Science.gov

Sample records for directed gene introduction

  1. Direct Introduction of Genes into Rats and Expression of the Genes

    NASA Astrophysics Data System (ADS)

    Benvenisty, Nissim; Reshef, Lea

    1986-12-01

    A method of introducing actively expressed genes into intact mammals is described. DNA precipitated with calcium phosphate has been injected intraperitoneally into newborn rats. The injected genes have been taken up and expressed by the animal tissues. To examine the generality of the method we have injected newborn rats with the chloramphenicol acetyltransferase prokaryotic gene fused with various viral and cellular gene promoters and the gene for hepatitis B surface antigen, and we observed appearance of chloramphenicol acetyltransferase activity and hepatitis B surface antigen in liver and spleen. In addition, administration of genes coding for hormones (insulin or growth hormone) resulted in their expression.

  2. Self-Directed Job Search: An Introduction.

    ERIC Educational Resources Information Center

    Employment and Training Administration (DOL), Washington, DC.

    This document provides an introduction to a job search training activity--self-directed job search--which can be implemented by Private Industry Councils (PICs) or Comprehensive Employment and Training Act (CETA) Prime Sponsors. The first section introduces self-directed job search for the economically disadvantaged. The next section describes…

  3. Plant introductions, hybridization and gene flow.

    PubMed Central

    Abbott, Richard J; James, Juliet K; Milne, Richard I; Gillies, Amanda C M

    2003-01-01

    Many regional floras contain a high proportion of recently introduced plant species. Occasionally, hybridization between an introduced species and another species (introduced or native) can result in interspecific gene flow. This may occur even in instances where the F(1) hybrid shows very high sterility, but occasionally produces a few viable gametes. We provide examples of gene flow occurring between some rhododendrons recently introduced to the British flora, and between an introduced and native Senecio species. Neutral molecular markers have normally been employed to obtain evidence of interspecific gene flow, but the challenge now is to isolate and characterize functional introgressed genes and to determine how they affect the fitness of introgressants and whether they improve adaptation to novel habitats allowing introgressants to expand the range of a species. We outline a candidate gene approach for isolating and characterizing an allele of the RAY gene in Senecio vulgaris, which is believed to have introgressed from S. squalidus, and which causes the production of ray florets in flower heads. We discuss the effects of this introgressed allele on individual fitness, including those that originate directly from the production of ray florets plus those that may arise from pleiotropy and/or linkage. PMID:12831478

  4. Introduction to the Gene Expression Analysis.

    PubMed

    Segundo-Val, Ignacio San; Sanz-Lozano, Catalina S

    2016-01-01

    In 1941, Beadle and Tatum published experiments that would explain the basis of the central dogma of molecular biology, whereby the DNA through an intermediate molecule, called RNA, results proteins that perform the functions in cells. Currently, biomedical research attempts to explain the mechanisms by which develops a particular disease, for this reason, gene expression studies have proven to be a great resource. Strictly, the term "gene expression" comprises from the gene activation until the mature protein is located in its corresponding compartment to perform its function and contribute to the expression of the phenotype of cell.The expression studies are directed to detect and quantify messenger RNA (mRNA) levels of a specific gene. The development of the RNA-based gene expression studies began with the Northern Blot by Alwine et al. in 1977. In 1969, Gall and Pardue and John et al. independently developed the in situ hybridization, but this technique was not employed to detect mRNA until 1986 by Coghlan. Today, many of the techniques for quantification of RNA are deprecated because other new techniques provide more information. Currently the most widely used techniques are qPCR, expression microarrays, and RNAseq for the transcriptome analysis. In this chapter, these techniques will be reviewed. PMID:27300529

  5. Introduction of genes into living cells

    NASA Astrophysics Data System (ADS)

    Nishimura, E.; Nagai, A.; Tomimasu, T.; Kina, T.; Fujimoto, S.; Katsura, Y.

    1998-02-01

    One of our main subjects is an application of the FEL to gene therapy of genetic diseases, immunodeficiency syndromes and cancer. In this study, using the FEL, we tried to establish a model system for introducing genes into the stem cells from which all blood cells are derived. Our aim is to specifically mark the stem cells with monoclonal antibodies which are conjugated with efficient FEL absorbers. Cells are then irradiated with FEL at a wavelength corresponding to the absorption energy of the absorber. We speculate that the gap formation of cell membrane will occur, caused by the thermal shock due to the absorption of the FEL energy. As an animal model for gene therapy, we tried to transfer the RAG-2 genes into hematopoietic stem cells from RAG-2 deficient mice, which have severe immunodeficiency because of the lack of RAG-2 gene required for lymphocyte development. As the results by this construct, the infant lymphocytes (T and B cells) could be observed in the thymus of the RAG-2 deficient mice 2 weeks post-operative.

  6. [A brief introduction to the methods for novel gene cloning].

    PubMed

    Sun, C X; Yu, A C

    2000-01-01

    There are a lot of methods for novel gene cloning, but how to clone candidate gene(s) quickly and correctly? This is a brief introduction to methods of novel gene cloning, these methods includes: differential display reverse transcriptase polymerase chain reaction(DD RT-PCR), suppression subtractive hybridization(SSH), RNA arbitrarily primed PCR(RAP-PCR), representational difference analysis(RDA), yeast two-hybrid system, cDNA capturation, et al. We not only introduced these methods, but also discussed the advantages and disadvantages of them. However, no single method is omnipotent, one should pick up the method most suitable for a special purpose. PMID:12532765

  7. Sample introduction into a direct current plasma by filament vaporization

    SciTech Connect

    Buckley, B.T.

    1989-01-01

    This dissertation describes sample introduction into a direct current plasma by a tungsten filament vaporizer. The filament heater was designed to resistively heat a 0.1 mm diameter tungsten wire quickly and efficiently. The heating system is under microprocessor control for precise power application to the filament. The cell volume is small, less than 4 mL, and the accessibility of the primary emission zone allowed placement of the filament less than 5 cm from the confluence point of the plasma. The first study describes some of the fundamental design considerations, as well as performance of the interface. The absolute mass detection limits for Ca, Fe, Al, and Cu are 80, 2,000, 90, and 200 fg respectively. The blackbody emission temperature of the filament was measured. The initial heating rate was 50,000{degree}C/s. Observations are reported for optimization of operating parameters, as well as how to locate the region of maximum analyte emission intensity. Finally, the application of this technique to the analysis of a biological sample, swine blood, is reported. The second study examines the sources of noise and their components. Noise is grouped into additive and multiplicative noise occurring in three frequency ranges. The largest contribution, greater than 90%, was shot to shot multiplicative variations in sample vaporization and excitation. The third study examines the effect of addition of concomitant substances to the analyte. The substances were added both as metal salts to the aqueous analyte solution and as dopant gases to the carrier gas. Measured transport efficiencies ranged from 60 to 103% for manganese under various concomitant conditions. A 1% doping of the carrier gas with hydrogen caused significant enhancement of the emission signal of three metals, Fe, Al, and Ca. Enhancement correlated with volatility of the reduced form of the element.

  8. Introduction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This publication represents an introduction to a special issue of the journal General and Comparative Endocrinology dedicated to Insect Endocrinology. The issue addresses a number of aspects of invertebrate neuropeptide research including identification of novel invertebrate neuropeptide sequences ...

  9. Introduction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The introduction to the second edition of the Compendium of Apple and Pear Diseases contains a general description of genus and species of commercial importance, some general information about growth and fruiting habits as well as recent production statistics. A general description of major scion c...

  10. Introduction

    NASA Astrophysics Data System (ADS)

    Belrose, John S.

    1993-05-01

    An introduction and welcome to the Specialists' Meeting on 'ELF/VLF/LF Radio Propagation and System Aspects' given at the Electromagnetic Wave Propagation Panel Symposium, held at the Quartier Reine Elisabeth, Brussels, Belgium, 28 Sep. - 2 Oct. 1992, is presented. The following topics are discussed: the early history of radio communications, NATO interest in ELF/VLF/LF, propagation mode, effect of the finite conductivity of the ground, and VLF antennas.

  11. Introduction

    NASA Astrophysics Data System (ADS)

    Carotenuto, Luigi

    This chapter introduces the context, objectives and structure of the book. This book aims both to contribute to disseminate the knowledge about the scientific research conducted in space and to promote new exploitation of existing data in this field. While space experiments are characterised by a long time for preparation, high costs and few opportunities, significant scientific value is expected from the resulting data for almost scientific disciplines. In this context, ISS is a unique experimental environment for research. As part of its Seventh Framework Programme, the European Commission intends to support further exploitation and valorisation of space experimental data. This book was realised as part of the ULISSE project, co-funded by the European Union. The book intends to provide an introduction to space research with a focus on the experiments performed on the ISS and related disciplines. The book also intends to be a useful guide, not only for scientists but also for teachers, students and newcomers to space research activities.

  12. Introduction

    NASA Astrophysics Data System (ADS)

    Takayama, Ken; Briggs*, Richard J.

    The motivation for the initial development of linear induction accelerators starting in the early 1960s came mainly from applications requiring intense electron pulses with beam currents and a charge per pulse above the range accessible to RF accelerators, and with particle energies beyond the capabilities of single stage pulsed-power diodes. The linear induction accelerators developed to meet these needs utilize a series of induction cells containing magnetic cores (torroidal geometry) driven directly by pulse modulators (pulsed power sources). This multistage "one-to-one transformer" configuration with non-resonant, low impedance induction cells accelerates kilo-Ampere-scale electron beam current pulses in induction linacs.

  13. Introduction

    NASA Astrophysics Data System (ADS)

    Klingshirn, C.

    The purpose of this introduction is - after a few general words on ZnO - to inform the reader about the history of ZnO research, the contents of this book and the intentions of the authors. Zinc oxide (ZnO) is a IIb-VI compound semiconductor. This group comprises the binary compounds of Zn, Cd and Hg with O, S, Se, Te and their ternary and quaternary alloys. The band gaps of these compounds cover the whole band gap range from E g ≈ 3. 94 eV for hexagonal ZnS down to semimetals (i.e., E g = 0 eV) for most of the mercury compounds. ZnO itself is also a wide gap semiconductor with E g ≈ 3. 436 eV at T = 0 K and (3. 37 ± 0. 01) eV at room temperature. For more details on the band structure, see Chaps. 4 and 6 or for a recent collection of data on ZnO, for example, [Rössler et al. (eds) Landolt-Börnstein, New Series, Group III, Vols. 17 B, 22, and 41B, 1999]. Like most of the compounds of groups IV, III-V, IIb-VI and Ib-VII, ZnO shows a tetrahedral coordination. In contrast to several other IIb-VI compounds, which occur both in the hexagonal wurtzite and the cubic zinc blende type structure such as ZnS, which gave the name to these two modifications, ZnO occurs almost exclusively in the wurtzite type structure. It has a relatively strong ionic binding (see Chap. 2). The exciton binding energy in ZnO is 60 meV [Thomas, J. Phys. Chem. Solids 15:86, 1960], the largest among the IIb-VI compounds, but by far not the largest for all semiconductors since, for example, CuCl and CuO have exciton binding energies around 190 and 150 meV, respectively. See, for example, [Rössler et al. (eds) Landolt-Börnstein, New Series, Group III, Vols. 17B, 22, and 41B, 1999; Thomas, J. Phys. Chem. Solids 15:86, 1960; Klingshirn and Haug, Phy. Rep. 70:315, 1981; Hönerlage et al., Phys. Rep. 124:161, 1985] and references therein. More details on excitons will be given in Chap. 6. ZnO has a density of about 5. 6 g / cm3 corresponding to 4. 2 × 1022 ZnO molecules per cm3 [Hallwig and

  14. Introduction

    NASA Astrophysics Data System (ADS)

    de Laat, Cees; Develder, Chris; Jukan, Admela; Mambretti, Joe

    This topic is devoted to communication issues in scalable compute and storage systems, such as parallel computers, networks of workstations, and clusters. All aspects of communication in modern systems were solicited, including advances in the design, implementation, and evaluation of interconnection networks, network interfaces, system and storage area networks, on-chip interconnects, communication protocols, routing and communication algorithms, and communication aspects of parallel and distributed algorithms. In total 15 papers were submitted to this topic of which we selected the 7 strongest papers. We grouped the papers in two sessions of 3 papers each and one paper was selected for the best paper session. We noted a number of papers dealing with changing topologies, stability and forwarding convergence in source routing based cluster interconnect network architectures. We grouped these for the first session. The authors of the paper titled: “Implementing a Change Assimilation Mechanism for Source Routing Interconnects” propose a mechanism that can obtain the new topology, and compute and distribute a new set of fabric paths to the source routed network end points to minimize the impact on the forwarding service. The article entitled “Dependability Analysis of a Fault-tolerant Network Reconfiguration Strateg” reports on a case study analyzing the effects of network size, mean time to node failure, mean time to node repair, mean time to network repair and coverage of the failure when using a 2D mesh network with a fault-tolerant mechanism (similar to the one used in the BlueGene/L system), that is able to remove rows and/or columns in the presence of failures. The last paper in this session: “RecTOR: A New and Efficient Method for Dynamic Network Reconfiguration” presents a new dynamic reconfiguration method, that ensures deadlock-freedom during the reconfiguration without causing performance degradation such as increased latency or decreased

  15. Introduction

    NASA Astrophysics Data System (ADS)

    de Laat, Cees; Develder, Chris; Jukan, Admela; Mambretti, Joe

    This topic is devoted to communication issues in scalable compute and storage systems, such as parallel computers, networks of workstations, and clusters. All aspects of communication in modern systems were solicited, including advances in the design, implementation, and evaluation of interconnection networks, network interfaces, system and storage area networks, on-chip interconnects, communication protocols, routing and communication algorithms, and communication aspects of parallel and distributed algorithms. In total 15 papers were submitted to this topic of which we selected the 7 strongest papers. We grouped the papers in two sessions of 3 papers each and one paper was selected for the best paper session. We noted a number of papers dealing with changing topologies, stability and forwarding convergence in source routing based cluster interconnect network architectures. We grouped these for the first session. The authors of the paper titled: “Implementing a Change Assimilation Mechanism for Source Routing Interconnects” propose a mechanism that can obtain the new topology, and compute and distribute a new set of fabric paths to the source routed network end points to minimize the impact on the forwarding service. The article entitled “Dependability Analysis of a Fault-tolerant Network Reconfiguration Strateg” reports on a case study analyzing the effects of network size, mean time to node failure, mean time to node repair, mean time to network repair and coverage of the failure when using a 2D mesh network with a fault-tolerant mechanism (similar to the one used in the BlueGene/L system), that is able to remove rows and/or columns in the presence of failures. The last paper in this session: “RecTOR: A New and Efficient Method for Dynamic Network Reconfiguration” presents a new dynamic reconfiguration method, that ensures deadlock-freedom during the reconfiguration without causing performance degradation such as increased latency or decreased

  16. Introduction

    NASA Astrophysics Data System (ADS)

    Koper, Rob

    In 2003 we started a new research programme at the Centre for Learning Sciences and Technologies (CELSTEC) that was aiming to help people to further develop their professional competences by using the innovative powers of new media, mobile devices, and modern Internet services. The idea behind the programme was to contribute to one of the bigger challenges in our society: how to deal with the growing complexity, the growing quantity and the permanent changes in knowledge and technologies. For companies this question relates to the core of their business: how to become innovative and stay competitive. For the employees, the ‘professionals’, this question relates directly to their jobs: how to become and stay employable. In this book we will concentrate on the last group, the professionals and their question how to stay employable, how to keep up-to-date and how to develop professional competence during their careers. The professionals represent the human capital, the knowledge, the innovative power in our economy.

  17. Introduction

    NASA Astrophysics Data System (ADS)

    Ben-Menahem, Yemima; Hemmo, Meir

    Questions concerning the meaning of probability and its applications in physics are notoriously subtle. In the philosophy of the exact sciences, the conceptual analysis of the foundations of a theory often lags behind the discovery of the mathematical results that form its basis. The theory of probability is no exception. Although Kolmogorov's axiomatization of the theory [1] is generally considered definitive, the meaning of the notion of probability remains a matter of controversy.1 Questions pertain both to gaps between the formalism and the intuitive notions of probability and to the inter-relationships between the intuitive notions. Further, although each of the interpretations of the notion of probability is usually intended to be adequate throughout, independently of context, the various applications of the theory of probability pull in different interpretative directions: some applications, say in decision theory, are amenable to a subjective interpretation of probability as representing an agent's degree of belief, while others, say in genetics, call upon an objective notion of probability that characterizes certain biological phenomena. In this volume we focus on the role of probability in physics. We have the dual goal and challenge of bringing the analysis of the notion of probability to bear on the meaning of the physical theories that employ it, and of using the prism of physics to study the notion of probability.

  18. Introduction

    NASA Astrophysics Data System (ADS)

    Kobayashi, T.

    In the history of modern physics and engineering, the electron quantum mechanical effect and its utilization in electronics have attracted much attention. With increase in demand for ultrahigh sensitivity of signal sensing, ultrahigh speed of data processing, ultralow power dissipation of computer components and so on, quantum effect electronics has become more and more promising. Since the middle of the twentieth century most of vacuum electronics have been replaced by the solid state electronics, where the electron dynamics are well described by the band-diagram description. Solid state electronics itself and band-diagram description were originally in the category of quantum mechanics. However, the treatment of carriers based on the band-diagram inside semiconductors used the classical model where the electron wave concept has been missing. One should perceive it to be also true even for semiconductor superlattices. In the late twentieth century, along with the extremely miniaturized scale of semiconductor devices, mesoscopic physics and mesoscopic electronics have boomed. In this research area, one attempts to manipulate directly the coherent electron wave instead of the electron particle. In ordinary semiconductors, however, only the nanoscale dimension allowed us to handle electron wave interference, interaction and so on to some extent. Besides, success was obtained only at cryogenic temperatures. Collisions between electrons or between electron and lattice (or impurity) was recognized again as a forcible enemy of electron wave engineering. It was a time when both researchers and engineers in the field were urged forward to search for better physical and engineering stages where no electron collisions take place thereby maintaining electron wave coherency over very long distances in the appropriate temperature range.

  19. Progress on introduction of rust resistance genes into confection sunflower

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sunflower rust (Puccinia helianthi) emerged as a serious disease in the last few years. Confection sunflower is particularly vulnerable to the disease due to the lack of resistance sources. The objectives of this project are to transfer rust resistance genes from oil sunflower to confectionery sunfl...

  20. Energy, genes and evolution: introduction to an evolutionary synthesis.

    PubMed

    Lane, Nick; Martin, William F; Raven, John A; Allen, John F

    2013-07-19

    Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. No energy, no evolution. The 'modern synthesis' of the past century explained evolution in terms of genes, but this is only part of the story. While the mechanisms of natural selection are correct, and increasingly well understood, they do little to explain the actual trajectories taken by life on Earth. From a cosmic perspective-what is the probability of life elsewhere in the Universe, and what are its probable traits?-a gene-based view of evolution says almost nothing. Irresistible geological and environmental changes affected eukaryotes and prokaryotes in very different ways, ones that do not relate to specific genes or niches. Questions such as the early emergence of life, the morphological and genomic constraints on prokaryotes, the singular origin of eukaryotes, and the unique and perplexing traits shared by all eukaryotes but not found in any prokaryote, are instead illuminated by bioenergetics. If nothing in biology makes sense except in the light of evolution, nothing in evolution makes sense except in the light of energetics. This Special Issue of Philosophical Transactions examines the interplay between energy transduction and genome function in the major transitions of evolution, with implications ranging from planetary habitability to human health. We hope that these papers will contribute to a new evolutionary synthesis of energetics and genetics. PMID:23754807

  1. Energy, genes and evolution: introduction to an evolutionary synthesis

    PubMed Central

    Lane, Nick; Martin, William F.; Raven, John A.; Allen, John F.

    2013-01-01

    Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. No energy, no evolution. The ‘modern synthesis’ of the past century explained evolution in terms of genes, but this is only part of the story. While the mechanisms of natural selection are correct, and increasingly well understood, they do little to explain the actual trajectories taken by life on Earth. From a cosmic perspective—what is the probability of life elsewhere in the Universe, and what are its probable traits?—a gene-based view of evolution says almost nothing. Irresistible geological and environmental changes affected eukaryotes and prokaryotes in very different ways, ones that do not relate to specific genes or niches. Questions such as the early emergence of life, the morphological and genomic constraints on prokaryotes, the singular origin of eukaryotes, and the unique and perplexing traits shared by all eukaryotes but not found in any prokaryote, are instead illuminated by bioenergetics. If nothing in biology makes sense except in the light of evolution, nothing in evolution makes sense except in the light of energetics. This Special Issue of Philosophical Transactions examines the interplay between energy transduction and genome function in the major transitions of evolution, with implications ranging from planetary habitability to human health. We hope that these papers will contribute to a new evolutionary synthesis of energetics and genetics. PMID:23754807

  2. Strategies used for genetically modifying bacterial genome: site-directed mutagenesis, gene inactivation, and gene over-expression.

    PubMed

    Xu, Jian-zhong; Zhang, Wei-guo

    2016-02-01

    With the availability of the whole genome sequence of Escherichia coli or Corynebacterium glutamicum, strategies for directed DNA manipulation have developed rapidly. DNA manipulation plays an important role in understanding the function of genes and in constructing novel engineering bacteria according to requirement. DNA manipulation involves modifying the autologous genes and expressing the heterogenous genes. Two alternative approaches, using electroporation linear DNA or recombinant suicide plasmid, allow a wide variety of DNA manipulation. However, the over-expression of the desired gene is generally executed via plasmid-mediation. The current review summarizes the common strategies used for genetically modifying E. coli and C. glutamicum genomes, and discusses the technical problem of multi-layered DNA manipulation. Strategies for gene over-expression via integrating into genome are proposed. This review is intended to be an accessible introduction to DNA manipulation within the bacterial genome for novices and a source of the latest experimental information for experienced investigators. PMID:26834010

  3. Strategies used for genetically modifying bacterial genome: ite-directed mutagenesis, gene inactivation, and gene over-expression*

    PubMed Central

    Xu, Jian-zhong; Zhang, Wei-guo

    2016-01-01

    With the availability of the whole genome sequence of Escherichia coli or Corynebacterium glutamicum, strategies for directed DNA manipulation have developed rapidly. DNA manipulation plays an important role in understanding the function of genes and in constructing novel engineering bacteria according to requirement. DNA manipulation involves modifying the autologous genes and expressing the heterogenous genes. Two alternative approaches, using electroporation linear DNA or recombinant suicide plasmid, allow a wide variety of DNA manipulation. However, the over-expression of the desired gene is generally executed via plasmid-mediation. The current review summarizes the common strategies used for genetically modifying E. coli and C. glutamicum genomes, and discusses the technical problem of multi-layered DNA manipulation. Strategies for gene over-expression via integrating into genome are proposed. This review is intended to be an accessible introduction to DNA manipulation within the bacterial genome for novices and a source of the latest experimental information for experienced investigators. PMID:26834010

  4. Introduction to direct variational and moment methods and an application to the Child-Langmuir law

    NASA Astrophysics Data System (ADS)

    Anderson, D.; Desaix, M.

    2015-11-01

    A short introduction is given of direct variational methods and its relation to Galerkin and moment methods, all flexible and powerful approaches for finding approximate solutions of difficult physical equations. A pedagogical application of moment methods is given to the physically and technically important Child-Langmuir law in electron physics. The analysis is shown to provide simple, yet accurate, approximate solutions of the two-dimensional problem (a problem which does not allow an exact analytical solution) and illustrates the usefulness and the power of moment methods.

  5. In vitro culture of embryonic mouse intestinal epithelium: cell differentiation and introduction of reporter genes

    PubMed Central

    Quinlan, Jonathan M; Yu, Wei-Yuan; Hornsey, Mark A; Tosh, David; Slack, Jonathan MW

    2006-01-01

    Background Study of the normal development of the intestinal epithelium has been hampered by a lack of suitable model systems, in particular ones that enable the introduction of exogenous genes. Production of such a system would advance our understanding of normal epithelial development and help to shed light on the pathogenesis of intestinal neoplasia. The criteria for a reliable culture system include the ability to perform real time observations and manipulations in vitro, the preparation of wholemounts for immunostaining and the potential for introducing genes. Results The new culture system involves growing mouse embryo intestinal explants on fibronectin-coated coverslips in basal Eagle's medium+20% fetal bovine serum. Initially the cultures maintain expression of the intestinal transcription factor Cdx2 together with columnar epithelial (cytokeratin 8) and mesenchymal (smooth muscle actin) markers. Over a few days of culture, differentiation markers appear characteristic of absorptive epithelium (sucrase-isomaltase), goblet cells (Periodic Acid Schiff positive), enteroendocrine cells (chromogranin A) and Paneth cells (lysozyme). Three different approaches were tested to express genes in the developing cultures: transfection, electroporation and adenoviral infection. All could introduce genes into the mesenchyme, but only to a small extent into the epithelium. However the efficiency of adenovirus infection can be greatly improved by a limited enzyme digestion, which makes accessible the lateral faces of cells bearing the Coxsackie and Adenovirus Receptor. This enables reliable delivery of genes into epithelial cells. Conclusion We describe a new in vitro culture system for the small intestine of the mouse embryo that recapitulates its normal development. The system both provides a model for studying normal development of the intestinal epithelium and also allows for the manipulation of gene expression. The explants can be cultured for up to two weeks, they

  6. The Comparative Utility of Viromer RED and Lipofectamine for Transient Gene Introduction into Glial Cells

    PubMed Central

    Rao, Sudheendra; Morales, Alejo A.; Pearse, Damien D.

    2015-01-01

    The introduction of genes into glial cells for mechanistic studies of cell function and as a therapeutic for gene delivery is an expanding field. Though viral vector based systems do exhibit good delivery efficiency and long-term production of the transgene, the need for transient gene expression, broad and rapid gene setup methodologies, and safety concerns regarding in vivo application still incentivize research into the use of nonviral gene delivery methods. In the current study, aviral gene delivery vectors based upon cationic lipid (Lipofectamine 3000) lipoplex or polyethylenimine (Viromer RED) polyplex technologies were examined in cell lines and primary glial cells for their transfection efficiencies, gene expression levels, and toxicity. The transfection efficiencies of polyplex and lipoplex agents were found to be comparable in a limited, yet similar, transfection setting, with or without serum across a number of cell types. However, differential effects on cell-specific transgene expression and reduced viability with cargo loaded polyplex were observed. Overall, our data suggests that polyplex technology could perform comparably to the market dominant lipoplex technology in transfecting various cells lines including glial cells but also stress a need for further refinement of polyplex reagents to minimize their effects on cell viability. PMID:26539498

  7. Introduction of Foreign Genes into Tissues of Living Mice by DNA-Coated Microprojectiles

    NASA Astrophysics Data System (ADS)

    Sanders Williams, R.; Johnston, Stephen A.; Riedy, Mark; Devit, Michael J.; McElligott, Sandra G.; Sanford, John C.

    1991-04-01

    Foreign genes were expressed in liver and skin cells of live mice by using a new apparatus to accelerate DNA-coated microprojectiles into tissues. After introduction of a plasmid in which the firefly luciferase gene was controlled by the human β-actin promoter, luciferase activity was detectable for up to 14 days in mouse tissues (skin and liver). In situ hybridization histochemistry revealed that microprojectiles penetrated through multiple cell layers without evidence of tissue injury and that 10-20% of the cells in the bombarded area expressed the foreign gene. An advantage of the new design is that internal organs, such as liver, can be transfected without subjecting the tissue to a vacuum. This procedure potentially is applicable to a wide variety of tissues and cell types for studies of transcriptional control elements and for expression of foreign proteins in intact animals.

  8. Genes directing flower development in Arabidopsis.

    PubMed Central

    Bowman, J L; Smyth, D R; Meyerowitz, E M

    1989-01-01

    We describe the effects of four recessive homeotic mutations that specifically disrupt the development of flowers in Arabidopsis thaliana. Each of the recessive mutations affects the outcome of organ development, but not the location of organ primordia. Homeotic transformations observed are as follows. In agamous-1, stamens to petals; in apetala2-1, sepals to leaves and petals to staminoid petals; in apetala3-1, petals to sepals and stamens to carpels; in pistillata-1, petals to sepals. In addition, two of these mutations (ap2-1 and pi-1) result in loss of organs, and ag-1 causes the cells that would ordinarily form the gynoecium to differentiate as a flower. Two of the mutations are temperature-sensitive. Temperature shift experiments indicate that the wild-type AP2 gene product acts at the time of primordium initiation; the AP3 product is active later. It seems that the wild-type alleles of these four genes allow cells to determine their place in the developing flower and thus to differentiate appropriately. We propose that these genes may be involved in setting up or responding to concentric, overlapping fields within the flower primordium. PMID:2535466

  9. Gene marking and gene therapy directed at primary hematopoietic cells.

    PubMed

    Dunbar, C E; Young, N S

    1996-11-01

    The past year has been a very active one in the field of gene transfer to hematopoietic targets, specifically stem cells and T cells. A number of clinical trials were published that both demonstrated progress as well as identified problems that investigators will face in trying to make the technology therapeutically applicable. Important laboratory and animal experiments focused on predictive models for human stem cell behavior, methods for culturing and expanding primitive cells ex vivo, immune responses against transgenes, in vitro and in vivo selection of transduced cells, and alternatives to standard retroviral vectors. PMID:9372114

  10. Size dependence of the bandgap of plasma synthesized silicon nanoparticles through direct introduction of sulfur hexafluoride

    NASA Astrophysics Data System (ADS)

    Theingi, S.; Guan, T. Y.; Kendrick, C.; Klafehn, G.; Gorman, B. P.; Taylor, P. C.; Lusk, M. T.; Stradins, P.; Collins, R. T.

    2015-10-01

    Developing silicon nanoparticle (SiNP) synthesis techniques that allow for straightforward control of nanoparticle size and associated optical properties is critical to potential applications of these materials. In addition, it is, in general, hard to probe the absorption threshold in these materials due to silicon's low absorption coefficient. In this study, size is controlled through direct introduction of sulfur hexafluoride (SF6) into the dilute silane precursor of plasma synthesized SiNPs. Size reduction by nearly a factor of two with high crystallinity independent of size is demonstrated. The optical absorption spectra of the SiNPs in the vicinity of the bandgap are measured using photothermal deflection spectroscopy. Bandgap as a function of size is extracted taking into account the polydispersity of the samples. A systematic blue shift in absorption edge due to quantum confinement in the SiNPs is observed with increasing flow of SF6. Photoluminescence (PL) spectra show a similar blue shift with size. However, a ˜300 meV difference in energy between emission and absorption for all sizes suggests that PL emission involves a defect related process. This shows that, while PL may allow size-induced shifts in the bandgap of SiNPs to be monitored, it cannot be relied on to give an accurate value for the bandgap as a function of size.

  11. Size dependence of the bandgap of plasma synthesized silicon nanoparticles through direct introduction of sulfur hexafluoride

    SciTech Connect

    Theingi, S.; Guan, T. Y.; Klafehn, G.; Taylor, P. C.; Lusk, M. T.; Collins, R. T.; Kendrick, C.; Gorman, B. P.; Stradins, P.

    2015-10-19

    Developing silicon nanoparticle (SiNP) synthesis techniques that allow for straightforward control of nanoparticle size and associated optical properties is critical to potential applications of these materials. In addition, it is, in general, hard to probe the absorption threshold in these materials due to silicon's low absorption coefficient. In this study, size is controlled through direct introduction of sulfur hexafluoride (SF{sub 6}) into the dilute silane precursor of plasma synthesized SiNPs. Size reduction by nearly a factor of two with high crystallinity independent of size is demonstrated. The optical absorption spectra of the SiNPs in the vicinity of the bandgap are measured using photothermal deflection spectroscopy. Bandgap as a function of size is extracted taking into account the polydispersity of the samples. A systematic blue shift in absorption edge due to quantum confinement in the SiNPs is observed with increasing flow of SF{sub 6}. Photoluminescence (PL) spectra show a similar blue shift with size. However, a ∼300 meV difference in energy between emission and absorption for all sizes suggests that PL emission involves a defect related process. This shows that, while PL may allow size-induced shifts in the bandgap of SiNPs to be monitored, it cannot be relied on to give an accurate value for the bandgap as a function of size.

  12. Size Dependence of the Bandgap of Plasma Synthesized Silicon Nanoparticles Through Direct Introduction of Sulfur Hexafluoride

    SciTech Connect

    Theingi, S.; Guan, T. Y.; Kendrick, C.; Klafehn, G.; Gorman, B. P.; Taylor, P. C.; Lusk, M. T.; Stradins, Pauls; Collins, R. T.

    2015-10-19

    Developing silicon nanoparticle (SiNP) synthesis techniques that allow for straightforward control of nanoparticle size and associated optical properties is critical to potential applications of these materials. In addition, it is, in general, hard to probe the absorption threshold in these materials due to silicon's low absorption coefficient. In this study, size is controlled through direct introduction of sulfur hexafluoride (SF6) into the dilute silane precursor of plasma synthesized SiNPs. Size reduction by nearly a factor of two with high crystallinity independent of size is demonstrated. Optical absorption spectra of the SiNPs in the vicinity of the bandgap are measured using photothermal deflection spectroscopy. Bandgap as a function of size is extracted taking into account the polydispersity of the samples. A systematic blue shift inabsorption edge due to quantum confinement in the SiNPs is observed with increasing flow of SF6. Photoluminescence (PL) spectra show a similar blue shift with size. However, a ~300 meV difference in energy between emission and absorption for all sizes suggests that PL emission involves a defect related process. While PL may allow size-induced shifts in the bandgap of SiNPs to be monitored, it cannot be relied on to give an accurate value for the bandgap as a function of size.

  13. Introduction of yeast artificial chromosomes containing mutant human amyloid precursor protein genes into transgenic mice

    SciTech Connect

    Call, L.M.; Lamb, B.T.; Boese, K.F.

    1994-09-01

    Several hypothetical mechanisms have been proposed for the generation and deposition of the amyloid beta (A{beta}) peptide in Alzheimer`s disease (AD). These include overexpression of the amyloid precursor protein (APP) gene, as suggested by Down Syndrome (DS, trisomy 21), and mutation of APP, as suggested by mutations associated with the presence of disease/amyloid deposition in some cases of familial AD (FAD). Although numerous in vitro studies have lead to certain insights into the molecular basis for amyloid deposition, the mechanisms(s) of amyloidogenesis in vivo remains poorly defined. To examine the effect of FAD mutations on amyloidogenesis in an animal model, we have focused on producing APP YAC transgenic mice containing the human APP gene with FAD mutations. These APP YAC transgenics are being produced by introduction of a 650 kb APP YAC through lipid-mediated transfection of ES cells. This strategy has two principal advantages: the APP genomic sequences contain transcriptional regulatory elements required for proper spatial and temporal expression and contain appropriate splice donor and acceptor sites needed to generate the entire spectrum of alternatively spliced APP transcripts. As a first step, we cloned the genomic regions surrounding APP exons 16 and 17 from an APP YAC sublibrary. Both the Swedish and the 717 mutations were then introduced into exons 16 and 17, respectively, by PCR mutagenesis, and subsequently transferred into the 650 kb APP YAC by a two step gene replacement in yeast. The mutant YACs have been introduced into ES cells, and we have determined that these cells are expressing human mutant APP mRNA and protein. These cells are being used to generate transgenic mice. This paradigm should provide the appropriate test of whether a mutant APP gene is capable of producing AD-like pathology in a mouse model.

  14. Simulation of gene evolution under directional mutational pressure

    NASA Astrophysics Data System (ADS)

    Dudkiewicz, Małgorzata; Mackiewicz, Paweł; Kowalczuk, Maria; Mackiewicz, Dorota; Nowicka, Aleksandra; Polak, Natalia; Smolarczyk, Kamila; Banaszak, Joanna; R. Dudek, Mirosław; Cebrat, Stanisław

    2004-05-01

    The two main mechanisms generating the genetic diversity, mutation and recombination, have random character but they are biased which has an effect on the generation of asymmetry in the bacterial chromosome structure and in the protein coding sequences. Thus, like in a case of two chiral molecules-the two possible orientations of a gene in relation to the topology of a chromosome are not equivalent. Assuming that the sequence of a gene may oscillate only between certain limits of its structural composition means that the gene could be forced out of these limits by the directional mutation pressure, in the course of evolution. The probability of the event depends on the time the gene stays under the same mutation pressure. Inversion of the gene changes the directional mutational pressure to the reciprocal one and hence it changes the distance of the gene to its lower and upper bound of the structural tolerance. Using Monte Carlo methods we were able to simulate the evolution of genes under experimentally found mutational pressure, assuming simple mechanisms of selection. We found that the mutation and recombination should work in accordance to lower their negative effects on the function of the products of coding sequences.

  15. Site-Specific Gene Expression in Vivo by Direct Gene Transfer into the Arterial Wall

    NASA Astrophysics Data System (ADS)

    Nabel, Elizabeth G.; Plautz, Gregory; Nabel, Gary J.

    1990-09-01

    A recombinant β-galactosidase gene has been expressed in a specific arterial segment in vivo by direct infection with a murine amphotropic retroviral vector or by DNA transfection with the use of liposomes. Several cell types in the vessel wall were transduced, including endothelial and vascular smooth muscle cells. After retroviral infection, a recombinant reporter gene was expressed for at least 5 months, and no helper virus was detected. Recombinant gene expression achieved by direct retroviral infection or liposome-mediated DNA transfection was limited to the site of infection and was absent from liver, lung, kidney, and spleen. These results demonstrate that site-specific gene expression can be achieved by direct gene transfer in vivo and could be applied to the treatment of such human diseases as atherosclerosis or cancer.

  16. GeneGenie: optimized oligomer design for directed evolution

    PubMed Central

    Swainston, Neil; Currin, Andrew; Day, Philip J.; Kell, Douglas B.

    2014-01-01

    GeneGenie, a new online tool available at http://www.gene-genie.org, is introduced to support the design and self-assembly of synthetic genes and constructs. GeneGenie allows for the design of oligonucleotide cohorts encoding the gene sequence optimized for expression in any suitable host through an intuitive, easy-to-use web interface. The tool ensures consistent oligomer overlapping melting temperatures, minimizes the likelihood of misannealing, optimizes codon usage for expression in a selected host, allows for specification of forward and reverse cloning sequences (for downstream ligation) and also provides support for mutagenesis or directed evolution studies. Directed evolution studies are enabled through the construction of variant libraries via the optional specification of ‘variant codons’, containing mixtures of bases, at any position. For example, specifying the variant codon TNT (where N is any nucleotide) will generate an equimolar mixture of the codons TAT, TCT, TGT and TTT at that position, encoding a mixture of the amino acids Tyr, Ser, Cys and Phe. This facility is demonstrated through the use of GeneGenie to develop and synthesize a library of enhanced green fluorescent protein variants. PMID:24782527

  17. Basic Business and Economics: New Directions for Introduction to Business at the Collegiate Level.

    ERIC Educational Resources Information Center

    Manzer, John P.

    1979-01-01

    Discusses objectives of the introduction to business course: to provide some basic knowledge of business and economics for non-business majors; to serve as a foundation course for majors in specific areas of business; and to satisfy personal interests. Notes various teaching strategies and areas of needed research on content and teaching…

  18. Nucleotide sequence of the thermostable direct hemolysin gene of Vibrio parahaemolyticus.

    PubMed Central

    Nishibuchi, M; Kaper, J B

    1985-01-01

    The gene encoding the thermostable direct hemolysin of Vibrio parahaemolyticus was characterized. This gene (designated tdh) was subcloned into pBR322 in Escherichia coli, and the functional tdh gene was localized to a 1.3-kilobase HindIII fragment. This fragment was sequenced, and the structural gene was found to encode a mature protein of 165 amino acid residues. The mature protein sequence was preceded by a putative signal peptide sequence of 24 amino acids. A putative tdh promoter, determined by its similarity to concensus sequences, was not functional in E. coli. However, a promoter that was functional in E. coli was shown to exist further upstream by use of a promoter probe plasmid. A 5.7-kilobase SalI fragment containing the structural gene and both potential promoters was cloned into a broad-host-range plasmid and mobilized into a Kanagawa phenomenon-negative V. parahaemolyticus strain. In contrast to E. coli, where the hemolysin was detected only in cell lysates, introduction of the cloned gene into V. parahaemolyticus resulted in the production of extracellular hemolysin. Images PMID:3988703

  19. Short torch design for direct liquid sample introduction using conventional and micro-nebulizers for plasma spectrometry

    SciTech Connect

    Montaser, Akbar; Westphal, Craig S.; Kahen, Kaveh; Rutkowski, William F.

    2008-01-08

    An apparatus and method for providing direct liquid sample introduction using a nebulizer are provided. The apparatus and method include a short torch having an inner tube and an outer tube, and an elongated adapter having a cavity for receiving the nebulizer and positioning a nozzle tip of the nebulizer a predetermined distance from a tip of the outer tube of the short torch. The predetermined distance is preferably about 2-5 mm.

  20. Excision of plastid marker genes using directly repeated DNA sequences.

    PubMed

    Mudd, Elisabeth A; Madesis, Panagiotis; Avila, Elena Martin; Day, Anil

    2014-01-01

    Excision of marker genes using DNA direct repeats makes use of the predominant homologous recombination pathways present in the plastids of algae and plants. The method is simple, efficient, and widely applicable to plants and microalgae. Marker excision frequency is dependent on the length and number of directly repeated sequences. When two repeats are used a repeat size of greater than 600 bp promotes efficient excision of the marker gene. A wide variety of sequences can be used to make the direct repeats. Only a single round of transformation is required, and there is no requirement to introduce site-specific recombinases by retransformation or sexual crosses. Selection is used to maintain the marker and ensure homoplasmy of transgenic plastid genomes. Release of selection allows the accumulation of marker-free plastid genomes generated by marker excision, which is spontaneous, random, and a unidirectional process. Positive selection is provided by linking marker excision to restoration of the coding region of an herbicide resistance gene from two overlapping but incomplete coding regions. Cytoplasmic sorting allows the segregation of cells with marker-free transgenic plastids. The marker-free shoots resulting from direct repeat-mediated excision of marker genes have been isolated by vegetative propagation of shoots in the T0 generation. Alternatively, accumulation of marker-free plastid genomes during growth, development and flowering of T0 plants allows the collection of seeds that give rise to a high proportion of marker-free T1 seedlings. The simplicity and convenience of direct repeat excision facilitates its widespread use to isolate marker-free crops. PMID:24599849

  1. ARID3B Directly Regulates Ovarian Cancer Promoting Genes

    PubMed Central

    Bobbs, Alexander; Gellerman, Katrina; Hallas, William Morgan; Joseph, Stancy; Yang, Chao; Kurkewich, Jeffrey; Cowden Dahl, Karen D.

    2015-01-01

    The DNA-binding protein AT-Rich Interactive Domain 3B (ARID3B) is elevated in ovarian cancer and increases tumor growth in a xenograft model of ovarian cancer. However, relatively little is known about ARID3B's function. In this study we perform the first genome wide screen for ARID3B direct target genes and ARID3B regulated pathways. We identified and confirmed numerous ARID3B target genes by chromatin immunoprecipitation (ChIP) followed by microarray and quantitative RT-PCR. Using motif-finding algorithms, we characterized a binding site for ARID3B, which is similar to the previously known site for the ARID3B paralogue ARID3A. Functionality of this predicted site was demonstrated by ChIP analysis. We next demonstrated that ARID3B induces expression of its targets in ovarian cancer cell lines. We validated that ARID3B binds to an epidermal growth factor receptor (EGFR) enhancer and increases mRNA expression. ARID3B also binds to the promoter of Wnt5A and its receptor FZD5. FZD5 is highly expressed in ovarian cancer cell lines, and is upregulated by exogenous ARID3B. Both ARID3B and FZD5 expression increase adhesion to extracellular matrix (ECM) components including collagen IV, fibronectin and vitronectin. ARID3B-increased adhesion to collagens II and IV require FZD5. This study directly demonstrates that ARID3B binds target genes in a sequence-specific manner, resulting in increased gene expression. Furthermore, our data indicate that ARID3B regulation of direct target genes in the Wnt pathway promotes adhesion of ovarian cancer cells. PMID:26121572

  2. Direct interplay between two candidate genes in FSHD muscular dystrophy

    PubMed Central

    Ferri, Giulia; Huichalaf, Claudia H.; Caccia, Roberta; Gabellini, Davide

    2015-01-01

    Facioscapulohumeral muscular dystrophy (FSHD) is one of the most common neuromuscular disorders. The major form of the disease (FSHD1) is linked to decrease in copy number of a 3.3-kb tandem repeated macrosatellite (D4Z4), located on chromosome 4q35. D4Z4 deletion alters chromatin structure of the locus leading to aberrant expression of nearby 4q35 genes. Given the high variability in disease onset and progression, multiple factors could contribute to the pathogenesis of FSHD. Among the FSHD candidate genes are double homeobox 4 (DUX4), encoded by the most telomeric D4Z4 unit, and FSHD region gene 1 (FRG1). DUX4 is a sequence-specific transcription factor. Here, we located putative DUX4 binding sites in the human FRG1 genomic area and we show specific DUX4 association to these regions. We found also that ectopically expressed DUX4 up-regulates the endogenous human FRG1 gene in healthy muscle cells, while DUX4 knockdown leads to a decrease in FRG1 expression in FSHD muscle cells. Moreover, DUX4 binds directly and specifically to its binding site located in the human FRG1 gene and transactivates constructs containing FRG1 genomic regions. Intriguingly, the mouse Frg1 genomic area lacks DUX4 binding sites and DUX4 is unable to activate the endogenous mouse Frg1 gene providing a possible explanation for the lack of muscle phenotype in DUX4 transgenic mice. Altogether, our results demonstrate that FRG1 is a direct DUX4 transcriptional target uncovering a novel regulatory circuit contributing to FSHD. PMID:25326393

  3. Direct interplay between two candidate genes in FSHD muscular dystrophy.

    PubMed

    Ferri, Giulia; Huichalaf, Claudia H; Caccia, Roberta; Gabellini, Davide

    2015-03-01

    Facioscapulohumeral muscular dystrophy (FSHD) is one of the most common neuromuscular disorders. The major form of the disease (FSHD1) is linked to decrease in copy number of a 3.3-kb tandem repeated macrosatellite (D4Z4), located on chromosome 4q35. D4Z4 deletion alters chromatin structure of the locus leading to aberrant expression of nearby 4q35 genes. Given the high variability in disease onset and progression, multiple factors could contribute to the pathogenesis of FSHD. Among the FSHD candidate genes are double homeobox 4 (DUX4), encoded by the most telomeric D4Z4 unit, and FSHD region gene 1 (FRG1). DUX4 is a sequence-specific transcription factor. Here, we located putative DUX4 binding sites in the human FRG1 genomic area and we show specific DUX4 association to these regions. We found also that ectopically expressed DUX4 up-regulates the endogenous human FRG1 gene in healthy muscle cells, while DUX4 knockdown leads to a decrease in FRG1 expression in FSHD muscle cells. Moreover, DUX4 binds directly and specifically to its binding site located in the human FRG1 gene and transactivates constructs containing FRG1 genomic regions. Intriguingly, the mouse Frg1 genomic area lacks DUX4 binding sites and DUX4 is unable to activate the endogenous mouse Frg1 gene providing a possible explanation for the lack of muscle phenotype in DUX4 transgenic mice. Altogether, our results demonstrate that FRG1 is a direct DUX4 transcriptional target uncovering a novel regulatory circuit contributing to FSHD. PMID:25326393

  4. Targeted gene knockout by direct delivery of ZFN proteins

    PubMed Central

    Gaj, Thomas; Guo, Jing; Kato, Yoshio; Sirk, Shannon J.; Barbas, Carlos F.

    2012-01-01

    Zinc-finger nucleases (ZFNs) are versatile reagents that have redefined genome engineering. Realizing the full potential of this technology requires the development of safe and effective methods for delivering ZFNs into cells. We demonstrate the intrinsic cell-penetrating capabilities of the standard ZFN architecture and show that direct delivery of ZFNs as proteins leads to efficient endogenous gene disruption in a variety of mammalian cell types with minimal off-target effects. PMID:22751204

  5. Genomewide Identification of Genes Under Directional Selection: Gene Transcription QST Scan in Diverging Atlantic Salmon Subpopulations

    PubMed Central

    Roberge, C.; Guderley, H.; Bernatchez, L.

    2007-01-01

    Evolutionary genomics has benefited from methods that allow identifying evolutionarily important genomic regions on a genomewide scale, including genome scans and QTL mapping. Recently, genomewide scanning by means of microarrays has permitted assessing gene transcription differences among species or populations. However, the identification of differentially transcribed genes does not in itself suffice to measure the role of selection in driving evolutionary changes in gene transcription. Here, we propose and apply a “transcriptome scan” approach to investigating the role of selection in shaping differential profiles of gene transcription among populations. We compared the genomewide transcription levels between two Atlantic salmon subpopulations that have been diverging for only six generations. Following assessment of normality and unimodality on a gene-per-gene basis, the additive genetic basis of gene transcription was estimated using the animal model. Gene transcription h2 estimates were significant for 1044 (16%) of all detected cDNA clones. In an approach analogous to that of genome scans, we used the distribution of the QST values estimated from intra- and intersubpopulation additive genetic components of the transcription profiles to identify 16 outlier genes (average QST estimate = 0.11) whose transcription levels are likely to have evolved under the influence of directional selection within six generations only. Overall, this study contributes both empirically and methodologically to the quantitative genetic exploration of gene transcription data. PMID:17720934

  6. Direct Gene Therapy for Bone Regeneration: Gene Delivery, Animal Models, and Outcome Measures

    PubMed Central

    Pelled, Gadi; Ben-Arav, Ayelet; Hock, Colleen; Reynolds, David G.; Yazici, Cemal; Zilberman, Yoram; Gazit, Zulma; Awad, Hani; Gazit, Dan

    2010-01-01

    While various problems with bone healing remain, the greatest clinical change is the absence of an effective approach to manage large segmental defects in limbs and craniofacial bones caused by trauma or cancer. Thus, nontraditional forms of medicine, such as gene therapy, have been investigated as a potential solution. The use of osteogenic genes has shown great potential in bone regeneration and fracture healing. Several methods for gene delivery to the fracture site have been described. The majority of them include a cellular component as the carrying vector, an approach known as cell-mediated gene therapy. Yet, the complexity involved with cell isolation and culture emphasizes the advantages of direct gene delivery as an alternative strategy. Here we review the various approaches of direct gene delivery for bone repair, the choice of animal models, and the various outcome measures required to evaluate the efficiency and safety of each technique. Special emphasis is given to noninvasive, quantitative, in vivo monitoring of gene expression and biodistribution in live animals. Research efforts should aim at inducing a transient, localized osteogenic gene expression within a fracture site to generate an effective therapeutic approach that would eventually lead to clinical use. PMID:20143927

  7. A C++ Infrastructure for Automatic Introduction and Translation of OpenMP Directives

    SciTech Connect

    Quinlan, D J; Scordan, M; Yi, Q; de Supinski, B R

    2003-07-28

    In this paper we describe a C++ infrastructure for source-to-source translation. We demonstrate the translation of a serial program with high-level abstractions to a lower-level parallel program in two separate phases. In the first phase OpenMP directives are introduced, driven by the semantics of high-level abstractions. Then the OpenMP directives are translated to a C++ program that explicitly creates and manages parallelism according to the specified directives. Both phases are implemented using the same mechanisms in our infrastructure.

  8. Cautions on direct gene flow estimation in plant populations.

    PubMed

    Burczyk, Jaroslaw; Chybicki, Igor J

    2004-05-01

    Through simulations we have investigated the statistical properties of two of the main approaches for directly estimating pollen gene flow (m) in plant populations: genotypic exclusion and mating models. When the assumptions about accurately known background pollen pool allelic frequencies are met, both methods provide unbiased results with comparable variances across a range of true m values. However, when presumed allelic frequencies differ from actual ones, which is more likely in research practice, both estimators are biased. We demonstrate that the extent and direction of bias largely depend on the difference (measured as genetic distance) between the presumed and actual pollen pools, and on the degree of genetic differentiation between the local population and the actual background pollen sources. However, one feature of the mating model is its ability to estimate pollen gene flow simultaneously with background pollen pool allelic frequencies. We have found that this approach gives nearly unbiased pollen gene flow estimates, and is practical because it eliminates the necessity of providing independent estimates of background pollen pool allelic frequencies. Violations of the mating model assumptions of random mating within local population affect the precision of the estimates only to a limited degree. PMID:15212377

  9. Enhanced auxeticity in Yukawa systems due to introduction of nanochannels in [001]-direction

    NASA Astrophysics Data System (ADS)

    Tretiakov, Konstantin V.; Pigłowski, Paweł M.; Hyżorek, Krzysztof; Wojciechowski, Krzysztof W.

    2016-05-01

    A new approach to search for materials with auxetic properties by modifying structures of solids at molecular level has been proposed. The analysis of elastic properties of the face-centered cubic Yukawa crystals with very narrow nanochannels in the [001] crystallographic direction using Monte Carlo simulations in the isothermal–isobaric ensemble has been done. An influence of the size of nanochannels on the value of Poisson’s ratio in main crystallographic directions has been studied. It has been shown that the insertion of nanochannels in the system causes a decrease of the Poisson’s ratio in the direction [110][1\\bar{1}0] from –0.15(2) to –0.29(3). That means an amplification of auxetity in the studied system twice as compared to the system without nanochannels.

  10. Towards liver-directed gene therapy: retrovirus-mediated gene transfer into human hepatocytes.

    PubMed

    Grossman, M; Raper, S E; Wilson, J M

    1991-11-01

    Liver-directed gene therapy is being considered in the treatment of inherited metabolic diseases. One approach we are considering is the transplantation of autologous hepatocytes that have been genetically modified with recombinant retroviruses ex vivo. We describe, in this report, techniques for isolating human hepatocytes and efficiently transducing recombinant genes into primary cultures. Hepatocytes were isolated from tissue of four different donors, plated in primary culture, and exposed to recombinant retroviruses expressing either the LacZ reporter gene or the cDNA for rabbit LDL receptor. The efficiency of gene transfer under optimal conditions, as determined by Southern blot analysis, varied from a maximum of one proviral copy per cell to a minimum of 0.1 proviral copy per cell. Cytochemical assays were used to detect expression of the recombinant derived proteins, E. coli beta-galactosidase and rabbit LDL receptor. Hepatocytes transduced with the LDL receptor gene expressed levels of receptor protein that exceeded the normal endogenous levels. The ability to isolate and genetically modify human hepatocytes, as described in this report, is an important step towards the development of liver-directed gene therapies in humans. PMID:1767337

  11. INTRODUCTING A THERMAL DISSIPATION PROBE SYSTEM FOR MEASURING BI-DIRECTIONAL ROOT WATER FLUX

    EPA Science Inventory

    The interest in measuring the direction and magnitude of root sapflow has accelerated in the past few years because of interest in the redistribution of water in the soil by roots. Plant roots have been shown to redistribute water between areas of soil with differing water conte...

  12. Predicting link directionality in gene regulation from gene expression profiles using volatility-constrained correlation.

    PubMed

    Ochiai, Tomoshiro; Nacher, Jose C

    2016-07-01

    To uncover potential disease molecular pathways and signaling networks, we do not only need undirected maps but also we need to infer the directionality of functional or physical interactions between cellular components. A wide range of methods for identifying functional interactions between genes relies on correlations between experimental gene expression measurements to some extent. However, the standard Pearson or Spearman correlation-based approaches can only determine undirected correlations between cellular components. Here, we apply a volatility-constrained correlation method for gene expression profiles that offers a new metric to capture directionality of interactions between genes. To evaluate the predictions we used four datasets distributed by the DREAM5 network inference challenge including an in silico-constructed network and three organisms such as S. aureus, E. coli and S. cerevisiae. The predictions performed by our proposed method were compared to a gold standard of experimentally verified directionality of genetic regulatory links. Our findings show that our method successfully predicts the genetic interaction directionality with a success rate higher than 0.5 with high statistical significance. PMID:27164307

  13. Condensed Phase Membrane Introduction Mass Spectrometry with Direct Electron Ionization: On-line Measurement of PAHs in Complex Aqueous Samples.

    PubMed

    Termopoli, Veronica; Famiglini, Giorgio; Palma, Pierangela; Cappiello, Achille; Vandergrift, Gregory W; Krogh, Erik T; Gill, Chris G

    2016-02-01

    Polycyclic aromatic hydrocarbons (PAHs) are USEPA regulated priority pollutants. Their low aqueous solubility requires very sensitive analytical methods for their detection, typically involving preconcentration steps. Presented is the first demonstrated ‘proof of concept’ use of condensed phase membrane introduction mass spectrometry (CP-MIMS) coupled with direct liquid electron ionization (DEI) for the direct, on-line measurement of PAHs in aqueous samples. DEI is very well suited for the ionization of PAHs and other nonpolar compounds, and is not significantly influenced by the co-elution of matrix components. Linear calibration data for low ppb levels of aqueous naphthalene, anthracene, and pyrene is demonstrated, with measured detection limits of 4 ppb. Analytical response times (t10%–90% signal rise) ranged from 2.8 min for naphthalene to 4.7 min for pyrene. Both intra- and interday reproducibility has been assessed (<3% and 5% RSD, respectively). Direct measurements of ppb level PAHs spiked in a variety of real, complex environmental sample matrices is examined, including natural waters, sea waters, and a hydrocarbon extraction production waste water sample. For these spiked, complex samples, direct PAH measurement by CP-MIMS-DEI yielded minimal signal suppression from sample matrix effects (81%–104%). We demonstrate the use of this analytical approach to directly monitor real-time changes in aqueous PAH concentrations with potential applications for continuous on-line monitoring strategies and binding/adsorption studies in heterogeneous samples. PMID:26471041

  14. Condensed Phase Membrane Introduction Mass Spectrometry with Direct Electron Ionization: On-line Measurement of PAHs in Complex Aqueous Samples

    NASA Astrophysics Data System (ADS)

    Termopoli, Veronica; Famiglini, Giorgio; Palma, Pierangela; Cappiello, Achille; Vandergrift, Gregory W.; Krogh, Erik T.; Gill, Chris G.

    2016-02-01

    Polycyclic aromatic hydrocarbons (PAHs) are USEPA regulated priority pollutants. Their low aqueous solubility requires very sensitive analytical methods for their detection, typically involving preconcentration steps. Presented is the first demonstrated `proof of concept' use of condensed phase membrane introduction mass spectrometry (CP-MIMS) coupled with direct liquid electron ionization (DEI) for the direct, on-line measurement of PAHs in aqueous samples. DEI is very well suited for the ionization of PAHs and other nonpolar compounds, and is not significantly influenced by the co-elution of matrix components. Linear calibration data for low ppb levels of aqueous naphthalene, anthracene, and pyrene is demonstrated, with measured detection limits of 4 ppb. Analytical response times (t10%-90% signal rise) ranged from 2.8 min for naphthalene to 4.7 min for pyrene. Both intra- and interday reproducibility has been assessed (<3% and 5% RSD, respectively). Direct measurements of ppb level PAHs spiked in a variety of real, complex environmental sample matrices is examined, including natural waters, sea waters, and a hydrocarbon extraction production waste water sample. For these spiked, complex samples, direct PAH measurement by CP-MIMS-DEI yielded minimal signal suppression from sample matrix effects (81%-104%). We demonstrate the use of this analytical approach to directly monitor real-time changes in aqueous PAH concentrations with potential applications for continuous on-line monitoring strategies and binding/adsorption studies in heterogeneous samples.

  15. Site-directed introduction of disulfide groups on antibodies for highly sensitive immunosensors.

    PubMed

    Acero Sánchez, Josep Ll; Fragoso, Alex; Joda, Hamdi; Suárez, Guillaume; McNeil, Calum J; O'Sullivan, Ciara K

    2016-07-01

    The interface between the sample and the transducer surface is critical to the performance of a biosensor. In this work, we compared different strategies for covalent self-assembly of antibodies onto bare gold substrates by introducing disulfide groups into the immunoglobulin structure, which acted as anchor molecules able to chemisorb spontaneously onto clean gold surfaces. The disulfide moieties were chemically introduced to the antibody via the primary amines, carboxylic acids, and carbohydrates present in its structure. The site-directed modification via the carbohydrate chains exhibited the best performance in terms of analyte response using a model system for the detection of the stroke marker neuron-specific enolase. SPR measurements clearly showed the potential for creating biologically active densely packed self-assembled monolayers (SAMs) in a one-step protocol compared to both mixed SAMs of alkanethiol compounds and commercial immobilization layers. The ability of the carbohydrate strategy to construct an electrochemical immunosensor was investigated using electrochemical impedance spectroscopy (EIS) and differential pulse voltammetry (DPV) transduction. Graphical Abstract Left: Functionalization strategies of bare gold substrates via direct bio-SAM using disulfide-containing antibody chemically modified via their primary amines (A), carbohydrates (B) and carboxylic acids (C). Right: Dependence of the peak height with NSE concentration at NSE21-CHO modified electrochemical immunosensor. Inset: Logarithmic calibration plot. PMID:27220524

  16. Comparison between Agrobacterium-mediated and direct gene transfer using the gene gun.

    PubMed

    Gao, Caixia; Nielsen, Klaus K

    2013-01-01

    Agrobacterium-mediated transformation and direct gene transfer using the gene gun (microparticle -bombardment) are the two most widely used methods for plant genetic modification. The Agrobacterium method has been successfully practiced in dicots for many years, but only recently have efficient protocols been developed for grasses. Microparticle bombardment has evolved as a method delivering exogenous nucleic acids into plant genome and is a commonly employed technique in plant science. Here these two systems are compared for transformation efficiency, transgene integration, and transgene expression when used to transform tall fescue (Festuca arundinacea Schreb.). The tall fescue transformation protocols lead to the production of large numbers of fertile, independent transgenic lines. PMID:23104329

  17. Oligonucleotide-directed mutagenesis for precision gene editing.

    PubMed

    Sauer, Noel J; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-02-01

    Differences in gene sequences, many of which are single nucleotide polymorphisms, underlie some of the most important traits in plants. With humanity facing significant challenges to increase global agricultural productivity, there is an urgent need to accelerate the development of these traits in plants. oligonucleotide-directed mutagenesis (ODM), one of the many tools of Cibus' Rapid Trait Development System (RTDS(™) ) technology, offers a rapid, precise and non-transgenic breeding alternative for trait improvement in agriculture to address this urgent need. This review explores the application of ODM as a precision genome editing technology, with emphasis on using oligonucleotides to make targeted edits in plasmid, episomal and chromosomal DNA of bacterial, fungal, mammalian and plant systems. The process of employing ODM by way of RTDS technology has been improved in many ways by utilizing a fluorescence conversion system wherein a blue fluorescent protein (BFP) can be changed to a green fluorescent protein (GFP) by editing a single nucleotide of the BFP gene (CAC→TAC; H66 to Y66). For example, dependent on oligonucleotide length, applying oligonucleotide-mediated technology to target the BFP transgene in Arabidopsis thaliana protoplasts resulted in up to 0.05% precisely edited GFP loci. Here, the development of traits in commercially relevant plant varieties to improve crop performance by genome editing technologies such as ODM, and by extension RTDS, is reviewed. PMID:26503400

  18. Xwnt8 directly initiates expression of labial Hox genes.

    PubMed

    In der Rieden, Paul M J; Vilaspasa, Ferran Lloret; Durston, Antony J

    2010-01-01

    Hox transcription factors play an essential role in patterning the anteroposterior axis during embryogenesis and exhibit a complex array of spatial and temporal patterns of expression. Their earliest onset of expression in vertebrates is during gastrulation in a temporally collinear sequence in the presomitic/ventrolateral mesoderm, and it is not clear which upstream signal transduction events initiate this expression. Using Xenopus, we present evidence that Xwnt8 is necessary for initiation of this collinear sequence by activating Hox-1 expression in three Hox clusters: hoxd, hoxa, and hoxb. All three labial genes appear to be direct targets of canonical Wnt signaling through Tcf/Lef. In addition, Xwnt8 loss- and gain-of-function leads to indirect regulation of other Hox genes: Hoxb4, Hoxd4, Hoxa7, Hoxc6, and Hoxc8. These findings shed new light on the early role of Wnt8 as well as of a proposed WNT gradient in patterning the Xenopus central nervous system (Kiecker and Niehrs [2001] Development 128:4189-4201). PMID:19623617

  19. System and method for introduction and stabilization of genes in Thermus sp.

    DOEpatents

    Kayser, Kevin J.; Park, Ho-Shin; Kilbane, II, John J.

    2005-03-01

    A method for introducing and stabilizing heterologous and recombinant genes in a thermophilic host in which a characteristic gene defining a detectable host characteristic is inactivated or deleted from the thermophilic host, resulting in a modified thermophilic host expressing an absence of the detectable host characteristic. A DNA fragment of interest is inserted into the modified thermophilic host together with an intact characteristic gene, whereby the detectable host characteristic is restored to the thermophilic host, thereby enabling detection and confirmation of successful transformation using plasmid vectors and integration of the DNA fragment into the chromosome of the thermophilic host.

  20. Inhibition of cervical carcinoma cell line proliferation by the introduction of a bovine papillomavirus regulatory gene.

    PubMed Central

    Hwang, E S; Riese, D J; Settleman, J; Nilson, L A; Honig, J; Flynn, S; DiMaio, D

    1993-01-01

    Human papillomavirus (HPV) E6 and E7 oncogenes are expressed in the great majority of human cervical carcinomas, whereas the viral E2 regulatory gene is usually disrupted in these cancers. To investigate the roles of the papillomavirus E2 genes in the development and maintenance of cervical carcinoma, the bovine papillomavirus (BPV) E2 gene was acutely introduced into cervical carcinoma cell lines by infection with high-titer stocks of simian virus 40-based recombinant viruses. Expression of the BPV E2 protein in HeLa, C-4I, and MS751 cells results in specific inhibition of the expression of the resident HPV type 18 (HPV18) E6 and E7 genes and in inhibition of cell growth. HeLa cells, in which HPV gene expression is nearly completely abolished, undergo a dramatic and rapid inhibition of proliferation, which appears to be largely a consequence of a block in progression from the G1 to the S phase of the cell cycle. Loss of HPV18 gene expression in HeLa cells is also accompanied by a marked increase in the level of the cellular p53 tumor suppressor protein, apparently as a consequence of abrogation of HPV18 E6-mediated destabilization of p53. The proliferation of HT-3 cells, a human cervical carcinoma cell line devoid of detectable HPV DNA, is also inhibited by E2 expression, whereas two other epithelial cell lines that do not contain HPV DNA are not inhibited. Thus, a number of cervical carcinoma cell lines are remarkably sensitive to growth inhibition by the E2 protein. Although BPV E2-mediated inhibition of HPV18 E6 and E7 expression may contribute to growth inhibition in some of the cervical carcinoma cell lines, the BPV E2 protein also appears to exert a growth-inhibitory effect that is independent of its effects on HPV gene expression. Images PMID:8389903

  1. Direct Imaging of Gene-Carrier Complexes in Animal Cells

    NASA Astrophysics Data System (ADS)

    Lin, Alison J.; Slack, Nelle L.; Ahmad, Ayesha; Matsumoto, Brian; Safinya, Cyrus R.

    1998-03-01

    Cationic lipids are promising gene carriers for DNA transfection. Establishing the correlations between structures of cationic lipid/DNA complexes (CL-DNA) and pathways of transfection will greatly aid us in achieving the optimal CL-DNA transfections. Our first step is to determine the uptake mechanism of DNA by studying the interactions and structures of DNA and cationic lipids. X-ray diffraction shows that the CL-DNA undergoes structural phase transitions from lamellar( J. Raedler, I. Koltover, T. Salditt, C. R. Safinya, Science 275, 810 (1997).) to inverted hexagonal self-assemblies as we change the lipid composition. X-ray diffraction and optical microscopy techniques are used to directly image the progress of the CL-DNA in mouse L-cells and unravel the complex structure in-situ. Fluorescence and confocal optical microscopy techniques allow us to monitor the interactions between the complexes and different organelles in the cell cytoplasm. Current results indicate that once inside cells, complexes containing DOPE follow a different pathway from those containing DOPC. This research is funded by NSF-DMR-9624091, PRF-31352-AC7, and Los Alamos-STB/UC:96-108.

  2. Gene Expression Analysis in the Age of Mass Sequencing: An Introduction.

    PubMed

    Pilarsky, Christian; Nanduri, Lahiri Kanth; Roy, Janine

    2016-01-01

    During the last years the technology used for gene expression analysis has changed dramatically. The old mainstay, DNA microarray, has served its due course and will soon be replaced by next-generation sequencing (NGS), the Swiss army knife of modern high-throughput nucleic acid-based analysis. Therefore preparation technologies have to adapt to suit the emerging NGS technology platform. Moreover, interpretation of the results is still time consuming and employs the use of high-end computers usually not found in molecular biology laboratories. Alternatively, cloud computing might solve this problem. Nevertheless, these new challenges have to be embraced for gene expression analysis in general. PMID:26667455

  3. Introduction to Viral Vectors and Other Delivery Methods for Gene Therapy of the Nervous System.

    PubMed

    Manfredsson, Fredric P

    2016-01-01

    The use of gene therapy in neuroscience research has become common place in many laboratories across the world. However, contrary to common belief, the practical application of viral or non-viral gene therapy is not as straightforward as it may seem. All too often investigators see their experiments fail due to low-quality third-party vectors or due to a lack of knowledge regarding the proper use of these tools. For example, researchers often find themselves performing experiments using the wrong methodology (e.g., using the wrong type of vector or mishandling the vector to the point where the efficacy is significantly reduced) resulting in experiments that potentially fail to accurately answer a hypothesis, or the generation of irreproducible data. Thus, it is important for investigators that seek to utilize gene therapy approaches to gain a basic understanding of how to apply this technology. This includes understanding how to appropriately design and execute an experiment, understanding various delivery vehicles (e.g., what virus to use), delivery methods (e.g., systemic versus intracranial injections), what expression system to use, and the time course involved with a particular expression system. This chapter is intended to present an overview of this fundamental knowledge, providing the researcher with a decision tree upon which to build their gene therapy experiment. PMID:26611575

  4. Iron-biofortification in rice by the introduction of three barley genes participated in mugineic acid biosynthesis with soybean ferritin gene

    PubMed Central

    Masuda, Hiroshi; Kobayashi, Takanori; Ishimaru, Yasuhiro; Takahashi, Michiko; Aung, May S.; Nakanishi, Hiromi; Mori, Satoshi; Nishizawa, Naoko K.

    2013-01-01

    Iron deficiency is a serious problem around the world, especially in developing countries. The production of iron-biofortified rice will help ameliorate this problem. Previously, expression of the iron storage protein, ferritin, in rice using an endosperm-specific promoter resulted in a two-fold increase in iron concentration in the resultant transgenic seeds. However, further over expression of ferritin did not produce an additional increase in the seed iron concentration, and symptoms of iron deficiency were noted in the leaves of the transgenic plants. In the present study, we aimed to further increase the iron concentration in rice seeds without increasing the sensitivity to iron deficiency by enhancing the uptake and transport of iron via a ferric iron chelator, mugineic acid. To this end, we introduced the soybean ferritin gene (SoyferH2) driven by two endosperm-specific promoters, along with the barley nicotianamine synthase gene (HvNAS1), two nicotianamine aminotransferase genes (HvNAAT-A and -B), and a mugineic acid synthase gene (IDS3) to enhance mugineic acid production in rice plants. A marker-free vector was utilized as a means of increasing public acceptance. Representative lines were selected from 102 transformants based on the iron concentration in polished seeds and ferritin accumulation in the seeds. These lines were grown in both commercially supplied soil (iron-sufficient conditions) and calcareous soil (iron-deficient conditions). Lines expressing both ferritin and mugineic acid biosynthetic genes showed signs of iron-deficiency tolerance in calcareous soil. The iron concentration in polished T3 seeds was increased by 4 and 2.5 times, as compared to that in non-transgenic lines grown in normal and calcareous soil, respectively. These results indicate that the concomitant introduction of the ferritin gene and mugineic acid biosynthetic genes effectively increased the seed iron level without causing iron sensitivity under iron-limited conditions

  5. Investigations on the direct introduction of cigarette smoke for trace elements analysis by inductively coupled plasma mass spectrometry

    NASA Astrophysics Data System (ADS)

    Chang, Michael J.; Naworal, John D.; Walker, Kathleen; Connell, Chris T.

    2003-11-01

    Direct introduction of mainstream cigarette smoke into an inductively coupled plasma mass spectrometry (ICP-MS) has been investigated with respect to its feasibility for on-line analysis of trace elements. An automated apparatus was designed and built interfacing a smoking machine with an ICP-MS for smoke generation, collection, injection and analysis. Major and minor elements present in the particulate phase and the gas phase of mainstream cigarette smoke of 2R4F reference cigarettes have been qualitatively identified by examination of their full mass spectra. This method provides a rapid-screening analysis of the transfer of trace elements into mainstream smoke during cigarette combustion. A full suite of elements present in the whole cigarette smoke has been identified, including As, B, Ba, Br, Cd, Cl, Cs, Cu, Hg, I, K, Li, Mn, Na, Pb, Rb, Sb, Sn, Tl and Zn. Of these elements, the major portions of B, Ba, Cs, Cu, K, Li, Mn, Na, Pb, Rb, Sn, Tl and Zn are present in the particulate phase, whereas the major portion of Hg is present in the gas phase. As, Br, Cd, Cl, I and Sb exist in a distribution between the gas phase and the particulate phase. Depending on the element, the precision of measurement ranges from 5 to 25% in terms of relative standard deviation of peak height and peak area, based on the fourth puff of 2R4F mainstream cigarette smoke analyzed in five smoking replicates.

  6. Direct sample introduction gas chromatography and mass spectrometry for the determination of phthalate esters in cleaning products.

