Fruiting bodies of the social amoeba Dictyostelium discoideum increase spore transport by Drosophila
2014-01-01
Background Many microbial phenotypes are the product of cooperative interactions among cells, but their putative fitness benefits are often not well understood. In the cellular slime mold Dictyostelium discoideum, unicellular amoebae aggregate when starved and form multicellular fruiting bodies in which stress-resistant spores are held aloft by dead stalk cells. Fruiting bodies are thought to be adaptations for dispersing spores to new feeding sites, but this has not been directly tested. Here we experimentally test whether fruiting bodies increase the rate at which spores are acquired by passing invertebrates. Results Drosophila melanogaster accumulate spores on their surfaces more quickly when exposed to intact fruiting bodies than when exposed to fruiting bodies physically disrupted to dislodge spore masses from stalks. Flies also ingest and excrete spores that still express a red fluorescent protein marker. Conclusions Multicellular fruiting bodies created by D. discoideum increase the likelihood that invertebrates acquire spores that can then be transported to new feeding sites. These results thus support the long-hypothesized dispersal benefits of altruism in a model system for microbial cooperation. PMID:24884856
Shibasaki, Shota; Shirokawa, Yuka; Shimada, Masakazu
2017-05-21
Biological studies of the evolution of cooperation are challenging because this process is vulnerable to cheating. Many mechanisms, including kin discrimination, spatial structure, or by-products of self-interested behaviors, can explain this evolution. Here we propose that the evolution of cooperation can be induced by other cooperation. To test this idea, we used a model organism Dictyostelium discoideum because it exhibits two cooperative dormant phases, the fruiting body and the macrocyst. In both phases, the same chemoattractant, cyclic AMP (cAMP), is used to collect cells. This common feature led us to hypothesize that the evolution of macrocyst formation would be induced by coexistence with fruiting bodies. Before forming a mathematical model, we confirmed that macrocysts coexisted with fruiting bodies, at least under laboratory conditions. Next, we analyzed our evolutionary game theory-based model to investigate whether coexistence with fruiting bodies would stabilize macrocyst formation. The model suggests that macrocyst formation represents an evolutionarily stable strategy and a global invader strategy under this coexistence, but is unstable if the model ignores the fruiting body formation. This result indicates that the evolution of macrocyst formation and maintenance is attributable to coexistence with fruiting bodies. Therefore, macrocyst evolution can be considered as an example of evolution of cooperation induced by other cooperation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kuwayama, Hidekazu; Kikuchi, Haruhisa; Oshima, Yoshiteru; Kubohara, Yuzuru
2016-12-01
In the development of the cellular slime mold Dictyostelium discoideum , two chlorinated compounds, the differentiation-inducing factors DIF-1 and DIF-2, play important roles in the regulation of both cell differentiation and chemotactic cell movement. However, the receptors of DIFs and the components of DIF signaling systems have not previously been elucidated. To identify the receptors for DIF-1 and DIF-2, we here performed DIF-conjugated affinity gel chromatography and liquid chromatography-tandem mass spectrometry and identified the glutathione S-transferase GST4 as a major DIF-binding protein. Knockout and overexpression mutants of gst4 ( gst4 - and gst4 OE , respectively) formed fruiting bodies, but the fruiting bodies of gst4 - cells were smaller than those of wild-type Ax2 cells, and those of gst4 OE cells were larger than those of Ax2 cells. Both chemotaxis regulation and in vitro stalk cell formation by DIFs in the gst4 mutants were similar to those of Ax2 cells. These results suggest that GST4 is a DIF-binding protein that regulates the sizes of cell aggregates and fruiting bodies in D. discoideum .
Baviskar, Sandhya N; Shields, Malcolm S
2010-01-01
Glucose-regulated 94 kDa protein (Grp94) is a resident of the endoplasmic reticulum (ER) of multicellular eukaryotes. It is a constitutively expressed protein that is overexpressed in certain abnormal conditions of the cell such as depletion of glucose and calcium, and low oxygen and pH. The protein is also implicated in diseased conditions like cancer and Alzheimer's disease. In this study, the consequences of downregulation of Grp94 were investigated at both unicellular and multicellular stages of Dictyostelium discoideum. Previous studies have shown the expression of Dd-Grp94 (Dictyostelium discoideum glucose-regulated 94 kDa protein) in wild-type cells varies during development, and overexpression of Dd-Grp94 leads to abnormal cell shape and inhibition of development (i.e., formation of fruiting bodies). Grp94 is a known calcium binding protein and an efficient calcium buffer. Therefore, in the present study we hypothesized that downregulation of Dd-Grp94 protein would affect Dictyostelium cell structure, growth, and development. We found that Dd-grp94 RNAi recombinants exhibited reduced growth rate, cell size, and a subtle change in cell motility compared to the parental cells. The recombinants also exhibited a delay in development and small fruiting bodies. These results establish that Dd-grp94 plays a crucial role in determining normal cell structure, growth and differentiation.
Strassmann, Joan E; Queller, David C
2011-05-01
Dictyostelium discoideum has been very useful for elucidating principles of development over the last 50 years, but a key attribute means there is a lot to be learned from a very different intellectual tradition: social evolution. Because Dictyostelium arrives at multicellularity by aggregation instead of through a single-cell bottleneck, the multicellular body could be made up of genetically distinct cells. If they are genetically distinct, natural selection will result in conflict over which cells become fertile spores and which become dead stalk cells. Evidence for this conflict includes unequal representation of two genetically different clones in spores of a chimera, the poison-like differentiation inducing factor (DIF) system that appears to involve some cells forcing others to become stalk, and reduced functionality in migrating chimeras. Understanding how selection operates on chimeras of genetically distinct clones is crucial for a comprehensive view of Dictyostelium multicellularity. In nature, Dictyostelium fruiting bodies are often clonal, or nearly so, meaning development will often be very cooperative. Relatedness levels tell us what benefits must be present for sociality to evolve. Therefore it is important to measure relatedness in nature, show that it has an impact on cooperation in the laboratory, and investigate genes that Dictyostelium uses to discriminate between relatives and non-relatives. Clearly, there is a promising future for research at the interface of development and social evolution in this fascinating group. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.
Kikuchi, H; Saito, Y; Komiya, J; Takaya, Y; Honma, S; Nakahata, N; Ito, A; Oshima, Y
2001-10-19
We investigated the constituents of Dictyostelium discoideum to clarify the diversity of secondary metabolites of Dictyostelium cellular slime molds and to explore biologically active substances that could be useful in the development of novel drugs. From a methanol extract of the multicellular fruit body of D. discoideum, we isolated two novel amino sugar analogues, furanodictine A (1) and B (2). They are the first 3,6-anhydrosugars to be isolated from natural sources. Their relative structures were elucidated by spectral means, and the absolute configurations were confirmed by asymmetric syntheses of 1 and 2. These furanodictines potently induce neuronal differentiation of rat pheochromocytoma (PC-12) cells.
Deficiency of Huntingtin Has Pleiotropic Effects in the Social Amoeba Dictyostelium discoideum
Myre, Michael A.; Lumsden, Amanda L.; Thompson, Morgan N.; Wasco, Wilma; MacDonald, Marcy E.; Gusella, James F.
2011-01-01
Huntingtin is a large HEAT repeat protein first identified in humans, where a polyglutamine tract expansion near the amino terminus causes a gain-of-function mechanism that leads to selective neuronal loss in Huntington's disease (HD). Genetic evidence in humans and knock-in mouse models suggests that this gain-of-function involves an increase or deregulation of some aspect of huntingtin's normal function(s), which remains poorly understood. As huntingtin shows evolutionary conservation, a powerful approach to discovering its normal biochemical role(s) is to study the effects caused by its deficiency in a model organism with a short life-cycle that comprises both cellular and multicellular developmental stages. To facilitate studies aimed at detailed knowledge of huntingtin's normal function(s), we generated a null mutant of hd, the HD ortholog in Dictyostelium discoideum. Dictyostelium cells lacking endogenous huntingtin were viable but during development did not exhibit the typical polarized morphology of Dictyostelium cells, streamed poorly to form aggregates by accretion rather than chemotaxis, showed disorganized F-actin staining, exhibited extreme sensitivity to hypoosmotic stress, and failed to form EDTA-resistant cell–cell contacts. Surprisingly, chemotactic streaming could be rescued in the presence of the bivalent cations Ca2+ or Mg2+ but not pulses of cAMP. Although hd − cells completed development, it was delayed and proceeded asynchronously, producing small fruiting bodies with round, defective spores that germinated spontaneously within a glassy sorus. When developed as chimeras with wild-type cells, hd − cells failed to populate the pre-spore region of the slug. In Dictyostelium, huntingtin deficiency is compatible with survival of the organism but renders cells sensitive to low osmolarity, which produces pleiotropic cell autonomous defects that affect cAMP signaling and as a consequence development. Thus, Dictyostelium provides a novel haploid
The effect of selected monoterpenoids on the cellular slime mold, Dictyostelium discoideum NC4.
Hwang, J Y; Kim, J H; Yun, K W
2004-06-01
We tested the activity of 11 main compounds identified from Pinus plants on the growth of Dictyostelium discoideum NC4. Four concentrations (1, 0.1, 0.01, 0.001 microg/microl) of each compound were tested using a disk volatilization technique following germination of D. discoideum NC4 spores. Photographs of D. discoideum NC4 fruiting bodies were taken 2 days after treatment. Fenchone (at 0.1, 0.01, and 0.001 microg/microl) and camphene (at 0.01 microg/microl) stimulated growth of D. discoideum NC4. (1S)-(-)-verbenone, (1S)-(-)-alpha-pinene, (+)-beta-pinene, myrcene, (-)-menthone, (-)-bornyl acetate, (S)-(+)-carvone, (-)-camphene, and (R)-(+)-limonene inhibit its growth. All of the compounds at 1 microg/microl had a strong inhibitory effect on cell growth of D. discoideum NC4. Microscopic observation of the fruiting bodies matched the results of growth rate analysis. Most of the inhibitory effects were represented by changes in the shapes of the fruiting bodies. These changes include short sorophores, smaller sized sori, and sori without spores. Our results suggest that inhibition of growth is the most common effect of monoterpenoids on D. discoideum NC4. Nevertheless, some of them, like fenchone and camphene, seem to enhance its growth.
Okuwa, T; Katayama, T; Takano, A; Kodaira, K; Yasukawa, H
2001-12-01
Countin, a cell-counting factor in Dictyostelium discoideum, is considered to limit the maximum size of the multicellular structure, because a countin null strain forms a huge fruiting body compared to that of the wild-type. A novel gene, countin2, that is highly homologous to countin (40% identity in amino acid sequence) was identified in the D. discoideum genome. The countin2 null strain formed a 1.7-fold higher number of the aggregates, resulting in smaller fruiting bodies compared with those of wild-type cells. Thus, the Countin2 protein is thought to limit the minimum size of the multicellular structure. The size and number of aggregates formed by a mixture of countin null and countin2 null strains were the same as those of the wild-type. These findings demonstrate that a combination of Countin and Countin2 proteins determines the appropriate size of the multicellular structure of D. discoideum.
A RabGAP Regulates Life-Cycle Duration via Trimeric G-protein Cascades in Dictyostelium discoideum
Kuwayama, Hidekazu; Miyanaga, Yukihiro; Urushihara, Hideko; Ueda, Masahiro
2013-01-01
Background The life-cycle of cellular slime molds comprises chronobiologically regulated processes. During the growth phase, the amoeboid cells proliferate at a definite rate. Upon starvation, they synthesize cAMP as both first and second messengers in signalling pathways and form aggregates, migrating slugs, and fruiting bodies, consisting of spores and stalk cells, within 24 h. In Dictyostelium discoideum, because most growth-specific events cease during development, proliferative and heterochronic mutations are not considered to be interrelated and no genetic factor governing the entire life-cycle duration has ever been identified. Methodology/Principal Findings Using yeast 2-hybrid library screening, we isolated a Dictyostelium discoideum RabGAP, Dd Rbg-3, as a candidate molecule by which the Dictyostelium Gα2 subunit directs its effects. Rab GTPase-activating protein, RabGAP, acts as a negative regulator of Rab small GTPases, which orchestrate the intracellular membrane trafficking involved in cell proliferation. Deletion mutants of Dd rbg-3 exhibited an increased growth rate and a shortened developmental period, while an overexpression mutant demonstrated the opposite effects. We also show that Dd Rbg-3 interacts with 2 Gα subunits in an activity-dependent manner in vitro. Furthermore, both human and Caenorhabditis elegans rbg-3 homologs complemented the Dd rbg-3–deletion phenotype in D. discoideum, indicating that similar pathways may be generally conserved in multicellular organisms. Conclusions/Significance Our findings suggest that Dd Rbg-3 acts as a key element regulating the duration of D. discoideum life-span potentially via trimeric G-protein cascades. PMID:24349132
Rodríguez-Ruiz, Amaia; Dondero, Francesco; Viarengo, Aldo; Marigómez, Ionan
2016-06-01
A suite of organisms from different taxonomical and ecological positions is needed to assess environmentally relevant soil toxicity. A new bioassay based on Dictyostelium is presented that is aimed at integrating slime molds into such a testing framework. Toxicity tests on elutriates and the solid phase developmental cycle assay were successfully applied to a soil spiked with a mixture of Zn, Cd, and diesel fuel freshly prepared (recently contaminated) and after 2 yr of aging. The elutriates of both soils provoked toxic effects, but toxicity was markedly lower in the aged soil. In the D. discoideum developmental cycle assay, both soils affected amoeba viability and aggregation, with fewer multicellular units, smaller fruiting bodies and, overall, inhibition of fruiting body formation. This assay is quick and requires small amounts of test soil, which might facilitate its incorporation into a multispecies multiple-endpoint toxicity bioassay battery suitable for environmental risk assessment in soils. Environ Toxicol Chem 2016;35:1413-1421. © 2015 SETAC. © 2015 SETAC.
Bacterial communities in the fruit bodies of ground basidiomycetes
NASA Astrophysics Data System (ADS)
Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.
2015-06-01
Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.
Fruit body formation on silkworm by Cordyceps militaris
USDA-ARS?s Scientific Manuscript database
Injection inoculation protocols for fruit body formation of Cordyceps militaris were investigated to improve the incidence of infection in the silkworm species Bombyx mori. Injection, with suspensions of C. militaris hyphal bodies into living silkworm pupae, was used to test for fruit body productio...
Regulation of cell-fate determination in Dictyostelium.
Brown, J M; Firtel, R A
1999-12-15
A key step in the development of all multicellular organisms is the differentiation of specialized cell types. The eukaryotic microorganism Dictyostelium discoideum provides a unique experimental system for studying cell-type determination and spatial patterning in a developing multicellular organism. Unlike metazoans, which become multicellular by undergoing many rounds of cell division after fertilization of an egg, the social amoeba Dictyostelium achieves multicellularity by the aggregation of approximately 10(5) cells in response to nutrient depletion. Following aggregation, cell-type differentiation and morphogenesis result in a multicellular organism with only a few cell types that exhibit a defined patterning along the anterior-posterior axis of the organism. Analysis of the mechanisms that control these processes is facilitated by the relative simplicity of Dictyostelium development and the availability of molecular, genetic, and cell biological tools. Interestingly, analysis has shown that many molecules that play integral roles in the development of higher eukaryotes, such as PKA, STATs, and GSK-3, are also essential for cell-type differentiation and patterning in Dictyostelium. The role of these and other signaling pathways in the induction, maintenance, and patterning of cell types during Dictyostelium development is discussed.
Spectral characterization of Dictyostelium autofluorescence.
Engel, Ruchira; Van Haastert, Peter J M; Visser, Antonie J W G
2006-03-01
Dictyostelium discoideum is used extensively as a model organism for the study of chemotaxis. In recent years, an increasing number of studies of Dictyostelium chemotaxis have made use of fluorescence-based techniques. One of the major factors that can interfere with the application of these techniques in cells is the cellular autofluorescence. In this study, the spectral properties of Dictyostelium autofluorescence have been characterized using fluorescence microscopy. Whole cell autofluorescence spectra obtained using spectral imaging microscopy show that Dictyostelium autofluorescence covers a wavelength range from approximately 500 to 650 nm with a maximum at approximately 510 nm, and thus, potentially interferes with measurements of green fluorescent protein (GFP) fusion proteins with fluorescence microscopy techniques. Further characterization of the spatial distribution, intensity, and brightness of the autofluorescence was performed with fluorescence confocal microscopy and fluorescence fluctuation spectroscopy (FFS). The autofluorescence in both chemotaxing and nonchemotaxing cells is localized in discrete areas. The high intensity seen in cells incubated in the growth medium HG5 reduces by around 50% when incubated in buffer, and can be further reduced by around 85% by photobleaching cells for 5-7 s. The average intensity and spatial distribution of the autofluorescence do not change with long incubations in the buffer. The cellular autofluorescence has a seven times lower molecular brightness than eGFP. The influence of autofluorescence in FFS measurements can be minimized by incubating cells in buffer during the measurements, pre-bleaching, and making use of low excitation intensities. The results obtained in this study thus offer guidelines to the design of future fluorescence studies of Dictyostelium. Microsc. Res. Tech. 69:168-174, 2006. (c) 2006 Wiley-Liss, Inc.
Levraud, Jean-Pierre; Adam, Myriam; Luciani, Marie-Françoise; de Chastellier, Chantal; Blanton, Richard L.; Golstein, Pierre
2003-01-01
Cell death in the stalk of Dictyostelium discoideum, a prototypic vacuolar cell death, can be studied in vitro using cells differentiating as a monolayer. To identify early events, we examined potentially dying cells at a time when the classical signs of Dictyostelium cell death, such as heavy vacuolization and membrane lesions, were not yet apparent. We observed that most cells proceeded through a stereotyped series of differentiation stages, including the emergence of “paddle” cells showing high motility and strikingly marked subcellular compartmentalization with actin segregation. Paddle cell emergence and subsequent demise with paddle-to-round cell transition may be critical to the cell death process, as they were contemporary with irreversibility assessed through time-lapse videos and clonogenicity tests. Paddle cell demise was not related to formation of the cellulose shell because cells where the cellulose-synthase gene had been inactivated underwent death indistinguishable from that of parental cells. A major subcellular alteration at the paddle-to-round cell transition was the disappearance of F-actin. The Dictyostelium vacuolar cell death pathway thus does not require cellulose synthesis and includes early actin rearrangements (F-actin segregation, then depolymerization), contemporary with irreversibility, corresponding to the emergence and demise of highly polarized paddle cells. PMID:12654899
Autophagy contributes to degradation of Hirano bodies
Kim, Dong-Hwan; Davis, Richard C.; Furukawa, Ruth; Fechheimer, Marcus
2009-01-01
Hirano bodies are actin-rich inclusions reported most frequently in the hippocampus in association with a variety of conditions including neurodegenerative diseases and aging. We have developed a model system for formation of Hirano bodies in Dictyostelium and cultured mammalian cells to permit detailed studies of the dynamics of these structures in living cells. Model Hirano bodies are frequently observed in membrane-enclosed vesicles in mammalian cells consistent with a role of autophagy in the degradation of these structures. Clearance of Hirano bodies by an exocytotic process is supported by images from electron microscopy showing extracellular release of Hirano bodies, and observation of Hirano bodies in the culture medium of Dictyostelium and mammalian cells. An autophagosome marker protein Atg8-GFP was colocalized with model Hirano bodies in wild-type Dictyostelium cells, but not in atg5- or atg1-1 autophagy mutant strains. Induction of model Hirano bodies in Dictyostelium with a high-level expression of 34 kDa ΔEF1 from the inducible discoidin promoter resulted in larger Hirano bodies and a cessation of cell doubling. The degradation of model Hirano bodies still occurred rapidly in autophagy mutant (atg5-) Dictyostelium, suggesting that other mechanisms such as the ubiquitin-mediated proteasome pathway could contribute to the degradation of Hirano bodies. Chemical inhibition of the proteasome pathway with lactacystin significantly decreased the turnover of Hirano bodies in Dictyostelium, providing direct evidence that autophagy and the proteasome can both contribute to degradation of Hirano bodies. Short-term treatment of mammalian cells with either lactacystin or 3-methyl adenine results in higher levels of Hirano bodies and a lower level of viable cells in the cultures, supporting the conclusion that both autophagy and the proteasome contribute to degradation of Hirano bodies. PMID:18989098
Interconnected Cavernous Structure of Bacterial Fruiting Bodies
Harvey, Cameron W.; Du, Huijing; Xu, Zhiliang; ...
2012-12-27
The formation of spore-filled fruiting bodies by myxobacteria is a fascinating case of multicelular self-organization by bacteria. The organization of Myxococcus xanthus into fruiting bodies has long been studied not only as an important example of collective motion of bacteria, but also as a simplified model for developmental morphogenesis. Sporulation within the nascent fruiting body requires signaling between moving cells in order that the rod-shaped self-propelled cells differentiate into spores at the appropriate time. Probing the three-dimensional structure of myxobacteria fruiting bodies has previously presented a challenge due to Imitations at different imaging methods. A new technique using Infrared Opticalmore » Coherence Tomography (OCT) revealed previously unknown details of the Internal structure of M. xanthus fruiting bodies consisting of interconnected pockets of relative nigh and low spore density regions. Here, to make sense of the experimentally observed structure, modeling and computer simulations were used to test a hypothesized mechanism that could produce high density pockets of spores. The mechanism consists of self-propelled cells aligning with each other and signaling by end-to-end contact to coordinate the process of differentiation resulting in a pattern of clusters observed in the experiment. The Integration of novel OCT experimental techniques with computational simulations can provide new insight Into the mechanisms that can give rise to the pattern formation seen In other biological systems such as dlctyostelids, social amoeba known to form multicellular aggregates observed as slugs under starvation conditions.« less
Myxobacteria Fruiting Body Formation
NASA Astrophysics Data System (ADS)
Jiang, Yi
2006-03-01
Myxobacteria are social bacteria that swarm and glide on surfaces, and feed cooperatively. When starved, tens of thousands of cells change their movement pattern from outward spreading to inward concentration; they form aggregates that become fruiting bodies, inside which cells differentiate into nonmotile, environmentally resistant spores. Traditionally, cell aggregation has been considered to imply chemotaxis, a long-range cell interaction mediated by diffusing chemicals. However, myxobacteria aggregation is the consequence of direct cell-contact interactions. I will review our recent efforts in modeling the fruiting body formation of Myxobacteria, using lattice gas cellular automata models that are based on local cell-cell contact signaling. These models have reproduced the individual phases in Myxobacteria development such as the rippling, streaming, early aggregation and the final sporulation; the models can be unified to simulate the whole developmental process of Myxobacteria.
Ma, H; Gamper, M; Parent, C; Firtel, R A
1997-01-01
We have identified a MAP kinase kinase (DdMEK1) that is required for proper aggregation in Dictyostelium. Null mutations produce extremely small aggregate sizes, resulting in the formation of slugs and terminal fruiting bodies that are significantly smaller than those of wild-type cells. Time-lapse video microscopy and in vitro assays indicate that the cells are able to produce cAMP waves that move through the aggregation domains. However, these cells are unable to undergo chemotaxis properly during aggregation in response to the chemoattractant cAMP or activate guanylyl cyclase, a known regulator of chemotaxis in Dictyostelium. The activation of guanylyl cyclase in response to osmotic stress is, however, normal. Expression of putative constitutively active forms of DdMEK1 in a ddmek1 null background is capable, at least partially, of complementing the small aggregate size defect and the ability to activate guanylyl cyclase. However, this does not result in constitutive activation of guanylyl cyclase, suggesting that DdMEK1 activity is necessary, but not sufficient, for cAMP activation of guanylyl cyclase. Analysis of a temperature-sensitive DdMEK1 mutant suggests that DdMEK1 activity is required throughout aggregation at the time of guanylyl cyclase activation, but is not essential for proper morphogenesis during the later multicellular stages. The activation of the MAP kinase ERK2, which is essential for chemoattractant activation of adenylyl cyclase, is not affected in ddmek1 null strains, indicating that DdMEK1 does not regulate ERK2 and suggesting that at least two independent MAP kinase cascades control aggregation in Dictyostelium. PMID:9250676
Du, Qingyou; Schaap, Pauline
2014-01-01
Amoebas and other freely moving protists differentiate into walled cysts when exposed to stress. As cysts, amoeba pathogens are resistant to biocides, preventing treatment and eradication. Lack of gene modification procedures has left the mechanisms of encystation largely unexplored. Genetically tractable Dictyostelium discoideum amoebas require cellulose synthase for formation of multicellular fructifications with cellulose-rich stalk and spore cells. Amoebas of its distant relative Polysphondylium pallidum (Ppal), can additionally encyst individually in response to stress. Ppal has two cellulose synthase genes, DcsA and DcsB, which we deleted individually and in combination. Dcsa- mutants formed fruiting bodies with normal stalks, but their spore and cyst walls lacked cellulose, which obliterated stress-resistance of spores and rendered cysts entirely non-viable. A dcsa-/dcsb- mutant made no walled spores, stalk cells or cysts, although simple fruiting structures were formed with a droplet of amoeboid cells resting on an sheathed column of decaying cells. DcsB is expressed in prestalk and stalk cells, while DcsA is additionally expressed in spores and cysts. We conclude that cellulose is essential for encystation and that cellulose synthase may be a suitable target for drugs to prevent encystation and render amoeba pathogens susceptible to conventional antibiotics. PMID:25113829
Genes Expressed During Fruiting Body Formation of Agrocybe cylindracea
Shim, Sung Mi; Kim, Sang Beom; Kim, Hey Young; Rho, Hyun-Su; Lee, Hyun Sook; Lee, Min Woong; Lee, U Youn; Im, Kyung Hoan
2006-01-01
Agrocybe cylindracea, an edible mushroom belonging to Bolbitiaceae, Agaricales, is widely used as invaluable medicinal material in the oriental countries. This study was initiated to find the genes expressed during the fruiting body formation of A. cylindracea. The cDNAs expressed differentially during fruiting body morphogenesis of A. cylindracea were isolated through subtractive hybridization between vegetative mycelia and fruiting bodies. The cDNAs expressed in the fruiting body morphogenesis of A. cylindracea were cloned and twenty genes were identified. Eleven were homologous to genes of known functions, three were homologous to genes in other organism without any function known. Six were completely novel genes specific to A. cylindracea so far examined. Some genes with known functions were a pleurotolysin, a self-assembling poreforming cytolysins; Aa-Pri1 and Pir2p, specifically induced genes during fruiting initiation of other mushroom, Agrocybe aegerita; an amino acid permease; a cytochrome P450; a MADS-box gene; a peptidylprolyl isomerase; and a serine proteinase. For other clones, no clear function was annotated so far. We believe the first report of the differentially expressed genes in fruiting process of A. cylindracea will be great helps for further research. PMID:24039501
Evidence for nucleolar subcompartments in Dictyostelium
DOE Office of Scientific and Technical Information (OSTI.GOV)
Catalano, Andrew, E-mail: acatalano@ccny.cuny.edu; O’Day, Danton H., E-mail: danton.oday@utoronto.ca; Department of Cell and Systems Biology, University of Toronto, 25 Harbord St., Toronto, Ontario M5S 3G5
2015-01-24
Highlights: • Two nucleolar subcompartments (NoSC1, NoSC2) were found in Dictyostelium. • Specific nucleolar proteins localize to different nucleolar subcompartments. • Specific proteins exit NoSC1 and NoSC2 differently upon Actinomycin D treatment. • KRKR appears to function as an NoSC2 nucleolar subcompartment localization signal. - Abstract: The nucleolus is a multifunctional nuclear compartment usually consisting of two to three subcompartments which represent stages of ribosomal biogenesis. It is linked to several human diseases including viral infections, cancer, and neurodegeneration. Dictyostelium is a model eukaryote for the study of fundamental biological processes as well as several human diseases however comparatively littlemore » is known about its nucleolus. Unlike most nucleoli it does not possess visible subcompartments at the ultrastructural level. Several recently identified nucleolar proteins in Dictyostelium leave the nucleolus after treatment with the rDNA transcription inhibitor actinomycin-D (AM-D). Different proteins exit in different ways, suggesting that previously unidentified nucleolar subcompartments may exist. The identification of nucleolar subcompartments would help to better understand the nucleolus in this model eukaryote. Here, we show that Dictyostelium nucleolar proteins nucleomorphin isoform NumA1 and Bud31 localize throughout the entire nucleolus while calcium-binding protein 4a localizes to only a portion, representing nucleolar subcompartment 1 (NoSC1). SWI/SNF complex member Snf12 localizes to a smaller area within NoSC1 representing a second nucleolar subcompartment, NoSC2. The nuclear/nucleolar localization signal KRKR from Snf12 localized GFP to NoSC2, and thus also appears to function as a nucleolar subcompartment localization signal. FhkA localizes to the nucleolar periphery displaying a similar pattern to that of Hsp32. Similarities between the redistribution patterns of Dictyostelium nucleolar proteins
Evaluation of the mechanisms of intron loss and gain in the social amoebae Dictyostelium.
Ma, Ming-Yue; Che, Xun-Ru; Porceddu, Andrea; Niu, Deng-Ke
2015-12-18
Spliceosomal introns are a common feature of eukaryotic genomes. To approach a comprehensive understanding of intron evolution on Earth, studies should look beyond repeatedly studied groups such as animals, plants, and fungi. The slime mold Dictyostelium belongs to a supergroup of eukaryotes not covered in previous studies. We found 441 precise intron losses in Dictyostelium discoideum and 202 precise intron losses in Dictyostelium purpureum. Consistent with these observations, Dictyostelium discoideum was found to have significantly more copies of reverse transcriptase genes than Dictyostelium purpureum. We also found that the lost introns are significantly further from the 5' end of genes than the conserved introns. Adjacent introns were prone to be lost simultaneously in Dictyostelium discoideum. In both Dictyostelium species, the exonic sequences flanking lost introns were found to have a significantly higher GC content than those flanking conserved introns. Together, these observations support a reverse-transcription model of intron loss in which intron losses were caused by gene conversion between genomic DNA and cDNA reverse transcribed from mature mRNA. We also identified two imprecise intron losses in Dictyostelium discoideum that may have resulted from genomic deletions. Ninety-eight putative intron gains were also observed. Consistent with previous studies of other lineages, the source sequences were found in only a small number of cases, with only two instances of intron gain identified in Dictyostelium discoideum. Although they diverged very early from animals and fungi, Dictyostelium species have similar mechanisms of intron loss.
Naringenin is a novel inhibitor of Dictyostelium cell proliferation and cell migration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Russ, Misty; Martinez, Raquel; Ali, Hind
2006-06-23
Naringenin is a flavanone compound that alters critical cellular processes such as cell multiplication, glucose uptake, and mitochondrial activity. In this study, we used the social amoeba, Dictyostelium discoideum, as a model system for examining the cellular processes and signaling pathways affected by naringenin. We found that naringenin inhibited Dictyostelium cell division in a dose-dependent manner (IC{sub 5} {approx} 20 {mu}M). Assays of Dictyostelium chemotaxis and multicellular development revealed that naringenin possesses a previously unrecognized ability to suppress amoeboid cell motility. We also found that naringenin, which is known to inhibit phosphatidylinositol 3-kinase activity, had no apparent effect on phosphatidylinositolmore » 3,4,5-trisphosphate synthesis in live Dictyostelium cells; suggesting that this compound suppresses cell growth and migration via alternative signaling pathways. In another context, the discoveries described here highlight the value of using the Dictyostelium model system for identifying and characterizing the mechanisms by which naringenin, and related compounds, exert their effects on eukaryotic cells.« less
Modeling oscillations and spiral waves in Dictyostelium populations
NASA Astrophysics Data System (ADS)
Noorbakhsh, Javad; Schwab, David J.; Sgro, Allyson E.; Gregor, Thomas; Mehta, Pankaj
2015-06-01
Unicellular organisms exhibit elaborate collective behaviors in response to environmental cues. These behaviors are controlled by complex biochemical networks within individual cells and coordinated through cell-to-cell communication. Describing these behaviors requires new mathematical models that can bridge scales—from biochemical networks within individual cells to spatially structured cellular populations. Here we present a family of "multiscale" models for the emergence of spiral waves in the social amoeba Dictyostelium discoideum. Our models exploit new experimental advances that allow for the direct measurement and manipulation of the small signaling molecule cyclic adenosine monophosphate (cAMP) used by Dictyostelium cells to coordinate behavior in cellular populations. Inspired by recent experiments, we model the Dictyostelium signaling network as an excitable system coupled to various preprocessing modules. We use this family of models to study spatially unstructured populations of "fixed" cells by constructing phase diagrams that relate the properties of population-level oscillations to parameters in the underlying biochemical network. We then briefly discuss an extension of our model that includes spatial structure and show how this naturally gives rise to spiral waves. Our models exhibit a wide range of novel phenomena. including a density-dependent frequency change, bistability, and dynamic death due to slow cAMP dynamics. Our modeling approach provides a powerful tool for bridging scales in modeling of Dictyostelium populations.
De novo transcriptomic analysis during Lentinula edodes fruiting body growth.
Wang, Yingzhu; Zeng, Xianlu; Liu, Wenguang
2018-01-30
The fruiting body of Lentinula edodes is a popular edible mushroom, and extracts from the mycelium and the fruiting body of this species have diverse therapeutic potential. To gain insights into the molecular mechanisms underlying the fruiting body growth of L. edodes from the early bud stage (EBS), through the intermediate developing stage (IDS), to the fully developed stage (FDS), we performed de novo transcriptomic analysis using high-throughput Illumina RNA-sequencing. First, we generated three cDNA libraries representative of the three respective stages. We then obtained 38,933,148, 44,594,472, and 37,905,646 high-quality reads from the respective libraries and assembled the reads into 25,104 transcriptional contigs, containing 15,199 unigenes. We found that only 9331 of the unigenes had been annotated in the NCBI non-redundant protein database, and we functionally annotated 4758 of them through Gene Ontology (GO) analysis and 2921 of them through Clusters of Orthologous Groups of proteins (COGs) analysis. We also assigned 3995 unigenes to metabolic pathways by using the Kyoto Encyclopedia of Genes and Genomes (KEGG). We further identified 399 differentially expressed genes (DEGs) between EBS and IDS, 1428 between IDS and FDS, and 1830 between EBS and FDS, uncovering 769 DEGs in multiple metabolic and signaling pathways. Interestingly, there were a limited number of DEGs whose expression was dramatically associated with FDS. Finally, genes, whose expression was either highly up-regulated in FDS or remained at a high level during fruiting body growth, were annotated specifically in the pathways of purine metabolism, unsaturated fatty acid metabolism and meiosis, suggesting that these key molecular events were actively occurring in the fruiting body. Our work is the first high-throughput transcriptome study on the growth of L. edodes fruiting bodies, and the results uncovered candidate genes for future gene identification and utilization of this commercially and
Ovaskainen, Otso; Schigel, Dmitry; Ali-Kovero, Heini; Auvinen, Petri; Paulin, Lars; Nordén, Björn; Nordén, Jenni
2013-01-01
Before the recent revolution in molecular biology, field studies on fungal communities were mostly confined to fruit bodies, whereas mycelial interactions were studied in the laboratory. Here we combine high-throughput sequencing with a fruit body inventory to study simultaneously mycelial and fruit body occurrences in a community of fungi inhabiting dead wood of Norway spruce. We studied mycelial occurrence by extracting DNA from wood samples followed by 454-sequencing of the ITS1 and ITS2 regions and an automated procedure for species identification. In total, we detected 198 species as mycelia and 137 species as fruit bodies. The correlation between mycelial and fruit body occurrences was high for the majority of the species, suggesting that high-throughput sequencing can successfully characterize the dominating fungal communities, despite possible biases related to sampling, PCR, sequencing and molecular identification. We used the fruit body and molecular data to test hypothesized links between life history and population dynamic parameters. We show that the species that have on average a high mycelial abundance also have a high fruiting rate and produce large fruit bodies, leading to a positive feedback loop in their population dynamics. Earlier studies have shown that species with specialized resource requirements are rarely seen fruiting, for which reason they are often classified as red-listed. We show with the help of high-throughput sequencing that some of these species are more abundant as mycelium in wood than what could be expected from their occurrence as fruit bodies. PMID:23575372
Takahashi, Kei; Toyota, Taro
2015-01-01
The cytosol of amoeba cells controls the membrane deformation during their motion in vivo. To investigate such ability of the cytosol of amoeba cell, Dictyostelium discoideum (Dictyostelium), in vitro, we used lipids extracted from Dictyostelium and commercially available phospholipids, and prepared substrate-supported lipid membrane patches on the micrometer scale by spin coating. We found that the spin coater holder, which has pores (pore size = 3.1 mm) of negative pressure to hold the cover glass induced the concave surface of the cover glass. The membrane lipid patches were formed at each position in the vicinity of the holder pores and their sizes were in the range of 2.7 to 3.2 × 10(4) μm(2). After addition of the cytosol extracted from Dictyostelium to the lipid membrane patches, through time-lapse observation with a confocal laser scanning fluorescence microscope, we observed an autonomous buckling of the Dictyostelium lipid patches and localized behaviours of proteins found within. The current method serves as the novel technique for the preparation of film patches in which the positions of patches are controlled by the holder pores without fabricating, modifying, and arranging the chemical properties of the solution components of lipids. The findings imply that lipid-binding proteins in the cytosol were adsorbed and accumulated within the Dictyostelium lipid patches, inducing the transformation of the cell-sized patch.
Flow-driven instabilities during pattern formation of Dictyostelium discoideum
NASA Astrophysics Data System (ADS)
Gholami, A.; Steinbock, O.; Zykov, V.; Bodenschatz, E.
2015-06-01
The slime mold Dictyostelium discoideum is a well known model system for the study of biological pattern formation. In the natural environment, aggregating populations of starving Dictyostelium discoideum cells may experience fluid flows that can profoundly change the underlying wave generation process. Here we study the effect of advection on the pattern formation in a colony of homogeneously distributed Dictyostelium discoideum cells described by the standard Martiel-Goldbeter model. The external flow advects the signaling molecule cyclic adenosine monophosphate (cAMP) downstream, while the chemotactic cells attached to the solid substrate are not transported with the flow. The evolution of small perturbations in cAMP concentrations is studied analytically in the linear regime and by corresponding numerical simulations. We show that flow can significantly influence the dynamics of the system and lead to a flow-driven instability that initiate downstream traveling cAMP waves. We also show that boundary conditions have a significant effect on the observed patterns and can lead to a new kind of instability.
Bitter tastant responses in the amoeba Dictyostelium correlate with rat and human taste assays.
Cocorocchio, Marco; Ives, Robert; Clapham, David; Andrews, Paul L R; Williams, Robin S B
2016-01-01
Treatment compliance is reduced when pharmaceutical compounds have a bitter taste and this is particularly marked for paediatric medications. Identification of bitter taste liability during drug discovery utilises the rat in vivo brief access taste aversion (BATA) test which apart from animal use is time consuming with limited throughput. We investigated the suitability of using a simple, non-animal model, the amoeba Dictyostelium discoideum to investigate taste-related responses and particularly identification of compounds with a bitter taste liability. The effect of taste-related compounds on Dictyostelium behaviour following acute exposure (15 minutes) was monitored. Dictyostelium did not respond to salty, sour, umami or sweet tasting compounds, however, cells rapidly responded to bitter tastants. Using time-lapse photography and computer-generated quantification to monitor changes in cell membrane movement, we developed an assay to assess the response of Dictyostelium to a wide range of structurally diverse known bitter compounds and blinded compounds. Dictyostelium showed varying responses to the bitter tastants, with IC50 values providing a rank order of potency. Comparison of Dictyostelium IC50 values to those observed in response to a similar range of compounds in the rat in vivo brief access taste aversion test showed a significant (p = 0.0172) positive correlation between the two models, and additionally a similar response to that provided by a human sensory panel assessment test. These experiments demonstrate that Dictyostelium may provide a suitable model for early prediction of bitterness for novel tastants and drugs. Interestingly, a response to bitter tastants appears conserved from single-celled amoebae to humans.
Tanaka, Takeshi; Shima, Yasuyuki; Ogawa, Naoki; Nagayama, Koki; Yoshida, Takashi; Ohmachi, Tetsuo
2011-01-01
Acetoacetyl-CoA thiolase (AT) is an enzyme that catalyses the CoA-dependent thiolytic cleavage of acetoacetyl-CoA to yield 2 molecules of acetyl-CoA, or the reverse condensation reaction. A full-length cDNA clone pBSGT-3, which has homology to known thiolases, was isolated from Dictyostelium cDNA library. Expression of the protein encoded in pBSGT-3 in Escherichia coli, its thiolase enzyme activity, and the amino acid sequence homology search revealed that pBSGT-3 encodes an AT. The recombinant AT (r-thiolase) was expressed in an active form in an E. coli expression system, and purified to homogeneity by selective ammonium sulfate fractionation and two steps of column chromatography. The purified enzyme exhibited a specific activity of 4.70 mU/mg protein. Its N-terminal sequence was (NH2)-Arg-Met-Tyr-Thr-Thr-Ala-Lys-Asn-Leu-Glu-, which corresponds to the sequence from positions 15 to 24 of the amino acid sequence deduced from pBSGT-3 clone. The r-thiolase in the inclusion body expressed highly in E. coli was the precursor form, which is slightly larger than the purified r-thiolase. When incubated with the cell-free extract of Dictyostelium cells, the precursor was converted to the same size to the purified r-thiolase, suggesting that the presequence at the N-terminus is removed by a Dictyostelium processing peptidase. PMID:21209787
Current progress on truffle submerged fermentation: a promising alternative to its fruiting bodies.
Tang, Ya-Jie; Liu, Rui-Sang; Li, Hong-Mei
2015-03-01
Truffle (Tuber spp.), also known as "underground gold," is popular in various cuisines because of its unique and characteristic aroma. Currently, truffle fruiting bodies are mostly obtained from nature and semi-artificial cultivation. However, the former source is scarce, and the latter is time-consuming, usually taking 4 to 12 years before harvest of the fruiting body. The truffle submerged fermentation process was first developed in Tang's lab as an alternative to its fruiting bodies. To the best of our knowledge, most reports of truffle submerged fermentation come from Tang's group. This review examines the current state of the truffle submerged fermentation process. First, the strategy to optimize the truffle submerged fermentation process is summarized; the final conditions yielded not only the highest reported truffle biomass but also the highest production of extracellular and intracellular polysaccharides. Second, the comparison of metabolites produced by truffle fermentation and fruiting bodies is presented, and the former were superior to the latter. Third, metabolites (i.e., volatile organic compounds, equivalent umami concentration, and sterol) derived from truffle fermentation could be regulated by fermentation process optimization. These findings indicated that submerged fermentation of truffles can be used for commercial production of biomass and metabolites as a promising alternative to generating its fruiting bodies in bioreactor.
[Chemical study on fruiting bodies of Boletus vioaceo-fuscus].
Ma, Bing-ji; Ruan, Yuan; Liu, Ji-kai
2007-09-01
To investigate the chemical constituents of Boletus vioaceo-fuscus. The compounds were isolated with column chromatography. The structures were determined by spectroscopic techniques. Six compounds were isolated from the fruiting bodies of Boletus vioaceo-fiuscus. They were identified as ergosta-5, 7, 22-triene-3beta-ol (1), dihydrofuran-2, 5-dione (2), (22E, 24R)-5alpha, 6alpha-epoxyergosta-8, 22-diene-3beta, 7alpha-diol (3), (22E, 24R)-5alpha, 6alpha-epoxyergosta-8 (14), 22-diene-3beta, 7alphadiol (4), cerebroside B (5) and adenosine (6), respectively. All the Compounds were obtained from the fruiting bodies of Boletus vioaceo-fiscus for the first time.
Simple system--substantial share: the use of Dictyostelium in cell biology and molecular medicine.
Müller-Taubenberger, Annette; Kortholt, Arjan; Eichinger, Ludwig
2013-02-01
Dictyostelium discoideum offers unique advantages for studying fundamental cellular processes, host-pathogen interactions as well as the molecular causes of human diseases. The organism can be easily grown in large amounts and is amenable to diverse biochemical, cell biological and genetic approaches. Throughout their life cycle Dictyostelium cells are motile, and thus are perfectly suited to study random and directed cell motility with the underlying changes in signal transduction and the actin cytoskeleton. Dictyostelium is also increasingly used for the investigation of human disease genes and the crosstalk between host and pathogen. As a professional phagocyte it can be infected with several human bacterial pathogens and used to study the infection process. The availability of a large number of knock-out mutants renders Dictyostelium particularly useful for the elucidation and investigation of host cell factors. A powerful armory of molecular genetic techniques that have been continuously expanded over the years and a well curated genome sequence, which is accessible via the online database dictyBase, considerably strengthened Dictyostelium's experimental attractiveness and its value as model organism. Copyright © 2012 Elsevier GmbH. All rights reserved.
Ko, Yun-Fei; Liau, Jian-Ching; Lee, Chien-Sheng; Chiu, Chen-Yaw; Martel, Jan; Lin, Chuan-Sheng; Tseng, Shun-Fu; Ojcius, David M.; Lu, Chia-Chen; Lai, Hsin-Chih; Young, John D.
2017-01-01
The caterpillar fungus Ophiocordyceps sinensis (previously called Cordyceps sinensis) has been used for centuries in Asia as a tonic to improve health and longevity. Recent studies show that O. sinensis produces a wide range of biological effects on cells, laboratory animals and humans, including anti-fatigue, anti-infection, anti-inflammatory, antioxidant, and anti-tumor activities. In view of the rarity of O. sinensis fruiting bodies in nature, cultivation of its anamorph mycelium represents a useful alternative for large-scale production. However, O. sinensis fruiting bodies harvested in nature harbor several fungal contaminants, a phenomenon that led to the isolation and characterization of a large number of incorrect mycelium strains. We report here the isolation of a mycelium from a fruiting body of O. sinensis and we identify the isolate as O. sinensis’ anamorph (also called Hirsutella sinensis) based on multi-locus sequence typing of several fungal genes (ITS, nrSSU, nrLSU, RPB1, RPB2, MCM7, β-tubulin, TEF-1α, and ATP6). The main characteristics of the isolated mycelium, including its optimal growth at low temperature (16°C) and its biochemical composition, are similar to that of O. sinensis fruiting bodies, indicating that the mycelium strain characterized here may be used as a substitute for the rare and expensive O. sinensis fruiting bodies found in nature. PMID:28046129
Mohamed, Wasima; Ray, Sibnath; Brazill, Derrick; Baskar, Ramamurthy
2017-01-01
A number of organisms possess several isoforms of protein kinase C but little is known about the significance of any specific isoform during embryogenesis and development. To address this we characterized a PKC ortholog (PkcA; DDB_G0288147) in Dictyostelium discoideum. pkcA expression switches from prestalk in mound to prespore in slug, indicating a dynamic expression pattern. Mutants lacking the catalytic domain of PkcA (pkcA−) did not exhibit tip dominance. A striking phenotype of pkcA− was the formation of an aggregate with a central hollow, and aggregates later fragmented to form small mounds, each becoming a fruiting body. Optical density wave patterns of cAMP in the late aggregates showed several cAMP wave generation centers. We attribute these defects in pkcA− to impaired cAMP signaling, altered cell motility and decreased expression of the cell adhesion molecules – CadA and CsaA. pkcA− slugs showed ectopic expression of ecmA in the prespore region. Further, the use of a PKC-specific inhibitor, GF109203X that inhibits the activity of catalytic domain phenocopied pkcA−. PMID:26183108
Signal relay during the life cycle of Dictyostelium.
Mahadeo, Dana C; Parent, Carole A
2006-01-01
A fundamental property of multicellular organisms is signal relay, the process by which information is transmitted from one cell to another. The integration of external information, such as nutritional status or developmental cues, is critical to the function of organisms. In addition, the spatial organizations of multicellular organisms require intricate signal relay mechanisms. Signal relay is remarkably exhibited during the life cycle of the social amoebae Dictyostelium discoideum, a eukaryote that retains a simple way of life, yet it has greatly contributed to our knowledge of the mechanisms cells use to communicate and integrate information. This chapter focuses on the molecules and mechanisms that Dictyostelium employs during its life cycle to relay temporal and spatial cues that are required for survival.
Zhao, Wei; Wang, Xiao-Hua; Li, Hong-Mei; Wang, Shi-Hua; Chen, Tao; Yuan, Zhan-Peng; Tang, Ya-Jie
2014-03-01
Fifty-two polysaccharides were isolated from the fermentation systems of Tuber melanosporum, Tuber indicum, Tuber sinense, Tuber aestivum and the fruiting bodies of Tuber indicum, Tuber himalayense, Tuber sinense by elution with an activated carbon column. Polysaccharides from Tuber fermentation system exhibited relatively higher in vitro antitumor activity against HepG2, A549, HCT-116, SK-BR-3, and HL-60 cells than those from Tuber fruiting bodies. All polysaccharides were mainly composed of D-mannose, D-glucose, and D-galactose, which suggested that the polysaccharides from Tuber fruiting bodies and fermentation system have identical chemical compositions. The results of antitumor activity and structural identification indicated that the polysaccharide fractions could promote antitumor activity. Tuber polysaccharides from Tuber fermentation system exhibited relatively higher than that from Tuber fruiting bodies. These results confirm the potential of Tuber fermentation mycelia for use as an alternative resource for its fruiting bodies.
Cui, Fengjie; Li, Yunhong; Yang, Yan; Sun, Wenjing; Wu, Di; Ping, Lifeng
2014-12-31
The present study investigated the changes of the chemical components and cytotoxicity potency at 5 developmental stages of Pleurotus eryngii fruiting body. The carbohydrate and protein contents increased along the maturity of fruiting body while fat content decreased. By comparison, the polysaccharide-protein fractions had the highest antiproliferative effect on SGC-7901 and HepG-2 cells in vitro and increasing activity with growing maturity of P. eryngii fruiting body.The maturation process increased the protein content and acid property through the enhanced relative abundance of Asp, Thr, and Glu in polysaccharide-protein fractions. Further purification and electrophoresis identified that the polysaccharide-protein PEG-1with three subunits possibly was the target cytotoxical component. Our findings proved that mature fruiting body of P. eryngii containing these polysaccharide-proteins possessed highly nutritional values and therapeutical benefits.
Shrestha, Bhushan; Han, Sang-Kuk; Sung, Jae-Mo
2012-01-01
Interest in commercial cultivation and product development of Cordyceps species has shown a recent increase. Due to its biochemical and pharmacological effects, Cordyceps militaris, commonly known as orange caterpillar fungus, is being investigated with great interest. Cultivation of C. militaris has been practiced on a large scale in order to fulfill a demand for scientific investigation and product development. Isolates of C. militaris can be easily established from both spores and tissue. For isolation of spores, ascospores released from mature stromata are trapped in sterile medium. Multi-ascospore isolates, as well as combinations of single ascospore strains, are used for production of fruiting bodies. Progeny ascospore strains can be isolated from artificial fruiting bodies, thus, the cycle of fruiting body production can be continued for a long period of time. In this study, we examined fruiting body production from multi-ascospore isolates and their progeny strains for three generations. F1 progeny strains generally produced a larger number of fruiting bodies, compared with their mother multi-ascospore isolates; however, F2 and F3 progeny strains produced fewer fruiting bodies. Optimum preservation conditions could help to increase the vitality of the progeny strains. In order to retain the fruiting ability of the strains, further testing of various methods of preservation and different methods for isolation should be performed. PMID:22870051
NASA Astrophysics Data System (ADS)
Ohnuki, Toshihiko; Aiba, Yukitoshi; Sakamoto, Fuminori; Kozai, Naofumi; Niizato, Tadafumi; Sasaki, Yoshito
2016-07-01
This paper presents the accumulation process of radioactive Cs in edible mushrooms. We here first report the direct accumulation pathway of radioactive Cs from contaminated wood logs to the fruit-bodies of shiitake mushrooms through the basal portion of the stipe. In this pathway, radioactive Cs is not transported through the hyphae. This pathway results in a high accumulation of radioactive Cs in the fruit-body, more by the excess accumulation of radioactive Cs from the wood logs than that through the hyphae. We grew the fruit-bodies of Shiitake mushroom from radioactive-Cs-contaminated wood logs. The spatial distributions of radioactive Cs and Prussian blue as a tracer of interstitial water in the cross section of the wood log measured after the harvest of the fruit-body from the inoculated sawdust spawn area indicated that some fraction of the radioactive Cs and Prussian blue were transported directly to the basal portion of the stipe during the growth of the fruit-bodies.
Dispatch. Dictyostelium chemotaxis: fascism through the back door?
Insall, Robert
2003-04-29
Aggregating Dictyostelium cells secrete cyclic AMP to attract their neighbours by chemotaxis. It has now been shown that adenylyl cyclase is enriched in the rear of cells, and this localisation is required for normal aggregation.
Chemotaxis of Dictyostelium discoideum: Collective Oscillation of Cellular Contacts
Schäfer, Edith; Tarantola, Marco; Polo, Elena; Westendorf, Christian; Oikawa, Noriko; Bodenschatz, Eberhard; Geil, Burkhard; Janshoff, Andreas
2013-01-01
Chemotactic responses of Dictyostelium discoideum cells to periodic self-generated signals of extracellular cAMP comprise a large number of intricate morphological changes on different length scales. Here, we scrutinized chemotaxis of single Dictyostelium discoideum cells under conditions of starvation using a variety of optical, electrical and acoustic methods. Amebas were seeded on gold electrodes displaying impedance oscillations that were simultaneously analyzed by optical video microscopy to relate synchronous changes in cell density, morphology, and distance from the surface to the transient impedance signal. We found that starved amebas periodically reduce their overall distance from the surface producing a larger impedance and higher total fluorescence intensity in total internal reflection fluorescence microscopy. Therefore, we propose that the dominant sources of the observed impedance oscillations observed on electric cell-substrate impedance sensing electrodes are periodic changes of the overall cell-substrate distance of a cell. These synchronous changes of the cell-electrode distance were also observed in the oscillating signal of acoustic resonators covered with amebas. We also found that periodic cell-cell aggregation into transient clusters correlates with changes in the cell-substrate distance and might also contribute to the impedance signal. It turned out that cell-cell contacts as well as cell-substrate contacts form synchronously during chemotaxis of Dictyostelium discoideum cells. PMID:23349816
Whitney, T J; Gardner, D G; Mott, M L; Brandon, M
2010-03-09
The unusual life cycle of Dictyostelium discoideum, in which an extra-cellular stressor such as starvation induces the development of a multicellular fruiting body consisting of stalk cells and spores from a culture of identical amoebae, provides an excellent model for investigating the molecular control of differentiation and the transition from single- to multi-cellular life, a key transition in development. We utilized serial analysis of gene expression (SAGE), a molecular method that is unbiased by dependence on previously identified genes, to obtain a transcriptome from a high-density culture of amoebae, in order to examine the transition to multi-cellular development. The SAGE method provides relative expression levels, which allows us to rank order the expressed genes. We found that a large number of ribosomal proteins were expressed at high levels, while various components of the proteosome were expressed at low levels. The only identifiable transmembrane signaling system components expressed in amoebae are related to quorum sensing, and their expression levels were relatively low. The most highly expressed gene in the amoeba transcriptome, dutA untranslated RNA, is a molecule with unknown function that may serve as an inhibitor of translation. These results suggest that high-density amoebae have not initiated development, and they also suggest a mechanism by which the transition into the development program is controlled.
Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue.
Kawata, Takefumi; Hirano, Tatsunori; Ogasawara, Shun; Aoshima, Ryota; Yachi, Ayako
2011-09-01
Several mammalian protein families inhibit the activity of signal transducer and activator of transcription (STAT) proteins. The protein inhibitor of activated STAT (PIAS) was initially identified through its ability to interact with human STAT proteins. We isolated a gene (pisA) encoding a Dictyostelium orthologue of PIAS, Dd-PIAS, which possesses almost all the representative motifs and domains of mammalian PIAS proteins. A Dd-PIAS null mutant strain displays a normal terminal morphology but with accelerated development once cells are aggregated. In contrast, Dd-PIAS overexpressor strains demonstrate delayed aggregation, almost no slug phototaxis, impaired slug motility, and a prolonged slug migration period. This strain is a near phenocopy of the Dd-STATa null mutant, although it eventually forms a fruiting body, albeit inefficiently. The expression of several Dd-STATa-activated genes is upregulated in the Dd-PIAS null mutant and there is ectopic expression of pstAB makers. The concentration of a PIAS-green fluorescent protein (GFP) fusion protein, expressed under the PIAS promoter, is greatest in the pstO cells and gradually decreases with proximity to the tip of the slug and culminant: a pattern diametrically opposite to that of Dd-STATa. Our results suggest a functional interrelationship between Dd-PIAS and Dd-STATa that influences gene expression and development. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.
Liu, Lin
2013-03-01
Dynamics of lipid bodies and plastids in chili pepper fruits during ripening were investigated by means of transmission electron microscopy. Mesocarp of chili pepper fruits consists of collenchyma, normal parenchyma, and huge celled parenchyma. In mature green fruits, plastids contain numerous thylakoids that are well organized into grana in collenchyma, a strikingly huge amount of starch and irregularly organized thylakoids in normal parenchyma, and simple tubes rather than thylakoids in huge celled parenchyma. These morphological features suggest that plastids are chloroplasts in collenchyma, chloroamyloplasts in normal parenchyma, proplastids in huge celled parenchyma. As fruits ripen to red, plastids in all cell types convert to chromoplasts and, concomitantly, lipid bodies accumulate in both cytoplasm and chromoplasts. Cytosolic lipid bodies are lined up in a regular layer adjacent to plasma membrane. The cytosolic lipid body consists of a core surrounded by a membrane. The core is comprised of a more electron-dense central part enclosed by a slightly less electron-dense peripheral layer. Plastidial lipid bodies in collenchyma, normal parenchyma, and endodermis initiate as plastoglobuli, which in turn convert to rod-like structures. Therefore, plastidial lipid bodies are more dynamic than cytosolic lipid bodies. Both cytosolic and plastidial lipid bodies contain rich unsaturated lipids. Copyright © 2012 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Hanely, Julia C.; Reinsch, Sigrid; Myers, Zachary A.; Freeman, John; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David G.
2014-01-01
The European Modular Cultivation System, EMCS, was developed by ESA for plant experiments. To expand the use of flight verified hardware for various model organisms, we performed ground experiments to determine whether ARC EMCS Seed Cassettes could be adapted for use with cellular slime mold for future space flight experiments. Dictyostelium is a cellular slime mold that can exist both as a single-celled independent organism and as a part of a multicellular colony which functions as a unit (pseudoplasmodium). Under certain stress conditions, individual amoebae will aggregate to form multicellular structures. Developmental pathways are very similar to those found in Eukaryotic organisms, making this a uniquely interesting organism for use in genetic studies. Dictyostelium has been used as a genetic model organism for prior space flight experiments. Due to the formation of spores that are resistant to unfavorable conditions such as desiccation, Dictyostelium is also a good candidate for use in the EMCS Seed Cassettes. The growth substratum in the cassettes is a gridded polyether sulfone (PES) membrane. A blotter beneath the PES membranes contains dried growth medium. The goals of this study were to (1) verify that Dictyostelium are capable of normal growth and development on PES membranes, (2) develop a method for dehydration of Dictyostelium spores with successful recovery and development after rehydration, and (3) successful mock rehydration experiments in cassettes. Our results show normal developmental progression in two strains of Dictyostelium discoideum on PES membranes with a bacterial food source. We have successfully performed a mock rehydration of spores with developmental progression from aggregation to slug formation, and production of morphologically normal spores within 9 days of rehydration. Our results indicate that experiments on the ISS using the slime mold, Dictyostelium discoideum could potentially be performed in the flight verified hardware of
Boersma, F G Hidde; Warmink, Jan A; Andreote, Fernando A; van Elsas, Jan Dirk
2009-04-01
The dense hyphal network directly underneath the fruiting bodies of ectomycorrhizal fungi might exert strong influences on the bacterial community of soil. Such fruiting bodies might serve as hot spots for bacterial activity, for instance by providing nutrients and colonization sites in soil. Here, we assessed the putative selection of specific members of the Sphingomonadaceae family at the bases of the fruiting bodies of the ectomycorrhizal fungi Laccaria proxima and Russula exalbicans in comparison to the adjacent bulk soil. To do so, we used a previously designed Sphingomonadaceae-specific PCR-denaturing gradient gel electrophoresis (DGGE) system and complemented this with analyses of sequences from a Sphingomonadaceae-specific clone library. The analyses showed clear selective effects of the fruiting bodies of both fungi on the Sphingomonadaceae community structures. The effect was especially prevalent with R. exalbicans. Strikingly, similar fungi sampled approximately 100 m apart showed similar DGGE patterns, while corresponding bulk soil-derived patterns differed from each other. However, the mycospheres of L. proxima and R. exalbicans still revealed divergent community structures, indicating that different fungi select for different members of the Sphingomonadaceae family. Excision of specific bands from the DGGE patterns, as well as analyses of the clone libraries generated from both habitats, revealed fruiting body-specific Sphingomonadaceae types. It further showed that major groups from the mycospheres of R. exalbicans and L. proxima did not cluster with known bacteria from the database, indicating new groups within the family of Sphingomonadaceae present in these environments.
Lu, Yuan-Ping; Chen, Ren-Liang; Long, Ying; Li, Xiao; Jiang, Yu-Ji; Xie, Bao-Gui
2016-01-01
Flammulina velutipes, one of the most popular mushroom species in the world, has been recognized as a useful model system to study the biochemical and physiological aspects of the formation and elongation of fruit body. However, few reports have been published on the regulation of fruiting body formation in F. velutipes at the molecular level. In this study, a jacalin-related lectin gene from F. velutipes was characterized. The phylogenetic tree revealed that Fv-JRL1 clustered with other basidiomycete jacalin-like lectins. Moreover, the transcriptional pattern of the Fv-JRL1 gene in different developmental stages of F. velutipes implied that Fv-JRL1 could be important for formation of fruit body. Additionally, RNA interference (RNAi) and overexpression analyses provided powerful evidence that the lectin gene Fv-JRL1 from F. velutipes plays important roles in fruiting body formation. PMID:27916794
Ghalaeh, Reihaneh Seyed; Gholi, Zahra; Bank, Sahar Saraf; Azadbakht, Leila
2012-01-01
Obesity is growing rapidly in our country. Nutrition is an important issue of obesity. The aim of this study was to determine the association between fruit and vegetable intake with the waist circumference and the body mass index (BMI) among young female university students. This cross-sectional study was conducted on 236 healthy female university students aged between 18 and 30 years old, who were selected randomly from the students of Isfahan University of Medical Sciences, Iran. A previously validated semi-quantitative food frequency questionnaire was used to assess the entire dietary component intake. Physical activity was assessed by daily recording of the physical activities. The prevalence of obesity, central adiposity and overweight was 1.7, 0.9 and 8.1%, respectively. The mean value of BMI and the waist circumference was 21.54 kg/m(2) and 70.37 cm, respectively. There was an inverse correlation between the fruit and vegetable intake and body weight (r = -0.1, P = 0.03) as well as BMI (r = -0.1, P = 0.04) and also there was an inverse correlation between the fruit intake and body weight (r = -0.1, P = 0.01) and BMI (r = -0.1, P = 0.01). There was no significant correlation between fruit and vegetable as well as fruit or vegetable separately with the waist circumference. There were significant correlations between fruit and also fruit and vegetable and body weight and BMI among female university students. There was no significant correlation between fruit and vegetable as well as fruit or vegetable separately with waist circumference.
Xie, Fan; Zhao, Lili
2018-01-01
Ganoderma lucidum is a medicinal mushroom that has been widely used in East Asia for the treatment of various diseases. The pharmacological activity of this fungus is primarily attributable to the polysaccharides and triterpenoids. In this study, to obtain the fruit bodies with improved content of active constituents, we examined the effect of salicylic acid (SA) and calcium ion on the biosynthesis of polysaccharides and triterpenoids by spraying the chemicals during the fruiting. To explore the underlying mechanisms for the variation, the transcripts of related genes involved in the polysaccharide and triterpenoid biosynthesis were measured. Results showed that Ca2+ had no effect on production of polysaccharides and triterpenoids, whereas SA increased triterpenoid content by 23.32%, compared to the control, but it had little influence on polysaccharide production. Interestingly, the combined induction increased polysaccharide and triterpenoid content by 9.02% and 13.61%, respectively, compared to the control. Under Ca2+ induction, the transcript of ugp gene in the polysaccharide biosynthetic pathway up-regulated in all three stages (mycelium, primordium, and fruit body), while pgm and gls gave no response in the mycelium and primordium stages, and up-regulated in the fruit body stage. Differently, six key triterpenoid biosynthetic genes including hmgr, hmgs, mvd, fps, sqs, and ls did not respond to the induction. In the case of SA and combined induction, pgm and ugp were up-regulated in all three stages, while gls showed an increased expression in the primordium stage and no response in other stages. The six triterpenoid biosynthetic genes were up-regulated in all three stages. The present study provides a useful approach to producing G. lucidum fruit bodies with high polysaccharide and triterpenoid content. This is important to the G. lucidum industry. PMID:29694432
Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.
Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M
1996-01-01
The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645
Ghalaeh, Reihaneh Seyed; Gholi, Zahra; Bank, Sahar Saraf; Azadbakht, Leila
2012-01-01
Background: Obesity is growing rapidly in our country. Nutrition is an important issue of obesity. The aim of this study was to determine the association between fruit and vegetable intake with the waist circumference and the body mass index (BMI) among young female university students. Materials and Methods: This cross-sectional study was conducted on 236 healthy female university students aged between 18 and 30 years old, who were selected randomly from the students of Isfahan University of Medical Sciences, Iran. A previously validated semi-quantitative food frequency questionnaire was used to assess the entire dietary component intake. Physical activity was assessed by daily recording of the physical activities. Findings: The prevalence of obesity, central adiposity and overweight was 1.7, 0.9 and 8.1%, respectively. The mean value of BMI and the waist circumference was 21.54 kg/m2 and 70.37 cm, respectively. There was an inverse correlation between the fruit and vegetable intake and body weight (r = -0.1, P = 0.03) as well as BMI (r = -0.1, P = 0.04) and also there was an inverse correlation between the fruit intake and body weight (r = -0.1, P = 0.01) and BMI (r = -0.1, P = 0.01). There was no significant correlation between fruit and vegetable as well as fruit or vegetable separately with the waist circumference. Conclusion: There were significant correlations between fruit and also fruit and vegetable and body weight and BMI among female university students. There was no significant correlation between fruit and vegetable as well as fruit or vegetable separately with waist circumference. PMID:23555132
The genome of the social amoeba Dictyostelium discoideum
Eichinger, L.; Pachebat, J.A.; Glöckner, G.; Rajandream, M.-A.; Sucgang, R.; Berriman, M.; Song, J.; Olsen, R.; Szafranski, K.; Xu, Q.; Tunggal, B.; Kummerfeld, S.; Madera, M.; Konfortov, B. A.; Rivero, F.; Bankier, A. T.; Lehmann, R.; Hamlin, N.; Davies, R.; Gaudet, P.; Fey, P.; Pilcher, K.; Chen, G.; Saunders, D.; Sodergren, E.; Davis, P.; Kerhornou, A.; Nie, X.; Hall, N.; Anjard, C.; Hemphill, L.; Bason, N.; Farbrother, P.; Desany, B.; Just, E.; Morio, T.; Rost, R.; Churcher, C.; Cooper, J.; Haydock, S.; van Driessche, N.; Cronin, A.; Goodhead, I.; Muzny, D.; Mourier, T.; Pain, A.; Lu, M.; Harper, D.; Lindsay, R.; Hauser, H.; James, K.; Quiles, M.; Babu, M. Madan; Saito, T.; Buchrieser, C.; Wardroper, A.; Felder, M.; Thangavelu, M.; Johnson, D.; Knights, A.; Loulseged, H.; Mungall, K.; Oliver, K.; Price, C.; Quail, M.A.; Urushihara, H.; Hernandez, J.; Rabbinowitsch, E.; Steffen, D.; Sanders, M.; Ma, J.; Kohara, Y.; Sharp, S.; Simmonds, M.; Spiegler, S.; Tivey, A.; Sugano, S.; White, B.; Walker, D.; Woodward, J.; Winckler, T.; Tanaka, Y.; Shaulsky, G.; Schleicher, M.; Weinstock, G.; Rosenthal, A.; Cox, E.C.; Chisholm, R. L.; Gibbs, R.; Loomis, W. F.; Platzer, M.; Kay, R. R.; Williams, J.; Dear, P. H.; Noegel, A. A.; Barrell, B.; Kuspa, A.
2005-01-01
The social amoebae are exceptional in their ability to alternate between unicellular and multicellular forms. Here we describe the genome of the best-studied member of this group, Dictyostelium discoideum. The gene-dense chromosomes encode ~12,500 predicted proteins, a high proportion of which have long repetitive amino acid tracts. There are many genes for polyketide synthases and ABC transporters, suggesting an extensive secondary metabolism for producing and exporting small molecules. The genome is rich in complex repeats, one class of which is clustered and may serve as centromeres. Partial copies of the extrachromosomal rDNA element are found at the ends of each chromosome, suggesting a novel telomere structure and the use of a common mechanism to maintain both the rDNA and chromosomal termini. A proteome-based phylogeny shows that the amoebozoa diverged from the animal/fungal lineage after the plant/animal split, but Dictyostelium appears to have retained more of the diversity of the ancestral genome than either of these two groups. PMID:15875012
Poloz, Yekaterina; Catalano, Andrew
2012-01-01
Bestatin methyl ester (BME) is an inhibitor of Zn2+-binding aminopeptidases that inhibits cell proliferation and induces apoptosis in normal and cancer cells. We have used Dictyostelium as a model organism to study the effects of BME. Only two Zn2+-binding aminopeptidases have been identified in Dictyostelium to date, puromycin-sensitive aminopeptidase A and B (PsaA and PsaB). PSA from other organisms is known to regulate cell division and differentiation. Here we show that PsaA is differentially expressed throughout growth and development of Dictyostelium, and its expression is regulated by developmental morphogens. We present evidence that BME specifically interacts with PsaA and inhibits its aminopeptidase activity. Treatment of cells with BME inhibited the rate of cell growth and the frequency of cell division in growing cells and inhibited spore cell differentiation during late development. Overexpression of PsaA-GFP (where GFP is green fluorescent protein) also inhibited spore cell differentiation but did not affect growth. Using chimeras, we have identified that nuclear versus cytoplasmic localization of PsaA affects the choice between stalk or spore cell differentiation pathway. Cells that overexpressed PsaA-GFP (primarily nuclear) differentiated into stalk cells, while cells that overexpressed PsaAΔNLS2-GFP (cytoplasmic) differentiated into spores. In conclusion, we have identified that BME inhibits cell growth, division, and differentiation in Dictyostelium likely through inhibition of PsaA. PMID:22345351
Dictyostelium discoideum mutants with temperature-sensitive defects in endocytosis
1994-01-01
We have isolated and characterized temperature-sensitive endocytosis mutants in Dictyostelium discoideum. Dictyostelium is an attractive model for genetic studies of endocytosis because of its high rates of endocytosis, its reliance on endocytosis for nutrient uptake, and tractable molecular genetics. Endocytosis-defective mutants were isolated by a fluorescence-activated cell sorting (FACS) as cells unable to take up a fluorescent marker. One temperature-sensitive mutant (indy1) was characterized in detail and found to exhibit a complete block in fluid phase endocytosis at the restrictive temperature, but normal rates of endocytosis at the permissive temperature. Likewise, a potential cell surface receptor that was rapidly internalized in wild-type cells and indy1 cells at the permissive temperature was poorly internalized in indy1 under restrictive conditions. Growth was also completely arrested at the restrictive temperature. The endocytosis block was rapidly induced upon shift to the restrictive temperature and reversed upon return to normal conditions. Inhibition of endocytosis was also specific, as other membrane-trafficking events such as phagocytosis, secretion of lysosomal enzymes, and contractile vacuole function were unaffected at the restrictive temperature. Because recycling and transport to late endocytic compartments were not affected, the site of the defect's action is probably at an early step in the endocytic pathway. Additionally, indy1 cells were unable to proceed through the normal development program at the restrictive temperature. Given the tight functional and growth phenotypes, the indy1 mutant provides an opportunity to isolate genes responsible for endocytosis in Dictyostelium by complementation cloning. PMID:7929583
DiSalvo, Susanne; Haselkorn, Tamara S.; Bashir, Usman; Jimenez, Daniela; Brock, Debra A.; Queller, David C.; Strassmann, Joan E.
