Science.gov

Sample records for dna electrophoretic mobility

  1. Coarse-grained model of conformation-dependent electrophoretic mobility and its influence on DNA dynamics.

    PubMed

    Pandey, Harsh; Underhill, Patrick T

    2015-11-01

    The electrophoretic mobility of molecules such as λ-DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large. PMID:26651689

  2. Coarse-grained model of conformation-dependent electrophoretic mobility and its influence on DNA dynamics

    NASA Astrophysics Data System (ADS)

    Pandey, Harsh; Underhill, Patrick T.

    2015-11-01

    The electrophoretic mobility of molecules such as λ -DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large.

  3. Using Electrophoretic Mobility Shift Assays to Measure Equilibrium Dissociation Constants: GAL4-p53 Binding DNA as a Model System

    ERIC Educational Resources Information Center

    Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…

  4. Predicting Electrophoretic Mobility of Protein-Ligand Complexes for Ligands from DNA-Encoded Libraries of Small Molecules.

    PubMed

    Bao, Jiayin; Krylova, Svetlana M; Cherney, Leonid T; Hale, Robert L; Belyanskaya, Svetlana L; Chiu, Cynthia H; Shaginian, Alex; Arico-Muendel, Christopher C; Krylov, Sergey N

    2016-05-17

    Selection of target-binding ligands from DNA-encoded libraries of small molecules (DELSMs) is a rapidly developing approach in drug-lead discovery. Methods of kinetic capillary electrophoresis (KCE) may facilitate highly efficient homogeneous selection of ligands from DELSMs. However, KCE methods require accurate prediction of electrophoretic mobilities of protein-ligand complexes. Such prediction, in turn, requires a theory that would be applicable to DNA tags of different structures used in different DELSMs. Here we present such a theory. It utilizes a model of a globular protein connected, through a single point (small molecule), to a linear DNA tag containing a combination of alternating double-stranded and single-stranded DNA (dsDNA and ssDNA) regions of varying lengths. The theory links the unknown electrophoretic mobility of protein-DNA complex with experimentally determined electrophoretic mobilities of the protein and DNA. Mobility prediction was initially tested by using a protein interacting with 18 ligands of various combinations of dsDNA and ssDNA regions, which mimicked different DELSMs. For all studied ligands, deviation of the predicted mobility from the experimentally determined value was within 11%. Finally, the prediction was tested for two proteins and two ligands with a DNA tag identical to those of DELSM manufactured by GlaxoSmithKline. Deviation between the predicted and experimentally determined mobilities did not exceed 5%. These results confirm the accuracy and robustness of our model, which makes KCE methods one step closer to their practical use in selection of drug leads, and diagnostic probes from DELSMs. PMID:27119259

  5. Mapping DNA Quantity into Electrophoretic Mobility through Quantum Dot Nanotethers for High Resolution Genetic and Epigenetic Analysis

    PubMed Central

    Zhang, Yi; Liu, Kelvin J.; Wang, Tian-Li; Shih, Ie-Ming; Wang, Tza-Huei

    2011-01-01

    Newly discovered nanoparticle properties have driven the development of novel applications and uses. We report a new observation where the electrophoretic mobility of a quantum dot-DNA nanoassembly can be precisely modulated by the degree of surface DNA conjugation. By using streptavidin-coated quantum dots (QD) as nanotethers to gather biotin-labeled DNA into electrophoretic nanoassemblies, the QD surface charge is modulated and transformed into electrophoretic mobility shifts using standard agarose gel electrophoresis. Typical fluorescent assays quantify based on relative intensity. However, this phenomenon uses a novel approach that accurately maps DNA quantity into shifts in relative band position. This property was applied in a quantum dot enabled nanoassay called Quantum Dot Electrophoretic Mobility Shift Assay (QEMSA) that enables accurate quantification of DNA targets down to 1.1-fold (9%) changes in quantity, beyond what is achievable in qPCR. In addition to these experimental findings, an analytical model is presented to explain this behavior. Finally, QEMSA was applied to both genetic and epigenetic analysis of cancer. First, it was used to analyze copy number variation (CNV) of the RSF1/HBXAP gene where conventional approaches for CNV analysis based on comparative genomic hybridization (CGH), microarrays, and qPCR are unable to reliably differentiate less than 2-fold changes in copy number. Then, QEMSA was used for DNA methylation analysis of the p16/CDK2A tumor suppressor gene where its ability to detect subtle changes in methylation was shown to be superior to that of qPCR. PMID:22136600

  6. Non-monotonic mobility vs. length dependence observed in electrophoretic separation of 25 bp DNA ladder in Pluronic gels.

    NASA Astrophysics Data System (ADS)

    You, Seungyong; van Winkle, David

    2009-03-01

    We electrophoresed a double-stranded DNA ladder first in an agarose gel, then in gels of Pluronic F-127 at room temperature. The DNA ladder consisted of 19 discrete fragments ranging in length from 25 to 450 bp at 25 bp increments plus 500 bp. The DNA fragments were first separated in agarose gel and stacked normally with 25 bp having the highest mobility. A single lane of the separated DNA ladder in the agarose gel was inserted at the edge of a Pluronic gel slab. The DNA was electrophoresed from the agarose into the Pluronic gels perpendicular to the original separation axis. Mobilities of DNA fragments increased from 25 bp to 175 bp and then decreased from 175 bp to 500 bp. The 25 bp and 500 bp bands of the ladder had approximately the same mobility in several different Pluronic gel concentrations. Both were slower than most bands in between. The highest mobility fragments with length of 175 bp have 59.5 nm contour length which is about 3.5 times the diameter of a micelle (17 nm). This result suggests a crossover from chromatographic separation to electrophoretic separation for these short DNAs. This research is supported by the state of Florida (Martech) and Research Corporation.

  7. Electrophoretic mobility of linear and star-branched DNA in semidilute polymer solutions.

    PubMed

    Saha, Sourav; Heuer, Daniel M; Archer, Lynden A

    2006-08-01

    Electrophoresis of large linear T2 (162 kbp) and 3-arm star-branched (N(Arm) = 48.5 kbp) DNA in linear polyacrylamide (LPA) solutions above the overlap concentration c* has been investigated using a fluorescence visualization technique that allows both the conformation and mobility mu of the DNA to be determined. LPA solutions of moderate polydispersity index (PI approximately 1.7-2.1) and variable polymer molecular weight Mw (0.59-2.05 MDa) are used as the sieving media. In unentangled semidilute solutions (c* < c < c(e)), we find that the conformational dynamics of linear and star-branched DNA in electric fields are strikingly different; the former migrating in predominantly U- or I-shaped conformations, depending on electric field strength E, and the latter migrating in a squid-like profile with the star-arms outstretched in the direction opposite to E and dragging the branch point through the sieving medium. Despite these visual differences, mu for linear and star-branched DNA of comparable size are found to be nearly identical in semidilute, unentangled LPA solutions. For LPA concentrations above the entanglement threshold (c > c(e)), the conformation of migrating linear and star-shaped DNA manifest only subtle changes from their unentangled solution features, but mu for the stars decreases strongly with increasing LPA concentration and molecular weight, while mu for linear DNA becomes nearly independent of c and Mw. These findings are discussed in the context of current theories for electrophoresis of large polyelectrolytes. PMID:16850503

  8. Photoaffinity electrophoretic mobility shift assay using photoreactive DNA bearing 3-trifluoromethyl-3-phenyldiazirine in its phosphate backbone.

    PubMed

    Sadakane, Yutaka; Hatanaka, Yasumaru

    2016-08-01

    Photoaffinity cross-linking enables the analysis of interactions between DNA and proteins even under denaturing conditions. We present a photoaffinity electrophoretic mobility shift assay (EMSA) in which two heterogeneous techniques-photoaffinity cross-linking using DNA bearing 3-trifluoromethyl-3-phenyldiazirine and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis-are combined. To prepare the photoreactive DNA, which is an essential tool for photoaffinity EMSA, we first determined the optimal conditions for the integration of 4-(3-trifluoromethyl-3H-diazirin-3-yl)benzyl bromide to the specific site of oligonucleotide where phosphodiester linkage was replaced with phosphorothioate linkage. The photoaffinity EMSA was developed using the POU (initial letters of three genes: Pit-l, Oct-1,2, and unc-86) domain region of Oct-1 protein, which specifically bound to octamer DNA motif (ATGCAAAT). The affinity-purified recombinant POU domain proteins conjugated with glutathione-S-transferase (GST) contained three distinct proteins with molecular weights of 34, 36, and 45 kDa. The photoaffinity EMSA could clearly distinguish the individual binding abilities of three proteins on a single lane and showed that the whole POU domain protein specifically bound to octamer DNA motif by competition experiments. Using the nuclear extract of HeLa cells, the photoaffinity EMSA revealed that at least five specific proteins could bind to the octamer DNA motif. These results show that photoaffinity EMSA using 3-trifluoromethyl-3-phenyldiazirine can provide high-performance analysis of DNA-binding proteins. PMID:27156811

  9. Sedimentation of macroscopic rigid knots and its relation to gel electrophoretic mobility of DNA knots.

    PubMed

    Weber, Cédric; Carlen, Mathias; Dietler, Giovanni; Rawdon, Eric J; Stasiak, Andrzej

    2013-01-01

    We address the general question of the extent to which the hydrodynamic behaviour of microscopic freely fluctuating objects can be reproduced by macrosopic rigid objects. In particular, we compare the sedimentation speeds of knotted DNA molecules undergoing gel electrophoresis to the sedimentation speeds of rigid stereolithographic models of ideal knots in both water and silicon oil. We find that the sedimentation speeds grow roughly linearly with the average crossing number of the ideal knot configurations, and that the correlation is stronger within classes of knots. This is consistent with previous observations with DNA knots in gel electrophoresis. PMID:23346349

  10. Sedimentation of macroscopic rigid knots and its relation to gel electrophoretic mobility of DNA knots

    PubMed Central

    Weber, Cédric; Carlen, Mathias; Dietler, Giovanni; Rawdon, Eric J.; Stasiak, Andrzej

    2013-01-01

    We address the general question of the extent to which the hydrodynamic behaviour of microscopic freely fluctuating objects can be reproduced by macrosopic rigid objects. In particular, we compare the sedimentation speeds of knotted DNA molecules undergoing gel electrophoresis to the sedimentation speeds of rigid stereolithographic models of ideal knots in both water and silicon oil. We find that the sedimentation speeds grow roughly linearly with the average crossing number of the ideal knot configurations, and that the correlation is stronger within classes of knots. This is consistent with previous observations with DNA knots in gel electrophoresis. PMID:23346349

  11. Electrophoretic mobilities of erythrocytes in various buffers

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    The calibration of space flight equipment depends on a source of standard test particles, this test particle of choice is the fixed erythrocyte. Erythrocytes from different species have different electrophoretic mobilities. Electrophoretic mobility depends upon zeta potential, which, in turn depends upon ionic strength. Zeta potential decreases with increasing ionic strength, so cells have high electrophoretic mobility in space electrophoresis buffers than in typical physiological buffers. The electrophoretic mobilities of fixed human, rat, and rabbit erythrocytes in 0.145 M salt and buffers of varying ionic strength, temperature, and composition, to assess the effects of some of the unique combinations used in space buffers were characterized. Several effects were assessed: glycerol or DMSO (dimethylsulfoxide) were considered for use as cryoprotectants. The effect of these substances on erythrocyte electrophoretic mobility was examined. The choice of buffer depended upon cell mobility. Primary experiments with kidney cells established the choice of buffer and cryoprotectant. A nonstandard temperature of EPM in the suitable buffer was determined. A loss of ionic strength control occurs in the course of preparing columns for flight, the effects of small increases in ionic strength over the expected low values need to be evaluated.

  12. ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS

    EPA Science Inventory

    The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms isolated from clinical and environmental sources were measured in 9.15 mM KH2PO4 buffered water. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1 ...

  13. ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS

    EPA Science Inventory

    The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms were measured. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1s-1, and the EPMs of fifteen environmental isolates ranged from -1...

  14. Electrophoretic mobility of semi-flexible double-stranded DNA in defect-controlled polymer networks: Mechanism investigation and role of structural parameters

    NASA Astrophysics Data System (ADS)

    Khairulina, Kateryna; Li, Xiang; Nishi, Kengo; Shibayama, Mitsuhiro; Chung, Ung-il; Sakai, Takamasa

    2015-06-01

    Our previous studies have reported an empirical model, which explains the electrophoretic mobility (μ) of double-stranded DNA (dsDNA) as a combination of a basic migration term (Rouse-like or reptation) and entropy loss term in polymer gels with ideal network structure. However, this case is of exception, considering a large amount of heterogeneity in the conventional polymer gels. In this study, we systematically tune the heterogeneity in the polymer gels and study the migration of dsDNA in these gels. Our experimental data well agree with the model found for ideal networks. The basic migration mechanism (Rouse-like or reptation) persists perfectly in the conventional heterogeneous polymer gel system, while the entropy loss term continuously changes with increase in the heterogeneity. Furthermore, we found that in the limit where dsDNA is shorter than dsDNA persistence length, the entropy loss term may be related to the collisional motions between DNA fragments and the cross-links.

  15. Sequence-specific nucleic acid mobility using a reversible block copolymer gel matrix and DNA amphiphiles (lipid-DNA) in capillary and microfluidic electrophoretic separations.

    PubMed

    Wagler, Patrick; Minero, Gabriel Antonio S; Tangen, Uwe; de Vries, Jan Willem; Prusty, Deepak; Kwak, Minseok; Herrmann, Andreas; McCaskill, John S

    2015-10-01

    Reversible noncovalent but sequence-dependent attachment of DNA to gels is shown to allow programmable mobility processing of DNA populations. The covalent attachment of DNA oligomers to polyacrylamide gels using acrydite-modified oligonucleotides has enabled sequence-specific mobility assays for DNA in gel electrophoresis: sequences binding to the immobilized DNA are delayed in their migration. Such a system has been used for example to construct complex DNA filters facilitating DNA computations. However, these gels are formed irreversibly and the choice of immobilized sequences is made once off during fabrication. In this work, we demonstrate the reversible self-assembly of gels combined with amphiphilic DNA molecules, which exhibit hydrophobic hydrocarbon chains attached to the nucleobase. This amphiphilic DNA, which we term lipid-DNA, is synthesized in advance and is blended into a block copolymer gel to induce sequence-dependent DNA retention during electrophoresis. Furthermore, we demonstrate and characterize the programmable mobility shift of matching DNA in such reversible gels both in thin films and microchannels using microelectrode arrays. Such sequence selective separation may be employed to select nucleic acid sequences of similar length from a mixture via local electronics, a basic functionality that can be employed in novel electronic chemical cell designs and other DNA information-processing systems. PMID:26095642

  16. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA).

    PubMed

    Miller, Daniel E; Patel, Zubin H; Lu, Xiaoming; Lynch, Arthur T; Weirauch, Matthew T; Kottyan, Leah C

    2016-01-01

    Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical disease or phenotype. For many diseases and traits, most variants are non-coding, and are thus likely to act by impacting subtle, comparatively hard to predict mechanisms controlling gene expression. Here, we describe a general strategic approach to prioritize non-coding variants, and screen them for their function. This approach involves computational prioritization using functional genomic databases followed by experimental analysis of differential binding of transcription factors (TFs) to risk and non-risk alleles. For both electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genetic variants, a synthetic DNA oligonucleotide (oligo) is used to identify factors in the nuclear lysate of disease or phenotype-relevant cells. For EMSA, the oligonucleotides with or without bound nuclear factors (often TFs) are analyzed by non-denaturing electrophoresis on a tris-borate-EDTA (TBE) polyacrylamide gel. For DAPA, the oligonucleotides are bound to a magnetic column and the nuclear factors that specifically bind the DNA sequence are eluted and analyzed through mass spectrometry or with a reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blot analysis. This general approach can be widely used to study the function of non-coding genetic variants associated with any disease, trait, or phenotype. PMID:27585267

  17. Electrophoretic mobility of particles in concentrated solutions of electrolytes

    SciTech Connect

    Deinega, Yu.F.; Polyakova, V.M.; Aleksandrova, L.N.

    1986-11-01

    The electrophoretic mobility of particles of phenol-formaldehyde and aniline-formaldehyde resins in zinc sulfate solutions has been investigated. It is shown that as the electrolyte concentration rises, the electrophoretic mobility falls, reaches a minimum, and then increases. A possible mechanism for the formation of an electric double layer on the surface of particles in concentrated solutions of electrolytes is proposed.

  18. Electrophoretic Migration of Branched DNA in Polymer Solutions

    NASA Astrophysics Data System (ADS)

    Lau, Henry; Archer, Lynden

    2009-03-01

    The electrophoretic migration of large, star-branched DNA molecules has previously been studied in both neutral polymer solutions and gels, and the results have provided insight into the local interactions between the analytes and the sieving matrix during electrophoresis (Electrophoresis, 2006, 27, 3128). This talk focuses on using rigid-rod DNA molecules of complex shapes as model analytes in studying the effects of analyte architecture on mobility in polymer solutions. Electrophoresis of a series of Y-shaped DNA molecules that mimick the shapes of antibodies, was performed in polymer solutions above the overlap concentration and at electric fields up to 300V/cm. The location of the branch point as well as the arm sizes are varied in order to examine their influence on mobility. Our results point to novel, topology-based fractionation strategies for separating biological molecules using capillary electrophoresis with polymer sieving media.

  19. Identification of tissue-specific DNA-protein binding sites by means of two-dimensional electrophoretic mobility shift assay display.

    PubMed

    Chernov, Igor P; Timchenko, Kira A; Akopov, Sergey B; Nikolaev, Lev G; Sverdlov, Eugene D

    2007-05-01

    We developed a technique of differential electrophoretic mobility shift assay (EMSA) display allowing identification of tissue-specific protein-binding sites within long genomic sequences. Using this approach, we identified 10 cell type-specific protein-binding sites (protein target sites [PTSs]) within a 137-kb human chromosome 19 region. In general, tissue-specific binding of proteins from different nuclear extracts by individual PTSs did not follow the all-or-nothing principle. Most often, PTS-protein complexes were formed in all cases, but they were different for different nuclear extracts used. PMID:17359930

  20. Simulations of electrophoretic collisions of DNA knots with gel obstacles

    NASA Astrophysics Data System (ADS)

    Weber, C.; DeLos Rios, P.; Dietler, G.; Stasiak, A.

    2006-04-01

    Gel electrophoresis can be used to separate nicked circular DNA molecules of equal length but forming different knot types. At low electric fields, complex knots drift faster than simpler knots. However, at high electric field the opposite is the case and simpler knots migrate faster than more complex knots. Using Monte Carlo simulations we investigate the reasons of this reversal of relative order of electrophoretic mobility of DNA molecules forming different knot types. We observe that at high electric fields the simulated knotted molecules tend to hang over the gel fibres and require passing over a substantial energy barrier to slip over the impeding gel fibre. At low electric field the interactions of drifting molecules with the gel fibres are weak and there are no significant energy barriers that oppose the detachment of knotted molecules from transverse gel fibres.

  1. The Electrophoretic Mobility of Proteins near Surfaces

    NASA Astrophysics Data System (ADS)

    Ramasamy, Perumal; Singh, Avtar; Rafailovich, Miriam; Sokolov, Jonathan

    2004-03-01

    We have attempted to apply the methods developed for surface DNA electrophoresis (1) for proteomics. Droplets of FITC stained Abumin, Poly- L-Lysine, or Casein purchased from Sigma were deposited on glass cover slips. The droplets were then place in contact with a TBE buffer solution contained in a cell molded from PDMS. Pt electrodes were inserted into the cell and a voltage was a applied. The motion of the protein was then imaged with a Leica Confocal microscope as a function of buffer concentration, distance from the surface, and applied voltage. The mobilities were then compared with those of uncharged one micron florescent Polystyrene beads. References: 1)Henzel WJ, Watanabe C, Stults JT., !0 Protein Identification: The Origins of Peptide Mass Fingerprinting. !1 J. American Society for Mass Spectrometry. 14 (September 2003): 931-942 2)Mathesius U, Imin N, Natera SH, Rolfe BG., !0 Proteomics as a functional genomics tool. !1 Methods of Molecular Biology 236: 395-414. *Work supported in part by the NSF-MRSEC program

  2. Electrophoretic mobility of oil droplets in electrolyte and surfactant solutions.

    PubMed

    Wuzhang, Jiachen; Song, Yongxin; Sun, Runzhe; Pan, Xinxiang; Li, Dongqing

    2015-10-01

    Electrophoretic mobility of oil droplets of micron sizes in PBS and ionic surfactant solutions was measured in this paper. The experimental results show that, in addition to the applied electric field, the speed and the direction of electrophoretic motion of oil droplets depend on the surfactant concentration and on if the droplet is in negatively charged SDS solutions or in positively charged hexadecyltrimethylammonium bromide (CTAB) solutions. The absolute value of the electrophoretic mobility increases with increased surfactant concentration before the surfactant concentration reaches to the CMC. It was also found that there are two vortices around the oil droplet under the applied electric field. The size of the vortices changes with the surfactant and with the electric field. The vortices around the droplet directly affect the drag of the flow field to the droplet motion and should be considered in the studies of electrophoretic mobility of oil droplets. The existence of the vortices will also influence the determination and the interpretation of the zeta potential of the oil droplets based on the measured mobility data. PMID:26140616

  3. Controlled method of reducing electrophoretic mobility of various substances

    NASA Technical Reports Server (NTRS)

    Vanalstine, James M. (Inventor)

    1989-01-01

    A method of reducing electrophoretic mobility of macromolecules, particles, cells, and the like is provided. The method comprises interacting the particles or cells with a polymer-linked affinity compound composed of: a hydrophilic neutral polymer such as polyethylene glycol, and an affinity component consisting of a hydrophobic compound such as a fatty acid ester, an immunocompound such as an antibody or active fragment thereof or simular macromolecule, or other ligands. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and the mobility reduction obtainable is up to 100 percent for particular particles and cells. The present invention is advantageous in that analytical electrophoretic separation can not be achieved for macromolecules, particles, and cells whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions. The present method is also advantageous in that it can be used in a variety of standard laboratory electrophoresis equipment.

  4. Electrophoretic mobilities and migrating analytes: Part 1: Relationships.

    PubMed

    Cross, Reginald F; Wong, Margaret G

    2002-01-01

    The molecular radii (r) of a series of peptides have been determined by molecular modeling. With these data, it is shown that electrophoretic mobility (mu(ep)) is proportional to 1/r2, and that the dependence presented in textbooks (mu(ep) infinity 1/r) is wrong. Use of the approximately equivalent, mass-based Offord equation is discussed, and other relevant considerations are presented. PMID:12546161

  5. Electrophoretic dynamics of self-assembling branched DNA structures

    NASA Astrophysics Data System (ADS)

    Heuer, Daniel Milton

    This study advances our understanding of the electrophoretic dynamics of branched biopolymers and explores technologies designed to exploit their unique properties. New self-assembly techniques were developed to create branched DNA for visualization via fluorescence microscopy. Experiments in fixed gel networks reveal a distinct trapping behavior, in contrast with linear topologies. The finding that detection can be achieved by introducing a branch point contributes significantly to the field of separation science and can be exploited to develop new applications. Results obtained in polymer solutions point to identical mobilities for branched and linear topologies, despite large differences in their dynamics. This finding led to a new description of electrophoresis based on non-Newtonian viscoelastic effects in the electric double layer surrounding a charged object. This new theoretical framework presents a new outlook important not only to the electrophoretic physics of nucleic acids, but all charged objects including proteins, colloids, and nanoparticles. To study the behavior of smaller biopolymers, such as restriction fragments and recombination intermediates, a library of symmetrically branched DNA was synthesized followed by characterization in gels. The experimental results contribute a large body of information relating molecular architecture and the dynamics of rigid structures in an electric field. The findings allow us to create new separation technologies based on topology. These contributions can also be utilized in a number of different applications including the study of recombination intermediates and the separation of proteins according to structure. To demonstrate the importance of these findings, a sequence and mutation detection technique was envisioned and applied for genetic analysis. Restriction fragments from mutation "hotspots" in the p53 tumor suppressor gene, known to play a role in cancer development, were analyzed with this technique

  6. Electrophoretic mobility of spherical particles in bounded domain.

    PubMed

    Liu, Yu-Wei; Pennathur, Sumita; Meinhart, Carl D

    2016-01-01

    In this study, we improve on our 3D steady-state model of electrophoretic motion of spherical particles in bounded fluidic channels (Liu et al., 2014) to include the effect of nonsymmetric electrolytes, and further validate this improved model with detailed comparisons to experimental data. Specifically, we use the experimentally-measured particle mobilities from the work of Semenov et al. (2013), Napoli et al. (2011), and Wynne et al. (2012) to determine the corresponding particle zeta potentials using our model, and compare these results with classical theory. Incorporating the effects of nonsymmetric electrolytes, EDL polarization, and confinement, we show that our improved model is applicable to a wide range of practical experimental conditions, for example, particles that have high zeta potentials in a bounded channel filled with nonsymmetric electrolyte solutions, where classical theory is not applicable. In addition, we find that when electrolyte concentration is comparable to the concentration of hydronium or hydroxide ions, the complicated composition of ions increases the particle mobility. Finally, increased electrophoretic mobility can be observed when buffer solutions (phosphate or borate) were used as electrolyte solutions in experiments as opposed to simple symmetric electrolytes. PMID:26397906

  7. Electrophoretic mobilities of counterions and a polymer in cylindrical pores

    PubMed Central

    Singh, Sunil P.; Muthukumar, M.

    2014-01-01

    We have simulated the transport properties of a uniformly charged flexible polymer chain and its counterions confined inside cylindrical nanopores under an external electric field. The hydrodynamic interaction is treated by describing the solvent molecules explicitly with the multiparticle collision dynamics method. The chain consisting of charged monomers and the counterions interact electrostatically with themselves and with the external electric field. We find rich behavior of the counterions around the polymer under confinement in the presence of the external electric field. The mobility of the counterions is heterogeneous depending on their location relative to the polymer. The adsorption isotherm of the counterions on the polymer depends nonlinearly on the electric field. As a result, the effective charge of the polymer exhibits a sigmoidal dependence on the electric field. This in turn leads to a nascent nonlinearity in the chain stretching and electrophoretic mobility of the polymer in terms of their dependence on the electric field. The product of the electric field and the effective polymer charge is found to be the key variable to unify our simulation data for various polymer lengths. Chain extension and the electrophoretic mobility show sigmoidal dependence on the electric field, with crossovers from the linear response regime to the nonlinear regime and then to the saturation regime. The mobility of adsorbed counterions is nonmonotonic with the electric field. For weaker and moderate fields, the adsorbed counterions move with the polymer and at higher fields they move opposite to the polymer's direction. We find that the effective charge and the mobility of the polymer decrease with a decrease in the pore radius. PMID:25240366

  8. Electrophoretic mobility of cells in a vertical Ficoll gradiant

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Todd, P. W.; Kunze, M. E.; Gaines, R. A.

    1985-01-01

    The upward migration of living cells and test particles under the influence of a constant electric field in a low conductivity Ficoll gradient occurs at nearly constant velocity. Viscosity and neutral polymer concentration affect migration rate. Decreasing viscosity speeds up the particle migration, decreasing neutral polymer (Ficoll) concentration, slows particle migration, since electrophoretic mobility increases approximately linearly with neutral polymer concentration. Neutral polymers interact with the cell surface to effectively raise its zeta potential. An analytic function was developed from the known dependence of these physical variables on migration distance; the analysis expresses migration velocity as an explicit function of position in the density gradient. It predicts an almost linear increase in velocity of about 12 to 16% over the working region of the gradient. It was numerically integrated and correctly predicts cell migration distance vs time curves without the use of any fitted parameters. The resulting migration curves follow the expected slowly varying exponential form that closely resembles a straight line. The ability to determine standard electrophoretic mobilities from such curves depends on knowledge of the effect of Ficoll on the zeta potential of the cell type that is separated.

  9. Electrophoretic behavior of DNA-methyl-CpG-binding domain protein complexes revealed by capillary electrophoreses laser-induced fluorescence.

    PubMed

    Zhong, Shangwei; Zou, Dandan; Zhao, Bailin; Zhang, Dapeng; Li, Xiangjun; Wang, Hailin

    2015-12-01

    The free solution electrophoretic behavior of DNA-protein complexes depends on their charge and mass in a certain experimental condition, which are two fundamental properties of DNA-protein complexes in free solution. Here, we used CE LIF to study the free solution behavior of DNA-methyl-CpG-binding domain protein (MBD2b) complexes through exploring the relationship between the mobilities, charge, and mass of DNA-protein complexes. This method is based on the effective separation of free DNA and DNA-protein complexes because of their different electrophoretic mobility in a certain electric field. In order to avoid protein adsorption, a polyacrylamide-coated capillary was used. Based on the evaluation of the electrophoretic behavior of formed DNA-MBD2b complexes, we found that the values of (μ0 /μ)-1 were directly proportional to the charge-to-mass ratios of formed complexes, where the μ0 and μ are the mobility of free DNA probe and DNA-protein complex, respectively. The models were further validated by the complex mobilities of protein with various lengths of DNA probes. The deviation of experimental and calculated charge-to-mass ratios of formed complexes from the theoretical data was less than 10%, suggesting that our models are useful to analyze the DNA-binding properties of the purified MBD2b protein and help to analyze other DNA-protein complexes. Additionally, this study enhances the understanding of the influence of the charge-to-mass ratios of formed DNA-protein complexes on their separation and electrophoretic behaviors. PMID:26377303

  10. Electrophoretic mobility patterns of collagen following laser welding

    NASA Astrophysics Data System (ADS)

    Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.

    1991-06-01

    Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.

  11. Electrophoretic mobilities of cultured human embryonic kidney cells in various buffers

    NASA Technical Reports Server (NTRS)

    1985-01-01

    Data on the electrophoretic mobility distributions of cells in the new D-1 buffer and the interlaboratory standardization of urokinase assay methods are presented. A table of cell strains and recent data on cell dispersal methods are also included. It was decided that glycerol in A-1 electrophoretic mobility data on cultured human embryonic kidney cells subjected to electrophoresis in this buffer. The buffer composition is presented.

  12. Effect of passage number on electrophoretic mobility distributions of cultured human embryonic kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.

    1985-01-01

    A systematic investigation was undertaken to characterize population shifts that occur in cultured human embryonic kidney cells as a function of passage number in vitro after original explantation. This approach to cell population shift analysis follows the suggestion of Mehreshi, Klein and Revesz that perturbed cell populations can be characterized by electrophoretic mobility distributions if they contain subpopulations with different electrophoretic mobilities. It was shown that this is the case with early passage cultured human embryo cells.

  13. Electrophoretic mobilities of neutral analytes and electroosmotic flow markers in aqueous solutions of Hofmeister salts.

    PubMed

    Křížek, Tomáš; Kubíčková, Anna; Hladílková, Jana; Coufal, Pavel; Heyda, Jan; Jungwirth, Pavel

    2014-03-01

    Small neutral organic compounds have traditionally the role of EOF markers in electrophoresis, as they are expected to have zero electrophoretic mobility in external electric fields. The BGE contains, however, ions that have unequal affinities to the neutral molecules, which in turn results in their mobilization. In this study we focused on two EOF markers-thiourea and DMSO, as well as on N-methyl acetamide (NMA) as a model of the peptide bond. By means of CE and all atom molecular dynamics simulations we explored mobilization of these neutral compounds in large set of Hofmeister salts. Employing a statistical mechanics approach, we were able to reproduce by simulations the experimental electrophoretic mobility coefficients. We also established the role of the chemical composition of marker and the BGE on the measured electrophoretic mobility coefficient. For NMA, we interpreted the results in terms of the relative affinities of cations versus anions to the peptide bond. PMID:24338984

  14. Capillary electrophoresis separation of vinpocetine and related compounds: prediction of electrophoretic mobilities in partly aqueous media.

    PubMed

    Mazák, K; Szakács, Z; Nemes, A; Noszál, B

    2000-07-01

    Offord's equation, a relationship between electrophoretic mobility and charge, size and shape of peptides, has been extended to quantitate the electrophoretic mobility of vinca alkaloids. Partly aqueous protonation constants and the derived theoretical mobilities have been proven to be able to predict experimental electrophoretic mobilities. In practice, seven vincamine derivatives of very low water-solubility were separated by capillary electrophoresis. Buffer total concentration, apparent pH and methanol content, the three most important parameters of the running buffer, were used in triangular resolution mapping to characterize separation. Even though electrophoresis is well known to slow down in partly aqueous media, under our optimized circumstances a baseline separation was achieved within 8 min in each case. PMID:10939454

  15. Electrophoretic mobility patterns of immunologically phenotyped cells in different hemopoietic malignancies.

    PubMed

    Babusíková, O; Koníková, E; Ujházy, P

    1986-01-01

    The electrophoretic mobility distribution along with the immunologic phenotype (rosette tests, surface membrane immunoglobulin determination and mainly the detection of differentiation and leukemia-associated antigens by monoclonal antibodies) have been studied in 120 patients with different hemopoietic cell malignancies and in a group of healthy donors. The aim of our study was to compare the electrophoretic mobility character of malignant cells with that of normal T and B lymphocytes and their immune phenotype. Normal peripheral blood lymphocytes showed the typical bimodal pattern of two clearly distinguishable populations of different electrophoretic mobilities, corresponding to T and B cells. In leukemia and lymphoma cells the sharp unimodal peak has appeared, which was attributed to monoclonal origin of these cells. Moreover, the electrophoretic mobility of cells in different hemopoietic cell malignancies reflected different cell lineages and maturation stages within the given lineage group. Utilizing of the cell electrophoretic mobility as an additional marker to the immunologic data for the characterization of leukemia and lymphoma cells is proposed. PMID:3808126

  16. The electrophoretic mobility of montmorillonite. Zeta potential and surface conductivity effects.

    PubMed

    Leroy, Philippe; Tournassat, Christophe; Bernard, Olivier; Devau, Nicolas; Azaroual, Mohamed

    2015-08-01

    Clay minerals have remarkable adsorption properties because of their high specific surface area and surface charge density, which give rise to high electrochemical properties. These electrochemical properties cannot be directly measured, and models must be developed to estimate the electrostatic potential at the vicinity of clay mineral surfaces. In this context, an important model prediction is the zeta potential, which is thought to be representative of the electrostatic potential at the plane of shear. The zeta potential is usually deduced from electrophoretic measurements but for clay minerals, high surface conductivity decreases their mobility, thereby impeding straightforward interpretation of these measurements. By combining a surface complexation, conductivity and electrophoretic mobility model, we were able to reconcile zeta potential predictions with electrophoretic measurements on montmorillonite immersed in NaCl aqueous solutions. The electrochemical properties of the Stern and diffuse layers of the basal surfaces were computed by a triple-layer model. Computed zeta potentials have considerably higher amplitudes than measured zeta potentials calculated with the Smoluchowski equation. Our model successfully reproduced measured electrophoretic mobilities. This confirmed our assumptions that surface conductivity may be responsible for montmorillonite's low electrophoretic mobility and that the zeta potential may be located at the beginning of the diffuse layer. PMID:25875489

  17. Alteration of the electrophoretic mobility of human peripheral blood mononuclear cells following treatment with dimethyl sulfoxide

    SciTech Connect

    Skrabut, E.M.; Catsimpoolas, N.; Kurtz, S.R.; Griffith, A.L.; Valeri, C.R.

    1983-12-01

    Studies have been conducted to determine the effects of DMSO and freezing on the electrophoretic distribution of peripheral blood mononuclear cells. Sodium (/sup 51/Cr)chromate was used to label the cells, and the distributions of cell number and cell-associated radioactivity were determined. Cells treated with DMSO had a narrower distribution of electrophoretic mobilities when compared with those not treated. DMSO-treated cells also demonstrated a more homogeneous distribution of radioactivity relative to the cell distribution than did the nontreated cells. The freezing of DMSO-treated cells did not result in any additional alteration of electrophoretic pattern compared to DMSO treatment alone. Analysis by linear categorization techniques indicated that the DMSO-treated and nontreated cells were completely distinguished by their electrophoretic behavior.

  18. Sterically stabilized liposomes. Reduction in electrophoretic mobility but not electrostatic surface potential.

    PubMed Central

    Woodle, M C; Collins, L R; Sponsler, E; Kossovsky, N; Papahadjopoulos, D; Martin, F J

    1992-01-01

    The electrophoretic mobility of liposomes containing a negatively charged derivative of phosphatidylethanolamine with a large headgroup composed of the hydrophilic polymer polyethylene glycol (PEG-PE) was determined by Doppler electrophoretic light scattering. The results show that this method is improved by the use of measurements at multiple angles to eliminate artifacts and that very small mobilities can be measured. The electrophoretic mobility of liposomes with 5 to 10 mol% PEG-PE is approximately -0.5 mu ms-1/Vcm-1 regardless of PEG-PE content compared with approximately -2 mu ms-1/Vcm-1 for similar liposomes but containing 7.5% phosphatidylglycerol (PG) instead of PEG-PE. Measurements of surface potential by distribution of an anionic fluorescent probe show that the PEG-PE imparts a negative charge identical to that by PG, consistent with the expectation of similar locations of the ionized phosphate responsible for the charge. The reduced mobility imparted by the surface bound PEG is attributed to a mechanism similar to that described for colloidal steric stabilization: hydrodynamic drag moves the hydrodynamic plane of shear, or the hydrodynamic radius, away from the charge-bearing plane, that of the phosphate moities. An extended length of approximately 50 A for the 2,000 molecular weight PEG is estimated from the reduction in electrophoretic mobility. PMID:1581503

  19. Enhancement of electrophoretic mobility of microparticles near a solid wall--experimental verification.

    PubMed

    Liang, Qian; Zhao, Cunlu; Yang, Chun

    2015-03-01

    Although the existing theories have predicted enhancement of electrophoretic mobility of microparticles near a solid wall, the relevant experimental studies are rare. This is mainly due to difficulties in experimentally controlling and measuring particle-wall separations under dynamic electrophoretic conditions. This paper reports an experimental verification of the enhancement of electrophoretic mobility of a microparticle moving near the wall of a microchannel. This is achieved by balancing dielectrophoretic and lift forces against gravitational force acting on the microparticle so as to control the gap of particle-wall separation. A simple experimental setup is configured and a fabrication method is developed to measure such separation gap. The experiments are conducted for various particle sizes under different electric field strengths. Our experimental results are compared against the available theoretical predictions in the literature. PMID:25421107

  20. Characterization of the Cell Surface Properties of Drinking Water Pathogens by Microbial Adhesion to Hydrocarbon and Electrophoretic Mobility Measurements

    EPA Science Inventory

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregati...

  1. ELECTROPHORETIC MOBILITIES OF ESCHERICHIA COLI 0157:H7 AND WILD-TYPE ESCHERICHIA COLI STRAINS

    EPA Science Inventory

    The electrophoretic mobility (EPM) of a number of human-virulent and "wild-type" Escherichia coli strains in phosphate buffered water was measured. The impact of pH, ionic strength, cation type (valence) and concentration, and bacterial strain on the EPM was investigated. Resul...

  2. Controlled method of reducing electrophoretic mobility of macromolecules, particles, or cells

    NASA Technical Reports Server (NTRS)

    Vanalstine, James M. (Inventor)

    1992-01-01

    A method of reducing electrophoretic mobility of macromolecules, particles, cells, and other substances is provided which comprises interacting in a conventional electrophoretic separating procedure, the substances with a polymer-linked affinity compound comprised of a hydrophilic neutral polymer such as polyethylene glycol bound to a second component such as a hydrophobic compound, an immunocompound such as an antibody or antibody active fragment, or a ligand such as a hormone, drug, antigen, or a hapten. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and such reduction can comprise up to 100 percent for particular particles and cells. The present invention is advantageous in that electrophoretic separation can now be achieved for substances whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of the specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions.

  3. Size and DNA distributions of electrophoretically separated cultured human kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.; Plank, L. D.; Todd, P. W.

    1985-01-01

    Electrophoretic purification of purifying cultured cells according to function presumes that the size of cycle phase of a cell is not an overriding determinant of its electrophoretic velocity in an electrophoretic separator. The size distributions and DNA distributions of fractions of cells purified by density gradient electrophoresis were determined. No systematic dependence of electrophoretic migration upward in a density gradient column upon either size or DNA content were found. It was found that human leukemia cell populations, which are more uniform function and found in all phases of the cell cycle during exponential growth, separated on a vertical sensity gradient electrophoresis column according to their size, which is shown to be strictly cell cycle dependent.

  4. Electrophoretic Mobility of Poly(acrylic acid)-Coated Alumina Particles

    SciTech Connect

    Bhosale, Prasad S.; Chun, Jaehun; Berg, John C.

    2011-06-01

    The effect of poly (acrylic acid) (PAA) adsorption on the electrokinetic behavior of alumina dispersions under high pH conditions was investigated as a function of polymer concentration and molecular weight as well as the presence, concentration and ion type of background electrolyte. Systems of this type are relevant to nuclear waste treatment, in which PAA is known to be an effective rheology modifier. The presence of all but the lowest molecular weight PAA studied (1800) led to decreases in dynamic electrophoretic mobility at low polymer concentrations, attributable to bridging flocculation, as verified by measurements of particle size distribution. Bridging effects increased with polymer molecular weight, and decreased with polymer concentration. Increases in background electrolyte concentration enhanced dynamic electrophoretic mobility as the polymer layers were compressed and bridging was reduced. Such enhancements were reduced as the cation was changed from Na+ to K+ to Cs+.

  5. Electrophoretic Mobility of a Dilute, Highly Charged "Soft" Spherical Particle in a Charged Hydrogel.

    PubMed

    Allison, Stuart; Li, Fei; Le, Melinda

    2016-08-25

    In this paper, numerical modeling studies are carried out on the electrophoretic mobility of a dilute, highly charged "soft" spherical particle in a hard hydrogel subjected to a weak, constant, external electric field. The particle contains a solid core with either a uniform charge density or "zeta" potential on its surface. Outside of this lies a charged gel layer of uniform thickness, composition, and charge density. The present work extends previous studies by accounting for the "relaxation effect", or distortion of the charge distribution in the vicinity of the model particle due to the imposition of an external electric and/or flow field. The particle gel layer and ambient hydrogel are modeled as porous Brinkman media. The (steady state) electrodynamic problem is solved at the level of the Poisson equation. Applications emphasize the influence of the relaxation effect and hydrogel charge density on the electrophoretic mobility. PMID:26815300

  6. Cobalt ferrite nanoparticles with improved aqueous colloidal stability and electrophoretic mobility

    NASA Astrophysics Data System (ADS)

    Munjal, Sandeep; Khare, Neeraj

    2016-04-01

    We have synthesized CoFe2O4 (CFO) nanoparticles of size ˜ 12.2 nm by hydrothermal synthesis method. To control the size of these CFO nanoparticles, oleic acid was used as a surfactant. The inverse spinel phase of the synthesized nanoparticles was confirmed by X-ray diffraction method. As synthesized oleic acid coated CFO (OA@CFO) nanoparticles has very less electrophoretic mobility in the water and are not water dispersible. These OA@CFO nanoparticles were successfully turned into water soluble phase with a better colloidal aqueous stability, through a chemical treatment using citric acid. The modified citric acid coated CFO (CA@CFO) nanoparticles were dispersible in water and form a stable aqueous solution with high electrophoretic mobility.

  7. Fenton fragmentation for faster electrophoretic on chip purification of amplifiable genomic DNA.

    PubMed

    Hakenberg, S; Hügle, M; Meyer, P; Behrmann, O; Dame, G; Urban, G A

    2015-05-15

    With a rapid and simple actuation protocol electrophoretic nucleic acid extraction is easy automatable, requires no moving parts, is easy to miniaturize and furthermore possesses a size dependent cut-off filter adjustable by the pore size of the hydrogel. However electrophoretic nucleic acid extraction from bacteria has so far been applied mainly for short RNA targets. One of the reasons is that electrophoretic processing of unfragmented genomic DNA strands is time-consuming, because of the length. Here DNA fragmentation would accelerate extraction and isolation. We introduce on-chip lysis and non-enzymatic DNA cleavage directly followed by a purifying step for receiving amplifiable DNA fragments from bacteria in less than 25 min. In contrast to restriction enzymes the Fenton reaction is known to cleave DNA without nucleotide specificity. The reaction mix contains iron(II) EDTA, sodium ascorbate, hydrogen peroxide and lysozyme. The degree of fragmentation can be adjusted by the concentration of reagents. The results enable electrophoretic extraction methods to unspecifically process long genomic DNA in a short time frame, e.g. for pathogen detection in a lab-on-a-chip format. PMID:24970713

  8. Microflora on explanted silicone rubber voice prostheses: taxonomy, hydrophobicity and electrophoretic mobility.

    PubMed

    Neu, T R; Verkerke, G J; Herrmann, I F; Schutte, H K; Van der Mei, H C; Busscher, H J

    1994-05-01

    Silicone rubber voice prostheses are implants which are inserted in a non-sterile environment and therefore become quickly colonized by micro-organisms. The micro-organisms exist on the medical grade silicone rubber as mixed biofilms of bacteria and yeasts. A total of 79 bacterial and 39 yeast strains were isolated from these biofilms by soft ultrasonic treatment. Gram-positive/catalase-negative and Gram-positive/catalase-positive cocci represented the dominant bacterial strains. The yeasts were mainly Candida species. Further characterization of cell surface properties such as hydrophobicity by microbial adhesion to hexadecane and electrophoretic mobility showed a distinct difference when the bacterial strains were compared with the yeasts. The bacterial hydrophobicities ranged from 0 to 100% adhesion to hexadecane, whereas the yeast strains, especially the Candida albicans strains, all had markedly hydrophilic cell surfaces. A comparison of the electrophoretic mobilities showed also differences between bacteria and yeast. The values for the bacteria were found to be between -2.5 to -0.5 (10(-8) m2 V-1 s-1), whereas for the yeasts electrophoretic mobilities were more positive. Based on the adhesive properties of the isolated micro-organisms, strategies can now be developed to modify the properties of the silicone rubber to reduce biofilm formation on such prostheses. PMID:8005837

  9. Approximate Analytic Expression for the Electrophoretic Mobility of Moderately Charged Cylindrical Colloidal Particles.

    PubMed

    Ohshima, Hiroyuki

    2015-12-29

    An approximate analytic expression for the electrophoretic mobility of an infinitely long cylindrical colloidal particle in a symmetrical electrolyte solution in a transverse electric field is obtained. This mobility expression, which is correct to the order of the third power of the zeta potential ζ of the particle, considerably improves Henry's mobility formula correct to the order of the first power of ζ (Proc. R. Soc. London, Ser. A 1931, 133, 106). Comparison with the numerical calculations by Stigter (J. Phys. Chem. 1978, 82, 1417) shows that the obtained mobility formula is an excellent approximation for low-to-moderate zeta potential values at all values of κa (κ = Debye-Hückel parameter and a = cylinder radius). PMID:26639309

  10. High-Throughput Electrophoretic Mobility Shift Assays for Quantitative Analysis of Molecular Binding Reactions

    PubMed Central

    2015-01-01

    We describe a platform for high-throughput electrophoretic mobility shift assays (EMSAs) for identification and characterization of molecular binding reactions. A photopatterned free-standing polyacrylamide gel array comprised of 8 mm-scale polyacrylamide gel strips acts as a chassis for 96 concurrent EMSAs. The high-throughput EMSAs was employed to assess binding of the Vc2 cyclic-di-GMP riboswitch to its ligand. In optimizing the riboswitch EMSAs on the free-standing polyacrylamide gel array, three design considerations were made: minimizing sample injection dispersion, mitigating evaporation from the open free-standing polyacrylamide gel structures during electrophoresis, and controlling unit-to-unit variation across the large-format free-standing polyacrylamide gel array. Optimized electrophoretic mobility shift conditions allowed for 10% difference in mobility shift baseline resolution within 3 min. The powerful 96-plex EMSAs increased the throughput to ∼10 data/min, notably more efficient than either conventional slab EMSAs (∼0.01 data/min) or even microchannel based microfluidic EMSAs (∼0.3 data/min). The free-standing polyacrylamide gel EMSAs yielded reliable quantification of molecular binding and associated mobility shifts for a riboswitch–ligand interaction, thus demonstrating a screening assay platform suitable for riboswitches and potentially a wide range of RNA and other macromolecular targets. PMID:25233437

  11. Passive trapping of rigid rods due to conformation-dependent electrophoretic mobility.

    PubMed

    Pandey, Harsh; Szafran, Sylvia A; Underhill, Patrick T

    2016-03-16

    We present computer simulations of a rigid rod in a combination of an extensional fluid flow and extensional electric field. The electrophoretic mobility of the rod is different parallel or perpendicular to the rod. The dependence of the mobility on the conformation (orientation) leads to a new phenomenon where the rods can be passively trapped in all directions at the stagnation point. This contrasts with the behavior in either fluid flow or electric field alone, in which an object can be pushed towards the stagnation point along some directions but is pushed away in others. We have determined the state space where trapping occurs and have developed a model that describes the strength of trapping when it does occur. This new phenomenon could be used in the future to separate objects based on a coupling between their mobility and ability to be oriented. PMID:26892384

  12. DNA analysis on microfabricated electrophoretic devices with bubble cells.

    PubMed

    Tseng, Wei-Lung; Lin, Yang-Wei; Chen, Ko-Chun; Chang, Huan-Tsung

    2002-08-01

    Microfluidic devices with bubble cells have been fabricated on poly(methyl methacrylate) (PMMA) plates and have been employed for the analysis of DNA using polyethylene oxide (PEO) solutions. First, the separation channel was fabricated using a wire-imprinting method. Then, wires with greater sizes or a razor blade glued in a polycarbonate plate was used to fabricate bubble cells, with sizes of 190-650 microm. The improvements in resolution and sensitivity have been achieved for large DNA (> 603 base pair, bp) using such devices, which depend on the geometry of the bubble cell. The main contributor for optimal resolution is mainly due to DNA migration at lower electric field strengths inside the bubble cell. On the other hand, slight losses of resolution for small DNA fragments have been found mainly due to diffusion, supported by the loss of resolution when separating two small solutes. With a bubble cell of 75 microm (width) x 500 microm (depth), the sensitivity improvement up to 17-fold has been achieved for the 271 bp fragment in the separation of PhiX-174/HaeIII DNA restriction fragments. We have also found that a microfluidic device with a bubble cell of 360 microm x 360 microm is appropriate for DNA analysis. Such a device has been used for separating DNA ranging from 8 to 2176 bp and polymerase chain reaction (PCR) products amplified after 30 cycles, with rapidity and improvements in the sensitivity as well as resolution. PMID:12210206

  13. DNA fingerprinting and electrophoretic karyotype of environmental and clinical isolates of Candida parapsilosis.

    PubMed Central

    Carruba, G; Pontieri, E; De Bernardis, F; Martino, P; Cassone, A

    1991-01-01

    The endonuclease restriction pattern (DNA fingerprinting) and the electrophoretic karyotype of 16 Candida parapsilosis isolates from environmental and clinical sources were investigated. DNA from both whole cells and separated mitochondria was digested with enzymes, including EcoRI, BamHI, KpnI, BglII, HpaII, PvuII, and HindIII. Regardless of their source and pathogenic properties, all isolates showed a uniform, reproducible, and overlapping whole-cell DNA fingerprinting with each endonuclease digest. Mitochondrial DNA fragments were, in all cases, major contributors to the total cellular DNA restriction pattern. In contrast, the electrophoretic karyotype generated by rotating field gel electrophoresis (RFGE) or contour clamped homogeneous field electrophoresis (CHEF) showed a remarkable polymorphism among the isolates. This polymorphism concerned the smaller molecular size section of the karyotype (range, 1.8 to 0.7 Mb), where at least two to five chromosomal bands could be consistently detected by both RFGE and CHEF. Larger (greater than or equal to 3.0 to 1.9 Mb) chromosome-sized DNA bands (four in CHEF and three in RFGE) were quite distinct and common to all isolates. Thus, seven karyotype classes could be defined, on the basis of both the number and size of putative chromosomes. The three categories of isolates (soil, vaginal, and hematological) were not randomly distributed among the seven classes. In particular, the four hematological isolates had a karyotype pattern which was clearly distinct from that shown by the three environmental isolates, and of the nine vaginal isolates only one shared a class with isolates from another source (soil). Although tentative, the classification was totally consistent with the independent and reproducible results obtained by the two pulse-field electrophoretic techniques employed. It is suggested that the electrophoretic analysis of the karyotype might be particularly useful for epidemiological and pathogenicity studies on

  14. Electrophoretic mobility of silica particles in a mixture of toluene and ethanol at different particle concentrations.

    PubMed

    Medrano, M; Pérez, A T; Lobry, L; Peters, F

    2009-10-20

    In this paper we present measurements of the electrophoretic mobility of colloidal particles by using heterodyne detection of light scattering. The measurements have been made up to concentrations of 5.4% silica nanoparticles, with a diameter on the order of 80 nm, in a mixture of 70% toluene and 30% ethanol. To make possible the measurements at these concentrations, the liquid mixture is chosen so as to match the index of refraction of the particles, thus resulting in a transparent suspension. PMID:19754057

  15. The influence of hydrodynamic slip on the electrophoretic mobility of a spherical colloidal particle

    NASA Astrophysics Data System (ADS)

    Khair, Aditya S.; Squires, Todd M.

    2009-04-01

    Recent theoretical studies have suggested a significant enhancement in electro-osmotic flows over hydrodynamically slipping surfaces, and experiments have indeed measured O(1) enhancements. In this paper, we investigate whether an equivalent effect occurs in the electrophoretic motion of a colloidal particle whose surface exhibits hydrodynamic slip. To this end, we compute the electrophoretic mobility of a uniformly charged spherical particle with slip length λ as a function of the zeta (or surface) potential of the particle ζ and diffuse-layer thickness κ-1. In the case of a thick diffuse layer, κa ≪1 (where a is the particle size), simple arguments show that slip does lead to an O(1) enhancement in the mobility, owing to the reduced viscous drag on the particle. On the other hand, for a thin-diffuse layer κa ≫1, the situation is more complicated. A detailed asymptotic analysis, following the method of O'Brien [J. Colloid Interface Sci. 92, 204 (1983)], reveals that an O(κλ) increase in the mobility occurs at low-to-moderate zeta potentials (with ζ measured on the scale of thermal voltage kBT /e≈25 mV). However, as ζ is further increased, the mobility decreases and ultimately becomes independent of the slip length—the enhancement is lost—which is due to the importance of nonuniform surface conduction within the thin-diffuse layer, at large ζ and large, but finite, κa. Our asymptotic calculations for thick and thin-diffuse layers are corroborated and bridged by computation of the mobility from the numerical solution of the full electrokinetic equations (using the method of O'Brien and White [J. Chem. Soc., Faraday Trans. 2 74, 1607 (1978)]). In summary, then, we demonstrate that hydrodynamic slip can indeed produce an enhancement in the electrophoretic mobility; however, such enhancements will not be as dramatic as the previously studied κa →∞ limit would suggest. Importantly, this conclusion applies not only to electrophoresis but also to

  16. Control and Reversal of the Electrophoretic Force on DNA in a Charged Nanopore

    PubMed Central

    Luan, Binquan

    2011-01-01

    Electric field-driven transport of DNA through solid-state nanopores is the key process in nanopore-based DNA sequencing that promises dramatic reduction of genome sequencing costs. A major hurdle in the development of this sequencing method is that DNA transport through the nanopores occurs too quickly for the DNA sequence to be detected. By means of all-atom molecular dynamics simulations, we demonstrate in this communication that velocity of DNA transport through a nanopore can be controlled by the charge state of the nanopore surface. In particular, we show that the charge density of the nanopore surface controls the magnitude and/or direction of the electro-osmotic flow through the nanopore and thereby can significantly reduce or even reverse the effective electrophoretic force on DNA. Our work suggests a physical mechanism to control DNA transport in a nanopore by chemical, electrical or electrochemical modification of the nanopore surface. PMID:21339610

  17. Electrophoretic mobility as a tool to separate immune adjuvant saponins from Quillaja saponaria Molina.

    PubMed

    Gilabert-Oriol, Roger; Weng, Alexander; von Mallinckrodt, Benedicta; Stöshel, Anja; Nissi, Linda; Melzig, Matthias F; Fuchs, Hendrik; Thakur, Mayank

    2015-06-20

    Quillaja saponins are used as adjuvants in animal vaccines but their application in human vaccination is still under investigation. Isolation and characterization of adjuvant saponins is very tedious. Furthermore, standardization of Quillaja saponins is critical pertaining to its application in humans. In this study, a convenient method based on agarose gel electrophoresis was developed for the separation of Quillaja saponins. Six different commercial Quillaja saponins were segregated by size/charge into numerous fractions. Each of the fractions was characterized by ESI-TOF-MS spectroscopy and thin layer chromatography. Real-time impedance-based monitoring and red blood cell lysis assay were used to evaluate cytotoxicity and hemolytic activities respectively. Two specific regions in the agarose gel (delimited by specific relative electrophoretic mobility values) were identified and characterized by exclusive migration of acylated saponins known to possess immune adjuvant properties (0.18-0.58), and cytotoxic and hemolytic saponins (0.18-0.94). In vivo experiments in mice with the isolated fractions for evaluation of adjuvant activity also correlated with the relative electrophoretic mobility. In addition to the separation of specific Quillaja saponins with adjuvant effects as a pre-purification step to HPLC, agarose gel electrophoresis stands out as a new method for rapid screening, separation and quality control of saponins. PMID:25839418

  18. Electrophoretic Mobility Shift Assay (EMSA) for Detecting Protein-Nucleic Acid Interactions

    PubMed Central

    Hellman, Lance M.; Fried, Michael G.

    2009-01-01

    The gel electrophoresis mobility shift assay (EMSA) is used to detect protein complexes with nucleic acids. It is the core technology underlying a wide range of qualitative and quantitative analyses for the characterization of interacting systems. In the classical assay, solutions of protein and nucleic acid are combined and the resulting mixtures are subjected to electrophoresis under native conditions through polyacrylamide or agarose gel. After electrophoresis, the distribution of species containing nucleic acid is determined, usually by autoradiography of 32P-labeled nucleic acid. In general, protein-nucleic acid complexes migrate more slowly than the corresponding free nucleic acid. In this article, we identify the most important factors that determine the stabilities and electrophoretic mobilities of complexes under assay conditions. A representative protocol is provided and commonly used variants are discussed. Expected outcomes are briefly described. References to extensions of the method and a troubleshooting guide are provided. PMID:17703195

  19. DNA mobility modifier

    DOEpatents

    Barron, Annelise E.

    2004-04-20

    Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.

  20. DNA mobility modifier

    DOEpatents

    Barron, Annelise

    2002-01-01

    Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.

  1. Cell surface adhesiveness of mouse sarcoma lines evaluated by latex particle adherence assay: correlation with growth behavior and electrophoretic mobility.

    PubMed

    Bubeník, J; Jandlová, T; Suhajová, E; Malkovský, M

    1979-01-01

    Using the latex particle adherence assay and five mouse sarcoma cell lines of the identical origin, etiology and genotype but differing in malignancy we attempted to correlate the degree of cell surface adhesiveness with growth behavior and electrophoretic mobility of cells. Higher tumorigenicity of four of the cell lines (Mc11--Mc14) was associated with lower cell surface adhesiveness and, conversely, lower malignancy of the fifth line (Mc15) with higher cell surface adhesiveness. No simple correlation or causal relationship was found among the electrophoretic mobility of the lines and other cellular characteristics. PMID:522921

  2. Observation of separate cation and anion electrophoretic mobilities in pure ionic liquids

    NASA Astrophysics Data System (ADS)

    Zhang, Zhiyang; Madsen, Louis A.

    2014-02-01

    Ionic liquids (ILs) continue to show relevance in many fields, from battery electrolytes, to carbon capture, to advanced separations. These highly ion-dense fluids present unique challenges in understanding their electrochemical properties due to deviations in behavior from existing electrolyte theories. Here we present a novel characterization of ILs using electrophoretic NMR (ENMR) to determine separate cation and anion mobilities. This method uses an applied electric field coincident with a pulsed magnetic field gradient to encode the E-field driven flow into NMR signals for cations (1H) and anions (19F). We describe the detailed design of these experiments, including quantitative analysis of artifact mitigation and necessary control experiments. We then explore mobilities and diffusion coefficients for two representative ILs: 1-ethyl-3-methyl imidazolium tetrafluoroborate ([C2mim][BF4]) and 1-ethyl-3-methyl imidazolium trifluoromethanesulfonate ([C2mim][TfO]). We further use the individual ion mobilities to calculate the bulk net conductivity, which closely agrees with bulk conductivity measurements obtained using impedance spectroscopy. These observations represent the first reliable measurements of cation and anion mobilities in pure ILs, with errors of ±7%. We discuss this advanced experimental methodology in detail, as well as implications of these sensitive measurements for understanding conduction mechanisms in ion-dense electrolytes.