    PubMed

    Cacho, J I; Campillo, N; Viñas, P; Hernández-Córdoba, M

    2015-02-01

    A method using direct sample introduction (DSI) coupled to gas chromatography-mass spectrometry (GC-MS) is developed for the determination of six phthalate esters (dimethyl, diethyl, dibutyl, butylbenzyl, diethylhexyl and dioctyl phthalate) in cleaning products. The different variables involved in the DSI step, including venting time and temperature, vaporisation time and temperature, injector heating temperature and gas flow rate and pressure, were evaluated and optimised using Taguchi orthogonal arrays. The proposed method, using calibration against methanolic standards, showed good linearity in the 0.05-15 μg g(-1) range and good repeatability, with RSD values ranging from 3.5% to 5.7%. Quantification limits between 0.010 and 0.041 μg g(-1), depending on the compound, were attained, while recovery assays provided values from 83% to 115%. Twenty-seven cleaning products were analysed using the DSI-GC-MS method, being four phthalates (dimethyl, diethyl, dibutyl and diethylhexyl phthalate) found in fourteen of them at concentration levels in the 0.1-21 μg g(-1) range. Compared with the most common GC injection technique, which uses the split/splitless injector, the proposed DSI procedure provided larger peak areas and lower detection limits, as result of the greater injected volume and reduction in noise. PMID:25582486

  7. Loss of sense transgene-induced post-transcriptional gene silencing by sequential introduction of the same transgene sequences in tobacco.

    PubMed

    Hirai, Sayaka; Takahashi, Kouta; Abiko, Tomomi; Kodama, Hiroaki

    2010-04-01

    RNA silencing is an epigenetic inhibition of gene expression and is guided by small interfering RNAs. Sense transgene-induced post-transcriptional gene silencing (S-PTGS) occurs in a portion of a transgenic plant population. When a sense transgene encoding a tobacco endoplasmic reticulum omega-3 fatty acid desaturase (NtFAD3) was introduced into tobacco plants, an S-PTGS line, S44, was obtained. Introduction of another copy of the NtFAD3 transgene into S44 plants caused a phenotypic change from S-PTGS to overexpression. Because this change was associated with the methylation of the promoter sequences of the transgene, reduced transcriptional activity may abolish S-PTGS and residual transcription of the sense transgene may account for the overexpression. To clarify whether RNA-directed DNA methylation (RdDM) can repress the transcriptional activity of the S44 transgene locus, we introduced several RdDM constructs targeting the transgene promoter. An RdDM construct harboring a 200-bp-long fragment of promoter sequences efficiently abrogated the generation of NtFAD3 small interfering RNAs in S44 plants. Transcription of the transgene was partially repressed, but the resulting NtFAD3 mRNAs successfully accumulated and an overexpressed phenotype was established. Our results indicate an example in which overexpression of the transgene is established by complex epigenetic interactions among the transgenic loci. PMID:20180844

  8. Macrophage mediated PCI enhanced gene-directed enzyme prodrug therapy

    NASA Astrophysics Data System (ADS)

    Christie, Catherine E.; Zamora, Genesis; Kwon, Young J.; Berg, Kristian; Madsen, Steen J.; Hirschberg, Henry

    2015-03-01

    Photochemical internalization (PCI) is a photodynamic therapy-based approach for improving the delivery of macromolecules and genes into the cell cytosol. Prodrug activating gene therapy (suicide gene therapy) employing the transduction of the E. coli cytosine deaminase (CD) gene into tumor cells, is a promising method. Expression of this gene within the target cell produces an enzyme that converts the nontoxic prodrug, 5-FC, to the toxic metabolite, 5-fluorouracil (5-FU). 5-FC may be particularly suitable for brain tumors, because it can readily cross the bloodbrain barrier (BBB). In addition the bystander effect, where activated drug is exported from the transfected cancer cells into the tumor microenvironment, plays an important role by inhibiting growth of adjacent tumor cells. Tumor-associated macrophages (TAMs) are frequently found in and around glioblastomas. Monocytes or macrophages (Ma) loaded with drugs, nanoparticles or photosensitizers could therefore be used to target tumors by local synthesis of chemo attractive factors. The basic concept is to combine PCI, to enhance the ex vivo transfection of a suicide gene into Ma, employing specially designed core/shell NP as gene carrier.

  9. Direct transfer of IL-12 gene into growing Renca tumors.

    PubMed

    Budryk, M; Wilczyńska, U; Szary, J; Szala, S

    2000-01-01

    We investigated the feasibility of transferring naked plasmid DNA containing a therapeutic gene (IL-12) into mice harboring growing Renca tumors. We found that naked DNA transferred into growing Renca and B16(F10) tumors gives higher expression level of reporter gene than complexes of DNA with DDAB/DOPE or DC-Chol/DOPE. Transfer of naked DNA carrying the IL-12 gene into growing Renca tumors causes a distinct therapeutic effect that depends on the time span between inoculation of mice with cancer cells and the beginning of the therapy. Therapy started on day 3 resulted in total cure (100%) of mice. PMID:11051203

  10. Introduction to Gene Editing and Manipulation Using CRISPR/Cas9 Technology.

    PubMed

    Newman, Martin; Ausubel, Frederick M

    2016-01-01

    Until very recently, the prospect of introducing mutations or exogenous DNA sequences at precise locations in the genomes of plants and animals was difficult, if not impossible. This rapidly changed with the demonstration that the type II CRISPR-Cas complex, a bacterial anti-viral surveillance system, could be engineered into a simple and robust platform for introducing double-stranded DNA breaks at nearly any position of plant and animal genomes. The prospect of efficiently creating tailored changes to a gene of interest is revolutionizing biomedical research, allowing exciting new questions to be asked. This overview introduces CRISPR-Cas technology as a tool for molecular biology and briefly discusses the advantages of this method over earlier techniques, as well as unique opportunities to create new avenues of research. © 2016 by John Wiley & Sons, Inc. PMID:27366890

  11. Gene introduction into the mitochondria of Arabidopsis thaliana via peptide-based carriers

    NASA Astrophysics Data System (ADS)

    Chuah, Jo-Ann; Yoshizumi, Takeshi; Kodama, Yutaka; Numata, Keiji

    2015-01-01

    Available methods in plant genetic transformation are nuclear and plastid transformations because similar procedures have not yet been established for the mitochondria. The double membrane and small size of the organelle, in addition to its large population in cells, are major obstacles in mitochondrial transfection. Here we report the intracellular delivery of exogenous DNA localized to the mitochondria of Arabidopsis thaliana using a combination of mitochondria-targeting peptide and cell-penetrating peptide. Low concentrations of peptides were sufficient to deliver DNA into the mitochondria and expression of imported DNA reached detectable levels within a short incubation period (12 h). We found that electrostatic interaction with the cell membrane is not a critical factor for complex internalization, instead, improved intracellular penetration of mitochondria-targeted complexes significantly enhanced gene transfer efficiency. Our results delineate a simple and effective peptide-based method, as a starting point for the development of more sophisticated plant mitochondrial transfection strategies.

  12. Gene introduction into the mitochondria of Arabidopsis thaliana via peptide-based carriers

    PubMed Central

    Chuah, Jo-Ann; Yoshizumi, Takeshi; Kodama, Yutaka; Numata, Keiji

    2015-01-01

    Available methods in plant genetic transformation are nuclear and plastid transformations because similar procedures have not yet been established for the mitochondria. The double membrane and small size of the organelle, in addition to its large population in cells, are major obstacles in mitochondrial transfection. Here we report the intracellular delivery of exogenous DNA localized to the mitochondria of Arabidopsis thaliana using a combination of mitochondria-targeting peptide and cell-penetrating peptide. Low concentrations of peptides were sufficient to deliver DNA into the mitochondria and expression of imported DNA reached detectable levels within a short incubation period (12 h). We found that electrostatic interaction with the cell membrane is not a critical factor for complex internalization, instead, improved intracellular penetration of mitochondria-targeted complexes significantly enhanced gene transfer efficiency. Our results delineate a simple and effective peptide-based method, as a starting point for the development of more sophisticated plant mitochondrial transfection strategies. PMID:25583214

  13. Evaluation of automated direct sample introduction with comprehensive two-dimensional gas chromatography/time-of-flight mass spectrometry for the screening analysis of dioxins of fish oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An automated direct sample introduction technique coupled to comprehensive two-dimensional gas chromatography-time of flight mass spectrometry (DSI-GC×GC/TOF-MS) was applied for the development of a relatively fast and easy analytical screening method for 17 polychlorinated dibenzo-p-dioxins/dibenzo...

  14. Glaucoma: genes, phenotypes, and new directions for therapy

    PubMed Central

    Fan, Bao Jian; Wiggs, Janey L.

    2010-01-01

    Glaucoma, a leading cause of blindness worldwide, is characterized by progressive optic nerve damage, usually associated with intraocular pressure. Although the clinical progression of the disease is well defined, the molecular events responsible for glaucoma are currently poorly understood and current therapeutic strategies are not curative. This review summarizes the human genetics and genomic approaches that have shed light on the complex inheritance of glaucoma genes and the potential for gene-based and cellular therapies that this research makes possible. PMID:20811162

  15. Transcription mediated insulation and interference direct gene cluster expression switches

    PubMed Central

    Nguyen, Tania; Brown, David; Murray, Struan C; Haenni, Simon; Halstead, James M; O'Connor, Leigh; Shipkovenska, Gergana; Steinmetz, Lars M; Mellor, Jane

    2014-01-01

    In yeast, many tandemly arranged genes show peak expression in different phases of the metabolic cycle (YMC) or in different carbon sources, indicative of regulation by a bi-modal switch, but it is not clear how these switches are controlled. Using native elongating transcript analysis (NET-seq), we show that transcription itself is a component of bi-modal switches, facilitating reciprocal expression in gene clusters. HMS2, encoding a growth-regulated transcription factor, switches between sense- or antisense-dominant states that also coordinate up- and down-regulation of transcription at neighbouring genes. Engineering HMS2 reveals alternative mono-, di- or tri-cistronic and antisense transcription units (TUs), using different promoter and terminator combinations, that underlie state-switching. Promoters or terminators are excluded from functional TUs by read-through transcriptional interference, while antisense TUs insulate downstream genes from interference. We propose that the balance of transcriptional insulation and interference at gene clusters facilitates gene expression switches during intracellular and extracellular environmental change. DOI: http://dx.doi.org/10.7554/eLife.03635.001 PMID:25407679

  16. Site-directed mutagenesis and gene deletion using reverse genetics.

    PubMed

    Muhl, Daniela; Filloux, Alain

    2014-01-01

    Understanding gene function is far easier when tools are available to engineer a bacterial strain lacking a specific gene and phenotypically compare its behavior with the corresponding parental strain. Such mutants could be selected randomly, either by natural selection under particular stress conditions or by random mutagenesis using transposon delivery as described elsewhere in this book. However, with the advent of the genomic era there are now hundreds of bacterial genomes whose sequence is available, and thus, genes can be identified, chosen, and strategies designed to specifically inactivate them. This can be done by using suicide plasmids and is most convenient when the bacterium of interest is easily amenable to genetic manipulation. The method presented here will describe the use of a suicide vector, pKNG101, which allows the selection of a double-recombination event. The first event results in the integration of the pKNG101 derivative carrying the "mutator" fragment onto the chromosome, and could be selected on plates containing appropriate antibiotics. The pKNG101 carries the sacB gene, which induces death when cells are grown on sucrose. Growth on sucrose plates will thus select the second homologous recombination event, which results in removing the plasmid backbone and leaving behind the mutated target gene. This method has been widely used over the last 20 years to inactivate genes in a wide range of gram-negative bacteria and in particular in Pseudomonas aeruginosa. PMID:24818930

  17. Introduction to Bioinformatics Resources for Post-transcriptional Regulation of Gene Expression.

    PubMed

    Quattrone, Alessandro; Dassi, Erik

    2016-01-01

    Untranslated regions (UTRs) and, to a lesser extent, coding sequences of mRNAs are involved in defining the fate of the mature transcripts through the modulation of three primary control processes, mRNA localization, degradation and translation; the action of trans-factors such as RNA-binding proteins (RBPs) and noncoding RNAs (ncRNAs) combined with the presence of defined sequence and structural cis-elements ultimately determines translation levels. Identifying functional regions in UTRs and uncovering post-transcriptional regulators acting upon these regions is thus of paramount importance to understand the spectrum of regulatory possibilities for any given mRNA. This tasks can now be approached computationally, to reduce the space of testable hypotheses and to drive experimental validation.This chapter focuses on presenting databases and tools allowing to study the various aspects of post-transcriptional regulation, including motif search (sequence and secondary structure), prediction of regulatory networks (e.g., RBP and ncRNA binding sites), profiling of the mRNAs translational state, and other aspects of this level of gene expression regulation. Two analysis pipelines are also presented as practical examples of how the described tools could be integrated and effectively employed. PMID:26463374

  18. Electroporation-Mediated Gene Transfer Directly to the Swine Heart

    PubMed Central

    Hargrave, Barbara; Downey, Harre; Strange, Robert; Murray, Len; Cinnamond, Cade; Lundberg, Cathryn; Israel, Annelise; Chen, Yeong-Jer; Marshall, William; Heller, Richard

    2012-01-01

    In vivo gene transfer to the ischemic heart via electroporation holds promise as a potential therapeutic approach for the treatment of heart disease. In the current study, we investigated the use of in vivo electroporation for gene transfer using 3 different penetrating electrodes and one non-penetrating electrode. The hearts of adult male swine were exposed through a sternotomy. Eight electric pulses synchronized to the rising phase of the R wave of the ECG were administered at varying pulse widths and field strengths following an injection of either a plasmid encoding luciferase or one encoding green fluorescent protein. Four sites on the anterior wall of the left ventricle were treated. Animals were euthanized 48 hours after injection and electroporation and gene expression was determined. Results were compared to sites in the heart that received plasmid injection but no electric pulses or were not treated. Gene expression was higher in all electroporated sites when compared to injection only sites demonstrating the robustness of this approach. Our results provide evidence that in vivo electroporation can be a safe and effective non-viral method for delivering genes to the heart, in vivo. PMID:22456328

  19. Introduction. Antarctic ecology: from genes to ecosystems. Part 2. Evolution, diversity and functional ecology.

    PubMed

    Rogers, Alex D; Murphy, Eugene J; Johnston, Nadine M; Clarke, Andrew

    2007-12-29

    The Antarctic biota has evolved over the last 100 million years in increasingly isolated and cold conditions. As a result, Antarctic species, from micro-organisms to vertebrates, have adapted to life at extremely low temperatures, including changes in the genome, physiology and ecological traits such as life history. Coupled with cycles of glaciation that have promoted speciation in the Antarctic, this has led to a unique biota in terms of biogeography, patterns of species distribution and endemism. Specialization in the Antarctic biota has led to trade-offs in many ecologically important functions and Antarctic species may have a limited capacity to adapt to present climate change. These include the direct effects of changes in environmental parameters and indirect effects of increased competition and predation resulting from altered life histories of Antarctic species and the impacts of invasive species. Ultimately, climate change may alter the responses of Antarctic ecosystems to harvesting from humans. The unique adaptations of Antarctic species mean that they provide unique models of molecular evolution in natural populations. The simplicity of Antarctic communities, especially from terrestrial systems, makes them ideal to investigate the ecological implications of climate change, which are difficult to identify in more complex systems. PMID:17553772

  20. Improving lipoprotein profiles by liver-directed gene transfer of low density lipoprotein receptor gene in hypercholesterolaemia mice.

    PubMed

    Ou, Hailong; Zhang, Qinghai; Zeng, Jia

    2016-06-01

    The defect of low density lipoprotein receptor disturbs cholesterol metabolism and causes familial hypercholesterolaemia (FH). In this study, we directly delivered exogenous Ldlr gene into the liver of FH model mice (Ldlr(-/-)) by lentiviral gene transfer system. The results showed that the Ldlr gene controlled by hepatocyte-specific human thyroxine-binding globulin (TBG) promoter successfully and exclusively expressed in livers.We found that, although, the content of high density lipoprotein in serum was not significantly affected by the Ldlr gene expression, the serum low density lipoprotein level was reduced by 46%, associated with a 30% and 28% decrease in triglyceride and total cholesterol, respectively, compared to uninjected Ldlr(-/-) mice. Moreover, the TBG directed expression of Ldlr significantly decreased the lipid accumulation in liver and reduced plaque burden in aorta (32%). Our results indicated that the hepatocyte-specific expression of Ldlr gene strikingly lowered serum lipid levels and resulted in amelioration of hypercholesterolaemia. PMID:27350674

  1. Quantitative real-time monitoring of multi-elements in airborne particulates by direct introduction into an inductively coupled plasma mass spectrometer

    NASA Astrophysics Data System (ADS)

    Suzuki, Yoshinari; Sato, Hikaru; Hiyoshi, Katsuhiro; Furuta, Naoki

    2012-10-01

    A new calibration system for real-time determination of trace elements in airborne particulates was developed. Airborne particulates were directly introduced into an inductively coupled plasma mass spectrometer, and the concentrations of 15 trace elements were determined by means of an external calibration method. External standard solutions were nebulized by an ultrasonic nebulizer (USN) coupled with a desolvation system, and the resulting aerosol was introduced into the plasma. The efficiency of sample introduction via the USN was calculated by two methods: (1) the introduction of a Cr standard solution via the USN was compared with introduction of a Cr(CO)6 standard gas via a standard gas generator and (2) the aerosol generated by the USN was trapped on filters and then analyzed. The Cr introduction efficiencies obtained by the two methods were the same, and the introduction efficiencies of the other elements were equal to the introduction efficiency of Cr. Our results indicated that our calibration method for introduction efficiency worked well for the 15 elements (Ti, V, Cr, Mn, Co, Ni, Cu, Zn, As, Mo, Sn, Sb, Ba, Tl and Pb). The real-time data and the filter-collection data agreed well for elements with low-melting oxides (V, Co, As, Mo, Sb, Tl, and Pb). In contrast, the real-time data were smaller than the filter-collection data for elements with high-melting oxides (Ti, Cr, Mn, Ni, Cu, Zn, Sn, and Ba). This result implies that the oxides of these 8 elements were not completely fused, vaporized, atomized, and ionized in the initial radiation zone of the inductively coupled plasma. However, quantitative real-time monitoring can be realized after correction for the element recoveries which can be calculated from the ratio of real-time data/filter-collection data.

  2. Silent assassin: oncogenic ras directs epigenetic inactivation of target genes.

    PubMed

    Cheng, Xiaodong

    2008-01-01

    Oncogenic transformation is associated with genetic changes and epigenetic alterations. A study now shows that oncogenic Ras uses a complex and elaborate epigenetic silencing program to specifically repress the expression of multiple unrelated cancer-suppressing genes through a common pathway. These results suggest that cancer-related epigenetic modifications may arise through a specific and instructive mechanism and that genetic changes and epigenetic alterations are intimately connected and contribute to tumorigenesis cooperatively. PMID:18385037

  3. Multiple introductions and gene flow in subtropical South American populations of the fireweed, Senecio madagascariensis(Asteraceae)

    PubMed Central

    Mäder, Geraldo; Castro, Luana; Bonatto, Sandro Luis; de Freitas, Loreta Brandão

    2016-01-01

    Abstract Non-indigenous plants exhibit different attributes that make them aggressive competitors with indigenous plants and serious threats to biodiversity.Senecio madagascariensis (fireweed, Asteraceae), a native from southern Africa, is a strong competitor in agricultural activities and has toxic alkaloids that may result in high cattle mortality. In Brazil, this weed was collected for the first time in 1995 and has since spread quickly throughout the Pampas region. To better understand the invasion of the fireweed in South America, we used a genetic characterization with internal transcribed spacer (ITS) and microsatellite markers. Based on the ITS data, the southern Brazil populations of S. madagascariensis shared genetic homology with samples taken from the Hawaiian Islands and South Africa. Microsatellite analysis showed the genetic diversity split in two clusters, perhaps intimating the independent introduction of each species into South America. Although fireweed was introduced recently in southern Brazil, the considerable levels of genetic diversity, gene flow, and inbreeding may indicate success in the species establishment in this environment. PMID:27007907

  4. Multiple introductions and gene flow in subtropical South American populations of the fireweed, Senecio madagascariensis(Asteraceae).

    PubMed

    Mäder, Geraldo; Castro, Luana; Bonatto, Sandro Luis; Freitas, Loreta Brandão de

    2016-03-01

    Non-indigenous plants exhibit different attributes that make them aggressive competitors with indigenous plants and serious threats to biodiversity.Senecio madagascariensis (fireweed, Asteraceae), a native from southern Africa, is a strong competitor in agricultural activities and has toxic alkaloids that may result in high cattle mortality. In Brazil, this weed was collected for the first time in 1995 and has since spread quickly throughout the Pampas region. To better understand the invasion of the fireweed in South America, we used a genetic characterization with internal transcribed spacer (ITS) and microsatellite markers. Based on the ITS data, the southern Brazil populations of S. madagascariensis shared genetic homology with samples taken from the Hawaiian Islands and South Africa. Microsatellite analysis showed the genetic diversity split in two clusters, perhaps intimating the independent introduction of each species into South America. Although fireweed was introduced recently in southern Brazil, the considerable levels of genetic diversity, gene flow, and inbreeding may indicate success in the species establishment in this environment. PMID:27007907

  5. Genomewide identification of genes under directional selection: gene transcription Q(ST) scan in diverging Atlantic salmon subpopulations.

    PubMed

    Roberge, C; Guderley, H; Bernatchez, L

    2007-10-01

    Evolutionary genomics has benefited from methods that allow identifying evolutionarily important genomic regions on a genomewide scale, including genome scans and QTL mapping. Recently, genomewide scanning by means of microarrays has permitted assessing gene transcription differences among species or populations. However, the identification of differentially transcribed genes does not in itself suffice to measure the role of selection in driving evolutionary changes in gene transcription. Here, we propose and apply a "transcriptome scan" approach to investigating the role of selection in shaping differential profiles of gene transcription among populations. We compared the genomewide transcription levels between two Atlantic salmon subpopulations that have been diverging for only six generations. Following assessment of normality and unimodality on a gene-per-gene basis, the additive genetic basis of gene transcription was estimated using the animal model. Gene transcription h(2) estimates were significant for 1044 (16%) of all detected cDNA clones. In an approach analogous to that of genome scans, we used the distribution of the Q(ST) values estimated from intra- and intersubpopulation additive genetic components of the transcription profiles to identify 16 outlier genes (average Q(ST) estimate = 0.11) whose transcription levels are likely to have evolved under the influence of directional selection within six generations only. Overall, this study contributes both empirically and methodologically to the quantitative genetic exploration of gene transcription data. PMID:17720934

  6. High-quality gene assembly directly from unpurified mixtures of microarray-synthesized oligonucleotides

    PubMed Central

    Borovkov, Alex Y.; Loskutov, Andrey V.; Robida, Mark D.; Day, Kristen M.; Cano, Jose A.; Le Olson, Tien; Patel, Hetal; Brown, Kevin; Hunter, Preston D.; Sykes, Kathryn F.

    2010-01-01

    To meet the growing demand for synthetic genes more robust, scalable and inexpensive gene assembly technologies must be developed. Here, we present a protocol for high-quality gene assembly directly from low-cost marginal-quality microarray-synthesized oligonucleotides. Significantly, we eliminated the time- and money-consuming oligonucleotide purification steps through the use of hybridization-based selection embedded in the assembly process. The protocol was tested on mixtures of up to 2000 oligonucleotides eluted directly from microarrays obtained from three different chip manufacturers. These mixtures containing <5% perfect oligos, and were used directly for assembly of 27 test genes of different sizes. Gene quality was assessed by sequencing, and their activity was tested in coupled in vitro transcription/translation reactions. Genes assembled from the microarray-eluted material using the new protocol matched the quality of the genes assembled from >95% pure column-synthesized oligonucleotides by the standard protocol. Both averaged only 2.7 errors/kb, and genes assembled from microarray-eluted material without clonal selection produced only 30% less protein than sequence-confirmed clones. This report represents the first demonstration of cost-efficient gene assembly from microarray-synthesized oligonucleotides. The overall cost of assembly by this method approaches 5¢ per base, making gene synthesis more affordable than traditional cloning. PMID:20693531

  7. Nitric oxide directly regulates gene expression during Drosophila development: need some gas to drive into metamorphosis?

    PubMed

    Yamanaka, Naoki; O'Connor, Michael B

    2011-07-15

    Nitric oxide (NO) is an important second messenger involved in numerous biological processes, but how it regulates gene expression is not well understood. In this issue of Genes & Development, Cáceres and colleagues (pp. 1476-1485) report a critical requirement of NO as a direct regulator of gene expression through its binding to a heme-containing nuclear receptor in Drosophila. This may be an anciently evolved mechanism to coordinate behavior and metabolism during animal development. PMID:21764850

  8. Co-introduction of an antisense gene for an endogenous seed storage protein can increase expression of a transgene in Arabidopsis thaliana seeds.

    PubMed

    Goossens, A; Van Montagu, M; Angenon, G

    1999-07-30

    We have investigated whether the expression in Arabidopsis thaliana seeds of a transgene (the Phaseolus vulgaris arcelin (arc)5-I gene) could be enhanced by the simultaneous introduction of an antisense gene for an endogenous seed storage protein (2S albumin). Seeds of plants transformed with both the arc5-I gene and a 2S albumin antisense gene contained reduced amounts of 2S albumins and increased arcelin-5 (Arc5) accumulation levels compared to lines harboring the arc5-I gene only. Arc5 production could be enhanced to more than 24% of the total seed protein content, suggesting that antisense technology could be of great utility to favor high expression of transgenes. PMID:10452550

  9. Direct and reverse pollen-mediated gene flow between GM rice and red rice weed

    PubMed Central

    Serrat, X.; Esteban, R.; Peñas, G.; Català, M. M.; Melé, E.; Messeguer, J.

    2013-01-01

    Potential risks of genetically modified (GM) crops must be identified before their commercialization, as happens with all new technologies. One of the major concerns is the proper risk assessment of adventitious presence of transgenic material in rice fields due to cross-pollination. Several studies have been conducted in order to quantify pollen-mediated gene flow from transgenic rice (Oryza sativa) to both conventional rice and red rice weed (O. sativa f. spontanea) under field conditions. Some of these studies reported GM pollen-donor rice transferring GM traits to red rice. However, gene flow also occurs in the opposite direction, in a phenomenon that we have called reverse gene flow, resulting in transgenic seeds that have incorporated the traits of wild red rice. We quantified reverse gene flow using material from two field trials. A molecular analysis based on amplified fragment length polymorphisms was carried out, being complemented with a phenotypic identification of red rice traits. In both field trials, the reverse gene flow detected was greater than the direct gene flow. The rate of direct gene flow varied according to the relative proportions of the donor (GM rice) and receptor (red rice) plants and was influenced by wind direction. The ecological impact of reverse gene flow is limited in comparison with that of direct gene flow because non-shattered and non-dormant seeds would be obtained in the first generation. Hybrid seed would remain in the spike and therefore most of it would be removed during harvesting. Nevertheless, this phenomenon must be considered in fields used for elite seed production and in developing countries where farmers often keep some seed for planting the following year. In these cases, there is a higher risk of GM red rice weed infestation increasing from year to year and therefore a proper monitoring plan needs to be established.

  10. Recombinant AAV-directed gene therapy for type I glycogen storage diseases

    PubMed Central

    Chou, JY; Mansfield, BC

    2011-01-01

    Introduction Glycogen storage disease (GSD) type Ia and Ib are disorders of impaired glucose homeostasis affecting the liver and kidney. GSD-Ib also affects neutrophils. Current dietary therapies cannot prevent long-term complications. In animal studies, recombinant adeno-associated virus (rAAV) vector-mediated gene therapy can correct or minimize multiple aspects of the disorders, offering hope for human gene therapy. Areas covered A summary of recent progress in rAAV-mediated gene therapy for GSD-I; strategies to improve rAAV-mediated gene delivery, transduction efficiency and immune avoidance; and vector refinements that improve expression. Expert opinion rAAV-mediated gene delivery to the liver can restore glucose homeostasis in preclinical models of GSD-I, but some long-term complications of the liver and kidney remain. Gene therapy for GSD-Ib is less advanced than for GSD-Ia and only transient correction of myeloid dysfunction has been achieved. A question remains whether a single rAAV vector can meet the expression efficiency and tropism required to treat all aspects of GSD-I, or if a multi-prong approach is needed. An understanding of the strengths and weaknesses of rAAV vectors in the context of strategies to achieve efficient transduction of the liver, kidney, and hematopoietic stem cells is required for treating GSD-I. PMID:21504389

  11. Drop-on-demand sample introduction system coupled with the flowing atmospheric-pressure afterglow for direct molecular analysis of complex liquid microvolume samples.

    PubMed

    Schaper, J Niklas; Pfeuffer, Kevin P; Shelley, Jacob T; Bings, Nicolas H; Hieftje, Gary M

    2012-11-01

    One of the fastest developing fields in analytical spectrochemistry in recent years is ambient desorption/ionization mass spectrometry (ADI-MS). This burgeoning interest has been due to the demonstrated advantages of the method: simple mass spectra, little or no sample preparation, and applicability to samples in the solid, liquid, or gaseous state. One such ADI-MS source, the flowing atmospheric-pressure afterglow (FAPA), is capable of direct analysis of solids just by aiming the source at the solid surface and sampling the produced ions into a mass spectrometer. However, direct introduction of significant volumes of liquid samples into this source has not been possible, as solvent loads can quench the afterglow and, thus, the formation of reagent ions. As a result, the analysis of liquid samples is preferably carried out by analyzing dried residues or by desorbing small amounts of liquid samples directly from the liquid surface. In the former case, reproducibility of sample introduction is crucial if quantitative results are desired. In the present study, introduction of liquid samples as very small droplets helps overcome the issues of sample positioning and reduced levels of solvent intake. A recently developed "drop-on-demand" (DOD) aerosol generator is capable of reproducibly producing very small volumes of liquid (∼17 pL). In this paper, the coupling of FAPA-MS and DOD is reported and applications are suggested. Analytes representing different classes of substances were tested and limits of detections were determined. Matrix tolerance was investigated for drugs of abuse and their metabolites by analyzing raw urine samples and quantification without the use of internal standards. Limits of detection below 2 μg/mL, without sample pretreatment, were obtained. PMID:23025277

  12. Drop-on-demand sample introduction system coupled with the flowing atmospheric-pressure afterglow for direct molecular analysis of complex liquid micro-volume samples

    PubMed Central

    Schaper, J. Niklas; Pfeuffer, Kevin P.; Shelley, Jacob T.; Bings, Nicolas H.

    2012-01-01

    One of the fastest developing fields in analytical spectrochemistry in recent years is ambient desorption/ionization mass spectrometry (ADI-MS). This burgeoning interest has been due to the demonstrated advantages of the method: simple mass spectra, little or no sample preparation, and applicability to samples in the solid, liquid, or gaseous state. One such ADI-MS source, the flowing atmospheric-pressure afterglow (FAPA), is capable of direct analysis of solids just by aiming the source at the solid surface and sampling the produced ions into a mass spectrometer. However, direct introduction of significant volumes of liquid samples into this source has not been possible, as solvent loads can quench the afterglow and, thus, the formation of reagent ions. As a result, the analysis of liquid samples is preferably carried out by analyzing dried residues or by desorbing small amounts of liquid samples directly from the liquid surface. In the former case, reproducibility of sample introduction is crucial if quantitative results are desired. In the present study, introduction of liquid samples as very small droplets helps overcome the issues of sample positioning and reduced levels of solvent intake. A recently developed “drop-on-demand” (DOD) aerosol generator is capable of reproducibly producing very small volumes of liquid (~17 pL). In this paper, the coupling of FAPA-MS and DOD is reported and applications are suggested. Analytes representing different classes of substances were tested and limits of detections were determined. Matrix tolerance was investigated for drugs of abuse and their metabolites by analyzing raw urine samples and quantification without the use of internal standards. Limits of detection below 2 µg/mL, without sample pretreatment, were obtained. PMID:23025277

  13. Direct retroviral delivery of human cytochrome P450 2B6 for gene-directed enzyme prodrug therapy of cancer.

    PubMed

    Kan, O; Griffiths, L; Baban, D; Iqball, S; Uden, M; Spearman, H; Slingsby, J; Price, T; Esapa, M; Kingsman, S; Kingsman, A; Slade, A; Naylor, S

    2001-07-01

    Human cytochrome P450 2B6 (CYP2B6) metabolizes the prodrug cyclophosphamide (CPA) to produce phosphoramide mustard that cross-links DNA leading to cell death. We have constructed a novel retroviral vector encoding CYP2B6 (designated "MetXia-P450") and used it to transduce the human tumor cell lines HT29 and T47D. MetXia-P450 transduction sensitised these cells to the cytotoxic effects of the prodrug CPA. Results from in vitro experiments demonstrated adverse effects on the clonogenic survival of cyclophosphamide-treated cells transduced with MetXia-P450. Cytotoxic activity accompanied by bystander effect was particularly evident in 3-D multicellular spheroid models suggesting that this in vitro system may be a more appropriate model for assessing the efficacy of gene directed-enzyme prodrug therapy (GDEPT). We have applied this approach in a clinically relevant gene therapy protocol on established subcutaneous tumor xenografts. These studies show for the first time the efficacy of a P450-based GDEPT strategy mediated by a direct retroviral gene transfer in vivo. PMID:11498768

  14. Direct Detection and Quantification of Bacterial Genes Associated with Inflammation in DNA Isolated from Stool

    PubMed Central

    Gómez-Moreno, Ramón; Robledo, Iraida E.; Baerga-Ortiz, Abel

    2014-01-01

    Although predominantly associated with health benefits, the gut microbiota has also been shown to harbor genes that promote inflammation. In this work, we report a method for the direct detection and quantification of these pro-inflammatory bacterial genes by PCR and qPCR in DNA extracted from human stool samples. PCR reactions were performed to detect (i) the pks island genes, (ii) tcpC, which is present in some strains of Escherichia coli and (iii) gelE presented in some strains of Enterococcus faecalis. Additionally, we screened for the presence of the following genes encoding cyclomodulins that disrupted mammalian cell division: (iv) cdt (which encodes the cytolethal distending toxin) and (v) cnf-1 (which encodes the cytotoxic necrotizing factor-1). Our results show that 20% of the samples (N = 41) tested positive for detectable amounts of pks island genes, whereas 10% of individuals were positive for tcpC or gelE and only one individual was found to harbor the cnf-1 gene. Of the 13 individuals that were positive for at least one of the pro-inflammatory genes, 5 were found to harbor more than one. A quantitative version of the assay, which used real-time PCR, revealed the pro-inflammatory genes to be in high copy numbers: up to 1.3 million copies per mg of feces for the pks island genes. Direct detection of specific genes in stool could prove useful toward screening for the presence of pro-inflammatory bacterial genes in individuals with inflammatory bowel diseases or colorectal cancer. PMID:25635239

  15. Problem-Based Learning Revisited, Introduction of Active and Self-Directed Learning to Reduce Fatigue among Students

    ERIC Educational Resources Information Center

    Czabanowska, Katarzyna; Moust, Jos H. C.; Meijer, Andre W. M.; Schroder-Back, Peter; Roebertsen, Herma

    2012-01-01

    Despite several years of successfully applying problem-based learning at Maastricht University, the Faculty of Medicine observed a slow erosion of problem-based practices and "PBL fatigue" among themselves and students. In response to this fatigue and new research into the development of the young adult brain, Active Self-Directed Learning was…

  16. Direct gene transfer into human cultured cells facilitated by laser micropuncture of the cell membrane

    SciTech Connect

    Tao, W.; Wilkinson, J.; Stanbridge, E.J.; Berns, M.W.

    1987-06-01

    The selective alteration of the cellular genome by laser microbeam irradiation has been extensively applied in cell biology. We report here the use of the third harmonic (355 nm) of an yttrium-aluminum garnet laser to facilitate the direct transfer of the neo gene into cultured human HT1080-6TG cells. The resultant transformants were selected in media containing an aminoglycoside antibiotic, G418. Integration of the neo gene into individual chromosomes and expression of the gene were demonstrated by Southern blot analyses, microcell-mediated chromosome transfer, and chromosome analyses. The stability of the integrated neo gene in the transformants was shown by a comparative growth assay in selective and nonselective media. Transformation and incorporation of the neo gene into the host genome occurred at a frequency of 8x10-4-3x10-3. This method appears to be 100-fold more efficient than the standard calcium phosphate-mediated method of DNA transfer.

  17. Direct Gene Transfer into Human Cultured Cells Facilitated by Laser Micropuncture of the Cell Membrane

    NASA Astrophysics Data System (ADS)

    Tao, Wen; Wilkinson, Joyce; Stanbridge, Eric J.; Berns, Michael W.

    1987-06-01

    The selective alteration of the cellular genome by laser microbeam irradiation has been extensively applied in cell biology. We report here the use of the third harmonic (355 nm) of an yttrium-aluminum garnet laser to facilitate the direct transfer of the neo gene into cultured human HT1080-6TG cells. The resultant transformants were selected in medium containing an aminoglycoside antibiotic, G418. Integration of the neo gene into individual human chromosomes and expression of the gene were demonstrated by Southern blot analyses, microcell-mediated chromosome transfer, and chromosome analyses. The stability of the integrated neo gene in the transformants was shown by a comparative growth assay in selective and nonselective media. Transformation and incorporation of the neo gene into the host genome occurred at a frequency of 8 × 10-4-3 × 10-3. This method appears to be 100-fold more efficient than the standard calcium phosphate-mediated method of DNA transfer.

  18. Directing Cardiomyogenic Differentiation and Transdifferentiation By Ectopic Gene Expression - Direct Transition Or Reprogramming Detour?

    PubMed

    Andrée, Birgit; Zweigerdt, Robert

    2016-01-01

    Cardiovascular disorders and associated morbidities remain the leading cause of premature death worldwide. Since the regeneration of diseased hearts is very limited and the insufficient supply of donor organs persists, hopes rely on new therapies for heart repair. Reviving the proliferation of endogenous cardiomyocytes (CMs) or the administration of adult stem cells to the heart was of limited curative success to date. Thus, the administration of in vitro generated CMs is under investigation to replenish loss of functional heart muscle tissue. This requires a sustainable source of CMs. Induced pluripotent stem cells (iPSC) have raised hopes for developing autologous cell therapies. To serve for heart repair, efficient and safe iPSC differentiation protocols for CMs production are required. iPSC differentiation into CMs and even functional subtypes was indeed achieved in recent years, either by the ectopic expression of cardiac transcription factors or the supplementation of chemical pathway modulators. An alternative approach aims at the direct transdifferentiation of fibroblasts, which are present in the interstitial tissue of many organs, into functional lineage-specific cell types. As a result the formation of induced cardiomyocyte-like cells (iCMs) by the ectopic expression of specific transcription factors combinations has been demonstrated in vitro and in vivo. This is an important proof-of-concept that the intermediate state of iPSC induction is dispensable. However, most of the early experiments were conducted in mice and translation to more relevant large animal models and subsequently to the clinic are challenging. Progress, drawbacks, and perspectives in this field will be discussed. PMID:26725881

  19. Organization of the qa Gene Cluster in NEUROSPORA CRASSA: Direction of Transcription of the qa-3 Gene

    PubMed Central

    Strøman, Per; Reinert, William; Case, Mary E.; Giles, Norman H.

    1979-01-01

    In Neurospora crassa, the enzyme quinate (shikimate) dehydrogenase catalyzes the first reaction in the inducible quinic acid catabolic pathway and is encoded in the qa-3 gene of the qa cluster. In this cluster, the order of genes has been established as qa-1 qa-3 qa-4 qa-2. Amino-terminal sequences have been determined for purified quinate dehydrogenase from wild type and from UV-induced revertants in two different qa-3 mutants. These two mutants (M16 and M45) map at opposite ends of the qa-3 locus. In addition, mapping data (Case et al. 1978) indicate that the end of the qa-3 gene specified by M45 is closer to the adjacent qa-1 gene than is the end specified by the M16 mutant site. In one of the revertants (R45 from qa-3 mutant M45), the aminoterminal sequence for the first ten amino acids is identical to that of wild type. The other revertant (R1 from qa-3 mutant M16) differs from wild type at the amino-terminal end by a single altered residue at position three in the sequence. The observed change involves the substitution of an isoleucine in M16-R1 for a proline in wild type. This substitution requires a two-nucleotide change in the corresponding wild-type codon.——The combined genetic and biochemical data indicate that the qa-3 mutants M16 and M45 carry amino acid substitutions near the amino-terminal and carboxyl-terminal ends of the quinate dehydrogenase enzyme, respectively. On this basis we conclude that transcription of the qa-3 gene proceeds from the end specified by the M16 mutant site in the direction of the qa-1 gene. It appears probable that transcription is initiated from a promoter site within the qa cluster, possibly immediately adjacent to the qa-3 gene. PMID:159203

  20. GIPS: A Software Guide to Sequencing-Based Direct Gene Cloning in Forward Genetics Studies.

    PubMed

    Hu, Han; Wang, Weitao; Zhu, Zhongxu; Zhu, Jianhua; Tan, Deyong; Zhou, Zhipeng; Mao, Chuanzao; Chen, Xin

    2016-04-01

    The Gene Identification via Phenotype Sequencing (GIPS) software considers a range of experimental and analysis choices in sequencing-based forward genetics studies within an integrated probabilistic framework, which enables direct gene cloning from the sequencing of several unrelated mutants of the same phenotype without the need to create segregation populations. GIPS estimates four measurements to help optimize an analysis procedure as follows: (1) the chance of reporting the true phenotype-associated gene; (2) the expected number of random genes that may be reported; (3) the significance of each candidate gene's association with the phenotype; and (4) the significance of violating the Mendelian assumption if no gene is reported or if all candidate genes have failed validation. The usage of GIPS is illustrated with the identification of a rice (Oryza sativa) gene that epistatically suppresses the phenotype of the phosphate2 mutant from sequencing three unrelated ethyl methanesulfonate mutants. GIPS is available at https://github.com/synergy-zju/gips/wiki with the user manual and an analysis example. PMID:26842621

  1. Directional gene expression and antisense transcripts in sexual and asexual stages of Plasmodium falciparum

    PubMed Central

    2011-01-01

    Background It has been shown that nearly a quarter of the initial predicted gene models in the Plasmodium falciparum genome contain errors. Although there have been efforts to obtain complete cDNA sequences to correct the errors, the coverage of cDNA sequences on the predicted genes is still incomplete, and many gene models for those expressed in sexual or mosquito stages have not been validated. Antisense transcripts have widely been reported in P. falciparum; however, the extent and pattern of antisense transcripts in different developmental stages remain largely unknown. Results We have sequenced seven bidirectional libraries from ring, early and late trophozoite, schizont, gametocyte II, gametocyte V, and ookinete, and four strand-specific libraries from late trophozoite, schizont, gametocyte II, and gametocyte V of the 3D7 parasites. Alignment of the cDNA sequences to the 3D7 reference genome revealed stage-specific antisense transcripts and novel intron-exon splicing junctions. Sequencing of strand-specific cDNA libraries suggested that more genes are expressed in one direction in gametocyte than in schizont. Alternatively spliced genes, antisense transcripts, and stage-specific expressed genes were also characterized. Conclusions It is necessary to continue to sequence cDNA from different developmental stages, particularly those of non-erythrocytic stages. The presence of antisense transcripts in some gametocyte and ookinete genes suggests that these antisense RNA may play an important role in gene expression regulation and parasite development. Future gene expression studies should make use of directional cDNA libraries. Antisense transcripts may partly explain the observed discrepancy between levels of mRNA and protein expression. PMID:22129310

  2. Farnesoid X receptor directly regulates xenobiotic detoxification genes in the long-lived Little mice

    PubMed Central

    Jiang, Yanjun; Jin, Jingling; Iakova, Polina; Hernandez, Julio Cesar; Jawanmardi, Nicole; Sullivan, Emily; Guo, Grace L.; Timchenko, Nikolai A.; Darlington, Gretchen J.

    2013-01-01

    Activation of xenobiotic metabolism pathways has been linked to lifespan extension in different models of aging. However, the mechanisms underlying activation of xenobiotic genes remain largely unknown. Here we showed that although FXR mRNA levels do not change significantly, FXR (farnesoid X receptor, Nr1h4) protein levels are elevated in the livers of the long-lived Little mice, leading to increased DNA binding activity of FXR. Hepatic FXR expression is sex-dependent in wild-type mice but not in Little mice, implying that up-regulation of FXR might be dependent on the reduction of growth hormone in Little mice. Growth hormone treatment decreased hepatic expression of FXR and xenobiotic genes Abcb1a, Fmo3 and Gsta2 in both wild-type and Little mice, suggesting an association between FXR and xenobiotic gene expression. We found that Abcb1a is transactivated by FXR via direct binding of FXR/retinoid X receptor α (RXRα) heterodimer to a response element at the proximal promoter. FXR also positively controls Fmo3 and Gsta2 expression through direct interaction with the response elements in these genes. Our study demonstrates that xenobiotic genes are direct transcriptional targets of FXR and suggests that FXR signaling may play a critical role in the lifespan extension observed in Little mice. PMID:24007921

  3. Introduction and expression of the bacterial genes cysE and cysK in eukaryotic cells.

    PubMed Central

    Leish, Z; Byrne, C R; Hunt, C L; Ward, K A

    1993-01-01

    The coding sequences of the cysE and cysK genes from Escherichia coli, which encode the enzymes of the cysteine biosynthetic pathway, namely, serine acetyltransferase (EC 2.3.1.30) and O-acetylserine sulfhydrylase (or cysteine synthase [EC 4.2.99.8]), were modified for expression in eukaryotic cells and introduced into murine L cells. A number of fusion genes comprising the cysE or cysK coding sequences joined to the promoter of the ovine metallothionein-Ia (MT-Ia) gene and various portions of the ovine growth hormone (GH) gene were prepared. Significant differences in the level of transcription were observed, depending on the amount and arrangement of the GH gene sequences used, the highest levels being obtained with the constructs MTCE10 and MTCK7, which contained only the GH 3' untranslated gene sequences. These two constructs were fused to produce the gene MTCEK1. In this single DNA sequence, each bacterial gene is under independent MT-Ia promoter control. Expression of the cysK sequence in this construct (MT-Ia promoter-cysE-3' GH sequence-MT-Ia promoter-cysK-3' GH sequence) was elevated compared with expression of the cysK gene in MTCK7. However, expression of the cysE sequence in MTCEK1 was only 40% of that of the cysE gene cloned into MTCE10. The double-promoter configuration, which enhances the expression of the second gene in MTCEK1, is proposed as a model for the modification of bacterial genes in general. Images PMID:7683185

  4. Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins.

    PubMed

    Cho, Seung Woo; Lee, Jihyun; Carroll, Dana; Kim, Jin-Soo; Lee, Junho

    2013-11-01

    We present a novel method of targeted gene disruption that involves direct injection of recombinant Cas9 protein complexed with guide RNA into the gonad of the nematode Caenorhabditis elegans. Biallelic mutants were recovered among the F1 progeny, demonstrating the high efficiency of this method. PMID:23979576

  5. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  6. IDENTIFICATION, CLONING, AND CHARACTERIZATION OF SNTOX3 USING HETEROLOGOUS EXPRESSION TRANSFORMATION, AND SITE DIRECTED GENE DISRUPTION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stagonospora nodorum blotch (SNB) of wheat caused by Stagonospora nodorum (teleomorph Phaeosphaeria nodorum) has been shown to be at least partially controlled by multiple host selective toxins (HSTs) that interact directly or indirectly with dominant host sensitivity gene products in wheat leading ...

  7. Direct phylogenetic evidence for lateral transfer of elongation factor-like gene

    PubMed Central

    Kamikawa, Ryoma; Inagaki, Yuji; Sako, Yoshihiko

    2008-01-01

    Genes encoding elongation factor-like (EFL) proteins, which show high similarity to elongation factor-1α (EF-1α), have been found in phylogenetically distantly related eukaryotes. The sporadic distribution of “EFL-containing” lineages within “EF-1α-containing” lineages indirectly, but strongly, suggests lateral gene transfer as the principal driving force in EFL evolution. However, one of the most critical aspects in the above hypothesis, the donor lineages in any putative cases of lateral EFL gene transfer, remained unclear. In this study, we provide direct evidence for lateral transfer of an EFL gene through the analyses of 10 diatom EFL genes. All diatom EFL homologues tightly clustered in phylogenetic analyses, suggesting acquisition of the exogenous EFL gene early in diatom evolution. Our survey additionally identified Thalassiosira pseudonana as a eukaryote bearing EF-1α and EFL genes and secondary EFL gene loss in Phaeodactylum tricornutum, the complete genome of which encodes only the EF-1α gene. Most importantly, the EFL phylogeny recovered a robust grouping of homologues from diatoms, the cercozoan Bigelowiella natans, and the foraminifer Planoglabratella opecularis, with the diatoms nested within the Bigelowiella plus Planoglabratella (Rhizaria) grouping. The particular relationships recovered are further consistent with two characteristic sequence motifs. The best explanation of our data analyses is an EFL gene transfer from a foraminifer to a diatom, the first case in which the donor–recipient relationship was clarified. Finally, based on a reverse transcriptase quantitative PCR assay and the genome information of Thalassiosira and Phaeodactylum, we propose the loss of elongation factor function in Thalassiosira EF-1α. PMID:18458344

  8. Glucocorticoid Ultradian Rhythmicity Directs Cyclical Gene Pulsing of the Clock Gene Period 1 in Rat Hippocampus

    PubMed Central

    McKenna, M. A.; Pooley, J. R.; Kershaw, Y. M.; Meijer, O. C.; de Kloet, E. R.; Lightman, S. L.

    2016-01-01

    In vivo glucocorticoid (GC) secretion exhibits a distinctive ultradian rhythmicity. The lipophilic hormone can rapidly diffuse into cells, although only the pulse peak is of sufficient amplitude to activate the low affinity glucocorticoid receptor (GR). Discrete pulses readily access brain regions such as the hippocampus where GR expression is enriched and known to regulate neuronal function, including memory and learning processes. In the present study, we have tested the hypothesis that GR brain targets are responsive to ultradian GC rhythmicity. We have used adrenalectomised rats replaced with pulses of corticosterone to determine the transcriptional effects of ultradian pulses in the hippocampus. Confocal microscopy confirmed that each GC pulse results in transient GR nuclear localisation in hippocampal CA1 neurones. Concomitant GR activation and DNA binding was demonstrated by synthetic glucocorticoid response element oligonucleotide binding, and verified for the Clock gene Period 1 promoter region by chromatin immunoprecipitation assays. Strikingly each GC pulse induced a ‘burst’ of transcription of Period 1 measured by heterogeneous nuclear RNA quantitative polymerase chain reaction. The net effect of pulsatile GC exposure on accumulation of the mature transcript was also assessed, revealing a plateau of mRNA levels throughout the time course of pulsatile exposure, indicating the pulse timing works optimally for steady state Per1 expression. The plateau dropped to baseline within 120 min of the final pulse, indicating a relatively short half-life for hippocampal Per1. The significance of this strict temporal control is that any perturbation to the pulse frequency or duration would have rapid quantitative effects on the levels of Per1. This in turn could affect hippocampal function, especially circadian related memory and learning processes. PMID:20649850

  9. Direct cloning and refactoring of a silent lipopeptide biosynthetic gene cluster yields the antibiotic taromycin A.

    PubMed

    Yamanaka, Kazuya; Reynolds, Kirk A; Kersten, Roland D; Ryan, Katherine S; Gonzalez, David J; Nizet, Victor; Dorrestein, Pieter C; Moore, Bradley S

    2014-02-01

    Recent developments in next-generation sequencing technologies have brought recognition of microbial genomes as a rich resource for novel natural product discovery. However, owing to the scarcity of efficient procedures to connect genes to molecules, only a small fraction of secondary metabolomes have been investigated to date. Transformation-associated recombination (TAR) cloning takes advantage of the natural in vivo homologous recombination of Saccharomyces cerevisiae to directly capture large genomic loci. Here we report a TAR-based genetic platform that allows us to directly clone, refactor, and heterologously express a silent biosynthetic pathway to yield a new antibiotic. With this method, which involves regulatory gene remodeling, we successfully expressed a 67-kb nonribosomal peptide synthetase biosynthetic gene cluster from the marine actinomycete Saccharomonospora sp. CNQ-490 and produced the dichlorinated lipopeptide antibiotic taromycin A in the model expression host Streptomyces coelicolor. The taromycin gene cluster (tar) is highly similar to the clinically approved antibiotic daptomycin from Streptomyces roseosporus, but has notable structural differences in three amino acid residues and the lipid side chain. With the activation of the tar gene cluster and production of taromycin A, this study highlights a unique "plug-and-play" approach to efficiently gaining access to orphan pathways that may open avenues for novel natural product discoveries and drug development. PMID:24449899

  10. Safety and feasibility of liver-directed ex vivo gene therapy for homozygous familial hypercholesterolemia.

    PubMed Central

    Raper, S E; Grossman, M; Rader, D J; Thoene, J G; Clark, B J; Kolansky, D M; Muller, D W; Wilson, J M

    1996-01-01

    OBJECTIVE: The purpose of this report was to provide detailed information on the safety and feasibility of surgical procedures associated with the first ex vivo liver-directed gene therapy trial for the treatment of vivo gene therapy for homozygous familial hypercholesterolemia (FH). SUMMARY BACKGROUND DATA: Familial hypercholesterolemia is an autosomal dominant disease in which the gene encoding the low density lipoprotein receptor is defective. Patients homozygous for this mutation have extraordinarily high levels of cholesterol and accelerated atherosclerosis and die prematurely of myocardial infarction. The concept of liver-directed gene therapy was based on the report of normalization of cholesterol levels by orthotopic cardiac/liver transplant in a child with homozygous FH. METHODS: Five patients with homozygous FH were selected for inclusion in this trial. The patients underwent hepatic resection and placement of a portal venous catheter. Primary hepatocytes cultures were prepared from the resected liver and transduced with a recombinant retrovirus encoding the gene for the human low density lipoprotein receptor. The genetically modified cells were then transplanted into the liver through the portal venous catheter. RESULTS: Numerous clinical, laboratory, and radiologic parameters were analyzed. Elevations of the hepatic transaminases and leukocyte counts and a decline in hematocrit count were noted. Transient elevations of the portal pressure were observed during cell infusion. No major perioperative morbidity--specifically, myocardial infarct, perioperative hemorrhage, or portal vein thrombosis--or death occurred as a result of this protocol. CONCLUSION: Liver-directed ex vivo gene therapy can be accomplished safely in humans and is appropriate for selected patients. Images Figure 5. PMID:8597504

  11. Direct Reprogramming for Pancreatic Beta-Cells Using Key Developmental Genes

    PubMed Central

    Cavelti-Weder, Claudia; Li, Weida; Zumsteg, Adrian; Stemann, Marianne; Yamada, Takatsugu; Bonner-Weir, Susan; Weir, Gordon

    2015-01-01

    Direct reprogramming is a promising approach for regenerative medicine whereby one cell type is directly converted into another without going through a multipotent or pluripotent stage. This reprogramming approach has been extensively explored for the generation of functional insulin-secreting cells from non-beta-cells with the aim of developing novel cell therapies for the treatment of people with diabetes lacking sufficient endogenous beta-cells. A common approach for such conversion studies is the introduction of key regulators that are important in controlling beta-cell development and maintenance. In this review, we will summarize the recent advances in the field of beta-cell reprogramming and discuss the challenges of creating functional and long-lasting beta-cells. PMID:26998407

  12. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  13. A direct molecular link between the autism candidate gene RORa and the schizophrenia candidate MIR137

    NASA Astrophysics Data System (ADS)

    Devanna, Paolo; Vernes, Sonja C.

    2014-02-01

    Retinoic acid-related orphan receptor alpha gene (RORa) and the microRNA MIR137 have both recently been identified as novel candidate genes for neuropsychiatric disorders. RORa encodes a ligand-dependent orphan nuclear receptor that acts as a transcriptional regulator and miR-137 is a brain enriched small non-coding RNA that interacts with gene transcripts to control protein levels. Given the mounting evidence for RORa in autism spectrum disorders (ASD) and MIR137 in schizophrenia and ASD, we investigated if there was a functional biological relationship between these two genes. Herein, we demonstrate that miR-137 targets the 3'UTR of RORa in a site specific manner. We also provide further support for MIR137 as an autism candidate by showing that a large number of previously implicated autism genes are also putatively targeted by miR-137. This work supports the role of MIR137 as an ASD candidate and demonstrates a direct biological link between these previously unrelated autism candidate genes.

  14. A Bayesian Approach to Pathway Analysis by Integrating Gene–Gene Functional Directions and Microarray Data

    PubMed Central

    Zhao, Yifang; Chen, Ming-Hui; Pei, Baikang; Rowe, David; Shin, Dong-Guk; Xie, Wangang; Yu, Fang; Kuo, Lynn

    2012-01-01

    Many statistical methods have been developed to screen for differentially expressed genes associated with specific phenotypes in the microarray data. However, it remains a major challenge to synthesize the observed expression patterns with abundant biological knowledge for more complete understanding of the biological functions among genes. Various methods including clustering analysis on genes, neural network, Bayesian network and pathway analysis have been developed toward this goal. In most of these procedures, the activation and inhibition relationships among genes have hardly been utilized in the modeling steps. We propose two novel Bayesian models to integrate the microarray data with the putative pathway structures obtained from the KEGG database and the directional gene–gene interactions in the medical literature. We define the symmetric Kullback–Leibler divergence of a pathway, and use it to identify the pathway(s) most supported by the microarray data. Monte Carlo Markov Chain sampling algorithm is given for posterior computation in the hierarchical model. The proposed method is shown to select the most supported pathway in an illustrative example. Finally, we apply the methodology to a real microarray data set to understand the gene expression profile of osteoblast lineage at defined stages of differentiation. We observe that our method correctly identifies the pathways that are reported to play essential roles in modulating bone mass. PMID:23482678

  15. Pathogen corruption and site-directed recombination at a plant disease resistance gene cluster

    PubMed Central

    Nagy, Ervin D.; Bennetzen, Jeffrey L.

    2008-01-01

    The Pc locus of sorghum (Sorghum bicolor) determines dominant sensitivity to a host-selective toxin produced by the fungal pathogen Periconia circinata. The Pc region was cloned by a map-based approach and found to contain three tandemly repeated genes with the structures of nucleotide binding site–leucine-rich repeat (NBS–LRR) disease resistance genes. Thirteen independent Pc-to-pc mutations were analyzed, and each was found to remove all or part of the central gene of the threesome. Hence, this central gene is Pc. Most Pc-to-pc mutations were associated with unequal recombination. Eight recombination events were localized to different sites in a 560-bp region within the ∼3.7-kb NBS–LRR genes. Because any unequal recombination located within the flanking NBS–LRR genes would have removed Pc, the clustering of cross-over events within a 560-bp segment indicates that a site-directed recombination process exists that specifically targets unequal events to generate LRR diversity in NBS–LRR loci. PMID:18719093

  16. Automated DNA mutation detection using universal conditions direct sequencing: application to ten muscular dystrophy genes

    PubMed Central

    2009-01-01

    Background One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive. These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels. The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput. Results An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other patients). Methods and assay

  17. Short, direct repeats at the breakpoints of deletions of the retinoblastoma gene

    SciTech Connect

    Canning, S.; Dryja, T.P. )

    1989-07-01

    The authors found deletions involving the retinoblastoma gene in 12 of 49 tumors from patients with retinoblastoma or osteosarcoma. After mapping the deletion breakpoints, they found that no two breakpoints coincided. Thus, the data do not support the conclusions of others regarding the existence of a hotspot for deletion breakpoints in this gene. In 4 of the tumors, they sequenced 200 base pairs surrounding each deletion breakpoint. Three deletions had termini within pairs of short, direct repeats ranging in size from 4 to 7 base pairs. These results indicate that the slipped mispairing mechanism may predominate in the generation of deletions at this locus. The review of deletion breakpoints at other genetic loci reveals that the nature of the sequences present at deletion breakpoints (short, direct repeats versus middle repetitive elements) varies according to the genetic locus under study.

  18. p53-directed translational control can shape and expand the universe of p53 target genes

    PubMed Central

    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A

    2014-01-01

    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses. PMID:24926617

  19. p53-directed translational control can shape and expand the universe of p53 target genes.

    PubMed

    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A

    2014-10-01

    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses. PMID:24926617

  20. Direct Repression of Evening Genes by CIRCADIAN CLOCK-ASSOCIATED1 in the Arabidopsis Circadian Clock.

    PubMed

    Kamioka, Mari; Takao, Saori; Suzuki, Takamasa; Taki, Kyomi; Higashiyama, Tetsuya; Kinoshita, Toshinori; Nakamichi, Norihito

    2016-03-01

    The circadian clock is a biological timekeeping system that provides organisms with the ability to adapt to day-night cycles. Timing of the expression of four members of theArabidopsis thaliana PSEUDO-RESPONSE REGULATOR(PRR) family is crucial for proper clock function, and transcriptional control ofPRRsremains incompletely defined. Here, we demonstrate that direct regulation ofPRR5by CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) determines the repression state ofPRR5in the morning. Chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) analyses indicated that CCA1 associates with three separate regions upstream ofPRR5 CCA1 and its homolog LATE ELONGATED HYPOCOTYL (LHY) suppressedPRR5promoter activity in a transient assay. The regions bound by CCA1 in thePRR5promoter gave rhythmic patterns with troughs in the morning, when CCA1 and LHY are at high levels. Furthermore,ChIP-seqrevealed that CCA1 associates with at least 449 loci with 863 adjacent genes. Importantly, this gene set contains genes that are repressed but upregulated incca1 lhydouble mutants in the morning. This study shows that direct binding by CCA1 in the morning provides strong repression ofPRR5, and repression by CCA1 also temporally regulates an evening-expressed gene set that includesPRR5. PMID:26941090

  1. Introduction of apple ANR genes into tobacco inhibits expression of both CHI and DFR genes in flowers, leading to loss of anthocyanin

    PubMed Central

    Han, Yuepeng; Vimolmangkang, Sornkanok; Soria-Guerra, Ruth Elena; Korban, Schuyler S.

    2012-01-01

    Three genes encoding anthocyanidin reductase (ANR) in apple (Malus×domestica Borkh.), designated MdANR1, MdANR2a, and MdANR2b, have been cloned and characterized. MdANR1 shows 91% identity in coding DNA sequences with MdANR2a and MdANR2b, while MdANR2a and MdANR2b are allelic and share 99% nucleotide sequence identity in the coding region. MdANR1 and MdANR2 genes are located on linkage groups 10 and 5, respectively. Expression levels of both MdANR1 and MdANR2 genes are generally higher in yellow-skinned cv. Golden Delicious than in red-skinned cv. Red Delicious. Transcript accumulation of MdANR1 and MdANR2 genes in fruits gradually decreased throughout fruit development. Ectopic expression of apple MdANR genes in tobacco positively and negatively regulates the biosynthesis of proanthocyanidins (PAs) and anthocyanin, respectively, resulting in white, pale pink-coloured, and white/red variegated flowers. The accumulation of anthocyanin is significantly reduced in all tobacco transgenic flowers, while catechin and epicatechin contents in transgenic flowers are significantly higher than those in flowers of wild-type plants. The inhibition of anthocyanin synthesis in tobacco transgenic flowers overexpressing MdANR genes is probably attributed to down-regulation of CHALCONE ISOMERASE (CHI) and DIHYDROFLAVONOL-4-REDUCTASE (DFR) genes involved in the anthocyanin pathway. Interestingly, several transgenic lines show no detectable transcripts of the gene encoding leucoanthocyanidin reductase (LAR) in flowers, but accumulate higher levels of catechin in flowers of transgenic plants than those of wild-type plants. This finding suggests that the ANR gene may be capable of generating catechin via an alternative route, although this mechanism is yet to be further elucidated. PMID:22238451

  2. Forced expression of Hnf4a induces hepatic gene activation through directed differentiation.

    PubMed

    Yahoo, Neda; Pournasr, Behshad; Rostamzadeh, Jalal; Fathi, Fardin

    2016-08-01

    Embryonic stem (ES) cells are capable of unlimited self-renewal and have a diverse differentiation potential. These unique features make ES cells as an attractive source for developmental biology studies. Having the mature hepatocyte in the lab with functional activities is valuable in drug discovery studies. Overexpression of hepatocyte lineage-specific transcription factors (TFs) becomes a promising approach in pluripotent cell differentiation toward liver cells. Many studies generate transgenic ES cell lines to examine the effects of specific TFs overexpression in cell differentiation. In the present report, we have addressed whether a suspension or adherent model of differentiation is an appropriate way to study the role of Hnf4a overexpression. We generated ES cells that carried a doxycycline (Dox)-inducible Hnf4a using lentiviral vectors. The transduced cells were subjected to induced Hnf4a overexpression through both spontaneous and directed differentiation methods. Gene expression analysis showed substantially increased expression of hepatic gene markers, particularly Ttr and endogenous Hnf4a, in transduced cells differentiated by the directed approach. These results demonstrated that forced expression of TFs during directed differentiation would be an appropriate way to study relevant gene activation and the effects of overexpression in the context of hepatic differentiation. PMID:27233607

  3. INTRODUCTION OF THE VITELLOGENIN GENE IN EARLY LIFE STAGE FATHEAD MINNOWS AS AN EFFECTIVE EXPOSURE INDICATOR FOR ESTROGENIC COMPOUNDS

    EPA Science Inventory

    Vitellogenin (Vg) gene expression in adult male fathead minnows (FHM) has previously been used successfully to detect exposures to estrogenic compounds in aquatic systems; however, sample volume(s)required for >24h exposure durations and the logistics of sampling pose some limita...

  4. Transient expression of minimum linear gene cassettes in onion epidermal cells via direct transformation.

    PubMed

    Cheng, Yun-Qing; Yang, Jun; Xu, Feng-Ping; An, Li-Jia; Liu, Jian-Feng; Chen, Zhi-Wen

    2009-12-01

    A new method without any special devices for direct transformation of linear gene cassettes was developed. Its feasibility was verified through 5'-fluorescent dye (fluorescein isothiocyanate, FITC)-labeled fluorescent tracing and transient expression of a gus reporter gene. Minimal linear gene cassettes, containing necessary regulation elements and a gus reporter gene, was prepared by polymerase chain reaction and dissolved in transformation buffer solution to 100 ng/mL. The basic transformation solution used was Murashige and Skoog basal salt mixture (MS) liquid medium. Hypertonic pretreatment of explants and transformation cofactors, including Ca(2+), surfactant assistants, Agrobacterium LBA4404 cell culture on transformation efficiency were evaluated. Prior to the incubation of the explants and target linear cassette in each designed transformation solution for 3 h, the onion low epidermal explants were pre-cultured in darkness at 27 degrees C for 48 h and then transferred to MS solid media for 72 h. FITC-labeled linear DNA was used to trace the delivery of DNA entry into the cell and the nuclei. By GUS staining and flow-cytometry-mediated fluorescent detection, a significant increase of the ratios of fluorescent nuclei as well as expression of the gus reporter gene was observed by each designed transformation solution. This potent and feasible method showed prospective applications in plant transgenic research. PMID:19255730

  5. Efficiency of gene silencing in Arabidopsis: direct inverted repeats vs. transitive RNAi vectors.

    SciTech Connect

    Filichkin, Sergei A; DiFazio, Steven P; Brunner, Amy M; Davis, John M; Yang, Zamin Koo; Kalluri, Udaya C; Arias, Renee S; Etherington, Elizabeth; Tuskan, Gerald A; Strauss, S

    2007-01-01

    We investigated the efficiency of RNA interference (RNAi) in Arabidopsis using transitive and homologous inverted repeat (hIR) vectors. hIR constructs carry self-complementary intron-spliced fragments of the target gene whereas transitive vectors have the target sequence fragment adjacent to an intron-spliced, inverted repeat of heterologous origin. Both transitive and hIR constructs facilitated specific and heritable silencing in the three genes studied (AP1, ETTIN and TTG1). Both types of vectors produced a phenotypic series that phenocopied reduction of function mutants for the respective target gene. The hIR yielded up to fourfold higher proportions of events with strongly manifested reduction of function phenotypes compared to transitive RNAi. We further investigated the efficiency and potential off-target effects of AP1 silencing by both types of vectors using genome-scale microarrays and quantitative RT-PCR. The depletion of AP1 transcripts coincided with reduction of function phenotypic changes among both hIR and transitive lines and also showed similar expression patterns among differentially regulated genes. We did not detect significant silencing directed against homologous potential off-target genes when constructs were designed with minimal sequence similarity. Both hIR and transitive methods are useful tools in plant biotechnology and genomics. The choice of vector will depend on specific objectives such as cloning throughput, number of events and degree of suppression required.

  6. Direct gene transfer into human cultured cells facilitated by laser micropuncture of the cell membrane

    SciTech Connect

    Tao, W.; Wilkinson, J.; Stanbridge, E.J.; Berns, M.W.

    1987-06-01

    The selective alteration of the cellular genome by laser microbeam irradiation has been extensively applied in cell biology. The authors report here the use of the third harmonic (355 nm) of an yttrium-aluminum garnet laser to facilitate the direct transfer of the neo gene into cultured human HT1080-6TG cells. The resultant transformants were selected in medium containing an aminoglycoside antibiotic, G418. Integration of the neo gene into individual human chromosomes and expression of the gene were demonstrated by Southern blot analyses, microcell-mediated chromosome transfer, and chromosome analyses. The stability of the integrated neo gene in the transformants was shown by a comparative growth assay in selective and nonselective media. Transformation and incorporation of the neo gene into the host genome occurred at a frequency of 8 x 10 /sup -4/-3 x 10/sup -3/. This method appears to be 100-fold more efficient than the standard calcium phosphate-mediated method of DNA transfer.

  7. Disruption of a toxin gene by introduction of a foreign gene into the Chromosome of Clostridium perfringens using targetron induced mutagenesis

    PubMed Central

    Chen, Yue; Caruso, Lori; McClane, Bruce; Fisher, Derek; Gupta, Phalguni

    2007-01-01

    Clostridium perfringens (C. perfringens) has been developed as a potential oral delivery vehicle to deliver antigens or therapeutic compounds to Gut Associated Lymphoid Tissue (GALT). However, this recombinant C. perfringens carries a plasmid-encoded expression system, which raises several safety concerns regarding possible horizontal plasmid transfer and spread of plasmid-associated antibiotic resistant genes. Furthermore, this bacterium produces the extracellular theta toxin, which poses a potential safety issue for general administration. Using a Clostridium-specific-targetron-donor plasmid, we inserted the Simian Immunodefiency Virus (SIV) p27 gene into the theta toxin gene (pfoA) on the C. perfringens chromosome, which simultaneously inactivated the theta gene and introduced SIV p27 gene onto bacterial chromosome. Such mutant C. perfringens without an input plasmid or antibiotic resistant gene stably produced a large amount of SIV p27 protein during sporulation and did not produce theta toxin. Upon oral feeding of the mutant bacteria to mice, intact p27 protein was detected in the lower GI tract. The re-engineered C. perfringens provides a biosafe efficient oral vehicle to deliver antigen to gastrointestinal tract. PMID:17553563

  8. Congenital Nystagmus Gene FRMD7 Is Necessary for Establishing a Neuronal Circuit Asymmetry for Direction Selectivity

    PubMed Central

    Yonehara, Keisuke; Fiscella, Michele; Drinnenberg, Antonia; Esposti, Federico; Trenholm, Stuart; Krol, Jacek; Franke, Felix; Scherf, Brigitte Gross; Kusnyerik, Akos; Müller, Jan; Szabo, Arnold; Jüttner, Josephine; Cordoba, Francisco; Reddy, Ashrithpal Police; Németh, János; Nagy, Zoltán Zsolt; Munier, Francis; Hierlemann, Andreas; Roska, Botond

    2016-01-01

    Summary Neuronal circuit asymmetries are important components of brain circuits, but the molecular pathways leading to their establishment remain unknown. Here we found that the mutation of FRMD7, a gene that is defective in human congenital nystagmus, leads to the selective loss of the horizontal optokinetic reflex in mice, as it does in humans. This is accompanied by the selective loss of horizontal direction selectivity in retinal ganglion cells and the transition from asymmetric to symmetric inhibitory input to horizontal direction-selective ganglion cells. In wild-type retinas, we found FRMD7 specifically expressed in starburst amacrine cells, the interneuron type that provides asymmetric inhibition to direction-selective retinal ganglion cells. This work identifies FRMD7 as a key regulator in establishing a neuronal circuit asymmetry, and it suggests the involvement of a specific inhibitory neuron type in the pathophysiology of a neurological disease. Video Abstract PMID:26711119

  9. Congenital Nystagmus Gene FRMD7 Is Necessary for Establishing a Neuronal Circuit Asymmetry for Direction Selectivity.

    PubMed

    Yonehara, Keisuke; Fiscella, Michele; Drinnenberg, Antonia; Esposti, Federico; Trenholm, Stuart; Krol, Jacek; Franke, Felix; Scherf, Brigitte Gross; Kusnyerik, Akos; Müller, Jan; Szabo, Arnold; Jüttner, Josephine; Cordoba, Francisco; Reddy, Ashrithpal Police; Németh, János; Nagy, Zoltán Zsolt; Munier, Francis; Hierlemann, Andreas; Roska, Botond

    2016-01-01

    Neuronal circuit asymmetries are important components of brain circuits, but the molecular pathways leading to their establishment remain unknown. Here we found that the mutation of FRMD7, a gene that is defective in human congenital nystagmus, leads to the selective loss of the horizontal optokinetic reflex in mice, as it does in humans. This is accompanied by the selective loss of horizontal direction selectivity in retinal ganglion cells and the transition from asymmetric to symmetric inhibitory input to horizontal direction-selective ganglion cells. In wild-type retinas, we found FRMD7 specifically expressed in starburst amacrine cells, the interneuron type that provides asymmetric inhibition to direction-selective retinal ganglion cells. This work identifies FRMD7 as a key regulator in establishing a neuronal circuit asymmetry, and it suggests the involvement of a specific inhibitory neuron type in the pathophysiology of a neurological disease. PMID:26711119

  10. Direct detection of antibiotic resistance genes in specimens of chicken and pork meat.

    PubMed

    Garofalo, Cristiana; Vignaroli, Carla; Zandri, Giada; Aquilanti, Lucia; Bordoni, Donatella; Osimani, Andrea; Clementi, Francesca; Biavasco, Francesca

    2007-01-01

    Antibiotic resistance (AR) in bacteria, a major threat to human health, has emerged in the last few decades as a consequence of the selective pressure exerted by the widespread use of antibiotics in medicine, agriculture and veterinary practice and as growth promoters in animal husbandry. The frequency of 11 genes [tet(M), tet(O), tet(K), erm(A), erm(B), erm(C), vanA, vanB, aac (6')-Ie aph (2'')-Ia, mecA, blaZ] encoding resistance to some antibiotics widely used in clinical practice was analysed in raw pork and chicken meat and in fermented sausages as well as in faecal samples from the relevant farm animals using a molecular approach based on PCR amplification of bacterial DNA directly extracted from specimens. Some of the 11 AR genes were highly prevalent, the largest number being detected in chicken meat and pig faeces. The genes found most frequently in meat were tet(K) and erm(B); vanB and mecA were the least represented. All 11 determinants were detected in faecal samples except mecA, which was found only in chicken faeces. erm(B) and erm(C) were detected in all faecal samples. The frequency of AR genes was not appreciably different in meat compared to faecal specimens of the relevant animal except for vanB, which was more prevalent in faeces. Our findings suggest that AR genes are highly prevalent in food-associated bacteria and that AR contamination is likely related to breeding rather than processing techniques. Finally, the cultivation-independent molecular method used in this work to determine the prevalence of AR genes in foods proved to be a rapid and reliable alternative to traditional tools. PMID:17005283

  11. RORγ directly regulates the circadian expression of clock genes and downstream targets in vivo.

    PubMed

    Takeda, Yukimasa; Jothi, Raja; Birault, Veronique; Jetten, Anton M

    2012-09-01

    In this study, we demonstrate that the lack of retinoic acid-related orphan receptor (ROR) γ or α expression in mice significantly reduced the peak expression level of Cry1, Bmal1, E4bp4, Rev-Erbα and Per2 in an ROR isotype- and tissue-selective manner without affecting the phase of their rhythmic expression. Analysis of RORγ/RORα double knockout mice indicated that in certain tissues RORγ and RORα exhibited a certain degree of redundancy in regulating clock gene expression. Reporter gene analysis showed that RORγ was able to induce reporter gene activity through the RORE-containing regulatory regions of Cry1, Bmal1, Rev-Erbα and E4bp4. Co-expression of Rev-Erbα or addition of a novel ROR antagonist repressed this activation. ChIP-Seq and ChIP-Quantitative real-time polymerase chain reaction (QPCR) analysis demonstrated that in vivo RORγ regulate these genes directly and in a Zeitgeber time (ZT)-dependent manner through these ROREs. This transcriptional activation by RORs was associated with changes in histone acetylation and chromatin accessibility. The rhythmic expression of RORγ1 by clock proteins may lead to the rhythmic expression of RORγ1 target genes. The presence of RORγ binding sites and its down-regulation in RORγ-/- liver suggest that the rhythmic expression of Avpr1a depends on RORγ consistent with the concept that RORγ1 provides a link between the clock machinery and its regulation of metabolic genes. PMID:22753030

  12. Generation of insect-resistant and glyphosate-tolerant rice by introduction of a T-DNA containing two Bt insecticidal genes and an EPSPS gene*

    PubMed Central

    ZHAO, Qi-chao; LIU, Ming-hong; ZHANG, Xian-wen; LIN, Chao-yang; ZHANG, Qing; SHEN, Zhi-cheng

    2015-01-01

    Insect resistance and glyphosate tolerance have been two of the most important traits in the genetic improvement of various crops. In this study, two Bacillus thuringiensis (Bt) insecticidal genes, Cry1Ac and Cry1Ig, and a modified glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene (G10) were combined into a single transferred DNA (T-DNA) fragment and introduced into rice by Agrobacterium-mediated transformation. A transgenic line with single-copy T-DNA insertion named GAI-14 was found to be highly resistant to striped stem borer and rice leaf roller, and tolerant to glyphosate. Analysis of T-DNA border sequence suggested that the transgenes were inserted at the chromosome 3 and appeared to have not interrupted any known or putative genes. A field trial observed no significant difference in the basic agronomic traits between GAI-14 and the recipient rice. PMID:26465130

  13. Generation of insect-resistant and glyphosate-tolerant rice by introduction of a T-DNA containing two Bt insecticidal genes and an EPSPS gene.