2015-01-01
Symbiotic associations can allow an organism to acquire novel traits by accessing the genetic repertoire of its partner. In the Dictyostelium discoideum farming symbiosis, certain amoebas (termed “farmers”) stably associate with bacterial partners. Farmers can suffer a reproductive cost but also gain beneficial capabilities, such as carriage of bacterial food (proto-farming) and defense against competitors. Farming status previously has been attributed to amoeba genotype, but the role of bacterial partners in its induction has not been examined. Here, we explore the role of bacterial associates in the initiation, maintenance, and phenotypic effects of the farming symbiosis. We demonstrate that two clades of farmer-associated Burkholderia isolates colonize D. discoideum nonfarmers and infectiously endow them with farmer-like characteristics, indicating that Burkholderia symbionts are a major driver of the farming phenomenon. Under food-rich conditions, Burkholderia-colonized amoebas produce fewer spores than uncolonized counterparts, with the severity of this reduction being dependent on the Burkholderia colonizer. However, the induction of food carriage by Burkholderia colonization may be considered a conditionally adaptive trait because it can confer an advantage to the amoeba host when grown in food-limiting conditions. We observed Burkholderia inside and outside colonized D. discoideum spores after fruiting body formation; this observation, together with the ability of Burkholderia to colonize new amoebas, suggests a mixed mode of symbiont transmission. These results change our understanding of the D. discoideum farming symbiosis by establishing that the bacterial partner, Burkholderia, is an important causative agent of the farming phenomenon. PMID:26305954
DiSalvo, Susanne; Haselkorn, Tamara S; Bashir, Usman; Jimenez, Daniela; Brock, Debra A; Queller, David C; Strassmann, Joan E
2015-09-08
Symbiotic associations can allow an organism to acquire novel traits by accessing the genetic repertoire of its partner. In the Dictyostelium discoideum farming symbiosis, certain amoebas (termed "farmers") stably associate with bacterial partners. Farmers can suffer a reproductive cost but also gain beneficial capabilities, such as carriage of bacterial food (proto-farming) and defense against competitors. Farming status previously has been attributed to amoeba genotype, but the role of bacterial partners in its induction has not been examined. Here, we explore the role of bacterial associates in the initiation, maintenance, and phenotypic effects of the farming symbiosis. We demonstrate that two clades of farmer-associated Burkholderia isolates colonize D. discoideum nonfarmers and infectiously endow them with farmer-like characteristics, indicating that Burkholderia symbionts are a major driver of the farming phenomenon. Under food-rich conditions, Burkholderia-colonized amoebas produce fewer spores than uncolonized counterparts, with the severity of this reduction being dependent on the Burkholderia colonizer. However, the induction of food carriage by Burkholderia colonization may be considered a conditionally adaptive trait because it can confer an advantage to the amoeba host when grown in food-limiting conditions. We observed Burkholderia inside and outside colonized D. discoideum spores after fruiting body formation; this observation, together with the ability of Burkholderia to colonize new amoebas, suggests a mixed mode of symbiont transmission. These results change our understanding of the D. discoideum farming symbiosis by establishing that the bacterial partner, Burkholderia, is an important causative agent of the farming phenomenon.
Zhang, Jin-Jing; Chen, Hui; Xie, Min-Ying; Chen, Ming-Jie; Hao, Hai-Bo; Wang, Hong; Feng, Zhi-Yong
2017-01-01
To understand the fruiting process of Hypsizygus marmoreus, a synthetic liquid medium (SLM) was optimized to induce fruiting body initiation. Dependent on the SLM, the effect of a monofactor (glucose) on the fruiting bodies of H. marmoreus was studied at different concentrations (10 and 40 g/L). Primordia appeared approximately 10 days earlier in low-glucose media (LGM) than in high-glucose media (HGM), whereas mature fruiting bodies formed on mushrooms approximately 7 days earlier and more primordia developed into mature fruiting bodies when cultured in HGM. In addition, the morphogenesis of the primordia was clustered in HGM, which was different than what was observed in LGM. Furthermore, differentially expressed genes (DEGs) that encoded various proteins involved in cell structure, general metabolism, signal transduction, and transcription and translation were analyzed by transcriptome sequencing. Six DEGs were detected by quantitative reverse-transcriptase polymerase chain reaction, and the results were consistent with the altered patterns of gene expression revealed by the transcriptome. This study not only identifies new candidate genes involved in the development of H. marmoreus but also provides a new research platform for studying the development of other edible mushrooms.
Teichert, Ines; Lutomski, Miriam; Märker, Ramona; Nowrousian, Minou; Kück, Ulrich
2017-02-01
During the sexual life cycle of filamentous fungi, multicellular fruiting bodies are generated for the dispersal of spores. The filamentous ascomycete Sordaria macrospora has a long history as a model system for studying fruiting body formation, and two collections of sterile mutants have been generated. However, for most of these mutants, the underlying genetic defect remains unknown. Here, we investigated the mutant spadix (spd) that was generated by X-ray mutagenesis in the 1950s and terminates sexual development after the formation of pre-fruiting bodies (protoperithecia). We sequenced the spd genome and found a 22 kb deletion affecting four genes, which we termed spd1-4. Generation of deletion strains revealed that only spd4 is required for fruiting body formation. Although sterility in S. macrospora is often coupled with a vegetative hyphal fusion defect, Δspd4 was still capable of fusion. This feature distinguishes SPD4 from many other regulators of sexual development. Remarkably, GFP-tagged SPD4 accumulated in the nuclei of vegetative hyphae and fruiting body initials, the ascogonial coils, but not in sterile tissue from the developing protoperithecium. Our results point to SPD4 as a specific determinant of fruiting body formation. Research on SPD4 will, therefore, contribute to understanding cellular reprogramming during initiation of sexual development in fungi.
Gong, Wen-Bing; Li, Lei; Zhou, Yan; Bian, Yin-Bing; Kwan, Hoi-Shan; Cheung, Man-Kit; Xiao, Yang
2016-06-01
To provide a better understanding of the genetic architecture of fruiting body formation of Lentinula edodes, quantitative trait loci (QTLs) mapping was employed to uncover the loci underlying seven fruiting body-related traits (FBRTs). An improved L. edodes genetic linkage map, comprising 572 markers on 12 linkage groups with a total map length of 983.7 cM, was constructed by integrating 82 genomic sequence-based insertion-deletion (InDel) markers into a previously published map. We then detected a total of 62 QTLs for seven target traits across two segregating testcross populations, with individual QTLs contributing 5.5 %-30.2 % of the phenotypic variation. Fifty-three out of the 62 QTLs were clustered in six QTL hotspots, suggesting the existence of main genomic regions regulating the morphological characteristics of fruiting bodies in L. edodes. A stable QTL hotspot on MLG2, containing QTLs for all investigated traits, was identified in both testcross populations. QTLs for related traits were frequently co-located on the linkage groups, demonstrating the genetic basis for phenotypic correlation of traits. Meta-QTL (mQTL) analysis was performed and identified 16 mQTLs with refined positions and narrow confidence intervals (CIs). Nine genes, including those encoding MAP kinase, blue-light photoreceptor, riboflavin-aldehyde-forming enzyme and cyclopropane-fatty-acyl-phospholipid synthase, and cytochrome P450s, were likely to be candidate genes controlling the shape of fruiting bodies. The study has improved our understanding of the genetic architecture of fruiting body formation in L. edodes. To our knowledge, this is the first genome-wide QTL detection of FBRTs in L. edodes. The improved genetic map, InDel markers and QTL hotspot regions revealed here will assist considerably in the conduct of future genetic and breeding studies of L. edodes.
Input-output relationship in galvanotactic response of Dictyostelium cells.
Sato, Masayuki J; Ueda, Michihito; Takagi, Hiroaki; Watanabe, Tomonobu M; Yanagida, Toshio; Ueda, Masahiro
2007-04-01
Under a direct current electric field, Dictyostelium cells exhibit migration towards the cathode. To determine the input-output relationship of the cell's galvanotactic response, we developed an experimental instrument in which electric signals applied to the cells are highly reproducible and the motile response are analyzed quantitatively. With no electric field, the cells moved randomly in all directions. Upon applying an electric field, cell migration speeds became about 1.3 times faster than those in the absence of an electric field. Such kinetic effects of electric fields on the migration were observed for cells stimulated between 0.25 and 10 V/cm of the field strength. The directions of cell migrations were biased toward the cathode in a positive manner with field strength, showing galvanotactic response in a dose-dependent manner. Quantitative analysis of the relationship between field strengths and directional movements revealed that the biased movements of the cells depend on the square of electric field strength, which can be described by one simple phenomenological equation. The threshold strength for the galvanotaxis was between 0.25 and 1 V/cm. Galvanotactic efficiency reached to half-maximum at 2.6 V/cm, which corresponds to an approximate 8 mV voltage difference between the cathode and anode direction of 10 microm wide, round cells. Based on these results, possible mechanisms of galvanotaxis in Dictyostelium cells were discussed. This development of experimental system, together with its good microscopic accessibility for intracellular signaling molecules, makes Dictyostelium cells attractive as a model organism for elucidating stochastic processes in the signaling systems responsible for cell motility and its regulations.
Dictyostelium cell death: early emergence and demise of highly polarized paddle cells.
Levraud, Jean-Pierre; Adam, Myriam; Luciani, Marie-Françoise; de Chastellier, Chantal; Blanton, Richard L; Golstein, Pierre
2003-03-31
Cell death in the stalk of Dictyostelium discoideum, a prototypic vacuolar cell death, can be studied in vitro using cells differentiating as a monolayer. To identify early events, we examined potentially dying cells at a time when the classical signs of Dictyostelium cell death, such as heavy vacuolization and membrane lesions, were not yet apparent. We observed that most cells proceeded through a stereotyped series of differentiation stages, including the emergence of "paddle" cells showing high motility and strikingly marked subcellular compartmentalization with actin segregation. Paddle cell emergence and subsequent demise with paddle-to-round cell transition may be critical to the cell death process, as they were contemporary with irreversibility assessed through time-lapse videos and clonogenicity tests. Paddle cell demise was not related to formation of the cellulose shell because cells where the cellulose-synthase gene had been inactivated underwent death indistinguishable from that of parental cells. A major subcellular alteration at the paddle-to-round cell transition was the disappearance of F-actin. The Dictyostelium vacuolar cell death pathway thus does not require cellulose synthesis and includes early actin rearrangements (F-actin segregation, then depolymerization), contemporary with irreversibility, corresponding to the emergence and demise of highly polarized paddle cells.
Hirose, Shigenori; Santhanam, Balaji; Katoh-Kurosawa, Mariko; Shaulsky, Gad; Kuspa, Adam
2015-01-01
The social amoeba Dictyostelium discoideum integrates into a multicellular organism when individual starving cells aggregate and form a mound. The cells then integrate into defined tissues and develop into a fruiting body that consists of a stalk and spores. Aggregation is initially orchestrated by waves of extracellular cyclic adenosine monophosphate (cAMP), and previous theory suggested that cAMP and other field-wide diffusible signals mediate tissue integration and terminal differentiation as well. Cooperation between cells depends on an allorecognition system comprising the polymorphic adhesion proteins TgrB1 and TgrC1. Binding between compatible TgrB1 and TgrC1 variants ensures that non-matching cells segregate into distinct aggregates prior to terminal development. Here, we have embedded a small number of cells with incompatible allotypes within fields of developing cells with compatible allotypes. We found that compatibility of the allotype encoded by the tgrB1 and tgrC1 genes is required for tissue integration, as manifested in cell polarization, coordinated movement and differentiation into prestalk and prespore cells. Our results show that the molecules that mediate allorecognition in D. discoideum also control the integration of individual cells into a unified developing organism, and this acts as a gating step for multicellularity. PMID:26395484
Phase separation like dynamics during Myxococcus xanthus fruiting body formation
NASA Astrophysics Data System (ADS)
Liu, Guannan; Thutupalli, Shashi; Wigbers, Manon; Shaevitz, Joshua
2015-03-01
Collective motion exists in many living organisms as an advantageous strategy to help the entire group with predation, forage, and survival. However, the principles of self-organization underlying such collective motions remain unclear. During various developmental stages of the soil-dwelling bacterium, Myxococcus xanthus, different types of collective motions are observed. In particular, when starved, M. xanthus cells eventually aggregate together to form 3-dimensional structures (fruiting bodies), inside which cells sporulate in response to the stress. We study the fruiting body formation process as an out of equilibrium phase separation process. As local cell density increases, the dynamics of the aggregation M. xanthus cells switch from a spatio-temporally random process, resembling nucleation and growth, to an emergent pattern formation process similar to a spinodal decomposition. By employing high-resolution microscopy and a video analysis system, we are able to track the motion of single cells within motile collective groups, while separately tuning local cell density, cell velocity and reversal frequency, probing the multi-dimensional phase space of M. xanthus development.
A secreted protein is an endogenous chemorepellant in Dictyostelium discoideum
Phillips, Jonathan E.; Gomer, Richard H.
2012-01-01
Chemorepellants may play multiple roles in physiological and pathological processes. However, few endogenous chemorepellants have been identified, and how they function is unclear. We found that the autocrine signal AprA, which is produced by growing Dictyostelium discoideum cells and inhibits their proliferation, also functions as a chemorepellant. Wild-type cells at the edge of a colony show directed movement outward from the colony, whereas cells lacking AprA do not. Cells show directed movement away from a source of recombinant AprA and dialyzed conditioned media from wild-type cells, but not dialyzed conditioned media from aprA− cells. The secreted protein CfaD, the G protein Gα8, and the kinase QkgA are necessary for the chemorepellant activity of AprA as well as its proliferation-inhibiting activity, whereas the putative transcription factor BzpN is dispensable for the chemorepellant activity of AprA but necessary for inhibition of proliferation. Phospholipase C and PI3 kinases 1 and 2, which are necessary for the activity of at least one other chemorepellant in Dictyostelium, are not necessary for recombinant AprA chemorepellant activity. Starved cells are not repelled by recombinant AprA, suggesting that aggregation-phase cells are not sensitive to the chemorepellant effect. Cell tracking indicates that AprA affects the directional bias of cell movement, but not cell velocity or the persistence of cell movement. Together, our data indicate that the endogenous signal AprA acts as an autocrine chemorepellant for Dictyostelium cells. PMID:22711818
Requirements for Hirano Body Formation
Griffin, Paul; Piggott, Cleveland; Maselli, Andrew; Fechheimer, Marcus
2014-01-01
Hirano bodies are paracrystalline F-actin-rich structures associated with diverse conditions, including neurodegeneration and aging. Generation of model Hirano bodies using altered forms of Dictyostelium 34-kDa actin-bundling protein allows studies of their physiological function and mechanism of formation. We describe a novel 34-kDa protein mutant, E60K, with a point mutation within the inhibitory domain of the 34-kDa protein. Expression of E60K in Dictyostelium induces the formation of model Hirano bodies. The E60K protein has activated actin binding and is calcium regulated, unlike other forms of the 34-kDa protein that induce Hirano bodies and that have activated actin binding but lack calcium regulation. Actin filaments in the presence of E60K in vitro show enhanced resistance to disassembly induced by latrunculin B. Actin filaments in model Hirano bodies are also protected from latrunculin-induced depolymerization. We used nocodazole and blebbistatin to probe the role of the microtubules and myosin II, respectively, in the formation of model Hirano bodies. In the presence of these inhibitors, model Hirano bodies can form but are smaller than controls at early times of formation. The ultrastructure of model Hirano bodies did not reveal any major difference in structure and organization in the presence of inhibitors. In summary, these results support the conclusion that formation of model Hirano bodies is promoted by gain-of-function actin filament bundling, which enhances actin filament stabilization. Microtubules and myosin II contribute to but are not required for formation of model Hirano bodies. PMID:24632241
Strand-Specific RNA-Seq Analyses of Fruiting Body Development in Coprinopsis cinerea
Muraguchi, Hajime; Umezawa, Kiwamu; Niikura, Mai; ...
2015-10-28
We report that the basidiomycete fungus Coprinopsis cinerea is an important model system for multicellular development. Fruiting bodies of C. cinerea are typical mushrooms, which can be produced synchronously on defined media in the laboratory. To investigate the transcriptome in detail during fruiting body development, high-throughput sequencing (RNA-seq) was performed using cDNA libraries strand-specifically constructed from 13 points (stages/tissues) with two biological replicates. The reads were aligned to 14,245 predicted transcripts, and counted for forward and reverse transcripts. Differentially expressed genes (DEGs) between two adjacent points and between vegetative mycelium and each point were detected by Tag Count Comparison (TCC).more » To validate RNA-seq data, expression levels of selected genes were compared using RPKM values in RNA-seq data and qRT-PCR data, and DEGs detected in microarray data were examined in MA plots of RNA-seq data by TCC. We discuss events deduced from GO analysis of DEGs. In addition, we uncovered both transcription factor candidates and antisense transcripts that are likely to be involved in developmental regulation for fruiting.« less
Strand-Specific RNA-Seq Analyses of Fruiting Body Development in Coprinopsis cinerea
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muraguchi, Hajime; Umezawa, Kiwamu; Niikura, Mai
We report that the basidiomycete fungus Coprinopsis cinerea is an important model system for multicellular development. Fruiting bodies of C. cinerea are typical mushrooms, which can be produced synchronously on defined media in the laboratory. To investigate the transcriptome in detail during fruiting body development, high-throughput sequencing (RNA-seq) was performed using cDNA libraries strand-specifically constructed from 13 points (stages/tissues) with two biological replicates. The reads were aligned to 14,245 predicted transcripts, and counted for forward and reverse transcripts. Differentially expressed genes (DEGs) between two adjacent points and between vegetative mycelium and each point were detected by Tag Count Comparison (TCC).more » To validate RNA-seq data, expression levels of selected genes were compared using RPKM values in RNA-seq data and qRT-PCR data, and DEGs detected in microarray data were examined in MA plots of RNA-seq data by TCC. We discuss events deduced from GO analysis of DEGs. In addition, we uncovered both transcription factor candidates and antisense transcripts that are likely to be involved in developmental regulation for fruiting.« less
Stajdohar, Miha; Rosengarten, Rafael D; Kokosar, Janez; Jeran, Luka; Blenkus, Domen; Shaulsky, Gad; Zupan, Blaz
2017-06-02
Dictyostelium discoideum, a soil-dwelling social amoeba, is a model for the study of numerous biological processes. Research in the field has benefited mightily from the adoption of next-generation sequencing for genomics and transcriptomics. Dictyostelium biologists now face the widespread challenges of analyzing and exploring high dimensional data sets to generate hypotheses and discovering novel insights. We present dictyExpress (2.0), a web application designed for exploratory analysis of gene expression data, as well as data from related experiments such as Chromatin Immunoprecipitation sequencing (ChIP-Seq). The application features visualization modules that include time course expression profiles, clustering, gene ontology enrichment analysis, differential expression analysis and comparison of experiments. All visualizations are interactive and interconnected, such that the selection of genes in one module propagates instantly to visualizations in other modules. dictyExpress currently stores the data from over 800 Dictyostelium experiments and is embedded within a general-purpose software framework for management of next-generation sequencing data. dictyExpress allows users to explore their data in a broader context by reciprocal linking with dictyBase-a repository of Dictyostelium genomic data. In addition, we introduce a companion application called GenBoard, an intuitive graphic user interface for data management and bioinformatics analysis. dictyExpress and GenBoard enable broad adoption of next generation sequencing based inquiries by the Dictyostelium research community. Labs without the means to undertake deep sequencing projects can mine the data available to the public. The entire information flow, from raw sequence data to hypothesis testing, can be accomplished in an efficient workspace. The software framework is generalizable and represents a useful approach for any research community. To encourage more wide usage, the backend is open
Huber, Robert J
2016-11-24
Neuronal ceroid lipofuscinosis (NCL), also known as Batten disease, is a debilitating neurological disorder that affects both children and adults. Thirteen genetically distinct genes have been identified that when mutated, result in abnormal lysosomal function and an excessive accumulation of ceroid lipofuscin in neurons, as well as other cell types outside of the central nervous system. The NCL family of proteins is comprised of lysosomal enzymes (PPT1/CLN1, TPP1/CLN2, CTSD/CLN10, CTSF/CLN13), proteins that peripherally associate with membranes (DNAJC5/CLN4, KCTD7/CLN14), a soluble lysosomal protein (CLN5), a protein present in the secretory pathway (PGRN/CLN11), and several proteins that display different subcellular localizations (CLN3, CLN6, MFSD8/CLN7, CLN8, ATP13A2/CLN12). Unfortunately, the precise functions of many of the NCL proteins are still unclear, which has made targeted therapy development challenging. The social amoeba Dictyostelium discoideum has emerged as an excellent model system for studying the normal functions of proteins linked to human neurological disorders. Intriguingly, the genome of this eukaryotic soil microbe encodes homologs of 11 of the 13 known genes linked to NCL. The genetic tractability of the organism, combined with its unique life cycle, makes Dictyostelium an attractive model system for studying the functions of NCL proteins. Moreover, the ability of human NCL proteins to rescue gene-deficiency phenotypes in Dictyostelium suggests that the biological pathways regulating NCL protein function are likely conserved from Dictyostelium to human. In this review, I will discuss each of the NCL homologs in Dictyostelium in turn and describe how future studies can exploit the advantages of the system by testing new hypotheses that may ultimately lead to effective therapy options for this devastating and currently untreatable neurological disorder.
[Study on variation of main ingredients from spores and fruiting bodies of Ganoderma lucidum].
Li, Jing-Jing; Hu, Xiao-Qin; Zhang, Xin-Feng; Liu, Jing-Jing; Cao, Long-Shu
2014-11-01
To reveal the quality variation of polysaccharides, triterpenoids and proteins in spores and fruiting bodies of Ganoderma lucidum from producing areas, different varieties, harvesting parts and periods, and wall-breaking treatments. Spores and fruiting bodies from varieties of Longzhi No. 1 and Hunong No. 1 were collected as test samples, together with wall-broken spores sold in domestic main producing areas. The anthrone-sulfuric acid colorimetric method was used to determine the content of total polysaccharides. The vanillin-glacial acetic acid-perchloric acid colorimetric method was used to determine the content of total triterpenoids. The Lowry method was used to determine the content of total proteins. The content ranges of total polysaccharides, total triterpenoids, and total proteins from 6 domestic main producing areas were 0.40% - 2.25%, 1.36%-3.15% and 0.74% -1.91% respectively. The content ranges of total polysaccharides, triterpenoids, and proteins in the fruiting bodies from 2 varieties cultured in Zhejiang were 0.25% -1.42%, 0.44% -1.42% and 1.82% -3.67% respectively. In addition, the ranges of samples from wall-unbroken spores were 0.41% - 0.91%, 0.09% - 0.12%, 0.78% - 0.90% respectively and wall-broken spores are 1.03% - 2.25%, 1.89% - 3.15%, 0.96% - 1.04% respectively. There are significant differences in the contents of main chemical ingredients of wall-broken G. lucidum spores saled in the markets. The samples from Zhejiang contain high content of total polysaccharides and triterpenoids, and samples from Fujian contains more proteins. Between the 2 major varieties cultured in Zhejiang, Longzhi No. 1 contains higher content of triterpenoids, but Hunong No. 1 has more polysaccharides. Contents of triterpenoids and polysaccharides from wall-broken spores are much higher than those of fruiting bodies. The stipes from fruiting bodies contains more polysaccharides than those of the pileus, while the triterpenoids contents are higher in the pileus than
Meroterpenoids from the fruiting bodies of Ganoderma theaecolum.
Luo, Qi; Tu, Zheng-Chao; Yang, Zhu-Liang; Cheng, Yong-Xian
2018-03-01
A series of new terminal cyclohexane-type meroterpenoids, ganotheaecoloids A-N (1-6, 8-13, 15, and 16), along with three known ones (7, 14, and 17), were isolated from the dried fruiting bodies of Ganoderma theaecolum. Their chemical structures were identified by using spectroscopic data and computational methods. Biological activity of all the new meroterpenoids against COX-2 was evaluated in vitro, only ganotheaecoloid J (11) was found to have COX-2 inhibitory activity with IC 50 value of 9.96μM. Copyright © 2018 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Nguyen, Hoang Chinh; Thi, Dinh Huynh Mong; Pham, Dinh Chuong
2018-04-01
Polysaccharides from fruiting body of Cordyceps militaris (L.) Link possess various pharmaceutical activities. In this study, polysaccharides from the fruiting body of C. militaris were extracted with different solvents. Of those solvents tested, distilled water was identified as the most efficient solvent for the extraction, resulting in a significant increase in polysaccharides yield. Response surface methodology was then used to optimize the extraction conditions and establish a reliable mathematical model for prediction. A maximum polysaccharides yield of 11.07% was reached at a ratio of water to raw material of 23.2:1 mL/g, an extraction time of 76 min, and a temperature of 93.6°C. This study indicates that the obtained optimal extraction conditions are an efficient method for extraction of polysaccharides from the fruiting body of C. militaris.
1989-01-01
A severin deficient mutant of Dictyostelium discoideum has been isolated by the use of colony immunoblotting after chemical mutagenesis. In homogenates of wild-type cells, severin is easily detected as a very active F-actin fragmenting protein. Tests for severin in the mutant, HG1132, included viscometry for the assay of F- actin fragmentation in fractions from DEAE-cellulose columns, labeling of blots with monoclonal and polyclonal antibodies, and immunofluorescent-labeling of cryosections. Severin could not be detected in the mutant using these methods. The mutation in HG1132 is recessive and has been mapped to linkage group VII. The mutant failed to produce the normal severin mRNA, but small amounts of a transcript that was approximately 100 bases larger than the wild-type mRNA were detected in the mutant throughout all stages of development. On the DNA level a new Mbo II restriction site was found in the mutant within the coding region of the severin gene. The severin deficient mutant cells grew at an approximately normal rate, aggregated and formed fruiting bodies with viable spores. By the use of an image processing system, speed of cell movement, turning rates, and precision of chemotactic orientation in a stable gradient of cyclic AMP were quantitated, and no significant differences between wild-type and mutant cells were found. Thus, under the culture conditions used, severin proved to be neither essential for growth of D. discoideum nor for any cell function that is important for aggregation or later development. PMID:2537840
Two new isobenzofuranone derivatives from the fruiting bodies of Hericium erinaceus.
Li, Jing; Wang, Xu-Li; Li, Guang; Xu, Ping-Sheng; Xu, Kang-Ping; Tan, Gui-Shan
2017-11-01
Two new isobenzofuranone derivatives erinaceolactones G and H (1 and 2) were isolated from the ethanolic extract of fruiting bodies of Hericium erinaceus. Their structures were characterized on the basis of spectroscopic evidences. Compound 2 was suggested to be racemic by specific rotation, which was resolved by chiral HPLC into enantiomers.
Lee, Wi Young; Ahn, Jin Kwon; Ka, Kang-Hyeon
2009-01-01
The levels of ergothioneine (ERG), which have been shown to act as an excellent antioxidant, were determined in both fruiting bodies and mycelia of various mushroom species. We found that ERG accumulated at different levels in fruiting bodies of mushrooms and showed up to a 92.3-fold difference between mushrooms. We also found that ERG accumulated at higher levels in mycelia than in fruiting bodies of economically important mushroom species such as Ganoderma neo-japonicum, G. applanatum and Paecilomyces tenuipes. The addition of 2 mM methionine (Met) to mycelial culture medium increased the ERG contents in most mushroom species tested, indicating that Met is a good additive to enhance the ERG levels in a variety of mushroom species. Taking these results into consideration, we suggest that the addition of Met to the mycelial culture medium is an efficient way to enhance the antioxidant properties in economically important mushroom species. PMID:23983506
Chen, Hui; Zhao, Mingwen; Shi, Liang; Chen, Mingjie; Wang, Hong; Feng, Zhiyong
2015-01-01
To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M), mycelial pigmentation (H-V), primordium (H-P) and fruiting body (H-F) stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06%) unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG), Gene Ontology (GO), and Eukaryotic Orthologous Group (KOG) databases. Differentially expressed genes (DEGs) from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis. PMID:25837428
Lin, Qunying; Long, Liangkun; Wu, Liangliang; Zhang, Fenglun; Wu, Shuling; Zhang, Weiming; Sun, Xiaoming
2017-08-01
In commercial production of Cordyceps militaris (a famous Chinese medicine), cereal grains are usually utilized as cultivation substrates. This study aimed to evaluate the efficiency of agricultural wastes as substitute materials in the low-cost production of C. militaris. Cottonseed shells (CS), corn cob particles (CCP), Italian poplar sawdusts (IPS) and substrates spent by Flammulina velutipes (SS) were employed to cultivate C. militaris, using rice medium as control. CS and CCP were suitable for fruit body formation of C. militaris, with yields of 22 and 20 g per bottle respectively. Fruit bodies grown on CCP showed the highest levels of cordycepin and adenosine, up to 9.45 and 5.86 mg g -1 respectively. The content of d-mannitol in fruit bodies obtained on CS was 120 mg g -1 (80% of the control group), followed by that on CCP, 100 mg g -1 . Fruit bodies cultivated on CCP displayed a high crude polysaccharide level of 26.9 mg g -1 , which was the closest to that of the control group (34.5 mg g -1 ). CS and CCP are effective substrates for the production of fruit bodies and bioactive compounds by C. militaris. This study provides a new approach to decreasing the cost of C. militaris cultivation and dealing with these agricultural wastes. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Dictyostelium discoideum mutants with conditional defects in phagocytosis
1994-01-01
We have isolated and characterized Dictyostelium discoideum mutants with conditional defects in phagocytosis. Under suspension conditions, the mutants exhibited dramatic reductions in the uptake of bacteria and polystyrene latex beads. The initial binding of these ligands was unaffected, however, indicating that the defect was not in a plasma membrane receptor: Because of the phagocytosis defect, the mutants were unable to grow when cultured in suspensions of heat-killed bacteria. The mutants exhibited normal capacities for fluid phase endocytosis and grew as rapidly as parental (AX4) cells in axenic medium. Both the defects in phagocytosis and growth on bacteria were corrected when the mutant Dictyostelium cells were cultured on solid substrates. Reversion and genetic complementation analysis suggested that the mutant phenotypes were caused by single gene defects. While the precise site of action of the mutations was not established, the mutations are likely to affect an early signaling event because the binding of bacteria to mutant cells in suspension was unable to trigger the localized polymerization of actin filaments required for ingestion; other aspects of actin function appeared normal. This class of conditional phagocytosis mutant should prove to be useful for the expression cloning of the affected gene(s). PMID:7519624
2013-01-01
Background The transition from the vegetative mycelium to the primordium during fruiting body development is the most complex and critical developmental event in the life cycle of many basidiomycete fungi. Understanding the molecular mechanisms underlying this process has long been a goal of research on basidiomycetes. Large scale assessment of the expressed transcriptomes of these developmental stages will facilitate the generation of a more comprehensive picture of the mushroom fruiting process. In this study, we coupled 5'-Serial Analysis of Gene Expression (5'-SAGE) to high-throughput pyrosequencing from 454 Life Sciences to analyze the transcriptomes and identify up-regulated genes among vegetative mycelium (Myc) and stage 1 primordium (S1-Pri) of Coprinopsis cinerea during fruiting body development. Results We evaluated the expression of >3,000 genes in the two respective growth stages and discovered that almost one-third of these genes were preferentially expressed in either stage. This identified a significant turnover of the transcriptome during the course of fruiting body development. Additionally, we annotated more than 79,000 transcription start sites (TSSs) based on the transcriptomes of the mycelium and stage 1 primoridum stages. Patterns of enrichment based on gene annotations from the GO and KEGG databases indicated that various structural and functional protein families were uniquely employed in either stage and that during primordial growth, cellular metabolism is highly up-regulated. Various signaling pathways such as the cAMP-PKA, MAPK and TOR pathways were also identified as up-regulated, consistent with the model that sensing of nutrient levels and the environment are important in this developmental transition. More than 100 up-regulated genes were also found to be unique to mushroom forming basidiomycetes, highlighting the novelty of fruiting body development in the fungal kingdom. Conclusions We implicated a wealth of new candidate genes
Mendoza, Guillermo; Suárez-Medellín, Jorge; Espinoza, César; Ramos-Ligonio, Angel; Fernández, José J; Norte, Manuel; Trigos, Ángel
2015-01-01
Various species of the genus Ganoderma have been used for centuries according to oriental tradition as a source of medicines and nutrients. A chemical study of the fruiting bodies and mycelial culture of G. oerstedii was carried out with the idea of isolating and characterizing active natural components present to make use of their potential pharmaceutical application in Mexico. The fruiting bodies and mycelial culture of G. oesrtedii were lyophylized and extracted one after the other with hexane, chloroform, and methanol. Following this process, each substance was extracted separately by using column chromatography. From fruiting bodies eight metabolites, five sterols (ergosta-7,22-dien-3β-ol, ergosterol peroxide, ergosterol, cerevisterol, and ergosta-7,22-dien-3-one) as well as three terpene compounds (ganodermanondiol, ganoderic acid Sz, and ganoderitriol M) were obtained from fruiting bodies. From the mycelial culture three metabolites, two sterols (ergosterol and cerevisterol), and a new terpene compound (ganoderic acetate from the acid) were obtained. These structures were established based on a spectroscopic analysis mainly using nuclear magnetic resonance and a comparison with data already established.
Gabriel, Jiří; Švec, Karel; Kolihová, Dana; Tlustoš, Pavel; Száková, Jiřina
2016-03-01
The cultivation and fructification of 15 saprotrophic and wood-rotting fungal strains were tested on three various semi-natural medium. The formation of fruit bodies was observed for Panellus stipticus, Psilocybe cubensis, Schizophyllum commune and Stropharia rugosoannulata in the frame of 1-2 months. Mercury translocation from the substrate to the fruit bodies was then followed in oat flakes medium. Translocation was followed for treatments of 0, 1.25, 2.5, 5, 10 and 20ppm Hg in the substrate. All four fungi formed fruit bodies in almost all replicates. The fruit body yield varied from 0.5 to 15.3g dry weight. The highest bioconcentration factor (BCF) of 2.99 was found for P. cubensis at 1.25ppm Hg. The BCF decreased with increasing Hg concentration in the substrate: 2.49, 0, 2.38, 1.71 and 1.82 for P. stipticus; 3.00, 2.78, 2.48, 1.81 and 2.15 for P. cubensis; 2.47, 1.81, 1.78, 1.07 and 0.96 for S. commune; and 1.96, 1.84, 1.21, 1.71 and 0.96 for S. rugosoannulata. The Hg contents in the fruit bodies reflected the Hg contents in the substrate; the highest contents in the fruit bodies were found in P. cubensis (43.08±7.36ppm Hg) and P. stipticus (36.42±3.39ppm). Copyright © 2015 Elsevier Inc. All rights reserved.
Functional Properties of Five Dictyostelium discoideum P2X Receptors*
Baines, Abigail; Parkinson, Katie; Sim, Joan A.; Bragg, Laricia; Thompson, Christopher R. L.; North, R. Alan
2013-01-01
The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors. PMID:23740252
Functional properties of five Dictyostelium discoideum P2X receptors.
Baines, Abigail; Parkinson, Katie; Sim, Joan A; Bragg, Laricia; Thompson, Christopher R L; North, R Alan
2013-07-19
The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors.
Self-organized Motion During Dictyostelium amoebae aggregation
NASA Astrophysics Data System (ADS)
Levine, Herbert
2004-03-01
After starvation, amoeba of the cellular slime mold Dictyostelium discoideum aggregate to form rudimentary multicellular organisms. The coordination of the individual motions of hundreds of thousands of individual cells is an important ingredient in the success of this process. This coordination is accomplished by chemical signaling during the early stages and by direct cell-cell interactions once the cells reach the nascent mound. This talk will review the basic nonequilibrium physics underlying the spatial patterns formed by these cooperative motions, including high-density incoming streams and spontaneously rotating mounds.
Knecht, David A.; Silale, Augustinas; Traynor, David; Williams, Thomas D.; Thomason, Peter A.; Insall, Robert H.; Chubb, Jonathan R.; Kay, Robert R.; Veltman, Douwe M.
2018-01-01
Dictyostelium has a mature technology for molecular-genetic manipulation based around transfection using several different selectable markers, marker re-cycling, homologous recombination and insertional mutagenesis, all supported by a well-annotated genome. However this technology is optimized for mutant, axenic cells that, unlike non-axenic wild type, can grow in liquid medium. There is a pressing need for methods to manipulate wild type cells and ones with defects in macropinocytosis, neither of which can grow in liquid media. Here we present a panel of molecular genetic techniques based on the selection of Dictyostelium transfectants by growth on bacteria rather than liquid media. As well as extending the range of strains that can be manipulated, these techniques are faster than conventional methods, often giving usable numbers of transfected cells within a few days. The methods and plasmids described here allow efficient transfection with extrachromosomal vectors, as well as chromosomal integration at a ‘safe haven’ for relatively uniform cell-to-cell expression, efficient gene knock-in and knock-out and an inducible expression system. We have thus created a complete new system for the genetic manipulation of Dictyostelium cells that no longer requires cell feeding on liquid media. PMID:29847546
Two new compounds from the fruiting bodies of Ganoderma philippii.
Yang, Shuang; Ma, Qing-Yun; Kong, Fan-Dong; Xie, Qing-Yi; Huang, Sheng-Zhuo; Zhou, Li-Man; Dai, Hao-Fu; Yu, Zhi-Fang; Zhao, You-Xing
2018-03-01
Two new compounds, philippin (1) and 3β,9α,14α-trihydroxy-(22E,24R)-ergost-22-en-7-one (2), were isolated from the fruiting bodies of Ganoderma philippii. Their structures were elucidated on the basis of the spectroscopic technologies, including 1D and 2D NMR as well as MS. The bioassay of inhibitory activity against acetylcholinesterase (AChE) showed compound 1 exhibited weak inhibitory activity against AChE.
Wu, Chiu-Yeh; Liang, Zeng-Chin; Tseng, Chin-Yin; Hu, Shu-Hui
2016-01-01
We investigated the effects of light intensity in the 3 cultivation stages separately-the mycelium colonization stage, the primordial initiation stage, and the fruiting stage (in order)-on fruiting body and bioactive compound production by Cordyceps militaris. In the mycelium colonization stage, rice substrates were incubated in a spawn running room at 23°C. During the primordial initiation stage, C. militaris was grown at 18°C and illuminated 12 hours/day. In the fruiting stage the temperature was 23°C, with illumination provided 12 hours/day. The highest fruiting body yield and biological efficiency were 4.06 g dry weight/bottle and 86.83%, respectively, under 1750 ± 250 lux during the second and third stages. The cordycepin content was highest during the second and third stages under 1250 ± 250 lux. The mannitol and polysaccharide contents were highest under 1250 ± 250 and 1750 ± 250 lux during the primordial initiation stage and the fruiting stage, respectively. Thus, with controlled lighting, C. militaris can be cultivated in rice-water medium to increase fruiting body yield and bioactive compound production.
Sociogenomics of self vs. non-self cooperation during development of Dictyostelium discoideum.
Li, Si I; Buttery, Neil J; Thompson, Christopher R L; Purugganan, Michael D
2014-07-21
Dictyostelium discoideum, a microbial model for social evolution, is known to distinguish self from non-self and show genotype-dependent behavior during chimeric development. Aside from a small number of cell-cell recognition genes, however, little is known about the genetic basis of self/non-self recognition in this species. Based on the key hypothesis that there should be differential expression of genes if D. discoideum cells were interacting with non-clone mates, we performed transcriptomic profiling study in this species during clonal vs. chimeric development. The transcriptomic profiles of D. discoideum cells in clones vs. different chimeras were compared at five different developmental stages using a customized microarray. Effects of chimerism on global transcriptional patterns associated with social interactions were observed. We find 1,759 genes significantly different between chimera and clone, 1,144 genes associated significant strain differences, and 6,586 genes developmentally regulated over time. Principal component analysis showed a small amount of the transcriptional variance to chimerism-related factors (Chimerism: 0.18%, Chimerism × Timepoint: 0.03%). There are 162 genes specifically regulated under chimeric development, with continuous small differences between chimera vs. clone over development. Almost 60% of chimera-associated differential genes were differentially expressed at the 4 h aggregate stage, which corresponds to the initial transition of D. discoideum from solitary life to a multicellular phase. A relatively small proportion of over-all variation in gene expression is explained by differences between chimeric and clonal development. The relatively small modifications in gene expression associated with chimerism is compatible with the high level of cooperation observed among different strains of D. discoideum; cells of distinct genetic backgrounds will co-aggregate indiscriminately and co-develop into fruiting bodies. Chimeric
El-Halawany, Medhat S; Ohkouchi, Susumu; Shibata, Hideki; Hitomi, Kiyotaka; Maki, Masatoshi
2004-06-01
Family 1 cystatins are cytosolic inhibitors of cysteine proteases, and they are conserved in higher eukaryotes. We characterized two newly identified family 1 cystatins of the cellular slime mold Dictyostelium discoideum, cystatin A1 and A2. Their recombinant proteins showed specific inhibitory activity against papain and cathepsin B, respectively. Using specific polyclonal antibodies, we found that cystatin A1 is stably expressed throughout the life cycle of Dictyostelium, whereas cystatin A2 expression is up-regulated during the course of development.
Woolston, Benjamin M.; Schlagnhaufer, Carl; Wilkinson, Jack; Larsen, Jeffrey; Shi, Zhixin; Mayer, Kimberly M.; Walters, Donald S.; Curtis, Wayne R.; Romaine, C. Peter
2011-01-01
Commercial cultivation of the mushroom fungus, Agaricus bisporus, utilizes a substrate consisting of a lower layer of compost and upper layer of peat. Typically, the two layers are seeded with individual mycelial inoculants representing a single genotype of A. bisporus. Studies aimed at examining the potential of this fungal species as a heterologous protein expression system have revealed unexpected contributions of the mycelial inoculants in the morphogenesis of the fruiting body. These contributions were elucidated using a dual-inoculant method whereby the two layers were differientially inoculated with transgenic β-glucuronidase (GUS) and wild-type (WT) lines. Surprisingly, use of a transgenic GUS line in the lower substrate and a WT line in the upper substrate yielded fruiting bodies expressing GUS activity while lacking the GUS transgene. Results of PCR and RT-PCR analyses for the GUS transgene and RNA transcript, respectively, suggested translocation of the GUS protein from the transgenic mycelium colonizing the lower layer into the fruiting body that developed exclusively from WT mycelium colonizing the upper layer. Effective translocation of the GUS protein depended on the use of a transgenic line in the lower layer in which the GUS gene was controlled by a vegetative mycelium-active promoter (laccase 2 and β-actin), rather than a fruiting body-active promoter (hydrophobin A). GUS-expressing fruiting bodies lacking the GUS gene had a bonafide WT genotype, confirmed by the absence of stably inherited GUS and hygromycin phosphotransferase selectable marker activities in their derived basidiospores and mycelial tissue cultures. Differientially inoculating the two substrate layers with individual lines carrying the GUS gene controlled by different tissue-preferred promoters resulted in up to a ∼3.5-fold increase in GUS activity over that obtained with a single inoculant. Our findings support the existence of a previously undescribed phenomenon of long
Association between fruit juice consumption and self-reported body mass index among adult Canadians.
Akhtar-Danesh, N; Dehghan, M
2010-04-01
The prevalence of obesity and being overweight is rising among adult Canadians and diet is recognised as one of the main causes of obesity. The consumption of fruit and vegetables is shown to be protective against obesity and being overweight but little is known about the association of fruit juice consumption and obesity and being overweight. The present study aimed to investigate the association between fruit juice consumption and self-reported body mass index (BMI) among adult Canadians. This analysis is based on the Canadian Community Health Survey, Cycle 3.1. A regression method was used to assess the association of fruit juice consumption with self-reported BMI in 18-64-year-old Canadians who had been adjusted for sex, age, total household income, education, self-rated health, and daily energy expenditure. Because the analysis is based on a cross-sectional dataset, it does not imply a cause and effect relationship. Almost 38.6% of adult Canadians reported a fruit juice intake of 0.5-1.4 times per day and 18.2% consumed fruit juice more than 1.5 times per day. Participants with normal weight were likely to consume more fruit juice than obese individuals. Regression analysis showed a negative association between fruit juice consumption and BMI after adjusting for age, sex, education, marital status, income, total fruit and vegetable intake, daily energy expenditure, and self-rated health. On average, for each daily serving of fruit juice, a -0.22 unit (95% confidence interval = -0.33 to -0.11) decrease in BMI was observed. The results obtained showed a moderate negative association between fruit juice intake and BMI, which may suggest that a moderate daily consumption of fruit juice is associated with normal weight status.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schoenitzer, Veronika; Universitaet Regensburg, Biochemie I, Universitaetsstrasse 31, D-93053 Regensburg; Eichner, Norbert
Highlights: Black-Right-Pointing-Pointer Dictyostelium produces the 264 kDa myosin chitin synthase of bivalve mollusc Atrina. Black-Right-Pointing-Pointer Chitin synthase activity releases chitin, partly associated with the cell surface. Black-Right-Pointing-Pointer Membrane extracts of transgenic slime molds produce radiolabeled chitin in vitro. Black-Right-Pointing-Pointer Chitin producing Dictyostelium cells can be characterized by atomic force microscopy. Black-Right-Pointing-Pointer This model system enables us to study initial processes of chitin biomineralization. -- Abstract: Several mollusc shells contain chitin, which is formed by a transmembrane myosin motor enzyme. This protein could be involved in sensing mechanical and structural changes of the forming, mineralizing extracellular matrix. Here we report themore » heterologous expression of the transmembrane myosin chitin synthase Ar-CS1 of the bivalve mollusc Atrina rigida (2286 amino acid residues, M.W. 264 kDa/monomer) in Dictyostelium discoideum, a model organism for myosin motor proteins. Confocal laser scanning immunofluorescence microscopy (CLSM), chitin binding GFP detection of chitin on cells and released to the cell culture medium, and a radiochemical activity assay of membrane extracts revealed expression and enzymatic activity of the mollusc chitin synthase in transgenic slime mold cells. First high-resolution atomic force microscopy (AFM) images of Ar-CS1 transformed cellulose synthase deficient D. discoideumdcsA{sup -} cell lines are shown.« less
Kück, Ulrich
2005-10-01
Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.
Kubohara, Y; Okamoto, K; Tanaka, Y; Asahi, K; Sakurai, A; Takahashi, N
1993-05-03
Differanisole A isolated from the conditioned medium of a soil microorganism, Chaetomium strain RB-001, is an inducer of the differentiation of the Friend leukemic cells (mouse leukemia cells). The chemical structure of this substance is very similar to that of stalk cell differentiation-inducing factor (DIF) isolated from the cellular slime mould, Dictyostelium discoideum. We examined the effects of differanisole A on Dictyostelium HM44 cells, a mutant strain which is defective in DIF production, and found this substance to be an inducer of stalk cell differentiation in D. discoideum.
Mound-Interface Kinetics in Dictyostelium Aggregation
NASA Astrophysics Data System (ADS)
Tutu, Hiroki
2002-09-01
The mound development of the cellular slime mold amoebae Dictyostelium discoideum is studied with an interface kinetic model for the height of cell layers. As a competitive role for the chemotaxis, we compare two types of curvature relaxations; the surface relaxation induced by cell-substrate affinity (model A), and that comes from a cell-cell adhesive effect (model B). It is found that both models are characterized by the growth law for the maximum mound height. Based on a self-similarity scaling hypothesis for the spatial structure of streaming pattern, we suggest a scaling law for the growth of mound-height hmax ˜ t1-1/α+β/α with α = 2 (4) for the model A (B) and a number 0 ≤ β < 1.
Maselli, Andrew; Furukawa, Ruth; Thomson, Susanne A. M.; Davis, Richard C.; Fechheimer, Marcus
2003-01-01
Hirano bodies are paracrystalline actin filament-containing structures reported to be associated with a variety of neurodegenerative diseases. However, the biological function of Hirano bodies remains poorly understood, since nearly all prior studies of these structures were done with postmortem samples of tissue. In the present study, we generated a full-length form of a Dictyostelium 34-kDa actin cross-linking protein with point mutations in the first putative EF hand, termed 34-kDa ΔEF1. The 34-kDa ΔEF1 protein binds calcium normally but has activated actin binding that is unregulated by calcium. The expression of the 34-kDa ΔEF1 protein in Dictyostelium induces the formation of Hirano bodies, as assessed by both fluorescence microscopy and transmission electron microscopy. Dictyostelium cells bearing Hirano bodies grow normally, indicating that Hirano bodies are not associated with cell death and are not deleterious to cell growth. Moreover, the expression of the 34-kDa ΔEF1 protein rescues the phenotypes of cells lacking the 34-kDa protein and cells lacking both the 34-kDa protein and α-actinin. Finally, the expression of the 34-kDa ΔEF1 protein also initiates the formation of Hirano bodies in cultured mouse fibroblasts. These results show that the failure to regulate the activity and/or affinity of an actin cross-linking protein can provide a signal for the formation of Hirano bodies. More generally, the formation of Hirano bodies is a cellular response to or a consequence of aberrant function of the actin cytoskeleton. PMID:12912897
Effect of light quality on development of fruiting bodies of Panus fragilis
Orson K. Miller; John G. Palmer
1977-01-01
Under a system that permits mass screening of mycelia within bands of the visible spectrum, fruit bodies initiated and developed in two light bands (387-400nm and 425-430nm) in axenic culture. Either or both of these light bands will trigger fruitbody initiation at as low an energy level as 0.2 K (1 K = 1,000 microwatts/cm2). Maturation of sporocarp and hymenium...
Chen, Xi; Stone, Michelle; Schlagnhaufer, Carl; Romaine, C. Peter
2000-01-01
We describe a modified Agrobacterium-mediated method for the efficient transformation of Agaricus bisporus. Salient features of this procedure include cocultivation of Agrobacterium and fruiting body gill tissue and use of a vector with a homologous promoter. This method offers new prospects for the genetic manipulation of this commercially important mushroom species. PMID:11010906
Extracellular calmodulin regulates growth and cAMP-mediated chemotaxis in Dictyostelium discoideum
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Day, Danton H., E-mail: danton.oday@utoronto.ca; Department of Biology, University of Toronto Mississauga, 3359 Mississauga Rd. N., Mississauga, Ontario, Canada L5L 1C6; Huber, Robert J.
2012-09-07
Highlights: Black-Right-Pointing-Pointer Extracellular calmodulin is present throughout growth and development in Dictyostelium. Black-Right-Pointing-Pointer Extracellular calmodulin localizes within the ECM during development. Black-Right-Pointing-Pointer Extracellular calmodulin inhibits cell proliferation and increases chemotaxis. Black-Right-Pointing-Pointer Extracellular calmodulin exists in eukaryotic microbes. Black-Right-Pointing-Pointer Extracellular calmodulin may be functionally as important as intracellular calmodulin. -- Abstract: The existence of extracellular calmodulin (CaM) has had a long and controversial history. CaM is a ubiquitous calcium-binding protein that has been found in every eukaryotic cell system. Calcium-free apo-CaM and Ca{sup 2+}/CaM exert their effects by binding to and regulating the activity of CaM-binding proteins (CaMBPs). Most of themore » research done to date on CaM and its CaMBPs has focused on their intracellular functions. The presence of extracellular CaM is well established in a number of plants where it functions in proliferation, cell wall regeneration, gene regulation and germination. While CaM has been detected extracellularly in several animal species, including frog, rat, rabbit and human, its extracellular localization and functions are less well established. In contrast the study of extracellular CaM in eukaryotic microbes remains to be done. Here we show that CaM is constitutively expressed and secreted throughout asexual development in Dictyostelium where the presence of extracellular CaM dose-dependently inhibits cell proliferation but increases cAMP mediated chemotaxis. During development, extracellular CaM localizes within the slime sheath where it coexists with at least one CaMBP, the matricellular CaM-binding protein CyrA. Coupled with previous research, this work provides direct evidence for the existence of extracellular CaM in the Dictyostelium and provides insight into its functions in this model
Nanovesicles released by Dictyostelium cells: a potential carrier for drug delivery.
Lavialle, Françoise; Deshayes, Sophie; Gonnet, Florence; Larquet, Eric; Kruglik, Sergei G; Boisset, Nicolas; Daniel, Régis; Alfsen, Annette; Tatischeff, Irène
2009-10-01
Nanovesicles released by Dictyostelium discoideum cells grown in the presence of the DNA-specific dye Hoechst 33342 have been previously shown to mediate the transfer of the dye into the nuclei of Hoechst-resistant cells. The present investigation extends this work by conducting experiments in the presence of hypericin, a fluorescent therapeutic photosensitizer assayed for antitumoral photodynamic therapy. Nanovesicles released by Dictyostelium cells exhibit an averaged diameter between 50 and 150 nm, as measured by transmission cryoelectron microscopy. A proteomic analysis reveals a predominance of actin and actin-related proteins. The detection of a lysosomal membrane protein (LIMP II) indicates that these vesicles are likely generated in the late endosomal compartment. The use of the hypericin-containing nanovesicles as nanodevices for in vitro drug delivery was investigated by fluorescence microscopy. The observed signal was almost exclusively located in the perinuclear area of two human cell lines, skin fibroblasts (HS68) and cervix carcinoma (HeLa) cells. Studies by confocal microscopy with specific markers of cell organelles, provided evidence that hypericin was accumulated in the Golgi apparatus. All these data shed a new light on in vitro drug delivery by using cell-released vesicles as carriers.
Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.
Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad
2016-09-01
Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.
A study of wound repair in Dictyostelium cells by using novel laserporation.
Pervin, Mst Shaela; Itoh, Go; Talukder, Md Shahabe Uddin; Fujimoto, Koushiro; Morimoto, Yusuke V; Tanaka, Masamitsu; Ueda, Masahiro; Yumura, Shigehiko
2018-05-22
We examined the mechanism of cell membrane repair in Dictyostelium cells by using a novel laser-based cell poration method. The dynamics of wound pores opening and closing were characterized by live imaging of fluorescent cell membrane proteins, influx of fluorescent dye, and Ca 2+ imaging. The wound closed within 2-4 sec, depending on the wound size. Cells could tolerate a wound size of less than 2.0 µm. In the absence of Ca 2+ in the external medium, the wound pore did not close and cells ruptured. The release of Ca 2+ from intracellular stores also contributed to the elevation of cytoplasmic Ca 2+ but not to wound repair. Annexin C1 immediately accumulated at the wound site depending on the external Ca 2+ concentration, and annexin C1 knockout cells had a defect in wound repair, but it was not essential. Dictyostelium cells were able to respond to multiple repeated wounds with the same time courses, in contrast to previous reports showing that the first wound accelerates the second wound repair in fibroblasts.
Stochastic Noise and Synchronisation during Dictyostelium Aggregation Make cAMP Oscillations Robust
Kim, Jongrae; Heslop-Harrison, Pat; Postlethwaite, Ian; Bates, Declan G
2007-01-01
Stable and robust oscillations in the concentration of adenosine 3′, 5′-cyclic monophosphate (cAMP) are observed during the aggregation phase of starvation-induced development in Dictyostelium discoideum. In this paper we use mathematical modelling together with ideas from robust control theory to identify two factors which appear to make crucial contributions to ensuring the robustness of these oscillations. Firstly, we show that stochastic fluctuations in the molecular interactions play an important role in preserving stable oscillations in the face of variations in the kinetics of the intracellular network. Secondly, we show that synchronisation of the aggregating cells through the diffusion of extracellular cAMP is a key factor in ensuring robustness of the oscillatory waves of cAMP observed in Dictyostelium cell cultures to cell-to-cell variations. A striking and quite general implication of the results is that the robustness analysis of models of oscillating biomolecular networks (circadian clocks, Ca2+ oscillations, etc.) can only be done reliably by using stochastic simulations, even in the case where molecular concentrations are very high. PMID:17997595
High-throughput analysis of spatio-temporal dynamics in Dictyostelium
Sawai, Satoshi; Guan, Xiao-Juan; Kuspa, Adam; Cox, Edward C
2007-01-01
We demonstrate a time-lapse video approach that allows rapid examination of the spatio-temporal dynamics of Dictyostelium cell populations. Quantitative information was gathered by sampling life histories of more than 2,000 mutant clones from a large mutagenesis collection. Approximately 4% of the clonal lines showed a mutant phenotype at one stage. Many of these could be ordered by clustering into functional groups. The dataset allows one to search and retrieve movies on a gene-by-gene and phenotype-by-phenotype basis. PMID:17659086
Jabłońska-Ryś, Ewa; Sławińska, Aneta; Radzki, Wojciech; Gustaw, Waldemar
2016-01-01
The available literature does not provide data on the application of probiotic strains in mushroom processing. The aim of the study was to evaluate the potential to use the L. plantarum 299v strain with documented probiotic properties in the process of lactic fermentation of button mushroom fruiting bodies (Agaricus bisporus). Fresh button mushroom fruiting bodies and cultures of lactic acid bacteria L. plantarum Ib and a probiotic strain L. plantarum 299v were the material analysed. Sensory evaluation was performed with a 5-point scale, an instrumental method of colour measurement based on the CIA L*a*b* scale, total phenolic compounds were determined with the Folin method, antioxidant properties were assayed with the DPPH radical test, and reducing power was determined using the FRAP method. After a week-long lactic fermentation, the pH value in the samples declined to a level of 3.6 (L. plantarum Ib) and 3.75 (L. plantarum 299v); these values persisted or decreased slightly during the period of maturation of the fermented samples under refrigeration. Fermented mushrooms were assigned high grades in the organoleptic evaluation. The colour analysis revealed significant changes in the values of the L*a*b* parameters in the fermented product, in comparison with fresh mushrooms. Blanching contributed to a significant decrease in the content of total phenolic compounds in the mushroom fruiting bodies and to a decline in antioxidant activity. Mushrooms fermented with the probiotic strain were characterised by higher phenolic compound content and higher antioxidant activity. L. plantarum 299v strain with documented probiotic properties can be applied in fermentation of button mushroom fruiting bodies. Products obtained with the use of both strains were characterised by good sensory properties. The type of strain used in the lactic fermentation of mushroom fruiting bodies had an effect on the phenolic compound content and antioxidant properties of the final product.
NASA Astrophysics Data System (ADS)
Sánchez, Francisco; Korine, Carmi; Kotler, Burt P.; Pinshow, Berry
2008-06-01
Ethanol occurs in fleshy fruit as a result of sugar fermentation by both microorganisms and the plant itself; its concentration [EtOH] increases as fruit ripens. At low concentrations, ethanol is a nutrient, whereas at high concentrations, it is toxic. We hypothesized that the effects of ethanol on the foraging behavior of frugivorous vertebrates depend on its concentration in food and the body condition of the forager. We predicted that ethanol stimulates food consumption when its concentration is similar to that found in ripe fruit, whereas [EtOH] below or above that of ripe fruit has either no effect, or else deters foragers, respectively. Moreover, we expected that the amount of food ingested on a particular day of feeding influences the toxic effects of ethanol on a forager, and consequently shapes its feeding decisions on the following day. We therefore predicted that for a food-restricted forager, ethanol-rich food is of lower value than ethanol-free food. We used Egyptian fruit bats ( Rousettus aegyptiacus) as a model to test our hypotheses, and found that ethanol did not increase the value of food for the bats. High [EtOH] reduced the value of food for well-fed bats. However, for food-restricted bats, there was no difference between the value of ethanol-rich and ethanol-free food. Thus, microorganisms, via their production of ethanol, may affect the patterns of feeding of seed-dispersing frugivores. However, these patterns could be modified by the body condition of the animals because they might trade-off the costs of intoxication against the value of nutrients acquired.
Molowitz, R; Bahn, M; Hock, B
1976-01-01
Fruiting body formation of Sordaria macrospora Auersw. is controlled by L-arginine and biotin when the fungus is grown on a synthetic nutrient medium containing optimal concentrations of fructose, KNO3, KH2PO4, MgSO4, and ZnSO4. Arginine and biotin operate in very low concentrations which exclude unspecific nutrient effects. In spite of the complicated interactions of arginine and biotin which are shown qualitatively (Figs. 3 and 4a) and quantitatively (Figs. 2 and 4b), the following conclusions are reached: 1. In the absence of biotin, the development of Sordaria macrospora is blocked at the stage of small protoperithecia. The external addition of biotin (optimal concentration: 3-12 μg/l) allows the formation of fertile fruiting bodies. This effect cannot be imitated by arginine. The biotin effect is discussed in connection with stimulated RNA synthesis.-2. The developmental velocity is influenced by the external addition of arginine. Without arginine but at permissible biotin concentrations, the total life cycle takes about 10 days, in the presence of arginine (1 mM), however, about 6 days.-3. The hyphal density, as well as the total number of fruiting bodies being produced, is controlled in a similar manner by biotin and arginine. The induction of fruiting body formation obviously takes place after the transgression of a critical hyphal density.
Du, Xiaoli; Herrfurth, Cornelia; Gottlieb, Thomas; Kawelke, Steffen; Feussner, Kristin; Rühling, Harald; Feussner, Ivo
2014-01-01
Triacylglycerol (TAG), the common energy storage molecule, is formed from diacylglycerol and a coenzyme A-activated fatty acid by the action of an acyl coenzyme A:diacylglycerol acyltransferase (DGAT). In order to conduct this step, most organisms rely on more than one enzyme. The two main candidates in Dictyostelium discoideum are Dgat1 and Dgat2. We show, by creating single and double knockout mutants, that the endoplasmic reticulum (ER)-localized Dgat1 enzyme provides the predominant activity, whereas the lipid droplet constituent Dgat2 contributes less activity. This situation may be opposite from what is seen in mammalian cells. Dictyostelium Dgat2 is specialized for the synthesis of TAG, as is the mammalian enzyme. In contrast, mammalian DGAT1 is more promiscuous regarding its substrates, producing diacylglycerol, retinyl esters, and waxes in addition to TAG. The Dictyostelium Dgat1, however, produces TAG, wax esters, and, most interestingly, also neutral ether lipids, which represent a significant constituent of lipid droplets. Ether lipids had also been found in mammalian lipid droplets, but the role of DGAT1 in their synthesis was unknown. The ability to form TAG through either Dgat1 or Dgat2 activity is essential for Dictyostelium to grow on bacteria, its natural food substrate. PMID:24562909
Lanostane-type triterpenoids from the fruiting body of Ganoderma calidophilum.
Huang, Sheng-Zhuo; Ma, Qing-Yun; Kong, Fan-Dong; Guo, Zhi-Kai; Cai, Cai-Hong; Hu, Li-Li; Zhou, Li-Man; Wang, Qi; Dai, Hao-Fu; Mei, Wen-Li; Zhao, You-Xing
2017-11-01
To search for active anti-cancer constituents in the fruiting body of Ganoderma calidophilum, we have successfully isolated four previously undescribed spiro-lactone lanostane triterpenoids (spiroganocalitones A-D), two previously undescribed lanostanoids (ganodecalones A and B) together with twenty-three known ones. The structures of the six previously undescribed compounds were elucidated based on 1D, 2D-NMR, and HRMS analyses. Ganoderone A showed moderate cytotoxic activity against K562, BEL7402, and SGC790 cell lines with IC 50 values of 7.62, 6.28, and 3.55 μM, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nowrousian, Minou
2009-04-01
During fungal fruiting body development, hyphae aggregate to form multicellular structures that protect and disperse the sexual spores. Analysis of microarray data revealed a gene cluster strongly upregulated during fruiting body development in the ascomycete Sordaria macrospora. Real time PCR analysis showed that the genes from the orthologous cluster in Neurospora crassa are also upregulated during development. The cluster encodes putative polyketide biosynthesis enzymes, including a reducing polyketide synthase. Analysis of knockout strains of a predicted dehydrogenase gene from the cluster showed that mutants in N. crassa and S. macrospora are delayed in fruiting body formation. In addition to the upregulated cluster, the N. crassa genome comprises another cluster containing a polyketide synthase gene, and five additional reducing polyketide synthase (rpks) genes that are not part of clusters. To study the role of these genes in sexual development, expression of the predicted rpks genes in S. macrospora (five genes) and N. crassa (six genes) was analyzed; all but one are upregulated during sexual development. Analysis of knockout strains for the N. crassa rpks genes showed that one of them is essential for fruiting body formation. These data indicate that polyketides produced by RPKSs are involved in sexual development in filamentous ascomycetes.
Aoshima, Ryota; Hiraoka, Rieko; Shimada, Nao; Kawata, Takefumi
2006-01-01
A Dd-STATa-null mutant, which is defective in expression of a Dictyostelium homologue of the metazoan STAT (signal transducers and activators of transcription) proteins, fails to culminate and this phenotype correlates with the loss of expression of various prestalk (pst) genes. An EST clone, SSK395, encodes a close homologue of the adducin amino-terminal head domain and harbors a putative actin-binding domain. We fused promoter fragments of the cognate gene, ahhA (adducin head homologue A), to a lacZ reporter and determined their expression pattern. The proximal promoter region is necessary for the expression of ahhA at an early (pre-aggregative) stage of development and this expression is Dd-STATa independent. The distal promoter region is necessary for expression at later stages of development in pstA cells, of the slug and in upper cup and pstAB cells during culmination. The distal region is partly Dd-STATa-dependent. The ahhA-null mutant develops almost normally until culmination, but it forms slanting culminants that tend to collapse on to the substratum. The mutant also occasionally forms fruiting bodies with swollen papillae and with constrictions in the prestalk region. The AhhA protein localizes to the stalk tube entrance and also to the upper cup cells and in cells at or near to the constricted region where an F-actin ring is localized. These findings suggest that Dd-STATa regulates culmination and may be necessary for straight downward elongation of the stalk, via the putative actin-binding protein AhhA.
Huber, Robert J; O'Day, Danton H
2011-08-01
The Dictyostelium discoideum homolog of mammalian cyclin dependent kinase 5 (Cdk5) has previously been shown to be required for optimal growth and differentiation in this model organism, however, the subcellular localization of the protein has not previously been studied. In this study, immunolocalizations and a GFP fusion construct localized Cdk5 predominantly to the nucleus of vegetative cells. Western blots showed that Cdk5 was present in both nuclear and non-nuclear fractions, suggesting a functional role in both cellular locales. During the early stages of mitosis, Cdk5 gradually moved from a punctate nucleoplasmic distribution to localize adjacent to the inner nuclear envelope. During anaphase and telophase, Cdk5 localized to the cytoplasm and was not detected in the nucleoplasm. Cdk5 returned to the nucleus during cytokinesis. Proteolytic activity has been shown to be a critical regulator of the cell cycle. Immunoprecipitations coupled with immunolocalizations identified puromycin-sensitive aminopeptidase A (PsaA) as a potential Cdk5 binding partner in Dictyostelium. Immunoprecipitations also identified two phosphotyrosine proteins (35 and 18 kDa) that may interact with Cdk5 in vivo. Together, this work provides new insight into the localization of Cdk5, its function during cell division, and its binding to a proteolytic enzyme in Dictyostelium.
Wu, Ding-Tao; Li, Wen-Zhi; Chen, Jun; Zhong, Qian-Xia; Ju, Yao-Jun; Zhao, Jing; Bzhelyansky, Anton; Li, Shao-Ping
2015-06-25
An evaluation system including colorimetric assay with iodine and potassium iodide, HPSEC-MALLS-RID analysis, GC-MS analysis, and saccharide mapping based on PACE analysis was proposed for the identification and discrimination of commercial product of Hericium erinaceus based on the chemical characters of polysaccharides in H. erinaceus fruiting body collected from different regions of China. The results showed that the molecular weights, the compositional monosaccharides and the glycosidic linkages of polysaccharides in H. erinaceus collected from different regions of China were similar, respectively. However, polysaccharides in the widely consumed product of H. erinaceus in China were significantly different from those of H. erinaceus fruiting body. The implications from these results were found to be beneficial to improve the quality control of polysaccharides from the H. erinaceus fruiting body, and suggest that the proposed evaluation system could be used as a routine approach for the quality control of polysaccharides in other edible and medicinal mushrooms. Copyright © 2015 Elsevier Ltd. All rights reserved.
Three new isobenzofuranone derivatives from the fruiting bodies of Hericium erinaceus.
Wang, Xu-Li; Gao, Jie; Li, Jing; Long, Hong-Ping; Xu, Ping-Sheng; Xu, Kang-Ping; Tan, Gui-Shan
2017-02-01
Three new isobenzofuranone derivatives erinaceolactones D-F (1-3), together with four known ones (4-7), were isolated from the fruiting bodies of Hericium erinaceus. Their structures were determined on the basis of comprehensive spectroscopic analyses including UV, 1D, 2D NMR and HR-TOF-MS. The absolute configuration of erinaceolactone D (1) and erinaceolactone E (2) were assigned by comparing their specific rotation with those of analogs in literatures. The four known compounds were isomers with each other and were isolated simultaneously for the first time.
Xie, Chunliang; Gong, Wenbing; Zhu, Zuohua; Yan, Li; Hu, Zhenxiu; Peng, Yuande
2018-05-01
Blue light is an important environmental factor which could induce mushroom primordium differentiation and fruiting body development. However, the mechanisms of Pleurotus eryngii primordium differentiation and development induced by blue light are still unclear. The CAZymes (carbohydrate-active enzymes) play important roles in degradation of renewable lignocelluloses to provide carbohydrates for fungal growth, development and reproduction. In the present research, the expression profiles of genes were measured by comparison between the Pleurotus eryngii at primordium differentiated into fruiting body stage after blue light stimulation and dark using high-throughput sequencing approach. After assembly and compared to the Pleurotus eryngii reference genome, 11,343 unigenes were identified. 539 differentially expressed genes including white collar 2 type of transcription factor gene, A mating type protein gene, MAP kinase gene, oxidative phosphorylation associated genes, CAZymes genes and other metabolism related genes were identified during primordium differentiated into fruiting body stage after blue light stimulation. KEGG results showed that carbon metabolism, glycolysis/gluconeogenesis and biosynthesis of amino acids pathways were affected during blue light inducing primordia formation. Most importantly, 319 differentially expressed CAZymes participated in carbon metabolism were identified. The expression patterns of six representative CAZymes and laccase genes were further confirmed by qRT-PCR. Enzyme activity results indicated that the activities of CAZymes and laccase were affected in primordium differentiated into fruiting body under blue light stimulation. In conclusion, the comprehensive transcriptome and CAZymes of Pleurotus eryngii at primordium differentiated into fruiting body stage after blue light stimulation were obtained. The biological insights gained from this integrative system represent a valuable resource for future genomic studies on this
Liang, Chih-Hung; Ho, Kung-Jui; Huang, Ling-Yi; Tsai, Ching-Hsuan; Lin, Shin-Yi; Mau, Jeng-Leun
2013-01-01
The culinary-medicinal king oyster mushroom Pleurotus eryngii is known to contain ergothioneine, and its products, including fruiting bodies, mycelia, and solid-state fermented products (adlay and buckwheat), were prepared to study their antioxidant properties. Fruiting bodies, regular and Hi-Ergo mycelia, and fermented products contained 2.05, 1.68, 5.76, 0.79-0.80 mg/g of ergothioneine, respectively. On the basis of the results obtained, P. eryngii products had effective antioxidant activity, reducing power, and scavenging ability on 1,1-diphenyl-2-picrylhydrazyl radicals and chelating ability on ferrous ions. Hi-Ergo mycelia was the most effective in the first 3 antioxidant properties in addition to its ergothioneine content. In addition, fruiting bodies were more effective in all antioxidant properties than regular mycelia. For ethanolic and hot water extracts from mycelia and fruiting bodies, the correlation coefficients between total phenol contents and each antioxidant attribute were 0.483-0.921. Overall, P. eryngii products with high amounts of ergothioneine could be used beneficially as a functional food.
Iwadate, Yoshiaki; Okimura, Chika; Sato, Katsuya; Nakashima, Yuta; Tsujioka, Masatsune; Minami, Kazuyuki
2013-01-01
Living cells are constantly subjected to various mechanical stimulations, such as shear flow, osmotic pressure, and hardness of substratum. They must sense the mechanical aspects of their environment and respond appropriately for proper cell function. Cells adhering to substrata must receive and respond to mechanical stimuli from the substrata to decide their shape and/or migrating direction. In response to cyclic stretching of the elastic substratum, intracellular stress fibers in fibroblasts and endothelial, osteosarcoma, and smooth muscle cells are rearranged perpendicular to the stretching direction, and the shape of those cells becomes extended in this new direction. In the case of migrating Dictyostelium cells, cyclic stretching regulates the direction of migration, and not the shape, of the cell. The cells migrate in a direction perpendicular to that of the stretching. However, the molecular mechanisms that induce the directional migration remain unknown. Here, using a microstretching device, we recorded green fluorescent protein (GFP)-myosin-II dynamics in Dictyostelium cells on an elastic substratum under cyclic stretching. Repeated stretching induced myosin II localization equally on both stretching sides in the cells. Although myosin-II-null cells migrated randomly, myosin-II-null cells expressing a variant of myosin II that cannot hydrolyze ATP migrated perpendicular to the stretching. These results indicate that Dictyostelium cells accumulate myosin II at the portion of the cell where a large strain is received and migrate in a direction other than that of the portion where myosin II accumulated. This polarity generation for migration does not require the contraction of actomyosin. PMID:23442953
Rat medium-term multi-organ carcinogenesis bioassay of Agaricus blazei Murrill fruit-body extract.
Doi, Yuko; Furukawa, Fumio; Suguro, Mayuko; Ito, Hikaru; Imai, Norio; Nabae, Kyoko; Toda, Yosuke; Inatomi, Satoshi; Kinugasa, Satomi; Kobayashi, Hitoshi
2010-01-01
The modifying potential of Agaricus blazei Murrill fruit-body extract (ABFE) on tumor development was investigated in a medium-term multi-organ carcinogenesis bioassay. Male 6-week-old F344 rats were treated with N-nitrosodiethylamine (DEN), N-methyl-N-nitrosourea (MNU), 1,2-dimethylhydrazine dihydrochloride (DMH), N-butyl-N-(hydroxybutyl)-nitrosamine (BBN), and diisopropanolnitrosamine (DHPN) for initiation (DMBDD treatment). After a 1-week withdrawal period, the animals received distilled water (vehicle control) or ABFE A, gamma-amino butyric acid (GABA) at 0.8 mg/kg, ABFE B (GABA level of 3.0mg/kg) or ABFE C (GABA level of 12.0mg/kg) by gavage for 24 weeks. There were no effects of ABFE on survival rate, general condition, body weight, food and water consumption, and organ weights. The multiplicity of large intestinal nodules, smaller than 2mm was significantly increased in the ABFE C group with DMBDD treatment. However, there were no significantly inter-group differences in incidences of hyperplastic or neoplastic lesions in colon or other organs, or in immunohistochemically identified preneoplastic lesions in the liver. In conclusion, A. blazei Murrill fruit-body extract, even at a GABA level up to 12 mg/kg, did not exert modifying potential in the present medium-term multi-organ carcinogenesis bioassay in male F344 rats (DMBDD method). Copyright 2009 Elsevier Ltd. All rights reserved.
