micron. Afin de déterminer les propriétés géométriques de ces disques et celles des grains de poussière qui s'y trouvent, j'ai entrepris une modélisation de la diffusion multiple de la lumière en utilisant une approche Monte-Carlo. Cette étude indique que l'anneau circumbinaire de GG Tau est géométriquement épais (avec un rapport d'aspect h/r~0.18), qu'il comporte des grains de poussière très petits (<1 micron) et que la masse totale de poussière dans l'anneau est au moins 10-3 masses solaires. L'environnement de UY Aur apparaît beaucoup plus complexe que celui de GG Tau: le disque circumbinaire, dont l'inclinaison est ré-évaluée à environ 60 degrés, coexiste avec un filament situé à proximité mais distinct, et plusieurs "branches&qu

  11. Far-Infrared and Millimeter Continuum Studies of K Giants: Alpha Boo and Alpha Tau

    E-print Network

    Martin Cohen; Duane F. Carbon; William J. Welch; Tanya Lim; Bernhard Schulz; A. D. McMurry; James R. Forster; David Goorvitch; .

    2005-02-24

    We have imaged two normal, non-coronal, infrared-bright K giants, Alpha Tau and Alpha Boo, in the 1.4-mm and 2.8-mm continuum using the Berkeley Illinois Maryland Association millimeter array. These stars have been used as important absolute calibrators for several infrared infrared satellites. Our goals are: (1) to establish whether these stars radiate as simple photospheres or possess long-wavelength chromospheres; and (2) to make a connection between millimeter wave and far-infrared absolute flux calibrations. To accomplish these goals we also present Infrared Space Observatory Long Wavelength Spectrometer measurements of both these K giants. The far-infrared and millimeter continuum radiation is produced in the vicinity of the temperature minimum in Alpha Tau and Alpha Boo. We find that current photospheric models predict fluxes in reasonable agreement with those observed for wavelengths which sample the upper photosphere, namely <=125 microns in Alpha Tau and Alpha Boo. We clearly detect chromospheric radiation from both stars by 2.8mm (by 1.4mm in the case of Alpha Boo). Only additional observations can determine precisely where beyond 125 microns the purely radiative models fail. Until then, purely radiative models for these stars can only be used with confidence for calibration purposes below 125 microns.

  12. Factors governing helical preference of peptides containing multiple alpha,alpha-dialkyl amino acids.

    PubMed Central

    Marshall, G R; Hodgkin, E E; Langs, D A; Smith, G D; Zabrocki, J; Leplawy, M T

    1990-01-01

    The presence of multiple alpha,alpha-dialkyl amino acids such as alpha-methylalanine (alpha-aminoisobutyric acid, Aib) leads to predominantly helical structures, either with alpha-helical or 3(10)-helical hydrogen bonding patterns. The crystal structure of emerimicin-(1-9) benzyl ester (Ac-Phe-Aib-Aib-Aib-Val-Gly-Leu-Aib-Aib-OBzl) reported here shows essentially pure alpha-helical character, whereas other similar compounds show predominantly 3(10)-helical structures. The factors that govern helical preference include the inherent relative stability of the alpha-helix compared with the 3(10)-helix, the extra hydrogen bond seen with 3(10)-helices, and the enhanced electrostatic dipolar interaction of the 3(10)-helix when packed in a crystalline lattice. The balance of these forces, when combined with the steric requirements of the amino acid side chains, determines the relative stability of the two helical conformations under a given set of experimental conditions. Images PMID:2296604

  13. Etude des particularits de la poule Fayoumi. III. Ponte, caractristiques des œufs, efficacit alimentaire

    E-print Network

    Paris-Sud XI, Université de

    Etude des particularités de la poule Fayoumi. III. Ponte, caractéristiques des œufs, efficacité alimentaire et paramètres physiologiques de poules Fayoumi, Rhode-Island et F1 en batteries P'Hygiène alimentaire, F 22440 Ploufragan Résumé Des poules de la race Egyptienne Fayoumi ont été contrôlées pour la

  14. Profil épidemio-clinique et radiologique des atteintes ostéo-articulaires des hémophiles à Madagascar

    PubMed Central

    Narindra, Lova Hasina Rajaonarison Ny Ony; Rabemanorintsoa, Feno Hasina; Randrianantenaina, Faralahy Ravelonarivo; Rakoto, Olivat Alson Aimée; Ahmad, Ahmad

    2014-01-01

    Introduction Déterminer le profil épidémio-clinique et radiologique des atteintes ostéo-articulaires des hémophiles malagasy. Méthodes Une étude prospective, descriptive portant sur 25 patients hémophiles venant de tout Madagascar a été réalisée. Des radiographies numérisées des genoux, des chevilles et des coudes en incidence de face et de profil ainsi qu'une échographie des hanches, des genoux, des chevilles et des coudes ont été réalisées chez ces patients. Le type et la sévérité de la maladie ainsi que l'aspect de la cavité articulaire, la synoviale, les noyaux épiphysaires et les surfaces articulaires ont été analysés. Résultats Soixante-huit pourcent des patients étaient hémophiles de type A et 32 % de type B. Quarante pourcent étaient classés sévères, 28 % modérés et 32 % mineurs. Les atteintes ostéo-articulaires ont été retrouvées chez 56 % des patients. Il n'existait pas de prédominance d'atteinte selon le type ni la sévérité de la maladie. Les plus jeunes étaient les plus atteints et l'articulation du genou et de la cheville étaient les plus touchées. Conclusion Les complications ostéo-articulaire de l'hémophilie sont graves et ne dépendent pas du type ni de la sévérité de l'affection. Elles touchent surtout les enfants d'âge scolaire. Le couple radiographie-échographie permet de diagnostiquer et de surveiller ces lésions. PMID:25870742

  15. Proprits thermiques; matriaux pour haute temprature Facult des Sciences Appliques, Dpartement ASMA, Science des Matriaux

    E-print Network

    Liège, Université de

    , Département ASMA, Science des Matériaux Jacqueline LECOMTE-BECKERS & Yann GREDAY dans le cadre du Printemps pour haute température Faculté des Sciences Appliquées, Département ASMA, Science des Matériaux

  16. DIFFUSION DES ESSAIS DE MATRISE Procdure l'usage des facults

    E-print Network

    DIFFUSION DES ESSAIS DE MAÎTRISE Procédure à l'usage des facultés de l'Université Laval (UL) ENTRÉE bonifié en ce qui concerne la diffusion des essais de maîtrise. Ce document présente la procédure à suivre pour déposer une demande de diffusion d'un essai. La diffusion d'un format électronique rend les essais

  17. Aide aux doctorants pour la participation des Aide aux doctorants pour la participation des colloques

    E-print Network

    Di Girolami, Cristina

    Aide aux doctorants pour la participation à des colloques Aide aux doctorants pour la participation à des colloques retour Formation doctorale Aide aux doctorants pour la participation à des colloques aide vient compléter les financements déjà prévus par les laboratoires et les Écoles doctorales pour

  18. LISTE DES SECTIONS ET DES COMMISSIONS INTERDISCIPLINAIRES DU COMIT NATIONAL DE LA RECHERCHE SCIENTIFIQUE

    E-print Network

    van Tiggelen, Bart

    LISTE DES SECTIONS ET DES COMMISSIONS INTERDISCIPLINAIRES DU COMITÉ NATIONAL DE LA RECHERCHE laboratoire au cosmos Institut national de physique nucléaire et de physique des particules (IN2P3) 2 Théories physiques : méthodes, modèles et applications Institut de physique (INP) 3 Matière condensée : structures et

  19. RECHERCHES SUR LES TEXTURES DES TATS MSOMORPHES. 6 2014 DISLOCATIONS COINS ET SIGNIFICATION DES CLOISONS

    E-print Network

    Boyer, Edmond

    DES CLOISONS DE GRANDJEAN-CANO DANS LES CHOLESTÉRIQUES (*) Y. BOULIGAND Laboratoire de Zoologie, E suivants sont des paires de disinclinaisons (03C4 -, 03BB+) dans la terminologie de Kléman et de Friedel décrochements ± p/2 le long des paires (03C4 -, 03BB+) sont de courts segments présentant une configuration

  20. Dotation et disparités régionales des performances scolaires. Le cas des collèges au Burkina Faso

    Microsoft Academic Search

    Justine Coulidiati-Kiëlem

    2008-01-01

    Cette étude a pour but d'identifier les caractéristiques des régions stables dans la performance mesurée par la réussite au BEPC, et tenant compte des ressources qui leur ont été allouées pour leur fonctionnement. La stabilité dans le temps de la performance des établissements est abordée en considérant les scores obtenus au BEPC sur un certain nombre d'années. Les résultats saillants

  1. Matrise et usage des TIC : la situation des enseignants en Belgique francophone

    E-print Network

    Paris-Sud XI, Université de

    1 Maîtrise et usage des TIC : la situation des enseignants en Belgique francophone Henry Julie discours européen concernant la maîtrise des TIC par les enseignants, les auteurs pointent du doigt les complémentaires et présentent la seule certification TIC existant à l'heure d'écrire ce texte : form@TICEF. La

  2. La valorisation boursire des tats financiers des socits franaises : pertinence du rfrentiel IFRS

    E-print Network

    Paris-Sud XI, Université de

    IFRS Denis Cormier CIFO ESG UQAM Samira Demaria Université de Nice-Sophia Antipolis - GREDEG Pascale valorisation boursière des états financiers des sociétés françaises : pertinence du référentiel IFRS Résumé du référentiel comptable français et après l'adoption des IFRS. Les résultats sont les suivants

  3. L'EVALUATION DES PERFORMANCES : UNE COMPARAISON ENTRE LES PRATIQUES DES

    E-print Network

    Boyer, Edmond

    année à des entreprises américaines par L. Maisel en partenariat avec l'AICPA (American Institute'utiliser des indicateurs financiers et non monétaires dans l'évaluation de la performance des entreprises the use of financial and non-monetary information in the measurement and the analysis of firms

  4. Difficile convergence des archives ouvertes en SIC # Difficile convergence des archives ouvertes

    E-print Network

    Paris-Sud XI, Université de

    Difficile convergence des archives ouvertes en SIC # Difficile convergence des archives ouvertes en Paris RÉSUMÉ. L'article rend compte d'un test de moissonnage pour quatre archives ouvertes sélectionnées'identification des archives ouvertes SIC sur le répertoire international OpenDOAR, est ensuite approfondie à partir

  5. MTABOLISME DE LA FLORE INTESTINALE DU PORC DGRADATION DES FORMES L ET D DES ACIDES AMINS

    E-print Network

    Paris-Sud XI, Université de

    MÉTABOLISME DE LA FLORE INTESTINALE DU PORC DÉGRADATION DES FORMES L ET D DES ACIDES AMINÉS M. C. MICHEL Simone BOCHE Laboratoire des Métabolismes Centre national de Recheyches zootechniques, 78 - Jouy-en-Josas - -- SOMMAIRE In vitro, la flore microbienne intestinale du porc catabolise tous les acides aminés. L

  6. CONTRIBUTION A LA DTERMINATION DES PARAMTRES DES RSONANCES NEUTRONIQUES DE L'URANIUM 235

    E-print Network

    Paris-Sud XI, Université de

    712. CONTRIBUTION A LA DÉTERMINATION DES PARAMÈTRES DES RÉSONANCES NEUTRONIQUES DE L'URANIUM 235, OCTOBRE 1961, La mesure de la section efficace de fission de l'uranium-235, déjà publiée, et qui avait. venin du Service de Calcul Électronique de Saclay, pondant à une température de Debye des oxydes d'uranium

  7. Minorites, capacites cognitives et revenus des Canadiens

    Microsoft Academic Search

    Ross Meng Ronald Finnie

    2003-01-01

    A partir des donnees de l'Enquete sur les capacites de lecture et d'ecriture utilisees quotidiennement (ECLEUQ) de Statistique Canada, nous avons etudie les differences de revenus entre les minorites et les Blancs et l'importance des capacites cognitives dans les modeles de revenus observes. Certains groupes de minorites ont des capacites de lecture et de calcul considerablement inferieures (d'apres les tests)

  8. NOUVEL APPAREILLAGE DE MESURE DES AIMANTATIONS ;

    E-print Network

    Paris-Sud XI, Université de

    est suivant l'axe c à basse température et dans le plan de base à des températures. supérieures à 600 0 dans laquelle 0 désigne l'angle de l'aimantation spontanée Jg avec l'axe c. La déter- mination des'angle du champ extérieur He avec l'axe c ; nous avons mesuré pour différents angles cp, dans des champs

  9. Gesundheit als Sehnsucht — Religiöse Aspekte des Gesundheitsbegriffs

    Microsoft Academic Search

    Matthias Stiehler

    2001-01-01

    Zusammenfassung  Religiöse Aspekte des Gesundheitsbegriffs spielen innerhalb der Gesundheitswis-senschaft nur eine untergeordnete Rolle, obwohl\\u000a Sinn- und Wertefragen unser Ver-stdndnis von Gesundheit bis heute beeinflussen. Diese Fragen sind dabei weniger im Alltag\\u000a als mehr in Krisensituationen verortet, die das selbstverständlich Gege-bene aufheben. Eine Analyse des biblischen Befundes\\u000a eröffnet vier Themenfür eine Ausweitung des Gesundheitsbegriffs unter religiösen Gesichtspunkten, die in dieser Arbeit begin-nend

  10. Produire des actes juridiques David Pontille*

    E-print Network

    Paris-Sud XI, Université de

    'espace, c'est qu'on l'a partagée avec des non-humains. (Latour 1994, p. 604) Incarner la force du droit Deux'ensemble des professions juridiques, des conseillers d'Etat qui ont le pouvoir de dire le droit (Latour 2002'est au moins en partie parce qu'il prend une forme palpable et transportable. B. Latour (2002, chap. 2

  11. Iatrogénie Sexuelle des Médicaments: conduite à tenir

    Microsoft Academic Search

    Stéphane Droupy

    2005-01-01

    Résumé  Une des étapes primordiale de la prise en charge des troubles sexuelles est l’identification d’une éventuelle cause médicamenteuse.\\u000a De nombreux médicaments sont en fait probablement moins impliqués eux-mêmes dans la survenue de troubles sexuels que la maladie\\u000a pour laquelle ils ont été prescrits. Ainsi, l’analyse critique de la littérature, la standardisation des paramètres mesurables\\u000a de la sexualité utilisés en études

  12. CONSEIL GENERAL DES CTES D'ARMOR

    E-print Network

    Brest, Université de

    CONSEIL GENERAL DES CÔTES D'ARMOR LUTTE PREVENTIVE ET CURATIVE CONTRE LA PROLIFERATION DES MAREES-Michel-en-Grève (Côtes d'Armor) _________ GEOMER Septembre 2003 UMR LETG - 6554 du C.N.R.S. hal-00083706,version1-12Aug2014 #12;Poche du Yar 2002-2003 ­ GEOMER-UMR 6554 CNRS -1- CONSEIL GENERAL DES COTES D'ARMOR LUTTE

  13. Sur la théorie des perturbations en mécanique quantique (I)

    Microsoft Academic Search

    M. Schönberg

    1951-01-01

    Resumé  Nous donnons des formes modifiées des développements de la théorie quantique des perturbations pour des problèmes stationnaires\\u000a ou non stationnaires. Les formes modifiées du développement stationnaire de Schrödinger sont plus simples que le développement\\u000a original. La forme modifiée du développement non stationnaire de Dirac ne contient pas des termes séculaires et elle se rattache\\u000a étroitement à une des formes modifiées

  14. Der osmotische Druck des Serumalbumins

    Microsoft Academic Search

    Wolfgang Pauli; Paul Fent

    1934-01-01

    Zusammenfassung  \\u000a \\u000a \\u000a \\u000a 1. \\u000a \\u000a Die Methode von Krogh und Nakazawa wird durch einige Abnderungen der osmotischen Zelle, der Ablesung und der Gehaltsbestimmung\\u000a der gemessenen Flssigkeit zur genaueren Bestimmung des osmotischen Druckes von Kolloiden, insbesondere von Proteinen, mit\\u000a Mengen von 0,4 ccm verwendbar gemacht.\\u000a \\u000a \\u000a \\u000a \\u000a 2. \\u000a \\u000a Es werden die bisherigen Ergebnisse der ultrazentrifugalen und der osmotischen Druckmethode bei der Bestimmung des Molekulargewichtes\\u000a isoelektrischer Proteine

  15. Determining the alpha dynamo parameter in incompressible homogeneous magnetohydrodynamic turbulence

    NASA Technical Reports Server (NTRS)

    Matthaeus, W. H.; Goldstein, M. L.; Lantz, S. R.