  3. Observation of separate cation and anion electrophoretic mobilities in pure ionic liquids.

    PubMed

    Zhang, Zhiyang; Madsen, Louis A

    2014-02-28

    Ionic liquids (ILs) continue to show relevance in many fields, from battery electrolytes, to carbon capture, to advanced separations. These highly ion-dense fluids present unique challenges in understanding their electrochemical properties due to deviations in behavior from existing electrolyte theories. Here we present a novel characterization of ILs using electrophoretic NMR (ENMR) to determine separate cation and anion mobilities. This method uses an applied electric field coincident with a pulsed magnetic field gradient to encode the E-field driven flow into NMR signals for cations ((1)H) and anions ((19)F). We describe the detailed design of these experiments, including quantitative analysis of artifact mitigation and necessary control experiments. We then explore mobilities and diffusion coefficients for two representative ILs: 1-ethyl-3-methyl imidazolium tetrafluoroborate ([C2mim][BF4]) and 1-ethyl-3-methyl imidazolium trifluoromethanesulfonate ([C2mim][TfO]). We further use the individual ion mobilities to calculate the bulk net conductivity, which closely agrees with bulk conductivity measurements obtained using impedance spectroscopy. These observations represent the first reliable measurements of cation and anion mobilities in pure ILs, with errors of ±7%. We discuss this advanced experimental methodology in detail, as well as implications of these sensitive measurements for understanding conduction mechanisms in ion-dense electrolytes. PMID:24588161

  4. Difference in microchip electrophoretic mobility between partially and fully PEGylated poly(amidoamine) dendrimers.

    PubMed

    Park, Eun Ji; Na, Dong Hee

    2015-11-01

    The objective of this study was to investigate the difference in electrophoretic mobility between partially and fully poly(ethylene glycol)-conjugated poly(amidoamine) dendrimers (part-PEG-PAMAM and full-PEG-PAMAM, respectively) using a microchip capillary gel electrophoresis (MCGE). While MCGE allowed size-based separation of PEG-PAMAMs prepared with monomethoxy PEG-nitrophenyl carbonate, full-PEG-PAMAMs migrated slower than part-PEG-PAMAMs that were similar in size or larger. When the measured molecular weights obtained from MCGE analysis and the calculated molecular weights were plotted, each part-PEG-PAMAM and full-PEG-PAMAM showed correlation coefficients greater than 0.98. This study indicates that MCGE would be useful for characterizing PEG-PAMAMs with different PEGylation degrees. PMID:26253023

  5. Effect of pH on the Electrophoretic Mobility of Spores of Bacillus anthracis and Its Surrogates in Aqueous Solutions

    EPA Science Inventory

    Electrophoretic mobility (EPM) of endospores of Bacillus anthracis and surrogates were measured in aqueous solution across a broad pH range and several ionic strengths. EPM values trended around phylogenetic clustering based on the 16S rRNA gene. Measurements reported here prov...

  6. Electrophoretic mobility shift assays: analysis of tRNA binding to the T box riboswitch antiterminator RNA.

    PubMed

    Anupam, R; Zhou, S; Hines, J V

    2015-01-01

    Changes in electrophoretic mobility upon complex formation with RNA can be used to probe structure-function relationships that are critical for complex formation. Here, we describe the application of this technique to monitor tRNA binding to the T box riboswitch antiterminator RNA. PMID:25352142

  7. Rapid agarose gel electrophoretic mobility shift assay for quantitating protein: RNA interactions.

    PubMed

    Ream, Jennifer A; Lewis, L Kevin; Lewis, Karen A

    2016-10-15

    Interactions between proteins and nucleic acids are frequently analyzed using electrophoretic mobility shift assays (EMSAs). This technique separates bound protein:nucleic acid complexes from free nucleic acids by electrophoresis, most commonly using polyacrylamide gels. The current study utilizes recent advances in agarose gel electrophoresis technology to develop a new EMSA protocol that is simpler and faster than traditional polyacrylamide methods. Agarose gels are normally run at low voltages (∼10 V/cm) to minimize heating and gel artifacts. In this study we demonstrate that EMSAs performed using agarose gels can be run at high voltages (≥20 V/cm) with 0.5 × TB (Tris-borate) buffer, allowing for short run times while simultaneously yielding high band resolution. Several parameters affecting band and image quality were optimized for the procedure, including gel thickness, agarose percentage, and applied voltage. Association of the siRNA-binding protein p19 with its target RNA was investigated using the new system. The agarose gel and conventional polyacrylamide gel methods generated similar apparent binding constants in side-by-side experiments. A particular advantage of the new approach described here is that the short run times (5-10 min) reduce opportunities for dissociation of bound complexes, an important concern in non-equilibrium nucleic acid binding experiments. PMID:27495142

  8. Easy measurement and analysis method of zeta potential and electrophoretic mobility of water-dispersed colloidal particles by using a self-mixing solid-state laser

    NASA Astrophysics Data System (ADS)

    Sudo, S.; Ohtomo, T.; Otsuka, K.

    2013-08-01

    We describe a highly sensitive method of measuring electrophoretic mobility and zeta potential of water-dispersed colloidal particles by using a self-mixing laser Doppler velocimeter with a laser-diode-pumped, thin-slice solid-state laser with extremely high optical sensitivity. The power spectra of laser output modulated by reinjected laser light scattered by the electrophoretic particles were observed. The power spectrum cannot be described by the well-known formula for translational motion or flowing Brownian motion, i.e., a combination of Doppler shift, diffusion, and translation. The power spectra shape is found to reflect the velocity distribution of electrophoretic particles in a capillary tube due to the electro-osmotic flow contribution. Not only evaluation of the electrophoretic mobility and zeta potential but also the particle diameter undergoing electrophoretic motion can be performed from the shape of the power spectrum.

  9. A computer program for determining the electrophoretic mobility of cells in a rectangular chamber during asymmetric electroosmotic flow

    NASA Technical Reports Server (NTRS)

    1985-01-01

    In the field of cell electrophoresis, computer programs have been used for the estimation of zeta potential and surface charge density of specific charged chemical species from electrophoretic mobility data. The union of computer and microscope cell electrophoresis in the laboratory has yielded several satisfying results. The method organizes and error checks these data and stores them on permanent file for future reference or reanalysis. This computer analysis, accomplished in two steps by two main programs and a major subroutine, provides a quick, useful and realistic presentation of mobility data in histogram form, and is appropriate for any microelectrophoretic work using rectangular chambers. Computer program 1 is the first step of two in the analysis of mobility data. Program 2 consists of the main program, POLY2, which fits a least squares parabola to the apparent mobility data generated by Program 1, and the subroutine EXTRA which determines actual cell mobilities using the regression curve equation.

  10. Electrophoretic concentration of DNA at nanoporous polymer membranes for separations and diagnostics.

    SciTech Connect

    Thaitrong, Numrin; Meagher, Robert J.; Singh, Anup K.

    2010-11-01

    We report on the use of thin ({approx}30 micron) photopatterned polymer membranes for on-line preconcentration of single- or double-stranded DNA samples prior to electrophoretic analysis. Shaped UV laser light is used to quickly ({approx}10 seconds) polymerize a highly crosslinked polyacrylamide plug. By applying an electric field across the membrane, DNA from a dilute sample can be concentrated into a narrow zone (<100 micron wide) at the outside edge of the membrane. The field at the membrane can then be reversed, allowing the narrow plug to be cleanly injected into a separation channel filled with a sieving polymer for analysis. Concentration factors >100 are possible, increasing the sensitivity of analysis for dilute samples. We have fabricated both neutral membranes (purely size-based exclusion) as well as anionic membranes (size and charge exclusion), and characterized the rate of preconcentration as well as the efficiency of injection from both types of membrane, for DNA, ranging from a 20 base ssDNA oligonucleotide to >14 kbp dsDNA. We have also investigated the effects of concentration polarization on device performance for the charged membrane. Advantages of the membrane preconcentration approach include the simplicity of device fabrication and operation, and the generic (non-sequence specific) nature of DNA capture, which is useful for complex or poorly characterized samples where a specific capture sequence is not present. The membrane preconcentration approach is well suited to simple single-level etch glass chips, with no need for patterned electrodes, integrated heaters, valves, or other elements requiring more complex chip fabrication. Additionally, the ability to concentrate multiple charged analytes into a narrow zone enables a variety of assay functionalities, including enzyme-based and hybridization-based analyses.

  11. An electrophoretic mobility shift assay identifies a mechanistically unique inhibitor of protein sumoylation.

    PubMed

    Kim, Yeong Sang; Nagy, Katelyn; Keyser, Samantha; Schneekloth, John S

    2013-04-18

    The dynamic, posttranslational modification of proteins with a small ubiquitin-like modifier (SUMO) tag has been recognized as an important cellular regulatory mechanism relevant to a number of cancers as well as normal embryonic development. As part of a program aimed toward the identification of inhibitors of SUMO-conjugating enzymes, we developed a microfluidic electrophoretic mobility shift assay to monitor sumoylation events in real time. We disclose herein the use of this assay to identify a cell-permeable compound capable of blocking the transfer of SUMO-1 from the E2 enzyme Ubc9 to the substrate. We screened a small collection of compounds and identified an oxygenated flavonoid derivative that inhibits sumoylation in vitro. Next, we carried out an in-depth mechanistic analysis that ruled out many common false-positive mechanisms such as aggregation or alkylation. Furthermore, we report that this flavonoid inhibits a single step in the sumoylation cascade: the transfer of SUMO from the E2 enzyme (Ubc9) thioester conjugate to the substrate. In addition to having a unique mechanism of action, this inhibitor has a discrete structure-activity relationship uncharacteristic of a promiscuous inhibitor. Cell-based studies showed that the flavonoid inhibits the sumoylation of topoisomerase-I in response to camptothecin treatment in two different breast cancer cell lines, while isomeric analogs are inactive. Importantly, this compound blocks sumoylation while not affecting ubiquitylation in cells. This work identifies a point of entry for pharmacologic inhibition of the sumoylation cascade and may serve as the basis for continued study of additional pharmacophores that modulate SUMO-conjugating enzymes such as Ubc9. PMID:23601649

  12. Electrophoretic Transport of Single DNA Nucleotides through Nanoslits: A Molecular Dynamics Simulation Study.

    PubMed

    Xia, Kai; Novak, Brian R; Weerakoon-Ratnayake, Kumuditha M; Soper, Steven A; Nikitopoulos, Dimitris E; Moldovan, Dorel

    2015-09-01

    There is potential for flight time based DNA sequencing involving disassembly into individual nucleotides which would pass through a nanochannel with two or more detectors. We performed molecular dynamics simulations of electrophoretic motion of single DNA nucleotides through 3 nm wide hydrophobic slits with both smooth and rough walls. The electric field (E) varied from 0.0 to 0.6 V/nm. The nucleotides adsorb and desorb from walls multiple times during their transit through the slit. The nucleotide-wall interactions differed due to nucleotide hydrophobicities and wall roughness which determined duration and frequency of nucleotide adsorptions and their velocities while adsorbed. Transient association of nucleotides with one, two, or three sodium ions occurred, but the mean association numbers (ANs) were weak functions of nucleotide type. Nucleotide-wall interactions contributed more to separation of nucleotide flight time distributions than ion association and thus indicate that nucleotide-wall interactions play a defining role in successfully discriminating between nucleotides on the basis of their flight times through nanochannels/slits. With smooth walls, smaller nucleotides moved faster, but with rough walls larger nucleotides moved faster due to fewer favorable wall adsorption sites. This indicates that roughness, or surface patterning, might be exploited to achieve better time-of-flight based discrimination between nucleotides. PMID:26237155

  13. Solubilization of Minerals by Bacteria: Electrophoretic Mobility of Thiobacillus ferrooxidans in the Presence of Iron, Pyrite, and Sulfur

    PubMed Central

    Blake, Robert C.; Shute, Elizabeth A.; Howard, Gary T.

    1994-01-01

    Thiobacillus ferroxidans is an obligate acidophile that respires aerobically on pyrite, elemental sulfur, or soluble ferrous ions. The electrophoretic mobility of the bacterium was determined by laser Doppler velocimetry under physiological conditions. When grown on pyrite or ferrous ions, washed cells were negatively charged at pH 2.0. The density of the negative charge depended on whether the conjugate base was sulfate, perchlorate, chloride, or nitrate. The addition of ferric ions shifted the net charge on the surface asymptotically to a positive value. When grown on elemental sulfur, washed cells were close to their isoelectric point at pH 2.0. Both pyrite and colloidal sulfur were negatively charged under the same conditions. The electrical double layer around the bacterial cells under physiological conditions exerted minimal electrostatic repulsion in possible interactions between the cell and either of its charged insoluble substrates. When Thiobacillus ferrooxidans was mixed with either pyrite or colloidal sulfur at pH 2.0, the mobility spectra of the free components disappeared with time to be replaced with a new colloidal particle whose electrophoretic properties were intermediate between those of the starting components. This new particle had the charge and size properties anticipated for a complex between the bacterium and its insoluble substrates. The utility of such measurements for the study of the interactions of chemolithotrophic bacteria with their insoluble substrates is discussed. Images PMID:16349387

  14. Electrophoretic mobility of concentrated carbon black dispersions in a low-permittivity solvent by optical coherence tomography.

    PubMed

    Patel, Mehul N; Smith, P Griffin; Kim, Jihoon; Milner, Thomas E; Johnston, Keith P

    2010-05-15

    Electrophoretic mobilities of concentrated dispersions of carbon black particles in a low-permittivity solvent were measured using differential-phase optical coherence tomography (DP-OCT). An electrode spacing of only 0.18 mm enables measurement of highly concentrated dispersions up to 1 wt.% of highly absorbing carbon black particles with high electric fields at low potentials. The capabilities of this DP-OCT method, including high sensitivity, high spatial resolution, and strong electric fields, enable enhanced measurement of low electrophoretic mobilities encountered in low-permittivity solvents. The zeta potential of carbon black particles ranged from -24 mV to -12 mV as the concentration of surfactant sodium bis(2-ethyl-1-hexyl)sulfosuccinate (AOT) was increased from 1 mM to 100 mM. A mechanism is presented to explain the electrostatic charging of carbon black particles in terms of the partitioning of the ions between the reverse micelles in the double layer and the surfactant adsorbed on the particle surface, as AOT concentration is varied. PMID:20176365

  15. Liquid phase separation of proteins based on electrophoretic effects in an electrospray setup during sample introduction into a gas-phase electrophoretic mobility molecular analyzer (CE–GEMMA/CE–ES–DMA)

    PubMed Central

    Weiss, Victor U.; Kerul, Lukas; Kallinger, Peter; Szymanski, Wladyslaw W.; Marchetti-Deschmann, Martina; Allmaier, Günter

    2014-01-01

    Nanoparticle characterization is gaining importance in food technology, biotechnology, medicine, and pharmaceutical industry. An instrument to determine particle electrophoretic mobility (EM) diameters in the single-digit to double-digit nanometer range receiving increased attention is the gas-phase electrophoretic mobility molecular analyzer (GEMMA) separating electrophoretically single charged analytes in the gas-phase at ambient pressure. A fused-silica capillary is used for analyte transfer to the gas-phase by means of a nano electrospray (ES) unit. The potential of this capillary to separate analytes electrophoretically in the liquid phase due to different mobilities is, at measurement conditions recommended by the manufacturer, eliminated due to elevated pressure applied for sample introduction. Measurements are carried out upon constant feeding of analytes to the system. Under these conditions, aggregate formation is observed for samples including high amounts of non-volatile components or complex samples. This makes the EM determination of individual species sometimes difficult, if not impossible. With the current study we demonstrate that liquid phase electrophoretic separation of proteins (as exemplary analytes) occurs in the capillary (capillary zone electrophoresis, CE) of the nano ES unit of the GEMMA. This finding was consecutively applied for on-line desalting allowing EM diameter determination of analytes despite a high salt concentration within samples. The present study is to our knowledge the first report on the use of the GEMMA to determine EM diameters of analytes solubilized in the ES incompatible electrolyte solutions by the intended use of electrophoresis (in the liquid phase) during sample delivery. Results demonstrate the proof of concept of such an approach and additionally illustrate the high potential of a future on-line coupling of a capillary electrophoresis to a GEMMA instrument. PMID:25109866

  16. Affinity Capillary Electrophoresis for Selective Control of Electrophoretic Mobility of Sialic Acid Using Lanthanide-Hexadentate Macrocyclic Polyazacarboxylate Complexes.

    PubMed

    Goto, Daiki; Ouchi, Kazuki; Shibukawa, Masami; Saito, Shingo

    2015-01-01

    It is difficult to control the electrophoretic mobility in order to obtain high resolution among saccharides in complex samples. We report herein on a new affinity capillary electrophoresis (ACE) method for an anionic monosaccharide, N-acetylneuraminic acid (Neu5Ac), which is important in terms of pathological diagnosis, using lanthanide-hexadentate macrocyclic polyazacarboxylate complexes (Ln-NOTA) as affinity reagents. It was shown that Ln-NOTA complexes increased the anionic mobility of Neu5Ac by approximately 40% through selective complexation with Neu5Ac. The extent of change in the mobility strongly depended on the type of central metal ion of Ln-NOTA. The stability constant (K) of Lu-NOTA with Neu5Ac was determined by ACE to be log Kb = 3.62 ± 0.04, which is the highest value among artificial receptors for Neu5Ac reported so far. Using this ACE, the Neu5Ac content in a glycoprotein sample, α1-acid glycoprotein (AGP), was determined after acid hydrolysis. Complete separation between Neu5Ac and hydrolysis products was successful by controlling the mobility to determine the concentration of Neu5Ac. PMID:26561258

  17. Patterns of Molecular Variation. II. Associations of Electrophoretic Mobility and Larval Substrate within Species of the DROSOPHILA MULLERI Complex

    PubMed Central

    Richardson, R. H.; Smouse, Peter E.; Richardson, Martha E.

    1977-01-01

    Electromorphic variation among populations of Drosophila mojavensis, D. arizonensis and D. longicornis was examined for seven genetic loci. The average electrophoretic mobility for a population was used as the metric. D. mojavensis and D. arizonensis use larval substrates in different parts of their geographic ranges, while D. longicornis is more narrowly restricted to different species of the cactus Opuntia in different localities. There is marked electromorphic variation among populations of either D. mojavensis or D. arizonensis, and the bulk of this variation is accounted for by differences in laval substrate. There is somewhat less variation among populations of D. longicornis, and only a moderate portion of this is accounted for by larval substrate differences. There appears to be an association between the taxonomic diversity of the larval substrates and the electromorphic diversity of the Drosophila populations utilizing those substrates. Evidence is reviewed that suggests physiological mechanisms for these possibly adaptive associations. PMID:838268

  18. Gel electrophoretic restriction fragment length polymorphism analysis of DNA derived from individual nematodes, using the PhastSystem.

    PubMed

    Triga, D; Pamjav, H; Vellai, T; Fodor, A; Buzás, Z

    1999-06-01

    The DNA sequences constituting the internal transcribed spacer region, located between 18S and 26S rDNA genes within the rRNA operon, derived from single nematodes of two genera (Steinernema and Heterorhabditis) were amplified by polymerase chain reaction (PCR) and subjected to digestion by four restriction enzymes. The digests were analyzed by restriction fragment length polymorphism (RFLP) gel electrophoresis on the PhastSystem, using 7.5%T, 5%C(Bis) polyacrylamide. The downscaling from conventional agarose to PhastSystem gels permitted the analysis to be done on individual nematodes, rather than on mixed samples with average properties. The analysis time was reduced so as to allow for the electrophoretic separation on 200 samples/workday. The resulting patterns of DNA fragments differed from those obtained by agarose gel electrophoresis under conventional conditions by an increased number of detected fragments. The PhastSystem gel analysis provides the basis for taxonomical revisions. PMID:10380768

  19. Gel mobilities of linking-number topoisomers and their dependence on DNA helical repeat and elasticity

    PubMed Central

    Vetcher, Alexandre A.; McEwen, Abbye E.; Abujarour, Ramzey; Hanke, Andreas; Levene, Stephen D.

    2010-01-01

    Agarose-gel electrophoresis has been used for more than thirty years to characterize the linking-number (Lk) distribution of closed-circular DNA molecules. Although the physical basis of this technique remains poorly understood, the gel-electrophoretic behavior of covalently closed DNAs has been used to determine the local unwinding of DNA by proteins and small-molecule ligands, characterize supercoiling-dependent conformational transitions in duplex DNA, and to measure helical-repeat changes due to shifts in temperature and ionic strength. Those results have been analyzed by assuming that the absolute mobility of a particular topoisomer is mainly a function of the integral number of superhelical turns, and thus a slowly varying function of plasmid molecular weight. In examining the mobilities of Lk topoisomers for a series of plasmids that differ incrementally in size over more than one helical turn, we found that the size-dependent agarose-gel mobility of individual topoisomers with identical values of Lk (but different values of the excess linking number, ΔLk) vary dramatically over a duplex turn. Our results suggest that a simple semi-empirical relationship holds between the electrophoretic mobility of linking-number topoisomers and their average writhe in solution. PMID:20346570

  20. Characterization of the cell surface properties of drinking water pathogens by microbial adhesion to hydrocarbon and electrophoretic mobility measurements.

    PubMed

    Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A

    2014-06-01

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove. PMID:24815929

  1. A 502-Base Free-Solution Electrophoretic DNA Sequencing Method Using End-Attached Wormlike Micelles.

    PubMed

    Istivan, Stephen B; Bishop, Daniel K; Jones, Angela L; Grosser, Shane T; Schneider, James W

    2015-11-17

    We demonstrate that the use of wormlike nonionic micelles as drag-tags in end-labeled free-solution electrophoresis ("micelle-ELFSE") provides single-base resolution of Sanger sequencing products up to 502 bases in length, a nearly 2-fold improvement over reported ELFSE separations. "CiEj" running buffers containing 48 mM C12E5, 6 mM C10E5, and 3 M urea (32.5 °C) form wormlike micelles that provide a drag equivalent to an uncharged DNA fragment with a length (α) of 509 bases (effective Rh = 27 nm). Runtime in a 40 cm capillary (30 kV) was 35 min for elution of all products down to the 26-base primer. We also show that smaller Triton X-100 micelles give a read length of 103 bases in a 4 min run, so that a combined analysis of the Sanger products using the two buffers in separate capillaries could be completed in 14 min for the full range of lengths. A van Deemter analysis shows that resolution is limited by diffusion-based peak broadening and wall adsorption. Effects of drag-tag polydispersity are not observed, despite the inherent polydispersity of the wormlike micelles. We ascribe this to a stochastic size-sampling process that occurs as micelle size fluctuates rapidly during the runtime. A theoretical model of the process suggests that fluctuations occur with a time scale less than 10 ms, consistent with the monomer exchange process in nonionic micelles. The CiEj buffer has a low viscosity (2.7 cP) and appears to be semidilute in micelle concentration. The large drag-tag size of the CiEj buffers leads to steric segregation of the DNA and tag for short fragments and attendant mobility shifts. PMID:26455271

  2. Determination of electrophoretic mobilities and hydrodynamic radii of three humic substances as a function of pH and ionic strength.

    PubMed

    Hosse, M; Wilkinson, K J

    2001-11-01

    Capillary electrophoresis (CE) and fluorescence correlation spectroscopy (FCS) were employed to determine electrophoretic mobilities and hydrodynamic sizes of three humic substances (IHSS aquatic fulvic acid (FA), IHSS aquatic humic acid (HA), and IHSS peat humic acid (PHA)) as a function of pH and ionic strength. A slight aggregation corresponding to the formation of dimers and trimers was observed at low pH using fluorescence correlation spectroscopy (FCS). For example, for the peat humic acid, diffusion coefficients decreased from 2.1 x 10(-10) m2 s(-1) at pH 4 to 2.4 x 10(-10) m2 s(-1) at pH 11. For all three humic substances, electrophoretic mobilities were also shown to decrease significantly below pH 6. Calculated zeta potentials observed at high pH of -69 mV (FA), -62 mV (HA), and -63 mV (PHA) decreased to -39, -50, and -47 mV, respectively, under slightly acidic pH (4.5-4.8) conditions. No evidence of ionic strength induced aggregation was found using fluorescence correlation spectroscopy (FCS); diffusion coefficients increased slightly (<25%) with increasing ionic strength (up to 1 M). Negative electrophoretic mobilities decreased to a maximum measured ionic strength of 0.18 M. Above this ionic strength, no peaks were observed due to an increased HS adsorption to the capillary wall and an important decrease in electroosmotic flow. Interpretation of electrophoretic mobilities determined by CE is complicated by the fact that under certain conditions, HS appeared to be complexed by CE buffer systems, including MES, BES, and AMPSO. PMID:11718346

  3. Understanding the poor iontophoretic transport of lysozyme across the skin: when high charge and high electrophoretic mobility are not enough.

    PubMed

    Dubey, S; Kalia, Y N

    2014-06-10

    The original aim of the study was to investigate the transdermal iontophoretic delivery of lysozyme and to gain further insight into the factors controlling protein electrotransport. Initial experiments were done using porcine skin. Lysozyme transport was quantified by using an activity assay based on the lysis of Micrococcus lysodeikticus and was corrected for the release of endogenous enzyme from the skin during current application. Cumulative iontophoretic permeation of lysozyme during 8h at 0.5mA/cm(2) (0.7mM; pH6) was surprisingly low (5.37±3.46μg/cm(2) in 8h) as compared to electrotransport of cytochrome c (Cyt c) and ribonuclease A (RNase A) under similar conditions (923.0±496.1 and 170.71±92.13μg/cm(2), respectively) - despite its having a higher electrophoretic mobility. The focus of the study then became to understand and explain the causes of its poor iontophoretic transport. Lowering formulation pH to 5 increased histidine protonation in the protein and decreased the ionisation of fixed negative charges in the skin (pI ~4.5) and resulted in a small but statistically significant increase in permeation. Co-iontophoresis of acetaminophen revealed a significant inhibition of electroosmosis; inhibition factors of 12-16 were indicative of strong lysozyme binding to skin. Intriguingly, lidocaine electrotransport, which is due almost exclusively to electromigration, was also decreased (approximately 2.7-fold) following skin pre-treatment by lysozyme iontophoresis (cf. iontophoresis of buffer solution) - suggesting that lysozyme was also able to influence subsequent cation electromigration. In order to elucidate the site of skin binding, different porcine skin models were tested (dermatomed skin with thicknesses of 250 and 750μm, tape-stripped skin and heat-separated dermis). Although no difference was seen between permeation across 250 and 750μm dermatomed skin (13.57±12.20 and 5.37±3.46μg/cm(2), respectively), there was a statistically significant

  4. Alpha chain hemoglobins with electrophoretic mobility similar to that of hemoglobin S in a newborn screening program

    PubMed Central

    Silva, Marcilene Rezende; Sendin, Shimene Mascarenhas; Araujo, Isabela Couto de Oliveira; Pimentel, Fernanda Silva; Viana, Marcos Borato

    2013-01-01

    Objective To characterize alpha-chain variant hemoglobins with electric mobility similar to that of hemoglobin S in a newborn screening program. Methods βS allele and alpha-thalassemia deletions were investigated in 14 children who had undefined hemoglobin at birth and an electrophoretic profile similar to that of hemoglobin S when they were six months old. Gene sequencing and restriction enzymes (DdeI, BsaJI, NlaIV, Bsu36I and TaqI) were used to identify hemoglobins. Clinical and hematological data were obtained from children who attended scheduled medical visits. Results The following alpha chain variants were found: seven children with hemoglobin Hasharon [alpha2 47(CE5) Asp>His, HbA2:c.142G>C], all associated with alpha-thalassemia, five with hemoglobin Ottawa [alpha1 15(A13) Gly>Arg, HBA1:c.46G>C], one with hemoglobin St Luke's [alpha1 95(G2) Pro>Arg, HBA1:c.287C>G] and another one with hemoglobin Etobicoke [alpha212 84(F5) Ser>Arg, HBA212:c.255C>G]. Two associations with hemoglobin S were found: one with hemoglobin Ottawa and one with hemoglobin St Luke's. The mutation underlying hemoglobin Etobicoke was located in a hybrid α212 allele in one child. There was no evidence of clinically relevant hemoglobins detected in this study. Conclusion Apparently these are the first cases of hemoglobin Ottawa, St Luke's, Etobicoke and the α212 gene described in Brazil. The hemoglobins detected in this study may lead to false diagnosis of sickle cell trait or sickle cell disease when only isoelectric focusing is used in neonatal screening. Additional tests are necessary for the correct identification of hemoglobin variants. PMID:23741188

  5. Capillary electrophoretic separation of DNA restriction fragments using dilute polymer solutions

    SciTech Connect

    Braun, B.; Blanch, W.; Prausnitz, J.M.

    1997-02-01

    Because the mechanism of DNA separation in capillary electrophoresis is not well understood, selection of polymers is a {open_quotes}trial-and-error{close_quotes} procedure. We investigated dilute-solution DNA separations by capillary electrophoresis using solutions of four polymers that differ in size, shape and stiffness. Hydroxyethylcellulose of high molecular weight provides excellent separation of large DNA fragments (2027 bp - 23130 bp). Polyvinylpyrrolidone separates DNA from 72 bp to 23 kbp and star-(polyethylene oxide), like linear poly (ethylene oxide), provides separation of fragments up to 1353 bp.

  6. Simulation guided design of a microfluidic device for electrophoretic stretching of DNA.

    PubMed

    Hsieh, Chih-Chen; Lin, Tsung-Hsien; Huang, Chiou-De

    2012-01-01

    We have used Brownian dynamics-finite element method (BD-FEM) to guide the optimization of a microfluidic device designed to stretch DNA for gene mapping. The original design was proposed in our previous study [C. C. Hsieh and T. H. Lin, Biomicrofluidics 5(4), 044106 (2011)] for demonstrating a new pre-conditioning strategy to facilitate DNA stretching through a microcontraction using electrophoresis. In this study, we examine the efficiency of the original device for stretching DNA with different sizes ranging from 48.5 kbp (λ-DNA) to 166 kbp (T4-DNA). The efficiency of the device is found to deteriorate with increasing DNA molecular weight. The cause of the efficiency loss is determined by BD-FEM, and a modified design is proposed by drawing an analogy between an electric field and a potential flow. The modified device does not only regain the efficiency for stretching large DNA but also outperforms the original device for stretching small DNA. PMID:24155866

  7. DNA Electrophoretic Migration Patterns Change after Exposure of Jurkat Cells to a Single Intense Nanosecond Electric Pulse

    PubMed Central

    Romeo, Stefania; Zeni, Luigi; Sarti, Maurizio; Sannino, Anna; Scarfì, Maria Rosaria; Vernier, P. Thomas; Zeni, Olga

    2011-01-01

    Intense nanosecond pulsed electric fields (nsPEFs) interact with cellular membranes and intracellular structures. Investigating how cells respond to nanosecond pulses is essential for a) development of biomedical applications of nsPEFs, including cancer therapy, and b) better understanding of the mechanisms underlying such bioelectrical effects. In this work, we explored relatively mild exposure conditions to provide insight into weak, reversible effects, laying a foundation for a better understanding of the interaction mechanisms and kinetics underlying nsPEF bio-effects. In particular, we report changes in the nucleus of Jurkat cells (human lymphoblastoid T cells) exposed to single pulses of 60 ns duration and 1.0, 1.5 and 2.5 MV/m amplitudes, which do not affect cell growth and viability. A dose-dependent reduction in alkaline comet-assayed DNA migration is observed immediately after nsPEF exposure, accompanied by permeabilization of the plasma membrane (YO-PRO-1 uptake). Comet assay profiles return to normal within 60 minutes after pulse delivery at the highest pulse amplitude tested, indicating that our exposure protocol affects the nucleus, modifying DNA electrophoretic migration patterns. PMID:22164287

  8. Sequence Dependent Electrophoretic Separations of DNA in Pluronic F127 Gels

    NASA Astrophysics Data System (ADS)

    You, Seungyong; van Winkle, David H.

    2010-03-01

    Two-dimensional (2-D) electrophoresis has successfully been used to visualize the separation of DNA fragments of the same length. We electrophorese a double-stranded DNA ladder in an Agarose gel for the first dimension and in gels of Pluronic F127 for the second dimension at room temperature. The 1000 bp band that travels together as a single band in an Agarose gel is split into two bands in Pluronic gels. The slower band follows the exponential decay trend that the other ladder constituents do. After sequencing the DNA fragments, the faster band has an apparently random sequence, while the slower band and the others have two A-tracts in each 250 bp segment. The A-tracts consist of a series of at least five adenine bases pairing with thymine bases. This result leads to the conclusion that the migration of the DNA molecules bent with A-tracts is more retarded in Pluronic gels than the wild-type of DNA molecules.

  9. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOEpatents

    Karger, B.L.; Thilly, W.G.; Foret, F.; Khrapko, K.; Koehavong, P.; Cohen, A.S.; Giese, R.W.

    1997-05-27

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability. 18 figs.

  10. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOEpatents

    Karger, Barry L.; Thilly, William G.; Foret, Frantisek; Khrapko, Konstaintin; Koehavong, Phouthone; Cohen, Aharon S.; Giese, Roger W.

    1997-01-01

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability.

  11. Impact of chemical and structural anisotropy on the electrophoretic mobility of spherical soft multilayer particles: the case of bacteriophage MS2.

    PubMed

    Langlet, Jérémie; Gaboriaud, Fabien; Gantzer, Christophe; Duval, Jérôme F L

    2008-04-15

    We report a theoretical investigation of the electrohydrodynamic properties of spherical soft particles composed of permeable concentric layers that differ in thickness, soft material density, chemical composition, and flow penetration degree. Starting from a recent numerical scheme developed for the computation of the direct-current electrophoretic mobility (mu) of diffuse soft bioparticles, the dependence of mu on the electrolyte concentration and solution pH is evaluated taking the known three-layered structure of bacteriophage MS2 as a supporting model system (bulk RNA, RNA-protein bound layer, and coat protein). The electrokinetic results are discussed for various layer thicknesses, hydrodynamic flow penetration degrees, and chemical compositions, and are discussed on the basis of the equilibrium electrostatic potential and hydrodynamic flow field profiles that develop within and around the structured particle. This study allows for identifying the cases where the electrophoretic mobility is a function of the inner structural and chemical specificity of the particle and not only of its outer surface properties. Along these lines, we demonstrate the general inapplicability of the notions of zeta potential (zeta) and surface charge for quantitatively interpreting electrokinetic data collected for such systems. We further shed some light on the physical meaning of the isoelectric point. In particular, numerical and analytical simulations performed on structured soft layers in indifferent electrolytic solution demonstrate that the isoelectric point is a complex ionic strength-dependent signature of the flow permeation properties and of the chemical and structural details of the particle. Finally, the electrophoretic mobilities of the MS2 virus measured at various ionic strength levels and pH values are interpreted on the basis of the theoretical formalism aforementioned. It is shown that the electrokinetic features of MS2 are to a large extent determined not only

  12. Impact of Chemical and Structural Anisotropy on the Electrophoretic Mobility of Spherical Soft Multilayer Particles: The Case of Bacteriophage MS2

    PubMed Central

    Langlet, Jérémie; Gaboriaud, Fabien; Gantzer, Christophe; Duval, Jérôme F. L.

    2008-01-01

    We report a theoretical investigation of the electrohydrodynamic properties of spherical soft particles composed of permeable concentric layers that differ in thickness, soft material density, chemical composition, and flow penetration degree. Starting from a recent numerical scheme developed for the computation of the direct-current electrophoretic mobility (μ) of diffuse soft bioparticles, the dependence of μ on the electrolyte concentration and solution pH is evaluated taking the known three-layered structure of bacteriophage MS2 as a supporting model system (bulk RNA, RNA-protein bound layer, and coat protein). The electrokinetic results are discussed for various layer thicknesses, hydrodynamic flow penetration degrees, and chemical compositions, and are discussed on the basis of the equilibrium electrostatic potential and hydrodynamic flow field profiles that develop within and around the structured particle. This study allows for identifying the cases where the electrophoretic mobility is a function of the inner structural and chemical specificity of the particle and not only of its outer surface properties. Along these lines, we demonstrate the general inapplicability of the notions of zeta potential (ζ) and surface charge for quantitatively interpreting electrokinetic data collected for such systems. We further shed some light on the physical meaning of the isoelectric point. In particular, numerical and analytical simulations performed on structured soft layers in indifferent electrolytic solution demonstrate that the isoelectric point is a complex ionic strength-dependent signature of the flow permeation properties and of the chemical and structural details of the particle. Finally, the electrophoretic mobilities of the MS2 virus measured at various ionic strength levels and pH values are interpreted on the basis of the theoretical formalism aforementioned. It is shown that the electrokinetic features of MS2 are to a large extent determined not only by

  13. Anti-epileptic drugs and bone loss: Phenytoin reduces pro-collagen I and alters the electrophoretic mobility of osteonectin in cultured bone cells.

    PubMed

    Wilson, Emma L; Garton, Mark; Fuller, Heidi R

    2016-05-01

    Phenytoin is an antiepileptic drug used in the management of partial and tonic-clonic seizures. In previous studies we have shown that valproate, another antiepileptic drug, reduced the amount of two key bone proteins, pro-collagen I and osteonectin (SPARC, BM-40), in both skin fibroblasts and cultured osteoblast-like cells. Here we show that phenytoin also reduces pro-collagen I production in osteoblast-like cells, but does not appear to cause a decrease in osteonectin message or protein production. Instead, a 24h exposure to a clinically relevant concentration of phenytoin resulted in a dose-dependent change in electrophoretic mobility of osteonectin, which was suggestive of a change in post-translational modification status. The perturbation of these important bone proteins could be one of the mechanisms to explain the bone loss that has been reported following long-term treatment with phenytoin. PMID:26999801

  14. A simple method for assessment and minimization of errors in determination of electrophoretic or electroosmotic mobilities and velocities associated with the axial electric field distortion.

    PubMed

    Nowak, Paweł Mateusz; Woźniakiewicz, Michał; Kościelniak, Paweł

    2015-12-01

    It is commonly accepted that the modern CE instruments equipped with efficient cooling system enable accurate determination of electrophoretic or electroosmotic mobilities. It is also often assumed that velocity of migration in a given buffer is constant throughout the capillary length. It is simultaneously neglected that the noncooled parts of capillary produce extensive Joule heating leading to an axial electric field distortion, which contributes to a difference between the effective and nominal electric field potentials and between velocities in the cooled and noncooled parts of capillary. This simplification introduces systematic errors, which so far were however not investigated experimentally. There was also no method proposed for their elimination. We show a simple and fast method allowing for estimation and elimination of these errors that is based on combination of a long-end and short-end injections. We use it to study the effects caused by variation of temperature, electric field, capillary length, and pH. PMID:26383237

  15. Measurement of Electrophoretic Mobility of Human Promyelocytic Leukemia Cell Lines (HL60) During Neutrophil Differentiation Using On-Chip Cell Electrophoresis

    NASA Astrophysics Data System (ADS)

    Matsuhashi, Ryutaro; Akagi, Takanori; Ichiki, Takanori

    Electrophoretic mobility (EPM) of human promyelocytic leukemia cell lines (HL60) during neutrophil differentiation induced by all-trans retinoic acid (ATRA) or dimethyl sulfoxide (DMSO) was measured using microcapillary electrophoresis chips. Prior to EPM measurement of HL60 cells, neutrophil differentiation of the cells was confirmed by morphological classification. Subsequently, EPM of HL60 cells was measured using an on-chip cell electrophoresis system before and after neutrophil differentiation. The EPM changed gradually with the progress of the neutrophil differentiation. From the analysis of experimental data by principal component analysis, it was revealed that there is a strong correlation between morphologic classification and EPM during the neutrophilic differentiation. The present result suggests that on-chip EPM measurement system can be used as a monitoring tool for the cell differentiation.

  16. Comprehensive size-determination of whole virus vaccine particles using gas-phase electrophoretic mobility macromolecular analyzer, atomic force microscopy, and transmission electron microscopy.

    PubMed

    Havlik, Marlene; Marchetti-Deschmann, Martina; Friedbacher, Gernot; Winkler, Wolfgang; Messner, Paul; Perez-Burgos, Laura; Tauer, Christa; Allmaier, Günter

    2015-09-01

    Biophysical properties including particle size distribution, integrity, and shape of whole virus vaccine particles at different stages in tick-borne encephalitis (TBE) vaccines formulation were analyzed by a new set of methods. Size-exclusion chromatography (SEC) was used as a conservative sample preparation for vaccine particle fractionation and gas-phase electrophoretic mobility macromolecular analyzer (GEMMA) for analyzing electrophoretic mobility diameters of isolated TBE virions. The derived particle diameter was then correlated with molecular weight. The diameter of the TBE virions determined after SEC by GEMMA instrumentation was 46.8 ± 1.1 nm. Atomic force microscopy (AFM) and transmission electron microscopy (TEM) were implemented for comparison purposes and to gain morphological information on the virion particle. Western blotting (Dot Blot) as an immunological method confirmed biological activity of the particles at various stages of the developed analytical strategy. AFM and TEM measurements revealed higher diameters with much higher SD for a limited number of virions, 60.4 ± 8.5 and 53.5 ± 5.3 nm, respectively. GEMMA instrumentation was also used for fractionation of virions with specifically selected diameters in the gas-phase, which were finally collected by means of an electrostatic sampler. At that point (i.e., after particle collection), AFM and TEM showed that the sampled virions were still intact, exhibiting a narrow size distribution (i.e., 59.8 ± 7.8 nm for AFM and 47.5 ± 5.2 nm for TEM images), and most importantly, dot blotting confirmed immunological activity of the collected samples. Furthermore dimers and virion artifacts were detected, too. PMID:26266988

  17. Analysis of a Common Cold Virus and Its Subviral Particles by Gas-Phase Electrophoretic Mobility Molecular Analysis and Native Mass Spectrometry

    PubMed Central

    2015-01-01

    Gas-phase electrophoretic mobility molecular analysis (GEMMA) separates nanometer-sized, single-charged particles according to their electrophoretic mobility (EM) diameter after transition to the gas-phase via a nano electrospray process. Electrospraying as a soft desorption/ionization technique preserves noncovalent biospecific interactions. GEMMA is therefore well suited for the analysis of intact viruses and subviral particles targeting questions related to particle size, bioaffinity, and purity of preparations. By correlating the EM diameter to the molecular mass (Mr) of standards, the Mr of analytes can be determined. Here, we demonstrate (i) the use of GEMMA in purity assessment of a preparation of a common cold virus (human rhinovirus serotype 2, HRV-A2) and (ii) the analysis of subviral HRV-A2 particles derived from such a preparation. (iii) Likewise, native mass spectrometry was employed to obtain spectra of intact HRV-A2 virions and empty viral capsids (B-particles). Charge state resolution for the latter allowed its Mr determination. (iv) Cumulatively, the data measured and published earlier were used to establish a correlation between the Mr and EM diameter for a range of globular proteins and the intact virions. Although a good correlation resulted from this analysis, we noticed a discrepancy especially for the empty and subviral particles. This demonstrates the influence of genome encapsulation (preventing analytes from shrinking upon transition into the gas-phase) on the measured analyte EM diameter. To conclude, GEMMA is useful for the determination of the Mr of intact viruses but needs to be employed with caution when subviral particles or even empty viral capsids are targeted. The latter could be analyzed by native MS. PMID:26221912

  18. Comprehensive Size-Determination of Whole Virus Vaccine Particles Using Gas-Phase Electrophoretic Mobility Macromolecular Analyzer, Atomic Force Microscopy, and Transmission Electron Microscopy

    PubMed Central

    Havlik, Marlene; Marchetti-Deschmann, Martina; Friedbacher, Gernot; Winkler, Wolfgang; Messner, Paul; Perez-Burgos, Laura; Tauer, Christa; Allmaier, Günter

    2015-01-01

    Biophysical properties including particle size distribution, integrity, and shape of whole virus vaccine particles at different stages in tick-borne encephalitis (TBE) vaccines formulation were analyzed by a new set of methods. Size-exclusion chromatography (SEC) was used as a conservative sample preparation for vaccine particle fractionation and gas-phase electrophoretic mobility macromolecular analyzer (GEMMA) for analyzing electrophoretic mobility diameters of isolated TBE virions. The derived particle diameter was then correlated with molecular weight. The diameter of the TBE virions determined after SEC by GEMMA instrumentation was 46.8 ± 1.1 nm. Atomic force microscopy (AFM) and transmission electron microscopy (TEM) were implemented for comparison purposes and to gain morphological information on the virion particle. Western blotting (Dot Blot) as an immunological method confirmed biological activity of the particles at various stages of the developed analytical strategy. AFM and TEM measurements revealed higher diameters with much higher SD for a limited number of virions, 60.4 ± 8.5 and 53.5 ± 5.3 nm, respectively. GEMMA instrumentation was also used for fractionation of virions with specifically selected diameters in the gas-phase, which were finally collected by means of an electrostatic sampler. At that point (i.e., after particle collection), AFM and TEM showed that the sampled virions were still intact, exhibiting a narrow size distribution (i.e., 59.8 ± 7.8 nm for AFM and 47.5 ± 5.2 nm for TEM images), and most importantly, dot blotting confirmed immunological activity of the collected samples. Furthermore dimers and virion artifacts were detected, too. PMID:26266988

  19. Electrophoretic cell separation by means of microspheres

    NASA Technical Reports Server (NTRS)

    Smolka, A. J. K.; Nerren, B. H.; Margel, S.; Rembaum, A.

    1979-01-01

    The electrophoretic mobility of fixed human erythrocytes immunologically labeled with poly(vinylpyridine) or poly(glutaraldehyde) microspheres was reduced by approximately 40%. This observation was utilized in preparative scale electrophoretic separations of fixed human and turkey erythrocytes, the mobilities of which under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. We suggest that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immunospecific labeling of target populations using microspheres.

  20. Electrophoretic transport of biomolecules across liquid-liquid interfaces.

    PubMed

    Hahn, Thomas; Münchow, Götz; Hardt, Steffen

    2011-05-11

    The mass transfer resistance of a liquid-liquid interface in an aqueous two-phase system composed of poly(ethylene glycol) and dextran is investigated. Different types of proteins and DNA stained with fluorescent dyes serve as probes to study the transport processes close to the interface. A microfluidic device is employed to enable the electrophoretic transport of biomolecules from one phase to another. The results obtained for proteins can be explained solely via the different electrophoretic mobilities and different affinities of the molecules to the two phases, without any indications of a significant mass transfer resistance of the liquid-liquid interface. By contrast, DNA molecules adsorb to the interface and only desorb under an increased electric field strength. The desorption process carries the signature of a thermally activated escape from a metastable state, as reflected in the exponential decay of the fluorescence intensity at the interface as a function of time. PMID:21508474

  1. Assessment of DNA-binding affinity of cholinesterase reactivators and electrophoretic determination of their effect on topoisomerase I and II activity.

    PubMed

    Janockova, J; Zilecka, E; Kasparkova, J; Brabec, V; Soukup, O; Kuca, K; Kozurkova, M

    2016-08-16

    In this paper, we describe the biochemical properties and biological activity of a series of cholinesterase reactivators (symmetrical bisquaternary xylene-linked compounds, K106-K114) with ctDNA. The interaction of the studied derivatives with ctDNA was investigated using UV-Vis, fluorescence, CD and LD spectrometry, and electrophoretic and viscometric methods. The binding constants K were estimated to be in the range 1.05 × 10(5)-5.14 × 10(6) M(-1) and the percentage of hypochromism was found to be 10.64-19.28% (from UV-Vis titration). The used methods indicate that the studied samples are groove binders. Electrophoretic methods proved that the studied compounds clearly influence calf thymus Topo I (at 5 μM concentration, except for compounds K107, K111 and K114 which were effective at higher concentrations) and human Topo II (K110 partially inhibited Topo II effects even at 5 μM concentration) activity. PMID:27412811

  2. Fluctuations of DNA mobility in nanofluidic entropic traps

    PubMed Central

    Wu, Lingling; Levy, Stephen

    2014-01-01

    We studied the mobility of DNA molecules driven by an electric field through a nanofluidic device containing a periodic array of deep and shallow regions termed entropic traps. The mobility of a group of DNA molecules was measured by fluorescent video microscopy. Since the depth of a shallow region is smaller than the DNA equilibrium size, DNA molecules are trapped for a characteristic time and must compress themselves to traverse the boundary between deep and shallow regions. Consistent with previous experimental results, we observed a nonlinear relationship between the mobility and electric field strength, and that longer DNA molecules have larger mobility. In repeated measurements under seemingly identical conditions, we measured fluctuations in the mobility significantly larger than expected from statistical variation. The variation was more pronounced for lower electric field strengths where the trapping time is considerable relative to the drift time. To determine the origin of these fluctuations, we investigated the dependence of the mobility on several variables: DNA concentration, ionic strength of the solvent, fluorescent dye staining ratio, electroosmotic flow, and electric field strength. The mobility fluctuations were moderately enhanced in conditions of reduced ionic strength and electroosmotic flow. PMID:25379088

  3. An integrated electrophoretic mobility control device with split design for signal improvement in liquid chromatography-electrospray ionization mass spectrometry analysis of aminoglycosides using a heptafluorobutyric acid containing mobile phase.

    PubMed

    Hung, Sih-Hua; Yu, Meng-Ju; Wang, Nan-Hsuan; Hsu, Ren-Yu; Wei, Guor-Jien; Her, Guor-Rong

    2016-08-24

    Electrophoretic mobility control (EMC) was used to alleviate the adverse effect of the ion-pairing agent heptafluorobutyric acid (HFBA) in the liquid chromatography-electrospray ionization mass spectrometry (LC-ESI-MS) analysis of aminoglycosides. Aminoglycosides separated by LC were directed to a connecting column before their detection via ESI. Applying an electric field across the connecting column caused the positively charged aminoglycosides to migrate toward the mass spectrometer whereas the HFBA anions remained in the junction reservoir, thus alleviating the ion suppression caused by HFBA. To accommodate the flow rate of a narrow-bore column, minimize the effect of electrophoretic mobility on separation, and facilitate the operation, an integrated EMC device with a split design was fabricated. With the proposed EMC device, the signals of aminoglycosides were enhanced by a factor of 5-85 without affecting the separation efficiency or elution order. For the analysis of aminoglycosides in bovine milk, the proposed approach demonstrates a sensitivity that is at least 10 times below the maximum residue limits set by most countries. PMID:27497008

  4. Mobile DNA can drive lineage extinction in prokaryotic populations.

    PubMed

    Rankin, D J; Bichsel, M; Wagner, A

    2010-11-01

    Natural selection ultimately acts on genes and other DNA sequences. Adaptations that are good for the gene can have adverse effects at higher levels of organization, including the individual or the population. Mobile genetic elements illustrate this principle well, because they can self-replicate within a genome at a cost to their host. As they are costly and can be transmitted horizontally, mobile elements can be seen as genomic parasites. It has been suggested that mobile elements may cause the extinction of their host populations. In organisms with very large populations, such as most bacteria, individual selection is highly effective in purging genomes of deleterious elements, suggesting that extinction is unlikely. Here we investigate the conditions under which mobile DNA can drive bacterial lineages to extinction. We use a range of epidemiological and ecological models to show that harmful mobile DNA can invade, and drive populations to extinction, provided their transmission rate is high and that mobile element-induced mortality is not too high. Population extinction becomes more likely when there are more elements in the population. Even if elements are costly, extinction can still occur because of the combined effect of horizontal gene transfer, a mortality induced by mobile elements. Our study highlights the potential of mobile DNA to be selected at the population level, as well as at the individual level. PMID:20860700

  5. The pH dependence of predictive models relating electrophoretic mobility to peptide chemico-physical properties in capillary zone electrophoresis.

    PubMed

    Castagnola, M; Rossetti, D V; Corda, M; Pellegrini, M; Misiti, F; Olianas, A; Giardina, B; Messana, I

    1998-10-01

    We applied best fitting procedures to capillary electrophoresis (CE) mobility values, measured at varying acidic pH, of a set of 21 peptides with a molecular mass ranging from about 350 to 1850 Da. This method allowed the contemporary measurements of C-terminus and carboxylic group of the side-chain of aspartic and glutamic acid dissociation constants and of peptide Stokes radius at different protonation stages. Stokes radius was related to peptide molecular mass M at the power of a fractional coefficient, and best correlation was found at pH 2.25, the fractional coefficient being equal to 0.68. This value is close to that proposed by R. E. Offord (Nature 1966, 211, 591-593), who suggested a proportionality between the polymer Stokes radius and M(2/3). The coefficient value decreases at higher pH, reaching a value of 0.58 at pH 4.25, corresponding to a mean peptide conformational transition towards more compact structures as a consequence of C-terminus dissociation. The measurement of the dissociation constants of each peptide allowed us to determine the percentage error on peptide charge predictions performed utilizing mean dissociation constants. Even for the charge, the best predictive performance is obtained at the most acidic edge of the range of the pH studied, mainly at pH 2.25. Conclusively, this study shows that the best performance of predictive models for peptide CE mobility is obtainable in the very acidic pH range (2.25-2.50) and in the absence of electroosmotic flow, and that a satisfactory predictive equation of peptide electrophoretic mobility (m2V(-1)s(-1) is given by mu = 85.4(Z/M(0.68))10(-8). PMID:9788308

  6. Relatedness Analyses of Histoplasma capsulatum Isolates from Mexican Patients with AIDS-Associated Histoplasmosis by Using Histoplasmin Electrophoretic Profiles and Randomly Amplified Polymorphic DNA Patterns

    PubMed Central

    Reyes-Montes, M. R.; Bobadilla-Del Valle, M.; Martínez-Rivera, M. A.; Rodríguez-Arellanes, G.; Maravilla, E.; Sifuentes-Osornio, J.; Taylor, M. L.

    1999-01-01

    The present paper analyzes the histoplasmin electrophoretic profiles and the randomly amplified polymorphic DNA (RAPD) patterns of the fungus Histoplasma capsulatum isolated from Mexican patients with AIDS-associated histoplasmosis. Clinical isolates from Guatemala, Colombia, and Panama, as well as H. capsulatum isolates from different sources in nature, were also processed. All histoplasmin samples shared four antigenic fractions of 200, 49, 10.5, and 8.5 kDa in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). According to their percentage of relatedness, based on SDS-PAGE histoplasmin electrophoretic image analysis, H. capsulatum isolates were divided in two groups: group A contained all AIDS-associated isolates studied and two human reference strains from Mexican histoplasmosis patients without AIDS; group B included bat guano, infected bat, and cock excreta isolates from the State of Guerrero, Mexico, plus three human histoplasmosis strains from Guatemala, Panama, and Colombia. Polymorphic DNA patterns evaluated by RAPD-PCR showed three major bands of 4.4, 3.2, and 2.3 kb in most H. capsulatum isolates studied. Four groups were related by DNA polymorphisms: group I was formed by most of the AIDS-associated H. capsulatum isolates studied, one human histoplasmosis strain from Colombia, two human reference strains from Mexican patients without AIDS, and one human histoplasmosis strain from Guatemala. Group II consisted of only a single strain from Panama. Group III included three strains: one from a Mexican patient with AIDS and two isolated from nature in Guerrero (cock excreta and bat guano). The last, group IV, consisted of only one strain isolated from an infected bat, captured in Guerrero. A tight relationship between phenotypic and genotypic characterization was observed, and both analyses could be useful tools for typing H. capsulatum from different sources and geographic origins. PMID:10203495

  7. Carrier mobility characterization of DNA-surfactant complexes

    NASA Astrophysics Data System (ADS)

    Lin, Ting-Yu; Hung, Yu-Chueh

    2012-02-01

    Deoxyribonucleic acid (DNA) biopolymer has been emerging as a promising material for photonic applications. As many optoelectronic devices rely on carrier transportation to achieve desired functionality, carrier mobility is important for the exploitation of these biopolymer-based materials for practical implementation. In this study, we present the mobility measurement by employing time-of-flight technique and characterize the current-voltage (I-V) properties based on DNA-surfactant complexes. An additional NPB layer was introduced in the fabricated structure to serve as a charge generation layer (CGL). The dependency of hole mobility with respect to the applied electric field was characterized and a linear correlation was exhibited. Hole transport was found to be dispersive, indicating a high degree energetic disorder in these DNA-surfactant complexes. The characterization results show promises for the employment of DNA complexes in the applications of organic light-emitting devices and organic field-effect transistors.

  8. Mobility of Electron in DNA Crystals by Laser Radiation

    NASA Technical Reports Server (NTRS)

    Zhang, Kaixi; Zhao, Qingxun; Cui, Zhiyun; Zhang, Ping; Dong, Lifang

    1996-01-01

    The mobility of electrons in laser radiated DNA is closed to the energy transfer and energy migration of a biological molecule. Arrhenius has studied the conductivity of the electrons in a biological molecule. But his result is far from the experimental result and meanwhile the relation between some parameters in his theory and the micro-quantities in DNA is not very clear. In this paper, we propose a new phonon model of electron mobility in DNA and use Lippman-Schwinger equation and S-matrix theory to study the mobility of electrons in DNA crystal. The result is relatively close to the experiment result and some parameters in Arrhenius theory are explained in our work.

  9. Electrophoretic Focusing

    NASA Technical Reports Server (NTRS)

    Snyder, Robert S.

    2001-01-01

    Electrophoretic focusing is a new method of continuous flow electrophoresis that introduces precision flow control to achieve high resolution separations. The electric field is applied perpendicular to an incoming sample lamina and buffer but also perpendicular to the broad faces of the thin rectangular chamber. A uniform fluid cross-flow then enters and exits the separation chamber through the same broad faces which are porous. A balance is achieved by adjusting either the electric field or the cross-flow so the desired sample fraction with its specific migration velocity encounters an opposing flow of the same velocity. Applying an electric field transverse to the incoming sample lamina and opposing this field with a carefully configured buffer flow, a sample constituent can be selected and focused into a narrow stream for subsequent analysis. Monotonically changing either electric field or buffer cross-flow will yield a scan of all constituents of the sample. Stopping the scan increases the collection time for minor constituents to improve their analysis. Using the high voltage gradients and/or cross-flow to rapidly deflect extraneous sample through the porous screens and into either of the side (purge) chambers, the selected sample is focused in the center plane of the separation chamber and collected without contact or interaction with the separation chamber walls. Results will be presented on the separation of a range of materials including dyes, proteins, and monodisperse polystyrene latexes. Sources of sample dispersion inherent in other electrokinetic techniques will be shown to be negligible for a variety of sample concentrations, buffer properties and operating conditions.

  10. Identification and secondary structure analysis of a region affecting electrophoretic mobility of the STR locus SE33.

    PubMed

    Wang, Dennis Y; Green, Robert L; Lagacé, Robert E; Oldroyd, Nicola J; Hennessy, Lori K; Mulero, Julio J

    2012-05-01

    SE33 is one of the most informative markers in forensic use due to its high power of discrimination. During the course of developing the AmpFℓSTR(®) NGM SElect™ PCR Amplification Kit several SE33 primer designs were screened with one primer pair yielding a high frequency of discordant alleles when compared to the AmpFℓSTR(®) SEfiler Plus™ PCR Amplification Kit. This discordance was mostly specific to samples of African descent with an estimated frequency of 5.1% and was a result of a mobility shift of approximately +0.84nt. The sequence analysis of the affected alleles revealed that the only difference from the wild type sequence was a single nucleotide polymorphism (SNP) outside of the SE33 repeat but within the amplicon of this particular set of experimental primers. In total, we identified three different SNPs all within 9nt of each other, each of which could cause the mobility shift individually. Further characterization of this region via site directed mutagenesis and thermostability measurements strongly suggests that this polymorphic region contains a secondary structure that, when disrupted due to the presence of a variant SNP, results in a mobility shift relative to the wild type sequence. To overcome this problem, the SE33 primers used in the final configuration of the NGM SElect™ Kit avoided the amplification of this polymorphic region yielding in turn results highly concordant with the SEfiler Plus™ Kit. PMID:21757416

  11. High Sensitivity Method to Estimate Distribution of Hyaluronan Molecular Sizes in Small Biological Samples Using Gas-Phase Electrophoretic Mobility Molecular Analysis

    PubMed Central

    Do, Lan; Dahl, Christen P.; Kerje, Susanne; Hansell, Peter; Mörner, Stellan; Lindqvist, Ulla; Engström-Laurent, Anna; Larsson, Göran; Hellman, Urban

    2015-01-01

    Hyaluronan is a negatively charged polydisperse polysaccharide where both its size and tissue concentration play an important role in many physiological and pathological processes. The various functions of hyaluronan depend on its molecular size. Up to now, it has been difficult to study the role of hyaluronan in diseases with pathological changes in the extracellular matrix where availability is low or tissue samples are small. Difficulty to obtain large enough biopsies from human diseased tissue or tissue from animal models has also restricted the study of hyaluronan. In this paper, we demonstrate that gas-phase electrophoretic molecular mobility analyzer (GEMMA) can be used to estimate the distribution of hyaluronan molecular sizes in biological samples with a limited amount of hyaluronan. The low detection level of the GEMMA method allows for estimation of hyaluronan molecular sizes from different parts of small organs. Hence, the GEMMA method opens opportunity to attain a profile over the distribution of hyaluronan molecular sizes and estimate changes caused by disease or experimental conditions that has not been possible to obtain before. PMID:26448761

  12. Charge regulation phenomenon predicted from the modeling of polypeptide electrophoretic mobilities as a relevant mechanism of amyloid-beta peptide oligomerization.