Wang, Shu-fang; He, Xiu-feng; He, Hui-xia; Zhu, Ping
2006-01-01
To select a proper Ganoderma luciderm strain for the fruiting body production. The strains were cultivated on the agar media and in the liquid media, respectively. Then the strains were inoculated onto the solid medium made from agricultural products (such as wheat bran, corn powder, wood meal, etc.) and cultured for a certain period. Strains, which were easier to produce polyporic tissues at the vegetative growth stage, would be more quickly to form fruiting body with high quality and yield of the spores. Appearance of the polyporic tissues at the mycelium vegetative growth stage could be used as a marker for the strain selection for the G. luciderm substituted cultivation.
Chen, Gong; Wang, Jun; Xu, Xiaoqun; Wu, Xiangfu; Piao, Ruihan; Siu, Chi-Hung
2013-06-01
Cell-cell adhesion plays crucial roles in cell differentiation and morphogenesis during development of Dictyostelium discoideum. The heterophilic adhesion protein TgrC1 (Tgr is transmembrane, IPT, IG, E-set, repeat protein) is expressed during cell aggregation, and disruption of the tgrC1 gene results in the arrest of development at the loose aggregate stage. We have used far-Western blotting coupled with MS to identify TgrB1 as the heterophilic binding partner of TgrC1. Co-immunoprecipitation and pull-down studies showed that TgrB1 and TgrC1 are capable of binding with each other in solution. TgrB1 and TgrC1 are encoded by a pair of adjacent genes which share a common promoter. Both TgrB1 and TgrC1 are type I transmembrane proteins, which contain three extracellular IPT/TIG (immunoglobulin, plexin, transcription factor-like/transcription factor immunoglobulin) domains. Antibodies raised against TgrB1 inhibit cell reassociation at the post-aggregation stage of development and block fruiting body formation. Ectopic expression of TgrB1 and TgrC1 driven by the actin15 promoter leads to heterotypic cell aggregation of vegetative cells. Using recombinant proteins that cover different portions of TgrB1 and TgrC1 in binding assays, we have mapped the cell-binding regions in these two proteins to Lys(537)-Ala(783) in TgrB1 and Ile(336)-Val(360) in TgrC1, corresponding to their respective TIG3 and TIG2 domain.
Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin
2015-10-01
In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.
New isoindolinones from the fruiting bodies of Hericium erinaceum.
Wang, Xu-Li; Xu, Kang-Ping; Long, Hong-Ping; Zou, Hui; Cao, Xiao-Zheng; Zhang, Kai; Hu, Jian-Zhong; He, Shu-Jin; Zhu, Gang-Zhi; He, Xiao-Ai; Xu, Ping-Sheng; Tan, Gui-Shan
2016-06-01
Hericium erinaceus is a well-known medicinal and edible mushroom, which is considered as a potential source to obtain antitumor candidates. In this work, five new isoindolinones, named erinaceolactams A-E (1-5), along with five known compounds (6-10), were isolated from 70% ethanol extract of the fruiting bodies of H. erinaceus. The structures of new compounds were validated by HRESIMS and 1D, 2D NMR. It's worth mentioning that there are two pairs of isomers included in the new compounds. Moreover, their cytotoxicity against metastatic human hepatocellular carcinoma cell lines SMMC-7221 and MHCC-97H were evaluated. The results showed that compounds 6 and 7 exhibited promising inhibitory potency against the growth of two cell lines. Copyright © 2016 Elsevier B.V. All rights reserved.
Hock, B; Bahn, M; Walk, R A; Nitschke, U
1978-01-01
The morphological effects of biotin and L-arginine on fruiting body formation of the ascomycete Sordaria macrospora are investigated by scanning electron and light microscopy. Biotin is recognized as an elongation factor and arginine as a branching factor in vegetative and reproductive hyphae. In the absence of exogenous biotin, development is blocked after the ascogonium-core hypha stage of protoperithecial morphogenesis, whereas linear growth of the myceliar front is maintained. The addition of exogenous arginine to a biotin deficient culture induces the formation of numerous side branches even in the older mycelium. Fruiting body formation, however, remains blocked at the protoperithecial stage as before, because of the inability of the side branches to elongate. When biotin and arginine are administered simultaneously, a most vigorous branching and growth are induced in the older mycelium, accompanied by a rapid and maximal formation of fruiting bodies. The results are summarized in a model of the exogenous control of hyphal morphogenesis. The model is designed to explain the relationship between fruiting and hyphal density as well as the edge effect on fruiting body formation.
New lanostane-type triterpenoids from the fruiting body of Ganoderma hainanense.
Li, Wei; Lou, Lan-Lan; Zhu, Jian-Yong; Zhang, Jun-Sheng; Liang, An-An; Bao, Jing-Mei; Tang, Gui-Hua; Yin, Sheng
2016-12-01
Five new lanostane-type triterpenoids, ganoderenses A-E (1-5), two new lanostane nor-triterpenoids, ganoderenses F and G (6 and 7), along with 13 known analogues (8-20) were isolated from the fruiting body of Ganoderma hainanense. Their structures were determined by combined chemical and spectral methods, and the absolute configurations of compounds 1 and 13 were confirmed by single crystal X-ray diffraction. All compounds were evaluated for inhibitory activity against thioredoxin reductase (TrxR), a potential target for cancer chemotherapy with redox balance and antioxidant functions, but were inactive. Copyright © 2016 Elsevier B.V. All rights reserved.
Removal of Emulsified Oil from Water by Fruiting Bodies of Macro-Fungus (Auricularia polytricha)
Yang, Xunan; Guo, Mengting; Wu, Yinghai; Wu, Qunhe; Zhang, Renduo
2014-01-01
The aim of this study was to investigate the feasibility of utilizing the fruiting bodies of a jelly macro-fungus Auricularia polytricha as adsorbents to remove emulsified oil from water. The effects of several factors, including temperature, initial pH, agitation speed, and adsorbent dosage, were taken into account. Results showed that the optimized conditions for adsorption of A. polytricha were a temperature of 35°C, pH of 7.5, and agitation speed of 100 rpm. The adsorption kinetics were characterized by the pseudo-first order model, which showed the adsorption to be a fast physical process. The Langmuir-Freundlich isotherm described the adsorption very well and predicted the maximum adsorption capacity of 398 mg g−1, under optimized conditions. As illustrated by scanning electron micrographs, the oil particles were adsorbed onto the hairs covering the bottom surface and could be desorbed by normal temperature volatilization. The material could be used as an emulsified oil adsorbent at least three times, retaining more than 95% of the maximum adsorption capacity. The results demonstrated that the fruiting bodies of A. polytricha can be a useful adsorbent to remove emulsified oil from water. PMID:24743498
Lee, Hyang-Mi; Kim, Ji-Sun; Kang, Sa-Ouk
2016-12-01
Despite the importance of glutathione in Dictyostelium, the role of glutathione synthetase (gshB/GSS) has not been clearly investigated. In this study, we observed that increasing glutathione content by constitutive expression of gshB leads to mound-arrest and defects in 3',5'-cyclic adenosine monophosphate (cAMP)-mediated aggregation and developmental gene expression. The overexpression of gpaB encoding G protein alpha 2 (Gα2), an essential component of the cAMP signalling pathway, results in a phenotype similar to that caused by gshB overexpression, whereas gpaB knockdown in gshB-overexpressing cells partially rescues the above-mentioned phenotypic defects. Furthermore, Gα2 is highly enriched at the plasma membrane of gshB-overexpressing cells compared to wild-type cells. Therefore, our findings suggest that glutathione upregulates cAMP signalling via Gα2 modulation during Dictyostelium development. © 2016 Federation of European Biochemical Societies.
Järvi, A; Karlström, B; Vessby, B; Becker, W
2016-05-28
A diet rich in fruits and vegetables has been associated with several health benefits. However, the effects on body weight (BW) and metabolic markers are not fully known. The present study investigated the effects of increased intake of fruits and vegetables in overweight and obese men and women on dietary habits, anthropometry and metabolic control. In a 16-week controlled intervention, thirty-four men and thirty-four women aged 35-65 years (BMI>27 kg/m2) were randomised to an intervention (IN) or a reference (RG) group. All participants received general dietary advice, and subjects in the IN group received fruits and vegetables for free, of which ≥500 g had to be eaten daily. BW, waist circumference (WC), sagittal abdominal diameter (SAD), plasma insulin, blood glucose, glycated Hb (HbA1c), serum lipids, blood pressure, plasminogen activator inhibitor-1 activity, urinary isoprostane (iso-8-PGF 2α) and serum carotenoids were measured. Diet was assessed using 3-d weighed food records. In all, thirty subjects in the IN group and thirty-two in the RG group completed the intervention. Intake of fruits and vegetables doubled in the IN group, whereas intake of fruits increased in the RG group. Serum α- and β-carotene concentrations and intakes of folate and vitamin C increased significantly in the IN group. Energy intake, BW, WC and SAD decreased significantly in both groups. Supine systolic blood pressure decreased significantly in the IN group, with no between-group differences. No significant changes were observed for other metabolic markers. Provision of fruits and vegetables led to substantially increased intakes, with subsequent favourable changes in anthropometry and insulin levels, which tended to be more pronounced in the IN group. The observed improvements may, in combination with improved nutritional markers, have health benefits in the long term.
Development and growth of fruit bodies and crops of the button mushroom, Agaricus bisporus.
Straatsma, Gerben; Sonnenberg, Anton S M; van Griensven, Leo J L D
2013-10-01
We studied the appearance of fruit body primordia, the growth of individual fruit bodies and the development of the consecutive flushes of the crop. Relative growth, measured as cap expansion, was not constant. It started extremely rapidly, and slowed down to an exponential rate with diameter doubling of 1.7 d until fruit bodies showed maturation by veil breaking. Initially many outgrowing primordia were arrested, indicating nutritional competition. After reaching 10 mm diameter, no growth arrest occurred; all growing individuals, whether relatively large or small, showed an exponential increase of both cap diameter and biomass, until veil breaking. Biomass doubled in 0.8 d. Exponential growth indicates the absence of competition. Apparently there exist differential nutritional requirements for early growth and for later, continuing growth. Flushing was studied applying different picking sizes. An ordinary flushing pattern occurred at an immature picking size of 8 mm diameter (picking mushrooms once a day with a diameter above 8 mm). The smallest picking size yielded the highest number of mushrooms picked, confirming the competition and arrested growth of outgrowing primordia: competition seems less if outgrowing primordia are removed early. The flush duration (i.e. between the first and last picking moments) was not affected by picking size. At small picking size, the subsequent flushes were not fully separated in time but overlapped. Within 2 d after picking the first individuals of the first flush, primordia for the second flush started outgrowth. Our work supports the view that the acquisition of nutrients by the mycelium is demand rather than supply driven. For formation and early outgrowth of primordia, indications were found for an alternation of local and global control, at least in the casing layer. All these data combined, we postulate that flushing is the consequence of the depletion of some unknown specific nutrition required by outgrowing
Greeshma, Panavalappil; Ravikumar, Korattuvalappil S; Neethu, Mangalathmelathil N; Pandey, Meera; Zuhara, Karattuthodi Fathimathu; Janardhanan, Kainoor K
2016-01-01
Ethanoic extracts from the fruiting bodies and mycelia of the elm oyster mushroom, Hypsizygus ulmarius, were evaluated for their antioxidant, anti-inflammatory, and antitumor properties. Ethnolic extracts of fruiting body and mycelia showed 88%, 85%, 71%, and 85%, 65%, 70% 2,2-diphenyl-1-picrylhydrazyl, hydroxyl (DPPH) and 2,2'-azinobis (3-ethyl benzothiazolin-6-sulfonic acid) (ABTS) radical-scavenging activities, respectively, at a concentration of 1000 µg/mL. The anti-inflammatory activity was determined using carrageenan- and formalin- induced paw edema models. Diclofenac was used as the standard drug. In both models, the mycelia extract showed higher activity than the fruiting body extract. The antitumor effect of the extracts against Dalton's Lymphoma Ascites cell-line-induced tumors showed significant antitumor activity. Mycochemical analysis confirmed the presence of many pharmacologically active compounds such as phenol, alkaloids, proteins, tannins, and polysaccharides. Among these, polysaccharides and phenolic compounds were present at a higher concentration in both extracts. These compounds might be largely responsible for the mushroom's medicinal properties. The results of this study indicate that H. ulmarius possesses significant antioxidant, anti-inflammatory, and antitumor properties.
Corrêa, Rúbia Carvalho Gomes; de Souza, Aloisio Henrique Pereira; Calhelha, Ricardo C; Barros, Lillian; Glamoclija, Jasmina; Sokovic, Marina; Peralta, Rosane Marina; Bracht, Adelar; Ferreira, Isabel C F R
2015-07-01
Pleurotus ostreatoroseus is a Brazilian edible mushroom whose chemical characterization and bioactivity still remain underexplored. In this study, the hydrophilic and lipophilic compounds as well as the antioxidant, anti-inflammatory and antimicrobial activities of formulations (ethanol extracts) prepared with its fruiting bodies and submerged culture mycelia were compared. The bioactive formulations contain at least five free sugars, four organic acids, four phenolic compounds and two tocopherols. The fruiting body-based formulation revealed higher reducing power, DPPH scavenging activity, β-carotene bleaching inhibition and lipid peroxidation inhibition in brain homogenates than the mycelium-based preparation, as well as higher anti-inflammatory and antimicrobial activities. The absence of hepatotoxicity was confirmed in porcine liver primary cells. These functional responses can be related to the levels of bioactive components including phenolic acids, organic acids and tocopherols.
Two new triterpenoids from fruiting bodies of fungus Ganoderma lucidum.
Zhao, Zhen-Zhu; Yin, Rong-Hua; Chen, He-Ping; Feng, Tao; Li, Zheng-Hui; Dong, Ze-Jun; Cui, Bao-Kai; Liu, Ji-Kai
2015-01-01
Two new triterpenoids, (24E)-9α,11α-epoxy-3β-hydroxylanosta-7,24-dien-26-al (1) and (22Z,24Z)-13-hydroxy-3-oxo-14(13 → 12)abeo-lanosta-8,22,24-trien-26,23-olide (2) were isolated from dried fruiting bodies of fungus Ganoderma lucidum. The structures of these two new compounds were elucidated on the basis of extensive spectroscopic analyses. Compound 1 possessed a lanostane skeleton, while compound 2 was based on a rare 14 (13 → 12)abeo-lanostane skeleton with a 26,23-olide moiety. Both of them were evaluated for their antifungal and cytotoxic activities. Neither of them displayed obvious inhibition on Candida albicans and five human cancer cell lines.
External stimulation strength controls actin response dynamics in Dictyostelium cells
NASA Astrophysics Data System (ADS)
Hsu, Hsin-Fang; Westendorf, Christian; Tarantola, Marco; Zykov, Vladimir; Bodenschatz, Eberhard; Beta, Carsten
2015-03-01
Self-sustained oscillation and the resonance frequency of the cytoskeletal actin polymerization/depolymerization have recently been observed in Dictyostelium, a model system for studying chemotaxis. Here we report that the resonance frequency is not constant but rather varies with the strength of external stimuli. To understand the underlying mechanism, we analyzed the polymerization and depolymerization time at different levels of external stimulation. We found that polymerization time is independent of external stimuli but the depolymerization time is prolonged as the stimulation increases. These observations can be successfully reproduced in the frame work of our time delayed differential equation model.
Nolting, Nicole; Pöggeler, Stefanie
2006-01-01
MADS box transcription factors control diverse developmental processes in plants, metazoans, and fungi. To analyze the involvement of MADS box proteins in fruiting body development of filamentous ascomycetes, we isolated the mcm1 gene from the homothallic ascomycete Sordaria macrospora, which encodes a putative homologue of the Saccharomyces cerevisiae MADS box protein Mcm1p. Deletion of the S. macrospora mcm1 gene resulted in reduced biomass, increased hyphal branching, and reduced hyphal compartment length during vegetative growth. Furthermore, the S. macrospora Δmcm1 strain was unable to produce fruiting bodies or ascospores during sexual development. A yeast two-hybrid analysis in conjugation with in vitro analyses demonstrated that the S. macrospora MCM1 protein can interact with the putative transcription factor SMTA-1, encoded by the S. macrospora mating-type locus. These results suggest that the S. macrospora MCM1 protein is involved in the transcriptional regulation of mating-type-specific genes as well as in fruiting body development. PMID:16835449
Nolting, Nicole; Pöggeler, Stefanie
2006-07-01
MADS box transcription factors control diverse developmental processes in plants, metazoans, and fungi. To analyze the involvement of MADS box proteins in fruiting body development of filamentous ascomycetes, we isolated the mcm1 gene from the homothallic ascomycete Sordaria macrospora, which encodes a putative homologue of the Saccharomyces cerevisiae MADS box protein Mcm1p. Deletion of the S. macrospora mcm1 gene resulted in reduced biomass, increased hyphal branching, and reduced hyphal compartment length during vegetative growth. Furthermore, the S. macrospora Deltamcm1 strain was unable to produce fruiting bodies or ascospores during sexual development. A yeast two-hybrid analysis in conjugation with in vitro analyses demonstrated that the S. macrospora MCM1 protein can interact with the putative transcription factor SMTA-1, encoded by the S. macrospora mating-type locus. These results suggest that the S. macrospora MCM1 protein is involved in the transcriptional regulation of mating-type-specific genes as well as in fruiting body development.
Shiozawa, J A; Jelenska, M M; Jacobson, B S
1987-07-28
Through the application of a unique method for isolating plasma membranes, it was possible to specifically iodinate cytoplasm-exposed plasma membrane proteins in vegetative cells of the cellular slime mold Dictyostelium discoideum. The original procedure [Chaney, L. K., & Jacobson, B. S. (1983) J. Biol. Chem. 258, 10062] which involved coating cells with colloidal silica has been modified to yield a more pure preparation. The presence of the continuous and dense silica pellicle on the outside surface of the isolated plasma membrane permitted the specific labeling of cytoplasm-exposed membrane proteins. Lactoperoxidase-catalyzed iodination was employed to label cell-surface and cytoplasm-exposed membrane proteins. The isolated and radioiodinated membranes were then compared and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The cell-surface and cytoplasmic face labeling patterns were distinct. A total of 65 proteins were found to be accessible to at least one surface of the membrane. Sixteen intermolecular disulfide bond complexes were observed in the plasma membrane of Dictyostelium; most of these complexes involved glycoproteins and, hence, were exposed to the cell surface.
Shimada, Nao; Nishio, Keiko; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi
2004-10-01
Dd-STATa is a functional Dictyostelium homologue of metazoan STAT (signal transducers and activators of transcription) proteins, which is activated by cAMP and is thereby translocated into the nuclei of anterior tip cells of the prestalk region of the slug. By using in situ hybridization analyses, we found that the SLF308 cDNA clone, which contains the ecmF gene that encodes a putative extracellular matrix protein and is expressed in the anterior tip cells, was greatly down-regulated in the Dd-STATa-null mutant. Disruption of the ecmF gene, however, resulted in almost no phenotypic change. The absence of any obvious mutant phenotype in the ecmF-null mutant could be due to a redundancy of similar genes. In fact, a search of the Dictyostelium whole genome database demonstrates the existence of an additional 16 homologues, all of which contain a cellulose-binding module. Among these homologues, four genes show Dd-STATa-dependent expression, while the others are Dd-STATa-independent. We discuss the potential role of Dd-STATa in morphogenesis via its effect on the interaction between cellulose and these extracellular matrix family proteins.
Adenylyl cyclase localization to the uropod of aggregating Dictyostelium cells requires RacC
Wang, C.; Jung, D.; Cao, Z.; Chung, C. Y.
2015-01-01
The localization of adenylyl cyclase A (ACA) to uropod of cells is required for the stream formation during Dictyostelium development. RacC is a Dictyostelium orthologue of Cdc42. We identified a streaming defect of racC− cells as they are clearly less polarized and form smaller and fragmented streams. ACA-YFP is mainly associated with intracellular vesicular structures, but not with the plasma membrane in racC− cells. racC− cells have a slightly higher number of vesicles than Ax3 cells, suggesting that the defect of ACA trafficking is not simply due to the lack of vesicle formation. While the ACA-YFP vesicles traveled with an average velocity of 9.1 µm/min in Ax3 cells, a slow and diffusional movement without direction with an average velocity of 4 µm/min was maintained in racC− cells. Images acquired by using total internal reflection fluorescence (TIRF) microscopy and fluorescence recovery after photobleaching (FRAP) analysis revealed that a significantly decreased number of ACA-YFP vesicles appeared near the cell membrane, indicating a defect in ACA-YFP vesicle trafficking. These results suggest an important role of RacC in the rapid and directional movements of ACA vesicles on microtubules to the plasma membrane, especially to the back of polarized cell. PMID:26315268
Masloff, S; Pöggeler, S; Kück, U
1999-05-01
During sexual morphogenesis, the filamentous ascomycete Sordaria macrospora differentiates into multicellular fruiting bodies called perithecia. Previously it has been shown that this developmental process is under polygenic control. To further understand the molecular mechanisms involved in fruiting body formation, we generated the protoperithecia forming mutant pro1, in which the normal development of protoperithecia into perithecia has been disrupted. We succeeded in isolating a cosmid clone from an indexed cosmid library, which was able to complement the pro1(-) mutation. Deletion analysis, followed by DNA sequencing, subsequently demonstrated that fertility was restored to the pro1 mutant by an open reading frame encoding a 689-amino-acid polypeptide, which we named PRO1. A region from this polypeptide shares significant homology with the DNA-binding domains found in fungal C6 zinc finger transcription factors, such as the GAL4 protein from yeast. However, other typical regions of C6 zinc finger proteins, such as dimerization elements, are absent in PRO1. The involvement of the pro1(+) gene in fruiting body development was further confirmed by trying to complement the mutant phenotype with in vitro mutagenized and truncated versions of the pro1 open reading frame. Southern hybridization experiments also indicated that pro1(+) homologues are present in other sexually propagating filamentous ascomycetes.
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
Jiaojiao, Zhang; Fen, Wang; Kuanbo, Liu; Qing, Liu; Ying, Yang; Caihong, Dong
2018-05-01
Cordyceps militaris is a highly valued edible and medicinal fungus due to its production of various metabolites, including adenosine, cordycepin, N 6 -(2-hydroxyethyl)-adenosine, and carotenoids. The contents of these metabolites are indicative of the quality of commercially available fruit body of this fungus. In this work, the effects of environmental abiotic factors, including heat and light stresses, on the fruit body growth and metabolite production in C. militaris were evaluated during the late growth stage. The optimal growth temperature of C. militaris was 20 °C. It was found that a heat stress of 25 °C for 5-20 days during the late growth stage significantly promoted cordycepin and carotenoid production without affecting the biological efficiency. Light stress at 6000 lx for 5-20 days during the late growth stage significantly promoted cordycepin production but decreased the carotenoid content. Both heat and light stresses promoted N 6 -(2-hydroxyethyl)-adenosine production. In addition, gene expression analysis showed that there were simultaneous increases in the expression of genes encoding a metal-dependent phosphohydrolase (CCM_04437) and ATP phosphoribosyltransferase (CCM_04438) that are involved in the cordycepin biosynthesis pathway, which was consistent with the accumulation of cordycepin during heat stress for 5-20 days. A positive weak correlation between the cordycepin and adenosine contents was observed with a Pearson correlation coefficient of 0.338 (P < 0.05). The results presented herein provide a new strategy for the production of a superior quality fruit body of C. militaris and contribute to further elucidation of the effects of abiotic stress on metabolite accumulation in fungi.
Masloff, S; Pöggeler, S; Kück, U
1999-01-01
During sexual morphogenesis, the filamentous ascomycete Sordaria macrospora differentiates into multicellular fruiting bodies called perithecia. Previously it has been shown that this developmental process is under polygenic control. To further understand the molecular mechanisms involved in fruiting body formation, we generated the protoperithecia forming mutant pro1, in which the normal development of protoperithecia into perithecia has been disrupted. We succeeded in isolating a cosmid clone from an indexed cosmid library, which was able to complement the pro1(-) mutation. Deletion analysis, followed by DNA sequencing, subsequently demonstrated that fertility was restored to the pro1 mutant by an open reading frame encoding a 689-amino-acid polypeptide, which we named PRO1. A region from this polypeptide shares significant homology with the DNA-binding domains found in fungal C6 zinc finger transcription factors, such as the GAL4 protein from yeast. However, other typical regions of C6 zinc finger proteins, such as dimerization elements, are absent in PRO1. The involvement of the pro1(+) gene in fruiting body development was further confirmed by trying to complement the mutant phenotype with in vitro mutagenized and truncated versions of the pro1 open reading frame. Southern hybridization experiments also indicated that pro1(+) homologues are present in other sexually propagating filamentous ascomycetes. PMID:10224253
Watson, N; McGuire, V; Alexander, S
1994-09-01
The PsB glycoprotein in Dictyostelium discoideum is one of a diverse group of developmentally regulated, prespore-cell-specific proteins, that contain a common O-linked oligosaccharide. This post-translational modification is dependent on the wild-type modB allele. The PsB protein exists as part of a multiprotein complex of six different proteins, which have different post-translational modifications and are held together by both covalent and non-covalent interactions (Watson et al. (1993). J. Biol. Chem. 268, 22634-22641). In this study we have used microscopic and biochemical analyses to examine the cellular localization and function of the PsB complex during development. We found that the PsB complex first accumulates in prespore vesicles in slug cells and is secreted later during culmination and becomes localized to both the extracellular matrix of the apical spore mass of mature fruiting bodies and to the inner layer of the spore coat. The PsB associated with the spore coat is covalently bound by disulfide bridges. The PsB protein always exists in a multiprotein complex, but the composition of the PsB complex changes during secretion and spore maturation. Some of the PsB complex proteins have been identified as spore coat proteins. These data demonstrate that some of the proteins that form the spore coat exist as a preassembled precursor complex. The PsB complex is secreted in a developmentally regulated manner during the process of spore differentiation, at which time proteins of the complex, as well as additional spore coat proteins, become covalently associated in at least two forms of extracellular matrix: the interspore matrix and the spore coat. These and other studies show that proteins with modB dependent O-linked oligosaccharides are involved in a wide variety of processes underlying morphogenesis in this organism. These developmental processes are the direct result of cellular mechanisms regulating protein targeting, assembly and secretion, and the
Paradoxical Effects of Fruit on Obesity
Sharma, Satya P.; Chung, Hea J.; Kim, Hyeon J.; Hong, Seong T.
2016-01-01
Obesity is exponentially increasing regardless of its preventable characteristics. The current measures for preventing obesity have failed to address the severity and prevalence of obesity, so alternative approaches based on nutritional and diet changes are attracting attention for the treatment of obesity. Fruit contains large amounts of simple sugars (glucose, fructose, sucrose, etc.), which are well known to induce obesity. Thus, considering the amount of simple sugars found in fruit, it is reasonable to expect that their consumption should contribute to obesity rather than weight reduction. However, epidemiological research has consistently shown that most types of fruit have anti-obesity effects. Thus, due to their anti-obesity effects as well as their vitamin and mineral contents, health organizations are suggesting the consumption of fruit for weight reduction purposes. These contradictory characteristics of fruit with respect to human body weight management motivated us to study previous research to understand the contribution of different types of fruit to weight management. In this review article, we analyze and discuss the relationships between fruit and their anti-obesity effects based on numerous possible underlying mechanisms, and we conclude that each type of fruit has different effects on body weight. PMID:27754404
Hyun, Sun-Hee; Lee, Seok-Young; Sung, Gi-Ho; Kim, Seong Hwan; Choi, Hyung-Kyoon
2013-01-01
The metabolic profiles of Cordyceps bassiana according to fruiting body developmental stage were investigated using gas chromatography-mass spectrometry. We were able to detect 62 metabolites, including 48 metabolites from 70% methanol extracts and 14 metabolites from 100% n-hexane extracts. These metabolites were classified as alcohols, amino acids, organic acids, phosphoric acids, purine nucleosides and bases, sugars, saturated fatty acids, unsaturated fatty acids, or fatty amides. Significant changes in metabolite levels were found according to developmental stage. Relative levels of amino acids, purine nucleosides, and sugars were higher in development stage 3 than in the other stages. Among the amino acids, valine, isoleucine, lysine, histidine, glutamine, and aspartic acid, which are associated with ABC transporters and aminoacyl-tRNA biosynthesis, also showed higher levels in stage 3 samples. The free radical scavenging activities, which were significantly higher in stage 3 than in the other stages, showed a positive correlation with purine nucleoside metabolites such as adenosine, guanosine, and inosine. These results not only show metabolic profiles, but also suggest the metabolic pathways associated with fruiting body development stages in cultivated C. bassiana. PMID:24058459
Benucci, Gian Maria Niccolò; Bonito, Gregory M
2016-07-01
Fungi that produce their fruiting bodies underground within the soil profile are known commonly as truffles. Truffle fruiting bodies harbor a diverse but poorly understood microbial community of bacteria, yeasts, and filamentous fungi. In this study, we used next-generation 454 amplicon pyrosequencing of the V1 and V4 region of the bacterial 16S ribosomal DNA (rDNA) in order to characterize and compare effects of truffle species and geographic origin on the truffle microbiome. We compared truffle microbiomes of the glebal tissue for eight truffle species belonging to four distinct genera within the Pezizales: Tuber, Terfezia, Leucangium, and Kalapuya. The bacterial community within truffles was dominated by Proteobacteria, Bacterioides, Actinobacteria, and Firmicutes. Bacterial richness within truffles was quite low overall, with between 2-23 operational taxonomic units (OTUs). Notably, we found a single Bradyrhizobium OTU to be dominant within truffle species belonging to the genus Tuber, irrespective of geographic origin, but not in other truffle genera sampled. This study offers relevant insights into the truffle microbiome and raises questions concerning the recruitment and function of these fungal-associated bacteria consortia.
Metallic elements (Ca, Hg, Fe, K, Mg, Mn, Na, Zn) in the fruiting bodies of Boletus badius.
Kojta, Anna K; Falandysz, Jerzy
2016-06-01
The aim of this study was to investigate and compare the levels of eight metallic elements in the fruiting bodies of Bay Bolete (Boletus badius; current name Imleria badia) collected from ten sites in Poland to understand better the value of this popular mushroom as an organic food. Bay Bolete fruiting bodies were collected from the forest area near the towns and villages of Kętrzyn, Poniatowa, Bydgoszcz, Pelplin, Włocławek, Żuromin, Chełmno, Ełk and Wilków communities, as well as in the Augustów Primeval Forest. Elements such as Ca, Fe, K, Mg, Mn, Na and Zn were analyzed by inductively coupled plasma atomic emission spectroscopy (ICP-OES), and mercury by cold vapor atomic absorption spectrometry (CV-AAS). This made it possible to assess the nutritional value of the mushroom, as well as possible toxicological risks associated with its consumption. The results were subjected to statistical analysis (Kruskal-Wallis test, cluster analysis, principal component analysis). Copyright © 2016 Elsevier Ltd. All rights reserved.
Fang, Sheng-Tao; Zhang, Ling; Li, Zheng-Hui; Li, Bo; Liu, Ji-Kai
2010-09-01
Two new cyathane-type diterpenoids, nigernin A and B (1, 2), one new nitrogenous terphenyl derivative, phellodonin (3), together with three known compounds, 2',3'-diacetoxy-3,4,5',6',4''-pentahydroxy-p-terphenyl, grifolin, and 4-O-methylgrifolic acid, were isolated from the fruiting bodies of basidiomycete Phellodon niger. The structures of these new compounds were elucidated by spectroscopic methods and comparison with the data of known compounds in the literature. All these compounds were isolated from this fungus for the first time.
Rivero, Francisco; Muramoto, Tetsuya; Meyer, Ann-Kathrin; Urushihara, Hideko; Uyeda, Taro QP; Kitayama, Chikako
2005-01-01
Background Formins are multidomain proteins defined by a conserved FH2 (formin homology 2) domain with actin nucleation activity preceded by a proline-rich FH1 (formin homology 1) domain. Formins act as profilin-modulated processive actin nucleators conserved throughout a wide range of eukaryotes. Results We present a detailed sequence analysis of the 10 formins (ForA to J) identified in the genome of the social amoeba Dictyostelium discoideum. With the exception of ForI and ForC all other formins conform to the domain structure GBD/FH3-FH1-FH2-DAD, where DAD is the Diaphanous autoinhibition domain and GBD/FH3 is the Rho GTPase-binding domain/formin homology 3 domain that we propose to represent a single domain. ForC lacks a FH1 domain, ForI lacks recognizable GBD/FH3 and DAD domains and ForA, E and J have additional unique domains. To establish the relationship between formins of Dictyostelium and other organisms we constructed a phylogenetic tree based on the alignment of FH2 domains. Real-time PCR was used to study the expression pattern of formin genes. Expression of forC, D, I and J increased during transition to multi-cellular stages, while the rest of genes displayed less marked developmental variations. During sexual development, expression of forH and forI displayed a significant increase in fusion competent cells. Conclusion Our analysis allows some preliminary insight into the functionality of Dictyostelium formins: all isoforms might display actin nucleation activity and, with the exception of ForI, might also be susceptible to autoinhibition and to regulation by Rho GTPases. The architecture GBD/FH3-FH1-FH2-DAD appears common to almost all Dictyostelium, fungal and metazoan formins, for which we propose the denomination of conventional formins, and implies a common regulatory mechanism. PMID:15740615
Rivero, Francisco; Muramoto, Tetsuya; Meyer, Ann-Kathrin; Urushihara, Hideko; Uyeda, Taro Q P; Kitayama, Chikako
2005-03-01
Formins are multidomain proteins defined by a conserved FH2 (formin homology 2) domain with actin nucleation activity preceded by a proline-rich FH1 (formin homology 1) domain. Formins act as profilin-modulated processive actin nucleators conserved throughout a wide range of eukaryotes. We present a detailed sequence analysis of the 10 formins (ForA to J) identified in the genome of the social amoeba Dictyostelium discoideum. With the exception of ForI and ForC all other formins conform to the domain structure GBD/FH3-FH1-FH2-DAD, where DAD is the Diaphanous autoinhibition domain and GBD/FH3 is the Rho GTPase-binding domain/formin homology 3 domain that we propose to represent a single domain. ForC lacks a FH1 domain, ForI lacks recognizable GBD/FH3 and DAD domains and ForA, E and J have additional unique domains. To establish the relationship between formins of Dictyostelium and other organisms we constructed a phylogenetic tree based on the alignment of FH2 domains. Real-time PCR was used to study the expression pattern of formin genes. Expression of forC, D, I and J increased during transition to multi-cellular stages, while the rest of genes displayed less marked developmental variations. During sexual development, expression of forH and forI displayed a significant increase in fusion competent cells. Our analysis allows some preliminary insight into the functionality of Dictyostelium formins: all isoforms might display actin nucleation activity and, with the exception of ForI, might also be susceptible to autoinhibition and to regulation by Rho GTPases. The architecture GBD/FH3-FH1-FH2-DAD appears common to almost all Dictyostelium, fungal and metazoan formins, for which we propose the denomination of conventional formins, and implies a common regulatory mechanism.
Platt, James L; Kent, Nicholas A; Kimmel, Alan R; Harwood, Adrian J
2017-04-01
Nucleosome placement and repositioning can direct transcription of individual genes; however, the precise interactions of these events are complex and largely unresolved at the whole-genome level. The Chromodomain-Helicase-DNA binding (CHD) Type III proteins are a subfamily of SWI2/SNF2 proteins that control nucleosome positioning and are associated with several complex human disorders, including CHARGE syndrome and autism. Type III CHDs are required for multicellular development of animals and Dictyostelium but are absent in plants and yeast. These CHDs can mediate nucleosome translocation in vitro, but their in vivo mechanism is unknown. Here, we use genome-wide analysis of nucleosome positioning and transcription profiling to investigate the in vivo relationship between nucleosome positioning and gene expression during development of wild-type (WT) Dictyostelium and mutant cells lacking ChdC, a Type III CHD protein ortholog. We demonstrate major nucleosome positional changes associated with developmental gene regulation in WT. Loss of chdC caused an increase of intragenic nucleosome spacing and misregulation of gene expression, affecting ∼50% of the genes that are repositioned during WT development. These analyses demonstrate active nucleosome repositioning during Dictyostelium multicellular development, establish an in vivo function of CHD Type III chromatin remodeling proteins in this process, and reveal the detailed relationship between nucleosome positioning and gene regulation, as cells transition between developmental states. © 2017 Platt et al.; Published by Cold Spring Harbor Laboratory Press.
Robery, Steven; Mukanowa, Janina; Percie du Sert, Nathalie; Andrews, Paul L R; Williams, Robin S B
2011-01-01
Novel chemical entities (NCEs) may be investigated for emetic liability in a range of unpleasant experiments involving retching, vomiting or conditioned taste aversion/food avoidance in sentient animals. We have used a range of compounds with known emetic /aversive properties to examine the possibility of using the social amoeba, Dictyostelium discoideum, for research into identifying and understanding emetic liability, and hence reduce adverse animal experimentation in this area. Twenty eight emetic or taste aversive compounds were employed to investigate the acute (10 min) effect of compounds on Dictyostelium cell behaviour (shape, speed and direction of movement) in a shallow chemotaxic gradient (Dunn chamber). Compound concentrations were chosen based on those previously reported to be emetic or aversive in in vivo studies and results were recorded and quantified by automated image analysis. Dictyostelium cell motility was rapidly and strongly inhibited by four structurally distinct tastants (three bitter tasting compounds--denatonium benzoate, quinine hydrochloride, phenylthiourea, and the pungent constituent of chilli peppers--capsaicin). In addition, stomach irritants (copper chloride and copper sulphate), and a phosphodiesterase IV inhibitor also rapidly blocked movement. A concentration-dependant relationship was established for five of these compounds, showing potency of inhibition as capsaicin (IC(50) = 11.9 ± 4.0 µM) > quinine hydrochloride (IC(50) = 44.3 ± 6.8 µM) > denatonium benzoate (IC(50) = 129 ± 4 µM) > phenylthiourea (IC(50) = 366 ± 5 µM) > copper sulphate (IC(50) = 1433 ± 3 µM). In contrast, 21 compounds within the cytotoxic and receptor agonist/antagonist classes did not affect cell behaviour. Further analysis of bitter and pungent compounds showed that the effect on cell behaviour was reversible and not cytotoxic, suggesting an uncharacterised molecular mechanism of action for these compounds. These results therefore demonstrate
Robery, Steven; Mukanowa, Janina; Percie du Sert, Nathalie; Andrews, Paul L. R.; Williams, Robin S. B.
2011-01-01
Novel chemical entities (NCEs) may be investigated for emetic liability in a range of unpleasant experiments involving retching, vomiting or conditioned taste aversion/food avoidance in sentient animals. We have used a range of compounds with known emetic /aversive properties to examine the possibility of using the social amoeba, Dictyostelium discoideum, for research into identifying and understanding emetic liability, and hence reduce adverse animal experimentation in this area. Twenty eight emetic or taste aversive compounds were employed to investigate the acute (10 min) effect of compounds on Dictyostelium cell behaviour (shape, speed and direction of movement) in a shallow chemotaxic gradient (Dunn chamber). Compound concentrations were chosen based on those previously reported to be emetic or aversive in in vivo studies and results were recorded and quantified by automated image analysis. Dictyostelium cell motility was rapidly and strongly inhibited by four structurally distinct tastants (three bitter tasting compounds - denatonium benzoate, quinine hydrochloride, phenylthiourea, and the pungent constituent of chilli peppers - capsaicin). In addition, stomach irritants (copper chloride and copper sulphate), and a phosphodiesterase IV inhibitor also rapidly blocked movement. A concentration-dependant relationship was established for five of these compounds, showing potency of inhibition as capsaicin (IC50 = 11.9±4.0 µM) > quinine hydrochloride (IC50 = 44.3±6.8 µM) > denatonium benzoate (IC50 = 129±4 µM) > phenylthiourea (IC50 = 366±5 µM) > copper sulphate (IC50 = 1433±3 µM). In contrast, 21 compounds within the cytotoxic and receptor agonist/antagonist classes did not affect cell behaviour. Further analysis of bitter and pungent compounds showed that the effect on cell behaviour was reversible and not cytotoxic, suggesting an uncharacterised molecular mechanism of action for these compounds. These results therefore demonstrate
Chen, Xian-Qiang; Chen, Ling-Xiao; Li, Shao-Ping; Zhao, Jing
2017-12-01
One new expoxy nortriterpenoid (1) and one new ergostane-type steroid (2), together with seven known steroids (3-9), were obtained from the fruiting bodies of the fungus Ganoderma resinaceum. The new compounds were elucidated on the basis of extensive spectroscopic data (MS, NMR, IR, and UV) and the known compounds were identified by comparing spectroscopic data with those reported in literature.
The Dictyostelium discoideum RACK1 orthologue has roles in growth and development
2014-01-01
Background The receptor for activated C-kinase 1 (RACK1) is a conserved protein belonging to the WD40 repeat family of proteins. It folds into a beta propeller with seven blades which allow interactions with many proteins. Thus it can serve as a scaffolding protein and have roles in several cellular processes. Results We identified the product of the Dictyostelium discoideum gpbB gene as the Dictyostelium RACK1 homolog. The protein is mainly cytosolic but can also associate with cellular membranes. DdRACK1 binds to phosphoinositides (PIPs) in protein-lipid overlay and liposome-binding assays. The basis of this activity resides in a basic region located in the extended loop between blades 6 and 7 as revealed by mutational analysis. Similar to RACK1 proteins from other organisms DdRACK1 interacts with G protein subunits alpha, beta and gamma as shown by yeast two-hybrid, pulldown, and immunoprecipitation assays. Unlike the Saccharomyces cerevisiae and Cryptococcus neoformans RACK1 proteins it does not appear to take over Gβ function in D. discoideum as developmental and other defects were not rescued in Gβ null mutants overexpressing GFP-DdRACK1. Overexpression of GFP-tagged DdRACK1 and a mutant version (DdRACK1mut) which carried a charge-reversal mutation in the basic region in wild type cells led to changes during growth and development. Conclusion DdRACK1 interacts with heterotrimeric G proteins and can through these interactions impact on processes specifically regulated by these proteins. PMID:24930026
Reczyński, Witold; Muszyńska, Bożena; Opoka, Włodzimierz; Smalec, Agata; Sułkowska-Ziaja, Katarzyna; Malec, Mirosław
2013-06-01
Cantharellus cibarius Fr. (chanterelle) and Boletus badius Pers. (bay bolete) harvested from natural sites in Poland were used to derive in vitro cultures. The optimal medium composition for cultures was developed. Concentrations of the chosen elements (Zn, Cu, Fe, Mg, Ni, and Cd) in mycelium samples were measured by means of atomic absorption spectrometry. Fe concentration in the analyzed mushroom materials was in the range 215.4-680.3 μg/g dry weight. Mean values of Mg were respectively (in micrograms per gram dry weight) 541.8 for mycelium of C. cibarius cultured in vitro and 1,004.1 for C. cibarius fruiting bodies and 928.9 for the mycelium of B. badius cultured in vitro and 906.4 for B. badius fruiting bodies. The mean concentrations of Zn were 442.7 μg/g dry weight in mycelium from in vitro cultures of B. badius and 172.1 in B. badius fruiting bodies and 131.9 in the case of C. cibarius in mycelium from in vitro cultures and 95.5 for the C. cibarius fruiting bodies. Cu exhibited a reversal tendency, i.e., the element concentrations in naturally grown mushrooms were significantly higher (43.57 μg/g dry weight for C. cibarius and 43.54 μg/g for B. badius) than in cultured in vitro mycelium (12.47 μg/g for C. cibarius and 4.17 μg/g for B. badius). Ni was found in lowest concentrations ranging from 0.33 to 1.88 μg/g dry weight. Toxic metal Cd was found in relatively high concentrations in naturally grown species (0.79 μg/g dry weight-1.02). The lowest was the concentration of Cd in C. cibarius mycelium from in vitro culture-0.06 μg/g dry weight-a bit higher than it was in the B. badius mycelium (0.21 μg/g).
Gao, Yuan; Xu, Hongyu; Lu, Zhenming; Xu, Zhenghong
2009-11-01
This study describes the method of quantitative determination of betulin, ergosterol, cholesterol, lanosterol, stigmasterol and sitosterol in the fruiting bodies and submerged-cultured mycelia of Inonotus obliquus. A high performance liquid chromatographic (HPLC) method was applied to separate these steroids. The procedure was carried out on a reversed-phase C, column, using a stepwise gradient of water-methanol as mobile phase with the following profile: 0-10 min, 10% water, 90% methanol; 10-40 min, 3% water, 97% methanol. The flow rate was 1.4 mL/min and the detection wavelength was 202 nm. The analysis was completed within 40 min. The results showed that this method has good reproducibility and satisfactory recoveries for the determination of steroids. The relative standard deviations of the peak areas were less than 2.94% (n = 5) for intraday assays. A good linear correlation was obtained in a range of 0.4-4.8 microg. The recoveries of betulin, ergosterol, cholesterol, lanosterol, stigmasterol, and sitosterol were 100.05%-100.72%, 99.31%-101.04%, 97.52%-101.63%, 96.61%-100.08%, 96.21%-100.76% and 100.04%-100.51%, respectively. This method can be applied to evaluate real samples, and it is rapid, accurate and suitable for the quantitative determination of steroids in the fruiting bodies and submerged-cultured mycelia of Inonotus obliquus.
Chen, Bingzhi; van Peer, Arend F; Yan, Junjie; Li, Xiao; Xie, Bin; Miao, Juan; Huang, Qianhui; Zhang, Lei; Wang, Wei; Fu, Junsheng; Zhang, Xiang; Zhang, Xiaoyin; Hu, Fengli; Kong, Qingfang; Sun, Xianyun; Zou, Feng; Zhang, Hanxing; Li, Shaojie; Xie, Baogui
2016-07-07
Volvariella volvacea is an important crop in Southeast Asia, but erratic fruiting presents a serious challenge for its production and breeding. Efforts to explain inconsistent fruiting have been complicated by the multinucleate nature, typical lack of clamp connections, and an incompletely identified sexual reproductive system. In this study, we addressed the life cycle of V. volvacea using whole genome sequencing, cloning of MAT loci, karyotyping of spores, and fruiting assays. Microscopy analysis of spores had previously indicated the possible coexistence of heterothallic and homothallic life cycles. Our analysis of the MAT loci showed that only MAT-A, and not MAT-B, controlled heterokaryotization. Thus, the heterothallic life cycle was bipolar. Karyotyping of single spore isolates (SSIs) using molecular markers supported the existence of heterokaryotic spores. However, most SSIs were clearly not heterokaryotic, yet contained structural variation (SV) markers relating to both alleles of both parents. Heterokaryons from crossed, self-sterile homokaryons could produce fruiting bodies, agreeing with bipolar heterothallism. Meanwhile, some SSIs with two different MAT-A loci also produced fruiting bodies, which supported secondary homothallism. Next, SSIs that clearly contained only one MAT-A locus (homothallism) were also able to fruit, demonstrating that self-fertile SSIs were not, per definition, secondary homothallic, and that a third life cycle or genetic mechanism must exist. Finally, recombination between SV markers was normal, yet 10 out of 24 SV markers showed 1:2 or 1:3 distributions in the spores, and large numbers of SSIs contained doubled SV markers. This indicated selfish genes, and possibly partial aneuploidy. Copyright © 2016 Chen et al.
Thutupalli, Shashi; Sun, Mingzhai; Bunyak, Filiz; Palaniappan, Kannappan; Shaevitz, Joshua W.
2015-01-01
The formation of a collectively moving group benefits individuals within a population in a variety of ways. The surface-dwelling bacterium Myxococcus xanthus forms dynamic collective groups both to feed on prey and to aggregate during times of starvation. The latter behaviour, termed fruiting-body formation, involves a complex, coordinated series of density changes that ultimately lead to three-dimensional aggregates comprising hundreds of thousands of cells and spores. How a loose, two-dimensional sheet of motile cells produces a fixed aggregate has remained a mystery as current models of aggregation are either inconsistent with experimental data or ultimately predict unstable structures that do not remain fixed in space. Here, we use high-resolution microscopy and computer vision software to spatio-temporally track the motion of thousands of individuals during the initial stages of fruiting-body formation. We find that cells undergo a phase transition from exploratory flocking, in which unstable cell groups move rapidly and coherently over long distances, to a reversal-mediated localization into one-dimensional growing streams that are inherently stable in space. These observations identify a new phase of active collective behaviour and answer a long-standing open question in Myxococcus development by describing how motile cell groups can remain statistically fixed in a spatial location. PMID:26246416
Nowrousian, Minou; Cebula, Patricia
2005-11-03
The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies called perithecia that protect the developing ascospores and ensure their proper discharge. In previous microarray analyses, several genes have been identified that are downregulated in sterile mutants compared to the wild type. Among these genes was tap1 (transcript associated with perithecial development), a gene encoding a putative lectin homolog. Analysis of tap1 transcript levels in the wild type under conditions allowing only vegetative growth compared to conditions that lead to fruiting body development showed that tap1 is not only downregulated in developmental mutants but is also upregulated in the wild type during fruiting body development. We have cloned and sequenced a 3.2 kb fragment of genomic DNA containing the tap1 open reading frame and adjoining sequences. The genomic region comprising tap1 is syntenic to its homologous region in the closely related filamentous fungus Neurospora crassa. To determine whether tap1 is involved in fruiting body development in S. macrospora, a knockout construct was generated in which the tap1 open reading frame was replaced by the hygromycin B resistance gene hph under the control of fungal regulatory regions. Transformation of the S. macrospora wild type with this construct resulted in a tap1 deletion strain where tap1 had been replaced by the hph cassette. The knockout strain displayed no phenotypic differences under conditions of vegetative growth and sexual development when compared to the wild type. Double mutants carrying the Deltatap1 allele in several developmental mutant backgrounds were phenotypically similar to the corresponding developmental mutant strains. The tap1 transcript is strongly upregulated during sexual development in S. macrospora; however, analysis of a tap1 knockout strain shows that tap1 is not essential for fruiting body formation in S. macrospora.
Nowrousian, Minou; Cebula, Patricia
2005-01-01
Background The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies called perithecia that protect the developing ascospores and ensure their proper discharge. In previous microarray analyses, several genes have been identified that are downregulated in sterile mutants compared to the wild type. Among these genes was tap1 (transcript associated with perithecial development), a gene encoding a putative lectin homolog. Results Analysis of tap1 transcript levels in the wild type under conditions allowing only vegetative growth compared to conditions that lead to fruiting body development showed that tap1 is not only downregulated in developmental mutants but is also upregulated in the wild type during fruiting body development. We have cloned and sequenced a 3.2 kb fragment of genomic DNA containing the tap1 open reading frame and adjoining sequences. The genomic region comprising tap1 is syntenic to its homologous region in the closely related filamentous fungus Neurospora crassa. To determine whether tap1 is involved in fruiting body development in S. macrospora, a knockout construct was generated in which the tap1 open reading frame was replaced by the hygromycin B resistance gene hph under the control of fungal regulatory regions. Transformation of the S. macrospora wild type with this construct resulted in a tap1 deletion strain where tap1 had been replaced by the hph cassette. The knockout strain displayed no phenotypic differences under conditions of vegetative growth and sexual development when compared to the wild type. Double mutants carrying the Δtap1 allele in several developmental mutant backgrounds were phenotypically similar to the corresponding developmental mutant strains. Conclusion The tap1 transcript is strongly upregulated during sexual development in S. macrospora; however, analysis of a tap1 knockout strain shows that tap1 is not essential for fruiting body formation in S. macrospora. PMID:16266439
NASA Astrophysics Data System (ADS)
Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard
2010-03-01
In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.
Govender, Nisha T; Mahmood, Maziah; Seman, Idris A; Mui-Yun, Wong
2016-08-26
Ganoderma boninense, a phytopathogenic white rot fungus had sought minimal genetic characterizations despite huge biotechnological potentials. Thus, efficient collection of fruiting body, basidiospore and protoplast of G. boninense is described. Matured basidiocarp raised under the glasshouse conditions yielded a total of 8.3 × 104 basidiospores/ml using the low speed centrifugation technique. Mycelium aged 3-day-old treated under an incubation period of 3 h in lysing enzyme from Trichoderma harzianum (10 mg/ml) suspended in osmotic stabilizer (0.6 M potassium chloride and 20 mM dipotassium phosphate buffer) yielded the highest number of viable protoplasts (8.9 × 106 single colonies) among all possible combinations tested (regeneration media, age of mycelium, osmotic stabilizer, digestive enzyme and incubation period).
Content of selected elements in Boletus badius fruiting bodies growing in extremely polluted wastes.
Mleczek, Mirosław; Siwulski, Marek; Mikołajczak, Patrycja; Gąsecka, Monika; Sobieralski, Krzysztof; Szymańczyk, Mateusz; Goliński, Piotr
2015-01-01
The aim of the study was to analyse levels of 17 trace elements and 5 major minerals in 11 Boletus badius fruiting bodies able to grow in extremely polluted waste (flotation tailings) and polluted soil in southern Poland. The presented data widen the limited literature data about the abilities of wild-growing mushroom species to grow on heavily contaminated substrates. Content of elements in waste, soil and mushrooms was analysed by flame atomic absorption spectrometry (FAAS) and cold vapour atomic absorption spectrometry (CVAAS - Hg). The industrial areas differed greatly as regards the content of elements in flotation tailings and soil; therefore differences in Ag, Ba, Cd, Co, Fe, Mo, Ni, Pb, Ca, K, Mg, Na and P accumulation in mushrooms were observed. The highest contents of elements in mushrooms were observed for: As, Al, Cu and Zn (86 ± 28, 549 ± 116, 341 ± 59 and 506 ± 40 mg kg(-1) dry matter, respectively). Calculated bioconcentration factor (BCF) values were higher than 1 for Al (15.1-16.9), Fe (10.6-24.4) and Hg (10.2-16.4) only. The main value of the presented results is the fact that one of the common wild-growing mushroom species was able to grow on flotation tailings containing over 22 g kg(-1) of As and, additionally, effective accumulation of other elements was observed. In view of the high content of the majority of analysed elements in fruiting bodies, edible mushrooms from such polluted areas are nonconsumable.
The filamentous fungus Sordaria macrospora as a genetic model to study fruiting body development.
Teichert, Ines; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich
2014-01-01
Filamentous fungi are excellent experimental systems due to their short life cycles as well as easy and safe manipulation in the laboratory. They form three-dimensional structures with numerous different cell types and have a long tradition as genetic model organisms used to unravel basic mechanisms underlying eukaryotic cell differentiation. The filamentous ascomycete Sordaria macrospora is a model system for sexual fruiting body (perithecia) formation. S. macrospora is homothallic, i.e., self-fertile, easily genetically tractable, and well suited for large-scale genomics, transcriptomics, and proteomics studies. Specific features of its life cycle and the availability of a developmental mutant library make it an excellent system for studying cellular differentiation at the molecular level. In this review, we focus on recent developments in identifying gene and protein regulatory networks governing perithecia formation. A number of tools have been developed to genetically analyze developmental mutants and dissect transcriptional profiles at different developmental stages. Protein interaction studies allowed us to identify a highly conserved eukaryotic multisubunit protein complex, the striatin-interacting phosphatase and kinase complex and its role in sexual development. We have further identified a number of proteins involved in chromatin remodeling and transcriptional regulation of fruiting body development. Furthermore, we review the involvement of metabolic processes from both primary and secondary metabolism, and the role of nutrient recycling by autophagy in perithecia formation. Our research has uncovered numerous players regulating multicellular development in S. macrospora. Future research will focus on mechanistically understanding how these players are orchestrated in this fungal model system. Copyright © 2014 Elsevier Inc. All rights reserved.
Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz
2012-01-01
Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.
NASA Astrophysics Data System (ADS)
Falandysz, J.; Kubotal, R.; Kunito, T.; Bielawski, L.; Brzostowski, A.; Gucia, M.; Jedrusiak, A.; Lipka, K.; Tanabe, S.
2003-05-01
The relationships between concentrations of total selenium and mercury were investigated for the whole fruiting bodies, caps and/or stalks of King bolete (Boletus edulis), Brown birch scaber stalk (Leccinum scabrum), Parasol mushroom (Macrolepiota procera), Poison pax (Paxillus involutus) and Fly agaric (Amatiita niuscaria) collected from the various sites in Poland. The mushroom species examined varied largely due to the contents and proportions between the total selenium and mercury concentrations, what seems to indicate on species-dependent strategy of co-uptake and accumulation of these elements.
Differentiation of Dictyostelium discoideum vegetative cells into spores during earth orbit in space
NASA Astrophysics Data System (ADS)
Takahashi, A.; Ohnishi, K.; Takahashi, S.; Masukawa, M.; Sekikawa, K.; Amano, T.; Nakano, T.; Nagaoka, S.; Ohnishi, T.
2001-01-01
We reported previously that emerged amoebae of Dictyosterium ( D.) discoideum grew, aggregated and differentiated to fruiting bodies with normal morphology in space. Here, we investigated the effects of space radiation and/or microgravity on the number, viability, kinetics of germination, growth rate and mutation frequency of spores formed in space in a radiation-sensitive strain, γs13, and the parental strain, NC4. In γs13, there were hardly spores in the fruiting bodies formed in space. In NC4, we found a decrease in the number of spores, a delay in germination of the spores and delayed start of cell growth of the spores formed in space when compared to the ground control. However, the mutation frequency of the NC4 spores formed in space was similar to that of the ground control. We conclude that the depression of spore formation might be induced by microgravity and/or space radiation through the depression of some stage(s) of DNA repair during cell differentiation in the slime mold.
Whole-body kinematics of a fruit bat reveal the influence of wing inertia on body accelerations.
Iriarte-Díaz, José; Riskin, Daniel K; Willis, David J; Breuer, Kenneth S; Swartz, Sharon M
2011-05-01
The center of mass (COM) of a flying animal accelerates through space because of aerodynamic and gravitational forces. For vertebrates, changes in the position of a landmark on the body have been widely used to estimate net aerodynamic forces. The flapping of relatively massive wings, however, might induce inertial forces that cause markers on the body to move independently of the COM, thus making them unreliable indicators of aerodynamic force. We used high-speed three-dimensional kinematics from wind tunnel flights of four lesser dog-faced fruit bats, Cynopterus brachyotis, at speeds ranging from 2.4 to 7.8 m s(-1) to construct a time-varying model of the mass distribution of the bats and to estimate changes in the position of their COM through time. We compared accelerations calculated by markers on the trunk with accelerations calculated from the estimated COM and we found significant inertial effects on both horizontal and vertical accelerations. We discuss the effect of these inertial accelerations on the long-held idea that, during slow flights, bats accelerate their COM forward during 'tip-reversal upstrokes', whereby the distal portion of the wing moves upward and backward with respect to still air. This idea has been supported by the observation that markers placed on the body accelerate forward during tip-reversal upstrokes. As in previously published studies, we observed that markers on the trunk accelerated forward during the tip-reversal upstrokes. When removing inertial effects, however, we found that the COM accelerated forward primarily during the downstroke. These results highlight the crucial importance of the incorporation of inertial effects of wing motion in the analysis of flapping flight.
Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report inmore » the interest of brevity.« less
Huber, Robert; O'Day, Danton H
2011-04-01
Current knowledge suggests that cell movement in the eukaryotic slime mold Dictyostelium discoideum is mediated by different signaling pathways involving a number of redundant components. Our previous research has identified a specific motility-enhancing function for epidermal growth factor-like (EGFL) repeats in Dictyostelium, specifically for the EGFL repeats of cyrA, a matricellular, calmodulin (CaM)-binding protein in Dictyostelium. Using mutants of cAMP signaling (carA(-), carC(-), gpaB(-), gpbA(-)), the endogenous calcium (Ca(2+)) release inhibitor TMB-8, the CaM antagonist W-7, and a radial motility bioassay, we show that DdEGFL1, a synthetic peptide whose sequence is obtained from the first EGFL repeat of cyrA, functions independently of the cAMP-mediated signaling pathways to enhance cell motility through a mechanism involving Ca(2+) signaling, CaM, and RasG. We show that DdEGFL1 increases the amounts of polymeric myosin II heavy chain and actin in the cytoskeleton by 24.1±10.7% and 25.9±2.1% respectively and demonstrate a link between Ca(2+)/CaM signaling and cytoskeletal dynamics. Finally, our findings suggest that carA and carC mediate a brake mechanism during chemotaxis since DdEGFL1 enhanced the movement of carA(-)/carC(-) cells by 844±136% compared to only 106±6% for parental DH1 cells. Based on our data, this signaling pathway also appears to involve the G-protein β subunit, RasC, RasGEFA, and protein kinase B. Together, our research provides insight into the functionality of EGFL repeats in Dictyostelium and the signaling pathways regulating cell movement in this model organism. It also identifies several mechanistic components of DdEGFL1-enhanced cell movement, which may ultimately provide a model system for understanding EGFL repeat function in higher organisms. Copyright © 2010 Elsevier Inc. All rights reserved.
Martínez-García, Ricardo; Tarnita, Corina E
2017-08-07
The social amoeba Dictyostelium discoideum has been recently suggested as an example of bet-hedging in microbes. In the presence of resources, amoebae reproduce as unicellular organisms. Resource depletion, however, leads to a starvation phase in which the population splits between aggregators, which form a fruiting body made of a stalk and resistant spores, and non-aggregators, which remain as vegetative cells. Spores are favored when starvation periods are long, but vegetative cells can exploit resources in environments where food replenishes quickly. The investment in aggregators versus non-aggregators can therefore be understood as a bet-hedging strategy that evolves in response to stochastic starvation times. A genotype (or strategy) is defined by the balance between each type of cells. In this framework, if the ecological conditions on a patch are defined in terms of the mean starvation time (i.e. time between the onset of starvation and the arrival of a new food pulse), a single genotype dominates each environment, which is inconsistent with the huge genetic diversity observed in nature. Here we investigate whether seasonality, represented by a periodic, wet-dry alternation in the mean starvation times, allows the coexistence of several strategies in a single patch. We study this question in a non-spatial (well-mixed) setting in which different strains compete for a common pool of resources over a sequence of growth-starvation cycles. We find that seasonality induces a temporal storage effect that can promote the stable coexistence of multiple genotypes. Two conditions need to be met in our model. First, there has to be a temporal niche partitioning (two well-differentiated habitats within the year), which requires not only different mean starvation times between seasons but also low variance within each season. Second, each season's well-adapted strain has to grow and create a large enough population that permits its survival during the subsequent
Pantoea hericii sp. nov., Isolated from the Fruiting Bodies of Hericium erinaceus.
Rong, Chengbo; Ma, Yuanwei; Wang, Shouxian; Liu, Yu; Chen, Sanfeng; Huang, Bin; Wang, Jing; Xu, Feng
2016-06-01
Three Gram-negative, facultatively anaerobic bacterial isolates were obtained from the fruiting bodies of the edible mushroom Hericium erinaceus showing symptoms of soft rot disease in Beijing, China. Sequences of partial 16S rRNA gene placed these isolates in the genus Pantoea. Multilocus sequence analysis based on the partial sequences of atpD, gyrB, infB and rpoB revealed P. eucalypti and P. anthophila as their closest phylogenetic relatives and indicated that these isolates constituted a possible novel species. DNA-DNA hybridization studies confirmed the classification of these isolates as a novel species and phenotypic tests allowed for differentiation from the closest phylogenetic neighbours. The name Pantoea hericii sp. nov. [Type strain LMG 28847(T) = CGMCC 1.15224(T) = JZB 2120024(T)] is proposed.
Zhu, Lina; Tang, Qingjiu; Zhou, Shuai; Liu, Yanfang; Zhang, Zhong; Gao, Xinhua; Wang, Shiping; Wang, Zhaolong
2014-01-01
A novel polysaccharide (CP2-S) was purified from Cordyceps militaris fruit bodies by hot water extraction, ethanol precipitation, DEAE-Sepharose Fast Flow and Sephacryl S-400 high-resolution chromatography. The polysaccharide had a molecular weight of 5.938 × 10(6) g/mol and was mainly composed of glucose. CP2-S had carbohydrate content estimated to be 100% using the phenol-sulfuric acid method. Immunostimulating experiments in vitro indicated that CP2-S could stimulate nitric oxide production, phagocytosis, respiratory burst activity, and secretion of interleukin-1β and interleukin-2 of macrophages, suggesting that this water-soluble polysaccharide from the fruit body of C. militaris is a natural immunostimulating polysaccharide with potential for further application.
Carbohydrate changes during growth and fruiting in Pleurotus ostreatus.
Zhou, Shuai; Ma, Fuying; Zhang, Xiaoyu; Zhang, Jingsong
2016-01-01
The carbohydrate distribution in mushrooms is reported changing greatly in its different regions during growth and fruiting. In this study, the carbohydrate distribution in the compost and fruiting bodies of Pleurotus ostreatus was analysed. Sugar, polyol, polysaccharide, and chitin content during different growth phases and in different regions of the mushroom were determined. Results indicate that trehalose, mannitol, and glucose were first accumulated in the compost and then decreased during differentiation and growth of fruiting bodies. Meanwhile, trehalose, mannitol, and glucose also accumulated in the fruiting bodies and primarily distributed in the stipe, base, and pileus region, respectively. Polysaccharides mainly accumulated within the pileus and stipe regions, and chitin was mainly observed in the base region. These findings provide insights into carbohydrate function and utilisation during mushroom growth. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Spontaneous Symmetry Breaking Turing-Type Pattern Formation in a Confined Dictyostelium Cell Mass
NASA Astrophysics Data System (ADS)
Sawai, Satoshi; Maeda, Yasuo; Sawada, Yasuji
2000-09-01
We have discovered a new type of patterning which occurs in a two-dimensionally confined cell mass of the cellular slime mold Dictyostelium discoideum. Besides the longitudinal structure reported earlier, we observed a spontaneous symmetry breaking spot pattern whose wavelength shows similar strain dependency to that of the longitudinal pattern. We propose that these structures are due to a reaction-diffusion Turing instability similar to the one which has been exemplified by CIMA (chlorite-iodide-malonic acid) reaction. The present finding may exhibit the first biochemical Turing structure in a developmental system with a controllable boundary condition.
Yasukawa, Hiro; Kuroita, Toshihiro; Tamura, Kentaro; Yamaguchi, Kazuo
2003-07-01
Penicillin binding proteins (PBPs) are penicillin-sensitive DD-peptidases catalyzing the terminal stages of bacterial cell wall assembly. We identified a Dictyostelium discoideum gene that encodes a protein of 522 amino acids showing similarity to Escherichia coli PBP4. The D. discoideum protein conserves three consensus sequences (SXXK, SXN and KTG) that are responsible for the catalytic activities of PBPs. The gene product prepared in the cell-free translation system showed carboxypeptidase activity but the activity was not detected in the presence of penicillin G. These results demonstrate that the D. discoideum gene encodes a eukaryotic form of penicillin-sensitive carboxypeptidase.
Mitochondrial Stress Tests Using Seahorse Respirometry on Intact Dictyostelium discoideum Cells.
Lay, Sui; Sanislav, Oana; Annesley, Sarah J; Fisher, Paul R
2016-01-01
Mitochondria not only play a critical and central role in providing metabolic energy to the cell but are also integral to the other cellular processes such as modulation of various signaling pathways. These pathways affect many aspects of cell physiology, including cell movement, growth, division, differentiation, and death. Mitochondrial dysfunction which affects mitochondrial bioenergetics and causes oxidative phosphorylation defects can thus lead to altered cellular physiology and manifest in disease. The assessment of the mitochondrial bioenergetics can thus provide valuable insights into the physiological state, and the alterations to the state of the cells. Here, we describe a method to successfully use the Seahorse XF(e)24 Extracellular Flux Analyzer to assess the mitochondrial respirometry of the cellular slime mold Dictyostelium discoideum.
Lucidumol D, a new lanostane-type triterpene from fruiting bodies of Reishi (Ganoderma lingzhi).
Satria, Dedi; Amen, Yhiya; Niwa, Yasuharu; Ashour, Ahmed; Allam, Ahmed E; Shimizu, Kuniyoshi
2018-02-19
A new lanostane-type triterpenoid, lucidumol D (1) was isolated from the fruiting bodies of Ganoderma lingzhi. Its structure was elucidated on the basis of extensive 1D- and 2D-NMR studies as well as mass spectrometry. The cytotoxicity of lucidumol D against proliferation of several cancer cells were assayed by using MTT method and the obtained result suggested selective anti-proliferative and cytotoxic effects against MCF-7, HepG2, HeLa, Caco-2, and HCT-116. In comparison to lucidumol C (2) isolated previously by our group, the structure-activity relationship indicated that carbonyl function at C-11 is necessary to enhance the cytotoxicity.
Stalk cell differentiation without polyketides in the cellular slime mold.
Sato, Yukie G; Suarez, Teresa; Saito, Tamao
2016-07-01
Polyketides induce prestalk cell differentiation in Dictyostelium. In the double-knockout mutant of the SteelyA and B polyketide synthases, most of the pstA cells-the major part of the prestalk cells-are lost, and we show by whole mount in situ hybridization that expression of prestalk genes is also reduced. Treatment of the double-knockout mutant with the PKS inhibitor cerulenin gave a further reduction, but some pstA cells still remained in the tip region, suggesting the existence of a polyketide-independent subtype of pstA cells. The double-knockout mutant and cerulenin-treated parental Ax2 cells form fruiting bodies with fragile, single-cell layered stalks after cerulenin treatment. Our results indicate that most pstA cells are induced by polyketides, but the pstA cells at the very tip of the slug are induced in some other way. In addition, a fruiting body with a single-cell layered, vacuolated stalk can form without polyketides.
Insights into the Cell Shape Dynamics of Migrating Dictyostelium discoideum
NASA Astrophysics Data System (ADS)
Driscoll, Meghan; Homan, Tess; McCann, Colin; Parent, Carole; Fourkas, John; Losert, Wolfgang
2010-03-01
Dynamic cell shape is a highly visible manifestation of the interaction between the internal biochemical state of a cell and its external environment. We analyzed the dynamic cell shape of migrating cells using the model system Dictyostelium discoideum. Applying a snake algorithm to experimental movies, we extracted cell boundaries in each frame and followed local boundary motion over long time intervals. Using a local motion measure that corresponds to protrusive/retractive activity, we found that protrusions are intermittent and zig-zag, whereas retractions are more sustained and straight. Correlations of this local motion measure reveal that protrusions appear more localized than retractions. Using a local shape measure, curvature, we also found that small peaks in boundary curvature tend to originate at the front of cells and propagate backwards. We will review the possible cytoskeletal origin of these mechanical waves.
Du, Xiu-ju; Zhang, Jing-song; Yang, Yan; Tang, Qing-jiu; Jia, Wei; Pan, Ying-jie
2010-01-01
Ultrafiltration and a series of chromatographic steps were used to isolate and purify polysaccharides from Tremella aurantialba fruit bodies. Three crude fractions (TAP50w, TAP10–50w, and TAP1–10w), five semi-purified fractions (TAPA–TAPE), and one purified fraction (TAPA1) were obtained. A sulfated derivative of TAPA1 (TAPA1-s) was prepared by chemical modification. The immunostimulating activity of the polysaccharide fractions in vitro was determined using the mouse spleen lymphocyte proliferation assay. Of the three crude fractions tested, cell proliferation rates were increased most by TAP50w. Furthermore, TAPA1-s was markedly more stimulatory than TAPA1, indicating that sulfonation was an effective way to enhance the immunostimulating activity of polysaccharide. PMID:20506575
Developmental lineage priming in Dictyostelium by heterogeneous Ras activation.
Chattwood, Alex; Nagayama, Koki; Bolourani, Parvin; Harkin, Lauren; Kamjoo, Marzieh; Weeks, Gerald; Thompson, Christopher R L
2013-11-26
In cell culture, genetically identical cells often exhibit heterogeneous behavior, with only 'lineage primed' cells responding to differentiation inducing signals. It has recently been proposed that such heterogeneity exists during normal embryonic development to allow position independent patterning based on 'salt and pepper' differentiation and sorting out. However, the molecular basis of lineage priming and how it leads to reproducible cell type proportioning are poorly understood. To address this, we employed a novel forward genetic approach in the model organism Dictyostelium discoideum. These studies reveal that the Ras-GTPase regulator gefE is required for normal lineage priming and salt and pepper differentiation. This is because Ras-GTPase activity sets the intrinsic response threshold to lineage specific differentiation signals. Importantly, we show that although gefE expression is uniform, transcription of its target, rasD, is both heterogeneous and dynamic, thus providing a novel mechanism for heterogeneity generation and position-independent differentiation. DOI: http://dx.doi.org/10.7554/eLife.01067.001.