    1983-01-01

    Alpha, an important parameter in dynamo theory, is proportional to either the kinetic, current, magnetic, or velocity helicity of the fluctuating magnetic field and fluctuating velocity field. The particular helicity to which alpha is proportional depends on the assumptions used in deriving the first order smoothed equations that describe the alpha effect. In two cases, when alpha is proportional to either the magnetic helicity or velocity helicity, alpha is determined experimentally from two point measurements of the fluctuating fields in incompressible, homogeneous turbulence having arbitrary symmetry. For the other two possibilities, alpha is determined if the turbulence is isotropic.

  16. Are you thinking of joining a coed fraternity? Alpha Theta, Phi Tau or The Tabard

    E-print Network

    Myers, Lawrence C.

    @dartmouth.edu TBA Are you thinking of joining an IFC fraternity? Alpha Chi Alpha, Alpha Delta, Beta Alpha OmegaAre you thinking of joining a coed fraternity? Alpha Theta, Phi Tau or The Tabard First you need session Coed Council Recruitment Dates (for each individual chapter) Alpha Theta 33 North Main St Alpha

  17. HACK Patrice Les coulisses des assistances tlphoniques

    E-print Network

    Paris-Sud XI, Université de

    HACK Patrice 1 ________________________________________________________________ Les coulisses des Criminologie et de Police Technique et Scientifique LXV (2012) 110" #12;HACK Patrice 2 1 ­ Données et méthode

  18. Temperature-dependent chaperone activity and structural properties of human alphaA- and alphaB-crystallins.

    PubMed

    Reddy, G B; Das, K P; Petrash, J M; Surewicz, W K

    2000-02-18

    The chaperone activity and biophysical properties of recombinant human alphaA- and alphaB-crystallins were studied by light scattering and spectroscopic methods. While the chaperone function of alphaA-crystallin markedly improves with an increase in temperature, the activity of alphaB homopolymer appears to change very little upon heating. Compared with alphaB-crystallin, the alphaA-homopolymer is markedly less active at low temperatures, but becomes a more active species at high temperatures. At physiologically relevant temperatures, the alphaB homopolymer appears to be modestly (two times or less) more potent chaperone than alphaA homopolymer. In contrast to very similar thermotropic changes in the secondary structure of both homopolymers, alphaA- and alphaB-crystallins markedly differ with respect to the temperature-dependent surface hydrophobicity profiles. Upon heating, alphaA-crystallin undergoes a conformational transition resulting in the exposure of additional hydrophobic sites, whereas no such transition occurs for alphaB-crystallin. The correlation between temperature-dependent changes in the chaperone activity and hydrophobicity properties of the individual homopolymers supports the view that the chaperone activity of alpha-crystallin is dependent on the presence of surface-exposed hydrophobic patches. However, the present data also show that the surface hydrophobicity is not the sole determinant of the chaperone function of alpha-crystallin. PMID:10671481

  19. Methoden zur Diagnose und zum Monitoring des Trockenen Auges: Bericht des Diagnostic Methodology Subcommittee des International Dry Eye WorkShop (2007)

    Microsoft Academic Search

    J. Bron; Mark B. Abelson; George Ousler; E. Pearce; Alan Tomlinson; Norihiko Yokoi; Janine A. Smith; Carolyn Begley; Barbara Caffery; Kelly Nichols; Debra Schaumberg; Oliver Schein; Margarita Calonge; Christophe Baudouin; Eiki Goto; Franz Grus; Jerry Paugh

    ZUSAMMENFASSUNG Das Diagnostic Methodology Subcommittee des DEWS (Dry Eye Workshop) hatte folgende Ziele: 1) Identifi kation von Tests für Screening, Diagnose und Überwachung des Trockenen Auges, 2) Etablierung von Leistungskriterien für diese Tests und 3) Betrachtung des Nutzens von Tests in einer Vielzahl klinischer Situationen. Das Komitee erstellte eine Datenbank mit Tests zur Verwendung bei der Diagnose und Überwachung des

  20. Pour une histoire mtisse des sciences du monde physique

    E-print Network

    Aubin, David

    Pour une histoire métisse des sciences du monde physique (chaos, observatoire, guerre) Document de ....................................................................................................................... 47 e) six propositions pour une histoire métisse des sciences du monde physique

  1. Prediction of {alpha}-decay half-lives and Q{sub {alpha}} values of superheavy nuclei by a global potential for {alpha} + nucleus systems

    SciTech Connect

    Sahu, Basudeb [Department of Physics, North Orissa University, Baripada-757003 (India)

    2011-09-15

    An approach we have proposed recently for calculation of Q{sub {alpha}} energy and decay half-life T{sub 1/2}{sup {alpha}} on the {alpha} decay of radioactive heavy ions is applied to the evaluation of these two important parameters for the nuclei in the superheavy region Z = 112-118 for which experimental data are not available. It is shown that the {alpha} + nucleus potential represented by an exactly solvable potential used in the calculation could be expressed in terms of proton (Z) and neutron (N) numbers of the {alpha} emitter so that varieties of {alpha}-emitting nuclei differing in their Z and N values could be addressed for their decay properties without the help of any adjustable parameter and the results of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} for a nucleus are estimated without any prior knowledge of any one of these quantities. This procedure to obtain the values of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} works well to reproduce the known experimental results for superheavy nuclei and hence, the procedure is expected to provide proper information about these parameters in experiments on {alpha} decay of new nuclei in the superheavy region.

  2. Global acoustic oscillations on Alpha Bootis

    Microsoft Academic Search

    Juan A. Belmonte; Andrew R. Jones; Pere L. Palle; Teodoro Roca Cortes

    1990-01-01

    A two-week time series of precise radial velocity measurements of Alpha Bootis (Arcturus) covering 7-8 hr per night is reported. The radial barycentric velocity of the star is found to be -5021 + or - 5 m\\/s. When data from the whole run are jointly analyzed, several equispaced peaks in the frequency appear in the range of a few microhertz,

  3. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  4. Method of making nanocrystalline alpha alumina

    DOEpatents

    Siegel, Richard W. (Hinsdale, IL); Hahn, Horst (Champaign, IL); Eastman, Jeffrey A. (Woodridge, IL)

    1992-01-01

    Method of making selected phases of nanocrystalline ceramic materials. Various methods of controlling the production of nanocrystalline alpha alumina and titanium oxygen phases are described. Control of the gas atmosphere and use of particular oxidation treatments give rise to the ability to control the particular phases provided in the aluminum/oxygen and titanium/oxygen system.

  5. Alpha labelings of straight simple polyominal caterpillars

    E-print Network

    Froncek, Dalibor

    and Minion [1] introduced the notion of snake polyomino graphs and proved that they admit an alpha labeling, and Computing in Boca Raton in March, 2014, Sarah Minion (an undergraduate student) presented her joint re report that later developed into the presented paper. Barrientos and Minion [1] define a snake polyomino

  6. Intelligence and Frequency of the Alpha Rhythm

    ERIC Educational Resources Information Center

    Ellingson, Robert J.; Lathrop, Gerald H.

    1973-01-01

    The alpha rhythm frequencies (8 to 13 cycles per second, occurring during a S's relaxed state with eyes closed, measured by the electroencephalogram) of three groups of Ss (30 Down's Syndrome residents, 21 psychiatric patients, and 10 university students) aged 13 to 24 years, were determined according to explicit criteria. (Author/MC)

  7. Role of alpha interferon in multiple myeloma

    Microsoft Academic Search

    D. E. Joshua; S. MacCallum; J. Gibson

    1997-01-01

    Interferons are soluble proteins produced by cells in response to viruses. Although they were first introduced as therapeutic agents for myeloma in 1979 their exact role in the management of myeloma remains to be precisely defined. Interferons have both anti-proliferative and immune regulation effects, but the predominant mode of action of interferons in myeloma is still unclear. Recombinant alpha interferon

  8. Alpha 97: Basic Education and Institutional Environments.

    ERIC Educational Resources Information Center

    Hautecoeur, Jean-Paul, Ed.

    This document was published by Alpha, a research program specializing in alternative, experimental approaches to adult basic education. It is an attempt to widen the field and examine the relationship between the micro and macro levels, between the diversity of different practices and the major policy orientations that foster or limit this…

  9. General dynamics of varying-alpha universes

    NASA Astrophysics Data System (ADS)

    Barrow, John D.; Graham, Alexander A. H.

    2013-11-01

    We introduce and study extensions of the varying alpha theory of Bekenstein-Sandvik-Barrow-Magueijo to allow for an arbitrary coupling function and self-interaction potential term in the theory. We study the full evolution equations without assuming that variations in alpha have a negligible effect on the expansion scale factor and the matter density evolution, as was assumed in earlier studies. The background Friedmann-Robertson-Walker cosmology of this model in the cases of zero and nonzero spatial curvature is studied in detail, using dynamical systems techniques, for a wide class of potentials and coupling functions. All the asymptotic behaviors are found, together with some new solutions. We study the cases where the electromagnetic parameter, zeta, is positive and negative, corresponding to magnetic and electrostatic energy domination in the nonrelativistic matter. In particular, we investigate the cases where the scalar field driving alpha variations has exponential and power-law self-interaction potentials and the behavior of theories where the coupling constant between matter and alpha variations is no longer a constant.

  10. alphaCertified Jonathan D. Hauenstein

    E-print Network

    Sottile, Frank

    Certified The program alphaCertified by Jonathan D. Hauenstein and Frank Sottile implements algorithms based on Smale's -theory to certify solutions to polynomial and polynomial-exponential systems. This manual provides in C and uses the GMP[3] and MPFR[2] libraries to perform rational and arbitrary floating point

  11. Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"

    ERIC Educational Resources Information Center

    Ritter, Nicola L.

    2010-01-01

    It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact…

  12. Electron Screening Effects on {alpha}-decay

    SciTech Connect

    Musumarra, A.; Bonasera, A.; Del Zoppo, A.; Di Pietro, A.; Figuera, P.; Kimura, S.; Lattuada, M.; Pellegriti, M. G.; Scuderi, V.; Torresi, D. [INFN-LNS and University of Catania, Catania (Italy); Farinon, F.; Geissel, H.; Knoebel, R.; Prochazka, A.; Scheidenberger, C. [GSI, Darmstadt (Germany); Justus-Liebig Universitaet, Giessen (Germany); Nociforo, C.; Behr, K.-H.; Bosch, F.; Boutin, D.; Bruenle, A. [GSI, Darmstadt (Germany)] (and others)

    2009-08-26

    An open problem in Nuclear Astrophysics concerns the understanding of electron-screening effects on nuclear reaction rates at stellar energies. In this framework, we have proposed to investigate the influence of the electron cloud on {alpha}-decay by measuring Q-values and {alpha}-decay half-lives of fully stripped, H-like and He-like ions. These kinds of measurements have been feasible just recently for highly-charged radioactive nuclides by fragmentation of {sup 238}U at relativistic energies at the FRS-ESR facility at GSI. In this way it is possible to produce, efficiently separate and store highly-charged {alpha}-emitters. Candidates for the proposed investigation were carefully selected and will be studied by using the Schottky Mass Spectroscopy technique. In order to establish a solid reference data set, lifetimes and Q{sub {alpha}}-value measurements of the corresponding neutrals have been performed directly at the FRS, by implanting the separated ions into an active Silicon stopper.

  13. The Ups and Downs of Alpha Centauri

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    2013-07-01

    The nearby Alpha Centauri triple system has two solar-type stars in a relatively close orbit (20 au separation), and a dim red dwarf companion -- Proxima -- about 10,000 au away, on the Sun-ward side of the group. The heaviest star -- Alpha Cen A -- is a close twin of the Sun. Its slightly less massive companion -- Alpha Cen B -- is a K-type dwarf, and is the closest star thought to host an exoplanet (Earth-sized, but in a much tighter orbit). The close pair has been scrutinized for more than a decade in X-rays by XMM and Chandra, on a semiannual basis since 2003 and 2005, respectively. However, in recent years only Chandra has been able to cleanly separate the pair, which are approaching closest separation on the sky (only a few arcseconds) in their 80-year orbit. For the past 3 years, the HST STIS spectrograph has joined the crowd, also capturing FUV snapshots of the pair every six months. The Alpha Cen stars provide an important complement to long-term studies of the Sun at high energies. The K-star has displayed a clear 8-year cycle in recent years, while the G-star remains mired in a Maunder-like minimum.

  14. Alpha Shapes --a Survey Herbert Edelsbrunner1

    E-print Network

    Edelsbrunner, Herbert

    generalized his planar convex hull algorithm to a method that generates something like the shape of a finite point set. We recall that this algorithm computes the convex hull one edge at a time, pivoting a line with a historical account and discusses geometric, algorithmic, topological, and combinatorial aspects of alpha

  15. Coefficient Alpha and Reliability of Scale Scores

    ERIC Educational Resources Information Center

    Almehrizi, Rashid S.