    PubMed

    Zhao, Qi-chao; Liu, Ming-hong; Zhang, Xian-wen; Lin, Chao-yang; Zhang, Qing; Shen, Zhi-cheng

    2015-10-01

    Insect resistance and glyphosate tolerance have been two of the most important traits in the genetic improvement of various crops. In this study, two Bacillus thuringiensis (Bt) insecticidal genes, Cry1Ac and Cry1Ig, and a modified glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene (G10) were combined into a single transferred DNA (T-DNA) fragment and introduced into rice by Agrobacterium-mediated transformation. A transgenic line with single-copy T-DNA insertion named GAI-14 was found to be highly resistant to striped stem borer and rice leaf roller, and tolerant to glyphosate. Analysis of T-DNA border sequence suggested that the transgenes were inserted at the chromosome 3 and appeared to have not interrupted any known or putative genes. A field trial observed no significant difference in the basic agronomic traits between GAI-14 and the recipient rice. PMID:26465130

  14. A method for introduction of unmarked mutations in the genome of Paracoccus denitrificans: construction of strains with multiple mutations in the genes encoding periplasmic cytochromes c550, c551i, and c553i.

    PubMed Central

    Van Spanning, R J; Wansell, C W; Reijnders, W N; Harms, N; Ras, J; Oltmann, L F; Stouthamer, A H

    1991-01-01

    A new suicide vector, pRVS1, was constructed to facilitate the site-directed introduction of unmarked mutations in the chromosome of Paracoccus denitrificans. The vector was derived from suicide vector pGRPd1, which was equipped with the lacZ gene encoding beta-galactosidase. The reporter gene was found to be a successful screening marker for the discrimination between plasmid integrant strains and mutant strains which had lost the plasmid after homologous recombination. Suicide vectors pGRPd1 and pRVS1 were used in gene replacement techniques for the construction of mutant strains with multiple mutations in the cycA, moxG, and cycB genes encoding the periplasmic cytochromes c550, c551i, and c553i, respectively. Southern analyses of the DNA and protein analyses of the resultant single, double, and triple mutant strains confirmed the correctness of the mutations. The wild type and mutant strains were all able to grow on succinate and choline chloride. In addition, all strains grew on methylamine and displayed wild-type levels of methylamine dehydrogenase activities. cycA mutant strains, however, showed a decreased maximum specific growth rate on the methylamine substrate. The wild-type strain, cycA and cycB mutant strains, and the cycA cycB double mutant strain were able to grow on methanol and showed wild-type levels of methanol dehydrogenase activities. moxG mutant strains failed to grow on methanol and had low levels of methanol dehydrogenase activities. The maximum specific growth rate of the cycA mutant strain on methanol was comparable with that of the wild-type strain. The data indicate the involvement of the soluble cytochromes c in clearly defined electron transport routes. Images FIG. 3 FIG. 4 PMID:1657872

  15. Partial rescue of a lethal phenotype of fragile bones in transgenic mice with a chimeric antisense gene directed against a mutated collagen gene.

    PubMed Central

    Khillan, J S; Li, S W; Prockop, D J

    1994-01-01

    Previously, transgenic mice were prepared that developed a lethal phenotype of fragile bones because they expressed an internally deleted mini-gene for the pro alpha 1(I) chain of human type I procollagen. The shortened pro alpha 1(I) chains synthesized from the human transgene bound to and produced degradation of normal pro alpha 1(I) chains synthesized from the normal mouse alleles. Here we assembled an antisense gene that was similar to the internally deleted COL1A1 minigene but the 3' half of the gene was inverted so as to code for an antisense RNA. Transgenic mice expressing the antisense gene had a normal phenotype, apparently because the antisense gene contained human sequences instead of mouse sequences. Two lines of mice expressing the antisense gene were bred to two lines of transgenic mice expressing the mini-gene. In mice that inherited both genes, the incidence of the lethal fragile bone phenotype was reduced from 92% to 27%. The effects of the antisense gene were directly demonstrated by an increase in the ratio of normal mouse pro alpha 1(I) chains to human mini-pro alpha 1(I) chains in tissues from mice that inherited both genes and had a normal phenotype. The results raise the possibility that chimeric gene constructs that contain intron sequences and in which only the second half of a gene is inverted may be particularly effective as antisense genes. Images PMID:8022775

  16. Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering with introduction of bacterial phytoene synthase gene crtB.

    PubMed

    Fujisawa, Masaki; Watanabe, Mio; Choi, Song-Kang; Teramoto, Maki; Ohyama, Kanji; Misawa, Norihiko

    2008-06-01

    Linseed flax (Linum usitatissimum L.) is an industrially important oil crop, which includes large amounts of alpha-linolenic acid (18:3) and lignan in its seed oil. We report here the metabolic engineering of flax plants to increase carotenoid amount in seeds. Agrobacterium-mediated transformation of flax was performed to express the phytoene synthase gene (crtB) derived from the soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3) under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter or the Arabidopsis thaliana fatty acid elongase 1 gene (FAE1) seed-specific promoter. As a result, eight transgenic flax plants were generated. They formed orange seeds (embryos), in which phytoene, alpha-carotene, and beta-carotene were newly accumulated in addition to increased amounts of lutein, while untransformed flax plants formed light-yellow seeds, in which only lutein was detected. Interestingly, despite the control of the CaMV 35S promoter, the expression of crtB was not observed in the leaves but in the seeds in the transgenic flax plants. Total carotenoid amounts in these seeds were 65.4-156.3 microg/g fresh weight, which corresponded to 7.8- to 18.6-fold increase, compared with those of untransformed controls. These results suggest that the flux of phytoene synthesis from geranylgeranyl diphosphate was first promoted by the expressed crtB gene product (CrtB), and then phytoene was consecutively decomposed to the downstream metabolites alpha-carotene, beta-carotene, and lutein, as catalyzed by endogenous carotenoid biosynthetic enzymes in seeds. The transgenic flaxseeds enriched with the carotenoids could be valuable as nutritional sources for human health. PMID:18640603

  17. Recursive directional ligation by plasmid reconstruction allows rapid and seamless cloning of oligomeric genes.

    PubMed

    McDaniel, Jonathan R; Mackay, J Andrew; Quiroz, Felipe García; Chilkoti, Ashutosh

    2010-04-12

    This paper reports a new strategy, recursive directional ligation by plasmid reconstruction (PRe-RDL), to rapidly clone highly repetitive polypeptides of any sequence and specified length over a large range of molecular weights. In a single cycle of PRe-RDL, two halves of a parent plasmid, each containing a copy of an oligomer, are ligated together, thereby dimerizing the oligomer and reconstituting a functional plasmid. This process is carried out recursively to assemble an oligomeric gene with the desired number of repeats. PRe-RDL has several unique features that stem from the use of type IIs restriction endonucleases: first, PRe-RDL is a seamless cloning method that leaves no extraneous nucleotides at the ligation junction. Because it uses type IIs endonucleases to ligate the two halves of the plasmid, PRe-RDL also addresses the major limitation of RDL in that it abolishes any restriction on the gene sequence that can be oligomerized. The reconstitution of a functional plasmid only upon successful ligation in PRe-RDL also addresses two other limitations of RDL: the significant background from self-ligation of the vector observed in RDL, and the decreased efficiency of ligation due to nonproductive circularization of the insert. PRe-RDL can also be used to assemble genes that encode different sequences in a predetermined order to encode block copolymers or append leader and trailer peptide sequences to the oligomerized gene. PMID:20184309

  18. Direct effect of acaricides on pathogen loads and gene expression levels in honey bees Apis mellifera.

    PubMed

    Boncristiani, Humberto; Underwood, Robyn; Schwarz, Ryan; Evans, Jay D; Pettis, Jeffery; vanEngelsdorp, Dennis

    2012-05-01

    The effect of using acaricides to control varroa mites has long been a concern to the beekeeping industry due to unintended negative impacts on honey bee health. Irregular ontogenesis, suppression of immune defenses, and impairment of normal behavior have been linked to pesticide use. External stressors, including parasites and the pathogens they vector, can confound studies on the effects of pesticides on the metabolism of honey bees. This is the case of Varroa destructor, a mite that negatively affects honey bee health on many levels, from direct parasitism, which diminishes honey bee productivity, to vectoring and/or activating other pathogens, including many viruses. Here we present a gene expression profile comprising genes acting on diverse metabolic levels (detoxification, immunity, and development) in a honey bee population that lacks the influence of varroa mites. We present data for hives treated with five different acaricides; Apiguard (thymol), Apistan (tau-fluvalinate), Checkmite (coumaphos), Miteaway (formic acid) and ApiVar (amitraz). The results indicate that thymol, coumaphos and formic acid are able to alter some metabolic responses. These include detoxification gene expression pathways, components of the immune system responsible for cellular response and the c-Jun amino-terminal kinase (JNK) pathway, and developmental genes. These could potentially interfere with the health of individual honey bees and entire colonies. PMID:22212860

  19. Direct linking of metabolism and gene expression in the proline utilization A protein from Escherichia coli

    PubMed Central

    Zhou, Yuzhen; Zhu, Weidong; Bellur, Padmanetra S.; Rewinkel, Dustin; Becker, Donald F.

    2009-01-01

    Summary The control of gene expression by enzymes provides a direct pathway for cells to respond to fluctuations in metabolites and nutrients. One example is the proline utilization A (PutA) protein from Escherichia coli. PutA is a membrane-associated enzyme that catalyzes the oxidation of L-proline to glutamate using a flavin containing proline dehydrogenase domain and a NAD+ dependent Δ1-pyrroline-5-carboxylate dehydrogenase domain. In some Gram-negative bacteria such as E. coli, PutA is also endowed with a ribbon-helix-helix DNA-binding domain and acts as a transcriptional repressor of the proline utilization genes. PutA switches between transcriptional repressor and enzymatic functions in response to proline availability. Molecular insights into the redox based mechanism of PutA functional switching from recent studies are reviewed. In addition, new results from cell-based transcription assays are presented which correlate PutA membrane localization with put gene expression levels. General membrane localization of PutA, however, is not sufficient to activate the put genes. PMID:18324349

  20. Capsid-Modified Adenoviral Vectors for Improved Muscle-Directed Gene Therapy

    PubMed Central

    Guse, Kilian; Suzuki, Masataka; Sule, Gautam; Bertin, Terry K.; Tyynismaa, Henna; Ahola-Erkkilä, Sofia; Palmer, Donna; Suomalainen, Anu; Ng, Philip; Cerullo, Vincenzo; Hemminki, Akseli

    2012-01-01

    Abstract Skeletal muscle represents an attractive target tissue for adenoviral gene therapy to treat muscle disorders and as a production platform for systemic expression of therapeutic proteins. However, adenovirus serotype 5 vectors do not efficiently transduce adult muscle tissue. Here we evaluated whether capsid modifications on adenoviral vectors could improve transduction in mature murine muscle tissue. First-generation and helper-dependent serotype 5 adenoviral vectors featuring the serotype 3 knob (5/3) showed significantly increased transduction of skeletal muscle after intramuscular injection in adult mice. Furthermore, we showed that full-length dystrophin could be more efficiently transferred to muscles of mdx mice using a 5/3-modified helper-dependent adenoviral vector. In contrast to first-generation vectors, helper-dependent adenoviral vectors mediated stable marker gene expression for at least 1 year after intramuscular injection. In conclusion, 5/3 capsid-modified helper-dependent adenoviral vectors show enhanced transduction in adult murine muscle tissue and mediate long-term gene expression, suggesting the suitability of these vectors for muscle-directed gene therapy. PMID:22888960

  1. Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

    SciTech Connect

    Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong; Chung, Hyun Joo; Kim, Myoung Hee

    2010-02-19

    Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna was similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.

  2. Direct effect of cocaine on epigenetic regulation of PKCepsilon gene repression in the fetal rat heart.

    PubMed

    Meyer, Kurt; Zhang, Haitao; Zhang, Lubo

    2009-10-01

    Maternal cocaine administration during gestation caused a down-regulation of PKCepsilon expression in the heart of adult offspring resulting in an increased sensitivity to ischemia and reperfusion injury. The present study investigated the direct effect of cocaine in epigenetic modification of PKCepsilon gene repression in the fetal heart. Hearts were isolated from gestational day 17 fetal rats and treated with cocaine in an ex vivo organ culture system. Cocaine treatment for 48 h resulted in significant decreases in PKCepsilon protein and mRNA abundance and increases in CpG methylation at two SP1 binding sites in the PKCepsilon promoter region (-346 and -268). Electrophoretic mobility shift assays demonstrated that CpG methylation of both SP1 sites inhibited SP1 binding. Consistently, chromatin immunoprecipitation assays showed that cocaine treatment significantly decreased binding of SP1 to the SP1 sites in the intact fetal heart. Reporter gene assays revealed that site-directed mutations of CpG methylation at both SP1 sites significantly reduced the PKCepsilon promoter activity while methylation of a single site at either -346 or -268 did not have a significant effect. The causal effect of increased methylation in the cocaine-induced down-regulation of PKCepsilon was demonstrated with the use of DNA methylation inhibitors. The presence of either 5-aza-2'-deoxycytodine or procainamide blocked the cocaine-induced increase in SP1 sites methylation and decrease in PKCepsilon mRNA. The results demonstrate a direct effect of cocaine in epigenetic modification of DNA methylation and programming of cardiac PKCepsilon gene repression linking prenatal cocaine exposure and pathophysiological consequences in the heart of adult offspring. PMID:19538969

  3. MYRF is a membrane-associated transcription factor that autoproteolytically cleaves to directly activate myelin genes.

    PubMed

    Bujalka, Helena; Koenning, Matthias; Jackson, Stacey; Perreau, Victoria M; Pope, Bernard; Hay, Curtis M; Mitew, Stanlislaw; Hill, Andrew F; Lu, Q Richard; Wegner, Michael; Srinivasan, Rajini; Svaren, John; Willingham, Melanie; Barres, Ben A; Emery, Ben

    2013-01-01

    The myelination of axons is a crucial step during vertebrate central nervous system (CNS) development, allowing for rapid and energy efficient saltatory conduction of nerve impulses. Accordingly, the differentiation of oligodendrocytes, the myelinating cells of the CNS, and their expression of myelin genes are under tight transcriptional control. We previously identified a putative transcription factor, Myelin Regulatory Factor (Myrf), as being vital for CNS myelination. Myrf is required for the generation of CNS myelination during development and also for its maintenance in the adult. It has been controversial, however, whether Myrf directly regulates transcription, with reports of a transmembrane domain and lack of nuclear localization. Here we show that Myrf is a membrane-associated transcription factor that undergoes an activating proteolytic cleavage to separate its transmembrane domain-containing C-terminal region from a nuclear-targeted N-terminal region. Unexpectedly, this cleavage event occurs via a protein domain related to the autoproteolytic intramolecular chaperone domain of the bacteriophage tail spike proteins, the first time this domain has been found to play a role in eukaryotic proteins. Using ChIP-Seq we show that the N-terminal cleavage product directly binds the enhancer regions of oligodendrocyte-specific and myelin genes. This binding occurs via a defined DNA-binding consensus sequence and strongly promotes the expression of target genes. These findings identify Myrf as a novel example of a membrane-associated transcription factor and provide a direct molecular mechanism for its regulation of oligodendrocyte differentiation and CNS myelination. PMID:23966833

  4. Improvement in fruiting body yield by introduction of the Ampullaria crossean multi-functional cellulase gene into Volvariella volvacea.

    PubMed

    Zhao, Feng-Yun; Lin, Jun-Fang; Zeng, Xian-Lu; Guo, Li-Qiong; Wang, Yi-Hong; You, Li-Rong

    2010-08-01

    The multi-functional cellulase gene, mfc, from Ampullaria crossean was transformed into Volvariella volvacea by PEG-mediated protoplast transformation to improve the biological efficiency and fruiting body yield. PCR and Southern blotting indicated that mfc was integrated into the genomes of four transformants. In laboratory and large scale cultivation experiments, the average biological efficiency of the transformants was 18.39+/-1.27% and 27.84+/-3.21%, respectively, considerably higher than the corresponding values for untransformed controls of 12.69+/-1.31% and 20.63+/-2.59%. This is the first report of an improvement in biological efficiency and fruiting body yield of V. volvacea through transgenesis. PMID:20378340

  5. A Cell-Penetrating Peptide with a Guanidinylethyl Amine Structure Directed to Gene Delivery

    PubMed Central

    Oba, Makoto; Kato, Takuma; Furukawa, Kaori; Tanaka, Masakazu

    2016-01-01

    A peptide composed of lysine with a guanidinylethyl (GEt) amine structure in the side chain [Lys(GEt)] was developed as a cell-penetrating peptide directed to plasmid DNA (pDNA) delivery. The GEt amine adopted a diprotonated form at neutral pH, which may have led to the more efficient cellular uptake of a Lys(GEt)-peptide than an arginine-peptide at a low concentration. Lys(GEt)-peptide/pDNA complexes showed the highest transfection efficiency due to efficient endosomal escape without any cytotoxicity. Lys(GEt)-peptide may be a promising candidate as a gene delivery carrier. PMID:26814673

  6. A Cell-Penetrating Peptide with a Guanidinylethyl Amine Structure Directed to Gene Delivery

    NASA Astrophysics Data System (ADS)

    Oba, Makoto; Kato, Takuma; Furukawa, Kaori; Tanaka, Masakazu

    2016-01-01

    A peptide composed of lysine with a guanidinylethyl (GEt) amine structure in the side chain [Lys(GEt)] was developed as a cell-penetrating peptide directed to plasmid DNA (pDNA) delivery. The GEt amine adopted a diprotonated form at neutral pH, which may have led to the more efficient cellular uptake of a Lys(GEt)-peptide than an arginine-peptide at a low concentration. Lys(GEt)-peptide/pDNA complexes showed the highest transfection efficiency due to efficient endosomal escape without any cytotoxicity. Lys(GEt)-peptide may be a promising candidate as a gene delivery carrier.

  7. Direct lineage reprogramming via pioneer factors; a detour through developmental gene regulatory networks.

    PubMed

    Morris, Samantha A

    2016-08-01

    Although many approaches have been employed to generate defined fate in vitro, the resultant cells often appear developmentally immature or incompletely specified, limiting their utility. Growing evidence suggests that current methods of direct lineage conversion may rely on the transition through a developmental intermediate. Here, I hypothesize that complete conversion between cell fates is more probable and feasible via reversion to a developmentally immature state. I posit that this is due to the role of pioneer transcription factors in engaging silent, unmarked chromatin and activating hierarchical gene regulatory networks responsible for embryonic patterning. Understanding these developmental contexts will be essential for the precise engineering of cell identity. PMID:27486230

  8. A potential target gene for the host-directed therapy of mycobacterial infection in murine macrophages

    PubMed Central

    Bao, Zhang; Chen, Ran; Zhang, Pei; Lu, Shan; Chen, Xing; Yao, Yake; Jin, Xiaozheng; Sun, Yilan; Zhou, Jianying

    2016-01-01

    Mycobacterium tuberculosis (MTB), one of the major bacterial pathogens for lethal infectious diseases, is capable of surviving within the phagosomes of host alveolar macrophages; therefore, host genetic variations may alter the susceptibility to MTB. In this study, to identify host genes exploited by MTB during infection, genes were non-selectively inactivated using lentivirus-based antisense RNA methods in RAW264.7 macrophages, and the cells that survived virulent MTB infection were then screened. Following DNA sequencing of the surviving cell clones, 26 host genes affecting susceptibility to MTB were identified and their pathways were analyzed by bioinformatics analysis. In total, 9 of these genes were confirmed as positive regulators of collagen α-5(IV) chain (Col4a5) expression, a gene encoding a type IV collagen subunit present on the cell surface. The knockdown of Col4a5 consistently suppressed intracellular mycobacterial viability, promoting the survival of RAW264.7 macrophages following mycobacterial infection. Furthermore, Col4a5 deficiency lowered the pH levels of intracellular vesicles, including endosomes, lysosomes and phagosomes in the RAW264.7 cells. Finally, the knockdown of Col4a5 post-translationally increased microsomal vacuolar-type H+-ATPase activity in macrophages, leading to the acidification of intracellular vesicles. Our findings reveal a novel role for Col4a5 in the regulation of macrophage responses to mycobacterial infection and identify Col4a5 as a potential target for the host-directed anti-mycobacterial therapy. PMID:27432120

  9. A potential target gene for the host-directed therapy of mycobacterial infection in murine macrophages.

    PubMed

    Bao, Zhang; Chen, Ran; Zhang, Pei; Lu, Shan; Chen, Xing; Yao, Yake; Jin, Xiaozheng; Sun, Yilan; Zhou, Jianying

    2016-09-01

    Mycobacterium tuberculosis (MTB), one of the major bacterial pathogens for lethal infectious diseases, is capable of surviving within the phagosomes of host alveolar macrophages; therefore, host genetic variations may alter the susceptibility to MTB. In this study, to identify host genes exploited by MTB during infection, genes were non-selectively inactivated using lentivirus-based antisense RNA methods in Raw264.7 macrophages, and the cells that survived virulent MTB infection were then screened. Following DNA sequencing of the surviving cell clones, 26 host genes affecting susceptibility to MTB were identified and their pathways were analyzed by bioinformatics analysis. In total, 9 of these genes were confirmed as positive regulators of collagen α-5(IV) chain (Col4a5) expression, a gene encoding a type IV collagen subunit present on the cell surface. The knockdown of Col4a5 consistently suppressed intracellular mycobacterial viability, promoting the survival of Raw264.7 macrophages following mycobacterial infection. Furthermore, Col4a5 deficiency lowered the pH levels of intracellular vesicles, including endosomes, lysosomes and phagosomes in the Raw264.7 cells. Finally, the knockdown of Col4a5 post-translationally increased microsomal vacuolar-type H+-ATPase activity in macrophages, leading to the acidification of intracellular vesicles. Our findings reveal a novel role for Col4a5 in the regulation of macrophage responses to mycobacterial infection and identify Col4a5 as a potential target for the host-directed anti-mycobacterial therapy. PMID:27432120

  10. Alterations in the RB1 gene in Pakistani patients with retinoblastoma using direct sequencing analysis

    PubMed Central

    Wasim, Muhammad; Afzal, Sibtain; Shahzad, Muhammad Saqib; Ramzan, Shaiqa; Awan, Ali Raza; Anjum, Aftab Ahmed; Ramzan, Khushnooda

    2015-01-01

    Purpose Retinoblastoma (RB) is a rare intraocular malignant tumor of the developing retina with an estimated incidence of 1:20,000 live births in children under the age of 5 years. In addition to the abnormal whitish appearance of the pupil or leukocoria, strabismus has also been reported as a clinical symptom of the disease. RB1 is the first cloned tumor suppressor gene, and mutational inactivation of this gene is responsible for the development of RB during early childhood. The purpose of this study was to identify mutational alterations in the RB1 gene in Pakistani patients with RB. Methods During this study, 70 clinically evaluated patients with RB were recruited from different regions of Pakistan. The cases included 23 sporadic bilateral (32.9%), 34 sporadic unilateral (48.6%), nine familial bilateral (12.8%), and four familial unilateral (5.7%) cases. Constitutional causative mutations in the RB1 gene were screened via direct sequencing of all RB1 exons and their flanking regions. Results In this report, genetic testing resulted in the identification of 18 mutations in 25 patients with RB including six novel RB1 mutations. Of the total mutations identified, 13 (72.22%) were found to be null mutations caused by nine nonsense, three deletions, and one insertion. Two (11.11%) missense, two (11.11%) splice site mutations, and one (5.55%) base substitution in the promoter region were also found. Moreover, ten intronic variants were identified, one of which is novel. Conclusions Molecular screening and identification of these mutations in Pakistani patients with RB provide the mutational variants of the RB1 gene in the Pakistani population. The detection of oncogenic mutations in patients with RB and genetically predisposed individuals is a major step in clinical management, prognosis, follow-up care, accurate genetic counseling, and presymptomatic diagnosis of RB. PMID:26396485

  11. Regulatory region in choline acetyltransferase gene directs developmental and tissue-specific expression in transgenic mice.

    PubMed Central

    Lönnerberg, P; Lendahl, U; Funakoshi, H; Arhlund-Richter, L; Persson, H; Ibáñez, C F

    1995-01-01

    Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons. Images Fig. 1 Fig. 2 PMID:7732028

  12. Differentiation of LA-N-5 neuroblastoma cells into cholinergic neurons: methods for differentiation, immunohistochemistry and reporter gene introduction.

    PubMed

    Hill, D P; Robertson, K A

    1998-03-01

    cell line, Exp. Cell Res. 155 (1984) 305-309 [14]). These cells provide a setting for the study of cholinergic neuronal differentiation and of the factors that influence that process. We also discuss procedures that can be used to study gene expression in LA-N-5 cells by immunohistochemistry and reporter gene analysis. PMID:9507116

  13. Helper-dependent adenoviral vectors for liver-directed gene therapy of primary hyperoxaluria type 1.

    PubMed

    Castello, R; Borzone, R; D'Aria, S; Annunziata, P; Piccolo, P; Brunetti-Pierri, N

    2016-02-01

    Primary hyperoxaluria type 1 (PH1) is an inborn error of liver metabolism due to deficiency of the peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT), which catalyzes conversion of glyoxylate into glycine. AGT deficiency results in overproduction of oxalate that ultimately leads to end-stage renal disease and death. Organ transplantation as either preemptive liver transplantation or combined liver/kidney transplantation is the only available therapy to prevent disease progression. Gene therapy is an attractive option to provide an alternative treatment for PH1. Toward this goal, we investigated helper-dependent adenoviral (HDAd) vectors for liver-directed gene therapy of PH1. Compared with saline controls, AGT-deficient mice injected with an HDAd encoding the AGT under the control of a liver-specific promoter showed a significant reduction of hyperoxaluria and less increase of urinary oxalate following challenge with ethylene glycol, a precursor of glyoxylate. These studies may thus pave the way to clinical application of HDAd for PH1 gene therapy. PMID:26609667

  14. Exchange factors directly activated by cAMP mediate melanocortin 4 receptor-induced gene expression

    PubMed Central

    Glas, Evi; Mückter, Harald; Gudermann, Thomas; Breit, Andreas

    2016-01-01

    Gs protein-coupled receptors regulate many vital body functions by activation of cAMP response elements (CRE) via cAMP-dependent kinase A (PKA)-mediated phosphorylation of the CRE binding protein (CREB). Melanocortin 4 receptors (MC4R) are prototypical Gs-coupled receptors that orchestrate the hypothalamic control of food-intake and metabolism. Remarkably, the significance of PKA for MC4R-induced CRE-dependent transcription in hypothalamic cells has not been rigorously interrogated yet. In two hypothalamic cell lines, we observed that blocking PKA activity had only weak or no effects on reporter gene expression. In contrast, inhibitors of exchange factors directly activated by cAMP-1/2 (EPAC-1/2) mitigated MC4R-induced CRE reporter activation and mRNA induction of the CREB-dependent genes c-fos and thyrotropin-releasing hormone. Furthermore, we provide first evidence that extracellular-regulated kinases-1/2 (ERK-1/2) activated by EPACs and not PKA are the elusive CREB kinases responsible for MC4R-induced CREB/CRE activation in hypothalamic cells. Overall, these data emphasize the pivotal role of EPACs rather than PKA in hypothalamic gene expression elicited by a prototypical Gs-coupled receptor. PMID:27612207

  15. Directed evolution of novel adeno-associated viruses for therapeutic gene delivery.

    PubMed

    Bartel, M A; Weinstein, J R; Schaffer, D V

    2012-06-01

    Gene therapy vectors based on adeno-associated virus (AAV) are currently in clinical trials for numerous disease targets, such as muscular dystrophy, hemophilia, Parkinson's disease, Leber's congenital amaurosis and macular degeneration. Despite its considerable promise and emerging clinical success, several challenges impede the broader implementation of AAV gene therapy, including the prevalence of neutralizing antibodies in the human population, low transduction of a number of therapeutically relevant cell and tissue types, an inability to overcome physical and cellular barriers in vivo and a relatively limited carrying capacity. These challenges arise as the demands we place on AAV vectors are often different from or even at odds with the properties nature bestowed on their parent viruses. Viral-directed evolution-the iterative generation of large, diverse libraries of viral mutants and selection for variants with specific properties of interest-offers an approach to address these problems. Here we outline progress in creating novel classes of AAV variant libraries and highlight the successful isolation of variants with novel and advantageous in vitro and in vivo gene delivery properties. PMID:22402323

  16. Controllability analysis of the directed human protein interaction network identifies disease genes and drug targets.

    PubMed

    Vinayagam, Arunachalam; Gibson, Travis E; Lee, Ho-Joon; Yilmazel, Bahar; Roesel, Charles; Hu, Yanhui; Kwon, Young; Sharma, Amitabh; Liu, Yang-Yu; Perrimon, Norbert; Barabási, Albert-László

    2016-05-01

    The protein-protein interaction (PPI) network is crucial for cellular information processing and decision-making. With suitable inputs, PPI networks drive the cells to diverse functional outcomes such as cell proliferation or cell death. Here, we characterize the structural controllability of a large directed human PPI network comprising 6,339 proteins and 34,813 interactions. This network allows us to classify proteins as "indispensable," "neutral," or "dispensable," which correlates to increasing, no effect, or decreasing the number of driver nodes in the network upon removal of that protein. We find that 21% of the proteins in the PPI network are indispensable. Interestingly, these indispensable proteins are the primary targets of disease-causing mutations, human viruses, and drugs, suggesting that altering a network's control property is critical for the transition between healthy and disease states. Furthermore, analyzing copy number alterations data from 1,547 cancer patients reveals that 56 genes that are frequently amplified or deleted in nine different cancers are indispensable. Among the 56 genes, 46 of them have not been previously associated with cancer. This suggests that controllability analysis is very useful in identifying novel disease genes and potential drug targets. PMID:27091990

  17. Helper-dependent adenoviral vectors for liver-directed gene therapy of primary hyperoxaluria type 1

    PubMed Central

    Castello, Raffaele; Borzone, Roberta; D’Aria, Stefania; Annunziata, Patrizia; Piccolo, Pasquale; Brunetti-Pierri, Nicola

    2015-01-01

    Primary hyperoxaluria type 1 (PH1) is an inborn error of liver metabolism due to deficiency of the peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT) which catalyzes conversion of glyoxylate into glycine. AGT deficiency results in overproduction of oxalate which ultimately leads to end-stage renal disease and death. Organ transplantation as either preemptive liver transplantation or combined liver/kidney transplantation is the only available therapy to prevent disease progression. Gene therapy is an attractive option to provide an alternative treatment for PH1. Towards this goal, we investigated helper-dependent adenoviral (HDAd) vectors for liver-directed gene therapy of PH1. Compared to saline controls, AGT-deficient mice injected with an HDAd encoding the AGT under the control of a liver-specific promoter showed a significant reduction of hyperoxaluria and less increase of urinary oxalate following challenge with Ethylene Glycol (EG), a precursor of glyoxylate. These studies may thus pave the way to clinical application of HDAd for PH1 gene therapy. PMID:26609667

  18. Recent progress in gene-directed enzyme prodrug therapy: an emerging cancer treatment.

    PubMed

    Both, Gerald W

    2009-08-01

    The principle of gene-directed enzyme prodrug therapy (GDEPT) has existed for many years but, while simple in concept, the effective practical application of this therapy has proven to be challenging. Improvements in the efficacy of GDEPT have been achieved principally through the choice and development of more effective vectors, by optimizing and controlling gene expression and by increasing the activity of the delivered enzyme through mutation. While innovation continues in this field, the pioneering GDEPT systems designed to treat glioma and prostate cancer have completed or are now entering late-stage clinical trials, respectively. As the pace of innovation in GDEPT technology far exceeds its clinical application, these initial products are anticipated to be replaced by next-generation biologicals. This review highlights recent progress in the strategies and development of GDEPT and summarizes the status of current clinical trials. With the first GDEPT product for treatment of resected gliomas poised to gain marketing approval, a new era in cancer gene medicine is emerging. PMID:19649987

  19. Nitroreductase gene-directed enzyme prodrug therapy: insights and advances toward clinical utility.

    PubMed

    Williams, Elsie M; Little, Rory F; Mowday, Alexandra M; Rich, Michelle H; Chan-Hyams, Jasmine V E; Copp, Janine N; Smaill, Jeff B; Patterson, Adam V; Ackerley, David F

    2015-10-15

    This review examines the vast catalytic and therapeutic potential offered by type I (i.e. oxygen-insensitive) nitroreductase enzymes in partnership with nitroaromatic prodrugs, with particular focus on gene-directed enzyme prodrug therapy (GDEPT; a form of cancer gene therapy). Important first indications of this potential were demonstrated over 20 years ago, for the enzyme-prodrug pairing of Escherichia coli NfsB and CB1954 [5-(aziridin-1-yl)-2,4-dinitrobenzamide]. However, it has become apparent that both the enzyme and the prodrug in this prototypical pairing have limitations that have impeded their clinical progression. Recently, substantial advances have been made in the biodiscovery and engineering of superior nitroreductase variants, in particular development of elegant high-throughput screening capabilities to enable optimization of desirable activities via directed evolution. These advances in enzymology have been paralleled by advances in medicinal chemistry, leading to the development of second- and third-generation nitroaromatic prodrugs that offer substantial advantages over CB1954 for nitroreductase GDEPT, including greater dose-potency and enhanced ability of the activated metabolite(s) to exhibit a local bystander effect. In addition to forging substantial progress towards future clinical trials, this research is supporting other fields, most notably the development and improvement of targeted cellular ablation capabilities in small animal models, such as zebrafish, to enable cell-specific physiology or regeneration studies. PMID:26431849

  20. Directed natural product biosynthesis gene cluster capture and expression in the model bacterium Bacillus subtilis

    NASA Astrophysics Data System (ADS)

    Li, Yongxin; Li, Zhongrui; Yamanaka, Kazuya; Xu, Ying; Zhang, Weipeng; Vlamakis, Hera; Kolter, Roberto; Moore, Bradley S.; Qian, Pei-Yuan

    2015-03-01

    Bacilli are ubiquitous low G+C environmental Gram-positive bacteria that produce a wide assortment of specialized small molecules. Although their natural product biosynthetic potential is high, robust molecular tools to support the heterologous expression of large biosynthetic gene clusters in Bacillus hosts are rare. Herein we adapt transformation-associated recombination (TAR) in yeast to design a single genomic capture and expression vector for antibiotic production in Bacillus subtilis. After validating this direct cloning ``plug-and-play'' approach with surfactin, we genetically interrogated amicoumacin biosynthetic gene cluster from the marine isolate Bacillus subtilis 1779. Its heterologous expression allowed us to explore an unusual maturation process involving the N-acyl-asparagine pro-drug intermediates preamicoumacins, which are hydrolyzed by the asparagine-specific peptidase into the active component amicoumacin A. This work represents the first direct cloning based heterologous expression of natural products in the model organism B. subtilis and paves the way to the development of future genome mining efforts in this genus.

  1. Directed natural product biosynthesis gene cluster capture and expression in the model bacterium Bacillus subtilis

    PubMed Central

    Li, Yongxin; Li, Zhongrui; Yamanaka, Kazuya; Xu, Ying; Zhang, Weipeng; Vlamakis, Hera; Kolter, Roberto; Moore, Bradley S.; Qian, Pei-Yuan

    2015-01-01

    Bacilli are ubiquitous low G+C environmental Gram-positive bacteria that produce a wide assortment of specialized small molecules. Although their natural product biosynthetic potential is high, robust molecular tools to support the heterologous expression of large biosynthetic gene clusters in Bacillus hosts are rare. Herein we adapt transformation-associated recombination (TAR) in yeast to design a single genomic capture and expression vector for antibiotic production in Bacillus subtilis. After validating this direct cloning “plug-and-play” approach with surfactin, we genetically interrogated amicoumacin biosynthetic gene cluster from the marine isolate Bacillus subtilis 1779. Its heterologous expression allowed us to explore an unusual maturation process involving the N-acyl-asparagine pro-drug intermediates preamicoumacins, which are hydrolyzed by the asparagine-specific peptidase into the active component amicoumacin A. This work represents the first direct cloning based heterologous expression of natural products in the model organism B. subtilis and paves the way to the development of future genome mining efforts in this genus. PMID:25807046

  2. Directed natural product biosynthesis gene cluster capture and expression in the model bacterium Bacillus subtilis.

    PubMed

    Li, Yongxin; Li, Zhongrui; Yamanaka, Kazuya; Xu, Ying; Zhang, Weipeng; Vlamakis, Hera; Kolter, Roberto; Moore, Bradley S; Qian, Pei-Yuan

    2015-01-01

    Bacilli are ubiquitous low G+C environmental Gram-positive bacteria that produce a wide assortment of specialized small molecules. Although their natural product biosynthetic potential is high, robust molecular tools to support the heterologous expression of large biosynthetic gene clusters in Bacillus hosts are rare. Herein we adapt transformation-associated recombination (TAR) in yeast to design a single genomic capture and expression vector for antibiotic production in Bacillus subtilis. After validating this direct cloning "plug-and-play" approach with surfactin, we genetically interrogated amicoumacin biosynthetic gene cluster from the marine isolate Bacillus subtilis 1779. Its heterologous expression allowed us to explore an unusual maturation process involving the N-acyl-asparagine pro-drug intermediates preamicoumacins, which are hydrolyzed by the asparagine-specific peptidase into the active component amicoumacin A. This work represents the first direct cloning based heterologous expression of natural products in the model organism B. subtilis and paves the way to the development of future genome mining efforts in this genus. PMID:25807046

  3. Double replacement: strategy for efficient introduction of subtle mutations into the murine Col1a-1 gene by homologous recombination in embryonic stem cells.

    PubMed Central

    Wu, H; Liu, X; Jaenisch, R

    1994-01-01

    A subtle mutation that rendered type I collagen resistant to mammalian collagenase has been introduced into the murine Col1a-1 (recently redesignated Cola-1) gene by homologous recombination in embryonic stem (ES) cells. Initially, a "hit and run" procedure was used. Since two steps were required for introducing each mutation and more than one mutation was to be introduced in the same genomic region independently, we have developed a streamlined procedure that involves two sequential replacement-type homologous recombination events. In the first step, an internal deletion was introduced into the Col1a-1 locus along with the positive and negative selectable markers, neo and tk, to mark the region of interest. G418-resistant homologous recombinants were isolated and used in the second step in which the deleted Col1a-1 allele was replaced with a construct containing the desired mutation. Homologous recombinants containing the mutation were identified among the Tk- ES clones after selection with FIAU [1-(2-deoxy-2-fluoro-beta-D-arabinofuranosyl)-5-iodouracil (called fialuridine)]. Approximately 10% of such clones contained the desired mutation. The double replacement procedure greatly reduces the time and amount of work required to introduce mutations independently into the same or closely linked regions. Once the homologous recombinants derived from the first step are established, the introduction of other mutations into the deleted region becomes a one-step procedure. For X number of introduced mutations, 2X selections are required with the "hit and run" approach, but only X + 1 are required with the double-replacement method. This innovative procedure could be very useful in studies of gene structure and function as well as gene expression and regulation. Images PMID:8146196

  4. Enhancing Heat Tolerance of the Little Dogwood Cornus canadensis L. f. with Introduction of a Superoxide Reductase Gene from the Hyperthermophilic Archaeon Pyrococcus furiosus

    PubMed Central

    Geng, Xing-Min; Liu, Xiang; Ji, Mikyoung; Hoffmann, William A.; Grunden, Amy; Xiang, Qiu-Yun J.

    2016-01-01

    Production of reactive oxygen species (ROS) can be accelerated under various biotic and abiotic stresses causing lipid peroxidation, protein degradation, enzyme inactivation, and DNA damage. Superoxide reductase (SOR) is a novel antioxidant enzyme from Pyrococcus furiosus and is employed by this anaerobic hyperthermophilic archaeon for efficient detoxification of ROS. In this study, SOR was introduced into a flowering plant Cornus canadensis to enhance its heat tolerance and reduce heat induced damage. A fusion construct of the SOR gene and Green Fluorescent Protein gene (GFP) was introduced into C. canadensis using Agrobacterium-mediated transformation. Heat tolerance of the GFP-SOR expressing transgenic plants was investigated by observing morphological symptoms of heat injury and by examining changes in photosynthesis, malondialdehyde (MDA), and proline levels in the plants. Our results indicate that the expression of the P. furiosus SOR gene in the transgenic plants alleviated lipid peroxidation of cell membranes and photoinhibition of PS II, and decreased the accumulation of proline at 40°C. After a series of exposures to increasing temperatures, the SOR transgenic plants remained healthy and green whereas most of the non-transgenic plants dried up and were unable to recover. While it had previously been reported that expression of SOR in Arabidopsis enhanced heat tolerance, this is the first report of the successful demonstration of improved heat tolerance in a non-model plant resulting from the introduction of P. furiosus SOR. The study demonstrates the potential of SOR for crop improvement and that inherent limitations of plant heat tolerance can be ameliorated with P. furiosus SOR. PMID:26858741

  5. Oxytocin receptor gene polymorphisms are associated with human directed social behavior in dogs (Canis familiaris).

    PubMed

    Kis, Anna; Bence, Melinda; Lakatos, Gabriella; Pergel, Enikő; Turcsán, Borbála; Pluijmakers, Jolanda; Vas, Judit; Elek, Zsuzsanna; Brúder, Ildikó; Földi, Levente; Sasvári-Székely, Mária; Miklósi, Adám; Rónai, Zsolt; Kubinyi, Enikő

    2014-01-01

    The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (-212AG, 19131AG) and one known (rs8679684) single nucleotide polymorphisms (SNPs) in the regulatory regions (5' and 3' UTR) of the oxytocin receptor gene in German Shepherd (N = 104) and Border Collie (N = 103) dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3' and 5' UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene-behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i) proximity seeking towards an unfamiliar person, as well as their owner, and on (ii) how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system. PMID:24454713

  6. Muscle-targeted hydrodynamic gene introduction of insulin-like growth factor-1 using polyplex nanomicelle to treat peripheral nerve injury.

    PubMed

    Nagata, Kazuya; Itaka, Keiji; Baba, Miyuki; Uchida, Satoshi; Ishii, Takehiko; Kataoka, Kazunori

    2014-06-10

    The recovery of neurologic function after peripheral nerve injury often remains incomplete because of the prolonged reinnervation process, which leads to skeletal muscle atrophy and articular contracture from disuse over time. To rescue the skeletal muscle and promote functional recovery, insulin-like growth factor-1 (IGF-1), a potent myogenic factor, was introduced into the muscle by hydrodynamic injection of IGF-1-expressing plasmid DNA using a biocompatible nonviral gene carrier, a polyplex nanomicelle. In a mouse model of sciatic nerve injury, the introduction of IGF-1 into the skeletal muscle of the paralyzed limb effectively alleviated a decrease in muscle weight compared with that in untreated control mice. Histologic analysis of the muscle revealed the IGF-1-expressing plasmid DNA (pDNA) to have a myogenic effect, inducing muscle hypertrophy with the upregulation of the myogenic regulatory factors, myogenin and MyoD. The evaluation of motor function by walking track analysis revealed that the group that received the hydrodynamic injection of IGF-1-expressing pDNA using the polyplex nanomicelle had significantly early recovery of motor function compared with groups receiving negative control pDNA and untreated controls. Early recovery of sensation in the distal area of sciatic nerve injury was also induced by the introduction of IGF-1-expressing pDNA, presumably because of the effect of secreted IGF-1 protein in the vicinity of the injured sciatic nerve exerting a synergistic effect with muscle hypertrophy, inducing a more favorable prognosis. This approach of introducing IGF-1 into skeletal muscle is promising for the treatment of peripheral nerve injury by promoting early motor function recovery. PMID:24657809

  7. Introduction to Biophotonics

    NASA Astrophysics Data System (ADS)

    Prasad, Paras N.

    2003-04-01

    Paras Prasad's text provides a basic knowledge of a broad range of topics so that individuals in all disciplines can rapidly acquire the minimal necessary background for research and development in biophotonics. Introduction to Biophotonics serves as both a textbook for education and training as well as a reference book that aids research and development of those areas integrating light, photonics, and biological systems. Each chapter contains a topic introduction, a review of key data, and description of future directions for technical innovation. Introduction to Biophotonics covers the basic principles of Optics Optical spectroscopy Microscopy Each section also includes illustrated examples and review questions to test and advance the reader's knowledge. Sections on biosensors and chemosensors, important tools for combating biological and chemical terrorism, will be of particular interest to professionals in toxicology and other environmental disciplines. Introduction to Biophotonics proves a valuable reference for graduate students and researchers in engineering, chemistry, and the life sciences.

  8. Clinical isolates of Aeromonas veronii biovar veronii harbor a nonfunctional gene similar to the thermostable direct hemolysin-related hemolysin (trh) gene of Vibrio parahaemolyticus.

    PubMed

    Raghunath, Pendru; Maiti, Biswajit; Shekar, Malathi; Karunasagar, Iddya; Karunasagar, Indrani

    2010-06-01

    Thermostable direct hemolysin-related hemolysin encoded by the trh gene is considered a major virulence factor in the pathogenesis of Vibrio parahaemolyticus infections. In this study, we report the presence of a trh homolog in three clinical isolates of Aeromonas veronii biovar veronii. The presence of a trh homolog in these strains of A. veronii was confirmed by PCR, followed by cloning, sequencing and colony hybridization using a digoxigenin-labelled probe. DNA sequence analysis revealed that the A. veronii trh gene had an identity of 99% and 84% to the trh1 and trh2 genes of V. parahaemolyticus, respectively. However, the expression of a trh-like gene in A. veronii could not be detected by reverse transcription PCR. Hence, the role of the gene product in the virulence of A. veronii strains is not clear. Further, these A. veronii isolates were negative for the ure gene encoding urease and the transposase gene by PCR. These genes are part of the trh gene cluster in V. parahaemolyticus. However, the presence of a trh homolog in a pathogen other than V. parahaemolyticus points to the fact that detection of the trh gene in stool samples, seafood enrichments or environmental samples does not always imply that trh-carrying V. parahaemolyticus are present. PMID:20636974

  9. A unique nuclear receptor direct repeat 17 (DR17) is present within the upstream region of Schistosoma mansoni female-specific p14 gene

    SciTech Connect

    Fantappie, Marcelo Rosado Furtado, Daniel Rodrigues; Rumjanek, Franklin David; LoVerde, Philip T.

    2008-07-11

    The eggs produced by sexually mature female Schistosma mansoni are responsible for the pathogenesis of the disease. The eggshell precursor gene p14 is expressed only in the vitelline cells of sexually mature female worms in response to a yet unidentified male stimulus. Herein, we report the identification of a novel nuclear receptor response element in the upstream region of the p14 gene. This element contains the canonical hexameric DNA core motif, 5'-PuGGTCA, composed of an atypically spaced direct repeat (DR17). Schistosome nuclear receptors SmRXR1 and SmNR1 specifically bound to the p14-DR17 element as a heterodimer. SmRXR1, but not SmNR1, bound to the motif as a monomer. Introduction of mutations in the TCA core sequence completely abolished the binding by SmRXR1/SmNR1 heterodimer. This finding supports our hypothesis that the expression of Schistosoma mansonip14 gene is regulated through the nuclear receptor signaling pathway.

  10. Direct regulation of the floral homeotic APETALA1 gene by APETALA3 and PISTILLATA in Arabidopsis.

    PubMed

    Sundström, Jens F; Nakayama, Naomi; Glimelius, Kristina; Irish, Vivian F

    2006-05-01

    The floral homeotic gene APETALA1 (AP1) specifies floral meristem identity and sepal and petal identity in Arabidopsis. Consistent with its multiple roles during floral development, AP1 is initially expressed throughout the floral meristem, and later its expression becomes restricted to sepal and petal primordia. Using chromatin immunoprecipitation, we show that the floral homeotic PISTILLATA (PI) protein, required for petal and stamen development, has the ability to bind directly to the promoter region of AP1. In support of the hypothesis that PI, and its interacting partner APETALA3 (AP3), regulates the transcription of AP1, we show that AP1 transcript levels are elevated in strong ap3-3 mutant plants. Kinetic studies, using transgenic Arabidopsis plants in which both AP3 and PI are under post-translational control, show that AP1 transcript levels are down regulated within 2 h of AP3/PI activation. This implies that the reduction in AP1 transcripts is an early event in the cascade following AP3/PI induction and provides independent support for the hypothesis that AP1 is a direct target of the AP3/PI heterodimer. Together these results suggest a model whereby AP3/PI directly acts, in combination with other factors, to restrict the expression of AP1 during early stages of floral development. PMID:16640596

  11. Direct conversion of mouse fibroblasts to GABAergic neurons with combined medium without the introduction of transcription factors or miRNAs.

    PubMed

    Xu, Huiming; Wang, Yonghui; He, Zuping; Yang, Hao; Gao, Wei-Qiang

    2015-08-01

    Degeneration or loss of GABAergic neurons frequently may lead to many neuropsychiatric disorders such as epilepsy and autism spectrum disorders. So far no clinically effective therapies can slow and halt the progression of these diseases. Cell-replacement therapy is a promising strategy for treatment of these neuropsychiatric diseases. Although increasing evidence showed that mammalian somatic cells can be directly converted into functional neurons using specific transcription factors or miRNAs via virus delivery, the application of these induced neurons is potentially problematic, due to integration of vectors into the host genome, which results in the disruption or dysfunction of nearby genes. Here, we show that mouse fibroblasts could be efficiently reprogrammed into GABAergic neurons in a combined medium composed of conditioned medium from neurotrophin-3 modified Olfactory Ensheathing Cells (NT3-OECs) plus SB431542, GDNF and RA. Following 3 weeks of induction, these cells derived from fibroblasts acquired the morphological and phenotypical GABAerigic neuronal properties, as demonstrated by the expression of neuronal markers including Tuj1, NeuN, Neurofilament-L, GABA, GABA receptors and GABA transporter 1. More importantly, these converted cells acquired neuronal functional properties such as synapse formation and increasing intracellular free calcium influx when treated with BayK, a specific activator of L-type calcium channel. Therefore, our findings demonstrate for the first time that fibroblasts can be directly converted into GABAergic neurons without ectopic expression of specific transcription factors or miRNA. This study may provide a promising cell source for the application of cell replacement therapy in neuropsychiatric disorders. PMID:26114472

  12. Novel applications of motif-directed profiling to identify disease resistance genes in plants

    PubMed Central

    2013-01-01

    Background Molecular profiling of gene families is a versatile tool to study diversity between individual genomes in sexual crosses and germplasm. Nucleotide binding site (NBS) profiling, in particular, targets conserved nucleotide binding site-encoding sequences of resistance gene analogs (RGAs), and is widely used to identify molecular markers for disease resistance (R) genes. Results In this study, we used NBS profiling to identify genome-wide locations of RGA clusters in the genome of potato clone RH. Positions of RGAs in the potato RH and DM genomes that were generated using profiling and genome sequencing, respectively, were compared. Largely overlapping results, but also interesting discrepancies, were found. Due to the clustering of RGAs, several parts of the genome are overexposed while others remain underexposed using NBS profiling. It is shown how the profiling of other gene families, i.e. protein kinases and different protein domain-coding sequences (i.e., TIR), can be used to achieve a better marker distribution. The power of profiling techniques is further illustrated using RGA cluster-directed profiling in a population of Solanum berthaultii. Multiple different paralogous RGAs within the Rpi-ber cluster could be genetically distinguished. Finally, an adaptation of the profiling protocol was made that allowed the parallel sequencing of profiling fragments using next generation sequencing. The types of RGAs that were tagged in this next-generation profiling approach largely overlapped with classical gel-based profiling. As a potential application of next-generation profiling, we showed how the R gene family associated with late blight resistance in the SH*RH population could be identified using a bulked segregant approach. Conclusions In this study, we provide a comprehensive overview of previously described and novel profiling primers and their genomic targets in potato through genetic mapping and comparative genomics. Furthermore, it is shown how

  13. Effects of FVIII immunity on hepatocyte and hematopoietic stem cell–directed gene therapy of murine hemophilia A

    PubMed Central

    Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B

    2016-01-01

    Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV. PMID:26909355

  14. Metabolic engineering of the Chl d-dominated cyanobacterium Acaryochloris marina: production of a novel Chl species by the introduction of the chlorophyllide a oxygenase gene.

    PubMed

    Tsuchiya, Tohru; Mizoguchi, Tadashi; Akimoto, Seiji; Tomo, Tatsuya; Tamiaki, Hitoshi; Mimuro, Mamoru

    2012-03-01

    In oxygenic photosynthetic organisms, the properties of photosynthetic reaction systems primarily depend on the Chl species used. Acquisition of new Chl species with unique optical properties may have enabled photosynthetic organisms to adapt to various light environments. The artificial production of a new Chl species in an existing photosynthetic organism by metabolic engineering provides a model system to investigate how an organism responds to a newly acquired pigment. In the current study, we established a transformation system for a Chl d-dominated cyanobacterium, Acaryochloris marina, for the first time. The expression vector (constructed from a broad-host-range plasmid) was introduced into A. marina by conjugal gene transfer. The introduction of a gene for chlorophyllide a oxygenase, which is responsible for Chl b biosynthesis, into A. marina resulted in a transformant that synthesized a novel Chl species instead of Chl b. The content of the novel Chl in the transformant was approximately 10% of the total Chl, but the level of Chl a, another Chl in A. marina, did not change. The chemical structure of the novel Chl was determined to be [7-formyl]-Chl d(P) by mass spectrometry and nuclear magnetic resonance spectroscopy. [7-Formyl]-Chl d(P) is hypothesized to be produced by the combined action of chlorophyllide a oxygenase and enzyme(s) involved in Chl d biosynthesis. These results demonstrate the flexibility of the Chl biosynthetic pathway for the production of novel Chl species, indicating that a new organism with a novel Chl might be discovered in the future. PMID:22302713

  15. Phenotype Sequencing: Identifying the Genes That Cause a Phenotype Directly from Pooled Sequencing of Independent Mutants

    PubMed Central

    Harper, Marc A.; Chen, Zugen; Toy, Traci; Machado, Iara M. P.; Nelson, Stanley F.; Liao, James C.; Lee, Christopher J.

    2011-01-01

    Random mutagenesis and phenotype screening provide a powerful method for dissecting microbial functions, but their results can be laborious to analyze experimentally. Each mutant strain may contain 50–100 random mutations, necessitating extensive functional experiments to determine which one causes the selected phenotype. To solve this problem, we propose a “Phenotype Sequencing” approach in which genes causing the phenotype can be identified directly from sequencing of multiple independent mutants. We developed a new computational analysis method showing that 1. causal genes can be identified with high probability from even a modest number of mutant genomes; 2. costs can be cut many-fold compared with a conventional genome sequencing approach via an optimized strategy of library-pooling (multiple strains per library) and tag-pooling (multiple tagged libraries per sequencing lane). We have performed extensive validation experiments on a set of E. coli mutants with increased isobutanol biofuel tolerance. We generated a range of sequencing experiments varying from 3 to 32 mutant strains, with pooling on 1 to 3 sequencing lanes. Our statistical analysis of these data (4099 mutations from 32 mutant genomes) successfully identified 3 genes (acrB, marC, acrA) that have been independently validated as causing this experimental phenotype. It must be emphasized that our approach reduces mutant sequencing costs enormously. Whereas a conventional genome sequencing experiment would have cost $7,200 in reagents alone, our Phenotype Sequencing design yielded the same information value for only $1200. In fact, our smallest experiments reliably identified acrB and marC at a cost of only $110–$340. PMID:21364744

  16. Oxytocin Receptor Gene Polymorphisms Are Associated with Human Directed Social Behavior in Dogs (Canis familiaris)

    PubMed Central

    Lakatos, Gabriella; Pergel, Enikő; Turcsán, Borbála; Pluijmakers, Jolanda; Vas, Judit; Elek, Zsuzsanna; Brúder, Ildikó; Földi, Levente; Sasvári-Székely, Mária; Miklósi, Ádám; Rónai, Zsolt; Kubinyi, Enikő

    2014-01-01

    The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (−212AG, 19131AG) and one known (rs8679684) single nucleotide polymorphisms (SNPs) in the regulatory regions (5′ and 3′ UTR) of the oxytocin receptor gene in German Shepherd (N = 104) and Border Collie (N = 103) dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3′ and 5′ UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene–behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i) proximity seeking towards an unfamiliar person, as well as their owner, and on (ii) how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system. PMID:24454713

  17. Challenges to develop nitrogen-fixing cereals by direct nif-gene transfer.

    PubMed

    Curatti, Leonardo; Rubio, Luis M

    2014-08-01

    Some regions of the developing world suffer low cereal production yields due to low fertilizer inputs, among other factors. Biological N2 fixation, catalyzed by the prokaryotic enzyme nitrogenase, is an alternative to the use of synthetic N fertilizers. The molybdenum nitrogenase is an O2-labile metalloenzyme composed of the NifDK and NifH proteins, which biosyntheses require a number of nif gene products. A challenging strategy to increase cereal crop productivity in a scenario of low N fertilization is the direct transfer of nif genes into cereals. The sensitivity of nitrogenase to O2 and the apparent complexity of nitrogenase biosynthesis are the main barriers identified so far. Expression of active NifH requires the products of nifM, nifH, and possibly nifU and nifS, whereas active NifDK requires the products of nifH, nifD, nifK, nifB, nifE, nifN, and possibly nifU, nifS, nifQ, nifV, nafY, nifW and nifZ. Plastids and mitochondria are potential subcellular locations for nitrogenase. Both could provide the ATP and electrons required for nitrogenase to function but they differ in their internal O2 levels and their ability to incorporate ammonium into amino acids. PMID:25017168

  18. Angiogenesis gene therapy to rescue ischaemic tissues: achievements and future directions

    PubMed Central

    Emanueli, Costanza; Madeddu, Paolo

    2001-01-01

    Ischaemic diseases are characterized by an impaired supply of blood resulting from narrowed or blocked arteries that starve tissues of needed nutrients and oxygen. Coronary-atherosclerosis induced myocardial infarction is one of the leading causes of mortality in developed countries. Ischaemic disease also affects the lower extremities. Considerable advances in both surgical bypassing and percutaneous revascularization techniques have been reached. However, many patients cannot benefit from these therapies because of the extension of arterial occlusion and/or microcirculation impairment. Consequently, the need for alternative therapeutic strategies is compelling. An innovative approach consists of stimulating collateral vessel growth, a natural host defence response that intervenes upon occurrence of critical reduction in tissue perfusion (Isner & Asahara, 1999). This review will debate the relevance of therapeutic angiogenesis for promotion of tissue repair. The following issues will receive attention: (a) vascular growth patterns, (b) delivery systems for angiogenesis gene transfer, (c) achievements of therapeutic angiogenesis in myocardial and peripheral ischaemia, and (d) future directions to improve effectiveness and safety of vascular gene therapy. PMID:11487503

  19. Tight junction CLDN2 gene is a direct target of the vitamin D receptor

    PubMed Central

    Zhang, Yong-guo; Wu, Shaoping; Lu, Rong; Zhou, David; Zhou, Jingsong; Carmeliet, Geert; Petrof, Elaine; Claud, Erika C.; Sun, Jun

    2015-01-01

    The breakdown of the intestinal barrier is a common manifestation of many diseases. Recent evidence suggests that vitamin D and its receptor VDR may regulate intestinal barrier function. Claudin-2 is a tight junction protein that mediates paracellular water transport in intestinal epithelia, rendering them “leaky”. Using whole body VDR-/- mice, intestinal epithelial VDR conditional knockout (VDRΔIEC) mice, and cultured human intestinal epithelial cells, we demonstrate here that the CLDN2 gene is a direct target of the transcription factor VDR. The Caudal-Related Homeobox (Cdx) protein family is a group of the transcription factor proteins which bind to DNA to regulate the expression of genes. Our data showed that VDR-enhances Claudin-2 promoter activity in a Cdx1 binding site-dependent manner. We further identify a functional vitamin D response element (VDRE) 5΄-AGATAACAAAGGTCA-3΄ in the Cdx1 site of the Claudin-2 promoter. It is a VDRE required for the regulation of Claudin-2 by vitamin D. Absence of VDR decreased Claudin-2 expression by abolishing VDR/promoter binding. In vivo, VDR deletion in intestinal epithelial cells led to significant decreased Claudin-2 in VDR-/- and VDRΔIEC mice. The current study reveals an important and novel mechanism for VDR by regulation of epithelial barriers. PMID:26212084

  20. Liver-directed gene therapy corrects cardiovascular lesions in feline mucopolysaccharidosis type I

    PubMed Central

    Hinderer, Christian; Bell, Peter; Gurda, Brittney L.; Wang, Qiang; Louboutin, Jean-Pierre; Zhu, Yanqing; Bagel, Jessica; O’Donnell, Patricia; Sikora, Tracey; Ruane, Therese; Wang, Ping; Haskins, Mark E.; Wilson, James M.

    2014-01-01

    Patients with mucopolysaccharidosis type I (MPS I), a genetic deficiency of the lysosomal enzyme α-l-iduronidase (IDUA), exhibit accumulation of glycosaminoglycans in tissues, with resulting diverse clinical manifestations including neurological, ocular, skeletal, and cardiac disease. MPS I is currently treated with hematopoietic stem cell transplantation or weekly enzyme infusions, but these therapies have significant drawbacks for patient safety and quality of life and do not effectively address some of the most critical clinical sequelae, such as life-threatening cardiac valve involvement. Using the naturally occurring feline model of MPS I, we tested liver-directed gene therapy as a means of achieving long-term systemic IDUA reconstitution. We treated four MPS I cats at 3–5 mo of age with an adeno-associated virus serotype 8 vector expressing feline IDUA from a liver-specific promoter. We observed sustained serum enzyme activity for 6 mo at ∼30% of normal levels in one animal, and in excess of normal levels in three animals. Remarkably, treated animals not only demonstrated reductions in glycosaminoglycan storage in most tissues, but most also exhibited complete resolution of aortic valve lesions, an effect that has not been previously observed in this animal model or in MPS I patients treated with current therapies. These data point to clinically meaningful benefits of the robust enzyme expression achieved with hepatic gene transfer that extend beyond the economic and quality of life advantages over lifelong enzyme infusions. PMID:25267637

  1. Direct evaluation of the effect of gene dosage on secretion of protein from yeast Pichia pastoris by expressing EGFP.

    PubMed

    Liu, Hailong; Qin, Yufeng; Huang, Yuankai; Chen, Yaosheng; Cong, Peiqing; He, Zuyong

    2014-02-28

    Increasing the gene copy number has been commonly used to enhance the protein expression level in the yeast Pichia pastoris. However, this method has been shown to be effective up to a certain gene copy number, and a further increase of gene dosage can result in a decrease of expression level. Evidences indicate the gene dosage effect is product-dependent, which needs to be determined when expressing a new protein. Here, we describe a direct detection of the gene dosage effect on protein secretion through expressing the enhanced green fluorescent protein (EGFP) gene under the direction of the α-factor preprosequence in a panel of yeast clones carrying increasing copies of the EGFP gene (from one to six copies). Directly examined under fluorescence microscopy, we found relatively lower levels of EGFP were secreted into the culture medium at one copy and two copies, substantial improvement of secretion appeared at three copies, plateau happened at four and five copies, and an apparent decrease of secretion happened at six copies. The secretion of EGFP being limiting at four and five copies was due to abundant intracellular accumulation of proteins, observed from the fluorescence image of yeast and confirmed by western blotting, which significantly activated the unfolded protein response indicated by the up-regulation of the BiP (the KAR2 gene product) and the protein disulfide isomerase. This study implies that tagging a reporter like GFP to a specific protein would facilitate a direct and rapid determination of the optimal gene copy number for high-yield expression. PMID:24225373

  2. A direct role for murine Cdx proteins in the trunk neural crest gene regulatory network.

    PubMed

    Sanchez-Ferras, Oraly; Bernas, Guillaume; Farnos, Omar; Touré, Aboubacrine M; Souchkova, Ouliana; Pilon, Nicolas

    2016-04-15

    Numerous studies in chordates and arthropods currently indicate that Cdx proteins have a major ancestral role in the organization of post-head tissues. In urochordate embryos, Cdx loss-of-function has been shown to impair axial elongation, neural tube (NT) closure and pigment cell development. Intriguingly, in contrast to axial elongation and NT closure, a Cdx role in neural crest (NC)-derived melanocyte/pigment cell development has not been reported in any other chordate species. To address this, we generated a new conditional pan-Cdx functional knockdown mouse model that circumvents Cdx functional redundancy as well as the early embryonic lethality of Cdx mutants. Through directed inhibition in the neuroectoderm, we providein vivoevidence that murine Cdx proteins impact melanocyte and enteric nervous system development by, at least in part, directly controlling the expression of the key early regulators of NC ontogenesisPax3,Msx1andFoxd3 Our work thus reveals a novel role for Cdx proteins at the top of the trunk NC gene regulatory network in the mouse, which appears to have been inherited from their ancestral ortholog. PMID:26952979

  3. Gene-environment interaction: Introduction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The execution and completion of the Human Genome Project was surrounded by great expectations and many overstated promises, and for the first time in history, the information revolution has made of the general public a first row spectator of the scientific advances in real time. Therefore, the publi...

  4. Notch stimulates growth by direct regulation of genes involved in the control of glycolysis and the tricarboxylic acid cycle.

    PubMed

    Slaninova, Vera; Krafcikova, Michaela; Perez-Gomez, Raquel; Steffal, Pavel; Trantirek, Lukas; Bray, Sarah J; Krejci, Alena

    2016-02-01

    Glycolytic shift is a characteristic feature of rapidly proliferating cells, such as cells during development and during immune response or cancer cells, as well as of stem cells. It results in increased glycolysis uncoupled from mitochondrial respiration, also known as the Warburg effect. Notch signalling is active in contexts where cells undergo glycolytic shift. We decided to test whether metabolic genes are direct transcriptional targets of Notch signalling and whether upregulation of metabolic genes can help Notch to induce tissue growth under physiological conditions and in conditions of Notch-induced hyperplasia. We show that genes mediating cellular metabolic changes towards the Warburg effect are direct transcriptional targets of Notch signalling. They include genes encoding proteins involved in glucose uptake, glycolysis, lactate to pyruvate conversion and repression of the tricarboxylic acid cycle. The direct transcriptional upregulation of metabolic genes is PI3K/Akt independent and occurs not only in cells with overactivated Notch but also in cells with endogenous levels of Notch signalling and in vivo. Even a short pulse of Notch activity is able to elicit long-lasting metabolic changes resembling the Warburg effect. Loss of Notch signalling in Drosophila wing discs as well as in human microvascular cells leads to downregulation of glycolytic genes. Notch-driven tissue overgrowth can be rescued by downregulation of genes for glucose metabolism. Notch activity is able to support growth of wing during nutrient-deprivation conditions, independent of the growth of the rest of the body. Notch is active in situations that involve metabolic reprogramming, and the direct regulation of metabolic genes may be a common mechanism that helps Notch to exert its effects in target tissues. PMID:26887408

  5. Notch stimulates growth by direct regulation of genes involved in the control of glycolysis and the tricarboxylic acid cycle

    PubMed Central

    Slaninova, Vera; Krafcikova, Michaela; Perez-Gomez, Raquel; Steffal, Pavel; Trantirek, Lukas; Bray, Sarah J.

    2016-01-01

    Glycolytic shift is a characteristic feature of rapidly proliferating cells, such as cells during development and during immune response or cancer cells, as well as of stem cells. It results in increased glycolysis uncoupled from mitochondrial respiration, also known as the Warburg effect. Notch signalling is active in contexts where cells undergo glycolytic shift. We decided to test whether metabolic genes are direct transcriptional targets of Notch signalling and whether upregulation of metabolic genes can help Notch to induce tissue growth under physiological conditions and in conditions of Notch-induced hyperplasia. We show that genes mediating cellular metabolic changes towards the Warburg effect are direct transcriptional targets of Notch signalling. They include genes encoding proteins involved in glucose uptake, glycolysis, lactate to pyruvate conversion and repression of the tricarboxylic acid cycle. The direct transcriptional upregulation of metabolic genes is PI3K/Akt independent and occurs not only in cells with overactivated Notch but also in cells with endogenous levels of Notch signalling and in vivo. Even a short pulse of Notch activity is able to elicit long-lasting metabolic changes resembling the Warburg effect. Loss of Notch signalling in Drosophila wing discs as well as in human microvascular cells leads to downregulation of glycolytic genes. Notch-driven tissue overgrowth can be rescued by downregulation of genes for glucose metabolism. Notch activity is able to support growth of wing during nutrient-deprivation conditions, independent of the growth of the rest of the body. Notch is active in situations that involve metabolic reprogramming, and the direct regulation of metabolic genes may be a common mechanism that helps Notch to exert its effects in target tissues. PMID:26887408

  6. The NGATHA Genes Direct Style Development in the Arabidopsis Gynoecium[C][W

    PubMed Central

    Trigueros, Marina; Navarrete-Gómez, Marisa; Sato, Shusei; Christensen, Sioux K.; Pelaz, Soraya; Weigel, Detlef; Yanofsky, Martin F.; Ferrándiz, Cristina

    2009-01-01

    The gynoecium is the most complex floral organ, designed to protect the ovules and ensure their fertilization. Correct patterning and tissue specification in the developing gynoecium involves the concerted action of a host of genetic factors. In addition, apical-basal patterning into different domains, stigma and style, ovary and gynophore, appears to depend on the establishment and maintenance of asymmetric auxin distribution, with an auxin maximum at the apex. Here, we show that a small subfamily of the B3 transcription factor superfamily, the NGATHA (NGA) genes, act redundantly to specify style development in a dosage-dependent manner. Characterization of the NGA gene family is based on an analysis of the activation-tagged mutant named tower-of-pisa1 (top1), which was found to overexpress NGA3. Quadruple nga mutants completely lack style and stigma development. This mutant phenotype is likely caused by a failure to activate two auxin biosynthetic enzymes, YUCCA2 and YUCCA4, in the apical gynoecium domain. The NGA mutant phenotypes are similar to those caused by multiple combinations of mutations in STYLISH1 (STY1) and additional members of its family. NGA3/TOP1 and STY1 share almost identical patterns of expression, but they do not appear to regulate each other at the transcriptional level. Strong synergistic phenotypes are observed when nga3/top1 and sty1 mutants are combined. Furthermore, constitutive expression of both NGA3/TOP1 and STY1 induces the conversion of the ovary into style tissue. Taken together, these data suggest that the NGA and STY factors act cooperatively to promote style specification, in part by directing YUCCA-mediated auxin synthesis in the apical gynoecium domain. PMID:19435937

  7. Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems

    PubMed Central

    Bialk, Pawel; Rivera-Torres, Natalia; Strouse, Bryan; Kmiec, Eric B.