Rai, Amrita; Fedorov, Roman; Manstein, Dietmar J
2014-02-01
Dye-decolourizing peroxidases are haem-containing peroxidases with broad substrate specificity. Using H2O2 as an electron acceptor, they efficiently decolourize various dyes that are of industrial and environmental relevance, such as anthraquninone- and azo-based dyes. In this study, the dye-decolourizing peroxidase DdDyP from Dictyostelium discoideum was overexpressed in Escherichia coli strain Rosetta(DE3)pLysS, purified and crystallized using the vapour-diffusion method. A native crystal diffracted to 1.65 Å resolution and belonged to space group P4(1)2(1)2, with unit-cell parameters a = b = 141.03, c = 95.56 Å, α = β = γ = 90°. The asymmetric unit contains two molecules.
Isolation of Latex Bead Phagosomes from Dictyostelium for in vitro Functional Assays.
D'Souza, Ashwin; Sanghavi, Paulomi; Rai, Ashim; Pathak, Divya; Mallik, Roop
2016-12-05
We describe a protocol to purify latex bead phagosomes (LBPs) from Dictyostelium cells. These can be later used for various in vitro functional assays. For instance, we use these LBPs to understand the microtubule motor-driven transport on in vitro polymerized microtubules. Phagosomes are allowed to mature for defined periods inside cells before extraction for in vitro motility. These assays allow us to probe how lipids on the phagosome membrane recruit and organize motors, and also measure the motion and force generation resulting from underlying lipid-motor interactions. This provides a unique opportunity to interrogate native-like organelles using biophysical and biochemical assays, and understand the role of motor proteins in phagosome maturation and pathogen clearance.
Mleczek, Mirosław; Magdziak, Zuzanna; Gąsecka, Monika; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Zalicka, Sylwia; Sobieralski, Krzysztof
2016-10-01
The aim of the study was to (i) investigate the potential of edible mushroom Boletus badius (Fr.) Fr. to accumulate 53 elements from unpolluted acidic sandy soil and polluted alkaline flotation tailing sites in Poland, (ii) to estimate the low-molecular-weight organic acid (LMWOA) profile and contents in fruit bodies, and finally (iii) to explore the possible relationship between elements and LMWOA content in mushrooms. The content of most elements in fruiting bodies collected from the flotation tailings was significantly higher than in mushrooms from the unpolluted soils. The occurrence of elements determined in fruiting bodies of B. badius has been varied (from 0.01 mg kg -1 for Eu, Lu, and Te up to 18,932 mg kg -1 for K). The results established the high importance of element contents in substrate. Among ten organic acids, nine have been found in wide range: from below 0.01 mg kg -1 for fumaric acid to 14.8 mg g -1 for lactic acid. Lactic and succinic acids were dominant in both areas, and citric acid was also in high content in polluted area. The correlation between element contents and the individual and total content of LMWOAs was confirmed.
Early, A; Gamper, M; Moniakis, J; Kim, E; Hunter, T; Williams, J G; Firtel, R A
2001-04-01
The protein tyrosine phosphatase PTP1, which mediates reversible phosphorylation on tyrosine, has been shown to play an important regulatory role during Dictyostelium development. Mutants lacking PTP1 develop more rapidly than normal, while strains that overexpress PTP1 display aberrant morphology. However, the signalling pathways involved have not been characterised. In reexamining these strains, we have found that there is an inverse correlation between levels of PTP1 activity, the extent of tyrosine phosphorylation on Dictyostelium STATa after treatment with cAMP, and the proportion of the slug population exhibiting STATa nuclear enrichment in vivo. This suggests that PTP1 acts to attenuate the tyrosine phosphorylation of STATa and downstream STATa-mediated pathways. Consistent with this, we show that when PTP1 is overexpressed, there is increased expression of a prestalk cell marker at the slug posterior, a phenocopy of STATa null slugs. In ptp1 null strains, STATa tyrosine phosphorylation and nuclear enrichment in the slug anterior is increased. There is also a change in the prestalk to prespore cell ratio. Synergy experiments suggest that this is due to a cell-autonomous defect in forming the subset of prespore cells that are located in the anterior prespore region. Copyright 2001 Academic Press.
Anti-oxidant effects of kiwi fruit in vitro and in vivo.
Iwasawa, Haruyo; Morita, Erika; Yui, Satoru; Yamazaki, Masatoshi
2011-01-01
We previously reported that kiwi fruit is rich in polyphenols and has immunostimulatory activity. Polyphenols are widely known for having anti-oxidant effects. We also revealed potential anti-oxidant effects of kiwi fruit in vivo by oral administration to mice. Here, we compared the anti-oxidant effects of kiwi fruit with those of other fruits in vitro. Then, we examined the inhibitory effects of kiwi fruit on oxidation in the human body. There are two varieties of kiwi fruit, green kiwi and gold kiwi. We also examined variation between these varieties. Comparison of the anti-oxidant effects in vitro demonstrated that kiwi fruit had stronger anti-oxidant effects than orange and grapefruit, which are rich in vitamin C; gold kiwi had the strongest anti-oxidant effects. Kiwi fruit inhibited oxidation of biological substances in the human body. In particular, kiwi fruit may inhibit early lipid oxidation. In this study, kiwi fruit had strong anti-oxidant effects and may prevent the development and deterioration of diseases caused by oxidative stress.
Dannat, K; Tillner, J; Winckler, T; Weiss, M; Eger, K; Dingermann, T
2003-03-01
Dictyostelium discoideum is a single-cell, eukaryotic microorganism that can undergo multicellular development in order to produce dormant spores. We investigated the capacity of D. discoideum to be used as a rapid screening system for potential developmental toxicity of compounds under development as pharmaceuticals. We used a set of four transgenic D. discoideum strains that expressed a reporter gene under the control of promoters that are active at certain time periods and in distinct cell types during D. discoideum development. We found that teratogens such as valproic acid, tretinoin, or thalidomide interfered to various extents with D. discoideum development, and had different effects on prestalk and prespore cell-specific reporter gene expression. Phenytoin was inactive in this assay, which may point to limitations in metabolization of the compound in Dictyostelium required to exert developmental toxicity. D. discoideum cell culture is cheap and easy to handle compared to mammalian cell cultures or animal teratogenicity models. Although the Dictyostelium-based assay described in this report may not securely predict the teratogenic potential of these drugs in humans, this organism may be qualified for rapid large-scale screenings of synthetic compounds under development as new pharmaceuticals for their potential to interfere with developmental processes and thus help to reduce the amount of teratogenicity tests in animal models.
Nortriterpenoids from the Fruiting Bodies of the Mushroom Ganoderma resinaceum.
Chen, Xian-Qiang; Chen, Ling-Xiao; Zhao, Jing; Tang, Yu-Ping; Li, Shao-Ping
2017-06-28
Ganoderma resinaceum is usually used as ethnomedicine for immune-regulation, hyperglycemia, and liver disease. To date, only a few chemical constituents have been reported from G . resinaceum . In this study, fifteen nortriterpenoids including six new nortriterpenoids ( 1 - 6 ) and nine known analogs ( 7 - 15 ), were separated and purified from the fruiting bodies of G . resinaceum . New compounds were identified as lucidone I ( 1 ), lucidone J ( 2 ), lucidone K ( 3 ), lucidone I ( 4 ), ganosineniol B ( 5 ), and ganosineniol C ( 6 ), based on analysis of extensive spectroscopic data (high resolution mass spectrometry (HRMS), nuclear magnetic resonance (NMR), infrared (IR), and ultraviolet (UV)). The known compounds were assigned as lucidone A ( 7 ), lucidone B ( 8 ), lucidone H ( 9 ), lucidone E ( 10 ), lucidone F ( 11 ), lucidone D ( 12 ), lucidone C ( 13 ), ganoderense F ( 14 ), and ganosineniol A ( 15 ), by comparing their spectroscopic data with those reported in the literature. Compounds 3 , 4 , and 7 - 13 were examined for α -glucosidase inhibitory activity and display no significant activity, but the finding may support that the side chain of ganoderma triterpenoids played an important role in α -glucosidase inhibitory activity.
Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi
2009-02-01
Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.
Evolution of complex fruiting-body morphologies in homobasidiomycetes.
Hibbett, David S; Binder, Manfred
2002-01-01
The fruiting bodies of homobasidiomycetes include some of the most complex forms that have evolved in the fungi, such as gilled mushrooms, bracket fungi and puffballs ('pileate-erect') forms. Homobasidiomycetes also include relatively simple crust-like 'resupinate' forms, however, which account for ca. 13-15% of the described species in the group. Resupinate homobasidiomycetes have been interpreted either as a paraphyletic grade of plesiomorphic forms or a polyphyletic assemblage of reduced forms. The former view suggests that morphological evolution in homobasidiomycetes has been marked by independent elaboration in many clades, whereas the latter view suggests that parallel simplification has been a common mode of evolution. To infer patterns of morphological evolution in homobasidiomycetes, we constructed phylogenetic trees from a dataset of 481 species and performed ancestral state reconstruction (ASR) using parsimony and maximum likelihood (ML) methods. ASR with both parsimony and ML implies that the ancestor of the homobasidiomycetes was resupinate, and that there have been multiple gains and losses of complex forms in the homobasidiomycetes. We also used ML to address whether there is an asymmetry in the rate of transformations between simple and complex forms. Models of morphological evolution inferred with ML indicate that the rate of transformations from simple to complex forms is about three to six times greater than the rate of transformations in the reverse direction. A null model of morphological evolution, in which there is no asymmetry in transformation rates, was rejected. These results suggest that there is a 'driven' trend towards the evolution of complex forms in homobasidiomycetes. PMID:12396494
Phillips, Jonathan E.; Gomer, Richard H.
2015-01-01
Neuronal ceroid lipofuscinosis (NCL) is the most common childhood-onset neurodegenerative disease. NCL is inevitably fatal, and there is currently no treatment available. Children with NCL show a progressive decline in movement, vision and mental abilities, and an accumulation of autofluorescent deposits in neurons and other cell types. Late-infantile NCL is caused by mutations in the lysosomal protease tripeptidyl peptidase 1 (TPP1). TPP1 cleaves tripeptides from the N-terminus of proteins in vitro, but little is known about the physiological function of TPP1. TPP1 shows wide conservation in vertebrates but it is not found in Drosophila, Caenorhabditis elegans or Saccharomyces cerevisiae. Here, we characterize ddTpp1, a TPP1 ortholog present in the social amoeba Dictyostelium discoideum. Lysates from cells lacking ddTpp1 show a reduced but not abolished ability to cleave a TPP1 substrate, suggesting that other Dictyostelium enzymes can perform this cleavage. ddTpp1 and human TPP1 localize to the lysosome in Dictyostelium, indicating conserved function and trafficking. Cells that lack ddTpp1 show precocious multicellular development and a reduced ability to form spores during development. When cultured in autophagy-stimulating conditions, cells lacking ddTpp1 rapidly decrease in size and are less viable than wild-type cells, suggesting that one function of ddTpp1 could be to limit autophagy. Cells that lack ddTpp1 exhibit strongly impaired development in the presence of the lysosome-perturbing drug chloroquine, and this phenotype can be suppressed through a secondary mutation in the gene that we name suppressor of tpp1− A (stpA), which encodes a protein with some similarity to mammalian oxysterol-binding proteins (OSBPs). Taken together, these results suggest that targeting specific proteins could be a viable way to suppress the effects of loss of TPP1 function. PMID:25540127
Sun, Tong; Kim, Bohye; Kim, Lou W.
2013-01-01
Glycogen Synthase Kinase 3 (GSK3) is a multifunctional kinase involved in diverse cellular activities such as metabolism, differentiation, and morphogenesis. Recent studies showed that GSK3 in Dictyostelium affects chemotaxis via TorC2 pathway and Daydreamer. Now we report that GSK3 affects PI3K membrane localization, of which mechanism has remained to be fully understood in Dictyostelium. The membrane localization domain (LD) of Phosphatidylinositol-3-kinase 1 (PI3K1) is phosphorylated on serine residues in a GSK3 dependent mechanism and PI3K1-LD exhibited biased membrane localization in gsk3− cells compared to the wild type cells. Furthermore, multiple GSK3-phosphorylation consensus sites exist in PI3K1-LD, of which phosphomimetic substitutions restored cAMP induced transient membrane localization of PI3K1-LD in gsk3− cells. Serine to alanine substitution mutants of PI3K1-LD, in contrast, displayed constitutive membrane localization in wild type cells. Biochemical analysis revealed that GSK3 dependent serine phosphorylation of PI3K1-LD is constitutive during the course of cAMP stimulation. Together, these data suggest that GSK3 dependent serine phosphorylation is a prerequisite for chemoattractant cAMP induced PI3K membrane localization. PMID:24102085
Lee, Seoung Rak; Jung, Kiwon; Noh, Hyung Jun; Park, Yong Joo; Lee, Hye Lim; Lee, Kang Ro; Kang, Ki Sung; Kim, Ki Hyun
2015-12-15
A new cerebroside, cerebroside E (1) was isolated from the fruiting bodies of Hericium erinaceus (Hericiaceae). The structure of 1 was elucidated by a combination of extensive spectroscopic analyses, including extensive 2D NMR, HR-MS, and chemical reactions. Compound 1 was evaluated for its applicability to medicinal use in several human diseases using cell-based assays. As a result, compound 1 attenuated cisplatin-induced nephrotoxicity in LLC-PK1 cells and exhibited a significant inhibitory effect on angiogenesis in HUVECs. These results collectively reflect the beneficial effects of compound 1 in cancer treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.
Hobdey, Sarah E.; Knott, Brandon C.; Momeni, Majid Haddad; ...
2016-04-01
Glycoside hydrolase family 7 (GH7) cellobiohydrolases (CBHs) are enzymes often employed in plant cell wall degradation across eukaryotic kingdoms of life, as they provide significant hydrolytic potential in cellulose turnover. To date, many fungal GH7 CBHs have been examined, yet many questions regarding structure-activity relationships in these important natural and commercial enzymes remain. Here, we present the crystal structures and a biochemical analysis of two GH7 CBHs from social amoeba: Dictyostelium discoideum Cel7A (DdiCel7A) and Dictyostelium purpureum Cel7A (DpuCel7A). DdiCel7A and DpuCel7A natively consist of a catalytic domain and do not exhibit a carbohydrate-binding module (CBM). The structures of DdiCel7Amore » and DpuCel7A, resolved to 2.1 Å and 2.7 Å, respectively, are homologous to those of other GH7 CBHs with an enclosed active-site tunnel. Two primary differences between the Dictyostelium CBHs and the archetypal model GH7 CBH, Trichoderma reesei Cel7A (TreCel7A), occur near the hydrolytic active site and the product-binding sites. To compare the activities of these enzymes with the activity of TreCel7A, the family 1 TreCel7A CBM and linker were added to the C terminus of each of the Dictyostelium enzymes, creating DdiCel7A CBM and DpuCel7A CBM, which were recombinantly expressed in T. reesei. DdiCel7A CBM and DpuCel7A CBM hydrolyzed Avicel, pretreated corn stover, and phosphoric acid-swollen cellulose as efficiently as TreCel7A when hydrolysis was compared at their temperature optima. The K i of cellobiose was significantly higher for DdiCel7A CBM and DpuCel7A CBM than for TreCel7A: 205, 130, and 29 μM, respectively. Finally, taken together, the present study highlights the remarkable degree of conservation of the activity of these key natural and industrial enzymes across quite distant phylogenetic trees of life.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hobdey, Sarah E.; Knott, Brandon C.; Momeni, Majid Haddad
Glycoside hydrolase family 7 (GH7) cellobiohydrolases (CBHs) are enzymes often employed in plant cell wall degradation across eukaryotic kingdoms of life, as they provide significant hydrolytic potential in cellulose turnover. To date, many fungal GH7 CBHs have been examined, yet many questions regarding structure-activity relationships in these important natural and commercial enzymes remain. Here, we present the crystal structures and a biochemical analysis of two GH7 CBHs from social amoeba: Dictyostelium discoideum Cel7A (DdiCel7A) and Dictyostelium purpureum Cel7A (DpuCel7A). DdiCel7A and DpuCel7A natively consist of a catalytic domain and do not exhibit a carbohydrate-binding module (CBM). The structures of DdiCel7Amore » and DpuCel7A, resolved to 2.1 Å and 2.7 Å, respectively, are homologous to those of other GH7 CBHs with an enclosed active-site tunnel. Two primary differences between the Dictyostelium CBHs and the archetypal model GH7 CBH, Trichoderma reesei Cel7A (TreCel7A), occur near the hydrolytic active site and the product-binding sites. To compare the activities of these enzymes with the activity of TreCel7A, the family 1 TreCel7A CBM and linker were added to the C terminus of each of the Dictyostelium enzymes, creating DdiCel7A CBM and DpuCel7A CBM, which were recombinantly expressed in T. reesei. DdiCel7A CBM and DpuCel7A CBM hydrolyzed Avicel, pretreated corn stover, and phosphoric acid-swollen cellulose as efficiently as TreCel7A when hydrolysis was compared at their temperature optima. The K i of cellobiose was significantly higher for DdiCel7A CBM and DpuCel7A CBM than for TreCel7A: 205, 130, and 29 μM, respectively. Finally, taken together, the present study highlights the remarkable degree of conservation of the activity of these key natural and industrial enzymes across quite distant phylogenetic trees of life.« less
Siegert, F; Weijer, C J; Nomura, A; Miike, H
1994-01-01
We describe the application of a novel image processing method, which allows quantitative analysis of cell and tissue movement in a series of digitized video images. The result is a vector velocity field showing average direction and velocity of movement for every pixel in the frame. We apply this method to the analysis of cell movement during different stages of the Dictyostelium developmental cycle. We analysed time-lapse video recordings of cell movement in single cells, mounds and slugs. The program can correctly assess the speed and direction of movement of either unlabelled or labelled cells in a time series of video images depending on the illumination conditions. Our analysis of cell movement during multicellular development shows that the entire morphogenesis of Dictyostelium is characterized by rotational cell movement. The analysis of cell and tissue movement by the velocity field method should be applicable to the analysis of morphogenetic processes in other systems such as gastrulation and neurulation in vertebrate embryos.
Rot, Gregor; Parikh, Anup; Curk, Tomaz; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaz
2009-08-25
Bioinformatics often leverages on recent advancements in computer science to support biologists in their scientific discovery process. Such efforts include the development of easy-to-use web interfaces to biomedical databases. Recent advancements in interactive web technologies require us to rethink the standard submit-and-wait paradigm, and craft bioinformatics web applications that share analytical and interactive power with their desktop relatives, while retaining simplicity and availability. We have developed dictyExpress, a web application that features a graphical, highly interactive explorative interface to our database that consists of more than 1000 Dictyostelium discoideum gene expression experiments. In dictyExpress, the user can select experiments and genes, perform gene clustering, view gene expression profiles across time, view gene co-expression networks, perform analyses of Gene Ontology term enrichment, and simultaneously display expression profiles for a selected gene in various experiments. Most importantly, these tasks are achieved through web applications whose components are seamlessly interlinked and immediately respond to events triggered by the user, thus providing a powerful explorative data analysis environment. dictyExpress is a precursor for a new generation of web-based bioinformatics applications with simple but powerful interactive interfaces that resemble that of the modern desktop. While dictyExpress serves mainly the Dictyostelium research community, it is relatively easy to adapt it to other datasets. We propose that the design ideas behind dictyExpress will influence the development of similar applications for other model organisms.
CDK5RAP2 Is an Essential Scaffolding Protein of the Corona of the Dictyostelium Centrosome.
Pitzen, Valentin; Askarzada, Sophie; Gräf, Ralph; Meyer, Irene
2018-04-23
Dictyostelium centrosomes consist of a nucleus-associated cylindrical, three-layered core structure surrounded by a corona consisting of microtubule-nucleation complexes embedded in a scaffold of large coiled-coil proteins. One of them is the conserved CDK5RAP2 protein. Here we focus on the role of Dictyostelium CDK5RAP2 for maintenance of centrosome integrity, its interaction partners and its dynamic behavior during interphase and mitosis. GFP-CDK5RAP2 is present at the centrosome during the entire cell cycle except from a short period during prophase, correlating with the normal dissociation of the corona at this stage. RNAi depletion of CDK5RAP2 results in complete disorganization of centrosomes and microtubules suggesting that CDK5RAP2 is required for organization of the corona and its association to the core structure. This is in line with the observation that overexpressed GFP-CDK5RAP2 elicited supernumerary cytosolic MTOCs. The phenotype of CDK5RAP2 depletion was very reminiscent of that observed upon depletion of CP148, another scaffolding protein of the corona. BioID interaction assays revealed an interaction of CDK5RAP2 not only with the corona markers CP148, γ-tubulin, and CP248, but also with the core components Cep192, CP75, and CP91. Furthermore, protein localization studies in both depletion strains revealed that CP148 and CDK5RAP2 cooperate in corona organization.
Rot, Gregor; Parikh, Anup; Curk, Tomaz; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaz
2009-01-01
Background Bioinformatics often leverages on recent advancements in computer science to support biologists in their scientific discovery process. Such efforts include the development of easy-to-use web interfaces to biomedical databases. Recent advancements in interactive web technologies require us to rethink the standard submit-and-wait paradigm, and craft bioinformatics web applications that share analytical and interactive power with their desktop relatives, while retaining simplicity and availability. Results We have developed dictyExpress, a web application that features a graphical, highly interactive explorative interface to our database that consists of more than 1000 Dictyostelium discoideum gene expression experiments. In dictyExpress, the user can select experiments and genes, perform gene clustering, view gene expression profiles across time, view gene co-expression networks, perform analyses of Gene Ontology term enrichment, and simultaneously display expression profiles for a selected gene in various experiments. Most importantly, these tasks are achieved through web applications whose components are seamlessly interlinked and immediately respond to events triggered by the user, thus providing a powerful explorative data analysis environment. Conclusion dictyExpress is a precursor for a new generation of web-based bioinformatics applications with simple but powerful interactive interfaces that resemble that of the modern desktop. While dictyExpress serves mainly the Dictyostelium research community, it is relatively easy to adapt it to other datasets. We propose that the design ideas behind dictyExpress will influence the development of similar applications for other model organisms. PMID:19706156
Optimization of fruit punch using mixture design.
Kumar, S Bharath; Ravi, R; Saraswathi, G
2010-01-01
A highly acceptable dehydrated fruit punch was developed with selected fruits, namely lemon, orange, and mango, using a mixture design and optimization technique. The fruit juices were freeze dried, powdered, and used in the reconstitution studies. Fruit punches were prepared according to the experimental design combinations (total 10) based on a mixture design and then subjected to sensory evaluation for acceptability. Response surfaces of sensory attributes were also generated as a function of fruit juices. Analysis of data revealed that the fruit punch prepared using 66% of mango, 33% of orange, and 1% of lemon had highly desirable sensory scores for color (6.00), body (5.92), sweetness (5.68), and pleasantness (5.94). The aroma pattern of individual as well as combinations of fruit juices were also analyzed by electronic nose. The electronic nose could discriminate the aroma patterns of individual as well as fruit juice combinations by mixture design. The results provide information on the sensory quality of best fruit punch formulations liked by the consumer panel based on lemon, orange, and mango.
Froquet, Romain; le Coadic, Marion; Perrin, Jackie; Cherix, Nathalie; Cornillon, Sophie; Cosson, Pierre
2012-02-01
TM9 proteins form a family of conserved proteins with nine transmembrane domains essential for cellular adhesion in many biological systems, but their exact role in this process remains unknown. In this study, we found that genetic inactivation of the TM9 protein Phg1A dramatically decreases the surface levels of the SibA adhesion molecule in Dictyostelium amoebae. This is due to a decrease in sibA mRNA levels, in SibA protein stability, and in SibA targeting to the cell surface. A similar phenotype was observed in cells devoid of SadA, a protein that does not belong to the TM9 family but also exhibits nine transmembrane domains and is essential for cellular adhesion. A contact site A (csA)-SibA chimeric protein comprising only the transmembrane and cytosolic domains of SibA and the extracellular domain of the Dictyostelium surface protein csA also showed reduced stability and relocalization to endocytic compartments in phg1A knockout cells. These results indicate that TM9 proteins participate in cell adhesion by controlling the levels of adhesion proteins present at the cell surface.
Lalucque, Hervé; Malagnac, Fabienne; Green, Kimberly; Gautier, Valérie; Grognet, Pierre; Chan Ho Tong, Laetitia; Scott, Barry; Silar, Philippe
2017-01-15
Filamentous ascomycetes produce complex multicellular structures during sexual reproduction. Little is known about the genetic pathways enabling the construction of such structures. Here, with a combination of classical and reverse genetic methods, as well as genetic mosaic and graft analyses, we identify and provide evidence for key roles for two genes during the formation of perithecia, the sexual fruiting bodies, of the filamentous fungus Podospora anserina. Data indicate that the proteins coded by these two genes function cell-non-autonomously and that their activity depends upon conserved cysteines, making them good candidate for being involved in the transmission of a reactive oxygen species (ROS) signal generated by the PaNox1 NADPH oxidase inside the maturing fruiting body towards the PaMpk1 MAP kinase, which is located inside the underlying mycelium, in which nutrients are stored. These data provide important new insights to our understanding of how fungi build multicellular structures. Copyright © 2016 Elsevier Inc. All rights reserved.
Zhang, Guang; Sun, Zehua; Ren, Ang; Shi, Liang; Shi, Dengke; Li, Xiongbiao; Zhao, Mingwen
2017-07-01
The mitogen-activated protein kinases (MAPKs) are crucial signaling instruments in eukaryotes that play key roles in regulating fungal growth, development, and secondary metabolism and in adapting to the environment. In this study, we characterized an Slt2-type MAPK in Ganoderma lucidum, GlSlt2, which was transcriptionally induced during the primordium and fruiting body stages. RNA interference was used to examine the function of GlSlt2. Knockdown of GlSlt2 caused defects in growth and increased hyphal branching as well as hypersensitivity to cell wall-disturbing substances. Consistently, the chitin and β-1,3-d-glucan contents and the expression of cell wall biosynthesis genes were decreased and down-regulated, respectively, in GlSlt2 knockdown strains compared with those in the wild type (WT). In addition, no primordium or fruiting body could be observed in GlSlt2 knockdown strains. Furthermore, the intracellular reactive oxygen species (ROS) content and ganoderic acid biosynthesis also decreased in GlSlt2 knockdown strains. Addition of H 2 O 2 could recover the decreased ganoderic acid content in GlSlt2 knockdown strains, indicating that GlSlt2 might regulate ganoderic acid biosynthesis via the intracellular ROS level. Overall, GlSlt2 is involved in hyphal growth, fruiting body development, cell wall integrity, oxidative stress and ganoderic acid biosynthesis in G. lucidum. Copyright © 2017 Elsevier Inc. All rights reserved.
Amaroli, Andrea; Trielli, Francesca; Bianco, Bruno; Giordano, Stefano; Moggia, Elsa; Corrado, Maria U Delmonte
2005-12-15
Recently, we detected propionylcholinesterase (PrChE) activity in single-cell amoebae of Dictyostelium discoideum using cytochemical, electrophoretic, and spectrophotometric methods. The involvement of this enzyme activity in cell-cell and cell-environment interactions was suggested. In this work, we found that exposure of single-cell amoebae to an extremely low-frequency electromagnetic fields (ELF-EMF) of 300 microT, 50 Hz, from 1 h up to 48 h at 21 +/- 1 degrees C affected PrChE activity.
Kikuchi, Haruhisa; Kubohara, Yuzuru; Nguyen, Van Hai; Katou, Yasuhiro; Oshima, Yoshiteru
2013-08-01
Cellular slime molds are expected to have the huge potential for producing secondary metabolites including polyketides, and we have studied the diversity of secondary metabolites of cellular slime molds for their potential utilization as new biological resources for natural product chemistry. From the methanol extract of fruiting bodies of Polysphondylium filamentosum, we obtained new chlorinated benzofurans Pf-1 (4) and Pf-2 (5) which display multiple biological activities; these include stalk cell differentiation-inducing activity in the well-studied cellular slime mold, Dictyostelium discoideum, and inhibitory activities on cell proliferation in mammalian cells and gene expression in Drosophila melanogaster. Copyright © 2013 Elsevier Ltd. All rights reserved.
A novel core 1 O-linked glycan-specific binding lectin from the fruiting body of Hericium erinaceus.
Kim, Seonghun
2018-02-01
Mucin-type O-glycans are involved in biological functions on the cell surface as well as the glycoproteins and can also be used as specific carbohydrate biomarkers of many diseases. In this study, I purified a novel core 1 O-linked glycan specific lectin, Hericium erinaceus lecin (HeL), from the fruiting body of the mushroom Hericium erinaceus, which is known as the natural source for a sialic acid-binding lectin. Upon optimization of the purification conditions, a sequence of ion exchange, affinity, ion exchange, and size-exclusion chromatography resulted in the highest yield and best quality of lectin without protease activity. The resulting purified HeL is an apparent hexameric protein with a subunit molecular weight of 15kDa, and a pI of 4.3. In hemagglutination inhibition assay, the purified lectin was only inhibited by glycoproteins containing mucin-type O-glycans and reacted weakly with Galβ(1,3)GalNAc. Glycan array analyses showed that HeL specifically interacts with core 1 O-linked glycans as well as extended O-glycan structures containing sialylation or fucosylation. The glycan binding specificity of HeL is comparable to that of peanut agglutinin for detection of a broader range of extended core 1 O-glycan structures. Taken together, these results provide an efficient and optimized procedure for the purification of HeL from the fruiting body of the mushroom Hericium erinaceus. Moreover, HeL represents a powerful tool for analyzing core 1 and extended core 1 O- glycan structures in diagnosis assays. Copyright © 2017 Elsevier B.V. All rights reserved.
Yun, Yeo Hong; Koo, Ja Sun
2015-01-01
Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi. PMID:26539050
Werner, Antonia; Herzog, Britta; Frey, Stefan; Pöggeler, Stefanie
2016-01-01
In filamentous fungi, autophagy functions as a catabolic mechanism to overcome starvation and to control diverse developmental processes under normal nutritional conditions. Autophagy involves the formation of double-membrane vesicles, termed autophagosomes that engulf cellular components and bring about their degradation via fusion with vacuoles. Two ubiquitin-like (UBL) conjugation systems are essential for the expansion of the autophagosomal membrane: the UBL protein ATG8 is conjugated to the lipid phosphatidylethanolamine and the UBL protein ATG12 is coupled to ATG5. We recently showed that in the homothallic ascomycete Sordaria macrospora autophagy-related genes encoding components of the conjugation systems are required for fruiting-body development and/or are essential for viability. In the present work, we cloned and characterized the S. macrospora (Sm)atg12 gene. Two-hybrid analysis revealed that SmATG12 can interact with SmATG7 and SmATG3. To examine its role in S. macrospora, we replaced the open reading frame of Smatg12 with a hygromycin resistance cassette and generated a homokaryotic ΔSmatg12 knockout strain, which displayed slower vegetative growth under nutrient starvation conditions and was unable to form fruiting bodies. In the hyphae of S. macrospora EGFP-labeled SmATG12 was detected in the cytoplasm and as punctate structures presumed to be phagophores or phagophore assembly sites. Delivery of EGFP-labelled SmATG8 to the vacuole was entirely dependent on SmATG12. PMID:27309377
Werner, Antonia; Herzog, Britta; Frey, Stefan; Pöggeler, Stefanie
2016-01-01
In filamentous fungi, autophagy functions as a catabolic mechanism to overcome starvation and to control diverse developmental processes under normal nutritional conditions. Autophagy involves the formation of double-membrane vesicles, termed autophagosomes that engulf cellular components and bring about their degradation via fusion with vacuoles. Two ubiquitin-like (UBL) conjugation systems are essential for the expansion of the autophagosomal membrane: the UBL protein ATG8 is conjugated to the lipid phosphatidylethanolamine and the UBL protein ATG12 is coupled to ATG5. We recently showed that in the homothallic ascomycete Sordaria macrospora autophagy-related genes encoding components of the conjugation systems are required for fruiting-body development and/or are essential for viability. In the present work, we cloned and characterized the S. macrospora (Sm)atg12 gene. Two-hybrid analysis revealed that SmATG12 can interact with SmATG7 and SmATG3. To examine its role in S. macrospora, we replaced the open reading frame of Smatg12 with a hygromycin resistance cassette and generated a homokaryotic ΔSmatg12 knockout strain, which displayed slower vegetative growth under nutrient starvation conditions and was unable to form fruiting bodies. In the hyphae of S. macrospora EGFP-labeled SmATG12 was detected in the cytoplasm and as punctate structures presumed to be phagophores or phagophore assembly sites. Delivery of EGFP-labelled SmATG8 to the vacuole was entirely dependent on SmATG12.
Ginsburg, G T; Kimmel, A R
1997-08-15
Early during Dictyostelium development a fundamental cell-fate decision establishes the anteroposterior (prestalk/prespore) axis. Signaling via the 7-transmembrane cAMP receptor CAR4 is essential for creating and maintaining a normal pattern; car4-null alleles have decreased levels of prestalk-specific mRNAs but enhanced expression of prespore genes. car4- cells produce all of the signals required for prestalk differentiation but lack an extracellular factor necessary for prespore differentiation of wild-type cells. This secreted factor decreases the sensitivity of prespore cells to inhibition by the prestalk morphogen DIF-1. At the cell autonomous level, CAR4 is linked to intracellular circuits that activate prestalk but inhibit prespore differentiation. The autonomous action of CAR4 is antagonistic to the positive intracellular signals mediated by another cAMP receptor, CAR1 and/or CAR3. Additional data indicate that these CAR-mediated pathways converge at the serine/threonine protein kinase GSK3, suggesting that the anterior (prestalk)/posterior (prespore) axis of Dictyostelium is regulated by an ancient mechanism that is shared by the Wnt/Fz circuits for dorsoventral patterning during early Xenopus development and establishing Drosophila segment polarity.
Katayama, Takahiro; Yasukawa, Hiro
2008-01-01
The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.
Origin and evolution of circular waves and spirals in Dictyostelium discoideum territories.
Pálsson, E; Cox, E C
1996-02-06
Randomly distributed Dictyostelium discoideum cells form cooperative territories by signaling to each other with cAMP. Cells initiate the process by sending out pulsatile signals, which propagate as waves. With time, circular and spiral patterns form. We show that by adding spatial and temporal noise to the levels of an important regulator of external cAMP levels, the cAMP phosphodiesterase inhibitor, we can explain the natural progression of the system from randomly firing cells to circular waves whose symmetries break to form double- and single- or multi-armed spirals. When phosphodiesterase inhibitor is increased with time, mimicking experimental data, the wavelength of the spirals shortens, and a proportion of them evolve into pairs of connected spirals. We compare these results to recent experiments, finding that the temporal and spatial correspondence between experiment and model is very close.
Journet, Agnès; Klein, Gérard; Brugière, Sabine; Vandenbrouck, Yves; Chapel, Agnès; Kieffer, Sylvie; Bruley, Christophe; Masselon, Christophe; Aubry, Laurence
2012-01-01
The cellular slime mold Dictyostelium discoideum is a soil-living eukaryote, which feeds on microorganisms engulfed by phagocytosis. Axenic laboratory strains have been produced that are able to use liquid growth medium internalized by macropinocytosis as the source of food. To better define the macropinocytosis process, we established the inventory of proteins associated with this pathway using mass spectrometry-based proteomics. Using a magnetic purification procedure and high-performance LC-MS/MS proteome analysis, a list of 2108 non-redundant proteins was established, of which 24% featured membrane-spanning domains. Bioinformatics analyses indicated that the most abundant proteins were linked to signaling, vesicular trafficking and the cytoskeleton. The present repertoire validates our purification method and paves the way for a future proteomics approach to study the dynamics of macropinocytosis. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Acanthamoeba and Dictyostelium as Cellular Models for Legionella Infection
Swart, A. Leoni; Harrison, Christopher F.; Eichinger, Ludwig; Steinert, Michael; Hilbi, Hubert
2018-01-01
Environmental bacteria of the genus Legionella naturally parasitize free-living amoebae. Upon inhalation of bacteria-laden aerosols, the opportunistic pathogens grow intracellularly in alveolar macrophages and can cause a life-threatening pneumonia termed Legionnaires' disease. Intracellular replication in amoebae and macrophages takes place in a unique membrane-bound compartment, the Legionella-containing vacuole (LCV). LCV formation requires the bacterial Icm/Dot type IV secretion system, which translocates literally hundreds of “effector” proteins into host cells, where they modulate crucial cellular processes for the pathogen's benefit. The mechanism of LCV formation appears to be evolutionarily conserved, and therefore, amoebae are not only ecologically significant niches for Legionella spp., but also useful cellular models for eukaryotic phagocytes. In particular, Acanthamoeba castellanii and Dictyostelium discoideum emerged over the last years as versatile and powerful models. Using genetic, biochemical and cell biological approaches, molecular interactions between amoebae and Legionella pneumophila have recently been investigated in detail with a focus on the role of phosphoinositide lipids, small and large GTPases, autophagy components and the retromer complex, as well as on bacterial effectors targeting these host factors. PMID:29552544
Structural investigation of a novel heteropolysaccharide from the fruiting bodies of Boletus edulis.
Zhang, An-qiang; Liu, Ye; Xiao, Nan-nan; Zhang, Yang; Sun, Pei-long
2014-03-01
A novel water-soluble heteropolysaccharide, BEPF1, was isolated from the fruiting bodies of Boletus edulis with boiling water extraction and purified by Sephacryl S-300, with a molecular weight of 1.08×10(4)Da. Sugar composition of BEPF1 showed that it was composed of l-fucose, d-mannose, d-glucose and d-galactose in the ratio of 0.21:0.23:1.17:1.00. Methylation analysis together with (1)H, (13)C and 2D NMR spectroscopy established that BEPF1 was consisted of α-d-(1→6)-galactopyranan backbone with a terminal of α-l-fucosyl unit on O-2 of the 2-d-(2→6)-galactosyl units, β-d-(1→6)-4-O-Me-glucopyranan and β-d-(1→6)-glucopyranan backbone with a terminal β-d-glucosyl unit and it also contained a minor of 2,6-β-d-Mannopyranan residues. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Teng, Fei; Bito, Tomohiro; Takenaka, Shigeo; Yabuta, Yukinori; Watanabe, Fumio
2014-02-19
This study determined the vitamin B12 content of the edible medicinal mushroom Hericium erinaceus, lion's mane mushroom fruiting body, using a microbiological assay based on Lactobacillus delbrueckii ATCC 7830. Trace levels (0.04-0.36 μg/100 g dry weight) of vitamin B12 were found in most of the dried mushroom samples, and two samples contained slightly higher levels (0.56 and 1.04 μg/100 g dry weight, respectively) of vitamin B12. We purified the corrinoid compounds from the extracts of dried lion's mane mushroom fruiting bodies using an immunoaffinity column and identified them as vitamin B12 or vitamin B12[c-lactone] (or both) based on LC/ESI-MS/MS chromatograms. This is the first report on an unnatural corrinoid, vitamin B12[c-lactone], occurring in foods. Vitamin B12[c-lactone] was simple to produce during incubation of authentic vitamin B12 and chloramine-T, an antimicrobial agent, at varying pH values (3.0-7.0) and was completely inactive in the vitamin B12-dependent bacteria that are generally used in vitamin B12 bioassays.
Trappe, James M; Nicholls, A O; Claridge, Andrew W; Cork, Steven J
2006-11-01
Fruit bodies of hypogeous fungi are an important food source for many small mammals and are consumed by larger mammals as well. A controversial hypothesis that prescribed burning increases fruiting of certain hypogeous fungi based on observations in Tasmania was tested in the Australian Capital Territory to determine if it applied in a quite different habitat. Ten pairs of plots, burnt and nonburnt, were established at each of two sites prescribe-burnt in May 1999. When sampled in early July, after autumn rains had initiated the fungal fruiting season, species richness and numbers of fruit bodies on the burnt plots were extremely low: most plots produced none at all. Both species richness and fruit body numbers were simultaneously high on nonburnt plots. One of the sites was resampled a year after the initial sampling. At that time species richness and fruit body abundance were still significantly less on burnt plots than on nonburnt, but a strong trend towards fungal recovery on the burnt plots was evident. This was particularly so when numbers of fruit bodies of one species, the hypogeous agaric Dermocybe globuliformis, were removed from the analysis. This species strongly dominated the nonburnt plots but was absent from burnt plots in both years. The trend towards recovery of fruit body abundance in the burnt plots one year after the burn was much more pronounced with exclusion of the Dermocybe data. The Tasmanian-based hypothesis was based mostly on the fruiting of two fire-adapted species in the Mesophelliaceae. Neither species occurred on our plots. Accordingly, the results and conclusions of the Tasmanian study cannot be extrapolated to other habitats without extensive additional study. Implications for management of habitat for fungi and the animals that rely on the fungi as a food source are discussed.
Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun
2016-01-01
Pleurotus citrinopileatus mycelium was prepared with high ergothioneine (Hi-Ergo) content and its proximate composition, nonvolatile taste components, and antioxidant properties were studied. The ergothioneine contents of fruiting bodies and Hi-Ergo and regular mycelia were 3.89, 14.57, and 0.37 mg/g dry weight, respectively. Hi-Ergo mycelium contained more dietary fiber, soluble polysaccharides, and ash but less carbohydrates, reducing sugar, fiber, and fat than regular mycelium. However, Hi-Ergo mycelium contained the smallest amounts of total sugars and polyols (47.43 mg/g dry weight). In addition, Hi-Ergo mycelium showed the most intense umami taste. On the basis of the half-maximal effective concentration values obtained, the 70% ethanolic extract from Hi-Ergo mycelium showed the most effective antioxidant activity, reducing power, and scavenging ability, whereas the fruiting body showed the most effective antioxidant activity, chelating ability, and Trolox-equivalent antioxidant capacity. Overall, Hi-Ergo mycelium could be beneficially used as a food-flavoring material or as a nutritional supplement.
Suseem, S R; Saral, Mary
2015-07-01
To evaluate the ethyl acetate, methanol and aqueous extracts of dried fruiting bodies of Pleurotus eous for its anti-platelet activity on human volunteer's blood. And also to analyze the free radical scavenging property of the extracts of P.eous by using various in vitro models. Anti-platelet activity of dried fruiting bodies of P.eous was evaluated by in vitro model using blood platelets. Inhibition of platelet aggregation was monitored after pre-incubation of platelets with the crude extracts of mushroom P.eous. Antioxidant activities of extracts of P.eous were evaluated by different in vitro experiments, namely, 1, 1-diphenyl-2-picryl hydrazyl (DPPH), superoxide, hydroxyl radical and lipid peroxide radical models. Crude extracts of mushroom P.eous inhibited platelet aggregation dose-dependently which was induced by adenosine diphosphate (ADP). At a maximum concentration of 10 mg/mL, methanol extract effected 64.02% inhibition of lipid per-oxidation and 50.12% scavenging effect on superoxide anion radical. Aqueous extract of P.eous have shown 69.43% chelating ability on ferrous ions, 24.27% scavenging effect on hydroxyl radical and 49.57% scavenging effect on DPPH radical at 10 mg/mL. Increasing concentrations of the extract were found to cause progressively decreasing of the intensity of absorbance. Anti-platelet effects could be related in part to the polyphenolic compounds present in the extracts. Antioxidant activity results indicated the free radical scavenging property of the extracts of P.eous which might be due to the high content of phenolic compounds and flavonoids.
Robson, Gillian E.; Williams, Keith L.
1979-01-01
The genetic basis of vegetative incompatibility in the cellular slime mold, Dictyostelium discoideum, is elucidated. Vegetatively compatible haploid strains from parasexual diploids at a frequency of between 10-6 and 10-5, whereas "escaped" diploids are formed between vegetatively incompatible strains at a frequency of ∼10-8. There is probably only a single vegetative incompatibility site, which appears to be located at, or closely linked to, the mating-type locus. The nature of the vegetative incompatibility is deduced from parasexual diploid formation between wild isolates and tester strains of each mating type, examination of the frequency of formation of "escaped" diploids formed between vegetatively incompatible strains, and examination of the mating type and vegetative incompatibility of haploid segregants obtained from "escaped" diploids. PMID:17248984
Schindler, Daniel; Nowrousian, Minou
2014-07-01
Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.
Glycogen synthase kinase-3 enhances nuclear export of a Dictyostelium STAT protein
Ginger, Rebecca S.; Dalton, Emma C.; Ryves, W.Jonathan; Fukuzawa, Masashi; Williams, Jeffrey G.; Harwood, Adrian J.
2000-01-01
Extracellular cAMP stimulates the rapid tyrosine phosphorylation and nuclear translocation of the Dictyostelium STAT protein Dd-STATa. Here we show that it also induces serine phosphorylation by GskA, a homologue of glycogen synthase kinase-3 (GSK-3). Tyrosine phosphorylation occurs within 10 s of stimulation, whereas serine phosphorylation takes 5 min, matching the kinetics observed for the cAMP regulation of GskA. Phosphorylation by GskA enhances nuclear export of Dd-STATa. The phosphorylated region, however, is not itself a nuclear export signal and we identify a region elsewhere in the protein that mediates nuclear export. These results suggest a biphasic regulation of Dd-STATa, in which extracellular cAMP initially directs nuclear import and then, via GskA, promotes its subsequent export. It also raises the possibility of an analogous regulation of STAT nuclear export in higher eukaryotes. PMID:11032815
Okuwa, Takako; Katayama, Takahiro; Takano, Akinori; Yasukawa, Hiroo
2002-10-01
Genes for the cell-counting factors in Dictyostelium discoideum, countin and countin2, are considered to control the size of the multicellular structure of this organism. A novel gene, countin3, that is homologous to countin and countin2 genes (49 and 39% identity in amino acid sequence, respectively) was identified in the D. discoideum genome. The expression of countin3 was observed in the vegetatively growing cells, decreased in the aggregating stage, increased in the mid-developmental stage and decreased again in subsequent stages. This expression pattern is different from that of countin and countin2. The distinct expression kinetics of three genes suggests that they would have unique roles in size control of D. discoideum.
NASA Astrophysics Data System (ADS)
Alber, Mark; Chen, Nan; Glimm, Tilmann; Lushnikov, Pavel M.
2006-05-01
The cellular Potts model (CPM) has been used for simulating various biological phenomena such as differential adhesion, fruiting body formation of the slime mold Dictyostelium discoideum, angiogenesis, cancer invasion, chondrogenesis in embryonic vertebrate limbs, and many others. We derive a continuous limit of a discrete one-dimensional CPM with the chemotactic interactions between cells in the form of a Fokker-Planck equation for the evolution of the cell probability density function. This equation is then reduced to the classical macroscopic Keller-Segel model. In particular, all coefficients of the Keller-Segel model are obtained from parameters of the CPM. Theoretical results are verified numerically by comparing Monte Carlo simulations for the CPM with numerics for the Keller-Segel model.
Sakamoto, Yuichi; Nakade, Keiko; Konno, Naotake
2011-01-01
The cell wall of the fruiting body of the mushroom Lentinula edodes is degraded after harvesting by enzymes such as β-1,3-glucanase. In this study, a novel endo-type β-1,3-glucanase, GLU1, was purified from L. edodes fruiting bodies after harvesting. The gene encoding it, glu1, was isolated by rapid amplification of cDNA ends (RACE)-PCR using primers designed from the N-terminal amino acid sequence of GLU1. The putative amino acid sequence of the mature protein contained 247 amino acid residues with a molecular mass of 26 kDa and a pI of 3.87, and recombinant GLU1 expressed in Pichia pastoris exhibited β-1,3-glucanase activity. GLU1 catalyzed depolymerization of glucans composed of β-1,3-linked main chains, and reaction product analysis by thin-layer chromatography (TLC) clearly indicated that the enzyme had an endolytic mode. However, the amino acid sequence of GLU1 showed no significant similarity to known glycoside hydrolases. GLU1 has similarity to several hypothetical proteins in fungi, and GLU1 and highly similar proteins should be classified as a novel glycoside hydrolase family (GH128). PMID:21965406
Huber, Robert J.; Myre, Michael A.; Cotman, Susan L.
2017-01-01
ABSTRACT Neuronal ceroid lipofuscinosis (NCL), also known as Batten disease, refers to a group of severe neurodegenerative disorders that primarily affect children. The most common subtype of the disease is caused by loss-of-function mutations in CLN3, which is conserved across model species from yeast to human. The precise function of the CLN3 protein is not known, which has made targeted therapy development challenging. In the social amoeba Dictyostelium discoideum, loss of Cln3 causes aberrant mid-to-late stage multicellular development. In this study, we show that Cln3-deficiency causes aberrant adhesion and aggregation during the early stages of Dictyostelium development. cln3− cells form ∼30% more multicellular aggregates that are comparatively smaller than those formed by wild-type cells. Loss of Cln3 delays aggregation, but has no significant effect on cell speed or cAMP-mediated chemotaxis. The aberrant aggregation of cln3− cells cannot be corrected by manually pulsing cells with cAMP. Moreover, there are no significant differences between wild-type and cln3− cells in the expression of genes linked to cAMP chemotaxis (e.g., adenylyl cyclase, acaA; the cAMP receptor, carA; cAMP phosphodiesterase, pdsA; g-protein α 9 subunit, gpaI). However, during this time in development, cln3− cells show reduced cell-substrate and cell-cell adhesion, which correlate with changes in the levels of the cell adhesion proteins CadA and CsaA. Specifically, loss of Cln3 decreases the intracellular level of CsaA and increases the amount of soluble CadA in conditioned media. Together, these results suggest that the aberrant aggregation of cln3− cells is due to reduced adhesion during the early stages of development. Revealing the molecular basis underlying this phenotype may provide fresh new insight into CLN3 function. PMID:27669405
He, Pengfei; Zhang, Anqiang; Zhou, Saijing; Zhang, Fuming; Linhardt, Robert J; Sun, Peilong
2016-11-03
A water-soluble polysaccharide containing 3-O-methyl galactose (PCP60W) was isolated from fruiting bodies of Pleurotus citrinopileatus and purified by anion-exchange and gel column chromatography. This polysaccharide has an average molecular weight of 2.74 × 10 4 Da and its structure was elucidated using monosaccharide composition and methylation analysis combined with one- and two-dimensional (COSY, TOCSY, NOESY, HMQC and HMBC) NMR spectroscopy. PCP60W was shown to be a linear partially 3-O-methylated α-galactopyranan comprised of 6-linked galactose, 6-linked 3-O-methyl galactose and 4-linked glucose in a ratio of 3.0:1.0:0.6. This work provides additional evidence for the view that 3-O-methyl galactose is common to the genus Pleurotus. Copyright © 2016 Elsevier Ltd. All rights reserved.
Pu, De-Bing; Zheng, Xi; Gao, Jun-Bo; Zhang, Xing-Jie; Qi, Yan; Li, Xiao-Si; Wang, Yong-Mei; Li, Xiao-Nian; Li, Xiao-Li; Wan, Chun-Ping; Xiao, Wei-Lie
2017-06-01
Eight new highly oxygenated lanostane triterpenes, gibbosic acids A-H (1-8), along with three known ones (9-11), were isolated from the fruiting body of Ganoderma gibbosum. The structures of new isolates were assigned by NMR and HRESIMS experiments. The absolute configurations of 1 were further confirmed by single crystal X-ray diffraction data and computational ECD methods. Immunoregulatory effect and anti-inflammatory activities of these compounds were screened in murine lymphocyte proliferation assay and in lipopolysaccharide (LPS)-stimulated RAW-264.7 macrophages, respectively. Compound 2 exhibited immunostimulatory effect both in lymphocyte proliferation assay without any induction and ConA-induced mitogenic activity of T-lymphocyte, and the proportion of lymphocyte proliferation at the concentration of 0.1μM are 20.01% and 21.40%, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.
An autoregulatory circuit for long-range self-organization in Dictyostelium cell populations.
Sawai, Satoshi; Thomason, Peter A; Cox, Edward C
2005-01-20
Nutrient-deprived Dictyostelium amoebae aggregate to form a multicellular structure by chemotaxis, moving towards propagating waves of cyclic AMP that are relayed from cell to cell. Organizing centres are not formed by founder cells, but are dynamic entities consisting of cores of outwardly rotating spiral waves that self-organize in a homogeneous cell population. Spiral waves are ubiquitously observed in chemical reactions as well as in biological systems. Although feedback control of spiral waves in spatially extended chemical reactions has been demonstrated in recent years, the mechanism by which control is achieved in living systems is unknown. Here we show that mutants of the cyclic AMP/protein kinase A pathway show periodic signalling, but fail to organize coherent long-range wave territories, owing to the appearance of numerous spiral cores. A theoretical model suggests that autoregulation of cell excitability mediated by protein kinase A acts to optimize the number of signalling centres.
Self-organized, near-critical behavior during aggregation in Dictyostelium discoideum
NASA Astrophysics Data System (ADS)
de Palo, Giovanna; Yi, Darvin; Gregor, Thomas; Endres, Robert
During starvation, the social amoeba Dictyostelium discoideum aggregates artfully via pattern formation into a multicellular slug and finally spores. The aggregation process is mediated by the secretion and sensing of cyclic adenosine monophosphate, leading to the synchronized movement of cells. The whole process is a remarkable example of collective behavior, spontaneously emerging from single-cell chemotaxis. Despite this phenomenon being broadly studied, a precise characterization of the transition from single cells to multicellularity has been elusive. Here, using fluorescence imaging data of thousands of cells, we investigate the role of cell shape in aggregation, demonstrating remarkable transitions in cell behavior. To better understand their functional role, we analyze cell-cell correlations and provide evidence for self-organization at the onset of aggregation (as opposed to leader cells), with features of criticality in this finite system. To capture the mechanism of self-organization, we extend a detailed single-cell model of D.discoideum chemotaxis by adding cell-cell communication. We then use these results to extract a minimal set of rules leading to aggregation in the population model. If universal, similar rules may explain other types of collective cell behavior.
Struempler, Barbara J; Parmer, Sondra M; Mastropietro, Lisa M; Arsiwalla, Dilbur; Bubb, Robert R
2014-01-01
To increase fruit and vegetable (FV) consumption of youth in Body Quest: Food of the Warrior (BQ), a childhood obesity prevention program. Quasi-experimental. Supplemental Nutrition Assistance Program-Education eligible schools (n = 60). Third-grade students (n = 2,477). Treatment groups (n = 1,674) self-reported foods consumed through the School Lunch Program for 17 weekly assessments; they participated in BQ curriculum, iPad app education, and weekly FV tastings. Control groups (n = 803) completed only pre- and post-assessments. Weekly FV consumed through School Lunch Program. ANCOVA and growth modeling. From before to after the program, the treatment group demonstrated significant, moderate increases in fruit (P < .01) and vegetable (P < .001) consumptions, increasing from 7 to 8 weekly FV servings. After the program, the treatment group consumed significantly (P < .001) more FV than the control group. Fruit and vegetable consumption increased to class 10 and then stabilized. From before to after the program, all FV predictors were significantly higher and included gender (vegetables), race (FV), and free/reduced lunch (fruit). Nutrition programs can increase FV intake. Even moderate increases in FV intake can be an initial step for the prevention of chronic disease. Copyright © 2014 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.
Cytochemical study of the nucleolus of the slime mold Dictyostelium discoideum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benichou, J.C.; Quiviger, B.; Ryter, A.
1983-07-01
The nucleus of the slime mold Dictyostelium discoideum is characterized by the presence of several large dense masses which are all in tight contact with the nuclear membrane. These dense masses, considered as nucleoli, present a rather homogeneous texture, in which dense chromatin, fibrillar, and granular material are not easily detected. The autoradiographic study of (/sup 3/H)uridine pulse-labeled cells showed that the majority of the silver grains were located inside these masses. The use of EDTA regressive-staining, acetylation and enzymatic digestion indicated that they are mostly composed of RNP and are totally devoid of dense chromatin as the rest ofmore » the nucleus is. After treatment with actinomycin D, fibrillar and granular material segregated but no chromatin could be found. All these observations confirmed that the dense masses correspond to nucleoli despite their peculiar ultrastructure. It can also be concluded that this type of nucleoli cannot be considered as a taxonomic character of the slime molds because it does not exist in all slime molds and was observed in some dinoflagellates, and ascomycetes.« less
Modelling of Dictyostelium discoideum movement in a linear gradient of chemoattractant.
Eidi, Zahra; Mohammad-Rafiee, Farshid; Khorrami, Mohammad; Gholami, Azam
2017-11-15
Chemotaxis is a ubiquitous biological phenomenon in which cells detect a spatial gradient of chemoattractant, and then move towards the source. Here we present a position-dependent advection-diffusion model that quantitatively describes the statistical features of the chemotactic motion of the social amoeba Dictyostelium discoideum in a linear gradient of cAMP (cyclic adenosine monophosphate). We fit the model to experimental trajectories that are recorded in a microfluidic setup with stationary cAMP gradients and extract the diffusion and drift coefficients in the gradient direction. Our analysis shows that for the majority of gradients, both coefficients decrease over time and become negative as the cells crawl up the gradient. The extracted model parameters also show that besides the expected drift in the direction of the chemoattractant gradient, we observe a nonlinear dependency of the corresponding variance on time, which can be explained by the model. Furthermore, the results of the model show that the non-linear term in the mean squared displacement of the cell trajectories can dominate the linear term on large time scales.
Influence of fast advective flows on pattern formation of Dictyostelium discoideum
Bae, Albert; Zykov, Vladimir; Bodenschatz, Eberhard
2018-01-01
We report experimental and numerical results on pattern formation of self-organizing Dictyostelium discoideum cells in a microfluidic setup under a constant buffer flow. The external flow advects the signaling molecule cyclic adenosine monophosphate (cAMP) downstream, while the chemotactic cells attached to the solid substrate are not transported with the flow. At high flow velocities, elongated cAMP waves are formed that cover the whole length of the channel and propagate both parallel and perpendicular to the flow direction. While the wave period and transverse propagation velocity are constant, parallel wave velocity and the wave width increase linearly with the imposed flow. We also observe that the acquired wave shape is highly dependent on the wave generation site and the strength of the imposed flow. We compared the wave shape and velocity with numerical simulations performed using a reaction-diffusion model and found excellent agreement. These results are expected to play an important role in understanding the process of pattern formation and aggregation of D. discoideum that may experience fluid flows in its natural habitat. PMID:29590179
Coukell, Barrie; Li, Yi; Moniakis, John; Cameron, Anne
2004-01-01
Changes in free intracellular Ca2+ are thought to regulate several major processes during Dictyostelium development, including cell aggregation and cell type-specific gene expression, but the mechanisms involved are unclear. To learn more about Ca2+ signaling and Ca2+ homeostasis in this organism, we used suppression subtractive hybridization to identify genes up-regulated by high extracellular Ca2+. Unexpectedly, many of the genes identified belong to a novel gene family (termed cup) with seven members. In vegetative cells, the cup genes were up-regulated by high Ca2+ but not by other ions or by heat, oxidative, or osmotic stress. cup induction by Ca2+ was blocked completely by inhibitors of calcineurin and protein synthesis. In developing cells, cup expression was high during aggregation and late development but low during the slug stage. This pattern correlates closely with reported levels of free intracellular Ca2+ during development. The cup gene products are highly homologous, acidic proteins possessing putative ricin domains. BLAST searches failed to reveal homologs in other organisms, but Western analyses suggested that Cup-like proteins might exist in certain other cellular slime mold species. Localization experiments indicated that Cup proteins are primarily cytoplasmic but become cell membrane-associated during Ca2+ stress and cell aggregation. When cup expression was down-regulated by antisense RNA, the cells failed to aggregate. However, this developmental block was overcome by partially up-regulating cup expression. Together, these results suggest that the Cup proteins in Dictyostelium might play an important role in stabilizing and/or regulating the cell membrane during Ca2+ stress and/or certain stages of development. PMID:14871937
Leaps and lulls in the developmental transcriptome of Dictyostelium discoideum.
Rosengarten, Rafael David; Santhanam, Balaji; Fuller, Danny; Katoh-Kurasawa, Mariko; Loomis, William F; Zupan, Blaz; Shaulsky, Gad
2015-04-13
Development of the soil amoeba Dictyostelium discoideum is triggered by starvation. When placed on a solid substrate, the starving solitary amoebae cease growth, communicate via extracellular cAMP, aggregate by tens of thousands and develop into multicellular organisms. Early phases of the developmental program are often studied in cells starved in suspension while cAMP is provided exogenously. Previous studies revealed massive shifts in the transcriptome under both developmental conditions and a close relationship between gene expression and morphogenesis, but were limited by the sampling frequency and the resolution of the methods. Here, we combine the superior depth and specificity of RNA-seq-based analysis of mRNA abundance with high frequency sampling during filter development and cAMP pulsing in suspension. We found that the developmental transcriptome exhibits mostly gradual changes interspersed by a few instances of large shifts. For each time point we treated the entire transcriptome as single phenotype, and were able to characterize development as groups of similar time points separated by gaps. The grouped time points represented gradual changes in mRNA abundance, or molecular phenotype, and the gaps represented times during which many genes are differentially expressed rapidly, and thus the phenotype changes dramatically. Comparing developmental experiments revealed that gene expression in filter developed cells lagged behind those treated with exogenous cAMP in suspension. The high sampling frequency revealed many genes whose regulation is reproducibly more complex than indicated by previous studies. Gene Ontology enrichment analysis suggested that the transition to multicellularity coincided with rapid accumulation of transcripts associated with DNA processes and mitosis. Later development included the up-regulation of organic signaling molecules and co-factor biosynthesis. Our analysis also demonstrated a high level of synchrony among the developing
Too hot to sleep? Sleep behaviour and surface body temperature of Wahlberg's Epauletted Fruit Bat.
Downs, Colleen T; Awuah, Adwoa; Jordaan, Maryna; Magagula, Londiwe; Mkhize, Truth; Paine, Christine; Raymond-Bourret, Esmaella; Hart, Lorinda A
2015-01-01
The significance of sleep and factors that affect it have been well documented, however, in light of global climate change the effect of temperature on sleep patterns has only recently gained attention. Unlike many mammals, bats (order: Chiroptera) are nocturnal and little is known about their sleep and the effects of ambient temperature (Ta) on their sleep. Consequently we investigated seasonal temperature effects on sleep behaviour and surface body temperature of free-ranging Wahlberg's epauletted fruit bat, Epomophorus wahlbergi, at a tree roost. Sleep behaviours of E. wahlbergi were recorded, including: sleep duration and sleep incidences (i.e. one eye open and both eyes closed). Sleep differed significantly across all the individuals in terms of sleep duration and sleep incidences. Individuals generally spent more time awake than sleeping. The percentage of each day bats spent asleep was significantly higher during winter (27.6%), compared with summer (15.6%). In summer, 20.7% of the sleeping bats used one eye open sleep, and this is possibly the first evidence of one-eye-sleep in non-marine mammals. Sleep duration decreased with extreme heat as bats spent significantly more time trying to cool by licking their fur, spreading their wings and panting. Skin temperatures of E. wahlbergi were significantly higher when Ta was ≥35°C and no bats slept at these high temperatures. Consequently extremely hot days negatively impact roosting fruit bats, as they were forced to be awake to cool themselves. This has implications for these bats given predicted climate change scenarios.
Dictyostelium RasG Is Required for Normal Motility and Cytokinesis, But Not Growth
Tuxworth, Richard I.; Cheetham, Janet L.; Machesky, Laura M.; Spiegelmann, George B.; Weeks, Gerald; Insall, Robert H.
1997-01-01
RasG is the most abundant Ras protein in growing Dictyostelium cells and the closest relative of mammalian Ras proteins. We have generated null mutants in which expression of RasG is completely abolished. Unexpectedly, RasG − cells are able to grow at nearly wild-type rates. However, they exhibit defective cell movement and a wide range of defects in the control of the actin cytoskeleton, including a loss of cell polarity, absence of normal lamellipodia, formation of unusual small, punctate polymerized actin structures, and a large number of abnormally long filopodia. Despite their lack of polarity and abnormal cytoskeleton, mutant cells perform normal chemotaxis. However, rasG − cells are unable to perform normal cytokinesis, becoming multinucleate when grown in suspension culture. Taken together, these data suggest a principal role for RasG in coordination of cell movement and control of the cytoskeleton. PMID:9245789
Akers, Jeremy D.; Cornett, Rachel A.; Savla, Jyoti S.; Davy, Kevin P.; Davy, Brenda M.
2012-01-01
Maintenance of weight loss remains a challenge for most individuals, thus practical and effective weight loss maintenance (WTLM) strategies are needed. A two-group (WEV versus WEV+) 12-month WTLM intervention trial was conducted (June 2007–February 2010) to determine the feasibility and effectiveness of weight loss maintenance intervention for older adults using daily self-monitoring of body weight, step count, fruit/vegetable intake and water consumption. Forty weight-reduced (mean weight lost = 6.7 ± 0.6 kg; BMI 29.2 ± 1.1 kg/m2) individuals aged 63 ± 1 yrs, who had previously participated in a 12-week randomized controlled weight loss intervention trial, were instructed to record daily body weight (Weight), step count (Exercise), and fruit/vegetable intake (Vegetable). Experimental group (WEV+) participants were also instructed to consume 16 floz of water before each main meal (i.e., three times daily), and to record daily water intake. Outcome measures included weight change, diet/physical activity behaviors, theoretical constructs related to health behaviors, and other clinical measures. Statistical analyses included growth curve analyses and repeated measures ANOVA. Over 12 months, there was a linear decline in weight (β = −0.32, P < 0.001) and a quadratic trend (β = 0.02, P < 0.01) over time, but no group difference (β = −0.23, P = 0.08). Analysis of the 365 days of self-reported body weight for each participant determined that weight loss was greater over the study period in WEV+ than WEV, corresponding to weight changes of −0.67 kg and 1.00 kg respectively, and an 87% greater weight loss (β = −0.01, P < 0.01). Overall compliance to daily tracking was 76 ± 5%. Daily self-monitoring of weight, physical activity, and fruit/vegetable consumption is a feasible and effective approach for maintaining weight loss for 12 months, and daily self-monitoring of increased water consumption may provide additional WTLM benefits. PMID:22709772
A Continuum Model of Actin Waves in Dictyostelium discoideum
Khamviwath, Varunyu; Hu, Jifeng; Othmer, Hans G.
2013-01-01
Actin waves are complex dynamical patterns of the dendritic network of filamentous actin in eukaryotes. We developed a model of actin waves in PTEN-deficient Dictyostelium discoideum by deriving an approximation of the dynamics of discrete actin filaments and combining it with a signaling pathway that controls filament branching. This signaling pathway, together with the actin network, contains a positive feedback loop that drives the actin waves. Our model predicts the structure, composition, and dynamics of waves that are consistent with existing experimental evidence, as well as the biochemical dependence on various protein partners. Simulation suggests that actin waves are initiated when local actin network activity, caused by an independent process, exceeds a certain threshold. Moreover, diffusion of proteins that form a positive feedback loop with the actin network alone is sufficient for propagation of actin waves at the observed speed of . Decay of the wave back can be caused by scarcity of network components, and the shape of actin waves is highly dependent on the filament disassembly rate. The model allows retraction of actin waves and captures formation of new wave fronts in broken waves. Our results demonstrate that a delicate balance between a positive feedback, filament disassembly, and local availability of network components is essential for the complex dynamics of actin waves. PMID:23741312
Pattern formation in Dictyostelium discoideum aggregates in confined microenvironments
NASA Astrophysics Data System (ADS)
Hallou, Adrien; Hersen, Pascal; di Meglio, Jean-Marc; Kabla, Alexandre
Dictyostelium Discoideum (Dd) is often viewed as a model system to study the complex collective cell behaviours which shape an embryo. Under starvation, Dd cells form multicellular aggregates which soon elongate, starting to display an anterior-posterior axis by differentiating into two distinct cell populations; prestalk (front) and prespore (rear) cells zones. Different models, either based on positional information or on differentiation followed up by cell sorting, have been proposed to explain the origin and the regulation of this spatial pattern.To decipher between the proposed hypotheses, we have developed am experimental platform where aggregates, made of genetically engineered Dd cells to express fluorescent reporters of cell differentiation in either prestalk or prespore cells, are allowed to develop in 20 to 400 μm wide hydrogel channels. Such a setup allows us to both mimic Dd confined natural soil environment and to follow the patterning dynamics using time-lapse microscopy. Tracking cell lineage commitments and positions in space and time, we demonstrate that Dd cells differentiate first into prestalk and prespore cells prior to sorting into an organized spatial pattern on the basis of collective motions based on differential motility and adhesion mechanisms. A. Hallou would like to thank the University of Cambridge for the Award of an ``Oliver Gatty Studentship in Biophysical and Colloid Science''.
Ueki, Toshiyuki; Inouye, Sumiko
2003-01-01
Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461
Brookie, Kate L.; Best, Georgia I.; Conner, Tamlin S.
2018-01-01
Background: Higher intakes of fruits and vegetables, rich in micronutrients, have been associated with better mental health. However, cooking or processing may reduce the availability of these important micronutrients. This study investigated the differential associations between intake of raw fruits and vegetables, compared to processed (cooked or canned) fruits and vegetables, and mental health in young adults. Methods: In a cross-sectional survey design, 422 young adults ages 18–25 (66.1% female) living in New Zealand and the United States completed an online survey that assessed typical consumption of raw vs. cooked/canned/processed fruits and vegetables, negative and positive mental health (depressive symptoms, anxiety, negative mood, positive mood, life satisfaction, and flourishing), and covariates (including socio-economic status, body mass index, sleep, physical activity, smoking, and alcohol use). Results: Controlling for covariates, raw fruit and vegetable intake (FVI) predicted reduced depressive symptoms and higher positive mood, life satisfaction, and flourishing; processed FVI only predicted higher positive mood. The top 10 raw foods related to better mental health were carrots, bananas, apples, dark leafy greens like spinach, grapefruit, lettuce, citrus fruits, fresh berries, cucumber, and kiwifruit. Conclusions: Raw FVI, but not processed FVI, significantly predicted higher mental health outcomes when controlling for the covariates. Applications include recommending the consumption of raw fruits and vegetables to maximize mental health benefits. PMID:29692750
Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin
2014-01-01
A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571
Maeda, Yasuo
2015-02-10
Apoptosis (programmed cell death) is regarded as ultimate differentiation of the cell. We have recently demonstrated that a targeted delivery of Dd-MRP4 (Dictyostelium mitochondrial ribosomal protein S4) suppresses specifically the proliferation of the human cancer cells, by inducing their apoptotic cell death (Chida et al., 2014, doi:10.1186/1475-2867-14-56). This amazing fact was discovered, simply based on the finding that Dd-MRP4 expression is absolutely required for transition of Dictyostelium cells from growth to differentiation (Chida et al., 2008, doi:10.1186/1471-2156-9-25; Maeda et al., 2013, doi:10.3390/biom3040943). Dd-MRP4 protein has quite unique structural characters, in that it is highly basic (pI: about 11.5) and interestingly has several nuclear-localization signals within the molecule. In this review, we introduce briefly the efficacy of several apoptosis-inducing substances reported thus far for cancer therapy, and speculate the possible mechanisms, by which apoptosis is specifically induced by Dd-MRP4, on the basis of its structural uniqueness. We also discuss several issues to be solved for the medical application of ectopically expressed Dd-MRP4 in human cancer cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kubohara, Yuzuru, E-mail: ykuboha@juntendo.ac.jp; Department of Health Science, Juntendo University Graduate School of Health and Sports Science, Inzai 270-1695; Komachi, Mayumi
Osteosarcoma is a common metastatic bone cancer that predominantly develops in children and adolescents. Metastatic osteosarcoma remains associated with a poor prognosis; therefore, more effective anti-metastatic drugs are needed. Differentiation-inducing factor-1 (DIF-1), −2, and −3 are novel lead anti-tumor agents that were originally isolated from the cellular slime mold Dictyostelium discoideum. Here we investigated the effects of a panel of DIF derivatives on lysophosphatidic acid (LPA)-induced migration of mouse osteosarcoma LM8 cells by using a Boyden chamber assay. Some DIF derivatives such as Br-DIF-1, DIF-3(+2), and Bu-DIF-3 (5–20 μM) dose-dependently suppressed LPA-induced cell migration with associated IC{sub 50} values of 5.5, 4.6, andmore » 4.2 μM, respectively. On the other hand, the IC{sub 50} values of Br-DIF-1, DIF-3(+2), and Bu-DIF-3 versus cell proliferation were 18.5, 7.2, and 2.0 μM, respectively, in LM8 cells, and >20, 14.8, and 4.3 μM, respectively, in mouse 3T3-L1 fibroblasts (non-transformed). Together, our results demonstrate that Br-DIF-1 in particular may be a valuable tool for the analysis of cancer cell migration, and that DIF derivatives such as DIF-3(+2) and Bu-DIF-3 are promising lead anti-tumor agents for the development of therapies that suppress osteosarcoma cell proliferation, migration, and metastasis. - Highlights: • LPA induces cell migration (invasion) in murine osteosarcoma LM8 cells. • DIFs are novel lead anti-tumor agents found in Dictyostelium discoideum. • We examined the effects of DIF derivatives on LPA-induced LM8 cell migration in vitro. • Some of the DIF derivatives inhibited LPA-induced LM8 cell migration.« less
Palacios, Irene; García-Lafuente, Ana; Guillamón, Eva; Villares, Ana
2012-09-01
Novel water-soluble polysaccharides have been isolated from the fruiting bodies of the edible mushroom Pleurotus ostreatus. Three polysaccharide fractions were obtained by ethanol precipitation from cold water, hot water and hot aqueous NaOH extracts. The fractions were purified by size exclusion chromatography showing a unique carbohydrate occurring in each fraction: PC from the cold fraction, PH from the hot fraction and PB from the hot aqueous NaOH fraction. The analysis of the methylated alditol acetates and the NMR studies revealed that all the polysaccharides displayed a linear backbone. PC was formed by α-(1→3),(1→6)-linked galactopyranosyl residues whereas PH and PB consisted of glucose-linked units. PH was exclusively composed of glucopyranosyl units bound by α-(1→4) linkages whereas PB was a β-linked glucan showing (1→3) and (1→6) glycosidic bonds. The analysis of molecular arrangement by complexation with Congo red showed that only the β-linked polysaccharide (PB) displayed a triple helix conformation. Copyright © 2012 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Gholami, A.; Steinbock, O.; Zykov, V.; Bodenschatz, E.