    2013-01-01

    The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw…

  16. Relation entre les caractéristiques des table-bancs et les mesures anthropométriques des écoliers au Benin

    PubMed Central

    Falola, Stève Marjelin; Gouthon, Polycarpe; Falola, Jean-Marie; Fiogbe, Michel Armand; Nigan, Issiako Bio

    2014-01-01

    Introduction Le mobilier scolaire et la posture assise en classe sont souvent impliqués dans l'apparition des douleurs rachidiennes, influant de fait sur la qualité des tâches réalisées par les apprenants. Aucune étude n'a encore vérifié le degré d'adéquation entre les caractéristiques du mobilier et celles des écoliers au Bénin. L'objectif de cette étude transversale est donc de déterminer la relation entre les dimensions des table-bancs utilisées en classe et les mesures anthropométriques des écoliers au Bénin. Methods Elle a été réalisée avec un échantillon probabiliste de 678 écoliers, âgés de 4 à 17 ans. Les mesures anthropométriques des écoliers et les mensurations relatives aux longueurs, largeurs et hauteurs des table-bancs ont été mesurées, puis intégrées aux équations proposées dans la littérature. Les pourcentages des valeurs situées hors des limitesacceptables, dérivées de l'application des équations ont été calculés. Results La largeur et la hauteur des table-bancs utilisées par les écoliers étaient plus élevées (p < 0,05) que les valeurs de référence recommandées par les structures officielles de contrôle et de production des mobiliers scolaires au Bénin. Quel que soit le sexe, il y avait une inadéquation entre la largeur du banc et la longueur fesse-poplité, puis entre la hauteur de la table et la distance coude-bancdes écoliers. Conclusion Les résultats suggèrent de prendre en compte l’évolution des mesures anthropométriques des écoliers dans la confection des table-bancs, afin de promouvoir de bonnes postures assises en classe et de réduire le risque de troubles du rachis. PMID:25317232

  17. Le traitement familial des enfants et des adolescents anorexiques : Des lignes directrices pour le médecin communautaire

    PubMed Central

    Findlay, S; Pinzon, J; Taddeo, D; Katzman, DK

    2010-01-01

    L’anorexie mentale (AM) est une maladie grave qui met la vie en danger et qui fait généralement son apparition pendant l’adolescence. Les données probantes au sujet du traitement optimal de l’AM chez les enfants et les adolescents sont en croissance, mais il reste beaucoup à apprendre. Même si les démarches thérapeutiques actuelles varient au Canada et ailleurs, les données jusqu’à présent indiquent que le traitement familial (TF) est le plus efficace pour les enfants et les adolescents anorexiques. Un élément essentiel du modèle de TF, c’est que les parents sont investis de la responsabilité de rétablir la santé physique de leur enfant et de s’assurer de la reprise complète de son poids. Le médecin qui comprend les principes fondamentaux et la philosophie du TF peut mettre en place les éléments de cette intervention fondée sur des faits probants auprès des jeunes patients anorexiques et de leur famille.

  18. Etude cytophotomtrique de l'ADN et des nucloprotines des spermatozodes du blier : influence du sjour

    E-print Network

    Paris-Sud XI, Université de

    Etude cytophotométrique de l'ADN et des nucléoprotéines des spermatozoïdes du bélier : influence du'un complexe entre l'ADN et la protéine spécifique du spermatozoïde (BNSP) riche en cystéine et en arginine colorabi- lité de l'ADN par le Feulgen sans que la teneur en ADN des spermatozoïdes, mesurée en UV ne

  19. Relations between PET-derived measures of thalamic glucose metabolism and EEG alpha power

    E-print Network

    Wisconsin at Madison, University of

    , Madison, USA Abstract Electroencephalogram ~EEG! alpha power has been demonstrated to be inversely related, Positron emission tomography, Alpha, Thalamus Alpha electroencephalogram ~EEG! power is a commonly used

  20. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

  1. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

  2. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

  3. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

  4. Precision determination of alpha_s using an unbiased global NLO parton set

    E-print Network

    Lionetti, Simone; Bertone, Valerio; Cerutti, Francesco; Del Debbio, Luigi; Forte, Stefano; Guffanti, Alberto; Latorre, Jose I; Rojo, Juan; Ubiali, Maria

    2011-01-01

    We determine the strong coupling alpha_s from a next-to-leading order analysis of processes used for the NNPDF2.1 parton determination, which includes data from neutral and charged current deep-inelastic scattering, Drell-Yan and inclusive jet production. We find alpha_s(M_Z)=0.1191+-0.0006 (exp), where the uncertainty includes all statistical and systematic experimental uncertainties, but not purely theoretical uncertainties. We study the dependence of the results on the dataset, by providing further determinations based respectively on deep-inelastic data only, and on HERA data only. The deep-inelastic fit gives the consistent result alpha_s(M_Z)=0.1177+-0.0009(exp), but the result of the HERA-only fit is only marginally consistent. We provide evidence that individual data subsets can have runaway directions due to poorly determined PDFs, thus suggesting that a global dataset is necessary for a reliable determination.

  5. Surrogate ratio method in the actinide region using the ({alpha},{alpha}{sup '}f) reaction

    SciTech Connect

    Lesher, S. R. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Burke, J. T.; Bernstein, L. A.; Dietrich, F. S.; Escher, J. E.; Moody, K. J.; Scielzo, N. D. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Ai, H. [Wright Nuclear Structure Laboratory, Yale University, New Haven, Connecticut 06520 (United States); Beausang, C. W. [Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Bleuel, D. L.; Wiedeking, M. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Clark, R. M.; Fallon, P.; Gibelin, J.; Lee, I. Y.; Macchiavelli, A. O.; McMahan, M. A.; Phair, L.; Rodriguez-Vieitez, E. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Goldblum, B. L. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Department of Nuclear Engineering, University of California, Berkeley, California 94720 (United States)] (and others)

    2009-04-15

    In the Surrogate Method, the measured decay probability of a compound nucleus formed via a direct reaction is used to extract the cross section for a reaction with a different entrance channel that proceeds through the same compound nucleus. An extension of the Surrogate Method, the Surrogate Ratio Method (SRM), uses a ratio of measured decay probabilities to infer an unknown cross section relative to a known one. To test the SRM we compare the direct-reaction-induced fission probability ratio of {sup 234}U({alpha},{alpha}{sup '}f) to {sup 236}U({alpha},{alpha}{sup '}f) with the ratio of cross sections of {sup 233}U(n,f) to {sup 235}U(n,f). These ratios were found to be in agreement over an equivalent neutron energy range of 0.4-18 MeV.

  6. Picrotoxin-mediated antagonism of alpha3beta4 and alpha7 acetylcholine receptors.

    PubMed

    Erkkila, Brian E; Weiss, David S; Wotring, Virginia E

    2004-08-26

    Picrotoxin (PTX) is a convulsant that antagonizes many inhibitory ligand-gated receptors. The mechanism of PTX block is believed to involve residues which line the pore in the second transmembrane domain (M2). The alpha(3)beta(4) and alpha(7) nicotinic acetylcholine receptors (nAChRs) have high homology to inhibitory LGICs in this M2 region and therefore could also be susceptible to block by PTX. Here, we report that PTX is an effective inhibitor at these nicotinic receptors (rat), with IC50 values of 96.1 +/- 5.5 and 194.9 +/- 19.2 microM for the alpha(3)beta(4) and alpha(7), respectively. These results provide insights into the structure-function relation of PTX-mediated antagonism in this family of ligand-activated receptors. Furthermore they should also be considered when employing PTX to selectively eliminate GABA- or glycine-mediated events. PMID:15305147

  7. Alpha-Alpha scattering, chiral symmetry and {sup 8}Be lifetime

    SciTech Connect

    Ruiz Arriola, E. [Departamento de Fisica Atomica, Molecular y Nuclear Universidad de Granada E-18071 Granada (Spain)

    2008-08-31

    Alpha-alpha scattering is discussed in terms of a chiral two pion exchange potential (TPE) which turns out to be attractive and singular at the origin, hence demanding renormalization. When {sup 8}Be is treated as a resonance state a model independent correlation between the Q-factor and lifetime 1/{gamma} for the decay into two alpha particles arises. For a wide range of parameters compatible with potential model analyses of low energy {pi}{alpha} scattering it is found {gamma} = 4.4(4)eV in fairly good agreement with the experimental value {gamma}{sub exp.} = 5.57(25)eV. The remaining discrepancy as well as the phase shift up to E{sub LAB} = 15 MeV could be accommodated by the leading nuclear peripheral contributions due to the {sup 3}H+p and {sup 3}He+n continuum.

  8. Using XML to encode TMA DES metadata

    PubMed Central

    Lyttleton, Oliver; Wright, Alexander; Treanor, Darren; Lewis, Paul

    2011-01-01

    Background: The Tissue Microarray Data Exchange Specification (TMA DES) is an XML specification for encoding TMA experiment data. While TMA DES data is encoded in XML, the files that describe its syntax, structure, and semantics are not. The DTD format is used to describe the syntax and structure of TMA DES, and the ISO 11179 format is used to define the semantics of TMA DES. However, XML Schema can be used in place of DTDs, and another XML encoded format, RDF, can be used in place of ISO 11179. Encoding all TMA DES data and metadata in XML would simplify the development and usage of programs which validate and parse TMA DES data. XML Schema has advantages over DTDs such as support for data types, and a more powerful means of specifying constraints on data values. An advantage of RDF encoded in XML over ISO 11179 is that XML defines rules for encoding data, whereas ISO 11179 does not. Materials and Methods: We created an XML Schema version of the TMA DES DTD. We wrote a program that converted ISO 11179 definitions to RDF encoded in XML, and used it to convert the TMA DES ISO 11179 definitions to RDF. Results: We validated a sample TMA DES XML file that was supplied with the publication that originally specified TMA DES using our XML Schema. We successfully validated the RDF produced by our ISO 11179 converter with the W3C RDF validation service. Conclusions: All TMA DES data could be encoded using XML, which simplifies its processing. XML Schema allows datatypes and valid value ranges to be specified for CDEs, which enables a wider range of error checking to be performed using XML Schemas than could be performed using DTDs. PMID:21969921

  9. Aqueous chemical growth of alpha-Fe2O3-alpha-Cr203 nanocompositethin films

    Microsoft Academic Search

    Lionel Vayssieres; Jinghua Guo; Joseph Nordgren

    2001-01-01

    We are reporting here on the inexpensive fabrication and optical properties of an iron(III) oxide chromium(III) oxide nanocomposite thin film of corundum crystal structure. Its novel and unique-designed architecture consists of uniformed, well-defined and oriented nanorods of Hematite (alpha-Fe2O3) of 50 nm in diameter and 500nm in length and homogeneously distributed nonaggregated monodisperse spherical nanoparticles of Eskolaite (alpha-Cr2O3) of 250

  10. Antibody-mediated reduction of {alpha}-ketoamides

    DOEpatents

    Schultz, P.G.; Gallop, M.A.

    1998-06-09

    Monoclonal antibodies raised against a 4-nitrophenyl phosphonate hapten catalyze the stereospecific reduction of an {alpha}-ketoamide to the corresponding {alpha}-hydroxyamide in the presence of an appropriate reducing agent.

  11. An assay for intermolecular exchange of alpha crystallin

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    An affinity column of alpha crystallin linked to cyanogen bromide-activated Sepharose was developed to study the exchange of alpha subunits. Alpha crystallin bound to the Sepharose-alpha complex was dissociated with 8 mol/l urea, followed by quantitation using high-performance reverse-phase liquid chromatography. The time course of binding at 37 degrees C showed a hyperbolic binding pattern reaching equilibrium between 6-18 hr. Under these conditions, binding of beta and gamma crystallins to the same matrix was less than 10% of the alpha values, as was binding of alpha to glycine-coupled Sepharose. This assay was used to demonstrate changes in the subunit exchange of alpha crystallins present in high molecular weight versus lower molecular weight aggregates of the human lens. These results show that this binding procedure was a specific reproducible assay that might be used to study intermolecular interactions of the alpha crystallins.

  12. 29 CFR 1926.1104 - alpha-Naphthylamine.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    29 Labor 8 2011-07-01 2011-07-01 false alpha-Naphthylamine. 1926.1104 Section 1926.1104 Labor...CONSTRUCTION Toxic and Hazardous Substances § 1926.1104 alpha-Naphthylamine. Note: The requirements applicable...

  13. 29 CFR 1926.1104 - alpha-Naphthylamine.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    29 Labor 8 2010-07-01 2010-07-01 false alpha-Naphthylamine. 1926.1104 Section 1926.1104 Labor...CONSTRUCTION Toxic and Hazardous Substances § 1926.1104 alpha-Naphthylamine. Note: The requirements applicable...

  14. Who Is at Risk for Alpha-1 Antitrypsin Deficiency?

    MedlinePLUS

    ... on Twitter. Who Is at Risk for Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency occurs in all ethnic groups. ... it doesn't mean that you'll develop one of the diseases related to the condition. Some ...

  15. Peroxisome proliferator-activated receptor {alpha}-independent peroxisome proliferation

    SciTech Connect

    Zhang Xiuguo [Department of Metabolic Regulation, Shinshu University Graduate School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan); Tanaka, Naoki [Department of Metabolic Regulation, Shinshu University Graduate School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan) and Department of Internal Medicine, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan)]. E-mail: naopi@hsp.md.shinshu-u.ac.jp; Nakajima, Takero [Department of Metabolic Regulation, Shinshu University Graduate School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan); Kamijo, Yuji [Department of Metabolic Regulation, Shinshu University Graduate School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan); Department of Internal Medicine, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan); Gonzalez, Frank J. [Laboratory of Metabolism, National Cancer Institute, Bethesda, MD 20892 (United States); Aoyama, Toshifumi [Department of Metabolic Regulation, Shinshu University Graduate School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan)

    2006-08-11

    Hepatic peroxisome proliferation, increases in the numerical and volume density of peroxisomes, is believed to be closely related to peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) activation; however, it remains unknown whether peroxisome proliferation depends absolutely on this activation. To verify occurrence of PPAR{alpha}-independent peroxisome proliferation, fenofibrate treatment was used, which was expected to significantly enhance PPAR{alpha} dependence in the assay system. Surprisingly, a novel type of PPAR{alpha}-independent peroxisome proliferation and enlargement was uncovered in PPAR{alpha}-null mice. The increased expression of dynamin-like protein 1, but not peroxisome biogenesis factor 11{alpha}, might be associated with the PPAR{alpha}-independent peroxisome proliferation at least in part.

  16. Antibody-mediated reduction of .alpha.-ketoamides

    DOEpatents

    Schultz, Peter G. (Oakland, CA); Gallop, Mark A. (East Palo Alto, CA)

    1998-01-01

    Monoclonal antibodies raised against a 4-nitrophenyl phosphonate hapten catalyze the stereospecific reduction of an .alpha.-ketoamide to the corresponding .alpha.-hydroxyamide in the presence of an appropriate reducing agent.

  17. Study of alpha background in a dark matter detector

    E-print Network

    Yegoryan, Hayk

    2010-01-01

    Alpha background, specifically from radon and its progeny in the uranium and thorium chains, has been a major issue in dark matter detectors. This work focuses on alpha background presence in the DMTPC experiment by examining ...