    2015-01-01

    Single-stranded DNA oligonucleotides (ssODNs) can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases). Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing. PMID:26053390

  8. RecET direct cloning and Redαβ recombineering of biosynthetic gene clusters, large operons or single genes for heterologous expression.

    PubMed

    Wang, Hailong; Li, Zhen; Jia, Ruonan; Hou, Yu; Yin, Jia; Bian, Xiaoying; Li, Aiying; Müller, Rolf; Stewart, A Francis; Fu, Jun; Zhang, Youming

    2016-07-01

    Full-length RecE and RecT from Rac prophage mediate highly efficient linear-linear homologous recombination that can be used to clone large DNA regions directly from genomic DNA into expression vectors, bypassing library construction and screening. Homologous recombination mediated by Redαβ from lambda phage has been widely used for recombinant DNA engineering. Here we present a protocol for direct cloning and engineering of biosynthetic gene clusters, large operons or single genes from genomic DNA using one Escherichia coli host that harbors both RecET and Redαβ systems. The pipeline uses standardized cassettes for horizontal gene transfer options, as well as vectors with different replication origins configured to minimize recombineering background through the use of selectively replicating templates or CcdB counterselection. These optimized reagents and protocols facilitate fast acquisition of transgenes from genomic DNA preparations, which are ready for heterologous expression within 1 week. PMID:27254463

  9. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

    PubMed Central

    Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S

    1989-01-01

    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other alpha-amylases, such as Taka-amylase A. The 48-kilodalton (kDa) amylase isolated from B. polymyxa was proven to have alpha-amylase activity. The amino acid sequences of the peptides generated from the 48-kDa amylase showed complete agreement with the predicted amino acid sequence of the C-terminal portion. The B. polymyxa amylase gene was therefore concluded to contain in-phase beta- and alpha-amylase-coding sequences in the 5' and 3' regions, respectively. A precursor protein, a 130-kDa amylase, directed by a plasmid, pYN520, carrying the entire amylase gene, had both beta- and alpha-amylase activities. This represents the first report of a single protein precursor in procaryotes that gives rise to two enzymes. Images PMID:2464578

  10. GLABRA2 Directly Suppresses Basic Helix-Loop-Helix Transcription Factor Genes with Diverse Functions in Root Hair Development

    PubMed Central

    Lin, Qing; Ohashi, Yohei; Kato, Mariko; Tsuge, Tomohiko; Gu, Hongya; Qu, Li-Jia; Aoyama, Takashi

    2015-01-01

    The Arabidopsis thaliana GLABRA2 (GL2) gene encodes a transcription factor involved in the cell differentiation of various epidermal tissues. During root hair pattern formation, GL2 suppresses root hair development in non-hair cells, acting as a node between the gene regulatory networks for cell fate determination and cell differentiation. Despite the importance of GL2 function, its molecular basis remains obscure because the GL2 target genes leading to the network for cell differentiation are unknown. We identified five basic helix-loop-helix (bHLH) transcription factor genes—ROOT HAIR DEFECTIVE6 (RHD6), RHD6-LIKE1 (RSL1), RSL2, LjRHL1-LIKE1 (LRL1), and LRL2—as GL2 direct targets using transcriptional and post-translational induction systems. Chromatin immunoprecipitation analysis confirmed GL2 binding to upstream regions of these genes in planta. Reporter gene analyses showed that these genes are expressed in various stages of root hair development and are suppressed by GL2 in non-hair cells. GL2 promoter-driven green fluorescent protein fusions of LRL1 and LRL2, but not those of the other bHLH proteins, conferred root hair development on non-hair cells. These results indicate that GL2 directly suppresses bHLH genes with diverse functions in root hair development. PMID:26486447

  11. Molecular cloning and characterization of two genes encoding sigma factors that direct transcription from a Bacillus thuringiensis crystal protein gene promoter.

    PubMed Central

    Adams, L F; Brown, K L; Whiteley, H R

    1991-01-01

    Two sigma factors, sigma 35 and sigma 28, direct transcription from the Bt I and Bt II promoters of the cryIA(a) gene of Bacillus thuringiensis; this gene encodes a lepidopteran-specific crystal protoxin. These sigma factors were biochemically characterized in previous work (K. L. Brown and H. R. Whiteley, Proc. Natl. Acad. Sci. USA 85:4166-4170, 1988; K. L. Brown and H. R. Whiteley, J. Bacteriol. 172:6682-6688, 1990). In this paper, we describe the cloning of the genes encoding these two sigma factors, as well as their nucleotide and deduced amino acid sequences. The deduced amino acid sequences of the sigma 35 and sigma 28 genes show 88 and 85% identity, respectively, to the sporulation-specific sigma E and sigma K polypeptides of Bacillus subtilis. Transformation of the sigma 35 and sigma 28 genes into B. subtilis shows that the respective B. thuringiensis sigma factor genes can complement spoIIG55 (sigma E) and spoIIIC94 (sigma K) defects. Further, B. thuringiensis core polymerase reconstituted with either the sigma 35 or sigma 28 polypeptide directs transcription from B. subtilis promoters recognized by B. subtilis RNA polymerase containing sigma E and sigma K, respectively. Thus, sigma 35 and sigma 28 of B. thuringiensis appear to be functionally equivalent to sigma E and sigma K of B. subtilis. However, unlike the situation for sigma K in B. subtilis, the homologous sigma 28 gene in B. thuringiensis does not result from a late-sporulation-phase chromosomal rearrangement of two separate, partial genes. Images PMID:1904859

  12. Six homeoproteins directly activate Myod expression in the gene regulatory networks that control early myogenesis.

    PubMed

    Relaix, Frédéric; Demignon, Josiane; Laclef, Christine; Pujol, Julien; Santolini, Marc; Niro, Claire; Lagha, Mounia; Rocancourt, Didier; Buckingham, Margaret; Maire, Pascal

    2013-04-01

    In mammals, several genetic pathways have been characterized that govern engagement of multipotent embryonic progenitors into the myogenic program through the control of the key myogenic regulatory gene Myod. Here we demonstrate the involvement of Six homeoproteins. We first targeted into a Pax3 allele a sequence encoding a negative form of Six4 that binds DNA but cannot interact with essential Eya co-factors. The resulting embryos present hypoplasic skeletal muscles and impaired Myod activation in the trunk in the absence of Myf5/Mrf4. At the axial level, we further show that Myod is still expressed in compound Six1/Six4:Pax3 but not in Six1/Six4:Myf5 triple mutant embryos, demonstrating that Six1/4 participates in the Pax3-Myod genetic pathway. Myod expression and head myogenesis is preserved in Six1/Six4:Myf5 triple mutant embryos, illustrating that upstream regulators of Myod in different embryonic territories are distinct. We show that Myod regulatory regions are directly controlled by Six proteins and that, in the absence of Six1 and Six4, Six2 can compensate. PMID:23637613

  13. Direct Gene Transfer into Plant Mature Seeds via Electroporation After Vacuum Treatment

    NASA Astrophysics Data System (ADS)

    Hagio, Takashi

    A number of direct gene transfer methods have been used successfully in plant genetic engineering, providing powerful tools to investigate fundamental and applied problems in plant biology (Chowrira et al., 1996; D'halluin et al., 1992; Morandini and Salamini, 2003; Rakoczy-Trojanowska, 2002; Songstad et al., 1995). In cereals, several methods have been found to be suitable for obtaining transgenic plant; these include bombardment of scutellum (Hagio et al., 1995) and inflorescence cultures (He et al., 2001), and silicon carbide fiber-mediated DNA delivery (Asano et al., 1991) and Agrobacterium tumefaciens transformation (Potrykus, 1990). Electroporation of cereal protoplasts also has proved successful but it involves prolonged cell treatments and generally is limited by the difficulties of regeneration from cereal protoplast cultures (Fromm et al., 1987). Many laboratories worldwide are now using Agrobacterium as a vehicle for routine production of transgenic crop plants. The primary application of the particle system (Klein et al., 1987) has been for transformation of species recalcitrant to conventional Agrobacterium (Binns, 1990) or protoplast methods. But these conventional methods can be applied to the species and varieties that are amenable to tissue culture (Machii et al., 1998). Mature seeds are readily available and free from the seasonal limits that immature embryo, inflorescence, and anther have. This method enables us to produce transgenic plants without time-consuming tissue culture process.

  14. Direct TFIIA-TFIID protein contacts drive budding yeast ribosomal protein gene transcription.

    PubMed

    Layer, Justin H; Weil, P Anthony

    2013-08-01

    We have previously shown that yeast TFIID provides coactivator function on the promoters of ribosomal protein-encoding genes (RPGs) by making direct contact with the transactivator repressor activator protein 1 (Rap1). Further, our structural studies of assemblies generated with purified Rap1, TFIID, and TFIIA on RPG enhancer-promoter DNA indicate that Rap1-TFIID interaction induces dramatic conformational rearrangements of enhancer-promoter DNA and TFIID-bound TFIIA. These data indicate a previously unknown yet critical role for yeast TFIIA in the integration of activator-TFIID contacts with promoter conformation and downstream preinitiation complex formation and/or function. Here we describe the use of systematic mutagenesis to define how specific TFIIA contacts contribute to these processes. We have verified that TFIIA is required for RPG transcription in vivo and in vitro, consistent with the existence of a critical Rap1-TFIIA-TFIID interaction network. We also identified essential points of contact for TFIIA and Rap1 within the Rap1 binding domain of the Taf4 subunit of TFIID. These data suggest a mechanism for how interactions between TFIID, TFIIA, and Rap1 contribute to the high rate of transcription initiation seen on RPGs in vivo. PMID:23814059

  15. Matching genetics with oceanography: directional gene flow in a Mediterranean fish species.

    PubMed

    Schunter, C; Carreras-Carbonell, J; Macpherson, E; Tintoré, J; Vidal-Vijande, E; Pascual, A; Guidetti, P; Pascual, M

    2011-12-01

    Genetic connectivity and geographic fragmentation are two opposing mechanisms determining the population structure of species. While the first homogenizes the genetic background across populations the second one allows their differentiation. Therefore, knowledge of processes affecting dispersal of marine organisms is crucial to understand their genetic distribution patterns and for the effective management of their populations. In this study, we use genetic analyses of eleven microsatellites in combination with oceanographic satellite and dispersal simulation data to determine distribution patterns for Serranus cabrilla, a ubiquitous demersal broadcast spawner, in the Mediterranean Sea. Pairwise population F(ST) values ranged between -0.003 and 0.135. Two genetically distinct clusters were identified, with a clear division located between the oceanographic discontinuities at the Ibiza Channel (IC) and the Almeria-Oran Front (AOF), revealing an admixed population in between. The Balearic Front (BF) also appeared to dictate population structure. Directional gene flow on the Spanish coast was observed as S. cabrilla dispersed from west to east over the AOF, from north to south on the IC and from south of the IC towards the Balearic Islands. Correlations between genetic and oceanographic data were highly significant. Seasonal changes in current patterns and the relationship between ocean circulation patterns and spawning season may also play an important role in population structure around oceanographic fronts. PMID:22097887

  16. Deployment of a retinal determination gene network drives directed cell migration in the sea urchin embryo

    PubMed Central

    Martik, Megan L; McClay, David R

    2015-01-01

    Gene regulatory networks (GRNs) provide a systems-level orchestration of an organism's genome encoded anatomy. As biological networks are revealed, they continue to answer many questions including knowledge of how GRNs control morphogenetic movements and how GRNs evolve. The migration of the small micromeres to the coelomic pouches in the sea urchin embryo provides an exceptional model for understanding the genomic regulatory control of morphogenesis. An assay using the robust homing potential of these cells reveals a ‘coherent feed-forward’ transcriptional subcircuit composed of Pax6, Six3, Six1/2, Eya, and Dach1 that is responsible for the directed homing mechanism of these multipotent progenitors. The linkages of that circuit are strikingly similar to a circuit involved in retinal specification in Drosophila suggesting that systems-level tasks can be highly conserved even though the tasks drive unrelated processes in different animals. DOI: http://dx.doi.org/10.7554/eLife.08827.001 PMID:26402456

  17. RNAi-directed post transcriptional gene silencing of an Arabidopsis Myb transgene in tobacco

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The AtMyb90 gene encodes the 'production of anthocyanin pigment 2' (PAP2) transcription factor of Arabidopsis thaliana and is able to induce a visible hyper-pigmented phenotype when expressed in tobacco. Based upon this phenotype, we have used the AtMyb90 gene as a reporter gene to examine RNAi-dire...

  18. Introduction of the anti-apoptotic baculovirus p35 gene in passion fruit induces herbicide tolerance, reduced bacterial lesions, but does not inhibits passion fruit woodiness disease progress induced by cowpea aphid-borne mosaic virus (CABMV).

    PubMed

    de Freitas, Daniele Scandiucci; Coelho, Marly C Felipe; Souza, Manoel T; Marques, Abi; Ribeiro, E Bergmann Morais

    2007-01-01

    The introduction of anti-apoptotic genes into plants leads to resistance to environmental stress and broad-spectrum disease resistance. The anti-apoptotic gene (p35) from a baculovirus was introduced into the genome of passion fruit plants by biobalistics. Eleven regenerated plants showed the presence of the p35 gene by PCR and/or dot blot hybridization. Transcriptional analysis of regenerated plants showed the presence of specific p35 transcripts in 9 of them. Regenerated plants containing the p35 gene were inoculated with the cowpea aphid-borne mosaic virus (CABMV), the bacterium Xanthomonas axonopodis pv passiflorae, and the herbicide, glufosinate, (Syngenta). None of the plants showed resistance to CABMV. Regenerated plants (p35+) showed less than half of local lesions showed by non-transgenic plants when inoculated with X. axonopodis and some p35+ plants showed increased tolerance to the glufosinate herbicide when compared to non-transgenic plants. PMID:17016672

  19. The 32-kilobase exp gene cluster of Rhizobium meliloti directing the biosynthesis of galactoglucan: genetic organization and properties of the encoded gene products.

    PubMed Central

    Becker, A; Rüberg, S; Küster, H; Roxlau, A A; Keller, M; Ivashina, T; Cheng, H P; Walker, G C; Pühler, A

    1997-01-01

    Proteins directing the biosynthesis of galactoglucan (exopolysaccharide II) in Rhizobium meliloti Rm2011 are encoded by the exp genes. Sequence analysis of a 32-kb DNA fragment of megaplasmid 2 containing the exp gene cluster identified previously (J. Glazebrook and G. C. Walker, Cell 56:661-672, 1989) revealed the presence of 25 open reading frames. Homologies of the deduced exp gene products to proteins of known function suggested that the exp genes encoded four proteins involved in the biosynthesis of dTDP-glucose and dTDP-rhamnose, six glycosyltransferases, an ABC transporter complex homologous to the subfamily of peptide and protein export complexes, and a protein homologous to Rhizobium NodO proteins. In addition, homologies of three Exp proteins to transcriptional regulators, methyltransferases, and periplasmic binding proteins were found. The positions of 26 Tn5 insertions in the exp gene cluster were determined, thus allowing the previously described genetic map to be correlated with the sequence. Operon analysis revealed that the exp gene cluster consists of five complementation groups. In comparison to the wild-type background, all exp complementation groups were transcribed at a substantially elevated level in the regulatory mucR mutant. PMID:9023225

  20. Direct detection of recombinant gene expression by two genetically engineered yeasts in soil on the transcriptional and translational levels.

    PubMed Central

    Tebbe, C C; Wenderoth, D F; Vahjen, W; Lübke, K; Munch, J C

    1995-01-01

    The expression of a recombinant gene by yeasts seeded into soil samples was directly measured by analyzing transcripts and gene product occurrences in soil extracts. Two yeast species, Saccharomyces cerevisiae WHL292 and Hansenula polymorpha LR9-Apr4, both engineered by a synthetic gene sequence encoding the mammalian peptide aprotinin, produced and secreted this peptide in batch cultures at concentrations of 90 and 64 ng ml-1, respectively. In S. cerevisiae, the aprotinin gene was located on plasmid p707 and expressed constitutively. H. polymorpha carried the gene chromosomally integrated, and its expression was inducible by methanol. To detect aprotinin transcripts, cells were directly lysed in the soil samples and the crude lysates were hybridized to oligo(dT)-coated magnetized polystyrene beads (Dynabeads). After separation and purification in a magnetic field, aprotinin mRNA was detected by reverse transcriptase PCR with aprotinin gene-specific primers. Transcripts from 10 cells g of soil-1 were sufficient for detection. When 10(7) cells of S. cerevisiae were inoculated into soil, aprotinin mRNA was detectable during the first 4 days. Addition of methanol and a combined nutrient solution was necessary to induce aprotinin gene expression of H. polymorpha in soil. Aprotinin could be detected directly in soil extracts by an indirect enzyme-linked immunosorbent assay with monoclonal aprotinin-specific antibodies. The detection threshold was 45 pg g of soil-1. In presterilized soil inoculated with S. cerevisiae (10(6) CFU g-1), aprotinin accumulated during the first 10 days to 12 ng g of soil-1 and then remained constant.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8534097

  1. The hemagglutinin gene A (hagA) of Porphyromonas gingivalis 381 contains four large, contiguous, direct repeats.

    PubMed Central

    Han, N; Whitlock, J; Progulske-Fox, A

    1996-01-01

    Porphyromonas gingivalis is a gram-negative anaerobic bacterial species strongly associated with adult periodontitis. One of its distinguishing characteristics and putative virulence properties is the ability to agglutinate erythrocytes. We have previously reported the cloning of multiple hemagglutinin genes from P. gingivalis 381. Subsequent sequencing of clone ST 2 revealed that the cloned fragment contained only an internal portion of the gene which lacked both start and stop codons. We here report the cloning and sequencing of the entire gene, designated hagA, as well as its relationship to other genes of this species. By use of inverse PCR technology and the construction of several additional genomic libraries, the complete open reading frame of hagA was found to be 7,887 bp in length, encoding a protein of 2,628 amino acids with a molecular mass of 283.3 kDa, which is among the largest genes ever cloned from a prokaryote to date. Within its open reading frame, four large, contiguous, direct repeats (varying from 1,318 to 1,368 bp) were identified. The repeat unit (HArep), which is assumed to contain the hemagglutinin domain, is also present in other recently reported protease and hemagglutinin genes in P. gingivalis. Thus, we propose that hagA and the other genes which share the HArep sequence form a multigene family with hagA as a central member. PMID:8926061

  2. Sleeping Beauty Transposon Vectors in Liver-directed Gene Delivery of LDLR and VLDLR for Gene Therapy of Familial Hypercholesterolemia.

    PubMed

    Turunen, Tytteli A K; Kurkipuro, Jere; Heikura, Tommi; Vuorio, Taina; Hytönen, Elisa; Izsvák, Zsuzsanna; Ylä-Herttuala, Seppo

    2016-03-01

    Plasmid-based Sleeping Beauty (SB) transposon vectors were developed and used to deliver genes for low-density lipoprotein and very-low-density lipoprotein receptors (LDLR and VLDLR, respectively) or lacZ reporter into liver of an LDLR-deficient mouse model of familial hypercholesterolemia (FH). SB transposase, SB100x, was used to integrate the therapeutic transposons into mice livers for evaluating the feasibility of the vectors in reducing high blood cholesterol and the progression of atherosclerosis. Hydrodynamic gene delivery of transposon-VLDLR into the livers of the mice resulted in initial 17-19% reductions in plasma cholesterol, and at the later time points, in a significant stabilization of the cholesterol level for the 6.5-month duration of the study compared to the control mice. Transposon-LDLR-treated animals also demonstrated a trend of stabilization in the cholesterol levels in the long term. Vector-treated mice had slightly less lipid accumulation in the liver and reduced aortic atherosclerosis. Clinical chemistry and histological analyses revealed normal liver function and morphology comparable to that of the controls during the follow-up with no safety issues regarding the vector type, transgenes, or the gene transfer method. The study demonstrates the safety and potential benefits of the SB transposon vectors in the treatment of FH. PMID:26670130

  3. Identification of Genes Directly Involved in Shell Formation and Their Functions in Pearl Oyster, Pinctada fucata

    PubMed Central

    Fang, Dong; Xu, Guangrui; Hu, Yilin; Pan, Cong; Xie, Liping; Zhang, Rongqing

    2011-01-01

    Mollusk shell formation is a fascinating aspect of biomineralization research. Shell matrix proteins play crucial roles in the control of calcium carbonate crystallization during shell formation in the pearl oyster, Pinctada fucata. Characterization of biomineralization-related genes during larval development could enhance our understanding of shell formation. Genes involved in shell biomineralization were isolated by constructing three suppression subtractive hybridization (SSH) libraries that represented genes expressed at key points during larval shell formation. A total of 2,923 ESTs from these libraries were sequenced and gave 990 unigenes. Unigenes coding for secreted proteins and proteins with tandem-arranged repeat units were screened in the three SSH libraries. A set of sequences coding for genes involved in shell formation was obtained. RT-PCR and in situ hybridization assays were carried out on five genes to investigate their spatial expression in several tissues, especially the mantle tissue. They all showed a different expression pattern from known biomineralization-related genes. Inhibition of the five genes by RNA interference resulted in different defects of the nacreous layer, indicating that they all were involved in aragonite crystallization. Intriguingly, one gene (UD_Cluster94.seq.Singlet1) was restricted to the ‘aragonitic line’. The current data has yielded for the first time, to our knowledge, a suite of biomineralization-related genes active during the developmental stages of P.fucata, five of which were responsible for nacreous layer formation. This provides a useful starting point for isolating new genes involved in shell formation. The effects of genes on the formation of the ‘aragonitic line’, and other areas of the nacreous layer, suggests a different control mechanism for aragonite crystallization initiation from that of mature aragonite growth. PMID:21747964

  4. Identification of genes directly involved in shell formation and their functions in pearl oyster, Pinctada fucata.

    PubMed

    Fang, Dong; Xu, Guangrui; Hu, Yilin; Pan, Cong; Xie, Liping; Zhang, Rongqing

    2011-01-01

    Mollusk shell formation is a fascinating aspect of biomineralization research. Shell matrix proteins play crucial roles in the control of calcium carbonate crystallization during shell formation in the pearl oyster, Pinctada fucata. Characterization of biomineralization-related genes during larval development could enhance our understanding of shell formation. Genes involved in shell biomineralization were isolated by constructing three suppression subtractive hybridization (SSH) libraries that represented genes expressed at key points during larval shell formation. A total of 2,923 ESTs from these libraries were sequenced and gave 990 unigenes. Unigenes coding for secreted proteins and proteins with tandem-arranged repeat units were screened in the three SSH libraries. A set of sequences coding for genes involved in shell formation was obtained. RT-PCR and in situ hybridization assays were carried out on five genes to investigate their spatial expression in several tissues, especially the mantle tissue. They all showed a different expression pattern from known biomineralization-related genes. Inhibition of the five genes by RNA interference resulted in different defects of the nacreous layer, indicating that they all were involved in aragonite crystallization. Intriguingly, one gene (UD_Cluster94.seq.Singlet1) was restricted to the 'aragonitic line'. The current data has yielded for the first time, to our knowledge, a suite of biomineralization-related genes active during the developmental stages of P. fucata, five of which were responsible for nacreous layer formation. This provides a useful starting point for isolating new genes involved in shell formation. The effects of genes on the formation of the 'aragonitic line', and other areas of the nacreous layer, suggests a different control mechanism for aragonite crystallization initiation from that of mature aragonite growth. PMID:21747964

  5. Gene-Environment Interactions in Genome-Wide Association Studies: Current Approaches and New Directions

    ERIC Educational Resources Information Center

    Winham, Stacey J.; Biernacka, Joanna M.

    2013-01-01

    Background: Complex psychiatric traits have long been thought to be the result of a combination of genetic and environmental factors, and gene-environment interactions are thought to play a crucial role in behavioral phenotypes and the susceptibility and progression of psychiatric disorders. Candidate gene studies to investigate hypothesized…

  6. Photoperiod and E-genes Directly Influence the Duration of Soybean Reproductive Development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Duration of the reproductive phase (DRP) is critical for soybean [Glycine max (L.) Merr.] yield. Manipulation of this phase may benefit breeding for higher yield. The soybean E-gene series control time to flowering and maturity through a photoperiod-mediated response. It is possible that E-genes and...

  7. Next-Generation Sequencing of Plasmodium vivax Patient Samples Shows Evidence of Direct Evolution in Drug-Resistance Genes

    PubMed Central

    Flannery, Erika L.; Wang, Tina; Akbari, Ali; Corey, Victoria C.; Gunawan, Felicia; Bright, A. Taylor; Abraham, Matthew; Sanchez, Juan F.; Santolalla, Meddly L.; Baldeviano, G. Christian; Edgel, Kimberly A.; Rosales, Luis A.; Lescano, Andrés G.; Bafna, Vineet; Vinetz, Joseph M.; Winzeler, Elizabeth A.

    2015-01-01

    Understanding the mechanisms of drug resistance in Plasmodium vivax, the parasite that causes the most widespread form of human malaria, is complicated by the lack of a suitable long-term cell culture system for this parasite. In contrast to P. falciparum, which can be more readily manipulated in the laboratory, insights about parasite biology need to be inferred from human studies. Here we analyze the genomes of parasites within 10 human P. vivax infections from the Peruvian Amazon. Using next-generation sequencing we show that some P. vivax infections analyzed from the region are likely polyclonal. Despite their polyclonality we observe limited parasite genetic diversity by showing that three or fewer haplotypes comprise 94% of the examined genomes, suggesting the recent introduction of parasites into this geographic region. In contrast we find more than three haplotypes in putative drug-resistance genes, including the gene encoding dihydrofolate reductase-thymidylate synthase and the P. vivax multidrug resistance associated transporter, suggesting that resistance mutations have arisen independently. Additionally, several drug-resistance genes are located in genomic regions with evidence of increased copy number. Our data suggest that whole genome sequencing of malaria parasites from patients may provide more insight about the evolution of drug resistance than genetic linkage or association studies, especially in geographical regions with limited parasite genetic diversity. PMID:26719854

  8. Involvement of condensin-directed gene associations in the organization and regulation of chromosome territories during the cell cycle.

    PubMed

    Iwasaki, Osamu; Corcoran, Christopher J; Noma, Ken-Ichi

    2016-05-01

    Chromosomes are not randomly disposed in the nucleus but instead occupy discrete sub-nuclear domains, referred to as chromosome territories. The molecular mechanisms that underlie the formation of chromosome territories and how they are regulated during the cell cycle remain largely unknown. Here, we have developed two different chromosome-painting approaches to address how chromosome territories are organized in the fission yeast model organism. We show that condensin frequently associates RNA polymerase III-transcribed genes (tRNA and 5S rRNA) that are present on the same chromosomes, and that the disruption of these associations by condensin mutations significantly compromises the chromosome territory arrangement. We also find that condensin-dependent intra-chromosomal gene associations and chromosome territories are co-regulated during the cell cycle. For example, condensin-directed gene associations occur to the least degree during S phase, with the chromosomal overlap becoming largest. In clear contrast, condensin-directed gene associations become tighter in other cell-cycle phases, especially during mitosis, with the overlap between the different chromosomes being smaller. This study suggests that condensin-driven intra-chromosomal gene associations contribute to the organization and regulation of chromosome territories during the cell cycle. PMID:26704981

  9. Directed in vitro evolution of reporter genes based on semi-rational design and high-throughput screening.

    PubMed

    Xiong, Ai-Sheng; Yao, Quan-Hong; Peng, Ri-He; Cheng, Zong-Ming

    2010-01-01

    Marker genes, such as gusA, lacZ, and gfp, have been applied comprehensively in biological studies. Directed in vitro evolution provides a powerful tool for modifying genes and for studying gene structure, expression, and function. Here, we describe a strategy for directed in vitro evolution of reporter genes based on semi-rational design and high-throughput screening. The protocol involves two processes of DNA shuffling and screening. The first DNA shuffling and screening process involves eight steps: (1) amplifying the target gene by PCR, (2) cutting the product into random fragments with DNase I, (3) purification of 50-100 bp fragments, (4) reassembly of the fragments in a primerless PCR, (5) amplification of the reassembled product by primer PCR, (6) cloning into expression vector, (7) transformation of E. coli by electroporation, and (8) screening the target mutants using a nitrocellulose filter. The second DNA shuffling and screening process also involves the same eight steps, except that degenerate oligonucleotide primers are based on the sequence of the selected mutant. PMID:20676989

  10. Involvement of condensin-directed gene associations in the organization and regulation of chromosome territories during the cell cycle

    PubMed Central

    Iwasaki, Osamu; Corcoran, Christopher J.; Noma, Ken-ichi

    2016-01-01

    Chromosomes are not randomly disposed in the nucleus but instead occupy discrete sub-nuclear domains, referred to as chromosome territories. The molecular mechanisms that underlie the formation of chromosome territories and how they are regulated during the cell cycle remain largely unknown. Here, we have developed two different chromosome-painting approaches to address how chromosome territories are organized in the fission yeast model organism. We show that condensin frequently associates RNA polymerase III-transcribed genes (tRNA and 5S rRNA) that are present on the same chromosomes, and that the disruption of these associations by condensin mutations significantly compromises the chromosome territory arrangement. We also find that condensin-dependent intra-chromosomal gene associations and chromosome territories are co-regulated during the cell cycle. For example, condensin-directed gene associations occur to the least degree during S phase, with the chromosomal overlap becoming largest. In clear contrast, condensin-directed gene associations become tighter in other cell-cycle phases, especially during mitosis, with the overlap between the different chromosomes being smaller. This study suggests that condensin-driven intra-chromosomal gene associations contribute to the organization and regulation of chromosome territories during the cell cycle. PMID:26704981

  11. Genome-Wide Transcriptome Directed Pathway Analysis of Maternal Pre-Eclampsia Susceptibility Genes

    PubMed Central

    Yong, Hannah E. J.; Melton, Phillip E.; Johnson, Matthew P.; Freed, Katy A.; Kalionis, Bill; Murthi, Padma; Brennecke, Shaun P.; Keogh, Rosemary J.; Moses, Eric K.

    2015-01-01

    Background Preeclampsia (PE) is a serious hypertensive pregnancy disorder with a significant genetic component. Numerous genetic studies, including our own, have yielded many susceptibility genes from distinct functional groups. Additionally, transcriptome profiling of tissues at the maternal-fetal interface has likewise yielded many differentially expressed genes. Often there is little overlap between these two approaches, although genes identified in both approaches are significantly associated with PE. We have thus taken a novel integrative bioinformatics approach of analysing pathways common to the susceptibility genes and the PE transcriptome. Methods Using Illumina Human Ht12v4 and Wg6v3 BeadChips, transcriptome profiling was conducted on n = 65 normotensive and n = 60 PE decidua basalis tissues collected at delivery. The R software package libraries lumi and limma were used to preprocess transcript data for pathway analysis. Pathways were analysed and constructed using Pathway Studio. We examined ten candidate genes, which are from these functional groups: activin/inhibin signalling—ACVR1, ACVR1C, ACVR2A, INHA, INHBB; structural components—COL4A1, COL4A2 and M1 family aminopeptidases—ERAP1, ERAP2 and LNPEP. Results/Conclusion Major common regulators/targets of these susceptibility genes identified were AGT, IFNG, IL6, INHBA, SERPINE1, TGFB1 and VEGFA. The top two categories of pathways associated with the susceptibility genes, which were significantly altered in the PE decidual transcriptome, were apoptosis and cell signaling (p < 0.001). Thus, susceptibility genes from distinct functional groups share similar downstream pathways through common regulators/targets, some of which are altered in PE. This study contributes to a better understanding of how susceptibility genes may interact in the development of PE. With this knowledge, more targeted functional analyses of PE susceptibility genes in these key pathways can be performed to examine their

  12. GENERAL INTRODUCTION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This unique resource reviews progress made by scientists researching into how ambient changes in the wavelength, intensity, direction and duration of light environment affect plant growth and development - explaining how combinations of new research with classical photobiology and physiology made fe...

  13. Targeted gene conversion induced by triplex-directed psoralen interstrand crosslinks in mammalian cells.

    PubMed

    Liu, Yaobin; Nairn, Rodney S; Vasquez, Karen M

    2009-10-01

    Correction of a defective gene is a promising approach for both basic research and clinical gene therapy. However, the absence of site-specific targeting and the low efficiency of homologous recombination in human cells present barriers to successful gene targeting. In an effort to overcome these barriers, we utilized triplex-forming oligonucleotides (TFOs) conjugated to a DNA interstrand crosslinking (ICL) agent, psoralen (pTFO-ICLs), to improve the gene targeting efficiency at a specific site in DNA. Gene targeting events were monitored by the correction of a deletion on a recipient plasmid with the homologous sequence from a donor plasmid in human cells. The mechanism underlying this event is stimulation of homologous recombination by the pTFO-ICL. We found that pTFO-ICLs are efficient in inducing targeted gene conversion (GC) events in human cells. The deletion size in the recipient plasmid influenced both the recombination frequency and spectrum of recombinants; i.e. plasmids with smaller deletions had a higher frequency and proportion of GC events. The polarity of the pTFO-ICL also had a prominent effect on recombination. Our results suggest that pTFO-ICL induced intermolecular recombination provides an efficient method for targeted gene correction in mammalian cells. PMID:19726585

  14. Epstein-Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression.

    PubMed

    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G; Sinclair, Alison J

    2015-04-20

    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  15. Gene fusions for the directed modification of the carotenoid biosynthesis pathway in Mucor circinelloides.

    PubMed

    Iturriaga, Enrique A; Papp, Tamás; Alvarez, María Isabel; Eslava, Arturo P

    2012-01-01

    Several fungal species, particularly some included in the Mucorales, have been used to develop fermentation processes for the production of β-carotene. Oxygenated derivatives of β-carotene are more valuable products, and the preference by the market of carotenoids from biological sources has increased the research in different carotenoid-producing organisms. We currently use Mucor circinelloides as a model organism to develop strains able to produce new, more valuable, and with an increased content of carotenoids. In this chapter we describe part of our efforts to construct active gene fusions which could advance in the diversification of carotenoid production by this fungus. The main carotenoid accumulated by M. circinelloides is β-carotene, although it has some hydroxylase activity and produces low amounts of zeaxanthin. Two enzymatic activities are required for the production of astaxanthin from β-carotene: a hydroxylase and a ketolase. We used the ctrW gene of Paracoccus sp. N81106, encoding a bacterial β-carotene ketolase, to construct gene fusions with two fungal genes essential for the modification of the pathway in M. circinelloides. First we fused it to the carRP gene of M. circinelloides, which is responsible for the phytoene synthase and lycopene cyclase activities in this fungus. The expected activity of this fusion gene would be the accumulation by M. circinelloides of canthaxanthin and probably some astaxanthin. A second construction was the fusion of the crtW gene of Paracoccus sp. to the crtS gene of Xanthophyllomyces dendrorhous, responsible for the synthesis of astaxanthin from β-carotene in this fungus, but which was shown to have only hydroxylase activity in M. circinelloides. The expected result in M. circinelloides transformants was the accumulation of astaxanthin. Here we describe a detailed and empirically tested protocol for the construction of these gene fusions. PMID:22711120

  16. Directed gene copy number amplification in Pichia pastoris by vector integration into the ribosomal DNA locus.

    PubMed

    Marx, Hans; Mecklenbräuker, Astrid; Gasser, Brigitte; Sauer, Michael; Mattanovich, Diethard

    2009-12-01

    The yeast Pichia pastoris is a widely used host organism for heterologous protein production. One of the basic steps for strain improvement is to ensure a sufficient level of transcription of the heterologous gene, based on promoter strength and gene copy number. To date, high-copy-number integrants of P. pastoris are achievable only by screening of random events or by cloning of gene concatemers. Methods for rapid and reliable multicopy integration of the expression cassette are therefore desirable. Here we present such a method based on vector integration into the rDNA locus and post-transformational vector amplification by repeated selection on increased antibiotic concentrations. Data are presented for two exemplary products: human serum albumin, which is secreted into the supernatant, and human superoxide dismutase, which is accumulated in the cytoplasm of the cells. The striking picture evolving is that intracellular protein production is tightly correlated with gene copy number, while use of the secretory pathway introduces a high clonal variability and the correlation with gene copy number is valid only for low gene copy numbers. PMID:19799640

  17. Directed mutagenesis in Candida albicans: one-step gene disruption to isolate ura3 mutants

    SciTech Connect

    Kelly, R.; Miller, S.M.; Kurtz, M.B.; Kirsch, D.R.

    1987-01-01

    A method for introducing specific mutations into the diploid Candida albicans by one-step gene disruption and subsequent UV-induced recombination was developed. The cloned C. albicans URA3 gene was disrupted with the C. albicans ADE2 gene, and the linearized DNA was used for transformation of two ade2 mutants, SGY-129 and A81-Pu. Both an insertional inactivation of the URA3 gene and a disruption which results in a 4.0-kilobase deletion were made. Southern hybridization analyses demonstrated that the URA3 gene was disrupted on one of the chromosomal homologs in 15 of the 18 transformants analyzed. These analyses also revealed restriction site dimorphism of EcoRI at the URA3 locus which provides a unique marker to distinguish between chromosomal homologs. This enabled us to show that either homolog could be disrupted and that disrupted transformants of SGY-129 contained more than two copies of the URA3 locus. The A81-Pu transformants heterozygous for the ura3 mutations were rendered homozygous and Ura- by UV-induced recombination. The homozygosity of a deletion mutant and an insertion mutant was confirmed by Southern hybridization. Both mutants were transformed to Ura+ with plasmids containing the URA3 gene and in addition, were resistant to 5-fluoro-orotic acid, a characteristic of Saccharomyces cerevisiae ura3 mutants as well as of orotidine-5'-phosphate decarboxylase mutants of other organisms.

  18. Vesicular stomatitis virus matrix protein inhibits host cell-directed transcription of target genes in vivo.

    PubMed Central

    Black, B L; Lyles, D S

    1992-01-01

    Infection by vesicular stomatitis virus (VSV) results in a rapid inhibition of host cell transcription and translation. To determine whether the viral matrix (M) protein was involved in this inhibition of host cell gene expression, an M protein expression vector was cotransfected with a target gene vector, encoding the target gene, encoding chloramphenicol acetyltransferase (CAT). Expression of M protein caused a decrease in CAT activity in a gene dosage-dependent manner, and inhibition was apparent by 12 h posttransfection. The inhibitory effect of M protein was quite potent. The level of M protein required for a 10-fold inhibition of CAT activity was less than 1% of the level of M protein produced during the sixth hour of VSV infection. Northern (RNA) analysis of cotransfected cells showed that expression of M protein caused a reduction in the steady-state level of the vector-encoded mRNAs. Expression of both CAT and M mRNAs was reduced in cells cotransfected with a plasmid encoding M protein, indicating that expression of small amounts of M protein from plasmid DNA inhibits further expression of both M and CAT mRNAs. Nuclear runoff transcription analysis demonstrated that expression of M protein inhibited transcription of the target genes. This is the first report of a viral gene product which is capable of inhibiting transcription in vivo in the absence of any other viral component. Images PMID:1318397

  19. Suppression of proliferative cholangitis in a rat model with direct adenovirus-mediated retinoblastoma gene transfer to the biliary tract.

    PubMed

    Terao, R; Honda, K; Hatano, E; Uehara, T; Yamamoto, M; Yamaoka, Y

    1998-09-01

    Proliferative cholangitis (PC) associated with hepatolithiasis develops the stricture of main bile ducts, and is the main cause of residual and/or recurrent stones after repeated treatments for hepatolithiasis. The aim of this study was to inhibit PC using the cytostatic gene therapy with direct adenovirus-mediated retinoblastoma (Rb) gene transfer to the biliary tract. PC was induced by introducing a fine nylon thread into the bile duct in a rat model. The adenovirus vector encoding a nonphosphorylatable, constitutively active form of retinoblastoma gene product (AdRb) was administered directly into the biliary tract. The adenovirus vector encoding beta-galactosidase (AdlacZ) was also given as a control. The bile duct wall thickness and 5'-bromodeoxyuridine (BrdU) labeling index were compared among uninfected, AdlacZ-infected, and AdRb-infected PC rats. The Rb expression in the bile duct was detected using reverse-transcription polymerase chain reaction (RT-PCR) and immunohistochemical study. AdRb-infected bile ducts showed inhibition of the epithelial and fibrous tissue proliferation and the peribiliary gland hyperplasia, resulting in a significant reduction of wall thickness compared with uninfected and AdlacZ-infected ones. The BrdU labeling index was 4.87% +/- 3.06% in the AdRb-infected bile ducts, while those of uninfected and AdlacZ-infected ones were 15.48% +/- 4.61% and 11.72% +/- 1.23%, respectively (P < .05). In conclusion, our cytostatic gene therapy approach using direct Rb gene transfer into the biliary tract suppressed PC in a rat model and may offer an effective therapeutic option for reducing recurrences following treatments against hepatolithiasis. PMID:9731547

  20. An Introduction to "My Environmental Education Evaluation Resource Assistant" (MEERA), a Web-Based Resource for Self-Directed Learning about Environmental Education Program Evaluation

    ERIC Educational Resources Information Center

    Zint, Michaela

    2010-01-01

    My Environmental Education Evaluation Resource Assistant or "MEERA" is a web-site designed to support environmental educators' program evaluation activities. MEERA has several characteristics that set it apart from other self-directed learning evaluation resources. Readers are encouraged to explore the site and to reflect on the role that…

  1. Modulation of Estrogen Response Element-Driven Gene Expressions and Cellular Proliferation with Polar Directions by Designer Transcription Regulators

    PubMed Central

    Muyan, Mesut; Güpür, Gizem; Yaşar, Pelin; Ayaz, Gamze; User, Sırma Damla; Kazan, Hasan Hüseyin; Huang, Yanfang

    2015-01-01

    Estrogen receptor α (ERα), as a ligand-dependent transcription factor, mediates 17β-estradiol (E2) effects. ERα is a modular protein containing a DNA binding domain (DBD) and transcription activation domains (AD) located at the amino- and carboxyl-termini. The interaction of the E2-activated ERα dimer with estrogen response elements (EREs) of genes constitutes the initial step in the ERE-dependent signaling pathway necessary for alterations of cellular features. We previously constructed monomeric transcription activators, or monotransactivators, assembled from an engineered ERE-binding module (EBM) using the ERα-DBD and constitutively active ADs from other transcription factors. Monotransactivators modulated cell proliferation by activating and repressing ERE-driven gene expressions that simulate responses observed with E2-ERα. We reasoned here that integration of potent heterologous repression domains (RDs) into EBM could generate monotransrepressors that alter ERE-bearing gene expressions and cellular proliferation in directions opposite to those observed with E2-ERα or monotransactivators. Consistent with this, monotransrepressors suppressed reporter gene expressions that emulate the ERE-dependent signaling pathway. Moreover, a model monotransrepressor regulated DNA synthesis, cell cycle progression and proliferation of recombinant adenovirus infected ER-negative cells through decreasing as well as increasing gene expressions with polar directions compared with E2-ERα or monotransactivator. Our results indicate that an ‘activator’ or a ‘repressor’ possesses both transcription activating/enhancing and repressing/decreasing abilities within a chromatin context. Offering a protein engineering platform to alter signal pathway-specific gene expressions and cell growth, our approach could also be used for the development of tools for epigenetic modifications and for clinical interventions wherein multigenic de-regulations are an issue. PMID:26295471

  2. The synthetic gestagen levonorgestrel directly affects gene expression in thyroid and pituitary glands of Xenopus laevis tadpoles.

    PubMed

    Lorenz, Claudia; Opitz, Robert; Trubiroha, Achim; Lutz, Ilka; Zikova, Andrea; Kloas, Werner

    2016-08-01

    The synthetic gestagen levonorgestrel (LNG) was previously shown to perturb thyroid hormone-dependent metamorphosis in Xenopus laevis. However, so far the mechanisms underlying the anti-metamorphic effects of LNG remained unknown. Therefore, a series of in vivo and ex vivo experiments was performed to identify potential target sites of LNG action along the pituitary-thyroid axis of X. laevis tadpoles. Prometamorphic tadpoles were treated in vivo with LNG (0.01-10nM) for 72h and brain-pituitary and thyroid tissue was analyzed for marker gene expression. While no treatment-related changes were observed in brain-pituitary tissue, LNG treatment readily affected thyroidal gene expression in tadpoles including decreased slc5a5 and iyd mRNA expression and a strong induction of dio2 and dio3 expression. When using an ex vivo organ explant culture approach, direct effects of LNG on both pituitary and thyroid gland gene expression were detecTable Specifically, treatment of pituitary explants with 10nM LNG strongly stimulated dio2 expression and concurrently suppressed tshb expression. In thyroid glands, ex vivo LNG treatment induced dio2 and dio3 mRNA expression in a thyrotropin-independent manner. When thyroid explants were cultured in thyrotropin-containing media, LNG caused similar gene expression changes as seen after 72h in vivo treatment including a very strong repression of thyrotropin-induced slc5a5 expression. Concerning the anti-thyroidal activity of LNG as seen under in vivo conditions, our ex vivo data provide clear evidence that LNG directly affects expression of genes important for thyroidal iodide handling as well as genes involved in negative feedback regulation of pituitary tshb expression. PMID:27262936

  3. Direct Repression of Evening Genes by CIRCADIAN CLOCK-ASSOCIATED1 in the Arabidopsis Circadian Clock[OPEN

    PubMed Central

    Kamioka, Mari; Takao, Saori; Suzuki, Takamasa; Taki, Kyomi; Higashiyama, Tetsuya; Nakamichi, Norihito

    2016-01-01

    The circadian clock is a biological timekeeping system that provides organisms with the ability to adapt to day-night cycles. Timing of the expression of four members of the Arabidopsis thaliana PSEUDO-RESPONSE REGULATOR (PRR) family is crucial for proper clock function, and transcriptional control of PRRs remains incompletely defined. Here, we demonstrate that direct regulation of PRR5 by CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) determines the repression state of PRR5 in the morning. Chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) analyses indicated that CCA1 associates with three separate regions upstream of PRR5. CCA1 and its homolog LATE ELONGATED HYPOCOTYL (LHY) suppressed PRR5 promoter activity in a transient assay. The regions bound by CCA1 in the PRR5 promoter gave rhythmic patterns with troughs in the morning, when CCA1 and LHY are at high levels. Furthermore, ChIP-seq revealed that CCA1 associates with at least 449 loci with 863 adjacent genes. Importantly, this gene set contains genes that are repressed but upregulated in cca1 lhy double mutants in the morning. This study shows that direct binding by CCA1 in the morning provides strong repression of PRR5, and repression by CCA1 also temporally regulates an evening-expressed gene set that includes PRR5. PMID:26941090

  4. The thermostable direct hemolysin-related hemolysin (trh) gene of Vibrio parahaemolyticus: Sequence variation and implications for detection and function.

    PubMed

    Nilsson, William B; Turner, Jeffrey W

    2016-07-01

    Vibrio parahaemolyticus is a leading cause of bacterial food-related illness associated with the consumption of undercooked seafood. Only a small subset of strains is pathogenic. Most clinical strains encode for the thermostable direct hemolysin (TDH) and/or the TDH-related hemolysin (TRH). In this work, we amplify and sequence the trh gene from over 80 trh+strains of this bacterium and identify thirteen genetically distinct alleles, most of which have not been deposited in GenBank previously. Sequence data was used to design new primers for more reliable detection of trh by endpoint PCR. We also designed a new quantitative PCR assay to target a more conserved gene that is genetically-linked to trh. This gene, ureR, encodes the transcriptional regulator for the urease gene cluster immediately upstream of trh. We propose that this ureR assay can be a useful screening tool as a surrogate for direct detection of trh that circumvents challenges associated with trh sequence variation. PMID:27094247

  5. Characterization and Expression Analysis of Genes Directing Galactomannan Synthesis in Coffee

    PubMed Central

    Pré, Martial; Caillet, Victoria; Sobilo, Julien; McCarthy, James

    2008-01-01

    Background and Aims Galactomannans act as storage reserves for the seeds in some plants, such as guar (Cyamopsis tetragonoloba) and coffee (Coffea arabica and Coffea canephora). In coffee, the galactomannans can represent up to 25 % of the mass of the mature green coffee grain, and they exert a significant influence on the production of different types of coffee products. The objective of the current work was to isolate and characterize cDNA encoding proteins responsible for galactomannan synthesis in coffee and to study the expression of the corresponding transcripts in the developing coffee grain from C. arabica and C. canephora, which potentially exhibit slight galactomannan variations. Comparative gene expression analysis was also carried out for several other tissues of C. arabica and C. canephora. Methods cDNA banks, RACE-PCR and genome walking were used to generate full-length cDNA for two putative coffee mannan synthases (ManS) and two galactomannan galactosyl transferases (GMGT). Gene-specific probe-primer sets were then generated and used to carry out comparative expression analysis of the corresponding genes in different coffee tissues using quantitative RT-PCR Key Results Two of the putative galactomannan biosynthetic genes, ManS1 and GMGT1, were demonstrated to have very high expression in the developing coffee grain of both Coffea species during endosperm development, consistent with our proposal that these two genes are responsible for the production of the majority of the galactomannans found in the grain. In contrast, the expression data presented indicates that the ManS2 gene product is probably involved in the synthesis of the galactomannans found in green tissue. Conclusions The identification of genes implicated in galactomannan synthesis in coffee are presented. The data obtained will enable more detailed studies on the biosynthesis of this important component of coffee grain and contribute to a better understanding of some functional

  6. Mmi1 RNA surveillance machinery directs RNAi complex RITS to specific meiotic genes in fission yeast

    PubMed Central

    Hiriart, Edwige; Vavasseur, Aurélia; Touat-Todeschini, Leila; Yamashita, Akira; Gilquin, Benoit; Lambert, Emeline; Perot, Jonathan; Shichino, Yuichi; Nazaret, Nicolas; Boyault, Cyril; Lachuer, Joel; Perazza, Daniel; Yamamoto, Masayuki; Verdel, André

    2012-01-01

    RNA interference (RNAi) silences gene expression by acting both at the transcriptional and post-transcriptional levels in a broad range of eukaryotes. In the fission yeast Schizosaccharomyces pombe the RNA-Induced Transcriptional Silencing (RITS) RNAi complex mediates heterochromatin formation at non-coding and repetitive DNA. However, the targeting and role of RITS at other genomic regions, including protein-coding genes, remain unknown. Here we show that RITS localizes to specific meiotic genes and mRNAs. Remarkably, RITS is guided to these meiotic targets by the RNA-binding protein Mmi1 and its associated RNA surveillance machinery that together degrade selective meiotic mRNAs during vegetative growth. Upon sexual differentiation, RITS localization to the meiotic genes and mRNAs is lost. Large-scale identification of Mmi1 RNA targets reveals that RITS subunit Chp1 associates with the vast majority of them. In addition, loss of RNAi affects the effective repression of sexual differentiation mediated by the Mmi1 RNA surveillance machinery. These findings uncover a new mechanism for recruiting RNAi to specific meiotic genes and suggest that RNAi participates in the control of sexual differentiation in fission yeast. PMID:22522705

  7. Dual sgRNA-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis elegans.

    PubMed

    Chen, Xiangyang; Xu, Fei; Zhu, Chengming; Ji, Jiaojiao; Zhou, Xufei; Feng, Xuezhu; Guang, Shouhong

    2014-01-01

    The CRISPR RNA-guided Cas9 nuclease gene-targeting system has been successfully used for genome editing in a variety of organisms. Here, we report the use of dual sgRNA-guided Cas9 nuclease to generate knockout mutants of protein coding genes, noncoding genes, and repetitive sequences in C. elegans. Co-injection of C. elegans with dual sgRNAs results in the removal of the interval between two sgRNAs and the loss-of-function phenotype of targeted genes. We sought to determine how large an interval can be eliminated and found that at least a 24 kb chromosome segment can be deleted using this dual sgRNA/Cas9 strategy. The deletion of large chromosome segments facilitates mutant screening by PCR and agarose electrophoresis. Thus, the use of the CRISPR/Cas9 system in combination with dual sgRNAs provides a powerful platform with which to easily generate gene knockout mutants in C. elegans. Our data also suggest that encoding multiple sgRNA sequences into a single CRISPR array to simultaneously edit several sites within the genome may cause the off-target deletion of chromosome sequences. PMID:25531445

  8. Toward Improved Solar Irradiance Forecasts: Introduction of Post-Processing to Correct the Direct Normal Irradiance from the Weather Research and Forecasting Model

    NASA Astrophysics Data System (ADS)

    Kim, Chang Ki; Clarkson, Matthew

    2016-05-01

    Solar electricity production is highly dependent on atmospheric conditions. This study focuses on comparing model forecasts with observations for the period of May-December, 2011. The Weather Research and Forecasting model was run for two nested domains centered on Arizona in order to better capture the complex terrain driven dynamics of the region. The modeling performance from the simulation with the Global Forecast System model output as initial and boundary condition was better, with respect to both direct normal irradiance and global horizontal irradiance, than that with the North American Mesoscale model output. The observed aerosol optical depth is correlated with the water vapor, soil moisture and wind-blown dust and therefore, the aerosol optical depth is parameterized by the modeling outputs for these variables. The aerosol correction factor reduces the relative root mean square error from 12 to 6 %. In cases where dust was transported at high altitude, our algorithm did not correct the bias of direct normal irradiance.

  9. The GLABRA2 homeodomain protein directly regulates CESA5 and XTH17 gene expression in Arabidopsis roots.

    PubMed

    Tominaga-Wada, Rumi; Iwata, Mineko; Sugiyama, Junji; Kotake, Toshihisa; Ishida, Tetsuya; Yokoyama, Ryusuke; Nishitani, Kazuhiko; Okada, Kiyotaka; Wada, Takuji

    2009-11-01

    Arabidopsis root hair formation is determined by the patterning genes CAPRICE (CPC), GLABRA3 (GL3), WEREWOLF (WER) and GLABRA2 (GL2), but little is known about the later changes in cell wall material during root hair formation. A combined Fourier-transform infrared microspectroscopy-principal components analysis (FTIR-PCA) method was used to detect subtle differences in the cell wall material between wild-type and root hair mutants in Arabidopsis. Among several root hair mutants, only the gl2 mutation affected root cell wall polysaccharides. Five of the 10 genes encoding cellulose synthase (CESA1-10) and 4 of 33 xyloglucan endotransglucosylase (XTH1-33) genes in Arabidopsis are expressed in the root, but only CESA5 and XTH17 were affected by the gl2 mutation. The L1-box sequence located in the promoter region of these genes was recognized by the GL2 protein. These results indicate that GL2 directly regulates cell wall-related gene expression during root development. PMID:19619157

  10. Site-directed point mutations in embryonic stem cells: a gene-targeting tag-and-exchange strategy.

    PubMed Central

    Askew, G R; Doetschman, T; Lingrel, J B

    1993-01-01

    Sequential gene targeting was used to introduce point mutations into one alpha 2 isoform Na,K-ATPase homolog in mouse embryonic stem (ES) cells. In the first round of targeted replacement, the gene was tagged with selectable markers by insertion of a Neor/HSV-tk gene cassette, and this event was selected for by gain of neomycin (G418) resistance. In the second targeted replacement event, the tagged genomic sequence was exchanged with a vector consisting of homologous genomic sequences carrying five site-directed nucleotide substitutions. Embryonic stem cell clones modified by exchange with the mutation vector were selected for loss of the HSV-tk gene by resistance to ganciclovir. Candidate clones were further screened and identified by polymerase chain reaction and Southern blot analysis. By this strategy, the endogenous alpha 2 isoform Na,K-ATPase gene was altered to encode two other amino acids so that the enzyme is resistant to inhibition by cardiac glycosides while maintaining its transmembrane ion-pumping function. Since the initial tagging event and the subsequent mutation-exchange event are independent of one another, a tagged cell line can be used to generate a variety of mutant lines by exchange with various mutation vectors at the tagged locus. This method should be useful for testing specific mutations introduced into the genomes of tissue culture cells and animals and for developing animal models encompassing the mutational variability of known genetic disorders. Images PMID:8391633

  11. Different regulatory sequences control creatine kinase-M gene expression in directly injected skeletal and cardiac muscle.

    PubMed Central

    Vincent, C K; Gualberto, A; Patel, C V; Walsh, K

    1993-01-01

    Regulatory sequences of the M isozyme of the creatine kinase (MCK) gene have been extensively mapped in skeletal muscle, but little is known about the sequences that control cardiac-specific expression. The promoter and enhancer sequences required for MCK gene expression were assayed by the direct injection of plasmid DNA constructs into adult rat cardiac and skeletal muscle. A 700-nucleotide fragment containing the enhancer and promoter of the rabbit MCK gene activated the expression of a downstream reporter gene in both muscle tissues. Deletion of the enhancer significantly decreased expression in skeletal muscle but had no detectable effect on expression in cardiac muscle. Further deletions revealed a CArG sequence motif at position -179 within the promoter that was essential for cardiac-specific expression. The CArG element of the MCK promoter bound to the recombinant serum response factor and YY1, transcription factors which control expression from structurally similar elements in the skeletal actin and c-fos promoters. MCK-CArG-binding activities that were similar or identical to serum response factor and YY1 were also detected in extracts from adult cardiac muscle. These data suggest that the MCK gene is controlled by different regulatory programs in adult cardiac and skeletal muscle. Images PMID:8423791

  12. Nr2e3-directed transcriptional regulation of genes involved in photoreceptor development and cell-type specific phototransduction.

    PubMed

    Haider, Neena B; Mollema, Nissa; Gaule, Meghan; Yuan, Yang; Sachs, Andrew J; Nystuen, Arne M; Naggert, Jürgen K; Nishina, Patsy M

    2009-09-01

    The retinal transcription factor Nr2e3 plays a key role in photoreceptor development and function. In this study we examine gene expression in the retina of Nr2e3(rd7/rd7) mutants with respect to wild-type control mice, to identify genes that are misregulated and hence potentially function in the Nr2e3 transcriptional network. Quantitative candidate gene real time PCR and subtractive hybridization approaches were used to identify transcripts that were misregulated in Nr2e3(rd7/rd7) mice. Chromatin immunoprecipitation assays were then used to determine which of the misregulated transcripts were direct targets of NR2E3. We identified 24 potential targets of NR2E3. In the developing retina, NR2E3 targets transcription factors such as Ror1, Rorg, and the nuclear hormone receptors Nr1d1 and Nr2c1. In the mature retina NR2E3 targets several genes including the rod specific gene Gnb1 and cone specific genes blue opsin, and two of the cone transducin subunits, Gnat2 and Gnb3. In addition, we identified 5 novel transcripts that are targeted by NR2E3. While mislocalization of proteins between rods and cones was not observed, we did observe diminished concentration of GNB1 protein in adult Nr2e3(rd7/rd7) retinas. These studies identified novel transcriptional pathways that are potentially targeted by Nr2e3 in the retina and specifically demonstrate a novel role for NR2E3 in regulating genes involved in phototransduction. PMID:19379737

  13. Histidine-rich stabilized polyplexes for cMet-directed tumor-targeted gene transfer

    NASA Astrophysics Data System (ADS)

    Kos, Petra; Lächelt, Ulrich; Herrmann, Annika; Mickler, Frauke Martina; Döblinger, Markus; He, Dongsheng; Krhač Levačić, Ana; Morys, Stephan; Bräuchle, Christoph; Wagner, Ernst

    2015-03-01

    Overexpression of the hepatocyte growth factor receptor/c-Met proto oncogene on the surface of a variety of tumor cells gives an opportunity to specifically target cancerous tissues. Herein, we report the first use of c-Met as receptor for non-viral tumor-targeted gene delivery. Sequence-defined oligomers comprising the c-Met binding peptide ligand cMBP2 for targeting, a monodisperse polyethylene glycol (PEG) for polyplex surface shielding, and various cationic (oligoethanamino) amide cores containing terminal cysteines for redox-sensitive polyplex stabilization, were assembled by solid-phase supported syntheses. The resulting oligomers exhibited a greatly enhanced cellular uptake and gene transfer over non-targeted control sequences, confirming the efficacy and target-specificity of the formed polyplexes. Implementation of endosomal escape-promoting histidines in the cationic core was required for gene expression without additional endosomolytic agent. The histidine-enriched polyplexes demonstrated stability in serum as well as receptor-specific gene transfer in vivo upon intratumoral injection. The co-formulation with an analogous PEG-free cationic oligomer led to a further compaction of pDNA polyplexes with an obvious change of shape as demonstrated by transmission electron microscopy. Such compaction was critically required for efficient intravenous gene delivery which resulted in greatly enhanced, cMBP2 ligand-dependent gene expression in the distant tumor.Overexpression of the hepatocyte growth factor receptor/c-Met proto oncogene on the surface of a variety of tumor cells gives an opportunity to specifically target cancerous tissues. Herein, we report the first use of c-Met as receptor for non-viral tumor-targeted gene delivery. Sequence-defined oligomers comprising the c-Met binding peptide ligand cMBP2 for targeting, a monodisperse polyethylene glycol (PEG) for polyplex surface shielding, and various cationic (oligoethanamino) amide cores containing

  14. Identification of Genes Expressed in Premalignant Breast Disease by Microscopy-Directed Cloning

    NASA Astrophysics Data System (ADS)

    Jensen, Roy A.; Page, David L.; Holt, Jeffrey T.

    1994-09-01

    Histopathologic study of human breast biopsy samples has identified specific lesions which are associated with a high risk of development of invasive breast cancer. Presumably, these lesions (collectively termed premalignant breast disease) represent the earliest recognizable morphologic expression of fundamental molecular events that lead to the development of invasive breast cancer. To study molecular events underlying premalignant breast disease, we have developed a method for isolating RNA from histologically identified lesions from frozen human breast tissue. This method specifically obtains mRNA from breast epithelial cells and has identified three genes which are differentially expressed in premalignant breast epithelial lesions. One gene identified by this method is overexpressed in four of five noncomedo ductal carcinoma in situ lesions and appears to be the human homologue of the gene encoding the M2 subunit of ribonucleotide reductase, an enzyme involved in DNA synthesis.

  15. Gene-environment interactions and obesity: recent developments and future directions

    PubMed Central

    2015-01-01

    Obesity, a major public health concern, is a multifactorial disease caused by both environmental and genetic factors. Although recent genome-wide association studies have identified many loci related to obesity or body mass index, the identified variants explain only a small proportion of the heritability of obesity. Better understanding of the interplay between genetic and environmental factors is the basis for developing effective personalized obesity prevention and management strategies. This article reviews recent advances in identifying gene-environment interactions related to obesity and describes epidemiological designs and newly developed statistical approaches to characterizing and discovering gene-environment interactions on obesity risk. PMID:25951849

  16. Direct interaction between causative genes of DYT1 and DYT6 primary dystonia.

    PubMed

    Gavarini, Sophie; Cayrol, Corinne; Fuchs, Tania; Lyons, Natalia; Ehrlich, Michelle E; Girard, Jean-Philippe; Ozelius, Laurie J

    2010-10-01

    Primary dystonia is a movement disorder characterized by sustained muscle contractions and in which dystonia is the only or predominant clinical feature. TOR1A(DYT1) and the transcription factor THAP1(DYT6) are the only genes identified thus far for primary dystonia. Using electromobility shift assays and chromatin immunoprecipitation (ChIP) quantitative polymerase chain reaction (qPCR), we demonstrate a physical interaction between THAP1 and the TOR1A promoter that is abolished by pathophysiologic mutations. Our findings provide the first evidence that causative genes for primary dystonia intersect in a common pathway and raise the possibility of developing novel therapies targeting this pathway. PMID:20865765

  17. The Arabidopsis SKU5 gene encodes an extracellular glycosyl phosphatidylinositol-anchored glycoprotein involved in directional root growth

    NASA Technical Reports Server (NTRS)

    Sedbrook, John C.; Carroll, Kathleen L.; Hung, Kai F.; Masson, Patrick H.; Somerville, Chris R.

    2002-01-01

    To investigate how roots respond to directional cues, we characterized a T-DNA-tagged Arabidopsis mutant named sku5 in which the roots skewed and looped away from the normal downward direction of growth on inclined agar surfaces. sku5 roots and etiolated hypocotyls were slightly shorter than normal and exhibited a counterclockwise (left-handed) axial rotation bias. The surface-dependent skewing phenotype disappeared when the roots penetrated the agar surface, but the axial rotation defect persisted, revealing that these two directional growth processes are separable. The SKU5 gene belongs to a 19-member gene family designated SKS (SKU5 Similar) that is related structurally to the multiple-copper oxidases ascorbate oxidase and laccase. However, the SKS proteins lack several of the conserved copper binding motifs characteristic of copper oxidases, and no enzymatic function could be assigned to the SKU5 protein. Analysis of plants expressing SKU5 reporter constructs and protein gel blot analysis showed that SKU5 was expressed most strongly in expanding tissues. SKU5 was glycosylated and modified by glycosyl phosphatidylinositol and localized to both the plasma membrane and the cell wall. Our observations suggest that SKU5 affects two directional growth processes, possibly by participating in cell wall expansion.

  18. Computed Tomography-Guided Access to the Cisterna Chyli: Introduction of a Technique for Direct Lymphangiography to Evaluate and Treat Chylothorax

    SciTech Connect

    Schoellnast, Helmut; Maybody, Majid; Getrajdman, George I.; Bains, Manjit S.; Finley, David J.; Solomon, Stephen B.

    2011-02-15

    The purpose of this report is to introduce a technique of direct lymphangiography to enable chylothorax treatment. Using a hybrid computed tomography (CT) and fluoroscopy imaging system, a 21-gauge needle was placed under CT guidance into the cisterna chyli to allow contrast lymphangiography and CT lymphangiography in two patients with presumed postoperative chylothorax. Water-soluble contrast media injection demonstrated the thoracic duct anatomy in both patients. Further successful needle disruption of the cisterna chyli was performed in one patient to interrupt lymph flow and stop the chylous leak, with subsequent resolution of the chylothorax.

  19. Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...

  20. Gene--Environment Interplay and Delinquent Involvement: Evidence of Direct, Indirect, and Interactive Effects

    ERIC Educational Resources Information Center

    Beaver, Kevin M.; DeLisi, Matt; Wright, John Paul; Vaughn, Michael G.

    2009-01-01

    Behavioral genetic research has revealed that biogenic factors play a role in the development of antisocial behaviors. Much of this research has also explicated the way in which the environment and genes may combine to create different phenotypes. The authors draw heavily from this literature and use data from the National Longitudinal Study of…

  1. Direct transfer of transforming growth factor beta 1 gene into arteries stimulates fibrocellular hyperplasia.

    PubMed Central

    Nabel, E G; Shum, L; Pompili, V J; Yang, Z Y; San, H; Shu, H B; Liptay, S; Gold, L; Gordon, D; Derynck, R

    1993-01-01

    The arterial wall responds to thrombosis or mechanical injury through the induction of specific gene products that increase cellular proliferation and connective tissue formation. These changes result in intimal hyperplasia that is observed in restenosis and the early phases of atherosclerosis. Transforming growth factor beta 1 (TGF-beta 1) is a secreted multi-functional protein that plays an important role in embryonal development and in repair following tissue injury. However, the function of TGF-beta 1 in vascular cell growth in vivo has not been defined. In this report, we have evaluated the role of TGF-beta 1 in the pathophysiology of intimal and medial hyperplasia by gene transfer of an expression plasmid encoding active TGF-beta 1 into porcine arteries. Expression of TGF-beta 1 in normal arteries resulted in substantial extracellular matrix production accompanied by intimal and medial hyperplasia. Increased procollagen, collagen, and proteoglycan synthesis in the neointima was demonstrated by immunohistochemistry relative to control transfected arteries. Expression of TGF-beta 1 induced a distinctly different program of gene expression and biologic response from the platelet-derived growth factor B (PDGF B) gene: procollagen synthesis induced by TGF-beta 1 was greater, and cellular proliferation was less prominent. These findings show that TGF-beta 1 differentially modulates extracellular matrix production and cellular proliferation in the arterial wall in vivo and could play a reparative role in the response to arterial injury. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8248168

  2. Earth System Monitoring, Introduction

    NASA Astrophysics Data System (ADS)

    Orcutt, John

    This section provides sensing and data collection methodologies, as well as an understanding of Earth's climate parameters and natural and man-made phenomena, to support a scientific assessment of the Earth system as a whole, and its response to natural and human-induced changes. The coverage ranges from climate change factors and extreme weather and fires to oil spill tracking and volcanic eruptions. This serves as a basis to enable improved prediction and response to climate change, weather, and natural hazards as well as dissemination of the data and conclusions. The data collection systems include satellite remote sensing, aerial surveys, and land- and ocean-based monitoring stations. Our objective in this treatise is to provide a significant portion of the scientific and engineering basis of Earth system monitoring and to provide this in 17 detailed articles or chapters written at a level for use by university students through practicing professionals. The reader is also directed to the closely related sections on Ecological Systems, Introduction and also Climate Change Modeling Methodology, Introduction as well as Climate Change Remediation, Introduction to. For ease of use by students, each article begins with a glossary of terms, while at an average length of 25 print pages each, sufficient detail is presented for use by professionals in government, universities, and industries. The chapters are individually summarized below.

  3. Genes implicated in stem cell identity and temporal programme are directly targeted by Notch in neuroblast tumours

    PubMed Central

    Zacharioudaki, Evanthia; Housden, Benjamin E.; Garinis, George; Stojnic, Robert; Delidakis, Christos; Bray, Sarah J.

    2016-01-01

    Notch signalling is involved in a multitude of developmental decisions and its aberrant activation is linked to many diseases, including cancers. One example is the neural stem cell tumours that arise from constitutive Notch activity in Drosophila neuroblasts. To investigate how hyperactivation of Notch in larval neuroblasts leads to tumours, we combined results from profiling the upregulated mRNAs and mapping the regions bound by the core Notch pathway transcription factor Su(H). This identified 246 putative direct Notch targets. These genes were highly enriched for transcription factors and overlapped significantly with a previously identified regulatory programme dependent on the proneural transcription factor Asense. Included were genes associated with the neuroblast maintenance and self-renewal programme that we validated as Notch regulated in vivo. Another group were the so-called temporal transcription factors, which have been implicated in neuroblast maturation. Normally expressed in specific time windows, several temporal transcription factors were ectopically expressed in the stem cell tumours, suggesting that Notch had reprogrammed their normal temporal regulation. Indeed, the Notch-induced hyperplasia was reduced by mutations affecting two of the temporal factors, which, conversely, were sufficient to induce mild hyperplasia on their own. Altogether, the results suggest that Notch induces neuroblast tumours by directly promoting the expression of genes that contribute to stem cell identity and by reprogramming the expression of factors that could regulate maturity. PMID:26657768

  4. The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element

    PubMed Central

    Cichocki, Frank; Hanson, Rebecca J.; Lenvik, Todd; Pitt, Michelle; McCullar, Valarie; Li, Hongchuan; Anderson, Stephen K.

    2009-01-01

    The killer cell immunoglobulin-like receptor (KIR) repertoire of natural killer (NK) cells determines their ability to detect infected or transformed target cells. Although epigenetic mechanisms play a role in KIR gene expression, work in the mouse suggests that other regulatory elements may be involved at specific stages of NK-cell development. Here we report the effects of the transcription factor c-Myc on KIR expression. c-Myc directly binds to, and promotes transcription from, a distal element identified upstream of most KIR genes. Binding of endogenous c-Myc to the distal promoter element is significantly enhanced upon interleukin-15 (IL-15) stimulation in peripheral blood NK cells and correlates with an increase in KIR transcription. In addition, the overexpression of c-Myc during NK-cell development promotes transcription from the distal promoter element and contributes to the overall transcription of multiple KIR genes. Our data demonstrate the significance of the 5′ promoter element upstream of the conventional KIR promoter region and support a model whereby IL-15 stimulates c-Myc binding at the distal KIR promoter during NK-cell development to promote KIR transcription. This finding provides a direct link between NK-cell activation signals and KIR expression required for acquisition of effector function during NK-cell education. PMID:18987359

  5. Efficient dual sgRNA-directed large gene deletion in rabbit with CRISPR/Cas9 system.

    PubMed

    Song, Yuning; Yuan, Lin; Wang, Yong; Chen, Mao; Deng, Jichao; Lv, Qingyan; Sui, Tingting; Li, Zhanjun; Lai, Liangxue

    2016-08-01

    The CRISPR RNA-guided Cas9 nuclease gene-targeting system has been extensively used to edit the genome of several organisms. However, most mutations reported to date have been are indels, resulting in multiple mutations and numerous alleles in targeted genes. In the present study, a large deletion of 105 kb in the TYR (tyrosinase) gene was generated in rabbit via a dual sgRNA-directed CRISPR/Cas9 system. The typical symptoms of albinism accompanied significantly decreased expression of TYR in the TYR knockout rabbits. Furthermore, the same genotype and albinism phenotype were found in the F1 generation, suggesting that large-fragment deletions can be efficiently transmitted to the germline and stably inherited in offspring. Taken together, our data demonstrate that mono and biallelic large deletions can be achieved using the dual sgRNA-directed CRISPR/Cas9 system. This system produces no mosaic mutations or off-target effects, making it an efficient tool for large-fragment deletions in rabbit and other organisms. PMID:26817461

  6. Tobamovirus-resistant tobacco generated by RNA interference directed against host genes.

    PubMed

    Asano, Momoko; Satoh, Rena; Mochizuki, Atsuko; Tsuda, Shinya; Yamanaka, Takuya; Nishiguchi, Masamichi; Hirai, Katsuyuki; Meshi, Tetsuo; Naito, Satoshi; Ishikawa, Masayuki

    2005-08-15

    Two homologous Nicotiana tabacum genes NtTOM1 and NtTOM3 have been identified. These genes encode polypeptides with amino acid sequence similarity to Arabidopsis thaliana TOM1 and TOM3, which function in parallel to support tobamovirus multiplication. Simultaneous RNA interference against NtTOM1 and NtTOM3 in N. tabacum resulted in nearly complete inhibition of the multiplication of Tomato mosaic virus and other tobamoviruses, but did not affect plant growth or the ability of Cucumber mosaic virus to multiply. As TOM1 and TOM3 homologues are present in a variety of plant species, their inhibition via RNA interference should constitute a useful method for generating tobamovirus-resistant plants. PMID:16081069

  7. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids.