    PubMed

    Deiber, Julio A; Peirotti, Marta B; Piaggio, Maria V

    2016-03-01

    Electrophoretic mobilities of amyloid-beta (1-40) and (1-42) peptides and their aggregates are modeled to study the amyloidogenic pathway associated with Alzheimer´s Disease. The near molecule pH generated by the intraparticle charge regulation phenomenon during the oligomerization of amyloid-beta (1-40) and (1-42) peptides is evaluated and discussed as a relevant mechanism supporting the "amyloid cascade hypothesis" proposed in the literature. A theoretical framework associated with the oligomerization of amyloid-beta peptides including simple scaling laws and the consideration of electrokinetic and hydrodynamic global properties of oligomers is presented. The central finding is the explanation of the near molecule pH change toward the pI when the oligomerization number increases. These results allow one to rationalize consecutive physical stages that validate the amyloid cascade hypothesis. Concluding remarks involving mainly the effects of pair and intraparticle charge regulation phenomena on the amyloidogenic pathway with some suggestions for future research are provided. PMID:26718015

  13. Estimation of electrokinetic and hydrodynamic global properties of relevant amyloid-beta peptides through the modeling of their effective electrophoretic mobilities and analysis of their propensities to aggregation.

    PubMed

    Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B

    2014-09-01

    Neuronal activity loss may be due to toxicity caused by amyloid-beta peptides forming soluble oligomers. Here amyloid-beta peptides (1-42, 1-40, 1-39, 1-38, and 1-37) are characterized through the modeling of their experimental effective electrophoretic mobilities determined by a capillary zone electrophoresis method as reported in the literature. The resulting electrokinetic and hydrodynamic global properties are used to evaluate amyloid-beta peptide propensities to aggregation through pair particles interaction potentials and Brownian aggregation kinetic theories. Two background electrolytes are considered at 25°C, one for pH 9 and ionic strength I = 40 mM (aggregation is inhibited through NH4OH) the other for pH 10 and I = 100 mM (without NH4OH). Physical explanations of peptide oligomerization mechanisms are provided. The effect of hydration, electrostatic, and dispersion forces in the amyloidogenic process of amyloid-beta peptides (1-40 and 1-42) are quantitatively presented. The interplay among effective charge number, hydration, and conformation of chains is described. It is shown that amyloid-beta peptides (1-40 and 1-42) at pH 10, I = 100 mM and 25°C, may form soluble oligomers, mainly of order 2 and 4, after an incubation of 48 h, which at higher times evolve and end up in complex structures (protofibrils and fibrils) found in plaques associated with Alzheimer's disease. PMID:24975363

  14. A68 proteins in Alzheimer's disease are composed of several tau isoforms in a phosphorylated state which affects their electrophoretic mobilities.

    PubMed Central

    Brion, J P; Hanger, D P; Couck, A M; Anderton, B H

    1991-01-01

    The tau-immunoreactive A68 polypeptides found in brains from patients with Alzheimer's disease have been studied by Western blotting using (1) antibodies to synthetic peptides corresponding to sequences that span the complete human tau molecule, and (2) antibodies specific for inserts 1 and 2 found towards the N-terminus of some tau isoforms. The three major A68 polypeptides were labelled by all of the antibodies to sequences common to all tau isoforms, but the faster-migrating A68 polypeptides was not labelled by either of the two antibodies specific for inserts 1 and 2. Treatment with alkaline phosphatase of non-solubilized A68 did not change its electrophoretic mobility on SDS/PAGE under the conditions described here. However, A68 that was solubilized before treating it with alkaline phosphatase was found to move faster on SDS/PAGE than untreated A68, to a position similar to that of normal tau. We also confirmed that A68 preparations contain numerous paired helical filaments (PHF). These PHF were labelled by all anti-tau antibodies, including insert-specific antibodies. Our results further support the notion that PHF contain abnormally phosphorylated tau in an aggregated state, and indicate that these abnormally phosphorylated tau forms are composed of several tau isoforms and that the full length of the tau molecule is present in these polypeptides. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:1953678

  15. Mobile small RNAs regulate genome-wide DNA methylation

    PubMed Central

    Lewsey, Mathew G.; Hardcastle, Thomas J.; Melnyk, Charles W.; Molnar, Attila; Valli, Adrián; Urich, Mark A.; Nery, Joseph R.; Baulcombe, David C.; Ecker, Joseph R.

    2016-01-01

    RNA silencing at the transcriptional and posttranscriptional levels regulates endogenous gene expression, controls invading transposable elements (TEs), and protects the cell against viruses. Key components of the mechanism are small RNAs (sRNAs) of 21–24 nt that guide the silencing machinery to their nucleic acid targets in a nucleotide sequence-specific manner. Transcriptional gene silencing is associated with 24-nt sRNAs and RNA-directed DNA methylation (RdDM) at cytosine residues in three DNA sequence contexts (CG, CHG, and CHH). We previously demonstrated that 24-nt sRNAs are mobile from shoot to root in Arabidopsis thaliana and confirmed that they mediate DNA methylation at three sites in recipient cells. In this study, we extend this finding by demonstrating that RdDM of thousands of loci in root tissues is dependent upon mobile sRNAs from the shoot and that mobile sRNA-dependent DNA methylation occurs predominantly in non-CG contexts. Mobile sRNA-dependent non-CG methylation is largely dependent on the DOMAINS REARRANGED METHYLTRANSFERASES 1/2 (DRM1/DRM2) RdDM pathway but is independent of the CHROMOMETHYLASE (CMT)2/3 DNA methyltransferases. Specific superfamilies of TEs, including those typically found in gene-rich euchromatic regions, lose DNA methylation in a mutant lacking 22- to 24-nt sRNAs (dicer-like 2, 3, 4 triple mutant). Transcriptome analyses identified a small number of genes whose expression in roots is associated with mobile sRNAs and connected to DNA methylation directly or indirectly. Finally, we demonstrate that sRNAs from shoots of one accession move across a graft union and target DNA methylation de novo at normally unmethylated sites in the genomes of root cells from a different accession. PMID:26787884

  16. On electrophoretic NMR. Exploring high conductivity samples

    NASA Astrophysics Data System (ADS)

    Bielejewski, Michał; Giesecke, Marianne; Furó, István

    2014-06-01

    The performance of a new electrophoretic NMR (eNMR) method that uses a Carr-Purcell-Meiboom-Gill echo train with repeated electric field reversal is investigated. We show that this pulse sequence, with acronym CPMGER, yields strongly reduced artifacts from convective flow effects caused by the simultaneous presence of electroosmotic and thermal driving forces. We demonstrate the achieved improvements in various aqueous solutions. Ultimately, the method can be used for obtaining electrophoretic mobilities by eNMR without relying on uncharged reference molecules, otherwise a significant limitation for electrophoretic experiments performed with nuclei other than 1H.

  17. Instrument and method to determine the electrophoretic mobility of nanoparticles and proteins by combining electrical and flow field-flow fractionation.

    PubMed

    Johann, Christoph; Elsenberg, Stephan; Schuch, Horst; Rösch, Ulrich

    2015-04-21

    A new FFF method is presented which combines asymmetrical flow-FFF (AF4) and electrical FFF (ElFFF) in one channel to electrical asymmetrical flow-FFF (EAF4) to overcome the restrictions of pure ElFFF. It allows for measuring electrophoretic mobility (μ) as a function of size. The method provides an absolute value and does not require calibration. Results of μ for two particle standards are in good agreement with values determined by phase analysis light scattering (PALS). There is no requirement for low ionic strength carriers with EAF4. This overcomes one of the main limitations of ElFFF, making it feasible to measure proteins under physiological conditions. EAF4 has the capability to determine μ for individual populations which are resolved into separate peaks. This is demonstrated for a mixture of three polystyrene latex particles with different sizes as well as for the monomer and dimer of BSA and an antibody. The experimental setup consists of an AF4 channel with added electrodes; one is placed beneath the frit at the bottom wall and the other covers the inside of the upper channel plate. This design minimizes contamination from the electrolysis reactions by keeping the particles distant from the electrodes. In addition the applied voltage range is low (1.5-5 V), which reduces the quantity of gaseous electrolysis products below a threshold that interferes with the laminar flow profile or detector signals. Besides measuring μ, the method can be useful to improve the separation between sample components compared to pure flow-FFF. For two proteins (BSA and a monoclonal antibody), enhanced resolution of the monomer and dimer is achieved by applying an electric field. PMID:25789885

  18. Quantifying the Heterogeneity of Chemical Structures in Complex Charged Polymers through the Dispersity of Their Distributions of Electrophoretic Mobilities or of Compositions.

    PubMed

    Thevarajah, Joel J; Sutton, Adam T; Maniego, Alison R; Whitty, Elizabeth G; Harrisson, Simon; Cottet, Hervé; Castignolles, Patrice; Gaborieau, Marianne

    2016-02-01

    The complexity of synthetic and natural polymers used in industrial and medical applications is expanding; thus, it becomes increasingly important to improve and develop methods for their molecular characterization. Free-solution capillary electrophoresis is a robust technique for the separation and characterization of both natural and synthetic complex charged polymers. In the case of polyelectrolytes, free-solution capillary electrophoresis is in the "critical conditions" (CE-CC): it allows their separation by factors other than molar mass for molar masses typically higher than 20000 g/mol. This method is thus complementary to size-exclusion chromatography (SEC). SEC is widely used to determine molar mass distributions and their dispersities. Utilizing CE-CC, an analogous calculation of dispersity based on the distributions of electrophoretic mobilities was derived and the heterogeneity of composition or branching in different polysaccharides or synthetic polymers was obtained in a number of experimental cases. Calculations are based on a ratio of moments and could therefore be compared to simulations of polymerization processes, in analogy to the work performed on molar mass distributions. Among four possible types of dispersity, the most precise values were obtained with the calculation analogous with the dispersity of molar mass distribution Mw/Mn. In addition, the dispersity value allows conclusions based on a single value: the closer the dispersity is to 1, the more homogeneous the polymer is in terms of composition or branching. This approach allows the analysis of dispersity of important molecular attributes of polymers other than molar mass and aims at improving the overall molecular characterization of both synthetic and natural polymers. The dispersity can also be monitored online while performing a chemical reaction within the CE instrument. PMID:26674535

  19. Mobility of long-chain DNA in two-dimensional artificial gels

    NASA Astrophysics Data System (ADS)

    Turner, Stephen W. P.; Han, Jongyoon; Craighead, Harold G.

    2000-03-01

    In this study, a two-dimensional array of nanofabricated obstacles is used as an artificial gel to study the electrophoretic mobility dependence of DNA as a function of pore size, molecule length and electric field. Limitations in feature size have prevented previous studies from testing the crossover from the separating to the non-separating regime predicted by the biased reptation model of Lumpkin, Dejardin and Zimm[1] and the modified model of Duke, Semenov and Viovy.[2] That limitation is overcome in this work with the use of electron beam lithography to define features as small as 30 nm. Attainment of these feature sizes was made possible by the use of a sacrificial-layer-based technique for fluidics fabrication.[3] A novel band-launching strategy is used to provide band separation data for the first time in this system. Molecule lengths between 5 and 150 kilobases are studied for electric field strengths from 0.1 to 20 Volts per meter. [1] O. Lumpkin, P. Dejardin and B. Zimm, Biopolymers, Vol. 24, 1573-1593 (1985) [2] T. Duke, A. Semenov and J. Viovy, Phys. Rev. Lett. Vol. 69, No. 22, 3260-3263 (1992) [3] S. Turner, A. Perez, A. Lopez, and H. Craighead, J. Vac. Sci. Technol. B 16(6) 3835-3840 (1998)

  20. Stability of DNA-Tethered Lipid Membranes with Mobile Tethers

    PubMed Central

    Chung, Minsub; Boxer, Steven G.

    2011-01-01

    We recently introduced two approaches for tethering planar lipid bilayers as membrane patches to either a supported lipid bilayer or DNA-functionalized surface using DNA hybridization (Chung, M., Lowe, R. D., Chan, Y-H. M., Ganesan, P. V., Boxer, S. G. J. Struct. Biol. 2009, 168, 190–9). When mobile DNA tethers are used, the tethered bilayer patches become unstable, while they are stable if the tethers are fixed on the surface. Because the mobile tethers between a patch and a supported lipid bilayer offer a particularly interesting architecture for studying the dynamics of membrane-membrane interactions, we have investigated the sources of instability, focusing on membrane composition. The most stable patches were made with a mixture of saturated lipids and cholesterol, suggesting an important role for membrane stiffness. Other factors such as the effect of tether length, lateral mobility and patch membrane edge were also investigated. Based on these results, a model for the mechanism of patch destruction is developed. PMID:21452847

  1. Electrophoretic transport equations - Electrophoretic models based on migration only and their interrelationships

    NASA Technical Reports Server (NTRS)

    Thormann, Wolfgang; Mosher, Richard A.

    1985-01-01

    The general equations which describe the electrophoretic transport of components in solution are restated using Newman's general concept of mobilities. A concise derivation of the moving boundary equation and the regulating function from the continuity equation is presented. Various other regulating principles across moving and stationary boundaries are also discussed, which permits a review of the features and interrelationships of the electrophoretic models based on electromigration only. The effect of considering an interactive (dissociating) solvent on the mathematical treatment is discussed.

  2. Mobile DNA and evolution in the 21st century

    PubMed Central

    2010-01-01

    Scientific history has had a profound effect on the theories of evolution. At the beginning of the 21st century, molecular cell biology has revealed a dense structure of information-processing networks that use the genome as an interactive read-write (RW) memory system rather than an organism blueprint. Genome sequencing has documented the importance of mobile DNA activities and major genome restructuring events at key junctures in evolution: exon shuffling, changes in cis-regulatory sites, horizontal transfer, cell fusions and whole genome doublings (WGDs). The natural genetic engineering functions that mediate genome restructuring are activated by multiple stimuli, in particular by events similar to those found in the DNA record: microbial infection and interspecific hybridization leading to the formation of allotetraploids. These molecular genetic discoveries, plus a consideration of how mobile DNA rearrangements increase the efficiency of generating functional genomic novelties, make it possible to formulate a 21st century view of interactive evolutionary processes. This view integrates contemporary knowledge of the molecular basis of genetic change, major genome events in evolution, and stimuli that activate DNA restructuring with classical cytogenetic understanding about the role of hybridization in species diversification. PMID:20226073

  3. Global properties and propensity to dimerization of the amyloid-beta (12-28) peptide fragment through the modeling of its monomer and dimer diffusion coefficients and electrophoretic mobilities.

    PubMed

    Deiber, Julio A; Peirotti, Marta B; Piaggio, Maria V

    2015-03-01

    Neuronal activity loss may be due to toxicity caused mainly by amyloid-beta (1-40) and (1-42) peptides forming soluble oligomers. Here the amyloid-beta (12-28) peptide fragment (monomer) and its dimer are characterized at low pH through the modeling of their diffusion coefficients and effective electrophoretic mobilities. Translational diffusion coefficient experimental values of monomer and dimer analogs of this peptide fragment and monomer and dimer mixtures at thermodynamic equilibrium are used as reported in the literature for different monomer initial concentrations. The resulting electrokinetic and hydrodynamic global properties are employed to evaluate the amyloid-beta (12-28) peptide fragment propensity to dimerization through a thermodynamic theoretical framework. Therefore equilibrium constants are considered at pH 2.9 to elucidate one of the amyloidogenic mechanisms involving the central hydrophobic region LVFFA of the peptide spanning residues 17-21 associated with phenylalanine at positions 19 and 20 in the amino acid sequence of amyloid-beta peptides. An analysis demonstrating that peptide aggregation is a concentration-dependent process is provided, where both pair and intraparticle charge regulation phenomena become relevant. It is shown that the modeling of the effective electrophoretic mobility of the amyloid-beta (12-28) peptide fragment is crucial to understand the effect of hydrophobic region LVFFA in the amyloidogenic process. PMID:25403948

  4. Reversible Light Switch for Macrocycle Mobility in a DNA Rotaxane

    PubMed Central

    2012-01-01

    A recent trend in DNA nanotechnology consists of the assembly of architectures with dynamic properties that can be regulated by employing external stimuli. Reversible processes are important for implementing molecular motion into DNA architectures as they allow for the regeneration of the original state. Here we describe two different approaches for the reversible switching of a double-stranded DNA rotaxane architecture from a stationary pseudorotaxane mode into a state with movable components. Both states only marginally differ in their respective topologies but their mechanical properties are fundamentally different. In the two approaches, the switching operation is based on strand-displacement reactions. One of them employs toehold-extended oligodeoxynucleotides whereas in the other one the switching is achieved by light-irradiation. In both cases, multiple back and forth switching between the stationary and the mobile states was achieved in nearly quantitative fashion. The ability to reversibly operate mechanical motion in an interlocked DNA nanostructure opens exciting new avenues in DNA nanotechnology. PMID:22780815

  5. Surface modification of inorganic black particles for electrophoretic display

    NASA Astrophysics Data System (ADS)

    Kim, Sang Deuk; Ahn, Woo Jin; Choi, Hyoung Jin

    2014-11-01

    Inorganic black particles (Black 444) were modified with poly(methyl methacrylate) as a shell material by using dispersion polymerization to improve their dispersion stability in a medium oil for electrophoretic display applications. They were also positively charged with vinylimidazole to enhance their electrophoretic mobility. The morphology and the shape of the composite particles were characterized by using scanning electron microscopy. The thermal properties and the chemical structure of the samples were examined by using thermogravimetric analysis and Fourier-transform infrared spectroscopy, respectively. In addition, the electrophoretic mobility and the zeta-potential of the black444/PMMA/vinylimidazole particles in a dielectric fluid were measured by using optical microscopy and electrophoretic light scattering. With increasing positive charge, the black444/PMMA/vinylimidazole particles showed improved electrophoretic characteristics compared to pristine Black 444.

  6. Simultaneous measurements of mobility, dispersion, and orientation of DNA during steady-field gel electrophoresis coupling a fluorescence recovery after photobleaching apparatus with a fluorescence detected linear dichroism setup

    NASA Astrophysics Data System (ADS)

    Tinland, B.; Meistermann, L.; Weill, G.

    2000-06-01

    Orientation of molecules is responsible for the loss of separability during steady-field gel electrophoresis. In this work we develop a technique to measure simultaneously the relevant parameters involved in the separation mechanism: electrophoretic mobility, band broadening, and molecular orientation. To do that we have associated a fluorescence recovery after photobleaching (FRAP) apparatus with a fluorescence detected linear dichroism setup. This coupling allows one to follow the buildup of orientation during the FRAP experiment. Because orientation involves a change in the angular distribution of fluorescence, we have added a fluorescence polarization setup which can be used in parallel with the FRAP and gives an exact value of the steady-state orientation factor. We illustrate the possibilities of these combined experiments by analyzing the coupling of electrophoretic transport and orientation of λ DNA in 1% agarose gels.

  7. DNA electrophoresis in agarose gels: A new mobility vs. DNA length dependence

    NASA Astrophysics Data System (ADS)

    Beheshti, Afshin

    2002-04-01

    Separations were performed on double stranded DNA (dsDNA) using electrophoresis. Electrophoresis is the steady transport of particles under the influence of an external electric field. Double stranded DNA fragments ranging in length from 200 base pairs (bp) to 194,000 bp (0.34 nm = 1 bp) were electrophoresed at agarose gel concentrations T = 0.4%--1.5%. The electric field was varied from 0.62 V/cm to 6.21 V/cm. A wide range of electric fields and gel concentrations were used to study the usefulness of a new interpolation equation, 1mL =1mL-( 1mL-1 ms)e-L/g , where mL,ms , and g are independent free fitting parameters. The long length mobility limit is interpreted as mL , the short length mobility limit is ms , and g is the crossover between the long length limit and the short length limit. This exponential relation fit very well (chi2 ≥ 0.999) when there are two smooth transitions observed in the "reptation plots" (plotting 3mL/m∘ vs. L) (J. Rousseau, G. Drouin, and G. W. Slater, Phys Rev Lett. 1997, 79, 1945--1948). Fits deviate from the data when three different slopes were observed in the reptation plots. Reptation plots were used to determine a phase diagram for dsDNA migration regimes. The phase diagrams define different regions where mechanisms for molecular transport affect the migration of dsDNA in agarose gels during electrophoresis. The parameters from the equation have also been interpreted to provide a physical description of the structure of the agarose gel by calculating the pore sizes. The relations between the values for the pore sizes and the phase diagrams are interpreted to better understand the migration of the DNA through agarose gels.

  8. Studies on the effect of mobile phone radiation on DNA using laser induced fluorescence technique

    NASA Astrophysics Data System (ADS)

    Vishnu, K.; Nithyaja, B.; Pradeep, C.; Sujith, R.; Mohanan, P.; Nampoori, V. P. N.

    2011-11-01

    In the present study we have investigated the effect of mobile phone radiation on deoxyribonucleic acid by using fluorescence technique. Absorption spectra shows increase in absorption of DNA after exposure to radiation from mobile phone with different SAR values and microwave frequency which give information about unwinding of the DNA double strand. Fluorescence intensity of dye doped DNA solution is getting reduced suggesting that the absorbed energy is used for unwinding of double strand of DNA after irradiating with microwave radiation. Unwinding of the DNA is very sensitive to power of the microwave radiation.

  9. Multistage Electrophoretic Separators

    NASA Technical Reports Server (NTRS)

    Thomas, Nathan; Doyle, John F.; Kurk, Andy; Vellinger, John C.; Todd, Paul

    2006-01-01

    A multistage electrophoresis apparatus has been invented for use in the separation of cells, protein molecules, and other particles and solutes in concentrated aqueous solutions and suspensions. The design exploits free electrophoresis but overcomes the deficiencies of prior free-electrophoretic separators by incorporating a combination of published advances in mathematical modeling of convection, sedimentation, electro-osmotic flow, and the sedimentation and aggregation of droplets. In comparison with other electrophoretic separators, these apparatuses are easier to use and are better suited to separation in relatively large quantities characterized in the art as preparative (in contradistinction to smaller quantities characterized in the art as analytical). In a multistage electrophoretic separator according to the invention, an applied vertical steady electric field draws the electrically charged particles of interest from within a cuvette to within a collection cavity that has been moved into position of the cuvette. There are multiple collection cavities arranged in a circle; each is aligned with the cuvette for a prescribed short time. The multistage, short-migration-path character of the invention solves, possibly for the first time, the fluid-instability problems associated with free electrophoresis. The figure shows a prototype multistage electrophoretic separator that includes four sample stations and five collection stages per sample. At each sample station, an aqueous solution or suspension containing charged species to be separated is loaded into a cuvette, which is machined into a top plate. The apparatus includes a lower plate, into which 20 collection cavities have been milled. Each cavity is filled with an electrophoresis buffer solution. For the collection of an electrophoretic fraction, the lower plate is rotated to move a designated collection cavity into alignment with the opening of the cuvette. An electric field is then applied between a non

  10. Pulsed-Field Electrophoresis: Application of a Computer Model to the Separation of Large DNA Molecules

    NASA Astrophysics Data System (ADS)

    Lalande, Marc; Noolandi, Jaan; Turmel, Chantal; Rousseau, Jean; Slater, Gary W.

    1987-11-01

    The biased reptation theory has been applied to the pulsed-field electrophoresis of DNA in agarose gels. A computer simulation of the theoretical model that calculates the mobility of large DNA molecules as a function of agarose pore size, DNA chain properties, and electric field conditions has been used to generate mobility curves for DNA molecules in the size range of the larger yeast chromosomes. Pulsed-field electrophoresis experiments resulting in the establishment of an electrophoretic karyotype for yeast, where the mobility of the DNA fragments is a monotonic function of molecular size for the entire size range that is resolved (200-2200 kilobase pairs), has been compared to the theoretical mobility curves generated by the computer model. The various physical mechanisms and experimental conditions responsible for band inversion and improved electrophoretic separation are identified and discussed in the framework of the model.

  11. Ion Mobility Spectrometry Reveals Duplex DNA Dissociation Intermediates

    NASA Astrophysics Data System (ADS)

    Burmistrova, Anastasia; Gabelica, Valérie; Duwez, Anne-Sophie; De Pauw, Edwin

    2013-11-01

    Electrospray ionization (ESI) soft desolvation is widely used to investigate fragile species such as nucleic acids. Tandem mass spectrometry (MS/MS) gives access to the gas phase energetics of the intermolecular interactions in the absence of solvent, by following the dissociation of mass-selected ions. Ion mobility mass spectrometry (IMS) provides indications on the tridimensional oligonucleotide structure by attributing a collision cross section (CCS) to the studied ion. Electrosprayed duplexes longer than eight bases pairs retain their helical structure in a solvent-free environment. However, the question of conformational changes under activation in MS/MS studies remains open. The objective of this study is to probe binding energetics and characterize the unfolding steps occurring prior to oligonucleotide duplex dissociation. Comparing the evolution of CCS with collision energy and breakdown curves, we characterize dissociation pathways involved in CID-activated DNA duplex separation into single strands, and we demonstrate here the existence of stable dissociation intermediates. At fixed duplex length, dissociation pathways were found to depend on the percentage of GC base pairs and on their position in the duplex. Our results show that pure GC sequences undergo a gradual compaction until reaching the dissociation intermediate: A-helix. Mixed AT-GC sequences were found to present at least two conformers: a classic B-helix and an extended structure where the GC tract is a B-helix and the AT tract(s) fray. The dissociation in single strands takes place from both conformers when the AT base pairs are enclosed between two GC tracts or only from the extended conformer when the AT tract is situated at the end(s) of the sequence.

  12. Effects of Crowder Structure and Salt on DNA Mobility and Conformation in Crowded Environments

    NASA Astrophysics Data System (ADS)

    Gorczyca, Stephanie M.; Robertson-Anderson, Rae M.

    Biological cells are crowded environments in which DNA must move through to perform specific functions. We study how the properties of crowded cell-like environments impact DNA dynamics by tracking individual 115 kbp ring and linear DNA in different crowded environments using single-molecule fluorescence microscopy. We determine the role of crowder structure and salt on DNA diffusion and conformation by measuring the mean-squared center-of-mass displacements, as well as the conformational shape, size, and fluctuations of each molecule. Previously, we used 10 and 500 kDa dextran as crowders and showed that mobility of both ring and linear DNA decreased exponentially with increased crowding, but rings compact while linear DNA elongate. These effects were dependent solely on the reduction in available volume for DNA rather than size or number of crowders. Here we use crowders of similar molecular weight, but different structure to dextran (10 kDa PEG and 400 kDa Ficoll). We find that DNA mobility reduction is independent of crowder structure and that ring and linear DNA undergo more significant compaction. Finally, we characterize the role of salt on DNA mobility and conformation to determine the relative roles of enthalpic versus entropic effects on crowding-induced DNA dynamics. This research was funded by the AFOSR Young Investigator Program, Grant No. FA95550-12-1-0315 and the Arnold and Mabel Beckman Scholarship Foundation.

  13. Electrophoretic Transport of Biomolecules through Carbon Nanotube Membranes

    PubMed Central

    Sun, Xinghua; Su, Xin; Wu, Ji; Hinds, Bruce J.

    2013-01-01

    Electrophoretic transport of proteins across electrochemically oxidized multi-walled carbon nanotube (MWCNT) membranes has been investigated. Small charged protein, lysozyme, was successfully pumped across MWCNT membranes by electric field while rejecting larger bovine serum albumin (BSA). Transport of the lysozome was reduced by a factor of about 30 in comparison to bulk mobility and consistent with prediction for hindered transport. Mobilities between 0.33-1.4×10-9 m2/V-s were observed and are approximately 10 fold faster than comparable ordered nanoporous membranes and are consistent with continuum models. For mixtures of BSA and lysozyme, complete rejection of BSA is seen with electrophoretic separations PMID:21338104

  14. Construction and evaluation of a capillary electrophoresis DNA sequencer

    SciTech Connect

    Drossman, H.

    1992-01-01

    This dissertation describes the construction and evaluation of an automated DNA sequencer using capillary gel electrophoresis (CGE) for separating single-strand DNA fragments and a fluorescence detector for analyzing labeled fragments. Theories governing the electrophoretic separation of DNA, dispersion processes in CGE and high sensitivity fluorescence detection are reviewed. The CGE DNA sequencer is compared with current DNA sequencing instruments and with projections of future DNA sequencing instruments. Parameters affecting the limits of detection, DNA sample loading, sample mobility and resolution are evaluated. Predictions for the future of capillary electrophoresis for large-scale sequencing projects are presented.

  15. Convection Compensated Electrophoretic NMR

    NASA Astrophysics Data System (ADS)

    He, Qiuhong; Wei, Zhaohui

    2001-06-01

    A novel method of convection compensated ENMR (CC-ENMR) has been developed to detect electrophoretic motion of ionic species in the presence of bulk solution convection. This was accomplished using a gradient moment nulling technique to remove spectral artifacts from heat-induced convection and using the polarity switch of the applied electric field to retain spin phase modulations due to electrophoretic flow. Experiments were carried out with a mixture of 100 mM L-aspartic acid and 100 mM 4,9-dioxa-1,12-dodecanediamine to demonstrate this new method of ENMR. CC-ENMR enhances our previously developed capillary array ENMR (CA-ENMR) in solving the convection problem. The combined CA- and CC-ENMR approach strengthens the potential of multidimensional ENMR in simultaneous structural determination of coexisting proteins and protein conformations in biological buffer solutions of high ionic strength. Structural mapping of interacting proteins during biochemical reactions becomes possible in the future using ENMR techniques, which may have a profound impact on the understanding of biological events, including protein folding, genetic control, and signal transduction in general.

  16. Two high-mobility group box domains act together to underwind and kink DNA

    SciTech Connect

    Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.; Saperas, N.; Churchill, M. E. A.; Campos, J. L.

    2015-06-30

    The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.

  17. Combinative exposure effect of radio frequency signals from CDMA mobile phones and aphidicolin on DNA integrity.

    PubMed

    Tiwari, R; Lakshmi, N K; Surender, V; Rajesh, A D V; Bhargava, S C; Ahuja, Y R

    2008-01-01

    The aim of present study is to assess DNA integrity on the effect of exposure to a radio frequency (RF) signal from Code Division Multiple Access (CDMA) mobile phones. Whole blood samples from six healthy male individuals were exposed for RF signals from a CDMA mobile phone for 1 h. Alkaline comet assay was performed to assess the DNA damage. The combinative exposure effect of the RF signals and APC at two concentrations on DNA integrity was studied. DNA repair efficiency of the samples was also studied after 2 h of exposure. The RF signals and APC (0.2 microg/ml) alone or in synergism did not have any significant DNA damage as compared to sham exposed. However, univariate analysis showed that DNA damage was significantly different among combinative exposure of RF signals and APC at 0.2 microg/ml (p < 0.05) and at 2 microg/ml (p < 0.02). APC at 2 microg/ml concentration also showed significant damage levels (p < 0.05) when compared to sham exposed. DNA repair efficiency also varied in a significant way in combinative exposure sets (p < 0.05). From these results, it appears that the repair inhibitor APC enhances DNA breaks at 2 microg/ml concentration and that the damage is possibly repairable. Thus, it can be inferred that the in vitro exposure to RF signals induces reversible DNA damage in synergism with APC. PMID:19037791

  18. Epigenetic control of mobile DNA as an interface between experience and genome change

    PubMed Central

    Shapiro, James A.

    2014-01-01

    Mobile DNA in the genome is subject to RNA-targeted epigenetic control. This control regulates the activity of transposons, retrotransposons and genomic proviruses. Many different life history experiences alter the activities of mobile DNA and the expression of genetic loci regulated by nearby insertions. The same experiences induce alterations in epigenetic formatting and lead to trans-generational modifications of genome expression and stability. These observations lead to the hypothesis that epigenetic formatting directed by non-coding RNA provides a molecular interface between life history events and genome alteration. PMID:24795749

  19. INFLUENCE OF BORATE BUFFERS ON THE ELECTROPHORETIC BEHAVIOR OF HUMIC SUBSTANCES IN CAPILLARY ZONE ELECTROPHORESIS

    EPA Science Inventory

    The influence of tetrahydroxyborate ions on the electrophoretic mobility of humic acids was evaluated by capillary electrophoresis (CE). Depending on the molarity of borate ions in the separation buffer, the humic acids exhibit electropherograms with sharp peaks consistently exte...

  20. Using Measurements of Mobility, Diffusion, and Dispersion to Predict Separation Resolution in DNA Electrophoresis

    NASA Astrophysics Data System (ADS)

    Lo, Roger

    2005-03-01

    Electrophoresis of DNA continues to be a key component in a wide variety of genomic analysis assays. In order to customize and optimize these assay systems, much effort has been directed to improve and predict separation resolution using various sieving matrices and experimental platforms. Predicting separation resolution requires a much more detailed understanding of mobility, diffusion, and dispersion phenomena of DNA fragments migrating in the sieving matrix than is currently available in literature. In this study, we address this issue by obtaining a series of systematic measurements of mobility, diffusion, and dispersion using an automated DNA sequencer. Using this data, we are able to isolate key factors governing separation performance, and make comparisons with biased reptation theory to extract information on gel structure and predict achievable resolution under each set of operating conditions. We are also able to predict the separation resolution under specific run conditions, thereby giving researchers and engineers the ability to easily tailor DNA separation systems for required separation performance.

  1. Single DNA imaging and length quantification through a mobile phone microscope

    NASA Astrophysics Data System (ADS)

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2016-03-01

    The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.

  2. Skeleton versus fine earth: what information is stored in the mobile extracellular soil DNA fraction?

    NASA Astrophysics Data System (ADS)

    Ascher, Judith; Ceccherini, Maria Teresa; Agnelli, Alberto; Corti, Guiseppe; Pietramellara, Giacomo

    2010-05-01

    The soil genome consists of an intracellular and an extracellular fraction. Recently, soil extracellular DNA (eDNA) has been shown to be quantitatively relevant, with a high survival capacity and mobility, playing a crucial role in the gene transfer by transformation, in the formation of bacterial biofilm and as a source of nutrients for soil microorganisms. The eDNA fraction can be discriminated and classified by its interaction with clay minerals, humic acids and Al/Fe oxihydroxides, resulting in differently mobile components. The eDNA extractable in water, classified as DNA free in the extracellular soil environment or adsorbed on soil colloids (eDNAfree/adsorbed), is hypothesized to be the most mobile DNA in soil. Challenging to assess the information stored in this DNA fraction, eDNAfree/adsorbed was recovered from fine earth (< 4 mm) and highly altered rock fragments or skeleton (4-10 mm) of six consecutive horizons (A1-BCb2) of a forest soil profile by washing the two soil fractions with H2O. Quantitative analysis have been conducted in terms of DNA yields (fluorimeter and spectrophotometer), molecular weight and fragment length distribution (gel electrophoresis), and qualitative analysis in terms of the composition and distribution of fungal and bacterial communities (Denaturing Gradient Gel Electrophoresis- fingerprinting). The mobile soil eDNA, extracted from each horizon, was characterised by low molecular weight (< 2 kb) and amounts ranging from 3.96 (±0.179) to 0.17 (±0.023) µg g-1 for the fine earth and from 1.42 (±0.111) to 0.11 (±0.007) µg g-1 for the skeleton. Genetic fingerprinting of eDNA recovered from fine earth and skeleton revealed characteristic fungal and bacterial communities of each horizon, but also similarities among the microbial communities of both soil fractions and horizons. This could be interpreted also as a result of the movement of eDNA along the soil profile and from fine earth to skeleton. The molecular characterization

  3. Electrophoretic deposition of biomaterials

    PubMed Central

    Boccaccini, A. R.; Keim, S.; Ma, R.; Li, Y.; Zhitomirsky, I.

    2010-01-01

    Electrophoretic deposition (EPD) is attracting increasing attention as an effective technique for the processing of biomaterials, specifically bioactive coatings and biomedical nanostructures. The well-known advantages of EPD for the production of a wide range of microstructures and nanostructures as well as unique and complex material combinations are being exploited, starting from well-dispersed suspensions of biomaterials in particulate form (microsized and nanoscale particles, nanotubes, nanoplatelets). EPD of biological entities such as enzymes, bacteria and cells is also being investigated. The review presents a comprehensive summary and discussion of relevant recent work on EPD describing the specific application of the technique in the processing of several biomaterials, focusing on (i) conventional bioactive (inorganic) coatings, e.g. hydroxyapatite or bioactive glass coatings on orthopaedic implants, and (ii) biomedical nanostructures, including biopolymer–ceramic nanocomposites, carbon nanotube coatings, tissue engineering scaffolds, deposition of proteins and other biological entities for sensors and advanced functional coatings. It is the intention to inform the reader on how EPD has become an important tool in advanced biomaterials processing, as a convenient alternative to conventional methods, and to present the potential of the technique to manipulate and control the deposition of a range of nanomaterials of interest in the biomedical and biotechnology fields. PMID:20504802

  4. Electrophoretic separation of kidney and pituitary cells on STS-8

    NASA Astrophysics Data System (ADS)

    Morrison, D. R.; Nachtwey, D. S.; Barlow, G. H.; Cleveland, C.; Lanham, J. W.; Farrington, M. A.; Hatfield, J. M.; Hymer, W. C.; Todd, P.; Wilfinger, W.; Grindeland, R.; Lewis, M. L.

    A Continuous Flow Electrophoresis System (CFES) was used on Space Shuttle flight STS-8 to separate specific secretory cells from suspensions of cultured primary human embryonic kidney cells and rat pituitary cells. The objectives were to isolate the subfractions of kidney cells that produce the largest amounts of urokinase (plasminogen activator), and to isolate the subfractions of rat pituitary cells that secrete growth hormone, prolactin, and other hormones. Kidney cells were separated into more than 32 fractions in each of two electrophoretic runs. Electrophoretic mobility distributions in flight experiments were spread more than the ground controls. Multiple assay methods confirmed that all cultured kidney cell fractions produced some urokinase, and five to six fractions produced significantly more urokinase than the other fractions. Several fractions also produced tissue plasminogen activator. The pituitary cells were separated into 48 fractions in each of the two electrophoretic runs, and the amounts of growth hormone (GH) and prolactin (PRL) released into the medium for each cell fraction were determined. Cell fractions were grouped into eight mobility classes and immunocytochemically assayed for the presence of GH, PRL, ACTH, LH, TSH, and FSH. The patterns of hormone distribution indicate that the specialized cells producing GH and PRL are isolatable due to the differences in electrophoretic mobilities.

  5. A DNA-Inspired Encryption Methodology for Secure, Mobile Ad Hoc Networks

    NASA Technical Reports Server (NTRS)

    Shaw, Harry

    2012-01-01

    Users are pushing for greater physical mobility with their network and Internet access. Mobile ad hoc networks (MANET) can provide an efficient mobile network architecture, but security is a key concern. A figure summarizes differences in the state of network security for MANET and fixed networks. MANETs require the ability to distinguish trusted peers, and tolerate the ingress/egress of nodes on an unscheduled basis. Because the networks by their very nature are mobile and self-organizing, use of a Public Key Infra structure (PKI), X.509 certificates, RSA, and nonce ex changes becomes problematic if the ideal of MANET is to be achieved. Molecular biology models such as DNA evolution can provide a basis for a proprietary security architecture that achieves high degrees of diffusion and confusion, and resistance to cryptanalysis. A proprietary encryption mechanism was developed that uses the principles of DNA replication and steganography (hidden word cryptography) for confidentiality and authentication. The foundation of the approach includes organization of coded words and messages using base pairs organized into genes, an expandable genome consisting of DNA-based chromosome keys, and a DNA-based message encoding, replication, and evolution and fitness. In evolutionary computing, a fitness algorithm determines whether candidate solutions, in this case encrypted messages, are sufficiently encrypted to be transmitted. The technology provides a mechanism for confidential electronic traffic over a MANET without a PKI for authenticating users.

  6. Electrophoretic approach to the biochemical systematics of gammarids

    NASA Astrophysics Data System (ADS)

    Bulnheim, H.-P.; Scholl, A.

    1981-12-01

    By utilizing the techniques for electrophoretic separation of proteins by vertical starch gels, the biochemical systematics of 10 Gammaridae species obtained from marine, brackish and freshwater habitats was studied. They included Chaetogammarus marinus, Gammarus zaddachi, G. salinus, G. oceanicus, G. tigrinus, G. chevreuxi, G. locusta, G. duebeni duebeni, G. d. celticus, G. pulex pulex, and G. fossarum. For comparison of electrophoretic mobilities selected enzymes (phosphoglucose isomerase, glutamate oxalacetate transaminase, arginine phosphokinase, hexokinase, leucine amino peptidase, mannose 6-phosphate isomerase) were assayed. They were used as diagnostic characters in terms of electrophoretic identities or diversities of most frequent alleles at polymorphic gene loci. These criteria could be applied to estimate intrageneric enzymic variation and degrees of genetic relatedness between the crustacean amphipod species under consideration, thereby complementing traditional morphological classification.

  7. Bioinorganic Chemistry Special Feature: Gapped DNA is anisotropically bent

    NASA Astrophysics Data System (ADS)

    Guo, Hong; Tullius, Thomas D.

    2003-04-01

    Ionizing radiation damages DNA in several ways, including through formation of a single-nucleoside gap in one DNA strand. We have developed a two-dimensional gel electrophoresis method to investigate the effect of a strand gap on DNA structure. We generate a library of gapped DNA molecules by treating a DNA restriction fragment with the hydroxyl radical, generated by the reaction of Fe(II) EDTA with hydrogen peroxide. The DNA molecule studied contains a fixed bend produced by a set of phased adenine tracts. The A-tract bend serves as a reference bend for investigating the conformational nature of a strand gap. In the first electrophoretic dimension, a bent DNA molecule that has been treated with the hydroxyl radical is electrophoresed on a native gel. Smearing of the band on the native gel indicates that the library of gapped DNA molecules contains a variety of DNA conformations. In the second electrophoretic dimension, gapped DNA molecules having different native gel mobilities are electrophoresed on separate lanes of a denaturing gel to reveal how each strand gap affects the native gel mobility (and thus shape) of the DNA. Our results demonstrate that a single-nucleoside gap in a DNA duplex leads to an anisotropic, directional bend in the DNA helix axis. The implications of our findings for recognition of this lesion by DNA repair proteins are discussed.

  8. AN ELECTROPHORETIC STUDY OF A STREPTOCOCCAL PROTEINASE AND ITS PRECURSOR

    PubMed Central

    Shedlovsky, Theodore; Elliott, S. D.

    1951-01-01

    An electrophoretic study of crystalline preparations of a streptococcal proteinase and its precursor established their isoelectric points at pH values of 8.42 and 7.35 respectively (ionic strength 0.10). Preparations of the proteinase appeared to be electrophoretically homogeneous over a pH range of 5 to 8.5. Precursor preparations contained a relatively low concentration of the active enzyme visible as a separate peak in electrophoretic patterns of sufficiently concentrated solutions. Autocatalytic conversion of precursor to active enzyme was complete and resulted in a corresponding change in the electrophoretic pattern. Treatment of precursor preparations with trypsin produced incomplete conversion to the active enzyme and resulted in the formation of a modified precursor protein. This differed from the parent substance in electrophoretic mobility and in susceptibility to trypsin, but resembled it in immunological specificity and, as previously shown, in susceptibility to conversion to active enzyme by autocatalysis. Serological reactions of precursor and active enzyme components withdrawn from the cell after electrophoresis are described. It appears that the precursor protein may have two antigenic groups, one specific, the other shared by the active enzyme which behaves as a single antigen. PMID:14888818

  9. A plasmid containing the human metallothionein II gene can function as an antibody-assisted electrophoretic biosensor for heavy metals.

    PubMed

    Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J

    2016-01-01

    Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and

  10. Nanoscale histone localization in live cells reveals reduced chromatin mobility in response to DNA damage

    PubMed Central

    Liu, Jing; Vidi, Pierre-Alexandre; Lelièvre, Sophie A.; Irudayaraj, Joseph M. K.

    2015-01-01

    ABSTRACT Nuclear functions including gene expression, DNA replication and genome maintenance intimately rely on dynamic changes in chromatin organization. The movements of chromatin fibers might play important roles in the regulation of these fundamental processes, yet the mechanisms controlling chromatin mobility are poorly understood owing to methodological limitations for the assessment of chromatin movements. Here, we present a facile and quantitative technique that relies on photoactivation of GFP-tagged histones and paired-particle tracking to measure chromatin mobility in live cells. We validate the method by comparing live cells to ATP-depleted cells and show that chromatin movements in mammalian cells are predominantly energy dependent. We also find that chromatin diffusion decreases in response to DNA breaks induced by a genotoxic drug or by the ISceI meganuclease. Timecourse analysis after cell exposure to ionizing radiation indicates that the decrease in chromatin mobility is transient and precedes subsequent increased mobility. Future applications of the method in the DNA repair field and beyond are discussed. PMID:25501817

  11. Electrophoretic Deposition for Fabricating Microbatteries

    NASA Technical Reports Server (NTRS)

    West, William; Whitacre, Jay; Bugga, Ratnakumar

    2003-01-01

    An improved method of fabrication of cathodes of microbatteries is based on electrophoretic deposition. Heretofore, sputtering (for deposition) and the use of photoresist and liftoff (for patterning) have been the primary methods of fabricating components of microbatteries. The volume of active electrode material that can be deposited by sputtering is limited, and the discharge capacities of prior microbatteries have been limited accordingly. In addition, sputter deposition is slow. In contrast, electrophoretic deposition is much faster and has shown promise for increasing discharge capacities by a factor of 10, relative to those of microbatteries fabricated by prior methods.

  12. Electrophoretic Process For Purifying Wastewater

    NASA Technical Reports Server (NTRS)

    Sammons, David W.; Twitty, Garland E.; Sharnez, Rizwan; Egen, Ned B.

    1992-01-01

    Microbes, poisonous substances, and colloidal particles removed by combination of electric fields. Electrophoretic process removes pathogenicorganisms, toxins, toxic metals, and cooloidal soil particles from wastewater. Used to render domestic, industrial, and agricultural wastewater streams potable. Process also useful in bioregenerative and other closed systems like in space stations and submarines, where water must be recycled.

  13. Diffusion of DNA during gel electrophoresis; a predictive function spanning the relevant regimes

    NASA Astrophysics Data System (ADS)

    McCormick, Laurette; Slater, Gary

    2004-03-01

    Gel electrophoresis is used extensively to separate DNA. Diffusion of the DNA bands during electrophoresis is an important phenomenon which reduces the resolution obtained. As with DNA mobility, the diffusion of DNA can be split into several different regimes, each described by relevant theory. Unfortunately, until recently there was no single formula for DNA mobility or diffusion that could be used in more than one regime. However, Van Winkle and co workers [Van Winkle DH, Beheshti A, Rill RL, ELECTROPHORESIS 23 (1): 15-19 JAN 2002] have successfully developed an analytical function to analyze DNA mobility data, throughout the relevant regimes. We present the development of a complementary function for the analysis of DNA diffusion. This function should be very useful both in analyzing DNA electrophoretic data, and as a predictive tool.

  14. An electrophoretic study of urinary protein in the rat.

    PubMed

    SELLERS, A L; ROBERTS, S; RASK, I; SMITH, S; MARMORSTON, J; GOODMAN, H C

    1952-05-01

    The nature of the proteins present in the urine of the normal rat has been investigated by electrophoretic analysis and by fractional precipitation of these proteins by ammonium sulfate. Components similar to serum alpha- and beta-globulin constitute the major portion of the urinary protein in both male and female rats. Following the intraperitoneal injection of renin, a massive proteinuria occurs. The proteins excreted are similar in proportion and electric mobility to those of normal rat serum. PMID:14927799

  15. AN ELECTROPHORETIC STUDY OF URINARY PROTEIN IN THE RAT

    PubMed Central

    Sellers, Alvin L.; Roberts, Sidney; Rask, Irene; Smith, Stephen; Marmorston, Jessie; Goodman, Howard C.

    1952-01-01

    The nature of the proteins present in the urine of the normal rat has been investigated by electrophoretic analysis and by fractional precipitation of these proteins by ammonium sulfate. Components similar to serum α- and β-globulin constitute the major portion of the urinary protein in both male and female rats. Following the intraperitoneal injection of renin, a massive proteinuria occurs. The proteins excreted are similar in proportion and electric mobility to those of normal rat serum. PMID:14927799

  16. Interaction of cis-diamminedichloroplatinum(II) with PM-2 DNA.

    PubMed

    Mong, S; Huang, C H; Prestayko, A W; Crooke, S T

    1980-09-01

    The interaction of cis-diamminedichloroplatinum(II) (CDDP) with PM-2 DNA was studied using two techniques: (a) agarose gel electrophoresis of PM-2 DNA conformation isomers after CDDP binding; and (b) viscometric measurement of different forms of CDDP-bound PM-2 DNA. In both systems, the results indicated that the DNA isomers interacted differently with CDDP. CDDP induced a decrease of viscosity upon interacting with single-strand broken relaxed circular (Form II) and double-strand broken linear (Form III) PM-2 DNA's. These observations are consistent with a "DNA shortening effect" proposed by Cohen et al. [Science (Wash. D. C.), 203: 1014-1016, 1979] and Macquet et al. [Biochimie (Paris), 60: 901-914, 1978] When covalently closed circular (Form I) PM-2 DNA was used, increasing concentrations of CDDP induced an initial slight increase and then decrease of electrophoretic mobility to the degree that it comigrated with CDDP-bound Form II DNA. Further addition of CDDP restored the electrophoretic mobility of Form I DNA. Corresponding changes in the viscosity of CDDP-bound Form I DNA showed an initial decrease, then an increase, and a final prolonged decrease of viscosity. These effects are similar but not identical to those induced by either DNA intercalators (e.g., ethidium bromide) or certain DNA denaturating agents (e.g., formaldehyde, ultraviolet light, alkali trichloroacetate, methylmercuric hydroxide, and carbodiimide). Thus, CDP may induce a DNA superhelix-unwinding process followed either by rewinding or a denaturation process or both. Quantitative analysis of the agarose gel electrophoretic pattern plus sucrose density gradient centrifugation studies also indicated that there was little DNA strand breakage induced by CDDP treatment. PMID:7191776

  17. Identification and quantitation of morphological cell types in electrophoretically separated human embryonic kidney cell cultures

    NASA Technical Reports Server (NTRS)

    Williams, K. B.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    Four major cell types were identified by phase microscopy in early passage human embryonic kidney cell cultures. They are small and large epithelioid, domed, and fenestrated cells. Fibroblasts are also present in some explants. The percent of each cell type changes with passage number as any given culture grows. As a general rule, the fraction of small epithelioid cells increases, while the fraction of fenestrated cells, always small, decreases further. When fibroblasts are present, they always increase in percentage of the total cell population. Electrophoretic separation of early passage cells showed that the domed cells have the highest electrophoretic mobility, fibroblasts have an intermediate high mobility, small epithelioid cells have a low mobility, broadly distributed, and fenestrated cells have the lowest mobility. All cell types were broadly distributed among electrophoretic subfractions, which were never pure but only enriched with respect to a given cell type.

  18. Universal scaling of crowding-induced DNA mobility is coupled with topology-dependent molecular compaction and elongation.

    PubMed

    Gorczyca, Stephanie M; Chapman, Cole D; Robertson-Anderson, Rae M

    2015-10-21

    Using single-molecule fluorescence microscopy and particle-tracking techniques, we elucidate the role DNA topology plays in the diffusion and conformational dynamics of crowded DNA molecules. We focus on large (115 kbp), double-stranded ring and linear DNA crowded by varying concentrations (0-40%) of dextran (10, 500 kDa) that mimic cellular conditions. By tracking the center-of-mass and measuring the lengths of the major and minor axes of single DNA molecules, we characterize both DNA mobility reduction as well as crowding-induced conformational changes (from random spherical coils). We reveal novel topology-dependent conformations, with single ring molecules undergoing compaction to ordered spherical configurations ∼20% smaller than dilute random coils, while linear DNA elongates by ∼2-fold. Surprisingly, these highly different conformations result in nearly identical exponential mobility reduction dependent solely on crowder volume fraction Φ, revealing a universal critical crowding concentration of Φc≅ 2.3. Beyond Φc DNA exhibits topology-independent conformational relaxation dynamics despite highly distinct topology-driven conformations. Our collective results reveal that topology-dependent conformational changes, unique to crowded environments, enable DNA to overcome the classically expected mobility reduction that high-viscosity crowded environments impose. Such coupled universal dynamics suggest a mechanism for DNA to maintain sufficient mobility required for wide-ranging biological processes despite severe cellular crowding. PMID:26303877

  19. High mobility of flap endonuclease 1 and DNA polymerase eta associated with replication foci in mammalian S-phase nucleus.

    PubMed

    Solovjeva, Lioudmila; Svetlova, Maria; Sasina, Lioudmila; Tanaka, Kyoji; Saijo, Masafumi; Nazarov, Igor; Bradbury, Morton; Tomilin, Nikolai

    2005-05-01

    Originally detected in fixed cells, DNA replication foci (RFi) were later visualized in living cells by using green fluorescent protein (GFP)-tagged proliferating cell nuclear antigen (PCNA) and DNA ligase I. It was shown using fluorescence redistribution after photobleaching (FRAP) assay that focal GFP-PCNA slowly exchanged, suggesting the existence of a stable replication holocomplex. Here, we used the FRAP assay to study the dynamics of the GFP-tagged PCNA-binding proteins: Flap endonuclease 1 (Fen1) and DNA polymerase eta (Pol eta). We also used the GFP-Cockayne syndrome group A (CSA) protein, which does associate with transcription foci after DNA damage. In normal cells, GFP-Pol eta and GFP-Fen1 are mobile with residence times at RFi (t(m)) approximately 2 and approximately 0.8 s, respectively. GFP-CSA is also mobile but does not concentrate at discrete foci. After methyl methanesulfonate (MMS) damage, the mobile fraction of focal GFP-Fen1 decreased and t(m) increased, but it then recovered. The mobilities of focal GFP-Pol eta and GFP-PCNA did not change after MMS. The mobility of GFP-CSA did not change after UV-irradiation. These data indicate that the normal replication complex contains at least two mobile subunits. The decrease of the mobile fraction of focal GFP-Fen1 after DNA damage suggests that Fen1 exchange depends on the rate of movement of replication forks. PMID:15758026

  20. Detection, purification and characterization of a protein that binds the (6-4) photoproduct-containing DNA in HeLa cells.

    PubMed

    Fujiwara, Y; Masutani, C; Hanaoka, F; Iwai, S

    1997-01-01

    HeLa cell proteins that bind DNA containing the pyrimidine(6-4)pyrimidone photoproduct were detected by the electrophoretic mobility shift assay using synthetic oligonucleotide duplexes as probes. The major species was purified to near homogeneity, and the amino acid sequences of the proteolytic peptides revealed that it was the human damage-specific DNA-binding protein, which was reported previously. The substrate specificity of this protein was determined using damaged or modified DNA duplexes. PMID:9586107

  1. Sensitive and robust electrophoretic NMR: Instrumentation and experiments

    NASA Astrophysics Data System (ADS)

    Hallberg, Fredrik; Furó, István; Yushmanov, Pavel V.; Stilbs, Peter

    2008-05-01

    Although simple as a concept, electrophoretic NMR (eNMR) has so far failed to find wider application. Problems encountered are mainly due to disturbing and partly irreproducible convection-like bulk flow effects from both electro-osmosis and thermal convection. Additionally, bubble formation at the electrodes and rf noise pickup has constrained the typical sample geometry to U-tube-like arrangements with a small filling factor and a low resulting NMR sensitivity. Furthermore, the sign of the electrophoretic mobility cancels out in U-tube geometries. We present here a new electrophoretic sample cell based on a vertically placed conventional NMR sample tube with bubble-suppressing palladium metal as electrode material. A suitable radiofrequency filter design prevents noise pickup by the NMR sample coil from the high-voltage leads which extend into the sensitive sample volume. Hence, the obtained signal-to-noise ratio of this cell is one order of magnitude higher than that of our previous U-tube cells. Permitted by the retention of the sign of the displacement-related signal phase in the new cell design, an experimental approach is described where bulk flow effects by electro-osmosis and/or thermal convection are compensated through parallel monitoring of a reference signal from a non-charged species in the sample. This approach, together with a CPMG-like pulse train scheme provides a superior first-order cancellation of non-electrophoretic bulk flow effects.

  2. Design Modification of Electrophoretic Equipment

    NASA Technical Reports Server (NTRS)

    Reddick, J. M.; Hirsch, I.

    1973-01-01

    The improved design of a zone electrophoretic sampler is reported that can be used in mass screening for hemoglobin S, the cause of sickle cell anemia. Considered is a high voltage multicell cellulose acetate device that requires 5 to 6 minutes electrophoresis periods; cells may be activitated individually or simultaneously. A multisample hemoglobin applicator standardizes the amount of sample applied and transfers the homolysate to the electrical wires.

  3. Hole mobilities of periodic models of DNA double helices in the nucleosomes at different temperatures

    NASA Astrophysics Data System (ADS)

    Bende, Attila; Bogár, Ferenc; Ladik, János

    2013-04-01

    Using the Hartree-Fock crystal orbital method band structures of poly(G˜-C˜) and poly(A˜-T˜) were calculated (G˜, etc. means a nucleotide) including water molecules and Na+ ions. Due to the close packing of DNA in the ribosomes the motion of the double helix and the water molecules around it are strongly restricted, therefore the band picture can be used. The mobilities were calculated from the highest filled bands. The hole mobilities increase with decreasing temperatures. They are of the same order of magnitude as those of poly(A˜) and poly(T˜). For poly(G˜) the result is ˜5 times larger than in the poly(G˜-C˜) case.

  4. Electrophoresis of DNA on a disordered two-dimensional substrate

    NASA Astrophysics Data System (ADS)

    Olson Reichhardt, Cynthia J.; Reichhardt, Charles

    2006-03-01

    We propose a new method for electrophoretic separation of DNA in which adsorbed polymers are driven over a disordreed two-dimensional substrate which contains attractive sites for the polymers. Using simulations of a model for long polymer chains, we show that the mobility increases with polymer length, in contrast to gel electrophoresis techniques, and that separation can be achieved for a range of length scales. We demonstrate that the separation mechanism relies on excluded volume interactions between polymer segments.

  5. Time-of-flight studies of hole mobilities in DNA-CTMA films fabricated and passivated in a dry environment

    NASA Astrophysics Data System (ADS)

    Yaney, Perry P.; Gorman, Timothy T.; Ouchen, Fahima; Grote, James G.

    2012-01-01

    Salmon DNA-based films, including as-received DNA (molecular weight, MW>2000 kDa) and sonicated DNA of MW ˜200 kDa, both complexed with hexacetyltrimethyl-ammonium chloride (CTMA) surfactant, were studied. The DNA solutions were spin-coated on indium tin oxide (ITO)-coated quartz slides with vacuum deposited gold charge-collecting electrodes. The films were fabricated entirely at ˜0% humidity (0 to 86 ppmv of water) in a nitrogen-purged glove box and coated with 500 to 600 nm passivating layers of conformal urethane before exposure to room air. A quadrupled, 20 ns pulsed Nd:YAG laser with output at 266 nm was used for charge injection. The room temperature photoconductive transients were dispersive with hole mobilities in DNA films ranging between 7E-3 to 5E-5 cm2/Vs for fields ranging from 10 to 380 kV/cm. No electron response was observed in these films. The mobilities were determined from the transient curves at the intersections of initial and final tangent lines that defined the shoulders in the log-log plots. The results of these hole mobility studies, which appear to support predictions of high hole mobility in DNA, are the first on DNA-based films that were fabricated in a dry environment and passivated for measurements in room air.