  18. Differential gene expression of Caenorhabditis elegans grown on unmethylated sterols or 4alpha-methylsterols.

    PubMed

    Merris, Mark; Wang, Tongsheng; Soteropoulos, Patricia; Lenard, John

    2007-05-01

    Transcriptional profiles of Caenorhabditis elegans grown on unmethylated sterols (desMSs) or on 4alpha-methylsterols (4MSs) were compared using microarrays. Thirty-four genes were upregulated and 2 were downregulated>2-fold by growth on 4MSs, including 13 cuticle collagen (col) genes, 1 cuticulin gene (cut-1), 2 groundhog-like (grl) genes, and 1 groundhog gene (grd-4); col-36 and grl-20 were increased 12- and 19-fold, respectively. Fifteen of these 17 genes have been assigned to metabolic mountain 17, suggesting coordinate 4MS-mediated regulation of expression. Quantitative RT-PCR was performed on 27-51 h old animals grown on cholesterol (a desMS) or lophenol (a 4MS). col-36 and grl-20 showed similar cyclic peaks of expression in cholesterol and similar alterations in lophenol, suggesting coregulation. Of six additional grl genes, only grl-3 was upregulated on lophenol; the rest were downregulated. Cyclicity of expression was lost or altered in all six. Nuclear receptor genes nhr-23, nhr-25, nhr-41, and daf-12 all showed cyclic expression in cholesterol and significant downregulation in lophenol by RT-PCR. Expression of the insulin-like receptor daf-2 was lower in lophenol, whereas that of its major downstream target daf-16 was higher. Thus, major changes in gene expression accompany growth on 4MSs, but with surprisingly little effect on normal growth and development. PMID:17277379

  19. Integrin alpha v beta 3 differentially regulates adhesive and phagocytic functions of the fibronectin receptor alpha 5 beta 1

    PubMed Central

    1994-01-01

    The plasma protein fibronectin is an important opsonin in wound repair and host defense. To better understand the process of fibronectin- mediated phagocytosis, we have transfected K562 cells, which endogenously express alpha 5 beta 1, with alpha v beta 3. In these transfectants, antibodies to alpha v beta 3 block phagocytosis of fibronectin-opsonized beads completely, even though half the ingestion occurs through endogenous alpha 5 beta 1 receptors. alpha 5 beta 1- mediated adhesion to fibronectin-coated surfaces is unaffected by alpha v beta 3 ligation. Neither alpha v beta 5 nor alpha M beta 2 ligation affects alpha 5 beta 1 phagocytic function in transfectants expressing these receptors. Pharmacologic data suggest that alpha v beta 3 ligation suppresses the phagocytic competence of high affinity alpha 5 beta 1 receptors through a signal transduction pathway, perhaps involving protein kinase C. In addition to its significance for phagocytosis, alpha v beta 3 regulation of alpha 5 beta 1 function may be significant for its roles in cell migration, metastasis, and angiogenesis. PMID:7525603

  20. Removal of alpha-Gal epitopes from porcine aortic valve and pericardium using recombinant human alpha galactosidase A.

    PubMed

    Park, Seongsik; Kim, Woong-Han; Choi, Sun-Young; Kim, Yong-Jin

    2009-12-01

    It has been reported that the immune response due to alpha-Gal epitopes is an important factor in tissue valve failure. The elimination of the interaction between the natural anti-Gal antibodies and alpha-gal epitopes on the xenografts is a prerequisite to the success of xenografts in humans. Previously, we reported that the green coffee bean alpha-galactosidase could remove all alpha-Gal epitopes from cell surface of porcine aortic valve and pericardial tissue, but it has limitations on cost effectiveness. In this study we wanted to know whether the recently produced recombinant human alpha-galactosidase A has the same effective enzymatic activity as green coffee bean alpha-galactosidase in removing alpha-Gal epitopes from the same tissues. After treating fresh porcine aortic valve and pericardial tissue with recombinant alpha-galactosidase A, each sample was stained with Griffonia simplicifolia type I isolectin B4 indirect immunoperoxidase avidin-biotin technique. We then examined whether the alpha-Gal epitopes were reduced or abolished in each consecutive concentration of recombinant alpha-galactosidase A by comparing the degree of the Griffonia simplicifolia isolectin B4 staining. As a result, the recombinant alpha-galactosidase A could remove cell surface alpha-Gals on porcine aortic valve and pericardial tissue as effectively as green coffee bean alpha-galactosidase. PMID:19949670

  1. Chaperone-like activities of {alpha}-synuclein: {alpha}-Synuclein assists enzyme activities of esterases

    SciTech Connect

    Ahn, Misun [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of); Kim, SeungBum [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of); Kang, Mira [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of); Ryu, Yeonwoo [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of)]. E-mail: ywryu@ajou.ac.kr; Doohun Kim, T. [Division of Biotechnology and Molecular Engineering, College of Engineering, Ajou University, Suwon 443-749 (Korea, Republic of)]. E-mail: doohunkim@ajou.ac.kr

    2006-08-11

    {alpha}-Synuclein, a major constituent of Lewy bodies (LBs), has been implicated to play a critical role in the pathogenesis of Parkinson's disease (PD), although the physiological function of {alpha}-synuclein has not yet been known. Here we have shown that {alpha}-synuclein, which has no well-defined secondary or tertiary structure, can protect the enzyme activity of microbial esterases against stress conditions such as heat, pH, and organic solvents. In particular, the flexibility of {alpha}-synuclein and its C-terminal region seems to be important for complex formation, but the structural integrity of the C-terminal region may not be required for stabilization of enzyme activity. In addition, atomic force microscopy (AFM) and in vivo enzyme assays showed highly specific interactions of esterases with {alpha}-synuclein. Our results indicate that {alpha}-synuclein not only protects the enzyme activity of microbial esterases in vitro, but also can stabilize the active conformation of microbial esterases in vivo.

  2. Possible stimulation of nuclear alpha-decay by superfluid helium

    E-print Network

    A. L. Barabanov

    2009-09-03

    It is suggested that superfluid helium (condensate of 4-He atoms) may stimulate nuclear alpha-decay in a situation when an alpha-emitter moves through superfluid helium with fine-tuned velocity, so that the backward-emitted alpha-particle is at rest in the laboratory frame. It is shown that the probability of stimulated alpha-decay in this case may be sizable enough to be detected.

  3. Analyse des possibilités de fonctionnement en régime des désexcitation des moteurs à aimants permanents

    NASA Astrophysics Data System (ADS)

    Multon, Bernard; Lucidarme, Jean; Prévond, Laurent

    1995-05-01

    In this paper, we study the extending of speed range of motors (or generators) with permanent magnet inductor and supplied by electronic converter. The amplitude of phase voltage and current waveforms are limited by electronics supply. The aim of this study is to achieve a maximum power near of the base speed one on an extended speed range. This require an airgap flux weakening so called “flux weakening” above base speed. A parametric analysis of motor electromagnetic characteristics is made to show the influence of armature reaction and magnetic saliency on speed range. We show that exists an ideal condition to obtain a constant power speed range theoretically unlimited. Magnetic saliency permits to enhance the power factor especially when L_d> L_q. As main hypotheses, we consider no saturation, e.m.f. and current sine waveforms and a sinusoidal airgap flux density. Finally, we recapitulate the permanent magnet rotor structures able to obtain a flux-weakening operation. Cet article traite de l'extension de la plage de vitesse des moteurs (ou alternateurs) à excitation par aimants permanents et alimentés par convertisseur électronique. La tension et le courant sont limités en amplitude par l'alimentation électronique.L'objectif est d'obtenir une puissance proche de celle correspondant au régime de base sur une plage de vitesse étendue. Ceci nécessite une réduction de flux d'entrefer ou “désexition” au delà de la vitesse de base. Une analyse paramétrique des caractéristiques du moteur est effectuée pour mettre en évidence l'influence de la réaction d'induit et de la saillance magnétique. Nous montrons qu'il existe une condition idéale pour obtenir une plage de fonctionnement à puissance constante théoriquement illimitée. La saillance magnétique permet d'accroître le facteur de puissance surtout lorsque L_d> L_q. Les principales hypothèses de cette étude sont l'absence de saturation, des f.e.m. et des courants sinusoïdaux et une induction spatiale sinusoïdale dans l'entrefer. Enfin, nous effectuons un bilan des structures de rotors permettant un fonctionnement en régime de désexcitation.

  4. Some numerical reslts on best uniform polynomial approximation of. chi. sup. alpha. on (0,1)

    SciTech Connect

    Carpenter, A.J.; Varga, R.S.

    1992-01-01

    Let {alpha} be a positive number, and let E{sub n}(chi{sup {alpha}}; (0,1)) denote the error of best uniform approximation to {chi}{sup {alpha}}, by polynomials of degree at most n, on the interval (0,1). The Russian mathematician S.N. Bernstein established the existence of a nonnegative constant {Beta}({alpha}) such that {Beta}({alpha}):= {sub n{yields}{infinity}lim(2n){sup 2{alpha}}E{sub n}({chi}{sup {alpha}};(0.1)). In addition, Bernstein showed that {Beta}{alpha} < {Gamma}(2{alpha}){vert bar}sin(pi}{alpha}){vert bar}/{pi} ({alpha} > 0) and that {Gamma}(2{alpha}){vert bar}sin({pi}{alpha}){vert bar}/{pi} (1{minus}1/2{alpha}{minus}1) < {Beta}({alpha}) ({alpha} > {1/2}), so that the asymptotic behavior of {Beta}({alpha}) is known when {alpha}{yields}{infinity}. Still, the problem of trying to determine {Beta}({alpha}) more precisely, for all {alpha} > 0, is intriguing. To this end, we have rigorously determined the numbers for thirteen values of {alpha}, where these numbers were calculated with a precision of at least 200 significant digits. For each of these thirteen values of {alpha}, Richardson's extrapolation was applied to the products to obtain estimates of {Beta}({alpha}) to approximately 40 decimal places. Included are graphs of the points ({alpha},{Beta}({alpha})) for the thirteen values of {alpha} that we considered.

  5. FACULT DES LETTRES PRIX MARCEL COMPAGNON

    E-print Network

    Halazonetis, Thanos

    [Texte] FACULTÉ DES LETTRES PRIX MARCEL COMPAGNON ... des sciences de l'Antiquité : récompense un mémoire de maîtrise dans un domaine qui ne bénéficie pas d'un prix spécifique. Montant 3'000 CHF pour chaque prix Conditions particulières Obtenir au mémoire de maîtrise la note minimale de 5,5. Le mémoire

  6. Table des mati`eres Introduction 5

    E-print Network

    Paris-Sud XI, Université de

    Table des mati`eres Introduction 5 1 Le verre et l'alt´eration des verres 9 1.1 Le verre et les verres d'aluminosilicate de calcium . . . . . . . . . . . . . . . . 9 1.1.1 L'´etat vitreux . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 1.1.2 Le verre obtenu `a partir d'un liquide . . . . . . . . . . . . . . . . . . . 11 1.1.3 Propri

  7. LETTRES A LA RDACTION MESURE DES MOBILITS

    E-print Network

    Boyer, Edmond

    verre et graphitage externe ( fcg. 1). 1/anode ne comporte pas de soudure, le fil étant terminé par des sont obtenus par ramollissement du verre (qualité B-24 des verreries de Choisy-le-Roi) ; les extrémités'introduisent aucune perturbation [5]. Les compteurs comportent un robinet en verre B-24 et un rodage conique

  8. HPC en Calcul des Structures Piotr Breitkopf

    E-print Network

    van Tiggelen, Bart

    HPC en Calcul des Structures Piotr Breitkopf UTC, Laboratoire Roberval, UMR (des solides) a été très présente à l'origine du HPC Aujourd'hui elle est quasi-absente Avons-nous encore besoin du HPC ? (queson provocatrice) Si oui

  9. Behandlung der Knocheninfektion im Bereich des Schädels

    Microsoft Academic Search

    P. Knöringer

    1986-01-01

    Zusammenfassung  Die Osteomyelitis im Bereich des Schdels tritt vorzugsweise postoperativ, aber auch posttraumatisch sowie fortgeleitet bei Nasenebenhhleninfektionen oder selten metastatisch hmatogen auf. Die bliche Behandlung besteht in einer exakten Wundsuberung mit Fistelexzision, der Resektion des osteomyelitischen Knochens und der Entfernung allen eitrigen und devitalen Gewebes, gegebenenfalls einschlielich der Sanierung einer infizierten Nasennebenhhle. Nach Beseitigung der Infektion wird sechs bis zwlf Monate

  10. Maligne, nichtepitheliale Tumoren des Corpus uteri

    Microsoft Academic Search

    Mathias K. Fehr; Daniel Fink

    ZusammenfassungUterine Sarkome stellen eine heterogene Gruppe von Neoplasien dar, welche etwa 8% der Malignome des Uterus ausmachen. Am häufigsten sind die Karzinosarkome [früher maligne, gemischte mesenchymale Tumoren (MMMT) des Uterus], die etwa 40–50% aller Sarkome stellen. Leiomyosarkome sind am zweithäufigsten und endometriale Stromasarkome am seltensten. Ein ausgedehntes operatives Staging inklusive Lymphadenektomie ist beim Karzinosarkom indiziert. Beim Leiomyosarkom wird eine abdominale

  11. Former des enseignants avec la visioconfrence

    E-print Network

    Paris-Sud XI, Université de

    visioconférence qui réunissent des enseignants novices en formation initiale, des enseignants experts sur le (beginners and experts) in the field and lecturers. Our study is based on the analysis of the participants be an enriching training auxiliary. MOTS-CLES : visioconférence, Technologies de l'Information et de la

  12. MISE AU POINT SYMTRIE DES INTERACTIONS FORTES

    E-print Network

    Paris-Sud XI, Université de

    sujet peut etre utile meme s'il est condamn6;k parattre mal equilibre d'ici quelque temps. Le nombre des. Le fait qu'on puisse aujour- d'hui rassembler 18 baryons dans un meme multiplet, et dans un autre 17 ainsi accumul6es fait ressortir des regularites remarquables. Plusieurs particules de meme spin et meme

  13. Verbreitung und Strukturen des Tabakkonsums in Deutschland

    Microsoft Academic Search

    T. Lampert; M. Burger

    2005-01-01

    Der Tabakkonsum erhöht die Auftretenswahrscheinlichkeit vieler chronisch-degenerativer Krankheiten und verursacht erhebliche gesellschaftliche Folgekosten. Die nach wie vor starke Verbreitung des Rauchens in der Bevölkerung verdeutlicht somit einen vordringlichen gesundheitspolitischen Handlungsbedarf. Nach Daten des telefonischen Gesundheitssurveys 2003 rauchen in Deutschland rund 37% der 18-jährigen und älteren Männer und 28% der gleichaltrigen Frauen. Fast die Hälfte der täglichen Raucher und ein Drittel

  14. DPARTEMENT DES RELATIONS EXTRIEURES Service Communication

    E-print Network

    Cerf, Nicolas

    dispositifs." 1 OMS, « Chronic and noncommunicable diseases: fact sheet », http://www-ingénieurs de l'ULB ont construit, au Vietnam, des dispositifs de purification de l'air des habitats. Ces dispositifs serviront dans le cadre d'une étude clinique destinée à déterminer le lien entre la pollution

  15. Le cynisme des chiens Jacky Dahomay.

    E-print Network

    Blondel, Corinne - Institut de Mathématiques de Jussieu, Université Paris 7

    Le cynisme des chiens Jacky Dahomay. Ecrivain, membre de la Ligue des Droits de l'Homme Professeur fait par un enseignant du Gers concernant l'intrusion dans sa classe de gendarmes et d'un chien, m'établissement, ni inspecteur, ni ministre et, à fortiori, ni gendarme ni chien. Impossible ! A moins d'un cas de

  16. Thorie des Jeux Et ses Applications

    E-print Network

    Giraud, Olivier

    relance »...) Importance de la théorie des probabilités #12;Un Peu d'Histoire John von Neumann (1903-1957 si cBJohn von Neumann (1944 économique et politique Quelques contributions de J. Von Neumann : Axiomatisation des mathématiques

  17. Ateliers Informatique TAL Traitement automatique des langues

    E-print Network

    Inkpen, Diana

    Ateliers Informatique TAL Traitement automatique des langues #12;Université d'Ottawa · Faculté de génie · Informatique #12;Faculté de génie | Faculty of Engineering · Nous enseignons quatre programmes à l'Ecole die SIGE ­ Informatique (CSI): Pour les étudiants qui désirent développer des applications