    PubMed

    Kim, Ki-Hyun; Nielsen, Peter E; Glazer, Peter M

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable to form pcPNA-pcPNA duplexes but can bind to complementary DNA sequences by Watson-Crick pairing via double duplex-invasion complex formation. We show that psoralen-conjugated pcPNAs can deliver site-specific photoadducts and mediate targeted gene modification within both episomal and chromosomal DNA in mammalian cells without detectable off-target effects. Most of the induced psoralen-pcPNA mutations were single-base substitutions and deletions at the predicted pcPNA-binding sites. The pcPNA-directed mutagenesis was found to be dependent on PNA concentration and UVA dose and required matched pairs of pcPNAs. Neither of the individual pcPNAs alone had any effect nor did complementary PNA pairs of the same sequence. These results identify pcPNAs as new tools for site-specific gene modification in mammalian cells without purine sequence restriction, thereby providing a general strategy for designing gene targeting molecules. PMID:17977869

  8. The Level of AdpA Directly Affects Expression of Developmental Genes in Streptomyces coelicolor ▿ †

    PubMed Central

    Wolański, Marcin; Donczew, Rafał; Kois-Ostrowska, Agnieszka; Masiewicz, Paweł; Jakimowicz, Dagmara; Zakrzewska-Czerwińska, Jolanta

    2011-01-01

    AdpA is a key regulator of morphological differentiation in Streptomyces. In contrast to Streptomyces griseus, relatively little is known about AdpA protein functions in Streptomyces coelicolor. Here, we report for the first time the translation accumulation profile of the S. coelicolor adpA (adpASc) gene; the level of S. coelicolor AdpA (AdpASc) increased, reaching a maximum in the early stage of aerial mycelium formation (after 36 h), and remained relatively stable for the next several hours (48 to 60 h), and then the signal intensity decreased considerably. AdpASc specifically binds the adpASc promoter region in vitro and in vivo, suggesting that its expression is autoregulated; surprisingly, in contrast to S. griseus, the protein presumably acts as a transcriptional activator. We also demonstrate a direct influence of AdpASc on the expression of several genes whose products play key roles in the differentiation of S. coelicolor: STI, a protease inhibitor; RamR, an atypical response regulator that itself activates expression of the genes for a small modified peptide that is required for aerial growth; and ClpP1, an ATP-dependent protease. The diverse influence of AdpASc protein on the expression of the analyzed genes presumably results mainly from different affinities of AdpASc protein to individual promoters. PMID:21926228

  9. Linkage approach and direct COL4A5 gene mutation screening in Alport syndrome

    SciTech Connect

    Turco, A.E.; Rossetti, S.; Biasi, O.

    1994-09-01

    Alport Syndrome (AS) is transmitted as an X-linked dominant trait in the majority of families, the defective gene being COL4A5 at Xq22. In the remaining cases AS appears to be autosomally inherited. Recently, mutations in COL4A3 and COL4A4 genes at 2q35-q37 were identified in families with autosomal recessive AS. Mutation detection screening is being performed by non-radioactive single stand conformation polymorphism (SSCP), heteroduplex analysis, and automated DNA sequencing in over 170 AS patients enrolled in the ongoing Italian Multicenter Study on AS. So far twenty-five different mutations have been found, including missense, splicing, and frameshifts. Moreover, by using six tightly linked COL4A5 informative makers, we have also typed two larger AS families, and have shown compatible sex-linked transmission in one other, suggesting autosomal recessive inheritance. In this latter three-generation COL4A5-unlinked family we are now looking for linkage and for mutations in the candidate COL4A3 and COL4A4 genes on chromosome 2q.

  10. Plant cell-directed control of virion sense gene expression in wheat dwarf virus.

    PubMed

    Gooding, P S; Batty, N P; Goldsbrough, A P; Mullineaux, P M

    1999-04-01

    We have used particle bombardment (biolistics) to deliver replication-competent wheat dwarf virus (WDV)-based constructs, carrying reporter gene sequences fused to the virion sense promoter (Pv) or the CaMV 35S promoter, to suspension culture cells and immature zygotic embryos of wheat. While the replication of WDV double-stranded DNA forms (replicons) was equivalent between wheat suspension culture cells and embryos, GUS reporter gene activity was 20-40 times higher in the embryo cultures. Maximum expression of WDV replicons occurred in the embryonic axis tissue of wheat embryos but their expression in suspension cells was compromised, compared with transiently maintained input plasmid DNA containing the same sequences. From these studies, we propose that WDV replicons are subject to a host cell-controlled competency for virion sense transcription. The term competency is used to distinguish between the phenomenon described here and control of gene expression by specific transcription factors. Control of competency is independent of Pv, the replacement 35S promoter and of the complementary sense control of virion sense expression involving specific sequences in Pv. We propose that factors controlling the competency for replicon expression may be present in cells which, as well as maintaining high rates of DNA synthesis, are totipotent. Cell type control of active chromatin, methylation of specific sequences in WDV minichromosomes and/or interaction of virus-encoded proteins with specific host factors are considered as possible mechanisms. PMID:10076003

  11. Identification of genes directly regulated by the oncogene ZNF217using ChIP-chip assays.

    SciTech Connect

    Krig, S.R.; Jin, V.X.; Bieda, M.C.; O'geen, H.; Yaswen, P.; Green, R.; Farnham, P.J.

    2007-01-26

    It has been proposed that ZNF217, which is amplified at 20q13 in various tumors, plays a key role during neoplastic transformation. ZNF217 has been purified in complexes that contain repressor proteins such as CtBP2, suggesting that it acts as a transcriptional repressor. However, the function of ZNF217 has not been well characterized due to a lack of known target genes. Using a global chromatin immunoprecipitation (ChIP)-chip approach, we identified thousands of ZNF217 binding sites in three tumor cell lines (MCF7, SW480, and Ntera2). Further analysis of ZNF217 in Ntera2 cells showed that many promoters are bound by ZNF217 and CtBP2 and that a subset of these promoters are activated upon removal of ZNF217. Thus, our in vivo studies corroborate the in vitro biochemical analyses of ZNF217-containing complexes and support the hypothesis that ZNF217 functions as a transcriptional repressor. Gene ontology analysis showed that ZNF217 targets in Ntera2 cells are involved in organ development, suggesting that one function of ZNF217 may be to repress differentiation. Accordingly we show that differentiation of Ntera2 cells with retinoic acid led to down-regulation of ZNF217. Our identification of thousands of ZNF217 target genes will enable further studies of the consequences of aberrant expression of ZNF217 during neoplastic transformation.

  12. A micro-fluidic sub-microliter sample introduction system for direct analysis of Chinese rice wine by inductively coupled plasma mass spectrometry using external aqueous calibration

    NASA Astrophysics Data System (ADS)

    Cheng, Heyong; Liu, Jinhua; Xu, Zigang; Yin, Xuefeng

    2012-07-01

    A microfluidic sub-microliter sample introducing system was developed for direct analysis of Chinese rice wine by inductively coupled plasma mass spectrometry (ICP-MS). It consisted of a microfluidic chip integrating variable-volume sampling channels (0.1-0.8 μL), an eight-way multi-functional valve used in flow injection analysis (FIA), a syringe pump and a peristaltic pump of the Ar ICP-MS instrument. Three solutions, i.e., 15, 40 and 100 g L- 1 glucose in 20% ethanol were used to simulate Chinese rice wine of the dry type, the semidry type and the semisweet type, each. The effects of their volume introduced into ICP-MS on the plasma stability and ICP-MS intensities were studied. The experimental results showed that neither alteration of plasma stability nor carbon deposition was observed when the sampling volume of 20% ethanol containing 100 g L- 1 glucose was downscaled to 0.8 μL. Further reducing the sampling volume to 0.4 μL, no significant difference between the intensities of multi-element standard prepared in three simulated Chinese rice wine matrices and those in aqueous solution was observed. It indicated no negative effect of Chinese rice wine matrix on the ICP-MS intensities. A sampling volume of 0.4 μL was considered to be a good compromise between sensitivity and matrix effect. The flow rate of the carrier was chosen as 20 μL min- 1 for obtaining peaks with the highest peak height within the shortest time. Based on these observations, a microflow injection (μFI) method for the direct determination of cadmium and lead in Chinese rice wine by ICP-MS using an external aqueous calibration was developed. The sample throughput was 45 h- 1 with the detection limit of 19.8 and 10.4 ng L- 1 for Cd and Pb, respectively. The contents of Cd and Pb in 10 Chinese rice wine samples were measured. The results agreed well with those determined by ICP-MS with the conventional sampling system after microwave assisted digestion. The recoveries of three Chinese

  13. Workshop introduction

    SciTech Connect

    Streeper, Charles

    2010-01-01

    The Department of Energy's National Nuclear Security Administration's Global Threat Reduction Initiative (GTRI) has three subprograms that directly reduce the nuclear/radiological threat; Convert (Highly Enriched Uranium), Protect (Facilities), and Remove (Materials). The primary mission of the Off-Site Source Recovery Project (OSRP) falls under the 'Remove' subset. The purpose of this workshop is to provide a venue for joint-technical collaboration between the OSRP and the Nuclear Radiation Safety Service (NRSS). Eisenhower's Atoms for Peace initiative and the Soviet equivalent both promoted the spread of the paradoxical (peaceful and harmful) properties of the atom. The focus of nonproliferation efforts has been rightly dedicated to fissile materials and the threat they pose. Continued emphasis on radioactive materials must also be encouraged. An unquantifiable threat still exists in the prolific quantity of sealed radioactive sources (sources) spread worldwide. It does not appear that the momentum of the evolution in the numerous beneficial applications of radioactive sources will subside in the near future. Numerous expert studies have demonstrated the potentially devastating economic and psychological impacts of terrorist use of a radiological dispersal or emitting device. The development of such a weapon, from the acquisition of the material to the technical knowledge needed to develop and use it, is straightforward. There are many documented accounts worldwide of accidental and purposeful diversions of radioactive materials from regulatory control. The burden of securing sealed sources often falls upon the source owner, who may not have a disposal pathway once the source reaches the end of its useful life. This disposal problem is exacerbated by some source owners not having the resources to safely and compliantly store them. US Nuclear Regulatory Commission (NRC) data suggests that, in the US alone, there are tens of thousands of high-activity (IAEA

  14. Direct determination of arsenic and antimony in naphtha by electrothermal atomic absorption spectrometry with microemulsion sample introduction and iridium permanent modifier.

    PubMed

    Cassella, Ricardo J; Barbosa, Bruno Alberto R S; Santelli, Ricardo E; Rangel, Alessandra T

    2004-05-01

    This paper reports the determination of arsenic and antimony in naphtha by employing electrothermal atomic absorption spectrometry (ETAAS) as the analytical technique. In order to promote the direct determination of the analytes in the very volatile naphtha, the formation of a microemulsion with different surfactants (Triton X-100 and Brij-35) and different chemical modification strategies were tested. The results indicated that Triton X-100 is the best emulsification agent for naphtha in both As and Sb determination when it is employed at a concentration of 1% w/v in the microemulsion. Under these conditions, the microemulsion was stabile for at least 2 h. By using Brij-35 it was possible to achieve good stability only in the first 15 min. Among all chemical modification approaches investigated (Ir permanent modifier, W-Ir permanent modifier, and Pd modifier), the Ir permanent modifier provided better sensitivity for both analytes and allowed a higher pyrolysis temperature, which decreased the background signals at lower levels. Under the best conditions established in this work, an RSD of 4.6% (20 microg L(-1)) and a detection limit of 2.7 microg L(-1) were observed for arsenic. For antimony, an RSD of 4.0% (20 microg L(-1)) and a detection limit of 2.5 microg L(-1) were obtained. The accuracy of the procedure was assessed by analyzing spiked samples of naphtha from different origins. PMID:14985916

  15. Targeted insertions of two exogenous collagen genes into both alleles of their endogenous loci in cultured human cells: the insertions are directed by relatively short fragments containing the promoters and the 5' ends of the genes.

    PubMed Central

    Ganguly, A; Smelt, S; Mewar, R; Fertala, A; Sieron, A L; Overhauser, J; Prockop, D J

    1994-01-01

    Previous studies demonstrated that type II procollagen is synthesized by HT-1080 cells that are stably transfected with constructs of the human COL2A1 gene that contain the promoter and 5' end of either the COL2A1 gene or the human COL1A1 gene. Since the host HT-1080 cells were from a human tumor line that synthesizes type IV collagen but not type II or type I procollagen, the results suggested that the constructs were integrated near active enhancers or promoters. Here, however, we demonstrate that a 33-kb construct of the COL2A1 gene containing a 5' fragment from the same gene was inserted into both alleles of the endogenous COL2A1 gene on chromosome 12, apparently by homologous recombination by a nonconservative pathway. In contrast, a similar construct of the COL2A1 gene in which the 5' end was replaced with a 1.9-kb fragment from the 5' end of the COL1A1 gene was inserted into both alleles of the locus for the COL1A1 gene on chromosome 17. Therefore, targeted insertion of the gene construct was not directed by the degree of sequence homology. Instead, it was directed by the relatively short 5' fragment from the COL1A1 gene that contained the promoter and the initially transcribed sequences of the gene. After insertion, both gene constructs were expressed from previously inactive loci. Images PMID:8041796

  16. A MADS-box gene NtSVP regulates pedicel elongation by directly suppressing a KNAT1-like KNOX gene NtBPL in tobacco (Nicotiana tabacum L.)

    PubMed Central

    Wang, Di; Chen, Xiaobo; Zhang, Zenglin; Liu, Danmei; Song, Gaoyuan; Kong, Xingchen; Geng, Shuaifeng; Yang, Jiayue; Wang, Bingnan; Wu, Liang; Li, Aili; Mao, Long

    2015-01-01

    Optimal inflorescence architecture is important for plant reproductive success by affecting the ultimate number of flowers that set fruits and for plant competitiveness when interacting with biotic or abiotic conditions. The pedicel is one of the key contributors to inflorescence architecture diversity. To date, knowledge about the molecular mechanisms of pedicel development is derived from Arabidopsis. Not much is known regarding other plants. Here, an SVP family MADS-box gene, NtSVP, in tobacco (Nicotiana tabacum) that is required for pedicel elongation was identified. It is shown that knockdown of NtSVP by RNA interference (RNAi) caused elongated pedicels, while overexpression resulted in compact inflorescences with much shortened pedicels. Moreover, an Arabidopsis BREVIPEDECELLUS/KNAT1 homologue NtBP-Like (NtBPL) was significantly up-regulated in NtSVP-RNAi plants. Disruption of NtBPL decreased pedicel lengths and shortened cortex cells. Consistent with the presence of a CArG-box at the NtBPL promoter, the direct binding of NtSVP to the NtBPL promoter was demonstrated by yeast one-hybrid assay, electrophoretic mobility shift assay, and dual-luciferase assay, in which NtSVP may act as a repressor of NtBPL. Microarray analysis showed that down-regulation of NtBPL resulted in differential expression of genes associated with a number of hormone biogenesis and signalling genes such as those for auxin and gibberellin. These findings together suggest the function of a MADS-box transcription factor in plant pedicel development, probably via negative regulation of a BP-like class I KNOX gene. The present work thus postulates the conservation and divergence of the molecular regulatory pathways underlying the development of plant inflorescence architecture. PMID:26175352

  17. A MADS-box gene NtSVP regulates pedicel elongation by directly suppressing a KNAT1-like KNOX gene NtBPL in tobacco (Nicotiana tabacum L.).

    PubMed

    Wang, Di; Chen, Xiaobo; Zhang, Zenglin; Liu, Danmei; Song, Gaoyuan; Kong, Xingchen; Geng, Shuaifeng; Yang, Jiayue; Wang, Bingnan; Wu, Liang; Li, Aili; Mao, Long

    2015-10-01

    Optimal inflorescence architecture is important for plant reproductive success by affecting the ultimate number of flowers that set fruits and for plant competitiveness when interacting with biotic or abiotic conditions. The pedicel is one of the key contributors to inflorescence architecture diversity. To date, knowledge about the molecular mechanisms of pedicel development is derived from Arabidopsis. Not much is known regarding other plants. Here, an SVP family MADS-box gene, NtSVP, in tobacco (Nicotiana tabacum) that is required for pedicel elongation was identified. It is shown that knockdown of NtSVP by RNA interference (RNAi) caused elongated pedicels, while overexpression resulted in compact inflorescences with much shortened pedicels. Moreover, an Arabidopsis BREVIPEDECELLUS/KNAT1 homologue NtBP-Like (NtBPL) was significantly up-regulated in NtSVP-RNAi plants. Disruption of NtBPL decreased pedicel lengths and shortened cortex cells. Consistent with the presence of a CArG-box at the NtBPL promoter, the direct binding of NtSVP to the NtBPL promoter was demonstrated by yeast one-hybrid assay, electrophoretic mobility shift assay, and dual-luciferase assay, in which NtSVP may act as a repressor of NtBPL. Microarray analysis showed that down-regulation of NtBPL resulted in differential expression of genes associated with a number of hormone biogenesis and signalling genes such as those for auxin and gibberellin. These findings together suggest the function of a MADS-box transcription factor in plant pedicel development, probably via negative regulation of a BP-like class I KNOX gene. The present work thus postulates the conservation and divergence of the molecular regulatory pathways underlying the development of plant inflorescence architecture. PMID:26175352

  18. Scavenger Chemokine (CXC Motif) Receptor 7 (CXCR7) Is a Direct Target Gene of HIC1 (Hypermethylated in Cancer 1)*

    PubMed Central

    Van Rechem, Capucine; Rood, Brian R.; Touka, Majid; Pinte, Sébastien; Jenal, Mathias; Guérardel, Cateline; Ramsey, Keri; Monté, Didier; Bégue, Agnès; Tschan, Mario P.; Stephan, Dietrich A.; Leprince, Dominique

    2009-01-01

    The tumor suppressor gene HIC1 (Hypermethylated in Cancer 1) that is epigenetically silenced in many human tumors and is essential for mammalian development encodes a sequence-specific transcriptional repressor. The few genes that have been reported to be directly regulated by HIC1 include ATOH1, FGFBP1, SIRT1, and E2F1. HIC1 is thus involved in the complex regulatory loops modulating p53-dependent and E2F1-dependent cell survival and stress responses. We performed genome-wide expression profiling analyses to identify new HIC1 target genes, using HIC1-deficient U2OS human osteosarcoma cells infected with adenoviruses expressing either HIC1 or GFP as a negative control. These studies identified several putative direct target genes, including CXCR7, a G-protein-coupled receptor recently identified as a scavenger receptor for the chemokine SDF-1/CXCL12. CXCR7 is highly expressed in human breast, lung, and prostate cancers. Using quantitative reverse transcription-PCR analyses, we demonstrated that CXCR7 was repressed in U2OS cells overexpressing HIC1. Inversely, inactivation of endogenous HIC1 by RNA interference in normal human WI38 fibroblasts results in up-regulation of CXCR7 and SIRT1. In silico analyses followed by deletion studies and luciferase reporter assays identified a functional and phylogenetically conserved HIC1-responsive element in the human CXCR7 promoter. Moreover, chromatin immunoprecipitation (ChIP) and ChIP upon ChIP experiments demonstrated that endogenous HIC1 proteins are bound together with the C-terminal binding protein corepressor to the CXCR7 and SIRT1 promoters in WI38 cells. Taken together, our results implicate the tumor suppressor HIC1 in the transcriptional regulation of the chemokine receptor CXCR7, a key player in the promotion of tumorigenesis in a wide variety of cell types. PMID:19525223

  19. Direct sample introduction of wines in graphite furnace atomic absorption spectrometry for the simultaneous determination of arsenic, cadmium, copper and lead content.

    PubMed

    Ajtony, Zsolt; Szoboszlai, Norbert; Suskó, Emoke Klaudia; Mezei, Pál; György, Krisztina; Bencs, László

    2008-07-30

    A multi-element graphite furnace atomic absorption spectrometry (GFAAS) method was elaborated for the simultaneous determination of As, Cd, Cu, and Pb in wine samples of various sugar contents using the transversally heated graphite atomizer (THGA) with end-capped tubes and integrated graphite platforms (IGPs). For comparative GFAAS analyses, direct injection (i.e., dispensing the sample onto the IGP) and digestion-based (i.e., adding oxidizing agents, such as HNO(3) and/or H(2)O(2) to the sample solutions) methods were optimized with the application of chemical modifiers. The mixture of 5 microg Pd (applied as nitrate) plus 3 microg Mg(NO(3))(2) chemical modifier was proven to be optimal for the present set of analytes and matrix, it allowing the optimal 600 degrees C pyrolysis and 2200 degrees C atomization temperatures, respectively. The IGP of the THGA was pre-heated at 70 degrees C to prevent the sputtering and/or foaming of sample solutions with a high organic content, dispensed together with the modifier solution, which method also improved the reproducibility of the determinations. With the digestion-based method, the recovery ranged between 87 and 122%, while with the direct injection method it was between 96 and 102% for Cd, Cu, and Pb, whereas a lower, compromise recovery of 45-85% was realized for As. The detection limits (LODs) were found to be 5.0, 0.03, 1.2, and 0.8 microg l(-1) for As, Cd, Cu, and Pb, respectively. The characteristic mass (m(0)) data were 24 pg As, 1.3 pg Cd, 13 pg Cu, and 35 pg Pb. The upper limits of the linear calibration range were 100, 2, 100, and 200 microg l(-1) for As, Cd, Cu, and Pb, respectively. The precisions were not worse than 4.8, 3.1, 3.7, and 2.3% for As, Cd, Cu, and Pb, respectively. For arsenic, a higher amount of the modifier (e.g., 20 microg Pd plus 12 microg Mg(NO(3))(2)) could be recommended to overcome the interference from the presence of sulphate and phosphate in wines. Although this method increased the

  20. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

    PubMed

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

    2014-01-01

    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction. PMID:25717364

  1. Direct and indirect effects of H-NS and Fis on global gene expression control in Escherichia coli

    PubMed Central

    Kahramanoglou, Christina; Seshasayee, Aswin S. N.; Prieto, Ana I.; Ibberson, David; Schmidt, Sabine; Zimmermann, Jurgen; Benes, Vladimir; Fraser, Gillian M.

    2011-01-01

    Nucleoid-associated proteins (NAPs) are global regulators of gene expression in Escherichia coli, which affect DNA conformation by bending, wrapping and bridging the DNA. Two of these—H-NS and Fis—bind to specific DNA sequences and structures. Because of their importance to global gene expression, the binding of these NAPs to the DNA was previously investigated on a genome-wide scale using ChIP-chip. However, variation in their binding profiles across the growth phase and the genome-scale nature of their impact on gene expression remain poorly understood. Here, we present a genome-scale investigation of H-NS and Fis binding to the E. coli chromosome using chromatin immunoprecipitation combined with high-throughput sequencing (ChIP-seq). By performing our experiments under multiple time-points during growth in rich media, we show that the binding regions of the two proteins are mutually exclusive under our experimental conditions. H-NS binds to significantly longer tracts of DNA than Fis, consistent with the linear spread of H-NS binding from high- to surrounding lower-affinity sites; the length of binding regions is associated with the degree of transcriptional repression imposed by H-NS. For Fis, a majority of binding events do not lead to differential expression of the proximal gene; however, it has a significant indirect effect on gene expression partly through its effects on the expression of other transcription factors. We propose that direct transcriptional regulation by Fis is associated with the interaction of tandem arrays of Fis molecules to the DNA and possible DNA bending, particularly at operon-upstream regions. Our study serves as a proof-of-principle for the use of ChIP-seq for global DNA-binding proteins in bacteria, which should become significantly more economical and feasible with the development of multiplexing techniques. PMID:21097887

  2. Direct Detection of Soil mRNAs using Targeted Microarrays for Genes Associated with Lignin Degradation

    SciTech Connect

    Bailey, Vanessa L.; Fansler, Sarah J.; Bandyopadhyay, Somnath; Smith, Jeff L.; Waters, Katrina M.; Bolton, Harvey

    2010-07-04

    Microarrays have become established tools for describing microbial systems, however the assessment of expression profiles for environmental microbial communities still presents unique challenges. Notably, the concentration of particular transcripts are likely very dilute relative to the pool of total RNA, and PCR-based amplification strategies are vulnerable to amplification biases and the appropriate primer selection. Thus, we apply a signal amplification approach, rather than template amplification, to analyze the expression of genes encoding selected lignin-degrading enzymes in soil. Controls in the form of known amplicons and cDNA from Phanerochaete chrysosporium were included and mixed with the soil cDNA both before and after the signal amplification in order to assess the dynamic range of the microarray. We demonstrate that restored prairie soil expresses a diverse range of genes encoding lignin-degrading enzymes following incubation with lignin substrate, while farmed agricultural soil does not. The mixed additions of control cDNA with soil cDNA does interfere with detection of the low abundance transcripts, nevertheless this microarray approach consistently reports the higher-abundance transcripts which present more robust signals.

  3. Hydroxymethylation at Gene Regulatory Regions Directs Stem/Early Progenitor Cell Commitment during Erythropoiesis

    PubMed Central

    Vasanthakumar, Aparna; Sundaravel, Sriram; Caces, Donne Bennett D.; Looney, Timothy J.; Zhang, Li; Lepore, Janet B.; Macrae, Trisha; Duszynski, Robert; Shih, Alan H.; Song, Chun-Xiao; Yu, Miao; Yu, Yiting; Grossman, Robert; Raumann, Brigitte; Verma, Amit; He, Chuan; Levine, Ross L.; Lavelle, Don; Lahn, Bruce T.; Wickrema, Amittha; Godley, Lucy A.

    2014-01-01

    SUMMARY Hematopoietic stem cell differentiation involves the silencing of self-renewal genes and induction of a specific transcriptional program. Identification of multiple covalent cytosine modifications raises the question of how these derivatized bases influence stem cell commitment. Using a replicative primary human hematopoietic stem/progenitor cell differentiation system, we demonstrate dynamic changes of 5-hydroxymethylcytosine (5-hmC) during stem cell commitment and differentiation to the erythroid line-age. Genomic loci that maintain or gain 5-hmC density throughout erythroid differentiation contain binding sites for erythroid transcription factors and several factors not previously recognized as erythroid-specific factors. The functional importance of 5-hmC was demonstrated by impaired erythroid differentiation, with augmentation of myeloid potential, and disrupted 5-hmC patterning in leukemia patient-derived CD34+ stem/early progenitor cells with TET methylcytosine dioxygenase 2 (TET2) mutations. Thus, chemical conjugation and affinity purification of 5-hmC-enriched sequences followed by sequencing serve as resources for deciphering functional implications for gene expression during stem cell commitment and differentiation along a particular lineage. PMID:24373966

  4. Direct visualization of the highly polymorphic RNU2 locus in proximity to the BRCA1 gene.

    PubMed

    Tessereau, Chloé; Buisson, Monique; Monnet, Nastasia; Imbert, Marine; Barjhoux, Laure; Schluth-Bolard, Caroline; Sanlaville, Damien; Conseiller, Emmanuel; Ceppi, Maurizio; Sinilnikova, Olga M; Mazoyer, Sylvie

    2013-01-01

    Although the breast cancer susceptibility gene BRCA1 is one of the most extensively characterized genetic loci, much less is known about its upstream variable number tandem repeat element, the RNU2 locus. RNU2 encodes the U2 small nuclear RNA, an essential splicing element, but this locus is missing from the human genome assembly due to the inherent difficulty in the assembly of repetitive sequences. To fill the gap between RNU2 and BRCA1, we have reconstructed the physical map of this region by re-examining genomic clone sequences of public databases, which allowed us to precisely localize the RNU2 array 124 kb telomeric to BRCA1. We measured by performing FISH analyses on combed DNA for the first time the exact number of repeats carried by each of the two alleles in 41 individuals and found a range of 6-82 copies and a level of heterozygosity of 98%. The precise localisation of the RNU2 locus in the genome reference assembly and the implementation of a new technical tool to study it will make the detailed exploration of this locus possible. This recently neglected macrosatellite could be valuable for evaluating the potential role of structural variations in disease due to its location next to a major cancer susceptibility gene. PMID:24146815

  5. Direct measurement of oligonucleotide binding stoichiometry of gene V protein by mass spectrometry.

    PubMed Central

    Cheng, X; Harms, A C; Goudreau, P N; Terwilliger, T C; Smith, R D

    1996-01-01

    The binding stoichiometry of gene V protein from bacteriophage f1 to several oligonucleotides was studied using electrospray ionization-mass spectrometry (ESI-MS). Using mild mass spectrometer interface conditions that preserve noncovalent associations in solution, gene V protein was observed as dimer ions from a 10 mM NH4OAc solution. Addition of oligonucleotides resulted in formation of protein-oligonucleotide complexes with stoichiometry of approximately four nucleotides (nt) per protein monomer. A 16-mer oligonucleotide gave predominantly a 4:1 (protein monomer: oligonucleotide) complex while oligonucleotides shorter than 15 nt showed stoichiometries of 2:1. Stoichiometries and relative binding constants for a mixture of oligonucleotides were readily measured using mass spectrometry. The binding stoichiometry of the protein with the 16-mer oligonucleotide was measured independently using size-exclusion chromatography and the results were consistent with the mass spectrometric data. These results demonstrate, for the first time, the observation and stoichiometric measurement of protein-oligonucleotide complexes using ESI-MS. The sensitivity and high resolution of ESI-MS should make it a useful too] in the study of protein-DNA interactions. PMID:8692937

  6. Interleukin-1 receptor antagonist delivered directly and by gene therapy inhibits matrix degradation in the intact degenerate human intervertebral disc: an in situ zymographic and gene therapy study

    PubMed Central

    Le Maitre, Christine L; Hoyland, Judith A; Freemont, Anthony J

    2007-01-01

    Data implicate IL-1 in the altered matrix biology that characterizes human intervertebral disc (IVD) degeneration. In the current study we investigated the enzymic mechanism by which IL-1 induces matrix degradation in degeneration of the human IVD, and whether the IL-1 inhibitor IL-1 receptor antagonist (IL-1Ra) will inhibit degradation. A combination of in situ zymography (ISZ) and immunohistochemistry was used to examine the effects of IL-1 and IL-1Ra on matrix degradation and metal-dependent protease (MDP) expression in explants of non-degenerate and degenerate human IVDs. ISZ employed three substrates (gelatin, collagen, casein) and different challenges (IL-1β, IL-1Ra and enzyme inhibitors). Immunohistochemistry was undertaken for MDPs. In addition, IL-1Ra was introduced into degenerate IVD explants using genetically engineered constructs. The novel findings from this study are: IL-1Ra delivered directly onto explants of degenerate IVDs eliminates matrix degradation as assessed by multi-substrate ISZ; there is a direct relationship between matrix degradation assessed by ISZ and MDP expression defined by immunohistochemistry; single injections of IVD cells engineered to over-express IL-1Ra significantly inhibit MDP expression for two weeks. Our findings show that IL-1 is a key cytokine driving matrix degradation in the degenerate IVD. Furthermore, IL-1Ra delivered directly or by gene therapy inhibits IVD matrix degradation. IL-1Ra could be used therapeutically to inhibit degeneration of the IVD. PMID:17760968

  7. Modulation of Enhancer Looping and Differential Gene Targeting by Epstein-Barr Virus Transcription Factors Directs Cellular Reprogramming

    PubMed Central

    McClellan, Michael J.; Wood, C. David; Ojeniyi, Opeoluwa; Cooper, Tim J.; Kanhere, Aditi; Arvey, Aaron; Webb, Helen M.; Palermo, Richard D.; Harth-Hertle, Marie L.; Kempkes, Bettina; Jenner, Richard G.; West, Michelle J.

    2013-01-01

    Epstein-Barr virus (EBV) epigenetically reprogrammes B-lymphocytes to drive immortalization and facilitate viral persistence. Host-cell transcription is perturbed principally through the actions of EBV EBNA 2, 3A, 3B and 3C, with cellular genes deregulated by specific combinations of these EBNAs through unknown mechanisms. Comparing human genome binding by these viral transcription factors, we discovered that 25% of binding sites were shared by EBNA 2 and the EBNA 3s and were located predominantly in enhancers. Moreover, 80% of potential EBNA 3A, 3B or 3C target genes were also targeted by EBNA 2, implicating extensive interplay between EBNA 2 and 3 proteins in cellular reprogramming. Investigating shared enhancer sites neighbouring two new targets (WEE1 and CTBP2) we discovered that EBNA 3 proteins repress transcription by modulating enhancer-promoter loop formation to establish repressive chromatin hubs or prevent assembly of active hubs. Re-ChIP analysis revealed that EBNA 2 and 3 proteins do not bind simultaneously at shared sites but compete for binding thereby modulating enhancer-promoter interactions. At an EBNA 3-only intergenic enhancer site between ADAM28 and ADAMDEC1 EBNA 3C was also able to independently direct epigenetic repression of both genes through enhancer-promoter looping. Significantly, studying shared or unique EBNA 3 binding sites at WEE1, CTBP2, ITGAL (LFA-1 alpha chain), BCL2L11 (Bim) and the ADAMs, we also discovered that different sets of EBNA 3 proteins bind regulatory elements in a gene and cell-type specific manner. Binding profiles correlated with the effects of individual EBNA 3 proteins on the expression of these genes, providing a molecular basis for the targeting of different sets of cellular genes by the EBNA 3s. Our results therefore highlight the influence of the genomic and cellular context in determining the specificity of gene deregulation by EBV and provide a paradigm for host-cell reprogramming through modulation of

  8. Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

    PubMed Central

    2010-01-01

    Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

  9. Genetic counseling for patients with nonsyndromic hearing impairment directed by gene analysis

    PubMed Central

    MA, DINGYUAN; ZHANG, JINGJING; LUO, CHUNYU; LIN, YING; JI, XIUQING; HU, PING; XU, ZHENGFENG

    2016-01-01

    The aim of the present study was to investigate the genetic etiology of patients with nonsyndromic hearing impairment through gene analysis, and provide accurate genetic counseling and prenatal diagnosis for deaf patients and families with deaf children. Previous molecular etiological studies have demonstrated that the most common molecular changes in Chinese patients with nonsyndromic hearing loss (NSHL) involved gap junction protein β 2, solute carrier family 26, member 4 (SLC26A4), and mitochondrial DNA 12S rRNA. A total of 117 unrelated NSHL patients were included. Mutation screening was performed by Sanger sequencing in GJB2, 12S rRNA, and the hot-spot regions of SLC26A4. In addition, patients with a single mutation of SLC26A4 in the hot-spot regions underwent complete exon sequencing to identify a mutation in the other allele. A total of 36 of the 117 deaf patients were confirmed to have two pathogenic mutations, which included 4 deaf couples, husband or wife in 11 deaf couples and 17 deaf individuals. In addition, prenatal diagnoses was performed in 7 pregnant women at 18–21 weeks gestation who had previously given birth to a deaf child, and the results showed that two fetal genotypes were the same as the proband's genotypes, four fetuses carried one pathogenic gene from their parents, and one fetus was identified to have no mutations. Taken together, the genetic testing of deaf patients can provide reasonable guidance to deaf patients and families with deaf children. PMID:26783197

  10. AP-1-directed human T cell leukemia virus type 1 viral gene expression during monocytic differentiation.

    PubMed

    Grant, Christian; Jain, Pooja; Nonnemacher, Michael; Flaig, Katherine E; Irish, Bryan; Ahuja, Jaya; Alexaki, Aikaterini; Alefantis, Timothy; Wigdahl, Brian

    2006-09-01

    Human T cell leukemia virus type 1 (HTLV-1) has previously been shown to infect antigen-presenting cells and their precursors in vivo. However, the role these important cell populations play in the pathogenesis of HTLV-1-associated myelopathy/tropical spastic paraparesis or adult T cell leukemia remains unresolved. To better understand how HTLV-1 infection of these important cell populations may potentially impact disease progression, the regulation of HTLV-1 viral gene expression in established monocytic cell lines was examined. U-937 promonocytic cells transiently transfected with a HTLV-1 long-terminal repeat (LTR) luciferase construct were treated with phorbol 12-myristate 13-acetate (PMA) to induce cellular differentiation. PMA-induced cellular differentiation resulted in activation of basal and Tax-mediated transactivation of the HTLV-1 LTR. In addition, electrophoretic mobility shift analyses demonstrated that PMA-induced cellular differentiation induced DNA-binding activity of cellular transcription factors to Tax-responsive element 1 (TRE-1) repeat II. Supershift analyses revealed that factors belonging to the activator protein 1 (AP-1) family of basic region/leucine zipper proteins (Fra-1, Fra-2, JunB, and JunD) were induced to bind to TRE-1 repeat II during cellular differentiation. Inhibition of AP-1 DNA-binding activity by overexpression of a dominant-negative c-Fos mutant (A-Fos) in transient expression analyses resulted in severely decreased levels of HTLV-1 LTR activation in PMA-induced U-937 cells. These results have suggested that following infection of peripheral blood monocytes, HTLV-1 viral gene expression may become up-regulated by AP-1 during differentiation into macrophages or dendritic cells. PMID:16829632

  11. Muscle segment homeobox genes direct embryonic diapause by limiting inflammation in the uterus

    SciTech Connect

    Cha, Jeeyeon; Burnum-Johnson, Kristin E.; Bartos, Amanda; Li, Yingju; Baker, Erin Shammel; Tilton, Susan C.; Webb-Robertson, Bobbie-Jo M.; Piehowski, Paul D.; Monroe, Matthew E.; Jegga, Anil; Murata, Shigeo; Hirota, Yasushi; Dey, Sudhansu K.

    2015-06-11

    Embryonic diapause (delayed implantation) is a reproductive strategy widespread in the animal kingdom. Under this condition, embryos at the blastocyst stage become dormant simultaneously with uterine quiescence until environmental or physiological conditions are favorable for the survival of the mother and newborn. Under favorable conditions, activation of the blastocyst and uterus ensues with implantation and progression of pregnancy. Although endocrine factors are known to participate in this process, the underlying molecular mechanism coordinating this phenomenon is not clearly understood. We recently found that uterine muscle segment homeobox (Msx) transcription factors are critical for the initiation and maintenance of delayed implantation in mice. To better understand why Msx genes are critical for delayed implantation, we compared uterine proteomics profiles between littermate floxed (Msx1/Msx2f/f) mice and mice with uterine deletion of Msx genes (Msx1/Msx2d/d) under delayed conditions. In Msx1/Msx2d/d uteri, pathways including protein translation, ubiquitin-proteasome system, inflammation, chaperone-mediated protein folding, and endoplasmic reticulum (ER) stress were enriched, and computational modeling showed intersection of these pathways on inflammatory responses. Indeed, increases in the ubiquitin-proteasome system and inflammation conformed to proteotoxic and ER stress in Msx1/Msx2d/d uteri under delayed conditions. Interestingly, treatment with a proteasome inhibitor bortezomib further exacerbated ER stress in Msx1/Msx2d/d uteri with aggravated inflammatory response, deteriorating rate of blastocyst recovery and failure to sustain delayed implantation. This study highlights a previously unrecognized role for Msx in preventing proteotoxic stress and inflammatory responses to coordinate embryo dormancy and uterine quiescence during embryonic diapause.

  12. Ultrasound directs a transposase system for durable hepatic gene delivery in mice.

    PubMed

    Anderson, Cynthia D; Urschitz, Johann; Khemmani, Mark; Owens, Jesse B; Moisyadi, Stefan; Shohet, Ralph V; Walton, Chad B

    2013-12-01

    Our aim was to evaluate the delivery of transposase-based vectors by ultrasound targeted microbubble destruction (UTMD) in mice. DNA vectors were attached to cationic lipid microbubbles (1-3 μm in diameter), injected intravenously and delivered to the liver by destruction of the carrier bubbles with ultrasound in burst mode at 1.0 MHz, 20-μs pulse duration, 10-Hz pulse repetition frequency and ∼1.3-MPa acoustic peak negative pressure. We evaluated the expression and genomic integration of conventional (pcDNA3) and piggyBac transposase-based (pmGENIE) reporter vectors. In vivo, we observed UTMD-mediated liver-specific expression of pmGENIE for an average of 24 d, compared with 4 d with pcDNA3. Reporter expression was located predominately near blood vessels initially, whereas expression after 3 d was more evenly distributed through the parenchyma of the liver. We confirmed random genomic integration for pmGENIE in vitro; however, integration events for pmGENIE in vivo were targeted to specific areas of chromosome 14. Our results suggest that a combination of UTMD and non-viral DNA transposase vectors can mediate weeks of hepatic-specific gene transfer in vivo, and analyses performed by non-restrictive linear amplification-mediated (nrLAM) polymerase chain reaction, cloning and sequencing identify an unexpected tropism for integration within a specific sequence on chromosome 14 in mice. UTMD delivery of transgenes may be useful for the treatment of hepatic gene deficiency disorders. PMID:24035623

  13. Nuclear gene silencing directs reception of long-distance mRNA silencing in Arabidopsis.

    PubMed

    Brosnan, C A; Mitter, N; Christie, M; Smith, N A; Waterhouse, P M; Carroll, B J

    2007-09-11

    In plants, silencing of mRNA can be transmitted from cell to cell and also over longer distances from roots to shoots. To investigate the long-distance mechanism, WT and mutant shoots were grafted onto roots silenced for an mRNA. We show that three genes involved in a chromatin silencing pathway, NRPD1a encoding RNA polymerase IVa, RNA-dependent RNA polymerase 2 (RDR2), and DICER-like 3 (DCL3), are required for reception of long-distance mRNA silencing in the shoot. A mutant representing a fourth gene in the pathway, argonaute4 (ago4), was also partially compromised in the reception of silencing. This pathway produces 24-nt siRNAs and resulted in decapped RNA, a known substrate for amplification of dsRNA by RDR6. Activation of silencing in grafted shoots depended on RDR6, but no 24-nt siRNAs were detected in mutant rdr6 shoots, indicating that RDR6 also plays a role in initial signal perception. After amplification of decapped transcripts, DCL4 and DCL2 act hierarchically as they do in antiviral resistance to produce 21- and 22-nt siRNAs, respectively, and these guide mRNA degradation. Several dcl genotypes were also tested for their capacity to transmit the mobile silencing signal from the rootstock. dcl1-8 and a dcl2 dcl3 dcl4 triple mutant are compromised in micro-RNA and siRNA biogenesis, respectively, but were unaffected in signal transmission. PMID:17785412

  14. Ultrasound directs a transposase system for durable hepatic gene delivery in mice

    PubMed Central

    Anderson, Cynthia D; Urschitz, Johann; Khemmani, Mark; Owens, Jesse B; Moisyadi, Stefan

    2013-01-01

    Our aim was to evaluate the delivery of transposase-based vectors by Ultrasound Targeted Microbubble Destruction (UTMD) in mice. DNA vectors were attached to cationic lipid microbubbles (1-3 μm in diameter), injected intravenously, and delivered to the liver by destruction of the carrier bubbles with ultrasound in burst mode at a 1.0 MHz, 20 μs pulse duration, 10 Hz pulse repetition frequency, and acoustic peak negative pressure of ~1.3 MPa. We evaluated the expression and genomic integration of conventional (pcDNA3) and piggyBac transposase-based (pmGENIE) reporter vectors. In vivo, we observed UTMD-mediated liver-specific expression of pmGENIE for an average of 24 days, compared to 4 days with pcDNA3. Reporter expression was predominately located in proximity to blood vessels initially, while expression after three days was more evenly distributed through the parenchyma of the liver. We confirmed random genomic integration for pmGENIE in vitro, however, integration events for pmGENIE in vivo were targeted to specific areas of chromosome 14. Our results suggest that a combination of UTMD with nonviral DNA transposase vectors can mediate weeks of hepatic-specific gene transfer in vivo, and analyses performed by non-restrictive linear amplification-mediated (nrLAM) PCR, cloning, and sequencing identify an unexpected tropism for integration within a specific sequence on chromosome 14 in mice. UTMD delivery of transgenes may be useful for the treatment of hepatic gene deficiency disorders. PMID:24035623

  15. Chromatinized protein kinase C-θ directly regulates inducible genes in epithelial to mesenchymal transition and breast cancer stem cells.

    PubMed

    Zafar, Anjum; Wu, Fan; Hardy, Kristine; Li, Jasmine; Tu, Wen Juan; McCuaig, Robert; Harris, Janelle; Khanna, Kum Kum; Attema, Joanne; Gregory, Philip A; Goodall, Gregory J; Harrington, Kirsti; Dahlstrom, Jane E; Boulding, Tara; Madden, Rebecca; Tan, Abel; Milburn, Peter J; Rao, Sudha

    2014-08-01

    Epithelial to mesenchymal transition (EMT) is activated during cancer invasion and metastasis, enriches for cancer stem cells (CSCs), and contributes to therapeutic resistance and disease recurrence. Signal transduction kinases play a pivotal role as chromatin-anchored proteins in eukaryotes. Here we report for the first time that protein kinase C-theta (PKC-θ) promotes EMT by acting as a critical chromatin-anchored switch for inducible genes via transforming growth factor β (TGF-β) and the key inflammatory regulatory protein NF-κB. Chromatinized PKC-θ exists as an active transcription complex and is required to establish a permissive chromatin state at signature EMT genes. Genome-wide analysis identifies a unique cohort of inducible PKC-θ-sensitive genes that are directly tethered to PKC-θ in the mesenchymal state. Collectively, we show that cross talk between signaling kinases and chromatin is critical for eliciting inducible transcriptional programs that drive mesenchymal differentiation and CSC formation, providing novel mechanisms to target using epigenetic therapy in breast cancer. PMID:24891615

  16. A direct comparison of next generation sequencing enrichment methods using an aortopathy gene panel- clinical diagnostics perspective

    PubMed Central

    2012-01-01

    Background Aortopathies are a group of disorders characterized by aneurysms, dilation, and tortuosity of the aorta. Because of the phenotypic overlap and genetic heterogeneity of diseases featuring aortopathy, molecular testing is often required for timely and correct diagnosis of affected individuals. In this setting next generation sequencing (NGS) offers several advantages over traditional molecular techniques. Methods The purpose of our study was to compare NGS enrichment methods for a clinical assay targeting the nine genes known to be associated with aortopathy. RainDance emulsion PCR and SureSelect RNA-bait hybridization capture enrichment methods were directly compared by enriching DNA from eight samples. Enriched samples were barcoded, pooled, and sequenced on the Illumina HiSeq2000 platform. Depth of coverage, consistency of coverage across samples, and the overlap of variants identified were assessed. This data was also compared to whole-exome sequencing data from ten individuals. Results Read depth was greater and less variable among samples that had been enriched using the RNA-bait hybridization capture enrichment method. In addition, samples enriched by hybridization capture had fewer exons with mean coverage less than 10, reducing the need for followup Sanger sequencing. Variants sets produced were 77% concordant, with both techniques yielding similar numbers of discordant variants. Conclusions When comparing the design flexibility, performance, and cost of the targeted enrichment methods to whole-exome sequencing, the RNA-bait hybridization capture enrichment gene panel offers the better solution for interrogating the aortopathy genes in a clinical laboratory setting. PMID:23148498

  17. Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells

    PubMed Central

    Zafar, Anjum; Wu, Fan; Hardy, Kristine; Li, Jasmine; Tu, Wen Juan; McCuaig, Robert; Harris, Janelle; Khanna, Kum Kum; Attema, Joanne; Gregory, Philip A.; Goodall, Gregory J.; Harrington, Kirsti; Dahlstrom, Jane E.; Boulding, Tara; Madden, Rebecca; Tan, Abel; Milburn, Peter J.

    2014-01-01

    Epithelial to mesenchymal transition (EMT) is activated during cancer invasion and metastasis, enriches for cancer stem cells (CSCs), and contributes to therapeutic resistance and disease recurrence. Signal transduction kinases play a pivotal role as chromatin-anchored proteins in eukaryotes. Here we report for the first time that protein kinase C-theta (PKC-θ) promotes EMT by acting as a critical chromatin-anchored switch for inducible genes via transforming growth factor β (TGF-β) and the key inflammatory regulatory protein NF-κB. Chromatinized PKC-θ exists as an active transcription complex and is required to establish a permissive chromatin state at signature EMT genes. Genome-wide analysis identifies a unique cohort of inducible PKC-θ-sensitive genes that are directly tethered to PKC-θ in the mesenchymal state. Collectively, we show that cross talk between signaling kinases and chromatin is critical for eliciting inducible transcriptional programs that drive mesenchymal differentiation and CSC formation, providing novel mechanisms to target using epigenetic therapy in breast cancer. PMID:24891615

  18. Targeted DNA methylation by homology-directed repair in mammalian cells. Transcription reshapes methylation on the repaired gene

    PubMed Central

    Morano, Annalisa; Angrisano, Tiziana; Russo, Giusi; Landi, Rosaria; Pezone, Antonio; Bartollino, Silvia; Zuchegna, Candida; Babbio, Federica; Bonapace, Ian Marc; Allen, Brittany; Muller, Mark T.; Chiariotti, Lorenzo; Gottesman, Max E.; Porcellini, Antonio; Avvedimento, Enrico V.

    2014-01-01

    We report that homology-directed repair of a DNA double-strand break within a single copy Green Fluorescent Protein (GFP) gene in HeLa cells alters the methylation pattern at the site of recombination. DNA methyl transferase (DNMT)1, DNMT3a and two proteins that regulate methylation, Np95 and GADD45A, are recruited to the site of repair and are responsible for selective methylation of the promoter-distal segment of the repaired DNA. The initial methylation pattern of the locus is modified in a transcription-dependent fashion during the 15–20 days following repair, at which time no further changes in the methylation pattern occur. The variation in DNA modification generates stable clones with wide ranges of GFP expression. Collectively, our data indicate that somatic DNA methylation follows homologous repair and is subjected to remodeling by local transcription in a discrete time window during and after the damage. We propose that DNA methylation of repaired genes represents a DNA damage code and is source of variation of gene expression. PMID:24137009

  19. The arcelin-5 gene of Phaseolus vulgaris directs high seed-specific expression in transgenic Phaseolus acutifolius and Arabidopsis plants.

    PubMed

    Goossens, A; Dillen, W; De Clercq, J; Van Montagu, M; Angenon, G

    1999-08-01

    The regulatory sequences of many genes encoding seed storage proteins have been used to drive seed-specific expression of a variety of proteins in transgenic plants. Because the levels at which these transgene-derived proteins accumulate are generally quite low, we investigated the utility of the arcelin-5 regulatory sequences in obtaining high seed-specific expression in transgenic plants. Arcelin-5 is an abundant seed protein found in some wild common bean (Phaseolus vulgaris L.) genotypes. Seeds of Arabidopsis and Tepary bean (Phaseolus acutifolius A. Gray) plants transformed with arcelin-5 gene constructs synthesized arcelin-5 to levels of 15% and 25% of the total protein content, respectively. To our knowledge, such high expression levels directed by a transgene have not been reported before. The transgenic plants also showed low plant-to-plant variation in arcelin expression. Complex transgene integration patterns, which often result in gene silencing effects, were not associated with reduced arcelin-5 expression. High transgene expression was the result of high mRNA steady-state levels and was restricted to seeds. This indicates that all requirements for high seed-specific expression are cis elements present in the cloned genomic arcelin-5 sequence and trans-acting factors that are available in Arabidopsis and Phaseolus spp., and thus probably in most dicotyledonous plants. PMID:10444093

  20. Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon activator.

    PubMed Central

    James, D W; Lim, E; Keller, J; Plooy, I; Ralston, E; Dooner, H K

    1995-01-01

    The FATTY ACID ELONGATION1 (FAE1) gene of Arabidopsis is required for the synthesis of very long chain fatty acids in the seed. The product of the FAE1 gene is presumed to be a condensing enzyme that extends the chain length of fatty acids from C18 to C20 and C22. We report here the cloning of FAE1 by directed transposon tagging with the maize element Activator (Ac). An unstable fae1 mutant was isolated in a line carrying Ac linked to the FAE1 locus on chromosome 4. Cosegregation and reversion analyses established that the new mutant was tagged by Ac. A DNA fragment flanking Ac was cloned by inverse polymerase chain reaction and used to isolate FAE1 genomic clones and a cDNA clone from a library made from immature siliques. The predicted amino acid sequence of the FAE1 protein shares homology with those of other condensing enzymes (chalcone synthase, stilbene synthases, and beta-ketoacyl-acyl carrier protein synthase III), supporting the notion that FAE1 is the structural gene for a synthase or condensing enzyme. FAE1 is expressed in developing seed, but not in leaves, as expected from the effect of the fae1 mutation on the fatty acid compositions of those tissues. PMID:7734965

  1. Detection of the thermostable direct hemolysin gene and related DNA sequences in Vibrio parahaemolyticus and other vibrio species by the DNA colony hybridization test.

    PubMed Central

    Nishibuchi, M; Ishibashi, M; Takeda, Y; Kaper, J B

    1985-01-01

    A specific gene probe for the Vibrio parahaemolyticus thermostable direct hemolysin gene was constructed and used to examine the presence or absence of the thermostable direct hemolysin gene or related DNA sequences in V. parahaemolyticus and other vibrios by the DNA colony hybridization method. The gene probe consisted of a 406-base-pair, completely internal fragment covering 71% of the structural gene with PstI linkers added to the ends. Six copies of this 415-base-pair PstI fragment were cloned into plasmid pBR322, which yielded large amounts of the probe DNA. One hundred forty-one V. parahaemolyticus strains were tested with the gene probe, and the results were compared with those of phenotypic assays for the thermostable direct hemolysin. All Kanagawa phenomenon-positive strains were gene positive. However, 86% of the strains that exhibited weak Kanagawa phenomenon and 16% of Kanagawa phenomenon-negative strains also reacted with the gene probe. Immunological methods for the detection of the thermostable direct hemolysin (modified Elek test, enzyme-linked immunosorbent assay) showed better correlation with gene probe results. All gene-positive strains produced hemolysin detectable in the enzyme-linked immunosorbent assay, although occasional strains showed weak reaction. The modified Elek test was slightly less sensitive than the enzyme-linked immunosorbent assay. All gene-negative strains were also negative in these immunological assays. One hundred twenty-one strains of Vibrio spp. other than V. parahaemolyticus were tested with the gene probe; only Vibrio hollisae strains reacted with the probe under stringent conditions. PMID:4030087

  2. MicroRNA-21 regulates T-cell apoptosis by directly targeting the tumor suppressor gene Tipe2

    PubMed Central

    Ruan, Q; Wang, P; Wang, T; Qi, J; Wei, M; Wang, S; Fan, T; Johnson, D; Wan, X; Shi, W; Sun, H; Chen, Y H

    2014-01-01

    MicroRNAs (MiRs) are short noncoding RNAs that can regulate gene expression. It has been reported that miR-21 suppresses apoptosis in activated T cells, but the molecular mechanism remains undefined. Tumor suppressor Tipe2 (or tumor necrosis factor-α-induced protein 8 (TNFAIP8)-like 2 (TNFAIP8L2)) is a newly identified anti-inflammatory protein of the TNFAIP8 family that is essential for maintaining immune homeostasis. We report here that miR-21 is a direct target of nuclear factor-κB and could regulate Tipe2 expression in a Tipe2 coding region-dependent manner. In activated T cells and macrophages, Tipe2 expression was markedly downregulated, whereas miR-21 expression was upregulated. Importantly, Tipe2-deficient T cells were significantly less sensitive to apoptosis. Conversely, overexpression of Tipe2 in EL-4 T cells increased their susceptibility to activation-induced apoptosis. Therefore, Tipe2 provides a molecular bridge between miR-21 and cell apoptosis; miR-21 suppresses apoptosis in activated T cells at least in part through directly targeting tumor suppressor gene Tipe2. PMID:24577093

  3. Dissection of tumour and host cells from target organs of metastasis for testing gene expression directly ex vivo.

    PubMed Central

    Rocha, M.; Hexel, K.; Bucur, M.; Schirrmacher, V.; Umansky, V.

    1996-01-01

    We report on a new methodology which allows the direct analysis ex vivo of tumour cells and host cells (lymphocytes, macrophages, endothelial cells) from a metastasised organ (liver or spleen) at any time point during the metastatic process and without any further in vitro culture. First, we used a tumour cell line transduced with the bacterial gene lacZ, which permits the detection of the procaryotic enzyme beta-galactosidase in eukaryotic cells at the single cell level thus allowing flow adhesion cell sorting (FACS) analysis of tumour cells from metastasised target organs. Second, we established a method for the separation and enrichment of tumour and host cells from target organs of metastasis with a high viability and reproducibility. As exemplified with the murine lymphoma ESb, this new methodology permits the study of molecules of importance for metastasis or anti-tumour immunity (adhesion, costimulatory and cytotoxic molecules, cytokines, etc.) at the RNA or protein level in tumour and host cells during the whole process of metastasis. This novel approach may open new possibilities of developing strategies for intervention in tumour progression, since it allows the determination of the optimal window in time for successful treatments. The possibility of direct analysis of tumour and host cell properties also provides a new method for the evaluation of the effects of immunisation with tumour vaccines or of gene therapy. Images Figure 3 PMID:8883407

  4. Lhx2 is a direct NF-κB target gene that promotes primary hair follicle placode down-growth.

    PubMed

    Tomann, Philip; Paus, Ralf; Millar, Sarah E; Scheidereit, Claus; Schmidt-Ullrich, Ruth

    2016-05-01

    In the epidermis of mice lacking transcription factor nuclear factor-kappa B (NF-κB) activity, primary hair follicle (HF) pre-placode formation is initiated without progression to proper placodes. NF-κB modulates WNT and SHH signaling at early stages of HF development, but this does not fully account for the phenotypes observed upon NF-κB inhibition. To identify additional NF-κB target genes, we developed a novel method to isolate and transcriptionally profile primary HF placodes with active NF-κB signaling. In parallel, we compared gene expression at the same developmental stage in NF-κB-deficient embryos and controls. This uncovered novel NF-κB target genes with potential roles in priming HF placodes for down-growth. Importantly, we identify Lhx2 (encoding a LIM/homeobox transcription factor) as a direct NF-κB target gene, loss of which replicates a subset of phenotypes seen in NF-κB-deficient embryos. Lhx2 and Tgfb2 knockout embryos exhibit very similar abnormalities in HF development, including failure of the E-cadherin suppression required for follicle down-growth. We show that TGFβ2 signaling is impaired in NF-κB-deficient and Lhx2 knockout embryos and that exogenous TGFβ2 rescues the HF phenotypes in Lhx2 knockout skin explants, indicating that it operates downstream of LHX2. These findings identify a novel NF-κB/LHX2/TGFβ2 signaling axis that is crucial for primary HF morphogenesis, which may also function more broadly in development and disease. PMID:26952977

  5. Genomic signatures of local directional selection in a high gene flow marine organism; the Atlantic cod (Gadus morhua)

    PubMed Central

    2009-01-01

    Background Marine fishes have been shown to display low levels of genetic structuring and associated high levels of gene flow, suggesting shallow evolutionary trajectories and, possibly, limited or lacking adaptive divergence among local populations. We investigated variation in 98 gene-associated single nucleotide polymorphisms (SNPs) for evidence of selection in local populations of Atlantic cod (Gadus morhua L.) across the species distribution. Results Our global genome scan analysis identified eight outlier gene loci with very high statistical support, likely to be subject to directional selection in local demes, or closely linked to loci under selection. Likewise, on a regional south/north transect of central and eastern Atlantic populations, seven loci displayed strongly elevated levels of genetic differentiation. Selection patterns among populations appeared to be relatively widespread and complex, i.e. outlier loci were generally not only associated with one of a few divergent local populations. Even on a limited geographical scale between the proximate North Sea and Baltic Sea populations four loci displayed evidence of adaptive evolution. Temporal genome scan analysis applied to DNA from archived otoliths from a Faeroese population demonstrated stability of the intra-population variation over 24 years. An exploratory landscape genetic analysis was used to elucidate potential effects of the most likely environmental factors responsible for the signatures of local adaptation. We found that genetic variation at several of the outlier loci was better correlated with temperature and/or salinity conditions at spawning grounds at spawning time than with geographic distance per se. Conclusion These findings illustrate that adaptive population divergence may indeed be prevalent despite seemingly high levels of gene flow, as found in most marine fishes. Thus, results have important implications for our understanding of the interplay of evolutionary forces in

  6. SUMOylation of DRIL1 Directs Its Transcriptional Activity Towards Leukocyte Lineage-Specific Genes

    PubMed Central

    van Lohuizen, Maarten; Peeper, Daniel S.

    2009-01-01

    DRIL1 is an ARID family transcription factor that can immortalize primary mouse fibroblasts, bypass RASV12-induced cellular senescence and collaborate with RASV12 or MYC in mediating oncogenic transformation. It also activates immunoglobulin heavy chain transcription and engages in heterodimer formation with E2F to stimulate E2F-dependent transcription. Little, however, is known about the regulation of DRIL1 activity. Recently, DRIL1 was found to interact with the SUMO-conjugating enzyme Ubc9, but the functional relevance of this association has not been assessed. Here, we show that DRIL1 is sumoylated both in vitro and in vivo at lysine 398. Moreover, we provide evidence that PIASy functions as a specific SUMO E3-ligase for DRIL1 and promotes its sumoylation both in vitro and in vivo. Furthermore, consistent with the subnuclear localization of PIASy in the Matrix-Associated Region (MAR), SUMO-modified DRIL1 species are found exclusively in the MAR fraction. This post-translational modification interferes neither with the subcellular localization nor the DNA-binding activity of the protein. In contrast, DRIL1 sumoylation impairs its interaction with E2F1 in vitro and modifies its transcriptional activity in vivo, driving transcription of subset of genes regulating leukocyte fate. Taken together, these results identify sumoylation as a novel post-translational modification of DRIL1 that represents an important mechanism for targeting and modulating DRIL1 transcriptional activity. PMID:19436740

  7. Current Challenges and Future Directions in Recombinant AAV-Mediated Gene Therapy of Duchenne Muscular Dystrophy.

    PubMed

    Okada, Takashi; Takeda, Shin'ichi

    2013-01-01

    Various characteristics of adeno-associated virus (AAV)-based vectors with long-term safe expression have made it an exciting transduction tool for clinical gene therapy of Duchenne muscular dystrophy (DMD). Although host immune reactions against the vector as well as transgene products were detected in some instances of the clinical studies, there have been promising observations. Methods of producing AAV vectors for considerable in vivo experimentation and clinical investigations have been developed and a number of studies with AAV vector-mediated muscle transduction were attempted. Notably, an intravenous limb perfusion transduction technique enables extensive transgene expression in the skeletal muscles without noticeable adverse events. Furthermore, cardiac transduction by the rAAV9-microdystrophin would be promising to prevent development of cardiac dysfunction. Recent achievements in transduction technology suggest that long-term transgene expression with therapeutic benefits in DMD treatment would be achieved by the rAAV-mediated transduction strategy with an adequate regimen to regulate host immune response. PMID:24276316

  8. Stimulation of new bone formation by direct transfer of osteogenic plasmid genes.

    PubMed Central

    Fang, J; Zhu, Y Y; Smiley, E; Bonadio, J; Rouleau, J P; Goldstein, S A; McCauley, L K; Davidson, B L; Roessler, B J

    1996-01-01

    Degradable matrices containing expression plasmid DNA [gene-activated matrices (GAMs)] were implanted into segmental gaps created in the adult rat femur. Implantation of GAMs containing beta-galactosidase or luciferase plasmids led to DNA uptake and functional enzyme expression by repair cells (granulation tissue) growing into the gap. Implantation of a GAM containing either a bone morphogenetic protein-4 plasmid or a plasmid coding for a fragment of parathyroid hormone (amino acids 1-34) resulted in a biological response of new bone filling the gap. Finally, implantation of a two-plasmid GAM encoding bone morphogenetic protein-4 and the parathyroid hormone fragment, which act synergistically in vitro, caused new bone to form faster than with either factor alone. These studies demonstrate for the first time that repair cells (fibroblasts) in bone can be genetically manipulated in vivo. While serving as a useful tool to study the biology of repair fibroblasts and the wound healing response, the GAM technology may also have wide therapeutic utility. Images Fig. 1 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8650165

  9. Introduction to Dark Matter Experiments

    NASA Astrophysics Data System (ADS)

    Schnee, Richard W.

    2011-03-01

    I provide an introduction to experiments designed to detect WIMP dark matter directly, focussing on building intuitive understanding of the characteristics of potential WIMP signals and the experimental techniques. After deriving the characteristics of potential signals in direct-detection experiments for standard WIMP models, I summarize the general experimental methods shared by most direct-detection experiments and review the advantages, challenges, and status of such searches. Experiments are already probing SUSY models, with best limits on the spin-independent coupling below 10-7 pb. Combined information from direct and indirect detection, along with detection at colliders, promises to teach us much about fundamental particle physics, cosmology, and astrophysics.

  10. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    PubMed

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants. PMID:22009051

  11. Enrichment of provitamin A content in wheat (Triticum aestivum L.) by introduction of the bacterial carotenoid biosynthetic genes CrtB and CrtI.

    PubMed

    Wang, Cheng; Zeng, Jian; Li, Yin; Hu, Wei; Chen, Ling; Miao, Yingjie; Deng, Pengyi; Yuan, Cuihong; Ma, Cheng; Chen, Xi; Zang, Mingli; Wang, Qiong; Li, Kexiu; Chang, Junli; Wang, Yuesheng; Yang, Guangxiao; He, Guangyuan

    2014-06-01

    Carotenoid content is a primary determinant of wheat nutritional value and affects its end-use quality. Wheat grains contain very low carotenoid levels and trace amounts of provitamin A content. In order to enrich the carotenoid content in wheat grains, the bacterial phytoene synthase gene (CrtB) and carotene desaturase gene (CrtI) were transformed into the common wheat cultivar Bobwhite. Expression of CrtB or CrtI alone slightly increased the carotenoid content in the grains of transgenic wheat, while co-expression of both genes resulted in a darker red/yellow grain phenotype, accompanied by a total carotenoid content increase of approximately 8-fold achieving 4.76 μg g(-1) of seed dry weight, a β-carotene increase of 65-fold to 3.21 μg g(-1) of seed dry weight, and a provitamin A content (sum of α-carotene, β-carotene, and β-cryptoxanthin) increase of 76-fold to 3.82 μg g(-1) of seed dry weight. The high provitamin A content in the transgenic wheat was stably inherited over four generations. Quantitative PCR analysis revealed that enhancement of provitamin A content in transgenic wheat was also a result of the highly coordinated regulation of endogenous carotenoid biosynthetic genes, suggesting a metabolic feedback regulation in the wheat carotenoid biosynthetic pathway. These transgenic wheat lines are not only valuable for breeding wheat varieties with nutritional benefits for human health but also for understanding the mechanism regulating carotenoid biosynthesis in wheat endosperm. PMID:24692648

  12. Regulatory elements of the EKLF gene that direct erythroid cell-specific expression during mammalian development.

    PubMed

    Xue, Li; Chen, Xiaoyong; Chang, Yanjie; Bieker, James J

    2004-06-01

    Erythroid Krüppel-like factor (EKLF) plays an essential role in enabling beta-globin expression during erythroid ontogeny. It is first expressed in the extraembryonic mesoderm of the yolk sac within the morphologically unique cells that give rise to the blood islands, and then later within the hepatic primordia. The BMP4/Smad pathway plays a critical role in the induction of EKLF, and transient transfection analyses demonstrate that sequences located within less than 1 kb of its transcription initiation site are sufficient for high-level erythroid-specific transcription. We have used transgenic analyses to verify that 950 bp located adjacent to the EKLF start site of transcription is sufficient to generate lacZ expression within the blood islands as well as the fetal liver during embryonic development. Of particular importance are 3 regions, 2 of which overlap endogenous erythroid-specific DNase hypersensitive sites, and 1 of which includes the proximal promoter region. The onset of transgene expression mimics that of endogenous EKLF as it begins by day 7.5 (d7.5) to d8.0. In addition, it exhibits a strict hematopoietic specificity, localized only to these cells and not to the adjacent vasculature at all stages examined. Finally, expression is heterocellular, implying that although these elements are sufficient for tissue-specific expression, they do not shield against the position effects of adjacent chromatin. These analyses demonstrate that a surprisingly small DNA segment contains all the information needed to target a linked gene to the hematopoietic compartment at both early and later stages of development, and may be a useful cassette for this purpose. PMID:14764531

  13. Introduction of Pea DNA Helicase 45 Into Sugarcane (Saccharum spp. Hybrid) Enhances Cell Membrane Thermostability And Upregulation Of Stress-responsive Genes Leads To Abiotic Stress Tolerance.

    PubMed

    Augustine, Sruthy Maria; Ashwin Narayan, J; Syamaladevi, Divya P; Appunu, C; Chakravarthi, M; Ravichandran, V; Tuteja, Narendra; Subramonian, N

    2015-05-01

    DNA helicases are motor proteins that play an essential role in nucleic acid metabolism, by providing a duplex-unwinding function. To improve the drought and salinity tolerance of sugarcane, a DEAD-box helicase gene isolated from pea with a constitutive promoter, Port Ubi 2.3 was transformed into the commercial sugarcane variety Co 86032 through Agrobacterium-mediated transformation, and the transgenics were screened for tolerance to soil moisture stress and salinity. The transgene integration was confirmed through polymerase chain reaction, and the V 0 transgenic events showed significantly higher cell membrane thermostability under normal irrigated conditions. The V 1 transgenic events were screened for tolerance to soil moisture stress and exhibited significantly higher cell membrane thermostability, transgene expression, relative water content, gas exchange parameters, chlorophyll content, and photosynthetic efficiency under soil moisture stress compared to wild-type (WT). The overexpression of PDH45 transgenic sugarcane also led to the upregulation of DREB2-induced downstream stress-related genes. The transgenic events demonstrated higher germination ability and better chlorophyll retention than WT under salinity stress. Our results suggest the possibility for development of increased abiotic stress tolerant sugarcane cultivars through overexpression of PDH45 gene. Perhaps this is the first report, which provides evidence for increased drought and salinity tolerance in sugarcane through overexpression of PDH45. PMID:25875731

  14. Mutations in human cytomegalovirus UL97 gene confer clinical resistance to ganciclovir and can be detected directly in patient plasma.

    PubMed Central

    Wolf, D G; Smith, I L; Lee, D J; Freeman, W R; Flores-Aguilar, M; Spector, S A

    1995-01-01

    Specific mutations in the UL97 region of human cytomegalovirus (HCMV) have been found to confer resistance to laboratory-adapted strains subjected to ganciclovir selection. In this study, mutations in the UL97 region of HCMV isolates obtained from patients receiving ganciclovir therapy were examined to determine whether they would confer ganciclovir resistance, and if these mutations could be detected directly in the plasma of AIDS patients with progressive HCMV disease despite ganciclovir treatment. A single nucleotide change within a conserved region of UL97 was found in five resistant isolates, resulting in an amino acid substitution in residue 595: from leucine to phenylalanine in one, and from leucine to serine in four resistant isolates. A sixth resistant isolate demonstrated a single nucleotide change, leading to a threonine to isoleucine substitution in residue 659. The role of the 595 amino acid substitution in conferring ganciclovir resistance was confirmed by marker transfer experiments. In further studies, direct sequencing of HCMV DNA present in plasma obtained from persons with resistant viruses revealed the identical amino acid substitutions in plasma as those present in the cultured viruses. These findings indicate that clinical resistance to ganciclovir can result from specific point mutations in the UL97 gene, and that the emergence of the resistant genotype can be detected directly in patient plasma. Images PMID:7814623

  15. Estrogen regulation of chicken riboflavin carrier protein gene is mediated by ERE half sites without direct binding of estrogen receptor.

    PubMed

    Bahadur, Urvashi; Ganjam, Goutham K; Vasudevan, Nandini; Kondaiah, Paturu

    2005-02-28

    Estrogen is an important steroid hormone that mediates most of its effects on regulation of gene expression by binding to intracellular receptors. The consensus estrogen response element (ERE) is a 13bp palindromic inverted repeat with a three nucleotide spacer. However, several reports suggest that many estrogen target genes are regulated by diverse elements, such as imperfect EREs and ERE half sites (ERE 1/2), which are either the proximal or the distal half of the palindrome. To gain more insight into ERE half site-mediated gene regulation, we used a region from the estrogen-regulated chicken riboflavin carrier protein (RCP) gene promoter that contains ERE half sites. Using moxestrol, an analogue of estrogen and transient transfection of deletion and mutation containing RCP promoter/reporter constructs in chicken hepatoma (LMH2A) cells, we identified an estrogen response unit (ERU) composed of two consensus ERE 1/2 sites and one non-consensus ERE 1/2 site. Mutation of any of these sites within this ERU abolishes moxestrol response. Further, the ERU is able to confer moxestrol responsiveness to a heterologous promoter. Interestingly, RCP promoter is regulated by moxestrol in estrogen responsive human MCF-7 cells, but not in other cell lines such as NIH3T3 and HepG2 despite estrogen receptor-alpha (ER-alpha) co transfection. Electrophoretic mobility shift assays (EMSAs) with promoter regions encompassing the half sites and nuclear extracts from LMH2A cells show the presence of a moxestrol-induced complex that is abolished by a polyclonal anti-ERalpha antibody. Surprisingly, estrogen receptor cannot bind to these promoter elements in isolation. Thus, there appears to be a definite requirement for some other factor(s) in addition to estrogen receptor, for the generation of a suitable response of this promoter to estrogen. Our studies therefore suggest a novel mechanism of gene regulation by estrogen, involving ERE half sites without direct binding of ER to the

  16. Direct genotyping of Toxoplasma gondii from amniotic fluids based on B1 gene polymorphism using minisequencing analysis

    PubMed Central

    2013-01-01

    Background Because some Toxoplasma gondii genotypes may be more virulent in pregnant women, discriminating between them appears valuable. Currently, the main genotyping method is based on single copy microsatellite markers, which limit direct genotyping from amniotic fluids (AFs) to samples with a high parasitic load. We investigated whether the multicopy gene B1 could type the parasite with a higher sensitivity. To estimate the amplifiable DNA present in AFs, we first compared three different PCR assays used for Toxoplasma infection diagnosis: the P30-PCR, targeting the single copy gene P30; the B1-PCR, targeting the repeated B1 gene; and RE-PCR, targeting the repeated element. Results Of the 1792 AFs analyzed between 2008 and 2011, 73 were RE-PCR positive. Of those, 49 (67.1%) were P30-PCR and B1-PCR positive, and 14 (19.2%) additional AFs were B1-PCR positive only. All 63 BI-positive AFs (France n = 49; overseas n = 14) could be genotyped based on an analysis of eight nucleotide polymorphisms (SNPs) located within the B1 gene. Following high-resolution melting (HRM) analysis, minisequencing was carried out for each of the eight SNPs. DNA from six reference strains was included in the study, and AFs were assigned to one of the three major lineages (Types I, II, and III). In total, 26 genotypes were observed, and the hierarchical clustering distinguished two clades in lineages II (IIa, n = 30 and IIb, n = 4) and III (IIIa n = 23 and IIIb n = 6). There was an overrepresentation of overseas isolates in Clade IIb (4/4, 100%) and Clade IIIa (8/22; 36.4%) (p <0.0001), whereas medical interruption and fetal death were overrepresented in Clade IIb (2/4, 50%) and Clade IIIa (4/23, 17.4%) (p = 0.049). Conclusions Although the current genotyping system cannot pretend to replace multilocus typing, we clearly show that targeting the multicopy B1 gene yields a genotyping capacity of AFs around 20% better than when single copy targets are used. The

  17. Directing 101.

    ERIC Educational Resources Information Center

    Pintoff, Ernest

    Providing an introduction to anyone considering directing as a field of study or career, this book takes a broad look at the process of directing and encourages students and professionals alike to look outside of the movie industry for inspiration. Chapters in the book discuss selecting and acquiring material; budgeting and financing; casting and…

  18. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    PubMed Central

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  19. Direct detection and differentiation of pathogenic Leptospira species using a multi-gene targeted real time PCR approach.