  6. FLP-mediated DNA mobilization to specific target sites in Drosophila chromosomes.

    PubMed Central

    Golic, M M; Rong, Y S; Petersen, R B; Lindquist, S L; Golic, K G

    1997-01-01

    The ability to place a series of gene constructs at a specific site in the genome opens new possibilities for the experimental examination of gene expression and chromosomal position effects. We report that the FLP- FRT site-specific recombination system of the yeast 2mu plasmid can be used to integrate DNA at a chromosomal FRT target site in Drosophila. The technique we used was to first integrate an FRT- flanked gene by standard P element-mediated transformation. FLP was then used to excise the FRT- flanked donor DNA and screen for FLP-mediated re-integration at an FRT target at a different chromosome location. Such events were recovered from up to 5% of the crosses used to screen for mobilization and are easily detectable by altered linkage of a white reporter gene or by the generation of a white + gene upon integration. PMID:9278488

  7. High mobility group protein-mediated transcription requires DNA damage marker γ-H2AX

    PubMed Central

    Singh, Indrabahadur; Ozturk, Nihan; Cordero, Julio; Mehta, Aditi; Hasan, Diya; Cosentino, Claudia; Sebastian, Carlos; Krüger, Marcus; Looso, Mario; Carraro, Gianni; Bellusci, Saverio; Seeger, Werner; Braun, Thomas; Mostoslavsky, Raul; Barreto, Guillermo

    2015-01-01

    The eukaryotic genome is organized into chromatins, the physiological template for DNA-dependent processes including replication, recombination, repair, and transcription. Chromatin-mediated transcription regulation involves DNA methylation, chromatin remodeling, and histone modifications. However, chromatin also contains non-histone chromatin-associated proteins, of which the high-mobility group (HMG) proteins are the most abundant. Although it is known that HMG proteins induce structural changes of chromatin, the processes underlying transcription regulation by HMG proteins are poorly understood. Here we decipher the molecular mechanism of transcription regulation mediated by the HMG AT-hook 2 protein (HMGA2). We combined proteomic, ChIP-seq, and transcriptome data to show that HMGA2-induced transcription requires phosphorylation of the histone variant H2AX at S139 (H2AXS139ph; γ-H2AX) mediated by the protein kinase ataxia telangiectasia mutated (ATM). Furthermore, we demonstrate the biological relevance of this mechanism within the context of TGFβ1 signaling. The interplay between HMGA2, ATM, and H2AX is a novel mechanism of transcription initiation. Our results link H2AXS139ph to transcription, assigning a new function for this DNA damage marker. Controlled chromatin opening during transcription may involve intermediates with DNA breaks that may require mechanisms that ensure the integrity of the genome. PMID:26045162

  8. Diffusion, Dispersion, and Mobility of Single-stranded DNA in Polyacrylamide Gel Electrophoresis

    NASA Astrophysics Data System (ADS)

    Lo, Roger; Ugaz, Victor

    2004-03-01

    The ability to perform DNA electrophoresis in miniaturized microfluidic systems has the potential to provide a new generation of low-cost high-throughput genomic analysis technology. Further progress toward improving separation performance under these conditions, however, requires a more detailed understanding of diffusion and dispersion phenomena in the gel matrix. Unfortunately, it has thus far proven difficult to obtain extensive measurements of these quantities due in large part to the lack of a convenient experimental platform. In this paper, we demonstrate the use of microfabricated gel electrophoresis devices to measure diffusion, dispersion, and mobility of single-stranded DNA fragments in crosslinked and uncrosslinked polyacrylamide gels. The microdevice format allows a complete set of diffusion and dispersion data to be collected in approximately one hour, as opposed to experiment times lasting several days using conventional sequencing equipment. By comparing runs using identical DNA samples, gel formulations, and operating conditions in both microfabricated electrophoresis devices and an ALF Express automated DNA sequencer, we are able to isolate the key factors governing separation performance in each system. The results of these experiments are then compared with biased reptation theory to extract information about the gel structure and predict achievable resolution. The effects of gel composition and polymerization chemistry are also explored.

  9. ATM Alters the Otherwise Robust Chromatin Mobility at Sites of DNA Double-Strand Breaks (DSBs) in Human Cells

    PubMed Central

    Becker, Annabelle; Durante, Marco; Taucher-Scholz, Gisela; Jakob, Burkhard

    2014-01-01

    Ionizing radiation induces DNA double strand breaks (DSBs) which can lead to the formation of chromosome rearrangements through error prone repair. In mammalian cells the positional stability of chromatin contributes to the maintenance of genome integrity. DSBs exhibit only a small, submicron scale diffusive mobility, but a slight increase in the mobility of chromatin domains by the induction of DSBs might influence repair fidelity and the formation of translocations. The radiation-induced local DNA decondensation in the vicinity of DSBs is one factor potentially enhancing the mobility of DSB-containing chromatin domains. Therefore in this study we focus on the influence of different chromatin modifying proteins, known to be activated by the DNA damage response, on the mobility of DSBs. IRIF (ionizing radiation induced foci) in U2OS cells stably expressing 53BP1-GFP were used as a surrogate marker of DSBs. Low angle charged particle irradiation, known to trigger a pronounced DNA decondensation, was used for the defined induction of linear tracks of IRIF. Our results show that movement of IRIF is independent of the investigated chromatin modifying proteins like ACF1 or PARP1 and PARG. Also depletion of proteins that tether DNA strands like MRE11 and cohesin did not alter IRIF dynamics significantly. Inhibition of ATM, a key component of DNA damage response signaling, resulted in a pronounced confinement of DSB mobility, which might be attributed to a diminished radiation induced decondensation. This confinement following ATM inhibition was confirmed using X-rays, proving that this effect is not restricted to densely ionizing radiation. In conclusion, repair sites of DSBs exhibit a limited mobility on a small spatial scale that is mainly unaffected by depletion of single remodeling or DNA tethering proteins. However, it relies on functional ATM kinase which is considered to influence the chromatin structure after irradiation. PMID:24651490

  10. Electrophoretic separator for purifying biologicals

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Mathematical expressions were developed to describe the interrelationships between operating requirements (capabilities), cell parameters, and system constraints in terms of design criteria definition. The mathematical model was programmed for computer solution. The model was exercised to identify performance-limiting characteristics, and analyses were conducted to predict operation in space of an experiment involving separation of four components. An engineering model of a flowing electrophoretic separator was constructed. The design is directed toward verifying improvements in resolution and throughput of a thicker cell than can be used on earth.

  11. Nonlinear electrophoretic response yields a unique parameter for separation of biomolecules

    PubMed Central

    Pel, Joel; Broemeling, David; Mai, Laura; Poon, Hau-Ling; Tropini, Giorgia; Warren, René L.; Holt, Robert A.; Marziali, Andre

    2009-01-01

    We demonstrate a unique parameter for biomolecule separation that results from the nonlinear response of long, charged polymers to electrophoretic fields and apply it to extraction and concentration of nucleic acids from samples that perform poorly under conventional methods. Our method is based on superposition of synchronous, time-varying electrophoretic fields, which can generate net drift of charged molecules even when the time-averaged molecule displacement generated by each field individually is zero. Such drift can only occur for molecules, such as DNA, whose motive response to electrophoretic fields is nonlinear. Consequently, we are able to concentrate DNA while rejecting high concentrations of contaminants. We demonstrate one application of this method by extracting DNA from challenging samples originating in the Athabasca oil sands. PMID:19706437

  12. Objective data on DNA success rates can aid the selection process of crime samples for analysis by rapid mobile DNA technologies.

    PubMed

    Mapes, A A; Kloosterman, A D; Poot, C J de; van Marion, V

    2016-07-01

    Mobile Rapid-DNA devices have recently become available on the market. These devices can perform DNA analyses within 90min with an easy 'sample in-answer out' system, with the option of performing comparisons with a DNA database or reference profile. However, these fast mobile systems cannot yet compete with the sensitivity of the standard laboratory analysis. For the future this implies that Scene of Crime Officers (SoCOs) need to decide on whether to analyse a crime sample with a Rapid-DNA device and to get results within 2h or to secure and analyse the sample at the laboratory with a much longer throughput time but with higher sensitivity. This study provides SoCOs with evidence-based information on DNA success rates, which can improve their decisions at the crime scene on whether or not to use a Rapid-DNA device. Crime samples with a high success rate in the laboratory will also have the highest potential for Rapid-DNA analysis. These include samples from e.g. headwear, cigarette ends, articles of clothing, bloodstains, and drinking items. PMID:27015156

  13. Electrophoretic separator for purifying biologicals, part 1

    NASA Technical Reports Server (NTRS)

    Mccreight, L. R.

    1978-01-01

    A program to develop an engineering model of an electrophoretic separator for purifying biologicals is summarized. An extensive mathematical modeling study and numerous ground based tests were included. Focus was placed on developing an actual electrophoretic separator of the continuous flow type, configured and suitable for flight testing as a space processing applications rocket payload.

  14. Urokinase production by electrophoretically separated cultured human embryonic kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.; Plank, L. D.; Giranda, V.; Sedor, K.; Todd, P. W.

    1985-01-01

    Urokinase is a plasminogen activator found in urine. Relatively pure preparations have been tested in Europe, Japan and the United States for the treatment of deep vein thrombosis and other dangerous blood clots. Human embryonic kidney cell cultures have been found to produce urokinase at much higher concentrations, but less than 5% of the cells in typical cultures are producers. Since human diploid cells become senescent in culture the selection of clones derived from single cells will not provide enough material to be useful, so a bulk purification method is needed for the isolation of urokinase producing cell populations. Preparative cell electrophoresis was chosen as the method, since evidence exists that human embryonic cell cultures are richly heterogeneous with respect to electrophoretic mobility, and preliminary electrophoretic separations on the Apollo-Soyuz space flight produced cell populations that were rich in urokinase production. Similarly, erythropoietin is useful in the treatment of certain anemias and is a kidney cell duct, and electrophoretically enriched cell populations producing this product have been reported. Thus, there is a clear need for diploid human cells that produce these products, and there is evidence that such cells should be separable by free-flow cell electrophoresis.

  15. Strain-specific mobilization and amplification of a transgenic defective-interfering DNA of the geminivirus beet curly top virus.

    PubMed

    Stenger, D C

    1994-09-01

    Transgenic Nicotiana benthamiana plants have been constructed which bear integrated, tandemly repeated copies of a beet curly top virus (BCTV) defective-interfering (DI) DNA derived from the Logan strain. Transgenic DI-DNA plant lines challenge-inoculated with BCTV-Logan exhibited delayed and attenuated symptoms compared to nontransgenic plants. Infection of transgenic plants with the Logan strain resulted in the mobilization of the integrated DI-DNA sequence, which was subsequently amplified as an episome. The accumulation of Logan helper virus DNA forms was reduced in transgenic plants, relative to nontransgenic plants. In contrast, no delay or attenuation of symptoms was observed for transgenic plants challenge-inoculated with the BCTV strains CFH and Worland. Infection by the CFH and Worland strains did not result in mobilization or amplification of the integrated Logan DI-DNA sequence, and no consistent differences in the accumulation of CFH or Worland genomic viral DNA forms were observed among transgenic and nontransgenic plants. These results, and a comparison of putative DNA replication origin sequences, suggest that BCTV strains display specificity with respect to recognition of heterologous DNA replication origin cis-elements. PMID:8053165

  16. Electrophoretic separation of kidney and pituitary cells on STS-8

    NASA Technical Reports Server (NTRS)

    Morrison, D. R.; Nachtwey, D. S.; Barlow, G. H.; Cleveland, C.; Lanham, J. W.; Farrington, M. A.; Hatfield, J. M.; Hymer, W. C.; Grindeland, R.; Lewis, M. L.

    1984-01-01

    Specific secretory cells were separated from suspensions of cultured primary human embryonic cells and rat pituitary cells in microgravity conditions, with an objective of isolating the subfractions of kidney cells that produce the largest amount of urakinase, and the subfractions of rat pituitary cells that secrete growth hormones (GH), prolactin (PRL), and other hormones. It is inferred from the experimental observations that the surface charge distributions of the GH-containing cells differ from those of the PRL-containing cells, which is explained by the presence of secretory products on the surface of pituitary cells. For kidney cells, the electrophoretic mobility distributions in flight experiments were spread more than the ground controls.

  17. Human immunodeficiency virus type 1 evolution in vivo tracked by DNA heteroduplex mobility assays.

    PubMed Central

    Delwart, E L; Sheppard, H W; Walker, B D; Goudsmit, J; Mullins, J I

    1994-01-01

    High mutation rates and strong selective pressures imposed on human immunodeficiency viruses in vivo result in the formation of pools of genetic variants known as quasispecies. DNA heteroduplex mobility and tracking analyses were used to monitor the generation of HIV sequence diversity, to estimate quasispecies complexity, and to assess the turnover of genetic variants to approach an understanding of the relationship between viral quasispecies evolution in vivo and disease progression. Proviral DNA pools were nearly homogeneous soon after sexual transmission. The emergence and clearance of individual variants then occurred at different rates in different individuals. High quasispecies complexity was found in long-term-infected, asymptomatic individuals, while rapid CD4+ cell decline and AIDS were often, but not always, associated with lower quasispecies complexity. Proviral genetic variation was often low following in vitro culture, because of the outgrowth of one or a few variants that often became more abundant only later as proviruses in peripheral blood mononuclear cells. These studies provide insight into the dynamics of human immunodeficiency virus sequence changes in vivo and illustrate the utility of heteroduplex analysis for the study of phenomena associated with rapid genetic changes. Images PMID:8084001

  18. Analyses of gonococcal H8 antigen. Surface location, inter- and intrastrain electrophoretic heterogeneity, and unusual two-dimensional electrophoretic characteristics.

    PubMed

    Hitchcock, P J; Hayes, S F; Mayer, L W; Shafer, W M; Tessier, S L

    1985-12-01

    The H8 protein is a surface-exposed antigen that is found, among members of the Neisseria genus, primarily on pathogenic species. In this study, the surface exposure of H8 was reassessed by four techniques. Results of slide agglutination, indirect fluorescent antibody binding, absorption of sera with whole gonococci, and immune electron microscopy all confirmed the presence of H8 in the outer membrane. The degree to which protein A-gold-labeled monoclonal antibodies bound to H8 was marked, and suggested that this antigen was present in abundant amounts in the outer membrane. Also in this study, the electrophoretic heterogeneity of this common surface antigen was examined. Because H8 stains poorly, electrophoretic mobility was assessed using polyclonal antibodies and a monoclonal antibody that recognizes a common H8 epitope. H8 was analyzed with respect to protein I, lipopolysaccharide (LPS), and pilus and opacity phenotypic variation; results confirmed that heterogeneity of Mr was the rule among strains (21 were examined), however, the variability in Mr was independent of protein I or LPS Mr. In one strain (FA1090), the heterogeneity of H8 was examined among 10 piliation/opacity variants; the H8 (and LPS) Mr was identical in all variants; similar data were generated in strains JS3 and JS1. The electrophoretic mobility of H8 was altered in serum-resistant and neutrophil enzyme-resistant gonococci compared to the sensitive gonococci. Some of the unusual electrophoretic migration characteristics of the antigen were also examined. H8 formed a unique mushroom-shaped band in one-dimensional gels; in a two-dimensional electrophoresis system, the antigen migrated aberrantly, very similarly to LPS. Also seen in the two-dimensional electrophoresis profile were multimers of the H8 antigen; in strain JS3 (Mr 23,500), these migrated at 43,600, 86,000, and greater than 150,000. In other strains, the Mr of the multimers differed depending upon the Mr of the monomer. The two

  19. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    PubMed Central

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electrophoretic system uses a refillable polymer that both coats the capillary wall to suppress electro-osmotic flow and acts as the sieving matrix. The addition of 8 M urea to the polymer solution, as in slab gel electrophoresis, is insufficient to fully denature some anomalously migrating ssDNA fragments in this capillary electrophoresis system. The sizing accuracy of these fragments is significantly improved by the addition of 2-pyrrolidinone, or increased capillary temperature (60 degrees C). the effect of these two denaturing strategies is additive, and the best accuracy and precision in sizing results are obtained with a combination of chemical and thermal denaturation. PMID:9380518

  20. BRCA2 diffuses as oligomeric clusters with RAD51 and changes mobility after DNA damage in live cells

    PubMed Central

    Reuter, Marcel; Zelensky, Alex; Smal, Ihor; Meijering, Erik; van Cappellen, Wiggert A.; de Gruiter, H. Martijn; van Belle, Gijsbert J.; van Royen, Martin E.; Houtsmuller, Adriaan B.; Essers, Jeroen; Kanaar, Roland

    2014-01-01

    Genome maintenance by homologous recombination depends on coordinating many proteins in time and space to assemble at DNA break sites. To understand this process, we followed the mobility of BRCA2, a critical recombination mediator, in live cells at the single-molecule level using both single-particle tracking and fluorescence correlation spectroscopy. BRCA2-GFP and -YFP were compared to distinguish diffusion from fluorophore behavior. Diffusive behavior of fluorescent RAD51 and RAD54 was determined for comparison. All fluorescent proteins were expressed from endogenous loci. We found that nuclear BRCA2 existed in oligomeric clusters, and exhibited heterogeneous mobility. DNA damage increased BRCA2 transient binding, presumably including binding to damaged sites. Despite its very different size, RAD51 displayed mobility similar to BRCA2, which indicates physical interaction between these proteins both before and after induction of DNA damage. We propose that BRCA2-mediated sequestration of nuclear RAD51 serves to prevent inappropriate DNA interactions and that all RAD51 is delivered to DNA damage sites in association with BRCA2. PMID:25488918

  1. Characterization of DNA recognition by the human UV-damaged DNA-binding protein.

    PubMed

    Fujiwara, Y; Masutani, C; Mizukoshi, T; Kondo, J; Hanaoka, F; Iwai, S

    1999-07-01

    The UV-damaged DNA-binding (UV-DDB) protein is the major factor that binds DNA containing damage caused by UV radiation in mammalian cells. We have investigated the DNA recognition by this protein in vitro, using synthetic oligonucleotide duplexes and the protein purified from a HeLa cell extract. When a 32P-labeled 30-mer duplex containing the (6-4) photoproduct at a single site was used as a probe, only a single complex was detected in an electrophoretic mobility shift assay. It was demonstrated by Western blotting that both of the subunits (p48 and p127) were present in this complex. Electrophoretic mobility shift assays using various duplexes showed that the UV-DDB protein formed a specific, high affinity complex with the duplex containing an abasic site analog, in addition to the (6-4) photoproduct. By circular permutation analyses, these DNA duplexes were found to be bent at angles of 54 degrees and 57 degrees in the complexes with this protein. From the previously reported NMR studies and the fluorescence resonance energy transfer experiments in the present study, it can be concluded that the UV-DDB protein binds DNA that can be bent easily at the above angle. PMID:10391953

  2. Electrophoretic karyotypes of clinical isolates of Coccidioides immitis.

    PubMed Central

    Pan, S; Cole, G T

    1992-01-01

    Chromosomes of the fungal respiratory pathogen, Coccidioides immitis, were separated by contour-clamped homogeneous electric field gel electrophoresis. Twelve isolates were examined, the majority of which showed four chromosomes with a range of molecular size from 11.5 to 3.2 Mb. Three isolates (C634, C735, and L) revealed three chromosomal bands under the conditions employed for electrophoretic separation. However, in two of these isolates (C634 and C735), four chromosomes were visible on membrane transfers of pulsed-field gels after Southern hybridization between the chromosomal DNA and selected DNA probes. The probes included a conserved ribosomal gene and three previously described cDNAs isolated from C. immitis expression libraries. The L isolate was determined to have the same genome size as a typical four-chromosome isolate on the basis of microspectrophotometric comparison of fluorescence intensity of the ethidium bromide-stained nuclear DNA. The genome size of C. immitis determined by microspectrophotometry was approximately 28.2 +/- 2.6 Mb. The calculated genome size based on addition of the average molecular weights of chromosomal bands separated by contour-clamped homogeneous electric field gel electrophoresis was approximately equal to the estimate derived from the spectrophotometric analyses. This is the first report of the electrophoretic karyotype of C. immitis. Images PMID:1398998

  3. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin analysis system is a device that electrophoretically separates and identifies normal and...

  4. Direct Probing of Solvent Accessibility and Mobility at the Binding Interface of Polymerase (Dpo4)-DNA Complex

    NASA Astrophysics Data System (ADS)

    Qin, Yangzhong; Zhong, Dongping

    2014-03-01

    Water plays essential structural and dynamical roles in protein-DNA recognition through contributing to enthalpic or entropic stabilization of binding complex and by mediating intermolecular interactions and fluctuations for biological function. These interfacial water molecules are confined in nanospace but mostly highly mobile. Here, we report our studies of interfacial water dynamics in the binary and ternary complexes of a polymerase (Dpo4) with DNA and an incoming nucleotide using a site-specific tryptophan probe with femtosecond resolution. By systematic comparison of the interfacial water motions and local sidechain fluctuations in the apo, binary and ternary states of Dpo4, we observed that the DNA binding interface and active site is dynamically solvent accessible and the interfacial water dynamics are slightly slow but similar to the surface hydration water fluctuations on picosecond time scales. Our MD simulations also show the binding interface full of water molecules and nonspecific weak interactions with protein and DNA. Such a fluid binding interface facilitates the polymerase sliding on DNA for fast translocation while the spacious and mobile hydrated active site contributes to the low fidelity of the lesion-bypass Y-family DNA polymerase.

  5. Cohesin phosphorylation and mobility of SMC1 at ionizing radiation-induced DNA double-strand breaks in human cells

    SciTech Connect

    Bauerschmidt, Christina; Helleday, Thomas

    2011-02-01

    Cohesin, a hetero-tetrameric complex of SMC1, SMC3, Rad21 and Scc3, associates with chromatin after mitosis and holds sister chromatids together following DNA replication. Following DNA damage, cohesin accumulates at and promotes the repair of DNA double-strand breaks. In addition, phosphorylation of the SMC1/3 subunits contributes to DNA damage-induced cell cycle checkpoint regulation. The aim of this study was to determine the regulation and consequences of SMC1/3 phosphorylation as part of the cohesin complex. We show here that the ATM-dependent phosphorylation of SMC1 and SMC3 is mediated by H2AX, 53BP1 and MDC1. Depletion of RAD21 abolishes these phosphorylations, indicating that only the fully assembled complex is phosphorylated. Comparison of wild type SMC1 and SMC1S966A in fluorescence recovery after photo-bleaching experiments shows that phosphorylation of SMC1 is required for an increased mobility after DNA damage in G2-phase cells, suggesting that ATM-dependent phosphorylation facilitates mobilization of the cohesin complex after DNA damage.

  6. Changes in chromatin structure and mobility in living cells at sites of DNA double-strand breaks.

    PubMed

    Kruhlak, Michael J; Celeste, Arkady; Dellaire, Graham; Fernandez-Capetillo, Oscar; Müller, Waltraud G; McNally, James G; Bazett-Jones, David P; Nussenzweig, André

    2006-03-13

    The repair of DNA double-strand breaks (DSBs) is facilitated by the phosphorylation of H2AX, which organizes DNA damage signaling and chromatin remodeling complexes in the vicinity of the lesion. The disruption of DNA integrity induces an alteration of chromatin architecture that has been proposed to activate the DNA damage transducing kinase ataxia telangiectasia mutated. However, little is known about the physical properties of damaged chromatin. In this study, we use a photoactivatable version of GFP-tagged histone H2B to examine the mobility and structure of chromatin containing DSBs in living cells. We find that chromatin containing DSBs exhibits limited mobility but undergoes an energy-dependent local expansion immediately after DNA damage. The localized expansion observed in real time corresponds to a 30-40% reduction in the density of chromatin fibers in the vicinity of DSBs, as measured by energy-filtering transmission electron microscopy. The observed opening of chromatin occurs independently of H2AX and ATM. We propose that localized adenosine triphosphate-dependent decondensation of chromatin at DSBs establishes an accessible subnuclear environment that facilitates DNA damage signaling and repair. PMID:16520385

  7. CAPILLARY ELECTROPHORETIC BEHAVIOR OF SEVEN SULFONYLUREAS

    EPA Science Inventory

    The electrophoretic behavior of bensulfuron Me, sulfometuron Me, nicosulfuron (Accent), chlorimuron Et, thifensulfuron Me (Harmony), metsulfuron Me, and chlorsulfuron was studied under capillary zone electrophoresis (CZE) and micellar electrokinetic chromatography (MEKC) conditio...

  8. Properties of electrophoretic fractions of human embryonic kidney cells separated on space shuttle flight STS-8

    NASA Technical Reports Server (NTRS)

    Morrison, D. R.; Lewis, M. L.; Barlow, G. H.; Todd, P. W.; Kunze, M. E.; Sarnoff, B. E.; Li, Z. K.

    1985-01-01

    Suspensions of cultured primary human embryonic kidney cells were subjected to continuous flow electrophoresis on Space Shuttle flight STS-8. The objectives of the experiments were to obtain electrophoretically separated fractions of the original cell populations and to test these fractions for the amount and kind of urokinase (a kidney plasminogen activator that is used medically for digesting blood clots), the morphologies of cells in the individual fractions, and their cellular electrophoretic mobilities after separation and subsequent proliferation. Individual fractions were successfully cultured after return from orbit, and they were found to differ substantially from one another and from the starting sample with respect to all of these properties.

  9. Properties of electrophoretic fractions of human embryonic kidney cells separated on space shuttle flight STS-8

    NASA Astrophysics Data System (ADS)

    Morrison, Dennis R.; Lewis, Marian L.; Barlow, Grant H.; Todd, Paul; Kunze, M. Elaine; Sarnoff, Burton E.; Li, Zhankui

    Suspensions of cultured primary human embryonic kidney cells were subjected to continuous flow electrophoresis on Space Shuttle flight STS-8. The objectives of the experiments were to obtain electrophoretically separated fractions of the original cell populations and to test these fractions for the amount and kind of urokinase (a kidney plasminogen activator that is used medically for digesting blood clots), the morphologies of cells in the individual fractions, and their cellular electrophoretic mobilities after separation and subsequent proliferation. Individual fractions were successfully cultured after return from orbit, and they were found to differ substantially from one another and from the starting sample with respect to all of these properties.

  10. Automated Parallel Capillary Electrophoretic System

    DOEpatents

    Li, Qingbo; Kane, Thomas E.; Liu, Changsheng; Sonnenschein, Bernard; Sharer, Michael V.; Kernan, John R.

    2000-02-22

    An automated electrophoretic system is disclosed. The system employs a capillary cartridge having a plurality of capillary tubes. The cartridge has a first array of capillary ends projecting from one side of a plate. The first array of capillary ends are spaced apart in substantially the same manner as the wells of a microtitre tray of standard size. This allows one to simultaneously perform capillary electrophoresis on samples present in each of the wells of the tray. The system includes a stacked, dual carousel arrangement to eliminate cross-contamination resulting from reuse of the same buffer tray on consecutive executions from electrophoresis. The system also has a gel delivery module containing a gel syringe/a stepper motor or a high pressure chamber with a pump to quickly and uniformly deliver gel through the capillary tubes. The system further includes a multi-wavelength beam generator to generate a laser beam which produces a beam with a wide range of wavelengths. An off-line capillary reconditioner thoroughly cleans a capillary cartridge to enable simultaneous execution of electrophoresis with another capillary cartridge. The streamlined nature of the off-line capillary reconditioner offers the advantage of increased system throughput with a minimal increase in system cost.

  11. Reduced graphene oxide-functionalized high electron mobility transistors for novel recognition pattern label-free DNA sensors.

    PubMed

    Zhang, Xiaohui; Zhang, Yue; Liao, Qingliang; Song, Yu; Ma, Siwei

    2013-12-01

    We designed and constructed reduced graphene oxide (rGO) functionalized high electron mobility transistor (HEMT) for rapid and ultra-sensitive detection of label-free DNA in real time. The micrometer sized rGO sheets with structural defects helped absorb DNA molecules providing a facile and robust approach to functionalization. DNA was immobilized onto the surface of HEMT gate through rGO functionalization, and changed the conductivity of HEMT. The real time monitor and detection of DNA hybridization by rGO functionalized HEMT presented interesting current responses: a "two steps" signal enhancement in the presence of target DNA; and a "one step" signaling with random DNA. These two different recognition patterns made the HEMT capable of specifically detecting target DNA sequence. The working principle of the rGO functionalized HEMT can be demonstrated as the variation of the ambience charge distribution. Furthermore, the as constructed DNA sensors showed excellent sensitivity of detect limit at 0.07 fM with linear detect range from 0.1 fM to 0.1 pM. The results indicated that the HEMT functionalized with rGO paves a new avenue to design novel electronic devices for high sensitive and specific genetic material assays in biomedical applications. PMID:23828864

  12. EMSA Analysis of DNA Binding By Rgg Proteins

    PubMed Central

    LaSarre, Breah; Federle, Michael J.

    2016-01-01

    In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases).

  13. Preferential binding of high mobility group 1 protein to UV-damaged DNA. Role of the COOH-terminal domain.

    PubMed

    Pasheva, E A; Pashev, I G; Favre, A

    1998-09-18

    Binding of chromosomal high mobility group 1 protein (HMG1) to UV-damaged DNA has been studied with oligonucleotides containing a single dipyrimidine site for formation of UV photolesions. Irradiation of an oligonucleotide with unique TT dinucleotide resulted in generation of cyclobutane pyrimidine dimer with no evidence for induction of (6-4) photoproducts, whereas the analysis of irradiated TC-containing oligonucleotide detected (6-4) photoproducts but not cyclobutane pyrimidine dimers. Mobility shift assays have revealed that HMG1 protein binds preferentially to irradiated TT and TC oligonucleotides. Photoreversal of cyclobutane pyrimidine dimers with DNA photolyase and hydrolysis of the (6-4) photoproducts with hot alkali substantially reduced but did not eliminate binding of HMG1. The protein, therefore, appears to bind the two main types of UV damages in DNA, but some other photolesion(s) contributes to the preferential binding of HMG1 to irradiated DNA. By quantifying gel shift assays and considering the efficiencies of lesion formation, we determined dissociation constants of 1.2 +/- 0.5 and 4.0 +/- 1.5 microM for irradiated TT and TC oligonucleotides, respectively, and 70 +/- 20 microM for the control non-irradiated probes. Tryptic removal of the acidic COOH-terminal domain of HMG1 significantly affected binding of the protein to both irradiated and intact oligonucleotides. The potential role of HMG1 in recognition of the UV lesions in DNA is discussed. PMID:9733773

  14. Direct Probing of Solvent Accessibility and Mobility at the Binding Interface of Polymerase (Dpo4)-DNA Complex

    PubMed Central

    Qin, Yangzhong; Yang, Yi; Zhang, Luyuan; Fowler, Jason D.; Qiu, Weihong; Wang, Lijuan; Suo, Zucai; Zhong, Dongping

    2014-01-01

    Water plays essential structural and dynamical roles in protein-DNA recognition through contributing to enthalpic or entropic stabilization of binding complex and by mediating intermolecular interactions and fluctuations for biological function. These interfacial water molecules are confined by the binding partners in nanospace but in many cases they are highly mobile and exchange with outside bulk solution. Here, we report our studies of the interfacial water dynamics in the binary and ternary complexes of a polymerase (Dpo4) with DNA and an incoming nucleotide using a site-specific tryptophan probe with femtosecond resolution. By systematic comparison of the interfacial water motions and local sidechain fluctuations in the apo, binary and ternary states of Dpo4, we observed that the DNA binding interface and active site is dynamically solvent accessible and the interfacial water dynamics are similar to the surface hydration water fluctuations on picosecond time scales. Our molecular dynamics simulations also show the binding interface full of water molecules and nonspecific weak interactions. Such a fluid binding interface facilitates the polymerase sliding on DNA for fast translocation while the spacious and mobile hydrated active site contributes to the low fidelity of the lesion-bypass Y-family DNA polymerase. PMID:24308461

  15. Methylated DNA-binding protein is present in various mammalian cell types

    SciTech Connect

    Supakar, P.C.; Weist, D.; Zhang, D.; Inamdar, N.; Zhang, Xianyang; Khan, R.; Ehrlich, M. ); Ehrlich, K.C. )

    1988-08-25

    A DNA-binding protein from human placenta, methylated DNA-binding protein (MDBP), binds to certain DNA sequences only when they contain 5-methylcytosine (m{sup 5}C) residues at specific positions. The authors found a very similar DNA-binding activity in nuclear extracts of rat tissues, calf thymus, human embryonal carcinoma cells, HeLa cells, and mouse LTK cells. Like human placental MDBP, the analogous DNA-binding proteins from the above mammalian cell lines formed a number of different low-electrophoretic-mobility complexes with a 14-bp MDBP-specific oligonucleotide duplex. All of these complexes exhibited the same DNA methylation specificity and DNA sequence specificity. Although MDBP activity was found in various mammalian cell types, it was not detected in extracts of cultured mosquito cells and so may be associated only with cells with vertebrate-type DNA methylation.

  16. Study of the Electrophoretic Behavior of Cephalosporins by Capillary Zone Electrophoresis

    PubMed Central

    Hancu, Gabriel; Sasebeşi, Adina; Rusu, Aura; Kelemen, Hajnal; Ciurba, Adriana

    2015-01-01

    Purpose: The aim of the study was the characterization of the electrophoretic behavior of cephalosporins from different generation having different structural characteristics in order to develop a rapid, simple and efficient capillary electrophoretic method for their identification and simultaneous separation from complex mixtures. Methods: Ten cephalosporin derivatives (cefaclor, cefadroxil, cefalexin, cefazolin, cefoxitin, cefuroxime, cefoperazone, cefotaxime, ceftazidime, ceftriaxone) were analyzed by capillary zone electrophoresis using different background electrolyte solutions at different pH values. Electrophoretic mobilities of the analytes were calculated, the influence of the electrophoretic parameteres on the separation was established and the analytical conditions were optimized. Results: Taking into consideration their structural and chemical properties cephalosporins can be detected over a pH range between 6 and 10. The best results were obtained using a buffer solution containing 25 mM disodium hydrogenophosphate - 25 mM sodium dihydrogenophosphate, at a pH – 7.00, + 25 kV voltage at a temperature of 25 °C, UV detection at 210 nm. Using the optimized analytical conditions we achieved the simultaneous baseline separation for seven cephalosporins in less then 10 minutes. Conclusion: Using the described optimized electrophoretic procedures, capillary electrophoresis can be used for the identification and determination of cephalosporins in formulated pharmaceutical products and for their separation from complex mixtures. PMID:26236661

  17. Yeast high mobility group protein HMO1 stabilizes chromatin and is evicted during repair of DNA double strand breaks

    PubMed Central

    Panday, Arvind; Xiao, LiJuan; Grove, Anne

    2015-01-01

    DNA is packaged into condensed chromatin fibers by association with histones and architectural proteins such as high mobility group (HMGB) proteins. However, this DNA packaging reduces accessibility of enzymes that act on DNA, such as proteins that process DNA after double strand breaks (DSBs). Chromatin remodeling overcomes this barrier. We show here that the Saccharomyces cerevisiae HMGB protein HMO1 stabilizes chromatin as evidenced by faster chromatin remodeling in its absence. HMO1 was evicted along with core histones during repair of DSBs, and chromatin remodeling events such as histone H2A phosphorylation and H3 eviction were faster in absence of HMO1. The facilitated chromatin remodeling in turn correlated with more efficient DNA resection and recruitment of repair proteins; for example, inward translocation of the DNA-end-binding protein Ku was faster in absence of HMO1. This chromatin stabilization requires the lysine-rich C-terminal extension of HMO1 as truncation of the HMO1 C-terminal tail phenocopies hmo1 deletion. Since this is reminiscent of the need for the basic C-terminal domain of mammalian histone H1 in chromatin compaction, we speculate that HMO1 promotes chromatin stability by DNA bending and compaction imposed by its lysine-rich domain and that it must be evicted along with core histones for efficient DSB repair. PMID:25979266

  18. Cell electrophoretic characterization of peripheral blood lymphocyte subpopulations enriched by rosette formation, from normal individuals and CLL patients.

    PubMed

    Rychly, J; Babusíková, O; Koníková, E; Anders, O

    1984-01-01

    Peripheral blood lymphocytes from healthy subjects and patients with chronic lymphatic leukemia (CLL) were isolated and their subpopulations enriched through formation of spontaneous rosettes with sheep or mouse red blood cells, respectively. Electrophoretic measurements were performed in unseparated as well as in fractionated cell populations. Normal blood lymphocytes showed two clearly distinguishable populations of different electrophoretic mobilities. After separation by SRBC rosette formation the rosette-forming cells could be identified as high mobility cells. CLL lymphocytes showed in most cases an unimodally distributed cytopherogram, the mean electrophoretic mobility being intermediate between the low and high mobility cells of control persons. After separation through mouse erythrocytes rosette formation these cells contained two cell fractions differing in their electrophoretic mobility: a fraction of slower mouse rosette-forming cells and a fraction of the non-MRFC which contained mainly cells of higher mobility that could be identified as enriched T cells. These both fractions showed unimodal distributions. This study shows that CLL lymphocyte subpopulations can be further characterized by surface charge density. PMID:6700796

  19. Tunable electrophoretic separations using a scalable, fabric-based platform.

    PubMed

    Narahari, Tanya; Dendukuri, Dhananjaya; Murthy, Shashi K

    2015-02-17

    There is a rising need for low-cost and scalable platforms for sensitive medical diagnostic testing. Fabric weaving is a mature, scalable manufacturing technology and can be used as a platform to manufacture microfluidic diagnostic tests with controlled, tunable flow. Given its scalability, low manufacturing cost (<$0.25 per device), and potential for patterning multiplexed channel geometries, fabric is a viable platform for the development of analytical devices. In this paper, we describe a fabric-based electrophoretic platform for protein separation. Appropriate yarns were selected for each region of the device and weaved into straight channel electrophoretic chips in a single step. A wide dynamic range of analyte molecules ranging from small molecule dyes (<1 kDa) to macromolecule proteins (67-150 kDa) were separated in the device. Individual yarns behave as a chromatographic medium for electrophoresis. We therefore explored the effect of yarn and fabric parameters on separation resolution. Separation speed and resolution were enhanced by increasing the number of yarns per unit area of fabric and decreasing yarn hydrophilicity. However, for protein analytes that often require hydrophilic, passivated surfaces, these effects need to be properly tuned to achieve well-resolved separations. A fabric device tuned for protein separations was built and demonstrated. As an analytical output parameter for this device, the electrophoretic mobility of a sedimentation marker, Naphthol Blue Black bovine albumin in glycine-NaOH buffer, pH 8.58 was estimated and found to be -2.7 × 10(-8) m(2) V(-1) s(-1). The ability to tune separation may be used to predefine regions in the fabric for successive preconcentrations and separations. The device may then be applied for the multiplexed detection of low abundance proteins from complex biological samples such as serum and cell lysate. PMID:25582166

  20. The high-mobility group protein T160 binds to both linear and cruciform DNA and mediates DNA bending as determined by ring closure.

    PubMed

    Gariglio, M; Ying, G G; Hertel, L; Gaboli, M; Clerc, R G; Landolfo, S

    1997-11-01

    The high-mobility group protein T160 was isolated by screening a phage library from a murine pre-B-cell line L1210. South-Western experiments have previously shown that this protein binds to V-(D)-J recombination signal sequences, suggesting that it may be a sequence-specific DNA-binding protein. However, neither gel-shift nor footprinting analyses have been successfully employed with the T160 protein, despite an extensive effort. In this study, the T160 protein or truncated forms made soluble through denaturing and renaturing cycles in urea were successfully used in gel-shift experiments showing that T160 binds to cruci-form or linear duplex DNA with no apparent sequence specificity. Furthermore, fragments longer than 100 bp efficiently formed covalently closed circular monomers in the presence of T160 and T4 DNA ligase, indicating that the protein is capable of introducing bends into the duplex. Last, tissue distribution by Western blotting analysis showed that the T160 protein is expressed in various murine tissues in addition to those of lymphoid origin. Considering its broad evolutionary conservation (from plants to mammals) also, these results suggest that the functional role of the T160 protein is not limited to V-(D)-J recombination, but might be involved in basic processes such as DNA replication and repairing, where irregular DNA structures are generated and very likely recognized by HMG domain proteins. PMID:9367632

  1. Numerical investigation of molecular nano-array in potential-energy profile for a single dsDNA.

    PubMed

    Alishahi, Marzieh; Kamali, Reza; Abouali, Omid

    2016-04-01

    A Rigorous numerical investigation on dsDNA translocation in quasi-2-dimensional nano-array filter is performed using Molecular Dynamics (MD) method. Various dsDNA molecules with different sizes are chosen in order to model Ogston sieving in a nano-array filter. The radius of gyration of dsDNA molecule is less than the characteristic length of the shallow region in nano-array. The dsDNA molecule is assumed to be in the 0.05M NaCl electrolyte. MD shows acceptable results for potential-energy profile for nano-array filter. According to the MD outcomes, the dsDNA electrophoretic mobility decreases almost linearly with dsDNA size and show the same trend as Ogston sieving for gel electrophoresis. In addition, different shapes for nano-array filter are studied for a unique dsDNA molecule. It is concluded that steeping the nano-array wall can cause the retardation of dsDNA translocation and decreases dsDNA electrophoretic mobility. PMID:27125679

  2. Electrophoretic characterization of insulin growth factor (IGF-1) functionalized magnetic nanoparticles.

    PubMed

    Viota, Julián L; Rudzka, Katarzyna; Trueba, Ángel; Torres-Aleman, Ignacio; Delgado, Ángel V

    2011-05-17

    The synthesis of composite nanoparticles consisting of a magnetite core coated with a layer of the hormone insulin growth factor 1 (IGF-1) is described. The adsorption of the hormone in the different formulations is first studied by electrophoretic mobility measurements as a function of pH, ionic strength, and time. Because of the permeable character expected for both citrate and IGF-1 coatings surrounding the magnetite cores, an appropriate analysis of their electrophoretic mobility must be addressed. Recent developments of electrokinetic theories for particles covered by soft surface layers have rendered possible the evaluation of the softness degree from raw electrophoretic mobility data. In the present contribution, the data are quantitatively analyzed based on the theoretical model of the electrokinetics of soft particles. As a result, information is obtained on both the thickness and the charge density of the surrounding layer. It is shown that IGF-1 adsorbs onto the surface of citrate-coated magnetite nanoparticles, and adsorption is confirmed by dot-blot analysis. In addition, it is also demonstrated that the external layer of IGF-1 exerts a shielding effect on the surface charge of citrate-magnetite particles, as suggested by the mobility reduction upon contacting the particles with the hormone. Aging effects are demonstrated, providing an electrokinetic fingerprint of changes in adsorbed protein configuration with time. PMID:21506536

  3. Connections between RNA splicing and DNA intron mobility in yeast mitochondria: RNA maturase and DNA endonuclease switching experiments.

    PubMed Central

    Goguel, V; Delahodde, A; Jacq, C

    1992-01-01

    The intron-encoded proteins bI4 RNA maturase and aI4 DNA endonuclease can be faithfully expressed in yeast cytoplasm from engineered forms of their mitochondrial coding sequences. In this work we studied the relationships between these two activities associated with two homologous intron-encoded proteins: the bI4 RNA maturase encoded in the fourth intron of the cytochrome b gene and the aI4 DNA endonuclease (I-SceII) encoded in the fourth intron of the gene coding for the subunit I of cytochrome oxidase. Taking advantage of both the high recombinogenic properties of yeast and the similarities between the two genes, we constructed in vivo a family of hybrid genes carrying parts of both RNA maturase and DNA endonuclease coding sequences. The presence of a sequence coding for a mitochondrial targeting peptide upstream from these hybrid genes allowed us to study the properties of their translation products within the mitochondria in vivo. We thus could analyze the ability of the recombinant proteins to complement RNA maturase deficiencies in different strains. Many combinations of the two parental intronic sequences were found in the recombinants. Their structural and functional analysis revealed the following features. (i) The N-terminal half of the bI4 RNA maturase could be replaced in total by its equivalent from the aI4 DNA endonuclease without affecting the RNA maturase activity. In contrast, replacing the C-terminal half of the bI4 RNA maturase with its equivalent from the aI4 DNA endonuclease led to a very weak RNA maturase activity, indicating that this region is more differentiated and linked to the maturase activity. (ii) None of the hybrid proteins carrying an RNA maturase activity kept the DNA endonuclease activity, suggesting that the latter requires the integrity of the aI4 protein. These observations are interesting because the aI4 DNA endonuclease is known to promote the propagation, at the DNA level, of the aI4 intron, whereas the bI4 RNA maturase

  4. Development of microfluidic modules for DNA purification via phenol extraction and analyte concentration using transverse electrokinetics

    NASA Astrophysics Data System (ADS)

    Morales, Mercedes C.

    In this work, microfluidic platforms have been designed and evaluated to demonstrate microscale DNA purification via organic (phenol) extraction as well as analyte trapping and concentration using a transverse electrokinetic force balance. First, in order to evaluate DNA purification via phenol extraction in a microdevice, an aqueous phase containing protein and DNA and an immiscible receiving organic phase were utilized to evaluate microfluidic DNA extraction under both stratified and droplet-based flow conditions using a serpentine microfluidic device. The droplet based flow resulted in a significant improvement of protein partitioning from the aqueous phase due to the flow recirculation inside each droplet improving material convective transport into the organic phase. The plasmid recovery from bacterial lysates using droplet-based flow was high (>92%) and comparable to the recovery achieved using commercial DNA purification kits and standard macroscale phenol extraction. Second, a converging Y-inlet microfluidic channel with integrated coplanar electrodes was used to investigate transverse DNA and protein migration under uniform direct current (DC) electric fields. Negatively charged samples diluted in low and high ionic strength buffers were co-infused with a receiving buffer of the same ionic strength into a main channel where transverse electric fields were applied. Experimental results demonstrated that charged analytes could traverse the channel width and accumulate at the positive bias electrode in a low electroosmotic mobility and high electrophoretic mobility condition (high ionic strength buffer) or migrated towards an equilibrium position within the channel when both electroosmotic mobility and electrophoretic mobility are high (low ionic strength buffer). The different behaviors are the result of a balance between the electrophoretic force and a drag force induced by a recirculating electroosmotic flow generated across the channel width due to the

  5. Combined electrophoretic-separation and electrospray method and system

    DOEpatents

    Smith, Richard D.; Olivares, Jose A.

    1989-01-01

    A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5-100 KVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., .+-.2-8 KVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit.

  6. Preparation of guinea pig macrophage for electrophoretic experiments in space

    NASA Technical Reports Server (NTRS)

    1979-01-01

    Methods of storage and cultivation of macrophage cells in preparation for space experiments were investigated. Results show that freezing and thawing immediately after extraction did not cause any change in viability or electrophoretic mobility of the cells. A prolonged storage at -80 C did cause cell damage as indicated by a 95% reduction in variable cells. Cell damage was decreased when Glycerol or Dimethyl Sulfoxide (DMSO) was added as a cryogenic protective agent. A 100% viability was observed in cultivation experiments after two weeks due to the additional serum. Results from gamma-glutamyl transpeptidase study showed a zero activity rate. It is suggested that a flat stationary field be used for the collection and use of macrophage. It was found that a 24-hour delay in obtaining macrophage cells helps to maintain a pure culture.

  7. Combined electrophoretic-separation and electrospray method and system

    DOEpatents

    Smith, R.D.; Olivares, J.A.

    1989-06-27

    A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5--100 kVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., [+-]2--8 kVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit. 10 figs.

  8. The 2100MHz radiofrequency radiation of a 3G-mobile phone and the DNA oxidative damage in brain.

    PubMed

    Sahin, Duygu; Ozgur, Elcin; Guler, Goknur; Tomruk, Arın; Unlu, Ilhan; Sepici-Dinçel, Aylin; Seyhan, Nesrin

    2016-09-01

    We aimed to evaluate the effect of 2100MHz radiofrequency radiation emitted by a generator, simulating a 3G-mobile phone on the brain of rats during 10 and 40 days of exposure. The female rats were randomly divided into four groups. Group I; exposed to 3G modulated 2100MHz RFR signal for 6h/day, 5 consecutive days/wk for 2 weeks, group II; control 10 days, were kept in an inactive exposure set-up for 6h/day, 5 consecutive days/wk for 2 weeks, group III; exposed to 3G modulated 2100MHz RFR signal for 6h/day, 5 consecutive days/wk for 8 weeks and group IV; control 40 days, were kept in an inactive exposure set-up for 6h/day, 5 consecutive days/wk for 8 weeks. After the genomic DNA content of brain was extracted, oxidative DNA damage (8-hydroxy-2'deoxyguanosine, pg/mL) and malondialdehyde (MDA, nmoL/g tissue) levels were determined. Our main finding was the increased oxidative DNA damage to brain after 10 days of exposure with the decreased oxidative DNA damage following 40 days of exposure compared to their control groups. Besides decreased lipid peroxidation end product, MDA, was observed after 40 days of exposure. The measured decreased quantities of damage during the 40 days of exposure could be the means of adapted and increased DNA repair mechanisms. PMID:26775761

  9. Mobilization of copper ions in human peripheral lymphocytes by catechins leading to oxidative DNA breakage: A structure activity study.

    PubMed

    Farhan, Mohd; Zafar, Atif; Chibber, Sandesh; Khan, Husain Yar; Arif, Hussain; Hadi, S M

    2015-08-15

    Epidemiological studies suggest that dietary consumption of plant polyphenols is related to a lower incidence of various cancers. Among these compounds catechins (present in green tea and other beverages) are considered to be potent inducers of apoptosis and cytotoxicity to cancer cells. Thus these compounds can be used as leads to synthesize novel anticancer drugs with greater bioavailability. In view of this in this paper we have examined the chemical basis of cytotoxicity of catechins by studying the structure-activity relationship between catechin (C), epicatechin (EC), epigallocatechin (EGC) and epigallocatechin-3-gallate (EGCG). Using single cell alkaline gel electrophoresis (comet assay) we have established the relative efficiency of cellular DNA breakage as EGCG>EGC>EC>C. We also show that cellular DNA breakage is the result of mobilization of copper ions bound to chromatin and the generation of reactive oxygen species. Further the relative DNA binding affinity order was confirmed using molecular docking and thermodynamic studies by studying the interaction of catechins with calf thymus DNA. The results suggest that the synthesis of any novel anti cancer molecule based on the structure of catechins should have as many galloyl moieties as possible resulting in an increased number of hydroxyl groups that may facilitate the binding of the molecule to cellular DNA. PMID:26142371

  10. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    PubMed Central

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  11. Electrophoretic purification of cells in space - Evaluation of results from STS-3

    NASA Technical Reports Server (NTRS)

    Sarnoff, B. E.; Kunze, M. E.; Todd, P.

    1983-01-01

    The procedure and results of Electrophoresis Equipment Verification Test, designed to examine electrophoretic behavior of animal cells is suspension more concentrated than possible on earth and flown on the Shuttle flight STS-3, were discussed. Ground-based laboratory values of electrophoretic mobilities of a mixture of human and rabbit aldehyde-fixed red blood cells (RBC) were compared with those recorded at 11 minute intervals on the Shuttle STS-3. RBC migration and separation observed through photographic records were not as expected. However, cell mobilities and migrating band profiles were consistent with the results of laboratory simulation experiments. It was concluded that zero G electrophoresis of very high concentrations (1 x 10 to the 9th) is possible and similar to electrophoresis of normal cell concentrations on earth.

  12. Gel Electrophoresis of Gold-DNA Nanoconjugates

    DOE PAGESBeta

    Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; Parak, W. J.

    2007-01-01

    Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

  13. The effect of pH on charge inversion and condensation of DNA.

    PubMed

    Guo, Zilong; Wang, Yanwei; Yang, Anthony; Yang, Guangcan

    2016-08-21

    Charge inversion and condensation of DNA in solutions of trivalent and quadrivalent counterions are significantly influenced by the pH value of the solution. We systematically investigated the condensation and charge compensation of DNA by spermidine, hexammine cobalt(iii) (cohex, [Co(NH3)6](3+)) and spermine in solutions of a wide range of pH values from 3 to 9.3 by dynamic light scattering, magnetic tweezers, and atomic force microscopy. In trivalent counterion solution, we found that there is a critical concentration (0.75 mM for cohex and 0.5 mM for spermidine), under which the electrophoresis mobility of DNA initially increases, reaches a maximum, and finally decreases when the pH value is decreased. In contrast, above the critical concentration, the electrophoretic mobility of DNA increases monotonously with decreasing pH value of the solution. The corresponding condensing force has the same dependence on the pH value. However, for the case of quadrivalent counterions, the electrophoretic mobility of DNA is monotonously promoted by lowering the pH value of the solution at any concentration of counterions in which charge inversion of DNA may occur. In atomic force microscopy images and force spectroscopy of magnetic tweezers, we found that maximal charge neutralization and condensation force correspond to the most compact DNA condensation. We propose a mechanism of promoting DNA charge neutralization: small and highly mobile hydrogen ions tend to attach to the DNA-counterion complex to further neutralize its remaining charge, which is related to the surface area of the complex. Therefore, this further neutralization is prominent when the complex is toroidal which corresponds to the case of mild ion concentration while it is less prominent for more compact globules or rod complexes at high counterion concentration. PMID:27427090

  14. Yield, Purity and Mobility of a Silver-DNA Fluorophore in Solution

    NASA Astrophysics Data System (ADS)

    O'Neill, Patrick; Velazquez, Lourdes; Goodwin, Peter; Driehorst, Til; Pennathur, Sumita; Fygenson, Deborah

    2010-03-01

    Chemical reduction of DNA oligonucleotide:Ag+ mixtures leads to the formation of fluorescent few-atom Ag clusters stabilized by the DNA. This reaction typically produces many species, some of which are fluorescent, with emission wavelengths and stabilities that vary widely with DNA sequence. While most DNA sequences studied produce many different Ag:DNA products, we identify a specific DNA sequence that strongly favors the formation of a green 11Ag cluster, stable for months under ambient conditions. We generate pure solutions of this emitter by synthesizing in the presence of excess silver and then removing free silver from solution. We report on results enabled by the purity of these samples, including determination of the extinction coefficient (using FCS), diffusion coefficient (using microfluidics) and bulk chemical yield of this fluorophore, and comment on the challenges that remain on the path to production of sufficient quantity and purity for high-resolution structure determination.

  15. Experimental strategies for cloning or identifying genes encoding DNA-binding proteins.

    PubMed

    Carey, Michael F; Peterson, Craig L; Smale, Stephen T

    2012-02-01

    This article describes experimental strategies for cloning or identifying genes encoding DNA-binding proteins. DNA-binding proteins are most commonly identified by electrophoretic mobility-shift assay (EMSA) or DNase I footprinting. To identify the gene encoding a protein detected by EMSA or DNase footprinting, the protein often needs to be purified and its sequence analyzed, as described here. Other methods are also available which do not resort to protein purification, including the one-hybrid screen, in vitro expression library screen, and mammalian expression cloning. These methods are outlined, and their advantages and disadvantages are discussed. PMID:22301659

  16. Method for in-situ calibration of electrophoretic analysis systems

    DOEpatents

    Liu, Changsheng; Zhao, Hequan

    2005-05-08

    An electrophoretic system having a plurality of separation lanes is provided with an automatic calibration feature in which each lane is separately calibrated. For each lane, the calibration coefficients map a spectrum of received channel intensities onto values reflective of the relative likelihood of each of a plurality of dyes being present. Individual peaks, reflective of the influence of a single dye, are isolated from among the various sets of detected light intensity spectra, and these can be used to both detect the number of dye components present, and also to establish exemplary vectors for the calibration coefficients which may then be clustered and further processed to arrive at a calibration matrix for the system. The system of the present invention thus permits one to use different dye sets to tag DNA nucleotides in samples which migrate in separate lanes, and also allows for in-situ calibration with new, previously unused dye sets.

  17. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study.

    PubMed

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-01-01

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure-activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids. PMID:26569217

  18. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study

    PubMed Central

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-01-01

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure–activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids. PMID:26569217

  19. B-DNA to Z-DNA structural transitions in the SV40 enhancer: stabilization of Z-DNA in negatively supercoiled DNA minicircles

    NASA Technical Reports Server (NTRS)

    Gruskin, E. A.; Rich, A.

    1993-01-01

    During replication and transcription, the SV40 control region is subjected to significant levels of DNA unwinding. There are three, alternating purine-pyrimidine tracts within this region that can adopt the Z-DNA conformation in response to negative superhelix density: a single copy of ACACACAT and two copies of ATGCATGC. Since the control region is essential for both efficient transcription and replication, B-DNA to Z-DNA transitions in these vital sequence tracts may have significant biological consequences. We have synthesized DNA minicircles to detect B-DNA to Z-DNA transitions in the SV40 enhancer, and to determine the negative superhelix density required to stabilize the Z-DNA. A variety of DNA sequences, including the entire SV40 enhancer and the two segments of the enhancer with alternating purine-pyrimidine tracts, were incorporated into topologically relaxed minicircles. Negative supercoils were generated, and the resulting topoisomers were resolved by electrophoresis. Using an anti-Z-DNA Fab and an electrophoretic mobility shift assay, Z-DNA was detected in the enhancer-containing minicircles at a superhelix density of -0.05. Fab saturation binding experiments demonstrated that three, independent Z-DNA tracts were stabilized in the supercoiled minicircles. Two other minicircles, each with one of the two alternating purine-pyrimidine tracts, also contained single Z-DNA sites. These results confirm the identities of the Z-DNA-forming sequences within the control region. Moreover, the B-DNA to Z-DNA transitions were detected at superhelix densities observed during normal replication and transcription processes in the SV40 life cycle.

  20. Electrophoretic mobility of magnetite particles in high temperature water

    SciTech Connect

    Vidojkovic, Sonja; Rodriguez-Santiago, V; Fedkin, Mark V.; Wesolowski, David J; Lvov, Serguei N.

    2011-01-01

    Magnetite(Fe3O4) isoneofthemostcommonoxidesformingdepositsandparticulatephasesin industrialhightemperaturewatercircuits.Itscolloidalcharacteristicsplayaprincipalroleinthe mechanismofdepositformationandcanbeusedascontrollingfactorstopreventorminimizedeposit formationanddamageofindustrialpipelinesduetounder-depositcorrosion.Inthisstudy,ahigh temperatureparticleelectrophoresistechniquewasemployedtomeasurethezetapotentialatthe magnetite/waterinterface the parameterthatcontrolscolloidalstabilityofparticles,theiraggrega- tion, anddeposition.Themeasurementsweremadeattemperaturesupto200 1C overawiderangeofpH. The isoelectricpointsofmagnetite,atwhichthedepositionofparticlesisincreased,weredeterminedatpH 6.35, 6.00,5.25,and5.05fortemperatures25,100,150,and200 1C, respectively.Theobserved temperaturedependenceofzetapotentialandtheisoelectricpHpointofmagnetitecanhelptoexplain the extentofinteractionsbetweenthecolloidalparticlesandthesteelwallsurfacesunderhydro- thermalconditions,andindicatemethodsforcontrollingandmitigatingoxidedepositioninhigh temperaturewatercycles.

  1. 8-Oxo-7, 8-dihydro-2'-deoxyguanosine as a biomarker of DNA damage by mobile phone radiation.

    PubMed

    Khalil, Ahmad M; Gagaa, M H; Alshamali, A M

    2012-07-01

    We examined the effect of exposure to mobile phone 1800 MHz radio frequency radiation (RFR) upon the urinary excretion of 8-oxo-7, 8-dihydro-2'-deoxyguanosine (8-oxodG), one major form of oxidative DNA damage, in adult male Sprague-Dawley rats. Twenty-four rats were used in three independent experiments (RFR exposed and control, 12 rats, each). The animals were exposed to RFR for 2 h from Global System for Mobile Communications (GSM) signal generator with whole-body-specific absorption rate of 1.0 W/kg. Urine samples were collected from the rat while housed in a metabolic cage during the exposure period over a 4-h period at 0.5, 1.0, 2.0 and 4.0 h from the beginning of exposure. In the control group, the signal generator was left in the turn-off position. The creatinine-standardized concentrations of 8-oxodG were measured. With the exception of the urine collected in the last half an hour of exposure, significant elevations were noticed in the levels of 8-oxodG in urine samples from rats exposed to RFR when compared to control animals. Significant differences were seen overall across time points of urine collection with a maximum at 1 h after exposure, suggesting repair of the DNA lesions leading to 8-oxodG formation. PMID:22249391

  2. Comparison of detection platforms and post-polymerase chain reaction DNA purification methods for use in conjunction with Cleavase fragment length polymorphism analysis.

    PubMed

    Sander, T; Olson, S; Hall, J; Siebert, M; Grooms, K; Heisler, L; de Arruda, M; Neri, B

    1999-06-01

    The removal of impurities and contaminants from PCR-amplified fragments is important for mutation detection methods which identify mutations based on shifts in electrophoretic mobility. This is particularly critical for assays and detection methods which use target DNA that is labeled prior to analysis and electrophoretic detection. We examined several procedures for purifying DNA amplified by the polymerase chain reaction (PCR) and their use in conjunction with a novel DNA scanning method, the Cleavase fragment length polymorphism (CFLP)* assay. In this study, a 480 bp DNA fragment, fluorescently labeled on the 5'-end of one strand, was amplified and subjected to various widely used purification procedures, including several commercially available clean-up kits. We demonstrate that visualization of the fluorescent label, as opposed to simple ethidium bromide staining, reveals the presence of considerable levels of labeled, truncated, amplification products. The various procedures were evaluated on the basis of their ability to remove these unwanted DNA fragments as well as on the degree to which they inhibited or promoted the CFLP reaction. Several procedures are recommended for use with CFLP analysis, including isopropanol precipitation, gel excision, and several commercially available spin columns. Concurrently, we evaluated (compared) a number of commonly used visualization platforms, including fluorescence imaging, chemiluminescence, and post-electrophoretic staining, for the ability to detect CFLP pattern changes. The advantages and disadvantages of different methods are discussed and amounts of DNA to be used for CFLP analysis on different detection platforms are recommended. PMID:10380752

  3. DNA electrophoresis in agarose gels: Effects of electric field and gel concentration on the exponential dependence of reciprocal mobility on DNA length

    NASA Astrophysics Data System (ADS)

    Beheshti, Afshin; van Winkle, David; Randolph, Rill

    2002-03-01

    Electrophoresis was performed on double stranded DNA fragments ranging in length from 200 bp to 48502 bp at agarose gel concentrations T = 0.5% - 1.5% and electric fields E = 0.71 V/cm to 5 V/cm. A wide range of electric fields and gel concentrations were used to find what range of conditions work with the new interpolation equation, 1/μ(L) = 1/μl - (1/μl - 1/μ_s)e^-L/γ. The equation fit extremely well (\\chi^2 >= 0.999) to data with E = 2.5 V/cm to 5 V/cm and for lower fields (E < 2.5 V/cm) at low gel concentrations (T = 0.5% and 0.7%). This exponential relation seemed to hold when there is a smooth transition from the Ogston sieving regime to the reptation regime when looking at the “reptation plots” (plotting 3μL/μo vs. L) (Rousseau, J., Drouin, G., and Slater, G. W., Phys Rev Lett. 1997, 79, 1945-1948). For separations of single-stranded DNA in polyacrylamide, similar reptation plots have a region with a negative slope between the Ogston sieving regime and the reptation regime which has been interpreted as the signature of entropic trapping. When separating double-stranded DNA in agarose it was observed that fits deviate from the data when three different slopes are observed in the reptation plots. Failure of the simple exponential relationship between reciprocal mobility and DNA length appears to be the consequence of entropic trapping.