  18. Habilitation Diriger des Recherches Spcialits : Mathmatiques, Informatique

    E-print Network

    Poinsot, Laurent

    Habilitation à Diriger des Recherches Spécialités : Mathématiques, Informatique Le 8 novembre 2011 6139 Gérard H. E. Duchamp Professeur des Universités, Université Paris XIII, Rapporteur Laboratoire d'Informatique Universités, Université Paris-Est Marne-la-Vallée, Examinateur Institut d'électronique et d'informatique

  19. Grosplansurl'anne desMathspourlaTerre

    E-print Network

    Dambrine, Marc

    on le souhai tera ;c'estlatechniqueCAES(compressed air energy storage). « Pour le stockage à grande leur nombre, pour des raisons géographiques. Suivant la même logique, l'eau peut être remplacée par l'air primerl'air,quipourraêtredétenduulté rieurement dans des turbines afin de restituer l'électricité quand

  20. ce des stages 821-7747 | co

    E-print Network

    Spino, Claude

    _____ Servic 819 8 Pré sur Tous couve notam vacan Au be pour ___________ ce des stages 821 et d personne formation Nos stagi mais bien pas dans Un stage vertu d'u fois leur p un progra droit d profession aires ne fon n des stage leur cas. de formatio ne loi, qui p programme amme d'étu xercer une p de

  1. Particularization of alpha contamination using CR39 track detectors

    Microsoft Academic Search

    M. F. Zaki; Y. H. El-Shaer

    2008-01-01

    Solid-state nuclear track detectors (SSNTDs) have found wide use in various domains of science and technology, e.g. in environmental experiments. Measurement of alpha activity on sources in an environment, such as air, is not easy because of the short penetration range of the alpha particles. Furthermore, the measurement of alpha activity by most gas ionization detectors suffers from the high

  2. Particularization of alpha contamination using CR39 track detectors

    Microsoft Academic Search

    M. F. Zaki; Y. H. El-Shaer

    2007-01-01

    Solid-state nuclear track detectors have found wide use in various domains of science and technology, e.g. in environmental experiments. The measurement of alpha activity on sources in an environment, such as air is not easy because of short penetration range of alpha particles. Furthermore, measurement of alpha activity by most gas ionization detectors suffers from high background induced by the

  3. Analytic expressions for {alpha} particle preformation in heavy nuclei

    SciTech Connect

    Zhang, H. F.; Wang, Y. J.; Dong, J. M. [School of Nuclear Science and Technology, Lanzhou University, Lanzhou 730000 (China); Royer, G. [Laboratoire Subatech, UMR IN2P3/CNRS Universite Ecole des Mines, Nantes 44 (France); Zuo, W.; Li, J. Q. [School of Nuclear Science and Technology, Lanzhou University, Lanzhou 730000 (China); Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou 730000 (China)

    2009-11-15

    Experimental {alpha} decay energies and half-lives are investigated systematically to extract {alpha} particle preformation in heavy nuclei. Formulas for the preformation factors are proposed that can be used to guide microscopic studies on preformation factors and perform accurate calculations of the {alpha} decay half-lives. There is little evidence for the existence of an island of long stability of superheavy nuclei.

  4. Dosimetry and radiobiological studies of automated alpha-particle irradiator.

    PubMed

    M V, Jyothish Babu; Shinde, Sanjay G; S, Sunil Kumar; Ali, Manjoor; Vasumathy, R; Kumar, Amit; Kolekar, R; Kumar, Manish; Nema, P; Bhagwat, P V; Pandey, Badri N

    2013-01-01

    Understanding the effect of alpha radiation on biological systems is an important component of radiation risk assessment and associated health consequences. However, due to the short path length of alpha radiation in the atmosphere, in vitro radiobiological experiments cannot be performed with accuracy in terms of dose and specified exposure time. The present paper describes the design and dosimetry of an automated alpha-particle irradiator named 'BARC BioAlpha', which is suitable for in vitro radiobiological studies. Compared to alpha irradiators developed in other laboratories, BARC BioAlpha has integrated computer-controlled movement of the alpha-particle source, collimator, and electronic shutter. The diaphragm blades of the electronic shutter can control the area (diameter) of irradiation without any additional shielding, which is suitable for radiobiological bystander studies. To avoid irradiation with incorrect parameters, a software interlock is provided to prevent shutter opening, unless the user-specified speed of the source and collimator are achieved. The dosimetry of the alpha irradiator using CR-39 and silicon surface barrier detectors showed that ~4 MeV energy of the alpha particle reached the cells on the irradiation dish. The alpha irradiation was also demonstrated by the evaluation of DNA double-strand breaks in human cells. In conclusion, 'BARC BioAlpha' provides a user-friendly alpha irradiation system for radiobiological experiments with a novel automation mechanism for better accuracy of dose and exposure time. PMID:24266413

  5. Alpha Theory to Certify Roots 1 Approximate Zeroes

    E-print Network

    Verschelde, Jan

    Newton's method in projective space Analytic Symbolic Computation (MCS 563) Alpha Theory to certify roots Newton's method in projective space Analytic Symbolic Computation (MCS 563) Alpha Theory to certify rootsAlpha Theory to Certify Roots 1 Approximate Zeroes what is an approximate zero? a criterion

  6. Playing Logic Programs with the Alpha-Beta Algorithm

    E-print Network

    Loddo, Jean-Vincent

    Playing Logic Programs with the Alpha-Beta Algorithm Jean-Vincent Loddo and Roberto Di Cosmo,dicosmog@pps.jussieu.fr Abstract. Alpha-Beta is a well known optimized algorithm used to compute the values of classical combinatorial games, like chess and check- ers . The known proofs of correctness of Alpha-Beta do rely on very

  7. Direct Measurement of {sup 21}Na+{alpha} Stellar Reaction

    SciTech Connect

    Binh, D. N.; Kubono, S.; Yamaguchi, H.; Hayakawa, S.; Hashimoto, T.; Kahl, D. [Center for Nuclear Study (CNS), University of Tokyo (Japan); Teranishi, T. [Department of Physics, Kuyshu University (Japan); Iwasa, N.; Kume, N. [Department of Physics, Tohoku University (Japan); Kato, S. [Department of Physics, Yamagata University (Japan); Khiem, L. H.; Tho, N. T. [Institute of Physics, Vietnamese Academy of Science and Technology (Viet Nam); Wakabayashi, Y. [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA) (Japan)

    2010-08-12

    The measurement of the resonant alpha scattering and the {sup 21}Na({alpha}, p) reaction were performed for the first time in inverse kinematics with the thick target method using a {sup 21}Na radioisotope (RI) beam. This paper reports the current result of alpha scattering measurement and its astrophysics implication.

  8. Alpha-particle-induced soft errors in dynamic memories

    Microsoft Academic Search

    T. C. May; M. H. Woods

    1979-01-01

    A new physical soft error mechanism in dynamic RAM's and CCD's is the upset of stored data by the passage of alpha particles through the memory array area. The alpha particles are emitted by the radioactive decay of uranium and thorium which are present in parts-per-million levels in packaging materials. When an alpha particle penetrates the die surface, it can

  9. Asymptotically Distribution-Free (ADF) Interval Estimation of Coefficient Alpha

    ERIC Educational Resources Information Center

    Maydeu-Olivares, Alberto; Coffman, Donna L.; Hartmann, Wolfgang M.

    2007-01-01

    The point estimate of sample coefficient alpha may provide a misleading impression of the reliability of the test score. Because sample coefficient alpha is consistently biased downward, it is more likely to yield a misleading impression of poor reliability. The magnitude of the bias is greatest precisely when the variability of sample alpha is…

  10. Bayesian Statistical Inference for Coefficient Alpha. ACT Research Report Series.

    ERIC Educational Resources Information Center

    Li, Jun Corser; Woodruff, David J.

    Coefficient alpha is a simple and very useful index of test reliability that is widely used in educational and psychological measurement. Classical statistical inference for coefficient alpha is well developed. This paper presents two methods for Bayesian statistical inference for a single sample alpha coefficient. An approximate analytic method…

  11. Sample Size Requirements for Testing and Estimating Coefficient Alpha.

    ERIC Educational Resources Information Center

    Bonett, Douglas G.

    2002-01-01

    Derived an approximate test and confidence interval for coefficient alpha and used the approximate test and confidence interval to derive closed-form sample size formulas that can be used to determine the sample size needed to test coefficient alpha with desired power or to test coefficient alpha with desired precision. (SLD)

  12. ALPHA-PARTICLE RADIOBIOLOGICAL EXPERIMENTS USING THIN CR-39 DETECTORS

    E-print Network

    Yu, K.N.

    ALPHA-PARTICLE RADIOBIOLOGICAL EXPERIMENTS USING THIN CR-39 DETECTORS K. F. Chan1 , S. Y. M. Siu2 advantages of using CR-39 detectors as the cell-culture substrates in alpha-particle radiobiological the DNA damage in individual HeLa cervix cancer cells after alpha-particle irradiation. We prepared thin

  13. Hematotoxic effects of 3,5-dinitro-4-chloro-alpha,alpha,alpha-trifluorotoluene, a water contaminant

    SciTech Connect

    Guastadisegni, C.; Hall, D.; Macri, A.

    1986-10-01

    Three short-term studies of 7, 14, and 21 days, respectively, were made to investigate the nature of the anemia induced in rats by 3,5-dinitro-4-chloro-alpha,alpha,alpha-trifluorotoluene (DNCTT). This compound is an intermediate in the synthesis of dinitroaniline herbicides and was detected as a contaminant of a water-bearing stratum in northern Italy. DNCTT was mixed in a powdered rodent diet at a level of 2000 ppm and administered to Wistar-derived rats. DNCTT was shown to produce a hemolytic anemia of rapid onset; packed cell volume and hemoglobin concentration were decreased at all three treatment periods. Methemoglobin and reticulocyte count were increased in all the treated groups. The relative organ weights of the spleen and the liver were increased compared to those of the control groups. Spleen enlargement was also evident at the macroscopic examination, whereas the liver appearance was normal. Pearl's Prussian blue staining performed on the spleen and liver was highly positive in the spleen of treated rats, but no iron deposition was detected in the liver of treated rats.

  14. Les implications du phénomène des médecins hospitaliers

    PubMed Central

    Lehmann, François; Brunelle, Yvon; Dawes, Martin; Boulé, Richard; Bergeron, Rénald

    2007-01-01

    RÉSUMÉ OBJECTIF Évaluer l’impact de 2 systèmes de soins hospitaliers par une revue de la littérature. QUALITÉ DES DONNÉES Il reste des zones nébuleuses car plusieurs des études sont opportunistes, signalant une expérience isolée ou de simples avant-après. Peu sont vraiment expérimentales et toutes ont été menées dans des milieux universitaires, limitant ainsi leur validité externe. MESSAGE PRINCIPAL Les données supportent l’utilisation de médecins hospitaliers qui consacrent un minimum de 2 mois par année à ce travail et qui sont alors à plein temps sur les étages. Les coûts sont plus souvent qu’autrement réduits et l’enseignement est amélioré. Point de repère important de la qualité des soins, la mortalité est égale dans les 2 systèmes de soins. CONCLUSION Certaines questions demeurent sans réponse dont le choix de la meilleure formation en vue de préparer les résidents au travail hospitalier et la façon de maintenir les compétences acquises. PMID:18077751

  15. Cotinine selectively activates a subpopulation of alpha3/alpha6beta2 nicotinic receptors in monkey striatum.

    PubMed

    O'Leary, Kathryn; Parameswaran, Neeraja; McIntosh, J Michael; Quik, Maryka

    2008-05-01

    The nicotine metabolite cotinine is an abundant long-lived bio-active compound that may contribute to the overall physiological effects of tobacco use. Although its mechanism of action in the central nervous system has not been extensively investigated, cotinine is known to evoke dopamine release in the nigrostriatal pathway through an interaction at nicotinic receptors (nAChRs). Because considerable evidence now demonstrates the presence of multiple nAChRs in the striatum, the present experiments were done to determine the subtypes through which cotinine exerts its effects in monkeys, a species that expresses similar densities of striatal alpha4beta2* (nAChR containing the alpha4 and beta2 subunits, but not alpha3 or alpha6) and alpha3/alpha6beta2* (nAChR composed of the alpha3 or alpha6 subunits and beta2) nAChRs. Competition binding studies showed that cotinine interacts with both alpha4beta2* and alpha3/alpha6beta2* nAChR subtypes in the caudate, with cotinine IC(50) values for inhibition of 5-[(125) I]iodo-3-[2(S)-azetinylmethoxy]pyridine-2HCl ([(125)I]A-85380) and (125)I-alpha-conotoxinMII binding in the micromolar range. This interaction at the receptor level is of functional significance because cotinine stimulated both alpha4beta2* and alpha3/alpha6beta2* nAChR [(3)H]dopamine release from caudate synaptosomes. Our results unexpectedly showed that nicotine evokes [(3)H]dopamine release from two alpha3/alpha6beta2* nAChR populations, one of which was sensitive to cotinine and the other was not. This cotinine-insensitive subtype was only present in the medial caudate and was preferentially lost with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced nigrostriatal damage. In contrast, cotinine and nicotine elicited equivalent levels of alpha4beta2* nAChR-mediated dopamine release. These data demonstrate that cotinine functionally discriminates between two alpha3/alpha6beta2* nAChRs in monkey striatum, with the cotinine-insensitive alpha3/alpha6beta2* nAChR preferentially vulnerable to nigrostriatal damage. PMID:18305015

  16. Rhamnogalacturonase B from Aspergillus aculeatus is a rhamnogalacturonan alpha-L-rhamnopyranosyl-(1-->4)-alpha-D-galactopyranosyluronide lyase.

    PubMed Central

    Mutter, M; Colquhoun, I J; Schols, H A; Beldman, G; Voragen, A G

    1996-01-01

    The recently described rhamnogalacturonase B, which is able to degrade ramified hairy regions of pectin, was found to be a rhamnogalacturonan alpha-L-rhamnopyranosyl-(1-->4)-alpha-D-galactopyranosyluronide lyase. The cleavage site and mechanism differ from that of the previously described rhamnogalacturonase A, which is a hydrolase and can now be termed rhamnogalacturonan alpha-D-galactopyranosyluronide-(1-->2)-alpha-L-rhamnopyranosyl hydrolase. PMID:8587995

  17. Automatically processed alpha-track radon monitor

    DOEpatents

    Langner, G.H. Jr.

    1993-01-12

    An automatically processed alpha-track radon monitor is provided which includes a housing having an aperture allowing radon entry, and a filter that excludes the entry of radon daughters into the housing. A flexible track registration material is located within the housing that records alpha-particle emissions from the decay of radon and radon daughters inside the housing. The flexible track registration material is capable of being spliced such that the registration material from a plurality of monitors can be spliced into a single strip to facilitate automatic processing of the registration material from the plurality of monitors. A process for the automatic counting of radon registered by a radon monitor is also provided.

  18. Optical conductivity of alpha-Mn

    NASA Technical Reports Server (NTRS)

    Scoles, K. J.; Christy, R. W.