    PubMed

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  20. Low relative humidity triggers RNA-directed de novo DNA methylation and suppression of genes controlling stomatal development

    PubMed Central

    Tricker, Penny J.; Gibbings, J. George; Rodríguez López, Carlos M.; Hadley, Paul; Wilkinson, Mike J.

    2012-01-01

    Environmental cues influence the development of stomata on the leaf epidermis, and allow plants to exert plasticity in leaf stomatal abundance in response to the prevailing growing conditions. It is reported that Arabidopsis thaliana ‘Landsberg erecta’ plants grown under low relative humidity have a reduced stomatal index and that two genes in the stomatal development pathway, SPEECHLESS and FAMA, become de novo cytosine methylated and transcriptionally repressed. These environmentally-induced epigenetic responses were abolished in mutants lacking the capacity for de novo DNA methylation, for the maintenance of CG methylation, and in mutants for the production of short-interfering non-coding RNAs (siRNAs) in the RNA-directed DNA methylation pathway. Induction of methylation was quantitatively related to the induction of local siRNAs under low relative humidity. Our results indicate the involvement of both transcriptional and post-transcriptional gene suppression at these loci in response to environmental stress. Thus, in a physiologically important pathway, a targeted epigenetic response to a specific environmental stress is reported and several of its molecular, mechanistic components are described, providing a tractable platform for future epigenetics experiments. Our findings suggest epigenetic regulation of stomatal development that allows for anatomical and phenotypic plasticity, and may help to explain at least some of the plant’s resilience to fluctuating relative humidity. PMID:22442411

  1. Analysis of a rape case by direct sequencing of the human immunodeficiency virus type 1 pol and gag genes.

    PubMed Central

    Albert, J; Wahlberg, J; Leitner, T; Escanilla, D; Uhlén, M

    1994-01-01

    Transmission of human immunodeficiency virus type 1 (HIV-1) from a male accused of rape and deliberate transmission of HIV-1 was investigated by sequencing of the HIV-1 pol and gag genes from virus obtained from the male and from the female victim. Parts of the reverse transcriptase and p17gag genes were amplified and directly sequenced from uncultured peripheral blood mononuclear cells. The sequences were compared with sequences from 21 unrelated HIV-1-infected controls from the same geographic area (Stockholm, Sweden). Bootstrap analysis of phylogenetic trees demonstrated that the sequences from the female were significantly more closely related to the sequences from the male than to sequences from the controls. Furthermore, we found that the male and female shared two distinct genetic variants of HIV-1. In p17gag the major variant had an unusual, out-of-frame deletion of 3 nucleotides which the minor variant lacked. These results indicated that the male had transmitted more than one infectious unit to the female. From this study we concluded that it was highly likely that the HIV-1 strains carried by the male and female were closely epidemiologically linked. PMID:7520096

  2. The Direct Effects of Atmospheric Change on Vegetation: From Gene Expression to Crop Production in the Field

    SciTech Connect

    Long, Stephen

    2005-08-31

    The CO2 and ozone (O3) concentrations of the troposphere are rising with direct impacts on plants. O3 currently costs crop production > 5bn Euro a year with parallel damage to natural ecosystems. In the short-term, elevated CO2 stimulates and elevated O3 depresses photosynthesis in highly predictable ways. Longer-term effects are less predictable, but new patterns are now emerging via meta-analysis of realistic field treatment in Free-Air Concentration Enrichment (FACE) facilities. The chain of effects from gene expression to acclimated phenotype that result from long-term growth in elevated CO2 or O3 will be reviewed. Significant season long increases in photosynthesis and production with CO2 are found, with some surprising changes in plant development that were not apparent or suspected in studies with field enclosures. Season-long exposures to the moderate increases in O3 observed in the field cause: more gene transcripts to be down-regulated than up-regulated; a chronic decrease in photosynthetic capacity, largely attributable to decreased activity of the primary carboxylation step; and accelerated senescence. The large FACE facilities, a biologists equivalent of the physicists accelerators, are providing new insights into plant responses to atmospheric change and will provide a basis for adapting crop plants to change.

  3. Rapid and efficient introduction of a foreign gene into bacterial artificial chromosome-cloned varicella vaccine by Tn7-mediated site-specific transposition

    SciTech Connect

    Somboonthum, Pranee; Koshizuka, Tetsuo; Okamoto, Shigefumi; Matsuura, Masaaki; Gomi, Yasuyuki; Takahashi, Michiaki; Yamanishi, Koichi; Mori, Yasuko

    2010-06-20

    Using a rapid and reliable system based on Tn7-mediated site-specific transposition, we have successfully constructed a recombinant Oka varicella vaccine (vOka) expressing the mumps virus (MuV) fusion protein (F). The backbone of the vector was our previously reported vOka-BAC (bacterial artificial chromosome) genome. We inserted the transposon Tn7 attachment sequence, LacZ{alpha}-mini-attTn7, into the region between ORF12 and ORF13 to generate a vOka-BAC-Tn genome. The MuV-F expressing cassette was transposed into the vOka-BAC genome at the mini-attTn7 transposition site. MuV-F protein was expressed in recombinant virus, rvOka-F infected cells. In addition, the MuV-F protein was cleaved in the rvOka-F infected cells as in MuV-infected cells. The growth of rvOka-F was similar to that of the original recombinant vOka without the F gene. Thus, we show that Tn7-mediated transposition is an efficient method for introducing a foreign gene expression cassette into the vOka-BAC genome as a live virus vector.

  4. 20 CFR 266.1 - Introduction.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 266.1 Section 266.1 Employees... § 266.1 Introduction. (a) Explanation of representative payment. This part explains the principles and... payee if it determines that the annuitant is not able to manage or direct the management of...

  5. Multiple introductions of a reassortant H5N1 avian influenza virus of clade 2.3.2.1c with PB2 gene of H9N2 subtype into Indian poultry.

    PubMed

    Tosh, Chakradhar; Nagarajan, Shanmugasundaram; Kumar, Manoj; Murugkar, Harshad V; Venkatesh, Govindarajulu; Shukla, Shweta; Mishra, Amit; Mishra, Pranav; Agarwal, Sonam; Singh, Bharati; Dubey, Prashant; Tripathi, Sushil; Kulkarni, Diwakar D

    2016-09-01

    Highly pathogenic avian influenza (HPAI) H5N1 viruses are a threat to poultry in Asia, Europe, Africa and North America. Here, we report isolation and characterization of H5N1 viruses isolated from ducks and turkeys in Kerala, Chandigarh and Uttar Pradesh, India between November 2014 and March 2015. Genetic and phylogenetic analyses of haemagglutinin gene identified that the virus belonged to a new clade 2.3.2.1c which has not been detected earlier in Indian poultry. The virus possessed molecular signature for high pathogenicity to chickens, which was corroborated by intravenous pathogenicity index of 2.96. The virus was a reassortant which derives its PB2 gene from H9N2 virus isolated in China during 2007-2013. However, the neuraminidase and internal genes are of H5N1 subtype. Phylogenetic and network analysis revealed that after detection in China in 2013/2014, the virus moved to Europe, West Africa and other Asian countries including India. The analyses further indicated multiple introductions of H5N1 virus in Indian poultry and internal spread in Kerala. One of the outbreaks in ducks in Kerala is linked to the H5N1 virus isolated from wild birds in Dubai suggesting movement of virus probably through migration of wild birds. However, the outbreaks in ducks in Chandigarh and Uttar Pradesh were from an unknown source in Asia which also contributed gene pools to the outbreaks in Europe and West Africa. The widespread incidence of the novel H5N1 HPAI is similar to the spread of clade 2.2 ("Qinghai-like") virus in 2005, and should be monitored to avoid threat to animal and public health. PMID:27174088

  6. Introduction of the human AVPR1A gene substantially alters brain receptor expression patterns and enhances aspects of social behavior in transgenic mice

    PubMed Central

    Charles, Rhonda; Sakurai, Takeshi; Takahashi, Nagahide; Elder, Gregory A.; Gama Sosa, Miguel A.; Young, Larry J.; Buxbaum, Joseph D.

    2014-01-01

    Central arginine vasopressin receptor 1A (AVPR1A) modulates a wide range of behaviors, including stress management and territorial aggression, as well as social bonding and recognition. Inter- and intra-species variations in the expression pattern of AVPR1A in the brain and downstream differential behavioral phenotypes have been attributed to differences in the non-coding regions of the AVPR1A gene, including polymorphic elements within upstream regulatory areas. Gene association studies have suggested a link between AVPR1A polymorphisms and autism, and AVPR1A has emerged as a potential pharmacological target for treatment of social cognitive impairments and mood and anxiety disorders. To further investigate the genetic mechanism giving rise to species differences in AVPR1A expression patterns and associated social behaviors, and to create a preclinical mouse model useful for screening drugs targeting AVPR1A, we engineered and extensively characterized bacterial artificial chromosome (BAC) transgenic mice harboring the entire human AVPR1A locus with the surrounding regulatory elements. Compared with wild-type animals, the humanized mice displayed a more widely distributed ligand-AVPR1A binding pattern, which overlapped with that of primates. Furthermore, humanized AVPR1A mice displayed increased reciprocal social interactions compared with wild-type animals, but no differences in social approach and preference for social novelty were observed. Aspects of learning and memory, specifically novel object recognition and spatial relocation recognition, were unaffected. The biological alterations in humanized AVPR1A mice resulted in the rescue of the prepulse inhibition impairments that were observed in knockout mice, indicating conserved functionality. Although further behavioral paradigms and additional cohorts need to be examined in humanized AVPR1A mice, the results demonstrate that species-specific variations in the genomic content of regulatory regions surrounding

  7. Increase in nervonic acid content in transformed yeast and transgenic plants by introduction of a Lunaria annua L. 3-ketoacyl-CoA synthase (KCS) gene.

    PubMed

    Guo, Yiming; Mietkiewska, Elzbieta; Francis, Tammy; Katavic, Vesna; Brost, Jennifer M; Giblin, Michael; Barton, Dennis L; Taylor, David C

    2009-03-01

    Nervonic acid is a Very Long-Chain Monounsaturated Fatty Acid (VLCMFA), 24:1 Delta15 (cis-tetracos-15-enoic acid) found in the seed oils of Lunaria annua, borage, hemp, Acer (Purpleblow maple) and Tropaeolum speciosum (Flame flower). However, of these, only the "money plant" (Lunaria annua L.) has been studied and grown sparingly for future development as a niche crop and the outlook has been disappointing. Therefore, our goal was to isolate and characterize strategic new genes for high nervonic acid production in Brassica oilseed crops. To this end, we have isolated a VLCMFA-utilizing 3-Keto-Acyl-CoA Synthase (KCS; fatty acid elongase; EC 2.3.1.86) gene from Lunaria annua and functionally expressed it in yeast, with the recombinant KCS protein able to catalyze the synthesis of several VLCMFAs, including nervonic acid. Seed-specific expression of the Lunaria KCS in Arabidopsis resulted in a 30-fold increase in nervonic acid proportions in seed oils, compared to the very low quantities found in the wild-type. Similar transgenic experiments using B. carinata as the host resulted in a 7-10 fold increase in seed oil nervonic acid proportions. KCS enzyme activity assays indicated that upon using (14)C-22:1-CoA as substrate, the KCS activity from developing seeds of transgenic B. carinata was 20-30-fold higher than the low erucoyl-elongation activity exhibited by wild type control plants. There was a very good correlation between the Lun KCS transcript intensity and the resultant 22:1-CoA KCS activity in developing seed. The highest nervonic acid level in transgenic B. carinata expressing the Lunaria KCS reached 30%, compared to 2.8% in wild type plant. In addition, the erucic acid proportions in these transgenic lines were considerably lower than that found in native Lunaria oil. These results show the functional utility of the Lunaria KCS in engineering new sources of high nervonate/reduced erucic oils in the Brassicaceae. PMID:19082744

  8. An integrated database of genes responsive to the Myc oncogenic transcription factor: identification of direct genomic targets

    PubMed Central

    Zeller, Karen I; Jegga, Anil G; Aronow, Bruce J; O'Donnell, Kathryn A; Dang, Chi V

    2003-01-01

    We report a database of genes responsive to the Myc oncogenic transcription factor. The database Myc Target Gene prioritizes candidate target genes according to experimental evidence and clusters responsive genes into functional groups. We coupled the prioritization of target genes with phylogenetic sequence comparisons to predict c-Myc target binding sites, which are in turn validated by chromatin immunoprecipitation assays. This database is essential for the understanding of the genetic regulatory networks underlying the genesis of cancers. PMID:14519204

  9. Introduction to metallic nanoparticles.

    PubMed

    Mody, Vicky V; Siwale, Rodney; Singh, Ajay; Mody, Hardik R

    2010-10-01

    Metallic nanoparticles have fascinated scientist for over a century and are now heavily utilized in biomedical sciences and engineering. They are a focus of interest because of their huge potential in nanotechnology. Today these materials can be synthesized and modified with various chemical functional groups which allow them to be conjugated with antibodies, ligands, and drugs of interest and thus opening a wide range of potential applications in biotechnology, magnetic separation, and preconcentration of target analytes, targeted drug delivery, and vehicles for gene and drug delivery and more importantly diagnostic imaging. Moreover, various imaging modalities have been developed over the period of time such as MRI, CT, PET, ultrasound, SERS, and optical imaging as an aid to image various disease states. These imaging modalities differ in both techniques and instrumentation and more importantly require a contrast agent with unique physiochemical properties. This led to the invention of various nanoparticulated contrast agent such as magnetic nanoparticles (Fe(3)O(4)), gold, and silver nanoparticles for their application in these imaging modalities. In addition, to use various imaging techniques in tandem newer multifunctional nanoshells and nanocages have been developed. Thus in this review article, we aim to provide an introduction to magnetic nanoparticles (Fe(3)O(4)), gold nanoparticles, nanoshells and nanocages, and silver nanoparticles followed by their synthesis, physiochemical properties, and citing some recent applications in the diagnostic imaging and therapy of cancer. PMID:21180459

  10. Introduction to metallic nanoparticles

    PubMed Central

    Mody, Vicky V.; Siwale, Rodney; Singh, Ajay; Mody, Hardik R.

    2010-01-01

    Metallic nanoparticles have fascinated scientist for over a century and are now heavily utilized in biomedical sciences and engineering. They are a focus of interest because of their huge potential in nanotechnology. Today these materials can be synthesized and modified with various chemical functional groups which allow them to be conjugated with antibodies, ligands, and drugs of interest and thus opening a wide range of potential applications in biotechnology, magnetic separation, and preconcentration of target analytes, targeted drug delivery, and vehicles for gene and drug delivery and more importantly diagnostic imaging. Moreover, various imaging modalities have been developed over the period of time such as MRI, CT, PET, ultrasound, SERS, and optical imaging as an aid to image various disease states. These imaging modalities differ in both techniques and instrumentation and more importantly require a contrast agent with unique physiochemical properties. This led to the invention of various nanoparticulated contrast agent such as magnetic nanoparticles (Fe3O4), gold, and silver nanoparticles for their application in these imaging modalities. In addition, to use various imaging techniques in tandem newer multifunctional nanoshells and nanocages have been developed. Thus in this review article, we aim to provide an introduction to magnetic nanoparticles (Fe3O4), gold nanoparticles, nanoshells and nanocages, and silver nanoparticles followed by their synthesis, physiochemical properties, and citing some recent applications in the diagnostic imaging and therapy of cancer. PMID:21180459

  11. Fetal Brain-directed AAV Gene Therapy Results in Rapid, Robust, and Persistent Transduction of Mouse Choroid Plexus Epithelia.

    PubMed

    Haddad, Marie Reine; Donsante, Anthony; Zerfas, Patricia; Kaler, Stephen G

    2013-01-01

    Fetal brain-directed gene addition represents an under-appreciated tool for investigating novel therapeutic approaches in animal models of central nervous system diseases with early prenatal onset. Choroid plexuses (CPs) are specialized neuroectoderm-derived structures that project into the brain's ventricles, produce cerebrospinal fluid (CSF), and regulate CSF biochemical composition. Targeting the CP may be advantageous for adeno-associated viral (AAV) gene therapy for central nervous system disorders due to its immunoprivileged location and slow rate of epithelial turnover. Yet the capacity of AAV vectors to transduce CP has not been delineated precisely. We performed intracerebroventricular injections of recombinant AAV serotype 5-green fluorescent protein (rAAV5-GFP) or rAAV9-GFP in embryonic day 15 (E15) embryos of CD-1 and C57BL/6 pregnant mice and quantified the percentages of GFP expression in CP epithelia (CPE) from lateral and fourth ventricles on E17, postnatal day 2 (P2), and P22. AAV5 was selective for CPE and showed significantly higher transduction efficiency in C57BL/6 mice (P = 0.0128). AAV9 transduced neurons and glial cells in both the mouse strains, in addition to CPE. We documented GFP expression in CPE on E17, within just 48 hours of rAAV administration to the fetal lateral ventricle, and expression by both the serotypes persisted at P130. Our results indicate that prenatal administration of rAAV5 and rAAV9 enables rapid, robust, and sustained transduction of mouse CPE and buttress the rationale for experimental therapeutics targeting the CP.Molecular Therapy-Nucleic Acids (2013) 2, e101; doi:10.1038/mtna.2013.27; published online 25 June 2013. PMID:23799375

  12. Genome-Wide Analysis of Binding Sites and Direct Target Genes of the Orphan Nuclear Receptor NR2F1/COUP-TFI

    PubMed Central

    Montemayor, Celina; Montemayor, Oscar A.; Ridgeway, Alex; Lin, Feng; Wheeler, David A.; Pletcher, Scott D.; Pereira, Fred A.

    2010-01-01

    Background Identification of bona fide direct nuclear receptor gene targets has been challenging but essential for understanding regulation of organismal physiological processes. Results We describe a methodology to identify transcription factor binding sites and target genes in vivo by intersecting microarray data, computational binding site queries, and evolutionary conservation. We provide detailed experimental validation of each step and, as a proof of principle, utilize the methodology to identify novel direct targets of the orphan nuclear receptor NR2F1 (COUP-TFI). The first step involved validation of microarray gene expression profiles obtained from wild-type and COUP-TFI−/− inner ear tissues. Secondly, we developed a bioinformatic tool to search for COUP-TFI DNA binding sites in genomes, using a classification-type Hidden Markov Model trained with 49 published COUP-TF response elements. We next obtained a ranked list of candidate in vivo direct COUP-TFI targets by integrating the microarray and bioinformatics analyses according to the degree of binding site evolutionary conservation and microarray statistical significance. Lastly, as proof-of-concept, 5 specific genes were validated for direct regulation. For example, the fatty acid binding protein 7 (Fabp7) gene is a direct COUP-TFI target in vivo because: i) we identified 2 conserved COUP-TFI binding sites in the Fabp7 promoter; ii) Fapb7 transcript and protein levels are significantly reduced in COUP-TFI−/− tissues and in MEFs; iii) chromatin immunoprecipitation demonstrates that COUP-TFI is recruited to the Fabp7 promoter in vitro and in vivo and iv) it is associated with active chromatin having increased H3K9 acetylation and enrichment for CBP and SRC-1 binding in the newborn brain. Conclusion We have developed and validated a methodology to identify in vivo direct nuclear receptor target genes. This bioinformatics tool can be modified to scan for response elements of transcription factors

  13. Gene array analysis of neural crest cells identifies transcription factors necessary for direct conversion of embryonic fibroblasts into neural crest cells

    PubMed Central

    Motohashi, Tsutomu; Watanabe, Natsuki; Nishioka, Masahiro; Nakatake, Yuhki; Yulan, Piao; Mochizuki, Hiromi; Kawamura, Yoshifumi; Ko, Minoru S. H.; Goshima, Naoki; Kunisada, Takahiro

    2016-01-01

    ABSTRACT Neural crest cells (NC cells) are multipotent cells that emerge from the edge of the neural folds and migrate throughout the developing embryo. Although the gene regulatory network for generation of NC cells has been elucidated in detail, it has not been revealed which of the factors in the network are pivotal to directing NC identity. In this study we analyzed the gene expression profile of a pure NC subpopulation isolated from Sox10-IRES-Venus mice and investigated whether these genes played a key role in the direct conversion of Sox10-IRES-Venus mouse embryonic fibroblasts (MEFs) into NC cells. The comparative molecular profiles of NC cells and neural tube cells in 9.5-day embryos revealed genes including transcription factors selectively expressed in developing trunk NC cells. Among 25 NC cell-specific transcription factor genes tested, SOX10 and SOX9 were capable of converting MEFs into SOX10-positive (SOX10+) cells. The SOX10+ cells were then shown to differentiate into neurons, glial cells, smooth muscle cells, adipocytes and osteoblasts. These SOX10+ cells also showed limited self-renewal ability, suggesting that SOX10 and SOX9 directly converted MEFs into NC cells. Conversely, the remaining transcription factors, including well-known NC cell specifiers, were unable to convert MEFs into SOX10+ NC cells. These results suggest that SOX10 and SOX9 are the key factors necessary for the direct conversion of MEFs into NC cells. PMID:26873953

  14. Gene array analysis of neural crest cells identifies transcription factors necessary for direct conversion of embryonic fibroblasts into neural crest cells.

    PubMed

    Motohashi, Tsutomu; Watanabe, Natsuki; Nishioka, Masahiro; Nakatake, Yuhki; Yulan, Piao; Mochizuki, Hiromi; Kawamura, Yoshifumi; Ko, Minoru S H; Goshima, Naoki; Kunisada, Takahiro

    2016-01-01

    Neural crest cells (NC cells) are multipotent cells that emerge from the edge of the neural folds and migrate throughout the developing embryo. Although the gene regulatory network for generation of NC cells has been elucidated in detail, it has not been revealed which of the factors in the network are pivotal to directing NC identity. In this study we analyzed the gene expression profile of a pure NC subpopulation isolated from Sox10-IRES-Venus mice and investigated whether these genes played a key role in the direct conversion of Sox10-IRES-Venus mouse embryonic fibroblasts (MEFs) into NC cells. The comparative molecular profiles of NC cells and neural tube cells in 9.5-day embryos revealed genes including transcription factors selectively expressed in developing trunk NC cells. Among 25 NC cell-specific transcription factor genes tested, SOX10 and SOX9 were capable of converting MEFs into SOX10-positive (SOX10+) cells. The SOX10+ cells were then shown to differentiate into neurons, glial cells, smooth muscle cells, adipocytes and osteoblasts. These SOX10+ cells also showed limited self-renewal ability, suggesting that SOX10 and SOX9 directly converted MEFs into NC cells. Conversely, the remaining transcription factors, including well-known NC cell specifiers, were unable to convert MEFs into SOX10+ NC cells. These results suggest that SOX10 and SOX9 are the key factors necessary for the direct conversion of MEFs into NC cells. PMID:26873953

  15. Introduction to deployable recovery systems

    SciTech Connect

    Meyer, J.

    1985-08-01

    This report provides an introduction to deployable recovery systems for persons with little or no background in parachutes but who are knowledgeable in aerodynamics. A historical review of parachute development is given along with a description of the basic components of most deployable recovery systems. Descriptions are given of the function of each component and of problems that occur if a component fails to perform adequately. Models are presented for deployable recovery systems. Possible directions for future work are suggested in the summary.

  16. Quantitative morphological comparison of axon-targeting strategies for gene therapies directed to the nigro-striatal projection.

    PubMed

    Padmanabhan, S; Kareva, T; Kholodilov, N; Burke, R E

    2014-02-01

    Cellular targeting of mRNAs and proteins to axons is essential for axon growth during development and is likely to be important for adult maintenance as well. Given the importance and potency of these axon-targeting motifs to the biology of axons, it seems possible that they can be used in the design of transgenes that are intended to enhance axon growth or maintenance, so as to improve potency and minimize off-target effects. To investigate this possibility, it is first essential to assess known motifs for their efficacy. We have therefore evaluated four axon-targeting motifs, using adeno-associated viral vector-mediated gene delivery in the nigro-striatal dopaminergic system, a projection that is predominantly affected in Parkinson's disease. We have tested two mRNA axonal zipcodes, the 3' untranslated region (UTR) of β-actin and 3' UTR of tau, and two axonal-targeting protein motifs, the palmitoylation signal sequence in GAP-43 and the last 15 amino acids in the amyloid precursor protein, to direct the expression of the fluorescent protein Tomato in axons. These sequences, fused to Tomato, were able to target its expression to dopaminergic axons. Based on quantification of Tomato-positive axons, and the density of striatal innervation, we conclude that the C-terminal of the amyloid precursor protein is the most effective axon-targeting motif. PMID:24305419

  17. Hsp90 Directly Modulates the Spatial Distribution of AF9/MLLT3 and Affects Target Gene Expression*

    PubMed Central

    Lin, Jeffrey J.; Hemenway, Charles S.

    2010-01-01

    AF9/MLLT3 contributes to the regulation of the gene encoding the epithelial sodium channel α, ENaCα, in renal tubular cells. Specifically, increases in AF9 protein lead to a reduction in ENaCα expression and changes in AF9 activity appear to be an important component of aldosterone signaling in the kidney. Whereas AF9 is found in the nucleus where it interacts with the histone H3 lysine 79 methyltransferase, Dot1, AF9 is also present in the cytoplasm. Data presented in this report indicate that the heat shock protein Hsp90 directly and specifically interacts with AF9 as part of an Hsp90-Hsp70-p60/Hop chaperone complex. Experimental manipulation of Hsp90 function by the inhibitor novobiocin, but not 17-AAG, results in redistribution of AF9 from a primarily nuclear to cytoplasmic location. Knockdown of Hsp90 with siRNA mimics the effect elicited by novobiocin. As expected, a shift in AF9 from the nucleus to the cytoplasm in response to Hsp90 interference leads to increased ENaCα expression. This is accompanied by a decrease in AF9 occupancy at the ENaCα promoter. Our data suggest that the interaction of Hsp90, Hsp70, and p60/Hop with AF9 is necessary for the proper subnuclear localization and activity of AF9. AF9 is among a growing number of nuclear proteins recognized to rely on the Hsp90 complex for nuclear targeting. PMID:20159978

  18. Facile Construction of Random Gene Mutagenesis Library for Directed Evolution Without the Use of Restriction Enzyme in Escherichia coli.

    PubMed

    Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival

    2016-09-01

    A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. PMID:27367290

  19. Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

    PubMed Central

    Pierce, M L; Ruffner, D E

    1998-01-01

    Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

  20. Enhancing Autophagy with Drugs or Lung-directed Gene Therapy Reverses the Pathological Effects of Respiratory Epithelial Cell Proteinopathy.

    PubMed

    Hidvegi, Tunda; Stolz, Donna B; Alcorn, John F; Yousem, Samuel A; Wang, Jieru; Leme, Adriana S; Houghton, A McGarry; Hale, Pamela; Ewing, Michael; Cai, Houming; Garchar, Evelyn Akpadock; Pastore, Nunzia; Annunziata, Patrizia; Kaminski, Naftali; Pilewski, Joseph; Shapiro, Steven D; Pak, Stephen C; Silverman, Gary A; Brunetti-Pierri, Nicola; Perlmutter, David H

    2015-12-11

    Recent studies have shown that autophagy mitigates the pathological effects of proteinopathies in the liver, heart, and skeletal muscle but this has not been investigated for proteinopathies that affect the lung. This may be due at least in part to the lack of an animal model robust enough for spontaneous pathological effects from proteinopathies even though several rare proteinopathies, surfactant protein A and C deficiencies, cause severe pulmonary fibrosis. In this report we show that the PiZ mouse, transgenic for the common misfolded variant α1-antitrypsin Z, is a model of respiratory epithelial cell proteinopathy with spontaneous pulmonary fibrosis. Intracellular accumulation of misfolded α1-antitrypsin Z in respiratory epithelial cells of the PiZ model resulted in activation of autophagy, leukocyte infiltration, and spontaneous pulmonary fibrosis severe enough to elicit functional restrictive deficits. Treatment with autophagy enhancer drugs or lung-directed gene transfer of TFEB, a master transcriptional activator of the autophagolysosomal system, reversed these proteotoxic consequences. We conclude that this mouse is an excellent model of respiratory epithelial proteinopathy with spontaneous pulmonary fibrosis and that autophagy is an important endogenous proteostasis mechanism and an attractive target for therapy. PMID:26494620

  1. Introduction to an introduction to holography

    NASA Astrophysics Data System (ADS)

    Unterseher, Fred D.; Deem, Rebecca E.

    1995-02-01

    A preliminary introduction to holography geared towards artists and the general public is discussed. The method is based on a participatory approach that relates holography to psychology/perception, science/physics, and art/imaging. The overall intention is designed to break down unconscious assumptions.

  2. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data

    PubMed Central

    Rowe, Will; Baker, Kate S.; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J.; Maskell, Duncan; Pearce, Gareth

    2015-01-01

    Background Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Results Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR’s application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. Conclusions We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or

  3. Direct hippocampal injection of pseudo lentivirus-delivered nerve growth factor gene rescues the damaged cognitive function after traumatic brain injury in the rat.

    PubMed

    Lin, Yong; Wan, Jie-qing; Gao, Guo-yi; Pan, Yao-hua; Ding, Sheng-hao; Fan, Yi-ling; Wang, Yong; Jiang, Ji-yao

    2015-11-01

    Traumatic brain injury (TBI) treatment is a long-term process and requires repeated medicine administration, which, however, can cause high expense, infection, and hemorrhage to patients. To investigate how a long-term expression of nerve growth factor (Ngf) gene affects the injured hippocampus function post-TBI, in this study, a pseudo lentivirus carrying the β-Ngf fusion gene, with green fluorescence protein (GFP) gene, was constructed to show the gene expression and its ability of protecting cells from oxidative damage in vitro. Then, the pseudo lentivirus-carried β-Ngf fusion gene was directly injected into the injured brain to evaluate its influence on the injured hippocampus function post-TBI in vivo. We found that the expression of the pseudo lentivirus-delivered β-Ngf fusion gene lasted more than four-week after the cell transduction and the encoded β-NGF fusion protein could induce the neuron-like PC12 cell differentiation. Moreover, the hippocampal injection of the pseudo lentivirus-carried β-Ngf fusion gene sped the injured cognitive function recovery of the rat subjected to TBI. Together, our findings indicate that the long-term expression of the β-Ngf fusion gene, delivered by the pseudo lentivirus, can promote the neurite outgrowth of the neuron-like cells and protect the cells from the oxidative damage in vitro, and that the direct and single dose hippocampal injection of the pseudo lentivirus-carried β-Ngf fusion gene is able to rescue the hippocampus function after the TBI in the rat. PMID:26285082

  4. Introduction of the rice CYP714D1 gene into Populus inhibits expression of its homologous genes and promotes growth, biomass production and xylem fibre length in transgenic trees

    PubMed Central

    Wang, Cuiting; Bao, Yan; Wang, Qiuqing; Zhang, Hongxia

    2013-01-01

    The rice (Oryza sativa) OsCYP714D1 gene (also known as EUI) encodes a cytochrome P450 monooxygenase which functions as a gibberellin (GA)-deactivating enzyme, catalysing 16α, 17-epoxidation of non-13-hydroxylated GAs. To understand whether it would also reduce the production of active GAs and depress the growth rate in transgenic trees, we constitutively expressed OsCYP714D1 in the aspen hybrid clone Populus alba×P. berolinensis. Unexpectedly, ectopic expression of OsCYP714D1 in aspen positively regulated the biosynthesis of GAs, including the active GA1 and GA4, leading to promotion of the growth rate and biomass production in transgenic plants. Transgenic lines which showed significant expression of the introduced OsCYP714D1 gene accumulated a higher GA level and produced more numerous and longer xylem fibres than did the wild-type plants. Quantitative real-time PCR indicated that transcription of most homologous PtCYP714 genes was suppressed in these transgenic lines. Therefore, the promoted GA and biomass production in transgenic trees constitutively expressing OsCYP714D1 is probably attributed to the down-regulated expression of the native PtCYP714 homologues involved in the GA biosynthesis pathway, although their precise functions are yet to be further elucidated. PMID:23667043

  5. The Yeast Hrs1 Gene Encodes a Polyglutamine-Rich Nuclear Protein Required for Spontaneous and Hpr1-Induced Deletions between Direct Repeats

    PubMed Central

    Santos-Rosa, H.; Clever, B.; Heyer, W. D.; Aguilera, A.

    1996-01-01

    The hrs1-1 mutation was isolated as an extragenic suppressor of the hyperrecombination phenotype of hpr1Δ cells. We have cloned, sequenced and deleted from the genome the HRS1 gene. The DNA sequence of the HRS1 gene reveals that it is identical to PGD1, a gene with no reported function, and that the Hrs1p protein contains polyglutamine stretches typically found in transcription factors. We have purified a His(6) tagged version of Hrs1p protein from E. coli and have obtained specific anti-Hrs1p polyclonal antibodies. We show that Hrs1p is a 49-kD nuclear protein, as determined by indirect immunofluorescence microscopy and Western blot analysis. The hrs1Δ null mutation reduces the frequency of deletions in wild-type and hpr1Δ backgrounds sevenfold below wild-type and rad52 levels. Furthermore, hrs1Δ cells show reduced induction of the GAL1,10 promoter relative to wild-type cells. Our results suggest that Hrs1p is required for the formation of deletions between direct repeats and that it may function in gene expression. This suggests a connection between gene expression and direct repeat recombination. In this context, we discuss the possible roles of Hrs1p and Hpr1p in initiation of direct-repeat recombination. PMID:8849881

  6. Gene expression profiling and chromatin immunoprecipitation identify DBN1, SETMAR and HIG2 as direct targets of SOX11 in mantle cell lymphoma.

    PubMed

    Wang, Xiao; Björklund, Stefan; Wasik, Agata M; Grandien, Alf; Andersson, Patrik; Kimby, Eva; Dahlman-Wright, Karin; Zhao, Chunyan; Christensson, Birger; Sander, Birgitta

    2010-01-01

    The SRY (sex determining region Y)-box 11 (SOX11) gene, located on chromosome 2p25, encodes for a transcription factor that is involved in tissue remodeling during embryogenesis and is crucial for neurogenesis. The role for SOX11 in hematopoiesis has not yet been defined. Two genes under direct control of SOX11 are the class- III β-tubulin gene (TUBB3) in neural cells and the transcription factor TEA domain family member 2 (TEAD2) in neural and mesenchymal progenitor cells. Normal, mature lymphocytes lack SOX11 but express SOX4, another member of the same group of SOX transcription factors. We and others recently identified SOX11 as aberrantly expressed in mantle cell lymphoma (MCL). Since SOX11 is variably expressed in MCL it may not be essential for tumorigenesis, but may carry prognostic information. Currently, no specific functional effects have been linked to SOX11 expression in MCL and it is not known which genes are under influence of SOX11 in lymphoma. In this study we found variable expression of SOX11, SOX4 and SOX12 mRNA in mantle cell lymphoma cell lines. Downregulation of SOX11 expression by siRNA verified that SOX11 controlled the expression of the gene TUBB3 in the MCL cell line Granta 519. Furthermore we identified, by global gene expression analysis, 26 new target genes influenced by siRNA SOX11 downmodulation. Among these genes, DBN1, SETMAR and HIG2 were found to be significantly correlated to SOX11 expression in two cohorts of primary mantle cell lymphomas. Chromatin immunoprecipitation (ChIP) analysis showed that these genes are direct targets of the SOX11 protein. In spite of almost complete downregulation of the SOX11 protein no significant effects on Granta 519 cell proliferation or survival in short term in vitro experiments was found. In summary we have identified a number of genes influenced by SOX11 expression in MCL cell lines and primary MCL. Among these genes, DBN1, SETMAR and HIG2 are direct transcriptional targets of the SOX11

  7. Genome engineering and direct cloning of antibiotic gene clusters via phage ϕBT1 integrase-mediated site-specific recombination in Streptomyces

    PubMed Central

    Du, Deyao; Wang, Lu; Tian, Yuqing; Liu, Hao; Tan, Huarong; Niu, Guoqing

    2015-01-01

    Several strategies have been used to clone large DNA fragments directly from bacterial genome. Most of these approaches are based on different site-specific recombination systems consisting of a specialized recombinase and its target sites. In this study, a novel strategy based on phage ϕBT1 integrase-mediated site-specific recombination was developed, and used for simultaneous Streptomyces genome engineering and cloning of antibiotic gene clusters. This method has been proved successful for the cloning of actinorhodin gene cluster from Streptomyces coelicolor M145, napsamycin gene cluster and daptomycin gene cluster from Streptomyces roseosporus NRRL 15998 at a frequency higher than 80%. Furthermore, the system could be used to increase the titer of antibiotics as we demonstrated with actinorhodin and daptomycin, and it will be broadly applicable in many Streptomyces. PMID:25737113

  8. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    SciTech Connect

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng . E-mail: Dongfeng_pan@yahoo.com

    2005-09-09

    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.

  9. WNT/β-catenin signaling promotes VSMCs to osteogenic transdifferentiation and calcification through directly modulating Runx2 gene expression.

    PubMed

    Cai, Ting; Sun, Danqin; Duan, Ying; Wen, Ping; Dai, Chunsun; Yang, Junwei; He, Weichun

    2016-07-15

    Arterial medial calcification (AMC) is prevalent in patients with chronic kidney disease (CKD) and contributes to elevated risk of cardiovascular events and mortality. Vascular smooth muscle cells (VSMCs) to osteogenic transdifferentiation (VOT) in a high-phosphate environment is involved in the pathogenesis of AMC in CKD. WNT/β-catenin signaling is indicated to play a crucial role in osteogenesis via promoting Runx2 expression in osteoprogenitor cells, however, its role in Runx2 regulation and VOT remains incompletely clarified. In this study, Runx2 was induced and β-catenin was activated by high-phosphate in VSMCs. Two forms of active β-catenin, dephosphorylated on Ser37/Thr41 and phosphorylated on Ser675 sites, were upregulated by high-phosphate. Activation of β-catenin, through ectopic expression of stabilized β-catenin, inhibition of GSK-3β, or WNT-3A protein, induced Runx2 expression, whereas blockade of WNT/β-catenin signaling with Porcupine (PORCN) inhibitor or Dickkopf-1 (DKK1) protein inhibited Runx2 induction by high-phosphate. WNT-3A promoted osteocalcin expression and calcium deposition in VSMCs, whereas DKK1 ameliorated calcification of VSMCs induced by high-phosphate. Two functional T cell factor (TCF)/lymphoid enhancer-binding factor binding sites were identified in the promoter region of Runx2 gene in VSMCs, which interacted with TCF upon β-catenin activation. Site-directed mutation of each of them attenuated Runx2 response to β-catenin, and deletion or destruction of both of them completely abolished this responsiveness. In the aortic tunica media of rats with chronic renal failure, followed by AMC, Runx2 and β-catenin was induced, and the Runx2 mRNA level was positively associated with the abundance of phosphorylated β-catenin (Ser675). Collectively, our study suggested that high-phosphate may activate WNT/β-catenin signaling through different pathways, and the activated WNT/β-catenin signaling, through direct downstream target Runx2

  10. Sequences contained within the promoter of the human thymidine kinase gene can direct cell-cycle regulation of heterologous fusion genes.

    PubMed Central

    Kim, Y K; Wells, S; Lau, Y F; Lee, A S

    1988-01-01

    Recent evidence on the transcriptional regulation of the human thymidine kinase (TK) gene raises the possibility that cell-cycle regulatory sequences may be localized within its promoter. A hybrid gene that combines the TK 5' flanking sequence and the coding region of the bacterial neomycin-resistance gene (neo) has been constructed. Upon transfection into a hamster fibroblast cell line K12, the hybrid gene exhibits cell-cycle-dependent expression. Deletion analysis reveals that the region important for cell-cycle regulation is within -441 to -63 nucleotides from the transcriptional initiation site. This region (-441 to -63) also confers cell-cycle regulation to the herpes simplex virus thymidine kinase (HSVtk) promoter, which is not expressed in a cell-cycle manner. We conclude that the -441 to -63 sequence within the human TK promoter is important for cell-cycle-dependent expression. Images PMID:3413063

  11. Gene-specific amplicons from metagenomes as an alternative to directed evolution for enzyme screening: a case study using phenylacetaldehyde reductases.

    PubMed

    Itoh, Nobuya; Kazama, Miki; Takeuchi, Nami; Isotani, Kentaro; Kurokawa, Junji

    2016-06-01

    Screening gene-specific amplicons from metagenomes (S-GAM) is a highly promising technique for the isolation of genes encoding enzymes for biochemical and industrial applications. From metagenomes, we isolated phenylacetaldehyde reductase (par) genes, which code for an enzyme that catalyzes the production of various Prelog's chiral alcohols. Nearly full-length par genes were amplified by PCR from metagenomic DNA, the products of which were fused with engineered par sequences at both terminal regions of the expression vector to ensure proper expression and then used to construct Escherichia coli plasmid libraries. Sequence- and activity-based screening of these libraries identified different homologous par genes, Hpar-001 to -036, which shared more than 97% amino acid sequence identity with PAR. Comparative characterization of these active homologs revealed a wide variety of enzymatic properties including activity, substrate specificity, and thermal stability. Moreover, amino acid substitutions in these genes coincided with those of Sar268 and Har1 genes, which were independently engineered by error-prone PCR to exhibit increased activity in the presence of concentrated 2-propanol. The comparative data from both approaches suggest that sequence information from homologs isolated from metagenomes is quite useful for enzyme engineering. Furthermore, by examining the GAM-based sequence dataset derived from soil metagenomes, we easily found amino acid substitutions that increase the thermal stability of PAR/PAR homologs. Thus, GAM-based approaches can provide not only useful homologous enzymes but also an alternative to directed evolution methodologies. PMID:27419059

  12. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System

    PubMed Central

    You, Zhipeng; Lissouba, Alexandra; Chen, Brian Edwin; Drapeau, Pierre

    2016-01-01

    The methodology for site-directed editing of single nucleotides in the vertebrate genome is of considerable interest for research in biology and medicine. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 type II (Cas9) system has emerged as a simple and inexpensive tool for editing genomic loci of interest in a variety of animal models. In zebrafish, error-prone non-homologous end joining (NHEJ) has been used as a simple method to disrupt gene function. We sought to develop a method to easily create site-specific SNPs in the zebrafish genome. Here, we report simple methodologies for using CRISPR/Cas9-mediated homology directed repair using single-stranded oligodeoxynucleotide donor templates (ssODN) for site-directed single nucleotide editing, for the first time in two disease-related genes, tardbp and fus. PMID:26930076

  13. The Lactobacillus acidophilus S-layer protein gene expression site comprises two consensus promoter sequences, one of which directs transcription of stable mRNA.

    PubMed Central

    Boot, H J; Kolen, C P; Andreadaki, F J; Leer, R J; Pouwels, P H

    1996-01-01

    S-proteins are proteins which form a regular structure (S-layer) on the outside of the cell walls of many bacteria. Two S-protein-encoding genes are located in opposite directions on a 6.0-kb segment of the chromosome of Lactobacillus acidophilus ATCC 4356 bacteria. Inversion of this chromosomal segment occurs through recombination between two regions with identical sequences, thereby interchanging the expressed and the silent genes. In this study, we show that the region involved in recombination also has a function in efficient S-protein production. Two promoter sequences are present in the S-protein gene expression site, although only the most downstream promoter (P-1) is used to direct mRNA synthesis. S-protein mRNA directed by this promoter has a half-life of 15 min. Its untranslated leader can form a stable secondary structure in which the 5' end is base paired, whereas the ribosome-binding site is exposed. Truncation of this leader sequence results in a reduction in protein production, as shown by reporter gene analysis of Lactobacillus casei. The results obtained indicate that the untranslated leader sequence of S-protein mRNA is involved in efficient S-protein production. PMID:8808926

  14. Putative direct and indirect Wnt targets identified through consistent gene expression changes in APC-mutant intestinal adenomas from humans and mice

    PubMed Central

    Segditsas, Stefania; Sieber, Oliver; Deheragoda, Maesha; East, Phil; Rowan, Andrew; Jeffery, Rosemary; Nye, Emma; Clark, Susan; Spencer-Dene, Bradley; Stamp, Gordon; Poulsom, Richard; Suraweera, Nirosha; Silver, Andrew; Ilyas, Mohammad; Tomlinson, Ian

    2008-01-01

    In order to identify new genes with differential expression in early intestinal tumours, we performed mRNA (messenger ribonucleic acid) expression profiling of 16 human and 63 mouse adenomas. All individuals had germline APC mutations to ensure that tumorigenesis was driven by ‘second hits’ at APC. Using stringent filtering to identify changes consistent between humans and mice, we identified 60 genes up-regulated and 151 down-regulated in tumours. For 22 selected genes—including known Wnt targets—expression differences were confirmed by qRT–PCR (quantitative reverse transcription polymerase chain reaction). Most, but not all, differences were also present in colorectal carcinomas. In situ analysis showed a complex picture. Expression of up-regulated genes in adenomas was usually uniform/diffuse (e.g. ITGA6) or prominent in the tumour core (e.g. LGR5); in normal tissue, these genes were expressed at crypt bases or the transit amplifying zone. Down-regulated genes were often undetectable in adenomas, but in normal tissue were expressed in mesenchyme (e.g. GREM1/2) or differentiated cells towards crypt tops (e.g. SGK1). In silico analysis of TCF4-binding motifs showed that some of our genes were probably direct Wnt targets. Previous studies, mostly focused on human tumours, showed partial overlap with our ‘expression signature’, but 37 genes were unique to our study, including TACSTD2, SEMA3F, HOXA9 and IER3 (up-regulated), and TAGLN, GREM1, GREM2, MAB21L2 and RARRES2 (down-regulated). Combined analysis of our and published human data identified additional genes differentially expressed in adenomas, including decreased BMPs (bone morphogenetic proteins) and increased BUB1/BUB1B. Several of the newly identified, differentially expressed genes represent potential diagnostic or therapeutic targets for intestinal tumours. PMID:18782851

  15. Pandemic H1N1 influenza A directly induces a robust and acute inflammatory gene signature in primary human bronchial epithelial cells downstream of membrane fusion

    SciTech Connect

    Paquette, Stéphane G.; Banner, David; Chi, Le Thi Bao; Leon, Alberto J.; Xu, Luoling; Ran, Longsi; Huang, Stephen S.H.; Farooqui, Amber; and others

    2014-01-05

    Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directly triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development.

  16. Introduction: Invertebrate Neuropeptides XIII

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This publication represents an introduction to the thirteenth in a series of special issues of the Peptides journal dedicated to invertebrate neuropeptides. The issue addresses a number of aspects of invertebrate neuropeptide research including identification of novel invertebrate neuropeptide sequ...

  17. Introduction: Invertebrate Neuropeptides IX

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Abstract This publication represents an introduction to the fifth in a series of special issues of the Peptides journal dedicated to invertebrate neuropeptides. The issue addresses a number of aspects of invertebrate neuropeptide research including identification of novel invertebrate neuropeptide ...

  18. Introduction to stellar evolution

    NASA Astrophysics Data System (ADS)

    Scilla, Degl’Innocenti

    2016-04-01

    This contribution is meant as a first brief introduction to stellar physics. First I shortly describe the main physical processes active in stellar structures then I summarize the most important features during the stellar life-cycle.

  19. Introduction: Invertebrate Neuropeptides XV

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This publication represents an introduction to the fifteenth in a series of special issues of the Peptides journal dedicated to invertebrate neuropeptides. The issue addresses a number of aspects of invertebrate neuropeptide research including identification of novel invertebrate neuropeptide seque...

  20. HSI2 Repressor Recruits MED13 and HDA6 to Down-Regulate Seed Maturation Gene Expression Directly During Arabidopsis Early Seedling Growth.

    PubMed

    Chhun, Tory; Chong, Suet Yen; Park, Bong Soo; Wong, Eriko Chi Cheng; Yin, Jun-Lin; Kim, Mijung; Chua, Nam-Hai

    2016-08-01

    Arabidopsis HSI2 (HIGH-LEVEL EXPRESSION OF SUGAR-INDUCIBLE GENE 2) which carries a EAR (ERF-associated amphiphilic repression) motif acts as a repressor of seed maturation genes and lipid biosynthesis, whereas MEDIATOR (MED) is a conserved multiprotein complex linking DNA-bound transcription factors to RNA polymerase II transcription machinery. How HSI2 executes its repressive function through MED is hitherto unknown. Here, we show that HSI2 and its homolog, HSI2-lik (HSL1), are able to form homo- and heterocomplexes. Both factors bind to the TRAP240 domain of MED13, a subunit of the MED CDK8 module. Mutant alleles of the med13 mutant show elevated seed maturation gene expression and increased lipid accumulation in cotyledons; in contrast, HSI2- or MED13-overexpressing plants display the opposite phenotypes. The overexpression phenotypes of HSI2 and MED13 are abolished in med13 and hsi2 hsl1, respectively, indicating that HSI2 and MED13 together are required for these functions. The HSI2 C-terminal region interacts with HDA6, whose overexpression also reduces seed maturation gene expression and lipid accumulation. Moreover, HSI2, MED13 and HDA6 bind to the proximal promoter and 5'-coding regions of seed maturation genes. Taken together, our results suggest that HSI2 recruits MED13 and HDA6 to suppress directly a subset of seed maturation genes post-germination. PMID:27335347

  1. Site-targeted non-viral gene delivery by direct DNA injection into the pancreatic parenchyma and subsequent in vivo electroporation in mice

    PubMed Central

    Sato, Masahiro; Inada, Emi; Saitoh, Issei; Ohtsuka, Masato; Nakamura, Shingo; Sakurai, Takayuki; Watanabe, Satoshi

    2013-01-01

    The pancreas is considered an important gene therapy target because the organ is the site of several high burden diseases, including diabetes mellitus, cystic fibrosis, and pancreatic cancer. We aimed to develop an efficient in vivo gene delivery system using non-viral DNA. Direct intra-parenchymal injection of a solution containing circular plasmid pmaxGFP DNA was performed on adult anesthetized ICR female mice. The injection site was sandwiched with a pair of tweezer-type electrode disks, and electroporated using a square-pulse generator. Green fluorescent protein (GFP) expression within the injected pancreatic portion was observed one day after gene delivery. GFP expression reduced to baseline within a week of transfection. Application of voltages over 40 V resulted in tissue damage during electroporation. We demonstrate that electroporation is effective for safe and efficient transfection of pancreatic cells. This novel gene delivery method to the pancreatic parenchyma may find application in gene therapy strategies for pancreatic diseases and in investigation of specific gene function in situ. PMID:23946268

  2. Staph ID/R: a Rapid Method for Determining Staphylococcus Species Identity and Detecting the mecA Gene Directly from Positive Blood Culture

    PubMed Central

    Pasko, Chris; Dunn, John; Jaeckel, Heidi; Nieuwlandt, Dan; Weed, Diane; Woodruff, Evelyn; Zheng, Xiaotian

    2012-01-01

    Rapid diagnosis of staphylococcal bacteremia directs appropriate antimicrobial therapy, leading to improved patient outcome. We describe herein a rapid test (<75 min) that can identify the major pathogenic strains of Staphylococcus to the species level as well as the presence or absence of the methicillin resistance determinant gene, mecA. The test, Staph ID/R, combines a rapid isothermal nucleic acid amplification method, helicase-dependent amplification (HDA), with a chip-based array that produces unambiguous visible results. The analytic sensitivity was 1 CFU per reaction for the mecA gene and was 1 to 250 CFU per reaction depending on the staphylococcal species present in the positive blood culture. Staph ID/R has excellent specificity as well, with no cross-reactivity observed. We validated the performance of Staph ID/R by testing 104 frozen clinical positive blood cultures and comparing the results with rpoB gene or 16S rRNA gene sequencing for species identity determinations and mecA gene PCR to confirm mecA gene results. Staph ID/R agreed with mecA gene PCR for all samples and agreed with rpoB/16S rRNA gene sequencing in all cases except for one sample that contained a mixture of two staphylococcal species, one of which Staph ID/R correctly identified, for an overall agreement of 99.0% (P < 0.01). Staph ID/R could potentially be used to positively affect patient management for Staphylococcus-mediated bacteremia. PMID:22170912

  3. The Hos2 Histone Deacetylase Controls Ustilago maydis Virulence through Direct Regulation of Mating-Type Genes

    PubMed Central

    Elías-Villalobos, Alberto; Fernández-Álvarez, Alfonso; Moreno-Sánchez, Ismael; Helmlinger, Dominique; Ibeas, José I.

    2015-01-01

    Morphological changes are critical for host colonisation in plant pathogenic fungi. These changes occur at specific stages of their pathogenic cycle in response to environmental signals and are mediated by transcription factors, which act as master regulators. Histone deacetylases (HDACs) play crucial roles in regulating gene expression, for example by locally modulating the accessibility of chromatin to transcriptional regulators. It has been reported that HDACs play important roles in the virulence of plant fungi. However, the specific environment-sensing pathways that control fungal virulence via HDACs remain poorly characterised. Here we address this question using the maize pathogen Ustilago maydis. We find that the HDAC Hos2 is required for the dimorphic switch and pathogenic development in U. maydis. The deletion of hos2 abolishes the cAMP-dependent expression of mating type genes. Moreover, ChIP experiments detect Hos2 binding to the gene bodies of mating-type genes, which increases in proportion to their expression level following cAMP addition. These observations suggest that Hos2 acts as a downstream component of the cAMP-PKA pathway to control the expression of mating-type genes. Interestingly, we found that Clr3, another HDAC present in U. maydis, also contributes to the cAMP-dependent regulation of mating-type gene expression, demonstrating that Hos2 is not the only HDAC involved in this control system. Overall, our results provide new insights into the role of HDACs in fungal phytopathogenesis. PMID:26317403

  4. Site-Directed Genome Knockout in Chicken Cell Line and Embryos Can Use CRISPR/Cas Gene Editing Technology

    PubMed Central

    Zuo, Qisheng; Wang, Yinjie; Cheng, Shaoze; Lian, Chao; Tang, Beibei; Wang, Fei; Lu, Zhenyu; Ji, Yanqing; Zhao, Ruifeng; Zhang, Wenhui; Jin, Kai; Song, Jiuzhou; Zhang, Yani; Li, Bichun

    2016-01-01

    The present study established an efficient genome editing approach for the construction of stable transgenic cell lines of the domestic chicken (Gallus gallus domesticus). Our objectives were to facilitate the breeding of high-yield, high-quality chicken strains, and to investigate gene function in chicken stem cells. Three guide RNA (gRNAs) were designed to knockout the C2EIP gene, and knockout efficiency was evaluated in DF-1 chicken fibroblasts and chicken ESCs using the luciferase single-strand annealing (SSA) recombination assay, T7 endonuclease I (T7EI) assay, and TA clone sequencing. In addition, the polyethylenimine-encapsulated Cas9/gRNA plasmid was injected into fresh fertilized eggs. At 4.5 d later, frozen sections of the embryos were prepared, and knockout efficiency was evaluated by the T7EI assay. SSA assay results showed that luciferase activity of the vector expressing gRNA-3 was double that of the control. Results of the T7EI assay and TA clone sequencing indicated that Cas9/gRNA vector-mediated gene knockdown efficiency was approximately 27% in both DF-1 cells and ESCs. The CRISPR/Cas9 vector was also expressed in chicken embryos, resulting in gene knockdown in three of the 20 embryos (gene knockdown efficiency 15%). Taken together, our results indicate that the CRISPR/Cas9 system can mediate stable gene knockdown at the cell and embryo levels in domestic chickens. PMID:27172204

  5. Site-Directed Genome Knockout in Chicken Cell Line and Embryos Can Use CRISPR/Cas Gene Editing Technology.

    PubMed

    Zuo, Qisheng; Wang, Yinjie; Cheng, Shaoze; Lian, Chao; Tang, Beibei; Wang, Fei; Lu, Zhenyu; Ji, Yanqing; Zhao, Ruifeng; Zhang, Wenhui; Jin, Kai; Song, Jiuzhou; Zhang, Yani; Li, Bichun

    2016-01-01

    The present study established an efficient genome editing approach for the construction of stable transgenic cell lines of the domestic chicken (Gallus gallus domesticus). Our objectives were to facilitate the breeding of high-yield, high-quality chicken strains, and to investigate gene function in chicken stem cells. Three guide RNA (gRNAs) were designed to knockout the C2EIP gene, and knockout efficiency was evaluated in DF-1 chicken fibroblasts and chicken ESCs using the luciferase single-strand annealing (SSA) recombination assay, T7 endonuclease I (T7EI) assay, and TA clone sequencing. In addition, the polyethylenimine-encapsulated Cas9/gRNA plasmid was injected into fresh fertilized eggs. At 4.5 d later, frozen sections of the embryos were prepared, and knockout efficiency was evaluated by the T7EI assay. SSA assay results showed that luciferase activity of the vector expressing gRNA-3 was double that of the control. Results of the T7EI assay and TA clone sequencing indicated that Cas9/gRNA vector-mediated gene knockdown efficiency was approximately 27% in both DF-1 cells and ESCs. The CRISPR/Cas9 vector was also expressed in chicken embryos, resulting in gene knockdown in three of the 20 embryos (gene knockdown efficiency 15%). Taken together, our results indicate that the CRISPR/Cas9 system can mediate stable gene knockdown at the cell and embryo levels in domestic chickens. PMID:27172204

  6. Mono-(2-ethylhexyl) Phthalate Directly Alters the Expression of Leydig Cell Genes and CYP17 Lyase Activity in Cultured Rat Fetal Testis

    PubMed Central

    Chauvigné, François; Plummer, Simon; Lesné, Laurianne; Cravedi, Jean-Pierre; Dejucq-Rainsford, Nathalie; Fostier, Alexis; Jégou, Bernard

    2011-01-01

    Exposure to phthalates in utero alters fetal rat testis gene expression and testosterone production, but much remains to be done to understand the mechanisms underlying the direct action of phthalate within the fetal testis. We aimed to investigate the direct mechanisms of action of mono-(2-ethylhexyl) phthalate (MEHP) on the rat fetal testis, focusing on Leydig cell steroidogenesis in particular. We used an in vitro system based on the culture for three days, with or without MEHP, of rat fetal testes obtained at 14.5 days post-coitum. Exposure to MEHP led to a dose-dependent decrease in testosterone production. Moreover, the production of 5 alpha-dihydrotestosterone (5α-DHT) (−68%) and androstenedione (−54%) was also inhibited by 10 µM MEHP, whereas 17 alpha-hydroxyprogesterone (17α-OHP) production was found to increase (+41%). Testosterone synthesis was rescued by the addition of androstenedione but not by any of the other precursors used. Thus, the hormone data suggested that steroidogenesis was blocked at the level of the 17,20 lyase activity of the P450c17 enzyme (CYP17), converting 17α-OHP to androstenedione. The subsequent gene expression and protein levels supported this hypothesis. In addition to Cyp17a1, microarray analysis showed that several other genes important for testes development were affected by MEHP. These genes included those encoding insulin-like factor 3 (INSL3), which is involved in controlling testicular descent, and Inha, which encodes the alpha subunit of inhibin B. These findings indicate that under in vitro conditions known to support normal differentiation of the fetal rat testis, the exposure to MEHP directly inhibits several important Leydig cell factors involved in testis function and that the Cyp17a1 gene is a specific target to MEHP explaining the MEHP-induced suppression of steroidogenesis observed. PMID:22087261

  7. The auxin response factor MONOPTEROS controls meristem function and organogenesis in both the shoot and root through the direct regulation of PIN genes.

    PubMed

    Krogan, Naden T; Marcos, Danielle; Weiner, Aaron I; Berleth, Thomas

    2016-10-01

    The regulatory effect auxin has on its own transport is critical in numerous self-organizing plant patterning processes. However, our understanding of the molecular mechanisms linking auxin signal transduction and auxin transport is still fragmentary, and important regulatory genes remain to be identified. To track a key link between auxin signaling and auxin transport in development, we established an Arabidopsis thaliana genetic background in which fundamental patterning processes in both shoot and root were essentially abolished and the expression of PIN FORMED (PIN) auxin efflux facilitators was dramatically reduced. In this background, we demonstrate that activating a steroid-inducible variant of the auxin response factor (ARF) MONOPTEROS (MP) is sufficient to restore patterning and PIN gene expression. Further, we show that MP binds to distinct promoter elements of multiple genetically defined PIN genes. Our work identifies a direct regulatory link between central, well-characterized genes involved in auxin signal transduction and auxin transport. The steroid-inducible MP system directly demonstrates the importance of this molecular link in multiple patterning events in embryos, shoots and roots, and provides novel options for interrogating the properties of self-regulated auxin-based patterning in planta. PMID:27441727

  8. Functional analysis of the long terminal repeats of intracisternal A-particle genes: Sequences within the U3 region determine both the efficiency and direction of promoter activity

    SciTech Connect

    Christy, R.J.; Huang, R.C.C.

    1988-03-01

    The transcriptional activity of five intracisternal A-particle (IAP) long terminal repeats (LTRs) in mouse embryonal carcinoma PCC3-A/1 cells and in Ltk/sup -/ cells was determined. The authors tested the promoter activity of the LTRs by coupling them to the reporter gene chloramphenicol acetyltransferase (CAT) or guanosine-xanthine phosphoribosyltransferase (gpt). Each LTR was tested for promoter function in both the sense (5' to 3') and antisense (3' to 5') orientation preceding the reporter gene. The transcriptional activity of individual IAP gene LTRs varied considerably, and the LTR from IAP81 possessed promoter activity in both directions. The bidirectional activity of the IAP81 LTR was confirmed by monitoring Ecogpt expression in stably transfected Ltk/sup -/ cells, with the initiation sites for sense and antisense transcription being localized to within the IAP81 LTR by S1 nuclease mapping. Deletions of LTR81 show that for normal 5'-to-3' gene transcription (sense direction), the /sup 3'/U3/R region determines the basal level of transcription, whereas sequences within the /sup 5'/U3 region enhance transcription four- to fivefold. Deletion mapping for antisense transcription indicates that a 64-base-pair region (nucleotides 47 to 110) within the U3 region is essential for activity. These data indicate that the U3 region contains all the regulatory elements for bidirectional transcription in IAP LTRs.

  9. Glucagon gene 5'-flanking sequences direct expression of simian virus 40 large T antigen to the intestine, producing carcinoma of the large bowel in transgenic mice.

    PubMed

    Lee, Y C; Asa, S L; Drucker, D J

    1992-05-25

    Glucagon and the glucagon-like peptides play important roles in the regulation of glucose homeostasis. Previous studies have demonstrated that approximately 1300 base pairs of rat glucagon gene 5'-flanking sequences direct transgene expression to the pancreas and brain, but not to the intestine, of transgenic mice. These observations suggested that different tissue-specific enhancer elements mediate activation of glucagon gene transcription in the pancreas and intestine. We have now generated mice that express SV40 large T antigen under the control of approximately 2000 base pairs of glucagon gene 5'-flanking sequences. Transgene expression was observed in the brain and pancreas in association with the development of pancreatic endocrine tumors. In contrast to the mice described previously, we also detected transgene expression throughout the gastrointestinal tract in endocrine cells of the stomach and small and large intestine. Focal areas of enteroendocrine cell hyperplasia in the large bowel invariably progressed to invasive and metastasizing plurihormonal endocrine carcinoma, which was clinically and pathologically evident by 4 weeks of age. In contrast, transgene expression in the small bowel and stomach was not associated with progression to either hyperplasia or carcinoma. The results of these studies provide functional evidence for the existence of an upstream cis-acting regulatory domain that directs glucagon gene transcription to the endocrine cells of the intestine in transgenic mice. PMID:1587847

  10. Direct repeat-mediated DNA deletion of the mating type MAT1-2 genes results in unidirectional mating type switching in Sclerotinia trifoliorum

    PubMed Central

    Xu, Liangsheng; Jardini, Teresa M.; Chen, Weidong

    2016-01-01

    The necrotrophic fungal pathogen Sclerotinia trifoliorum exhibits ascospore dimorphism and unidirectional mating type switching - self-fertile strains derived from large ascospores produce both self-fertile (large-spores) and self-sterile (small-spores) offsprings in a 4:4 ratio. The present study, comparing DNA sequences at MAT locus of both self-fertile and self-sterile strains, found four mating type genes (MAT1-1-1, MAT1-1-5, MAT1-2-1 and MAT1-2-4) in the self-fertile strain. However, a 2891-bp region including the entire MAT1-2-1 and MAT1-2-4 genes had been completely deleted from the MAT locus in the self-sterile strain. Meanwhile, two copies of a 146-bp direct repeat motif flanking the deleted region were found in the self-fertile strain, but only one copy of this 146-bp motif (a part of the MAT1-1-1 gene) was present in the self-sterile strain. The two direct repeats were believed to be responsible for the deletion through homologous intra-molecular recombination in meiosis. Tetrad analyses showed that all small ascospore-derived strains lacked the missing DNA between the two direct repeats that was found in all large ascospore-derived strains. In addition, heterokaryons at the MAT locus were observed in field isolates as well as in laboratory derived isolates. PMID:27255676

  11. Direct repeat-mediated DNA deletion of the mating type MAT1-2 genes results in unidirectional mating type switching in Sclerotinia trifoliorum.

    PubMed

    Xu, Liangsheng; Jardini, Teresa M; Chen, Weidong

    2016-01-01

    The necrotrophic fungal pathogen Sclerotinia trifoliorum exhibits ascospore dimorphism and unidirectional mating type switching - self-fertile strains derived from large ascospores produce both self-fertile (large-spores) and self-sterile (small-spores) offsprings in a 4:4 ratio. The present study, comparing DNA sequences at MAT locus of both self-fertile and self-sterile strains, found four mating type genes (MAT1-1-1, MAT1-1-5, MAT1-2-1 and MAT1-2-4) in the self-fertile strain. However, a 2891-bp region including the entire MAT1-2-1 and MAT1-2-4 genes had been completely deleted from the MAT locus in the self-sterile strain. Meanwhile, two copies of a 146-bp direct repeat motif flanking the deleted region were found in the self-fertile strain, but only one copy of this 146-bp motif (a part of the MAT1-1-1 gene) was present in the self-sterile strain. The two direct repeats were believed to be responsible for the deletion through homologous intra-molecular recombination in meiosis. Tetrad analyses showed that all small ascospore-derived strains lacked the missing DNA between the two direct repeats that was found in all large ascospore-derived strains. In addition, heterokaryons at the MAT locus were observed in field isolates as well as in laboratory derived isolates. PMID:27255676

  12. Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy with recombinant adenoviruses.

    PubMed Central

    Yang, Y; Li, Q; Ertl, H C; Wilson, J M

    1995-01-01

    Recombinant adenoviruses are an attractive vehicle for gene therapy to the lung in the treatment of cystic fibrosis (CF). First-generation viruses deleted of E1a and E1b transduce genes into airway epithelial cells in vivo; however, expression of the transgene is transient and associated with substantial inflammatory responses, and gene transfer is significantly reduced following a second administration of the virus. In this study, we have used mice deficient in immunological effector functions in combination with adoptive and passive transfer techniques to define antigen-specific cellular and humoral immune responses that underlie these important limitations. Our studies indicate that major histocompatibility complex class I-restricted CD8+ cytotoxic T lymphocytes are activated in response to newly synthesized antigens, leading to destruction of virus infected cells and loss of transgene expression. Major histocompatibility complex class II-associated presentation of exogenous viral antigens activates CD4+ T-helper (TH) cells of the TH1 subset and, to a lesser extent, of the TH2 subset. CD4+ cell-mediated responses are insufficient in the absence of cytotoxic T cells to completely eliminate transgene containing cells; however, they contribute to the formation of neutralizing antibodies in the airway which block subsequent adenovirus-mediated gene transfer. Definition of immunological barriers to gene therapy of cystic fibrosis should facilitate the design of rational strategies to overcome them. PMID:7884845

  13. [Direct cloning of gene encoding a novel amylomaltase from soil bacterial DNA for large-ring cyclodextrin production].

    PubMed

    Sawasdee, K; Rudeekulthamrong, P; Zimmermann, W; Murakami, S; Pongsawasdi, P; Kaulpiboon, J

    2014-01-01

    The aim of this study was to isolate a novel amylomaltase gene from community DNA of soil samples collected from Ban Nong Khrok hot spring in Thailand without bacterial cultivation. Using PCR, a 1.5 kb full-length gene was amplified and ligated with pGEM-T easy vector to transform into Escherichia coli DH5 alpha for sequencing. The obtained gene encoding an amylomaltase consisted of 1.503 bp that translated into 500 amino acids. Amino acid sequence deduced from this gene was highly homologous with that of amylomaltase from Thermus thermophillus ATCC 33923. In order to express the enzyme, the cloned gene was subcloned into plasmid pET-17b and introduced into E. coli BL21 (DE3). The maximum expression was observed when the cloned cells were cultured at 37 degrees C for 6 h with 0.5 mM IPTG induction. By 10% SDS-PAGE, the relative molecular mass of the purified amylomaltase was approximately 58 kDa. This enzyme was optimally active at 70 degrees C and pH 9.0. In addition, the enzyme could hydrolyze pea starch to yield the large-ring cyclodextrins with degrees of polymerization of 23 and higher. It is noted that CD29 was the product in the largest quantity under all tested conditions. PMID:25272748

  14. A PPO Promoter from Betalain-Producing Red Swiss Chard, Directs Petiole- and Root-Preferential Expression of Foreign Gene in Anthocyanins-Producing Plants.

    PubMed

    Yu, Zhi-Hai; Han, Ya-Nan; Xiao, Xing-Guo

    2015-01-01

    A 1670 bp 5'-flanking region of the polyphenol oxidase (PPO) gene was isolated from red Swiss chard, a betalain-producing plant. This region, named promoter BvcPPOP, and its 5'-truncated versions were fused with the GUS gene and introduced into Arabidopsis, an anthocyanins-producing plant. GUS histochemical staining and quantitative analysis of transgenic plants at the vegetative and reproductive stages showed that BvcPPOP could direct GUS gene expression in vegetative organs with root- and petiole-preference, but not in reproductive organs including inflorescences shoot, inflorescences leaf, flower, pod and seed. This promoter was regulated by developmental stages in its driving strength, but not in expression pattern. It was also regulated by the abiotic stressors tested, positively by salicylic acid (SA) and methyl jasmonate (MeJA) but negatively by abscisic acid (ABA), gibberellin (GA), NaCl and OH(-). Its four 5'-truncated versions varied in the driving strength, but not obviously in expression pattern, and even the shortest version (-225 to +22) retained the root- and petiole- preference. This promoter is, to our knowledge, the first PPO promoter cloned and functionally elucidated from the betalain-producing plant, and thus provides not only a useful tool for expressing gene(s) of agricultural interest in vegetative organs, but also a clue to clarify the function of metabolism-specific PPO in betalain biosynthesis. PMID:26569235

  15. A PPO Promoter from Betalain-Producing Red Swiss Chard, Directs Petiole- and Root-Preferential Expression of Foreign Gene in Anthocyanins-Producing Plants

    PubMed Central

    Yu, Zhi-Hai; Han, Ya-Nan; Xiao, Xing-Guo

    2015-01-01

    A 1670 bp 5′-flanking region of the polyphenol oxidase (PPO) gene was isolated from red Swiss chard, a betalain-producing plant. This region, named promoter BvcPPOP, and its 5′-truncated versions were fused with the GUS gene and introduced into Arabidopsis, an anthocyanins-producing plant. GUS histochemical staining and quantitative analysis of transgenic plants at the vegetative and reproductive stages showed that BvcPPOP could direct GUS gene expression in vegetative organs with root- and petiole-preference, but not in reproductive organs including inflorescences shoot, inflorescences leaf, flower, pod and seed. This promoter was regulated by developmental stages in its driving strength, but not in expression pattern. It was also regulated by the abiotic stressors tested, positively by salicylic acid (SA) and methyl jasmonate (MeJA) but negatively by abscisic acid (ABA), gibberellin (GA), NaCl and OH−. Its four 5′-truncated versions varied in the driving strength, but not obviously in expression pattern, and even the shortest version (−225 to +22) retained the root- and petiole- preference. This promoter is, to our knowledge, the first PPO promoter cloned and functionally elucidated from the betalain-producing plant, and thus provides not only a useful tool for expressing gene(s) of agricultural interest in vegetative organs, but also a clue to clarify the function of metabolism-specific PPO in betalain biosynthesis. PMID:26569235

  16. Acute TNF-induced repression of cell identity genes is mediated by NFκB-directed redistribution of cofactors from super-enhancers.