  4. New reflective-type electrophoretic display

    NASA Astrophysics Data System (ADS)

    Orsaev, A. M.; Orsaev, T. M.; Gaev, D. S.

    2001-06-01

    Advantages and problems of the electrophoretic display design are considered. To increase its lifetime a new EPD version is proposed, and operation process is described. Main distinguish feature is the present of an agile film as the third electrode. Such a display can be manufactured on the base of standard technological processes and promises to be X-Y multiplex addressed, simple and cheap for manufacturing.

  5. A unified mathematical theory of electrophoretic processes

    NASA Technical Reports Server (NTRS)

    Bier, M.; Palusinski, O. A.; Mosher, R. A.; Graham, A.; Saville, D. A.

    1983-01-01

    A mathematical theory is presented which shows that each of the four classical electrophoretic modes (zone electrophoresis, moving boundary electrophoresis, isotachophoresis, and isoelectric focusing) is based on the same general principles and can collectively be described in terms of a single set of equations. This model can predict the evolution of the four electrophoretic modes as a function of time. The model system is one-dimensional, neglecting the effects of electroosmosis, temperature gradients, and any bulk flows of liquid. The model is based on equations which express the components' dissociation equilibria, the mass transport due to electromigration and diffusion, electroneutrality, and the conservation of mass and charge. The model consists of a system of coupled partial differential and nonlinear algebraic equations which can be solved numerically by use of a computer. The versatility of this model was verified using an example of a three-component system containing cacodylate, tris hydroxylmethylaminomethane, and histidine. Results show that this model not only correctly predicts the characteristic features of each electrophoretic mode, but also gives details of the concentration, pH, and conductivity profiles not easily amenable to direct experimental measurement.

  6. A novel DNA-binding protein from Campylobacter jejuni bacteriophage NCTC12673.

    PubMed

    Arutyunov, Denis; Szymanski, Christine M

    2015-11-01

    We previously suggested that the double-stranded genomic DNA of Campylobacter jejuni bacteriophage NCTC12673 was complexed with proteins. Mass spectrometry of peptides obtained from tryptic digests of purified phage DNA indicated that phage protein Gp001 co-purified with the DNA. Gp001 is an acidic protein that lacks any obvious homology or conserved domains found in known DNA-binding proteins. The DNA-binding ability of recombinant Gp001 was examined using an electrophoretic mobility shift assay. Slow DNA-Gp001 complex formation was observed at pH 5.5, but not at neutral or basic pH. This nucleoprotein complex had difficulty entering agarose gels used in the assay while proteinase K pretreatment released the DNA from the complex. No mobility shift was observed when the DNA was immediately subjected to electrophoresis after mixing with Gp001, even if both components were separately pre-incubated at pH 5.5. The complexed DNA was unable to transform chemically competent Escherichia coli cells and was less susceptible to degradation by nucleases. The formation of Gp001-DNA complexes at low pH may provide a mechanism for maintaining DNA integrity while the phage pursues its host through the gastrointestinal tract. Also, this feature can potentially be used to improve DNA delivery protocols applied in gene therapy. PMID:26363017

  7. DNA binding of Jun and Fos bZip domains: homodimers and heterodimers induce a DNA conformational change in solution.

    PubMed Central

    John, M; Leppik, R; Busch, S J; Granger-Schnarr, M; Schnarr, M

    1996-01-01

    We constructed plasmids encoding the sequences for the bZip modules of c-Jun and c-Fos which could then be expressed as soluble proteins in Escherichia coli. The purified bZip modules were tested for their binding capacities of synthetic oligonucleotides containing either TRE or CRE recognition sites in electrophoretic mobility shift assays and circular dichroism (CD). Electrophoretic mobility shift assays showed that bZip Jun homodimers and bZip Jun/Fos heterodimers bind a collagenase-like TRE (CTGACTCAT) with dissociation constants of respectively 1.4 x 10(-7) M and 5 x 10(-8) M. As reported earlier [Patel et al. (1990) Nature 347, 572-575], DNA binding induces a marked change of the protein structure. However, we found that the DNA also undergoes a conformational change. This is most clearly seen with small oligonucleotides of 13 or 14 bp harboring respectively a TRE (TGACTCA) or a CRE (TGACGTCA) sequence. In this case, the positive DNA CD signal at 280 nm increases almost two-fold with a concomitant blue-shift of 3-4 nm. Within experimental error the same spectral changes are observed for TRE and CRE containing DNA fragments. The spectral changes observed with a non-specific DNA fragment are weaker and the signal of free DNA is recovered upon addition of much smaller salt concentrations than required for a specific DNA fragment. Surprisingly the spectral changes induced by Jun/Jun homodimers are not identical to those induced by Jun/Fos heterodimers. However, in both cases the increase of the positive CD band and the concomitant blue shift would be compatible with a B to A-transition of part of the binding site or a DNA conformation intermediate between the canonical A and B structures. PMID:8948639

  8. Trapping of branched DNA in microfabricated structures.

    PubMed Central

    Volkmuth, W D; Duke, T; Austin, R H; Cox, E C

    1995-01-01

    We have observed electrostatic trapping of tribranched DNA molecules undergoing electrophoresis in a microfabricated pseudo-two-dimensional array of posts. Trapping occurs in a unique transport regimen in which the electrophoretic mobility is extremely sensitive to polymer topology. The arrest of branched polymers is explained by considering their center-of-mass motion; in certain conformations, owing to the constraints imposed by the obstacles a molecule cannot advance without the center of mass first moving a short distance backwards. The depth of the resulting local potential well can be much greater than the thermal energy so that escape of an immobilized molecule can be extremely slow. We summarize the expected behavior of the mobility as a function of field strength and topology and point out that the microfabricated arrays are highly suitable for detecting an extremely small number of branched molecules in a very large population of linear molecules. Images Fig. 2 PMID:7624337

  9. Electrophoresis of DNA on a disordered two-dimensional substrate

    NASA Astrophysics Data System (ADS)

    Reichhardt, C. J. Olson; Reichhardt, C.

    2006-11-01

    We propose a method for electrophoretic separation of DNA in which adsorbed polymers are driven over a disordered two-dimensional substrate which contains attractive sites for the polymers. Using simulations of a model for long polymer chains, we show that the mobility increases with polymer length, in contrast to gel electrophoresis techniques, and that separation can be achieved for a range of length scales. We demonstrate that the separation mechanism relies on steric interactions between polymer segments, which prevent substrate disorder sites from trapping more than one DNA segment each. Since thermal activation does not play a significant role in determining the polymer mobility, band broadening due to diffusion can be avoided in our separation method.

  10. Electrophoresis of DNA on a disordered two-dimensional substrate

    NASA Astrophysics Data System (ADS)

    Olson Reichhardt, Cynthia J.; Reichhardt, Charles

    2007-03-01

    We propose a method for electrophoretic separation of DNA in which adsorbed polymers are driven over a disordered two-dimensional substrate which contains attractive sites for the polymers. Using simulations of a model for long polymer chains, we show that the mobility increases with polymer length, in contrast to gel electrophoresis techniques, and that separation can be achieved for a range of length scales. We demonstrate that the separation relies on steric interactions between polymer segments, which prevent substrate disorder sites from trapping more than one DNA segment each. Since thermal activation does not play a significant role in determining the polymer mobility, band broadening due to diffusion can be avoided in our separation method. [1] Phys. Rev. E 74, 051908 (2006).

  11. Ku counteracts mobilization of PARP1 and MRN in chromatin damaged with DNA double-strand breaks.

    PubMed

    Cheng, Qiao; Barboule, Nadia; Frit, Philippe; Gomez, Dennis; Bombarde, Oriane; Couderc, Bettina; Ren, Guo-Sheng; Salles, Bernard; Calsou, Patrick

    2011-12-01

    In mammalian cells, the main pathway for DNA double-strand breaks (DSBs) repair is classical non-homologous end joining (C-NHEJ). An alternative or back-up NHEJ (B-NHEJ) pathway has emerged which operates preferentially under C-NHEJ defective conditions. Although B-NHEJ appears particularly relevant to genomic instability associated with cancer, its components and regulation are still largely unknown. To get insights into this pathway, we have knocked-down Ku, the main contributor to C-NHEJ. Thus, models of human cell lines have been engineered in which the expression of Ku70/80 heterodimer can be significantly lowered by the conditional induction of a shRNA against Ku70. On Ku reduction in cells, resulting NHEJ competent protein extracts showed a shift from C- to B-NHEJ that could be reversed by addition of purified Ku protein. Using a cellular fractionation protocol after treatment with a strong DSBs inducer followed by western blotting or immunostaining, we established that, among C-NHEJ factors, Ku is the main counteracting factor against mobilization of PARP1 and the MRN complex to damaged chromatin. In addition, Ku limits PAR synthesis and single-stranded DNA production in response to DSBs. These data support the involvement of PARP1 and the MRN proteins in the B-NHEJ route for the repair of DNA DSBs. PMID:21880593

  12. Function of high-mobility group A proteins in the DNA damage signaling for the induction of apoptosis.

    PubMed

    Fujikane, Ryosuke; Komori, Kayoko; Sekiguchi, Mutsuo; Hidaka, Masumi

    2016-01-01

    O(6)-Methylguanine produced in DNA can pair with thymine during DNA replication, thus leading to a G-to-A transition mutation. To prevent such outcomes, cells harboring O(6)-methylguanine-containing mispair undergo apoptosis that requires the function of mismatch repair (MMR) protein complex. To identify the genes involved in the induction of apoptosis, we performed gene-trap mutagenesis and isolated a clone of mouse cells exhibiting an increased resistance to the killing effect of an alkylating agent, N-methyl-N-nitrosourea (MNU). The mutant carries an insertion in the Hmga2 gene, which belongs to a gene family encoding the high-mobility group A non-histone chromatin proteins. To elucidate the function of HMGA proteins in the apoptosis pathway, we introduced siRNAs for HMGA1 and/or HMGA2 into human HeLa MR cells defective in O(6)-methylguanine-DNA methyltransferase. HMGA1- and HMGA2-single knockdown cells showed an increased resistance to MNU, and HMGA1/HMGA2-double knockdown cells exhibited further increased tolerance compared to the control. The phosphorylation of ATR and CHK1, the appearance of a sub-G1 population, and caspase-9 activation were suppressed in the knockdown cells, although the formation of mismatch recognition complex was unaffected. These results suggest that HMGA family proteins function at the step following the damage recognition in the process of apoptosis triggered by O(6)-methylguanine. PMID:27538817

  13. Function of high-mobility group A proteins in the DNA damage signaling for the induction of apoptosis

    PubMed Central

    Fujikane, Ryosuke; Komori, Kayoko; Sekiguchi, Mutsuo; Hidaka, Masumi

    2016-01-01

    O6-Methylguanine produced in DNA can pair with thymine during DNA replication, thus leading to a G-to-A transition mutation. To prevent such outcomes, cells harboring O6-methylguanine-containing mispair undergo apoptosis that requires the function of mismatch repair (MMR) protein complex. To identify the genes involved in the induction of apoptosis, we performed gene-trap mutagenesis and isolated a clone of mouse cells exhibiting an increased resistance to the killing effect of an alkylating agent, N-methyl-N-nitrosourea (MNU). The mutant carries an insertion in the Hmga2 gene, which belongs to a gene family encoding the high-mobility group A non-histone chromatin proteins. To elucidate the function of HMGA proteins in the apoptosis pathway, we introduced siRNAs for HMGA1 and/or HMGA2 into human HeLa MR cells defective in O6-methylguanine-DNA methyltransferase. HMGA1- and HMGA2-single knockdown cells showed an increased resistance to MNU, and HMGA1/HMGA2-double knockdown cells exhibited further increased tolerance compared to the control. The phosphorylation of ATR and CHK1, the appearance of a sub-G1 population, and caspase-9 activation were suppressed in the knockdown cells, although the formation of mismatch recognition complex was unaffected. These results suggest that HMGA family proteins function at the step following the damage recognition in the process of apoptosis triggered by O6-methylguanine. PMID:27538817

  14. Luminescent electrophoretic particles via miniemulsion polymerization for night-vision electrophoretic displays.

    PubMed

    Meng, Xianwei; Wen, Ting; Qiang, Li; Ren, Jun; Tang, Fangqiong

    2013-05-01

    A novel glowing electrophoretic display (EPD) is achieved by luminescent electrophoretic particles (EPs), which is potentially to improve the situation in which the existing EPDs disable in darkness. To combine both modes of reflective and emissive displays, a trilayer luminescence EP is designed and synthesized via an improved miniemulsion polymerization. The luminescence EP is composed of a pigment core, a polystyrene interlayer, and a fluorescent coating. The particle sizes are from 140 to 170 nm, and the size distribution is narrow. Their ζ potential value is -12.4 mV, which is enough to migrate in the electrophoretic fluid by the driving of an electric field. The display performance of the particles in an EPD cell has been characterized under the bias of 20 V. Both the reflectance (491 nm) and fluorescence (521 nm) intensities of the EPD cell remained in a constant range after 30 switches. PMID:23547950

  15. A normalization strategy applied to HiCEP (an AFLP-based expression profiling) analysis: Toward the strict alignment of valid fragments across electrophoretic patterns

    PubMed Central

    Kadota, Koji; Fukumura, Ryutaro; Rodrigue, Joseph J; Araki, Ryoko; Abe, Masumi

    2005-01-01

    Background Gene expression analysis based on comparison of electrophoretic patterns is strongly dependent on the accuracy of DNA fragment sizing. The current normalization strategy based on molecular weight markers has limited accuracy because marker peaks are often masked by intense peaks nearby. Cumulative errors in fragment lengths cause problems in the alignment of same-length fragments across different electropherograms, especially for small fragments (< 100 bp). For accurate comparison of electrophoretic patterns, further inspection and normalization of electrophoretic data after fragment sizing by conventional strategies is needed. Results Here we describe a method for the normalization of a set of time-course electrophoretic data to be compared. The method uses Gaussian curves fitted to the complex peak mixtures in each electropherogram. It searches for target ranges for which patterns are dissimilar to the other patterns (called "dissimilar ranges") and for references (a kind of mean or typical pattern) in the set of resultant approximate patterns. It then constructs the optimal normalized pattern whose correlation coefficient against the reference in the range achieves the highest value among various combinations of candidates. We applied the procedure to time-course electrophoretic data produced by HiCEP, an AFLP-based expression profiling method which can detect a slight expression change in DNA fragments. We obtained dissimilar ranges whose electrophoretic patterns were obviously different from the reference and as expected, most of the fragments in the detected ranges were short (< 100 bp). The normalized electrophoretic patterns also agreed well with reference patterns. Conclusion The normalization strategy presented here demonstrates the importance of pre-processing before electrophoretic signal comparison, and we anticipate its usefulness especially for temporal expression analysis by the electrophoretic method. PMID:15748295

  16. Separation of DNA in nanoscale devices with alternating channel depth.

    NASA Astrophysics Data System (ADS)

    Lau, Henry; Strychalski, Elizabeth; Craighead, Harold; Archer, Lynden

    2008-03-01

    The size-dependent separation of DNA using nanofabricated devices consisting of alternating deep and shallow regions have been the subject of numerous experimental and theoretical works. Recent Brownian dynamics simulations suggest that the separation of rigid-rod DNA can be effected at high electric fields without a loss of resolution (PRL, 2007, 98, 098106). To study the dynamics of DNA separation at high fields, electrophoresis experiments were carried out using DNA fragments up to 753 bp in size. As the transport mechanism of DNA fragments in gels has been shown to be a strong function of topology (Electrophoresis, 2004, 25, 1772), electrophoresis of branched rigid-rod DNA molecules was performed to investigate the effects of analyte architecture on mobility in nanofabricated devices. By comparing the mobility of branched and linear DNA molecules of identical total molecular weight, we exclude the influence of size and charge and focus on the effects of branch size and location, and overall analyte topology. Our results help to elucidate the electrophoretic migration mechanism of DNA molecules with complex architecture in sieving media with precisely-controlled internal structures.

  17. Heterogeneous dynamics in DNA site discrimination by the structurally homologous DNA-binding domains of ETS-family transcription factors.

    PubMed

    He, Gaofei; Tolic, Ana; Bashkin, James K; Poon, Gregory M K

    2015-04-30

    The ETS family of transcription factors exemplifies current uncertainty in how eukaryotic genetic regulators with overlapping DNA sequence preferences achieve target site specificity. PU.1 and Ets-1 represent archetypes for studying site discrimination by ETS proteins because their DNA-binding domains are the most divergent in sequence, yet they share remarkably superimposable DNA-bound structures. To gain insight into the contrasting thermodynamics and kinetics of DNA recognition by these two proteins, we investigated the structure and dynamics of site discrimination by their DNA-binding domains. Electrophoretic mobilities of complexes formed by the two homologs with circularly permuted binding sites showed significant dynamic differences only for DNA complexes of PU.1. Free solution measurements by dynamic light scattering showed PU.1 to be more dynamic than Ets-1; moreover, dynamic changes are strongly coupled to site discrimination by PU.1, but not Ets-1. Interrogation of the protein/DNA interface by DNA footprinting showed similar accessibility to dimethyl sulfate for PU.1/DNA and Ets-1/DNA complexes, indicating that the dynamics of PU.1/DNA complexes reside primarily outside that interface. An information-based analysis of the two homologs' binding motifs suggests a role for dynamic coupling in PU.1's ability to enforce a more stringent sequence preference than Ets-1 and its proximal sequence homologs. PMID:25824951

  18. Preparation and surface encapsulation of hollow TiO nanoparticles for electrophoretic displays

    NASA Astrophysics Data System (ADS)

    Zhao, Qian; Tan, Tingfeng; Qi, Peng; Wang, Shirong; Bian, Shuguang; Li, Xianggao; An, Yong; Liu, Zhaojun

    2011-02-01

    Hollow black TiO nanosparticles were obtained via deposition of inorganic coating on the surface of hollow core-shell polymer latex with Ti(OBu)4 as precursor and subsequent calcination in ammonia gas. Hollow TiO particles were characterized by scanning electron microscope, transmission electronic microscopy, X-ray diffraction, and thermogravimetric analysis. Encapsulation of TiO via dispersion polymerization was promoved by pretreating the pigments with 3-(trimethoxysilyl) propyl methacrylate, making it possible to prepare hollow TiO-polymer particles. When St and DVB were used as polymerization monomer, hollow TiO-polymer core-shell particles came into being via dispersion polymerization, and the lipophilic degree is 28.57%. Glutin-arabic gum microcapsules containing TiO-polymer particles electrophoretic liquid were prepared using via complex coacervation. It was founded that hollow TiO-polymer particles had enough electrophoretic mobility after coating with polymer.

  19. A mobile group I intron from Physarum polycephalum can insert itself and induce point mutations in the nuclear ribosomal DNA of saccharomyces cerevisiae.

    PubMed Central

    Muscarella, D E; Vogt, V M

    1993-01-01

    Pp LSU3 is a mobile group I intron in the extrachromosomal nuclear ribosomal DNA (rDNA) of Physarum polycephalum. As found for other mobile introns, Pp LSU3 encodes a site-specific endonuclease, I-Ppo, which mediates "homing" to unoccupied target sites in Physarum rDNA. The recognition sequence for this enzyme is conserved in all eucaryotic nuclear rDNAs. We have introduced this intron into a heterologous species, Saccharomyces cerevisiae, in which nuclear group I introns have not been detected. The expression of Pp LSU3, under control of the inducible GAL10 promoter, was found to be lethal as a consequence of double-strand breaks in the rDNA. However, surviving colonies that are resistant to the lethal effects of I-Ppo because of alterations in the rDNA at the cleavage site were recovered readily. These survivors are of two classes. The first comprises cells that acquired one of three types of point mutations. The second comprises cells in which Pp LSU3 became inserted into the rDNA. In both cases, each resistant survivor appears to carry the same alterations in all approximately 150 rDNA repeats. When it is embedded in yeast rDNA, Pp LSU3 leads to the synthesis of I-Ppo and appears to be mobile in appropriate genetic crosses. The existence of yeast cells carrying a mobile intron should allow dissection of the steps that allow expression of the highly unusual I-Ppo gene. Images PMID:8380887

  20. Salt dependence of DNA translocation dynamics through silicon nanopores detected by ultraviolet excitation

    NASA Astrophysics Data System (ADS)

    Ito, Shintaro; Yamazaki, Hirohito; Tsukahara, Mutsumi; Esashika, Keiko; Saiki, Toshiharu

    2016-04-01

    DNA translocation through nanopores was observed using ultraviolet excitation to investigate the effect of salt concentration and counterion species on the translocation speed. The translocation of 9.6-kbp DNA molecules was measured in an aqueous solvent containing KCl, NaCl, or LiCl. An increase in the KCl concentration from 0.5 to 2 M increased the DNA translocation time. Maintaining the salt concentration at 1.0 M but replacing KCl with NaCl or LiCl also increased the translocation time. These results suggest that the effective charge on the DNA changed due to the binding of counterions, decreasing the DNA electrophoretic mobility. Significant correlation was observed between the translocation time and the dwell time in the observation volume (time needed to move out of the observation volume), and a possible explanation for this observation is provided.

  1. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation.

    PubMed

    Kim, Jinho; Olsen, Timothy R; Zhu, Jing; Hilton, John P; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  2. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    PubMed Central

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  3. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    NASA Astrophysics Data System (ADS)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  4. Polyacrylamide medium for the electrophoretic separation of biomolecules

    DOEpatents

    Madabhushi, Ramakrishna S.; Gammon, Stuart A.

    2003-11-11

    A polyacryalmide medium for the electrophoretic separation of biomolecules. The polyacryalmide medium comprises high molecular weight polyacrylamides (PAAm) having a viscosity average molecular weight (M.sub.v) of about 675-725 kDa were synthesized by conventional red-ox polymerization technique. Using this separation medium, capillary electrophoresis of BigDye DNA sequencing standard was performed. A single base resolution of .about.725 bases was achieved in .about.60 minute in a non-covalently coated capillary of 50 .mu.m i.d., 40 cm effective length, and a filed of 160 V/cm at 40.degree. C. The resolution achieved with this formulation to separate DNA under identical conditions is much superior (725 bases vs. 625 bases) and faster (60 min. vs. 75 min.) to the commercially available PAAm, such as supplied by Amersham. The formulation method employed here to synthesize PAAm is straight-forward, simple and does not require cumbersome methods such as emulsion polymerizaiton in order to achieve very high molecular weights. Also, the formulation here does not require separation of PAAm from the reaction mixture prior to reconstituting the polymer to a final concentration. Furthermore, the formulation here is prepared from a single average mol. wt. PAAm as opposed to the mixture of two different average mo. wt. PAAm previously required to achieve high resolution.

  5. Improvements in in-plane electrophoretic displays

    NASA Astrophysics Data System (ADS)

    Henzen, Alex

    2011-03-01

    Electronic paper is now developing fast into an accepted alternative for paper. Its applications nowadays seem focused on books, documents and newspapers. Development of credible color implementations of electrophoretic displays has been initiated, focusing on multi-layer in-plane electrophoresis, but the difficulties associated with these systems (particle drift, aperture, accuracy) were so far not solved. Electro-osmotic principles lead to openings towards multi-layer color displays as well as fast switching, high reflectance grayscale displays. Drift, aperture and accuracy can be brought to the level necessary to create in-plane switching electro-osmotic displays without the need for encapsulation

  6. Scanning and storage of electrophoretic records

    DOEpatents

    McKean, Ronald A.; Stiegman, Jeff

    1990-01-01

    An electrophoretic record that includes at least one gel separation is mounted for motion laterally of the separation record. A light source is positioned to illuminate at least a portion of the record, and a linear array camera is positioned to have a field of view of the illuminated portion of the record and orthogonal to the direction of record motion. The elements of the linear array are scanned at increments of motion of the record across the field of view to develop a series of signals corresponding to intensity of light at each element at each scan increment.

  7. A hybrid molecular dynamics study of the translocation of DNA through entropic traps

    NASA Astrophysics Data System (ADS)

    Hotmar, Petr

    2010-11-01

    The interplay between thermal diffusion and electrophoretic migration of λ-phage DNA in entropic traps was studied using a hybrid molecular dynamics algorithm. The governing systems of field equations are discretized by finite differences on curvilinear overlapping grids with the solvent modeled as a continuum in unsteady creeping flow. Similar to Brownian dynamics, the polymer segments are coarse-grained into a bead-spring model that follows Langevin dynamics. The hydrodynamic interactions are captured on a semi-empirical level with localized force-transfer. We have established the non-monotonic dependence of electrophoretic mobility on chain length, which characterizes the transition from the free flowing to the trapping behavior. We further quantify the subtle effects of dielectrophoresis and induced-charge electroosmosis on the polymer dynamics.

  8. Electrophoretic Porosimetry of Sol-Gels

    NASA Technical Reports Server (NTRS)

    Snow, L. A.; Smith, D. D.; Sibille, L.; Hunt, A. J.; Ng, J.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    It has been hypothesized that gravity has an effect on the formation and resulting microstructure of sol-gels. In order to more clearly resolve the effect of gravity, pores may be non-destructively analyzed in the wet gel, circumventing the shrinkage and coarsening associated with the drying procedure. We discuss the development of an electrophoretic technique, analogous to affinity chromatography, for the determination of pore size distribution and its application to silica gels. Specifically a monodisperse charged dye is monitored by an optical densitometer as it moves through the wet gel under the influence of an electric field. The transmittance data (output) represents the convolution of the dye concentration profile at the beginning of the run (input) with the pore size distribution (transfer function), i.e. linear systems theory applies. Because of the practical difficulty in producing a delta function input dye profile we prefer instead to use a step function. Average pore size is then related to the velocity of this dye front, while the pore size distribution is related to the spreading of the front. Preliminary results of this electrophoretic porosimetry and its application to ground and space-grown samples will be discussed.

  9. Functions of the high mobility group protein, Abf2p, in mitochondrial DNA segregation, recombination and copy number in Saccharomyces cerevisiae.

    PubMed Central

    Zelenaya-Troitskaya, O; Newman, S M; Okamoto, K; Perlman, P S; Butow, R A

    1998-01-01

    Previous studies have established that the mitochondrial high mobility group (HMG) protein, Abf2p, of Saccharomyces cerevisiae influences the stability of wild-type (rho+) mitochondrial DNA (mtDNA) and plays an important role in mtDNA organization. Here we report new functions for Abf2p in mtDNA transactions. We find that in homozygous deltaabf2 crosses, the pattern of sorting of mtDNA and mitochondrial matrix protein is altered, and mtDNA recombination is suppressed relative to homozygous ABF2 crosses. Although Abf2p is known to be required for the maintenance of mtDNA in rho+ cells growing on rich dextrose medium, we find that it is not required for the maintenance of mtDNA in p cells grown on the same medium. The content of both rho+ and rho- mtDNAs is increased in cells by 50-150% by moderate (two- to threefold) increases in the ABF2 copy number, suggesting that Abf2p plays a role in mtDNA copy control. Overproduction of Abf2p by > or = 10-fold from an ABF2 gene placed under control of the GAL1 promoter, however, leads to a rapid loss of rho+ mtDNA and a quantitative conversion of rho+ cells to petites within two to four generations after a shift of the culture from glucose to galactose medium. Overexpression of Abf2p in rho- cells also leads to a loss of mtDNA, but at a slower rate than was observed for rho+ cells. The mtDNA instability phenotype is related to the DNA-binding properties of Abf2p because a mutant Abf2p that contains mutations in residues of both HMG box domains known to affect DNA binding in vitro, and that binds poorly to mtDNA in vivo, complements deltaabf2 cells only weakly and greatly lessens the effect of overproduction on mtDNA instability. In vivo binding was assessed by colocalization to mtDNA of fusions between mutant or wild-type Abf2p and green fluorescent protein.These findings are discussed in the context of a model relating mtDNA copy number control and stability to mtDNA recombination. PMID:9581629

  10. Preparation and properties of red inorganic hollow nanospheres for electrophoretic display

    NASA Astrophysics Data System (ADS)

    Fang, Yi; Wang, Shirong; Xiao, Yin; Li, Xianggao

    2014-10-01

    An effective approach had been developed for the preparation of Fe-doped TiO2 red hollow nanospheres via template method using PMMA-BA copolymers as the core template by a two-step hydrolysis process. The nanospheres were rarely displayed fragmentation and exhibited hollow structures with uniform size and shape. Then, the multicomponent Fe/Co/Al-doped TiO2 hollow nanospheres were produced with Co and Al as tinting metal ions so as to endow them with higher color saturation and brightness. The average diameter of the hollow spheres coated with a layer of α-Fe2O3 was approximately 300 nm and the thickness of the layer was roughly 50 nm. The electrophoretic mobility and zeta potential of two kinds of hollow particles were about -1.0 × 10-5 cm2 v-1 s-1 and -100 mV, respectively. Finally, the electrophoretic inks prototype device was successfully assembled using dispersion of the obtained red hollow nanospheres in a mixed dielectric solvent with TiO2 white particles as contrast. Under an applied bias voltage of 30 V, the response time of the simple EPD device was 1121 ms and the max contrast was 3.173, which had shown great potential for practical application in a vivid chromatic electrophoretic display.

  11. Electrophoretically induced aqueous flow through single-wall carbon nanotube membranes

    PubMed Central

    Wu, Ji; Gerstandt, Karen; Zhang, Hongbo; Liu, Jie; Hinds, Bruce. J.

    2013-01-01

    Electrophoresis, the motion of charged species through liquids and pores under an external electric field, has been principle source of chemical pumping for numerous micro- and nano-fluidic devices platforms. Recent studies of ion current through single or few carbon nanotube channels range from near bulk mobility to 2-7 orders of magnitude of enhancement but cannot directly measure ion flux. Membranes, with large number of nanotube pores, allow independent confirmation of ion current and flux. Here we report that the aqueous electrophoretic mobility of ions within the graphitic cores of carbon nanotube membranes, with a uniform pore size of 0.9 ± 0.2 nm, is enhanced ∼3 times that of bulk mobilities. The induced electroosmotic velocities are 4 orders of magnitude faster than those measured in conventional porous materials. We also show that a nanotube membrane can function as a rectifying diode due to ionic steric effects within tightly controlled nanotube diameter. PMID:22245860

  12. All solution processed organic thin film transistor-backplane with printing technology for electrophoretic display

    USGS Publications Warehouse

    Lee, Myung W.; Song, C.K.

    2012-01-01

    In this study, solution processes were developed for backplane using an organic thin film transistor (OTFT) as a driving device for an electrophoretic display (EPD) panel. The processes covered not only the key device of OTFTs but also interlayer and pixel electrodes. The various materials and printing processes were adopted to achieve the requirements of devices and functioning layers. The performance of OTFT of the backplane was sufficient to drive EPD sheet by producing a mobility of 0.12 cm2/v x sec and on/off current ratio of 10(5).

  13. Human blood platelet membrane glycoproteins. Resolution in different polyacrylamide gel electrophoretic systems.

    PubMed

    Jenkins, C S; Ali-Briggs, E F; Zonneveld, G T; Sturk, A; Clemetson, K J

    1980-02-29

    The separation of the major platelet membrane glycoproteins of normal subjects and subjects with well defined platelet membrane glycoprotein abnormalities have been examined using four different polyacrylamide gel electrophoretic techniques (continuous and discontinuous). The mobilities of the resolved glycoprotein bands have been correlated with the glycoprotein nomenclature proposed for the conventional sodium dodecyl sulphate-phosphate buffer system. Since the glycoprotein distribution varies depending on the system used, the merits of each method should be considered before application to a specific problem. PMID:6768152

  14. Separation of Long DNA Molecules in a Microfabricated Entropic Trap Array

    NASA Astrophysics Data System (ADS)

    Han, J.; Craighead, H. G.

    2000-05-01

    A nanofluidic channel device, consisting of many entropic traps, was designed and fabricated for the separation of long DNA molecules. The channel comprises narrow constrictions and wider regions that cause size-dependent trapping of DNA at the onset of a constriction. This process creates electrophoretic mobility differences, thus enabling efficient separation without the use of a gel matrix or pulsed electric fields. Samples of long DNA molecules (5000 to ~160,000 base pairs) were efficiently separated into bands in 15-millimeter-long channels. Multiple-channel devices operating in parallel were demonstrated. The efficiency, compactness, and ease of fabrication of the device suggest the possibility of more practical integrated DNA analysis systems.

  15. Electrophoretic Deposition on Porous Non-Conductors

    NASA Technical Reports Server (NTRS)

    Compson, Charles; Besra, Laxmidhar; Liu, Meilin

    2007-01-01

    A method of electrophoretic deposition (EPD) on substrates that are porous and electrically non-conductive has been invented. Heretofore, in order to perform an EPD, it has been necessary to either (1) use a substrate material that is inherently electrically conductive or (2) subject a non-conductive substrate to a thermal and/or chemical treatment to render it conductive. In the present method, instead of relying on the electrical conductivity of the substrate, one ensures that the substrate is porous enough that when it is immersed in an EPD bath, the solvent penetrates throughout the thickness, thereby forming quasi-conductive paths through the substrate. By making it unnecessary to use a conductive substrate, this method simplifies the overall EPD process and makes new applications possible. The method is expected to be especially beneficial in enabling deposition of layers of ceramic and/or metal for chemical and electrochemical devices, notably including solid oxide fuel cells.

  16. SPAR electrophoretic separation experiments, part 2

    NASA Technical Reports Server (NTRS)

    Cosmi, F. M.

    1978-01-01

    The opportunity to use a sounding rocket for separation experiments is a logical continuation of earlier electrophoresis demonstrations and experiments. A free-flow electrophoresis system, developed under the Advanced Applications Flight Experiment (AAFE) Program, was designed so that it would fit into a rocket payload. The SPAR program provides a unique opportunity to complete the intial stages of microgravity testing prior to any Shuttle applications. The objective of the work described in this report was to ensure proper operating parameters for the defined experimental samples to be used in the SPAR Electrophoretic Separation Experiment. Ground based experiments were undertaken not only to define flight parameters but also to serve as a point of comparison for flight results. Possible flight experiment problem areas were also studied such as sample interaction due to sedimentation, concentration effects and storage effects. Late in the program anomalies of field strengths and buffer conductivities were also investigated.

  17. Recent patents on electrophoretic displays and materials.

    PubMed

    Christophersen, Marc; Phlips, Bernard F

    2010-11-01

    Electrophoretic displays (EPDs) have made their way into consumer products. EPDs enable displays that offer the look and form of a printed page, often called "electronic paper". We will review recent apparatus and method patents for EPD devices and their fabrication. A brief introduction into the basic display operation and history of EPDs is given, while pointing out the technological challenges and difficulties for inventors. Recently, the majority of scientific publications and patenting activity has been directed to micro-segmented EPDs. These devices exhibit high optical reflectance and contrast, wide viewing angle, and high image resolution. Micro-segmented EPDs can also be integrated with flexible transistors technologies into flexible displays. Typical particles size ranges from 200 nm to 2 micrometer. Currently one very active area of patenting is the development of full-color EPDs. We summarize the recent patenting activity for EPDs and provide comments on perceiving factors driving intellectual property protection for EPD technologies. PMID:20565384

  18. Electrochemically powered self-propelled electrophoretic nanosubmarines

    NASA Astrophysics Data System (ADS)

    Pumera, Martin

    2010-09-01

    In the past few years, we have witnessed rapid developments in the realization of the old nanotechnology dream, autonomous nanosubmarines. These nanomachines are self-powered, taking energy from their environment by electrocatalytic conversion of chemicals present in the solution, self-propelled by flux of the electrons within the submarine and the hydronium ions on the surface of the nanosub, powering it in the direction opposite to that of the flux of the hydronium. These nanosubmarines are responsive to external fields, able to follow complex magnetic patterns, navigate themselves in complex microfluidic channels, follow chemical gradients, carry cargo, and communicate with each other. This minireview focuses on a discussion of the fundamentals of the electrophoretic mechanism underlying the propulsion of this sort of nanosub, as well as a demonstration of the proof-of-concept capabilities of nanosubmarines.In the past few years, we have witnessed rapid developments in the realization of the old nanotechnology dream, autonomous nanosubmarines. These nanomachines are self-powered, taking energy from their environment by electrocatalytic conversion of chemicals present in the solution, self-propelled by flux of the electrons within the submarine and the hydronium ions on the surface of the nanosub, powering it in the direction opposite to that of the flux of the hydronium. These nanosubmarines are responsive to external fields, able to follow complex magnetic patterns, navigate themselves in complex microfluidic channels, follow chemical gradients, carry cargo, and communicate with each other. This minireview focuses on a discussion of the fundamentals of the electrophoretic mechanism underlying the propulsion of this sort of nanosub, as well as a demonstration of the proof-of-concept capabilities of nanosubmarines. In memory of Karel Zeman, Czech animator, who encouraged thousands of young people into science and technology, on the occasion of the 100th

  19. [Electrophoretic study of liver histones in the postnatal ontogeny of white rats: the effect of testosterone propionate and gonadectomy].

    PubMed

    Klimenko, A I; Khints, R

    1976-01-01

    By means of polyacrylamide gel disc electrophoresis heterogeneity, electrophoretic mobility and relative content of different fractions of histones in nuclei of liver cells were studied in gonadectomized Wistar rats and in castrated in intact animals, administered with testosteone propionate. In all the experiments a significant conservatism of histone proteins was found in postnatal development. In animals, treated with the endocrine preparations, the age peculiarities were shown to reflect the quanitative proportion of different histone fractions. PMID:1027242

  20. Separations of Short DNA in Agarose Gels: What Model Applies?

    NASA Astrophysics Data System (ADS)

    Beheshti, Afshin

    2000-03-01

    Gel Electrophoresis is used ubiquitously for separating proteins and DNA fragments from mixtures into individual components. Molecules separate because their mobilities, μ = v / E, depend on their effective charge and effective friction imposed by the gel. Models describing the dependence of μ on molecular parameters are inadequate. For example, the reptation theory as applied in other studies suggests μ proportional to (1/L). We asked whether the relationship (1/μ) proportional to AL + B, where A and B are independent parameters, would better describe electrophoretic separations of DNA fragments over a wide range of fragment lengths. A series of DNA ladders were electrophoresed in Seakem and in Metaphor agarose and mobilities studied as a function of their DNA length. In the Metaphor agarose a range of 10 bp to 1500 bp DNA fragments were observed. While in the Seakem agarose the study was done with DNA fragments ranging from 100 bp to 10 kbp. Results of the fits for μ vs. L indicate the dependence is more complex than these simple models suggest. Supported by NSF BES 9521381 and NSF Research Training Grant Fellowship 130362022.

  1. Association of electrophoretic karyotype of Candida stellatoidea with virulence for mice

    SciTech Connect

    Kwon-Chung, K.J.; Wickes, B.L.; Merz, W.G.

    1988-07-01

    Seven isolates of Candida stellatoidea were studied for their electrophoretic karyotype, virulence for mice, sensitivity to UV radiation, growth rate in vitro, reaction on cycloheximide-indicator medium, and proteinase activity. The isolates exhibited one of two distinct electrophoretic karyotypes as determined by orthogonal field alternating gel electrophoresis (OFAGE). Four isolates, including the type culture of C. stellatoidea, belonged to electrophoretic karyotype type I by OFAGE, showing eight to nine bands of which at least two bands were less than 1,000 kilobases in size as estimated by comparison with the DNA bands of Saccharomyces cerevisiae. These isolates failed to produce fatal infection in mice within 20 days when 5 X 10(5) cells were injected intravenously. The yeasts were cleared from the kidneys of two of three mice tested by day 30. Type I showed proteinase activity on bovine serum albumin agar at pH 3.8 and produced a negative reaction on cycloheximide-bromcresol green medium within 48 h. The three grouped in type II by OFAGE showed banding patterns similar to those of a well-characterized isolate of Candida albicans. The isolates of type II had an electrophoretic karyotype of six to seven bands approximately 1,200 kilobases or greater in size. All three type II isolates were highly virulent for mice, producing fatality curves similar to those of a previously studied C. albicans isolate. From 80 to 90% of the mice injected with 5 X 10(5) cells intravenously died within 20 days. The type II isolates produced a positive reaction on cycloheximide-bromcresol green agar and showed no proteinase activity on bovine serum albumin agar at the low pH. In addition, the type II isolates grew faster and were significantly more resistant to UV irradiation than the type I isolates.

  2. Intron mobility in phage T4 is dependent upon a distinctive class of endonucleases and independent of DNA sequences encoding the intron core: mechanistic and evolutionary implications.

    PubMed Central

    Bell-Pedersen, D; Quirk, S; Clyman, J; Belfort, M

    1990-01-01

    Although mobility of the phylogenetically widespread group I introns appears to be mechanistically similar, the phage T4 intron-encoded endonucleases that promote mobility of the td and sunY introns are different from their eukaryotic counterparts. Most notably, they cleave at a distance from the intron insertion sites. The td enzyme was shown to cleave 23-26 nt 5' and the sunY endonuclease 13-15 nt 3' to the intron insertion site to generate 3-nt or 2-nt 3'-OH extensions, respectively. The absolute coconversion of exon markers between the distant cleavage and insertion sites is consistent with the double-strand-break repair model for intron mobility. As a further critical test of the model we have demonstrated that the mobility event is independent of DNA sequences that encode the catalytic intron core structure. Thus, in derivatives in which the lacZ or kanR coding sequences replace the intron, these marker genes are efficiently inserted into intron-minus alleles when the cognate endonuclease is provided in trans. The process is therefore endonuclease-dependent, rather than dependent on the intron per se. These findings, which imply that the endonucleases rather than the introns themselves were the primordial mobile elements, are incorporated into a model for the evolution of mobile introns. Images PMID:2165250

  3. Cell and Particle Interactions and Aggregation During Electrophoretic Motion

    NASA Technical Reports Server (NTRS)

    Wang, Hua; Zeng, Shulin; Loewenberg, Michael; Todd, Paul; Davis, Robert H.

    1996-01-01

    The stability and pairwise aggregation rates of small spherical particles under the collective effects of buoyancy-driven motion and electrophoretic migration are analyzed. The particles are assumed to be non-Brownian, with thin double-layers and different zeta potentials. The particle aggregation rates may be enhanced or reduced, respectively, by parallel and antiparallel alignments of the buoyancy-driven and electrophoretic velocities. For antiparallel alignments, with the buoyancy-driven relative velocity exceeding the electrophoretic relative velocity between two widely-separated particles, there is a 'collision-forbidden region' in parameter space due to hydrodynamic interactions; thus, the suspension becomes stable against aggregation.

  4. Preparation and application of microcapsule-encapsulated color electrophortic fluid in Isopar M system for electrophoretic display

    NASA Astrophysics Data System (ADS)

    Sun, Cui; Feng, Ya-Qing; Zhang, Bao; Li, Xiang-Gao; Shao, Ji-Zhou; Han, Jing-Jing; Chen, Xu

    2013-05-01

    The use of Isopar M as a liquid suspending fluid for electrophoretic display was studied. The dispersion stability and chargeability of pigments suspended in Isopar M were investigated. Polyisobutylene monosuccinimide (T-151) as the charge control additive in Isopar M electrophoretic fluid can provide a good electrophoretic mobility to the particles. The wall materials of a series of blue-white, red-white and yellow-white dual-particle microcapsules were prepared by in situ polymerization of urea and formaldehyde. The mass ratio of wall/core material was a key factor in influencing the yield of microcapsules. The concentration of resorcinol has an impact on the surface morphology and mechanical strength of microcapsule wall. Microcapsules' surface morphologies were characterized by optical microscopy and scanning electron microscopy. The performance of the microcapsules with different binder materials and adhesive layers were investigated. Contrast ratio of microcapsules display device were tested every 10 days for a period of 90 days. The compatibility of Isopar M with both the electrophoretic particles and bounding capsule was studied.

  5. Effects of structural properties of the Stern layer on the electrophoretic migration of a highly charged spherical macroion.

    PubMed

    Rezaei, Majid; Azimian, Ahmad Reza

    2015-12-01

    The electrophoretic migration of a highly charged spherical macroion suspended in an aqueous solution of NaCl is studied using the molecular dynamic method. The objective is to examine the effects of the colloidal surface charge density on the electrophoretic mobility (μ) of the spherical macroion. The bare charge and the size of the macroion are varied separately to induce changes in the colloidal surface charge density. Our results indicate that μ depends on colloidal surface charge density in a nonmonotonic manner, but that this relationship is independent of the way the surface charge density is varied. It is found that an increase in colloidal surface charge density may lead to the formation of new sublayers in the Stern layer. The μ profile is also found to have a local maximum for a bare charge at which a new sublayer is formed in the Stern layer, and a local minimum for a bare charge at which the outer sublayer becomes relatively dense. Finally, the electrophoretic flow caused by the migration of the spherical macroion is studied to find that one decisive factor causing the electrophoretic flow is the ability of the macroion to carry anions in the electrolyte solution. PMID:26456026

  6. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  7. Evaluation of aptamers as molecular recognition elements for pathogens using capillary electrophoretic analysis

    NASA Astrophysics Data System (ADS)

    McMasters, Sun; Stratis-Cullum, Dimitra N.

    2006-10-01

    The biomolecular interactions between a fluorescently labeled aptamer and whole cell Campylobacter jejuni(C. jejuni) have been characterized using capillary electrophoresis with laser-induced fluorescence detection. From electrophoretic analysis, the bound complex forms, unbound aptamer, and cells were visualized. The relative binding affinity of the DNA aptamer with C. jejuni was compared with other food-borne pathogens including Escherichia coli O157:H7 and Salmonella typhimurium. Preliminary data suggests that this aptamer exhibits strong binding affinity towards C. jejuni with minimal cross reactivity over other food pathogens when equivalent cell concentrations were used.

  8. Detection of sequence variation in parasite ribosomal DNA by electrophoresis in agarose gels supplemented with a DNA-intercalating agent.

    PubMed

    Zhu, X Q; Chilton, N B; Gasser, R B

    1998-05-01

    This study evaluated the use of a commercially available DNA intercalating agent (Resolver Gold) in agarose gels for the direct detection of sequence variation in ribosomal DNA (rDNA). This agent binds preferentially to AT sequence motifs in DNA. Regions of nuclear rDNA, known to provide genetic markers for the identification of species of parasitic ascarid nematodes (order Ascaridida), were amplified by polymerase chain reaction (PCR) and subjected to electrophoresis in standard agarose gels versus gels supplemented with Resolver Gold. Individual taxa examined could not be distinguished reliably based on the size of their amplicons in standard agarose gels, whereas they could be readily delineated based on mobility using Resolver Gold-supplemented gels. The latter was achieved because of differences (approximately 0.1-8.2%) in the AT content of the fragments among different taxa, which were associated with significant interspecific differences (approximately 11-39%) in the rDNA sequences employed. There was a tendency for fragments with higher AT content to migrate slower in supplemented agarose gels compared with those of lower AT content. The results indicate the usefulness of this electrophoretic approach to rapidly screen for sequence variability within or among PCR-amplified rDNA fragments of similar sizes but differing AT contents. Although evaluated on rDNA of parasites, the approach has potential to be applied to a range of genes of different groups of infectious organisms. PMID:9629896

  9. DNA-mediated oxidation of p53.

    PubMed

    Schaefer, Kathryn N; Barton, Jacqueline K

    2014-06-01

    Transcription factor p53 is the most commonly altered gene in human cancer. As a redox-active protein in direct contact with DNA, p53 can directly sense oxidative stress through DNA-mediated charge transport. Electron hole transport occurs over long distances through the π-stacked bases and leads to the oxidative dissociation of p53. The extent of protein dissociation depends upon the redox potential of the DNA in direct contact with each p53 monomer. The DNA sequence dependence of p53 oxidative dissociation was examined by electrophoretic mobility shift assays using oligonucleotides containing both synthetic and human p53 consensus sequences with an appended photooxidant, anthraquinone. Greater p53 dissociation is observed from sequences containing low-redox potential purine regions, particularly guanine triplets. Using denaturing polyacrylamide gel electrophoresis of irradiated anthraquinone-modified DNA, the DNA damage sites corresponding to sites of preferred electron hole localization were determined. The resulting DNA damage preferentially localizes to guanine doublets and triplets. Oxidative DNA damage is inhibited in the presence of p53, but only at sites in direct contact with p53. From these data, predictions about the sensitivity of human p53-binding sites to oxidative stress as well as possible biological implications have been made. On the basis of our data, the guanine pattern within the purine region of each p53-binding site determines the response of p53 to DNA oxidation, yielding for some sequences the oxidative dissociation of p53 from a distance and thereby providing another potential role for DNA charge transport chemistry within the cell. PMID:24853816

  10. Reversible and Irreversible Mechanical Damaging of Large Double-Stranded DNA upon Electrospraying.

    PubMed

    Shlyapnikov, Yuri M; Shlyapnikova, Elena A; Morozov, Victor N

    2016-07-19

    Electrohydrodynamic spraying (or electrospaying, ES) of DNA solutions is an attractive technique for applications in mass spectrometry, in microarray fabrication, and in generation of DNA nanoaerosols. Here we report how ES affects DNA structure and evaluate possible ways to reduce DNA damage upon ES. It is shown that under any ES conditions, linear λ-phage DNA is subjected to intensive rupture producing a mixture of fragments. In addition to such fragmentation, notable reversible changes in the DNA structure were revealed by a slight increase in DNA electrophoretic mobility. The degree of fragmentation was shown to decrease with decreased DNA length and with increased flow rate through the ES capillary. Fragments shorter than 5 kbp did not show any notable damage upon ES. Both experimental data and theoretical estimations of the forces acting on DNA during ES indicate that DNA is damaged by mechanical forces, and the damage takes place in the vicinity of the Taylor cone tip, presumably due to the high shear stress or/and viscous drag forces operating there. Condensation of λ-DNA with hexamminecobalt(III) ions completely protected it from any damage upon ES. PMID:27306261

  11. Rapid, Affordable, and Point-of-Care Water Monitoring Via a Microfluidic DNA Sensor and a Mobile Interface for Global Health

    PubMed Central

    Ghanbari, Sarah; Ravikumar, Anusha; Seubert, John; Figueira, Silvia

    2013-01-01

    Contaminated water is a serious concern in many developing countries with severe health consequences particularly for children. Current methods for monitoring waterborne pathogens are often time consuming, expensive, and labor intensive, making them not suitable for these regions. Electrochemical detection in a microfluidic platform offers many advantages such as portability, minimal use of instrumentation, and easy integration with electronics. In many parts of the world, however, the required equipment for pathogen detection through electrochemical sensors is either not available or insufficiently portable, and operators may not be trained to use these sensors and interpret results, ultimately preventing its wide adoption. Counterintuitively, these same regions often have an extensive mobile phone infrastructure, suggesting the possibility of integrating electrochemical detection of bacterial pathogens with a mobile platform. Toward a solution to water quality interventions, we demonstrate a microfluidic electrochemical sensor combined with a mobile interface that detects the sequences from bacterial pathogens, suitable for rapid, affordable, and point-of-care water monitoring. We employ the transduction of DNA hybridization into a readily detectable electric signal by means of a conformational change of DNA stem-loop structure. Using this platform, we successfully demonstrate the detection of as low as 100 nM E. coli sequences and the automatic interpretation and mapping of the detection results via a mobile application. PMID:27170858

  12. Rapid, Affordable, and Point-of-Care Water Monitoring Via a Microfluidic DNA Sensor and a Mobile Interface for Global Health.

    PubMed

    Kim, Unyoung; Ghanbari, Sarah; Ravikumar, Anusha; Seubert, John; Figueira, Silvia

    2013-01-01

    Contaminated water is a serious concern in many developing countries with severe health consequences particularly for children. Current methods for monitoring waterborne pathogens are often time consuming, expensive, and labor intensive, making them not suitable for these regions. Electrochemical detection in a microfluidic platform offers many advantages such as portability, minimal use of instrumentation, and easy integration with electronics. In many parts of the world, however, the required equipment for pathogen detection through electrochemical sensors is either not available or insufficiently portable, and operators may not be trained to use these sensors and interpret results, ultimately preventing its wide adoption. Counterintuitively, these same regions often have an extensive mobile phone infrastructure, suggesting the possibility of integrating electrochemical detection of bacterial pathogens with a mobile platform. Toward a solution to water quality interventions, we demonstrate a microfluidic electrochemical sensor combined with a mobile interface that detects the sequences from bacterial pathogens, suitable for rapid, affordable, and point-of-care water monitoring. We employ the transduction of DNA hybridization into a readily detectable electric signal by means of a conformational change of DNA stem-loop structure. Using this platform, we successfully demonstrate the detection of as low as 100 nM E. coli sequences and the automatic interpretation and mapping of the detection results via a mobile application. PMID:27170858

  13. MICROSPORIDIAN TAXONOMY: APPLICATION OF ELECTROPHORETIC AND IMMUNOLOGICAL TECHNIQUES

    EPA Science Inventory

    A review of investigations utilizing electrophoretic and immunological methods for identification and classification of microsporidians, the group to which the first protozoan microbial pesticide belongs, indicate that these methods can be successfully used to classify strains an...

  14. Cell and Particle Interactions and Aggregation During Electrophoretic Motion

    NASA Technical Reports Server (NTRS)

    Davis, Robert H.

    2000-01-01

    The objectives of this research were (i) to perform experiments for observing and quantifying electrophoretic aggregation, (ii) to develop a theoretical description to appropriately analyze and compare with the experimental results, (iii) to study the combined effects of electrophoretic and gravitational aggregation of large particles, and the combined effects of electrophoretic and Brownian aggregation of small particles, and (iv) to perform a preliminary design of a potential future flight experiment involving electrophoretic aggregation. Electrophoresis refers to the motion of charged particles, droplets or molecules in response to an applied electric field. Electrophoresis is commonly used for analysis and separation of biological particles or molecules. When particles have different surface charge densities or potentials, they will migrate at different velocities in an electric field. This differential migration leads to the possibility that they will collide and aggregate, thereby preventing separation.

  15. Fluid Delivery System For Capillary Electrophoretic Applications.

    DOEpatents

    Li, Qingbo; Liu, Changsheng; Kane, Thomas E.; Kernan, John R.; Sonnenschein, Bernard; Sharer, Michael V.

    2002-04-23

    An automated electrophoretic system is disclosed. The system employs a capillary cartridge having a plurality of capillary tubes. The cartridge has a first array of capillary ends projecting from one side of a plate. The first array of capillary ends are spaced apart in substantially the same manner as the wells of a microtitre tray of standard size. This allows one to simultaneously perform capillary electrophoresis on samples present in each of the wells of the tray. The system includes a stacked, dual carrousel arrangement to eliminate cross-contamination resulting from reuse of the same buffer tray on consecutive executions from electrophoresis. The system also has a gel delivery module containing a gel syringe/a stepper motor or a high pressure chamber with a pump to quickly and uniformly deliver gel through the capillary tubes. The system further includes a multi-wavelength beam generator to generate a laser beam which produces a beam with a wide range of wavelengths. An off-line capillary reconditioner thoroughly cleans a capillary cartridge to enable simultaneous execution of electrophoresis with another capillary cartridge. The streamlined nature of the off-line capillary reconditioner offers the advantage of increased system throughput with a minimal increase in system cost.

  16. Microencapsulated Electrophoretic Films for Electronic Paper Displays

    NASA Astrophysics Data System (ADS)

    Amundson, Karl

    2003-03-01

    Despite the dominance of liquid crystal displays, they do not perform some functions very well. While backlit liquid crystal displays can offer excellent color performance, they wash out in bright lighting and suffer from high power consumption. Reflective liquid crystal displays have limited brightness, making these devices challenging to read for long periods of time. Flexible liquid crystal displays are difficult to manufacture and keep stable. All of these attributes (long battery lifetime, bright reflective appearance, compatibility with flexible substrates) are traits that would be found in an ideal electronic paper display - an updateable substitute for paper that could be employed in electronic books, newspapers, and other applications. I will discuss technologies that are being developed for electronic-paper-like displays, and especially on particle-based technologies. A microencapsulated electrophoretic display technology is being developed at the E Ink corporation. This display film offers offer high brightness and an ink-on-paper appearance, compatibility with flexible substrates, and image stability that can lead to very low power consumption. I will present some of the physical and chemical challenges associated with making display films with high performance.

  17. A lateral electrophoretic flow diagnostic assay

    PubMed Central

    Lin, Robert; Skandarajah, Arunan; Gerver, Rachel E.; Neira, Hector D.; Fletcher, Daniel A.

    2015-01-01

    Immunochromatographic assays are a cornerstone tool in disease screening. To complement existing lateral flow assays (based on wicking flow) we introduce a lateral flow format that employs directed electrophoretic transport. The format is termed a “lateral e-flow assay” and is designed to support multiplexed detection using immobilized reaction volumes of capture antigen. To fabricate the lateral e-flow device, we employ mask-based UV photopatterning to selectively immobilize unmodified capture antigen along the microchannel in a barcode-like pattern. The channel-filling polyacrylamide hydrogel incorporates a photoactive moiety (benzophenone) to immobilize capture antigen to the hydrogel without a priori antigen modification. We report a heterogeneous sandwich assay using low-power electrophoresis to drive biospecimen through the capture antigen barcode. Fluorescence barcode readout is collected via a low-resource appropriate imaging system (CellScope). We characterize lateral e-flow assay performance and demonstrate a serum assay for antibodies to the hepatitis C virus (HCV). In a pilot study, the lateral e-flow assay positively identifies HCV+ human sera in 60 min. The lateral e-flow assay provides a flexible format for conducting multiplexed immunoassays relevant to confirmatory diagnosis in near-patient settings. PMID:25608872

  18. Long DNA Molecules at Liquid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Samuilov, Vladimir; Li, B.; Sokolov, J.; Rafailovich, M.; Chu, B.

    2006-03-01

    The electrophoresis of long DNA molecules was studied using a newly developed method of electrophoresis on flat surfaces [1] in the regime of strong electrostatic interaction. The mobility of lambda- DNA molecules on this surface was found to scale as the square root of the persistent length with the ionic strength at high buffer. This experimental result indicates that at high buffer concentration the separation mechanism of solid-liquid interface electrophoresis is expected to be due to surface friction rather than biased reptation [2-4]. At low buffer concentrations the DNA chains are stretched .The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface as found to be higher then for the shorter ones in the electric field. [1]. N. Pernodet, V. Samuilov, K. Shin, et al. Physical Review Letters, 85 (2000) 5651-5654. [2] Y.-S. Seo, V.A. Samuilov, J. Sokolov, et al. Electrophoresis, 23 (2002) 2618-2625. [3] Y.-S. Seo, H.. Luo, V. A. Samuilov, et al. DNA Electrophoresis on nanopatterned surfaces, Nano Letters, 4, 2004, 659-664.

  19. Monodisperse light color nanoparticle ink toward chromatic electrophoretic displays.

    PubMed

    Peng, Bo; Li, Yue; Li, Jian; Bi, Lei; Lu, Haipeng; Xie, Jianliang; Ren, Xiangling; Cao, Yonghai; Wang, Ning; Meng, Xianwei; Deng, Longjiang; Guo, Zhanhu

    2016-06-01

    The facile synthesis of nanoparticles for precise image control and fast response of chromatic electrophoretic displays (EPDs) is a challenge. Herein, we report a general method to prepare pink, blue, and yellow nanoparticles with low density and a tunable size of 230-310 nm. The monodispersity is down to 0.02 and surface charges are up to 666e. Importantly, our work highlights the feasibility of chromatic nanoparticles as cost-effective candidates for electrophoretic displays. PMID:27189743

  20. DNA Electrophoresis on Nanopatterned surfaces

    NASA Astrophysics Data System (ADS)

    Luo, Haobin; Gersappe, Dilip

    2002-03-01

    Conventional electrophoretic methods for DNA separation use topological restriction such as the network point in a gel to separate DNA. Here, we present a new approach to DNA electrophoresis using a nanopatterned surface. We exploit the conformational differences that arise when chains of different length are adsorbed onto a flat nanopatterned surface. We use a MD simulation to determine conditions that will optimize separation and present guidelines for the design of nanopatterned surfaces that can separate DNA in a broad size range.