2015-01-01
We report experiments on flow-driven waves in a microfluidic channel containing the signaling slime mold Dictyostelium discoideum. The observed cyclic adenosine monophosphate (cAMP) wave trains developed spontaneously in the presence of flow and propagated with the velocity proportional to the imposed flow velocity. The period of the wave trains was independent of the flow velocity. Perturbations of flow-driven waves via external periodic pulses of the signaling agent cAMP induced 1 ∶1 , 2 ∶1 , 3 ∶1 , and 1 ∶2 frequency responses, reminiscent of Arnold tongues in forced oscillatory systems. We expect our observations to be generic to active media governed by reaction-diffusion-advection dynamics, where spatially bound autocatalytic processes occur under flow conditions.
Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L
1989-09-01
A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report inmore » the interest of brevity.« less
Localization of palmitoylated and activated G protein α-subunit in Dictyostelium discoideum.
Alamer, Sarah; Kageyama, Yusuke; Gundersen, Robert E
2018-06-01
Guanine nucleotide-binding proteins (G proteins) act as molecular switches to regulate many fundamental cellular processes. The lipid modification, palmitoylation, can be considered as a key factor for proper G protein function and plasma membrane localization. In Dictyostelium discoidum, Gα2 is essential for the chemotactic response to cAMP in their developmental life cycle. However, the regulation of Gα2 with respect to palmitoylation, activation and Gβγ association is less clear. In this study, Gα2 is shown to be palmitoylated on Cys-4 by [ 3 H]palmitate labeling. Loss of this palmitoylation site results in redistribution of Gα2 within the cell and poor D. discoideum development. Cellular re-localization is also observed for activated Gα2. In the membrane fraction, Gα2-wt (YFP) is highly enriched in a low-density membrane fraction, which is palmitoylation-dependent. Activated Gα2 monomer and heterotrimer are shifted to two different higher-density fractions. These results broaden our understanding of how G protein localization and function are regulated inside the cells. © 2018 Wiley Periodicals, Inc.
A discrete cell model with adaptive signalling for aggregation of Dictyostelium discoideum.
Dallon, J C; Othmer, H G
1997-01-01
Dictyostelium discoideum (Dd) is a widely studied model system from which fundamental insights into cell movement, chemotaxis, aggregation and pattern formation can be gained. In this system aggregation results from the chemotactic response by dispersed amoebae to a travelling wave of the chemoattractant cAMP. We have developed a model in which the cells are treated as discrete points in a continuum field of the chemoattractant, and transduction of the extracellular cAMP signal into the intracellular signal is based on the G protein model developed by Tang & Othmer. The model reproduces a number of experimental observations and gives further insight into the aggregation process. We investigate different rules for cell movement the factors that influence stream formation the effect on aggregation of noise in the choice of the direction of movement and when spiral waves of chemoattractant and cell density are likely to occur. Our results give new insight into the origin of spiral waves and suggest that streaming is due to a finite amplitude instability. PMID:9134569
Dictyostelium LvsB has a regulatory role in endosomal vesicle fusion
Falkenstein, Kristin; De Lozanne, Arturo
2014-01-01
ABSTRACT Defects in human lysosomal-trafficking regulator (Lyst) are associated with the lysosomal disorder Chediak–Higashi syndrome. The absence of Lyst results in the formation of enlarged lysosome-related compartments, but the mechanism for how these compartments arise is not well established. Two opposing models have been proposed to explain Lyst function. The fission model describes Lyst as a positive regulator of fission from lysosomal compartments, whereas the fusion model identifies Lyst as a negative regulator of fusion between lysosomal vesicles. Here, we used assays that can distinguish between defects in vesicle fusion versus fission. We compared the phenotype of Dictyostelium discoideum cells defective in LvsB, the ortholog of Lyst, with that of two known fission defect mutants (μ3- and WASH-null mutants). We found that the temporal localization characteristics of the post-lysosomal marker vacuolin, as well as vesicular acidity and the fusion dynamics of LvsB-null cells are distinct from those of both μ3- and WASH-null fission defect mutants. These distinctions are predicted by the fusion defect model and implicate LvsB as a negative regulator of vesicle fusion. PMID:25086066
Complete Genome Sequence of the Fruiting Myxobacterium Melittangium boletus DSM 14713.
Treuner-Lange, Anke; Bruckskotten, Marc; Rupp, Oliver; Goesmann, Alexander; Søgaard-Andersen, Lotte
2017-11-09
The formation of spore-filled fruiting bodies in response to starvation represents a hallmark of many members of the order Myxococcales Here, we present the complete 9.9-Mb genome of the fruiting type strain Melittangium boletus DSM 14713, the first member of this genus to have its genome sequenced. Copyright © 2017 Treuner-Lange et al.
Lapointe, Annie; Weisnagel, S John; Provencher, Véronique; Bégin, Catherine; Dufour-Bouchard, Andrée-Ann; Trudeau, Caroline; Lemieux, Simone
2010-10-01
The aim of the present study was to compare the long-term effects of two dietary approaches on changes in dietary intakes, eating behaviours and body weight: (1) approach using restrictive messages to limit high-fat foods (low-fat intake; LOFAT); (2) approach emphasising non-restrictive messages directed towards the inclusion of fruits and vegetables (high intake of fruits and vegetables; HIFV). A total of sixty-eight overweight or obese postmenopausal women were randomly assigned to one of the two dietary approaches. The 6-month dietary intervention included three group sessions and ten individual sessions with a dietitian. Dietary intakes, eating behaviours and anthropometrics were measured at baseline, at the end of the dietary intervention (T = 6) and 6 months and 12 months after the end of the intervention (T = 12 and T = 18). In the LOFAT group, energy and fat intakes were lower at T = 6 when compared with baseline and remained lower at T = 12 and T = 18. In the HIFV group, fruit and vegetable intakes increased significantly at T = 6 but were no longer significantly different from baseline at T = 12 and T = 18. Dietary restraint increased at T = 6 and remained higher than baseline at T = 18 in the LOFAT group while no significant change was observed in the HIFV group. At T = 6, body weight was significantly lower than baseline in both groups (LOFAT: - 3.7 (SD 2.8) kg; HIFV: - 1.8 (SD 3.0) kg) and no significant difference in body-weight change from baseline was found between groups at T = 18. We concluded that weight loss was similar at 1-year follow-up in both dietary approaches. Despite relatively good improvements in the short term, the adherence to a 6-month dietary intervention promoting high intakes of fruits and vegetables was difficult to maintain.
Saito, T; Ochiai, H
1999-10-01
cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.
Too Hot to Sleep? Sleep Behaviour and Surface Body Temperature of Wahlberg’s Epauletted Fruit Bat
Downs, Colleen T.; Awuah, Adwoa; Jordaan, Maryna; Magagula, Londiwe; Mkhize, Truth; Paine, Christine; Raymond-Bourret, Esmaella; Hart, Lorinda A.
2015-01-01
The significance of sleep and factors that affect it have been well documented, however, in light of global climate change the effect of temperature on sleep patterns has only recently gained attention. Unlike many mammals, bats (order: Chiroptera) are nocturnal and little is known about their sleep and the effects of ambient temperature (Ta) on their sleep. Consequently we investigated seasonal temperature effects on sleep behaviour and surface body temperature of free-ranging Wahlberg’s epauletted fruit bat, Epomophorus wahlbergi, at a tree roost. Sleep behaviours of E. wahlbergi were recorded, including: sleep duration and sleep incidences (i.e. one eye open and both eyes closed). Sleep differed significantly across all the individuals in terms of sleep duration and sleep incidences. Individuals generally spent more time awake than sleeping. The percentage of each day bats spent asleep was significantly higher during winter (27.6%), compared with summer (15.6%). In summer, 20.7% of the sleeping bats used one eye open sleep, and this is possibly the first evidence of one-eye-sleep in non-marine mammals. Sleep duration decreased with extreme heat as bats spent significantly more time trying to cool by licking their fur, spreading their wings and panting. Skin temperatures of E. wahlbergi were significantly higher when Ta was ≥35°C and no bats slept at these high temperatures. Consequently extremely hot days negatively impact roosting fruit bats, as they were forced to be awake to cool themselves. This has implications for these bats given predicted climate change scenarios. PMID:25775371
Berry fruit enhances beneficial signaling in brain
USDA-ARS?s Scientific Manuscript database
Increased lifespans have led to population aging and brought attention to healthcare concerns associated with old age. A growing body of pre-clinical and clinical research has identified neurological benefits associated with the consumption of berry fruits. In addition to their now well-known antio...
Fu, Shao Chun; Zhang, Mei Yan; Shang, Xiao Dong; Chen, Ming Jie; Tan, Qi
2011-01-01
The ability of two freshly isolated Boletus stains to fruit under axenic conditions was tested using different solid and liquid nutrient media. One strain (YNCX04) produced numerous primordia from which fruiting bodies, 12 mm and 10 mm in length, with grey, convex pilei, and yellow-white, clavate stipes developed between 15 and 30 d after inoculation of fungal mycelium onto a solid medium consisting of mineral salts, thiamine, glucose, potato, an extract of Cunninghamia lanceolata root, and agar. The other strain (YNB200) produced numerous primordia but no sporophores. Strain YNCX04 lost the ability to form fruiting bodies in axenic culture 6 mo after initial isolation but retained the ability to form primordia for up to 18 mo. Based on internal transcribed spacer sequencing data, strains YNB200 and YNCX04 formed a sub-cluster together with four previously designated Boletus edulis strains from China. Phylogenetic analysis placed the Chinese strains closer to B. aestivalis than to European and North American strains of B. edulis, although a 29-bp fragment specific to all the B. aestivalis strains was absent from all the Chinese strains. Furthermore, partial 18S rDNA sequences from strains YNB200 and YNCX04 exhibited 98% similarity with an 18S rDNA sequence from B. edulis strain Be3. Further molecular studies are indicated to more accurately establish the taxonomic positions ofF3 and F4-3, as well as the Chinese strains designated as B. edulis.
Loss of Cln3 impacts protein secretion in the social amoeba Dictyostelium.
Huber, Robert J
2017-07-01
Neuronal ceroid lipofuscinosis (NCL), also referred to as Batten disease, is the most common form of childhood neurodegeneration. Mutations in CLN3 cause the most prevalent subtype of the disease, which manifests during early childhood and is currently untreatable. The precise function of the CLN3 protein is still not known, which has inhibited the development of targeted therapies. In the social amoeba Dictyostelium discoideum, loss of the CLN3 homolog, Cln3, reduces adhesion during early development, which delays streaming and aggregation. The results of the present study indicate that this phenotype may be at least partly due to aberrant protein secretion in cln3 - cells. It is well-established that Cln3 localizes primarily to the contractile vacuole (CV) system in Dictyostelium, and to a lesser extent, compartments of the endocytic pathway. Intriguingly, the CV system has been linked to the secretion of proteins that do not contain a signal peptide for secretion (i.e., unconventional protein secretion). Proteins that do contain a signal peptide are secreted via a conventional mechanism involving the endoplasmic reticulum, transport through the Golgi, and secretion via vesicle release. In this study, Cln3 was observed to co-localize with the Golgi marker wheat germ agglutinin suggesting that Cln3 participates in both secretion mechanisms. Chimeras of wild-type (WT) and cln3 - cells displayed delayed streaming and aggregation, and interestingly, cln3 - cells starved in conditioned media (CM) harvested from starving WT cells showed near normal timing of streaming and aggregation suggesting aberrant protein secretion in Cln3-deficient cells. Based on these observations, LC-MS/MS was used to reveal the protein content of CM from starved cells (mass spectrometry data are available via ProteomeXchange with identifier PXD004897). A total of 450 proteins were detected in WT and cln3 - CM, of which 3 were absent in cln3 - CM. Moreover, 12 proteins that were present in
Han, Hye Jin; Jung, Un Ju; Kim, Hye-Jin; Cho, Su-Jung; Kim, Ae Hyang; Han, Youngji; Choi, Myung-Sook
2016-02-01
The aim of this study was to examine the efficacy of combined grape pomace and omija fruit ethanol extracts (GO) on metabolic disorders in overweight or obese subjects. Seventy-six subjects (30-70 years, body mass index ≥23.0 kg/m2) were divided into control (starch, 4 g/day, n = 24), low-GO (low dose GO, grape pomace extract [342.5 mg/day] + omija fruit extract [57.5 mg/day], n = 26), and high-GO (high dose GO, grape pomace extract [685 mg/day] + omija fruit extract [115 mg/day], n = 26) groups. Body composition, nutrient intake, plasma lipid profiles, inflammation, antioxidant capacity, and hepatotoxicity markers were assessed in all subjects at the baseline and 10 weeks after taking the supplements. The body weight and body fat of overweight or obese subjects was not significantly altered in the low-GO and high-GO groups. However, the high-GO supplement significantly decreased the baseline-adjusted final plasma total-cholesterol, low-density lipoprotein (LDL)-cholesterol, and non-high-density lipoprotein (HDL)-cholesterol levels and increased the baseline-adjusted final plasma apolipoprotein (apo) A-1 level compared with that of the control group. In addition, the high-GO supplement significantly lowered apo B, apo B/apo A-1, lipoprotein a (Lp[a]), atherogenic index, interleukin (IL)-1β, tumor necrosis factor-α, and elevated erythrocyte antioxidant capacity compared with the control group or the baseline levels. The low-GO supplement decreased the plasma IL-1β level and elevated erythrocyte superoxide dismutase activity compared with that at baseline. However, in general, high-GO exerted a greater effect than low-GO. There were no significant differences in activities of plasma glutamate oxaloacetate transaminase and glutamate pyruvate transaminase between the groups. This study is a preliminary clinical study to verify that GO could be beneficial for amelioration of obesity-related dyslipidemia, inflammation, and oxidative stress
Loayza, Andrea P.; Squeo, Francisco A.
2016-01-01
Scatter-hoarding rodents can act as both predators and dispersers for many large-seeded plants because they cache seeds for future use, but occasionally forget them in sites with high survival and establishment probabilities. The most important fruit or seed trait influencing rodent foraging behavior is seed size; rodents prefer large seeds because they have higher nutritional content, but this preference can be counterbalanced by the higher costs of handling larger seeds. We designed a cafeteria experiment to assess whether fruit and seed size of Myrcianthes coquimbensis, an endangered desert shrub, influence the decision-making process during foraging by three species of scatter-hoarding rodents differing in body size: Abrothrix olivaceus, Phyllotis darwini and Octodon degus. We found that the size of fruits and seeds influenced foraging behavior in the three rodent species; the probability of a fruit being harvested and hoarded was higher for larger fruits than for smaller ones. Patterns of fruit size preference were not affected by rodent size; all species were able to hoard fruits within the entire range of sizes offered. Finally, fruit and seed size had no effect on the probability of seed predation, rodents typically ate only the fleshy pulp of the fruits offered and discarded whole, intact seeds. In conclusion, our results reveal that larger M. coquimbensis fruits have higher probabilities of being harvested, and ultimately of its seeds being hoarded and dispersed by scatter-hoarding rodents. As this plant has no other dispersers, rodents play an important role in its recruitment dynamics. PMID:27861550
Kruse, Janis; Meier, Doreen; Zenk, Fides; Rehders, Maren; Nellen, Wolfgang; Hammann, Christian
2016-10-02
The maturation pathways of microRNAs (miRNAs) have been delineated for plants and several animals, belonging to the evolutionary supergroups of Archaeplastida and Opisthokonta, respectively. Recently, we reported the discovery of the microprocessor complex in Dictyostelium discoideum of the Amoebozoa supergroup. The complex is composed of the Dicer DrnB and the dsRBD (double-stranded RNA binding domain) containing protein RbdB. Both proteins localize at nucleoli, where they physically interact, and both are required for miRNA maturation. Here we show that the miRNA phenotype of a ΔdrnB gene deletion strain can be rescued by ectopic expression of a series of DrnB GFP fusion proteins, which consistently showed punctate perinucleolar localization in fluorescence microscopy. These punctate foci appear surprisingly stable, as they persist both disintegration of nucleoli and degradation of cellular nucleic acids. We observed that DrnB expression levels influence the number of microprocessor foci and alter RbdB accumulation. An investigation of DrnB variants revealed that its newly identified nuclear localization signal is necessary, but not sufficient for the perinucleolar localization. Biogenesis of miRNAs, which are RNA Pol II transcripts, is correlated with that localization. Besides its bidentate RNase III domains, DrnB contains only a dsRBD, which surprisingly is dispensable for miRNA maturation. This dsRBD can, however, functionally replace the homologous domain in RbdB. Based on the unique setup of the Dictyostelium microprocessor with a subcellular localization similar to plants, but a protein domain composition similar to animals, we propose a model for the evolutionary origin of RNase III proteins acting in miRNA maturation.
Smith, Derek D. N.; Nickzad, Arvin
2016-01-01
ABSTRACT Pantoea is a versatile genus of bacteria with both plant- and animal-pathogenic strains, some of which have been suggested to cause human infections. There is, however, limited knowledge on the potential determinants used for host association and pathogenesis in animal systems. In this study, we used the model host Dictyostelium discoideum to show that isolates of Pantoea ananatis exhibit differential grazing susceptibility, with some being resistant to grazing by the amoebae. We carried out a high-throughput genetic screen of one grazing-resistant isolate, P. ananatis BRT175, using the D. discoideum pathosystem to identify genes responsible for the resistance phenotype. Among the 26 candidate genes involved in grazing resistance, we identified rhlA and rhlB, which we show are involved in the biosynthesis of a biosurfactant that enables swarming motility in P. ananatis BRT175. Using liquid chromatography-mass spectrometry (LC-MS), the biosurfactant was shown to be a glycolipid with monohexose-C10-C10 as the primary congener. We show that this novel glycolipid biosurfactant is cytotoxic to the amoebae and is capable of compromising cellular integrity, leading to cell lysis. The production of this biosurfactant may be important for bacterial survival in the environment and could contribute to the establishment of opportunistic infections. IMPORTANCE The genetic factors used for host interaction by the opportunistic human pathogen Pantoea ananatis are largely unknown. We identified two genes that are important for the production of a biosurfactant that confers grazing resistance against the social amoeba Dictyostelium discoideum. We show that the biosurfactant, which exhibits cytotoxicity toward the amoebae, is a glycolipid that incorporates a hexose rather than rhamnose. The production of this biosurfactant may confer a competitive advantage in the environment and could potentially contribute to the establishment of opportunistic infections. PMID
Vicente, Juan J; Galardi-Castilla, María; Escalante, Ricardo; Sastre, Leandro
2008-01-03
The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N), that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87-89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.
Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta
2014-03-01
Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.
Structural elucidation of a heteroglycan from the fruiting bodies of Agaricus blazei Murill.
Liu, Jicheng; Zhang, Chunjing; Wang, Yajun; Yu, Haitao; Liu, Han; Wang, Liping; Yang, Xiuzhen; Liu, Zhecheng; Wen, Xianchun; Sun, Yongxu; Yu, Chunlei; Liu, Lei
2011-11-01
One water-soluble polysaccharide (ABP-W1) was purified from the fruiting bodies of Agaricus blazei by DEAE Sepharose Fast Flow and Sepharose 6 Fast Flow column chromatography. Its molecular weight was about 3.9×10(2) kDa as determined by high-performance size-exclusion chromatography (HPSEC). The structural feature of ABP-W1 was investigated by a combination of chemical and instrumental analysis, including partial hydrolysis with acid, periodate oxidation-Smith degradation, acetylation, methylation analysis and nuclear magnetic resonance spectroscopy (NMR (1)H, (13)C). The results revealed that ABP-W1 had a backbone consisting of (1→6)-linked-α-D-galactopyranosyl and (1→2,6)-linked-α-D-glucopyranosyl, which was branched with one single terminal (1→)-α-D-glucopyranosyl at the O-2 position of (1→2,6)-linked-α-D-glucopyranosyl along the main chain in the ratio of 1:1:1. The observation of the complex-formation between ABP-W1 and Congo Red indicated that ABP-W1 probably existed in a triple-strand helical conformation in water. Based on the data obtained, ABP-W1 was composed of a repeating unit with a structure as below: [structure: see text]. Copyright © 2011 Elsevier B.V. All rights reserved.
Memorizing fruit: The effect of a fruit memory-game on children's fruit intake.
Folkvord, Frans; Anastasiadou, Dimitra Tatiana; Anschütz, Doeschka
2017-03-01
Food cues of palatable food are omnipresent, thereby simulating the intake of unhealthy snack food among children. As a consequence, this might lead to a higher intake of energy-dense snacks and less fruit and vegetables, a habit that increases the risk of developing chronic diseases. The aim of this experimental study is to examine whether playing a memory game with fruit affects fruit intake among young children. We used a randomized between-subject design with 127 children (age: 7-12 y) who played a memory-game, containing either fruit ( n = 64) or non-food products ( n = 63). While playing the memory-game in a separate room in school during school hours, free intake of fruit (mandarins, apples, bananas, and grapes) was measured. Afterwards, the children completed self-report measures, and length and weight were assessed. The main finding is that playing a memory-game containing fruit increases overall fruit intake ( P = 0.016). Children who played the fruit version of the memory-game ate more bananas ( P = 0.015) and mandarins ( P = 0.036) than children who played the non-food memory-game; no effects were found for apples ( P > 0.05) and grapes ( P > 0.05). The findings suggest that playing a memory-game with fruit stimulates fruit intake among young children. This is an important finding because children eat insufficient fruit, according to international standards, and more traditional health interventions have limited success. Healthy eating habits of children maintain when they become adults, making it important to stimulate fruit intake among children in an enjoyable way. Nederlands Trial Register TC = 5687.
Sukumaran, Salil K.; Blau-Wasser, Rosemarie; Rohlfs, Meino; Gallinger, Christoph; Schleicher, Michael; Noegel, Angelika A
2015-01-01
CEP161 is a novel component of the Dictyostelium discoideum centrosome which was identified as binding partner of the pericentriolar component CP250. Here we show that the amino acids 1-763 of the 1381 amino acids CEP161 are sufficient for CP250 binding, centrosomal targeting and centrosome association. Analysis of AX2 cells over-expressing truncated and full length CEP161 proteins revealed defects in growth and development. By immunoprecipitation experiments we identified the Hippo related kinase SvkA (Hrk-svk) as binding partner for CEP161. Both proteins colocalize at the centrosome. In in vitro kinase assays the N-terminal domain of CEP161 (residues 1-763) inhibited the kinase activity of Hrk-svk. A comparison of D. discoideum Hippo kinase mutants with mutants overexpressing CEP161 polypeptides revealed similar defects. We propose that the centrosomal component CEP161 is a novel player in the Hippo signaling pathway and affects various cellular properties through this interaction. PMID:25607232
Rosaceae Fruit Development, Ripening and Post-harvest: An Epigenetic Perspective
Farinati, Silvia; Rasori, Angela; Varotto, Serena; Bonghi, Claudio
2017-01-01
Rosaceae is a family with an extraordinary spectrum of fruit types, including fleshy peach, apple, and strawberry that provide unique contributions to a healthy diet for consumers, and represent an excellent model for studying fruit patterning and development. In recent years, many efforts have been made to unravel regulatory mechanism underlying the hormonal, transcriptomic, proteomic and metabolomic changes occurring during Rosaceae fruit development. More recently, several studies on fleshy (tomato) and dry (Arabidopsis) fruit model have contributed to a better understanding of epigenetic mechanisms underlying important heritable crop traits, such as ripening and stress response. In this context and summing up the results obtained so far, this review aims to collect the available information on epigenetic mechanisms that may provide an additional level in gene transcription regulation, thus influencing and driving the entire Rosaceae fruit developmental process. The whole body of information suggests that Rosaceae fruit could become also a model for studying the epigenetic basis of economically important phenotypes, allowing for their more efficient exploitation in plant breeding. PMID:28769956
Li, Qiao-Zhen; Wu, Di; Zhou, Shuai; Liu, Yan-Fang; Li, Zheng-Peng; Feng, Jie; Yang, Yan
2016-06-25
HPB-3, a heteropolysaccharide, with a mean molecular weight of 1.5×10(4)Da, was obtained from the maturating-stage IV, V and VI fruiting body of Hericium erinaceus, exhibited higher macrophages stimulation activities, was able to upregulate the functional events mediated by activated macrophages, such as production of nitric oxide (NO). Monosaccharide composition analysis showed that HPB-3 comprised l-fucose, d-galactose and d-glucose in the ratio of 5.2:23.9:1. Its chemical structure was characterized by sugar and methylation analysis, along with (1)H and (13)C NMR spectroscopy, including (1)H-(1)H COSY, TOCSY, NOESY, HMQC and HMBC experiments. The results indicated that HPB-3 contained a-(1/6)-linked galactopyranosyl backbone, partially with a side chain composed of α-l-fucopyranose at the O-2 position. The predicted primary structure of the polysaccharide was established as below. Copyright © 2016 Elsevier Ltd. All rights reserved.
Seo, Hyo Won; Hung, Tran Manh; Na, MinKyun; Jung, Hyun Ju; Kim, Jin Cheol; Choi, Jae Sue; Kim, Jung Hee; Lee, Hyeong-Kyu; Lee, IkSoo; Bae, KiHwan; Hattori, Masao; Min, Byung Sun
2009-11-01
To determine the anti-complement activity of natural triterpenes, chromatographic separation of the EtOAc-soluble fraction from the fruiting body of Ganoderma lucidum led to the isolation of three steroids and five triterpenoids. They were identified as ergosterol peroxide (1), ergosterol (2), genoderic acid Sz (3), stella sterol (4), ganoderic aic C1 (5), ganoderic acid A (6), methyl ganoderate A (7), and lucidenic acid A (8) based on spectroscopic evidence and physicochemical properties. These compounds were examined for their anti-complement activity against the classical pathway of the complement system. Compounds 2 and 3 showed potent anti-complement activity with IC50 values of 52.0 and 44.6 microM, respectively. Compound 1 exhibited significant inhibitory activity with an IC50 value of 126.8 microM, whereas compounds 4-8 were inactive. Our findings suggested that in addition to the ketone group at C-3, the delta7(8), delta9(11)-lanostadiene type triterpene also plays an important role in inhibiting the hemolytic activity of human serum against erythrocytes.
O'Day, Danton H; Budniak, Aldona
2015-02-01
Mitosis is a fundamental and essential life process. It underlies the duplication and survival of all cells and, as a result, all eukaryotic organisms. Since uncontrolled mitosis is a dreaded component of many cancers, a full understanding of the process is critical. Evolution has led to the existence of three types of mitosis: closed, open, and semi-open. The significance of these different mitotic species, how they can lead to a full understanding of the critical events that underlie the asexual duplication of all cells, and how they may generate new insights into controlling unregulated cell division remains to be determined. The eukaryotic microbe Dictyostelium discoideum has proved to be a valuable biomedical model organism. While it appears to utilize closed mitosis, a review of the literature suggests that it possesses a form of mitosis that lies in the middle between truly open and fully closed mitosis-it utilizes a form of semi-open mitosis. Here, the nucleocytoplasmic translocation patterns of the proteins that have been studied during mitosis in the social amoebozoan D. discoideum are detailed followed by a discussion of how some of them provide support for the hypothesis of semi-open mitosis. © 2014 The Authors. Biological Reviews published by John Wiley & Sons Ltd on behalf of Cambridge Philosophical Society.
Sawarkar, Ritwick; Visweswariah, Sandhya S; Nellen, Wolfgang; Nanjundiah, Vidyanand
2009-09-04
Epigenetic modifications of histones regulate gene expression and lead to the establishment and maintenance of cellular phenotypes during development. Histone acetylation depends on a balance between the activities of histone acetyltransferases and histone deacetylases (HDACs) and influences transcriptional regulation. In this study, we analyse the roles of HDACs during growth and development of one of the cellular slime moulds, the social amoeba Dictyostelium discoideum. The inhibition of HDAC activity by trichostatin A results in histone hyperacetylation and a delay in cell aggregation and differentiation. Cyclic AMP oscillations are normal in starved amoebae treated with trichostatin A but the expression of a subset of cAMP-regulated genes is delayed. Bioinformatic analysis indicates that there are four genes encoding putative HDACs in D. discoideum. Using biochemical, genetic and developmental approaches, we demonstrate that one of these four genes, hdaB, is dispensable for growth and development under laboratory conditions. A knockout of the hdaB gene results in a social context-dependent phenotype: hdaB(-) cells develop normally but sporulate less efficiently than the wild type in chimeras. We infer that HDAC activity is important for regulating the timing of gene expression during the development of D. discoideum and for defining aspects of the phenotype that mediate social behaviour in genetically heterogeneous groups.
Activation of G-proteins by receptor-stimulated nucleoside diphosphate kinase in Dictyostelium.
Bominaar, A A; Molijn, A C; Pestel, M; Veron, M; Van Haastert, P J
1993-01-01
Recently, interest in the enzyme nucleoside diphosphate kinase (EC2.7.4.6) has increased as a result of its possible involvement in cell proliferation and development. Since NDP kinase is one of the major sources of GTP in cells, it has been suggested that the effects of an altered NDP kinase activity on cellular processes might be the result of altered transmembrane signal transduction via guanine nucleotide-binding proteins (G-proteins). In the cellular slime mould Dictyostelium discoideum, extracellular cAMP induces an increase of phospholipase C activity via a surface cAMP receptor and G-proteins. In this paper it is demonstrated that part of the cellular NDP kinase is associated with the membrane and stimulated by cell surface cAMP receptors. The GTP produced by the action of NDP kinase is capable of activating G-proteins as monitored by altered G-protein-receptor interaction and the activation of the effector enzyme phospholipase C. Furthermore, specific monoclonal antibodies inhibit the effect of NDP kinase on G-protein activation. These results suggest that receptor-stimulated NDP kinase contributes to the mediation of hormone action by producing GTP for the activation of GTP-binding proteins. Images PMID:8389692
Autophagy in Dictyostelium: Mechanisms, regulation and disease in a simple biomedical model.
Mesquita, Ana; Cardenal-Muñoz, Elena; Dominguez, Eunice; Muñoz-Braceras, Sandra; Nuñez-Corcuera, Beatriz; Phillips, Ben A; Tábara, Luis C; Xiong, Qiuhong; Coria, Roberto; Eichinger, Ludwig; Golstein, Pierre; King, Jason S; Soldati, Thierry; Vincent, Olivier; Escalante, Ricardo
2017-01-02
Autophagy is a fast-moving field with an enormous impact on human health and disease. Understanding the complexity of the mechanism and regulation of this process often benefits from the use of simple experimental models such as the social amoeba Dictyostelium discoideum. Since the publication of the first review describing the potential of D. discoideum in autophagy, significant advances have been made that demonstrate both the experimental advantages and interest in using this model. Since our previous review, research in D. discoideum has shed light on the mechanisms that regulate autophagosome formation and contributed significantly to the study of autophagy-related pathologies. Here, we review these advances, as well as the current techniques to monitor autophagy in D. discoideum. The comprehensive bioinformatics search of autophagic proteins that was a substantial part of the previous review has not been revisited here except for those aspects that challenged previous predictions such as the composition of the Atg1 complex. In recent years our understanding of, and ability to investigate, autophagy in D. discoideum has evolved significantly and will surely enable and accelerate future research using this model.
Dhanapal, Ramaiyan; Ratna, J.Vijaya; Sarathchandran, I.; Gupta, Malaya
2012-01-01
Objective To explore the antispermatogenic and testicular antisteroidogenic activities of Feronia limonia fruit pulp southern India. Methods Fourty Wistar male albino rats (Rattus norvegicus) were equally divided into four groups. Experimental groups were administered with the ethanolic extract of Feronia limonia (F. limoni) fruit pulp at doses of 250 and 500 mg/kg body weight once daily for 55 days. All treated rats had corresponding recovery groups. At the end of each treatment periods, various spermatological indices, tissue biochemicals and testicular enzymes levels were analysed. Blood profiles were also estimated. Results Compared with the control, the F. limonia fruit pulp at both dose levels did not decrease body weight, which were associated with decline in epididymal sperm count, motility, viability and increased percent of abnormal sperm. Further, F. limonia fruit pulp at 500 mg/kg body weight markedly reduced the epididymal and testicular protein content by 24.58% and 29.86%, respectively, as well as the glucose-6-phosphate dehydrogenase and Δ5-3β-hydroxy steroid dehydrogenase) levels by 42.82% and 38.08%, respectively, while a significant elevation was observed in testicular cholesterol and ascorbic acid content. A gradual recovery of all parameters was observed after 55 days of treatment withdrawal. No significant alterations in haematological indices were observed. Conclusions The present findings indicate that F. limonia fruit pulp may have reversible antispermatogenic and antisteroidogenic properties, and could partially support the traditional use as male contraceptive. PMID:23569995
Stadler, J; Keenan, T W; Bauer, G; Gerisch, G
1989-01-01
The contact site A glycoprotein, a cell adhesion protein of aggregating Dictyostelium cells, was labeled with fatty acid, myo-inositol, phosphate and ethanolamine in vivo, indicating that the protein is anchored in the membrane by a lipid. This lipid was not susceptible to phosphatidyl inositol specific phospholipase C. When cleaved with nitrous acid or when subjected to acetolysis, the anchor released lipids which were different from those released from Trypanosoma variant cell surface glycoprotein, a protein with a known phosphatidyl inositol-glycan anchor. Resistance to weak and sensitivity to strong alkali indicated that the fatty acid in the contact site A glycolipid anchor was in an amide bond. On incubation with sphingomyelinase, a lipid with the chromatographic behavior of ceramide was released. These results suggest that the contact site A glycoprotein is anchored by a ceramide based lipid glycan. Images PMID:2721485
The Effects of Herbs and Fruits on Leukaemia
Saedi, Tayebeh Azam; Md Noor, Sabariah; Ismail, Patimah; Othman, Fauziah
2014-01-01
In developing countries, herbal therapy is the first and basis form of treatment for most types of diseases. About 75–80% of the world's population prefers herbal therapy as a major treatment due to its better adequacy and satisfactoriness, which enhance human body's symmetry with minimal side effects. Fruits and plants have been presented from the past as promising tools in becoming a natural anticancer agents. Many of these plant extracts are currently used in cancer therapy and prevention. This review paper will particularly explore and emphasize on herbs and fruits used in the treatment of the leukaemia. PMID:25250054
Gupta, Deepak K; Rühl, Martin; Mishra, Bagdevi; Kleofas, Vanessa; Hofrichter, Martin; Herzog, Robert; Pecyna, Marek J; Sharma, Rahul; Kellner, Harald; Hennicke, Florian; Thines, Marco
2018-01-15
Agrocybe aegerita is an agaricomycete fungus with typical mushroom features, which is commercially cultivated for its culinary use. In nature, it is a saprotrophic or facultative pathogenic fungus causing a white-rot of hardwood in forests of warm and mild climate. The ease of cultivation and fructification on solidified media as well as its archetypal mushroom fruit body morphology render A. aegerita a well-suited model for investigating mushroom developmental biology. Here, the genome of the species is reported and analysed with respect to carbohydrate active genes and genes known to play a role during fruit body formation. In terms of fruit body development, our analyses revealed a conserved repertoire of fruiting-related genes, which corresponds well to the archetypal fruit body morphology of this mushroom. For some genes involved in fruit body formation, paralogisation was observed, but not all fruit body maturation-associated genes known from other agaricomycetes seem to be conserved in the genome sequence of A. aegerita. In terms of lytic enzymes, our analyses suggest a versatile arsenal of biopolymer-degrading enzymes that likely account for the flexible life style of this species. Regarding the amount of genes encoding CAZymes relevant for lignin degradation, A. aegerita shows more similarity to white-rot fungi than to litter decomposers, including 18 genes coding for unspecific peroxygenases and three dye-decolourising peroxidase genes expanding its lignocellulolytic machinery. The genome resource will be useful for developing strategies towards genetic manipulation of A. aegerita, which will subsequently allow functional genetics approaches to elucidate fundamentals of fruiting and vegetative growth including lignocellulolysis.
Kawaharada, Ritsuko; Nakamura, Akio; Takahashi, Katsunori; Kikuchi, Haruhisa; Oshima, Yoshiteru; Kubohara, Yuzuru
2016-06-15
Differentiation-inducing factor 1 (DIF-1), originally discovered in the cellular slime mold Dictyostelium discoideum, and its derivatives possess pharmacological activities, such as the promotion of glucose uptake in non-transformed mammalian cells in vitro. Accordingly, DIFs are considered promising lead candidates for novel anti-diabetic drugs. The aim of this study was to assess the anti-diabetic and toxic effects of DIF-1 in mouse 3T3-L1 fibroblast cells in vitro and in diabetic rats in vivo. Main methods We investigated the in vitro effects of DIF-1 and DIF-1(3M), a derivative of DIF-1, on glucose metabolism in 3T3-L1 cells by using capillary electrophoresis time-of-flight mass spectrometry (CE-TOF-MS). We also examined the effects of DIF-1 on blood glucose levels in streptozotocin (STZ)-induced rats. CE-TOF-MS revealed that 20μM DIF-1 and 20μM DIF-1(3M) promoted glucose uptake and metabolism in 3T3-L1 cells. Oral administration of DIF-1 (30mg/kg) significantly lowered basal blood glucose levels in STZ-treated rats and promoted a decrease in blood glucose levels after oral glucose loading (2.5g/kg) in the rats. In addition, daily oral administration of DIF-1 (30mg/kg/day) for 1wk significantly lowered the blood glucose levels in STZ-treated rats but did not affect their body weight and caused only minor alterations in the levels of other blood analytes. These results indicate that DIF-1 may be a good lead compound for the development of anti-diabetic drugs. Copyright © 2016 Elsevier Inc. All rights reserved.
Septembre-Malaterre, Axelle; Stanislas, Giovédie; Douraguia, Elisabeth; Gonthier, Marie-Paule
2016-12-01
Much attention is paid to the beneficial action of fruits against obesity-related oxidative stress. This study evaluated nutritional and antioxidant properties of banana, litchi, mango, papaya, passion fruit and pineapple from Réunion French Island. Results showed that total amounts of carbohydrates, vitamin C and carotenoids were 7.7-67.3g glucose equivalent, 4.7-84.9mg ascorbic acid equivalent and 26.6-3829.2μg β-carotene equivalent/100g fresh weight, respectively. Polyphenols were detected as the most abundant antioxidants (33.0-286.6mg gallic acid equivalent/100g fresh weight) with the highest content from passion fruit. UPLC-MS analysis led to identify epigallocatechin and quercetin derivatives from banana and litchi, ferulic, sinapic, syringic and gallic acids from pineapple and mango, and piceatannol from passion fruit. Polyphenol-rich extracts protected red blood cells and preadipose cells against oxidative stress. Altogether, these findings highlight nutritional benefits of French tropical fruits and their possible interest to improve antioxidant capacities of the body during obesity. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hsu, Shang-Te Danny; Cabrita, Lisa D; Christodoulou, John; Dobson, Christopher M
2009-06-01
The gelation factor from Dictyostelium discoideum (ABP-120) is an actin binding protein consisting of six immunoglobulin (Ig) domains in the C-terminal rod domain. We have recently used the pair of domains 5 and 6 of ABP-120 as a model system for studying multi-domain nascent chain folding on the ribosome. Here we present the NMR assignments of domain 5 in its native and 8M urea-denatured states.
Hepatotoxicity and subchronic toxicity tests of Morinda citrifolia (noni) fruit.
West, Brett J; Su, Chen X; Jensen, C Jarakae
2009-10-01
Morinda citrifolia (noni) fruit juice has been approved as a safe food in many nations. A few cases of hepatitis in people who had been drinking noni juice have been reported, even though no causal link could be established between the liver injury and ingestion of the juice. To more fully evaluate the hepatotoxic potential of noni fruit juice, in vitro hepatotoxicity tests were conducted in human liver cells, HepG2 cell line. A subchronic oral toxicity test of noni fruit was also performed in Sprague-Dawley (SD) rats to provide benchmark data for understanding the safety of noni juice, without the potential confounding variables associated with many commercial noni juice products. Freeze-dried filtered noni fruit puree did not decrease HepG2 cell viability or induce neutral lipid accumulation and phospholipidosis. There were no histopathological changes or evidence of dose-responses in hematological and clinical chemistry measurements, including liver function tests. The no-observed-adverse-effect level (NOAEL) for freeze-dried noni fruit puree is greater than 6.86 g/kg body weight, equivalent to approximately 90 ml of noni fruit juice/kg. These findings corroborate previous conclusions that consumption of noni fruit juice is unlikely to induce adverse liver effects.
Kapoor, Upasana; Srivastava, M K; Srivastava, Ashutosh Kumar; Patel, D K; Garg, Veena; Srivastava, L P
2013-03-01
A total of 250 samples-including fruits, fruit juices, and baby foods (50 samples each), vegetables (70 samples), and cereals (30 samples)-were collected from Lucknow, India, and analyzed for the presence of imidacloprid residues. The QuEChERS (quick, easy, cheap, effective, rugged, and safe) method of extraction coupled with high-performance liquid chromatographic analysis were carried out, and imidacloprid residues were qualitatively confirmed by liquid chromatography-mass spectrometry. Imidacloprid was not detected in samples of fruit juices and baby foods. It was, however, detected in 38 samples of fruits, vegetables, and cereals, which is about 15.20% of the total samples. Of samples of fruits, 22% showed the presence of imidacloprid, and 2% of samples showed residues above the maximal residue limit. Although imidacloprid was detected in 24% of vegetable samples, only 5.71% showed the presence of imidacloprid above the maximal residue limit. However, 33% of cereal samples showed the presence of imidacloprid, and about 3% of samples were above the maximal residue limit. The calculated estimated daily intake ranged between 0.004 and 0.131 µg/kg body weight, and the hazard indices ranged from 0.007 to 0.218 for these food commodities. It is therefore indicated that lifetime consumption of vegetables, fruits, fruit juices, baby foods, wheat, rice, and pulses may not pose a health hazard for the population of Lucknow because the hazard indices for imidacloprid residues were below one. Copyright © 2012 SETAC.
27 CFR 24.213 - Heavy bodied blending wine.
Code of Federal Regulations, 2013 CFR
2013-04-01
..., DEPARTMENT OF THE TREASURY ALCOHOL WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...
27 CFR 24.213 - Heavy bodied blending wine.
Code of Federal Regulations, 2011 CFR
2011-04-01
..., DEPARTMENT OF THE TREASURY LIQUORS WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...
27 CFR 24.213 - Heavy bodied blending wine.
Code of Federal Regulations, 2012 CFR
2012-04-01
..., DEPARTMENT OF THE TREASURY LIQUORS WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...
27 CFR 24.213 - Heavy bodied blending wine.
Code of Federal Regulations, 2014 CFR
2014-04-01
..., DEPARTMENT OF THE TREASURY ALCOHOL WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...
Alam, Nuhu; Yoon, Ki Nam; Lee, Jae Seong; Cho, Hae Jin; Lee, Tae Soo
2011-01-01
This study was initiated to screen the antioxidant activities, tyrosinase inhibitory effects on the fruiting bodies of Pleurotus ferulae extracted with acetone, methanol and hot water. The antioxidant activities were performed on β-carotene–linoleic acid, reducing power, DPPH, ferrous ions chelating abilities, and xanthine oxidase. In addition to this, phenolic compounds were also analyzed. The methanolic extract showed the strongest β-carotene–linoleic acid inhibition and high reducing power as compared to other extracts. The scavenging effects on DPPH radicals, the acetonic and methanolic extracts were more effective than hot water extracts. The strongest chelating effect was obtained from the methanolic extract as compared to the tested synthetic antioxidant. Gallic acid, protocatechuic acid, caffeic acid, vanillin, ferulic acid, naringin, resveratrol, naringenin, hesperetin, formononetin and biochanin-A were detected from acetonitrile and hydrochloric acid (5:1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of acetonic, methanolic, and hot water extracts of P. ferulae increased with increasing concentration. The results suggested that consumption of P. ferulae might be beneficial to the antioxidant, xanthine oxidase, and tyrosinase protection system of the human body against oxidative damage and others complications. PMID:23961169
USDA-ARS?s Scientific Manuscript database
In a botanical sense, fruits are the developed part of the seed-containing ovary. Evolutionarily speaking, plants have developed fruit with the goal of attracting insects, birds, reptiles and mammals to spread the seeds. Fruit can be dry such as the pod of a pea, or fleshy such as a peach. As humans...
Elleuche, Skander; Pöggeler, Stefanie
2009-01-01
Carbon dioxide (CO2) is among the most important gases for all organisms. Its reversible interconversion to bicarbonate (HCO3 −) reaches equilibrium spontaneously, but slowly, and can be accelerated by a ubiquitous group of enzymes called carbonic anhydrases (CAs). These enzymes are grouped by their distinct structural features into α-, β-, γ-, δ- and ζ-classes. While physiological functions of mammalian, prokaryotic, plant and algal CAs have been extensively studied over the past years, the role of β-CAs in yeasts and the human pathogen Cryptococcus neoformans has been elucidated only recently, and the function of CAs in multicellular filamentous ascomycetes is mostly unknown. To assess the role of CAs in the development of filamentous ascomycetes, the function of three genes, cas1, cas2 and cas3 (carbonic anhydrase of Sordaria) encoding β-class carbonic anhydrases was characterized in the filamentous ascomycetous fungus Sordaria macrospora. Fluorescence microscopy was used to determine the localization of GFP- and DsRED-tagged CAs. While CAS1 and CAS3 are cytoplasmic enzymes, CAS2 is localized to the mitochondria. To assess the function of the three isoenzymes, we generated knock-out strains for all three cas genes (Δcas1, Δcas2, and Δcas3) as well as all combinations of double mutants. No effect on vegetative growth, fruiting-body and ascospore development was seen in the single mutant strains lacking cas1 or cas3, while single mutant Δcas2 was affected in vegetative growth, fruiting-body development and ascospore germination, and the double mutant strain Δcas1/2 was completely sterile. Defects caused by the lack of cas2 could be partially complemented by elevated CO2 levels or overexpression of cas1, cas3, or a non-mitochondrial cas2 variant. The results suggest that CAs are required for sexual reproduction in filamentous ascomycetes and that the multiplicity of isoforms results in redundancy of specific and non-specific functions. PMID:19365544
Elleuche, Skander; Pöggeler, Stefanie
2009-01-01
Carbon dioxide (CO(2)) is among the most important gases for all organisms. Its reversible interconversion to bicarbonate (HCO(3) (-)) reaches equilibrium spontaneously, but slowly, and can be accelerated by a ubiquitous group of enzymes called carbonic anhydrases (CAs). These enzymes are grouped by their distinct structural features into alpha-, beta-, gamma-, delta- and zeta-classes. While physiological functions of mammalian, prokaryotic, plant and algal CAs have been extensively studied over the past years, the role of beta-CAs in yeasts and the human pathogen Cryptococcus neoformans has been elucidated only recently, and the function of CAs in multicellular filamentous ascomycetes is mostly unknown. To assess the role of CAs in the development of filamentous ascomycetes, the function of three genes, cas1, cas2 and cas3 (carbonic anhydrase of Sordaria) encoding beta-class carbonic anhydrases was characterized in the filamentous ascomycetous fungus Sordaria macrospora. Fluorescence microscopy was used to determine the localization of GFP- and DsRED-tagged CAs. While CAS1 and CAS3 are cytoplasmic enzymes, CAS2 is localized to the mitochondria. To assess the function of the three isoenzymes, we generated knock-out strains for all three cas genes (Deltacas1, Deltacas2, and Deltacas3) as well as all combinations of double mutants. No effect on vegetative growth, fruiting-body and ascospore development was seen in the single mutant strains lacking cas1 or cas3, while single mutant Deltacas2 was affected in vegetative growth, fruiting-body development and ascospore germination, and the double mutant strain Deltacas1/2 was completely sterile. Defects caused by the lack of cas2 could be partially complemented by elevated CO(2) levels or overexpression of cas1, cas3, or a non-mitochondrial cas2 variant. The results suggest that CAs are required for sexual reproduction in filamentous ascomycetes and that the multiplicity of isoforms results in redundancy of specific and
Burnett, A; McKoy, M-L; Singh, P
2015-01-01
ABSTRACT The Momordica charantia (MC) fruit has been documented to possess antidiabetic properties. However, these studies were not without controversy surrounding the blood glucose-lowering ability and the mechanism of action in diabetes therapy. In an effort to evaluate such claims in the Jamaican MC species known as cerasee, aqueous extracts of the unripe fruit were studied in normal and diabetic rats. Normal male Sprague-Dawley rats were divided into groups (n = 6) orally administered distilled water, 10% dimethyl sulfoxide (DMSO) solution, the aqueous extract (400 mg/kg body weight) and glibenclamide (15 mg/kg body weight), respectively prior to assessment of fasting blood glucose (FBG) concentration. The oral glucose tolerance test (OGTT) was conducted in normoglycaemic rats orally administered distilled water, 10% DMSO solution, glibenclamide (15 mg/kg body weight) or aqueous extracts of the fruit (200 and 400 mg/kg body weight). Blood glucose concentration was also monitored in streptozotocin-induced diabetic rats administered the aqueous extract (250 mg/kg body weight) or water vehicle after an overnight fast. The aqueous extracts showed no hypoglycaemic or antidiabetic activity. However, the administration of the aqueous extracts (200 and 400 mg/kg body weight) resulted in significant improvement in glucose tolerance of glucose-primed normoglycaemic rats during the OGTT. These data suggest that the glucose-lowering mechanism of the Jamaican MC fruit species likely involves altered glucose absorption across the gastrointestinal tract. PMID:26624580
Lee, Susan; Parent, Carole A.; Insall, Robert; Firtel, Richard A.
1999-01-01
We have identified a novel Ras-interacting protein from Dictyostelium, RIP3, whose function is required for both chemotaxis and the synthesis and relay of the cyclic AMP (cAMP) chemoattractant signal. rip3 null cells are unable to aggregate and lack receptor activation of adenylyl cyclase but are able, in response to cAMP, to induce aggregation-stage, postaggregative, and cell-type-specific gene expression in suspension culture. In addition, rip3 null cells are unable to properly polarize in a cAMP gradient and chemotaxis is highly impaired. We demonstrate that cAMP stimulation of guanylyl cyclase, which is required for chemotaxis, is reduced ∼60% in rip3 null cells. This reduced activation of guanylyl cyclase may account, in part, for the defect in chemotaxis. When cells are pulsed with cAMP for 5 h to mimic the endogenous cAMP oscillations that occur in wild-type strains, the cells will form aggregates, most of which, however, arrest at the mound stage. Unlike the response seen in wild-type strains, the rip3 null cell aggregates that form under these experimental conditions are very small, which is probably due to the rip3 null cell chemotaxis defect. Many of the phenotypes of the rip3 null cell, including the inability to activate adenylyl cyclase in response to cAMP and defects in chemotaxis, are very similar to those of strains carrying a disruption of the gene encoding the putative Ras exchange factor AleA. We demonstrate that aleA null cells also exhibit a defect in cAMP-mediated activation of guanylyl cyclase similar to that of rip3 null cells. A double-knockout mutant (rip3/aleA null cells) exhibits a further reduction in receptor activation of guanylyl cyclase, and these cells display almost no cell polarization or movement in cAMP gradients. As RIP3 preferentially interacts with an activated form of the Dictyostelium Ras protein RasG, which itself is important for cell movement, we propose that RIP3 and AleA are components of a Ras-regulated pathway
Lee, S; Parent, C A; Insall, R; Firtel, R A
1999-09-01
We have identified a novel Ras-interacting protein from Dictyostelium, RIP3, whose function is required for both chemotaxis and the synthesis and relay of the cyclic AMP (cAMP) chemoattractant signal. rip3 null cells are unable to aggregate and lack receptor activation of adenylyl cyclase but are able, in response to cAMP, to induce aggregation-stage, postaggregative, and cell-type-specific gene expression in suspension culture. In addition, rip3 null cells are unable to properly polarize in a cAMP gradient and chemotaxis is highly impaired. We demonstrate that cAMP stimulation of guanylyl cyclase, which is required for chemotaxis, is reduced approximately 60% in rip3 null cells. This reduced activation of guanylyl cyclase may account, in part, for the defect in chemotaxis. When cells are pulsed with cAMP for 5 h to mimic the endogenous cAMP oscillations that occur in wild-type strains, the cells will form aggregates, most of which, however, arrest at the mound stage. Unlike the response seen in wild-type strains, the rip3 null cell aggregates that form under these experimental conditions are very small, which is probably due to the rip3 null cell chemotaxis defect. Many of the phenotypes of the rip3 null cell, including the inability to activate adenylyl cyclase in response to cAMP and defects in chemotaxis, are very similar to those of strains carrying a disruption of the gene encoding the putative Ras exchange factor AleA. We demonstrate that aleA null cells also exhibit a defect in cAMP-mediated activation of guanylyl cyclase similar to that of rip3 null cells. A double-knockout mutant (rip3/aleA null cells) exhibits a further reduction in receptor activation of guanylyl cyclase, and these cells display almost no cell polarization or movement in cAMP gradients. As RIP3 preferentially interacts with an activated form of the Dictyostelium Ras protein RasG, which itself is important for cell movement, we propose that RIP3 and AleA are components of a Ras
Neotropical fish-fruit interactions: eco-evolutionary dynamics and conservation.
Correa, Sandra Bibiana; Costa-Pereira, Raul; Fleming, Theodore; Goulding, Michael; Anderson, Jill T
2015-11-01
Frugivorous fish play a prominent role in seed dispersal and reproductive dynamics of plant communities in riparian and floodplain habitats of tropical regions worldwide. In Neotropical wetlands, many plant species have fleshy fruits and synchronize their fruiting with the flood season, when fruit-eating fish forage in forest and savannahs for periods of up to 7 months. We conducted a comprehensive analysis to examine the evolutionary origin of fish-fruit interactions, describe fruit traits associated with seed dispersal and seed predation, and assess the influence of fish size on the effectiveness of seed dispersal by fish (ichthyochory). To date, 62 studies have documented 566 species of fruits and seeds from 82 plant families in the diets of 69 Neotropical fish species. Fish interactions with flowering plants are likely to be as old as 70 million years in the Neotropics, pre-dating most modern bird-fruit and mammal-fruit interactions, and contributing to long-distance seed dispersal and possibly the radiation of early angiosperms. Ichthyochory occurs across the angiosperm phylogeny, and is more frequent among advanced eudicots. Numerous fish species are capable of dispersing small seeds, but only a limited number of species can disperse large seeds. The size of dispersed seeds and the probability of seed dispersal both increase with fish size. Large-bodied species are the most effective seed dispersal agents and remain the primary target of fishing activities in the Neotropics. Thus, conservation efforts should focus on these species to ensure continuity of plant recruitment dynamics and maintenance of plant diversity in riparian and floodplain ecosystems. © 2015 Cambridge Philosophical Society.
Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe
2012-01-01
Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.
Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe
2012-01-01
Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures. PMID:22662159
Mata, Gerardo; Valdez, Karina; Mendoza, Remedios; Trigos, Ángel
2014-01-01
The chemical composition of the aroma of fresh fruiting bodies of the cultivated mushroom Lentinus boryanus is described here and compared with medicinal shiitake mushroom L. edodes. Volatile compounds were analyzed through headspace sampling coupled with gas chromatography-mass spectrometry. The mushrooms under study were grown on different substrates based on barley straw, sugarcane bagasse, oak wood sawdust, and beech leaf litter. It was determined that L. boryanus as well as L. edodes contain an abundant amount of a volatile compound identified as 3-octanone with a sweet fruity aroma. On the other hand, only L. boryanus produced 3-octanol a characteristic aroma of cod liver oil. In total, 10 aromatic compounds were identified, some of which were obtained exclusively in one species or substrate.
1993-01-01
Coronin is an actin-binding protein in Dictyostelium discoideum that is enriched at the leading edge of the cells and in projections of the cell surface called crowns. The polypeptide sequence of coronin is distinguished by its similarities to the beta-subunits of trimeric G proteins (E. L. de Hostos, B. Bradtke, F. Lottspeich, R. Guggenheim, and G. Gerisch, 1991. EMBO (Eur. Mol. Biol. Organ.) J. 10:4097-4104). To elucidate the in vivo function of coronin, null mutants have been generated by gene replacement. The mutant cells lacking coronin grow and migrate more slowly than wild-type cells. When these cor- cells grow in liquid medium they become multinucleate, indicating a role of coronin in cytokinesis. To explore this role, coronin has been localized in mitotic wild-type cells by immunofluorescence labeling. During separation of the daughter cells, coronin is strongly accumulated at their distal portions including the leading edges. This contrasts with the localization of myosin II in the cleavage furrow and suggests that coronin functions independently of the conventional myosin in facilitating cytokinesis. PMID:8380174
Waligórska, Agnieszka; Wianecka-Skoczeń, Magdalena; Korohoda, Włodzimierz
2007-01-01
Cell movement in the amoebae Dictyostelium discoideum has been examined in media differing in monovalent cation concentration (i.e. Na+ and K+). Under isotonic or even slightly hypertonic conditions, the cells move equally well in solutions in which either potassium or sodium ions dominate. However, in strongly hypertonic solutions the amoebae showed motility in a 2% potassium chloride solution, but remained motionless in a hypertonic 2% sodium chloride solution. This inhibition of D. discoideum amoebae movement in a hypertonic sodium chloride solution was fully reversible. Such behaviour corresponds to that of plant, fungi, and some invertebrate animal cells rather than protozoan or vertebrate cells. These observations suggest that studies using D. discoideum as a model for cell motility in vertebrate animal tissue cells should be considered with caution, and would seem to confirm the classification of cellular slime moulds as related rather to Fungi than to Protista. This also shows that the cell membrane models should consider the asymmetry in sodium/potassium ion concentrations found in vertebrate animal cells as one of various possibilities.
Effects of a 50 Hz magnetic field on Dictyostelium discoideum (Protista).
Amaroli, Andrea; Trielli, Francesca; Bianco, Bruno; Giordano, Stefano; Moggia, Elsa; Corrado, Maria Umberta Delmonte
2006-10-01
Some studies have demonstrated that a few biological systems are affected by weak, extremely low frequency (ELF) electromagnetic fields (EMFs), lower than 10 mT. However, to date there is scanty evidence of this effect on Protists in the literature. Due to their peculiarity as single-cell eukaryotic organisms, Protists respond directly to environmental stimuli, thus appearing as very suitable experimental systems. Recently, we showed the presence of propionylcholinesterase (PrChE) activity in single-cell amoebae of Dictyostelium discoideum. This enzyme activity was assumed to be involved in cell-cell and cell-environment interactions, as its inhibition affects cell aggregation and differentiation. In this work, we have exposed single-cell amoebae of D. discoideum to an ELF-EMF of about 200 microT, 50 Hz, for 3 h or 24 h at 21 degrees C. A delay in the early phase of the differentiation was observed in 3 h exposed cells, and a significant decrease in the fission rate appeared in 24 h exposed cells. The PrChE activity was significantly lower in 3 h exposed cells than in the controls, whereas 24 h exposed cells exhibited an increase in this enzyme activity. However, such effects appeared to be transient, as the fission rate and PrChE activity values returned to the respective control values after a 24 h stay under standard conditions.
Rodríguez, M Cristina; Parra, M Dolores; Marques-Lopes, Iva; De Morentin, Blanca E Martínez; González, Alvaro; Martínez, J Alfredo
2005-12-01
The consumption of specific foods in energy-restricted diets may affect the weight loss process. The purpose of this research was to evaluate whether obese women following two hypocaloric diets with distinct fruit content differ in weight loss and metabolic responses. Fifteen obese women were included, who were randomly assigned to follow a low or a high-fruit energy-restricted diet for 8 weeks. The main outcome variables were weight and fat losses. Metabolic measurements concerning macronutrient oxidation were also assessed by using (13)C labelled fructose and indirect calorimetry. The induced weight loss was similar for both diets (6.9 +/- 2% vs. 6.6 +/- 2%, p = 0.785). Both experimental diets similarly improved the lipid plasma profile in the participants, but the cholesterol fall was higher in obese subjects receiving the diet containing more fruit. No statistical differences in lipids carbohydrates and (13)C labelled fructose utilisation were observed, but protein oxidation was differently affected by the experimental diets. The compensatory effects of the associated fibre/fructose intake may explain the lack of a specific effect of the fruit amount on hypocaloric diets designed to weight loss, although the increased fibre content from enriched fruit diets may be involved in the favourable effects on cholesterol plasma levels.
The Long Noncoding RNA Transcriptome of Dictyostelium discoideum Development.
Rosengarten, Rafael D; Santhanam, Balaji; Kokosar, Janez; Shaulsky, Gad
2017-02-09
Dictyostelium discoideum live in the soil as single cells, engulfing bacteria and growing vegetatively. Upon starvation, tens of thousands of amoebae enter a developmental program that includes aggregation, multicellular differentiation, and sporulation. Major shifts across the protein-coding transcriptome accompany these developmental changes. However, no study has presented a global survey of long noncoding RNAs (ncRNAs) in D. discoideum To characterize the antisense and long intergenic noncoding RNA (lncRNA) transcriptome, we analyzed previously published developmental time course samples using an RNA-sequencing (RNA-seq) library preparation method that selectively depletes ribosomal RNAs (rRNAs). We detected the accumulation of transcripts for 9833 protein-coding messenger RNAs (mRNAs), 621 lncRNAs, and 162 putative antisense RNAs (asRNAs). The noncoding RNAs were interspersed throughout the genome, and were distinct in expression level, length, and nucleotide composition. The noncoding transcriptome displayed a temporal profile similar to the coding transcriptome, with stages of gradual change interspersed with larger leaps. The transcription profiles of some noncoding RNAs were strongly correlated with known differentially expressed coding RNAs, hinting at a functional role for these molecules during development. Examining the mitochondrial transcriptome, we modeled two novel antisense transcripts. We applied yet another ribosomal depletion method to a subset of the samples to better retain transfer RNA (tRNA) transcripts. We observed polymorphisms in tRNA anticodons that suggested a post-transcriptional means by which D. discoideum compensates for codons missing in the genomic complement of tRNAs. We concluded that the prevalence and characteristics of long ncRNAs indicate that these molecules are relevant to the progression of molecular and cellular phenotypes during development. Copyright © 2017 Rosengarten et al.
Garcia, Gene L; Rericha, Erin C; Heger, Christopher D; Goldsmith, Paul K; Parent, Carole A
2009-07-01
Starvation of Dictyostelium induces a developmental program in which cells form an aggregate that eventually differentiates into a multicellular structure. The aggregate formation is mediated by directional migration of individual cells that quickly transition to group migration in which cells align in a head-to-tail manner to form streams. Cyclic AMP acts as a chemoattractant and its production, secretion, and degradation are highly regulated. A key protein is the extracellular phosphodiesterase PdsA. In this study we examine the role and localization of PdsA during chemotaxis and streaming. We find that pdsA(-) cells respond chemotactically to a narrower range of chemoattractant concentrations compared with wild-type (WT) cells. Moreover, unlike WT cells, pdsA(-) cells do not form streams at low cell densities and form unusual thick and transient streams at high cell densities. We find that the intracellular pool of PdsA is localized to the endoplasmic reticulum, which may provide a compartment for storage and secretion of PdsA. Because we find that cAMP synthesis is normal in cells lacking PdsA, we conclude that signal degradation regulates the external cAMP gradient field generation and that the group migration behavior of these cells is compromised even though their signaling machinery is intact.
The Group Migration of Dictyostelium Cells Is Regulated by Extracellular Chemoattractant Degradation
Garcia, Gene L.; Rericha, Erin C.; Heger, Christopher D.; Goldsmith, Paul K.
2009-01-01
Starvation of Dictyostelium induces a developmental program in which cells form an aggregate that eventually differentiates into a multicellular structure. The aggregate formation is mediated by directional migration of individual cells that quickly transition to group migration in which cells align in a head-to-tail manner to form streams. Cyclic AMP acts as a chemoattractant and its production, secretion, and degradation are highly regulated. A key protein is the extracellular phosphodiesterase PdsA. In this study we examine the role and localization of PdsA during chemotaxis and streaming. We find that pdsA− cells respond chemotactically to a narrower range of chemoattractant concentrations compared with wild-type (WT) cells. Moreover, unlike WT cells, pdsA− cells do not form streams at low cell densities and form unusual thick and transient streams at high cell densities. We find that the intracellular pool of PdsA is localized to the endoplasmic reticulum, which may provide a compartment for storage and secretion of PdsA. Because we find that cAMP synthesis is normal in cells lacking PdsA, we conclude that signal degradation regulates the external cAMP gradient field generation and that the group migration behavior of these cells is compromised even though their signaling machinery is intact. PMID:19477920
Signaling molecules involved in the transition of growth to development of Dictyostelium discoideum.
Mir, Hina A; Rajawat, Jyotika; Pradhan, Shalmali; Begum, Rasheedunnisa
2007-03-01
The social amoeba Dictyostelium discoideum, a powerful paradigm provides clear insights into the regulation of growth and development. In addition to possessing complex individual cellular functions like a unicellular eukaryote, D. discoideum cells face the challenge of multicellular development. D. discoideum undergoes a relatively simple differentiation process mainly by cAMP mediated pathway. Despite this relative simplicity, the regulatory signaling pathways are as complex as those seen in metazoan development. However, the introduction of restriction-enzyme-mediated integration (REMI) technique to produce developmental gene knockouts has provided novel insights into the discovery of signaling molecules and their role in D. discoideum development. Cell cycle phase is an important aspect for differentiation of D. discoideum, as cells must reach a specific stage to enter into developmental phase and specific cell cycle regulators are involved in arresting growth phase genes and inducing the developmental genes. In this review, we present an overview of the signaling molecules involved in the regulation of growth to differentiation transition (GDT), molecular mechanism of early developmental events leading to generation of cAMP signal and components of cAMP relay system that operate in this paradigm.
Zahoor, Muhammad; Jan, Muhammad Rasul; Naz, Sumaira
2016-11-01
Glucose-6-phosphatase is a key enzyme of glucose metabolic pathways. Deficiency of this enzyme leads to glycogen storage disease. This enzyme also plays a negative role in diabetes mellitus disorder in which the catalytic activity of this enzyme increases. Thus there is need for activators to enhance the activity of glucose-6-phosphatase in glycogen storage disease of type 1b while in diabetes mellitus repressors are needed to reduce its activity. Crude extracts of apricot, fig, mulberry and apple fruits were investigated for their repressive/enhancive effects on glucose-6-phosphatase in vivo. Albino mice were used as experimental animal. All the selected extracts showed depressive effects on glucose-6-phosphatase, which shows that all these extracts can be used as antidiabetic supplement of food. The inhibitory pattern was competitive one, which was evident from the effect of increasing dose from 1g/Kg body weight to 3g/Kg body weight for all the selected fruit extracts. However fig and apple fruit extracts showed high repressive effects for high doses as compared to apricot and mulberry fruit extracts. None of these selected fruit extracts showed enhancive effect on glucose-6-phosphatase activity. All these fruits or their extracts can be used as antidiabetic dietary supplement for diabetes mellitus.
27 CFR 24.213 - Heavy bodied blending wine.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Heavy bodied blending wine..., DEPARTMENT OF THE TREASURY LIQUORS WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...
Georgakouli, Kalliopi; Mpesios, Anastasios; Kouretas, Demetrios; Petrotos, Konstantinos; Mitsagga, Chrysanthi; Giavasis, Ioannis; Jamurtas, Athanasios Z
2016-06-03
In the present study we investigated the effects of an olive polyphenol-enriched yogurt on yogurt microflora, as well as hematological, physiological and metabolic parameters, blood redox status and body composition. In a randomized double-blind, crossover design, 16 (6 men, 10 women) nonsmoking volunteers with non-declared pathology consumed either 400 g of olive fruit polyphenol-enriched yogurt with 50 mg of encapsulated olive polyphenols (experimental condition-EC) or 400 g of plain yogurt (control condition-CC) every day for two weeks. Physiological measurements and blood collection were performed before and after two weeks of each condition. The results showed that body weight, body mass index, hip circumference and systolic blood pressure decreased significantly (p < 0.05) following the two-week consumption of yogurt regardless of condition. A tendency towards significance for decreased levels of low density lipoprotein (LDL) cholesterol (p = 0.06) and thiobarbituric acid reactive substances (p < 0.05) following two weeks of polyphenol-enriched yogurt consumption was observed. The population of lactic acid bacteria (LAB) and production of lactate in yogurt were significantly enhanced after addition of olive polyphenols, contrary to the population of yeasts and molds. The results indicate that consumption of the polyphenol-enriched yogurt may help individuals with non-declared pathology reduce body weight, blood pressure, LDL cholesterol levels and lipid peroxidation, and promote growth of beneficial LAB.
Georgakouli, Kalliopi; Mpesios, Anastasios; Kouretas, Demetrios; Petrotos, Konstantinos; Mitsagga, Chrysanthi; Giavasis, Ioannis; Jamurtas, Athanasios Z.
2016-01-01
In the present study we investigated the effects of an olive polyphenol-enriched yogurt on yogurt microflora, as well as hematological, physiological and metabolic parameters, blood redox status and body composition. In a randomized double-blind, crossover design, 16 (6 men, 10 women) nonsmoking volunteers with non-declared pathology consumed either 400 g of olive fruit polyphenol-enriched yogurt with 50 mg of encapsulated olive polyphenols (experimental condition—EC) or 400 g of plain yogurt (control condition—CC) every day for two weeks. Physiological measurements and blood collection were performed before and after two weeks of each condition. The results showed that body weight, body mass index, hip circumference and systolic blood pressure decreased significantly (p < 0.05) following the two-week consumption of yogurt regardless of condition. A tendency towards significance for decreased levels of low density lipoprotein (LDL) cholesterol (p = 0.06) and thiobarbituric acid reactive substances (p < 0.05) following two weeks of polyphenol-enriched yogurt consumption was observed. The population of lactic acid bacteria (LAB) and production of lactate in yogurt were significantly enhanced after addition of olive polyphenols, contrary to the population of yeasts and molds. The results indicate that consumption of the polyphenol-enriched yogurt may help individuals with non-declared pathology reduce body weight, blood pressure, LDL cholesterol levels and lipid peroxidation, and promote growth of beneficial LAB. PMID:27271664
Paul, Rajkumar; Kulkarni, Paresh; Ganesh, Narayan
2011-01-01
Diets rich in fruits and vegetables have been associated with reduced risks for many types of cancers. Avocado (Persea americana Mill.) is a widely consumed fruit containing many cancer preventing nutrients, vitamins and phytochemicals. Studies have shown that phytochemicals extracted from the avocado fruit selectively induce cell cycle arrest, inhibit growth, and induce apoptosis in precancerous and cancer cell lines. Our recent studies indicate that phytochemicals extracted with 50% Methanol from avocado fruits help in proliferation of human lymphocyte cells and decrease chromosomal aberrations induced by cyclophosphamide. Among three concentrations (100 mg, 150 mg and 200 mg per Kg Body Weight), the most effective conc. of extract was 200 mg/Kg Body Wt. It decreased significant level of numerical and structural aberrations (breaks, premature centromeric division etc. up to 88%, p < 0.0001)), and accrocentric associtation within D & G group (up to 78%, p = 0.0008). These studies suggest that phytochemicals from the avocado fruit can be utilized for making active chemoprotective ingredient for lowering the side effect of chemotherapy like cyclophosphamide in cancer therapy.
Turning behaviour depends on frictional damping in the fruit fly Drosophila.
Hesselberg, Thomas; Lehmann, Fritz-Olaf
2007-12-01
Turning behaviour in the fruit fly Drosophila depends on several factors including not only feedback from sensory organs and muscular control of wing motion, but also the mass moments of inertia and the frictional damping coefficient of the rotating body. In the present study we evaluate the significance of body friction for yaw turning and thus the limits of visually mediated flight control in Drosophila, by scoring tethered flies flying in a flight simulator on their ability to visually compensate a bias on a moving object and a visual background panorama at different simulated frictional dampings. We estimated the fly's natural damping coefficient from a numerical aerodynamic model based on both friction on the body and the flapping wings during saccadic turning. The model predicts a coefficient of 54 x 10(-12) Nm s, which is more than 100-times larger than the value estimated from a previous study on the body alone. Our estimate suggests that friction plays a larger role for yaw turning in Drosophila than moments of inertia. The simulator experiments showed that visual performance of the fruit fly collapses near the physical conditions estimated for freely flying animals, which is consistent with the suggested role of the halteres for flight stabilization. However, kinematic analyses indicate that the measured loss of flight control might be due predominantly to the limited fine control in the fly's steering muscles below a threshold of 1-2 degrees stroke amplitude, rather than resulting from the limits of visual motion detection by the fly's compound eyes. We discuss the impact of these results and suggest that the elevated frictional coefficient permits freely flying fruit flies to passively terminate rotational body movements without producing counter-torque during the second half of the saccadic turning manoeuvre.