    PubMed

    Schmidt, Søren Fisker; Larsen, Bjørk Ditlev; Loft, Anne; Nielsen, Ronni; Madsen, Jesper Grud Skat; Mandrup, Susanne

    2015-09-01

    The proinflammatory cytokine tumor necrosis factor (TNF) plays a central role in low-grade adipose tissue inflammation and development of insulin resistance during obesity. In this context, nuclear factor κ-light-chain-enhancer of activated B cells (NFκB) is directly involved and required for the acute activation of the inflammatory gene program. Here, we show that the major transactivating subunit of NFκB, v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA), is also required for acute TNF-induced suppression of adipocyte genes. Notably, this repression does not involve RELA binding to the associated enhancers but rather loss of cofactors and enhancer RNA (eRNA) selectively from high-occupancy sites within super-enhancers. Based on these data, we have developed models that, with high accuracy, predict which enhancers and genes are repressed by TNF in adipocytes. We show that these models are applicable to other cell types where TNF represses genes associated with super-enhancers in a highly cell-type-specific manner. Our results propose a novel paradigm for NFκB-mediated repression, whereby NFκB selectively redistributes cofactors from high-occupancy enhancers, thereby specifically repressing super-enhancer-associated cell identity genes. PMID:26113076

  17. Acute TNF-induced repression of cell identity genes is mediated by NFκB-directed redistribution of cofactors from super-enhancers

    PubMed Central

    Schmidt, Søren Fisker; Larsen, Bjørk Ditlev; Loft, Anne; Nielsen, Ronni; Madsen, Jesper Grud Skat; Mandrup, Susanne

    2015-01-01

    The proinflammatory cytokine tumor necrosis factor (TNF) plays a central role in low-grade adipose tissue inflammation and development of insulin resistance during obesity. In this context, nuclear factor κ-light-chain-enhancer of activated B cells (NFκB) is directly involved and required for the acute activation of the inflammatory gene program. Here, we show that the major transactivating subunit of NFκB, v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA), is also required for acute TNF-induced suppression of adipocyte genes. Notably, this repression does not involve RELA binding to the associated enhancers but rather loss of cofactors and enhancer RNA (eRNA) selectively from high-occupancy sites within super-enhancers. Based on these data, we have developed models that, with high accuracy, predict which enhancers and genes are repressed by TNF in adipocytes. We show that these models are applicable to other cell types where TNF represses genes associated with super-enhancers in a highly cell-type–specific manner. Our results propose a novel paradigm for NFκB-mediated repression, whereby NFκB selectively redistributes cofactors from high-occupancy enhancers, thereby specifically repressing super-enhancer-associated cell identity genes. PMID:26113076

  18. Transcription factor ATF4 directs basal and stress-induced gene expression in the unfolded protein response and cholesterol metabolism in the liver

    PubMed Central

    Fusakio, Michael E.; Willy, Jeffrey A.; Wang, Yongping; Mirek, Emily T.; Al Baghdadi, Rana J. T.; Adams, Christopher M.; Anthony, Tracy G.; Wek, Ronald C.

    2016-01-01

    Disturbances in protein folding and membrane compositions in the endoplasmic reticulum (ER) elicit the unfolded protein response (UPR). Each of three UPR sensory proteins—PERK (PEK/EIF2AK3), IRE1, and ATF6—is activated by ER stress. PERK phosphorylation of eIF2 represses global protein synthesis, lowering influx of nascent polypeptides into the stressed ER, coincident with preferential translation of ATF4 (CREB2). In cultured cells, ATF4 induces transcriptional expression of genes directed by the PERK arm of the UPR, including genes involved in amino acid metabolism, resistance to oxidative stress, and the proapoptotic transcription factor CHOP (GADD153/DDIT3). In this study, we characterize whole-body and tissue-specific ATF4-knockout mice and show in liver exposed to ER stress that ATF4 is not required for CHOP expression, but instead ATF6 is a primary inducer. RNA-Seq analysis indicates that ATF4 is responsible for a small portion of the PERK-dependent UPR genes and reveals a requirement for expression of ATF4 for expression of genes involved in oxidative stress response basally and cholesterol metabolism both basally and under stress. Consistent with this pattern of gene expression, loss of ATF4 resulted in enhanced oxidative damage, and increased free cholesterol in liver under stress accompanied by lowered cholesterol in sera. PMID:26960794

  19. REST-Governed Gene Expression Profiling in a Neuronal Cell Model Reveals Novel Direct and Indirect Processes of Repression and Up-Regulation

    PubMed Central

    Garcia-Manteiga, Jose M.; Bonfiglio, Silvia; Folladori, Lucrezia; Malosio, Maria L.; Lazarevic, Dejan; Stupka, Elia; Cittaro, Davide; Meldolesi, Jacopo

    2015-01-01

    The role of REST changes in neurons, including the rapid decrease of its level during differentiation and its fluctuations during many mature functions and diseases, is well established. However, identification of many thousand possible REST-target genes, mostly based on indirect criteria, and demonstration of their operative dependence on the repressor have been established for only a relatively small fraction. In the present study, starting from our recently published work, we have expanded the identification of REST-dependent genes, investigated in two clones of the PC12 line, a recognized neuronal cell model, spontaneously expressing different levels of REST: very low as in neurons and much higher as in most non-neural cells. The molecular, structural and functional differences of the two PC12 clones were shown to depend largely on their different REST level and the ensuing variable expression of some dependent genes. Comprehensive RNA-Seq analyses of the 13,700 genes expressed, validated by parallel RT-PCR and western analyses of mRNAs and encoded proteins, identified in the high-REST clone two groups of almost 900 repressed and up-regulated genes. Repression is often due to direct binding of REST to target genes; up-regulation to indirect mechanism(s) mostly mediated by REST repression of repressive transcription factors. Most, but not all, genes governing neurosecretion, excitability, and receptor channel signaling were repressed in the high REST clone. The genes governing expression of non-channel receptors (G protein-coupled and others), although variably affected, were often up-regulated together with the genes of intracellular kinases, small G proteins, cytoskeleton, cell adhesion, and extracellular matrix proteins. Expression of REST-dependent genes governing functions other than those mentioned so far were also identified. The results obtained by the parallel investigation of the two PC12 clones revealed the complexity of the REST molecular and

  20. Schizophrenia Susceptibility Genes Directly Implicated in the Life Cycles of Pathogens: Cytomegalovirus, Influenza, Herpes simplex, Rubella, and Toxoplasma gondii

    PubMed Central

    Carter, C.J.

    2009-01-01

    Many genes implicated in schizophrenia can be related to glutamatergic transmission and neuroplasticity, oligodendrocyte function, and other families clearly related to neurobiology and schizophrenia phenotypes. Others appear rather to be involved in the life cycles of the pathogens implicated in the disease. For example, aspartylglucosaminidase (AGA), PLA2, SIAT8B, GALNT7, or B3GAT1 metabolize chemical ligands to which the influenza virus, herpes simplex, cytomegalovirus (CMV), rubella, or Toxoplasma gondii bind. The epidermal growth factor receptor (EGR/EGFR) is used by the CMV to gain entry to cells, and a CMV gene codes for an interleukin (IL-10) mimic that binds the host cognate receptor, IL10R. The fibroblast growth factor receptor (FGFR1) is used by herpes simplex. KPNA3 and RANBP5 control the nuclear import of the influenza virus. Disrupted in schizophrenia 1 (DISC1) controls the microtubule network that is used by viruses as a route to the nucleus, while DTNBP1, MUTED, and BLOC1S3 regulate endosomal to lysosomal routing that is also important in viral traffic. Neuregulin 1 activates ERBB receptors releasing a factor, EBP1, known to inhibit the influenza virus transcriptase. Other viral or bacterial components bind to genes or proteins encoded by CALR, FEZ1, FYN, HSPA1B, IL2, HTR2A, KPNA3, MED12, MED15, MICB, NQO2, PAX6, PIK3C3, RANBP5, or TP53, while the cerebral infectivity of the herpes simplex virus is modified by Apolipoprotein E (APOE). Genes encoding for proteins related to the innate immune response, including cytokine related (CCR5, CSF2RA, CSF2RB, IL1B, IL1RN, IL2, IL3, IL3RA, IL4, IL10, IL10RA, IL18RAP, lymphotoxin-alpha, tumor necrosis factor alpha [TNF]), human leukocyte antigen (HLA) antigens (HLA-A10, HLA-B, HLA-DRB1), and genes involved in antigen processing (angiotensin-converting enzyme and tripeptidyl peptidase 2) are all concerned with defense against invading pathogens. Human microRNAs (Hsa-mir-198 and Hsa-mir-206) are predicted to bind

  1. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  2. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  3. Direct Assessment of Articular Cartilage and Underlying Subchondral Bone Reveals a Progressive Gene Expression Change in Human Osteoarthritic Knees

    PubMed Central

    Chou, Ching-Heng; Lee, Chian-Her; Lu, Liang-Suei; Song, I-Wen; Chuang, Hui-Ping; Kuo, San-Yuan; Wu, Jer-Yuarn; Chen, Yuan-Tsong; Kraus, Virginia Byers; Wu, Chia-Chun; Lee, Ming Ta Michael

    2013-01-01

    Objective To evaluate the interaction of articular cartilage (AC) and subchondral bone (SB) through analysis of osteoarthritis (OA)-related genes of site-matched tissue. Design We developed a novel method for isolating site-matched overlying AC and underlying SB from three and four regions of interest respectively from the human knee tibial plateau (n=50). For each site, the severity of cartilage changes of OA were assessed histologically, and the severity of bone abnormalities were assessed by microcomputed tomography. An RNA isolation procedure was optimized that yielded high quality RNA from site-matched AC and SB tibial regions. Q-PCR analysis was performed to evaluate gene expression of 61 OA-associated genes for correlation with cartilage integrity and bone structure parameters. Results A total of 27 (44%) genes were coordinately up or down regulated in both tissues. The expression levels of 19 genes were statistically significantly correlated with the severity of AC degeneration and changes of SB structure; these included: ADAMTS1, ASPN, BMP6, BMPER, CCL2, CCL8, COL5A1, COL6A3, COL7A1, COL16A1, FRZB, GDF10, MMP3, OGN, OMD, POSTN, PTGES, TNFSF11 and WNT1. Conclusions These results provide a strategy for identifying targets whose modification may have the potential to ameliorate pathological alterations and progression of disease in both AC and SB simultaneously. In addition, this is the first study, to our knowledge, to overcome the major difficulties related to isolation of high quality RNA from site-matched joint tissues. We expect this method to facilitate advances in our understanding of the coordinated molecular responses of the whole joint organ. PMID:23220557

  4. Directed chromosomal integration and expression of the reporter gene gusA3 in Lactobacillus acidophilus NCFM.

    PubMed

    Douglas, Grace L; Klaenhammer, Todd R

    2011-10-01

    Lactobacillus acidophilus NCFM is a probiotic microbe that survives passage through the human gastrointestinal tract and interacts with the host epithelium and mucosal immune cells. The potential for L. acidophilus to express antigens at mucosal surfaces has been investigated with various antigens and plasmid expression vectors. Plasmid instability and antibiotic selection complicate the possibility of testing these constructs in human clinical trials. Integrating antigen encoding genes into the chromosome for expression is expected to eliminate selection requirements and provide genetic stability. In this work, a reporter gene encoding a β-glucuronidase (GusA3) was integrated into four intergenic chromosomal locations. The integrants were tested for genetic stability and GusA3 activity. Two locations were selected for insertion downstream of constitutively highly expressed genes, one downstream of slpA (LBA0169), encoding a highly expressed surface-layer protein, and one downstream of phosphopyruvate hydratase (LBA0889), a highly expressed gene with homologs in other lactic acid bacteria. An inducible location was selected downstream of lacZ (LBA1462), encoding a β-galactosidase. A fourth location was selected in a low-expression region. The expression of gusA3 was evaluated from each location by measuring GusA3 activity on 4-methyl-umbelliferyl-β-d-glucuronide (MUG). GusA3 activity from both highly expressed loci was more than three logs higher than the gusA3-negative parent, L. acidophilus NCK1909. GusA3 activity from the lacZ locus was one log higher in cells grown in lactose than in glucose. The differences in expression levels between integration locations highlights the importance of rational targeting with gene cassettes intended for chromosomal expression. PMID:21873486

  5. Introduction to HACCP.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction to HACCP Deana R. Jones, Ph.D. Egg Safety and Quality Research Unit USDA-Agricultural Research Service Russell Research Center Athens, GA Deana.Jones@ars.usda.gov HACCP is an acronym for Hazard Analysis and Critical Control Point and was initially developed by the Pillsbury Company a...

  6. Hindi, An Active Introduction.

    ERIC Educational Resources Information Center

    Sharma, D. N.; Stone, James W.

    This beginning text in Hindi follows the "microwave" style of lesson organization originated by Earl W. Stevick of the Foreign Service Institute. (An explanation of the "microwave" approach, as well as suggestions to the teacher, are provided in the Introduction.) Successful trial versions used in Peace Corps training programs at FSI were expanded…

  7. An Introduction to Psycholinguistics

    ERIC Educational Resources Information Center

    Jodai, Hojat

    2011-01-01

    This paper is written to have a preliminary introduction about psycholinguistics. Psycholinguistics or psychology of language is the study of the interrelation between linguistic factors and psychological aspects. The main subject of research in psycholinguistics is the study of cognitive processes that underlie the comprehension and production of…

  8. Introduction to chiral symmetry

    SciTech Connect

    Koch, V.

    1996-01-08

    These lectures are an attempt to a pedagogical introduction into the elementary concepts of chiral symmetry in nuclear physics. Effective chiral models such as the linear and nonlinear sigma model will be discussed as well as the essential ideas of chiral perturbation theory. Some applications to the physics of ultrarelativistic heavy ion collisions will be presented.

  9. Introduction to space dynamics.

    NASA Astrophysics Data System (ADS)

    Thomson, W. T.

    This Dover edition is an unabridged, corrected republication of the work first published by John Wiley & Sons Inc., New York, in 1961.Contents: 1. Introduction. 2. Kinematics. 3. Transformation of coordinates. 4. Particle dynamics (satellite orbits). 5. Gyrodynamics. 6. Dynamics of gyroscopic instruments. 7. Space vehicle motion. 8. Performance and optimization.9. Generalized theories of mechanics.

  10. Introduction: Invertebrate Neuropeptides XI

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This publication represents an introduction to the eleventh in a series of special issues of the Peptides journal dedicated to invertebrate neuropeptides. The issue addresses a number of aspects of invertebrate neuropeptide research including identification of novel characterization of new biologic...

  11. Introduction to International Trade.

    ERIC Educational Resources Information Center

    Crummett, Dan M.; Crummett, Jerrie

    This set of student and teacher guides is intended for use in a course to prepare students for entry-level employment in such occupational areas in international trade as business/finance, communications, logistics, and marketing. The following topics are covered in the course's five instructional units: introduction to careers in international…

  12. Introduction to Film.

    ERIC Educational Resources Information Center

    Burns, Gary

    There are numerous ways to structure the introduction to film course so as to meet the needs of the different types of students who typically enroll. Assuming there is no production component in the course, the teacher is left with two major approaches to choose from--historical and aesthetic. The units in the course will typically be built around…

  13. Introduction: Morality in Discourse.

    ERIC Educational Resources Information Center

    Bergmann, Jorg R.

    1998-01-01

    Introduces a special issue containing a series of articles on the relation of social interaction and morality. The articles analyze actual instances of moral discourse, elucidating the nature and dynamics of the relationship. This introduction discusses morality, discourse, and social science; proto-mortality as a substructure of discourse;…

  14. Introduction to Shakespeare: English.

    ERIC Educational Resources Information Center

    Hargraves, Richard

    The "Introduction to Shakespeare" course in the Quinmester Program involves the careful study of the tragedy "Romeo and Juliet" and the comedy "The Taming of the Shrew," emphasizing language, development of character and theme. The course also includes the study of biographical data relevant to the evolution of Shakespeare's literary genius, and…

  15. Mauritian Creole: An Introduction.

    ERIC Educational Resources Information Center

    Goodman, Morris F.; And Others

    The format of this 23-unit course in Mauritian Creole is based on "microwave" cycles, each cycle beginning with the introduction of new material and ending with the use of that material in communication. A small amount of new material is introduced at a time (usually in a monolog, drill, or dialog) which, after a brief bit of practice is used for…

  16. Why SRS Matters - Introduction

    SciTech Connect

    Hunt, Paul

    2015-01-21

    A video series presenting an overview of the Savannah River Site's (SRS) mission and operations. Each episode features a specific area/operation and how it contributes to help make the world safer. This episode provides an introduction to the SRS mission and operations.

  17. 3.1 Introduction

    NASA Astrophysics Data System (ADS)

    Kramer, H.-M.

    This document is part of Subvolume A 'Fundamentals and Data in Radiobiology, Radiation Biophysics, Dosimetry and Medical Radiological Protection' of Volume 7 'Medical Radiological Physics' of Landolt-Börnstein - Group VIII 'Advanced Materials and Technologies'. It contains the Section '3.1 Introduction' of the Chapter '3 Dosimetry in Diagnostic Radiology and Radiotherapy'.

  18. 4.1 Introduction

    NASA Astrophysics Data System (ADS)

    Noßke, D.; Mattsson, S.; Johansson, L.

    This document is part of Subvolume A 'Fundamentals and Data in Radiobiology, Radiation Biophysics, Dosimetry and Medical Radiological Protection' of Volume 7 'Medical Radiological Physics' of Landolt-Börnstein - Group VIII 'Advanced Materials and Technologies'. It contains the Section '4.1 Introduction' of the Chapter '4 Dosimetry in Nuclear Medicine Diagnosis and Therapy' with the contents:

  19. 5.1 Introduction

    NASA Astrophysics Data System (ADS)

    Almén, A.; Valentin, J.

    This document is part of Subvolume A 'Fundamentals and Data in Radiobiology, Radiation Biophysics, Dosimetry and Medical Radiological Protection' of Volume 7 'Medical Radiological Physics' of Landolt-Börnstein - Group VIII 'Advanced Materials and Technologies'. It contains the Section '5.1 Introduction' of the Chapter '5 Medical Radiological Protection' with the contents:

  20. 2.1 Introduction

    NASA Astrophysics Data System (ADS)

    Bernhardt, J. H.; Kasch, K.-U.; Kaul, A.

    This document is part of Subvolume A 'Fundamentals and Data in Radiobiology, Radiation Biophysics, Dosimetry and Medical Radiological Protection' of Volume 7 'Medical Radiological Physics' of Landolt-Börnstein - Group VIII 'Advanced Materials and Technologies'. It contains the Section '2.1 Introduction' of the Chapter '2 Radiation and Biological Effects'.

  1. Identification of genotypes of Giardia intestinalis isolates from dogs in Japan by direct sequencing of the PCR amplified glutamate dehydrogenase gene.

    PubMed

    Abe, Niichiro; Kimata, Isao; Iseki, Motohiro

    2003-01-01

    Giardia has been detected in domestic dogs in Japan, but the genotype of isolates has remained unclear because identification has relied on conventional microscopy. Here we tried to identify the genotypes of four isolates from dogs in Japan by direct sequencing of the PCR amplified Giardia glutamate dehydrogenase (GDH) gene. The primer pair GDHF3 and GDHB5, targeting the GDH gene, was designed to prime a region of the GDH gene sequence conserved in the strains found to have the dog-specific genotype. The specific PCR product (approximately 220 bp), amplified with this primer pair, was only observed when Giardia DNA was used as the template. The sequences of the diagnostic fragments were identical among the isolates from dogs, and were differed by 15 bp or 1 bp from the strains, which were found to be the dog-specific genotypes, Assemblage C or D respectively. To verify the identity of the amplified DNA, a phylogenetic analysis was performed. Consequently, the sequence of the isolates from dogs clearly clustered with the strain found to be Assemblage D with neighbor-joining analyses. Therefore, all the isolates from dogs examined were identified as the dog-specific genotype, Assemblage D. In the present study, we revealed the genotype of Giardia isolates in Japan, and showed that direct sequencing of the PCR product amplified with the primer pair GDHF3 and GDHB5 was a useful tool for distinguishing between the zoonotic and dog-specific genotypes. PMID:12576701

  2. Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.

    PubMed

    Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo

    2014-04-01

    The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells. PMID:24500196

  3. Functional studies of the gene slr2049 from Synechocystis sp. PCC6803 and its site-directed mutation.

    PubMed

    Liu, Bingjun; Chen, Sili; Zhang, Lei

    2015-06-01

    Phycobiliprotein is a homologous family of light-harvesting chromoproteins existing in cyanobacteria, red algae and cryptophytes. Phycobiliprotein is made up of phycobilin and its corresponding apophycobiliprotein, and they are covalently linked by the thioether bond with the bilin lyase. Using the software BLAST, we have found gene slr2049 in Synechocystis sp. PCC6803 homologous to the biliprotein lyase gene cpeS. This paper investigates the protein expressed by gene slr2049 to find the enzymatic activity characteristics. We cloned slr2049 and its related genes cpcB, ho1, and pcyA which are linked with the synthesis of phycocyanin. Special amino acid mutagenesis was performed on slr2049 to construct eight mutants slr2049 (H21S), slr2049 (L23S), slr2049 (A24S), slr2049 (F25S), slr2049 (W72L), slr2049 (G84S), slr2049 (R107S) and slr2049 (Y124S). These mutants were ligated with vectors pEDFDuet-1 and pET-23a to construct pCDF-cpcB-slr2049 wild-type, pCDF-cpcB-slr2049 mutants and pET-ho1-pcyA, for the purpose of protein expression and analysis. The results showed that the wild-type and mutants slr2049 (H21S), slr2049 (L23S), slr2049 (F25S), slr2049 (W72L), slr2049 (G84S), and slr2049 (Y124S) can catalyze CpcB to couple on PCB correctly and the products have unique spectral characteristics. However mutants slr2049 (A24S) and slr2049 (R107S) have no spectral characteristics. Thus, it is suggested that alanine at position 24 and arginine at position 107 are the active sites. PMID:25791490

  4. Ha-ras oncogene expression directed by a milk protein gene promoter: tissue specificity, hormonal regulation, and tumor induction in transgenic mice

    SciTech Connect

    Andres, A.C.; Schoenenberger, C.A.; Groner, B.; Henninghausen, L.; LeMeur, M.; Gelinger, P.

    1987-03-01

    The activated human Ha-ras oncogene was subjected to the control of the promoter region of the murine whey acidic protein (Wap) gene, which is expressed in mammary epithelial cells in response to lactogenic hormones. The Wap-ras gene was stably introduced into the mouse germ line of five transgenic mice (one male and four females). Wap-ras expression was observed in the mammary glands of lactating females in two lines derived from female founders. The tissue-directed and hormone-dependent Wap expression was conferred on the Ha-ras oncogene. The signals governing Wap expression are located within 2.5 kilobases of 5' flanking sequence. The other two lines derived from female founders did not express the chimeric gene. In the line derived from the male founder the Wap-ras gene is integrated into the Y chromosome. Expression was found in the salivary gland of male animals only. After a long latency, Wap-ras-expressing mice developed tumors. The tumors arose in tissues expressing Wap-ras - i.e., mammary or salivary glands. Compared to the corresponding nonmalignant tissues, Wap-ras expression was enhanced in the tumors.

  5. Meta-Analysis of Arabidopsis KANADI1 Direct Target Genes Identifies a Basic Growth-Promoting Module Acting Upstream of Hormonal Signaling Pathways.

    PubMed

    Xie, Yakun; Straub, Daniel; Eguen, Tenai; Brandt, Ronny; Stahl, Mark; Martínez-García, Jaime F; Wenkel, Stephan

    2015-10-01

    An intricate network of antagonistically acting transcription factors mediates the formation of a flat leaf lamina of Arabidopsis (Arabidopsis thaliana) plants. In this context, members of the class III homeodomain leucine zipper (HD-ZIPIII) transcription factor family specify the adaxial domain (future upper side) of the leaf, while antagonistically acting KANADI transcription factors determine the abaxial domain (future lower side). Here, we used a messenger RNA sequencing approach to identify genes regulated by KANADI1 (KAN1) and subsequently performed a meta-analysis combining our data sets with published genome-wide data sets. Our analysis revealed that KAN1 acts upstream of several genes encoding auxin biosynthetic enzymes. When exposed to shade, we found three YUCCA genes, YUC2, YUC5, and YUC8, to be transcriptionally up-regulated, which correlates with an increase in the levels of free auxin. When ectopically expressed, KAN1 is able to transcriptionally repress these three YUC genes and thereby block shade-induced auxin biosynthesis. Consequently, KAN1 is able to strongly suppress shade-avoidance responses. Taken together, we hypothesize that HD-ZIPIII/KAN form the basis of a basic growth-promoting module. Hypocotyl extension in the shade and outgrowth of new leaves both involve auxin synthesis and signaling, which are under the direct control of HD-ZIPIII/KAN. PMID:26246448

  6. Meta-Analysis of Arabidopsis KANADI1 Direct Target Genes Identifies a Basic Growth-Promoting Module Acting Upstream of Hormonal Signaling Pathways1[OPEN

    PubMed Central

    Xie, Yakun; Straub, Daniel; Eguen, Tenai; Brandt, Ronny; Stahl, Mark; Martínez-García, Jaime F.; Wenkel, Stephan

    2015-01-01

    An intricate network of antagonistically acting transcription factors mediates the formation of a flat leaf lamina of Arabidopsis (Arabidopsis thaliana) plants. In this context, members of the class III homeodomain leucine zipper (HD-ZIPIII) transcription factor family specify the adaxial domain (future upper side) of the leaf, while antagonistically acting KANADI transcription factors determine the abaxial domain (future lower side). Here, we used a messenger RNA sequencing approach to identify genes regulated by KANADI1 (KAN1) and subsequently performed a meta-analysis combining our data sets with published genome-wide data sets. Our analysis revealed that KAN1 acts upstream of several genes encoding auxin biosynthetic enzymes. When exposed to shade, we found three YUCCA genes, YUC2, YUC5, and YUC8, to be transcriptionally up-regulated, which correlates with an increase in the levels of free auxin. When ectopically expressed, KAN1 is able to transcriptionally repress these three YUC genes and thereby block shade-induced auxin biosynthesis. Consequently, KAN1 is able to strongly suppress shade-avoidance responses. Taken together, we hypothesize that HD-ZIPIII/KAN form the basis of a basic growth-promoting module. Hypocotyl extension in the shade and outgrowth of new leaves both involve auxin synthesis and signaling, which are under the direct control of HD-ZIPIII/KAN. PMID:26246448

  7. The Spn4 gene from Drosophila melanogaster is a multipurpose defence tool directed against proteases from three different peptidase families

    PubMed Central

    Brüning, Mareke; Lummer, Martina; Bentele, Caterina; Smolenaars, Marcel M. W.; Rodenburg, Kees W.; Ragg, Hermann

    2006-01-01

    By alternative use of four RSL (reactive site loop) coding exon cassettes, the serpin (serine protease inhibitor) gene Spn4 from Drosophila melanogaster was proposed to enable the synthesis of multiple protease inhibitor isoforms, one of which has been shown to be a potent inhibitor of human furin. Here, we have investigated the inhibitory spectrum of all Spn4 RSL variants. The analyses indicate that the Spn4 gene encodes inhibitors that may inhibit serine proteases of the subtilase family (S8), the chymotrypsin family (S1), and the papain-like cysteine protease family (C1), most of them at high rates. Thus a cohort of different protease inhibitors is generated simply by grafting enzyme-adapted RSL sequences on to a single serpin scaffold, even though the target proteases contain different types and/or a varying order of catalytic residues and are descendents of different phylogenetic lineages. Since all of the Spn4 RSL isoforms are produced as intracellular residents and additionally as variants destined for export or associated with the secretory pathway, the Spn4 gene represents a versatile defence tool kit that may provide multiple antiproteolytic functions. PMID:16989645

  8. Using Genomic Resources to Guide Research Directions. The Arabinogalactan Protein Gene Family as a Test Case1

    PubMed Central

    Schultz, Carolyn J.; Rumsewicz, Michael P.; Johnson, Kim L.; Jones, Brian J.; Gaspar, Yolanda M.; Bacic, Antony

    2002-01-01

    Arabinogalactan proteins (AGPs) are extracellular hydroxyproline-rich proteoglycans implicated in plant growth and development. The protein backbones of AGPs are rich in proline/hydroxyproline, serine, alanine, and threonine. Most family members have less than 40% similarity; therefore, finding family members using Basic Local Alignment Search Tool searches is difficult. As part of our systematic analysis of AGP function in Arabidopsis, we wanted to make sure that we had identified most of the members of the gene family. We used the biased amino acid composition of AGPs to identify AGPs and arabinogalactan (AG) peptides in the Arabidopsis genome. Different criteria were used to identify the fasciclin-like AGPs. In total, we have identified 13 classical AGPs, 10 AG-peptides, three basic AGPs that include a short lysine-rich region, and 21 fasciclin-like AGPs. To streamline the analysis of genomic resources to assist in the planning of targeted experimental approaches, we have adopted a flow chart to maximize the information that can be obtained about each gene. One of the key steps is the reformatting of the Arabidopsis Functional Genomics Consortium microarray data. This customized software program makes it possible to view the ratio data for all Arabidopsis Functional Genomics Consortium experiments and as many genes as desired in a single spreadsheet. The results for reciprocal experiments are grouped to simplify analysis and candidate AGPs involved in development or biotic and abiotic stress responses are readily identified. The microarray data support the suggestion that different AGPs have different functions. PMID:12177459

  9. Muscle-directed gene therapy for phenylketonuria (PKU): Development of transgenic mice with muscle-specific phenylalanine hydroxylase expression

    SciTech Connect

    Harding, C.O.; Messing, A.; Wolff, J.A.

    1994-09-01

    Phenylketonuria (PKU) is an attractive target for gene therapy because of shortcomings in current therapy including lifelong commitment to a difficult and expensive diet, persistent mild cognitive deficits in some children despite adequate dietary therapy, and maternal PKU syndrome. Phenylalanine hydroxylase (PAH) is normally expressed only in liver, but we propose to treat PKU by introducing the gene for PAH into muscle. In order to evaluate both the safety and efficacy of this approach, we have a developed a trangenic mouse which expresses PAH in both cardiac and skeletal muscle. The transgene includes promoter and enhancer sequences from the mouse muscle creatine kinase (MCK) gene fused to the mouse liver PAH cDNA. Mice which have inherited the transgene are healthy, active, and do not exhibit any signs of muscle weakness or wasting. Ectopic PAH expression in muscle is not detrimental to the health, neurologic function, or reproduction of the mice. Pah{sup enu2} hyperphenylalaninemic mice, a model of human PAH deficiency, bred to carry the transgene have substantial PAH expression in cardiac and skeletal muscle but none in liver. Muscle PAH expression alone does not complement the hyperphenylalaninemic phenotype of Pah{sup enu2} mice. However, administration of reduced tetrahydrobiopterin to transgenic Pah{sup enu2} mice is associated with a 25% mean decrease in serum phenylalanine levels. We predict that ectopic expression of PAH in muscle along with adequate muscle supplies of reduced biopterin cofactor will decrease hyperphenylalaninemia in PKU.

  10. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.

    1988-04-01

    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  11. Liver-Directed Adeno-Associated Virus Serotype 8 Gene Transfer Rescues a Lethal Murine Model of Citrullinemia Type 1

    PubMed Central

    Chandler, Randy J.; Tarasenko, Tatiana N.; Cusmano-Ozog, Kristina; Sun, Qin; Sutton, V. Reid; Venditti, Charles P.; McGuire, Peter J.

    2013-01-01

    Citrullinemia type 1 (CTLN1) is an autosomal recessive disorder of metabolism caused by a deficiency of argininosuccinate synthetase. Despite optimal management, CTLN1 patients still suffer from lethal metabolic instability and experience life threatening episodes of acute hyperammonemia. A murine model of CTLN1 (fold/fold) that displays lethality within the first 21 days of life was used to determine the efficacy of adeno-associated viral (AAV) gene transfer as a potential therapy. An AAV serotype 8 (AAV8) vector was engineered to express the human ASS1 cDNA under the control of a liver-specific promoter (thyroxine binding globulin, TBG), AAV8-TBG-hASS1, and delivered to 7–10 day old mice via intraperitoneal injection. Greater than 95% of the mice were rescued from lethality and survival was extended beyond 100 days after receiving a single dose of vector. AAV8-TBG-hASS1 treatment resulted in liver specific expression of hASS1, increased ASS1 enzyme activity, reduction in plasma ammonia and citrulline concentrations, and significant phenotypic improvement of the fold/fold growth and skin phenotypes. These experiments highlight a gene transfer approach using AAV8 vector for liver targeted gene therapy that could serve as a treatment for CTLN1. PMID:24131980

  12. 5 CFR 2500.1 - Introduction.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Administrative Personnel OFFICE OF ADMINISTRATION, EXECUTIVE OFFICE OF THE PRESIDENT INFORMATION SECURITY REGULATION § 2500.1 Introduction. (a) References. (1) Executive Order 12065, “National Security Information”, dated June 28, 1978. (2) Information Security Oversight Office Directive No. 1, “National...

  13. 5 CFR 2500.1 - Introduction.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Administrative Personnel OFFICE OF ADMINISTRATION, EXECUTIVE OFFICE OF THE PRESIDENT INFORMATION SECURITY REGULATION § 2500.1 Introduction. (a) References. (1) Executive Order 12065, “National Security Information”, dated June 28, 1978. (2) Information Security Oversight Office Directive No. 1, “National...

  14. The BAF60 subunit of the SWI/SNF chromatin-remodeling complex directly controls the formation of a gene loop at FLOWERING LOCUS C in Arabidopsis.

    PubMed

    Jégu, Teddy; Latrasse, David; Delarue, Marianne; Hirt, Heribert; Domenichini, Séverine; Ariel, Federico; Crespi, Martin; Bergounioux, Catherine; Raynaud, Cécile; Benhamed, Moussa

    2014-02-01

    SWI/SNF complexes mediate ATP-dependent chromatin remodeling to regulate gene expression. Many components of these complexes are evolutionarily conserved, and several subunits of Arabidopsis thaliana SWI/SNF complexes are involved in the control of flowering, a process that depends on the floral repressor FLOWERING LOCUS C (FLC). BAF60 is a SWI/SNF subunit, and in this work, we show that BAF60, via a direct targeting of the floral repressor FLC, induces a change at the high-order chromatin level and represses the photoperiod flowering pathway in Arabidopsis. BAF60 accumulates in the nucleus and controls the formation of the FLC gene loop by modulation of histone density, composition, and posttranslational modification. Physiological analysis of BAF60 RNA interference mutant lines allowed us to propose that this chromatin-remodeling protein creates a repressive chromatin configuration at the FLC locus. PMID:24510722

  15. The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm

    PubMed Central

    Elwell, Jennifer A.; Lovato, TyAnna L.; Adams, Melanie M.; Baca, Erica M.; Lee, Thai; Cripps, Richard M.

    2015-01-01

    Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arise through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist expression in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

  16. Introduction to Sporadic Groups

    NASA Astrophysics Data System (ADS)

    Boya, Luis J.

    2011-01-01

    This is an introduction to finite simple groups, in particular sporadic groups, intended for physicists. After a short review of group theory, we enumerate the 1+1+16=18 families of finite simple groups, as an introduction to the sporadic groups. These are described next, in three levels of increasing complexity, plus the six isolated ''pariah'' groups. The (old) five Mathieu groups make up the first, smallest order level. The seven groups related to the Leech lattice, including the three Conway groups, constitute the second level. The third and highest level contains the Monster group M, plus seven other related groups. Next a brief mention is made of the remaining six pariah groups, thus completing the 5+7+8+6=26 sporadic groups. The review ends up with a brief discussion of a few of physical applications of finite groups in physics, including a couple of recent examples which use sporadic groups.

  17. Promoters of AaGL2 and AaMIXTA-Like1 genes of Artemisia annua direct reporter gene expression in glandular and non-glandular trichomes

    PubMed Central

    Jindal, Sunita; Longchar, Bendangchuchang; Singh, Alka; Gupta, Vikrant

    2015-01-01

    Herein, we report cloning and analysis of promoters of GLABRA2 (AaGL2) homolog and a MIXTA-Like (AaMIXTA-Like1) gene from Artemisia annua. The upstream regulatory regions of AaGL2 and AaMIXTA-Like1 showed the presence of several crucial cis-acting elements. Arabidopsis and A. annua seedlings were transiently transfected with the promoter-GUS constructs using a robust agro-infiltration method. Both AaGL2 and AaMIXTA-Like1 promoters showed GUS expression preferentially in Arabidopsis single-celled trichomes and glandular as well as T-shaped trichomes of A. annua. Transgenic Arabidopsis harboring constructs in which AaGL2 or AaMIXTA-Like1 promoters would control GFP expression, showed fluorescence emanating specifically from trichome cells. Our study provides a fast and efficient method to study trichome-specific expression, and 2 promoters that have potential for targeted metabolic engineering in plants. PMID:26340695

  18. The role of vesicular stomatitis virus matrix protein in inhibition of host-directed gene expression is genetically separable from its function in virus assembly.

    PubMed Central

    Black, B L; Rhodes, R B; McKenzie, M; Lyles, D S

    1993-01-01

    Recently, the vesicular stomatitis virus matrix (M) protein has been shown to be capable of inhibition of host cell-directed transcription in the absence of other viral components (B. L. Black and D. S. Lyles, J. Virol. 66:4058-4064, 1992). M protein is a major structural protein that is known to play a critical role in virus assembly by binding the helical ribonucleoprotein core of the virus to the cytoplasmic surface of the cell plasma membrane during budding. In this study, two M protein mutants were tested to determine whether the inhibition of host transcription by M protein is an indirect effect of its function in virus assembly or whether it represents an independent function of M protein. The mutant M protein of the conditionally temperature-sensitive (ts) vesicular stomatitis virus mutant, tsO82, was found to be defective in its ability to inhibit host-directed gene expression, as shown by its inability to inhibit expression of a cotransfected target gene encoding chloramphenicol acetyltransferase. The ability of the tsO82 M protein to function in virus assembly was similar to that of wild-type M protein, as shown by its ability to complement the group III ts M protein mutant, tsO23. Another mutant, MN1, which lacks amino acids 4 to 21 of M protein demonstrated that the abilities of M protein to inhibit chloramphenicol acetyltransferase gene expression and to localize to the nucleus were unaffected by deletion of this lysine-rich amino-terminal region but that the ability to function in virus assembly was ablated. Thus, the two M protein mutants examined in this study exhibited complementary phenotypes: tsO82 M protein functioned in virus assembly but was defective in inhibition of host-directed gene expression, while MN1 M protein functioned in inhibiting gene expression but was unable to function in virus assembly. These data demonstrate that the role of M protein in inhibition of host transcription can be separated genetically from its role in virus

  19. Introduction to Extra Dimensions

    SciTech Connect

    Rizzo, Thomas G.; /SLAC

    2010-04-29

    Extra dimensions provide a very useful tool in addressing a number of the fundamental problems faced by the Standard Model. The following provides a very basic introduction to this very broad subject area as given at the VIII School of the Gravitational and Mathematical Physics Division of the Mexican Physical Society in December 2009. Some prospects for extra dimensional searches at the 7 TeV LHC with {approx}1 fb{sup -1} of integrated luminosity are provided.

  20. Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the Dystrophin gene detected by direct sequencing

    PubMed Central

    2011-01-01

    Background Duchenne and Becker Muscular dystrophies (DMD/BMD) are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD) without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis). This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients), followed by TAG (n = 7) and TAA (n = 4). We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects and dystrophin

  1. Rather than by direct acquisition via lateral gene transfer, GHF5 cellulases were passed on from early Pratylenchidae to root-knot and cyst nematodes

    PubMed Central

    2012-01-01

    not acquire this gene directly by lateral genes transfer. More likely, these genes were passed on by ancestors of a family nowadays known as the Pratylenchidae. PMID:23171084

  2. Truncated Cotton Subtilase Promoter Directs Guard Cell-Specific Expression of Foreign Genes in Tobacco and Arabidopsis

    PubMed Central

    Han, Lei; Han, Ya-Nan; Xiao, Xing-Guo

    2013-01-01

    A 993-bp regulatory region upstream of the translation start codon of subtilisin-like serine protease gene was isolated from Gossypium barbadense. This (T/A)AAAG-rich region, GbSLSP, and its 5′- and 3′-truncated versions were transferred into tobacco and Arabidopsis after fusing with GUS or GFP. Histochemical and quantitative GUS analysis and confocal GFP fluorescence scanning in the transgenic plants showed that the GbSLSP-driven GUS and GFP expressed preferentially in guard cells, whereas driven by GbSLSPF2 to GbSLSPF4, the 5′-truncated GbSLSP versions with progressively reduced Dof1 elements, both GUS and GFP expressed exclusively in guard cells, and the expression strength declined with (T/A)AAAG copy decrement. Deletion of 5′-untranslated region from GbSLSP markedly weakened the activity of GUS and GFP, while deletion from the strongest guard cell-specific promoter, GbSLSPF2, not only significantly decreased the expression strength, but also completely abolished the guard cell specificity. These results suggested both guard cell specificity and expression strength of the promoters be coordinately controlled by 5′-untranslated region and a cluster of at least 3 (T/A)AAAG elements within a region of about 100 bp relative to transcription start site. Our guard cell-specific promoters will enrich tools to manipulate gene expression in guard cells for scientific research and crop improvement. PMID:23555786

  3. A direct gene transfer strategy via brain internal capsule reverses the biochemical defect in Tay-Sachs disease.

    PubMed

    Martino, S; Marconi, P; Tancini, B; Dolcetta, D; De Angelis, M G Cusella; Montanucci, P; Bregola, G; Sandhoff, K; Bordignon, C; Emiliani, C; Manservigi, R; Orlacchio, A

    2005-08-01

    Therapy for neurodegenerative lysosomal Tay-Sachs (TS) disease requires active hexosaminidase (Hex) A production in the central nervous system and an efficient therapeutic approach that can act faster than human disease progression. We combined the efficacy of a non-replicating Herpes simplex vector encoding for the Hex A alpha-subunit (HSV-T0alphaHex) and the anatomic structure of the brain internal capsule to distribute the missing enzyme optimally. With this gene transfer strategy, for the first time, we re-established the Hex A activity and totally removed the GM2 ganglioside storage in both injected and controlateral hemispheres, in the cerebellum and spinal cord of TS animal model in the span of one month's treatment. In our studies, no adverse effects were observed due to the viral vector, injection site or gene expression and on the basis of these results, we feel confident that the same approach could be applied to similar diseases involving an enzyme defect. PMID:15961412

  4. Small RNA-mediated chromatin silencing directed to the 3' region of the Arabidopsis gene encoding the developmental regulator, FLC.

    PubMed

    Swiezewski, Szymon; Crevillen, Pedro; Liu, Fuquan; Ecker, Joseph R; Jerzmanowski, Andrzej; Dean, Caroline

    2007-02-27

    Small RNA-mediated chromatin silencing is well characterized for repeated sequences and transposons, but its role in regulating single-copy endogenous genes is unclear. We have identified two small RNAs (30 and 24 nucleotides) corresponding to the reverse strand 3' to the canonical poly(A) site of FLOWERING LOCUS C (FLC), an Arabidopsis gene encoding a repressor of flowering. Genome searches suggest that these RNAs originate from the FLC locus in a genomic region lacking repeats. The 24-nt small RNA, which is most abundant in developing fruits, is absent in mutants defective in RNA polymerase IVa, RNA-DEPENDENT RNA POLYMERASE 2, and DICER-LIKE 3, components required for RNAi-mediated chromatin silencing. The corresponding genomic region shows histone 3 lysine 9 dimethylation, which was reduced in a dcl2,3,4 triple mutant. Investigations into the origins of the small RNAs revealed a polymerase IVa-dependent spliced, antisense transcript covering the 3' FLC region. Mutation of this genomic region by T-DNA insertion led to FLC misexpression and delayed flowering, suggesting that RNAi-mediated chromatin modification is an important component of endogenous pathways that function to suppress FLC expression. PMID:17360694

  5. Genes V.

    SciTech Connect

    Lewin, B.

    1994-12-31

    This fifth edition book encompasses a wide range of topics covering 1,272 pages. The book is arranged into nine parts with a total of 36 chapters. These nine parts include Introduction; DNA as a Store of Information; Translation; Constructing Cells; Control of Prokaryotypic Gene Expression; Perpetuation of DNA; Organization of the Eukaryotypic Genome; Eukaryotypic Transcription and RNA Processing; The Dynamic Genome; and Genes in Development.

  6. Directed self-assembly, genomic assembly complexity and the formation of biological structure, or, what are the genes for nacre?

    PubMed

    Cartwright, Julyan H E

    2016-03-13

    Biology uses dynamical mechanisms of self-organization and self-assembly of materials, but it also choreographs and directs these processes. The difference between abiotic self-assembly and a biological process is rather like the difference between setting up and running an experiment to make a material remotely compared with doing it in one's own laboratory: with a remote experiment-say on the International Space Station-everything must be set up beforehand to let the experiment run 'hands off', but in the laboratory one can intervene at any point in a 'hands-on' approach. It is clear that the latter process, of directed self-assembly, can allow much more complicated experiments and produce far more complex structures than self-assembly alone. This control over self-assembly in biology is exercised at certain key waypoints along a trajectory and the process may be quantified in terms of the genomic assembly complexity of a biomaterial. PMID:26857670

  7. Direct evidence for Mendelian inheritance of the variations in the ribosomal protein gene introns in yellowfin tuna (Thunnus albacares).

    PubMed

    Chow, S; Scholey, V P; Nakazawa, A; Margulies, D; Wexler, J B; Olson, R J; Hazama, K

    2001-01-01

    Restriction fragment length polymorphism found in the S7 ribosomal protein gene introns of yellowfin tuna (Thunnus albacares) was compared between a single pair of parents and their offspring. The sizes of the first intron ( RP1) and second intron ( RP2) amplified by polymerase chain reaction were 810 bp and 1400 bp, respectively. The dam and sire had different restriction types from one another in HhaI and RsaI digestions for RP1 and in DdeI, HhaI, and ScrFI digestions for RP2. Putative genotypes in both introns of 64 larvae were found to be segregated in Mendelian proportions. Genotype distributions in a wild yellowfin tuna sample ( n = 34) were in Hardy-Weinberg proportions, and observed heterozygosity ranged from 0.149 to 0.388. This study presents novel Mendelian markers, which are feasible for tuna population genetic study and pedigree analysis. PMID:14961386

  8. Targeted silencing of BjMYB28 transcription factor gene directs development of low glucosinolate lines in oilseed Brassica juncea.

    PubMed

    Augustine, Rehna; Mukhopadhyay, Arundhati; Bisht, Naveen C

    2013-09-01

    Brassica juncea (Indian mustard), a globally important oilseed crop, contains relatively high amount of seed glucosinolates ranging from 80 to 120 μmol/g dry weight (DW). One of the major breeding objectives in oilseed Brassicas is to improve the seed-meal quality through the development of low-seed-glucosinolate lines (<30 μmol/g DW), as high amounts of certain seed glucosinolates are known to be anti-nutritional and reduce the meal palatability. Here, we report the development of transgenic B. juncea lines having seed glucosinolates as low as 11.26 μmol/g DW, through RNAi-based targeted suppression of BjMYB28, a R2R3-MYB transcription factor family gene involved in aliphatic glucosinolate biosynthesis. Targeted silencing of BjMYB28 homologs provided significant reduction in the anti-nutritional aliphatic glucosinolates fractions, without altering the desirable nonaliphatic glucosinolate pool, both in leaves and seeds of transgenic plants. Molecular characterization of single-copy, low glucosinolate homozygous lines confirmed significant down-regulation of BjMYB28 homologs vis-à-vis enhanced accumulation of BjMYB28-specific siRNA pool. Consequently, these low glucosinolate lines also showed significant suppression of genes involved in aliphatic glucosinolate biosynthesis. The low glucosinolate trait was stable in subsequent generations of the transgenic lines with no visible off-target effects on plant growth and development. Various seed quality parameters including fatty acid composition, oil content, protein content and seed weight of the low glucosinolate lines also remained unaltered, when tested under containment conditions in the field. Our results indicate that targeted silencing of a key glucosinolate transcriptional regulator MYB28 has huge potential for reducing the glucosinolates content and improving the seed-meal quality of oilseed Brassica crops. PMID:23721233

  9. Multiple promoters and targeted microRNAs direct the expressions of HMGB3 gene transcripts in dairy cattle.

    PubMed

    Li, Liming; Huang, Jinming; Ju, Zhihua; Li, Qiuling; Wang, Changfa; Qi, Chao; Zhang, Yan; Hou, Qinlei; Hang, Suqin; Zhong, Jifeng

    2013-06-01

    HMGB3 (high-mobility group box 3) is an X-linked member of a family of sequence-independent chromatin-binding proteins and functions as a universal sentinel for nucleic acid-mediated innate immune responses. The splice variant expression, promoter characterization and targeted microRNAs of the bovine HMGB3 gene were investigated to explore its expression pattern and possible regulatory mechanism. The results revealed that the expression of HMGB3 transcript variants 1 and 2 (HMGB3-TV1 and HMGB3-TV2) mRNA in the mastitis-infected mammary gland tissues was up-regulated by 8.46- and 5.31-fold respectively compared with that in healthy tissues (P < 0.05). HMGB3-TV1 was highly expressed in the mammary gland tissues, whereas HMGB3-TV2 was expressed primarily in liver. Functional analyses indicated that HMGB3 transcription is regulated by three distinct promoters - promoters 1, 2 and 3 (P1, P2 and P3) - resulting in two alternative transcripts with the same 3'-untranslated region. Promoter luciferase activity analysis suggested that the core sequences of P1 and P2 were mapped in the region of g.1535 to ~g.2076 and g.2074 to ~g.2491 respectively. The g.5880C>T SNP in P3 affected its base promoter activity, and different genotypes were associated with the bovine somatic count score. The expression of targets bovine miR-17-5p, miR-20b and miR-93 of the HMGB3 gene was down-regulated 1.56-, 1.72- and 2.94-fold respectively in mammary gland tissues as compared with that in healthy tissues (P < 0.05). The findings suggest that HMGB3 expression is under complex transcriptional and post-transcriptional control by alternate promoter usage, alternative splicing mechanism and microRNAs in dairy cattle. PMID:23206268

  10. Familial Dysautonomia (FD) Human Embryonic Stem Cell Derived PNS Neurons Reveal that Synaptic Vesicular and Neuronal Transport Genes Are Directly or Indirectly Affected by IKBKAP Downregulation

    PubMed Central

    Kantor, Gal; Cheishvili, David; Even, Aviel; Birger, Anastasya; Turetsky, Tikva; Gil, Yaniv; Even-Ram, Sharona; Aizenman, Einat; Bashir, Nibal; Maayan, Channa; Razin, Aharon; Reubinoff, Benjamim E.; Weil, Miguel

    2015-01-01

    A splicing mutation in the IKBKAP gene causes Familial Dysautonomia (FD), affecting the IKAP protein expression levels and proper development and function of the peripheral nervous system (PNS). Here we found new molecular insights for the IKAP role and the impact of the FD mutation in the human PNS lineage by using a novel and unique human embryonic stem cell (hESC) line homozygous to the FD mutation originated by pre implantation genetic diagnosis (PGD) analysis. We found that IKBKAP downregulation during PNS differentiation affects normal migration in FD-hESC derived neural crest cells (NCC) while at later stages the PNS neurons show reduced intracellular colocalization between vesicular proteins and IKAP. Comparative wide transcriptome analysis of FD and WT hESC-derived neurons together with the analysis of human brains from FD and WT 12 weeks old embryos and experimental validation of the results confirmed that synaptic vesicular and neuronal transport genes are directly or indirectly affected by IKBKAP downregulation in FD neurons. Moreover we show that kinetin (a drug that corrects IKBKAP alternative splicing) promotes the recovery of IKAP expression and these IKAP functional associated genes identified in the study. Altogether, these results support the view that IKAP might be a vesicular like protein that might be involved in neuronal transport in hESC derived PNS neurons. This function seems to be mostly affected in FD-hESC derived PNS neurons probably reflecting some PNS neuronal dysfunction observed in FD. PMID:26437462

  11. Identification of the set of genes, including nonannotated morA, under the direct control of ModE in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Katayama, Akira; Hiramatsu, Masakazu; Kiguchi, Yuya; Takeuchi, Masamitsu; Watanabe, Tomoyuki; Ogasawara, Hiroshi; Ishihama, Akira; Yamamoto, Kaneyoshi

    2013-10-01

    ModE is the molybdate-sensing transcription regulator that controls the expression of genes related to molybdate homeostasis in Escherichia coli. ModE is activated by binding molybdate and acts as both an activator and a repressor. By genomic systematic evolution of ligands by exponential enrichment (SELEX) screening and promoter reporter assays, we have identified a total of nine operons, including the hitherto identified modA, moaA, dmsA, and napF operons, of which six were activated by ModE and three were repressed. In addition, two promoters were newly identified and direct transcription of novel genes, referred to as morA and morB, located on antisense strands of yghW and torY, respectively. The morA gene encodes a short peptide, MorA, with an unusual initiation codon. Surprisingly, overexpression of the morA 5' untranslated region exhibited an inhibitory influence on colony formation of E. coli K-12. PMID:23913318

  12. Use of antibodies directed against synthetic peptides for identifying cDNA clones, establishing reading frames, and deducing the gene order of measles virus.

    PubMed Central

    Richardson, C D; Berkovich, A; Rozenblatt, S; Bellini, W J

    1985-01-01

    A number of cDNA clones complementary to measles virus mRNA and 50S genome RNA have been generated. These clones have been mapped by restriction enzyme analysis and were subsequently sequenced by the method of Maxam and Gilbert (A. M. Maxam and W. Gilbert, Methods Enzymol. 65:499-560, 1980). Computer analysis of these DNA sequences revealed open reading frames which potentially could code for a number of gene products. Portions of these putative polypeptides were synthesized, and rabbit antibodies directed against peptide-hemocyanin conjugates were produced. These antibodies were used to immunoprecipitate virus-specific polypeptides which were identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. For each of the antisera tested, a unique protein was precipitated whose migration on polyacrylamide gels corresponded to standard gene products identified by monoclonal antibodies and antisera against measles virus. By using this method, we were able to assign the coding regions of cDNA clones to specific protein products and, subsequently, to order the genes of the 3'-terminal third of measles genome RNA. Images PMID:3838350

  13. Lactobacillus rhamnosus GG and Streptococcus thermophilus induce suppressor of cytokine signalling 3 (SOCS3) gene expression directly and indirectly via interleukin-10 in human primary macrophages

    PubMed Central

    Latvala, S; Miettinen, M; Kekkonen, R A; Korpela, R; Julkunen, I

    2011-01-01

    In the present study we have characterized T helper type 2 (Th2) [interleukin (IL)-10]/Th1 (IL-12) cytokine expression balance in human primary macrophages stimulated with multiple non-pathogenic Gram-positive bacteria used in the food industry and as probiotic substances. Bacteria representing Lactobacillus, Bifidobacterium, Lactococcus, Leuconostoc, Propionibacterium and Streptococcus species induced anti-inflammatory IL-10 production, although quantitative differences between the bacteria were observed. S. thermophilus was able to induce IL-12 production, while the production of IL-12 induced by other bacteria remained at a low level. The highest anti-inflammatory potential was seen with bifidobacteria, as evidenced by high IL-10/IL-12 induction ratios. All studied non-pathogenic bacteria were able to stimulate the expression of suppressor of cytokine signalling (SOCS) 3 that controls the expression of proinflammatory cytokine genes. Lactobacillus and Streptococcus species induced SOCS3 mRNA expression directly in the absence of protein synthesis and indirectly via bacteria-induced IL-10 production, as demonstrated by experiments with cycloheximide (CHX) and anti-IL-10 antibodies, respectively. The mitogen-activated protein kinase (MAPK) p38 signalling pathway played a key role in bacteria-induced SOCS3 gene expression. Enhanced IL-10 production and SOCS3 gene expression induced by live non-pathogenic Lactobacillus and Streptococcus is also likely to contribute to their immunoregulatory effects in vivo. PMID:21545585

  14. The metabolic regulator CodY links Listeria monocytogenes metabolism to virulence by directly activating the virulence regulatory gene prfA.

    PubMed

    Lobel, Lior; Sigal, Nadejda; Borovok, Ilya; Belitsky, Boris R; Sonenshein, Abraham L; Herskovits, Anat A

    2015-02-01

    Metabolic adaptations are critical to the ability of bacterial pathogens to grow within host cells and are normally preceded by sensing of host-specific metabolic signals, which in turn can influence the pathogen's virulence state. Previously, we reported that the intracellular bacterial pathogen Listeria monocytogenes responds to low availability of branched-chain amino acids (BCAAs) within mammalian cells by up-regulating both BCAA biosynthesis and virulence genes. The induction of virulence genes required the BCAA-responsive transcription regulator, CodY, but the molecular mechanism governing this mode of regulation was unclear. In this report, we demonstrate that CodY directly binds the coding sequence of the L. monocytogenes master virulence activator gene, prfA, 15 nt downstream of its start codon, and that this binding results in up-regulation of prfA transcription specifically under low concentrations of BCAA. Mutating this site abolished CodY binding and reduced prfA transcription in macrophages, and attenuated bacterial virulence in mice. Notably, the mutated binding site did not alter prfA transcription or PrfA activity under other conditions that are known to activate PrfA, such as during growth in the presence of glucose-1-phosphate. This study highlights the tight crosstalk between L. monocytogenes metabolism and virulence, while revealing novel features of CodY-mediated regulation. PMID:25430920

  15. The arcelin-5 Gene of Phaseolus vulgaris Directs High Seed-Specific Expression in Transgenic Phaseolus acutifolius and Arabidopsis Plants1

    PubMed Central

    Goossens, Alain; Dillen, Willy; De Clercq, Janniek; Van Montagu, Marc; Angenon, Geert

    1999-01-01

    The regulatory sequences of many genes encoding seed storage proteins have been used to drive seed-specific expression of a variety of proteins in transgenic plants. Because the levels at which these transgene-derived proteins accumulate are generally quite low, we investigated the utility of the arcelin-5 regulatory sequences in obtaining high seed-specific expression in transgenic plants. Arcelin-5 is an abundant seed protein found in some wild common bean (Phaseolus vulgaris L.) genotypes. Seeds of Arabidopsis and Tepary bean (Phaseolus acutifolius A. Gray) plants transformed with arcelin-5 gene constructs synthesized arcelin-5 to levels of 15% and 25% of the total protein content, respectively. To our knowledge, such high expression levels directed by a transgene have not been reported before. The transgenic plants also showed low plant-to-plant variation in arcelin expression. Complex transgene integration patterns, which often result in gene silencing effects, were not associated with reduced arcelin-5 expression. High transgene expression was the result of high mRNA steady-state levels and was restricted to seeds. This indicates that all requirements for high seed-specific expression are cis elements present in the cloned genomic arcelin-5 sequence and trans-acting factors that are available in Arabidopsis and Phaseolus spp., and thus probably in most dicotyledonous plants. PMID:10444093

  16. The metabolic regulator CodY links L. monocytogenes metabolism to virulence by directly activating the virulence regulatory gene, prfA

    PubMed Central

    Lobel, Lior; Sigal, Nadejda; Borovok, Ilya; Belitsky, Boris R.; Sonenshein, Abraham L.; Herskovits, Anat A.

    2015-01-01

    Summary Metabolic adaptations are critical to the ability of bacterial pathogens to grow within host cells and are normally preceded by sensing of host-specific metabolic signals, which in turn can influence the pathogen's virulence state. Previously, we reported that the intracellular bacterial pathogen Listeria monocytogenes responds to low availability of branched-chain amino acids (BCAA) within mammalian cells by up-regulating both BCAA biosynthesis and virulence genes. The induction of virulence genes required the BCAA-responsive transcription regulator, CodY, but the molecular mechanism governing this mode of regulation was unclear. In this report, we demonstrate that CodY directly binds the coding sequence of the L. monocytogenes master virulence activator gene, prfA, 15 nt downstream of its start codon, and that this binding results in up-regulation of prfA transcription specifically under low concentrations of BCAA. Mutating this site abolished CodY binding and reduced prfA transcription in macrophages, and attenuated bacterial virulence in mice. Notably, the mutated binding site did not alter prfA transcription or PrfA activity under other conditions that are known to activate PrfA, such as during growth in the presence of glucose-1-phosphate. This study highlights the tight crosstalk between L. monocytogenes metabolism and virulence' while revealing novel features of CodY-mediated regulation. PMID:25430920

  17. Transcription of Oxidative Stress Genes Is Directly Activated by SpxA1 and, to a Lesser Extent, by SpxA2 in Streptococcus mutans

    PubMed Central

    Kajfasz, Jessica K.; Rivera-Ramos, Isamar; Scott-Anne, Kathleen; Gregoire, Stacy; Abranches, Jacqueline

    2015-01-01

    ABSTRACT The SpxA1 and SpxA2 (formerly SpxA and SpxB) transcriptional regulators of Streptococcus mutans are members of a highly conserved family of proteins found in Firmicutes, and they were previously shown to activate oxidative stress responses. In this study, we showed that SpxA1 exerts substantial positive regulatory influence over oxidative stress genes following exposure to H2O2, while SpxA2 appears to have a secondary regulatory role. In vitro transcription (IVT) assays using purified SpxA1 and/or SpxA2 showed that SpxA1 and, less often, SpxA2 directly activate transcription of some of the major oxidative stress genes. Addition of equimolar concentrations of SpxA1 and SpxA2 to the IVT reactions neither enhanced transcription of the tested genes nor disrupted the dominant role of SpxA1. Substitution of a conserved glycine residue (G52) present in both Spx proteins by arginine (SpxG52R) resulted in strains that phenocopied the Δspx strains. Moreover, addition of purified SpxA1G52R completely failed to activate transcription of ahpC, sodA, and tpx, further confirming that the G52 residue is critical for Spx functionality. IMPORTANCE Streptococcus mutans is a pathogen associated with the formation of dental caries in humans. Within the oral cavity, S. mutans routinely encounters oxidative stress. Our previous data revealed that two regulatory proteins, SpxA1 and SpxA2 (formerly SpxA and SpxB), bear high homology to the Spx regulator that has been characterized as a critical activator of oxidative stress genes in Bacillus subtilis. In this report, we prove that Spx proteins of S. mutans directly activate transcription of genes involved in the oxidative stress response, though SpxA1 appears to have a more dominant role than SpxA2. Therefore, the Spx regulators play a critical role in the ability of S. mutans to thrive within the oral cavity. PMID:25897032

  18. Enhancement by lithium of cAMP-induced CRE/CREB-directed gene transcription conferred by TORC on the CREB basic leucine zipper domain

    PubMed Central

    Böer, Ulrike; Eglins, Julia; Krause, Doris; Schnell, Susanne; Schöfl, Christof; Knepel, Willhart

    2007-01-01

    The molecular mechanism of the action of lithium salts in the treatment of bipolar disorder is not well understood. As their therapeutic action requires chronic treatment, adaptive neuronal processes are suggested to be involved. The molecular basis of this are changes in gene expression regulated by transcription factors such as CREB (cAMP-response-element-binding protein). CREB contains a transactivation domain, in which Ser119 is phosphorylated upon activation, and a bZip (basic leucine zipper domain). The bZip is involved in CREB dimerization and DNA-binding, but also contributes to CREB transactivation by recruiting the coactivator TORC (transducer of regulated CREB). In the present study, the effect of lithium on CRE (cAMP response element)/CREB-directed gene transcription was investigated. Electrically excitable cells were transfected with CRE/CREB-driven luciferase reporter genes. LiCl (6 mM or higher) induced an up to 4.7-fold increase in 8-bromo-cAMP-stimulated CRE/CREB-directed transcription. This increase was not due to enhanced Ser119 phosphorylation or DNA-binding of CREB. Also, the known targets inositol monophosphatase and GSK3β (glycogen-synthase-kinase 3β) were not involved as specific GSK3β inhibitors and inositol replenishment did not mimic and abolish respectively the effect of lithium. However, lithium no longer enhanced CREB activity when the CREB-bZip was deleted or the TORC-binding site inside the CREB-bZip was specifically mutated (CREB-R300A). Otherwise, TORC overexpression conferred lithium responsiveness on CREB-bZip or the CRE-containing truncated rat somatostatin promoter. This indicates that lithium enhances cAMP-induced CRE/CREB-directed transcription, conferred by TORC on the CREB-bZip. We thus support the hypothesis that lithium salts modulate CRE/CREB-dependent gene transcription and suggest the CREB coactivator TORC as a new molecular target of lithium. PMID:17696880

  19. Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

    PubMed Central

    Muscat, G E; Mynett-Johnson, L; Dowhan, D; Downes, M; Griggs, R

    1994-01-01

    Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the

  20. Speeding up directed evolution: Combining the advantages of solid-phase combinatorial gene synthesis with statistically guided reduction of screening effort.

    PubMed

    Hoebenreich, Sabrina; Zilly, Felipe E; Acevedo-Rocha, Carlos G; Zilly, Matías; Reetz, Manfred T

    2015-03-20

    Efficient and economic methods in directed evolution at the protein, metabolic, and genome level are needed for biocatalyst development and the success of synthetic biology. In contrast to random strategies, semirational approaches such as saturation mutagenesis explore the sequence space in a focused manner. Although several combinatorial libraries based on saturation mutagenesis have been reported using solid-phase gene synthesis, direct comparison with traditional PCR-based methods is currently lacking. In this work, we compare combinatorial protein libraries created in-house via PCR versus those generated by commercial solid-phase gene synthesis. Using descriptive statistics and probabilistic distributions on amino acid occurrence frequencies, the quality of the libraries was assessed and compared, revealing that the outsourced libraries are characterized by less bias and outliers than the PCR-based ones. Afterward, we screened all libraries following a traditional algorithm for almost complete library coverage and compared this approach with an emergent statistical concept suggesting screening a lower portion of the protein sequence space. Upon analyzing the biocatalytic landscapes and best hits of all combinatorial libraries, we show that the screening effort could have been reduced in all cases by more than 50%, while still finding at least one of the best mutants. PMID:24921161

  1. Complete correction of hyperphenylalaninemia following liver-directed, recombinant AAV2/8 vector-mediated gene therapy in murine phenylketonuria

    PubMed Central

    Harding, CO; Gillingham, MB; Hamman, K; Clark, H; Goebel-Daghighi, E; Bird, A; Koeberl, DD

    2009-01-01

    Novel recombinant adeno-associated virus vectors pseudo-typed with serotype 8 capsid (rAAV2/8) have recently shown exciting promise as effective liver-directed gene transfer reagents. We have produced a novel liver-specific rAAV2/8 vector expressing the mouse phenylalanine hydroxylase (Pah) cDNA and have administered this vector to hyperphenylalaninemic PAH-deficient Pahenu2 mice, a model of human phenylketonuria (PKU). Our hypothesis was that this vector would produce sufficient hepatocyte transduction frequency and PAH activity to correct blood phenylalanine levels in murine PKU. Portal vein injection of recombinant AAV2/8 vector into five adult Pahenu2 mice yielded complete and stable (up to 17 weeks) correction of serum phenylalanine levels. Liver PAH activity was corrected to 11.5±2.4% of wild type liver activity and was associated with a significant increase in phenylalanine clearance following parenteral phenylalanine challenge. Although questions of long-term safety and stability of expression remain, recombinant AAV2/8-mediated, liver-directed gene therapy is a promising novel treatment approach for PKU and allied inborn errors of metabolism. PMID:16319949

  2. Complete correction of hyperphenylalaninemia following liver-directed, recombinant AAV2/8 vector-mediated gene therapy in murine phenylketonuria.

    PubMed

    Harding, C O; Gillingham, M B; Hamman, K; Clark, H; Goebel-Daghighi, E; Bird, A; Koeberl, D D

    2006-03-01

    Novel recombinant adeno-associated virus vectors pseudotyped with serotype 8 capsid (rAAV2/8) have recently shown exciting promise as effective liver-directed gene transfer reagents. We have produced a novel liver-specific rAAV2/8 vector expressing the mouse phenylalanine hydroxylase (Pah) cDNA and have administered this vector to hyperphenylalaninemic PAH-deficient Pah(enu2) mice, a model of human phenylketonuria (PKU). Our hypothesis was that this vector would produce sufficient hepatocyte transduction frequency and PAH activity to correct blood phenylalanine levels in murine PKU. Portal vein injection of recombinant AAV2/8 vector into five adult Pah(enu2) mice yielded complete and stable (up to 17 weeks) correction of serum phenylalanine levels. Liver PAH activity was corrected to 11.5+/-2.4% of wild type liver activity and was associated with a significant increase in phenylalanine clearance following parenteral phenylalanine challenge. Although questions of long-term safety and stability of expression remain, recombinant AAV2/8-mediated, liver-directed gene therapy is a promising novel treatment approach for PKU and allied inborn errors of metabolism. PMID:16319949

  3. Abdominal imaging: An introduction

    SciTech Connect

    Frick, M.P.; Feinberg, S.B.

    1986-01-01

    This nine-chapter book gives an overview of the integrated approach to abdominal imaging. Chapter 1 provides an introduction to the physics used in medical imaging; chapter 2 is on the selection of imaging modalities. These are followed by four chapters that deal, respectively, with plain radiography, computed tomographic scanning, sonography, and nuclear imaging, as applied to the abdomen. Two chapters then cover contrast material-enhanced studies of the gastrointestinal (GI) tract: one focusing on technical considerations; the other, on radiologic study of disease processes. The final chapter is a brief account of different interventional procedures.

  4. Introduction to Heat Pipes

    NASA Technical Reports Server (NTRS)

    Ku, Jentung

    2015-01-01

    This is the presentation file for the short course Introduction to Heat Pipes, to be conducted at the 2015 Thermal Fluids and Analysis Workshop, August 3-7, 2015, Silver Spring, Maryland. NCTS 21070-15. Course Description: This course will present operating principles of the heat pipe with emphases on the underlying physical processes and requirements of pressure and energy balance. Performance characterizations and design considerations of the heat pipe will be highlighted. Guidelines for thermal engineers in the selection of heat pipes as part of the spacecraft thermal control system, testing methodology, and analytical modeling will also be discussed.

  5. Neurolaw: A brief introduction

    PubMed Central

    Petoft, Arian

    2015-01-01

    Neurolaw, as an interdisciplinary field which links the brain to law, facilitates the pathway to better understanding of human behavior in order to regulate it accurately through incorporating neuroscience achievements in legal studies. Since 1990’s, this emerging field, by study on human nervous system as a new dimension of legal phenomena, leads to a more precise explanation for human behavior to revise legal rules and decision-makings. This paper strives to bring about significantly a brief introduction to neurolaw so as to take effective steps toward exploring and expanding the scope of law and more thorough understanding of legal issues in the field at hand. PMID:25874060

  6. Introduction to Econophysics

    NASA Astrophysics Data System (ADS)

    Mantegna, Rosario N.; Stanley, H. Eugene

    2007-08-01

    Preface; 1. Introduction; 2. Efficient market hypothesis; 3. Random walk; 4. Lévy stochastic processes and limit theorems; 5. Scales in financial data; 6. Stationarity and time correlation; 7. Time correlation in financial time series; 8. Stochastic models of price dynamics; 9. Scaling and its breakdown; 10. ARCH and GARCH processes; 11. Financial markets and turbulence; 12. Correlation and anti-correlation between stocks; 13. Taxonomy of a stock portfolio; 14. Options in idealized markets; 15. Options in real markets; Appendix A: notation guide; Appendix B: martingales; References; Index.

  7. Introduction to Econophysics

    NASA Astrophysics Data System (ADS)

    Mantegna, Rosario N.; Stanley, H. Eugene

    1999-12-01

    Preface; 1. Introduction; 2. Efficient market hypothesis; 3. Random walk; 4. Lévy stochastic processes and limit theorems; 5. Scales in financial data; 6. Stationarity and time correlation; 7. Time correlation in financial time series; 8. Stochastic models of price dynamics; 9. Scaling and its breakdown; 10. ARCH and GARCH processes; 11. Financial markets and turbulence; 12. Correlation and anti-correlation between stocks; 13. Taxonomy of a stock portfolio; 14. Options in idealized markets; 15. Options in real markets; Appendix A: notation guide; Appendix B: martingales; References; Index.

  8. Introduction to biosensors

    PubMed Central

    Bhalla, Nikhil; Jolly, Pawan; Formisano, Nello

    2016-01-01

    Biosensors are nowadays ubiquitous in biomedical diagnosis as well as a wide range of other areas such as point-of-care monitoring of treatment and disease progression, environmental monitoring, food control, drug discovery, forensics and biomedical research. A wide range of techniques can be used for the development of biosensors. Their coupling with high-affinity biomolecules allows the sensitive and selective detection of a range of analytes. We give a general introduction to biosensors and biosensing technologies, including a brief historical overview, introducing key developments in the field and illustrating the breadth of biomolecular sensing strategies and the expansion of nanotechnological approaches that are now available. PMID:27365030

  9. Introduction to deconvolution

    NASA Astrophysics Data System (ADS)

    Jansson, Peter A.

    2005-09-01

    Deconvolution tasks will always lie at the frontier of human knowledge in many fields, almost by definition. Rising in the latter 20th century from near disreputability, first to usefulness, then necessity in some disciplines, the varied techniques of deconvolution have assumed an important role in the scientists tool kit. This talk will trace deconvolutions development with examples, including many ``firsts,'' drawn from spectroscopy, radio astronomy, photography, cell biology, color science and diverse other fields. Following a tutorial introduction, detail will be provided on modern super-resolving methods and lesser known topics such as selected-ordinate image (SORI) processing.