  1. Long DNA Molecules at Liuid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Seo, Young-Soo; Samuilov, Vladimir; Sokolov, John; Rafailovich, Miriam; Chu, Ben

    2003-03-01

    The electrical transport of long DNA molecules was studied using a newly developed method of electrophoresis on flat surfaces [1]. We have shown that a flat silicon substrate, without any surface features, can be used to fractionate DNA on a liquid-solid interface. We determine that the ability of a flat surface to separate DNA molecules results from the local friction between the surface and the adsorbed DNA segments. The mobility of lambda- DNA molecules on this surface was found to scale as the persistent length with the ionic strength of the buffer. This experimental result indicates that at high buffer concentration the separation mechanism of solid-liquid interface electrophoresis is expected to be due to surface friction rather than biased reptation [2]. At low buffer concentrations the adsorbed DNA move in the electrical field parallel to the surface, and also due the electroosmotic convection that drags the DNA chains and they are stretched . The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface, is higher than of the shorter ones in the electric field, oriented along the surface. [1]. N. Pernodet, V. Samuilov, K. Shin, J. Sokolov, M.H. Rafailovich, D. Gersappe, B. Chu. DNA Electrophoresis on a Flat Surface, Physical Review Letters, 85 (2000) 5651-5654. [2] Y.-S. Seo, V.A. Samuilov, J. Sokolov, M. Rafailovich, B. Tinland, J. Kim, B. Chu. DNA separation at a liquid-solid interface, Electrophoresis, 23 (2002) 2618-2625.

  2. Characterizing and controlling the motion of ssDNA in a solid-state nanopore.

    PubMed

    Luan, Binquan; Martyna, Glenn; Stolovitzky, Gustavo

    2011-11-01

    Sequencing DNA in a synthetic solid-state nanopore is potentially a low-cost and high-throughput method. Essential to the nanopore-based DNA sequencing method is the ability to control the motion of a single-stranded DNA (ssDNA) molecule at single-base resolution. Experimental studies showed that the average translocation speed of DNA driven by a biasing electric field can be affected by ionic concentration, solvent viscosity, or temperature. Even though it is possible to slow down the average translocation speed, instantaneous motion of DNA is too diffusive to allow each DNA base to stay in front of a sensor site for its measurement. Using extensive all-atom molecular dynamics simulations, we study the diffusion constant, friction coefficient, electrophoretic mobility, and effective charge of ssDNA in a solid-state nanopore. Simulation results show that the spatial fluctuation of ssDNA in 1 ns is comparable to the spacing between neighboring nucleotides in ssDNA, which makes the sensing of a DNA base very difficult. We demonstrate that the recently proposed DNA transistor could potentially solve this problem by electrically trapping ssDNA inside the DNA transistor and ratcheting ssDNA base-by-base in a biasing electric field. When increasing the biasing electric field, we observed that the translocation of ssDNA changes from ratcheting to steady-sliding. The simulated translocation of ssDNA in the DNA transistor was theoretically characterized using Fokker-Planck analysis. PMID:22067161

  3. DNA and buffers: the hidden danger of complex formation.

    PubMed

    Stellwagen, N C; Gelfi, C; Righetti, P G

    2000-08-01

    The free solution electrophoretic mobility of DNA differs significantly in different buffers, suggesting that DNA-buffer interactions are present in certain buffer systems. Here, capillary and gel electrophoresis data are combined to show that the Tris ions in Tris-acetate-EDTA (TAE) buffers are associated with the DNA helix to approximately the same extent as sodium ions. The borate ions in Tris-borate-EDTA (TBE) buffers interact with DNA to form highly charged DNA-borate complexes, which are stable both in free solution and in polyacrylamide gels. DNA-borate complexes are not observed in agarose gels, because of the competition of the agarose gel fibers for the borate residues. The resulting agarose-borate complexes increase the negative charge of the agarose gel fibers, leading to an increased electroendosmotic flow of the solvent in agarose-TBE gels. The combined results indicate that the buffers in which DNA is studied cannot automatically be assumed to be innocuous. PMID:10861374

  4. Fractionation of Long DNA Molecules in Microfabricated Arrays

    NASA Astrophysics Data System (ADS)

    Bakajin, Olgica; Duke, T. A. J.; Chou, C. F.; Tegenfeldt, J.; Chan, S. S.; Austin, R. H.; Cox, E. C.

    2000-03-01

    Novel microfabricated devices promise to accomplish fractionation of megabase DNA quickly, accurately, at low cost, and by using small sample amounts. At the entrance to the device the DNA is concentrated in a thin band either at a barrier via entropic forces, or on a platinum wire via dielectric forces. The DNA is then electrophoretically driven into an array of posts arranged in a hexagonal lattice. The dependence of mobility on the length of the DNA molecule is induced by a periodically changing electric field. Under the field whose direction changes by 120 degrees, the DNA molecules move in a regular fashion: the longer DNA molecules backtrack more and move forward at lower speeds than the shorter ones. This technique allows electric fields as large as 1000 V/cm and, thus reduces separation times of long molecules compared to the presently used technique of pulsed-field gel electrophoresis. While in a gel it takes up to 48 hours of pulsing to resolve T4 (167 kbp) and lambda (48.5 kbp) molecules, in our device it takes less than 10 seconds. In 10 minutes we can separate these molecules by many millimeters. For video clips of DNA in hexagonal arrays go to http://suiling.princeton.edu

  5. Column-coupling strategies for multidimensional electrophoretic separation techniques.

    PubMed

    Kler, Pablo A; Sydes, Daniel; Huhn, Carolin

    2015-01-01

    Multidimensional electrophoretic separations represent one of the most common strategies for dealing with the analysis of complex samples. In recent years we have been witnessing the explosive growth of separation techniques for the analysis of complex samples in applications ranging from life sciences to industry. In this sense, electrophoretic separations offer several strategic advantages such as excellent separation efficiency, different methods with a broad range of separation mechanisms, and low liquid consumption generating less waste effluents and lower costs per analysis, among others. Despite their impressive separation efficiency, multidimensional electrophoretic separations present some drawbacks that have delayed their extensive use: the volumes of the columns, and consequently of the injected sample, are significantly smaller compared to other analytical techniques, thus the coupling interfaces between two separations components must be very efficient in terms of providing geometrical precision with low dead volume. Likewise, very sensitive detection systems are required. Additionally, in electrophoretic separation techniques, the surface properties of the columns play a fundamental role for electroosmosis as well as the unwanted adsorption of proteins or other complex biomolecules. In this sense the requirements for an efficient coupling for electrophoretic separation techniques involve several aspects related to microfluidics and physicochemical interactions of the electrolyte solutions and the solid capillary walls. It is interesting to see how these multidimensional electrophoretic separation techniques have been used jointly with different detection techniques, for intermediate detection as well as for final identification and quantification, particularly important in the case of mass spectrometry. In this work we present a critical review about the different strategies for coupling two or more electrophoretic separation techniques and the

  6. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  7. Binding of an Indenoisoquinoline to the Topoisomerase-DNA Complex Induces Reduction of Linker Mobility and Strengthening of Protein-DNA Interaction

    PubMed Central

    Coletta, Andrea; Chillemi, Giovanni; Pommier, Yves; Cushman, Mark; Desideri, Alessandro

    2012-01-01

    Long-duration comparative molecular dynamics simulations of the DNA-topoisomerase binary and DNA-topoisomerase-indenoisoquinoline ternary complexes have been carried out. The analyses demonstrated the role of the drug in conformationally stabilizing the protein-DNA interaction. In detail, the protein lips, clamping the DNA substrate, interact more tightly in the ternary complex than in the binary one. The drug also reduces the conformational space sampled by the protein linker domain through an increased interaction with the helix bundle proximal to the active site. A similar alteration of linker domain dynamics has been observed in a precedent work for topotecan but the molecular mechanisms were different if compared to those described in this work. Finally, the indenoisoquinoline keeps Lys532 far from the DNA, making it unable to participate in the religation reaction, indicating that both short- and long-range interactions contribute to the drug poisoning effect. PMID:23236483

  8. Purification of a novel UV-damaged-DNA binding protein highly specific for (6-4) photoproduct.

    PubMed

    Wakasugi, M; Abe, Y; Yoshida, Y; Matsunaga, T; Nikaido, O

    1996-03-15

    UV damage-specific binding proteins are considered to play important roles in early responses of cells irradiated with UV, including damage recognition in the DNA repair process. We have surveyed nuclear and cytoplasmic proteins which bind selectively to UV-irradiated DNA using an electrophoretic mobility shift assay. We detected four distinct binding activities with different mobilities in fractions separated from HeLa cells by heparin chromatography. Three of them were found in nuclear extracts and one in cytoplasmic extracts. We purified one of the binding factors from nuclear extracts to homogeneity, which was designated NF-10 (the 10th fraction of nuclear extract on heparin chromatography). It migrated as a 40 kDa polypeptide in SDS-PAGE, and bound to UV-irradiated double- stranded DNA but not to unirradiated DNA. The binding pattern of the NF-10 protein to DNA irradiated with UV corresponded to the induction kinetics of (6-4) photoproduct. Removal of (6-4) photoproducts from UV- irradiated DNA by (6-4) photoproduct-specific photolyase diminished the binding of NF-10 protein. These results suggest that the NF-10 protein binds to UV-damaged DNA through (6-4) photoproduct. Immunoblot analysis using a monoclonal antibody revealed that the NF-10 protein was expressed in cell lines from all complementation groups of xeroderma pigmentosum, indicating that the NF-10 protein is a novel UV-damaged-DNA binding protein. PMID:8604344

  9. A comparison of the acoustic mobility and the electrophoretic mobility of coal dispersions

    SciTech Connect

    Marlow, B.J.; Rowell, R.L.

    1987-04-01

    Aqueous coal dispersions play a major role from mining to the utilization of coal. The properties of these dispersions, such as stability towards aggregation, rheology, etc., are controlled by two major factors, namely, the particle size and interfacial chemistry. The interfacial chemistry is controlled by the interactions of the coal surface with the aqueous phase. Coal surface-aqueous phase interactions are controlled by rank, mineral content, surface functional groups, pore structure, adsorption, pH, ionic strength, etc. These interactions can be probed using electrokinetic techniques. The authors describe a new electrokinetic technique that utilizes ultrasonics and preliminary data on the application of this technique to coal dispersions. The advantage of ultrasonics are virtually any particle size can be used from ions to aggregates, any concentration of the dispersed phase can be used from the ppm range to volume filling networks, and samples can be optically opaque.

  10. Fluorescence-detected DNA sequencing

    SciTech Connect

    Haugland, R.P.

    1990-01-01

    Our research effort funded by this grant primarily focused on development of suitable fluorescent dyes for DNA sequencing studies. Prior to our efforts, the dyes being sued in commercial DNA sequencers were various versions of fluorescein dyes for the shorter wavelengths and of rhodamine dyes for the longer wavelengths. Our initial goal was to synthesize a set of four dyes that could all be excited by the 488 and 514 nm line of the argon laser lines and that have emission spectra that minimize spectral overlap. The specific result sought was higher fluorescent intensity, particularly of the longest wavelength dyes than was available using existing dyes. Another important property of the desired set of dyes was uniform ionic charge in order to have minimum interference on the electrophoretic mobility during the sequencing. During the period of this grant we prepared and characterized four types of dyes: fluorescent bifluorophores, derivatives of rhodamine dyes, derivatives of rhodol dyes and derivatives of boron dipyrromethene difluoride (BODIPY{trademark}) dyes.

  11. Fluorescent silver nanocluster DNA probes for multiplexed detection using microfluidic capillary electrophoresis.

    PubMed

    Del Bonis-O'Donnell, Jackson Travis; Fygenson, Deborah K; Pennathur, Sumita

    2015-03-01

    DNA-stabilized fluorescent silver nanoclusters (AgNC DNA) are a new class of fluorophore that are formed by sequence specific interactions between silver and single-stranded DNA. By incorporating both target-binding and fluorescent-reporting sequences into a single synthetic DNA oligomer, AgNC DNA probes eliminate the need to conjugate dye or quencher molecules. In this study, we modify a AgNC DNA probe to demonstrate single-color multiplexed detection of DNA targets. We show that appending different lengths of poly-dT to the probe sequences tunes the electrophoretic mobility of AgNC DNA probes without affecting their fluorescence spectra. We use this to introduce a set of AgNC DNA probes selective for Hepatitis A, B and C target sequences that can be processed together in a simple, single-step protocol and distinguished with a resolution of 3.47 and signal to noise ratio of 17.23 in under 10 seconds by microfluidic capillary electrophoresis. PMID:25601044

  12. Genome-wide DNA methylation identifies trophoblast invasion-related genes: Claudin-4 and Fucosyltransferase IV control mobility via altering matrix metalloproteinase activity.

    PubMed

    Hu, Yuxiang; Blair, John D; Yuen, Ryan K C; Robinson, Wendy P; von Dadelszen, Peter

    2015-05-01

    Previously we showed that extravillous cytotrophoblast (EVT) outgrowth and migration on a collagen gel explant model were affected by exposure to decidual natural killer cells (dNK). This study investigates the molecular causes behind this phenomenon. Genome wide DNA methylation of exposed and unexposed EVT was assessed using the Illumina Infinium HumanMethylation450 BeadChip array (450 K array). We identified 444 differentially methylated CpG loci in dNK-treated EVT compared with medium control (P < 0.05). The genes associated with these loci had critical biological roles in cellular development, cellular growth and proliferation, cell signaling, cellular assembly and organization by Ingenuity Pathway Analysis (IPA). Furthermore, 23 mobility-related genes were identified by IPA from dNK-treated EVT. Among these genes, CLDN4 (encoding claudin-4) and FUT4 (encoding fucosyltransferase IV) were chosen for follow-up studies because of their biological relevance from research on tumor cells. The results showed that the mRNA and protein expressions of both CLDN4 and FUT4 in dNK-treated EVT were significantly reduced compared with control (P < 0.01 for both CLDN4 and FUT4 mRNA expression; P < 0.001 for CLDN4 and P < 0.01 for FUT4 protein expression), and were inversely correlated with DNA methylation. Knocking down CLDN4 and FUT4 by small interfering RNA reduced trophoblast invasion, possibly through the altered matrix metalloproteinase (MMP)-2 and/or MMP-9 expression and activity. Taken together, dNK alter EVT mobility at least partially in association with an alteration of DNA methylation profile. Hypermethylation of CLDN4 and FUT4 reduces protein expression. CLDN4 and FUT4 are representative genes that participate in modulating trophoblast mobility. PMID:25697377

  13. A Theoretical Study of the Use of Electroosmotic Flow to Extend the Read-Length of DNA Sequencing by End Labeled Free Solution Electrophoresis

    NASA Astrophysics Data System (ADS)

    McCormick, Laurette

    2005-03-01

    End Labeled Free Solution Electrophoresis provides a means of separating DNA with free solution capillary electrophoresis, eliminating the need for gels and polymer solutions which increase the run-time and can be difficult to load into a capillary. In free solution electrophoresis, DNA is normally free-draining and all fragments elute at the same time, whereas ELFSE uses an uncharged label molecule attached to each DNA fragment in order to render the electrophoretic mobility size-dependent. We show how an electroosmotic flow could be used to extend the read-length of DNA sequencing with ELFSE. In particular, we demonstrate that the magnitude of the electroosmotic flow must be selected very carefully in order to gain both in speed and in read length. The possibility of having molecules moving in opposite directions is also examined.

  14. Electrophoretic interactions and aggregation of colloidal biological particles

    NASA Technical Reports Server (NTRS)

    Davis, Robert H.; Nichols, Scott C.; Loewenberg, Michael; Todd, Paul

    1994-01-01

    The separation of cells or particles from solution has traditionally been accomplished with centrifuges or by sedimentation; however, many particles have specific densities close to unity, making buoyancy-driven motion slow or negligible, but most cells and particles carry surface charges, making them ideal for electrophoretic separation. Both buoyancy-driven and electrophoretic separation may be influenced by hydrodynamic interactions and aggregation of neighboring particles. Aggregation by electrophoresis was analyzed for two non-Brownian particles with different zeta potentials and thin double layers migrating through a viscous fluid. The results indicate that the initial rate of electrophoretically-driven aggregation may exceed that of buoyancy-driven aggregation, even under conditions in which buoyancy-driven relative motion of noninteracting particles is dominant.

  15. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    SciTech Connect

    Lu, Xun; Guanga, Gerald P; Wan, Cheng; Rose, Robert B

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G–5C–4 and central C0/G0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.

  16. Irreversible and reversible topoisomerase II DNA cleavage stimulated by clerocidin: sequence specificity and structural drug determinants.

    PubMed

    Binaschi, M; Zagotto, G; Palumbo, M; Zunino, F; Farinosi, R; Capranico, G

    1997-05-01

    In contrast to other topoisomerase II poisons, the microbial terpenoid clerocidin was shown to stimulate irreversible topoisomerase II-mediated DNA cleavage. To establish the structural determinants for drug activity, in this study we have investigated intensity patterns and sequence specificity of clerocidin-stimulated DNA cleavage using 5'-end 32P-labeled DNA fragments. At a majority of the sites, clerocidin-stimulated cleavage did not revert upon NaCl addition; nevertheless, at some sites, cleavage completely reverted. Statistical analyses showed that drug-preferred bases were different in the two cases: guanine and cytosine were highly preferred at position -1 at irreversible and reversible sites, respectively. These results demonstrated that cleavage irreversibility was site selective and required a guanine at the 3' end of the cut. Further experiments revealed that some irreversible sites showed an abnormal electrophoretic mobility in sequencing gels with respect to cleaved bands generated by 4-(9-acridinylamino)methanesulfon-m-anisidide, suggesting a chemical alteration of the DNA strand. Interestingly, the ability to stimulate irreversible cleavage progressively decreased over time when clerocidin was stored in ethanol. Under these conditions, nuclear magnetic resonance measurements demonstrated that the drug underwent structural modifications that involved the C-12-C-15 side chain. Thus, the results indicate that a specific moiety of clerocidin may react with the DNA (guanine at -1) in the ternary complex, resulting in cleavage irreversibility and in altered DNA mobility in sequencing gels. PMID:9135013

  17. Theory of electrophoretic separations. I - Formulation of a mathematical model

    NASA Technical Reports Server (NTRS)

    Saville, D. A.; Palusinski, O. A.

    1986-01-01

    A generally applicable model of electrophoretic processes is presented. The model describes the chemical reactions, treating the chemical processes as reactions at equilibrium and accounting for convection, conservation, diffusion, and electromigration of individual species as well as the relation between charge and potential. Conservation relations are described and simplified, taking advantage of the speed of the chemical reactions as compared to the transport processes to adapt the model to the electrophoretic processes involving weak electrolytes. As an application example, isotachophoresis in a one-dimensional column is considered in detail.

  18. High charged red pigment nanoparticles for electrophoretic displays

    NASA Astrophysics Data System (ADS)

    Hou, Xin-Yan; Bian, Shu-Guang; Chen, Jian-Feng; Le, Yuan

    2012-12-01

    Organic pigment permanent red F2R nanoparticles were prepared via surface modification to improve the surface charge and dispersion ability in organic medium. Their large surface chargeability is confirmed by ζ-potential value of -49.8 mV. The prepared particles exhibited average size of 105 nm and showed very narrow distribution with polydispersity index of 0.068. The sedimentation ratio of the prepared particles in tetrachloroethylene was less than 5% within 12 days. The electrophoretic inks consisting of the prepared red particles with white particles as contrast showed good electrophoretic display, its refresh time was 200 ms.

  19. Cloning of human Ca2+ homoeostasis endoplasmic reticulum protein (CHERP): regulated expression of antisense cDNA depletes CHERP, inhibits intracellular Ca2+ mobilization and decreases cell proliferation.

    PubMed Central

    Laplante, J M; O'Rourke, F; Lu, X; Fein, A; Olsen, A; Feinstein, M B

    2000-01-01

    A monoclonal antibody which blocks InsP(3)-induced Ca(2+) release from isolated endoplasmic reticulum was used to isolate a novel 4.0 kb cDNA from a human erythroleukaemia (HEL) cell cDNA expression library. A corresponding mRNA transcript of approx. 4.2 kb was present in all human cell lines and tissues examined, but cardiac and skeletal muscle had an additional transcript of 6.4 kb. The identification in GenBank(R) of homologous expressed sequence tags from many tissues and organisms suggests that the gene is ubiquitously expressed in higher eukaryotes. The gene was mapped to human chromosome 19p13.1. The cDNA predicts a 100 kDa protein, designated Ca(2+) homoeostasis endoplasmic reticulum protein (CHERP), with two putative transmembrane domains, multiple consensus phosphorylation sites, a polyglutamine tract of 12 repeats and regions of imperfect tryptophan and histadine octa- and nona-peptide repeats. In vitro translation of the full-length cDNA produced proteins of M(r) 128000 and 100000, corresponding to protein bands detected by Western blotting of many cell types. CHERP was co-localized in HEL cells with the InsP(3) receptor by two-colour immunofluorescence. Transfection of HEL cells with antisense cDNA led to an 80% decline in CHERP within 5 days of antisense induction, with markedly decreased intracellular Ca(2+) mobilization by thrombin, decreased DNA synthesis and growth arrest, indicating that the protein has an important function in Ca(2+) homoeostasis, growth and proliferation. PMID:10794731

  20. A 265-base DNA sequencing read by capillary electrophoresis with no separation matrix.

    PubMed

    Albrecht, Jennifer Coyne; Lin, Jennifer S; Barron, Annelise E

    2011-01-15

    Electrophoretic DNA sequencing without a polymer matrix is currently possible only with the use of some kind of "drag-tag" as a mobility modifier. In free-solution conjugate electrophoresis (FSCE), a drag-tag attached to each DNA fragment breaks linear charge-to-friction scaling, enabling size-based separation in aqueous buffer alone. Here we report a 265-base read for free-solution DNA sequencing by capillary electrophoresis using a random-coil protein drag-tag of unprecedented length and purity. We identified certain methods of protein expression and purification that allow the production of highly monodisperse drag-tags as long as 516 amino acids, which are almost charge neutral (+1 to +6) and yet highly water-soluble. Using a four-color LIF detector, 265 bases could be read in 30 min with a 267-amino acid drag-tag, on par with the average read of current next-gen sequencing systems. New types of multichannel systems that allow much higher throughput electrophoretic sequencing should be much more accessible in the absence of a requirement for viscous separation matrix. PMID:21182303

  1. G-quadruplex formation between G-rich PNA and homologous sequences in oligonucleotides and supercoiled plasmid DNA.

    PubMed

    Gaynutdinov, Timur I; Englund, Ethan A; Appella, Daniel H; Onyshchenko, Mykola I; Neumann, Ronald D; Panyutin, Igor G

    2015-04-01

    Guanine (G)-rich DNA sequences can adopt four-stranded quadruplex conformations that may play a role in the regulation of genetic processes. To explore the possibility of targeted molecular recognition of DNA sequences with short G-rich peptide nucleic acids (PNA) and to assess the strand arrangement in such complexes, we used PNA and DNA with the Oxytricha nova telomeric sequence d(G4T4G4) as a model. PNA probes were complexed with DNA targets in the following forms: single-stranded oligonucleotides, a loop of DNA in a hairpin conformation, and as supercoiled plasmid with the (G4T4G4)/(C4A4C4) insert. Gel-shift mobility assays demonstrated formation of stable hybrid complexes between the homologous G4T4G4 PNA and DNA with multiple modes of binding. Chemical and enzymatic probing revealed sequence-specific and G-quadruplex dependent binding of G4T4G4 PNA to dsDNA. Spectroscopic and electrophoretic analysis of the complex formed between PNA and the synthetic DNA hairpin containing the G4T4G4 loop showed that the stoichiometry of a prevailing complex is three PNA strands per one DNA strand. We speculate how this new PNA-DNA complex architecture can help to design more selective, quadruplex-specific PNA probes. PMID:25650982

  2. Electrophoretic and aggregation behavior of bovine, horse and human red blood cells in plasma and in polymer solutions.

    PubMed

    Bäumler, H; Neu, B; Mitlöhner, R; Georgieva, R; Meiselman, H J; Kiesewetter, H

    2001-01-01

    The electrophoretic mobility of native and glutaraldehyde-fixed bovine, human, and horse red blood cells (RBC) was investigated as a function of ionic strength (5-150 mM) and concentration of 464 kDa dextran (2 and 3 g/dl); RBC aggregation in autologous plasma and in dextran solutions was also measured. In agreement with previous observations, human and horse RBC form stable rouleaux whereas bovine RBC do not aggregate in either plasma or in dextran 464 kDa solutions. Electrophoretic measurements showed a species-dependent adsorption and depletion of dextran that can be theoretically evaluated. Adsorption of polymer is not a prerequisite for RBC aggregation (bovine RBC show the highest amount of adsorbed dextran yet do not aggregate). Aggregate formation thus occurs as long as the Gibbs free energy difference, given by the osmotic pressure difference between the bulk phase and the polymer-depleted region between two RBC, is larger than the steric and electrostatic repulsive energy contributed by the macromolecules present on the RBC surface. With increasing bulk-phase polymer concentration the depletion layer thickness decreases and the amount of adsorbed macromolecules increases, thereby resulting in an increase of the repulsive component of the interaction energy and decreased aggregation. We thus view electrophoretic measurements of RBC in various media as an important tool for understanding polymer behavior near the red cell surface and hence the mechanisms involved in RBC aggregation. PMID:11381164

  3. Mobilized retrotransposon Tos17 of rice by alien DNA introgression transposes into genes and causes structural and methylation alterations of a flanking genomic region.

    PubMed

    Han, F P; Liu, Z L; Tan, M; Hao, S; Fedak, G; Liu, B

    2004-01-01

    Tos17 is a copia-like endogenous retrotransposon of rice, which can be activated by various stresses such as tissue culture and alien DNA introgression. To confirm element mobilization by introgression and to study possible structural and epigenetic effects of Tos17 insertion on its target sequences, we isolated all flanking regions of Tos17 in an introgressed rice line (Tong35) that contains minute amount of genomic DNA from wild rice (Zizania latifolia). It was found that there has been apparent but limited mobilization of Tos17 in this introgression line, as being reflected by increased but stable copy number of the element in progeny of the line. Three of the five activated copies of the element have transposed into genes. Based on sequence analysis and Southern blot hybridization with several double-enzyme digests, no structural change in Tos17 could be inferred in the introgression line. Cytosine methylation status at all seven CCGG sites within Tos17 was also identical between the introgression line and its rice parent (Matsumae)-all sites being heavily methylated. In contrast, changes in structure and cytosine methylation patterns were detected in one of the three low-copy genomic regions that flank newly transposed Tos17, and all changes are stably inherited through selfed generations. PMID:15703040

  4. Integrated Capture, Concentration, PCR, and Capillary Electrophoretic Analysis of Pathogens on a Chip

    PubMed Central

    Beyor, Nathaniel; Yi, Lina; Seo, Tae Seok; Mathies, Richard A.

    2009-01-01

    A lab-on-a-chip system for pathogen detection is presented that integrates cell preconcentration, purification, PCR, and capillary electrophoretic (CE) analysis. The microdevice is comprised of micropumps and valves, a cell capture structure, a 100 nL PCR reactor, and a 5-cm long CE column for amplicon separation. Sample volumes ranging from 10 to 100 μL are introduced and driven through a fluidized bed of magnetically constrained immunomagnetic beads where the target cells are captured. After cell capture, beads are transferred using the on-chip pumps to the PCR reactor for DNA amplification. The resulting PCR products are electrophoretically injected onto the CE column for separation and detection of E. coli K12 and E. coli O157 targets. A detection limit of 0.2 cfu/μL is achieved using the E. coli O157 target and an input volume of 50 μL. Finally, the sensitive detection of E. coli O157 in the presence of K12 at a ratio of 1:1000 illustrates the capability of our system to identify target cells in a high commensal background. This cell capture-PCR-CE microsystem is a significant advance in the development of rapid, sensitive, and specific lab-on-a-chip devices for pathogen detection. PMID:19341275

  5. Investigation of the free flow electrophoretic process. Volume 2: Technical analysis

    NASA Technical Reports Server (NTRS)

    Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.

    1979-01-01

    The effect of gravity on the free flow electrophoretic process was investigated. The demonstrated effects were then compared with predictions made by mathematical models. Results show that the carrier buffer flow was affected by gravity induced thermal convection and that the movement of the separating particle streams was affected by gravity induced buoyant forces. It was determined that if gravity induced buoyant forces were included in the mathematical models, then effective predictions of electrophoresis chamber separation performance were possible. The results of tests performed using various methods of electrophoresis using supportive media show that the mobility and the ability to separate were essentially independent of concentration, providing promise of being able to perform electrophoresis with higher inlet concentrations in space.

  6. Computer simulation of two electrophoretic columns coupled for isoelectric focusing in simple buffers

    NASA Technical Reports Server (NTRS)

    Tsai, Amos; Mosher, Richard A.; Bier, Milan

    1986-01-01

    Computer simulation is used to analyze a system of two electrophoretic columns coupled by mixing the anolyte of one with the catholyte of the other. A mathematical model is presented which is used to predict the pH gradients formed by monovalent buffers in this system, when the currents in the columns are unequal. In the column with the higher current a pH gradient is created which increases from anode to cathode and is potentially useful for isoelectric focusing. The breadth of this gradient is dependent upon the ratio of the currents. The function of the second column is the compensation of buffer migration which occurs in the first column, thereby maintaining constant electrolyte composition. The effects of buffer pKs and mobilities are evaluated.

  7. Fluorescence energy transfer dye-labeled primers for DNA sequencing and analysis.

    PubMed Central

    Ju, J; Ruan, C; Fuller, C W; Glazer, A N; Mathies, R A

    1995-01-01

    Fluorescent dye-labeled DNA primers have been developed that exploit fluorescence energy transfer (ET) to optimize the absorption and emission properties of the label. These primers carry a fluorescein derivative at the 5' end as a common donor and other fluorescein and rhodamine derivatives attached to a modified thymidine residue within the primer sequence as acceptors. Adjustment of the donor-acceptor spacing through the placement of the modified thymidine in the primer sequence allowed generation of four primers, all having strong absorption at a common excitation wavelength (488 nm) and fluorescence emission maxima of 525, 555, 580, and 605 nm. The ET efficiency of these primers ranges from 65% to 97%, and they exhibit similar electrophoretic mobilities by gel electrophoresis. With argon-ion laser excitation, the fluorescence of the ET primers and of the DNA sequencing fragments generated with ET primers is 2- to 6-fold greater than that of the corresponding primers or fragments labeled with single dyes. The higher fluorescence intensity of the ET primers allows DNA sequencing with one-fourth of the DNA template typically required when using T7 DNA polymerase. With single-stranded M13mp18 DNA as the template, a typical sequencing reaction with ET primers on a commercial sequencer provided DNA sequences with 99.8% accuracy in the first 500 bases. ET primers should be generally useful in the development of other multiplex DNA sequencing and analysis methods. Images Fig. 4 Fig. 5 PMID:7753809

  8. Electrophoretic separation of human kidney cells at zero gravity

    NASA Technical Reports Server (NTRS)

    Barlow, G. H.; Lazer, S. L.; Rueter, A.; Allen, R. E.

    1977-01-01

    Electrophoretic isolation of cells results in a loss of resolution power caused by the sedimentation of the cells in the media. The results of an experiment to extract urokinase from human embryos during the Apollo Soyuz mission are presented and discussed.

  9. Antiplasmin activity of electrophoretically separated human serum fractions

    PubMed Central

    Mann, R. D.; Cotton, Susan; Jackson, D.

    1966-01-01

    The antiplasmin which migrates electrophoretically with the alpha2 globulins preponderates in effect over that of the alpha1 migrating antiplasmin. This preponderance persists at physiological pH value in vitro and the significance of this finding is discussed. No evidence has been obtained of the existence of anti-urokinase activity in antiplasmin-free serum fractions. PMID:4160096

  10. Monodisperse light color nanoparticle ink toward chromatic electrophoretic displays

    NASA Astrophysics Data System (ADS)

    Peng, Bo; Li, Yue; Li, Jian; Bi, Lei; Lu, Haipeng; Xie, Jianliang; Ren, Xiangling; Cao, Yonghai; Wang, Ning; Meng, Xianwei; Deng, Longjiang; Guo, Zhanhu

    2016-05-01

    The facile synthesis of nanoparticles for precise image control and fast response of chromatic electrophoretic displays (EPDs) is a challenge. Herein, we report a general method to prepare pink, blue, and yellow nanoparticles with low density and a tunable size of 230-310 nm. The monodispersity is down to 0.02 and surface charges are up to 666e. Importantly, our work highlights the feasibility of chromatic nanoparticles as cost-effective candidates for electrophoretic displays.The facile synthesis of nanoparticles for precise image control and fast response of chromatic electrophoretic displays (EPDs) is a challenge. Herein, we report a general method to prepare pink, blue, and yellow nanoparticles with low density and a tunable size of 230-310 nm. The monodispersity is down to 0.02 and surface charges are up to 666e. Importantly, our work highlights the feasibility of chromatic nanoparticles as cost-effective candidates for electrophoretic displays. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02524b

  11. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages §...

  12. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages §...

  13. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages §...

  14. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages §...

  15. Electrical Transport of Long DNA Molecules on Liuid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Samuilov, Vladimir; Seo, Young-Soo; Sokolov, Jonathan; Rafailovich, Miriam; Chu, Benjamin

    2002-03-01

    The electrical transport properties of long DNA molecules were studied based upon a newly developed method of electrophoresis on flat surfaces [1]. The electrophoretic mobilities of DNA in the presence of Si surface were found to be approximately one order less than in free solution. The electropherogram peaks of 1 kb- and Hind III DNA ladders have been clearly identified. The experimental dependencies of the mobilities on molecular weight were found to be scaled with power law with the exponents of an opposite sign at 2 different buffer concentrations: negative for surface transport at 10 -2 M concentration of TBE buffer and positive at 10 -3 M. A novel mechanism responsible for DNA molecules separation in the presence of the surface at low buffer concentrations has been developed. The multi-ion system is governed by the Nernst-Planck equations (ion movement due to convection, migration and diffusion), in combination with the Poisson-Boltzmann equation. The discrepancy from charge neutrality that occurs in the diffuse double layer very close to the substrate is the driving force for the Navier-Stokes equation, which finally results in a liquid movement very close to the surface that is denoted as electro-osmosis. The adsorbed DNA move due to the electrical field parallel to the surface, and also due the electro-osmotic convection that drags the DNA chains if they are only partly adsorbed. The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface, is higher than of the shorter ones in the electric field, oriented along the surface. The main features of the electro-hydrodynamic instability related to λ and T2 DNA molecules aggregation, observed in our system, are consistent with our model. This work was supported by NSF-MRSEC Program. [1]. N. Pernodet, V. Samuilov, K. Shin, J. Sokolov, M.H. Rafailovich, D. Gersappe, B. Chu, DNA Electrophoresis on a

  16. A New DNA Binding Protein Highly Conserved in Diverse Crenarchaeal Viruses

    SciTech Connect

    Larson, E.T.; Eilers, B.J.; Reiter, D.; Ortmann, A.C.; Young, M.J.; Lawrence, C.M.; /Montana State U. /Tubingen U.

    2007-07-09

    Sulfolobus turreted icosahedral virus (STIV) infects Sulfolobus species found in the hot springs of Yellowstone National Park. Its 37 open reading frames (ORFs) generally lack sequence similarity to other genes. One exception, however, is ORF B116. While its function is unknown, orthologs are found in three additional crenarchaeal viral families. Due to the central importance of this protein family to crenarchaeal viruses, we have undertaken structural and biochemical studies of B116. The structure reveals a previously unobserved fold consisting of a five-stranded beta-sheet flanked on one side by three alpha helices. Two subunits come together to form a homodimer with a 10-stranded mixed beta-sheet, where the topology of the central strands resembles an unclosed beta-barrel. Highly conserved loops rise above the surface of the saddle-shaped protein and suggest an interaction with the major groove of DNA. The predicted B116-DNA interaction is confirmed by electrophoretic mobility shift assays.

  17. Anionic/Zwitterionic Lipid-Based Gene Vectors of pDNA.

    PubMed

    Barrán-Berdón, Ana L; Aicart, Emilio; Junquera, Elena

    2016-01-01

    The use of anionic lipids (ALs) as non-viral gene vectors depicts a promising alternative to cationic lipids (CLs) since they are more biocompatible and present lower levels of phagocytosis by macrophages. Several experimental methods, such as electrophoretic mobility (ζ-potential), gel electrophoresis, small-angle X-ray scattering (SAXS), fluorescence and confocal fluorescence microscopies (FM and CFM), flow assisted cell sorting-flow cytometry (FACS-FCM), and cell viability/cytotoxicity assays can be used for a complete physicochemical and biochemical characterization of lipoplexes formed by an AL, a zwitterionic lipid (ZL), and a plasmid DNA (pDNA), their electrostatic interaction being necessarily mediated by divalent cations, such as Ca(2+). In the present chapter, we summarize the protocols optimized for the mentioned characterization techniques. PMID:27436312

  18. Capillary electrophoresis of small ssDNA molecules

    NASA Astrophysics Data System (ADS)

    Kopecka, Katerina; Slater, Gary W.; Drouin, Guy

    2004-03-01

    Recently, the electrophoretic separation of small ssDNA fragments (bellow 250 bases) has attracted a lot of attention because of applications related to Single Nucleotide Polymorphisms. In order to optimize these systems, we require a better understanding of DNA migration behavior in this size range. While the reptation model provides an excellent understanding of the dynamics of long DNA fragments in gel electrophoresis, the properties of small DNA fragments has not been studied extensively yet. At least three theoretical formulas have been proposed to explain the mobility of short ssDNA molecules in this regime. Specifically, the Ogston regime was introduced for small molecules having radii-of-gyration comparable to or smaller than the pore size of the sieving matrix. We introduce these three different formulas and discuss how their free parameters are related to actual physical parameters. We then test these formulas with new data obtained by capillary electrophoresis in our laboratory using poly(dimethylacrylamide) sieving matrices. Our results show that all three formulas provide decent fits, and that their fitting parameters are consistent with one another. This is the first step towards the development of a systematic approach to optimizing sequencing systems for this size range.

  19. Molecular Dynamics Simulation of DNA Capture and Transport in Heated Nanopores.

    PubMed

    Belkin, Maxim; Aksimentiev, Aleksei

    2016-05-25

    The integration of local heat sources with solid-state nanopores offers new means for controlling the transmembrane transport of charged biomacromolecules. In the case of electrophoretic transport of DNA, recent experimental studies revealed unexpected temperature dependences of the DNA capture rate, the DNA translocation velocity, and the ionic current blockades produced by the presence of DNA in the nanopore. Here, we report the results of all-atom molecular dynamics simulations that elucidated the effect of temperature on the key microscopic processes governing electric field-driven transport of DNA through nanopores. Mimicking the experimental setup, we simulated the capture and subsequent translocation of short DNA duplexes through a locally heated nanopore at several temperatures and electrolyte conditions. The temperature dependence of ion mobility at the DNA surface was found to cause the dependence of the relative conductance blockades on temperature. To the first order, the effective force on DNA in the nanopore was found to be independent of temperature, despite a considerable reduction of solution viscosity. The temperature dependence of the solution viscosity was found to make DNA translocations faster for a uniformly heated system but not in the case of local heating that does not affect viscosity of solution surrounding the untranslocated part of the molecule. Increasing solution temperature was also found to reduce the lifetime of bonds formed between cations and DNA. Using a flow suppression algorithm, we were able to separate the effects of electro-osmotic flow and direct ion binding, finding the reduced durations of DNA-ion bonds to increase, albeit weakly, the effective force experienced by DNA in an electric field. Unexpectedly, our simulations revealed a considerable temperature dependence of solvent velocity at the DNA surface-slip velocity, an effect that can alter hydrodynamic coupling between the motion of DNA and the surrounding fluid

  20. Electrophoresis system for high temperature mobility measurements of nanosize particles

    NASA Astrophysics Data System (ADS)

    Rodriguez-Santiago, Victor; Fedkin, Mark V.; Lvov, Serguei N.

    2008-09-01

    The electrophoretic mobility, which reflects the zeta potential of a solid material, is an important experimental quantity providing information about the electrical double layer at the solid/liquid interface. A new high temperature electrophoresis cell was developed suitable for electrophoretic mobility measurements of dispersed nanosize particles up to 150 °C and 40 bars. Amorphous silica (SiO2) particle size standards were used to test the particle size detection limit of the new instrument at 25, 100, and 150 °C and several pH values. The microscopic detection of the particles was enabled by dark-field illumination, which allowed extending the previously available capabilities and provided higher accuracy of the electrophoretic mobility data. The electrophoretic mobility measurements for SiO2 at temperatures above 100 °C were reported for the first time and indicated a gradual increase in particle electrophoretic response with increasing temperature. The obtained data indicated negatively charged SiO2 surface throughout the pH and temperature ranges studied.

  1. Electrophoretic Separation of Single Particles Using Nanoscale Thermoplastic Columns.

    PubMed

    Weerakoon-Ratnayake, Kumuditha M; Uba, Franklin I; Oliver-Calixte, Nyoté J; Soper, Steven A

    2016-04-01

    Phenomena associated with microscale electrophoresis separations cannot, in many cases, be applied to the nanoscale. Thus, understanding the electrophoretic characteristics associated with the nanoscale will help formulate relevant strategies that can optimize the performance of separations carried out on columns with at least one dimension below 150 nm. Electric double layer (EDL) overlap, diffusion, and adsorption/desorption properties and/or dielectrophoretic effects giving rise to stick/slip motion are some of the processes that can play a role in determining the efficiency of nanoscale electrophoretic separations. We investigated the performance characteristics of electrophoretic separations carried out in nanoslits fabricated in poly(methyl methacrylate), PMMA, devices. Silver nanoparticles (AgNPs) were used as the model system with tracking of their transport via dark field microscopy and localized surface plasmon resonance. AgNPs capped with citrate groups and the negatively charged PMMA walls (induced by O2 plasma modification of the nanoslit walls) enabled separations that were not apparent when these particles were electrophoresed in microscale columns. The separation of AgNPs based on their size without the need for buffer additives using PMMA nanoslit devices is demonstrated herein. Operational parameters such as the electric field strength, nanoslit dimensions, and buffer composition were evaluated as to their effects on the electrophoretic performance, both in terms of efficiency (plate numbers) and resolution. Electrophoretic separations performed at high electric field strengths (>200 V/cm) resulted in higher plate numbers compared to lower fields due to the absence of stick/slip motion at the higher electric field strengths. Indeed, 60 nm AgNPs could be separated from 100 nm particles in free solution using nanoscale electrophoresis with 100 μm long columns. PMID:26963496

  2. Sequence-specific interactions between a cellular DNA-binding protein and the simian virus 40 origin of DNA replication

    SciTech Connect

    Traut, W.; Fanning, E.

    1988-02-01

    The core origin of simian virus 40 (SV40) DNA replication is composed of a 64-base-pair sequence encompassing T-antigen-binding site II and adjacent sequences on either side. A 7-base-pair sequence to the early side of T-antigen-binding site II which is conserved among the papovavirus genomes SV40, BK, JC and SA12 was recently shown to be part of a 10-base-pair sequence required for origin activity, but its functional role was not defined. In the present report, the authors used gel retention assays to identify a monkey cell factor that interacts specifically with double-stranded DNA carrying this sequence and also binds to single-stranded DNA. DNA-protein complexes formed with extracts from primate cells are more abundant and display electrophoretic mobilities distinct from those formed with rodent cell extracts. The binding activity of the factor on mutant templates is correlate with the replication activity of the origin. The results suggest that the monkey cell factor may be involved in SV40 DNA replication.

  3. Kinetics and binding of the thymine-DNA mismatch glycosylase, Mig-Mth, with mismatch-containing DNA substrates.

    PubMed

    Begley, Thomas J; Haas, Brian J; Morales, Juan C; Kool, Eric T; Cunningham, Richard P

    2003-01-01

    We have examined the removal of thymine residues from T-G mismatches in DNA by the thymine-DNA mismatch glycosylase from Methanobacterium thermoautrophicum (Mig-Mth), within the context of the base excision repair (BER) pathway, to investigate why this glycosylase has such low activity in vitro. Using single-turnover kinetics and steady-state kinetics, we calculated the catalytic and product dissociation rate constants for Mig-Mth, and determined that Mig-Mth is inhibited by product apyrimidinic (AP) sites in DNA. Electrophoretic mobility shift assays (EMSA) provide evidence that the specificity of product binding is dependent upon the base opposite the AP site. The binding of Mig-Mth to DNA containing the non-cleavable substrate analogue difluorotoluene (F) was also analyzed to determine the effect of the opposite base on Mig-Mth binding specificity for substrate-like duplex DNA. The results of these experiments support the idea that opposite strand interactions play roles in determining substrate specificity. Endonuclease IV, which cleaves AP sites in the next step of the BER pathway, was used to analyze the effect of product removal on the overall rate of thymine hydrolysis by Mig-Mth. Our results support the hypothesis that endonuclease IV increases the apparent activity of Mig-Mth significantly under steady-state conditions by preventing reassociation of enzyme to product. PMID:12509271

  4. Analyte zone sharpening in pressurized capillary electrochromatography based on electrophoretic migration under a heterogeneous field.

    PubMed

    Kitagawa, Shinya; Buno, Hiroki; Sakabe, Koichi; Nakagawa, Hiroyuki; Ohtani, Hajime

    2014-11-01

    Significant peak width reductions, or peak height enhancements, of angiotensins were observed when a high voltage was applied to hydrophilic interaction pressurized capillary electrochromatography using gradient elution with mobile phases containing perchloric acid. The investigation using a contactless conductivity detector revealed that perchloric acid was adsorbed on the surface of the stationary phase, when the acetonitrile content in the mobile phase was high, and released from the stationary phase by increasing the water content during a gradient procedure. The released perchloric acid formed a highly concentrated zone moving from the column inlet to the outlet. The electrochromatographic behavior of the analytes, primarily electrophoretic migration, was changed in this zone. As a consequence of the significant variation in migration velocity of the analytes, the sample band width was reduced similar fashion to on-capillary concentration in capillary electrophoresis. Using this result, the reduction of band width and enhancement in separation efficiency was demonstrated in reversed-phase pressurized electrochromatography, in which the conductivity of the mobile phase was significantly altered using a step gradient. The resolution between benzoic acid and 1-naphthalene sulfonic acid was successfully improved from 2.7 to 4.3 by using the band width reduction method based on field-amplified stacking. PMID:25115853

  5. Electrophoretically deposited multiwalled carbon nanotube based amperometric genosensor for E.coli detection

    NASA Astrophysics Data System (ADS)

    Bhardwaj, Hema; Solanki, Shipra; Sumana, Gajjala

    2016-04-01

    This work reports on a sensitive and selective genosensor fabrication method for Escherichia coli (E.coli) detection. The functionalized multiwalled carbon nanotubes (MWCNT) synthesized via chemical vapour deposition have been deposited electrophoretically onto indium tin oxide coated glass surface and have been utilized as matrices for the covalent immobilization of E.coli specific probe oligonucleotide that was identified from the 16s rRNA coding region of the E.coli genome. This fabricated functionalized MWCNT based platform sought to provide improved fundamental characteristics to electrode interface in terms of electro-active surface area and diffusion coefficient. Electrochemical cyclic voltammetry revealed that this genosensor exhibits a linear response to complementary DNA in the concentration range of 10-7 to 10-12 M with a detection limit of 1×10-12 M.

  6. Molecular Dynamics Simulation of DNA Capture and Transport in Heated Nanopores

    PubMed Central

    2016-01-01

    The integration of local heat sources with solid-state nanopores offers new means for controlling the transmembrane transport of charged biomacromolecules. In the case of electrophoretic transport of DNA, recent experimental studies revealed unexpected temperature dependences of the DNA capture rate, the DNA translocation velocity, and the ionic current blockades produced by the presence of DNA in the nanopore. Here, we report the results of all-atom molecular dynamics simulations that elucidated the effect of temperature on the key microscopic processes governing electric field-driven transport of DNA through nanopores. Mimicking the experimental setup, we simulated the capture and subsequent translocation of short DNA duplexes through a locally heated nanopore at several temperatures and electrolyte conditions. The temperature dependence of ion mobility at the DNA surface was found to cause the dependence of the relative conductance blockades on temperature. To the first order, the effective force on DNA in the nanopore was found to be independent of temperature, despite a considerable reduction of solution viscosity. The temperature dependence of the solution viscosity was found to make DNA translocations faster for a uniformly heated system but not in the case of local heating that does not affect viscosity of solution surrounding the untranslocated part of the molecule. Increasing solution temperature was also found to reduce the lifetime of bonds formed between cations and DNA. Using a flow suppression algorithm, we were able to separate the effects of electro-osmotic flow and direct ion binding, finding the reduced durations of DNA–ion bonds to increase, albeit weakly, the effective force experienced by DNA in an electric field. Unexpectedly, our simulations revealed a considerable temperature dependence of solvent velocity at the DNA surface—slip velocity, an effect that can alter hydrodynamic coupling between the motion of DNA and the surrounding fluid

  7. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  8. Technical advances: genome-wide cDNA-AFLP analysis of the Arabidopsis transcriptome.

    PubMed

    Volkmuth, Wayne; Turk, Stefan; Shapiro, Amy; Fang, Yiwen; Kiegle, Ed; van Haaren, Mark; Donson, Jonathan

    2003-01-01

    cDNA-AFLP, a technology historically used to identify small numbers of differentially expressed genes, was adapted as a genome-wide transcript profiling method. mRNA levels were assayed in a diverse range of tissues from Arabidopsis thaliana plants grown under a variety of environmental conditions. The resulting cDNA-AFLP fragments were sequenced. By linking cDNA-AFLP fragments to their corresponding mRNAs via these sequences, a database was generated that contained quantitative expression information for up to two-thirds of gene loci in A. thaliana, ecotype Ws. Using this resource, the expression levels of genes, including those with high nucleotide sequence similarity, could be determined in a high-throughput manner merely by comparing cDNA-AFLP profiles with the database. The lengths of cDNA-AFLP fragments inferred from their electrophoretic mobilities correlated well with actual fragment lengths determined by sequencing. In addition, the concentrations of AFLP fragments from single cDNAs were highly correlated, illustrating the validity of cDNA-AFLP as a quantitative, genome-wide, transcript profiling method. cDNA-AFLP profiles were also qualitatively consistent with mRNA profiles obtained from parallel microarray analysis, and with data from previous studies. PMID:14506844

  9. Quantitative Analysis of Protein-DNA Interaction by qDPI-ELISA.

    PubMed

    Fischer, Stefan M; Böser, Alexander; Hirsch, Jan P; Wanke, Dierk

    2016-01-01

    The specific binding of DNA-binding proteins to their cognate DNA motifs is a crucial step for gene expression control and chromatin organization in vivo. The development of methods for the identification of in vivo binding regions by, e.g. chromatin immunoprecipitation (ChIP) or DNA adenine methyltransferase identification (Dam-ID) added an additional level of qualitative information for data mining in systems biology or applications in synthetic biology. In this respect, the in vivo techniques outpaced methods for thorough characterization of protein-DNA interaction and, especially, of the binding motifs at single base-pair resolution. The elucidation of DNA-binding capacities of proteins is frequently done with methods such as yeast one-hybrid, electrophoretic mobility shift assay (EMSA) or systematic evolution of ligands by exponential enrichment (SELEX) that provide only qualitative binding information and are not suited for automation or high-throughput screening of several DNA motifs. Here, we describe the quantitative DNA-protein-Interaction-ELISA (qDPI-ELISA) protocol, which makes use of fluorescent fusion proteins and, hence, is faster and easier to handle than the classical DPI-ELISA. Although every DPI-ELISA experiment delivers quantitative information, the qDPI-ELISA has an increased consistency, as it does not depend on immunological detection. We demonstrate the high comparability between probes and different protein extracts in qDPI-ELISA experiments. PMID:27557760

  10. Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing) by the Topoisomerase II inhibitor, Etoposide, in rice

    PubMed Central

    2012-01-01

    Background Etoposide (epipodophyllotoxin) is a chemical commonly used as an anti-cancer drug which inhibits DNA synthesis by blocking topoisomerase II activity. Previous studies in animal cells have demonstrated that etoposide constitutes a genotoxic stress which may induce genomic instability including mobilization of normally quiescent transposable elements (TEs). However, it remained unknown whether similar genetically mutagenic effects could be imposed by etoposide in plant cells. Also, no information is available with regard to whether the drug may cause a perturbation of epigenetic stability in any organism. Results To investigate whether etoposide could generate genetic and/or epigenetic instability in plant cells, we applied etoposide to germinating seeds of six cultivated rice (Oryza sativa L.) genotypes including both subspecies, japonica and indica. Based on the methylation-sensitive gel-blotting results, epigenetic changes in DNA methylation of three TEs (Tos17, Osr23 and Osr36) and two protein-encoding genes (Homeobox and CDPK-related genes) were detected in the etoposide-treated plants (S0 generation) in four of the six studied japonica cultivars, Nipponbare, RZ1, RZ2, and RZ35, but not in the rest japonica cultivar (Matsumae) and the indica cultivar (93-11). DNA methylation changes in the etoposide-treated S0 rice plants were validated by bisulfite sequencing at both of two analyzed loci (Tos17 and Osr36). Transpositional activity was tested for eight TEs endogenous to the rice genome in both the S0 plants and their selfed progenies (S1 and S2) of one of the cultivars, RZ1, which manifested heritable phenotypic variations. Results indicated that no transposition occurred in the etoposide-treated S0 plants for any of the TEs. Nonetheless, a MITE transposon, mPing, showed rampant mobilization in the S1 and S2 progenies descended from the drug-treated S0 plants. Conclusions Our results demonstrate that etoposide imposes a similar genotoxic stress on

  11. Characterization of Halomonas sp. ZM3 isolated from the Zelazny Most post-flotation waste reservoir, with a special focus on its mobile DNA

    PubMed Central

    2013-01-01

    Background Halomonas sp. ZM3 was isolated from Zelazny Most post-flotation mineral waste repository (Poland), which is highly contaminated with heavy metals and various organic compounds. Mobile DNA of the strain (i.e. plasmids and transposons) were analyzed in order to identify genetic information enabling adaptation of the bacterium to the harsh environmental conditions. Results The analysis revealed that ZM3 carries plasmid pZM3H1 (31,370 bp), whose replication system may be considered as an archetype of a novel subgroup of IncU-like replicons. pZM3H1 is a narrow host range, mobilizable plasmid (encodes a relaxase of the MOBV family) containing mercury resistance operon (mer) and czcD genes (mediate resistance to zinc and cobalt), which are part of a large truncated Tn3 family transposon. Further analysis demonstrated that the phenotypes determined by the pZM3H1 resistance cassette are highly dependent on the host strain. In another strand of the study, the trap plasmid pMAT1 was employed to identify functional transposable elements of Halomonas sp. ZM3. Using the sacB positive selection strategy two insertion sequences were identified: ISHsp1 - representing IS5 group of IS5 family and ISHsp2 - a distinct member of the IS630 family. Conclusions This study provides the first detailed description of mobile DNA in a member of the family Halomonadaceae. The identified IncU plasmid pZM3H1 confers resistance phenotypes enabling adaptation of the host strain to the Zelazny Most environment. The extended comparative analysis has shed light on the distribution of related IncU plasmids among bacteria, which, in many cases, reflects the frequency and direction of horizontal gene transfer events. Our results also identify plasmid-encoded modules, which may form the basis of novel shuttle vectors, specific for this group of halophilic bacteria. PMID:23497212

  12. Separation performance of single-stranded DNA electrophoresis in photopolymerized cross-linked polyacrylamide gels.

    PubMed

    Lo, Roger C; Ugaz, Victor M

    2006-02-01

    Considerable effort has been directed toward optimizing performance and maximizing throughput in ssDNA electrophoresis because it is a critical analytical step in a variety of genomic assays. Ultimately, it would be desirable to quantitatively determine the achievable level of separation resolution directly from measurements of fundamental physical properties associated with the gel matrix rather than by the trial and error process often employed. Unfortunately, this predictive capability is currently lacking, due in large part to the need for a more detailed understanding of the fundamental parameters governing separation performance (mobility, diffusion, and dispersion). We seek to address this issue by systematically characterizing electrophoretic mobility, diffusion, and dispersion behavior of ssDNA fragments in the 70-1,000 base range in a photopolymerized cross-linked polyacrylamide matrix using a slab gel DNA sequencer. Data are collected for gel concentrations of 6, 9, and 12%T at electric fields ranging from 15 to 40 V/cm, and resolution predictions are compared with corresponding experimentally measured values. The data exhibit a transition from behavior consistent with the Ogston model for small fragments to behavior in agreement with the biased reptation model at larger fragment sizes. Mobility data are also used to estimate the mean gel pore size and compare the predictions of several models. PMID:16331587

  13. [A new electrophoretic method for coating metalceramic elements with opaque].

    PubMed

    Weber, H

    1979-05-01

    A new, electrophoretical method of coating dental alloys (Au or Ni-Cr) with opaque is described for the first time. The comparison of this method with the known wet brush technique shows that bubbles or voids might occur at the interface between metal and opaque when applying the first ceramic layer manually whereas the electrophoretical one generates a thin and dense layer of porcelain being free of voids within the adherence zone. Those bubbles are considered to be inherent with the brush technique. The author suggests to galvanize dental alloys particularly noble metals in order to suppress any anodic reactions. General advantage for the bond due to galvanization are expected no matter how the opaque was applied. PMID:380960

  14. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    SciTech Connect

    Stephenson, S J

    2011-08-10

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

  15. Nonlinear focusing of DNA macromolecules

    NASA Astrophysics Data System (ADS)

    Frumin, Leonid L.; Peltek, Sergey E.; Zilberstein, Gleb V.

    2001-08-01

    The present paper reports the nonlinear electrophoretic focusing techniques developed after an original idea by Chacron and Slater [Phys. Rev. E 56, 3436 (1997)]. Focusing of DNA molecules is achieved in an alternating nonuniform electric field, created in a wedge gel with hyperbolic boundaries. The fractions separated on such a wedge retained their rectilinear shape during the electrophoresis. Experiments with gel electrophoresis confirm the possibility of a noticeable nonlinear focusing of DNA molecules.

  16. DNA Binding Mode Transitions of Escherichia coli HUαβ: Evidence for Formation of a Bent DNA – Protein Complex on Intact, Linear Duplex DNA

    PubMed Central

    Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas

    2008-01-01

    Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548

  17. Structural alterations of pathologically or physiologically modified DNA.

    PubMed Central

    Ciomei, M; Spadari, S; Pedrali-Noy, G; Ciarrocchi, G

    1984-01-01

    We have studied the alterations of DNA conformation in in vitro depurinated or methylated topological isomers of the plasmid pAT 153. Depurination by heat/acid treatment or alkylation by methyl methanesulfonate (pathological modifications) result in DNA unwinding detected as a reduction in the degree of supercoiling of DNA topoisomers as measured by the alteration of electrophoretic mobility on agarose gel. On the contrary, in vitro enzymic methylation at the C-5 position of cytosine (physiological modification) does not measurably alter the tertiary structure of the circular substrates. From the average number of modified sites needed to remove one superhelical twist from each single topoisomer of a population of partially relaxed DNA molecules, we have calculated an unwinding angle smaller than -3.4 degree per methylated purine and of approximately -12.0 degree per apurinic site. These results, together with previously reported values of unwinding by pyrimidine dimers, suggest a possible mechanism of recognition of damaged sites by repair mechanisms that are not single-damage specific. Images PMID:6366741

  18. Study on the interaction of catechins with human serum albumin using spectroscopic and electrophoretic techniques

    NASA Astrophysics Data System (ADS)

    Trnková, Lucie; Boušová, Iva; Staňková, Veronika; Dršata, Jaroslav

    2011-01-01

    The interaction between eight naturally occurring flavanols (catechin, epicatechin, gallocatechin, epigallocatechin, catechin gallate, epicatechin gallate, gallocatechin gallate, and epigallocatechin gallate) and human serum albumin (HSA) has been investigated by spectroscopic (fluorescence quenching and UV-Vis absorption) and electrophoretic (native and SDS PAGE) techniques under simulated physiological conditions (pH 7.40, 37 °C). The spectroscopic results confirmed the complex formation for the tested systems. The binding constants and the number of binding sites were obtained by analysis of fluorescence data. The strongest binding affinity to HSA was found for epicatechin gallate and decreased in the order epicatechin gallate ⩾ catechin gallate > epigallocatechin gallate > gallocatechin gallate ≫ epicatechin ⩾ catechin > gallocatechin ⩾ epigallocatechin. All free energy changes possessed negative sign indicating the spontaneity of catechin-HSA systems formation. The binding distances between the donor (HSA) and the acceptors (catechins) estimated by the Förster theory revealed that non-radiation energy transfer from HSA to catechins occurred with high possibility. According to results obtained by native PAGE, the galloylated catechins increased the electrophoretic mobility of HSA, which indicated the change in the molecular charge of HSA, whilst the non-galloylated catechins caused no changes. The ability of aggregation and cross-linking of tested catechins with HSA was not proved by SDS-PAGE. The relationship between the structure characteristics of all tested catechins (e.g. presence of the galloyl moiety on the C-ring, the number of hydroxyl groups on the B-ring, and the spatial arrangement of the substituents on the C-ring) and their binding properties to HSA is discussed. The presented study contributes to the current knowledge in the area of protein-ligand binding, particularly catechin-HSA interactions.