    1982-01-01

    The optical constants were measured at room temperature in the photon-energy range 0.6 to 6.5 eV on evaporated thin films. Evaporation conditions were chosen that gave the alpha-Mn crystal structure with reasonably large grains. The optical conductivity was separated into intraband and interband contributions by fitting to the Drude formula at low energies. The results are anomalous in comparison to other 3d transition metals. The free-electron lifetime is exceptionally sort (in agreement with the large dc resistivity of Mn), and the interband transitions seem unusually weak at the lower energies. Possible explanations related to the complicated crystal structure of alpha-Mn are discussed.

  19. Optical conductivity of alpha-Mn

    NASA Technical Reports Server (NTRS)

    Scoles, K. J.; Christy, R. W.

    1982-01-01

    The optical constants were measured at room temperature in the photon-energy range 0.6-6.5 eV on evaporated thin films. Evaporation conditions were chosen that gave the alpha-Mn crystal structure with relatively large grains. The optical conductivity was separated into intraband and interband contributions by fitting to the Drude formula at low energies. The results are anomalous in comparison to other 3d transition metals: the free-electron lifetime is exceptionally short (in agreement with the large dc resistivity of Mn), and the interband transitions seem unusually weak at the lower energies. Possible explanations related to the complicated crystal structure of alpha-Mn with its loss of point symmetry at the atom sites are discussed.

  20. Alpha ash transport and ash control

    SciTech Connect

    Miley, G.H.; Hu, S.C.; Varadarajan, V.

    1990-01-01

    This paper discusses: thermal {alpha}-particle transport is a crucial issue in ash buildup. The transport will determine if buildup prevents ignition and if external control is necessary. Due to uncertainties in the transport coefficients, 1-1/2-D sensitivity study of the influence on the fusion power density is done using the BALDUR code. The Baldur simulations with varying diffusion coefficients for ash plasma are performed. The results of ash transport in the presence of sawteeth and varying edge conditions are discussed. Also, the nature of the fishbone oscillation in the presence of two hot species consisting of hot alphas and beam injected ions is discussed. The sawteeth and fishbones can be potential mechanisms for enhanced ash transport; the latter will indirectly influence the ash transport.

  1. $\\alpha $-Attractors: Planck, LHC and Dark Energy

    E-print Network

    Carrasco, John Joseph M; Linde, Andrei

    2015-01-01

    We develop four-parameter supergravity models of inflation and dark energy, constrained so that ${\\delta\\rho\\over \\rho}$, $n_s$ and the cosmological constant $\\Lambda $ take their known observable values, but where the mass of gravitino $m_{3/2}$ and the tensor-to-scalar ratio $r$ are free parameters. We focus on generalized cosmological $\\alpha$-attractor models, with logarithmic Kahler potentials, a nilpotent goldstino and spontaneously broken supersymmetry at the de Sitter minimum. The future data on B-modes will specify the parameter $\\alpha$, measuring the geometry of the Kahler, manifold. The string landscape idea for dark energy is supported in these models via an incomplete cancellation of the universal positive goldstino and negative gravitino contribution. The scale of SUSY breaking M related to the mass of gravitino in our models is a controllable parameter, independent on the scale of inflation, it will be constrained by LHC data and future collider Energy-frontier experiments.

  2. Alpha Cluster Model of Atomic Nuclei

    E-print Network

    Zbigniew Sosin; Jan B?ocki; Jinesh Kallunkathariyil; Jerzy ?ukasik; Piotr Paw?owski

    2015-06-22

    The description of the nuclear system in its ground state and at low excitations based on the equation of state (EoS) around the saturation density is presented. In the expansion of the EoS around the saturation point additional spin polarization terms are taken into account. In addition for atomic nuclei a correction of the average nucleonic energy for the surface energy is introduced. The ground state configurations for the N=Z even-even nuclei, obtained with the proposed EoS, exhibit a clear cluster structure. At the nuclear surface these clusters can be identified as alpha particles. Taking into account an additional interaction between clusters the binding energy and sizes of the considered nuclei are very accurately described. From properties of the {\\alpha} particle, 3He and t limits of the EoS parameters are established.

  3. Alpha Cluster Model of Atomic Nuclei

    E-print Network

    Sosin, Zbigniew; Kallunkathariyil, Jinesh; ?ukasik, Jerzy; Paw?owski, Piotr

    2015-01-01

    The description of the nuclear system in its ground state and at low excitations based on the equation of state (EoS) around the saturation density is presented. In the expansion of the EoS around the saturation point additional spin polarization terms are taken into account. In addition for atomic nuclei a correction of the average nucleonic energy for the surface energy is introduced. The ground state configurations for the N=Z even-even nuclei, obtained with the proposed EoS, exhibit a clear cluster structure. At the nuclear surface these clusters can be identified as alpha particles. Taking into account an additional interaction between clusters the binding energy and sizes of the considered nuclei are very accurately described. From properties of the {\\alpha} particle, 3He and t limits of the EoS parameters are established.

  4. Alpha complementation in the Cre recombinase enzyme.

    PubMed

    Casanova, Emilio; Lemberger, Thomas; Fehsenfeld, Sandra; Mantamadiotis, Theo; Schütz, Günther

    2003-09-01

    The Cre-loxP system is increasingly exploited for spatial and temporal gene inactivation. Here we present a novel approach to achieve this goal of selective gene inactivation. Following the model of alpha complementation in the beta-galactosidase enzyme, where the enzyme is split into independent polypeptides which are able to associate and maintain the enzymatic activity, we divided the Cre recombinase into two independent polypeptides (one containing the NH(2) terminus (alpha) and a second one containing the COOH-terminus (beta)). Individually, the two polypeptides have no detectable activity. However, when coexpressed the polypeptides are able to associate, giving rise to Cre enzymatic activity, which optimally is as high as 30% of that seen with wildtype Cre recombinase in vitro. We present this strategy as a modification of the traditional Cre-loxP system, which could be used to obtain a highly specific recombination pattern by expressing the two halves under the control of separate promoters. PMID:14502574

  5. The acoustic spectrum of alpha Cen A

    E-print Network

    F. Bouchy; F. Carrier

    2002-06-04

    This paper presents the analysis of Doppler p-mode observations of the G2V star $\\alpha$ Cen A obtained with the spectrograph CORALIE in May 2001. Thirteen nights of observations have made it possible to collect 1850 radial velocity measurements with a standard deviation of about 1.5 m s$^{-1}$. Twenty-eight oscillation modes have been identified in the power spectrum between 1.8 and 2.9 mHz with amplitudes in the range 12 to 44 cm s$^{-1}$. The average large and small spacing are respectively equal to 105.5 and 5.6 $\\mu$Hz. A comparison with stellar models of $\\alpha$ Cen A is presented.

  6. AlphaRad, a new integrated CMOS System-On-Chip for high efficiency alpha particle counting.

    E-print Network

    Paris-Sud XI, Université de

    1 AlphaRad, a new integrated CMOS System-On-Chip for high efficiency alpha particle counting. D * corresponding author : daniel.husson@ires.in2p3.fr Abstract An integrated System-on-Chip (SoC) has been designed; #12;2 Key words: Solid state detectors; System-on-chip; Alpha particles; Neutrons. The field

  7. Binding of alpha -bungarotoxin to Isolated alpha Subunit of the Acetylcholine Receptor of Torpedo californica: Quantitative Analysis with Protein Blots

    Microsoft Academic Search

    Jonathan M. Gershoni; Edward Hawrot; Thomas L. Lentz

    1983-01-01

    The direct binding of alpha -bungarotoxin to the alpha subunit of the acetylcholine receptor from Torpedo electric organ immobilized onto protein blots was demonstrated. Protein blots were prepared by electrophoretically transferring resolved acetylcholine receptor subunits from 10% polyacrylamide gels onto Zetabind, positively charged nylon membrane filters. Such blots, when incubated with 125I-labeled alpha -bungarotoxin, washed, and autoradiographed, gave rise to

  8. Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha.

    PubMed

    Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas

    2007-09-01

    Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway. PMID:17640976

  9. L'valuation du prix des actions par les fondamentaux

    E-print Network

    Paris-Sud XI, Université de

    L'évaluation du prix des actions par les fondamentaux : analyse du marché français Dominique Pépin(*) Depuis 1920, le prix des actions en France, comme partout dans le monde, a connu d'importantes variations des banques centrales, et à se demander si ces dernières ne devaient pas prendre en compte le prix des

  10. Les disparits binoculaires des verres unifocaux Cline Devismea,b

    E-print Network

    Paris-Sud XI, Université de

    Les disparités binoculaires des verres unifocaux Céline Devismea,b , Björn Drobeb , Guillaume'apposition de verres ophtalmiques devant les yeux va engendrer une modification de la distribution des'analyse descriptive des disparités binoculaires, horizontales et verticales, produites par des verres ophtalmiques

  11. Journes Filtration des Arosols NANCY 7 & 8 juin 2007

    E-print Network

    Paris-Sud XI, Université de

    1ères Journées Filtration des Aérosols NANCY ­ 7 & 8 juin 2007 C11 / 1 FILTRATION DES rebond thermique. Mots Clés : Filtration, Nanoparticules, Rebond Thermique. INTRODUCTION Le développement spectaculaire des nanotechnologies ces dernières années a rendu la question de la filtration des

  12. GE.07-51666 (F) 240907 280907 des Nations Unies

    E-print Network

    Muðan, Uðurhan

    relatives à l'application des normes internationales d'information financière (IFRS) en vue d'élaborer des (IFRS). Dans la présente étude de cas, les questions pratiques relatives au cadre réglementaire, au'application des IFRS. La présente étude de cas a pour principal objectif de tirer des enseignements de l

  13. Changement de normes : la stabilit des choix comptables Samira DEMARIA

    E-print Network

    Boyer, Edmond

    comptables effectués par les groupes français lors de la première adoption des normes comptables IAS/IFRS questionnaire en ligne et des entretiens semi-directifs auprès des responsables de la migration vers les IFRS au normatif. Mots clés : normes IAS/IFRS, transition, choix d'options comptables, théorie des conventions

  14. TabledesMatiresServicesuniversitairesetservices Table des Matires Services

    E-print Network

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 180 · Zone de Central Square . . . . . . . . . . . . . . . . . . . . . . . . . 181 · Sports et loisirs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181 · Installations sportives . . . . . . . . . . . . . . . . . . . . . . . . . . . 182 · Bureau des

  15. iovi* ^MAA-L ft} DES PONTS ET CHAUSSEES

    E-print Network

    Paris-Sud XI, Université de

    'Ecole Nationale Supérieure des Travaux Publics - Yamoussoukro" (ENSTP) du 3è r a e Projet de Développement Urbain motivation et de persévérance. J'exprime toute ma gratitude à M. Michel SAVY, Professeur à Ï'ENPC et des collègues et des personnes travaillant sur des questions similaires dans l'administration et dans

  16. RECHERCHES EXPRIMENTALES SUR LA DURE DE PASSAGE DES SPERMATOZODES

    E-print Network

    Boyer, Edmond

    pertes d'ADN au cours des extractions : - variations dans la teneur en ADN en fonction du nombre des lavages avec la solution de KREI3S-lIENSELEIT-RINGER, - variations dans la teneur en ADN des autres : - contamination par le plasma séminal des phospholipides,- contamination de l'ADN. 2. Dosage du

  17. Fourth High Alpha Conference, volume 1

    NASA Technical Reports Server (NTRS)

    1994-01-01

    The goal of the Fourth High Alpha Conference was to focus on the flight validation of high angle-of-attack technologies and provide an in-depth review of the latest high angle-of-attack activities. Areas that were covered include: high angle-of-attack aerodynamics, propulsion and inlet dynamics, thrust vectoring, control laws and handling qualities, tactical utility, and forebody controls.

  18. A Portable Scintillation Alpha Survey Instrument

    Microsoft Academic Search

    W. G. Spear

    1957-01-01

    A scintillation alpha counter utilizing a zinc sulfide fluor, a multiplier phototube, and a two-stage vacuum tube amplifier has been developed. A neon-bulb oscillator high-voltage supply is used to supply 900 volts to the multiplier phototube, and headphones are used to obtain an aural indication of counting. The average geometry or counting efficiency over the 7.43-inch2 probe area is approximately

  19. Alpha1-antitrypsin deficiency and hepatocellular carcinoma

    Microsoft Academic Search

    J K Kelly; J S Davies; A W Jones

    1979-01-01

    Forty-two cases of hepatocellular carcinoma (HCC) were examined for the presence of the inclusions of alpha-1-antitrypsin (AAT), which indicate a carrier state for the Pi Z gene. These were found in the non-neoplastic liver tissue of two cases of HCC and in one of the 98 control livers, a difference that is not statistically significant. Typical globules of AAT deficiency

  20. ALPHA, Mass Generation and Quantum Information

    Microsoft Academic Search

    Shantilal Goradia

    2008-01-01

    The generation of Planck energy 10E19 Gev\\/Planck time during the observable age of the universe (10E60 Planck times) would generate 10E79 Gev. 10E79 Gev approximates the energy of the baryon number, implying an increase of the baryon number by 10E19\\/Planck time. What is the source of energy for this mass generation? The ALPHA implicated as negative entropy in [1] must

  1. Skeletal Muscle Alpha-Actin Diseases

    Microsoft Academic Search

    Kathryn N. North; Nigel G. Laing

    Skeletal muscle ?-actin is the principal protein component of the adult skeletal muscle thin filament. The interaction between\\u000a skeletal, muscle ?-actin and the various myosin heavy chain proteins in the different muscle fibre types generates the force\\u000a of muscle contraction. Skeletal muscle ?-alpha actin is thus of fundamental importance to normal muscle contraction. To date\\u000a over 140 different disease-causing mutations

  2. Alpha high-power chemical laser program

    Microsoft Academic Search

    Anthony J. Cordi; Henry Lurie; David W. Callahan; Matthew Thomson

    1993-01-01

    Alpha is a megawatt-class ground demonstration of a hydrogen fluoride, continuous wave, space-based chemical laser. The laser operates in the infrared at 2.8 microns. The basic device consists of a cylindrical combustion chamber that exhausts radially outward through circumferential nozzles into an annular lasing area. An annular ring resonator is used to extract the laser energy from this area. Technical

  3. Fourth High Alpha Conference, volume 2

    NASA Technical Reports Server (NTRS)

    1994-01-01

    The goal of the Fourth High Alpha Conference, held at the NASA Dryden Flight Research Center on July 12-14, 1994, was to focus on the flight validation of high angle of attack technologies and provide an in-depth review of the latest high angle of attack activities. Areas that were covered include high angle of attack aerodynamics, propulsion and inlet dynamics, thrust vectoring, control laws and handling qualities, and tactical utility.