Jilcott Pitts, Stephanie B; Hinkley, Jedediah; Wu, Qiang; McGuirt, Jared T; Lyonnais, Mary Jane; Rafferty, Ann P; Whitt, Olivia R; Winterbauer, Nancy; Phillips, Lisa
2017-01-11
The association between farmers' market characteristics and consumer shopping habits remains unclear. Our objective was to examine associations among distance to farmers' markets, amenities within farmers' markets, frequency of farmers' market shopping, fruit and vegetable consumption, and body mass index (BMI). We hypothesized that the relationship between frequency of farmers' market shopping and BMI would be mediated by fruit and vegetable consumption. In 15 farmers' markets in northeastern North Carolina, July-September 2015, we conducted a cross-sectional survey among 263 farmers' market customers (199 provided complete address data) and conducted farmers' market audits. To participate, customers had to be over 18 years of age, and English speaking. Dependent variables included farmers' market shopping frequency, fruit and vegetable consumption, and BMI. Analysis of variance, adjusted multinomial logistic regression, Poisson regression, and linear regression models, adjusted for age, race, sex, and education, were used to examine associations between distance to farmers' markets, amenities within farmers' markets, frequency of farmers' market shopping, fruit and vegetable consumption, and BMI. Those who reported shopping at farmers' markets a few times per year or less reported consuming 4.4 (standard deviation = 1.7) daily servings of fruits and vegetables, and those who reported shopping 2 or more times per week reported consuming 5.5 (2.2) daily servings. There was no association between farmers' market amenities, and shopping frequency or fruit and vegetable consumption. Those who shopped 2 or more times per week had a statistically significantly lower BMI than those who shopped less frequently. There was no evidence of mediation of the relationship between frequency of shopping and BMI by fruit and vegetable consumption. More work should be done to understand factors within farmers' markets that encourage fruit and vegetable purchases.
Cohen, Nachshol; Cohen, Jacob; Asatiani, Mikheil D; Varshney, Vinay K; Yu, Hui-Tzu; Yang, Yi-Chi; Li, Yu-Hsuan; Mau, Jeng-Leun; Wasser, Solomon P
2014-01-01
This research gives the results of a proximate analysis (moisture, ash, crude protein, fat, total carbohydrates, and total energy); a bioactive compounds analysis (γ-aminobutyric acid [GABA], ergothioneine, lovastatin, and cordycepin); fatty acid and amino acid analysis; and an analysis of macro- and microelement content of fruit bodies and mycelia of 15 higher Basidiomycetes medicinal mushroom strains belonging to 12 species. The results obtained demonstrate that almost all investigated mushrooms were found to be good sources of proteins and carbohydrates, with content varying in the ranges of 8.6-42.5% and 42.9-83.6%, respectively. Different species exhibited distinct free amino acid profiles. The total amino acid content was highest in Ophiocordyceps sinensis (MB) (23.84 mg/g) and Cordyceps militaris (FB) (23.69 mg/g). The quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, stearic acid, and linoleic acid were the major fatty acids. The micro- and macroelement compositions were studied, and the highest results were (as milligrams per kilogram) 224-7307 for calcium, 1668-38564 for potassium, 1091-11676 for phosphorus, and 5-97 for zinc. Bioactive components were lovastatin, GABA, and ergothioneine, which are commonly found in most mushrooms. C. militaris (FB), Pleurotus ostreatus (FB), and Coprinus comatus (FB) were most abundant and contained a high amount of GABA (756.30 μg/g, 1304.99 μg/g, 1092.45 μg/g, respectively) and ergothioneine (409.88 μg/g, 2443.53 μg/g, 764.35 μg/g, respectively). The highest lovastatin content was observed in Hericium erinaceus (FB) (14.38 μg/g) and Ganoderma lucidum (FB) (11.54 μg/g). In contrast to C. militaris (FB), cordycepin was not detected in O. sinensis (MB). The fruit body biomass of C. militaris cordycepin content reached 1.743 mg/g dry weight. The nutritional values of the mushroom species studied here could potentially be used in well-balanced diets and as sources
SEROLOGICAL ANALYSES OF CELLULAR SLIME-MOLD DEVELOPMENT I.
Sonneborn, D. R.; Sussman, M.; Levine, L.
1964-01-01
Sonneborn, D. R. (Brandeis University, Waltham, Mass.), M. Sussman, and L. Levine. Serological analysis of cellular slime-mold development. I. Changes in antigenic activity during cell aggregation. J. Bacteriol. 87:1321–1329. 1964.—During aggregation in Dictyostelium discoideum, the concentration of a single antigenic determinant increased markedly, starting from very low or undetectable levels. Subsequently, the determinant appeared to segregate preferentially into the stalks of terminal fruiting bodies. Sera containing the antibody specific for this determinant inhibited the aggregation of D. discoideum without disturbing cell viability. The properties of the antigen during fractionation are consistent with the supposition that it may be a protein associated with the cell membrane. The ability or inability of three species to coaggregate with D. discoideum was correlated with the presence or absence of the antigenic determinant in aggregates of these species. PMID:14188709
Hasegawa, Yasuna; Wakabayashi, Masayuki; Nakamura, Shogo; Kodaira, Ken-ichi; Shinohara, Hiroaki; Yasukawa, Hiro
2004-05-04
The cellular slime mold Dictyostelium discoideum expresses a gene encoding a 452-amino-acid polypeptide that is 47% identical to Escherichia coli RecA. A recA-deficient E. coli, JE6651, was transformed by pYSN1, which was designed to express the truncated form of the D. discoideum gene, and used in suppression assays. The viability of the transformant, JE6651(pYSN1), increased following UV irradiation or mitomycin C treatment. Phage lambda (red(-) gam(-)), which required RecA activity for DNA packaging, formed plaques on a lawn of JE6651(pYSN1). These results indicate that the gene product has a DNA recombination activity. Fluorescence of D. discoideum protein fused with GFP was detected in mitochondria. The gene disruption mutant was hypersensitive to UV-light (254nm), mitomycin C and H(2)O(2), indicating that D. discoideum recA is important for survival following exposure to DNA damaging agents.
Caribbean Fruit Fly (Diptera: Tephritidae) and Small Fruit in Florida
USDA-ARS?s Scientific Manuscript database
Tephritid fruit flies are among the most important pests of fruits and vegetables worldwide. The Caribbean fruit fly, Anastrepha suspensa (Loew), is a tephritid pest that became established in Florida following introduction in 1965. Populations of this fruit fly also occur in Puerto Rico and Cuba, ...
Pisani, Cristina; Nguyen, Trang Thoaivan; Gubler, Walter Douglas
2015-09-01
Sour rot, is a pre-harvest disease that affects many grape varieties. Sour rot symptoms include initial berry cracking and breakdown of berry tissue. This is a disease complex with many filamentous fungi and bacteria involved, but is usually initiated by Aspergillus niger or Aspergillus carbonarius. Usually, by the time one sees the rot there are many other organisms involved and it is difficult to attribute the disease to one species. In this study two species of Aspergillus were shown to produce a previously unknown fruiting structure in infected berries. The nodulous morphology, bearing conidia, suggests them to be an 'everted polymorphic stroma'. This structure forms freely inside the berry pulp and assumes multiple shapes and sizes, sometimes sclerotium-like in form. It is composed of a mass of vegetative hyphae with or without tissue of the host containing spores or fruiting bodies bearing spores. Artificially inoculated berries placed in soil in winter showed the possible overwintering function of the fruiting body. Inoculated berry clusters on standing vines produced fruiting structures within 21 d post inoculation when wounds were made at veraison or after (July-September). Histological studies confirmed that the fruiting structure was indeed fungal tissue. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Coleman, J C; Downs, C T
2012-08-01
Whether nectarivores or frugivores place selective pressure on the plants they feed on, in terms of nectar or fruit traits, is much debated. Globally sugar preferences, concentration preference and digestive ability of avian nectarivores have been extensively researched. In contrast, relatively little is known about mammalian nectarivores or frugivores in terms of these, particularly Old World species. Consequently effect of sugar type and concentration on food preference in Wahlberg's epauletted fruit bat Epomophorus wahlbergi was investigated. Pair-wise choice tests were conducted using equicaloric hexose and sucrose solutions at five different concentrations (5%-25%). It was expected that they would prefer hexose sugars as these are dominant in available indigenous fruits. However, bats preferred hexoses only when offered dilute (5%) concentrations. From 10% to 25% they showed a decrease in volume intake. Their body mass was generally higher and similar after feeding during the night with the exception of 5% concentration where the mean body mass decreased. When E. wahlbergi were offered a range of sucrose or hexose solutions (10%-25%) respectively, they showed no concentration preference in terms of total volume consumed, nor energy intake. These findings suggest that these fruit bats do not appear to act as a selective pressure on sugar composition in Old World fruit. In fruit bats with high energy requirements, dietary flexibility may be an advantage when faced with seasonal and unpredictable fruit availability. Copyright © 2012 Elsevier Inc. All rights reserved.
An Attempt of Nondestructive Imaging of Sugar Distribution inside a Fruit Using Microwaves
NASA Astrophysics Data System (ADS)
Watanabe, Masakazu; Miyakawa, Michio
Chirp Pulse Microwave Computed Tomography (CP-MCT) that was originally developed for noninvasive imaging of a human body was applied to visualize sugar distribution inside a fruit. It can visualize not only permittivity distribution itself of a fruit but also various physical- or chemical-quantities relating to the permittivity value. Almost all fruits are dielectric materials containing much water, sugar, acids and so on. But for water, the principal ingredient of a fruit is sugar. Most of the fruits contain sugar from 8% to 22% by weight at the harvest time. Therefore sugar content distribution should be measured by CP-MCT nondestructively. By using apples and Japanese pears, feasibility of sugar distribution imaging has been evaluated by comparing the gray level of CP-MCT and sugar content of the cross section. The averaged correlation coefficients of the apple and pear are 0.793 and 0.681.
Fruit as Potent Natural Antioxidants and Their Biological Effects.
Gomes-Rochette, Neuza F; Da Silveira Vasconcelos, Mirele; Nabavi, Seyed M; Mota, Erika F; Nunes-Pinheiro, Diana C S; Daglia, Maria; De Melo, Dirce F
The consumption of fruit has increased in the last 20 years, along with the growing recognition of its nutritional and protective values. Many of the benefits of a diet rich in fruit are attributed to the presence of different bioactive substances, such as vitamins, carotenoids and phenolic compounds. Flavanoids, a class of phenolic compounds, present particular antioxidant activity and thus provide protection against cellular damage caused by reactive oxygen species. Research suggests that an increased intake of plant foods is associated with a reduced incidence of chronic disease. There is currently a great deal of interest in the study of antioxidants, in particular due to the discovery of the damaging effects of free radicals to the body. Thus, this review aims to address the beneficial effects of the antioxidants present in fruits, on the neutralization of reactive species and the reduction of any damage they may cause.
Comparison of the nutrient content of fresh fruit juices vs commercial fruit juices.
Densupsoontorn, Narumon; Jirapinyo, Pipop; Thamonsiri, Nuchnoi; Wongarn, Renu; Phosuya, Panarat; Tritiprat, Amornrat; Patraarat, Siriphan; Pidatcha, Pannee; Suwannthol, Lerson
2002-08-01
To compare the types and quantities of carbohydrate, electrolytes, pH and osmolarity of fresh fruit juices and commercial fruit juices. Forty kinds of fresh fruits available in Thai markets were analyzed for types and quantities of carbohydrate, electrolyte, pH and osmolarity and compared with previously obtained data for commercial fruit juices. Most fresh fruit juices did not contain sucrose, whereas, commercial fruit juices mostly have sucrose in the range of 3-112 g/L. Although both fruit juices were acidic (pH varied from 3.6-6.7 and 3.2-5.8 of fresh juice and commercial juice), fresh fruit juices had a more neutral pH than commercial fruit juices. Apple, guava, orange, pear, and pineapple juices from commercial fruit juices had a high osmolarity compared with fresh fruit juices. All types of fresh fruit juices contained less sodium than commercial ones, whereas, most fresh fruit juices contained more potassium, phosphorus, and magnesium than commercial fluids. The nutrient content of fresh fruit juices and commercial fruit juices from the same kinds of fruits are not the same, possibly due to the manufacturing process. Therefore, physicians should know the composition of fruit juices in order to advise patients properly.
Xu, Lishan; Zhang, Yaojie; Wang, Lizhi
2016-08-01
Dragon fruit is a tropical fruit with good taste. It can bring health benefits to human body. As one of the major bioactive components in this fruit, the polysaccharides might contribute to the health benefits. However, the precise structure information remains unknown. A leading polysaccharide of dragon fruit pulp, DFPP, was purified and identified by NMR and GC-MS. →4-β-d-GlcpA-1→, →6-β-d-Galp-1→ and →4-α-l-Rhap-1→ constituted the backbone and α-l-Araf-1→5-α-l-Araf-1→ formed the branch chain. The precise structure was putatively identified as below. The molecular weight was 2.2×10(3)kDa. The structure information of polysaccharides will be helpful to understand this fruit. Copyright © 2016 Elsevier Ltd. All rights reserved.
Focus on Fruits: 10 Tips to Eat More Fruits
... lunch, pack a tangerine, banana, or grapes to eat or choose fruits from a salad bar. Individual containers of fruits like peaches or applesauce are easy to carry and convenient for lunch. 7 Enjoy fruit at dinner, too At dinner, add crushed pineapple to coleslaw ...
Edible coatings influence fruit ripening, quality, and aroma biosynthesis in mango fruit.
Dang, Khuyen T H; Singh, Zora; Swinny, Ewald E
2008-02-27
The effects of different edible coatings on mango fruit ripening and ripe fruit quality parameters including color, firmness, soluble solids concentrations, total acidity, ascorbic acid, total carotenoids, fatty acids, and aroma volatiles were investigated. Hard mature green mango (Mangifera indica L. cv. Kensigton Pride) fruits were coated with aqueous mango carnauba (1:1 v/v), Semperfresh (0.6%), Aloe vera gel (1:1, v/v), or A. vera gel (100%). Untreated fruit served as the control. Following the coating, fruits were allowed to dry at room temperature and packed in soft-board trays to ripen at 21+/-1 degrees C and 55.2+/-11.1% relative humidity until the eating soft stage. Mango carnauba was effective in retarding fruit ripening, retaining fruit firmness, and improving fruit quality attributes including levels of fatty acids and aroma volatiles. Semperfresh and A. vera gel (1:1 or 100%) slightly delayed fruit ripening but reduced fruit aroma volatile development. A. vera gel coating did not exceed the commercial mango carnauba and Semperfresh in retarding fruit ripening and improving aroma volatile biosynthesis.
Flow-driven waves and sink-driven oscillations during aggregation of Dictyostelium discoideum
NASA Astrophysics Data System (ADS)
Gholami, Azam; Zykov, Vladimir; Steinbock, Oliver; Bodenschatz, Eberhard
The slime mold Dictyostelium discoideum (D.d) is a well-known model system for the study of biological pattern formation. Under starvation, D.d. cells aggregate chemotactically towards cAMP signals emitted periodically from an aggregation center. In the natural environment, D.d cells may experience fluid flows that can profoundly change the underlying wave generation process. We investigate spatial-temporal dynamics of a uniformly distributed population of D.d. cells in a flow-through narrow microfluidic channel with a cell-free inlet area. We show that flow can significantly influence the dynamics of the system and lead to a flow- driven instability that initiate downstream traveling cAMP waves. We also show that cell-free boundary regions have a significant effect on the observed patterns and can lead to a new kind of instability. Since there are no cells in the inlet to produce cAMP, the points in the vicinity of the inlet lose cAMP due to advection or diffusion and gain only a little from the upstream of the channel (inlet). In other words, there is a large negative flux of cAMP in the neighborhood close to the inlet, which can be considered as a sink. This negative flux close to the inlet drives a new kind of instability called sink-driven oscillations. Financial support of the MaxSynBio Consortium is acknowledged.
GBF-dependent family genes morphologically suppress the partially active Dictyostelium STATa strain.
Shimada, Nao; Kanno-Tanabe, Naoko; Minemura, Kakeru; Kawata, Takefumi
2008-02-01
Transcription factor Dd-STATa, a functional Dictyostelium homologue of metazoan signal transducers and activators of transcription proteins, is necessary for culmination during development. We have isolated more than 18 putative multicopy suppressors of Dd-STATa using genetic screening. One was hssA gene, whose expression is known to be G-box-binding-factor-dependent and which was specific to prestalk A (pstA) cells, where Dd-STATa is activated. Also, hssA mRNA was expressed in pstA cells in the Dd-STATa-null mutant. At least 40 hssA-related genes are present in the genome and constitute a multigene family. The tagged HssA protein was translated; hssA encodes an unusually high-glycine-serine-rich small protein (8.37 kDa), which has strong homology to previously reported cyclic-adenosine-monophosphate-inducible 2C and 7E proteins. Overexpression of hssA mRNA as well as frame-shifted versions of hssA RNA suppressed the phenotype of the partially active Dd-STATa strain, suggesting that translation is not necessary for suppression. Although overexpression of prespore-specific genes among the family did not suppress the parental phenotype, prestalk-specific family members did. Although overexpression of the hssA did not revert the expression of Dd-STATa target genes, and although its suppression mechanism remains unknown, morphological reversion implies functional relationships between Dd-STATa and hssA.
Comparing the Dictyostelium and Entamoeba Genomes Reveals an Ancient Split in the Conosa Lineage
Song, Jie; Xu, Qikai; Olsen, Rolf; Loomis, William F; Shaulsky, Gad; Kuspa, Adam; Sucgang, Richard
2005-01-01
The Amoebozoa are a sister clade to the fungi and the animals, but are poorly sampled for completely sequenced genomes. The social amoeba Dictyostelium discoideum and amitochondriate pathogen Entamoeba histolytica are the first Amoebozoa with genomes completely sequenced. Both organisms are classified under the Conosa subphylum. To identify Amoebozoa-specific genomic elements, we compared these two genomes to each other and to other eukaryotic genomes. An expanded phylogenetic tree built from the complete predicted proteomes of 23 eukaryotes places the two amoebae in the same lineage, although the divergence is estimated to be greater than that between animals and fungi, and probably happened shortly after the Amoebozoa split from the opisthokont lineage. Most of the 1,500 orthologous gene families shared between the two amoebae are also shared with plant, animal, and fungal genomes. We found that only 42 gene families are distinct to the amoeba lineage; among these are a large number of proteins that contain repeats of the FNIP domain, and a putative transcription factor essential for proper cell type differentiation in D. discoideum. These Amoebozoa-specific genes may be useful in the design of novel diagnostics and therapies for amoebal pathologies. PMID:16362072
The GATA transcription factor gene gtaG is required for terminal differentiation in Dictyostelium.
Katoh-Kurasawa, Mariko; Santhanam, Balaji; Shaulsky, Gad
2016-03-09
The GATA transcription factor GtaG is conserved in Dictyostelids and essential for terminal differentiation in Dictyostelium discoideum, but its function is not well understood. Here we show that gtaG is expressed in prestalk cells at the anterior region of fingers and in the extending stalk during culmination. The gtaG - phenotype is cell-autonomous in prestalk cells and non-cell-autonomous in prespore cells. Transcriptome analyses reveal that GtaG regulates prestalk gene expression during cell differentiation before culmination and is required for progression into culmination. GtaG-dependent genes include genetic suppressors of the Dd-STATa-defective phenotype as well as Dd-STATa target-genes, including extra cellular matrix genes. We show that GtaG may be involved in the production of two culmination-signaling molecules, cyclic di-GMP and the spore differentiation factor SDF-1 and that addition of c-di-GMP rescues the gtaG - culmination and spore formation deficiencies. We propose that GtaG is a regulator of terminal differentiation that functions in concert with Dd-STATa and controls culmination through regulating c-di-GMP and SDF-1 production in prestalk cells. © 2016. Published by The Company of Biologists Ltd.
Tikhonenko, Irina; Irizarry, Karen; Khodjakov, Alexey; Koonce, Michael P.
2015-01-01
It has long been known that the interphase microtubule (MT) array is a key cellular scaffold that provides structural support and directs organelle trafficking in eukaryotic cells. Although in animal cells, a combination of centrosome nucleating properties and polymer dynamics at the distal microtubule ends is generally sufficient to establish a radial, polar array of MTs, little is known about how effector proteins (motors and crosslinkers) are coordinated to produce the diversity of interphase MT array morphologies found in nature. This diversity is particularly important in multinucleated environments where multiple MT arrays must coexist and function. We initiate here a study to address the higher ordered coordination of multiple, independent MT arrays in a common cytoplasm. Deletion of a MT crosslinker of the MAP65/Ase1/PRC1 family disrupts the spatial integrity of multiple arrays in Dictyostelium discoideum, reducing the distance between centrosomes and increasing the intermingling of MTs with opposite polarity. This result, coupled with previous dynein disruptions suggest a robust mechanism by which interphase MT arrays can utilize motors and crosslinkers to sense their position and minimize overlap in a common cytoplasm. PMID:26298292
D'Aoust, M A; Yelle, S; Nguyen-Quoc, B
1999-01-01
The role of sucrose synthase (SuSy) in tomato fruit was studied in transgenic tomato (Lycopersicon esculentum) plants expressing an antisense fragment of fruit-specific SuSy RNA (TOMSSF) under the control of the cauliflower mosaic virus 35S promoter. Constitutive expression of the antisense RNA markedly inhibited SuSy activity in flowers and fruit pericarp tissues. However, inhibition was only slight in the endosperm and was undetectable in the embryo, shoot, petiole, and leaf tissues. The activity of sucrose phosphate synthase decreased in parallel with that of SuSy, but acid invertase activity did not increase in response to the reduced SuSy activity. The only effect on the carbohydrate content of young fruit was a slight reduction in starch accumulation. The in vitro sucrose import capacity of fruits was not reduced by SuSy inhibition at 23 days after anthesis, and the rate of starch synthesized from the imported sucrose was not lessened even when SuSy activity was decreased by 98%. However, the sucrose unloading capacity of 7-day-old fruit was substantially decreased in lines with low SuSy activity. In addition, the SuSy antisense fruit from the first week of flowering had a slower growth rate. A reduced fruit set, leading to markedly less fruit per plant at maturity, was observed for the plants with the least SuSy activity. These results suggest that SuSy participates in the control of sucrose import capacity of young tomato fruit, which is a determinant for fruit set and development. PMID:10590167
Livermore, Thomas Miles; Chubb, Jonathan Robert; Saiardi, Adolfo
2016-01-01
Inorganic polyphosphate (polyP) is composed of linear chains of phosphate groups linked by high-energy phosphoanhydride bonds. However, this simple, ubiquitous molecule remains poorly understood. The use of nonstandardized analytical methods has contributed to this lack of clarity. By using improved polyacrylamide gel electrophoresis we were able to visualize polyP extracted from Dictyostelium discoideum. We established that polyP is undetectable in cells lacking the polyphosphate kinase (DdPpk1). Generation of this ppk1 null strain revealed that polyP is important for the general fitness of the amoebae with the mutant strain displaying a substantial growth defect. We discovered an unprecedented accumulation of polyP during the developmental program, with polyP increasing more than 100-fold. The failure of ppk1 spores to accumulate polyP results in a germination defect. These phenotypes are underpinned by the ability of polyP to regulate basic energetic metabolism, demonstrated by a 2.5-fold decrease in the level of ATP in vegetative ppk1. Finally, the lack of polyP during the development of ppk1 mutant cells is partially offset by an increase of both ATP and inositol pyrophosphates, evidence for a model in which there is a functional interplay between inositol pyrophosphates, ATP, and polyP. PMID:26755590
Voigt, Oliver; Herzog, Britta; Jakobshagen, Antonia; Pöggeler, Stefanie
2013-12-01
Autophagy is a precisely controlled degradation process in eukaryotic cells, during which the bulk of the cytoplasm is engulfed by a double membrane vesicle, the autophagosome. Fusion of the autophagosome with the vacuole leads to breakdown of its contents, such as proteins and organelles, and the recycling of nutrients. Earlier studies of autophagic genes of the core autophagic machinery in the filamentous ascomycete Sordaria macrospora elucidated the impact of autophagy on fungal viability, vegetative growth and fruiting-body development. To gain further knowledge about the regulation of autophagy in S. macrospora, we analyzed the function of the bZIP transcription factor SmJLB1, a homolog of the Podospora anserina basic zipper-type transcription factor induced during incompatibility 4 (IDI-4) and the Aspergillus nidulans transcription factor jun-like bZIP A (JlbA). Generation of the homokaryotic deletion mutant demonstrated S. macrospora Smjlb1 is associated with autophagy-dependent processes. Deletion of Smjlb1 abolished fruiting-body formation and impaired vegetative growth. SmJLB1 is localized to the cytoplasm and to nuclei. Quantitative real-time PCR experiments revealed an upregulated expression of autophagy-related genes Smatg8 and Smatg4 in the Smjlb1 deletion mutant, suggesting a transcriptional repression function of SmJLB1. Copyright © 2013 Elsevier Inc. All rights reserved.
Relationship between body satisfaction with self esteemand unhealthy body weight management.
Daniali, Shahrbanoo; Azadbakht, Leila; Mostafavi, Firoozeh
2013-01-01
< 0.004), consumption of fruit (r = 0.13, P < 0.008) all correlated with self-esteem significantly. Women with higher self esteem used higher fruits had a good nutrition overall (r = 0.11, P = 0.02). 92.15%, 10.8% of women respectively participated in one of healthy and unhealthy weight control behavior. There was not any Relationship between self esteem and healthy weight control behavior while finding showed reverse relationship between self esteem and Unhealthy Dieting Behaviors. It seemed women identity in our society tied to social appreciations that formed and supported by body satisfaction. When they feel their current appearance is differ from ideal appearance, they feel down and have lower self esteem and used unhealthy dieting behavior and low fruits daily. Due to importance of precise self evaluation, self esteem can be used to design and conduct public health programs, especially for women.
Sheikh, M Osman; Thieker, David; Chalmers, Gordon; Schafer, Christopher M; Ishihara, Mayumi; Azadi, Parastoo; Woods, Robert J; Glushka, John N; Bendiak, Brad; Prestegard, James H; West, Christopher M
2017-11-17
Skp1 is a conserved protein linking cullin-1 to F-box proteins in SCF ( S kp1/ C ullin-1/ F -box protein) E3 ubiquitin ligases, which modify protein substrates with polyubiquitin chains that typically target them for 26S proteasome-mediated degradation. In Dictyostelium (a social amoeba), Toxoplasma gondii (the agent for human toxoplasmosis), and other protists, Skp1 is regulated by a unique pentasaccharide attached to hydroxylated Pro-143 within its C-terminal F-box-binding domain. Prolyl hydroxylation of Skp1 contributes to O 2 -dependent Dictyostelium development, but full glycosylation at that position is required for optimal O 2 sensing. Previous studies have shown that the glycan promotes organization of the F-box-binding region in Skp1 and aids in Skp1's association with F-box proteins. Here, NMR and MS approaches were used to determine the glycan structure, and then a combination of NMR and molecular dynamics simulations were employed to characterize the impact of the glycan on the conformation and motions of the intrinsically flexible F-box-binding domain of Skp1. Molecular dynamics trajectories of glycosylated Skp1 whose calculated monosaccharide relaxation kinetics and rotational correlation times agreed with the NMR data indicated that the glycan interacts with the loop connecting two α-helices of the F-box-combining site. In these trajectories, the helices separated from one another to create a more accessible and dynamic F-box interface. These results offer an unprecedented view of how a glycan modification influences a disordered region of a full-length protein. The increased sampling of an open Skp1 conformation can explain how glycosylation enhances interactions with F-box proteins in cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Ras proteins have multiple functions in vegetative cells of Dictyostelium.
Bolourani, Parvin; Spiegelman, George; Weeks, Gerald
2010-11-01
During the aggregation of Dictyostelium cells, signaling through RasG is more important in regulating cyclic AMP (cAMP) chemotaxis, whereas signaling through RasC is more important in regulating the cAMP relay. However, RasC is capable of substituting for RasG for chemotaxis, since rasG⁻ cells are only partially deficient in chemotaxis, whereas rasC⁻/rasG⁻ cells are totally incapable of chemotaxis. In this study we have examined the possible functional overlap between RasG and RasC in vegetative cells by comparing the vegetative cell properties of rasG⁻, rasC⁻, and rasC⁻/rasG⁻ cells. In addition, since RasD, a protein not normally found in vegetative cells, is expressed in vegetative rasG⁻ and rasC⁻/rasG⁻ cells and appears to partially compensate for the absence of RasG, we have also examined the possible functional overlap between RasG and RasD by comparing the properties of rasG⁻ and rasC⁻/rasG⁻ cells with those of the mutant cells expressing higher levels of RasD. The results of these two lines of investigation show that RasD is capable of totally substituting for RasG for cytokinesis and growth in suspension, whereas RasC is without effect. In contrast, for chemotaxis to folate, RasC is capable of partially substituting for RasG, but RasD is totally without effect. Finally, neither RasC nor RasD is able to substitute for the role that RasG plays in regulating actin distribution and random motility. These specificity studies therefore delineate three distinct and none-overlapping functions for RasG in vegetative cells.
Dictyostelium mobile elements: strategies to amplify in a compact genome.
Winckler, T; Dingermann, T; Glöckner, G
2002-12-01
Dictyostelium discoideum is a eukaryotic microorganism that is attractive for the study of fundamental biological phenomena such as cell-cell communication, formation of multicellularity, cell differentiation and morphogenesis. Large-scale sequencing of the D. discoideum genome has provided new insights into evolutionary strategies evolved by transposable elements (TEs) to settle in compact microbial genomes and to maintain active populations over evolutionary time. The high gene density (about 1 gene/2.6 kb) of the D. discoideum genome leaves limited space for selfish molecular invaders to move and amplify without causing deleterious mutations that eradicate their host. Targeting of transfer RNA (tRNA) gene loci appears to be a generally successful strategy for TEs residing in compact genomes to insert away from coding regions. In D. discoideum, tRNA gene-targeted retrotransposition has evolved independently at least three times by both non-long terminal repeat (LTR) retrotransposons and retrovirus-like LTR retrotransposons. Unlike the nonspecifically inserting D. discoideum TEs, which have a strong tendency to insert into preexisting TE copies and form large and complex clusters near the ends of chromosomes, the tRNA gene-targeted retrotransposons have managed to occupy 75% of the tRNA gene loci spread on chromosome 2 and represent 80% of the TEs recognized on the assembled central 6.5-Mb part of chromosome 2. In this review we update the available information about D. discoideum TEs which emerges both from previous work and current large-scale genome sequencing, with special emphasis on the fact that tRNA genes are principal determinants of retrotransposon insertions into the D. discoideum genome.
Dictyostelium myosin I double mutants exhibit conditional defects in pinocytosis.
Novak, K D; Peterson, M D; Reedy, M C; Titus, M A
1995-12-01
The functional relationship between three Dictyostelium myosin Is, myoA, myoB, and myoC, has been examined through the creation of double mutants. Two double mutants, myoA-/B- and myoB-/C-, exhibit similar conditional defects in fluid-phase pinocytosis. Double mutants grown in suspension culture are significantly impaired in their ability to take in nutrients from the medium, whereas they are almost indistinguishable from wild-type and single mutant strains when grown on a surface. The double mutants are also found to internalize gp126, a 116-kD membrane protein, at a slower rate than either the wild-type or single mutant cells. Ultrastructural analysis reveals that both double mutants possess numerous small vesicles, in contrast to the wild-type or myosin I single mutants that exhibit several large, clear vacuoles. The alterations in fluid and membrane internalization in the suspension-grown double mutants, coupled with the altered vesicular profile, suggest that these cells may be compromised during the early stages of pinocytosis, a process that has been proposed to occur via actin-based cytoskeletal rearrangements. Scanning electron microscopy and rhodamine-phalloidin staining indicates that the myosin I double mutants appear to extend a larger number of actin-filled structures, such as filopodia and crowns, than wild-type cells. Rhodamine-phalloidin staining of the F-actin cytoskeleton of these suspension-grown cells also reveals that the double mutant cells are delayed in the rearrangement of cortical actin-rich structures upon adhesion to a substrate. We propose that myoA, myoB, and myoC play roles in controlling F-actin filled membrane projections that are required for pinosome internalization in suspension.
Crowe-White, Kristi; O'Neil, Carol E; Parrott, J Scott; Benson-Davies, Sue; Droke, Elizabeth; Gutschall, Melissa; Stote, Kim S; Wolfram, Taylor; Ziegler, Paula
2016-01-01
Consumption of 100% fruit juice remains controversial for its potential adverse impact on weight and displacement of essential foods in the diets of children. A systematic review of the literature published from 1995-2013 was conducted using the PubMed database to evaluate associations between intake of 100% fruit juice and weight/adiposity and nutrient intake/adequacy among children of 1 to 18 years of age. Weight status outcome measures included body mass index (BMI), BMI z-score, ponderal index, obesity, weight gain, adiposity measures, and body composition. Nutrient outcome measures included intake and adequacy of shortfall nutrients. Data extraction and analysis was conducted according to the Academy of Nutrition and Dietetics Evidence Analysis Process. Twenty-two studies on weight status provided evidence that did not support an association between 100% fruit juice consumption and weight/adiposity in children after controlling for energy intake. Limited evidence from eight studies suggests that children consuming 100% fruit juice have higher intake and adequacy of dietary fiber, vitamin C, magnesium, and potassium. Differences in methodology and study designs preclude causal determination of 100% fruit juice as sole influencer of weight status or nutrient intake/adequacy of shortfall nutrients. In context of a healthy dietary pattern, evidence suggests that consumption of 100% fruit juice may provide beneficial nutrients without contributing to pediatric obesity.
Shimada, Nao; Kawata, Takefumi
2007-06-01
Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism.
Shimada, Nao; Kawata, Takefumi
2007-01-01
Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism. PMID:17435008
[Spectral navigation technology and its application in positioning the fruits of fruit trees].
Yu, Xiao-Lei; Zhao, Zhi-Min
2010-03-01
An innovative technology of spectral navigation is presented in the present paper. This new method adopts reflectance spectra of fruits, leaves and branches as one of the key navigation parameters and positions the fruits of fruit trees relying on the diversity of spectral characteristics. The research results show that the distinct smoothness as effect is available in the spectrum of leaves of fruit trees. On the other hand, gradual increasing as the trend is an important feature in the spectrum of branches of fruit trees while the spectrum of fruit fluctuates. In addition, the peak diversity of reflectance rate between fruits and leaves of fruit trees is reached at 850 nm of wavelength. So the limit value can be designed at this wavelength in order to distinguish fruits and leaves. The method introduced here can not only quickly distinguish fruits, leaves and branches, but also avoid the effects of surroundings. Compared with the traditional navigation systems based on machine vision, there are still some special and unique features in the field of positioning the fruits of fruit trees using spectral navigation technology.
Competition for Assimilates and Fruit Position Affect Fruit Set in Indeterminate Greenhouse Tomato
Bertin, N.
1995-01-01
Localization and characterization of fruit set in winter tomato crops was investigated to determine the main internal and external controlling factors and to establish a quantitative relationship between fruit set and competition for assimilates. Individual fruit growth and development was assessed on a beef tomato cultivar during the reproductive period (first nine inflorescences). A non-destructive photograph technique was used to measure fruit growth from very early stages of their development and then calliper measurements were made on big fruits. From these measurements we determined the precise developmental stage at which fruit growth stopped. Fruit potential growth, which is defined as the growth achieved in non-limiting conditions for assimilate supply, was also assessed by this method on plants thinned to one flower per inflorescence. The latter was used to calculate the ratio between actual and potential growth, which was found to be a good index of the competition for assimilates. Time lags of fruit set were observed mainly on distal organs. When more than three flowers were left on each inflorescence, distal organs developed at the same time as proximal organs of the following inflorescence. Consequently they were submitted to a double competition within one inflorescence and among inflorescences. It was shown that, what is commonly named ‘fruit set failure’, is not an irreversible death of the organ and that a small fruit could resume growth after a delay of several weeks as soon as the first fruits ripened and thus ceased to compete for assimilates. In that case proximal fruits resumed growth before distal ones. The delayed fruits contained only few seeds but a germination test confirmed that fertilization took place before fruit set failed. Competition for assimilates was calculated during plant development by the ratio between actual and potential fruit growth. Potential growth of proximal fruits was strongly dependent on the position of the
Social support is a primary influence on home fruit, 100% juice, and vegetable availability.
Baranowski, Tom; Watson, Kathy; Missaghian, Mariam; Broadfoot, Alison; Cullen, Karen; Nicklas, Theresa; Fisher, Jennifer; Baranowski, Janice; O'Donnell, Sharon
2008-07-01
Children tend to eat more fruit and vegetables when more are available in the home. We proposed and tested a model that predicts the availability at home (hereinafter termed "home availability") of fruit, 100% juice, and vegetables, using new measures of frequency of food shopping, purchase, and comparative purchase outcome expectancies (ie, the perceived benefits and costs of purchasing fruit and vegetables), home food pantry management practices, family social support for purchasing fruit and vegetables, food shopping practices, and body mass index (BMI). Participants (N=98) were recruited in 2004 in front of grocery stores and completed two telephone interviews. Cross-sectional hierarchical regression was employed with backward deletion of nonsignificant variables. Despite many statistically significant bivariate correlations between the new variables and home fruit, 100% juice, and vegetable availability, social support was the primary predictor of home fruit availability in multivariate regression. BMI and home 100% juice pantry management were the primary predictors of home 100% juice availability. Social support, BMI, and shopping practices were the primary predictors of home vegetable availability. Social support for purchasing fruit, 100% juice, and vegetables was an important, consistent predictor of home availability. These findings need to be replicated in larger samples.
Aquatic gilled mushrooms: Psathyrella fruiting in the Rogue River in southern Oregon.
Frank, Jonathan L; Coffan, Robert A; Southworth, Darlene
2010-01-01
A species of Psathyrella (Basidiomycota) with true gills has been observed fruiting underwater in the clear, cold, flowing waters of the upper Rogue River in Oregon. Fruiting bodies develop and mature in the main channel, where they are constantly submerged, and were observed fruiting over 11 wk. These mushrooms develop underwater, not on wood recently washed into the river. Substrates include water-logged wood, gravel and the silty riverbed. DNA sequences of the ITS region and a portion of the ribosomal large subunit gene place this fungus in Psathyrella sensu stricto near P. atomata, P. fontinalis and P. superiorensis. Morphological characters distinguish the underwater mushroom from previously described species. Fruiting bodies have long fibrillose stipes with small diameter caps. Immature stages have a thin veil that is soon lost. Gills lack reddish edges. Cystidia are ventricose with subacute apices. Spores were observed as wedge-shape rafts released into gas pockets below the caps. Underwater gills and ballistospores indicate a recent adaptation to the stream environment. This particular river habitat combines the characteristics of spring-fed flows and cold, aerated water with woody debris in shallow depths on a fine volcanic substrate. Based on molecular and morphological evidence we conclude that the underwater mushrooms are a new species, Psathyrella aquatica. This report adds to the biodiversity of stream fungi that degrade woody substrates. The underwater environment is a new habitat for gilled mushrooms.
Wu, Fangfang; Zhou, Chunhui; Zhou, Dandan; Ou, Shiyi; Zhang, Xiaoai; Huang, Huihua
2018-01-24
A novel polysaccharide fraction (HEP-S) was extracted and isolated from the fruiting bodies of Hericium erinaceus. Structural characterization revealed that HEP-S had an average molecular weight of 1.83 × 10 4 Da and consisted of rhamnose, fucose, mannose, glucose and galactose at a molar ratio of 1.47 : 0.93 : 1.36 : 8.68 : 4.08. Periodate oxidation-Smith degradation and NMR analysis showed that the main linkage types of HEP-S were composed of (1→)-α-d-Glc, (1→3,4)-α-d-Glc, (1→6)-α-d-Gal, (1→3,4)-β-d-Man, (1→3,6)-α-Rha and (1→2)-β-l-Fuc. The immunomodulatory assay indicated that HEP-S could significantly enhance the pinocytic and phagocytic capacity and promote the secretion of nitric oxide and pro-inflammatory cytokines by activating the corresponding mRNA and protein expression in RAW 264.7 cells involving a toll-like receptor 2 membrane receptor. Besides, HEP-S was also found to improve the adaptive immune function by enhancing T and B lymphocyte proliferation and increasing the interleukin-2, interleukin-4 and interferon-γ secretion in spleen lymphocytes. These results suggested that HEP-S could be used as a potential immunoregulatory agent in functional foods.
Bird fruit preferences match the frequency of fruit colours in tropical Asia
Duan, Qiong; Goodale, Eben; Quan, Rui-chang
2014-01-01
While many factors explain the colour of fleshy fruits, it is thought that black and red fruits are common in part because frugivorous birds prefer these colours. We examined this still controversial hypothesis at a tropical Asian field site, using artificial fruits, fresh fruits, four wild-caught resident frugivorous bird species, and hand-raised naïve birds from three of the same species. We demonstrate that all birds favored red artificial fruits more than yellow, blue, black and green, although the artificial black colour was found subsequently to be similar to the artificial blue colour in its spectral reflectance. Wild-caught birds preferred both black and red fleshy natural fruits, whereas hand-raised naïve birds preferred black to red natural fleshy fruits and to those of other colours. All birds avoided artificial and naturally ripe green fruits. The inter-individual variation in colour choice was low and the preferences were constant over time, supporting the hypothesis that bird colour preferences are a contributing factor driving fruit colour evolution in tropical Asia. PMID:25033283
Comparison of fruit and vegetable intakes during weight loss in males and females.
Williams, R L; Wood, L G; Collins, C E; Callister, R
2016-01-01
Globally, fruit and vegetable intakes are well below recommendations despite ample evidence to link insufficient intake with increased risk of overweight and obesity. Intakes of fruits and vegetables in the general population differ between males and females, and although there is growing evidence of intakes in men and women during weight loss, evidence that directly compares intakes in men and women during weight loss is lacking. This study aimed to identify any differences between males and females in fruit and vegetable intakes and plasma carotenoid concentrations during weight loss, and determine whether there is a relationship between any changes in fruit and vegetable intakes and weight change in both males and females. Men and women (n=100; body mass index 25-40 kg/m(2)) aged 18-60 years were selected for the study. Dietary intake of fruits and vegetables was assessed using the Australian Eating Survey and fasting blood was collected to assess plasma carotenoids, which were determined by high-performance liquid chromatography. There was little change in fruit or vegetable intakes during weight loss, although men tended to increase fruit intakes. Changes in intakes were influenced by baseline intakes, with males and females with the highest intakes at baseline reducing intakes. Males had better correlations between fruit and vegetable intakes and plasma carotenoid concentrations than females, and fruit and vegetable intakes during weight loss appear to predict weight loss for males but not females. Fruit and vegetable intake during weight loss does not appear to differ largely between males and females.
Li, L; Ng, T B; Song, M; Yuan, F; Liu, Z K; Wang, C L; Jiang, Y; Fu, M; Liu, F
2007-06-01
The antioxidant effects of a polysaccharide-peptide complex (F22) from mushroom (Pleurotus abalonus)-fruiting bodies were studied. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) in the liver, kidney, and brain of senescence-accelerated mice showed a marked increase after treatment with the polysaccharide-peptide complex. Concurrently, the gene expression levels of SOD, CAT, and GPx, as determined with real-time polymerase chain reaction, were up-regulated in the liver, kidney, and brain, whereas the MDA content in these organs declined. The maximal lifespan of the mice was prolonged.
Xu, Yuechi; Brown, Kevin M.; Wang, Zhuo A.; van der Wel, Hanke; Teygong, Crystal; Zhang, Dongmei; Blader, Ira J.; West, Christopher M.
2012-01-01
In diverse types of organisms, cellular hypoxic responses are mediated by prolyl 4-hydroxylases that use O2 and α-ketoglutarate as substrates to hydroxylate conserved proline residues in target proteins. Whereas in metazoans these enzymes control the stability of the HIFα family of transcription factor subunits, the Dictyostelium enzyme (DdPhyA) contributes to O2 regulation of development by a divergent mechanism involving hydroxylation and subsequent glycosylation of DdSkp1, an adaptor subunit in E3SCF ubiquitin ligases. Sequences related to DdPhyA, DdSkp1, and the glycosyltransferases that cap Skp1 hydroxyproline occur also in the genomes of Toxoplasma and other protists, suggesting that this O2 sensing mechanism may be widespread. Here we show by disruption of the TgphyA locus that this enzyme is required for Skp1 glycosylation in Toxoplasma and that disrupted parasites grow slowly at physiological O2 levels. Conservation of cellular function was tested by expression of TgPhyA in DdphyA-null cells. Simple gene replacement did not rescue Skp1 glycosylation, whereas overexpression not only corrected Skp1 modification but also restored the O2 requirement to a level comparable to that of overexpressed DdPhyA. Bacterially expressed TgPhyA protein can prolyl hydroxylate both Toxoplasma and Dictyostelium Skp1s. Kinetic analyses showed that TgPhyA has similar properties to DdPhyA, including a superimposable dependence on the concentration of its co-substrate α-ketoglutarate. Remarkably, however, TgPhyA had a significantly higher apparent affinity for O2. The findings suggest that Skp1 hydroxylation by PhyA is a conserved process among protists and that this biochemical pathway may indirectly sense O2 by detecting the levels of O2-regulated metabolites such as α-ketoglutarate. PMID:22648409
Effects of Nickel, Chlorpyrifos and Their Mixture on the Dictyostelium discoideum Proteome
Boatti, Lara; Robotti, Elisa; Marengo, Emilio; Viarengo, Aldo; Marsano, Francesco
2012-01-01
Mixtures of chemicals can have additive, synergistic or antagonistic interactions. We investigated the effects of the exposure to nickel, the organophosphate insecticide chlorpyrifos at effect concentrations (EC) of 25% and 50% and their binary mixture (Ec25 + EC25) on Dictyostelium discoideum amoebae based on lysosomal membrane stability (LMS). We treated D. discoideum with these compounds under controlled laboratory conditions and evaluated the changes in protein levels using a two-dimensional gel electrophoresis (2DE) proteomic approach. Nickel treatment at EC25 induced changes in 14 protein spots, 12 of which were down-regulated. Treatment with nickel at EC50 resulted in changes in 15 spots, 10 of which were down-regulated. Treatment with chlorpyrifos at EC25 induced changes in six spots, all of which were down-regulated; treatment with chlorpyrifos at EC50 induced changes in 13 spots, five of which were down-regulated. The mixture corresponding to EC25 of each compound induced changes in 19 spots, 13 of which were down-regulated. The data together reveal that a different protein expression signature exists for each treatment, and that only a few proteins are modulated in multiple different treatments. For a simple binary mixture, the proteomic response does not allow for the identification of each toxicant. The protein spots that showed significant differences were identified by mass spectrometry, which revealed modulations of proteins involved in metal detoxification, stress adaptation, the oxidative stress response and other cellular processes. PMID:23443088
De Palo, Giovanna; Yi, Darvin; Endres, Robert G.
2017-01-01
The transition from single-cell to multicellular behavior is important in early development but rarely studied. The starvation-induced aggregation of the social amoeba Dictyostelium discoideum into a multicellular slug is known to result from single-cell chemotaxis towards emitted pulses of cyclic adenosine monophosphate (cAMP). However, how exactly do transient, short-range chemical gradients lead to coherent collective movement at a macroscopic scale? Here, we developed a multiscale model verified by quantitative microscopy to describe behaviors ranging widely from chemotaxis and excitability of individual cells to aggregation of thousands of cells. To better understand the mechanism of long-range cell—cell communication and hence aggregation, we analyzed cell—cell correlations, showing evidence of self-organization at the onset of aggregation (as opposed to following a leader cell). Surprisingly, cell collectives, despite their finite size, show features of criticality known from phase transitions in physical systems. By comparing wild-type and mutant cells with impaired aggregation, we found the longest cell—cell communication distance in wild-type cells, suggesting that criticality provides an adaptive advantage and optimally sized aggregates for the dispersal of spores. PMID:28422986
Takahashi, Kei; Toyota, Taro
2017-03-07
The transformation of the supported lipid bilayer (SLB) membrane by extracted cytosol from living resources, has recently drawn much attention. It enables us to address the question of whether the purified phospholipid SLB membrane, including lipids related to amoeba locomotion, which was discussed in many previous studies, exhibits membrane deformation in the presence of cytosol extracted from amoeba; Methods: In this report, a method for reconstituting a supported lipid bilayer (SLB) membrane, composed of purified phospholipids and cytosol extracted from Dictyostelium discoideum , is described. This technique is a new reconstitution method combining the artificial constitution of membranes with the reconstitution using animate cytosol (without precise purification at a molecular level), contributing to membrane deformation analysis; Results: The morphology transition of a SLB membrane composed of phosphatidylcholines, after the addition of cytosolic extract, was traced using a confocal laser scanning fluorescence microscope. As a result, pore formation in the SLB membrane was observed and phosphatidylinositides incorporated into the SLB membrane tended to suppress pore formation and expansion; Conclusions: The current findings imply that phosphatidylinositides have the potential to control cytoplasm activity and bind to a phosphoinositide-containing SLB membrane.
Carroll, Suzanne J; Niyonsenga, Theo; Coffee, Neil T; Taylor, Anne W; Daniel, Mark
2018-05-18
Descriptive norms (what other people do) relate to individual-level dietary behaviour and health outcome including overweight and obesity. Descriptive norms vary across residential areas but the impact of spatial variation in norms on individual-level diet and health is poorly understood. This study assessed spatial associations between local descriptive norms for overweight/obesity and insufficient fruit intake (spatially-specific local prevalence), and individual-level dietary intakes (fruit, vegetable and sugary drinks) and 10-year change in body mass index (BMI) and glycosylated haemoglobin (HbA 1c ). HbA 1c and BMI were clinically measured three times over 10 years for a population-based adult cohort (n = 4056) in Adelaide, South Australia. Local descriptive norms for both overweight/obesity and insufficient fruit intake specific to each cohort participant were calculated as the prevalence of these factors, constructed from geocoded population surveillance data aggregated for 1600 m road-network buffers centred on cohort participants' residential addresses. Latent growth models estimated the effect of local descriptive norms on dietary behaviours and change in HbA 1c and BMI, accounting for spatial clustering and covariates (individual-level age, sex, smoking status, employment and education, and area-level median household income). Local descriptive overweight/obesity norms were associated with individual-level fruit intake (inversely) and sugary drink consumption (positively), and worsening HbA 1c and BMI. Spatially-specific local norms for insufficient fruit intake were associated with individual-level fruit intake (inversely) and sugary drink consumption (positively) and worsening HbA 1c but not change in BMI. Individual-level fruit and vegetable intakes were not associated with change in HbA 1c or BMI. Sugary drink consumption was also not associated with change in HbA 1c but rather with increasing BMI. Adverse local descriptive norms for overweight
Baldwin, Elizabeth; Plotto, Anne; Manthey, John; McCollum, Greg; Bai, Jinhe; Irey, Mike; Cameron, Randall; Luzio, Gary
2010-01-27
More than 90% of oranges in Florida are processed, and since Huanglongbing (HLB) disease has been rumored to affect fruit flavor, chemical and physical analyses were conducted on fruit and juice from healthy (Las -) and diseased (Las +) trees on three juice processing varieties over two seasons, and in some cases several harvests. Fruit, both asymptomatic and symptomatic for the disease, were used, and fresh squeezed and processed/pasteurized juices were evaluated. Fruit and juice characteristics measured included color, size, solids, acids, sugars, aroma volatiles, ascorbic acid, secondary metabolites, pectin, pectin-demethylating enzymes, and juice cloud. Results showed that asymptomatic fruit from symptomatic trees were similar to healthy fruit for many of the quality factors measured, but that juice from asymptomatic and especially symptomatic fruits were often higher in the bitter compounds limonin and nomilin. However, values were generally below reported taste threshold levels, and only symptomatic fruit seemed likely to cause flavor problems. There was variation due to harvest date, which was often greater than that due to disease. It is likely that the detrimental flavor attributes of symptomatic fruit (which often drop off the tree) will be largely diluted in commercial juice blends that include juice from fruit of several varieties, locations, and seasons.
BTG interacts with retinoblastoma to control cell fate in Dictyostelium.
Conte, Daniele; MacWilliams, Harry K; Ceccarelli, Adriano
2010-03-12
In the genesis of many tissues, a phase of cell proliferation is followed by cell cycle exit and terminal differentiation. The latter two processes overlap: genes involved in the cessation of growth may also be important in triggering differentiation. Though conceptually distinct, they are often causally related and functional interactions between the cell cycle machinery and cell fate control networks are fundamental to coordinate growth and differentiation. A switch from proliferation to differentiation may also be important in the life cycle of single-celled organisms, and genes which arose as regulators of microbial differentiation may be conserved in higher organisms. Studies in microorganisms may thus contribute to understanding the molecular links between cell cycle machinery and the determination of cell fate choice networks. Here we show that in the amoebozoan D. discoideum, an ortholog of the metazoan antiproliferative gene btg controls cell fate, and that this function is dependent on the presence of a second tumor suppressor ortholog, the retinoblastoma-like gene product. Specifically, we find that btg-overexpressing cells preferentially adopt a stalk cell (and, more particularly, an Anterior-Like Cell) fate. No btg-dependent preference for ALC fate is observed in cells in which the retinoblastoma-like gene has been genetically inactivated. Dictyostelium btg is the only example of non-metazoan member of the BTG family characterized so far, suggesting that a genetic interaction between btg and Rb predated the divergence between dictyostelids and metazoa. While the requirement for retinoblastoma function for BTG antiproliferative activity in metazoans is known, an interaction of these genes in the control of cell fate has not been previously documented. Involvement of a single pathway in the control of mutually exclusive processes may have relevant implication in the evolution of multicellularity.
Relationship between body satisfaction with self esteemand unhealthy body weight management
Daniali, Shahrbanoo; Azadbakht, Leila; Mostafavi, Firoozeh
2013-01-01
.22, P < 0.001), income (r = 0.14, P < 0.004), consumption of fruit (r = 0.13, P < 0.008) all correlated with self-esteem significantly. Women with higher self esteem used higher fruits had a good nutrition overall (r = 0.11, P = 0.02). 92.15%, 10.8% of women respectively participated in one of healthy and unhealthy weight control behavior. There was not any Relationship between self esteem and healthy weight control behavior while finding showed reverse relationship between self esteem and Unhealthy Dieting Behaviors. Conclusion: It seemed women identity in our society tied to social appreciations that formed and supported by body satisfaction. When they feel their current appearance is differ from ideal appearance, they feel down and have lower self esteem and used unhealthy dieting behavior and low fruits daily. Due to importance of precise self evaluation, self esteem can be used to design and conduct public health programs, especially for women. PMID:24083279
The GATA transcription factor gene gtaG is required for terminal differentiation in Dictyostelium
2016-01-01
ABSTRACT The GATA transcription factor GtaG is conserved in Dictyostelids and is essential for terminal differentiation in Dictyostelium discoideum, but its function is not well understood. Here, we show that gtaG is expressed in prestalk cells at the anterior region of fingers and in the extending stalk during culmination. The gtaG− phenotype is cell-autonomous in prestalk cells and non-cell-autonomous in prespore cells. Transcriptome analyses reveal that GtaG regulates prestalk gene expression during cell differentiation before culmination and is required for progression into culmination. GtaG-dependent genes include genetic suppressors of the Dd-STATa-defective phenotype (Dd-STATa is also known as DstA) as well as Dd-STATa target-genes, including extracellular matrix genes. We show that GtaG might be involved in the production of two culmination-signaling molecules, cyclic di-GMP (c-di-GMP) and the spore differentiation factor SDF-1, and that addition of c-di-GMP rescues the gtaG− culmination and spore formation deficiencies. We propose that GtaG is a regulator of terminal differentiation that functions in concert with Dd-STATa and controls culmination through regulating c-di-GMP and SDF-1 production in prestalk cells. PMID:26962009
Saba, Martyna; Falandysz, Jerzy; Nnorom, Innocent C
2016-02-01
Presented in this paper is result of the study of the bioconcentration potential of mercury (Hg) by Suillus luteus mushroom collected from regions within Central, Eastern, and Northern regions of Europe. As determined by cold-vapor atomic absorption spectroscopy, the Hg content varied from 0.13 ± 0.05 to 0.33 ± 0.13 mg kg(-1) dry matter for caps and from 0.038 ± 0.014 to 0.095 ± 0.038 mg kg(-1) dry matter in stems. The Hg content of the soil substratum (0-10 cm layer) underneath the fruiting bodies showed generally low Hg concentrations that varied widely ranging from 0.0030 to 0.15 mg kg(-1) dry matter with mean values varying from 0.0078 ± 0.0035 to 0.053 ± 0.025 mg kg(-1) dry matter, which is below typical content in the Earth crust. The caps were observed to be on the richer in Hg than the stems at ratio between 1.8 ± 0.4 and 5.3 ± 2.6. The S. luteus mushroom showed moderate ability to accumulate Hg with bioconcentration factor (BCF) values ranging from 3.6 ± 1.3 to 42 ± 18. The consumption of fresh S. luteus mushroom in quantities up to 300 g week(-1) (assuming no Hg ingestion from other foods) from background areas in the Central, Eastern, and Northern part of Europe will not result in the intake of Hg exceeds the provisional weekly tolerance limit (PTWI) of 0.004 mg kg(-1) body mass.
Zhang, Dongmei; van der Wel, Hanke; Johnson, Jennifer M; West, Christopher M
2012-01-13
Cytoplasmic prolyl 4-hydroxylases (PHDs) have a primary role in O(2) sensing in animals via modification of the transcriptional factor subunit HIFα, resulting in its polyubiquitination by the E3(VHL)ubiquitin (Ub) ligase and degradation in the 26 S proteasome. Previously thought to be restricted to animals, a homolog (P4H1) of HIFα-type PHDs is expressed in the social amoeba Dictyostelium where it also exhibits characteristics of an O(2) sensor for development. Dictyostelium lacks HIFα, and P4H1 modifies a different protein, Skp1, an adaptor of the SCF class of E3-Ub ligases related to the E3(VHL)Ub ligase that targets animal HIFα. Normally, the HO-Skp1 product of the P4H1 reaction is capped by a GlcNAc sugar that can be subsequently extended to a pentasaccharide by novel glycosyltransferases. To analyze the role of glycosylation, the Skp1 GlcNAc-transferase locus gnt1 was modified with a missense mutation to block catalysis or a stop codon to truncate the protein. Despite the accumulation of the hydroxylated form of Skp1, Skp1 was not destabilized based on metabolic labeling. However, hydroxylation alone allowed for partial correction of the high O(2) requirement of P4H1-null cells, therefore revealing both glycosylation-independent and glycosylation-dependent roles for hydroxylation. Genetic complementation of the latter function required an enzymatically active form of Gnt1. Because the effect of the gnt1 deficiency depended on P4H1, and Skp1 was the only protein labeled when the GlcNAc-transferase was restored to mutant extracts, Skp1 apparently mediates the cellular functions of both P4H1 and Gnt1. Although Skp1 stability itself is not affected by hydroxylation, its modification may affect the stability of targets of Skp1-dependent Ub ligases.
Wang, Weiye; Chen, Song; Das, Satarupa; Losert, Wolfgang; Parent, Carole A
2018-05-04
Dictyostelium discoideum cells transport adenylyl cyclase A (ACA)-containing vesicles to the back of polarized cells to relay exogenous cAMP signals during chemotaxis. Fluorescence in situ hybridization (FISH) experiments showed that ACA mRNA is also asymmetrically distributed at the back of polarized cells. By using the MS2 bacteriophage system, we now visualize the distribution of ACA mRNA in live chemotaxing cells. We found that the ACA mRNA localization is not dependent on the translation of the protein product and requires multiple cis-acting elements within the ACA-coding sequence. We show that ACA mRNA is associated with actively translating ribosomes and is transported along microtubules towards the back of cells. By monitoring the recovery of ACA-YFP after photobleaching, we observed that local translation of ACA-YFP occurs at the back of cells. These data represent a novel functional role for localized translation in the relay of chemotactic signals during chemotaxis. © 2018. Published by The Company of Biologists Ltd.
Fruits and vegetables intake and characteristics associated among adolescents from Southern Brazil
2012-01-01
Background Increased body weight has been associated with an unhealthy diet, low consumption of fruits and vegetables. Our objective was to investigate whether adolescents had low intake of fruits and vegetables, and whether gender, age and education could affect the feeding patterns. Methods A population-based sample of adolescents, aged 12–19 years, were randomly selected in southern Brazil and included in this cross-sectional study. The total daily consumption of fruits, vegetables, rice and beans were investigated in standardized household interviews, using a food frequency questionnaire and questions, being categorized as five or more servings per day as the five-a-day diet. ANOVA, ANCOVA, and modified Poisson regression were used in the analysis. Results Adolescents (n = 568) were included, 49.5% boys, 14.3% had overweight and 8.8% obesity. Approximately 23% of participants consumed five daily servings of fruits and vegetables. It was observed that 36.7% of boys and 31.0% of girls consumed less than one serving of fruit per day, and 58.4% and 44.6%, respectively, consumed less than one serving of vegetables. The consumption of vegetables, fruits, and rice and beans were not independently associated with gender. Overweight was associated with higher intake of five-a-day, independently of confounding factors. Conclusions Adolescents from southern Brazil have lower frequency of consumption of five servings a day of fruits and vegetables combined. PMID:23158078
Predicting fruit fly's sensing rate with insect flight simulations.
Chang, Song; Wang, Z Jane
2014-08-05
Without sensory feedback, flies cannot fly. Exactly how various feedback controls work in insects is a complex puzzle to solve. What do insects measure to stabilize their flight? How often and how fast must insects adjust their wings to remain stable? To gain insights into algorithms used by insects to control their dynamic instability, we develop a simulation tool to study free flight. To stabilize flight, we construct a control algorithm that modulates wing motion based on discrete measurements of the body-pitch orientation. Our simulations give theoretical bounds on both the sensing rate and the delay time between sensing and actuation. Interpreting our findings together with experimental results on fruit flies' reaction time and sensory motor reflexes, we conjecture that fruit flies sense their kinematic states every wing beat to stabilize their flight. We further propose a candidate for such a control involving the fly's haltere and first basalar motor neuron. Although we focus on fruit flies as a case study, the framework for our simulation and discrete control algorithms is applicable to studies of both natural and man-made fliers.
Impact of Fruit Smoothies on Adolescent Fruit Consumption at School
ERIC Educational Resources Information Center
Bates, Dylan; Price, Joseph
2015-01-01
We examine the impact of serving fruit smoothies during school breakfast on fruit consumption among middle school and high school students. We draw on observational plate-waste data over a 10-week period during which fruit smoothies were introduced for breakfast at two Utah schools. Our total sample includes 2,760 student-day observations. We find…
Saga, Yukika; Inamura, Tomoka; Shimada, Nao; Kawata, Takefumi
2016-05-01
STATa, a Dictyostelium homologue of metazoan signal transducer and activator of transcription, is important for the organizer function in the tip region of the migrating Dictyostelium slug. We previously showed that ecmF gene expression depends on STATa in prestalk A (pstA) cells, where STATa is activated. Deletion and site-directed mutagenesis analysis of the ecmF/lacZ fusion gene in wild-type and STATa null strains identified an imperfect inverted repeat sequence, ACAAATANTATTTGT, as a STATa-responsive element. An upstream sequence element was required for efficient expression in the rear region of pstA zone; an element downstream of the inverted repeat was necessary for sufficient prestalk expression during culmination. Band shift analyses using purified STATa protein detected no sequence-specific binding to those ecmF elements. The only verified upregulated target gene of STATa is cudA gene; CudA directly activates expL7 gene expression in prestalk cells. However, ecmF gene expression was almost unaffected in a cudA null mutant. Several previously reported putative STATa target genes were also expressed in cudA null mutant but were downregulated in STATa null mutant. Moreover, mybC, which encodes another transcription factor, belonged to this category, and ecmF expression was downregulated in a mybC null mutant. These findings demonstrate the existence of a genetic hierarchy for pstA-specific genes, which can be classified into two distinct STATa downstream pathways, CudA dependent and independent. The ecmF expression is indirectly upregulated by STATa in a CudA-independent activation manner but dependent on MybC, whose expression is positively regulated by STATa. © 2016 Japanese Society of Developmental Biologists.
Fruit development and ripening.
Seymour, Graham B; Østergaard, Lars; Chapman, Natalie H; Knapp, Sandra; Martin, Cathie
2013-01-01
Fruiting structures in the angiosperms range from completely dry to highly fleshy organs and provide many of our major crop products, including grains. In the model plant Arabidopsis, which has dry fruits, a high-level regulatory network of transcription factors controlling fruit development has been revealed. Studies on rare nonripening mutations in tomato, a model for fleshy fruits, have provided new insights into the networks responsible for the control of ripening. It is apparent that there are strong similarities between dry and fleshy fruits in the molecular circuits governing development and maturation. Translation of information from tomato to other fleshy-fruited species indicates that regulatory networks are conserved across a wide spectrum of angiosperm fruit morphologies. Fruits are an essential part of the human diet, and recent developments in the sequencing of angiosperm genomes have provided the foundation for a step change in crop improvement through the understanding and harnessing of genome-wide genetic and epigenetic variation.
Sivankalyani, Velu; Feygenberg, Oleg; Maorer, Dalia; Zaaroor, Merav; Fallik, Elazar; Alkan, Noam
2015-01-01
Quarantine treatment enables export of avocado fruit (Persea americana) to parts of the world that enforce quarantine against fruit fly. The recommended cold-based quarantine treatment (storage at 1.1°C for 14 days) was studied with two commercial avocado cultivars 'Hass' and 'Ettinger' for 2 years. Chilling injuries (CIs) are prevalent in the avocado fruit after cold-quarantine treatment. Hence, we examined the effect of integrating several treatments: modified atmosphere (MA; fruit covered with perforated polyethylene bags), methyl jasmonate (MJ; fruit dipped in 2.5 μM MJ for Hass or 10 μM MJ for Ettinger for 30 s), 1-methylcyclopropene (1-MCP; fruit treated with 300 ppb 1-MCP for 18 h) and low-temperature conditioning (LTC; a gradual decrease in temperature over 3 days) on CI reduction during cold quarantine. Avocado fruit stored at 1°C suffered from severe CI, lipid peroxidation, and increased expression of chilling-responsive genes of fruit peel. The combined therapeutic treatments alleviated CI in cold-quarantined fruit to the level in fruit stored at commercial temperature (5°C). A successful therapeutic treatment was developed to protect 'Hass' and 'Ettinger' avocado fruit during cold quarantine against fruit fly, while maintaining fruit quality. Subsequently, treated fruit stored at 1°C had a longer shelf life and less decay than the fruit stored at 5°C. This therapeutic treatment could potentially enable the export of avocado fruit to all quarantine-enforcing countries. Similar methods might be applicable to other types of fruit that require cold quarantine.
Maorer, Dalia; Zaaroor, Merav; Fallik, Elazar; Alkan, Noam
2015-01-01
Quarantine treatment enables export of avocado fruit (Persea americana) to parts of the world that enforce quarantine against fruit fly. The recommended cold-based quarantine treatment (storage at 1.1°C for 14 days) was studied with two commercial avocado cultivars ‘Hass’ and ‘Ettinger’ for 2 years. Chilling injuries (CIs) are prevalent in the avocado fruit after cold-quarantine treatment. Hence, we examined the effect of integrating several treatments: modified atmosphere (MA; fruit covered with perforated polyethylene bags), methyl jasmonate (MJ; fruit dipped in 2.5 μM MJ for Hass or 10 μM MJ for Ettinger for 30 s), 1-methylcyclopropene (1-MCP; fruit treated with 300 ppb 1-MCP for 18 h) and low-temperature conditioning (LTC; a gradual decrease in temperature over 3 days) on CI reduction during cold quarantine. Avocado fruit stored at 1°C suffered from severe CI, lipid peroxidation, and increased expression of chilling-responsive genes of fruit peel. The combined therapeutic treatments alleviated CI in cold-quarantined fruit to the level in fruit stored at commercial temperature (5°C). A successful therapeutic treatment was developed to protect ‘Hass’ and ‘Ettinger’ avocado fruit during cold quarantine against fruit fly, while maintaining fruit quality. Subsequently, treated fruit stored at 1°C had a longer shelf life and less decay than the fruit stored at 5°C. This therapeutic treatment could potentially enable the export of avocado fruit to all quarantine-enforcing countries. Similar methods might be applicable to other types of fruit that require cold quarantine. PMID:26501421
Schafer, Christopher M; Sheikh, M Osman; Zhang, Dongmei; West, Christopher M
2014-03-28
The role of Skp1 as an adaptor protein that links Cullin-1 to F-box proteins in E3 Skp1/Cullin-1/F-box protein (SCF) ubiquitin ligases is well characterized. In the social amoeba Dictyostelium and probably many other unicellular eukaryotes, Skp1 is modified by a pentasaccharide attached to a hydroxyproline near its C terminus. This modification is important for oxygen-sensing during Dictyostelium development and is mediated by a HIF-α type prolyl 4-hydroxylase and five sequentially acting cytoplasmic glycosyltransferase activities. Gene disruption studies show that AgtA, the enzyme responsible for addition of the final two galactose residues, in α-linkages to the Skp1 core trisaccharide, is unexpectedly critical for oxygen-dependent terminal development. AgtA possesses a WD40 repeat domain C-terminal to its single catalytic domain and, by use of domain deletions, binding studies, and enzyme assays, we find that the WD40 repeats confer a salt-sensitive second-site binding interaction with Skp1 that mediates novel catalytic activation in addition to simple substrate recognition. In addition, AgtA binds similarly well to precursor isoforms of Skp1 by a salt-sensitive mechanism that competes with binding to an F-box protein and recognition by early modification enzymes, and the effect of binding is diminished when AgtA modifies Skp1. Genetic studies show that loss of AgtA is more severe when an earlier glycosylation step is blocked, and overexpressed AgtA is deleterious if catalytically inactivated. Together, the findings suggest that AgtA mediates non-enzymatic control of unmodified and substrate precursor forms of Skp1 by a binding mechanism that is normally relieved by switch-like activation of its glycosylation function.
Schafer, Christopher M.; Sheikh, M. Osman; Zhang, Dongmei; West, Christopher M.
2014-01-01
The role of Skp1 as an adaptor protein that links Cullin-1 to F-box proteins in E3 Skp1/Cullin-1/F-box protein (SCF) ubiquitin ligases is well characterized. In the social amoeba Dictyostelium and probably many other unicellular eukaryotes, Skp1 is modified by a pentasaccharide attached to a hydroxyproline near its C terminus. This modification is important for oxygen-sensing during Dictyostelium development and is mediated by a HIF-α type prolyl 4-hydroxylase and five sequentially acting cytoplasmic glycosyltransferase activities. Gene disruption studies show that AgtA, the enzyme responsible for addition of the final two galactose residues, in α-linkages to the Skp1 core trisaccharide, is unexpectedly critical for oxygen-dependent terminal development. AgtA possesses a WD40 repeat domain C-terminal to its single catalytic domain and, by use of domain deletions, binding studies, and enzyme assays, we find that the WD40 repeats confer a salt-sensitive second-site binding interaction with Skp1 that mediates novel catalytic activation in addition to simple substrate recognition. In addition, AgtA binds similarly well to precursor isoforms of Skp1 by a salt-sensitive mechanism that competes with binding to an F-box protein and recognition by early modification enzymes, and the effect of binding is diminished when AgtA modifies Skp1. Genetic studies show that loss of AgtA is more severe when an earlier glycosylation step is blocked, and overexpressed AgtA is deleterious if catalytically inactivated. Together, the findings suggest that AgtA mediates non-enzymatic control of unmodified and substrate precursor forms of Skp1 by a binding mechanism that is normally relieved by switch-like activation of its glycosylation function. PMID:24550398
Correlated waves of actin filaments and PIP3 in Dictyostelium cells.
Asano, Yukako; Nagasaki, Akira; Uyeda, Taro Q P
2008-12-01
Chemotaxis-deficient amiB-null mutant Dictyostelium cells show two distinct movements: (1) they extend protrusions randomly without net displacements; (2) they migrate persistently and unidirectionally in a keratocyte-like manner. Here, we monitored the intracellular distribution of phosphatidylinositol (3,4,5)-trisphosphate (PIP(3)) to gain insight into roles PIP(3) plays in those spontaneous motilities. In keratocyte-like cells, PIP(3) showed convex distribution over the basal membrane, with no anterior enrichment. In stalled cells, as well as in wild type cells, PIP(3) repeated wave-like changes, including emergence, expansion and disappearance, on the basal membrane. The waves induced lamellipodia when they approached the cell edge, and the advancing speed of the waves was comparable to the migration speed of the keratocyte-like cells. LY294002, an inhibitor of PI3 kinase, abolished PIP(3) waves in stalled cells and stopped keratocyte-like cells. These results together suggested that keratocyte-like cells are "surfing" on the PIP(3) waves by coupling steady lamellipodial protrusions to the PIP(3) waves. Simultaneous live observation of actin filaments and PIP(3) in wild type or stalled amiB(-) cells indicated that the PIP(3) waves were correlated with wave-like distributions of actin filaments. Most notably, PIP(3) waves often followed actin waves, suggesting that PIP(3) induces local depolymerization of actin filaments. Consistent with this idea, cortical accumulation of PIP(3) was often correlated with local retraction of the periphery. We propose that the waves of PIP(3) and actin filaments are loosely coupled with each other and play important roles in generating spontaneous cell polarity. Copyright 2008 Wiley-Liss, Inc.