  19. An Electro-hydrodynamics-based model for the ionic conductivity of solid-state nanopores during DNA translocation

    PubMed Central

    Luan, Binquan; Stolovitzky, Gustavo

    2013-01-01

    A solid-state nanopore can be used to sense DNA (or other macromolecules) by monitoring ion-current changes that result from translocation of the molecule through the pore. When transiting a nanopore, the highly negatively charged DNA interacts with a nanopore both electrically and hydrodynamically, causing a current blockage or a current enhancement at different ion concentrations. This effect was previously characterized using a phenomenological model that can be considered as the limit of the electro-hydrodynamics model presented here. We show theoretically that the effect of surface charge of a nanopore (or electroosmotic effect) can be equivalently treated as modifications of electrophoretic mobilities of ions in the pore, providing an improved physical understanding of the current blockage (or enhancement). PMID:23579206

  20. Electrophoretic isolation of saponin fractions from Saponinum album and their evaluation in synergistically enhancing the receptor-specific cytotoxicity of targeted toxins.

    PubMed

    Thakur, Mayank; Weng, Alexander; Bachran, Diana; Riese, Sebastian B; Böttger, Stefan; Melzig, Matthias F; Fuchs, Hendrik

    2011-11-01

    Saponinum album (SA) is a commercial mixture of saponins isolated from Gypsophila species. In the previously published work, we reported that SA dramatically improves the inhibition of tumor growth by targeted toxins in mice in a synergistic way. Here we report a simplified electrophoretic method for the isolation of a highly effective fraction of SA with a relative electrophoretic mobility to the dye front (R(f) ) of 0.63 from the mixture. In total, four different fractions were separated at a preparative scale, and evaluated by ESI-MS, HPLC and TLC analysis. Electrophoretic mobility and electrochemical properties of the different fractions of saponins from SA were set into relation to their ability to enhance the cytotoxicity of epidermal growth factor (EGF)-based targeted toxins. We here treated HER-14 cells, which are NIH-3T3 Swiss mouse embryo cells transfected with the human EGF receptor. Untransfected NIH-3T3 cells served as control. The major bulk of SA (72.3%) (R(f) =0.78) migrated the farthest and was found to be significantly ineffective (p<0.05) in enhancing the cytotoxicity of the targeted toxin, while the second fraction (R(f) =0.63) showed an enhancement of 9800-fold. The third (R(f) =0.56) had an enhancement factor of 3200, the fourth (R(f) =0.08) was again significantly ineffective (p<0.05) in exhibiting any enhancement of cytotoxicity. PMID:21997431

  1. Gel mobility shift assays for RNA binding viral RNAi suppressors.

    PubMed

    Csorba, Tibor; Burgyán, József

    2011-01-01

    The host-virus interaction is a continuous coevolutionary race involving both host defence strategies and virus escape mechanisms. RNA silencing is one of the main processes employed by eukaryotic organisms to fight viruses. However, viruses encode suppressor proteins to counteract this antiviral mechanism. Virtually all plant viruses encode at least one suppressor. In spite of being highly diverse at the protein level, a large group of these proteins inhibit RNA silencing very similarly, by sequestration of double-stranded RNA or small-interfering RNA molecules, the central players of the pathway. The RNA binding capacity of virus suppressor proteins can be studied by the electrophoretic mobility shift assay method. Also known as gel retardation assay, gel mobility assay, gel shift assay or band shift assay, EMSA is an in vitro technique used to characterize protein:DNA or protein:RNA interactions. The method had been developed based on the observation that protein: nucleic acid complexes migrate slower through a non-denaturing polyacrylamide gel than the free nucleic acid fragments. Here, we provide a detailed protocol for the analysis of crucifer-infecting Tobacco mosaic tobamovirus (cr-TMV) silencing suppressor protein p122 RNA binding capacity. PMID:21431690

  2. Identification of a telomeric DNA-binding protein in Eimeria tenella.

    PubMed

    Zhao, Na; Gong, Pengtao; Li, Zhipeng; Cheng, Baiqi; Li, Jianhua; Yang, Zhengtao; Li, He; Yang, Ju; Zhang, Guocai; Zhang, Xichen

    2014-09-01

    Coccidiosis is considered to be a major problem for the poultry industry, and coccidiosis control is yet urgent. Due to the roles in telomere length regulation and end protection, telomere-binding proteins have been considered as a good target for drug design. In this work, a putative Gbp1p that is similar to telomeric DNA-binding protein Gbp (G-strand binding protein) of Cryptosporidium parvum, was searched in the database of Eimeria tenella. Sequence analysis indicated E.tenella Gbp1p (EtGbp1p) has significant sequence similarity to other eukaryotic Gbps in their RNA recognition motif (RRM) domains. Electrophoretic mobility shift assays (EMSAs) demonstrated recombinant EtGbp1p bound G-rich telomeric DNA, but not C-rich or double-stranded telomeric DNA sequences. Competition and antibody supershift assays confirmed the interaction of DNA-protein complex. Chromatin immunoprecipitation assays confirmed that EtGbp1p interacted with telomeric DNA in vivo. Collectively, these evidences suggest that EtGbp1p represents a G-rich single-stranded telomeric DNA-binding protein in E.tenella. PMID:25128826

  3. The down regulation of target genes by photo activated DNA nanoscissors.

    PubMed

    Tsai, Tsung-Lin; Shieh, Dar-Bin; Yeh, Chen-Sheng; Tzeng, Yonhua; Htet, Khant; Chuang, Kao-Shu; Hwu, Jih Ru; Su, Wu-Chou

    2010-09-01

    An artificial, targeted, light-activated nanoscissor (ATLANS) was developed for precision photonic cleavage of DNA at selectable target sequences. The ATLANS is comprised of nanoparticle core and a monolayer of hydrazone-modified triplex-forming oligonucleotides (TFOs), which recognize and capture the targeted DNA duplex. Upon photo-illumination (lambda = 460 nm), the attached hydrazone scissor specifically cleaves the targeted DNA at a pre-designed nucleotide pair. Electrophoretic mobility shift and co-precipitation assays revealed sequence-specific binding with the short-fragment and long-form plasmid DNA of both TFO and TFO-nanoparticle probes. Upon photo-illumination, ATLANS introduced a precise double-stranded break 12bp downstream the TFO binding sequence and down-regulated the target gene in HeLa cell system. Gold nanoparticles multiplexed the cutting efficiency and potential for simultaneous manipulation of multiple targets, as well as protected DNA from non-specific photo-damage. This photon-mediated DNA manipulation technology will facilitate high spatial and temporal precision in simultaneous silencing at the genome level, and advanced simultaneous manipulation of multiple targeted genes. PMID:20605206

  4. Ku antigen displays the AP lyase activity on a certain type of duplex DNA.

    PubMed

    Kosova, Anastasiya A; Khodyreva, Svetlana N; Lavrik, Olga I

    2016-09-01

    In the search for proteins reactive to apurinic/apyrimidinic (AP) sites, it has been earlier found that proteins of human cell extracts formed the Schiff-base-dependent covalent adduct with an apparent molecular mass of 100kDa with a partial DNA duplex containing an AP site and 5'- and 3'-protruding ends (DDE-AP DNA). The adduct of such electrophoretic mobility was characteristic of only DDE-AP DNA (Ilina et al., Biochem. Biophys. Acta 1784 (2008) 1777-1785). The protein in this unusual adduct was identified as the Ku80 subunit of Ku antigen by peptide mass mapping based on MALDI-TOF MS data (Kosova et al., Biopolym. Cell 30 (2014) 42-46). Here we studied the interaction of Ku with DDE-AP DNA in details. Purified Ku (the Ku80 subunit) was shown to form the 100-kDa adduct highly specific for AP DNA with a certain length of protruding ends, base opposite the AP site and AP site location. Ku is capable of AP site cleavage in DDE-AP DNA unlike in analogous AP DNA with blunt ends. Ku cleaves AP sites via β-elimination and prefers apurinic sites over apyrimidinic ones. The AP site in DDE-DNA can be repaired in an apurinic/apyrimidinic endonuclease-independent manner via the successive action of Ku (cleavage of the AP site), tyrosyl-DNA phosphodiesterase 1 (removal of the 3'-deoxyribose residue), polynucleotide kinase 3'-phosphatase (removal of the 3'-phosphate), DNA polymerase β (incorporation of dNMP), and DNA ligase (sealing the nick). These results provide a new insight into the role of Ku in the repair of AP sites. PMID:27129632

  5. Biochemical Characterization of Kat1: a Domesticated hAT-Transposase that Induces DNA Hairpin Formation and MAT-Switching

    PubMed Central

    Chiruvella, Kishore K.; Rajaei, Naghmeh; Jonna, Venkateswara Rao; Hofer, Anders; Åström, Stefan U.

    2016-01-01

    Kluyveromyces lactis hAT-transposase 1 (Kat1) generates hairpin-capped DNA double strand breaks leading to MAT-switching (MATa to MATα). Using purified Kat1, we demonstrate the importance of terminal inverted repeats and subterminal repeats for its endonuclease activity. Kat1 promoted joining of the transposon end into a target DNA molecule in vitro, a biochemical feature that ties Kat1 to transposases. Gas-phase Electrophoretic Mobility Macromolecule analysis revealed that Kat1 can form hexamers when complexed with DNA. Kat1 point mutants were generated in conserved positions to explore structure-function relationships. Mutants of predicted catalytic residues abolished both DNA cleavage and strand-transfer. Interestingly, W576A predicted to be impaired for hairpin formation, was active for DNA cleavage and supported wild type levels of mating-type switching. In contrast, the conserved CXXH motif was critical for hairpin formation because Kat1 C402A/H405A completely blocked hairpinning and switching, but still generated nicks in the DNA. Mutations in the BED zinc-finger domain (C130A/C133A) resulted in an unspecific nuclease activity, presumably due to nonspecific DNA interaction. Kat1 mutants that were defective for cleavage in vitro were also defective for mating-type switching. Collectively, this study reveals Kat1 sharing extensive biochemical similarities with cut and paste transposons despite being domesticated and evolutionary diverged from active transposons. PMID:26902909

  6. Transient overexpression of DNA adenine methylase enables efficient and mobile genome engineering with reduced off-target effects

    PubMed Central

    Lennen, Rebecca M.; Nilsson Wallin, Annika I.; Pedersen, Margit; Bonde, Mads; Luo, Hao; Herrgård, Markus J.; Sommer, Morten O. A.

    2016-01-01

    Homologous recombination of single-stranded oligonucleotides is a highly efficient process for introducing precise mutations into the genome of E. coli and other organisms when mismatch repair (MMR) is disabled. This can result in the rapid accumulation of off-target mutations that can mask desired phenotypes, especially when selections need to be employed following the generation of combinatorial libraries. While the use of inducible mutator phenotypes or other MMR evasion tactics have proven useful, reported methods either require non-mobile genetic modifications or costly oligonucleotides that also result in reduced efficiencies of replacement. Therefore a new system was developed, Transient Mutator Multiplex Automated Genome Engineering (TM-MAGE), that solves problems encountered in other methods for oligonucleotide-mediated recombination. TM-MAGE enables nearly equivalent efficiencies of allelic replacement to the use of strains with fully disabled MMR and with an approximately 12- to 33-fold lower off-target mutation rate. Furthermore, growth temperatures are not restricted and a version of the plasmid can be readily removed by sucrose counterselection. TM-MAGE was used to combinatorially reconstruct mutations found in evolved salt-tolerant strains, enabling the identification of causative mutations and isolation of strains with up to 75% increases in growth rate and greatly reduced lag times in 0.6 M NaCl. PMID:26496947

  7. Selectively-etched nanochannel electrophoretic and electrochemical devices

    DOEpatents

    Surh, Michael P.; Wilson, William D.; Barbee, Jr., Troy W.; Lane, Stephen M.

    2006-06-27

    Nanochannel electrophoretic and electrochemical devices having selectively-etched nanolaminates located in the fluid transport channel. The normally flat surfaces of the nanolaminate having exposed conductive (metal) stripes are selectively-etched to form trenches and baffles. The modifications of the prior utilized flat exposed surfaces increase the amount of exposed metal to facilitate electrochemical redox reaction or control the exposure of the metal surfaces to analytes of large size. These etched areas variously increase the sensitivity of electrochemical detection devices to low concentrations of analyte, improve the plug flow characteristic of the channel, and allow additional discrimination of the colloidal particles during cyclic voltammetry.

  8. Antisera against electrophoretically purified tubulin stimulate colchicine-binding activity.

    PubMed

    Aubin, J E; Subrahmanyan, L; Kalnins, V I; Ling, V

    1976-04-01

    Several rabbit antisera have been prepared against reduced and alkylated, electrophoretically purified tubulin isolated from chick brain. These antisera give a single precipitin line in Ouchterlony double diffusion plates when tested against partially purified tubulin, and label specifically microtubule- and tubulin-containing structures, such as mitotic spindles, cilia, and vinblastine-induced crystals, in a variety of cells. The same antisera also display the unique ability to stimulate the colchicine-binding activity of tubulin preparations from chick brain and Chinese hamster ovary tissue culture cells. This specific stimulation of colchicine binding activity is also obtained with the gamma globulin fractions purified by ammonium sulfate precipitation of these antisera. PMID:57619

  9. Protein electrophoretic migration data from custom and commercial gradient gels.

    PubMed

    Miller, Andrew J; Roman, Brandon; Norstrom, Eric M

    2016-12-01

    This paper presents data related to the article "A method for easily customizable gradient gel electrophoresis" (A.J. Miller, B. Roman, E.M. Norstrom, 2016) [1]. Data is presented on the rate of electrophoretic migration of proteins in both hand-poured and commercially acquired acrylamide gradient gels. For each gel, migration of 9 polypeptides of various masses was measured upon completion of gel electrophoresis. Data are presented on the migration of proteins within separate lanes of the same gel as well as migration rates from multiple gels. PMID:27622203

  10. Selectively-etched nanochannel electrophoretic and electrochemical devices

    SciTech Connect

    Surh, Michael P.; Wilson, William D.; Barbee, Jr., Troy W.; Lane, Stephen M.

    2004-11-16

    Nanochannel electrophoretic and electrochemical devices having selectively-etched nanolaminates located in the fluid transport channel. The normally flat surfaces of the nanolaminate having exposed conductive (metal) stripes are selectively-etched to form trenches and baffles. The modifications of the prior utilized flat exposed surfaces increase the amount of exposed metal to facilitate electrochemical redox reaction or control the exposure of the metal surfaces to analytes of large size. These etched areas variously increase the sensitivity of electrochemical detection devices to low concentrations of analyte, improve the plug flow characteristic of the channel, and allow additional discrimination of the colloidal particles during cyclic voltammetry.

  11. Characterization of two unrelated satellite DNA families in the Colorado potato beetle Leptinotarsa decemlineata (Coleoptera, Chrysomelidae).

    PubMed

    Lorite, Pedro; Torres, M Isabel; Palomeque, Teresa

    2013-10-01

    The Colorado potato beetle (Leptinotarsa decemlineata, family Chrysomelidae),a phytophagous insect, which feeds preferably on potatoes, constitutes a serious pest of this crop and causes extensive damage to tomatoes and egg plants. It has a remarkable ability to develop resistance quickly against insecticides and shows a diversified and flexible life history. Consequently, the control of this pest has become difficult, requiring the development of new alternative biotechnology-based strategies. Such strategies require a thorough knowledge of the beetle’s genome,including the repetitive DNA. Satellite DNA (stDNA), composed of long arrays of tandemly arranged repeat units, constitutes the major component of heterochromatin and is located mainly in centromeric and telomeric chromosomal regions. We have studied two different unrelated satellite-DNA families of which the consensus sequences were 295 and 109bp in length, named LEDE-I and LEDE-II, respectively.Both were AT-rich (70.8% and 71.6%, respectively). Predictive models of sequence-dependent DNA bending and the study of electrophoretic mobility on non-denaturing polyacrylamide gels have shown that the DNA was curved in both satellite-DNA families. Among other features, the chromosome localization of both stDNAs has been studied. In situ hybridization performed on meiotic and mitoticnuclei showed chromosomes, including the X chromosome, with zero, one, or two stDNAs. In recent years, it has been proposed that the repetitive DNA may play a key role in biological diversification processes. This is the first molecular and cytogenetic study conducted on L. decemlineata repetitive DNA and specifically on stDNA, which is one of the important constituents of eukaryotic genomes. PMID:23448367

  12. High mobility group protein 2 functionally interacts with the POU domains of octamer transcription factors.

    PubMed Central

    Zwilling, S; König, H; Wirth, T

    1995-01-01

    The octamer transcription factors Oct1 and Oct2 are involved in the transcriptional regulation of both lymphoid-specific and ubiquitously expressed genes. Their activity depends critically on their interaction with distinct cellular cofactors. Therefore, we have isolated cDNAs encoding proteins that physically interact with Oct2. Here we describe the analysis of one such clone, representing the murine homologue of high mobility group (HMG) protein 2. We have mapped the interaction domains for both proteins and have shown that HMG2 and Oct2 interact via their HMG domains and POU homeodomains, respectively. This interaction is not restricted to Oct2, as other members of the octamer transcription factor family like Oct1 and Oct6 also interact with HMG2. The interaction with HMG2 results in a marked increase in the sequence-specific DNA binding activity of the Oct proteins. Interestingly, the HMG2 protein is not present in the protein-DNA complex detected by an electrophoretic mobility shift assay. The Oct and HMG2 proteins also interact in vivo. A chimeric protein, in which the strong transactivation domain of VP16 was fused directly to the HMG domains of HMG2, stimulated the activity of an octamer-dependent reporter construct upon cotransfection. Furthermore, the expression of antisense RNA for HMG2 specifically reduces octamer-dependent transcription. These results suggest that one of the functions of HMG2 is to support the octamer transcription factors in their role as transcriptional activators. Images PMID:7720710

  13. SOXE transcription factors form selective dimers on non-compact DNA motifs through multifaceted interactions between dimerization and high-mobility group domains

    PubMed Central

    Huang, Yong-Heng; Jankowski, Aleksander; Cheah, Kathryn S. E.; Prabhakar, Shyam; Jauch, Ralf

    2015-01-01

    The SOXE transcription factors SOX8, SOX9 and SOX10 are master regulators of mammalian development directing sex determination, gliogenesis, pancreas specification and neural crest development. We identified a set of palindromic SOX binding sites specifically enriched in regulatory regions of melanoma cells. SOXE proteins homodimerize on these sequences with high cooperativity. In contrast to other transcription factor dimers, which are typically rigidly spaced, SOXE group proteins can bind cooperatively at a wide range of dimer spacings. Using truncated forms of SOXE proteins, we show that a single dimerization (DIM) domain, that precedes the DNA binding high mobility group (HMG) domain, is sufficient for dimer formation, suggesting that DIM : HMG rather than DIM:DIM interactions mediate the dimerization. All SOXE members can also heterodimerize in this fashion, whereas SOXE heterodimers with SOX2, SOX4, SOX6 and SOX18 are not supported. We propose a structural model where SOXE-specific intramolecular DIM:HMG interactions are allosterically communicated to the HMG of juxtaposed molecules. Collectively, SOXE factors evolved a unique mode to combinatorially regulate their target genes that relies on a multifaceted interplay between the HMG and DIM domains. This property potentially extends further the diversity of target genes and cell-specific functions that are regulated by SOXE proteins. PMID:26013289

  14. Virion-associated cofactor high-mobility group DNA-binding protein-1 facilitates transposition from the herpes simplex virus/Sleeping Beauty amplicon vector platform.

    PubMed

    de Silva, Suresh; Lotta, Louis T; Burris, Clark A; Bowers, William J

    2010-11-01

    The development of the integration-competent, herpes simplex virus/Sleeping Beauty (HSV/SB) amplicon vector platform has created a means to efficiently and stably deliver therapeutic transcription units (termed "transgenons") to neurons within the mammalian brain. Furthermore, an investigation into the transposition capacity of the HSV/SB vector system revealed that the amplicon genome provides an optimal substrate for the transposition of transgenons at least 12 kb in length [de Silva, S., Mastrangelo, M.A., Lotta, L.T., Jr., Burris, C.A., Federoff, H.J., and Bowers, W.J. ( 2010 ). Gene Ther. 17, 424-431]. These results prompted an investigation into the factors that may contribute toward efficient transposition from the HSV/SB amplicon. One of the cellular cofactors known to play a key role during SB-mediated transposition is the high-mobility group DNA-binding protein-1 (HMGB1). Our present investigation into the role of HMGB1 during amplicon-based transposition revealed that transposition is not strictly dependent on the presence of cellular HMGB1, contrary to what had been previously demonstrated with plasmid-based SB transposition. We have shown for the first time that during amplicon preparation, biologically active HMGB1 derived from the packaging cell line is copackaged into amplicon vector particles. As a result, HSV/SB amplicon virions arrive prearmed with HMGB1 protein at levels sufficient for facilitating SB-mediated transposition in the transduced mammalian cell. PMID:20568967

  15. Mucosal immunization with high-mobility group box 1 in chitosan enhances DNA vaccine-induced protection against coxsackievirus B3-induced myocarditis.

    PubMed

    Wang, Maowei; Yue, Yan; Dong, Chunsheng; Li, Xiaoyun; Xu, Wei; Xiong, Sidong

    2013-11-01

    Coxsackievirus B3 (CVB3), a small single-stranded RNA virus, belongs to the Picornaviridae family. Its infection is the most common cause of myocarditis, with no vaccine available. Gastrointestinal mucosa is the major entry port for CVB3; therefore, the induction of local immunity in mucosal tissues may help control initial viral infections and alleviate subsequent myocardial injury. Here we evaluated the ability of high-mobility group box 1 (HMGB1) encapsulated in chitosan particles to enhance the mucosal immune responses induced by the CVB3-specific mucosal DNA vaccine chitosan-pVP1. Mice were intranasally coimmunized with 4 doses of chitosan-pHMGB1 and chitosan-pVP1 plasmids, at 2-week intervals, and were challenged with CVB3 4 weeks after the last immunization. Compared with chitosan-pVP1 immunization alone, coimmunization with chitosan-pHMGB1 significantly (P < 0.05) enhanced CVB3-specific fecal secretory IgA levels and promoted mucosal T cell immune responses. In accordance, reduced severity of myocarditis was observed in coimmunized mice, as evidenced by significantly (P < 0.05) reduced viral loads, decreased myocardial injury, and increased survival rates. Flow cytometric analysis indicated that HMGB1 enhanced dendritic cell (DC) recruitment to mesenteric lymph nodes and promoted DC maturation, which might partly account for its mucosal adjuvant effect. This strategy may represent a promising approach to candidate vaccines against CVB3-induced myocarditis. PMID:24027262

  16. [Analysis of proteins in food with electrophoretic and chromatographic methods].

    PubMed

    Kaiser, K P; Krause, I

    1985-03-01

    The efficiency of electrophoretic methods (gel electrophoresis, isoelectric focusing, twodimensional techniques) and of chromatographic methods (size exclusion and ion exchange chromatography, reversed phase HPLC) to analyze proteins in foods is reviewed. Several selected applications are discussed in detail. The large diversity of proteins in a particular food results in a unique electrophoretic or chromatographic pattern, that can be used for identification purposes, by means of the so called indicator proteins. The adaptability and resolving power of the methods assure their extended application to many protein containing foods. The uniqueness of the patterns obtained warranties differentiations of even closely related animal or plant foods as well as mixtures of them. The methods also allow quantitative determinations of mixtures of foods. Their ease of handling and good reproducibility and reliability favours their use in routine analyses. Numerous investigations on fish, meat and derived products, non-meat proteins in meat products, milk, cheese, cereals and products made of cereals, oilseed proteins, legumes, fruits and vegetables described in the literature are here presented. PMID:3890408

  17. SEM Analysis of Electrophoretically-Deposited Nanoparticle Films

    NASA Astrophysics Data System (ADS)

    Verma, Neil

    Cobalt ferrite nanoparticles (20 nm) were synthesized and electrophoretically deposited onto aluminum foil, graphite paper, and carbon felt in order to study its potential as a cost-effective electrocatalyst for the oxidation of ammonium sulfite to ammonium sulfate in a proposed sulfur ammonia thermochemical cycle. Scanning electron microscopy and linear sweep voltammetry were used to characterize the deposited films and investigate their electrochemical activity. Furthermore, the effects of electrophoretic deposition conditions on deposit morphology and subsequently the effects of deposit morphology on electrochemical activity in 2 M ammonium sulfite were studied to better understand how to improve electrocatalysts. It was found that there is a critical deposit thickness for each substrate, where additional deposited particles reduce overall electrocatalytic activity of the deposits. For graphite paper, this thickness was estimated to be 3 particle layers for the EPD conditions studied. The 3 particle layer film on graphite paper resulted in a 5.5 fold increase in current density from a blank graphite paper substrate. For carbon felt, the deposit thickness threshold was calculated to be 0.13 of a particle layer for the EPD conditions studied. Moreover, this film was found to have a 4.3 fold increase in current density from a blank carbon felt substrate.

  18. Electrophoretic deposition of zinc-substituted hydroxyapatite coatings.

    PubMed

    Sun, Guangfei; Ma, Jun; Zhang, Shengmin

    2014-06-01

    Zinc-substituted hydroxyapatite nanoparticles synthesized by the co-precipitation method were used to coat stainless steel plates by electrophoretic deposition in n-butanol with triethanolamine as a dispersant. The effect of zinc concentration in the synthesis on the morphology and microstructure of coatings was investigated. It is found that the deposition current densities significantly increase with the increasing zinc concentration. The zinc-substituted hydroxyapatite coatings were analyzed by X-ray diffraction, scanning electron microscopy and Fourier transform infrared spectroscopy. It is inferred that hydroxyapatite and triethanolamine predominate in the chemical composition of coatings. With the increasing Zn/Ca ratios, the contents of triethanolamine decrease in the final products. The triethanolamine can be burnt out by heat treatment. The tests of adhesive strength have confirmed good adhesion between the coatings and substrates. The formation of new apatite layer on the coatings has been observed after 7days of immersion in a simulated body fluid. In summary, the results show that dense, uniform zinc-substituted hydroxyapatite coatings are obtained by electrophoretic deposition when the Zn/Ca ratio reaches 5%. PMID:24863199

  19. Electrophoretic deposition of composite hydroxyapatite-chitosan coatings

    SciTech Connect

    Pang Xin; Zhitomirsky, Igor . E-mail: zhitom@mcmaster.ca

    2007-04-15

    Cathodic electrophoretic deposition has been utilized for the fabrication of composite hydroxyapatite-chitosan coatings on 316L stainless steel substrates. The addition of chitosan to the hydroxyapatite suspensions promoted the electrophoretic deposition of the hydroxyapatite nanoparticles and resulted in the formation of composite coatings. The obtained coatings were investigated by X-ray diffraction, thermogravimetric and differential thermal analysis, scanning and transmission electron microscopy, potentiodynamic polarization measurements, and electrochemical impedance spectroscopy. It was shown that the deposit composition can be changed by a variation of the chitosan or hydroxyapatite concentration in the solutions. Experimental conditions were developed for the fabrication of hydroxyapatite-chitosan nanocomposites containing 40.9-89.8 wt.% hydroxyapatite. The method enabled the formation of adherent and uniform coatings of thicknesses up to 60 {mu}m. X-ray studies revealed that the preferred orientation of the hydroxyapatite nanoparticles in the chitosan matrix increases with decreasing hydroxyapatite content in the composite coatings. The obtained coatings provided the corrosion protection for the 316L stainless steel substrates00.

  20. Domains of ERRgamma that mediate homodimerization and interaction with factors stimulating DNA binding.

    PubMed

    Hentschke, Moritz; Süsens, Ute; Borgmeyer, Uwe

    2002-08-01

    The estrogen receptor-related receptor gamma (ERRgamma/ERR3/NR3B3) is an orphan member of the nuclear receptor superfamily closely related to the estrogen receptors. To explore the DNA binding characteristics, the protein-DNA interaction was studied in electrophoretic mobility shift assays (EMSAs). In vitro translated ERRgamma binds as a homodimer to direct repeats (DR) without spacing of the nuclear receptor half-site 5'-AGGTCA-3' (DR-0), to extended half-sites, and to the inverted estrogen response element. Using ERRgamma deletion constructs, binding was found to be dependent on the presence of sequences in the ligand binding domain (LBD). A far-Western analysis revealed that ERRgamma forms dimers even in the absence of DNA. Two elements, located in the hinge region and in the LBD, respectively, are necessary for DNA-independent dimerization. DNA binding of bacterial expressed ERRgamma requires additional factors present in the serum and in cellular extracts. Fusion proteins of the germ cell nuclear factor (GCNF/NR6A1) with ERRgamma showed that the characteristic feature to be stimulated by additional factors can be transferred to a heterologous protein. The stimulating activity was further characterized and its target sequence narrowed down to a small element in the hinge region. PMID:12180985

  1. Crystal Structure and DNA Binding of the Homeodomain of the Stem Cell Transcription Factor Nanog

    SciTech Connect

    Jauch, Ralf; Ng, Calista Keow Leng; Saikatendu, Kumar Singh; Stevens, Raymond C.; Kolatkar, Prasanna R.

    2010-02-08

    The transcription factor Nanog is an upstream regulator in early mammalian development and a key determinant of pluripotency in embryonic stem cells. Nanog binds to promoter elements of hundreds of target genes and regulates their expression by an as yet unknown mechanism. Here, we report the crystal structure of the murine Nanog homeodomain (HD) and analysis of its interaction with a DNA element derived from the Tcf3 promoter. Two Nanog amino acid pairs, unique among HD sequences, appear to affect the mechanism of nonspecific DNA recognition as well as maintain the integrity of the structural scaffold. To assess selective DNA recognition by Nanog, we performed electrophoretic mobility shift assays using a panel of modified DNA binding sites and found that Nanog HD preferentially binds the TAAT(G/T)(G/T) motif. A series of rational mutagenesis experiments probing the role of six variant residues of Nanog on its DNA binding function establish their role in affecting binding affinity but not binding specificity. Together, the structural and functional evidence establish Nanog as a distant member of a Q50-type HD despite having considerable variation at the sequence level.

  2. Biased reptation model with electroosmosis for DNA electrophoresis in microchannels with a sub-micron pillar array

    NASA Astrophysics Data System (ADS)

    Wang, Wentao; Chuen Chan, Yick; Lee, Yi-Kuen

    2011-08-01

    A novel biased reptation model with electroosmosis (BRE) is proposed for a long-chain DNA electrophoresis separation mechanism in microchannels with a sub-micron pillar array. The BRE model incorporates effective electroosmosis into the classical biased reptation model (BRM). Initial investigation of the BRM with additional electroosmosis flow was conducted. In order to validate the proposed BRE model, the apparent electrophoretic mobilities of different sizes of long-chain DNA, T4 DNA and lambda DNA at different electric fields were measured in a microfabricated electrophoresis chip with an embedded sub-micron pillar array. The current-monitoring method was used to measure the electroosmotic mobility in the microfabricated electrophoresis chip. The proposed BRE model shows much better agreement with the experimental results compared to the classical BRM and the semi-empirical results based on the biased reptation with fluctuation (BRF). The average standard error between our proposed BRE model and experimental data is 8.13% without any fitting parameters, while the errors are 343.01% for the BRM and 17.54% for the BRF with one fitting parameter, respectively.

  3. Structure-specific DNA binding by bacteriophage T5 5'-->3' exonuclease.

    PubMed Central

    Garforth, S J; Sayers, J R

    1997-01-01

    Phage T5 exonuclease is a 5'-->3'exodeoxyribonuclease that also exhibits endonucleolytic activity on flap structures (branched duplex DNA containing a free single-stranded 5'-end). Oligonucleotides were used to construct duplexes with either blunt ends, 5'-overhangs, 3'-overhangs, a flap or a forked end (pseudo-Y). The binding of T5 exonuclease to various structures was investigated using native electrophoretic mobility shift assays (EMSA) in the absence of the essential divalent metal cofactor. Binding of T5 exonuclease to either blunt-ended duplexes or single-stranded oligonucleotides could not be detected by EMSA. However, duplexes with 5'-overhangs, flaps and pseudo-Y structures showed decreased mobility with added T5 exonuclease. On binding to DNA the wild-type enzyme was rendered partially resistant to proteolysis, yielding a biologically active 31.5 kDa fragment. However, the protein-DNA complex remained susceptible to inactivation by p-hydroxymercuribenzoate (PHMB, a cysteine-specific modifying agent), suggesting that neither cysteine is intimately associated with substrate binding. Replacement of both cysteine residues of the molecule with serine did not greatly alter the catalytic or binding characteristics of the protein but did render it highly resistant to inhibition by PHMB. PMID:9380501

  4. Electrokinetically-Driven Transport of DNA through Focused Ion Beam Milled Nanofluidic Channels

    PubMed Central

    Menard, Laurent D.; Ramsey, J. Michael

    2013-01-01

    The electrophoretically-driven transport of double-stranded λ-phage DNA through focused ion beam (FIB) milled nanochannels is described. Nanochannels were fabricated having critical dimensions (width and depth) corresponding to 0.5×, 1×, and 2× the DNA persistence length – or 25 nm, 50 nm, and 100 nm, respectively. The threshold field strength required to drive transport, the threading mobility, and the transport mobility were measured as a function of nanochannel size. As the nanochannel dimensions decreased, the entropic barrier to translocation increased and transport became more constrained. Equilibrium models of confinement provide a framework in which to understand the observed trends, although the dynamic nature of the experiments resulted in significant deviations from theory. It was also demonstrated that the use of dynamic wall coatings for the purpose of electroosmotic flow suppression can have a significant impact on transport dynamics that may obfuscate entropic contributions. The non-intermittent DNA transport through the FIB milled nanochannels demonstrates that they are well suited for use in nanofluidic devices. We expect that an understanding of the dynamic transport properties reported here will facilitate the incorporation of FIB-milled nanochannels in devices for single molecule and ensemble analyses. PMID:23234458

  5. CopR binds and bends its target DNA: a footprinting and fluorescence resonance energy transfer study

    PubMed Central

    Steinmetzer, Katrin; Behlke, Joachim; Brantl, Sabine; Lorenz, Mike

    2002-01-01

    Plasmid pIP501 encoded transcriptional repressor CopR is one of the two regulators of plasmid copy number. Previous data suggested that CopR is a HTH protein belonging to a family of 578 HTH proteins (termed HTH 3-family). Only a very limited number of proteins in this family, among them λ c1 repressor, 434 c1 repressor and P22 c2 repressor, have been characterized in detail so far. Previously, a CopR structural model was built based on structural homologies to the 434 c1 and P22 c2 repressor and used to identify amino acids involved in DNA binding and dimerization. Site-directed mutagenesis in combination with electrophoretic mobility shift assay (EMSA), dimerization studies and circular dichroism (CD) measurements verified the model predictions. In this study we used hydroxyl radical footprinting and fluorescence resonance energy transfer (FRET) measurements to obtain detailed information about the structure of the DNA in the CopR–DNA complex. Our results show that the DNA is bent gently around the protein, comparable to the bending angle of 20–25° observed in the 434 c1 repressor–DNA complex and the λ c1 repressor–DNA complex. The shape of CopR dimers as determined by sedimentation velocity experiments is extended and accounts for the relatively large area of protection observed with hydroxyl radical footprinting. PMID:11972345

  6. Electrophoretic Transport of Na(+) and K(+) Ions Within Cyclic Peptide Nanotubes.

    PubMed

    Carvajal-Diaz, Jennifer A; Cagin, Tahir

    2016-08-18

    One of the most important applications of cyclic peptide nanotubes (CPNTs) is their potential to be used as artificial ion channels. Natural ion channels are large and complex membrane proteins, which are very expensive, difficult to isolate, and sensible to denaturation; for this reason, artificial ion channels are an important alternative, as they can be produced by simple and inexpensive synthetic chemistry paths, allowing manipulation of properties and enhancement of ion selectivity properties. Artificial ion channels can be used as component in molecular sensors and novel therapeutic agents. Here, the electrophoretic transport of Na(+) and K(+) ions within cyclic peptide nanotubes is investigated by using molecular dynamic simulations. The effect of electric field in the stability of peptide nanotubes was studied by calculating the root mean square deviation curves. Results show that the stability for CPNTs decreases for higher electric fields. Selective transport of cations within the hydrophilic tubes was observed and the negative Cl(-) ions did not enter the peptide nanotubes during the simulation. Radial distribution functions were calculated to describe structural properties and coordination numbers and changes in the first and second hydration shell were observed for the transport of Na(+) and K(+) inside of cyclic peptide nanotubes. However, no effect on coordination number was observed. Diffusion coefficients were calculated from the mean square deviation curves and the Na(+) ion showed higher mobility than the K(+) ion as observed in equivalent experimental studies. The values for diffusion coefficients are comparable with previous calculations in protein channels of equivalent sizes. PMID:27448165

  7. Crystal Structure of Human Thymine DNA Glycosylase Bound to DNA Elucidates Sequence-Specific Mismatch Recognition

    SciTech Connect

    Maiti, A.; Morgan, M.T.; Pozharski, E.; Drohat, A.C.

    2009-05-19

    Cytosine methylation at CpG dinucleotides produces m{sup 5}CpG, an epigenetic modification that is important for transcriptional regulation and genomic stability in vertebrate cells. However, m{sup 5}C deamination yields mutagenic G{center_dot}T mispairs, which are implicated in genetic disease, cancer, and aging. Human thymine DNA glycosylase (hTDG) removes T from G{center_dot}T mispairs, producing an abasic (or AP) site, and follow-on base excision repair proteins restore the G{center_dot}C pair. hTDG is inactive against normal A{center_dot}T pairs, and is most effective for G{center_dot}T mispairs and other damage located in a CpG context. The molecular basis of these important catalytic properties has remained unknown. Here, we report a crystal structure of hTDG (catalytic domain, hTDG{sup cat}) in complex with abasic DNA, at 2.8 {angstrom} resolution. Surprisingly, the enzyme crystallized in a 2:1 complex with DNA, one subunit bound at the abasic site, as anticipated, and the other at an undamaged (nonspecific) site. Isothermal titration calorimetry and electrophoretic mobility-shift experiments indicate that hTDG and hTDG{sup cat} can bind abasic DNA with 1:1 or 2:1 stoichiometry. Kinetics experiments show that the 1:1 complex is sufficient for full catalytic (base excision) activity, suggesting that the 2:1 complex, if adopted in vivo, might be important for some other activity of hTDG, perhaps binding interactions with other proteins. Our structure reveals interactions that promote the stringent specificity for guanine versus adenine as the pairing partner of the target base and interactions that likely confer CpG sequence specificity. We find striking differences between hTDG and its prokaryotic ortholog (MUG), despite the relatively high (32%) sequence identity.

  8. Luteolin, an emerging anti-cancer flavonoid, poisons eukaryotic DNA topoisomerase I.

    PubMed Central

    Chowdhury, Arnab Roy; Sharma, Shalini; Mandal, Suparna; Goswami, Anindya; Mukhopadhyay, Sibabrata; Majumder, Hemanta K

    2002-01-01

    Luteolin, a naturally occurring flavonoid, is abundant in our daily dietary intake. It exhibits a wide spectrum of pharmacological properties, but little is known about its biochemical targets other than the fact that it induces topoisomerase II-mediated apoptosis. In the present study, we show that luteolin completely inhibits the catalytic activity of eukaryotic DNA topoisomerase I at a concentration of 40 microM, with an IC50 of 5 microM. Preincubation of enzyme with luteolin before adding a DNA substrate increases the inhibition of the catalytic activity (IC50=0.66 microM). Treatment of DNA with luteolin before addition of topoisomerase I reduces this inhibitory effect. Subsequent fluorescence tests show that luteolin not only interacts directly with the enzyme but also with the substrate DNA, and intercalates at a very high concentration (>250 microM) without binding to the minor groove. Direct interaction between luteolin and DNA does not affect the assembly of the enzyme-DNA complex, as evident from the electrophoretic mobility-shift assays. Here we show that the inhibition of topoisomerase I by luteolin is due to the stabilization of topoisomerase-I DNA-cleavable complexes. Hence, luteolin is similar to camptothecin, a class I inhibitor, with respect to its ability to form the topoisomerase I-mediated 'cleavable complex'. But, unlike camptothecin, luteolin interacts with both free enzyme and substrate DNA. The inhibitory effect of luteolin is translated into concanavalin A-stimulated mouse splenocytes, with the compound inducing SDS-K+-precipitable DNA-topoisomerase complexes. This is the first report on luteolin as an inhibitor of the catalytic activity of topoisomerase I, and our results further support its therapeutic potential as a lead anti-cancer compound that poisons topoisomerases. PMID:12027807

  9. The AMeX method: a multipurpose tissue-processing and paraffin-embedding method. II. Extraction of spooled DNA and its application to Southern blot hybridization analysis.

    PubMed Central

    Sato, Y.; Mukai, K.; Matsuno, Y.; Furuya, S.; Kagami, Y.; Miwa, M.; Shimosato, Y.

    1990-01-01

    In our previous report, we described a new fixation and paraffin-embedding method (the AMeX method) that preserves many of the antigens that are normally destroyed by routine formalin fixation. The current study was conducted to examine the preservation of high-molecular-weight DNA in tissues processed by this method. DNA was extracted from AMeX-processed tissue sections after deparaffinization by the same method as that used to extract DNA from fresh tissues. The total amounts of DNA extracted from 10 mg each in wet weight of AMeX-processed and fresh mouse liver tissues were identical. In tissues of malignant lymphoma, the total amount of spooled DNA extracted from 50 sections, each 20 microns thick, was about 8 micrograms/mm2. The electrophoretic pattern of DNA digested with restriction endonucleases on agarose gel from AMeX-processed tissue sections did not differ from that of fresh materials. Southern blot hybridization analysis also revealed that the mobility of specific DNA fragments was identical for AMeX-processed and fresh tissues. The AMeX method was thus proved to be a versatile multipurpose tissue-processing procedure, which is expected to provide important information regarding the correlation between morphology, phenotypic expression, and gene alteration. Images Figure 3 Figure 4 Figure 5A Figure 5B PMID:2407122

  10. Electrophoretic assay of specific estrogen receptors: a contribution to methodology.

    PubMed

    van Netten, J P; Algard, F T; Montessori, G; Weare, B

    1977-11-01

    Experimental evidence is presented that supports the use of the cold agar-gel electrophoretic method for the clinical quantitation of specific estrogen-binding protein present in some human mammary carcinomas. It is necessary to dilute tumor extracts to avoid interference by serum-borne, non-relevant hormone-binding proteins such as albumin, which migrates to the same anodal region as does the binding protein. Dilution to 2.5 mg or less of total protein per milliliter circumvents such interference while still permitting reliable quantitation of the binding protein. Seventy-two mammary carcinomas were compared for binding-protein content by both the cold agar-gel electrophoresis and a single-point dextran-coated charcoal assay. The correlation coefficient (0.96) indicated excellent agreement between results by the two methods. In addition results are presented which indicate that the preparation of tumor extracts for electrophoresis does not require the use of an ultracentrifuge. PMID:912871

  11. Electrophoretic deposition of nickel zinc ferrite nanoparticles into microstructured patterns

    NASA Astrophysics Data System (ADS)

    Kelly, Stefan J.; Wen, Xiao; Arnold, David P.; Andrew, Jennifer S.

    2016-05-01

    Using DC electric fields, nickel-zinc ferrite (Ni0.5Zn0.5Fe2O4) nanoparticles (Dh =16.6 ± 3.6 nm) are electrophoretically deposited onto silicon substrates to form dense structures defined by photoresist molds. Parameters such as electric field, bath composition, and deposition time are tuned to produce films ranging in thickness from 177 to 805 nm. The deposited films exhibit soft magnetic properties with a saturation magnetization of 60 emu/g and a coercivity of 2.6 kA/m (33 Oe). Additionally, the influence of the photoresist mold on the deposit profile is studied, and patterned films with different shapes (lines, squares, circles, etc.) are demonstrated with feature sizes down to 5 μm.

  12. Electrophoretic Deposition of Carbon Nitride Layers for Photoelectrochemical Applications.

    PubMed

    Xu, Jingsan; Shalom, Menny

    2016-05-25

    Electrophoretic deposition (EPD) is used for the growth of carbon nitride (C3N4) layers on conductive substrates. EPD is fast, environmentally friendly, and allows the deposition of negatively charged C3N4 with different compositions and chemical properties. In this method, C3N4 can be deposited on various conductive substrates ranging from conductive glass and carbon paper to nickel foam possessing complex 3D geometries. The high flexibility of this approach enables us to readily tune the photophysical and photoelectronic properties of the C3N4 electrodes. The advantage of this method was further illustrated by the tailored construction of a heterostructure between two complementary C3N4, with marked photoelectrochemical activity. PMID:27148889

  13. New capabilities and applications for electrophoretically deposited coatings

    SciTech Connect

    Sharp, D.J.

    1991-01-01

    Our primary purpose in this test is to provide a brief general description of a few applications of various electrophoretic systems which have been investigated and have found use in various coating applications at Sandia National Laboratories. Both organic and inorganic suspensions in aqueous and non-aqueous media have been considered in these studies. Applications include high voltage insulating dielectrics, thermally conductive/electrically insulating films, adherent lubricating films, uniform photoresist films, glass coatings, and fissile uranium oxide/carbon composite films for studies of nuclear powered lasers. More recently, we have become interested in the beneficial environmental aspects of being able to provide protective polymer coatings which reduce or minimize the use of organic solvents required by traditional spray coat processes. Important practical factors which relate to film uniformity, adhesion, and composition are related to unique coating or plating capabilities and applications. 6 refs., 2 figs., 1 tab.

  14. Studies on phytochrome. Some properties of electrophoretically pure phytochrome

    PubMed Central

    Walker, T. S.; Bailey, J. L.

    1970-01-01

    1. Phytochrome was purified from etiolated oat (Avena sativa) seedlings either by gel-filtration chromatography and ion-exchange chromatography or by gel-filtration chromatography and calcium phosphate chromatography. Differences were observed in the spectral properties of phytochrome isolated by the two methods. 2. Electrophoresis of pure phytochrome at pH values between 9.0 and 6.0 showed the tendency of phytochrome to form different molecular species. Studies in the ultracentrifuge did not show a corresponding change in the sedimentation coefficient with the change in pH. 3. Tryptic digestion of electrophoretically pure phytochrome gave 17 peptides and a photoactive core. The amino acid composition of the core is reported and compared with the analysis of whole phytochrome. 4. Some properties of phytochrome isolated from Pisum sativum are compared with those of phytochrome from A. sativa. 5. The properties of phytochrome purified by other workers are compared with our findings. ImagesFig. 4. PMID:5499974

  15. Formation of diamond nanoparticle thin films by electrophoretic deposition

    NASA Astrophysics Data System (ADS)

    Goto, Yosuke; Ohishi, Fujio; Tanaka, Kuniaki; Usui, Hiroaki

    2016-03-01

    Thin films of diamond nanoparticles were prepared by electrophoretic deposition (EPD) using 0.5 wt % dispersions in water, ethanol, and 2-propanol. The film growth rate increased with increasing voltage applied to the electrodes. However, an excessive increase in voltage caused the degradation of film morphology. The optimum voltage was 4 V with an electrode separation of 5 mm. The film growth rate was higher in organic solvents than in water. The deposited film had a smooth surface with an average surface roughness comparable to the size of primary particles of the source material. It is notable that the EPD films had a considerably higher physical stability than spin-coated and cast films. The stability was further improved by thermally annealing the films. IR analysis revealed that the diamond nanoparticles have carboxy and amino groups on their surfaces. It is considered that the stability of the EPD films originate from a chemical reaction between these functional groups.

  16. Electrophoretic deposition of ultrasonicated and functionalized nanomaterials for multifunctional composites

    NASA Astrophysics Data System (ADS)

    An, Qi

    Recent advances in the synthesis and characterization of nanostructured composite materials have enabled a broad range of opportunities for engineering the properties of polymer-matrix materials. Carbon nanotubes (CNTs) are known to have exceptional mechanical, electrical and thermal properties. Because of their small size, CNTs can occupy regions between traditional micro-scale reinforcements and create a hierarchical micro/nano structure spanning several orders of magnitude. Since CNTs possess critical reinforcement dimensions below 100 nm, new opportunities exist for tailoring the fiber/matrix interphase regions and ultimately the mechanical and electrical performance of advanced fiber-composites with minimal impact on the fiber-dominated properties. This growing interest in nanoscale hybridization with conventional fiber reinforcement has highlighted the need to develop new processing techniques for successful CNT integration. In this work, a novel and industrially scalable approach for producing multi-scale hybrid carbon nanotube/fiber composites using an electrophoretic deposition (EPD) technique has been studied as an alternative to in situ chemical vapor deposition growth (CVD). EPD is a widely used industrial coating process employed in areas ranging from automotive to electronics production. The method has a number of benefits which include low energy use and the ability to homogenously coat complex shapes with well adhered films of controlled thickness and density. A stable aqueous dispersion of multi-walled carbon nanotubes (MWCNTs) was produced using a novel ozonolysis and ultrasonication (USO) technique that results in dispersion and functionalization in a single step. Networks of CNTs span between adjacent fibers and the resulting composites exhibit significant increases in electrical conductivity and considerable improvements in the interlaminar shear strength and fracture toughness. In order to better understand the underlying mechanisms behind the

  17. Probing DNA with micro- and nanocapillaries and optical tweezers

    NASA Astrophysics Data System (ADS)

    Steinbock, L. J.; Otto, O.; Skarstam, D. R.; Jahn, S.; Chimerel, C.; Gornall, J. L.; Keyser, U. F.

    2010-11-01

    We combine for the first time optical tweezer experiments with the resistive pulse technique based on capillaries. Quartz glass capillaries are pulled into a conical shape with tip diameters as small as 27 nm. Here, we discuss the translocation of λ-phage DNA which is driven by an electrophoretic force through the nanocapillary. The resulting change in ionic current indicates the folding state of single λ-phage DNA molecules. Our flow cell design allows for the straightforward incorporation of optical tweezers. We show that a DNA molecule attached to an optically trapped colloid is pulled into a capillary by electrophoretic forces. The detected electrophoretic force is in good agreement with measurements in solid-state nanopores.

  18. A laser scanner for imaging fluorophore labeled molecules in electrophoretic gels

    SciTech Connect

    Fisk, D.J.; Sutherland, J.C.

    1995-08-01

    A laser scanner for imaging electrophoretic gels was constructed and tested. The scanner incorporates a green helium-neon (HeNe) laser (543.5nm wavelength) and can achieve a spatial resolution of 19{micro}m. The instrument can function in two modes : snap-shot and finish-line. In snapshot mode, all samples are electrophoresed for the same time and the gel is scanned after completion of electrophoresis, while in finish-line mode, fluorophore labeled samples are electrophoresed for a constant distance and the image is formed as the samples pass under the detector. The resolving power of the finish-line mode of imaging is found to be greater than that of the snapshot mode of imaging. This laser scanner is also compared with a Charge Coupled Device (CCD) camera and in terms of resolving power is found to be superior. Sensitivity of the instrument is presented in terms of the minimum amount of DNA that can be detected verses its molecular length.

  19. Sizing Large Proteins and Protein Complexes by Electrospray Ionization Mass Spectrometry and Ion Mobility

    PubMed Central

    Kaddis, Catherine S.; Lomeli, Shirley H.; Yin, Sheng; Berhane, Beniam; Apostol, Marcin I.; Kickhoefer, Valerie A.; Rome, Leonard H.; Loo, Joseph A.

    2009-01-01

    Mass spectrometry (MS) and ion mobility with electrospray ionization (ESI) have the capability to measure and detect large noncovalent protein-ligand and protein-protein complexes. Using an ion mobility method termed GEMMA (Gas-Phase Electrophoretic Mobility Molecular Analysis), protein particles representing a range of sizes can be separated by their electrophoretic mobility in air. Highly charged particles produced from a protein complex solution using electrospray can be manipulated to produce singly charged ions which can be separated and quantified by their electrophoretic mobility. Results from ESI-GEMMA analysis from our laboratory and others were compared to other experimental and theoretically determined parameters, such as molecular mass and cryoelectron microscopy and x-ray crystal structure dimensions. There is a strong correlation between the electrophoretic mobility diameter determined from GEMMA analysis and the molecular mass for protein complexes up to 12 MDa, including the 93 kDa enolase dimer, the 480 kDa ferritin 24-mer complex, the 4.6 MDa cowpea chlorotic mottle virus (CCMV), and the 9 MDa MVP-vault assembly. ESI-GEMMA is used to differentiate a number of similarly sized vault complexes that are composed of different N-terminal protein tags on the MVP subunit. The average effective density of the proteins and protein complexes studied was 0.6 g/cm3. Moreover, there is evidence that proteins and protein complexes collapse or become more compact in the gas phase in the absence of water. PMID:17434746

  20. The electrophoretically 'slow' and 'fast' forms of the alpha 2-macroglobulin molecule.

    PubMed Central

    Barrett, A J; Brown, M A; Sayers, C A

    1979-01-01

    alpha 2-Macroglobulin (alpha 2M) was isolated from human plasma by a four-step procedure: poly(ethylene glyco) fractionation, gel chromatography, euglobulin precipitation and immunoadsorption. No contaminants were detected in the final preparations by electrophoresis or immunoprecipitation. The protein ran as a single slow band in gel electrophoresis, and was designated 'S-alpha 2M'. S-alpha 2M bound about 2 mol of trypsin/mol. Treatment of S-alpha 2M with a proteinase or ammonium salts produced a form of the molecule more mobile in electrophoresis, and lacking proteinase-binding activity (F-alpha 2M). The electrophoretic mobility of the F-alpha 2M resulting from reaction with NH4+ salts was identical with that of proteinase complexes. We attribute the change in electrophoretic mobility of the alpha 2M to a conformation change, but there was no evidence of a change in pI or Strokes radius. Electrophoresis of S-alpha 2M in the presence of sodium dodecylsulphate gave results consistent with the view that the alpha 2M molecule is a tetramer of identical subunits, assembled as a non-covalent pair of disulphide-linked dimers. Some of the subunits seemed to be 'nicked' into two-thires-length and one-third-length chains, however. This was not apparent with F-alpha 2M produced by ammonium salts. F-alpha 2M produced by trypsin showed two new bands attributable to cleavage of the subunit polypeptide chain near the middle. Immunoassays of F-alpha 2M gave 'rockets' 12-29% lower than those with S-alpha 2M. The nature of the interactions between subunits in S-alpha 2M and F-alpha 2M was investigated by treating each form with glutaraldehyde before electrophoresis in the presence of sodium dodecyl sulphate. A much greater degree of cross-linking was observed with the F-alpha 2M, indicating that the subunits interact most closely in this form of the molecule. Exposure of S-alpha 2M to 3 M-urea or pH3 resulted in dissociation to the disulphide-bonded half-molecules; these did not

  1. A Nanoscale, Liquid-Phase DNA Separation Device Based on Brownian Ratchets

    NASA Astrophysics Data System (ADS)

    Bader, Joel S.

    1998-03-01

    Realizing the goals of the Human Genome Project depends on the ability to perform size-based separations of DNA molecules. DNA analysis has traditionally required inconvenient gel-based electrophoretic separations. We describe a novel, micromachined, non-electrophoretic device suitable for lab-on-a-chip applications. The device is designed to transport DNA using an asymmetric, periodic potential to rectify Brownian motion. The separation occurs in a homogeneous liquid, avoiding the use of gels or other special media. Experimental results from a working prototype NanoNiagara device validate theoretical predictions of its ability to transport DNA molecules based on size.

  2. Increase in Phi X174 DNA radiation sensitivity due to electric fields

    SciTech Connect

    McCormack, Percival D.; Swenberg, Charles E.

    1985-01-01

    The object of this research was to establish whether or not orientation of DNA in electric fields would result in a significant increase in its sensitivity to damage by ionizing radiation. The application of an external electric field simultaneously with gamma irradiation to an aqueous suspension of Phi X 174 (in the RFI form) is shown to increase significantly the number of strand breaks. Tritiated DNA allowed the number of single-strand breaks to be estimated from changes in the scintillation of electrophoretic gel band associated with the fastest mobility moiety. At 400 V ( approx. 2400 V/cm) the corrected increase (corrected for phoresis of DNA on the stainless steel plates) in the G-value yield is 38%. The increase in damage with field strength appears to follow the increase in reduced dichroism. Dichroism results correspond at 400 V to approximately 10% of the maximum orientation. These results support the conjecture that this significant increase in DNA-radiation interaction with an electric field is due to field-induced conformation changes in the molecule. Keywords: Polyelectrolytes, Polynucleotides, Polypeptides, Birefringence, Dipole, and Moments.

  3. Effect of oxidative DNA damage in promoter elements on transcription factor binding.

    PubMed Central

    Ghosh, R; Mitchell, D L

    1999-01-01

    Reactive oxygen species produced by endogenous metabolic activity and exposure to a multitude of exogenous agents impact cells in a variety of ways. The DNA base damage 8-oxodeoxyguanosine (8-oxodG) is a prominent indicator of oxidative stress and has been well-characterized as a premutagenic lesion in mammalian cells and putative initiator of the carcinogenic process. Commensurate with the recent interest in epigenetic pathways of cancer causation we investigated how 8-oxodG alters the interaction between cis elements located on gene promoters and sequence-specific DNA binding proteins associated with these promoters. Consensus binding sequences for the transcription factors AP-1, NF-kappaB and Sp1 were modified site-specifically at guanine residues and electrophoretic mobility shift assays were performed to assess DNA-protein interactions. Our results indicate that whereas a single 8-oxodG was sufficient to inhibit transcription factor binding to AP-1 and Sp1 sequences it had no effect on binding to NF-kappaB, regardless of its position. We conclude from these data that minor alterations in base composition at a crucial position within some, but not all, promoter elements have the ability to disrupt transcription factor binding. The lack of inhibition by damaged NF-kappaB sequences suggests that DNA-protein contact sites may not be as determinative for stable p50 binding to this promoter as other, as yet undefined, structural parameters. PMID:10454620

  4. Single-Molecule Spectroscopic Determination of Lac Repressor-DNA Loop Conformation

    PubMed Central

    Morgan, Michael A.; Okamoto, Kenji; Kahn, Jason D.; English, Douglas S.

    2005-01-01

    The Escherichia coli lactose repressor protein (LacI) provides a classic model for understanding protein-induced DNA looping. LacI has a C-terminal four-helix bundle tetramerization domain that may act as a flexible hinge. In previous work, several DNA constructs, each containing two lac operators bracketing a sequence-induced bend, were designed to stabilize different possible looping geometries. The resulting hyperstable LacI-DNA loops exist as both a compact “closed” form with a V-shaped repressor and also a more “open” form with an extended hinge. The “9C14” construct was of particular interest because footprinting, electrophoretic mobility shift, and ring closure experiments suggested that it forms both geometries. Previous fluorescence resonance energy transfer (FRET) measurements gave an efficiency of energy transfer (ET) of 70%, confirming the existence of a closed form. These measurements could not determine whether open form or intermediate geometries are populated or the timescale of interconversion. We have now applied single-molecule FRET to Cy3, Cy5 double-labeled LacI-DNA loops diffusing freely in solution. By using multiple excitation wavelengths and by carefully examining the behavior of the zero-ET peak during titration with LacI, we show that the LacI-9C14 loop exists exclusively in a single closed form exhibiting essentially 100% ET. PMID:16085773

  5. DNA strand breaks are not induced in human cells exposed to 2.1425 GHz band CW and W-CDMA modulated radiofrequency fields allocated to mobile radio base stations.

    PubMed

    Sakuma, N; Komatsubara, Y; Takeda, H; Hirose, H; Sekijima, M; Nojima, T; Miyakoshi, J

    2006-01-01

    We conducted a large-scale in vitro study focused on the effects of low level radiofrequency (RF) fields from mobile radio base stations employing the International Mobile Telecommunication 2000 (IMT-2000) cellular system in order to test the hypothesis that modulated RF fields may act as a DNA damaging agent. First, we evaluated the responses of human cells to microwave exposure at a specific absorption rate (SAR) of 80 mW/kg, which corresponds to the limit of the average whole body SAR for general public exposure defined as a basic restriction in the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. Second, we investigated whether continuous wave (CW) and Wideband Code Division Multiple Access (W-CDMA) modulated signal RF fields at 2.1425 GHz induced different levels of DNA damage. Human glioblastoma A172 cells and normal human IMR-90 fibroblasts from fetal lungs were exposed to mobile communication frequency radiation to investigate whether such exposure produced DNA strand breaks in cell culture. A172 cells were exposed to W-CDMA radiation at SARs of 80, 250, and 800 mW/kg and CW radiation at 80 mW/kg for 2 and 24 h, while IMR-90 cells were exposed to both W-CDMA and CW radiations at a SAR of 80 mW/kg for the same time periods. Under the same RF field exposure conditions, no significant differences in the DNA strand breaks were observed between the test groups exposed to W-CDMA or CW radiation and the sham exposed negative controls, as evaluated immediately after the exposure periods by alkaline comet assays. Our results confirm that low level exposures do not act as a genotoxicant up to a SAR of 800 mW/kg. PMID:16283663

  6. Characterization of U(VI)-carbonato ternary complexes on hematite: EXAFS and electrophoretic mobility measurements

    USGS Publications Warehouse

    Bargar, John R.; Reitmeyer, Rebecca; Lenhart, John J.; Davis, James A.