  4. Parallel Genetic Algorithm for Alpha Spectra Fitting

    Microsoft Academic Search

    Carlos J. García-Orellana; Pilar Rubio-Montero; Horacio González-Velasco

    2005-01-01

    We present a performance study of alpha-particle spectra fitting using parallel Genetic Algorithm (GA). The method uses a two-step approach. In the first step we run parallel GA to find an initial solution for the second step, in which we use Levenberg-Marquardt (LM) method for a precise final fit. GA is a high resources-demanding method, so we use a Beowulf

  5. Gallium Nitride Room Temperature alpha Particle Detectors

    Microsoft Academic Search

    Min Lu; Guo-Guang Zhang; Kai Fu; Guo-Hao Yu

    2010-01-01

    Gallium Nitride (GaN) room temperature alpha particle detectors are fabricated and characterized, whose device structure is Schottky diode. The current-voltage (I - V) measurements reveal that the reverse breakdown voltage of the detectors is more than 200 V owing to the consummate fabrication processes, and that the Schottky barrier and ideal factor of the detectors are 0.64 eV and 1.02,

  6. Alpha/beta hydrolase fold: an update.

    PubMed

    Carr, Paul D; Ollis, David L

    2009-01-01

    The alpha/beta hydrolase superfamily has rapidly expanded in recent years and continues to do so at an expeditious pace. According to the ESTHER database (http://bioweb.ensam.inra.fr/ESTHER) 29000 papers have been published cataloguing 89 family groups, comprising a total of 15438 gene loci and 666 structures. This paper presents a snapshot of the current family taxonomy, catalytic chemistries, structural topologies and useful technologies emerging from the knowledge base at the current time. PMID:19508187

  7. Dark Energy from $\\alpha$-Attractors

    E-print Network

    Linder, Eric V

    2015-01-01

    A class of inflation theories called $\\alpha$-attractors has been investigated recently with interesting properties interpolating between quadratic potentials, the Starobinsky model, and an attractor limit. Here we examine their use for late time cosmic acceleration. We generalize the class and demonstrate how it can interpolate between thawing and freezing dark energy, and reduce the fine tuning of initial conditions, allowing $w\\approx-1$ for a prolonged period or as a de Sitter attractor.

  8. Alpha decay of neutron deficient astatine isotopes

    Microsoft Academic Search

    William Treytl; Kalevi Valli

    1967-01-01

    Isotopes of astatine lighter than mass 205 were studied at the Heavy Ion Linear Accelerator by bombardment of 185Re and 187Re with 20Ne, using Si (Au) surface barrier detectors in on-line measurements. Mass number assignments of astatine 201 through 196 are based on excitation functions and on genetic relationships with polonium isotopes. Accurate alpha energies are reported for 204At through

  9. Lyman Alpha Photochemistry in the Solar Nebula

    NASA Technical Reports Server (NTRS)

    Fegley, Bruce, Jr.

    1997-01-01

    The purpose of the project "Lyman Alpha Photochemistry in the Solar Nebula" was to model photochemistry in the primitive solar nebula and the early solar systems. As part of the modeling, it was necessary to model the composition of the gas and dust accreted by the solar nebula. This final report contains a list of publications where the results of this project have been published.

  10. ALPHA, Mass Generation and Quantum Information

    NASA Astrophysics Data System (ADS)

    Goradia, Shantilal

    2008-05-01

    The generation of Planck energy 10E19 Gev/Planck time during the observable age of the universe (10E60 Planck times) would generate 10E79 Gev. 10E79 Gev approximates the energy of the baryon number, implying an increase of the baryon number by 10E19/Planck time. What is the source of energy for this mass generation? The ALPHA implicated as negative entropy in [1] must create vacuum energy. Vacuum energy is negative energy. Nature must balance negative energy by generating positive energy (mass), implying ALPHA balances the increasing entropy of the visible universe and generates baryonic mass. Additionally, the successful cloning of the sheep Dolly, and observed molecular blinking dots in biochemistry support the binary BITS of ON and OFF states in [1]. Vindicating Hermite's 1873 mathematical linkage of the base of natural logarithm to transcendentality will implicate natural log based ALPHA in [1] as connected to consciousness. [1] Goradia S: www.arXiv.org/pdf/physics/0210040v3.

  11. $\\alpha$ Centauri A in the far infrared

    E-print Network

    Liseau, R; Olofsson, G; Bryden, G; Marshall, J P; Ardila, D; Aran, A Bayo; Danchi, W C; del Burgo, C; Eiroa, C; Ertel, S; Fridlund, M C W; Krivov, A V; Pilbratt, G L; Roberge, A; Thébault, P; Wiegert, J; White, G J

    2012-01-01

    Chromospheres and coronae are common phenomena on solar-type stars. Understanding the energy transfer to these heated atmospheric layers requires direct access to the relevant empirical data. Study of these structures has, by and large, been limited to the Sun thus far. The region of the temperature reversal can be directly observed only in the far infrared and submm. We aim at the determination of the characteristics of the atmosphere in the region of the temperature minimum of the solar sister star alpha Cen A. For the nearby binary system alpha Centauri, stellar parameters are known with high accuracy from measurements. For the basic model parameters Teff, log g and [Fe/H], we interpolate in the grid of GAIA/PHOENIX stellar model atmospheres and compute the corresponding model for the G2 V star alpha Cen A. Comparison with photometric measurements shows excellent agreement between observed photospheric data in the optical and infrared. For longer wavelengths, the modelled spectral energy distribution is co...

  12. The Alpha Dynamo Effects in Laboratory Plasmas

    SciTech Connect

    Hantao Ji; Stewart C. Prager

    2001-10-16

    A concise review of observations of the alpha dynamo effect in laboratory plasmas is given. Unlike many astrophysical systems, the laboratory pinch plasmas are driven magnetically. When the system is overdriven, the resultant instabilities cause magnetic and flow fields to fluctuate, and their correlation induces electromotive forces along the mean magnetic field. This alpha-effect drives mean parallel electric current, which, in turn, modifies the initial background mean magnetic structure towards the stable regime. This drive-and-relax cycle, or the so-called self-organization process, happens in magnetized plasmas in a timescale much shorter than resistive diffusion time, thus it is a fast and unquenched dynamo process. The observed alpha-effect redistributes magnetic helicity (a measure of twistedness and knottedness of magnetic field lines) but conserves its total value. It can be shown that fast and unquenched dynamos are natural consequences of a driven system where fluctuations are statistically either not stationary in time or not homogeneous in space, or both. Implications to astrophysical phenomena will be discussed.

  13. {alpha}-condensed state with a core nucleus

    SciTech Connect

    Itagaki, N. [Department of physics, University of Tokyo, Hongo, 113-0033 Tokyo (Japan); Hahn-Meitner-Institut Berlin, D-14109 Berlin (Germany); Kimura, M. [Institute of Physics, University of Tsukuba, 305-8571 Tsukuba (Japan); Kurokawa, C. [Meme Media Laboratory, Graduate School of Engineering, Hokkaido University 060-8628 Sapporo (Japan); Ito, M. [Institute of Physical and Chemical Research (RIKEN), 351-0098 Wako (Japan); Oertzen, W. von [Hahn-Meitner-Institut Berlin, D-14109 Berlin (Germany); Freie Universitaet Berlin, Fachbereich Physik, D-14195 Berlin (Germany)

    2007-03-15

    We demonstrate based on a microscopic {alpha}-cluster model that {alpha}-condensed states appear not only in light nuclei such as {sup 12}C and {sup 16}O but also in heavier nuclei with a core at excitation energies corresponding to multi-{alpha}-threshold energies. To extend the study of normal {alpha}-condensed state to the cases of heavier nuclei with an inner strongly bound core ({sup 16}O) and also to non-4N-nuclei (e.g., 2{alpha}+dineutron), we introduce a Monte Carlo technique for the description of the Schuck wave function, which are called ''virtual Schuck'' wave function.

  14. Detection of alpha radiation in a beta radiation field

    DOEpatents

    Mohagheghi, Amir H. (Albuquerque, NM); Reese, Robert P. (Edgewood, NM)

    2001-01-01

    An apparatus and method for detecting alpha particles in the presence of high activities of beta particles utilizing an alpha spectrometer. The apparatus of the present invention utilizes a magnetic field applied around the sample in an alpha spectrometer to deflect the beta particles from the sample prior to reaching the detector, thus permitting detection of low concentrations of alpha particles. In the method of the invention, the strength of magnetic field required to adequately deflect the beta particles and permit alpha particle detection is given by an algorithm that controls the field strength as a function of sample beta energy and the distance of the sample to the detector.

  15. Positronium hyperfine splitting: analytical value at m*alpha^6

    Microsoft Academic Search

    Andrzej Czarnecki; Kirill Melnikov; Alexander Yelkhovsky

    1998-01-01

    We present an analytic calculation of the m*alpha^6 recoil corrections to the\\u000ahyperfine splitting (HFS) of the ground state energy levels in positronium. We\\u000afind \\\\Delta E_{\\\\rm rec} = m alpha^6 (-1\\/6 ln(alpha) + 331\\/432 -ln(2)\\/4 - 17\\u000aZeta(3)\\/(8 pi^2) + 5\\/(12 pi^2)) \\\\approx m alpha^6 (- 1\\/6 ln(alpha) + 0.37632),\\u000aconfirming Pachucki's numerical result \\\\cite{Ph}. We present a complete

  16. Characterization of alpha-crystallin-plasma membrane binding.

    PubMed

    Cobb, B A; Petrash, J M

    2000-03-01

    Alpha-crystallin, a large lenticular protein complex made up of two related subunits (alphaA- and alphaB-crystallin), is known to associate increasingly with fiber cell plasma membranes with age and/or the onset of cataract. To understand better the binding mechanism, we developed a sensitive membrane binding assay using lens plasma membranes and recombinant human alphaA- and alphaB-crystallins conjugated to a small fluorescent tag (Alexa350). Both alphaA and alphaB homopolymer complexes, as well as a reconstituted 3:1 heteromeric complex, bind to lens membranes in a specific, saturable, and partially irreversible manner that is sensitive to both time and temperature. The amount of alpha-crystallin that binds to the membrane increases under acidic pH conditions and upon removal of exposed intrinsic membrane protein domains but is not affected at high ionic strength, suggesting that alpha-crystallin binds to the fiber cell plasma membranes mainly through hydrophobic interactions. The binding capacity and affinity for the reconstituted 3:1 heteromeric complex were measured to be 3. 45 +/- 0.11 ng/microg of membrane and 4.57 +/- 0.50 x 10(-4) microg(-1) of membrane, respectively. The present membrane binding data support the hypothesis that the physical properties of a mixed alpha-crystallin complex may hold particular relevance for the function of alpha-crystallin within the lens. PMID:10692476

  17. L'apport de la gestion de production aux sciences agronomiques. Le cas des ressources fourragres

    E-print Network

    Paris-Sud XI, Université de

    connaissances des sciences biotechniques (agronomie et zootechnie) ne leur permet pas de définir seules les des sciences biotechniques, agronomie et zootechnie principalement, a été de fournir des bases

  18. Der Beta-Zerfall der Atomkerne und das Alter des Universums.

    NASA Astrophysics Data System (ADS)

    Klapdor, H. V.

    Contents: 1. Einleitung: Schwache Wechselwirkung und Entwicklung des Universums. 2. Ein Durchbruch im Verständnis des ?-Zerfalls neutronenreicher Kerne. 3. Elementsynthese und das Alter des Universums. 4. Kosmologie.

  19. Effets associs au gne Na (Cou Nu) sur le poids corporel et le poids des oeufs chez des poules "

    E-print Network

    Paris-Sud XI, Université de

    Effets associés au gène Na (Cou Nu) sur le poids corporel et le poids des oeufs chez des poules zoolechniques, LN.R.A.,., 78350 Jouy-en-Josas Résumé Le génotype hétérozygote au locus Na (Cou nu) chez la poule légère mais haute- ment significative du poids moyen des oeufs, tant chez des poules de taille normale

  20. Des pratiques temporelles du travail aux temporalits urbaines 20 annes de recherches sur la thmatique des temps sociaux

    E-print Network

    Paris-Sud XI, Université de

    thématique des temps sociaux Monique Haicault sociologue Résumé Le texte qui suivra l'introduction ci Rennes, Marseille, Liège, entre 2002 et 2005 et concernent la thématique « Temps des femmes, Temps de villes » qui aborde la question plus générale des temporalités sociales et des temps sociaux

  1. LE BULLETIN DE L'EPI N 60 USAGE PDAGOGIQUE DES CDROM SUR L'USAGE PDAGOGIQUE DES CDROM

    E-print Network

    Paris-Sud XI, Université de

    175 LE BULLETIN DE L'EPI N° 60 USAGE PÉDAGOGIQUE DES CDROM SUR L'USAGE PÉDAGOGIQUE DES CDROM Benoît HUFSCHMITT INTRODUCTION Les CDROM ont fait leur entrée dans l'Education Nationale en décembre 88, chaque des CDROM dans l'Académie de Besançon a demandé d'abord une familiarisation, des manipulations de

  2. Etude des possibilits d'utilisation agronomique des composts d'ordures mnagres en milieu tropical (1)

    E-print Network

    Paris-Sud XI, Université de

    Etude des possibilités d'utilisation agronomique des composts d'ordures ménagères en milieu'avère nécessaire uniquement en saison sèche pour obtenir un compost dont le rapport C/N se situe autour de Ordures les composts des paysompos age. industrialisés. La proportion équilibrée des oligo-éléments et la

  3. Ecole des Ponts prsente pour l'obtention du grade de Docteur de l'Ecole des

    E-print Network

    Paris-Sud XI, Université de

    Ecole des Ponts Certis Thèse présentée pour l'obtention du grade de Docteur de l'Ecole des Ponts 16 décembre 2008 devant le jury composé de : M. Bernard Lapeyre Professeur à l'Ecole des Ponts invité) M. Renaud Keriven Professeur à l'Ecole des Ponts (Directeur) #12;#12;A Papi et Mamie, A Papa et

  4. Sur les pics de frottement intrieur dus des mcanismes faisant intervenir des volumes d'activation importants

    E-print Network

    Paris-Sud XI, Université de

    L-339 Sur les pics de frottement intérieur dus à des mécanismes faisant intervenir des volumes d'influence sur les pics de frottement intérieur de la non linéarité de la vitesse des dislocations associée à des volume d'activation). Abstract. 2014 The influence on internal friction peaks of non linear effects due

  5. Ozone inactivation of human alpha 1-proteinase inhibitor

    SciTech Connect

    Johnson, D.A.

    1980-06-01

    Ozone decreased the trypsin, chymotrypsin, and elastase inhibitory activities of human alpha 1-proteinase inhibitor both in plasma and in solutions of the pure inhibitor. The total loss of porcine elastase inhibitory activity required 18 mol of ozone/mol of pure alpha 1-PI and approximately 850 mol of ozone/mol of alpha 1-PI in plasma. A corresponding loss of the ability to inhibit human leukocyte elastase was observed. Inactivated alpha 1-PI contains four residues of methionine sulfoxide, in addition to oxidized tryosine and tryptophan. Electrophoretic analysis demonstrated that the ozone-inactivated alpha 1-PI did not form normal complexes with serine proteinases. These findings suggest that the inhalation of ozone could inactivate alpha 1-PI on the airspace side of the lung to create a localized alpha 1-PI deficiency, which might contribute to the development of emphysema.

  6. On the Erraticity in Random-Cascading alpha Model

    E-print Network

    Zhou Yifei; Liu Qin; Tang Ying; Cheng Chun

    2001-07-23

    The erraticity in the random-cascading $\\alpha$ model is revisited. It is found that in contrary to the previous expectation, even in the pure single-$\\alpha$ random-cascading model without putting in any particle there exists erraticity behavior and the corresponding entropy indices do not vanish. This means that the dynamical fluctuations in a pure single-$\\alpha$ model already fluctuate event-by-event. Models with multiple-$\\alpha$ strengthen this fluctuation. Taking double-$\\alpha$ model as example, the variation of the event-space fluctuation strength with the mixing ratio of the two $\\alpha$'s is studied in some detail. The influence of particle number on the results when particles are putted into the system is also investigated.