  10. Introduction to biosensors.

    PubMed

    Bhalla, Nikhil; Jolly, Pawan; Formisano, Nello; Estrela, Pedro

    2016-06-30

    Biosensors are nowadays ubiquitous in biomedical diagnosis as well as a wide range of other areas such as point-of-care monitoring of treatment and disease progression, environmental monitoring, food control, drug discovery, forensics and biomedical research. A wide range of techniques can be used for the development of biosensors. Their coupling with high-affinity biomolecules allows the sensitive and selective detection of a range of analytes. We give a general introduction to biosensors and biosensing technologies, including a brief historical overview, introducing key developments in the field and illustrating the breadth of biomolecular sensing strategies and the expansion of nanotechnological approaches that are now available. PMID:27365030

  11. An introduction to webs

    NASA Astrophysics Data System (ADS)

    White, C. D.

    2016-04-01

    Webs are sets of Feynman diagrams that contribute to the exponents of scattering amplitudes, in the kinematic limit in which emitted radiation is soft. As such, they have a number of phenomenological and formal applications, and offer tantalizing glimpses into the all-order structure of perturbative quantum field theory. This article is based on a series of lectures given to graduate students, and aims to provide a pedagogical introduction to webs. Topics covered include exponentiation in (non-)abelian gauge theories, the web mixing matrix formalism for non-abelian gauge theories, and recent progress on the calculation of web diagrams. Problems are included throughout the text, to aid understanding.

  12. Detection of Extended-Spectrum β-Lactamase and Klebsiella pneumoniae Carbapenemase Genes Directly from Blood Cultures by Use of a Nucleic Acid Microarray

    PubMed Central

    Sinyavskiy, Oleg; Riederer, Kathleen; Hujer, Andrea M.; Bonomo, Robert A.

    2012-01-01

    The growing crisis of multidrug-resistant (MDR) Gram-negative bacteria requires that current technologies permit the rapid detection of extended-spectrum β-lactamase (blaESBL) and Klebsiella pneumoniae carbapenemase (blaKPC) genes. In the present study, we assessed the performance characteristics of a commercially available nucleic acid microarray system for the detection of blaESBL and blaKPC genes directly from positive blood cultures. Using blood cultures (BCs) that contained Gram-negative bacilli identified by Gram staining, we isolated bacterial DNA using spin columns (BC-C) and rapid water lysis (BC-W). Twenty ESBL/KPC-positive and 20 ESBL/KPC-negative blood culture samples, as well as 20 non-lactose-fermenting organisms, were tested. The 20 isolates that were ESBL positive by phenotypic testing were also evaluated on solid medium (SM), and the DNA was extracted by use of a spin column (SM-C). The resulting 140 DNA extractions were assessed for DNA quantity and quality using 260/280-nm absorbance ratios, and DNA microarray analysis was performed in a blinded fashion. Microarray and phenotypic results were concordant for 98.3% of BC-W, 90% of BC-C, and 95% of SM-C samples. Compared to phenotypic testing, the sensitivity and specificity for BC-C samples were 88.9% and 100%, respectively, and for BC-W samples, the sensitivity and specificity were 94.4% and 100%, respectively. BC-W samples yielded the highest concordance with phenotypic results. Nucleic acid microarrays offer promise in the identification of blaESBL and blaKPC genes directly from blood cultures, thereby reducing the time to identification of these important pathogens. PMID:22718942

  13. The Arabidopsis SWI2/SNF2 chromatin Remodeler BRAHMA regulates polycomb function during vegetative development and directly activates the flowering repressor gene SVP.

    PubMed

    Li, Chenlong; Chen, Chen; Gao, Lei; Yang, Songguang; Nguyen, Vi; Shi, Xuejiang; Siminovitch, Katherine; Kohalmi, Susanne E; Huang, Shangzhi; Wu, Keqiang; Chen, Xuemei; Cui, Yuhai

    2015-01-01

    The chromatin remodeler BRAHMA (BRM) is a Trithorax Group (TrxG) protein that antagonizes the functions of Polycomb Group (PcG) proteins in fly and mammals. Recent studies also implicate such a role for Arabidopsis (Arabidopsis thaliana) BRM but the molecular mechanisms underlying the antagonism are unclear. To understand the interplay between BRM and PcG during plant development, we performed a genome-wide analysis of trimethylated histone H3 lysine 27 (H3K27me3) in brm mutant seedlings by chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Increased H3K27me3 deposition at several hundred genes was observed in brm mutants and this increase was partially supressed by removal of the H3K27 methyltransferase CURLY LEAF (CLF) or SWINGER (SWN). ChIP experiments demonstrated that BRM directly binds to a subset of the genes and prevents the inappropriate association and/or activity of PcG proteins at these loci. Together, these results indicate a crucial role of BRM in restricting the inappropriate activity of PcG during plant development. The key flowering repressor gene SHORT VEGETATIVE PHASE (SVP) is such a BRM target. In brm mutants, elevated PcG occupancy at SVP accompanies a dramatic increase in H3K27me3 levels at this locus and a concomitant reduction of SVP expression. Further, our gain- and loss-of-function genetic evidence establishes that BRM controls flowering time by directly activating SVP expression. This work reveals a genome-wide functional interplay between BRM and PcG and provides new insights into the impacts of these proteins in plant growth and development. PMID:25615622

  14. Krüppel Homolog 1 Inhibits Insect Metamorphosis via Direct Transcriptional Repression of Broad-Complex, a Pupal Specifier Gene.

    PubMed

    Kayukawa, Takumi; Nagamine, Keisuke; Ito, Yuka; Nishita, Yoshinori; Ishikawa, Yukio; Shinoda, Tetsuro

    2016-01-22

    The Broad-Complex gene (BR-C) encodes transcription factors that dictate larval-pupal metamorphosis in insects. The expression of BR-C is induced by molting hormone (20-hydroxyecdysone (20E)), and this induction is repressed by juvenile hormone (JH), which exists during the premature larval stage. Krüppel homolog 1 gene (Kr-h1) has been known as a JH-early inducible gene responsible for repression of metamorphosis; however, the functional relationship between Kr-h1 and repression of BR-C has remained unclear. To elucidate this relationship, we analyzed cis- and trans elements involved in the repression of BR-C using a Bombyx mori cell line. In the cells, as observed in larvae, JH induced the expression of Kr-h1 and concurrently suppressed 20E-induced expression of BR-C. Forced expression of Kr-h1 repressed the 20E-dependent activation of the BR-C promoter in the absence of JH, and Kr-h1 RNAi inhibited the JH-mediated repression, suggesting that Kr-h1 controlled the repression of BR-C. A survey of the upstream sequence of BR-C gene revealed a Kr-h1 binding site (KBS) in the BR-C promoter. When KBS was deleted from the promoter, the repression of BR-C was abolished. Electrophoresis mobility shift demonstrated that two Kr-h1 molecules bound to KBS in the BR-C promoter. Based on these results, we conclude that Kr-h1 protein molecules directly bind to the KBS sequence in the BR-C promoter and thereby repress 20E-dependent activation of the pupal specifier, BR-C. This study has revealed a considerable portion of the picture of JH signaling pathways from the reception of JH to the repression of metamorphosis. PMID:26518872

  15. Mi-1.2, an R gene for aphid resistance in tomato, has direct negative effects on a zoophytophagous biocontrol agent, Orius insidiosus

    PubMed Central

    Pallipparambil, Godshen R.; Sayler, Ronald J.; Shapiro, Jeffrey P.; Thomas, Jean M. G.; Kring, Timothy J.; Goggin, Fiona L.

    2015-01-01

    Mi-1.2 is a single dominant gene in tomato that confers race-specific resistance against certain phloem-feeding herbivores including aphids, whiteflies, psyllids, and root-knot nematodes. Few prior studies have considered the potential non-target effects of race-specific resistance genes (R genes), and this paper evaluates the compatibility of Mi-mediated resistance in tomato with a beneficial zoophytophagous predator, Orius insidiosus (Say). In addition to preying on aphids and other pests, this piercing–sucking insect also feeds from the xylem, epidermis, and/or mesophyll, and oviposits within plant tissues. Comparison of O. insidiosus confined to isogenic tomato plants with and without Mi-1.2 revealed that immatures of O. insidiosus had lower survival on resistant plants even when the immatures were provisioned with prey that did not feed on the host plant. Molecular gut content analysis confirmed that adults and immatures of O. insidiosus feed on both resistant (Mi-1.2+) and susceptible (Mi-1.2–) genotypes, and bioassays suggest that resistance does not affect oviposition rates, plant sampling, or prey acceptance by O. insidiosus adults. These results demonstrate a direct negative impact of R-gene-mediated host plant resistance on a non-target beneficial species, and reveal that Mi-mediated resistance can impact organisms that do not feed on phloem sap. Through laser capture microdissection and RT-PCR, Mi-1.2 transcripts were detected in the epidermis and mesophyll as well as the phloem of tomato plants, consistent with our observations that Mi-mediated resistance is active outside the phloem. These results suggest that the mode of action and potential ecological impacts of Mi-mediated resistance are broader than previously assumed. PMID:25189594

  16. A Locked Nucleic Acid (LNA)-Based Real-Time PCR Assay for the Rapid Detection of Multiple Bacterial Antibiotic Resistance Genes Directly from Positive Blood Culture

    PubMed Central

    Zhu, Lingxiang; Shen, Dingxia; Zhou, Qiming; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2015-01-01

    Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA)-based quantitative real-time PCR (LNA-qPCR) method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1–10 colony forming units (CFU) per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4%) were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates. PMID:25775001

  17. Design of a novel triple helix-forming oligodeoxyribonucleotide directed to the major promoter of the c-myc gene

    PubMed Central

    McGuffie, E. M.; Catapano, C. V.

    2002-01-01

    Altered expression of c-myc is implicated in pathogenesis and progression of many human cancers. Triple helix-forming oligonucleotides (TFOs) directed to a polypurine/polypyrimidine sequence in a critical regulatory region near the c-myc P2 promoter have been shown to inhibit c-myc transcription in vitro and in cells. However, these guanine-rich TFOs had moderate binding affinity and required high concentrations for activity. The 23 bp myc P2 sequence is split equally into AT- and GC-rich tracts. Gel mobility analysis of a series of short TFOs directed in parallel and anti-parallel orientation to the purine strand of each tract showed that only parallel CT and anti-parallel GT TFOs formed stable triplex on the AT- and GC-rich tracts, respectively. A novel full-length GTC TFO was designed to bind simultaneously in parallel and anti-parallel orientation to the polypurine strand. Gel-shift and footprinting assays showed that the new TFO formed a triple helix in physiological conditions with significantly higher affinity than an anti-parallel TFO. Protein-binding assays showed that 1 µM GTC TFO inhibited binding of nuclear transcription factors to the P2 promoter sequence. The novel TFO can be developed into a potent antigene agent, and its design strategy applied to similar genomic sequences, thus expanding the TFO repertoire. PMID:12060688

  18. Transcription of the Schizosaccharomyces pombe U2 gene in vivo and in vitro is directed by two essential promoter elements

    PubMed Central

    Zhou, Dewang; Lobo-Ruppert, Susan M.

    2001-01-01

    As compared to the metazoan small nuclear RNAs (snRNAs), relatively little is known about snRNA synthesis in unicellular organisms. We have analyzed the transcription of the Schizosaccharomyces pombe U2 snRNA gene in vivo and in the homologous in vitro system. Deletion and linker-scanning analyses show that the S.pombe U2 promoter contains at least two elements: the spUSE centered at –55, which functions as an activator, and a TATA box at –26, which is essential for basal transcription. These data point to a similar architecture among S.pombe, plant and invertebrate snRNA promoters. Factors recognizing the spUSE can be detected in whole cell extracts by DNase I footprinting and competition studies show that the binding of these factors correlates with transcriptional activity. Electrophoretic mobility shift assays and gel-filtration chromatography revealed a native molecular mass of ∼200 kDa for the spUSE binding activity. Two polypeptides of molecular masses 25 and 65 kDa were purified by virtue of their ability to specifically bind the spUSE. PMID:11353068

  19. Gene regulatory networks mediating canonical Wnt signal directed control of pluripotency and differentiation in embryo stem cells

    PubMed Central

    Zhang, Xiaoxiao; Peterson, Kevin A.; Liu, X. Shirley; McMahon, Andrew P.; Ohba, Shinsuke

    2013-01-01

    Canonical Wnt signaling supports the pluripotency of embryonic stem cells (ESCs) but also promotes differentiation of early mammalian cell lineages. To explain these paradoxical observations, we explored the gene regulatory networks at play. Canonical Wnt signaling is intertwined with the pluripotency network comprising Nanog, Oct4, and Sox2 in mouse ESCs. In defined media supporting the derivation and propagation of ESCs, Tcf3 and β-catenin interact with Oct4; Tcf3 binds to Sox motif within Oct-Sox composite motifs that are also bound by Oct4-Sox2 complexes. Further, canonical Wnt signaling up-regulates the activity of the Pou5f1 distal enhancer via the Sox motif in ESCs. When viewed in the context of published studies on Tcf3 and β-catenin mutants, our findings suggest Tcf3 counters pluripotency by competition with Sox2 at these sites, and Tcf3 inhibition is blocked by β-catenin entry into this complex. Wnt pathway stimulation also triggers β-catenin association at regulatory elements with classic Lef/Tcf motifs associated with differentiation programs. The failure to activate these targets in the presence of a MEK/ERK inhibitor essential for ESC culture suggests MEK/ERK signaling and canonical Wnt signaling combine to promote ESC differentiation. PMID:23505158

  20. PPARalpha and PPARgamma activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene.

    PubMed Central

    Schoonjans, K; Peinado-Onsurbe, J; Lefebvre, A M; Heyman, R A; Briggs, M; Deeb, S; Staels, B; Auwerx, J

    1996-01-01

    Increased activity of lipoprotein lipase (LPL) may explain the hypotriglyceridemic effects of fibrates, thiazolidinediones and fatty acids, which are known activators (and/or ligands) of the various peroxisome proliferator-activated receptors (PPARs). Treatment with compounds which activate preferentially PPARalpha, such as fenofibrate, induced LPL expression exclusively in rat liver. In contrast, the antidiabetic thiazolidinedione BRL 49653, a high affinity ligand for PPARgamma, had no effect on liver, but induced LPL expression in rat adipose tissue. In the hepatocyte cell line AML-12, fenofibric acid, but not BRL 49653, induced LPL mRNA, whereas in 3T3-L1 preadipocytes, the PPARgamma ligand induced LPL mRNA levels much quicker and to a higher extent than fenofibric acid. In both the in vivo and in vitro studies, inducibility by either PPARalpha or gamma activators, correlated with the tissue distribution of the respective PPARs: an adipocyte-restricted expression of PPARgamma, whereas PPARalpha was expressed predominantly in liver. A sequence element was identified in the human LPL promoter that mediates the functional responsiveness to fibrates and thiazolidinediones. Methylation interference and gel retardation assays demonstrated that a PPARalpha or gamma and the 9-cis retinoic acid receptor (RXR) heterodimers bind to this sequence -169 TGCCCTTTCCCCC -157. These data provide evidence that transcriptional activation of the LPL gene by fibrates and thiazolidinediones is mediated by PPAR-RXR heterodimers and contributes significantly to their hypotriglyceridemic effects in vivo. Whereas thiazolidinediones predominantly affect adipocyte LPL production through activation of PPARgamma, fibrates exert their effects mainly in the liver via activation of PPARalpha. Images PMID:8895578

  1. Controlling feeding behavior by chemical or gene-directed targeting in the brain: what's so spatial about our methods?

    PubMed Central

    Khan, Arshad M.

    2013-01-01

    Intracranial chemical injection (ICI) methods have been used to identify the locations in the brain where feeding behavior can be controlled acutely. Scientists conducting ICI studies often document their injection site locations, thereby leaving kernels of valuable location data for others to use to further characterize feeding control circuits. Unfortunately, this rich dataset has not yet been formally contextualized with other published neuroanatomical data. In particular, axonal tracing studies have delineated several neural circuits originating in the same areas where ICI injection feeding-control sites have been documented, but it remains unclear whether these circuits participate in feeding control. Comparing injection sites with other types of location data would require careful anatomical registration between the datasets. Here, a conceptual framework is presented for how such anatomical registration efforts can be performed. For example, by using a simple atlas alignment tool, a hypothalamic locus sensitive to the orexigenic effects of neuropeptide Y (NPY) can be aligned accurately with the locations of neurons labeled by anterograde tracers or those known to express NPY receptors or feeding-related peptides. This approach can also be applied to those intracranial “gene-directed” injection (IGI) methods (e.g., site-specific recombinase methods, RNA expression or interference, optogenetics, and pharmacosynthetics) that involve viral injections to targeted neuronal populations. Spatial alignment efforts can be accelerated if location data from ICI/IGI methods are mapped to stereotaxic brain atlases to allow powerful neuroinformatics tools to overlay different types of data in the same reference space. Atlas-based mapping will be critical for community-based sharing of location data for feeding control circuits, and will accelerate our understanding of structure-function relationships in the brain for mammalian models of obesity and metabolic disorders

  2. Introduction of a new issue paper from CAST - Implications of gene flow in the scale-up and commercial use of biotechnology-derived crops: Economic and Policy Considerations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper reviews the concept of gene flow — the successful transfer of genetic information between different individuals, populations, and generations (to progeny) and across spatial dimensions. The paper also discusses the relatively limited situations in which gene flow is likely to cause ec...

  3. EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in Arabidopsis

    PubMed Central

    Qiu, Kai; Li, Zhongpeng; Yang, Zhen; Chen, Junyi; Wu, Shouxin; Zhu, Xiaoyu; Gao, Shan; Gao, Jiong; Ren, Guodong; Kuai, Benke; Zhou, Xin

    2015-01-01

    Degreening, caused by chlorophyll degradation, is the most obvious symptom of senescing leaves. Chlorophyll degradation can be triggered by endogenous and environmental cues, and ethylene is one of the major inducers. ETHYLENE INSENSITIVE3 (EIN3) is a key transcription factor in the ethylene signaling pathway. It was previously reported that EIN3, miR164, and a NAC (NAM, ATAF, and CUC) transcription factor ORE1/NAC2 constitute a regulatory network mediating leaf senescence. However, how this network regulates chlorophyll degradation at molecular level is not yet elucidated. Here we report a feed-forward regulation of chlorophyll degradation that involves EIN3, ORE1, and chlorophyll catabolic genes (CCGs). Gene expression analysis showed that the induction of three major CCGs, NYE1, NYC1 and PAO, by ethylene was largely repressed in ein3 eil1 double mutant. Dual-luciferase assay revealed that EIN3 significantly enhanced the promoter activity of NYE1, NYC1 and PAO in Arabidopsis protoplasts. Furthermore, Electrophoretic mobility shift assay (EMSA) indicated that EIN3 could directly bind to NYE1, NYC1 and PAO promoters. These results reveal that EIN3 functions as a positive regulator of CCG expression during ethylene-mediated chlorophyll degradation. Interestingly, ORE1, a senescence regulator which is a downstream target of EIN3, could also activate the expression of NYE1, NYC1 and PAO by directly binding to their promoters in EMSA and chromatin immunoprecipitation (ChIP) assays. In addition, EIN3 and ORE1 promoted NYE1 and NYC1 transcriptions in an additive manner. These results suggest that ORE1 is also involved in the direct regulation of CCG transcription. Moreover, ORE1 activated the expression of ACS2, a major ethylene biosynthesis gene, and subsequently promoted ethylene production. Collectively, our work reveals that EIN3, ORE1 and CCGs constitute a coherent feed-forward loop involving in the robust regulation of ethylene-mediated chlorophyll degradation

  4. Morbillivirus Infections: An Introduction

    PubMed Central

    de Vries, Rory D.; Duprex, W. Paul; de Swart, Rik L.

    2015-01-01

    Research on morbillivirus infections has led to exciting developments in recent years. Global measles vaccination coverage has increased, resulting in a significant reduction in measles mortality. In 2011 rinderpest virus was declared globally eradicated – only the second virus to be eradicated by targeted vaccination. Identification of new cellular receptors and implementation of recombinant viruses expressing fluorescent proteins in a range of model systems have provided fundamental new insights into the pathogenesis of morbilliviruses, and their interactions with the host immune system. Nevertheless, both new and well-studied morbilliviruses are associated with significant disease in wildlife and domestic animals. This illustrates the need for robust surveillance and a strategic focus on barriers that restrict cross-species transmission. Recent and ongoing measles outbreaks also demonstrate that maintenance of high vaccination coverage for these highly infectious agents is critical. This introduction briefly summarizes the most important current research topics in this field. PMID:25685949

  5. Introduction to superstrings

    NASA Astrophysics Data System (ADS)

    Kaku, Michio

    The history and fundamental principles of superstring theory are presented in a textbook for graduate physics students. The approach is based on the use of Feynman path integrals and the method of second quantization. Chapters are devoted to path integrals and point particles, Nambu-Goto strings, superstrings, conformal field theory and Kac-Moody algebras, multiple loops and Teichmueller spaces, light-cone field theory, and Becchi-Rouet-Stora-Tyupin field theory. Consideration is given to geometric string-field theory, anomalies and the Atiyah-Singer theorem, heterotic strings and compactification, and Calabi-Yau spaces and orbifolds. Brief introductions to topics in basic theory and a detailed glossary of terms are provided.

  6. Pediatric obesity. An introduction.

    PubMed

    Yanovski, Jack A

    2015-10-01

    The prevalence of child and adolescent obesity in the United States increased dramatically between 1970 and 2000, and there are few indications that the rates of childhood obesity are decreasing. Obesity is associated with myriad medical, psychological, and neurocognitive abnormalities that impact children's health and quality of life. Genotypic variation is important in determining the susceptibility of individual children to undue gains in adiposity; however, the rapid increase in pediatric obesity prevalence suggests that changes to children's environments and/or to their learned behaviors may dramatically affect body weight regulation. This paper presents an overview of the epidemiology, consequences, and etiopathogenesis of pediatric obesity, serving as a general introduction to the subsequent papers in this Special Issue that address aspects of childhood obesity and cognition in detail. PMID:25836737

  7. Introduction to lattice QCD

    SciTech Connect

    Gupta, R.

    1998-12-31

    The goal of the lectures on lattice QCD (LQCD) is to provide an overview of both the technical issues and the progress made so far in obtaining phenomenologically useful numbers. The lectures consist of three parts. The author`s charter is to provide an introduction to LQCD and outline the scope of LQCD calculations. In the second set of lectures, Guido Martinelli will discuss the progress they have made so far in obtaining results, and their impact on Standard Model phenomenology. Finally, Martin Luescher will discuss the topical subjects of chiral symmetry, improved formulation of lattice QCD, and the impact these improvements will have on the quality of results expected from the next generation of simulations.

  8. Direct in vitro effects of androgens and estrogens on ob gene expression and leptin secretion in human adipose tissue.

    PubMed

    Machinal-Quélin, Florence; Dieudonné, Marie-Noëlle; Pecquery, René; Leneveu, Marie-Christine; Giudicelli, Yves

    2002-07-01

    In the present study, we have explored, in vitro, the possibility that short exposure to androgens and estrogens for 24 h may directly influence leptin expression (ARNm and secretion) in sc adipose tissue from men and women. In men, only dihydrotestosterone at high concentration (100 nM) induced a reduction in leptin secretion and ob mRNA level. In women, 17beta-estradiol (10-100 nM) increased ob mRNA expression (+180 to +500%) and leptin release (+75%). Moreover, in adipose tissue of women, the estrogen precursors testosterone (100 nM) and dehydroepiandrosterone (1 microM) also induced an increase in leptin secretion (+84 and +96%, respectively), an effect that was prevented by the aromatase inhibitor letrozole. Finally, the stimulatory effect of 17beta-estradiol observed in women was antagonized by the antiestrogen ICI182780. Altogether, these results suggest that the sexual dimorphism of leptinemia in humans is mainly owing to the estrogen receptor-dependent stimulation of leptin expression in adipose tissue by estrogens and estrogen precursors in women. PMID:12374466

  9. Characterization of directly transformed weedy Brassica rapa and introgressed B. rapa with Bt cry1Ac and gfp genes.

    PubMed

    Moon, Hong S; Halfhill, Matthew D; Good, Laura L; Raymer, Paul L; Neal Stewart, C

    2007-07-01

    Crop to weed transgene flow, which could result in more competitive weed populations, is an agricultural biosafety concern. Crop Brassica napus to weedy Brassica rapa hybridization has been extensively characterized to better understand the transgene flow and its consequences. In this study, weedy accessions of B. rapa were transformed with Bacillus thuringiensis (Bt) cry1Ac- and green fluorescence protein (gfp)-coding transgenes using Agrobacterium to assess ecological performance of the wild biotype relative to introgressed hybrids in which the transgenic parent was the crop. Regenerated transgenic B. rapa events were characterized by progeny analysis, Bt protein enzyme-linked immunosorbent assay (ELISA), Southern blot analysis, and GFP expression assay. GFP expression level and Bt protein concentration were significantly different between independent transgenic B. rapa events. Similar reproductive productivity was observed in comparison between transgenic B. rapa events and B. rapa x B. napus introgressed hybrids in greenhouse and field experiments. In the greenhouse, Bt transgenic plants experienced significantly less herbivory damage from the diamondback moth (Plutella xylostella). No differences were found in the field experiment under ambient, low, herbivore pressure. Directly transformed transgenic B. rapa plants should be a helpful experimental control to better understand crop genetic load in introgressed transgenic weeds. PMID:17333014

  10. Group 1 Allergen Genes in Two Species of House Dust Mites, Dermatophagoides farinae and D. pteronyssinus (Acari: Pyroglyphidae): Direct Sequencing, Characterization and Polymorphism

    PubMed Central

    Shafique, Rubaba Hamid; Klimov, Pavel B.; Inam, Muhammad; Chaudhary, Farhana Riaz; OConnor, Barry M.

    2014-01-01

    Group 1 allergens of Dermatophagoides farinae (Der f 1) and D. pteronyssinus (Der p 1) dominate overall allergic responses in house dust mite allergy patients. The need for accurate identification and characterization of representative variants of group 1 allergens in any given geographic locality has been emphasized for development of appropriate allergen extracts. Regional amino acid sequence polymorphism has been described but the extent of this polymorphism is not well understood. Such data are completely absent for the USA and many other countries. Most previous studies used cDNA libraries generated by reverse transcriptase (RT-PCR) and/or primers amplifying shorter fragments of this gene. Using novel species-specific primers and direct PCR, we document group 1 allergen gene sequence polymorphism in populations of D. farinae and D. pteronyssinus from the USA and Pakistan. We report two novel introns (nt pos 87 and 291) in both species, and the absence of intron 3 in Der p 1. Thirteen silent and one novel non-synonymous mutation (Tryptophan W197 to Arginine R197) were detected in D. farinae. The potential medical significance of the latter mutation is discussed. Two haplotypes of the Der f 1 gene were identified, haplotype 1 (63%) was more frequent than haplotype 2 (18%). Polymorphism in Der f 1 displayed geographical localization, since both haplotypes were present in mite populations from Pakistan whereas haplotype 1 was observed only in the USA. In Der p 1, a silent mutation at nt (aa) position 1011(149) and four non-synonymous mutations at positions 589(50), 935(124), 971(136), 1268(215) were observed. These mutations were reported from many other geographic regions, suggesting that polymorphism in the Der p 1 gene is panmictic. The extent of polymorphism in both genes is substantially lower than that reported previously (0.10–0.16% vs 0.31–0.49%), indicating the need for careful evaluation of potential polymerase errors in studies utilizing RT

  11. Introduction to multivariate discrimination

    NASA Astrophysics Data System (ADS)

    Kégl, Balázs

    2013-07-01

    Multivariate discrimination or classification is one of the best-studied problem in machine learning, with a plethora of well-tested and well-performing algorithms. There are also several good general textbooks [1-9] on the subject written to an average engineering, computer science, or statistics graduate student; most of them are also accessible for an average physics student with some background on computer science and statistics. Hence, instead of writing a generic introduction, we concentrate here on relating the subject to a practitioner experimental physicist. After a short introduction on the basic setup (Section 1) we delve into the practical issues of complexity regularization, model selection, and hyperparameter optimization (Section 2), since it is this step that makes high-complexity non-parametric fitting so different from low-dimensional parametric fitting. To emphasize that this issue is not restricted to classification, we illustrate the concept on a low-dimensional but non-parametric regression example (Section 2.1). Section 3 describes the common algorithmic-statistical formal framework that unifies the main families of multivariate classification algorithms. We explain here the large-margin principle that partly explains why these algorithms work. Section 4 is devoted to the description of the three main (families of) classification algorithms, neural networks, the support vector machine, and AdaBoost. We do not go into the algorithmic details; the goal is to give an overview on the form of the functions these methods learn and on the objective functions they optimize. Besides their technical description, we also make an attempt to put these algorithm into a socio-historical context. We then briefly describe some rather heterogeneous applications to illustrate the pattern recognition pipeline and to show how widespread the use of these methods is (Section 5). We conclude the chapter with three essentially open research problems that are either

  12. GUEST EDITORS' INTRODUCTION: Guest Editors' introduction

    NASA Astrophysics Data System (ADS)

    Coulson, Geoff; de Meer, Jan B.

    1997-03-01

    service management' by Gregor v Bochmann and Abdelhakim Hafid offers lessons in QoS management learned during the implementation of a prototype News-on-Demand application. Some general principles are extracted from this experience. In particular, a novel QoS adaptation technique is highlighted: transparent automatic reconfiguration of the components involved in a communication (e.g. choice of an alternative network or server at run time). An algorithm which attempts to choose optimal configurations is discussed. `Quality of service management using generic modelling and monitoring techniques', by Leonard Franken and Boudewijn Haverkort investigates the use of Petri nets as the basis of generic QoS monitoring of distributed applications. A distributed application is exploded into finegrained component parts and interactions between these parts are instrumented. The paper offers a case study of the instrumentation of a videophone application using this technique. Simulation is used to evaluate the scheme. The final two papers in the special issue are more focused and pragmatic in nature. These papers explore QoS provision in particular environments (the World Wide Web and ATM networks respectively) through reported implementation experience. `QoS management in a World Wide Web environment which supports continuous media' by Michael Fry, Aruna Seneviratne, Andreas Vogel and Varuni Witana looks at the practical provision of end to end QoS management in the World Wide Web. The paper looks beyond currently available tools such as RealAudio and StreamWorks and presents a QoS managed RTP based solution featuring an adjunct QoS management protocol. This work offers QoS management functions (e.g. QoS negotiation, adaptation and control of QoS degradation paths) directly to the user via the usual Web GUI. `A QoS adaptive multimedia transport system: design, implementation and experiences' by Andrew Campbell and Geoff Coulson offers further practical experience of QoS management

  13. Molecular Determinants for Targeting Heterochromatin Protein 1-Mediated Gene Silencing: Direct Chromoshadow Domain–KAP-1 Corepressor Interaction Is Essential

    PubMed Central

    Lechner, Mark S.; Begg, Gillian E.; Speicher, David W.; Rauscher, Frank J.

    2000-01-01

    The KRAB domain is a highly conserved transcription repression module commonly found in eukaryotic zinc finger proteins. KRAB-mediated repression requires binding to the KAP-1 corepressor, which in turn recruits members of the heterochromatin protein 1 (HP1) family. The HP1 proteins are nonhistone chromosomal proteins, although it is unclear how they are targeted to unique chromosomal domains or promoters. In this report, we have reconstituted and characterized the HP1–KAP-1 interaction using purified proteins and have compared KAP-1 to three other known HP1 binding proteins: SP100, lamin B receptor (LBR), and the p150 subunit from chromatin assembly factor (CAF-1 p150). We show that the chromoshadow domain (CSD) of HP1 is a potent repression domain that binds directly to all four previously described proteins. For KAP-1, we have mapped the CSD interaction region to a 15-amino-acid segment, termed the HP1BD, which is also present in CAF-1 p150 but not SP100 or LBR. The region of KAP-1 harboring the HP1BD binds as a monomer to a dimer of the CSD, as revealed by gel filtration, analytical ultracentrifugation, and optical biosensor analyses. The use of a spectrum of amino acid substitutions in the human HP1α CSD revealed a strong correlation between CSD-mediated repression and binding to KAP-1, CAF-1 p150, and SP100 but not LBR. Differences among the HP1 binding partners could also be discerned by fusion to a heterologous DNA binding domain and by the potential to act as dominant negative molecules. Together, these results strongly suggest that KAP-1 is a physiologically relevant target for HP1 function. PMID:10938122

  14. Size and positional effects of promoter RNA segments on virus-induced RNA-directed DNA methylation and transcriptional gene silencing

    PubMed Central

    Otagaki, Shungo; Kawai, Miou; Masuta, Chikara; Kanazawa, Akira

    2011-01-01

    DNA methylation at a gene promoter can be triggered by double-stranded RNAs (dsRNAs) through the RNA-directed DNA methylation (RdDM) pathway and induces transcriptional gene silencing (TGS). Although genes involved in the RdDM pathway have been identified, whether dsRNAs of different promoter regions have different extent of effects on RdDM and/or TGS is unknown. Here, we addressed this question by targeting the CaMV 35S promoter in the plant genome using a recombinant Cucumber mosaic virus that contained various portions of the promoter. The efficiency of the induction of TGS depended on the length of the promoter segment triggering the RdDM; the lower size limit for TGS induction was 81-91 nt. TGS was induced when 70-nt fragments were connected in tandem, none of which solely induced TGS. TGS induction did not simply depend on the production of small interfering RNAs corresponding to the promoter. Along with the induction of RdDM, spreading of DNA methylation from the originally targeted site toward the adjacent regions was detected. The maintenance of TGS in the progeny that lacks an RNA trigger depended on the promoter segments triggering the RdDM in the former generation and was correlated with the number of cytosines at symmetrical sites in the targeted region. These results indicate that both the length of dsRNA above the threshold and the frequency of cytosines at symmetric sites in the region targeted by dsRNA are the major factors that allow induction of heritable TGS via RdDM. PMID:21610318

  15. Direct exposure of mouse ovaries and oocytes to high doses of an adenovirus gene therapy vector fails to lead to germ cell transduction.

    PubMed

    Gordon, J W

    2001-04-01

    The risk of insertion of adenovirus gene therapy DNA into female germ cells during the course of somatic gene therapy was stringently tested in the mouse by injecting up to 10(10) infectious particles directly into the ovary and by incubating naked oocytes in a solution of 2 x 10(8) particles/ml for 1 h prior to in vitro fertilization (IVF). The vector used was a recombinant adenovirus carrying the bacterial lacZ gene driven by the cytomegalovirus promoter (Adbeta-gal). Ovaries were stained for LacZ activity, or immunochemically for LacZ, 5-7 days after injection. Although very large amounts of LacZ activity and protein were detected, all positive staining was in the thecal portion of the ovary, with no staining seen in oocytes. In another series of experiments, mice with injected ovaries were mated, and preimplantation embryos or fetuses were analyzed either for LacZ expression or by PCR for lacZ DNA. None of 202 preimplantation embryos stained positively for LacZ and none of 58 fetuses were positive for DNA by PCR analysis. Finally, more than 1400 eggs were fertilized after exposure to the vector prior to IVF and stained as morulae for LacZ activity. Fewer than 2% of the embryos stained positively for LacZ, and experiments indicated that the staining was due to incomplete washing of the eggs prior to IVF. These data provide strong evidence that adenoviruses cannot infect oocytes and that the risk of female germ-line transduction with such vectors is very low. PMID:11319918

  16. OsNAP connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice

    PubMed Central

    Liang, Chengzhen; Wang, Yiqin; Zhu, Yana; Tang, Jiuyou; Hu, Bin; Liu, Linchuan; Ou, Shujun; Wu, Hongkai; Sun, Xiaohong; Chu, Jinfang; Chu, Chengcai

    2014-01-01

    It has long been established that premature leaf senescence negatively impacts the yield stability of rice, but the underlying molecular mechanism driving this relationship remains largely unknown. Here, we identified a dominant premature leaf senescence mutant, prematurely senile 1 (ps1-D). PS1 encodes a plant-specific NAC (no apical meristem, Arabidopsis ATAF1/2, and cup-shaped cotyledon2) transcriptional activator, Oryza sativa NAC-like, activated by apetala3/pistillata (OsNAP). Overexpression of OsNAP significantly promoted senescence, whereas knockdown of OsNAP produced a marked delay of senescence, confirming the role of this gene in the development of rice senescence. OsNAP expression was tightly linked with the onset of leaf senescence in an age-dependent manner. Similarly, ChIP-PCR and yeast one-hybrid assays demonstrated that OsNAP positively regulates leaf senescence by directly targeting genes related to chlorophyll degradation and nutrient transport and other genes associated with senescence, suggesting that OsNAP is an ideal marker of senescence onset in rice. Further analysis determined that OsNAP is induced specifically by abscisic acid (ABA), whereas its expression is repressed in both aba1 and aba2, two ABA biosynthetic mutants. Moreover, ABA content is reduced significantly in ps1-D mutants, indicating a feedback repression of OsNAP on ABA biosynthesis. Our data suggest that OsNAP serves as an important link between ABA and leaf senescence. Additionally, reduced OsNAP expression leads to delayed leaf senescence and an extended grain-filling period, resulting in a 6.3% and 10.3% increase in the grain yield of two independent representative RNAi lines, respectively. Thus, fine-tuning OsNAP expression should be a useful strategy for improving rice yield in the future. PMID:24951508

  17. [Informed consent for clinical investigation in the critically ill patient. An introduction to the regulation 536/2014/EC on clinical investigation of medicinal products for human use, repealing Directive 2001/20/EC].

    PubMed

    Savonitto, Stefano; Coppola, Teresa; Braglia, Paola; Ciccone, Alfonso

    2016-05-01

    The principle of patient information, awareness and documented consent for the participation in clinical trials is a cornerstone in the modern ethics of clinical research. However, this procedure is seldom applicable in the critically ill patient who becomes suddenly incapable of fully evaluating the risk vs benefit of the alternative therapeutic options. This issue becomes particularly problematic in those conditions where the benefit of any intervention is highly time-dependent, such as acute myocardial infarction, stroke, cardiac arrest, polytrauma and other similar conditions. The new directive 536/2014/EC defines the concept that in these cases the expert clinician and the Ethics Committees, based upon a rigorous study protocol, are in better conditions, as compared to patients' proxies and any legal representative, to take an appropriate decision. This decision should be later confirmed (deferred consent) by the patient, in case he returns competent, or by his proxies or legal tutor, in order to use experimental data. The new directive ends a long period of disparity among the Member States, some of which had taken unilateral decisions allowing the participation of incapable patients, whereas others, among which Italy, had a more conservative approach. Unfortunately, owing to technical and bureaucratic issues, the new regulation is unlikely to become active before the beginning of 2018. PMID:27310904

  18. The Arabidopsis SKU6/SPIRAL1 Gene Encodes a Plus End–Localized Microtubule-Interacting Protein Involved in Directional Cell ExpansionW⃞

    PubMed Central

    Sedbrook, John C.; Ehrhardt, David W.; Fisher, Sarah E.; Scheible, Wolf-Rüdiger; Somerville, Chris R.

    2004-01-01

    The sku6-1 mutant of Arabidopsis thaliana exhibits altered patterns of root and organ growth. sku6 roots, etiolated hypocotyls, and leaf petioles exhibit right-handed axial twisting, and root growth on inclined agar media is strongly right skewed. The touch-dependent sku6 root skewing phenotype is suppressed by the antimicrotubule drugs propyzamide and oryzalin, and right skewing is exacerbated by cold treatment. Cloning revealed that sku6-1 is allelic to spiral1-1 (spr1-1). However, modifiers in the Columbia (Col) and Landsberg erecta (Ler) ecotype backgrounds mask noncomplementation in sku6-1 (Col)/spr1-1 (Ler) F1 plants. The SPR1 gene encodes a plant-specific 12-kD protein that is ubiquitously expressed and belongs to a six-member gene family in Arabidopsis. An SPR1:green fluorescent protein (GFP) fusion expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle. SPR1:GFP was concentrated at the growing ends of cortical microtubules and was dependent on polymer growth state; the microtubule-related fluorescence dissipated upon polymer shortening. The protein has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. These observations suggest that SPR1 is involved in microtubule polymerization dynamics and/or guidance, which in turn influences touch-induced directional cell expansion and axial twisting. PMID:15155883

  19. The nuclear-encoded sigma factor SIG4 directly activates transcription of chloroplast psbA and ycf17 genes in the unicellular red alga Cyanidioschyzon merolae.

    PubMed

    Fujii, Gaku; Imamura, Sousuke; Era, Atsuko; Miyagishima, Shin-ya; Hanaoka, Mitsumasa; Tanaka, Kan

    2015-05-01

    The plant organelle chloroplast originated from the endosymbiosis of a cyanobacterial-like photosynthetic bacterium, and still retains its own genome derived from this ancestor. We have been focusing on a unicellular red alga, Cyanidioschyzon merolae, as a model photosynthetic eukaryote. In this study, we analyzed the transcriptional specificity of SIG4, which is one of four nuclear-encoded chloroplast RNA polymerase sigma factors in this alga. Accumulation of the SIG4 protein was observed in response to nitrogen depletion or high light conditions. By comparing the chloroplast transcriptomes under nitrogen depletion and SIG4-overexpressing conditions, we identified several candidate genes as SIG4 targets. Together with the results of chromatin immunoprecipitation analysis, the promoters of the psbA (encoding the D1 protein of the photosystem II reaction center) and ycf17 (encoding a protein of the early light-inducible protein family) genes were shown to be direct activation targets. The phycobilisome (PBS) CpcB protein was decreased by SIG4 overexpression, which suggests the negative involvement of SIG4 in PBS accumulation. PMID:25883111

  20. An anti-neuroinflammatory that targets dysregulated glia enhances the efficacy of CNS-directed gene therapy in murine infantile neuronal ceroid lipofuscinosis.

    PubMed

    Macauley, Shannon L; Wong, Andrew M S; Shyng, Charles; Augner, David P; Dearborn, Joshua T; Pearse, Yewande; Roberts, Marie S; Fowler, Stephen C; Cooper, Jonathan D; Watterson, D Martin; Sands, Mark S

    2014-09-24

    Infantile neuronal ceroid lipofuscinosis (INCL) is an inherited neurodegenerative lysosomal storage disease (LSD) caused by a deficiency in palmitoyl protein thioesterase-1 (PPT1). Studies in Ppt1(-/-) mice demonstrate that glial activation is central to the pathogenesis of INCL. Astrocyte activation precedes neuronal loss, while cytokine upregulation associated with microglial reactivity occurs before and concurrent with neurodegeneration. Therefore, we hypothesized that cytokine cascades associated with neuroinflammation are important therapeutic targets for the treatment of INCL. MW01-2-151SRM (MW151) is a blood-brain barrier penetrant, small-molecule anti-neuroinflammatory that attenuates glial cytokine upregulation in models of neuroinflammation such as traumatic brain injury, Alzheimer's disease, and kainic acid toxicity. Thus, we used MW151, alone and in combination with CNS-directed, AAV-mediated gene therapy, as a possible treatment for INCL. MW151 alone decreased seizure susceptibility. When combined with AAV-mediated gene therapy, treated INCL mice had increased life spans, improved motor performance, and eradication of seizures. Combination-treated INCL mice also had decreased brain atrophy, astrocytosis, and microglial activation, as well as intermediary effects on cytokine upregulation. These data suggest that MW151 can attenuate seizure susceptibility but is most effective when used in conjunction with a therapy that targets the primary genetic defect. PMID:25253854

  1. The Wnt and Delta-Notch signalling pathways interact to direct pair-rule gene expression via caudal during segment addition in the spider Parasteatoda tepidariorum.

    PubMed

    Schönauer, Anna; Paese, Christian L B; Hilbrant, Maarten; Leite, Daniel J; Schwager, Evelyn E; Feitosa, Natália Martins; Eibner, Cornelius; Damen, Wim G M; McGregor, Alistair P

    2016-07-01

    In short-germ arthropods, posterior segments are added sequentially from a segment addition zone (SAZ) during embryogenesis. Studies in spiders such as Parasteatoda tepidariorum have provided insights into the gene regulatory network (GRN) underlying segment addition, and revealed that Wnt8 is required for dynamic Delta (Dl) expression associated with the formation of new segments. However, it remains unclear how these pathways interact during SAZ formation and segment addition. Here, we show that Delta-Notch signalling is required for Wnt8 expression in posterior SAZ cells, but represses the expression of this Wnt gene in anterior SAZ cells. We also found that these two signalling pathways are required for the expression of the spider orthologues of even-skipped (eve) and runt-1 (run-1), at least in part via caudal (cad). Moreover, it appears that dynamic expression of eve in this spider does not require a feedback loop with run-1, as is found in the pair-rule circuit of the beetle Tribolium Taken together, our results suggest that the development of posterior segments in Parasteatoda is directed by dynamic interactions between Wnt8 and Delta-Notch signalling that are read out by cad, which is necessary but probably not sufficient to regulate the expression of eve and run-1 Our study therefore provides new insights towards better understanding the evolution and developmental regulation of segmentation in other arthropods, including insects. PMID:27287802

  2. Tbx2 Controls Lung Growth by Direct Repression of the Cell Cycle Inhibitor Genes Cdkn1a and Cdkn1b

    PubMed Central

    Lüdtke, Timo H-W.; Farin, Henner F.; Rudat, Carsten; Schuster-Gossler, Karin; Petry, Marianne; Barnett, Phil; Christoffels, Vincent M.; Kispert, Andreas

    2013-01-01

    Vertebrate organ development relies on the precise spatiotemporal orchestration of proliferation rates and differentiation patterns in adjacent tissue compartments. The underlying integration of patterning and cell cycle control during organogenesis is insufficiently understood. Here, we have investigated the function of the patterning T-box transcription factor gene Tbx2 in lung development. We show that lungs of Tbx2-deficient mice are markedly hypoplastic and exhibit reduced branching morphogenesis. Mesenchymal proliferation was severely decreased, while mesenchymal differentiation into fibrocytes was prematurely induced. In the epithelial compartment, proliferation was reduced and differentiation of alveolar epithelial cells type 1 was compromised. Prior to the observed cellular changes, canonical Wnt signaling was downregulated, and Cdkn1a (p21) and Cdkn1b (p27) (two members of the Cip/Kip family of cell cycle inhibitors) were strongly induced in the Tbx2-deficient lung mesenchyme. Deletion of both Cdkn1a and Cdkn1b rescued, to a large degree, the growth deficits of Tbx2-deficient lungs. Prolongation of Tbx2 expression into adulthood led to hyperproliferation and maintenance of mesenchymal progenitor cells, with branching morphogenesis remaining unaffected. Expression of Cdkn1a and Cdkn1b was ablated from the lung mesenchyme in this gain-of-function setting. We further show by ChIP experiments that Tbx2 directly binds to Cdkn1a and Cdkn1b loci in vivo, defining these two genes as direct targets of Tbx2 repressive activity in the lung mesenchyme. We conclude that Tbx2-mediated regulation of Cdkn1a and Cdkn1b represents a crucial node in the network integrating patterning information and cell cycle regulation that underlies growth, differentiation, and branching morphogenesis of this organ. PMID:23341776

  3. Direct Comparison of a Natural Loss-Of-Function Single Nucleotide Polymorphism with a Targeted Deletion in the Ncf1 Gene Reveals Different Phenotypes

    PubMed Central

    Sareila, Outi; Hagert, Cecilia; Rantakari, Pia; Poutanen, Matti; Holmdahl, Rikard

    2015-01-01

    The genetic targeting of mouse models has given insight into complex processes. However, phenotypes of genetically targeted mice are susceptible to artifacts due to gene manipulation, which may lead to misinterpretation of the observations. To directly address these issues, we have compared the immunological phenotypes of Ncf1 knockout mice with Ncf1m1J mice possessing a naturally occurring intronic loss-of-function SNP in their Ncf1 gene. Neutrophil cytosolic factor 1 (NCF1) is the key regulatory component of the phagocytic NADPH oxidase 2 (NOX2) complex. Defects in NCF1 lead to lower production of reactive oxygen species (ROS) associated with autoimmune diseases in humans. In mice, collagen induced arthritis (CIA) and psoriatic arthritis are autoimmune disorders known to be regulated by Ncf1, and they were utilized in the present study to compare the Ncf1 knockout with Ncf1m1J mice. Targeted Ncf1 knockout mice were generated on a pure C57BL/6N genetic background, and thereafter crossed with B10.Q.Ncf1m1J mice. The targeting silenced the Ncf1 gene as intended, and both the B6N;B10.Q.Ncf1m1J mice as well as the knockout littermates had reduced ROS production compared to wild type mice. Both also exhibited enhanced STAT1 (signal transducer and activator of transcription 1) protein expression as an indicator of pronounced interferon signature reported recently for Ncf1 deficient mice. Surprisingly, female Ncf1 knockout mice were protected from CIA whereas the Ncf1m1J females developed severe disease. Ovariectomization retrieved the susceptibility of Ncf1 knockout females pointing to a sex hormone regulated protection against CIA in these mice. The data partly explains the discrepancy of the phenotypes reported earlier utilizing the Ncf1m1J mice or Ncf1 knockout mice. These observations indicate that even a targeted knockout mutation may lead to a different biological outcome in comparison to the natural loss-of-function mutation of the same gene. PMID:26528554

  4. Arctic freshwater synthesis: Introduction

    NASA Astrophysics Data System (ADS)

    Prowse, T.; Bring, A.; Mârd, J.; Carmack, E.

    2015-11-01

    In response to a joint request from the World Climate Research Program's Climate and Cryosphere Project, the International Arctic Science Committee, and the Arctic Council's Arctic Monitoring and Assessment Program, an updated scientific assessment has been conducted of the Arctic Freshwater System (AFS), entitled the Arctic Freshwater Synthesis (AFSΣ). The major reason for joint request was an increasing concern that changes to the AFS have produced, and could produce even greater, changes to biogeophysical and socioeconomic systems of special importance to northern residents and also produce extra-Arctic climatic effects that will have global consequences. Hence, the key objective of the AFSΣ was to produce an updated, comprehensive, and integrated review of the structure and function of the entire AFS. The AFSΣ was organized around six key thematic areas: atmosphere, oceans, terrestrial hydrology, terrestrial ecology, resources and modeling, and the review of each coauthored by an international group of scientists and published as separate manuscripts in this special issue of Journal of Geophysical Research-Biogeosciences. This AFSΣ—Introduction reviews the motivations for, and foci of, previous studies of the AFS, discusses criteria used to define the domain of the AFS, and details key characteristics of the definition adopted for the AFSΣ.

  5. Geoenvironment: An Introduction

    NASA Astrophysics Data System (ADS)

    Boadu, Fred Kofi

    Geoenvironment: An Introduction looks at the geoenvironment not only from an environmental point of view but also in relation to social and economic factors and the perspective of human life. It is very important that global environment issues be looked at from socioeconomic and to some extent political points of view.The book is written in a way that nonhydrogeologists, nonenvironmental scientists and nonenvironmental engineers can understand the geoenvironment and its impact on human health and life. Theoretical concepts are kept to a minimum while the book conceptually links global contamination of the environment with human health. Based on his longtime experience with the United Nations on health issues, the author makes good efforts in treating the environment from the point of view of the individual's country. This is very desirable since different countries have different environmental policies and regulations as well as socioeconomic conditions. Rules and regulations in effect in developed countries may not be in effect in some third world nations.

  6. Introduction and Overview

    NASA Astrophysics Data System (ADS)

    Murphy, Nancey

    This chapter provides an overview of some of the history of debates regarding free will, and concurs with several authors who claim that the philosophical discussions have reached a stalemate due to their focus on a metaphysical doctrine of universal determinism. The way ahead, therefore, requires two developments. One is to focus not on determinism but on reductionism; the other is to attend to specific scientific findings that appear to call free will into question. The chapter provides an introduction to the topics of reductionism, emergence, and downward causation, and then surveys the works of Daniel Wegner and Benjamin Libet, which have been taken to show the irrelevance of conscious will in human action. It summarizes the chapters comprising the rest of the volume, and then offers a reflection on the achievement of the work as a whole - in brief, a critique of free-will skeptics based on human capacities such as meta-cognition and long-term planning, which allow agents to exert downward control on neural processes and behavior. It ends by highlighting, in light of Alasdair MacIntyre's work on moral responsibility, an important additional factor involved in creating the possibility for freedom of choice, namely the possession of abstract symbolic language.

  7. Six and Eya promote apoptosis through direct transcriptional activation of the proapoptotic BH3-only gene egl-1 in Caenorhabditis elegans.

    PubMed

    Hirose, Takashi; Galvin, Brendan D; Horvitz, H Robert

    2010-08-31

    The decision of a cell to undergo programmed cell death is tightly regulated during animal development and tissue homeostasis. Here, we show that the Caenorhabditis elegans Six family homeodomain protein C. elegans homeobox (CEH-34) and the Eyes absent ortholog EYA-1 promote the programmed cell death of a specific pharyngeal neuron, the sister of the M4 motor neuron. Loss of either ceh-34 or eya-1 function causes survival of the M4 sister cell, which normally undergoes programmed cell death. CEH-34 physically interacts with the conserved EYA domain of EYA-1 in vitro. We identify an egl-1 5' cis-regulatory element that controls the programmed cell death of the M4 sister cell and show that CEH-34 binds directly to this site. Expression of the proapoptotic gene egl-1 in the M4 sister cell requires ceh-34 and eya-1 function. We conclude that an evolutionarily conserved complex that includes CEH-34 and EYA-1 directly activates egl-1 expression through a 5' cis-regulatory element to promote the programmed cell death of the M4 sister cell. We suggest that the regulation of apoptosis by Six and Eya family members is conserved in mammals and involved in human diseases caused by mutations in Six and Eya. PMID:20713707

  8. RFQ's: An introduction

    SciTech Connect

    Staples, J.W.

    1990-09-01

    This report discusses the follow topics on radio frequency quadrupole accelerators: RFQ characteristics; low velocity accelerators; alternating-gradient focusing; acceleration; RFQ accelerator; bunching; adiabatic capture; injectors; transverse input matching; rf structures; mechanical designs; structure stabilization; rf considerations; space-charge effects; beam dynamics codes; cavity design codes; some real machines; heavy ions; and future directions.

  9. Introduction to Quantum Intelligence

    NASA Technical Reports Server (NTRS)

    Zak, Michail

    1996-01-01

    An impact of ideas associated with the concept of a hypothetical quantum computer upon classical computing is analyzed. Two fundamental properties of quantum computing: direct simulations of probabilities, and influence between different branches of probabilistic scenarios, as well as their classical versions, are discussed.

  10. An introduction to recombination and linkage analysis

    SciTech Connect

    Mcpeek, M.S.

    1996-12-31

    With a garden as his laboratory, Mendel was able to discern basic probabilistic laws of heredity. Although it first appeared as a baffling exception to one of Mendel`s principles, the phenomenon of variable linkage between characters was soon recognized to be a powerful tool in the process of chromosome mapping and location of genes of interest. In this introduction, we first describe Mendel`s work and the subsequent discovery of linkage. Next we describe the apparent cause of variable linkage, namely recombination, and we introduce linkage analysis. 33 refs., 1 fig., 2 tabs.

  11. Nonhemolytic Cell-Penetrating Peptides: Site Specific Introduction of Glutamine and Lysine Residues into the α-Helical Peptide Causes Deletion of Its Direct Membrane Disrupting Ability but Retention of Its Cell Penetrating Ability.

    PubMed

    Kim, Seoyeon; Hyun, Soonsil; Lee, Yuri; Lee, Yan; Yu, Jaehoon

    2016-09-12

    Cell-penetrating peptides (CPPs) often have cationic and amphipathic characteristics that are commonly associated with α-helical peptides. These features give CPPs both membrane demolishing and penetrating abilities. To make CPPs safe for biomedical applications, their toxicities resulting from their membrane demolishing abilities must be removed while their cell penetrating abilities must be retained. In this study, we systematically constructed mutants of the amphipathic α-helical model peptide (LKKLLKLLKKLLKLAG, LK peptide). The hydrophobic amino acid leucine in the LK peptide was replaced with hydrophilic amino acids to reduce hemolytic or cell toxicity. Most of the mutants were found to have weakened membrane disrupting abilities, but their cell penetrating abilities were also weakened. However, the L8Q and L8K mutants were found to have low micromolar range cell penetrating ability and almost no membrane disrupting ability. These selected mutants utilize energy-dependent endocytosis mechanisms instead of an energy-independent direct cell penetrating mechanism to enter cells. In addition, the mutants can be used to deliver the anticancer drug methotrexate (MTX) to cells, thereby overcoming resistance to this drug. To determine if the effect of these mutations on the membrane disrupting and cell penetrating abilities is general, Q and K mutations of the natural amphipathic α-helical antimicrobial peptide (AMP), LL37, were introduced. Specific positional Q and K mutants of LL37 were found to have lower hemolytic toxicities and preserved the ability to penetrate eukaryotic cells such as MDA-MB-231 cells. Taken together, observations made in this work suggest that interrupting the global hydrophobicity of amphipathic α-helical CPPs and AMPs, by replacing hydrophobic residues with mildly hydrophilic amino acids such as Q and K, might be an ideal strategy for constructing peptides that have strong cell penetrating abilities and weak cell membrane disrupting

  12. Introduction to Geomagnetic Fields

    NASA Astrophysics Data System (ADS)

    Hinze, William J.

    Coincidentally, as I sat down in late October 2003 to read and review the second edition of Wallace H. Campbell's text, Introduction to Geomagnetic Fields, we received warnings from the news media of a massive solar flare and its possible effect on power supply systems and satellite communications. News programs briefly explained the source of Sun-Earth interactions. If you are interested in learning more about the physics of the connection between sun spots and power supply systems and their impact on orbiting satellites, I urge you to become acquainted with Campbell's book. It presents an interesting and informative explanation of the geomagnetic field and its applications to a wide variety of topics, including oil exploration, climate change, and fraudulent claims of the utility of magnetic fields for alleviating human pain. Geomagnetism, the study of the nature and processes of the Earth's magnetic fields and its application to the investigation of the Earth, its processes, and history, is a mature science with a well-developed theoretical foundation and a vast array of observations. It is discussed in varied detail in Earth physics books and most entry-level geoscience texts. The latter treatments largely are driven by the need to discuss paleomagnetism as an essential tool in studying plate tectonics. A more thorough explanation of geomagnetism is needed by many interested scientists in related fields and by laypersons. This is the objective of Campbell's book. It is particularly germane in view of a broad range of geomagnetic topics that are at the forefront of today's science, including environmental magnetism, so-called ``jerks'' observed in the Earth's magnetic field, the perplexing magnetic field of Mars, improved satellite magnetic field observations, and the increasing availability of high-quality continental magnetic anomaly maps, to name only a few.

  13. Introduction to Mesoscale Science

    NASA Astrophysics Data System (ADS)

    Sarrao, John; Crabtree, George

    2012-02-01

    BESAC seeks community input for a forthcoming report on Mesoscale Materials and Chemistry, where classical, microscale and nanoscale science meet. The report, to be released in Fall 2012, will identify the most promising research opportunities in two areas: *new mesoscale materials, phenomena and functionality *facilities, instruments and tools needed to make, characterize and describe mesoscale materials, phenomena and functionality. You may contribute to the Town Hall through oral comments or by completing and uploading a Priority Research Direction quad chart through the Meso website, meso2012.com. If you upload a Priority Research Direction quad chart in advance, it can be projected at the Town Hall to illustrate your oral comments. Please see the Mesoscale Materials and Chemistry website for additional background and details: meso2012.com

  14. Computer Assisted Introduction to Mechanics.

    ERIC Educational Resources Information Center

    Huggins, Elisha R.

    These six chapters provide an introduction to Newtonian mechanics, based on a coordinated use of text material, laboratory work, and the computer. The material is essentially self-contained so that it can serve as a short text on mechanics or as a text supplement in a regular physics course. Chapter 1 is a brief introduction to the computer…

  15. Campus Networking Strategies: An Introduction.

    ERIC Educational Resources Information Center

    Roberts, Michael M.

    1988-01-01

    This article is adapted from the introduction to EDUCOM's forthcoming book, Campus Networking Strategies, which includes 10 case study chapters detailing academic experiences with computer networking. Topics discussed in the introduction include network issues for management, networking economics, engineering and telecommunications issues, and…

  16. Connection with dynamics: General introduction

    NASA Technical Reports Server (NTRS)

    Shandarin, Sergei F.

    1993-01-01

    This is a brief nontechnical introduction to a few theoretical issues to the density-velocity relation. The aim of this introduction is not an exhaustive analysis of the current theoretical situation but rather setting a stage for the following talks. The selection of topics has been determined by the sequel program.

  17. A novel needleless liquid jet injection methodology for improving direct cardiac gene delivery: An optimization of parameters, AAV mediated therapy and investigation of host responses in ischemic heart failure

    NASA Astrophysics Data System (ADS)

    Fargnoli, Anthony Samuel

    Heart disease remains the leading cause of mortality and morbidity worldwide, with 22 million new patients diagnosed annually. Essentially, all present therapies have significant cost burden to the healthcare system, yet fail to increase survival rates. One key employed strategy is the genetic reprogramming of cells to increase contractility via gene therapy, which has advanced to Phase IIb Clinical Trials for advanced heart failure patients. It has been argued that the most significant barrier preventing FDA approval are resolving problems with safe, efficient myocardial delivery, whereby direct injection in the infarct and remote tissue areas is not clinically feasible. Here, we aim to: (1) Improve direct cardiac gene delivery through the development of a novel liquid jet device approach (2) Compare the new method against traditional IM injection with two different vector constructions and evaluate outcome (3) Evaluate the host response resulting from both modes of direct cardiac injection, then advance a drug/gene combination with controlled release nanoparticle formulations.

  18. Introduction of the rd29A:AtDREB2A CA gene into soybean (Glycine max L. Merril) and its molecular characterization in leaves and roots during dehydration

    PubMed Central

    Engels, Cibelle; Fuganti-Pagliarini, Renata; Marin, Silvana Regina Rockenbach; Marcelino-Guimarães, Francismar Corrêa; Oliveira, Maria Cristina Neves; Kanamori, Norihito; Mizoi, Junya; Nakashima, Kazuo; Yamaguchi-Shinozaki, Kazuko; Nepomuceno, Alexandre Lima

    2013-01-01

    The loss of soybean yield to Brazilian producers because of a water deficit in the 2011–2012 season was 12.9%. To reduce such losses, molecular biology techniques, including plant transformation, can be used to insert genes of interest into conventional soybean cultivars to produce lines that are more tolerant to drought. The abscisic acid (ABA)-independent Dehydration Responsive Element Binding (DREB) gene family has been used to obtain plants with increased tolerance to abiotic stresses. In the present study, the rd29A:AtDREB2A CA gene from Arabidopsis thaliana was inserted into soybean using biolistics. Seventy-eight genetically modified (GM) soybean lines containing 2–17 copies of the AtDREB2A CA gene were produced. Two GM soybean lines (P1397 and P2193) were analyzed to assess the differential expression of the AtDREB2A CA transgene in leaves and roots submitted to various dehydration treatments. Both GM lines exhibited high expression of the transgene, with the roots of P2193 showing the highest expression levels during water deficit. Physiological parameters examined during water deficit confirmed the induction of stress. This analysis of AtDREB2A CA expression in GM soybean indicated that line P2193 had the greatest stability and highest expression in roots during water deficit-induced stress. PMID:24385860

  19. SKP2 Oncogene Is a Direct MYC Target Gene and MYC Down-regulates p27KIP1 through SKP2 in Human Leukemia Cells*

    PubMed Central

    Bretones, Gabriel; Acosta, Juan C.; Caraballo, Juan M.; Ferrándiz, Nuria; Gómez-Casares, M. Teresa; Albajar, Marta; Blanco, Rosa; Ruiz, Paula; Hung, Wen-Chun; Albero, M. Pilar; Perez-Roger, Ignacio; León, Javier

    2011-01-01

    SKP2 is the ubiquitin ligase subunit that targets p27KIP1 (p27) for degradation. SKP2 is induced in the G1-S transit of the cell cycle, is frequently overexpressed in human cancer, and displays transformation activity in experimental models. Here we show that MYC induces SKP2 expression at the mRNA and protein levels in human myeloid leukemia K562 cells with conditional MYC expression. Importantly, in these systems, induction of MYC did not activate cell proliferation, ruling out SKP2 up-regulation as a consequence of cell cycle entry. MYC-dependent SKP2 expression was also detected in other cell types such as lymphoid, fibroblastic, and epithelial cell lines. MYC induced SKP2 mRNA expression in the absence of protein synthesis and activated the SKP2 promoter in luciferase reporter assays. With chromatin immunoprecipitation assays, MYC was detected bound to a region of human SKP2 gene promoter that includes E-boxes. The K562 cell line derives from human chronic myeloid leukemia. In a cohort of chronic myeloid leukemia bone marrow samples, we found a correlation between MYC and SKP2 mRNA levels. Analysis of cancer expression databases also indicated a correlation between MYC and SKP2 expression in lymphoma. Finally, MYC-induced SKP2 expression resulted in a decrease in p27 protein in K562 cells. Moreover, silencing of SKP2 abrogated the MYC-mediated down-regulation of p27. Our data show that SKP2 is a direct MYC target gene and that MYC-mediated SKP2 induction leads to reduced p27 levels. The results suggest the induction of SKP2 oncogene as a new mechanism for MYC-dependent transformation. PMID:21245140

  20. SKP2 oncogene is a direct MYC target gene and MYC down-regulates p27(KIP1) through SKP2 in human leukemia cells.

    PubMed

    Bretones, Gabriel; Acosta, Juan C; Caraballo, Juan M; Ferrándiz, Nuria; Gómez-Casares, M Teresa; Albajar, Marta; Blanco, Rosa; Ruiz, Paula; Hung, Wen-Chun; Albero, M Pilar; Perez-Roger, Ignacio; León, Javier

    2011-03-18

    SKP2 is the ubiquitin ligase subunit that targets p27(KIP1) (p27) for degradation. SKP2 is induced in the G(1)-S transit of the cell cycle, is frequently overexpressed in human cancer, and displays transformation activity in experimental models. Here we show that MYC induces SKP2 expression at the mRNA and protein levels in human myeloid leukemia K562 cells with conditional MYC expression. Importantly, in these systems, induction of MYC did not activate cell proliferation, ruling out SKP2 up-regulation as a consequence of cell cycle entry. MYC-dependent SKP2 expression was also detected in other cell types such as lymphoid, fibroblastic, and epithelial cell lines. MYC induced SKP2 mRNA expression in the absence of protein synthesis and activated the SKP2 promoter in luciferase reporter assays. With chromatin immunoprecipitation assays, MYC was detected bound to a region of human SKP2 gene promoter that includes E-boxes. The K562 cell line derives from human chronic myeloid leukemia. In a cohort of chronic myeloid leukemia bone marrow samples, we found a correlation between MYC and SKP2 mRNA levels. Analysis of cancer expression databases also indicated a correlation between MYC and SKP2 expression in lymphoma. Finally, MYC-induced SKP2 expression resulted in a decrease in p27 protein in K562 cells. Moreover, silencing of SKP2 abrogated the MYC-mediated down-regulation of p27. Our data show that SKP2 is a direct MYC target gene and that MYC-mediated SKP2 induction leads to reduced p27 levels. The results suggest the induction of SKP2 oncogene as a new mechanism for MYC-dependent transformation. PMID:21245140

  1. Arabidopsis RNASE THREE LIKE2 Modulates the Expression of Protein-Coding Genes via 24-Nucleotide Small Interfering RNA-Directed DNA Methylation[OPEN

    PubMed Central

    Hachet, Mélanie; Comella, Pascale; Zytnicki, Matthias; Vaucheret, Hervé

    2016-01-01

    RNaseIII enzymes catalyze the cleavage of double-stranded RNA (dsRNA) and have diverse functions in RNA maturation. Arabidopsis thaliana RNASE THREE LIKE2 (RTL2), which carries one RNaseIII and two dsRNA binding (DRB) domains, is a unique Arabidopsis RNaseIII enzyme resembling the budding yeast small interfering RNA (siRNA)-producing Dcr1 enzyme. Here, we show that RTL2 modulates the production of a subset of small RNAs and that this activity depends on both its RNaseIII and DRB domains. However, the mode of action of RTL2 differs from that of Dcr1. Whereas Dcr1 directly cleaves dsRNAs into 23-nucleotide siRNAs, RTL2 likely cleaves dsRNAs into longer molecules, which are subsequently processed into small RNAs by the DICER-LIKE enzymes. Depending on the dsRNA considered, RTL2-mediated maturation either improves (RTL2-dependent loci) or reduces (RTL2-sensitive loci) the production of small RNAs. Because the vast majority of RTL2-regulated loci correspond to transposons and intergenic regions producing 24-nucleotide siRNAs that guide DNA methylation, RTL2 depletion modifies DNA methylation in these regions. Nevertheless, 13% of RTL2-regulated loci correspond to protein-coding genes. We show that changes in 24-nucleotide siRNA levels also affect DNA methylation levels at such loci and inversely correlate with mRNA steady state levels, thus implicating RTL2 in the regulation of protein-coding gene expression. PMID:26764378

  2. Aplysia californica neurons express microinjected neuropeptide genes.

    PubMed Central

    DesGroseillers, L; Cowan, D; Miles, M; Sweet, A; Scheller, R H

    1987-01-01

    Neuropeptide genes are expressed in specific subsets of large polyploid neurons in Aplysia californica. We have defined the transcription initiation sites of three of these neuropeptide genes (the R14, L11, and ELH genes) and determined the nucleotide sequence of the promoter regions. The genes contain the usual eucaryotic promoter signals as well as other structures of potential regulatory importance, including inverted and direct repeats. The L11 and ELH genes, which are otherwise unrelated, have homology in the promoter regions, while the R14 promoter was distinct. When cloned plasmids were microinjected into Aplysia neurons in organ culture, transitions between supercoiled, relaxed circular, and linear DNAs occurred along with ligation into high-molecular-weight species. About 20% of the microinjected neurons expressed the genes. The promoter region of the R14 gene functioned in expression of the microinjected DNA in all cells studied. When both additional 5' and 3' sequences were included, the gene was specifically expressed only in R14, suggesting that the specificity of expression is generated by a multicomponent repression system. Finally, the R14 peptide could be expressed in L11, demonstrating that it is possible to alter the transmitter phenotype of these neurons by introduction of cloned genes. Images PMID:3670293

  3. IFI16 Restricts HSV-1 Replication by Accumulating on the HSV-1 Genome, Repressing HSV-1 Gene Expression, and Directly or Indirectly Modulating Histone Modifications

    PubMed Central

    Johnson, Karen E.; Bottero, Virginie; Flaherty, Stephanie; Dutta, Sujoy; Singh, Vivek Vikram; Chandran, Bala

    2014-01-01

    Interferon-γ inducible factor 16 (IFI16) is a multifunctional nuclear protein involved in transcriptional regulation, induction of interferon-β (IFN-β), and activation of the inflammasome response. It interacts with the sugar-phosphate backbone of dsDNA and modulates viral and cellular transcription through largely undetermined mechanisms. IFI16 is a restriction factor for human cytomegalovirus (HCMV) and herpes simplex virus (HSV-1), though the mechanisms of HSV-1 restriction are not yet understood. Here, we show that IFI16 has a profound effect on HSV-1 replication in human foreskin fibroblasts, osteosarcoma cells, and breast epithelial cancer cells. IFI16 knockdown increased HSV-1 yield 6-fold and IFI16 overexpression reduced viral yield by over 5-fold. Importantly, HSV-1 gene expression, including the immediate early proteins, ICP0 and ICP4, the early proteins, ICP8 and TK, and the late proteins gB and Us11, was reduced in the presence of IFI16. Depletion of the inflammasome adaptor protein, ASC, or the IFN-inducing transcription factor, IRF-3, did not affect viral yield. ChIP studies demonstrated the presence of IFI16 bound to HSV-1 promoters in osteosarcoma (U2OS) cells and fibroblasts. Using CRISPR gene editing technology, we generated U2OS cells with permanent deletion of IFI16 protein expression. ChIP analysis of these cells and wild-type (wt) U2OS demonstrated increased association of RNA polymerase II, TATA binding protein (TBP) and Oct1 transcription factors with viral promoters in the absence of IFI16 at different times post infection. Although IFI16 did not alter the total histone occupancy at viral or cellular promoters, its absence promoted markers of active chromatin and decreased those of repressive chromatin with viral and cellular gene promoters. Collectively, these studies for the first time demonstrate that IFI16 prevents association of important transcriptional activators with wt HSV-1 promoters and suggest potential mechanisms of IFI16

  4. Introduction: Bridging Concepts.

    PubMed

    Davids, Karel

    2015-12-01

    How can those in the history of science, history of technology, and economics communicate more with each other than they are accustomed? How can they become more globally oriented? While these three disciplines today have more convergent interests than in the past, there is still a large potential for further exchange and involvement to explore and exploit. The contributors to this Focus section discuss a number of concepts that may serve as tools to bring these three disciplines more closely together and ease their evolution in a less Eurocentric direction. These concepts include trading zones, interaction and formalization, production, and machines and self-organization. PMID:27024939

  5. Introduction to Praxis

    SciTech Connect

    Greenwood, J.R.; Evans, A. Jr.; Morgan, C.R.; Zarnstorff, M.C.

    1980-12-03

    Praxis is the practice of the programming art, science, and skill. It is a high-order language designed for the efficient programming of control and systems applications. It is a comprehensive, strongly typed, block-structured language in the tradition of Pascal, with much of the power of the Mesa and Ada languages. It supports the development of systems composed of separately compiled modules, user-defined data types, exception handling, detailed control mechanisms, and encapsulated data and routines. Direct access to machine facilities, efficient bit manipulation, and interlocked critical regions are provided within Praxis.

  6. Introduction to Praxis

    SciTech Connect

    Greenwood, J.R.; Evans, A. Jr.; Morgan, C.R.; Zarnstorff, M.C.

    1980-07-01

    Praxis is the practice of the programming art, science, and skill. It is a high-order language designed for the efficient programming of control and systems applications. It is a comprehensive, strongly typed, block-structured language in the tradition of Pascal, with much of the power of the Mesa and Ada languages. It supports the development of systems composed of separately compiled modules, user-defined data types, exception handling, detailed control mechanisms, and encapsulated data and routines. Direct access to machine facilities, efficient bit manipulation, and interlocked critical regions are provided within Praxis.

  7. Introduction to radiation transport

    SciTech Connect

    Olson, G.L.

    1998-12-31

    This lectur