Mitochondrial tRNA 5'-editing in Dictyostelium discoideum and Polysphondylium pallidum.
Abad, Maria G; Long, Yicheng; Kinchen, R Dimitri; Schindel, Elinor T; Gray, Michael W; Jackman, Jane E
2014-05-30
Mitochondrial tRNA (mt-tRNA) 5'-editing was first described more than 20 years ago; however, the first candidates for 5'-editing enzymes were only recently identified in a eukaryotic microbe (protist), the slime mold Dictyostelium discoideum. In this organism, eight of 18 mt-tRNAs are predicted to be edited based on the presence of genomically encoded mismatched nucleotides in their aminoacyl-acceptor stem sequences. Here, we demonstrate that mt-tRNA 5'-editing occurs at all predicted sites in D. discoideum as evidenced by changes in the sequences of isolated mt-tRNAs compared with the expected sequences encoded by the mitochondrial genome. We also identify two previously unpredicted editing events in which G-U base pairs are edited in the absence of any other genomically encoded mismatches. A comparison of 5'-editing in D. discoideum with 5'-editing in another slime mold, Polysphondylium pallidum, suggests organism-specific idiosyncrasies in the treatment of U-G/G-U pairs. In vitro activities of putative D. discoideum editing enzymes are consistent with the observed editing reactions and suggest an overall lack of tRNA substrate specificity exhibited by the repair component of the editing enzyme. Although the presence of terminal mismatches in mt-tRNA sequences is highly predictive of the occurrence of mt-tRNA 5'-editing, the variability in treatment of U-G/G-U base pairs observed here indicates that direct experimental evidence of 5'-editing must be obtained to understand the complete spectrum of mt-tRNA editing events in any species. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Gautier, Hélène; Massot, Capucine; Stevens, Rebecca; Sérino, Sylvie; Génard, Michel
2009-02-01
The mechanisms involving light control of vitamin C content in fruits are not yet fully understood. The present study aimed to evaluate the impact of fruit and leaf shading on ascorbate (AsA) accumulation in tomato fruit and to determine how fruit sugar content (as an AsA precursor) affected AsA content. Cherry tomato plants were grown in a glasshouse. The control treatment (normally irradiated fruits and irradiated leaves) was compared with the whole-plant shading treatment and with leaf or fruit shading treatments in fruits harvested at breaker stage. In a second experiment, the correlation between sugars and AsA was studied during ripening. Fruit shading was the most effective treatment in reducing fruit AsA content. Under normal conditions, AsA and sugar content were correlated and increased with the ripening stage. Reducing fruit irradiance strongly decreased the reduced AsA content (-74 %), without affecting sugars, so that sugar and reduced AsA were no longer correlated. Leaf shading delayed fruit ripening: it increased the accumulation of oxidized AsA in green fruits (+98 %), whereas it decreased the reduced AsA content in orange fruits (-19 %), suggesting that fruit AsA metabolism also depends on leaf irradiance. Under fruit shading only, the absence of a correlation between sugars and reduced AsA content indicated that fruit AsA content was not limited by leaf photosynthesis or sugar substrate, but strongly depended on fruit irradiance. Leaf shading most probably affected fruit AsA content by delaying fruit ripening, and suggested a complex regulation of AsA metabolism which depends on both fruit and leaf irradiance and fruit ripening stage.
The real factor for polypeptide elongation in Dictyostelium cells is EF-2B, not EF-2A
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshino, Tomoko; Maeda, Yasuo; Amagai, Aiko
2007-08-03
Polypeptide elongation factor 2 (EF-2) plays an essential role in protein synthesis and is believed to be indispensable for cell proliferation. Recently, it has been demonstrated that there are two kinds of EF-2 (EF-2A and EF-2B with 76.6% of sequence identity at the amino acid level) in Dictyostelium discoideum. Although the knockout of EF-2A slightly impaired cytokinesis, EF-2A null cells exhibited almost normal protein synthesis and cell growth, suggesting that there is another molecule capable of compensating for EF-2 function. Since EF-2B is the most likely candidate, we examined its function using ef-2b knockdown cells prepared by the RNAi method.more » Our results strongly suggest that EF-2B is required for protein synthesis and cell proliferation, functioning as the real EF-2. Interestingly, the expressions of ef-2a and ef-2b mRNAs during development are reversely regulated, and the ef-2b expression is greatly augmented in ef-2a null cells.« less
Linking Fruit Ca Uptake Capacity to Fruit Growth and Pedicel Anatomy, a Cross-Species Study
Song, Wenpei; Yi, Junwen; Kurniadinata, Odit F.; Wang, Huicong; Huang, Xuming
2018-01-01
Calcium (Ca) in flesh fruits is important for quality formation and maintenance. Most studies on fruit Ca focus on one species. This study attempted to understand some universal relations to fruit Ca uptake across species. Calcium contents in fruit tissues were analyzed in different fruits, including three cultivars of litchi, two cultivars each of grape and citrus, and one cultivar each of loquat, apple, pear, Indian jujube, and longan. In situ Ca distribution was revealed with electron probe and xylem functionality visualized by dye tracing. Fruit Ca uptake rate and activity were calculated and correlated with fruit growth and pedicel anatomy. The results showed that fruit Ca uptake rate was the highest in pomes (loquat, apple, and pear), followed by Indian jujube drupe, arillate fruits (litchis and longan) and citrus, while grape berries were the lowest. Fruit Ca uptake rate showed a strong positive correlation to growth rate. However, Ca uptake activity, reflecting Ca uptake rate relative to growth, was the highest in arillate fruits and loquat and lowest in grape berries, and had a poor correlation with fruit growth rate. In all fruits, Ca concentration in the pedicel was higher than in the fruit, and they displayed a good positive correlation. In the pedicel, Ca was most abundant in the phloem. Dye tracing showed that xylem function loss occurred with maturation in all species/varieties. Apple had the poorest xylem functionality with the least development of secondary xylem, but its Ca uptake rate was among the highest. Vessel density, size and area in the pedicel showed no correlation with fruit Ca uptake rate. It is concluded that: (1) fruit growth may be a key determinant of Ca uptake; (2) the universal pattern of Ca being higher in the pedicel than in the fruit indicates existence of a pedicel-fruit “bottleneck” effect in Ca transport across species; (3) xylem functionality loss with fruit maturation is also a universal event; (4) in the pedicel, Ca
DeepFruits: A Fruit Detection System Using Deep Neural Networks.
Sa, Inkyu; Ge, Zongyuan; Dayoub, Feras; Upcroft, Ben; Perez, Tristan; McCool, Chris
2016-08-03
This paper presents a novel approach to fruit detection using deep convolutional neural networks. The aim is to build an accurate, fast and reliable fruit detection system, which is a vital element of an autonomous agricultural robotic platform; it is a key element for fruit yield estimation and automated harvesting. Recent work in deep neural networks has led to the development of a state-of-the-art object detector termed Faster Region-based CNN (Faster R-CNN). We adapt this model, through transfer learning, for the task of fruit detection using imagery obtained from two modalities: colour (RGB) and Near-Infrared (NIR). Early and late fusion methods are explored for combining the multi-modal (RGB and NIR) information. This leads to a novel multi-modal Faster R-CNN model, which achieves state-of-the-art results compared to prior work with the F1 score, which takes into account both precision and recall performances improving from 0 . 807 to 0 . 838 for the detection of sweet pepper. In addition to improved accuracy, this approach is also much quicker to deploy for new fruits, as it requires bounding box annotation rather than pixel-level annotation (annotating bounding boxes is approximately an order of magnitude quicker to perform). The model is retrained to perform the detection of seven fruits, with the entire process taking four hours to annotate and train the new model per fruit.
DeepFruits: A Fruit Detection System Using Deep Neural Networks
Sa, Inkyu; Ge, Zongyuan; Dayoub, Feras; Upcroft, Ben; Perez, Tristan; McCool, Chris
2016-01-01
This paper presents a novel approach to fruit detection using deep convolutional neural networks. The aim is to build an accurate, fast and reliable fruit detection system, which is a vital element of an autonomous agricultural robotic platform; it is a key element for fruit yield estimation and automated harvesting. Recent work in deep neural networks has led to the development of a state-of-the-art object detector termed Faster Region-based CNN (Faster R-CNN). We adapt this model, through transfer learning, for the task of fruit detection using imagery obtained from two modalities: colour (RGB) and Near-Infrared (NIR). Early and late fusion methods are explored for combining the multi-modal (RGB and NIR) information. This leads to a novel multi-modal Faster R-CNN model, which achieves state-of-the-art results compared to prior work with the F1 score, which takes into account both precision and recall performances improving from 0.807 to 0.838 for the detection of sweet pepper. In addition to improved accuracy, this approach is also much quicker to deploy for new fruits, as it requires bounding box annotation rather than pixel-level annotation (annotating bounding boxes is approximately an order of magnitude quicker to perform). The model is retrained to perform the detection of seven fruits, with the entire process taking four hours to annotate and train the new model per fruit. PMID:27527168
The Role of Social Support and Self-efficacy for Planning Fruit and Vegetable Intake.
Zhou, Guangyu; Gan, Yiqun; Hamilton, Kyra; Schwarzer, Ralf
2017-02-01
The aim of the current study was to examine the joint effect of self-efficacy, action planning, and received social support on fruit and vegetable intake. The study used a longitudinal design with 3 waves of data collection. Major university campus in Beijing, China. Young adults (n = 286). Age, gender, body mass index, dietary self-efficacy, and baseline behavior were measured at time 1. Two weeks after time 1, received social support and action planning were assessed (time 2); 4 weeks after time 1, subsequent fruit and vegetable consumption was measured (time 3). In a path analysis, action planning at time 2 was specified as a mediator between self-efficacy at time 1 and fruit and vegetable intake at time 3, controlling for age, gender, body mass index, and baseline behavior. In addition, in a conditional process analysis, received social support at time 2 was specified as a moderator of the self-efficacy-planning relationship. Action planning mediated between self-efficacy and subsequent dietary behavior, and received social support moderated between self-efficacy and planning supporting a compensation effect. Action planning served as a proximal predictor of fruit and vegetable intake, and planning one's consumption was facilitated by dietary self-efficacy. Through the identification of social cognitive factors influencing dietary planning, interventions can target self-efficacy and received social support to test the efficacy of these mechanisms in increasing individuals' ability to ensure they consume adequate amounts of fruits and vegetables. Copyright © 2016 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.
Biochemical characterization of a lipase from olive fruit (Olea europaea L.).
Panzanaro, S; Nutricati, E; Miceli, A; De Bellis, L
2010-09-01
Lipase (triacylglycerol acylhydrolase; EC 3.1.1.3) is the first enzyme of the degradation path of stored triacylglycerols (TAGs). In olive fruits, lipase may determine the increase of free fatty acids (FFAs) which level is an important index of virgin olive oil quality. However, despite the importance of virgin olive oil for nutrition and human health, few studies have been realized on lipase activity in Olea europaea fruits. In order to characterize olive lipase, fruits of the cv. Ogliarola, widely diffused in Salento area (Puglia, Italy), were harvested at four stages of ripening according to their skin colour (green, spotted I, spotted II, purple). Lipase activity was detected in the fatty layer obtained after centrifugation of the olive mesocarp homogenate. The enzyme exhibited a maximum activity at pH 5.0. The addition of calcium in the lipase assay medium leads to an increment of activity, whereas in the presence of copper the activity was reduced by 75%. Furthermore, mesocarp lipase activity increases during olive development but declined at maturity (purple stage). The data represent the first contribution to the biochemical characterization of an olive fruit lipase associated to oil bodies. 2010 Elsevier Masson SAS. All rights reserved.
Gautier, Hélène; Massot, Capucine; Stevens, Rebecca; Sérino, Sylvie; Génard, Michel
2009-01-01
Background and Aims The mechanisms involving light control of vitamin C content in fruits are not yet fully understood. The present study aimed to evaluate the impact of fruit and leaf shading on ascorbate (AsA) accumulation in tomato fruit and to determine how fruit sugar content (as an AsA precursor) affected AsA content. Methods Cherry tomato plants were grown in a glasshouse. The control treatment (normally irradiated fruits and irradiated leaves) was compared with the whole-plant shading treatment and with leaf or fruit shading treatments in fruits harvested at breaker stage. In a second experiment, the correlation between sugars and AsA was studied during ripening. Key Results Fruit shading was the most effective treatment in reducing fruit AsA content. Under normal conditions, AsA and sugar content were correlated and increased with the ripening stage. Reducing fruit irradiance strongly decreased the reduced AsA content (−74 %), without affecting sugars, so that sugar and reduced AsA were no longer correlated. Leaf shading delayed fruit ripening: it increased the accumulation of oxidized AsA in green fruits (+98 %), whereas it decreased the reduced AsA content in orange fruits (−19 %), suggesting that fruit AsA metabolism also depends on leaf irradiance. Conclusions Under fruit shading only, the absence of a correlation between sugars and reduced AsA content indicated that fruit AsA content was not limited by leaf photosynthesis or sugar substrate, but strongly depended on fruit irradiance. Leaf shading most probably affected fruit AsA content by delaying fruit ripening, and suggested a complex regulation of AsA metabolism which depends on both fruit and leaf irradiance and fruit ripening stage. PMID:19033285
Interactions between terrestrial mammals and the fruits of two neotropical rainforest tree species
NASA Astrophysics Data System (ADS)
Camargo-Sanabria, Angela A.; Mendoza, Eduardo
2016-05-01
Mammalian frugivory is a distinctive biotic interaction of tropical forests; however, most efforts in the Neotropics have focused on cases of animals foraging in the forest canopy, in particular primates and bats. In contrast much less is known about this interaction when it involves fruits deposited on the forest floor and terrestrial mammals. We conducted a camera-trapping survey to analyze the characteristics of the mammalian ensembles visiting fruits of Licania platypus and Pouteria sapota deposited on the forest floor in a well preserved tropical rainforest of Mexico. Both tree species produce large fruits but contrast in their population densities and fruit chemical composition. In particular, we expected that more species of terrestrial mammals would consume P. sapota fruits due to its higher pulp:seed ratio, lower availability and greater carbohydrate content. We monitored fruits at the base of 13 trees (P. sapota, n = 4 and L. platypus, n = 9) using camera-traps. We recorded 13 mammal species from which we had evidence of 8 consuming or removing fruits. These eight species accounted for 70% of the species of mammalian frugivores active in the forest floor of our study area. The ensemble of frugivores associated with L. platypus (6 spp.) was a subset of that associated with P. sapota (8 spp). Large body-sized species such as Tapirus bairdii, Pecari tajacu and Cuniculus paca were the mammals more frequently interacting with fruits of the focal species. Our results further our understanding of the characteristics of the interaction between terrestrial mammalian frugivores and large-sized fruits, helping to gain a more balanced view of its importance across different tropical forests and providing a baseline to compare against defaunated forests.
A Novel Method for Tracking Individuals of Fruit Fly Swarms Flying in a Laboratory Flight Arena.
Cheng, Xi En; Qian, Zhi-Ming; Wang, Shuo Hong; Jiang, Nan; Guo, Aike; Chen, Yan Qiu
2015-01-01
The growing interest in studying social behaviours of swarming fruit flies, Drosophila melanogaster, has heightened the need for developing tools that provide quantitative motion data. To achieve such a goal, multi-camera three-dimensional tracking technology is the key experimental gateway. We have developed a novel tracking system for tracking hundreds of fruit flies flying in a confined cubic flight arena. In addition to the proposed tracking algorithm, this work offers additional contributions in three aspects: body detection, orientation estimation, and data validation. To demonstrate the opportunities that the proposed system offers for generating high-throughput quantitative motion data, we conducted experiments on five experimental configurations. We also performed quantitative analysis on the kinematics and the spatial structure and the motion patterns of fruit fly swarms. We found that there exists an asymptotic distance between fruit flies in swarms as the population density increases. Further, we discovered the evidence for repulsive response when the distance between fruit flies approached the asymptotic distance. Overall, the proposed tracking system presents a powerful method for studying flight behaviours of fruit flies in a three-dimensional environment.
Liu, Yanfang; Zhang, Jingsong; Tang, Qingjiu; Yang, Yan; Guo, Qingbin; Wang, Qi; Wu, Di; Cui, Steve W
2014-01-30
A purified polysaccharide coded as GLP20 was obtained by precipitating a hot-water extract from Ganoderma lucidum fruiting bodies with 20% (V/V) ethanol. Its total carbohydrate content was 95.9%. Structural analysis showed that GLP20 was a β-(1→3)-linked d-glucan with a (1→6)-β-d-glucopyranosyl side-branching unit on every third residue. Cell culture study revealed that GLP20 can significantly increase NO production of RAW264.7 macrophages. The analysis of light scattering and high performance size exclusion chromatography (HPSEC) showed that the molecular weight and polydispersity of GLP20 was 3.75 × 10(6)Da and 1.36, respectively. GLP20 had a rigid chain conformation in aqueous solution. A conformation transition occurred in the alkaline solution with NaOH concentration larger than 0.15M. The transition from ordered structure to single chain happened when GLP20 was heated above 135°C in water solution and was irreversible as demonstrated by differential scanning calorimetry (DSC). GLP20 existed as random coils in DMSO. Copyright © 2013 Elsevier Ltd. All rights reserved.
Food prices and body fatness among youths.
Grossman, Michael; Tekin, Erdal; Wada, Roy
2014-01-01
We examine the effect of food prices on clinical measures of obesity, including body mass index (BMI) and percentage body fat (PBF) measures derived from bioelectrical impedance analysis (BIA) and dual energy X-ray absorptiometry (DXA), among youths ages 12 through 18 in the National Health and Nutrition Examination Survey. This is the first study to consider clinically measured levels of body composition rather than BMI to investigate the effects of food prices on obesity outcomes among youths classified by gender and race/ethnicity. Our findings suggest that increases in the real price per calorie of food for home consumption and the real price of fast-food restaurant food lead to improvements in obesity outcomes among youths. We also find that a rise in the real price of fruits and vegetables leads to increased obesity. Finally, our results indicate that measures of PBF derived from BIA and DXA are no less sensitive and in some cases more sensitive to the prices just mentioned than BMI, and serve an important role in demonstrating that rising food prices (except fruit and vegetable prices) are indeed associated with reductions in obesity rather than with reductions in body size proportions alone. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Korine, Carmi; Izhaki, Ido; Arad, Zeev
1998-04-01
This study analyses the fruit syndrome of the Egyptian fruit-bat, Rousettus aegyptiacus, the only fruit-bat found in East Mediterranean habitats. Two different sets of bat-fruit syndromes were revealed. One follows the general bat-fruit syndrome and one represents a special case of bat-dispersed fruit syndrome only found in East Mediterranean habitats. The latter syndrome is characterized by dry fruits with a relatively high protein content. Fruit species that belong to this syndrome are available mostly in winter (when the fruit-bat faces a severe shortage in fruit availability and inadequate fruit quality). The fruit syndromes and dietary overlap between frugivorous birds (based on the literature) and the fruit-bat were also studied. Features associated with each set of fruit species generally follow the known bat and bird syndromes. Bird-dispersed fruits tend to be small, with a high seed mass to pulp mass, variable in fat content and characterized by a high ash content. However, when the shared fruit species were included in the analysis, no significant differences were found in fruit features between the bird-dispersed and bat-dispersed fruit syndromes. A limited and asymmetrical dietary overlap was observed between these two taxa, mainly between introduced and cultivated fruits.
Zaburannyi, Nestor; Bunk, Boyke; Maier, Josef; Overmann, Jörg
2016-01-01
Here, we report the complete genome sequence of the type strain of the myxobacterial genus Chondromyces, Chondromyces crocatus Cm c5. It presents one of the largest prokaryotic genomes featuring a single circular chromosome and no plasmids. Analysis revealed an enlarged set of tRNA genes, along with reduced pressure on preferred codon usage compared to that of other bacterial genomes. The large coding capacity and the plethora of encoded secondary metabolite biosynthetic gene clusters are in line with the capability of Cm c5 to produce an arsenal of antibacterial, antifungal, and cytotoxic compounds. Known pathways of the ajudazol, chondramide, chondrochloren, crocacin, crocapeptin, and thuggacin compound families are complemented by many more natural compound biosynthetic gene clusters in the chromosome. Whole-genome comparison of the fruiting-body-forming type strain (Cm c5, DSM 14714) to an accustomed laboratory strain which has lost this ability (nonfruiting phenotype, Cm c5 fr−) revealed genetic changes in three loci. In addition to the low synteny found with the closest sequenced representative of the same family, Sorangium cellulosum, extensive genetic information duplication and broad application of eukaryotic-type signal transduction systems are hallmarks of this 11.3-Mbp prokaryotic genome. PMID:26773087
Rajagopalu, Devamalini; Show, Pau Loke; Tan, Yee Shin; Muniandy, Sekaran; Sabaratnam, Vikineswary; Ling, Tau Chuan
2016-09-01
The feasible use of aqueous two-phase systems (ATPSs) to establish a viable protocol for the recovery of laccase from processed Hericium erinaceus (Bull.:Fr.) Pers. fruiting bodies was evaluated. Cold-stored (4.00±1.00°C) H. erinaceus recorded the highest laccase activities of 2.02±0.04 U/mL among all the processed techniques. The evaluation was carried out in twenty-five ATPSs, which composed of polyethylene glycol (PEG) with various molecular weights and potassium phosphate salt solution to purify the protein from H. erinaceus. Optimum recovery condition was observed in the ATPS which contained 17% (w/w) PEG with a molecular weight of 8000 and 12.2% (w/w) potassium phosphate solution, at a volume ratio (VR) of 1.0. The use of ATPS resulted in one-single primary recovery stage process that produced an overall yield of 99% with a purification factor of 8.03±0.46. The molecular mass of laccases purified from the bottom phase was in the range of 55-66 kDa. The purity of the partitioned laccase was confirmed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Arjona, Davinia; Aragón, Carlos; Aguilera, José Antonio; Ramírez, Lucía; Pisabarro, Antonio G
2009-05-01
Fruiting is a crucial developmental process in basidiomycetes yet the genetic and molecular factors that control it are not yet fully understood. The search for fruiting inducers is of major relevance for both basic research and for their use in industrial applications. In this paper, an efficient and reproducible protocol for controlled fruiting induction of Pleurotus ostreatus growing on synthetic medium is described. The protocol is based on the control of light intensity and photoperiod and permits the life cycle for this fungus to be completed in less than two weeks. The fruiting bodies produced by this method release fertile spores after 4-5 d of culture. Our results indicate that fruiting induction is solely dependent on the illumination regime and that it occurs long before the available nutrients are depleted in the culture. This protocol will greatly facilitate molecular and developmental biology research in this fungus as it avoids the need for complex culture media based on lignocellulosic materials or the use of chemical inducers.
Biotransformation of Tryptamine in Fruiting Mycelia of Psilocybe cubensis.
Gartz, J
1989-06-01
Mycelial cultures of PSILOCYBE CUBENSIS, with the ability to form psilocybin and psilocin DE-NOVO, also hydroxylated and methylated fed tryptamine to give psilocin in up to 3.3% dry mass of the obtained fruit bodies. By using HPLC and TLC, it was found that these mushrooms contain only a small amount of psilocybin (0.01-0.2% dry mass). The values of psilocin are the highest described in any mushrooms.
Rajemison, Faneva I; Noroalintseheno Lalarivoniaina, Oliva S; Goodman, Steven M
2017-07-01
We examined the possible effects of host body size and throat gland development on the abundance of blood-feeding nycteribiid and streblid flies parasitizing a Malagasy fruit bat, Rousettus madagascariensis G. Grandidier, 1928. Data were collected in the Parc National d'Ankarana in northern Madagascar during four visits: September 2014, 2015 (dry season), and January 2015, 2016 (wet season). Two bat fly species were identified, Eucampsipoda madagascarensis Theodor, 1955 (Nycteribiidae) and Megastrebla wenzeli (Jobling, 1952) (Streblidae). A positive correlation was found between host body size and abundance of E. madagascarensis during the four visits, suggesting that larger hosts have more parasites, and for M. wenzeli, this relationship was identified only during the wet season visits. In male hosts, body size and throat gland development are correlated with variation in E. madagascarensis abundance during the two seasons; this relationship was not found for M. wenzeli. We present some explanations for the observed patterns of bat fly abundance associated with throat gland development: increased vascularization and easier access to bloodmeals, chemical properties of gland secretions acting as attractants or perhaps being consumed, and modification of hair around the gland providing protection from bat grooming. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Kin discrimination increases with genetic distance in a social amoeba.
Ostrowski, Elizabeth A; Katoh, Mariko; Shaulsky, Gad; Queller, David C; Strassmann, Joan E
2008-11-25
In the social amoeba Dictyostelium discoideum, thousands of cells aggregate upon starvation to form a multicellular fruiting body, and approximately 20% of them die to form a stalk that benefits the others. The aggregative nature of multicellular development makes the cells vulnerable to exploitation by cheaters, and the potential for cheating is indeed high. Cells might avoid being victimized if they can discriminate among individuals and avoid those that are genetically different. We tested how widely social amoebae cooperate by mixing isolates from different localities that cover most of their natural range. We show here that different isolates partially exclude one another during aggregation, and there is a positive relationship between the extent of this exclusion and the genetic distance between strains. Our findings demonstrate that D. discoideum cells co-aggregate more with genetically similar than dissimilar individuals, suggesting the existence of a mechanism that discerns the degree of genetic similarity between individuals in this social microorganism.
Drewnowski, Adam; Rehm, Colin D
2015-01-05
The consumption of fruit is generally associated with better health, but also higher socioeconomic status (SES). Most previous studies evaluating consumption of fruits have not separated 100% fruit juice and whole fruit, which may conceal interesting patterns in consumption. To estimate demographic and socioeconomic correlates of whole fruit versus 100% juice consumption among children and adults in the United States. Secondary analyses of two cycles of the nationally representative National Health and Nutrition Examination Survey (NHANES) from 2007-2010, by gender, age group, race/ethnicity and SES among 16,628 children and adults. Total fruit consumption (population average of 1.06 cup equivalents/d) fell far short of national goals. Overall, whole fruit provided about 65% of total fruit, while 100% juice provided the remainder. Whereas 100% juice consumption was highest among children and declined sharply with age, whole fruit consumption was highest among older adults. Total fruit and whole fruit consumption was generally higher among those with higher incomes or more education. By contrast, the highest 100% juice consumption was found among children, racial/ethnic minorities and lower-income groups. Consumption patterns for whole fruit versus 100% fruit juice showed different gradients by race/ethnicity, education, and income. The advice to replace 100% juice with whole fruit may pose a challenge for the economically disadvantaged and some minority groups, whose fruit consumption falls short of national goals.
Andersson, Jan O
2011-04-01
Protein families are often patchily distributed in the tree of life; they are present in distantly related organisms, but absent in more closely related lineages. This could either be the result of lateral gene transfer between ancestors of organisms that encode them, or losses in the lineages that lack them. Here a novel approach is developed to study the evolution of patchily distributed proteins shared between prokaryotes and eukaryotes. Proteins encoded in the genome of cellular slime mold Dictyostelium discoideum and a restricted number of other lineages, including at least one prokaryote, were identified. Analyses of the phylogenetic distribution of 49 such patchily distributed protein families showed conflicts with organismal phylogenies; 25 are shared with the distantly related amoeboflagellate Naegleria (Excavata), whereas only two are present in the more closely related Entamoeba. Most protein families show unexpected topologies in phylogenetic analyses; eukaryotes are polyphyletic in 85% of the trees. These observations suggest that gene transfers have been an important mechanism for the distribution of patchily distributed proteins across all domains of life. Further studies of this exchangeable gene fraction are needed for a better understanding of the origin and evolution of eukaryotic genes and the diversification process of eukaryotes. Copyright © 2011 S. Karger AG, Basel.
Dietary Patterns and Body Mass Index in Children with Autism and Typically Developing Children
ERIC Educational Resources Information Center
Evans, E. Whitney; Must, Aviva; Anderson, Sarah E.; Curtin, Carol; Scampini, Renee; Maslin, Melissa; Bandini, Linda
2012-01-01
To determine whether dietary patterns (juice and sweetened non-dairy beverages, fruits, vegetables, fruits and vegetables, snack foods, and kid's meals) and associations between dietary patterns and body mass index (BMI) differed between 53 children with autism spectrum disorders (ASD) and 58 typically developing children, ages 3-11, multivariate…
Powell, Lisa M; Auld, M Christopher; Chaloupka, Frank J; O'Malley, Patrick M; Johnston, Lloyd D
2007-01-01
We examine the extent to which food prices and restaurant outlet density are associated with adolescent fruit and vegetable consumption, body mass index (BMI), and the probability of overweight. We use repeated cross-sections of individual-level data on adolescents from the Monitoring the Future Surveys from 1997 to 2003 combined with fast food and fruit and vegetable prices obtained from the American Chamber of Commerce Researchers Association and fast food and full-service restaurant outlet density measures obtained from Dun & Bradstreet. The results suggest that the price of a fast food meal is an important determinant of adolescents' body weight and eating habits: a 10% increase in the price of a fast food meal leads to a 3.0% increase in the probability of frequent fruit and vegetable consumption, a 0.4% decrease in BMI, and a 5.9% decrease in probability of overweight. The price of fruits and vegetables and restaurant outlet density are less important determinants, although these variables typically have the expected sign and are often statistically associated with our outcome measures. Despite these findings, changes in all observed economic and socio-demographic characteristics together only explain roughly one-quarter of the change in mean BMI and one-fifth of the change in overweight over the 1997-2003 sampling period.
Cacao seeds are a "Super Fruit": A comparative analysis of various fruit powders and products
2011-01-01
Background Numerous popular media sources have developed lists of "Super Foods" and, more recently, "Super Fruits". Such distinctions often are based on the antioxidant capacity and content of naturally occurring compounds such as polyphenols within those whole fruits or juices of the fruit which may be linked to potential health benefits. Cocoa powder and chocolate are made from an extract of the seeds of the fruit of the Theobroma cacao tree. In this study, we compared cocoa powder and cocoa products to powders and juices derived from fruits commonly considered "Super Fruits". Results Various fruit powders and retail fruit products were obtained and analyzed for antioxidant capacity (ORAC (μM TE/g)), total polyphenol content (TP (mg/g)), and total flavanol content (TF (mg/g)). Among the various powders that were tested, cocoa powder was the most concentrated source of ORAC and TF. Similarly, dark chocolate was a significantly more concentrated source of ORAC and TF than the fruit juices. Conclusions Cocoa powder and dark chocolate had equivalent or significantly greater ORAC, TP, and TF values compared to the other fruit powders and juices tested, respectively. Cacao seeds thus provide nutritive value beyond that derived from their macronutrient composition and appear to meet the popular media's definition of a "Super Fruit". PMID:21299842
Cacao seeds are a "Super Fruit": A comparative analysis of various fruit powders and products.
Crozier, Stephen J; Preston, Amy G; Hurst, Jeffrey W; Payne, Mark J; Mann, Julie; Hainly, Larry; Miller, Debra L
2011-02-07
Numerous popular media sources have developed lists of "Super Foods" and, more recently, "Super Fruits". Such distinctions often are based on the antioxidant capacity and content of naturally occurring compounds such as polyphenols within those whole fruits or juices of the fruit which may be linked to potential health benefits. Cocoa powder and chocolate are made from an extract of the seeds of the fruit of the Theobroma cacao tree. In this study, we compared cocoa powder and cocoa products to powders and juices derived from fruits commonly considered "Super Fruits". Various fruit powders and retail fruit products were obtained and analyzed for antioxidant capacity (ORAC (μM TE/g)), total polyphenol content (TP (mg/g)), and total flavanol content (TF (mg/g)). Among the various powders that were tested, cocoa powder was the most concentrated source of ORAC and TF. Similarly, dark chocolate was a significantly more concentrated source of ORAC and TF than the fruit juices. Cocoa powder and dark chocolate had equivalent or significantly greater ORAC, TP, and TF values compared to the other fruit powders and juices tested, respectively. Cacao seeds thus provide nutritive value beyond that derived from their macronutrient composition and appear to meet the popular media's definition of a "Super Fruit".
D-Serine Metabolism and Its Importance in Development of Dictyostelium discoideum
Ito, Tomokazu; Hamauchi, Natsuki; Hagi, Taisuke; Morohashi, Naoya; Hemmi, Hisashi; Sato, Yukie G.; Saito, Tamao; Yoshimura, Tohru
2018-01-01
In mammals, D-Ser is synthesized by serine racemase (SR) and degraded by D-amino acid oxidase (DAO). D-Ser acts as an endogenous ligand for N-methyl-D-aspartate (NMDA)- and δ2 glutamate receptors, and is involved in brain functions such as learning and memory. Although SR homologs are highly conserved in eukaryotes, little is known about the significance of D-Ser in non-mammals. In contrast to mammals, the slime mold Dictyostelium discoideum genome encodes SR, DAO, and additionally D-Ser specific degradation enzyme D-Ser dehydratase (DSD), but not NMDA- and δ2 glutamate receptors. Here, we studied the significances of D-Ser and DSD in D. discoideum. Enzymatic assays demonstrated that DSD is 460- and 1,700-fold more active than DAO and SR, respectively, in degrading D-Ser. Moreover, in dsd-null cells D-Ser degradation activity is completely abolished. In fact, while in wild-type D. discoideum intracellular D-Ser levels were considerably low, dsd-null cells accumulated D-Ser. These results indicated that DSD but not DAO is the primary enzyme responsible for D-Ser decomposition in D. discoideum. We found that dsd-null cells exhibit delay in development and arrest at the early culmination stage. The efficiency of spore formation was considerably reduced in the mutant cells. These phenotypes were further pronounced by exogenous D-Ser but rescued by plasmid-borne expression of dsd. qRT-PCR analysis demonstrated that mRNA expression of key genes in the cAMP signaling relay is perturbed in the dsd knockout. Our data indicate novel roles for D-Ser and/or DSD in the regulation of cAMP signaling in the development processes of D. discoideum. PMID:29740415
How actin binds and assembles onto plasma membranes from Dictyostelium discoideum
1988-01-01
We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099
Fruit intake and incident diabetic retinopathy with type 2 diabetes.
Tanaka, Shiro; Yoshimura, Yukio; Kawasaki, Ryo; Kamada, Chiemi; Tanaka, Sachiko; Horikawa, Chika; Ohashi, Yasuo; Araki, Atsushi; Ito, Hideki; Akanuma, Yasuo; Yamada, Nobuhiro; Yamashita, Hidetoshi; Sone, Hirohito
2013-03-01
Antioxidants and dietary fiber are postulated to have preventive effects on diabetic retinopathy, but evidence is lacking. We investigated this association in a cohort with type 2 diabetes 40-70 years of age with hemoglobin (Hb)A1C ≥6.5%, originally part of the Japan Diabetes Complications Study. After excluding people who did not respond to a dietary survey and patients with diabetic retinopathy or a major ocular disease at baseline, we analyzed 978 patients. Baseline dietary intake was assessed by a food frequency questionnaire based on food groups and 24-hour dietary records. Primary outcome was incident diabetic retinopathy determined using international severity scales. Mean fruit intake in quartiles ranged from 23 to 253 g/day, with increasing trends across quartiles of fruit intake for vitamin C, vitamin E, carotene, retinol equivalent, dietary fiber, potassium, and sodium. Mean energy intake ranged from 1644 to 1863 kcal/day, and fat intake was approximately 25%. HbA1C, body mass index, triglycerides, and systolic blood pressure were well controlled. During the 8-year follow-up, the numbers of incident cases of diabetic retinopathy from the first through the fourth quartiles of fruit intake were 83, 74, 69, and 59. Multivariate-adjusted hazard ratios for the second, third, and fourth quartiles of fruit intake compared with the first quartile were 0.66 (95% confidence interval = 0.46-0.92), 0.59 (0.41-0.85), and 0.48 (0.32-0.71) (test for trend, P < 0.01). There was no substantial effect modification by age, sex, HbA1C, diabetes duration, overweight, smoking, and hypertension. Risk for diabetic retinopathy declined with increased intake of fruits and vegetables, vitamin C, and carotene. Increased fruit intake in ranges commonly consumed was associated with reduced incident diabetic retinopathy among patients adhering to a low-fat energy-restricted diet.
Schwingshackl, Lukas; Hoffmann, Georg; Kalle-Uhlmann, Tamara; Arregui, Maria; Buijsse, Brian; Boeing, Heiner
2015-01-01
Background Randomized controlled trials provide conflicting results on the effects of increased fruit and vegetable consumption on changes in body weight. We aimed to perform a systematic review and meta-analysis of prospective cohort studies on fruit and vegetable consumption in relation to changes in anthropometric measures. Methods PubMed and EMBASE were searched up to July 2015 for prospective studies reporting on habitual fruit and/or vegetable consumption in relation to changes in body weight or waist circumference or to risk of weight gain/overweight/obesity in adults. Random-effects meta-analysis was applied to pool results across studies. Findings Seventeen cohort studies (from 20 reports) including 563,277 participants met our inclusion criteria. Higher intake of fruits was inversely associated with weight change (decrease) (beta-coefficient per 100-g increment, -13.68 g/year; 95% CI, -22.97 to -4.40). No significant changes could be observed for combined fruit and vegetable consumption or vegetable consumption. Increased intake of fruits was inversely associated with changes (decrease) in waist circumference (beta: -0.04 cm/year; 95% CI, -0.05 to -0.02). Comparing the highest combined fruit & vegetable, fruit, and vegetable intake categories were associated with a 9%, 17%, and 17% reduced risk of adiposity (odds ratio [OR]: 0.91, 95% CI, 0.84 to 0.99), (OR: 0.83, 95% CI, 0.71 to 0.99), and (OR: 0.83, 95% CI, 0.70 to 0.99), respectively. Conclusion This meta-analysis showed several inverse associations between fruit and vegetable intake and prospective improvements in anthropometric parameters, and risk of adiposity. The present meta-analysis seems to be limited by low study quality. Nevertheless, when combined with evolutionary nutrition and epidemiological modeling studies, these findings have public health relevance and support all initiatives to increase fruit and vegetable intake. PMID:26474158
Keshteli, Ammar Hassanzadeh; Shaabani, Pouria; Tabibian, Seyed-Reza; Saneei, Parvane; Esmaillzadeh, Ahmad; Adibi, Peyman
2017-01-01
Background: Findings from studies that investigated the relationship between fruit and vegetable intake with gastroesophageal reflux disease (GERD) were inconsistent. We aimed to assess the relationship between fruit and vegetable consumption and GERD among a large group of Iranian adults. Materials and Methods: In this cross-sectional study on 3979 adults, a validated food frequency questionnaire was used to assess usual dietary intakes including fruits and vegetables. The presence of heartburn sometimes or more during the past 3 months were considered as having GERD. Results: The prevalence of GERD among study population was 23.9%. After adjustment for potential confounding factors, those with the highest consumption of fruits had 25% lower risk for GERD, in comparison to those with the lowest intake (odds ratio [OR] = 0.75, 95% confidence interval [CI]: 0.59–0.97). Vegetable intake was not significantly related to the risk of GERD in crude or multivariable-adjusted models. However, participants with the highest intake of fruits and vegetables had 33% lower risk of GERD (OR = 0.67, 95% CI: 0.51–0.88), after adjustment for confounders. Women with the highest fruit and vegetable intake had 36% lower risk for GERD (OR = 0.64, 95% CI: 0.45–0.91). Overweight/obese participants in the last tertile of fruit consumption had 42% lower risk for GERD, in comparison to the first category (OR = 0.58, 95% CI: 0.42–0.83). Furthermore, participants with body mass index higher than 25 kg/m2 and higher intake of fruits and vegetables had 53% lower risk for GERD (OR = 0.47, 95% CI: 0.32-0.69). Conclusion: We found inverse associations between fruit intake as well as fruit and vegetable intake and risk of GERD among Iranian adults. PMID:29259636
Keshteli, Ammar Hassanzadeh; Shaabani, Pouria; Tabibian, Seyed-Reza; Saneei, Parvane; Esmaillzadeh, Ahmad; Adibi, Peyman
2017-01-01
Findings from studies that investigated the relationship between fruit and vegetable intake with gastroesophageal reflux disease (GERD) were inconsistent. We aimed to assess the relationship between fruit and vegetable consumption and GERD among a large group of Iranian adults. In this cross-sectional study on 3979 adults, a validated food frequency questionnaire was used to assess usual dietary intakes including fruits and vegetables. The presence of heartburn sometimes or more during the past 3 months were considered as having GERD. The prevalence of GERD among study population was 23.9%. After adjustment for potential confounding factors, those with the highest consumption of fruits had 25% lower risk for GERD, in comparison to those with the lowest intake (odds ratio [OR] = 0.75, 95% confidence interval [CI]: 0.59-0.97). Vegetable intake was not significantly related to the risk of GERD in crude or multivariable-adjusted models. However, participants with the highest intake of fruits and vegetables had 33% lower risk of GERD (OR = 0.67, 95% CI: 0.51-0.88), after adjustment for confounders. Women with the highest fruit and vegetable intake had 36% lower risk for GERD (OR = 0.64, 95% CI: 0.45-0.91). Overweight/obese participants in the last tertile of fruit consumption had 42% lower risk for GERD, in comparison to the first category (OR = 0.58, 95% CI: 0.42-0.83). Furthermore, participants with body mass index higher than 25 kg/m 2 and higher intake of fruits and vegetables had 53% lower risk for GERD (OR = 0.47, 95% CI: 0.32-0.69). We found inverse associations between fruit intake as well as fruit and vegetable intake and risk of GERD among Iranian adults.
Nowrousian, Minou; Piotrowski, Markus; Kück, Ulrich
2007-07-01
During fungal fruiting body development, specialized cell types differentiate from vegetative mycelium. We have isolated a protein from the ascomycete Sordaria macrospora that is not present during vegetative growth but accumulates in perithecia. The protein was sequenced by mass spectrometry and the corresponding gene was termed app (abundant perithecial protein). app transcript occurs only after the onset of sexual development; however, the formation of ascospores is not a prerequisite for APP accumulation. The transcript of the Neurospora crassa ortholog is present prior to fertilization, but the protein accumulates only after fertilization. In crosses of N. crassa Deltaapp strains with the wild type, APP accumulates when the wild type serves as female parent, but not in the reciprocal cross; thus, the presence of a functional female app allele is necessary and sufficient for APP accumulation. These findings highlight multiple layers of temporal and spatial control of gene expression during fungal development.
NASA Astrophysics Data System (ADS)
de Camargo, Maria Gabriela G.; Cazetta, Eliana; Schaefer, Martin; Morellato, L. Patrícia C.
2014-05-01
Time and quantity and quality of fruits and seeds produced are limiting factors for the recruitment of new individuals and maintenance plant species. Furthermore, species that produced fruits dispersed by animals have an important role as a source of food for different groups of animals and relay on them to dispersed their seeds. In most of the Brazilian cerrado-savanna, as in others tropical vegetations, there is a predominance of animal-dispersed species, however there is a lack of information about fruit production and its availability over time on tropical savannas. Beyond the comprehension of fruiting patterns and their relation to biotic and abiotic factors, the fruit production over time can be associated with data on fruit quality such as the fruit color and nutritional content. Those combined informations allow us to evaluate the quantity and quality of resources available in a plant community for frugivores and seed predators. For a cerrado-savanna woody community in southeastern Brazil, subjected to a marked seasonal climate, we intended to describe: (i) fruit availability over time (in number and biomass); (ii) nutritional content; and (ii) fruit color patterns over a year. We counted fortnightly the number of ripe fruits and estimated fruit biomass over a year. For the nutritional content, we evaluated the percentage of protein, lipids and carbohydrates in the pulp or aril of fleshy-fruits. We classified fruit colors in red, black, yellow, dark-red, blue and multicolored (when the fruit display is composed by a combination of two non-green colors or more). We observed a period of the highest fruit production in the wet season, with two peaks of production, and a decline in the dry season, a possible period of scarcity. As expected, fruit nutritional content followed mainly the fruiting pattern in biomass. For lipids there was a different seasonal pattern in which lipid-rich fruits were produced mainly at the end of the wet season while fruits with less
McGuire, V; Alexander, S
1996-06-14
The differentiated spores of Dictyostelium are surrounded by an extracellular matrix, the spore coat, which protects them from environmental factors allowing them to remain viable for extended periods of time. This presumably is a major evolutionary advantage. This unique extracellular matrix is composed of cellulose and glycoproteins. Previous work has shown that some of these spore coat glycoproteins exist as a preassembled multiprotein complex (the PsB multiprotein complex) which is stored in the prespore vesicles (Watson, N., McGuire, V., and Alexander, S (1994) J. Cell Sci. 107, 2567-2579). Later in development, the complex is synchronously secreted from the prespore vesicles and incorporated into the spore coat. We now have shown that the PsB complex has a specific in vitro cellulose binding activity. The analysis of mutants lacking individual subunits of the PsB complex revealed the relative order of assembly of the subunit proteins and demonstrated that the protein subunits must be assembled for cellulose binding activity. These results provide a biochemical explanation for the localization of this multiprotein complex in the spore coat.
Katayama, Takahiro; Yasukawa, Hiro
2008-10-01
It has been reported that Dictyostelium discoideum encodes four silent information regulator 2 (Sir2) proteins (Sir2A-D) showing sequence similarity to human homologues of Sir2 (SIRT1-3). Further screening in a database revealed that D. discoideum encodes an additional Sir2 homologue (Sir2E). The amino acid sequence of Sir2E is not similar to those of SIRTs but is similar to those of proteins encoded by Giardia lamblia, Cryptosporidium hominis and Cryptosporidium parvum. Fluorescence of Sir2E-green fluorescent protein fusion protein was detected in the D. discoideum nucleus, indicating that Sir2E is a nuclear localizing protein. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that D. discoideum expressed sir2E in amoebae in the growth phase and in prestalk cells in the developmental phase. D. discoideum overexpressing sir2E grew faster than the wild type. These results indicate that Sir2E plays important roles both in the growth phase and developmental phase of D. discoideum.
Prevention of metabolic diseases: fruits (including fruit sugars) vs. vegetables.
Kuzma, Jessica N; Schmidt, Kelsey A; Kratz, Mario
2017-07-01
To discuss recent evidence from observational and intervention studies on the relationship between fruit and vegetable (F&V) consumption and metabolic disease. Observational studies have consistently demonstrated a modest inverse association between the intake of fruit and leafy green vegetables, but not total vegetables, and biomarkers of metabolic disease as well as incident type 2 diabetes mellitus. This is in contrast to limited evidence from recently published randomized controlled dietary intervention trials, which - in sum - suggests little to no impact of increased F&V consumption on biomarkers of metabolic disease. Evidence from observational studies that fruit and leafy green vegetable intake is associated with lower type 2 diabetes risk and better metabolic health could not be confirmed by dietary intervention trials. It is unclear whether this discrepancy is because of limitations inherent in observational studies (e.g., subjective dietary assessment methods, residual confounding) or due to limitations in the few available intervention studies (e.g., short duration of follow-up, interventions combining whole fruit and fruit juice, or lack of compliance). Future studies that attempt to address these limitations are needed to provide more conclusive insight into the impact of F&V consumption on metabolic health.
A Novel Method for Tracking Individuals of Fruit Fly Swarms Flying in a Laboratory Flight Arena
Cheng, Xi En; Qian, Zhi-Ming; Wang, Shuo Hong; Jiang, Nan; Guo, Aike; Chen, Yan Qiu
2015-01-01
The growing interest in studying social behaviours of swarming fruit flies, Drosophila melanogaster, has heightened the need for developing tools that provide quantitative motion data. To achieve such a goal, multi-camera three-dimensional tracking technology is the key experimental gateway. We have developed a novel tracking system for tracking hundreds of fruit flies flying in a confined cubic flight arena. In addition to the proposed tracking algorithm, this work offers additional contributions in three aspects: body detection, orientation estimation, and data validation. To demonstrate the opportunities that the proposed system offers for generating high-throughput quantitative motion data, we conducted experiments on five experimental configurations. We also performed quantitative analysis on the kinematics and the spatial structure and the motion patterns of fruit fly swarms. We found that there exists an asymptotic distance between fruit flies in swarms as the population density increases. Further, we discovered the evidence for repulsive response when the distance between fruit flies approached the asymptotic distance. Overall, the proposed tracking system presents a powerful method for studying flight behaviours of fruit flies in a three-dimensional environment. PMID:26083385
Sorbitol, Rubus fruit, and misconception.
Lee, Jungmin
2015-01-01
It is unclear how the misunderstanding that Rubus fruits (e.g., blackberries, raspberries) are high in sugar alcohol began, or when it started circulating in the United States. In reality, they contain little sugar alcohol. Numerous research groups have reported zero detectable amounts of sugar alcohol in fully ripe Rubus fruit, with the exception of three out of 82 Rubus fruit samples (cloudberry 0.01 g/100 g, red raspberry 0.03 g/100 g, and blackberry 4.8 g/100 g(∗); (∗)highly unusual as 73 other blackberry samples contained no detectable sorbitol). Past findings on simple carbohydrate composition of Rubus fruit, other commonly consumed Rosaceae fruit, and additional fruits (24 genera and species) are summarised. We are hopeful that this review will clarify Rosaceae fruit sugar alcohol concentrations and individual sugar composition; examples of non-Rosaceae fruit and prepared foods containing sugar alcohol are included for comparison. A brief summary of sugar alcohol and health will also be presented. Published by Elsevier Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thomas, P.
1986-01-01
The current status of research on the application of ionizing radiation for improving the storage of temperate fruits, i.e., apple, pear, peach, nectarine, apricot, cherry, plum, strawberry, bilberry, cranberry, raspberry, and black currant, is reviewed. Changes in fruit metabolism, chemical composition, texture, and organoleptic quality attributes are discussed with reference to the irradiation dose. The feasibility of using radiation either alone or in conjunction with heat treatment, refrigeration, and controlled atmospheres (CA) for the control of storage decay caused by fungal pathogens is considered. Areas of further research are suggested before irradiation could be considered for practical application in somemore » of these temperate fruits. The recent trends in the possible use of irradiation for disinfestation of certain pome and stone fruits and the prospects for the commercial utilization of irradiation for improving the market life of strawberries are discussed. 156 references.« less
Phytosanitary irradiation of peach fruit moth (Lepidoptera: Carposinidae) in apple fruits
NASA Astrophysics Data System (ADS)
Zhan, Guoping; Li, Baishu; Gao, Meixu; Liu, Bo; Wang, Yuejin; Liu, Tao; Ren, Lili
2014-10-01
Peach fruit moth, Carposina sasakii Matsumura, is a serious pest of many pome and stone fruits and presents a quarantine problem in some export markets. It is widely distributed in pome fruit production areas in China, Japan, Korea, North Korea and the Far Eastern Federal District of Russia. In this investigation, gamma radiation dose-response tests were conducted with late eggs (5-d-old) and various larval stages, followed by large-scale confirmatory tests on the most tolerant stage in fruit, the fifth instar. The dose-response tests, with the target radiation dose of 20 (late eggs), 40, 60, 80, 100, 120, 140, and 160 Gy (late fifth instars in vitro) respectively applied to all stages, showed that the tolerance to radiation increased with increasing age and developmental stage. The fifth instar (most advanced instar in fruits) was determined to be the most tolerant stage requiring an estimated minimum absorbed dose of 208.6 Gy (95% CI: 195.0, 226.5 Gy) to prevent adult emergence at 99.9968% efficacy (95% confidence level). In the confirmatory tests, irradiation was applied to 30,850 late fifth instars in apple fruits with a target dose of 200 Gy (171.6-227.8 Gy measured), but only 4 deformed adults emerged that died 2 d afterwards without laying eggs. A dose of 228 Gy may be recommended as a phytosanitary irradiation treatment under ambient atmosphere for the control of peach fruit moth on all commodities with an efficacy of 99.9902% at 95% confidence level.
Active and passive stabilization of body pitch in insect flight
Ristroph, Leif; Ristroph, Gunnar; Morozova, Svetlana; Bergou, Attila J.; Chang, Song; Guckenheimer, John; Wang, Z. Jane; Cohen, Itai
2013-01-01
Flying insects have evolved sophisticated sensory–motor systems, and here we argue that such systems are used to keep upright against intrinsic flight instabilities. We describe a theory that predicts the instability growth rate in body pitch from flapping-wing aerodynamics and reveals two ways of achieving balanced flight: active control with sufficiently rapid reactions and passive stabilization with high body drag. By glueing magnets to fruit flies and perturbing their flight using magnetic impulses, we show that these insects employ active control that is indeed fast relative to the instability. Moreover, we find that fruit flies with their control sensors disabled can keep upright if high-drag fibres are also attached to their bodies, an observation consistent with our prediction for the passive stability condition. Finally, we extend this framework to unify the control strategies used by hovering animals and also furnish criteria for achieving pitch stability in flapping-wing robots. PMID:23697713
The Role of Personality Traits in Young Adult Fruit and Vegetable Consumption.
Conner, Tamlin S; Thompson, Laura M; Knight, Rachel L; Flett, Jayde A M; Richardson, Aimee C; Brookie, Kate L
2017-01-01
This project investigated how individual differences in the big-five personality traits (neuroticism, extraversion, openness to experience, conscientiousness, and agreeableness) predicted plant-food consumption in young adults. A total of 1073 participants from two samples of young adults aged 17-25 reported their daily servings of fruits, vegetables, and two unhealthy foods for comparison purposes using an Internet daily diary for 21 or 13 days (micro-longitudinal, correlational design). Participants also completed the Neuroticism, Extraversion, Openness Five Factor Inventory (NEO-FFI) measure of personality, and demographic covariates including gender, age, ethnicity, and body mass index (BMI). Analyses used hierarchical regression to predict average daily fruit and vegetable consumption as separate dependent variables from the demographic covariates (step 1) and the five personality traits (step 2). Results showed that young adults higher in openness and extraversion, and to some extent conscientiousness, ate more fruits and vegetables than their less open, less extraverted, and less conscientious peers. Neuroticism and agreeableness were unrelated to fruit and vegetable consumption. These associations were unique to eating fruit and vegetables and mostly did not extend to unhealthy foods tested. Young adult women also ate more fruit and vegetables than young adult men. Results suggest that traits associated with greater intellect, curiosity, and social engagement (openness and extraversion), and to a lesser extent, discipline (conscientiousness) are associated with greater plant-food consumption in this population. Findings reinforce the importance of personality in establishing healthy dietary habits in young adulthood that could translate into better health outcomes later in life.
The economic burden of inadequate consumption of vegetables and fruit in Canada.
Ekwaru, John Paul; Ohinmaa, Arto; Loehr, Sarah; Setayeshgar, Solmaz; Thanh, Nguyen Xuan; Veugelers, Paul J
2017-02-01
Public health decision makers not only consider health benefits but also economic implications when articulating and issuing lifestyle recommendations. Whereas various estimates exist for the economic burden of physical inactivity, excess body weight and smoking, estimates of the economic burden associated with our diet are rare. In the present study, we estimated the economic burden attributable to the inadequate consumption of vegetables and fruit in Canada. We accessed the Canadian Community Health Survey to assess the inadequacy in the consumption of vegetables and fruit and published meta-analyses to assemble risk estimates for chronic diseases. Based on these inadequacy and risk estimates, we calculated the population-attributable fraction and avoidable direct and indirect costs to society. Direct costs include those for hospital care, physician services and drugs in 2015. About 80 % of women and 89 % of men consume inadequate amounts of vegetables and fruit. We estimated this to result in an economic burden of $CAN 3·3 billion per year, of which 30·5 % is direct health-care costs and 69·5 % is indirect costs due to productivity losses. A modest 1 percentage point annual reduction in the prevalence of inadequate vegetables and fruit consumption over the next 20 years would avoid approximately $CAN 10·8 billion, and an increase of one serving of vegetables and fruit per day would avoid approximately $CAN 9·2 billion. Further investments in the promotion of vegetables and fruit will prevent chronic disease and substantially reduce direct and indirect health-care costs.
Heller, Rebecca; Martin-Biggers, Jennifer; Berhaupt-Glickstein, Amanda; Quick, Virginia; Byrd-Bredbenner, Carol
2015-10-01
To determine whether food label information and advertisements for foods containing no fruit cause children to have a false impression of the foods' fruit content. In the food label condition, a trained researcher showed each child sixteen different food label photographs depicting front-of-food label packages that varied with regard to fruit content (i.e. real fruit v. sham fruit) and label elements. In the food advertisement condition, children viewed sixteen, 30 s television food advertisements with similar fruit content and label elements as in the food label condition. After viewing each food label and advertisement, children responded to the question 'Did they use fruit to make this?' with responses of yes, no or don't know. Schools, day-care centres, after-school programmes and other community groups. Children aged 4-7 years. In the food label condition, χ 2 analysis of within fruit content variation differences indicated children (n 58; mean age 4·2 years) were significantly more accurate in identifying real fruit foods as the label's informational load increased and were least accurate when neither a fruit name nor an image was on the label. Children (n 49; mean age 5·4 years) in the food advertisement condition were more likely to identify real fruit foods when advertisements had fruit images compared with when no image was included, while fruit images in advertisements for sham fruit foods significantly reduced accuracy of responses. Findings suggest that labels and advertisements for sham fruit foods mislead children with regard to the food's real fruit content.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1986-01-05
The N-linked oligosaccharides found on the lysosomal enzymes from Dictyostelium discoideum are highly sulfated and contain methylphosphomannosyl residues. Here the authors report studies done on the structure of N-linked oligosaccharides found on proteins secreted during growth, a major portion of which are lysosomal enzymes. Cells were metabolically labeled with (2-/sup 3/H)Man and /sup 35/SO/sub 4/ and a portion of the oligosaccharides were released by a sequential digestion with endoglycosidase H followed by endoglycosidase/peptide N-glycosidase F preparations. The oligosaccharides were separated by anion exchange high performance liquid chromatography into fractions containing from one up to six negative charges. Some of themore » oligosaccharides contained only sulfate esters or phosphodiesters, but most contained both. Less than 2% of the oligosaccharides contained a phosphomonoester or an acid-sensitive phosphodiester typical of the mammalian lysosomal enzymes. A combination of acid and base hydrolysis suggested that most of the sulfate esters were linked to primary hydroxyl groups. The presence of Man-6-SO/sub 4/ was demonstrated by the appearance of 3,6-anhydromannose in acid hydrolysates of base-treated, reduced oligosaccharides.« less
Evolution of the bilaterian body plan: what have we learned from annelids?
NASA Technical Reports Server (NTRS)
Shankland, M.; Seaver, E. C.
2000-01-01
Annelids, unlike their vertebrate or fruit fly cousins, are a bilaterian taxon often overlooked when addressing the question of body plan evolution. However, recent data suggest that annelids offer unique insights on the early evolution of spiral cleavage, anteroposterior axis formation, body axis segmentation, and head versus trunk distinction.
de Freitas, Sergio Tonetto; Shackel, Kenneth A; Mitcham, Elizabeth J
2011-05-01
Calcium (Ca) uptake into fruit and leaves is dependent on xylemic water movement, and hence presumably driven by transpiration and growth. High leaf transpiration is thought to restrict Ca movement to low-transpiring tomato fruit, which may increase fruit susceptibility to the Ca-deficiency disorder, blossom end rot (BER). The objective of this study was to analyse the effect of reduced leaf transpiration in abscisic acid (ABA)-treated plants on fruit and leaf Ca uptake and BER development. Tomato cultivars Ace 55 (Vf) and AB2 were grown in a greenhouse environment under Ca-deficit conditions and plants were treated weekly after pollination with water (control) or 500 mg l(-1) ABA. BER incidence was completely prevented in the ABA-treated plants and reached values of 30-45% in the water-treated controls. ABA-treated plants had higher stem water potential, lower leaf stomatal conductance, and lower whole-plant water loss than water-treated plants. ABA treatment increased total tissue and apoplastic water-soluble Ca concentrations in the fruit, and decreased Ca concentrations in leaves. In ABA-treated plants, fruit had a higher number of Safranin-O-stained xylem vessels at early stages of growth and development. ABA treatment reduced the phloem/xylem ratio of fruit sap uptake. The results indicate that ABA prevents BER development by increasing fruit Ca uptake, possibly by a combination of whole-plant and fruit-specific mechanisms.
Freeze-frame fruit selection by birds
Foster, Mercedes S.
2008-01-01
The choice of fruits by an avian frugivore is affected by choices it makes at multiple hierarchical levels (e.g., species of fruit, individual tree, individual fruit). Factors that influence those choices vary among levels in the hierarchy and include characteristics of the environment, the tree, and the fruit itself. Feeding experiments with wild-caught birds were conducted at El Tirol, Departamento de Itapua, Paraguay to test whether birds were selecting among individual fruits based on fruit size. Feeding on larger fruits, which have proportionally more pulp, is generally more efficient than feeding on small fruits. In trials (n = 56) with seven species of birds in four families, birds selected larger fruits 86% of the time. However, in only six instances were size differences significant, which is likely a reflection of small sample sizes.
Seal, Dakshina R.; Martin, Cliff G.
2016-01-01
Peppers (Capsicum spp.) are an important crop in the USA, with about 32,000 ha cultivated in 2007, which resulted in $588 million in farm revenue. The pepper weevil, Anthonomus eugenii Cano (Coleoptera: Curculionidae), is the most troublesome insect pest of peppers in the southern United States. It is therefore urgent to find different vulnerabilities of pepper cultivars, fruit and plants parts, fruit colors and sizes, and timing to infestation by A. eugenii. Also relevant is testing whether fruit length and infestation state affect fruit numbers, weights, and proportions of fruit that are infested. Counts of A. eugenii adults and marks from oviposition and feeding suggested that C. chinense Jacquin “Habanero” was least susceptible, and C. annuum L. cultivars “SY” and “SR” were most susceptible. Comparison of plant parts and fruit sizes revealed that A. eugenii preferred the peduncle, calyx, and top of pepper fruits over the middle, bottom, leaves, or remainder of flowers. Anthonomus eugenii does not discriminate between green or yellow fruit color nor vary diurnally in numbers. Based on adult counts, medium to extra-large fruits (≥1.5 cm long) attracted more weevils than small fruits (<1.5 cm). However based on proportions of fruit numbers or fruit weights that were infested, there were no differences between large and small fruits. Choice of pepper cultivar can thus be an important part of an IPM cultural control program designed to combat A. eugenii by reduced susceptibility or by synchronous fruit drop of infested fruits. Our results are potentially helpful in developing scouting programs including paying particular attention to the preferred locations of adults and their sites of feeding and oviposition on the fruit. The results also suggested the potential value of spraying when the fruits are still immature to prevent and control infestation. PMID:26959066
Pezdirc, Kristine; Hutchesson, Melinda J; Whitehead, Ross; Ozakinci, Gozde; Perrett, David; Collins, Clare E
2015-07-15
Fruit and vegetables contain carotenoid pigments, which accumulate in human skin, contributing to its yellowness. This effect has a beneficial impact on appearance. The aim was to evaluate associations between diet (fruit, vegetable and dietary carotenoid intakes) and skin color in young women. Ninety-one Caucasian women (Median and Interquartile Range (IQR) age 22.1 (18.1-29.1) years, BMI 22.9 (18.5-31.9) kg/m2) were recruited from the Hunter region (Australia). Fruit, vegetable and dietary carotenoid intakes were estimated by a validated food frequency questionnaire. Skin color was measured at nine body locations (sun exposed and unexposed sites) using spectrophotometry. Multiple linear regression was used to assess the relationship between fruit and vegetable intakes and skin yellowness adjusting for known confounders. Higher combined fruit and vegetable intakes (β = 0.8, p = 0.017) were associated with higher overall skin yellowness values. Higher fruit combined fruit and vegetable intakes (β = 1.0, p = 0.004) were associated with increased unexposed skin yellowness. Combined fruit and vegetables plus dietary carotenoid intakes contribute to skin yellowness in young Caucasian women. Evaluation of interventions using improvements in appearance as an incentive for increasing fruit and vegetable consumption in young women is warranted.
Pezdirc, Kristine; Hutchesson, Melinda J.; Whitehead, Ross; Ozakinci, Gozde; Perrett, David; Collins, Clare E.
2015-01-01
Fruit and vegetables contain carotenoid pigments, which accumulate in human skin, contributing to its yellowness. This effect has a beneficial impact on appearance. The aim was to evaluate associations between diet (fruit, vegetable and dietary carotenoid intakes) and skin color in young women. Ninety-one Caucasian women (Median and Interquartile Range (IQR) age 22.1 (18.1–29.1) years, BMI 22.9 (18.5–31.9) kg/m2) were recruited from the Hunter region (Australia). Fruit, vegetable and dietary carotenoid intakes were estimated by a validated food frequency questionnaire. Skin color was measured at nine body locations (sun exposed and unexposed sites) using spectrophotometry. Multiple linear regression was used to assess the relationship between fruit and vegetable intakes and skin yellowness adjusting for known confounders. Higher combined fruit and vegetable intakes (β = 0.8, p = 0.017) were associated with higher overall skin yellowness values. Higher fruit combined fruit and vegetable intakes (β = 1.0, p = 0.004) were associated with increased unexposed skin yellowness. Combined fruit and vegetables plus dietary carotenoid intakes contribute to skin yellowness in young Caucasian women. Evaluation of interventions using improvements in appearance as an incentive for increasing fruit and vegetable consumption in young women is warranted. PMID:26184306
Exercise in Young Adulthood with Simultaneous and Future Changes in Fruit and Vegetable Intake.
Jayawardene, Wasantha P; Torabi, Mohammad R; Lohrmann, David K
2016-01-01
Regarding weight management, changes in exercise behavior can also influence nutrition behavior by application of self-regulatory psychological resources across behaviors (transfer effect). This study aimed to determine: (1) if changes in exercise frequency in young adulthood predict simultaneous changes in fruit/vegetable intake (transfer as co-occurrence); and (2) if exercise frequency affects future fruit/vegetable intake (transfer as carry-over). 6244 respondents of the National Longitudinal Survey of Youth 1997 were followed at ages 18-22 (Time-1), 23-27 (Time-2), and 27-31 (Time-3). Repeated measures analysis of variance and hierarchical multiple regression determined if the change in exercise frequency between Time-1 and Time-2 was associated with simultaneous and sequential changes in fruit/vegetable intake frequency, controlling for sex, race/ethnicity, education, income, body mass index, and baseline fruit/vegetable intake. Only 9% continued exercising for 30 minutes more than 5 days/week, while 15% transitioned to adequate exercise and another 15% transitioned to inadequate exercise; for both fruits and vegetables, intake of once per day or more increased with age. Males were more likely to exercise adequately and females to consume fruits/vegetables adequately. Exercise frequency transition was linearly associated with concurrent fruit/vegetable intake during Time-1 and Time-2. The highest increase in mean fruit/vegetable intake occurred for participants who transitioned from inadequate to adequate exercise. A significant Time-2 exercise frequency effect on Time-3 fruit/vegetable intake emerged, after accounting for baseline intake. Increase in Time-2 exercise by one day/week resulted in increased Time-3 fruit and vegetable intakes by 0.17 and 0.13 times/week, respectively. Transfer effects, although usually discussed in interventions, may also be applicable to voluntary behavior change processes. Newly engaging in and continuing exercise behavior over
Fruit ripening using hyperspectral imaging
NASA Astrophysics Data System (ADS)
., Swetha; Chidangil, Santhosh; Karpate, Tanvi; Asundi, Anand
2017-06-01
The ripening of fruits is associated with changes, in some cases subtle, in the color of the fruit. Traditionally spectroscopy used to measure these subtle changes and infer the ripeness of fruits. Spectrometers provides high-resolution but only measure a small area of the fruit. That might not be a good indicator of the overall ripeness. In this paper, we propose a compact tunable LED based hyper spectral imaging system that scans through a set of wavelengths and images, the reflectance from the whole fruit. Based on the type of fruit, only specific wavelengths need to be scanned. Following a validation using a Rubik's cube, an example banana going through its ripening cycles is used to demonstrate the system.
Environmental Education as a Lived-Body Practice? A Contemplative Pedagogy Perspective
ERIC Educational Resources Information Center
Pulkki, Jani; Dahlin, Bo; Varri, Veli-Matti
2017-01-01
Environmental education usually appeals to the students' knowledge and rational understanding. Even though this is needed, there is a neglected aspect of learning ecologically fruitful action; that of the lived-body. This paper introduces the lived-body as an important site for learning ecological action. An argument is made for the need of a…
Nordey, Thibault; Léchaudel, Mathieu; Saudreau, Marc; Joas, Jacques; Génard, Michel
2014-01-01
Fruit physiology is strongly affected by both fruit temperature and water losses through transpiration. Fruit temperature and its transpiration vary with environmental factors and fruit characteristics. In line with previous studies, measurements of physical and thermal fruit properties were found to significantly vary between fruit tissues and maturity stages. To study the impact of these variations on fruit temperature and transpiration, a modelling approach was used. A physical model was developed to predict the spatial and temporal variations of fruit temperature and transpiration according to the spatial and temporal variations of environmental factors and thermal and physical fruit properties. Model predictions compared well to temperature measurements on mango fruits, making it possible to accurately simulate the daily temperature variations of the sunny and shaded sides of fruits. Model simulations indicated that fruit development induced an increase in both the temperature gradient within the fruit and fruit water losses, mainly due to fruit expansion. However, the evolution of fruit characteristics has only a very slight impact on the average temperature and the transpiration per surface unit. The importance of temperature and transpiration gradients highlighted in this study made it necessary to take spatial and temporal variations of environmental factors and fruit characteristics into account to model fruit physiology.
Global gene expression analysis of apple fruit development from the floral bud to ripe fruit
Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna
2008-01-01
Background Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45–55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Results Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Conclusion Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development. PMID:18279528
Global gene expression analysis of apple fruit development from the floral bud to ripe fruit.
Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna
2008-02-17
Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45-55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development.
Liu, Pengzhan; Kallio, Heikki; Yang, Baoru
2011-10-26
Phenolics in the fruits and leaves of Crataegus grayana were identified by HPLC-UV-ESI-MS. The contents of these compounds and their changes during autumn were also analyzed. Epicatechin [1-7 mg/g dry mass (DM) in fruits and 1-10 mg/g DM in leaves), procyanidins B2 (2-4 and 1-8 mg/g DM) and C1 (2-4 and 1-8 mg/g DM), hyperoside (0.5-1 and 2-11 mg/g DM), and a quercetin-pentoside (0.3-0.5 and 2-6 mg/g DM) were the major phenolics in both fruits and leaves. C-Glycosyl flavones were present in leaves (2-5 mg/g DM), whereas only trace levels were found in fruits. Ideain and 5-O-caffeoylquinic acid were found only in fruits. An additional 11 phenolics were identified/tentatively identified. Total phenolic contents reached highest levels by the end of August in fruits and by the end of September in leaves. The compositional profiles of phenolics in fruits and leaves of C. grayana were different from those of other Crataegus species.
ERIC Educational Resources Information Center
Sargent, Steven A.
2005-01-01
A fruit is alive, and for it to ripen normally, many biochemical reactions must occur in a proper order. After pollination, proper nutrition, growing conditions, and certain plant hormones cause the fruit to develop and grow to proper size. During this time, fruits store energy in the form of starch and sugars, called photosynthates because they…
Satisfying America's Fruit Gap: Summary of an Expert Roundtable on the Role of 100% Fruit Juice.
Byrd-Bredbenner, Carol; Ferruzzi, Mario G; Fulgoni, Victor L; Murray, Robert; Pivonka, Elizabeth; Wallace, Taylor C
2017-07-01
The 2015 to 2020 Dietary Guidelines for Americans (DGAs) recognize the role of 100% fruit juice in health and in helping people meet daily fruit recommendations and state that 100% fruit juice is a nutrient-dense beverage that should be a primary choice, along with water and low-fat/fat-free milk. The DGAs note that children are consuming 100% fruit juice within recommendations (that is, 120 to 180 mL/d for children aged 1 to 6 y and 236 to 355 mL/d for children aged 7 to 18 y). Evidence shows that compared to nonconsumers, those who consume 100% fruit juice come closer to meeting daily fruit needs and have better diet quality. In children, 100% fruit juice is associated with increased intakes of nutrients such as vitamin C, folate, and potassium. When consumed within the DGA recommendations, 100% fruit juice is not associated with overweight/obesity or childhood dental caries and does not compromise fiber intake. Preliminary data suggest that polyphenols in some 100% fruit juices may inhibit absorption of naturally occurring sugars. Given its role in promoting health and in helping people meet fruit needs, experts participating in a roundtable discussion agreed that there is no science-based reason to restrict access to 100% fruit juice in public health nutrition policy and programs such as the Special Supplemental Nutrition Program for Women, Infants, and Children (WIC). Reducing or eliminating 100% fruit juice could lead to unintended consequences such as reduced daily fruit intake and increased consumption of less nutritious beverages (for example, sugar-sweetened beverages). © 2017 Institute of Food Technologists®.