  7. Extreme alpha-clustering in the 18O nucleus

    E-print Network

    E. D. Johnson; G. V. Rogachev; V. Z. Goldberg; S. Brown; D. Robson; A. M. Crisp; P. D. Cottle; C. Fu; J. Giles; B. W. Green; K. W. Kemper; K. Lee; B. T. Roeder; R. E. Tribble

    2009-09-30

    The structure of the 18O nucleus at excitation energies above the alpha decay threshold was studied using 14C+alpha resonance elastic scattering. A number of states with large alpha reduced widths have been observed, indicating that the alpha-cluster degree of freedom plays an important role in this N not equal Z nucleus. However, the alpha-cluster structure of this nucleus is very different from the relatively simple pattern of strong alpha-cluster quasi-rotational bands in the neighboring 16O and 20Ne nuclei. A 0+ state with an alpha reduced width exceeding the single particle limit was identified at an excitation energy of 9.9+/-0.3 MeV. We discuss evidence that states of this kind are common in light nuclei and give possible explanations of this feature.

  8. Enzymatic synthesis of alpha-butylglucoside lactate: a new alpha-hydroxy acid derivative.

    PubMed

    Bousquet, M P; Willemot, R M; Monsan, P; Boures, E

    1999-01-20

    An alpha-hydroxy acid derivative, alpha-butylglucoside lactate, was successfully prepared by enzymatic transesterification of alpha-butylglucoside with a lactate alkyl ester in a non-aqueous medium using immobilized lipase as biocatalyst. Ester synthesis in organic solvent was optimized. Solvent choice was made on the basis of substrate solubility and enzyme stability in the medium. A solvent-free reaction using butyllactate as lactate donor led to the highest yields. In the presence of 0.5M alphabutylglucoside and 100 g/L Novozym(R), a 67 % yield could be obtained within 40 h at 50 degrees C. However, the presence of butanol by-product limited the reaction to a maximum that could not be exceeded in closed systems. The elimination of the alcohol under reduced pressure resulted in the complete equilibrium shift of the transesterification reaction in favor of synthesis; below 15 mbars, more than 95% of 0.5M alpha-butylglucoside could be converted within 30 h. Moreover, simultaneous evaporation of water allowed hydrolysis of butyllactate to be eliminated. Consequently, a very high alpha-butylglucoside lactate concentration (170 g/) could be obtained in a single batch reaction. A single purification procedure, consisting of butyllactate extraction with hexane, enabled the product to be obtained at a purity above 95% (w/w). 1H and 13C NMR analysis later demonstrated that lactic acid was exclusively grafted onto the primary hydroxyl group of alphabutylglucoside. PMID:10099533

  9. Occurrence of alpha-tocopherolquinone and alpha-tocopherolquinol in microorganisms.

    PubMed Central

    Hughes, P E; Tove, S B

    1982-01-01

    Both alpha-tocopherolquinol and alpha-tocopherolquinone were found in 56 of 93 strains of microorganisms examined. Organisms that contained these compounds included the single example of a eucaryotic alga, a Euglena, and a cyanobacterium (blue-green alga), 22 of 32 genera of bacteria, and 9 genera of yeasts. In the bacteria and yeasts the levels of quinone and hydroquinone were nearly equal and averaged about 3 nmol of each compound g-1 of packed cells. Included among the bacteria that contained these compounds were three examples from the newly proposed kingdom of Archaebacteriae. Those microorganisms that did not contain alpha-tocopherolquinol or alpha-tocopherolquinone tended to fall into two groups. One group consisted of gram-positive, anaerobic or facultative bacteria with a low content of guanine and cytosine, and the second group encompassed all of the filamentous microorganisms studied. No metabolic function is known for alpha-tocopherolquinol or its quinone other than as a cofactor in the biohydrogenation of unsaturated fatty acids that can be carried out by only a few organisms. PMID:6809730

  10. Estrogen receptor-alpha (ER-alpha) and defects in uterine receptivity in women

    PubMed Central

    Lessey, Bruce A; Palomino, Wilder A; Apparao, KBC; Young, Steven L; Lininger, Ruth A

    2006-01-01

    Endometriosis is a disorder that affects 5% of the normal population but is present in up to 40% of women with pelvic pain and/or infertility. Recent evidence suggests that the endometrium of women with endometriosis exhibits progesterone insensitivity. One endometrial protein that fluctuates in response to progesterone is the estrogen receptor-alpha (ER alpha), being down-regulated at the time of peak progesterone secretion during the window of implantation. Here we demonstrate that the biomarker of uterine receptivity, beta 3 integrin subunit, is reduced or absent in some women with endometriosis and that such defects are accompanied by inappropriate over-expression of ER alpha during the mid-secretory phase. Using a well-differentiated endometrial cell line we showed that the beta 3 integrin protein is negatively regulated by estrogen and positively regulated by epidermal growth factor (EGF). By competing against estrogen with various selective estrogen receptor modulators (SERMs) and estrogen receptor agonists and antagonists, inhibition of expression of the beta 3 integrin by estrogen can be mitigated. In conclusion, we hypothesize that certain types of uterine receptivity defects may be caused by the loss of appropriate ER alpha down-regulation in the mid-secretory phase, leading to defects in uterine receptivity. Such changes might be effectively treated by timely administration of the appropriate anti-estrogens to artificially block ER alpha and restore normal patterns of gene expression. Such treatments will require further clinical studies. PMID:17118173

  11. The running fine structure constant alpha(E) via the Adler function

    E-print Network

    F. Jegerlehner

    2008-07-26

    We present an up-to-date analysis for a precise determination of the effective fine structure constant and discuss the prospects for future improvements. We advocate to use a determination monitored by the Adler function which allows us to exploit perturbative QCD in an optimal well controlled way. Together with a long term program of hadronic cross section measurements at energies up to a few GeV, a determination of alpha(M_Z) at a precision comparable to the one of the Z mass M_Z should be feasible. Presently alpha(E) at E>1 GeV is the least precisely known of the fundamental parameters of the SM. Since, in spite of substantial progress due to new BaBar exclusive data, the region 1.4 to 2.4 GeV remains the most problematic one a major step in the reduction of the uncertainties are expected from VEPP-2000 and from a possible ``high-energy'' option DAFNE-2 at Frascati. The up-to-date evaluation reads Delta alpha^{(5)}_{had}(M_Z^2) = 0.027515 +/- 0.000149 or alpha^{-1}(M_Z)=128.957 +/- 0.020.

  12. Identification of hydrogen peroxide oxidation sites of alpha A- and alpha B-crystallins.

    PubMed

    Smith, J B; Jiang, X; Abraham, E C

    1997-02-01

    The alpha-crystallins are the most abundant structural proteins of the lens and, because of their chaperone activity, contribute to the solubility of the other crystallins. With aging, the lens crystallins undergo a variety of modifications which correlate with a loss of solubility and the development of cataract. A recent study demonstrating that alpha-crystallins exposed in vitro to FeCl3 and H2O2 exhibit decreased chaperone activity, implicates metal catalyzed oxidations of alpha-crystallins in this loss of solubility. The present study has determined that alpha-crystallins incubated with FeCl3 and H2O2 are modified by the nearly complete oxidation of all methionine residues to methionine sulfoxide, with no other detectable reaction products. The modifications were identified from the molecular weights of peptides formed by enzymatic digestion of the alpha-crystallins and located by tandem mass spectrometric analysis of the fragmentation pattern of the mass spectra of the fragments from peptides with oxidized methionine is loss of 64 Da, which corresponds to loss of CH3SOH from the methionine sulfoxide. These fragments are useful in identifying peptides that include oxidized methionine residues. PMID:9257122

  13. ITER alpha particle diagnostics using knock-on ion tails

    SciTech Connect

    Fisher, R.K.; Parks, P.B.; McChesney, J.M. [and others

    1995-09-01

    Alpha particles will play a critical role in the physics and successful operation of ITER. Achieving fusion ignition requires that the {alpha} particles created by deuterium-tritium (D-T) reactions deposit a large fraction of their energy in the reacting plasma before they are lost. Toroidal field ripple can localize any alpha particle losses and cause first wall damage. We have proposed a new method of measuring the fast confined {alpha}-particle distribution in a reacting plasma. The same elastic collisions that transfer the alpha energy to the D-T plasma ions and allow fusion ignition will also create a high energy tail on the deuterium and tritium ion energy distributions. Some of these energetic tail ions will undergo fusion reactions with the background plasma producing neutrons whose energy is increased significantly above 14 MeV due to the kinetic energy of the reacting ions. Measurement of this high energy tail on the D-T neutron distribution as a function of plasma minor radius would provide information on the alpha density profile with a time response equal to the ion slowing-down time. Although this technique may provide only limited information on the {alpha}-particle energy distribution, experimental studies of fast ions on existing tokamaks have shown that the observed slowing-down is essentially classical. Hence the {alpha}-energy distribution is expected to be classical except in situations where the {alpha}-confinement is poor. The confinement of {alpha}`s can be affected by ripple losses and a number of instabilities. Toroidal field ripple can cause both prompt orbit losses and stochastic ripple diffusion losses. Magnetohydrodynamic activity, including fishbone instabilities, toroidal Alfven eigenmodes, and sawtooth oscillations, may also affect alpha confinement. The diagnostic proposed here, by monitoring the confined alpha population, can provide valuable information on the confinement of fast alphas in a reacting plasma.

  14. Spectral features and asymptotic properties for alpha-circulants and alpha-Toeplitz sequences: theoretical results and examples

    Microsoft Academic Search

    Eric Ngondiep; Stefano Serra-Capizzano; Debora Sesana

    2009-01-01

    For a given nonnegative integer alpha, a matrix A_{n} of size n is called alpha-Toeplitz if its entries obey the rule A_{n}=[a_{r-alpha*s}]_{r,s=0}^{n-1}. Analogously, a matrix A_{n} again of size n is called alpha-circulant if A_{n}= [a_{(r-alpha*s)mod n}]_{r,s=0}^{n-1}. Such kind of matrices arises in wavelet analysis, subdivision algorithms and more generally when dealing with multigrid\\/multilevel methods for structured matrices and approximations

  15. Two different molecular organizations account for the single alpha-globin gene of the alpha-thalassemia-2 genotype.

    PubMed Central

    Embury, S H; Miller, J A; Dozy, A M; Kan, Y W; Chan, V; Todd, D

    1980-01-01

    The alpha-thalassemia-2 (alpha-thal-2) genotype or mild alpha-thalassemia gene consists of a single structural alpha-globin gene on the chromosome that normally bears two alpha-globin genes. We used blot hybridization to investigate variation in the molecular organization of this genotype and to determine the distributions of these variations in the world population. Two different patterns of gene organization responsible for the alpha-thal-2 genotype were found: the first was the result of a 4.2-kilobase pair deletion involving the normal 5' alpha-globin gene (leftward deletion alpha-thal-2 genotype), and the second probably the result of a crossover deletion of a DNA fragment bridging the two normal alpha-globin genes (rightward deletion alpha-thal-2- genotype). The rightward deletion was found in all 9 Black subjects, all 8 Mediterranean subjects, and 4 of 13 Chinese subjects. The leftward deletion was found in four and the nondeletion alpha-thalassemia lesion was found in five of the nine remaining Chinese subjects. It is likely that these deletions are related to specific DNA sequences that determine DNA recombinational events. Images PMID:7440717

  16. Producing a compound Nucleus via Inelastic Scattering: The 90Zr(alpha,alpha')90Zr* Case

    SciTech Connect

    Escher, J E; Dietrich, F S

    2008-05-23

    In a Surrogate reaction a compound nucleus is produced via a direct reaction (pickup, stripping, or inelastic scattering). For a proper application of the Surrogate approach it is necessary to predict the resulting angular momentum and parity distribution in the compound nucleus. A model for determining these distributions is developed for the case of inelastic alpha scattering off a spherical nucleus. The focus is on obtaining a first, simple description of the direct-reaction process that produces the compound nucleus and on providing the basis for a more complete treatment of the problem. The approximations employed in the present description are discussed and the extensions required for a more rigorous treatment of the problem are outlined. To illustrate the formalism, an application to {sup 90}Zr({alpha},{alpha}{prime}){sup 90}Zr* is presented.

  17. The 106Cd(alpha,alpha)106Cd elastic scattering in a wide energy range for gamma-process studies

    E-print Network

    Ornelas, A; Mohr, P; Galaviz, D; Fülöp, Zs; Gyürky, Gy; Máté, Z; Rauscher, T; Somorjai, E; Sonnabend, K; Zilges, A

    2015-01-01

    Alpha elastic scattering angular distributions of the 106Cd(alpha,alpha)106Cd reaction were measured at three energies around the Coulomb barrier to provide a sensitive test for the alpha + nucleus optical potential parameter sets. Furthermore, the new high precision angular distributions, together with the data available from the literature were used to study the energy dependence of the locally optimized {\\alpha}+nucleus optical potential in a wide energy region ranging from E_Lab = 27.0 MeV down to 16.1 MeV. The potentials under study are a basic prerequisite for the prediction of alpha-induced reaction cross sections and thus, for the calculation of stellar reaction rates used for the astrophysical gamma process. Therefore, statistical model predictions using as input the optical potentials discussed in the present work are compared to the available 106Cd + alpha cross section data.

  18. The 106Cd(alpha,alpha)106Cd elastic scattering in a wide energy range for gamma-process studies

    E-print Network

    A. Ornelas; G. G. Kiss; P. Mohr; D. Galaviz; Zs. Fülöp; Gy. Gyürky; Z. Máté; T. Rauscher; E. Somorjai; K. Sonnabend; A. Zilges

    2015-04-29

    Alpha elastic scattering angular distributions of the 106Cd(alpha,alpha)106Cd reaction were measured at three energies around the Coulomb barrier to provide a sensitive test for the alpha + nucleus optical potential parameter sets. Furthermore, the new high precision angular distributions, together with the data available from the literature were used to study the energy dependence of the locally optimized {\\alpha}+nucleus optical potential in a wide energy region ranging from E_Lab = 27.0 MeV down to 16.1 MeV. The potentials under study are a basic prerequisite for the prediction of alpha-induced reaction cross sections and thus, for the calculation of stellar reaction rates used for the astrophysical gamma process. Therefore, statistical model predictions using as input the optical potentials discussed in the present work are compared to the available 106Cd + alpha cross section data.

  19. Composition des lipides de l'œuf chez des poules Leghorn normales et naines

    E-print Network

    Boyer, Edmond

    Composition des lipides de l'œuf chez des poules Leghorn normales et naines Y. DEMARNE, P ségrégation pour le gène de nanisme lié au sexe dw, des oeufs (un par poule) provenant de 18 couples de soeurs vitellins chez la poule naine. Mots clés : Volaille, nanisme, œuf, lipides, acides gras. _ Summary

  20. Évaluation expérimentale des modes d’enchère des droits d’exploitation de la forêt québécoise

    Microsoft Academic Search

    Daniel Rondeau; Maurice Doyon; Pascal Courty

    2012-01-01

    Ce projet a pour objectif de pallier un manque de connaissances quant à l’impact des conditions de marché et de certains paramètres institutionnels sur les prix d’enchère de premier prix. Il s’inscrit dans le cadre de la réforme majeure du régime forestier québécois et de la mise en place d’un système d’allocation des droits de coupes reposant principalement sur des