Cocorocchio, Marco; Baldwin, Amy J.; Stewart, Balint; Kim, Lou; Harwood, Adrian J.; Thompson, Christopher R. L.; Andrews, Paul L. R.
2018-01-01
ABSTRACT Natural compounds often have complex molecular structures and unknown molecular targets. These characteristics make them difficult to analyse using a classical pharmacological approach. Curcumin, the main curcuminoid of turmeric, is a complex molecule possessing wide-ranging biological activities, cellular mechanisms and roles in potential therapeutic treatment, including Alzheimer's disease and cancer. Here, we investigate the physiological effects and molecular targets of curcumin in Dictyostelium discoideum. We show that curcumin exerts acute effects on cell behaviour, reduces cell growth and slows multicellular development. We employed a range of structurally related compounds to show the distinct role of different structural groups in curcumin's effects on cell behaviour, growth and development, highlighting active moieties in cell function, and showing that these cellular effects are unrelated to the well-known antioxidant activity of curcumin. Molecular mechanisms underlying the effect of curcumin and one synthetic analogue (EF24) were then investigated to identify a curcumin-resistant mutant lacking the protein phosphatase 2A regulatory subunit (PsrA) and an EF24-resistant mutant lacking the presenilin 1 orthologue (PsenB). Using in silico docking analysis, we then showed that curcumin might function through direct binding to a key regulatory region of PsrA. These findings reveal novel cellular and molecular mechanisms for the function of curcumin and related compounds. PMID:29361519
Cocorocchio, Marco; Baldwin, Amy J; Stewart, Balint; Kim, Lou; Harwood, Adrian J; Thompson, Christopher R L; Andrews, Paul L R; Williams, Robin S B
2018-01-29
Natural compounds often have complex molecular structures and unknown molecular targets. These characteristics make them difficult to analyse using a classical pharmacological approach. Curcumin, the main curcuminoid of turmeric, is a complex molecule possessing wide-ranging biological activities, cellular mechanisms and roles in potential therapeutic treatment, including Alzheimer's disease and cancer. Here, we investigate the physiological effects and molecular targets of curcumin in Dictyostelium discoideum We show that curcumin exerts acute effects on cell behaviour, reduces cell growth and slows multicellular development. We employed a range of structurally related compounds to show the distinct role of different structural groups in curcumin's effects on cell behaviour, growth and development, highlighting active moieties in cell function, and showing that these cellular effects are unrelated to the well-known antioxidant activity of curcumin. Molecular mechanisms underlying the effect of curcumin and one synthetic analogue (EF24) were then investigated to identify a curcumin-resistant mutant lacking the protein phosphatase 2A regulatory subunit (PsrA) and an EF24-resistant mutant lacking the presenilin 1 orthologue (PsenB). Using in silico docking analysis, we then showed that curcumin might function through direct binding to a key regulatory region of PsrA. These findings reveal novel cellular and molecular mechanisms for the function of curcumin and related compounds. © 2018. Published by The Company of Biologists Ltd.
Acute and subacute toxicity evaluation of ethanolic extract from fruits of Schinus molle in rats.
Ferrero, Adriana; Minetti, Alejandra; Bras, Cristina; Zanetti, Noelia
2007-09-25
Ethanolic and hexanic extracts from fruits and leaves of Schinus molle showed ability to control several insect pests. Potential vertebrate toxicity associated with insecticidal plants requires investigation before institutional promotion. The aim of the present study was to evaluate the acute and subacute toxicity of ethanolic extracts from fruits of Schinus molle in rats. The plant extract was added to the diet at 2g/kg body weight/day during 1 day to evaluate acute toxicity and at 1g/kg body weight/day during 14 days to evaluate subacute toxicity. At the end of the exposure and after 7 days, behavioral and functional parameters in a functional observational battery and motor activity in an open field were assessed. Finally, histopathological examinations were conducted on several organs. In both exposures, an increase in the arousal level was observed in experimental groups. Also, the landing foot splay parameter increased in the experimental group after acute exposure. Only the subacute exposure produced a significant increase in the motor activity in the open field. All these changes disappeared after 7 days. None of the exposures affected the different organs evaluated. Our results suggest that ethanolic extracts from fruits and leaves of Schinus molle should be relatively safe to use as insecticide.
Fruit photosynthesis in Satsuma mandarin.
Hiratsuka, Shin; Suzuki, Mayu; Nishimura, Hiroshi; Nada, Kazuyoshi
2015-12-01
To clarify detailed characteristics of fruit photosynthesis, possible gas exchange pathway and photosynthetic response to different environments were investigated in Satsuma mandarin (Citrus unshiu). About 300 mm(-2) stomata were present on fruit surface during young stages (∼10-30 mm diameter fruit) and each stoma increased in size until approximately 88 days after full bloom (DAFB), while the stomata collapsed steadily thereafter; more than 50% stomata deformed at 153 DAFB. The transpiration rate of the fruit appeared to match with stoma development and its intactness rather than the density. Gross photosynthetic rate of the rind increased gradually with increasing CO2 up to 500 ppm but decreased at higher concentrations, which may resemble C4 photosynthesis. In contrast, leaf photosynthesis increased constantly with CO2 increment. Although both fruit and leaf photosynthesis were accelerated by rising photosynthetic photon flux density (PPFD), fruit photosynthesis was greater under considerably lower PPFD from 13.5 to 68 μmolm(-2)s(-1). Thus, Satsuma mandarin fruit appears to incorporate CO2 through fully developed and non-collapsed stomata, and subject it to fruit photosynthesis, which may be characterized as intermediate status among C3, C4 and shade plant photosynthesis. The device of fruit photosynthesis may develop differently from its leaf to capture CO2 efficiently. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Lauzeral, J; Halloy, J; Goldbeter, A
1997-08-19
Whereas it is relatively easy to account for the formation of concentric (target) waves of cAMP in the course of Dictyostelium discoideum aggregation after starvation, the origin of spiral waves remains obscure. We investigate a physiologically plausible mechanism for the spontaneous formation of spiral waves of cAMP in D. discoideum. The scenario relies on the developmental path associated with the continuous changes in the activity of enzymes such as adenylate cyclase and phosphodiesterase observed during the hours that follow starvation. These changes bring the cells successively from a nonexcitable state to an excitable state in which they relay suprathreshold cAMP pulses, and then to autonomous oscillations of cAMP, before the system returns to an excitable state. By analyzing a model for cAMP signaling based on receptor desensitization, we show that the desynchronization of cells on this developmental path triggers the formation of fully developed spirals of cAMP. Developmental paths that do not correspond to the sequence of dynamic transitions no relay-relay-oscillations-relay are less able or fail to give rise to the formation of spirals.
Hartmann, A S; Thomas, J J; Greenberg, J L; Elliott, C M; Matheny, N L; Wilhelm, S
2015-06-01
Although body image is central to the etiological models of anorexia nervosa and body dysmorphic disorder, studies comparing body image and beliefs about attractiveness between the disorders are rare. Sixty-nine individuals (anorexia nervosa: n=24, body dysmorphic disorder: n=23, healthy controls: n=22) completed self-report measures (body image and general psychopathology), diagnostic interviews, and Go/No-Go Association tasks measuring implicit associations. Compared to controls, both clinical groups exhibited greater negative body image, a more negative attitude toward their physical selves, and more dysfunctional coping strategies (ps<.001). Also, both clinical groups shared greater explicit beliefs about the importance of attractiveness (ps<.001). In addition to supporting previous research with regard to comparable body image disturbance, this study also showed that beliefs regarding the importance of appearance (e.g., "one must be attractive to be successful") might be a fruitful target for therapy across both disorders. Copyright © 2015 Elsevier Ltd. All rights reserved.
Jung, Goeh; Remmert, Kirsten; Wu, Xufeng; Volosky, Joanne M.; III, John A. Hammer
2001-01-01
Fusion proteins containing the Src homology (SH)3 domains of Dictyostelium myosin IB (myoB) and IC (myoC) bind a 116-kD protein (p116), plus nine other proteins identified as the seven member Arp2/3 complex, and the α and β subunits of capping protein. Immunoprecipitation reactions indicate that myoB and myoC form a complex with p116, Arp2/3, and capping protein in vivo, that the myosins bind to p116 through their SH3 domains, and that capping protein and the Arp2/3 complex in turn bind to p116. Cloning of p116 reveals a protein dominated by leucine-rich repeats and proline-rich sequences, and indicates that it is a homologue of Acan 125. Studies using p116 fusion proteins confirm the location of the myosin I SH3 domain binding site, implicate NH2-terminal sequences in binding capping protein, and show that a region containing a short sequence found in several G-actin binding proteins, as well as an acidic stretch, can activate Arp2/3-dependent actin nucleation. p116 localizes along with the Arp2/3 complex, myoB, and myoC in dynamic actin-rich cellular extensions, including the leading edge of cells undergoing chemotactic migration, and dorsal, cup-like, macropinocytic extensions. Cells lacking p116 exhibit a striking defect in the formation of these macropinocytic structures, a concomitant reduction in the rate of fluid phase pinocytosis, a significant decrease in the efficiency of chemotactic aggregation, and a decrease in cellular F-actin content. These results identify a complex that links key players in the nucleation and termination of actin filament assembly with a ubiquitous barbed end–directed motor, indicate that the protein responsible for the formation of this complex is physiologically important, and suggest that previously reported myosin I mutant phenotypes in Dictyostelium may be due, at least in part, to defects in the assembly state of actin. We propose that p116 and Acan 125, along with homologues identified in Caenorhabditis elegans
Koko, W S; Abdalla, H S; Galal, M; Khalid, H S
2005-01-01
The efficacy of Balanites aegyptiaca fruit mesocarp was compared with praziquantel in mice infected with Sudanese strain of Schistosoma mansoni. Infected mice were given a single dose of 200 mg/kg body weight of B. aegyptiaca fruit mesocarp and 200 mg/kg b.w. of praziquantel after 6 weeks from the onset of the infection. A significant reduction was observed in EPG (egg count per gram of faeces), eggs burden in tissues and recovery of adult worms (P<0.05) for both the plant and the drug-treated animals.
Ninfali, Paolino; Chiarabini, Andrea; Angelino, Donato
2014-09-01
Fruit beverages are source of antioxidants, but their sugar content plays an important role in the epidemic of obesity. In this study, we considered 32 fruit beverages consumed in Italy (13 fruit juices, 11 nectars, and 8 fruit drinks), which were analyzed for caloric intake, total phenols (TP), ascorbic acid, and antioxidant capacity (oxygen radical absorbance capacity (ORAC) method). Results showed that the caloric intake was almost completely provided by the sugar content, ranging from 5.5 to 19%. The ORAC/kcal ratio was taken as an indicator of the antioxidant performance of fruit beverages. Fruit juices containing berries, red orange, and goji showed the best performances, together with berries or pears nectars and fruit drinks made with rose hips or tea extracts. The 95% of antioxidant capacity was provided by TP, which showed a significant linear correlation with the net ORAC values. Overall, the results indicate that the ORAC/kcal ratio is a suitable parameter to rank the quality of fruit beverages.
CaGLK2 regulates natural variation of chlorophyll content and fruit color in pepper fruit.
Brand, Arnon; Borovsky, Yelena; Hill, Theresa; Rahman, Khalis Afnan Abdul; Bellalou, Aharon; Van Deynze, Allen; Paran, Ilan
2014-10-01
We provide multiple evidences that CaGLK2 underlies a quantitative trait locus controlling natural variation in chlorophyll content and immature fruit color of pepper via modulating chloroplast compartment size. Pepper fruit quality is attributed to a variety of traits, affecting visual appearance, flavor, chemical composition and nutritional value. Among the quality traits, fruit color is of primary importance because the pigments that confer color are associated with nutrition, health and flavor. Although gene models have been proposed for qualitative aspects of fruit color, large natural variation in quantitative pigment content and fruit color exists in pepper. However, its genetic basis is largely unknown which hampers its utilization for plant improvement. We studied the role of GLK2, a GOLDEN2-like transcription factor that regulates chloroplast development in controlling natural variation for chlorophyll content and immature fruit color of pepper. The role of GLK2 in regulating fruit development has been studied previously in tomato using ectopic expression and the uniform ripening mutant analyses. However, pepper provides a unique opportunity to further study the function of this gene because of the wide natural variation of fruit colors in this species. Segregation, sequencing and expression analyses indicated that pepper GLK2 (CaGLK2) corresponds to the recently reported pc10 QTL that controls chloroplast development and chlorophyll content in pepper. CaGLK2 exerts its effect on chloroplast compartment size predominantly during immature fruit development. We show that the genetic background, sequence variation and expression pattern confer a complex and multi-level regulation of CaGLK2 and fruit color in Capsicum. The positive effect on fruit quality predominantly at the green stage conferred by CaGLK2 can be utilized to breed green pepper varieties with improved nutritional values and taste.
2018-01-01
ABSTRACT Botrytis cinerea is a plant-pathogenic fungus producing apothecia as sexual fruiting bodies. To study the function of mating type (MAT) genes, single-gene deletion mutants were generated in both genes of the MAT1-1 locus and both genes of the MAT1-2 locus. Deletion mutants in two MAT genes were entirely sterile, while mutants in the other two MAT genes were able to develop stipes but never formed an apothecial disk. Little was known about the reprogramming of gene expression during apothecium development. We analyzed transcriptomes of sclerotia, three stages of apothecium development (primordia, stipes, and apothecial disks), and ascospores by RNA sequencing. Ten secondary metabolite gene clusters were upregulated at the onset of sexual development and downregulated in ascospores released from apothecia. Notably, more than 3,900 genes were differentially expressed in ascospores compared to mature apothecial disks. Among the genes that were upregulated in ascospores were numerous genes encoding virulence factors, which reveals that ascospores are transcriptionally primed for infection prior to their arrival on a host plant. Strikingly, the massive transcriptional changes at the initiation and completion of the sexual cycle often affected clusters of genes, rather than randomly dispersed genes. Thirty-five clusters of genes were jointly upregulated during the onset of sexual reproduction, while 99 clusters of genes (comprising >900 genes) were jointly downregulated in ascospores. These transcriptional changes coincided with changes in expression of genes encoding enzymes participating in chromatin organization, hinting at the occurrence of massive epigenetic regulation of gene expression during sexual reproduction. PMID:29440571
CyrA, a matricellular protein that modulates cell motility in Dictyostelium discoideum.
Huber, Robert J; Suarez, Andres; O'Day, Danton H
2012-05-01
CyrA, an extracellular matrix (slime sheath), calmodulin (CaM)-binding protein in Dictyostelium discoideum, possesses four tandem EGF-like repeats in its C-terminus and is proteolytically cleaved during asexual development. A previous study reported the expression and localization of CyrA cleavage products CyrA-C45 and CyrA-C40. In this study, an N-terminal antibody was produced that detected the full-length 63kDa protein (CyrA-C63). Western blot analyses showed that the intracellular expression of CyrA-C63 peaked between 12 and 16h of development, consistent with the time that cells are developing into a motile, multicellular slug. CyrA immunolocalization and CyrA-GFP showed that the protein localized to the endoplasmic reticulum, particularly its perinuclear component. CyrA-C63 secretion began shortly after the onset of starvation peaking between 8 and 16h of development. A pharmacological analysis showed that CyrA-C63 secretion was dependent on intracellular Ca(2+) release and active CaM, PI3K, and PLA2. CyrA-C63 bound to CaM both intra- and extracellularly and both proteins were detected in the slime sheath deposited by migrating slugs. In keeping with its purported function, CyrA-GFP over-expression enhanced cAMP-mediated chemotaxis and CyrA-C45 was detected in vinculin B (VinB)-GFP immunoprecipitates, thus providing a link between the increase in chemotaxis and a specific cytoskeletal component. Finally, DdEGFL1-FITC was detected on the membranes of cells capped with concanavalin A suggesting that a receptor exists for this peptide sequence. Together with previous studies, the data presented here suggests that CyrA is a bona fide matricellular protein in D. discoideum. Copyright © 2012 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.
Armstrong, John W; Follett, Peter A
2007-08-01
Immersion of litchi fruit in 49 degrees C water for 20 min followed by hydrocooling in ambient (24 +/- 4 degrees C) temperature water for 20 min was tested as a quarantine treatment against potential infestations of Mediterranean fruit fly, Ceratitis capitata (Wiedemann); and oriental fruit fly, Bactrocera dorsalis Hendel, eggs or larvae in Hawaiian litchi, Litchi chinensis Sonnerat. The 49 degrees C hot-water immersion of litchi provided probit 9 (99.9968% mortality with >95% confidence) quarantine security against eggs and first instars. There were no survivors from 15,000 each feeding and nonfeeding Mediterranean fruit fly or oriental fruit fly third instars immersed in a computer-controlled water bath that simulated the litchi seed-surface temperature profile during the 49 degrees C hot-water immersion treatment. Litchi served as the model for longan, Dimocarpus longan Lour., a closely related fruit that is smaller and also has commercial potential for Hawaii. Modified fruit infestation and holding techniques used to obtain adequate estimated treated populations from poor host fruit, such as litchi and longan, are described. Data from these experiments were used to obtain approval of a hot-water immersion quarantine treatment against fruit flies for litchi and longan exported from Hawaii to the U.S. mainland.
USDA-ARS?s Scientific Manuscript database
North America has four native temperate tree fruit genera that have each played key cultural roles due to their edible fruit, medicinal uses, as well as their value as hardwood: Malus (apple), Prunus (cherry, plum, peach, etc.), Diospyros (persimmon), and Asimina (paw paw). Native North American spe...
Nepper, Martha J.; Chai, Weiwen
2017-01-01
Given the importance of parental influence on children’s eating habits, we explored perceptions of parents of overweight (body mass index–for-age percentile ≥85%) preschoolers (3-5 years) and overweight school-aged children (6-12 years) regarding challenges in promoting fruit and vegetable intake and how they and other family members influence their overweight children’s dietary habits. Focus groups were conducted with 13 parents of overweight preschoolers and 14 parents of overweight school-aged children. Codes and themes were developed by inductive data analysis. Four common themes were identified: short shelf life of fresh fruits and vegetables prohibiting parents from purchasing, children’s taste changes in fruits and vegetables, parents having the primary influence on children’s dietary intake, and wanting fruits and vegetables “ready to go.” Parents of school-aged children were more concerned about their children’s weight, and extended family members negatively influenced children’s dietary intake compared with parents of preschoolers. Our findings provide valuable insight for nutrition/health educators when developing family-based interventions for weight management. PMID:28462357
Alkan, Noam; Friedlander, Gilgi; Ment, Dana; Prusky, Dov; Fluhr, Robert
2015-01-01
The fungus Colletotrichum gloeosporioides breaches the fruit cuticle but remains quiescent until fruit ripening signals a switch to necrotrophy, culminating in devastating anthracnose disease. There is a need to understand the distinct fungal arms strategy and the simultaneous fruit response. Transcriptome analysis of fungal-fruit interactions was carried out concurrently in the appressoria, quiescent and necrotrophic stages. Conidia germinating on unripe fruit cuticle showed stage-specific transcription that was accompanied by massive fruit defense responses. The subsequent quiescent stage showed the development of dendritic-like structures and swollen hyphae within the fruit epidermis. The quiescent fungal transcriptome was characterized by activation of chromatin remodeling genes and unsuspected environmental alkalization. Fruit response was portrayed by continued highly integrated massive up-regulation of defense genes. During cuticle infection of green or ripe fruit, fungi recapitulate the same developmental stages but with differing quiescent time spans. The necrotrophic stage showed a dramatic shift in fungal metabolism and up-regulation of pathogenicity factors. Fruit response to necrotrophy showed activation of the salicylic acid pathway, climaxing in cell death. Transcriptome analysis of C. gloeosporioides infection of fruit reveals its distinct stage-specific lifestyle and the concurrent changing fruit response, deepening our perception of the unfolding fungal-fruit arms and defenses race. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Yuan, C; Lee, H-J; Shin, H J; Stampfer, M J; Cho, E
2015-11-01
Limited research has been conducted on the association between intake of fruits and vegetables and hypertriglyceridemia, especially in Asian populations. This study aimed to investigate the association between total fruit and vegetable intake, as well as subgroups of fruit and vegetable intake, with hypertriglyceridemia among Korean adults. We conducted a cross-sectional study of 7934 adults aged 19-64 years from the fourth Korean Health and Nutrition Examination Survey. Fruit and vegetable intake was estimated from a food frequency questionnaire. Subgroups of fruits and vegetables included citrus, non-citrus and carotene-rich fruits and cruciferous, green leafy and carotene-rich vegetables. Hypertriglyceridemia (plasma triglyceride ⩾150 mg/dl) was diagnosed using a blood sample drawn after 12+ hours of fasting. There were 2001 (25.2%) cases of hypertriglyceridemia among the participants. Total fruit intake was significantly inversely associated with the prevalence of hypertriglyceridemia; the multivariate odds ratios (95% confidence intervals) of hypertriglyceridemia across increasing quintiles were 1.00 (ref), 0.76 (0.62, 0.92), 0.72 (0.58, 0.90), 0.68 (0.54, 0.85) and 0.64 (0.49, 0.82; Ptrend=0.001) after controlling for survey year, body mass index, waist circumference, smoking, alcohol drinking, physical activity, education and income. Similar inverse associations were found for all fruit subgroups. However, we found no significant association between intakes of total or subgroups of vegetable and hypertriglyceridemia; the odds ratio for top vs bottom quintile was 1.00 (0.81-1.24) for total vegetable intake. Our findings support a potential beneficial role of fruit consumption to reduce blood triglyceride levels in Asian populations.
Biological Control of Olive Fruit Fly
USDA-ARS?s Scientific Manuscript database
Domestication of olive fruit, Olea europaea L., produced a better host for olive fruit fly, Bactrocera oleae (Gmelin), than wild olives, but fruit domestication reduced natural enemy efficiency. Important factors for selection of natural enemies for control of olive fruit fly include climate matchi...
1983-01-01
Amoebae of Dictyostelium discoideum produce tracks with two distinct morphologies on gold-coated coverslips. The wild-type strain and other strains that feed only by phagocytosis produced indistinct, fuzzy tracks, whereas mutants capable of axenic growth produced clear, sharp tracks. The sharp track morphology was found to be a recessive phenotype that segregates with axenicity and probably requires a previously unidentified axenic mutation. Axenic and nonaxenic strains also differed in their ability to pinocytose. When the two types of cells were shifted from bacterial growth plates to nutrient media, within 24 h the axenic strain established a rapid rate of pinocytosis, approximately 100-fold higher than the low rate detectable for the nonaxenic strain. However, track formation did not appear to be directly related to endocytosis. Electron microscopic examination of cells during track formation showed that both axenic and nonaxenic strains accumulated gold particles on their surfaces, but neither strain internalized the gold to any significant degree. Observation of living cells revealed that axenic strains collected all particles that they contacted, whereas wild-type strains left many particles undisturbed. The size of the gold particle clusters discarded by the cells also contributed to track morphology. PMID:6619183
Fruit Calcium: Transport and Physiology
Hocking, Bradleigh; Tyerman, Stephen D.; Burton, Rachel A.; Gilliham, Matthew
2016-01-01
Calcium has well-documented roles in plant signaling, water relations and cell wall interactions. Significant research into how calcium impacts these individual processes in various tissues has been carried out; however, the influence of calcium on fruit ripening has not been thoroughly explored. Here, we review the current state of knowledge on how calcium may impact the development, physical traits and disease susceptibility of fruit through facilitating developmental and stress response signaling, stabilizing membranes, influencing water relations and modifying cell wall properties through cross-linking of de-esterified pectins. We explore the involvement of calcium in hormone signaling integral to the physiological mechanisms behind common disorders that have been associated with fruit calcium deficiency (e.g., blossom end rot in tomatoes or bitter pit in apples). This review works toward an improved understanding of how the many roles of calcium interact to influence fruit ripening, and proposes future research directions to fill knowledge gaps. Specifically, we focus mostly on grapes and present a model that integrates existing knowledge around these various functions of calcium in fruit, which provides a basis for understanding the physiological impacts of sub-optimal calcium nutrition in grapes. Calcium accumulation and distribution in fruit is shown to be highly dependent on water delivery and cell wall interactions in the apoplasm. Localized calcium deficiencies observed in particular species or varieties can result from differences in xylem morphology, fruit water relations and pectin composition, and can cause leaky membranes, irregular cell wall softening, impaired hormonal signaling and aberrant fruit development. We propose that the role of apoplasmic calcium-pectin crosslinking, particularly in the xylem, is an understudied area that may have a key influence on fruit water relations. Furthermore, we believe that improved knowledge of the calcium
Evaluating health benefits of various fruits
USDA-ARS?s Scientific Manuscript database
Fruits are an essential part of our daily diets. Most fruits are naturally low in fat, sodium and calories. Fruits are important sources of many nutrients, including potassium, dietary fiber, vitamin C, folic acid and they do not contain cholesterol. Some fruits have laxative effects, prevent uri...
2010-01-01
Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644
Code of Federal Regulations, 2014 CFR
2014-04-01
... CONSUMPTION FRUIT BUTTERS, JELLIES, PRESERVES, AND RELATED PRODUCTS Requirements for Specific Standardized Fruit Butters, Jellies, Preserves, and Related Products § 150.140 Fruit jelly. (a) The jellies for which... Section Name of fruit Apple 7.5 Apricot 7.0 Blackberry (other than dewberry) 10.0 Black raspberry 9.0...
Code of Federal Regulations, 2011 CFR
2011-04-01
... CONSUMPTION FRUIT BUTTERS, JELLIES, PRESERVES, AND RELATED PRODUCTS Requirements for Specific Standardized Fruit Butters, Jellies, Preserves, and Related Products § 150.140 Fruit jelly. (a) The jellies for which... Section Name of fruit Apple 7.5 Apricot 7.0 Blackberry (other than dewberry) 10.0 Black raspberry 9.0...
Association of raw fruit and fruit juice consumption with blood pressure: the INTERMAP Study1234
Oude Griep, Linda M; Stamler, Jeremiah; Chan, Queenie; Van Horn, Linda; Steffen, Lyn M; Miura, Katsuyuki; Ueshima, Hirotsugu; Okuda, Nagako; Zhao, Liancheng; Daviglus, Martha L; Elliott, Paul
2013-01-01
Background: Epidemiologic evidence suggests that fruit consumption may lower the risk of cardiovascular diseases through blood pressure (BP)–lowering effects; little is known on the independent effect of raw fruit and fruit juice on BP. Objective: The objective was to quantify associations of raw fruit and fruit juice consumption with BP by using cross-sectional data from the INTERnational study on MAcro/micronutrients and blood Pressure (INTERMAP) of 4680 men and women aged 40–59 y from Japan, China, the United Kingdom, and the United States. Design: During 4 visits, 8 BP, four 24-h dietary recalls, and two 24-h urine samples were collected. Country-specific multivariate-controlled linear regression coefficients, including adjustment for urinary sodium excretion, were estimated and pooled, weighted by inverse of their variance. Results: The average total raw fruit consumption varied from a mean ± SD of 52 ± 65 g/1000 kcal in the United States to 68 ± 70 g/1000 kcal in China. Individual raw fruit intake was not associated with BP in pooled analyses for all countries or in participants from Western countries, although a positive association with diastolic BP was observed in East Asian participants (per 50 g/1000 kcal; 0.37 mm Hg; 95% CI: 0.02, 0.71). Positive relationships with diastolic BP were found for citrus fruit intake in Western consumers (per 25 g/1000 kcal; 0.47 mm Hg; 95% CI: 0.12, 0.81) and for apple intake in East Asian consumers (0.40 mm Hg; 95% CI: 0.03, 0.78). Among East Asian banana consumers, banana intake was inversely associated with diastolic BP (−1.01 mm Hg; 95% CI: −1.88, −0.02). Fruit juice intake, which was negligible in Asia, was not related to BP in Western countries. Conclusion: Consistent associations were not found between raw fruit and fruit juice consumption of individuals and BP. This observational study was registered at www.clinicaltrials.gov as NCT00005271. PMID:23553162
Development of passion fruit juice beverage
NASA Astrophysics Data System (ADS)
Zhu, Xiang-hao; Duan, Zhen-hua; Yang, Yu-xia; Huang, Xin-hui; Xu, Cheng-ling; Huang, Zhi-zhuo
2017-12-01
In this experiment, the whole fruit of passion fruit was used as raw material. The effects of the ratio of material to liquid (RML), the amount of sucrose addition and the pH on the quality of passion fruit juice beverage were investigated by single factor test. And the optimum process conditions of passion fruit juice beverage were determined by orthogonal test. The results show that the optimum process paramenters were as follow: RML was 1:3, pH was 4.0 and sucrose addition was 8%. Under such optimal conditions, the color of passion fruit juice beverage was red, the flavor of passion fruit was rich and it tasted pleasant.
Gene expression in developing watermelon fruit
Wechter, W Patrick; Levi, Amnon; Harris, Karen R; Davis, Angela R; Fei, Zhangjun; Katzir, Nurit; Giovannoni, James J; Salman-Minkov, Ayelet; Hernandez, Alvaro; Thimmapuram, Jyothi; Tadmor, Yaakov; Portnoy, Vitaly; Trebitsh, Tova
2008-01-01
Background Cultivated watermelon form large fruits that are highly variable in size, shape, color, and content, yet have extremely narrow genetic diversity. Whereas a plethora of genes involved in cell wall metabolism, ethylene biosynthesis, fruit softening, and secondary metabolism during fruit development and ripening have been identified in other plant species, little is known of the genes involved in these processes in watermelon. A microarray and quantitative Real-Time PCR-based study was conducted in watermelon [Citrullus lanatus (Thunb.) Matsum. & Nakai var. lanatus] in order to elucidate the flow of events associated with fruit development and ripening in this species. RNA from three different maturation stages of watermelon fruits, as well as leaf, were collected from field grown plants during three consecutive years, and analyzed for gene expression using high-density photolithography microarrays and quantitative PCR. Results High-density photolithography arrays, composed of probes of 832 EST-unigenes from a subtracted, fruit development, cDNA library of watermelon were utilized to examine gene expression at three distinct time-points in watermelon fruit development. Analysis was performed with field-grown fruits over three consecutive growing seasons. Microarray analysis identified three hundred and thirty-five unique ESTs that are differentially regulated by at least two-fold in watermelon fruits during the early, ripening, or mature stage when compared to leaf. Of the 335 ESTs identified, 211 share significant homology with known gene products and 96 had no significant matches with any database accession. Of the modulated watermelon ESTs related to annotated genes, a significant number were found to be associated with or involved in the vascular system, carotenoid biosynthesis, transcriptional regulation, pathogen and stress response, and ethylene biosynthesis. Ethylene bioassays, performed with a closely related watermelon genotype with a similar
Thippeswamy, H M; Kumar, Nanditha; Anand, S R; Prashant, G M; Chandu, G N
2010-01-01
The regular ingestion of fluoride lowers the prevalence of dental caries. The total daily intake of fluoride for optimal dental health should be 0.05-0.07 mg fluoride/kg body weight and to avoid the risk of dental fluorosis, the daily intake should not exceed a daily level of 0.10 mg fluoride/kg body weight. The main source of fluoride is from drinking water and other beverages. As in other countries, consumption of bottled water, juices and carbonated beverages has increased in our country. To analyze the fluoride content in bottled water, juices and carbonated soft drinks that were commonly available in Davangere city. Three samples of 10 commercially available brands of bottled drinking water, 12 fruit juices and 12 carbonated soft drinks were purchased. Bottled water and carbonated soft drinks were stored at a cold place until fluoride analysis was performed and a clear juice was prepared using different fruits without the addition of water. Then, the fluoride analysis was performed. The mean and standard deviation of fluoride content of bottled water, fruit juices and carbonated soft drinks were measured, which were found to be 0.20 mg (±0.19) F/L, 0.29 mg (±0.06) F/L and 0.22 mg (±0.05) F/L, respectively. In viewing the results of the present study, it can be concluded that regulation of the optimal range of fluoride in bottled drinking water, carbonated soft drinks and fruit juices should be drawn for the Indian scenario.
Borchert, Mark I.; DeFalco, Lesley
2016-01-01
PREMISE OF THE STUDY: The distribution of Yucca brevifolia, a keystone species of the Mojave Desert, may contract with climate change, yet reproduction and dispersal are poorly understood. We tracked reproduction, seed predation, and fruit dispersal for two years and discuss whether Y. brevifolia is a masting species. METHODS: Fruit maturation, seed predation (larval yucca moths), and fruit dispersal (rodents) were monitored on a random sample of panicles during 2013 and 2014, which were years of high and low reproduction, respectively. Fates of fruits placed on the ground and in canopies were also tracked. Rodents were live-trapped to assess abundance and species composition. KEY RESULTS: In 2013, 66% of inflorescences produced fruit of which 53% escaped larval predation; 19.5% of seeds were destroyed in infested fruits. Total seed production was estimated to be >100 times greater in 2013 than 2014. One-third of the fruit crop fell to the ground and was removed by rodents over the course of 120 d. After ground fruits became scarce, rodents exploited canopy fruits. Rodent numbers were low in 2013, so fruits remained in canopies for 370 d. In 2014, fruit production was approximately 20% lower. Larvae infested the majority of fruits, and almost twice the number of seeds were damaged. Fruits were exploited by rodents within 65 d. CONCLUSIONS: High fertilization, prolific seed production, and low predispersal predation in 2013 suggests that pollinator attraction and satiation of seed predators influence masting in Y. brevifolia. Abundant, prolonged fruit availability to seed-dispersing rodents likely extends recruitment opportunities during mast years.
Health Benefits of Fruits and Vegetables1
Slavin, Joanne L.; Lloyd, Beate
2012-01-01
Fruits and vegetables are universally promoted as healthy. The Dietary Guidelines for Americans 2010 recommend you make one-half of your plate fruits and vegetables. Myplate.gov also supports that one-half the plate should be fruits and vegetables. Fruits and vegetables include a diverse group of plant foods that vary greatly in content of energy and nutrients. Additionally, fruits and vegetables supply dietary fiber, and fiber intake is linked to lower incidence of cardiovascular disease and obesity. Fruits and vegetables also supply vitamins and minerals to the diet and are sources of phytochemicals that function as antioxidants, phytoestrogens, and antiinflammatory agents and through other protective mechanisms. In this review, we describe the existing dietary guidance on intake of fruits and vegetables. We also review attempts to characterize fruits and vegetables into groups based on similar chemical structures and functions. Differences among fruits and vegetables in nutrient composition are detailed. We summarize the epidemiological and clinical studies on the health benefits of fruits and vegetables. Finally, we discuss the role of fiber in fruits and vegetables in disease prevention. PMID:22797986
A comprehensive survey of fruit grading systems for tropical fruits of Maharashtra.
Khoje, Suchitra A; Bodhe, S K
2015-01-01
It is said that the backbone of Indian economy is agriculture. The contribution of the agriculture sector to the national GDP (Gross Domestic Products) was 14.6% in the year 2010. To attain a growth rate equivalent to that of industry (viz., about 9%), it is highly mandatory for Indian agriculture to modernize and use automation at various stages of cultivation and post-harvesting techniques. The use of computers in assessing the quality of fruits is one of the major activities in post-harvesting technology. As of now, this assessment is majorly done manually, except for a few fruits. Currently, the fruit quality assessment by machine vision in India is still at research level. Major research has been carried out in countries like China, Malaysia, UK, and Netherlands. To suit the Indian market and psychology of Indian farmers, it is necessary to develop indigenous technology. This paper is the first step toward evaluating the research carried out by the research community all over world for tropical fruits. For the purpose of survey, we have concentrated on the tropical fruits of the state of Maharashtra, while keeping in focus of the review image processing algorithms.
Kowal, Anthony S; Chisholm, Rex L
2011-05-01
Previous work from our laboratory showed that the Dictyostelium discoideum SadA protein plays a central role in cell-substrate adhesion. SadA null cells exhibit a loss of adhesion, a disrupted actin cytoskeleton, and a cytokinesis defect. How SadA mediates these phenotypes is unknown. This work addresses the mechanism of SadA function, demonstrating an important role for the C-terminal cytoplasmic tail in SadA function. We found that a SadA tailless mutant was unable to rescue the sadA adhesion deficiency, and overexpression of the SadA tail domain reduced adhesion in wild-type cells. We also show that SadA is closely associated with the actin cytoskeleton. Mutagenesis studies suggested that four serine residues in the tail, S924/S925 and S940/S941, may regulate association of SadA with the actin cytoskeleton. Glutathione S-transferase pull-down assays identified at least one likely interaction partner of the SadA tail, cortexillin I, a known actin bundling protein. Thus, our data demonstrate an important role for the carboxy-terminal cytoplasmic tail in SadA function and strongly suggest that a phosphorylation event in this tail regulates an interaction with cortexillin I. Based on our data, we propose a model for the function of SadA.
Code of Federal Regulations, 2010 CFR
2010-04-01
... ADDITIVES EXEMPT FROM CERTIFICATION Foods § 73.250 Fruit juice. (a) Identity. (1) The color additive fruit... the water infusion of the dried fruit. The color additive may be concentrated or dried. The definition of fruit juice in this paragraph is for the purpose of identity as a color additive only and shall...
Baldwin, M.J.; Barrow, W.C.; Jeske, C.; Rohwer, F.C.
2008-01-01
The invasive exotic Chinese tallow tree (Triadica sebifera) produces an abundant fruit crop, which is primarily bird-dispersed. The fruit pulp of tallow is lipid-rich, high in saturated fatty acids, and consumed by many bird species. Long-chained fatty acids can be difficult for many birds to digest and we investigated the ability of tallow consumers to assimilate energy in the pulp. We used the total collection method and compared apparent metabolizable energy (AME) of tallow fruit for three species of birds with differing fruit composition in their natural diets. All birds exhibited nitrogen deficits and lost body mass during the trials. Northern Cardinals (Cardinalis cardinalis) lost more mass (8.73%/day) than Yellow-rumped Warblers (Dendroica coronata) (5.29%/day) and American Robins (Turdus migratorius) (5.48%/day), and had larger nitrogen deficits (-120.1 mg N/g diet) than both species as well (-36.4 mg N/g diet and -68.9 mg N/g diet, respectively). Food intake relative to metabolic body mass was highest in Yellow-rumped Warblers (0.70 g-dry/g 0.75??day). Northern Cardinal and American Robin food intake was lower and did not differ from each other (both species: 0.13 g-dry/g 0.75??day). Nitrogen corrected values of AME were used to make species comparisons. Yellow-rumped-Warblers exhibited the highest values of AME (30.00 kJ/g), followed by American Robins (23.90 kJ/g), and Northern Cardinals (14.34 kJ/g). We suggest tallow may be an important winter food source for Yellow-rumped Warblers where their ranges overlap.
Green, Anita A.; Newell, Peter C.
1974-01-01
A procedure for the isolation and separation of three different subfractions of plasma membrane from the cellular slime mould Dictyostelium discoideum is described. The cells were disrupted by freeze-thawing in liquid N2 and plasma membranes were purified by equilibrium centrifugation in a sucrose gradient. The cell surface was labelled with radioactive iodide by using the lactoperoxidase iodination method. Alkaline phosphatase was identified as a plasma-membrane marker by its co-distribution with [125I]iodide. 5′-Nucleotidase, which has been widely described as a plasma-membrane marker enzyme in mammalian tissues, was not localized to any marked extent in D. discoideum plasma membrane. The isolated plasma membranes showed a 24-fold enrichment of alkaline phosphatase specific activity relative to the homogenate and a yield of 50% of the total plasma membranes. Determination of succinate dehydrogenase and NADPH–cytochrome c reductase activities indicated that the preparation contained 2% of the total mitochondria and 3% of the endoplasmic reticulum. When the plasma-membrane preparation was further disrupted in a tight-fitting homogenizer, three plasma-membrane subfractions of different densities were obtained by isopycnic centrifugation. The enrichment of alkaline phosphatase was greatest in the subfraction with the lowest density. This fraction was enriched 36-fold relative to the homogenate and contained 19% of the total alkaline phosphatase activity but only 0.08% of the succinate dehydrogenase activity and 0.34% of the NADPH–cytochrome c reductase activity. Electron microscopy of this fraction showed it to consist of smooth membrane vesicles with no recognizable contaminants. ImagesPLATE 1 PMID:4156170
Xiao, Z; Devreotes, P N
1997-05-01
Unlike most other cellular proteins, the chemoattractant receptor, cAR1, of Dictyostelium is resistant to extraction by the zwitterionic detergent, CHAPS. We exploited this property to isolate a subcellular fraction highly enriched in cAR1 by flotation of CHAPS lysates of cells in sucrose density gradients. Immunogold electron microscopy studies revealed a homogeneous preparation of membrane bilayer sheets. This preparation, designated CHAPS-insoluble floating fraction (CHIEF), also contained a defined set of 20 other proteins and a single uncharged lipid. Cell surface biotinylation and preembedding immunoelectron microscopy both confirmed the plasma membrane origin of this preparation. The cell surface phosphodiesterase (PDE) and a downstream effector of cAR1, adenylate cyclase (ACA), were specifically localized in these structures, whereas the cell adhesion molecule gp80, most of the major cell surface membrane proteins, cytoskeletal components, the actin-binding integral membrane protein ponticulin, and G-protein alpha- and beta-subunits were absent. Overall, CHIFF represents about 3-5% of cell externally exposed membrane proteins. All of these results indicate that CHIFF is derived from specialized microdomains of the plasma membrane. The method of isolation is analogous to that of caveolae. However, we were unable to detect distinct caveolae-like structures on the cell surface associated with cAR1, which showed a diffuse staining profile. The discovery of CHIFF facilitates the purification of cAR1 and related signaling proteins and the biochemical characterization of receptor-mediated processes such as G-protein activation and desensitization. It also has important implications for the "fluid mosaic" model of the plasma membrane structures.
Kuriakose, Jayesh; Lal Raisa, Helen; A, Vysakh; Eldhose, Binil; M S, Latha
2017-09-01
Terminalia bellirica (Gaertn.) Roxb. is a medicinal plant used for the treatment of various ailments in the traditional system of medicine like Ayurveda where it has been prescribed as a rejuvenator and general health tonic. The fruit of the plant is one of the components of the age old ayurvedic formulation-'Triphala'. The present study evaluates curative effect of aqueous acetone extract of Terminalia bellirica fruits (AATB) against CCl 4 induced oxidative stress and liver damage in an animal model. Two doses of the fruit extract (200mg/kg body weight and 400mg/kg body weight) were investigated for the beneficial effects. At the end of the treatment, liver function markers (ALT, AST, ALP, GGT, LDH, total bilirubin, total protein, albumin, globulin, albumin-globulin ratio) as well as hepatic oxidative stress markers (SOD, CAT, GSH) were evaluated. Treatment with AATB significantly restored the parameters towards normal level as compared to the elevated biochemical markers in the CCl 4 treated animals. Reversal to normal tissue architecture was observed in histological evaluation. The results of AATB (400mg/kg) were found comparable with that of standard drug silymarin in all the parameters. The above findings suggest the therapeutic potential of the plant in alleviating hepatic oxidative stress and tissue damage, hence the traditional use of the plant in this regard stands justified. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Computational analysis of amoeboid swimming at low Reynolds number.
Wang, Qixuan; Othmer, Hans G
2016-06-01
Recent experimental work has shown that eukaryotic cells can swim in a fluid as well as crawl on a substrate. We investigate the swimming behavior of Dictyostelium discoideum amoebae who swim by initiating traveling protrusions at the front that propagate rearward. In our model we prescribe the velocity at the surface of the swimming cell, and use techniques of complex analysis to develop 2D models that enable us to study the fluid-cell interaction. Shapes that approximate the protrusions used by Dictyostelium discoideum can be generated via the Schwarz-Christoffel transformation, and the boundary-value problem that results for swimmers in the Stokes flow regime is then reduced to an integral equation on the boundary of the unit disk. We analyze the swimming characteristics of several varieties of swimming Dictyostelium discoideum amoebae, and discuss how the slenderness of the cell body and the shapes of the protrusion effect the swimming of these cells. The results may provide guidance in designing low Reynolds number swimming models.
Microbiological Spoilage of Fruits and Vegetables
NASA Astrophysics Data System (ADS)
Barth, Margaret; Hankinson, Thomas R.; Zhuang, Hong; Breidt, Frederick
Consumption of fruit and vegetable products has dramatically increased in the United States by more than 30% during the past few decades. It is also estimated that about 20% of all fruits and vegetables produced is lost each year due to spoilage. The focus of this chapter is to provide a general background on microbiological spoilage of fruit and vegetable products that are organized in three categories: fresh whole fruits and vegetables, fresh-cut fruits and vegetables, and fermented or acidified vegetable products. This chapter will address characteristics of spoilage microorganisms associated with each of these fruit and vegetable categories including spoilage mechanisms, spoilage defects, prevention and control of spoilage, and methods for detecting spoilage microorganisms.
Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano
2009-12-01
Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.
Wu, Yuantai; Janetopoulos, Chris
2013-01-01
While GABA has been suggested to regulate spore encapsulation in the social amoeba Dictyostelium discoideum, the metabolic profile and other potential functions of GABA during development remain unclear. In this study, we investigated the homeostasis of GABA metabolism by disrupting genes related to GABA metabolism and signaling. Extracellular levels of GABA are tightly regulated during early development, and GABA is generated by the glutamate decarboxylase, GadB, during growth and in early development. However, overexpression of the prespore-specific homologue, GadA, in the presence of GadB reduces production of extracellular GABA. Perturbation of extracellular GABA levels delays the process of aggregation. Cytosolic GABA is degraded by the GABA transaminase, GabT, in the mitochondria. Disruption of a putative vesicular GABA transporter (vGAT) homologue DdvGAT reduces secreted GABA. We identified the GABAB receptor-like family member GrlB as the major GABA receptor during early development, and either disruption or overexpression of GrlB delays aggregation. This delay is likely the result of an abolished pre-starvation response and late expression of several “early” developmental genes. Distinct genes are employed for GABA generation during sporulation. During sporulation, GadA alone is required for generating GABA and DdvGAT is likely responsible for GABA secretion. GrlE but not GrlB is the GABA receptor during late development. PMID:23548898
NASA Astrophysics Data System (ADS)
Wijanarti, Sri; Putra, Agus Budiawan Naro; Nishi, Kosuke; Harmayani, Eni; Sugahara, Takuya
2017-05-01
Snake fruit (Salacca edulis Reinw) cultivar Pondoh Hitam is a tropical fruit produced in Indonesia. It is consumed freshly or processed and believed as the most delicious snake fruit cultivar. Snake fruit flesh contains high polisaccharides such as pectin and dietary fiber. Therefore, snake fruit is a potential immunostimulator candidates but the immunological effect of snake fruit flesh has not been reported. In the present study, immunostimulatory activity of snake fruit flesh extract (SFFE) on macrophages activation was evaluated. SFFE was prepared by extracting from snake fruit flesh with water, methanol 70%, and ethanol 70% for 15 h at 4°C. Then obtained SFFE was used to stimulated cytokine production in vitro using J774.1 cell line. The extract giving strongest stimulation was sellected for in vivo assay to stimulate cytokines production and gene expression using peritoneal macrophage (P-mac) of BALB/c mice. The results showed that SFFE exhibited immunostimulatory activities. Immunostimulatory activity could be indicated by macrophages activation characteristics such as cytokines production. Water extract of SFFE gave strongest stimulation on cytokines production in vitro and sellected for in vivo assay. In vivo assay showed that SFFE stimulated cytokines production as well as their gene expression levels. The optimum stimulation was demonstrated by SFFE 16.7 mg/g. Overall findings suggest that SFFE has a potent beneficial effects to promote the body health through activating macrophages.
Yield and fruit quality traits of dragon fruit lines and cultivars grown in Puerto Rico
USDA-ARS?s Scientific Manuscript database
Dragon fruit or pitahaya (Hylocereus undatus and Selenicereus megalanthus) is a member of the Cactaceae family and native to the tropical forest regions of Mexico, Central, and South America. The fruit was practically unknown 15 years ago but it occupies a growing niche in Europe’s exotic fruit mar...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-04-04
... Avocados From Areas Where Mediterranean Fruit Fly or South American Fruit Fly Exist AGENCY: Animal and... Mediterranean fruit fly quarantined areas in the United States with a certificate if the fruit is safeguarded... quarantine regulations to remove trapping requirements for Mediterranean fruit fly for Hass avocados imported...
Friedrich, Michael; Meier, Doreen; Schuster, Isabelle; Nellen, Wolfgang
2015-01-01
We have previously shown that the most abundant Dictyostelium discoideum retroelement DIRS-1 is suppressed by RNAi mechanisms. Here we provide evidence that both inverted terminal repeats have strong promoter activity and that bidirectional expression apparently generates a substrate for Dicer. A cassette containing the inverted terminal repeats and a fragment of a gene of interest was sufficient to activate the RNAi response, resulting in the generation of ~21 nt siRNAs, a reduction of mRNA and protein expression of the respective endogene. Surprisingly, no transitivity was observed on the endogene. This was in contrast to previous observations, where endogenous siRNAs caused spreading on an artificial transgene. Knock-down was successful on seven target genes that we examined. In three cases a phenotypic analysis proved the efficiency of the approach. One of the target genes was apparently essential because no knock-out could be obtained; the RNAi mediated knock-down, however, resulted in a very slow growing culture indicating a still viable reduction of gene expression. ADVANTAGES OF THE DIRS-1–RNAI SYSTEM: The knock-down system required a short DNA fragment (~400 bp) of the target gene as an initial trigger. Further siRNAs were generated by RdRPs since we have shown some siRNAs with a 5'-triphosphate group. Extrachromosomal vectors facilitate the procedure and allowed for molecular and phenotypic analysis within one week. The system provides an efficient and rapid method to reduce protein levels including those of essential genes.
Catteau, C; Trentesaux, T; Delfosse, C; Rousset, M-M
2012-02-01
The French dietary guidelines published in 2001 recommend daily consumption of 5 portions of fruit or vegetable. Despite this advice, the consumption of fruit in France, especially in the north of France, is low, whereas sale of 100% fruit juices, fruit drinks, and fruit-flavored beverages is increasing. The impact of contemporary changes in beverage patterns on dental caries has received less attention than the impact on childhood obesity. Nevertheless, the cariogenic potential of soft drinks is known. Drinking fruit juices, fruit drinks, or fruit-flavored beverages over a long period of time and continuous sipping could therefore be harmful for the teeth. The aim of this study was to examine the sugar content of such beverages. Four different major supermarkets were visited to select a representative sample of beverages for sale. Fruit juices, nectars, fruit drinks (water and fruit juices) and fruit-flavored waters were included. Lemonades, teas, and drinks containing artificial sweetener were not included. The data were collected in April 2010 by reading nutrition labels. The variables studied were the sugar content (g/100mL), the presence of added sugar, and the percentage of fruit juices. A descriptive analysis of the variables studied was conducted. The mean sugar content of the French population's favorite juices (orange, grapefruit, pineapple, apple, and grape) was compared to the sugar content of a corresponding 100-g portion of fresh fruit. The data were processed using Microsoft Excel. Hundred and eighty-seven different beverages were analyzed: 89 fruit juices, 26 nectars, 51 fruit drinks (sparkling or flat), and 21 fruit-flavored waters. Unlike fruit-flavored waters, nectars and fruit drinks contained fruit juices. Nectars and fruit drinks contained an average of 44.5% (± 10.7%) and 10.5% (± 3.8%) fruit juice, respectively. The sugar content varied from 0 g/100mL to 17.5 g/100mL. The average sugar content was 2.4 (± 2.1) g/100mL, 8.8 (± 2.3) g/100m
Fruit Consumption by Youth in the United States
Herrick, Kirsten A.; Rossen, Lauren M.; Nielsen, Samara Joy; Branum, Amy M; Ogden, Cynthia L.
2016-01-01
Objectives To describe the contribution of whole fruit, including discrete types of fruit, to total fruit consumption and to investigate differences in consumption by socio-demographic characteristics. Methods We analyzed data from 3129 youth aged 2–19 years, from the National Health and Nutrition Examination Survey, 2011–2012. Using the Food Patterns Equivalents Database (FPED) and the What We Eat in America 150 food groups (WWEIA 150), we calculated the contribution of whole fruit, 100% fruit juices, mixed fruit dishes, and 12 discrete fruit and fruit juices to total fruit consumption. We examined differences by age, sex, race and Hispanic origin, and poverty status. Results Nearly 90% of total fruit intake came from whole fruits (53%) and 100% fruit juices (34%) among youth aged 2–19 y. Apples, apple juice, citrus juice and bananas were responsible for almost half of total fruit consumption. Apples accounted for 18.9% of fruit intake. Differences by age were predominantly between youth aged 2–5 y and 6–11 y. For example, apples contributed a larger percentage of total fruit intake among youth 6–11 y (22.4%) than among youth 2–5 y (14.6%), but apple juice contributed a smaller percentage (8.8% v 16.8%), p<0.05. There were race/Hispanic origin differences in intake of citrus fruits, berries, melons, dried fruit, and citrus juices and other fruit juices. Conclusion These findings provide insight into what fruits U.S. youth are consuming and demographic factors that may influence consumption. PMID:26391940
Wu, Ting-Feng; Chan, Yu-Yi; Shi, Wan-Yin; Jhong, Meng-Ting
2017-01-01
Cordyceps militaris has been widely used as an herbal drug and tonic food in East Asia and has also been recently studied in the West because of its various pharmacological activities such as antitumoral, anti-inflammatory and immunomodulatory effects. In this study, we examined the molecular mechanism underlying the anti-allergic activity of ethanol extract prepared from silkworm pupa-cultivated Cordyceps militaris fruit bodies in activated mast cells. Our results showed that ethanol extract treatment significantly inhibited the release of [Formula: see text]-hexosaminidase (a degranulation marker) and mRNA levels of tumor necrosis factor-[Formula: see text] as well as interleukin-4 in RBL-2H3 cells. The cells were sensitized with 2,4-dinitrophenol specific IgE and then stimulated with human serum albumin conjugated with 2,4-dinitrophenol. Oral administration of 300[Formula: see text]mg/kg ethanol extract significantly ameliorated IgE-induced allergic reaction in mice with passive cutaneous anaphylaxis. Western immunoblotting results demonstrated that ethanol extract incubation significantly inhibited Syk/PI3K/MEKK4/JNK/c-jun biochemical cascade in activated RBL-2H3 cells, which activated the expression of various allergic cytokines. In addition, it suppressed Erk activation and PLC[Formula: see text] evocation, which would respectively evoke the synthesis of lipid mediators and Ca[Formula: see text] mobilization to induce degranulation in stimulated RBL-2H3 cells. A compound, identified as [Formula: see text]-sitostenone, was shown to inhibit [Formula: see text]-hexosaminidase secretion from activated mast cells. Our study demonstrated that ethanol extract contained the ingredients, which could inhibit immediate degranulation and de novo synthesis of allergic lipid mediators and cytokines in activated mast cells.
Berry fruit and nuts: their role in reducing oxidative stress and inflammation in the aging brain
USDA-ARS?s Scientific Manuscript database
Berry fruits and nuts are nutrient dense and contain a variety of bioactive phytochemicals, specifically polyphenols. A growing body of literature describes pre-clinical research, using both in vitro and in vivo techniques, which show beneficial effects of nut and berry consumption on the brain in ...
Miller, Margaret; Pollard, Christina
2005-04-01
In 1990, the Department of Health in Western Australia (DOH) initiated a five-year campaign to increase awareness of the need to eat more fruit and vegetables and to encourage increased consumption. This paper describes aspects of the campaign and reviews the strengths and weaknesses of health and fruit and vegetable industry alliances to extend and sustain the campaign. The fruit and vegetable industry was engaged through information sharing, consultation, working groups and joint promotions. The partnership was examined in terms of six inter-sectoral action dimensions (necessity; opportunity and capacity to work together; established relationships for goal achievement; degree of planning; potential for evaluation; and sustainability of action). There were both need and opportunity for each sector to work together. Health had commitment, expertise and resources to plan, implement and evaluate the campaign. Industry had established channels of communication within the supply chain. Sustained health sector presence provided incentive, endorsement and policy direction. Resources and infrastructure limited partnership sustainability. Greatest potential for success occurred when participants' contributions were closely aligned to their core business and there was a body responsible for co-ordinating action.
Guerin-Deremaux, Laetitia; Li, Shuguang; Pochat, Marine; Wils, Daniel; Mubasher, Mohamed; Reifer, Cheryl; Miller, Larry E
2011-09-01
The objective of the present study was to determine the effectiveness of a soluble dietary fiber, NUTRIOSE(®), on body weight, body composition, energy intake and hunger in overweight Chinese men. The volunteers were randomized in double-blind fashion to 250 ml fruit juice supplemented with NUTRIOSE(®) (Test, n = 60) or a maltodextrin (Control, n = 60) at a dosage of 17 g twice daily for 12 weeks. Body weight, body composition were performed at 0, 4, 8 and 12 weeks while daily energy intake and hunger were assessed every 3 days. Test subjects had reductions in body weight (1.5 kg, P < 0.001), body mass index (0.5 kg/m(2), P < 0.001) and body fat percentage (0.3%, P < 0.001) versus Controls. NUTRIOSE(®) supplementation resulted in a lower daily energy intake (3,079 kJ/day, P < 0.001) with group differences noted as early as 3 days. Test subjects reported less hunger across the study period versus Controls (P < 0.01). NUTRIOSE(®) supplementation for 12 weeks results in body composition improvements and reduces body weight, energy intake and hunger in overweight men.
Cavallo, David N; Horino, Masako; McCarthy, William J
2016-09-01
The US Department of Agriculture launched ChooseMyPlate.gov nutrition recommendations designed to encourage increased fruit and vegetable intake, in part, as a strategy for improving weight control through the consumption of high-satiation foods. The purpose of this cross-sectional study was to assess the relationship between adults' reported daily intake of fruits and nonstarchy vegetables (ie, those thought to have the lowest energy density) expressed as a proportion of their total daily food intake and objectively measured cardiovascular and metabolic disease risk factors using data from the 2009-2010 National Health and Nutrition Examination Survey (NHANES). Physical activity was included as a moderator variable. This study employed a cross-sectional examination of 2009-2010 NHANES data to assess how daily fruit and nonstarchy vegetable intake was associated with anthropometric measures and cardiometabolic blood chemistry markers. Adults free of cardiac or metabolic disease (n=1,197) participated in 24-hour dietary recalls; a variety of cardiometabolic biomarkers and anthropometric measures were also collected from participants. Among participants with complete data on all variables, the ratio of the combined cup-equivalents of fruit and nonstarchy vegetable intake to the total gram weight of all foods consumed daily (F/V ratio) served as the primary independent variable. Main dependent measures included fasting glucose, insulin, glycosylated hemoglobin, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, triglycerides, total cholesterol, waist circumference, and body mass index. Demographic and behavioral predictors of the F/V ratio and the association between the F/V ratio and cardiometabolic disease risk factors were examined using multivariate regression. Body mass index (β=-2.58; 95% CI -3.88 to -1.28), waist circumference (β=-6.33; 95% CI -9.81 to -2.84), and insulin (β=-0.21; 95% CI -0.37 to -0.05) were inversely
Unripe red fruits may be aposematic
Ne'eman, Gidi; Izhaki, Ido
2009-01-01
The unripe fruits of certain species are red. Some of these species disperse their seeds by wind (Nerium oleander, Anabasis articulata), others by adhering to animals with their spines (Emex spinosa) or prickles (Hedysarum spinosissimum). Certainly neither type uses red coloration as advertisement to attract the seed dispersing agents. Fleshy-fruited species (Rhamnus alaternus, Rubus sanguineus and Pistacia sp.), which disperse their seeds via frugivores, change fruit color from green to red while still unripe and then to black or dark blue upon ripening. The red color does not seem to function primarily in dispersal (unless red fruits form advertisement flags when there are already black ripe fruits on the plant) because the red unripe fruits of these species are poisonous, spiny, or unpalatable. The unripe red fruits of Nerium oleander are very poisonous, those of Rhamnus alaternus and Anabasis articulata are moderately poisonous, those of Rubus sanguineus are very sour, those of Pistacia sp. contain unpalatable resin and those of Emex spinosa and Hedysarum spinosissimum are prickly. We propose that these unripe red fruits are aposematic, protecting them from herbivory before seed maturation. PMID:19847110
Unripe red fruits may be aposematic.
Lev-Yadun, Simcha; Ne'eman, Gidi; Izhaki, Ido
2009-09-01
The unripe fruits of certain species are red. Some of these species disperse their seeds by wind (Nerium oleander, Anabasis articulata), others by adhering to animals with their spines (Emex spinosa) or prickles (Hedysarum spinosissimum). Certainly neither type uses red coloration as advertisement to attract the seed dispersing agents. Fleshy-fruited species (Rhamnus alaternus, Rubus sanguineus and Pistacia sp.), which disperse their seeds via frugivores, change fruit color from green to red while still unripe and then to black or dark blue upon ripening. The red color does not seem to function primarily in dispersal (unless red fruits form advertisement flags when there are already black ripe fruits on the plant) because the red unripe fruits of these species are poisonous, spiny, or unpalatable. The unripe red fruits of Nerium oleander are very poisonous, those of Rhamnus alaternus and Anabasis articulata are moderately poisonous, those of Rubus sanguineus are very sour, those of Pistacia sp. contain unpalatable resin and those of Emex spinosa and Hedysarum spinosissimum are prickly. We propose that these unripe red fruits are aposematic, protecting them from herbivory before seed maturation.
NASA Astrophysics Data System (ADS)
García, Daniel
1998-12-01
The relationships between the fruit features of Juniperus communis and the presence of fruit pests were studied in Sierra Nevada, SE Spain. The abundance of two insect species — a pulp-sucking scale and a seed-predator wasp — was surveyed with respect both to fruit characteristics and to viability of seeds contained therein. Seed-predator pressure was not significantly related to any fruit characteristics; however, pulp suckers tended to be more abundant in plants with low pulp: seed ratios and high fruit-water content. In addition, fruits with high levels of pulp-sucker attack tended to have higher water content. A multi-factor ANOVA, considering the identity of the plant and the attack of the different pests as factors, showed that plant identity accounts for most of the variation in fruit characteristics. The viability of seeds tended to be lower in plants strongly attacked by both pests. Fruits attacked by seed predators showed significantly lower proportions of viable and unviable seeds than did unattacked fruits. Seed viability was also lower in those fruits heavily attacked by pulp suckers, but this pattern is strongly mediated by plant identity. Pest activity proved to be clearly associated with a direct decrease in juniper reproductive capacity. This loss involved a reduction of the viable-seed number, mainly related to the seed predator, as well as a reduction of fruit attractiveness to frugivorous dispersers, related to the pulp sucker.
PERCEPTION OF BODY WEIGHT AMONG SAUDI SCHOOL CHILDREN
Abalkhail, Baha; Shawky, Sherine; Ghabrah, Tawfik
2002-01-01
Objectives: The objectives of this study were to explore the perception of body weight among students in schools in Jeddah City and identify the main determinants of self-perceived obesity, weight management goals and practices. Material and Methods: Data were collected from a sample of Saudi school children of 42 boys’ and 42 girls’ schools in Jeddah city during the month of April 2000. Personal interviews were conducted to collect data on socio-demographic factors, food choices, perception of body weight, weight management goals and weight management practices, as well as the actual measurement of weight and height. Students were asked about their perception of their body weight [responses included: very underweight (thin), slightly underweight, about right weight, slightly overweight and grossly overweight (obese)]. Proportion, prevalence and 95% confidence intervals were calculated. Multiple logistic regression models were fitted to calculate the adjusted odds ratio (OR) for an attempt to lose weight and weight management practices. Results: The distribution of self-perception of body size was nearly similar to the measured body mass index (BMI) classification except for the overweight students, where 21.3% perceived themselves, as slightly overweight and 5.5% as very overweight although 13.4% were actually overweight and 13.5% were obese by BMI standards. Approximately half the students took at least 3 pieces of fruit or fruit juice servings, and a third ate at least 4 vegetable servings per day. A third of the students managed to lose weight. This coincides with the proportion of those actually overweight and obese. Around 28.0% of the students ate less food, fat or calories, 31.0% took exercise and 17.6% were engaged in vigorous exercise to lose weight or prevent weight gain. Staying for at least 24 hours without food which is a potentially harmful means of weight control was practiced by 10.0% of students. Females were less likely than males to be
Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees.
Vadkertiová, Renáta; Molnárová, Jana; Vránová, Dana; Sláviková, Elena
2012-12-01
Yeasts are common inhabitants of the phyllosphere, but our knowledge of their diversity in various plant organs is still limited. This study focused on the diversity of yeasts and yeast-like organisms associated with matured fruits and fully open blossoms of apple, plum, and pear trees, during 2 consecutive years at 3 localities in southwest Slovakia. The occurrence of yeasts and yeast-like organisms in fruit samples was 2½ times higher and the yeast community more diverse than that in blossom samples. Only 2 species (Aureobasidium pullulans and Metschnikowia pulcherrima) occurred regularly in the blossom samples, whereas Galactomyces candidus, Hanseniaspora guilliermondii, Hanseniaspora uvarum, M. pulcherrima, Pichia kluyveri, Pichia kudriavzevii, and Saccharomyces cerevisiae were the most frequently isolated species from the fruit samples. The ratio of the number of samples where only individual species were present to the number of samples where 2 or more species were found (consortium) was counted. The occurrence of individual species in comparison with consortia was much higher in blossom samples than in fruit samples. In the latter, consortia predominated. Aureobasidium pullulans, M. pulcherrima, and S. cerevisiae, isolated from both the fruits and blossoms, can be considered as resident yeast species of various fruit tree species cultivated in southwest Slovakia localities.
Bioactivities and Health Benefits of Wild Fruits
Li, Ya; Zhang, Jiao-Jiao; Xu, Dong-Ping; Zhou, Tong; Zhou, Yue; Li, Sha; Li, Hua-Bin
2016-01-01
Wild fruits are exotic or underutilized. Wild fruits contain many bioactive compounds, such as anthocyanins and flavonoids. Many studies have shown that wild fruits possess various bioactivities and health benefits, such as free radical scavenging, antioxidant, anti-inflammatory, antimicrobial, and anticancer activity. Therefore, wild fruits have the potential to be developed into functional foods or pharmaceuticals to prevent and treat several chronic diseases. In the present article, we review current knowledge about the bioactivities and health benefits of wild fruits, which is valuable for the exploitation and utilization of wild fruits. PMID:27527154
Shariff, S.; Ibrahim, N. J.; Md-Zain, B. M.; Idris, A. B.; Suhana, Y.; Roff, M. N.; Yaakop, S.
2014-01-01
Abstract Malaysia is a tropical country that produces commercial fruits, including star fruits, Averrhoa carambola L. (Oxalidales: Oxalidaceae), and guavas, Psidium guajava L. (Myrtales: Myrtaceae). There is a high demand for these fruits, and they are planted for both local consumption and export purposes. Unfortunately, there has been a gradual reduction of these fruits, which has been shown to be related to fruit fly infestation, especially from the Bactrocera species. Most parasitic wasps (Hymenoptera: Braconidae: Opiinae) are known as parasitoids of fruit fly larvae. In this study, star fruits and guavas infested by fruit fry larvae were collected from the Malaysian Agricultural Research and Development Institute. The parasitized larvae were reared under laboratory conditions until the emergence of adult parasitoids. Multiplex PCR was performed to determine the braconid species using two mitochondrial DNA markers, namely cytochrome oxidase subunit I and cytochrome b . Two benefits of using multiplex PCR are the targeted bands can be amplified simultaneously using the same reaction and the identification process of the braconid species can be done accurately and rapidly. The species of fruit flies were confirmed using the COI marker. The results obtained from our study show that Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), Fopius arisanus (Sonan), and Pysttalia incisi (Silvestri) were parasitoids associated with Bactrocera carambolae (Drew and Hancock) (Diptera: Tephritidae) infested star fruits. Fopius arisanus was also the parasitoid associated with Bactrocera papayae (Drew and Hancock) infested guavas. Maximum parsimony was been constructed in Opiinae species to compare tree resolution between these two genes in differentiating among closely related species. The confirmation of the relationship between braconids and fruit fly species is very important, recognized as preliminary data, and highly necessary in biological control programs
Shariff, S; Ibrahim, N J; Md-Zain, B M; Idris, A B; Suhana, Y; Roff, M N; Yaakop, S
2014-01-23
Malaysia is a tropical country that produces commercial fruits, including star fruits, Averrhoa carambola L. (Oxalidales: Oxalidaceae), and guavas, Psidium guajava L. (Myrtales: Myrtaceae). There is a high demand for these fruits, and they are planted for both local consumption and export purposes. Unfortunately, there has been a gradual reduction of these fruits, which has been shown to be related to fruit fly infestation, especially from the Bactrocera species. Most parasitic wasps (Hymenoptera: Braconidae: Opiinae) are known as parasitoids of fruit fly larvae. In this study, star fruits and guavas infested by fruit fry larvae were collected from the Malaysian Agricultural Research and Development Institute. The parasitized larvae were reared under laboratory conditions until the emergence of adult parasitoids. Multiplex PCR was performed to determine the braconid species using two mitochondrial DNA markers, namely cytochrome oxidase subunit I and cytochrome b. Two benefits of using multiplex PCR are the targeted bands can be amplified simultaneously using the same reaction and the identification process of the braconid species can be done accurately and rapidly. The species of fruit flies were confirmed using the COI marker. The results obtained from our study show that Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), Fopius arisanus (Sonan), and Pysttalia incisi (Silvestri) were parasitoids associated with Bactrocera carambolae (Drew and Hancock) (Diptera: Tephritidae) infested star fruits. Fopius arisanus was also the parasitoid associated with Bactrocera papayae (Drew and Hancock) infested guavas. Maximum parsimony was been constructed in Opiinae species to compare tree resolution between these two genes in differentiating among closely related species. The confirmation of the relationship between braconids and fruit fly species is very important, recognized as preliminary data, and highly necessary in biological control programs. This is an
Zouari, Inès; Salvioli, Alessandra; Chialva, Matteo; Novero, Mara; Miozzi, Laura; Tenore, Gian Carlo; Bagnaresi, Paolo; Bonfante, Paola
2014-03-21
Tomato (Solanum lycopersicum) establishes a beneficial symbiosis with arbuscular mycorrhizal (AM) fungi. The formation of the mycorrhizal association in the roots leads to plant-wide modulation of gene expression. To understand the systemic effect of the fungal symbiosis on the tomato fruit, we used RNA-Seq to perform global transcriptome profiling on Moneymaker tomato fruits at the turning ripening stage. Fruits were collected at 55 days after flowering, from plants colonized with Funneliformis mosseae and from control plants, which were fertilized to avoid responses related to nutrient deficiency. Transcriptome analysis identified 712 genes that are differentially expressed in fruits from mycorrhizal and control plants. Gene Ontology (GO) enrichment analysis of these genes showed 81 overrepresented functional GO classes. Up-regulated GO classes include photosynthesis, stress response, transport, amino acid synthesis and carbohydrate metabolism functions, suggesting a general impact of fungal symbiosis on primary metabolisms and, particularly, on mineral nutrition. Down-regulated GO classes include cell wall, metabolism and ethylene response pathways. Quantitative RT-PCR validated the RNA-Seq results for 12 genes out of 14 when tested at three fruit ripening stages, mature green, breaker and turning. Quantification of fruit nutraceutical and mineral contents produced values consistent with the expression changes observed by RNA-Seq analysis. This RNA-Seq profiling produced a novel data set that explores the intersection of mycorrhization and fruit development. We found that the fruits of mycorrhizal plants show two transcriptomic "signatures": genes characteristic of a climacteric fleshy fruit, and genes characteristic of mycorrhizal status, like phosphate and sulphate transporters. Moreover, mycorrhizal plants under low nutrient conditions produce fruits with a nutrient content similar to those from non-mycorrhizal plants under high nutrient conditions
Why fruits go to the dark side
NASA Astrophysics Data System (ADS)
Schaefer, H. Martin
2011-11-01
The colours of fleshy fruits are usually attributed to attract seed dispersers to the plant. A cursory look at the gaudy colours of fleshy fruits on offer in a local fruit stall gives the impression that plants use primarily bright colours to attract fruit consumer. This impression is misleading; many small fruits 'go to the dark side' and become dark purple or black when ripe. Intermingled in foliage, these colours, which are produced by anthocyanins, can be fairly inconspicuous and are thus not easily reconciled with a signalling function to attract seed dispersers. In this review I therefore discuss complementary hypotheses on the function and evolution of fruit colouration. First, I focus on the evidence that fruit colours indeed function as signals to attract seed dispersers. I then show that anthocyanins, the most prevalent fruit pigments, are important dietary antioxidants that can be selected by blackcaps ( Sylvia atricapilla) which are important avian seed dispersers of many European plants. Moreover, the consumption of anthocyanins increases the likelihood that blackcaps mount an immune response during immune challenges. As a next step, I review evidence that anthocyanins accumulate in fruit skin in response to abiotic factors, in particular high illumination coupled with low temperature favour the increase of anthocyanins. Finally, I show that anthocyanins can also be selected for by fruit antagonists, consumers that do not disperse seeds. In particular, high contents of anthocyanins strongly reduce fungal growth in fruit tissue. Taken together, there are various selective pressures which likely influence fruit colour evolution. Currently, the relative importance of each of these selective agents is unknown. There is consequently a need to develop a more encompassing framework on fruit colour evolution.