    2000-01-01

    We have measured U(VI) adsorption on hematite using EXAFS spectroscopy and electrophoresis under conditions relevant to surface waters and aquifers (0.01 to 10 μM dissolved uranium concentrations, in equilibrium with air, pH 4.5 to 8.5). Both techniques suggest the existence of anionic U(VI)-carbonato ternary complexes. Fits to EXAFS spectra indicate that U(VI) is simultaneously coordinated to surface FeO6 octahedra and carbonate (or bicarbonate) ligands in bidentate fashions, leading to the conclusion that the ternary complexes have an inner-sphere metal bridging (hematite-U(VI)-carbonato) structure. Greater than or equal to 50% of adsorbed U(VI) was comprised of monomeric hematite-U(VI)-carbonato ternary complexes, even at pH 4.5. Multimeric U(VI) species were observed at pH ≥ 6.5 and aqueous U(VI) concentrations approximately an order of magnitude more dilute than the solubility of crystalline β-UO2(OH)2. Based on structural constraints, these complexes were interpreted as dimeric hematite-U(VI)-carbonato ternary complexes. These results suggest that Fe-oxide-U(VI)-carbonato complexes are likely to be important transport-limiting species in oxic aquifers throughout a wide range of pH values.

  7. Effects of method of detachment on electrophoretic mobility of mammalian cells grown in monolayer culture

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    A variety of proteolytic and micolytic enzumes, mechanical procedures, and changes in the ionic environment, especially Ca chelation, are used for dispersal of monolayer grown cells. If either chelating agents or mechanical dispersion are used alone, the cell yield is often low and suspensions of single cells are difficult to obtain. Confluent monolayers treated with EDTA tend to be released from their surfaces in sheets, and clumps of cells remain even after further incubation in EDTA. Crude trypsin is the most popular dispersal agent and is known to contain a variety of contaminating enzymes which contribute to the dispersal of cells. A variety of cell injuries resulting from the activity of proteolytic enzymes are reported. It is shown that crystalline trypsin is least harmful to cell integrity as judged by trypan blue uptake.

  8. Biochemical Analysis of Autophagy in Algae and Plants by Monitoring the Electrophoretic Mobility of ATG8.

    PubMed

    Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Crespo, José L

    2016-01-01

    Identification of specific autophagy markers has been fundamental to investigate autophagy as catabolic process. Among them, the ATG8 protein turned out to be one of the most widely used and specific molecular markers of autophagy both in higher and lower eukaryotes. Here, we describe how ATG8 can be used to monitor autophagy in Chlamydomonas and Arabidopsis by western blot analysis. PMID:27424752

  9. Overcharging in Biological Systems: Reversal of Electrophoretic Mobility of Aqueous Polyaspartate by Multivalent Cations

    NASA Astrophysics Data System (ADS)

    Kubíčková, Anna; Křížek, Tomáš; Coufal, Pavel; Vazdar, Mario; Wernersson, Erik; Heyda, Jan; Jungwirth, Pavel

    2012-05-01

    Charge reversal as an extreme case of charge compensation is directly observed by capillary electrophoresis for a negatively charged peptide in aqueous solutions of trivalent cations. Atomistic and coarse-grained simulations provide molecular interpretation of this effect showing that it is largely of electrostatic origin with a minor contribution of chemical specificity of the salt ions.

  10. Identification and mapping of DNA binding proteins target sequences in long genomic regions by two-dimensional EMSA.

    PubMed

    Chernov, Igor P; Akopov, Sergey B; Nikolaev, Lev G; Sverdlov, Eugene D

    2006-07-01

    Specific binding of nuclear proteins, in particular transcription factors, to target DNA sequences is a major mechanism of genome functioning and gene expression regulation in eukaryotes. Therefore, identification and mapping specific protein target sites (PTS) is necessary for understanding genomic regulation. Here we used a novel two-dimensional electrophoretic mobility shift assay (2D-EMSA) procedure for identification and mapping of 52 PTS within a 563-kb human genome region located between the FXYD5 and TZFP genes. The PTS occurred with approximately equal frequency within unique and repetitive genomic regions. PTS belonging to unique sequences tended to group together within gene introns and close to their 5' and 3' ends, whereas PTS located within repeats were evenly distributed between transcribed and intragenic regions. PMID:16869519

  11. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    NASA Astrophysics Data System (ADS)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  12. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components.

    PubMed

    Gerling, Thomas; Wagenbauer, Klaus F; Neuner, Andrea M; Dietz, Hendrik

    2015-03-27

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components' interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions. PMID:25814577

  13. Fluorescence energy transfer dye-labeled primers for DNA sequencing and analysis

    SciTech Connect

    Ju, J.; Glazer, A.N.; Mathies, R.A.; Ruan, C.; Fuller, C.W.

    1995-05-09

    Fluorescent dye-labeled DNA primers have been developed that exploit fluorescence energy transfer (ET) to optimize the absorption and emission properties of the label. These primers carry a fluorescein derivative at the 5{prime} end as a common donor and other fluorescein and rhodamine derivatives attached to a modified thymidine residue within the primer sequence as acceptors. Adjustment of the donor-acceptor spacing through the placement of the modified thymidine residue within the primer sequence as acceptors. Adjustment of the donor-acceptor spacing through the placement of the modified thymidine in the primer sequence allowed generation of four primers, all having strong absorption at a common excitation wavelength (488 nm) and fluorescence emission maxima of 525,555,580, and 605 nm. The ET efficiency of these primers ranges from 65% to 97%, and they exhibit similar electrophoretic mobilities by gel electrophoresis. With argon-ion laser excitation, the fluorescence of the ET primers and of the DNA sequencing fragments generated with ET primers is 2- to 6-fold greater than that of the corresponding primers or fragments labeled with single dyes. The higher fluorescence intensity of the ET primers allows DNA sequencing with one-fourth of the DNA template typically required when using T7 DNA polymerase. With single-stranded M13mp18 DNA as the template, a typical sequencing reaction with ET primers on a commercial sequencer provided DNA sequences with 99.8% accuracy in the first 500 bases. ET primers should be generally useful in the development of other multiplex DNA sequencing and analysis methods. 29 refs., 5 figs.

  14. Structure and Function Study of Phi29 DNA packaging motor

    NASA Astrophysics Data System (ADS)

    Fang, Huaming

    A powerful nanomotor is employed by the tailed dsDNA virus to package the genome into a preformed protein shell during the process of replication. The bacteriophage phi29 is an excellent model for investigating the viral DNA packaging mechanism. The phi29 DNA packaging motor is composed of three ring structures: the dodecameric connector ring, the hexameric pRNA ring and the hexameric ATPase gp16 ring. The connector is the central hub for the DNA to enter and to exit. There are four positively charged lysine rings scattered inside the highly negatively charged connector channel. It is speculated that these positive charged lysine rings may play active roles during DNA packaging in many models. To test this prevalent view, the basic lysine residues were mutated to neutral alanines and the pH environment was altered. Amazingly, the results were beyond expectation. Neither the DNA translocation nor the one-way traffic property of the channel were measurably influenced by the alteration of the charge of lysine residues when the basic lysine residues mutated to neutral alanines or the pH environment changed to acid or basic. The ATPase or the terminase is the central part of the viral DNA packaging motor. The phi29 ATPase is highly hydrophobic and tends to aggregate in solution. A green fluorescent protein tag (eGFP) fused to the N-terminus of gp16 enhanced its solubility and stability. The eGFP-gp16 showed similar activity to wild type gp16 and was easily detected by fluorescent instruments. The interaction between eGFP-gp16 and DNA in the various conditions were investigated by electrophoretic mobility shift assay, FRET and sucrose gradient. gamma-S-ATP dramatically increased gp16 binding affinity to DNA and ATP, ADP, phosphate could release gp16 from gp16-DNA-gamma-S-ATP complex. The sliding of gp16 out of the gp16-DNA-gamma-S-ATP complex could be blocked by addition of Steptavidin to ends of dsDNA which is conjugated with biotins. Also, we found that six eGFP-gp16

  15. Kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali (CLCuKV-Dab) coat protein and its mutants with ssDNA

    SciTech Connect

    Priyadarshini, C.G. Poornima; Savithri, H.S.

    2009-04-10

    Gemini viral assembly and transport of viral DNA into nucleus for replication, essentially involve DNA-coat protein interactions. The kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali recombinant coat protein (rCP) with DNA was studied by electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR). The rCP interacted with ssDNA with a K{sub A}, of 2.6 +- 0.29 x 10{sup 8} M{sup -1} in a sequence non-specific manner. The CP has a conserved C2H2 type zinc finger motif composed of residues C68, C72, H81 and H85. Mutation of these residues to alanine resulted in reduced binding to DNA probes. The H85A mutant rCP showed the least binding with approximately 756 fold loss in the association rate and a three order magnitude decrease in the binding affinity as compared to rCP. The CP-DNA interactions via the zinc finger motif could play a crucial role in virus assembly and in nuclear transport.

  16. Tim/Timeless, a member of the replication fork protection complex, operates with the Warsaw breakage syndrome DNA helicase DDX11 in the same fork recovery pathway.

    PubMed

    Calì, Federica; Bharti, Sanjay Kumar; Perna, Roberta Di; Brosh, Robert M; Pisani, Francesca M

    2016-01-29

    We present evidence that Tim establishes a physical and functional interaction with DDX11, a super-family 2 iron-sulfur cluster DNA helicase genetically linked to the chromosomal instability disorder Warsaw breakage syndrome. Tim stimulates DDX11 unwinding activity on forked DNA substrates up to 10-fold and on bimolecular anti-parallel G-quadruplex DNA structures and three-stranded D-loop approximately 4-5-fold. Electrophoretic mobility shift assays revealed that Tim enhances DDX11 binding to DNA, suggesting that the observed stimulation derives from an improved ability of DDX11 to interact with the nucleic acid substrate. Surface plasmon resonance measurements indicate that DDX11 directly interacts with Tim. DNA fiber track assays with HeLa cells exposed to hydroxyurea demonstrated that Tim or DDX11 depletion significantly reduced replication fork progression compared to control cells; whereas no additive effect was observed by co-depletion of both proteins. Moreover, Tim and DDX11 are epistatic in promoting efficient resumption of stalled DNA replication forks in hydroxyurea-treated cells. This is consistent with the finding that association of the two endogenous proteins in the cell extract chromatin fraction is considerably increased following hydroxyurea exposure. Overall, our studies provide evidence that Tim and DDX11 physically and functionally interact and act in concert to preserve replication fork progression in perturbed conditions. PMID:26503245

  17. Impact of molecular weight and degree of conjugation on the thermodynamics of DNA complexation and stability of polyethylenimine-graft-poly(ethylene glycol) copolymers.

    PubMed

    Smith, Ryan J; Beck, Rachel W; Prevette, Lisa E

    2015-01-01

    Poly(ethylene glycol) (PEG) is often conjugated to polyethylenimine (PEI) to provide colloidal stability to PEI-DNA polyplexes and shield charge leading to toxicity. Here, a library of nine cationic copolymers was synthesized by grafting three molecular weights (750, 2000, 5000Da) of PEG to linear PEI at three conjugation ratios. Using isothermal titration calorimetry, we have quantified the thermodynamics of the associations between the copolymers and DNA and determined the extent to which binding is hindered as a function of PEG molecular weight and conjugation ratio. Low conjugation ratios of 750Da PEG to PEI resulted in little decrease in DNA affinity, but a significant decrease-up to two orders of magnitude-was found for the other copolymers. We identified limitations in determination of affinity using indirect assays (electrophoretic mobility shift and ethidium bromide exclusion) commonly used in the field. Dynamic light scattering of the DNA complexes at physiological ionic strength showed that PEI modifications that did not reduce DNA affinity also did not confer significant colloidal stability, a finding that was supported by calorimetric data on the aggregation process. These results quantify the DNA interaction thermodynamics of PEGylated polycations for the first time and indicate that there is an optimum PEG chain length and degree of substitution in the design of agents that have desirable properties for effective in vivo gene delivery. PMID:26001068

  18. The role of cell size in density gradient electrophoretic separation of mouse leukemia cells according to position in the cell cycle

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    Cultured mouse leukemia cells line L5178Y were subjected to upward electrophoresis in a density gradient and the slower migrating cell populations were enriched in G2 cells. It is indicated that this cell line does not change electrophoretic mobility through the cell cycle. The possibility that increased sedimentation downward on the part of the larger G2 cells caused this separation was explored. Two different cell populations were investigated. The log phase population was found to migrate upward faster than the G2 population, and a similar difference between their velocities and calculated on the basis of a 1 um diameter difference between the two cell populations. The G2 and G1 enriched populations were isolated by Ficoll density gradient sedimentation. The bottom fraction was enriched in G2 cells and the top fraction was enriched with G1 cells, especially when compared with starting materials. The electrophoretic mobilities of these two cell populations did not differ significantly from one another. Cell diameter dependent migration curves were calculated and were found to be different. Families of migration curves that differ when cell size is considered as a parameter are predicted.

  19. Improved design of electrophoretic equipment for rapid sickle-cell-anemia screening

    NASA Technical Reports Server (NTRS)

    Reddick, J. M.; Hirsch, I.

    1974-01-01

    Effective mass screening may be accomplished by modifying existing electrophoretic equipment in conjunction with multisample applicator used with cellulose-acetate-matrix test paper. Using this method, approximately 20 to 25 samples can undergo electrophoresis in 5 to 6 minutes.

  20. A model for electrophoretic transport of charged particles through membrane before steady state

    NASA Astrophysics Data System (ADS)

    de Souza, Tatiana Miranda; Fragoso, Viviane Muniz da Silva; Cruz, Frederico Alan de Oliveira

    2015-12-01

    In this paper, we are presenting a model for electrophoretic motion of a charged particle through the membrane before it reaches the steady state, based on concepts of Physics. Some results from analysis of the model are discussed.

  1. AC electrophoretic deposition of organic-inorganic composite coatings.

    PubMed

    Yoshioka, T; Chávez-Valdez, A; Roether, J A; Schubert, D W; Boccaccini, A R

    2013-02-15

    Alternating current electrophoretic deposition (AC-EPD) of polyacrylic acid (PAA)-titanium oxide (TiO(2)) nanoparticle composites on stainless steel electrodes was investigated in basic aqueous solution. AC square wave with duty cycle of 80% was applied at a frequency of 1 kHz. FTIR-ATR spectra showed that both AC and direct current (DC) EPD successfully deposited PAA-TiO(2) composites. The deposition rate using AC-EPD was lower than that obtained in direct current DC-EPD. However, the microstructure and surface morphology of the deposited composite coatings were different depending on the type of electric field applied. AC-EPD applied for not more than 5 min led to smooth films without bubble formation, while DC-EPD for 1 min or more showed deposits with microstructural defects possibly as result of water electrolysis. AC-EPD was thus for the first time demonstrated to be a suitable technique to deposit organic-inorganic composite coatings from aqueous suspensions, showing that applying a square wave and frequency of 1 kHz leads to uniform PAA-TiO(2) composite coatings on conductive materials. PMID:23218240

  2. Open source simulation tool for electrophoretic stacking, focusing, and separation.

    PubMed

    Bercovici, Moran; Lele, Sanjiva K; Santiago, Juan G

    2009-02-01

    We present the development, formulation, and performance of a new simulation tool for electrophoretic preconcentration and separation processes such as capillary electrophoresis, isotachophoresis, and field amplified sample stacking. The code solves the one-dimensional transient advection-diffusion equations for multiple multivalent weak electrolytes (including ampholytes) and includes a model for pressure-driven flow and Taylor-Aris dispersion. The code uses a new approach for the discretization of the equations, consisting of a high resolution compact scheme which is combined with an adaptive grid algorithm. We show that this combination allows for accurate resolution of sharp concentration gradients at high electric fields, while at the same time significantly reducing the computational time. We demonstrate smooth, stable, and accurate solutions at current densities as high as 5000A/m(2) using only 300 grid points, and a 75-fold reduction in computational time compared with equivalent uniform grid techniques. The code is available as an open source for free at http://microfluidics.stanford.edu. PMID:19124132

  3. Origami paper-based fluidic batteries for portable electrophoretic devices.

    PubMed

    Chen, Sung-Sheng; Hu, Chih-Wei; Yu, I-Fan; Liao, Ying-Chih; Yang, Jing-Tang

    2014-06-21

    A manufacturing approach for paper-based fluidic batteries was developed based on the origami principle (three-dimension paper folding). Microfluidic channels were first created on a filter paper by a wax-printing method. Copper and aluminium sheets were then glued onto the paper as electrodes for the redox reaction. After the addition of copper sulphate and aluminium chloride, commonly available cellophane paper was attached as a membrane to separate the two electrodes. The resulting planar paper sheets were then folded into three-dimensional structures and compiled as a single battery with glue. The two half reactions (Al/Al(3+) and Cu/Cu(2+)) in the folded batteries provided an open-circuit potential from 0.82 V (one cell) to 5.0 V (eight cells in series) depending on the origami design. The prepared battery can provide a stable current of 500 μA and can light a regular LED for more than 65 min. These paper-based fluidic batteries in a set can also be compiled into a portable power bank to provide electric power for many electric or biomedical applications, such as LED lights and electrophoretic devices, as we report here. PMID:24811036

  4. Interfacial bond strength of electrophoretically deposited hydroxyapatite coatings on metals.

    PubMed

    Wei, M; Ruys, A J; Swain, M V; Kim, S H; Milthorpe, B K; Sorrell, C C

    1999-07-01

    Hydroxyapatite (HAp) coatings were deposited onto substrates of metal biomaterials (Ti, Ti6Al4V, and 316L stainless steel) by electrophoretic deposition (EPD). Only ultra-high surface area HAp powder, prepared by the metathesis method 10Ca(NO3)2 + 6(NH4)2HPO4 + 8NH4OH), could produce dense coatings when sintered at 875-1000degreesC. Single EPD coatings cracked during sintering owing to the 15-18% sintering shrinkage, but the HAp did not decompose. The use of dual coatings (coat, sinter, coat, sinter) resolved the cracking problem. Scanning electron microscopy/energy dispersive spectroscopy (SEM/EDS) inspection revealed that the second coating filled in the "valleys" in the cracks of the first coating. The interfacial shear strength of the dual coatings was found, by ASTM F1044-87, to be approximately 12 MPa on a titanium substrate and approximately 22 MPa on 316L stainless steel, comparing quite favorably with the 34 MPa benchmark (the shear strength of bovine cortical bone was found to be 34 MPa). Stainless steel gave the better result since -316L (20.5 microm mK(-1)) > alpha-HAp (approximately 14 microm mK(-1)), resulting in residual compressive stresses in the coating, whereas alpha-titanium (approximately 10.3 microm mK(-1)) < alpha-HAp, resulting in residual tensile stresses in the coating. PMID:15348125

  5. Electrophoretic assembly of organic molecules and composites for electrochemical supercapacitors.

    PubMed

    Su, Y; Zhitomirsky, I

    2013-02-15

    Electrophoretic deposition (EPD) method has been developed for the fabrication of 1-pyrenebutyric acid (PBH) films from aqueous solutions. The films can be deposited at constant voltage or potentiodynamic conditions. The method allowed the formation of 0.1-2 μm thick films, containing needle-shape PBH particles. The deposition mechanism involved the electrophoresis, pH decrease at the anode surface, charge neutralization and formation of insoluble PBH films. The film morphology and shape of the PBH particles are controlled by the π-π stacking mechanism of the polyaromatic PBH molecules. The important finding was the possibility of controlled EPD of multiwalled carbon nanotubes (MWCNTs) using PBH as a charging, dispersing and film forming agent. It was found that at low voltages or low PBH concentrations the deposits contained mainly MWCNT. The increase in the deposition voltage or/and PBH concentration resulted in co-deposition of MWCNT and needle-shape PBH particles. The new approach to the deposition of MWCNT was used for the fabrication of composite MnO(2)-MWCNT films for electrodes of electrochemical supercapacitors, which showed a specific capacitance of 250 F g(-1). The EPD method developed in this investigation paves the way for the deposition of other small organic molecules and composites and their applications in new materials and devices, utilizing functional properties of the organic molecules, CNT, and other advanced materials. PMID:23141761

  6. Electrophoretic nanotechnology of composite electrodes for electrochemical supercapacitors.

    PubMed

    Su, Y; Zhitomirsky, I

    2013-02-14

    The electrophoretic deposition (EPD) method has been developed for the fabrication of MnO(2)-multiwalled carbon nanotube (MWCNT) films for application in electrochemical supercapacitors (ESs). For MWCNT applications, which depend on electrical conductivity, it is challenging to achieve dispersion and EPD of pristine MWCNT and avoid defects due to chemical treatment or functionalization. An important finding was the possibility of efficient dispersion and controlled EPD of MWCNT using calconcarboxylic acid (CCA). Moreover, the use of CCA allowed efficient dispersion of MnO(2) in concentrated suspensions and EPD of MnO(2) films. The comparison of the experimental data for chromotrope FB (CFB) and CCA and chemical structures of the molecules provided insight into the mechanism of CCA adsorption on MnO(2). The fabrication of stable suspensions of MnO(2) nanoparticles containing MWCNT, and controlled codeposition of both materials is a crucial aspect in the EPD of composites. The new approach was based on the use of CCA as a charging and dispersing agent for EPD of MnO(2) nanoparticles and MWCNT. The deposition yield measurements at various experimental conditions and Fourier transform infrared spectroscopy data, coupled with results of electron microscopy, thermogravimetric, and differential thermal analysis provided evidence of the formation of MnO(2)-MWCNT composites. The electrochemical testing results and impedance spectroscopy data showed good capacitive behavior of the composite films and the beneficial effect of MWCNTs. PMID:22662969

  7. Improvement of electrophoretic enantioseparation of amlodipine by polybrene.

    PubMed

    Zandkarimi, Majid; Shafaati, Alireza; Foroutan, Sayyed Mohsen; A Lucy, Charles

    2012-01-01

    In chiral and non-chiral electrophoretic resolution of basic drugs, adsorption of analytes to negatively charged capillary wall could lead to poor repeatability of migration time and peak area. In addition, chiral resolutions of basic drugs are commonly performed in low pH buffers. Therefore, longer analysis time due to suppression of electroosmotic flow (EOF) is another dilemma. In this work the improvement effect of polybrene (PB), a cationic polymer, on chiral separation of a model basic drug, amlodipine (AML), was investigated. PB both as a semi-permanent coating agent and as an additive in the running buffer was utilized. Better results were obtained with PB as a buffer additive. Compare to untreated bare silica without using PB in running buffer, addition of 0.0005% PB buffer decreased analysis time downed to 3 folds; efficiency improved up to 5 folds; limit of detection (LOD) and limit of quantification (LOQ) downed to 8 folds and within-day migration time and peak area repeatabilities, in terms of relative standard deviations (RSD) downed to 5 and 20 folds, respectively. PMID:25317194

  8. Improvement of Electrophoretic Enantioseparation of Amlodipine by Polybrene

    PubMed Central

    Zandkarimi, Majid; Shafaati, Alireza; Foroutan, Sayyed Mohsen; A. Lucy, Charles

    2012-01-01

    In chiral and non-chiral electrophoretic resolution of basic drugs, adsorption of analytes to negatively charged capillary wall could lead to poor repeatability of migration time and peak area. In addition, chiral resolutions of basic drugs are commonly performed in low pH buffers. Therefore, longer analysis time due to suppression of electroosmotic flow (EOF) is another dilemma. In this work the improvement effect of polybrene (PB), a cationic polymer, on chiral separation of a model basic drug, amlodipine (AML), was investigated. PB both as a semi-permanent coating agent and as an additive in the running buffer was utilized. Better results were obtained with PB as a buffer additive. Compare to untreated bare silica without using PB in running buffer, addition of 0.0005% PB buffer decreased analysis time downed to 3 folds; efficiency improved up to 5 folds; limit of detection (LOD) and limit of quantification (LOQ) downed to 8 folds and within-day migration time and peak area repeatabilities, in terms of relative standard deviations (RSD) downed to 5 and 20 folds, respectively. PMID:25317194

  9. Fabrication of Electrophoretic Display Driven by Membrane Switch Array

    NASA Astrophysics Data System (ADS)

    Senda, Kazuo; Usui, Hiroaki

    2010-04-01

    Electrophoretic devices (EPDs) and organic light-emitting diodes (OLEDs) have potential application in a large-area flexible displays, such as digital signage. For this purpose, a new backplane is capable of driving a large unit is required instead of thin-film transistors. In this paper we describe the fabrication of a membrane switch array suitable for driving large-scale flat-panel displays. An array of membrane switches was prepared using flexible printed circuit (FPC) technology of polyimide films, by combining low-temperature processes of lamination and copper electroplating methods. An array of 256 matrix switches with a pixel size of 7 mm2 was prepared to drive the EPD front panel. The switches were driven at a voltage of about 40 V and a frequency of 10 Hz. The operation characteristics agreed well with the result of the theoretical calculation. The calculation also suggested that driving voltage can be lowered by increasing pixel size. The contact resistance of the membrane switch was as low as 0.2 Ω, which implies the wide applicability of this device for driving a variety of elements.

  10. Electrophoretic deposition of composite hydroxyapatite-silica-chitosan coatings

    SciTech Connect

    Grandfield, K.; Zhitomirsky, I.

    2008-01-15

    Electrophoretic deposition (EPD) method has been developed for the fabrication of nanocomposite silica-chitosan coatings. Cathodic deposits were obtained on various conductive substrates using suspensions of silica nanoparticles in a mixed ethanol-water solvent, containing dissolved chitosan. Co-deposition of silica and hydroxyapatite (HA) nanoparticles resulted in the fabrication of HA-silica-chitosan coatings. The deposition yield has been studied at a constant voltage mode at various deposition durations. The method enabled the formation of coatings of different thickness in the range of up to 100 {mu}m. Deposit composition, microstructure and porosity can be varied by variation of HA and silica concentration in the suspensions. It was demonstrated that EPD can be used for the fabrication of HA-silica-chitosan coatings of graded composition and laminates. The method enabled the deposition of coatings containing layers of silica-chitosan and HA-chitosan nanocomposites using suspensions with different HA and silica content. Obtained coatings were studied by X-ray diffraction, thermogravimetric and differential thermal analysis, scanning electron microscopy and energy dispersive spectroscopy. The mechanism of deposition is discussed.

  11. Solubilization and electrophoretic characterization of select edible nut seed proteins.

    PubMed

    Sathe, Shridhar K; Venkatachalam, Mahesh; Sharma, Girdhari M; Kshirsagar, Harshal H; Teuber, Suzanne S; Roux, Kenneth H

    2009-09-01

    The solubility of almond, Brazil nut, cashew nut, hazelnut, macadamia, pecan, pine nut, pistachio, walnut, and peanut proteins in several aqueous solvents was qualitatively and quantitatively assessed. In addition, the effects of extraction time and ionic strength on protein solubility were also investigated. Electrophoresis and protein determination (Lowry, Bradford, and micro-Kjeldahl) methods were used for qualitative and quantitative assessment of proteins, respectively. Depending on the seed, buffer type and ionic strength significantly affected protein solubility. The results suggest that buffered sodium borate (BSB; 0.1 M H(3)BO(3), 0.025 M Na(2)B(4)O(7), 0.075 M NaCl, pH 8.45) optimally solubilizes nut seed proteins. Qualitative differences in seed protein electrophoretic profiles were revealed. For a specific seed type, these differences were dependent on the solvent(s) used to solubilize the seed proteins. SDS-PAGE results suggest the polypeptide molecular mass range for the tree nut seed proteins to be 3-100 kDa. The results of native IEF suggested that the proteins were mainly acidic, with a pI range from >4.5 to <7.0. Western immunoblotting experiments indicated that rabbit polyclonal antibodies recognized substantially the same polypeptides as those recognized by the corresponding pooled patient sera IgE. PMID:19655801

  12. Electrophoretic deposition of tannic acid-polypyrrolidone films and composites.

    PubMed

    Luo, Dan; Zhang, Tianshi; Zhitomirsky, Igor

    2016-05-01

    Thin films of polyvinylpyrrolidone (PVP)-tannic acid (TA) complexes were prepared by a conceptually new strategy, based on electrophoretic deposition (EPD). Proof of concept investigations involved the analysis of the deposition yield, FTIR and UV-vis spectroscopy of the deposited material, and electron microscopy studies. The analysis of the deposition mechanism indicated that the limitations of the EPD in the deposition of small phenolic molecules, such as TA, and electrically neutral polymers, similar to PVP, containing hydrogen-accepting carbonyl groups, can be avoided. The remarkable adsorption properties of TA and film forming properties of the PVP-TA complexes allowed for the EPD of materials of different types, such as huntite mineral platelets and hydrotalcite clay particles, TiO2 and MnO2 oxide nanoparticles, multiwalled carbon nanotubes, TiN and Pd nanoparticles. Moreover, PVP-TA complexes were used for the co-deposition of different materials and formation of composite films. In another approach, TA was used as a capping agent for the hydrothermal synthesis of ZnO nanorods, which were then deposited by EPD using PVP-TA complexes. The fundamental adsorption and interaction mechanisms of TA involved chelation of metal atoms on particle surfaces with galloyl groups, π-π interactions and hydrogen bonding. The films prepared by EPD can be used for various applications, utilizing functional properties of TA, PVP, inorganic and organic materials of different types and their composites. PMID:26878711

  13. Vector-host-parasite inter-relationships in leishmaniasis. IV. Electrophoretic studies on proteins of four vertebrate bloods with and without Leishmania infantum or L. major.

    PubMed

    Daba, S; Mansour, N S; Youssef, F G; Shanbaky, N M; el Sawaf, B M

    1997-12-01

    Fifty five protein bands with relative mobilities of 8,954 to 245,471 kilo Daltons (kD) were electrophoretically separated from 12 feeding media of blood from 4 natural vertebrate hosts of Phlebotomus langeroni. The feeding media included human, dog (Canis familiaris), rat (Rattus rattus) and turkey (Melagris gallopava) bloods without or with Leishmania infantum or L. major promastigotes. Protein bands were identical among the feeding media of one host's blood but varied in number (24-28 bands) and relative mobilities among the various hosts' blood. Some protein fractions were common among the various hosts blood, others were only present in two or three hosts' blood and some were restricted to one host blood and were unique for each host. This study provides data which may help in understanding why blood from different natural hosts may variably influence the life cycle of Leishmania parasite in the sand fly gut. PMID:9425823

  14. A Nuclear Factor of High Mobility Group Box Protein in Toxoplasma gondii

    PubMed Central

    Wang, Hui; Lei, Tao; Liu, Jing; Li, Muzi; Nan, Huizhu; Liu, Qun

    2014-01-01

    High mobility group box 1 (HMGB1) is a nuclear factor that usually binds DNA and modulates gene expression in multicellular organisms. Three HMGB1 orthologs were predicted in the genome of Toxoplasma gondii, an obligate intracellular protozoan pathogen, termed TgHMGB1a, b and c. Phylogenetic and bioinformatic analyses indicated that these proteins all contain a single HMG box and which shared in three genotypes. We cloned TgHMGB1a, a 33.9 kDa protein that can stimulates macrophages to release TNF-α, and, we demonstrated that the TgHMGB1a binds distorted DNA structures such as cruciform DNA in electrophoretic mobility shift assays (EMSA). Immunofluorescence assay indicated TgHMGB1a concentrated in the nucleus of intracellular tachyzoites but translocated into the cytoplasm while the parasites release to extracellular. There were no significant phenotypic changes when the TgHMGB1a B box was deleted, while transgenic parasites that overexpressed TgHMGB1a showed slower intracellular growth and caused delayed death in mouse, further quantitative RT-PCR analyses showed that the expression levels of many important genes, including virulence factors, increased when TgHMGB1a was overexpressed, but no significant changes were observed in TgHMGB1a B box-deficient parasites. Our findings demonstrated that TgHMGB1a is indeed a nuclear protein that maintains HMG box architectural functions and is a potential proinflammatory factor during the T.gondii infection. Further studies that clarify the functions of TgHMGB1s will increase our knowledge of transcriptional regulation and parasite virulence, and might provide new insight into host–parasite interactions for T. gondii infection. PMID:25369210

  15. Functionalizing Designer DNA Crystals

    NASA Astrophysics Data System (ADS)

    Chandrasekaran, Arun Richard

    nucleotides is usually pH dependent (pH < 6) four different TFOs were examined: TFO-1 was unmodified while TFOs 2-4 contained additional stabilizing analogues capable of extending triplex formation to pH 7. In addition, each of the TFOs contained a Cy5 dye at the 5'-end of the oligonucleotide to aid in characterization of TFO binding - crystals were obtained with all four variations of TFOs. Formation of DNA triplex in the motif was characterized by an electrophoretic mobility shift assay (EMSA), UV melting studies and FRET. Crystals containing TFO-1 (unmodified) and TFO-2 (with 2'-amino ethoxy modification) were isolated and flash-frozen in liquid nitrogen for X-ray data collection at beam line NSLS-X25. X-ray data was also collected for crystals of the 3-turn triangle without any TFO bound to it. Difference maps were done between the crystals with TFO against the one without to identify any additional electron density corresponding to the third strand in the triplex binding region. The data from the crystal containing TFO-2 was used to further analyze if the additional density can match the expected position of the TFO on the triangle motif. Since the additional density did not correspond to the entire binding region, 2Fo-Fc, 3Fo-2Fc and 4Fo-3Fc maps were done to check for missing pieces of the electron density. From the resulting 2Fo-Fc map, the asymmetric unit from the 3-turn triangle (31-bp duplex model based on previous structure 3UBI) was inserted into the density as a reference. However, the electron density corresponding to the TFO was still not continuous throughout the 13-nt triplex binding region and allowed only a partial fit of the TFO. The third nucleotide in positions 1, 3, 4, 6, 7 were fit into the density in the major groove of the underlying duplex with proper triplex configuration. The third chapter describes the triplex approach to position a functional group (the UV cross-linking agent psoralen) within a pre-formed DNA motif. Triplex formation and

  16. Effect of micelles and mixed micelles on efficiency and selectivity of antibiotic-based capillary electrophoretic enantioseparations

    SciTech Connect

    Rundlett, K.L.; Armstrong, D.W.

    1995-07-01

    Vancomycin (an oligophenolic, glycopeptide, macrocyclic antibiotic) has been shown to be a superb chiral selector for anionic and neutral compounds. It was found that adding sodium dodecyl sulfate to the run buffer increased efficiency by over 1 order of magnitude, decreased analysis times, and reversed the elution order of the enantiomers. This allows for control of the retention order as well as the resolution of enantiomers in complex mixtures in a single run. A mechanism is proposed which explains all of the observed effects and is verified experimentally. Since vancomycin is present in both the micelle and in free solution, previously proposed micelle-selector models are, at best, limiting cases. A general equation is derived which can be used to describe all possible interactions, including those with the capillary wall, if needed. Also, it is shown that electrophoretic mobilities and not migration times must be used to calculate binding constants of a solute to the micelle, the chiral selector, or both. Furthermore, it is shown that a neutral marker molecule cannot be used to accurately correct mobilities that have been altered due to changes in solution viscosity. While this work utilizes the practical vancomycin-micelle system, the general conclusions and theory apply to most other analogous CE systems as well. 48 refs., 4 figs., 5 tabs.

  17. Determination of sulfonylureas in cereal samples with electrophoretic method using ionic liquid with dispersed carbon nanotubes as electrophoretic buffer.

    PubMed

    Springer, Valeria H; Aprile, Francisco; Lista, Adriana G

    2014-01-15

    A capillary electrophoresis method to determine four sulfonylureas in grain samples was developed using 10mM of 1-butyl-3-methyl imidazolium tetrafluoroborate (bminBF4) as electrophoretic buffer solution. 2mgL(-1) of Surfactant Coated-Single Wall-Carbon Nanotubes (SC-SWCNTs) was added to the buffer solution to improve the resolution. In this way, the separation of nicosulfuron, ethoxysulfuron, sulfometuron methyl and chlorsulfuron was carried out in 16min without using organic solvents. A clean up-preconcentration procedure was done prior to inject the sample into the CE instrument, in order to achieve the established maximum residue limits (MRLs). So, the detection limits (LODs) for each analytes were between 16.8 and 26.6μgkg(-1). The relative standard deviations (RSDs) were in the range 1.9-6.7%. A recovery study using the so-called matrix matched calibration demonstrates that no matrix interferences were found throughout the determination. The recovery percentages were ranged between 80% and 113%. PMID:24054250

  18. Mobile Learning Using Mobile Phones

    ERIC Educational Resources Information Center

    Vicente, Paula

    2013-01-01

    The participation in mobile learning programs is conditioned by having/using mobile communication technology. Those who do not have or use such technology cannot participate in mobile learning programs. This study evaluates who are the most likely participants of mobile learning programs by examining the demographic profile and mobile phone usage…

  19. Single Molecule Screening of Disease DNA Without Amplification

    SciTech Connect

    Ji-Young Lee

    2006-12-12

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  20. Important parameters in semi-dry electrophoretic transfer.

    PubMed

    Jacobson, G; Kårsnäs, P

    1990-01-01

    The efficiency of semi-dry electrophoretic transfer after sodium dodecyl sulfate (SDS)-electrophoresis using PhastGel media was investigated in a model system using three isotope labelled proteins. To give a full picture of the blotting process the amount of protein present in the gel, membranes, and filter papers was determined after different transfer times. The influence of the transfer buffer, commonly used additives such as methanol and SDS, and several different immobilizing matrices was investigated. Soybean trypsin inhibitor, bovine serum albumin, and ferritin were used as model proteins to study the effect of size on transfer efficiency. Basically, all three stages of the blotting process decide the result; the elution of protein from the gel, the immobilization of protein to the membrane, and the loss of material from the membrane during transfer. A theoretical explanation for the observed poor binding to a second membrane is discussed. Our results show that the buffer composition has little influence on the efficiency of transfer from the gel, but can be significant to the binding capacity of the membrane. In all experiments performed, there was never one moment during the transfer when all protein was eluted from the gel and simultaneously still bound to the membrane. The highest recovery in the membrane was obtained at different time intervals for different proteins. This indicates that quantitative transfer procedures cannot be generalized. However, obtaining an optimal method for reliable quantification of a specific protein or group of proteins is possible. For general protein staining of nitrocellulose and polyvinylidene difluoride membranes, a highly sensitive silver staining method requiring only 15 min has been used. PMID:1690643

  1. Mechanism for attenuation of DNA binding by MarR family transcriptional regulators by small molecule ligands.

    PubMed

    Perera, Inoka C; Lee, Yong-Hwan; Wilkinson, Steven P; Grove, Anne

    2009-07-31

    Members of the multiple antibiotic resistance regulator (MarR) family control gene expression in a variety of metabolic processes in bacteria and archaea. Hypothetical uricase regulator (HucR), which belongs to the ligand-responsive branch of the MarR family, regulates uricase expression in Deinococcus radiodurans by binding a shared promoter region between uricase and HucR genes. We show here that HucR responds only to urate and, to a lesser extent, to xanthine by attenuated DNA binding, compared to other intermediates of purine degradation. Using molecular-dynamics-guided mutational analysis, we identified the ligand-binding site in HucR. Electrophoretic mobility shift assays and intrinsic Trp fluorescence have identified W20 from the N-terminal helix and R80 from helix 3, which serves as a scaffold for the DNA recognition helix, as being essential for ligand binding. Using structural data combined with in silico and in vitro analyses, we propose a mechanism for the attenuation of DNA binding in which a conformational change initiated by charge repulsion due to a bound ligand propagates to DNA recognition helices. This mechanism may apply generally to MarR homologs that bind anionic phenolic ligands. PMID:19501097

  2. Mismatch repair and nucleotide excision repair proteins cooperate in the recognition of DNA interstrand crosslinks.

    PubMed

    Zhao, Junhua; Jain, Aklank; Iyer, Ravi R; Modrich, Paul L; Vasquez, Karen M

    2009-07-01

    DNA interstrand crosslinks (ICLs) are among the most cytotoxic types of DNA damage, thus ICL-inducing agents such as psoralen, are clinically useful chemotherapeutics. Psoralen-modified triplex-forming oligonucleotides (TFOs) have been used to target ICLs to specific genomic sites to increase the selectivity of these agents. However, how TFO-directed psoralen ICLs (Tdp-ICLs) are recognized and processed in human cells is unclear. Previously, we reported that two essential nucleotide excision repair (NER) protein complexes, XPA-RPA and XPC-RAD23B, recognized ICLs in vitro, and that cells deficient in the DNA mismatch repair (MMR) complex MutSbeta were sensitive to psoralen ICLs. To further investigate the role of MutSbeta in ICL repair and the potential interaction between proteins from the MMR and NER pathways on these lesions, we performed electrophoretic mobility-shift assays and chromatin immunoprecipitation analysis of MutSbeta and NER proteins with Tdp-ICLs. We found that MutSbeta bound to Tdp-ICLs with high affinity and specificity in vitro and in vivo, and that MutSbeta interacted with XPA-RPA or XPC-RAD23B in recognizing Tdp-ICLs. These data suggest that proteins from the MMR and NER pathways interact in the recognition of ICLs, and provide a mechanistic link by which proteins from multiple repair pathways contribute to ICL repair. PMID:19468048

  3. Ability of HMGB1 protein to bind to intrinsically bent and non-bent DNA sites in the AMPD2 gene amplicon.

    PubMed

    Passos, K J R; Fiorini, A; Rosado, F R; Freitas, D V B; Lima Neto, Q A; Pattaro Junior, J R; Gaspar, V P; Fernandez, M A

    2016-01-01

    HMGB-like proteins are architectural chromatin factors, and their function is heavily dependent on their ability to interact with DNA (especially non-canonical DNA structures). HMGB1 is involved in many DNA processes, and dysregulation of HMGB protein expression has profound effects on cellular transcription, resulting in severe developmental defects as well as cancer. During DNA replication, elements that form the origin are still not well defined in metazoans. Sites with A (adenine) or T (thymine) repeats cause intrinsic curvatures in the DNA and are described to be involved in the replication machinery by providing binding sites to replication proteins. As a result, the DNA molecule shows intrinsically bent DNA sites, caused by periodic repeats of 2 or more As/Ts (dA/dT) as well as intrinsically non-bent DNA sites (INBDs), due to a succession of curvatures that cancel each other. In the present study, we mapped 11 INBDSs present in the AMPD2 gene that are related to each replication origin (oriGNAI3, oriC, oriB, and oriA). Following characterization of INBDSs, we tested the ability of HMGB1 to bind to the bent (b1, b2, b4a, b4b, b5, b6, b7, and b8) and non-bent DNA fragments (nb7, nb11, nb1, nb2, nb4, and nb5) via electrophoretic mobility shift assays. All fragments showed efficient binding to HMGB1. However, the non-bent DNA fragments nb2, nb4, and nb5 showed slightly reduced binding efficiency. PMID:27323150

  4. Mass spectrometry and ion mobility spectrometry of G-quadruplexes. A study of solvent effects on dimer formation and structural transitions in the telomeric DNA sequence d(TAGGGTTAGGGT).

    PubMed

    Ferreira, Rubén; Marchand, Adrien; Gabelica, Valérie

    2012-05-01

    We survey here state of the art mass spectrometry methodologies for investigating G-quadruplexes, and will illustrate them with a new study on a simple model system: the dimeric G-quadruplex of the 12-mer telomeric DNA sequence d(TAGGGTTAGGGT), which can adopt either a parallel or an antiparallel structure. We will discuss the solution conditions compatible with electrospray ionisation, the quantification of complexes using ESI-MS, the interpretation of ammonium ion preservation in the complexes in the gas phase, and the use of ion mobility spectrometry to resolve ambiguities regarding the strand stoichiometry, or separate and characterise different structural isomers. We also describe that adding electrospray-compatible organic co-solvents (methanol, ethanol, isopropanol or acetonitrile) to aqueous ammonium acetate increases the stability and rate of formation of dimeric G-quadruplexes, and causes structural transitions to parallel structures. Structural changes were probed by circular dichroism and ion mobility spectrometry, and the excellent correlation between the two techniques validates the use of ion mobility to investigate G-quadruplex folding. We also demonstrate that parallel G-quadruplex structures are easier to preserve in the gas phase than antiparallel structures. PMID:22465284

  5. Fabrication and kinetics study of nano-Al/NiO thermite film by electrophoretic deposition.

    PubMed

    Zhang, Daixiong; Li, Xueming

    2015-05-21

    Nano-Al/NiO thermites were successfully prepared as film by electrophoretic deposition (EPD). For the key issue of this EPD, a mixture solvent of ethanol-acetylacetone (1:1 in volume) containing 0.00025 M nitric acid was proved to be a suitable dispersion system for EPD. The kinetics of electrophoretic deposition for both nano-Al and nano-NiO were investigated; the linear relation between deposition weight and deposition time in short time and parabolic relation in prolonged time were observed in both EPDs. The critical transition time between linear deposition kinetics and parabolic deposition kinetics for nano-Al and nano-NiO were 20 and 10 min, respectively. The theoretical calculation of the kinetics of electrophoretic deposition revealed that the equivalence ratio of nano-Al/NiO thermites film would be affected by the behavior of electrophoretic deposition for nano-Al and nano-NiO. The equivalence ratio remained steady when the linear deposition kinetics dominated for both nano-Al and nano-NiO. The equivalence ratio would change with deposition time when deposition kinetics for nano-NiO changed into parabolic kinetics dominated after 10 min. Therefore, the rule was suggested to be suitable for other EPD of bicomposites. We also studied thermodynamic properties of electrophoretic nano-Al/NiO thermites film as well as combustion performance. PMID:25950271

  6. Diffusion Coefficient in an Electrophoretic Asymmetrically Tilting Ratchet

    NASA Astrophysics Data System (ADS)

    Pasciak, P.; Kulakowski, K.; Gudowska-Nowak, E.

    2005-05-01

    We use the cellular-automaton Duke--Rubinstein model to simulate gel electrophoresis of DNA in periodically changing electric field. The field is dichotomic and its time average is zero. We observe non-vanishing current of molecules, what is known as the ratchet effect. We calculate the drift velocity and the diffusion coefficient for large field amplitude, where nonlinear effects can be observed. The results indicate that tuning the amplitude and frequency of the applied field for a given range of the molecule length can improve the resolving power of the separation of DNA.

  7. Development and validation of InnoQuant™, a sensitive human DNA quantitation and degradation assessment method for forensic samples using high copy number mobile elements Alu and SVA.

    PubMed

    Pineda, Gina M; Montgomery, Anne H; Thompson, Robyn; Indest, Brooke; Carroll, Marion; Sinha, Sudhir K

    2014-11-01

    There is a constant need in forensic casework laboratories for an improved way to increase the first-pass success rate of forensic samples. The recent advances in mini STR analysis, SNP, and Alu marker systems have now made it possible to analyze highly compromised samples, yet few tools are available that can simultaneously provide an assessment of quantity, inhibition, and degradation in a sample prior to genotyping. Currently there are several different approaches used for fluorescence-based quantification assays which provide a measure of quantity and inhibition. However, a system which can also assess the extent of degradation in a forensic sample will be a useful tool for DNA analysts. Possessing this information prior to genotyping will allow an analyst to more informatively make downstream decisions for the successful typing of a forensic sample without unnecessarily consuming DNA extract. Real-time PCR provides a reliable method for determining the amount and quality of amplifiable DNA in a biological sample. Alu are Short Interspersed Elements (SINE), approximately 300bp insertions which are distributed throughout the human genome in large copy number. The use of an internal primer to amplify a segment of an Alu element allows for human specificity as well as high sensitivity when compared to a single copy target. The advantage of an Alu system is the presence of a large number (>1000) of fixed insertions in every human genome, which minimizes the individual specific variation possible when using a multi-copy target quantification system. This study utilizes two independent retrotransposon genomic targets to obtain quantification of an 80bp "short" DNA fragment and a 207bp "long" DNA fragment in a degraded DNA sample in the multiplex system InnoQuant™. The ratio of the two quantitation values provides a "Degradation Index", or a qualitative measure of a sample's extent of degradation. The Degradation Index was found to be predictive of the observed loss

  8. Allele-specific DNA methylation reinforces PEAR1 enhancer activity.

    PubMed

    Izzi, Benedetta; Pistoni, Mariaelena; Cludts, Katrien; Akkor, Pinar; Lambrechts, Diether; Verfaillie, Catherine; Verhamme, Peter; Freson, Kathleen; Hoylaerts, Marc F

    2016-08-18

    Genetic variation in the PEAR1 locus is linked to platelet reactivity and cardiovascular disease. The major G allele of rs12041331, an intronic cytosine guanine dinucleotide-single-nucleotide polymorphism (CpG-SNP), is associated with higher PEAR1 expression in platelets and endothelial cells than the minor A allele. The molecular mechanism underlying this difference remains elusive. We have characterized the histone modification profiles of the intronic region surrounding rs12041331 and identified H3K4Me1 enhancer-specific enrichment for the region that covers the CpG-SNP. Interestingly, methylation studies revealed that the CpG site is fully methylated in leukocytes of GG carriers. Nuclear protein extracts from megakaryocytes, endothelial cells, vs control HEK-293 cells show a 3-fold higher affinity for the methylated G allele compared with nonmethylated G or A alleles in a gel electrophoretic mobility shift assay. To understand the positive relationship between methylation and gene expression, we studied DNA methylation at 4 different loci of PEAR1 during in vitro megakaryopoiesis. During differentiation, the CpG-SNP remained fully methylated, while we observed rapid methylation increases at the CpG-island overlapping the first 5'-untranslated region exon, paralleling the increased PEAR1 expression. In the same region, A-allele carriers of rs12041331 showed significantly lower DNA methylation at CGI1 compared with GG homozygote. This CpG-island contains binding sites for the methylation-sensitive transcription factor CTCF, whose binding is known to play a role in enhancer activation and/or repression. In conclusion, we report the molecular characterization of the first platelet function-related CpG-SNP, a genetic predisposition that reinforces PEAR1 enhancer activity through allele-specific DNA methylation. PMID:27313330

  9. Functionalizing Designer DNA Crystals

    NASA Astrophysics Data System (ADS)

    Chandrasekaran, Arun Richard

    nucleotides is usually pH dependent (pH < 6) four different TFOs were examined: TFO-1 was unmodified while TFOs 2-4 contained additional stabilizing analogues capable of extending triplex formation to pH 7. In addition, each of the TFOs contained a Cy5 dye at the 5'-end of the oligonucleotide to aid in characterization of TFO binding - crystals were obtained with all four variations of TFOs. Formation of DNA triplex in the motif was characterized by an electrophoretic mobility shift assay (EMSA), UV melting studies and FRET. Crystals containing TFO-1 (unmodified) and TFO-2 (with 2'-amino ethoxy modification) were isolated and flash-frozen in liquid nitrogen for X-ray data collection at beam line NSLS-X25. X-ray data was also collected for crystals of the 3-turn triangle without any TFO bound to it. Difference maps were done between the crystals with TFO against the one without to identify any additional electron density corresponding to the third strand in the triplex binding region. The data from the crystal containing TFO-2 was used to further analyze if the additional density can match the expected position of the TFO on the triangle motif. Since the additional density did not correspond to the entire binding region, 2Fo-Fc, 3Fo-2Fc and 4Fo-3Fc maps were done to check for missing pieces of the electron density. From the resulting 2Fo-Fc map, the asymmetric unit from the 3-turn triangle (31-bp duplex model based on previous structure 3UBI) was inserted into the density as a reference. However, the electron density corresponding to the TFO was still not continuous throughout the 13-nt triplex binding region and allowed only a partial fit of the TFO. The third nucleotide in positions 1, 3, 4, 6, 7 were fit into the density in the major groove of the underlying duplex with proper triplex configuration. The third chapter describes the triplex approach to position a functional group (the UV cross-linking agent psoralen) within a pre-formed DNA motif. Triplex formation and

  10. Electrical characterization of electrophoretically coated aluminum samples for photovoltaic concentrator application

    SciTech Connect

    Sugimura, R.S.; Mon, G.R.; Ross, R.G. Jr.

    1992-10-01

    The practicality of using a thin-film styrene/acrylate copolymer electrophoretic coating to isolate concentrator cells electrically from their surroundings in a photovoltaic concentrator module is assessed. Only the electrical isolation problem was investigated. The approach was to subject various types of EP-coated aluminum specimens to electrical stress testing and to aging tests while monitoring coating electrical resistivity properties. It was determined that, in general, longer processing times--i.e., thicker electrophoretic layers--resulted in better voltage-withstand properties. In particular, a two-minute processing time seemed sufficient to provide the electrical isolation required in photovoltaic concentrator application applications. Even though electrophoretic coatings did not seem to fill voids in porous-anodized aluminum substrates, breakdown voltages generally exceeded hi-pot pass-fail voltage levels with a comfortable margin. 6 refs, 11 figs, 5 tabs.

  11. Electrophoretic separation techniques and their hyphenation to mass spectrometry in biological inorganic chemistry.

    PubMed

    Holtkamp, Hannah; Grabmann, Gerlinde; Hartinger, Christian G

    2016-04-01

    Electrophoretic methods have been widely applied in research on the roles of metal complexes in biological systems. In particular, CE, often hyphenated to a sensitive MS detector, has provided valuable information on the modes of action of metal-based pharmaceuticals, and more recently new methods have been added to the electrophoretic toolbox. The range of applications continues to expand as a result of enhanced CE-to-MS interfacing, with sensitivity often at picomolar level, and evolved separation modes allowing for innovative sample analysis. This article is a followup to previous reviews about CE methods in metallodrug research (Electrophoresis, 2003, 24, 2023-2037; Electrophoresis, 2007, 28, 3436-3446; Electrophoresis, 2012, 33, 622-634), also providing a comprehensive overview of metal species studied by electrophoretic methods hyphenated to MS. It highlights the latest CE developments, takes a sneak peek into gel electrophoresis, traces biomolecule labeling, and focuses on the importance of early-stage drug development. PMID:26643265

  12. Identification of the polypeptides encoded in the unassigned reading frames 2, 4, 4L, and 5 of human mitochondrial DNA

    SciTech Connect

    Mariottini, P.; Chomyn, A.; Riley, M.; Cottrell, B.; Doolittle, R.F.; Attardi, G.

    1986-03-01

    In previous work, antibodies prepared against chemically synthesized peptides predicted from the DNA sequence were used to identify the polypeptides encoded in three of the eight unassigned reading frames (URFs) of human mitochondrial DNA (mtDNA). In the present study, this approach has been extended to other human mtDNA URFs. In particular, antibodies directed against the NH/sub 2/-terminal octapeptide of the putative URF2 product specifically precipitated component 11 of the HeLa cell mitochondrial translation products, the reaction being inhibited by the specific peptide. Similarly, antibodies directed against the COOH-terminal nonapeptide of the putative URF4 product reacted specifically with components 4 and 5, and antibodies against a COOH-terminal heptapeptide of the presumptive URF4L product reacted specifically with component 26. Antibodies against the NH/sub 2/-terminal heptapeptide of the putative product of URF5 reacted with component 1, but only to a marginal extent; however, the results of a trypsin fingerprinting analysis of component 1 point strongly to this component as being the authentic product of URF5. The polypeptide assignments to the mtDNA URFs analyzed here are supported by the relative electrophoretic mobilities of proteins 11, 4-5, 26, and 1, which are those expected for the molecular weights predicted from the DNA sequence for the products of URF2, URF4, URF4L, and URF5, respectively. With the present assignment, seven of the eight human mtDNA URFs have been shown to be expressed in HeLa cells.

  13. Poly(glycidyl methacrylate)/silver nanocomposite microspheres as a radioiodine scavenger: electrophoretic characterisation of carboxyl- and amine-modified particles.

    PubMed

    Macková, Hana; Oukacine, Farid; Plichta, Zdeněk; Hrubý, Martin; Kučka, Jan; Taverna, Myriam; Horák, Daniel

    2014-05-01

    Silver nanoparticles possess potent antibacterial properties and have extremely high affinities to radioiodine. For several applications, it is essential to anchor the nanoparticles to microparticles or solid surfaces to make them insoluble while retaining their unique properties. This current work is related to the design of anionic and cationic macroporous polymer microspheres based on poly(glycidyl methacrylate) (PGMA) obtained using a multistep swelling polymerisation. According to scanning electron microscopy, the microspheres were monodisperse in size and 4.2 μm in diameter. The presence of the carboxyl and amino groups in the PGMA-COOH and PGMA-NH2 microspheres was confirmed by FT-IR spectroscopy. Capillary electrophoresis (CE) and pressure-assisted capillary electrophoresis (PACE) were used to study the electrophoretic behaviour of both types of microparticles. The electrophoretic mobility of the microparticles was changed into ζ potential using Smoluchowski modelling. Finally, silver-containing microspheres were prepared by reducing silver nitrate in the presence of the microspheres, and they proved effective for scavenging radioiodide ions from a model medium. PMID:24594043

  14. Application of high-performance chromatographic and electrophoretic methods to the purification and characterization of glucose oxidase and catalase from Penicillium chrysogenum.

    PubMed

    Eriksson, K O; Kourteva, I; Yao, K Q; Liao, J L; Kilár, F; Hjertén, S; Chaga, G

    1987-06-26

    The high resolving power of the preparative and analytical high-performance chromatographic and electrophoretic methods recently developed in this laboratory for the separation of biopolymers has been demonstrated by the purification and characterization of glucose oxidase and catalase from Penicillium chrysogenum. Crude glucose oxidase was purified to homogeneity in one step by high-performance hydrophobic-interaction chromatography (HIC) on a pentylagarose column. Crude catalase was purified by a combination of HIC and high-performance anion-exchange chromatography on 3-diethylamino-2-hydroxypropylagarose. The homogeneity of the enzymes was monitored by high-performance electrophoresis and free zone electrophoresis. The pI values of these two enzymes determined by isoelectric focusing in the high-performance electrophoresis apparatus were 4.2 and 6.5, respectively. Their molecular weights were determined by high-performance molecular sieve chromatography on an agarose column. Glucose oxidase has a molecular weight of 175,000 and probably consists of two identical subunits, as sodium dodecyl sulphate polyacrylamide gel electrophoresis gave a molecular weight of around 72,000. The molecular weight of catalase, which is probably composed of non-identical subunits, as indicated by sodium dodecyl sulphate electrophoresis, is around 320,000. Some other characteristics of these two enzymes were also investigated, e.g., electrophoretic mobility, pH stability and optimum pH. PMID:3116021

  15. Beyond the dna: a prototype for functional genomics

    SciTech Connect

    Albala, J

    2000-03-02

    differences in gene expression among different cell populations; disease states and following drug treatments or toxic insult to whole cells. However, these technologies have yet to be extended beyond the examination of DNA/RNA molecules to dissect gene function. One of the most critical component of cellular biochemistry is the integrity of interaction between proteins and DNA. Protein-nucleic acid interactions are essential for the structural organization, replication, repair and expression of genetic information. Understanding the complexities of protein-DNA interactions is a fundamental step towards comprehending key aspects of disease biochemistry. The complexity of these cellular processes generally makes it necessary to analyze these interactions in vitro. Many techniques have been designed to offer insight into these processes including filter binding studies, electrophoretic mobility shift assays and footprinting technologies. But these techniques are laborious and time-consuming, and the development of high-throughput strategies for analysis of protein-DNA interactions would greatly propel these areas of research. Using an oligonucleotide chip approach, novel proteins can be analyzed for DNA binding or enzymatic characteristics. Proteins can be screened against the ''functional chip'' both individually and in combination.

  16. Electrophoretic deposition of hyaluronic acid and composite films for biomedical applications

    NASA Astrophysics Data System (ADS)

    Ma, R.; Li, Y.; Zhitomirsky, I.

    2010-06-01

    Hyaluronic acid (HYH) is a natural biopolymer, which has tremendous potential for various biomedical applications. Electrophoretic deposition (EPD) methods have been developed for the fabrication of HYH films and composites. New methods for the immobilization of drugs and proteins have been utilized for the fabrication of organic composites. Electrophoretic deposition enabled the fabrication of organic-inorganic composites containing bioceramics and bioglass in the HYH matrix. It was shown that the deposition yield, microstructure, and composition of the films can be controlled. Potential applications of EPD for the surface modification of biomedical implants and fabrication of biosensors are highlighted.

  17. Polyacrylamide gel electrophoretic methods in the separation of structural muscle proteins.

    SciTech Connect

    Barany, K.; Barany, M.; Giometti, C. S.; Center for Mechanistic Biology and Biotechnology; Univ. of Illinois at Chicago

    1995-04-28

    Polyacrylamide gel electrophoresis plays a major role in analyzing the function of muscle structural proteins. This review describes one- and two-dimensional gel electrophoretic methods for qualitative and quantitative investigation of the muscle proteins, with special emphasis on determination of protein phosphorylation. The electrophoretic studies established the subunit structures of the muscle proteins, characterized their multiple forms, revealed changes in subunit composition or shifts in isoform distribution of specific proteins during development, upon stimulation or denervation of the muscle. Protein phosphorylation during muscle contraction is preferentially studied by two-dimensional gel electrophoresis. The same method demonstrated protein alterations in human neuromuscular diseases.

  18. Capillary electrophoretic study of thiolated alpha-cyclodextrin-capped gold nanoparticles with tetraalkylammonium ions.

    PubMed

    Paau, Man Chin; Lo, Chung Keung; Yang, Xiupei; Choi, Martin M F

    2009-11-27

    Capillary zone electrophoresis (CZE) has been employed to characterize nanometer-sized thiolated alpha-cyclodextrin-capped gold nanoparticles (alpha-CD-S-AuNPs). The addition of tetrabutylammonium (Bu(4)N(+)) ions to the run buffer greatly narrows the migration peak of alpha-CD-S-AuNP. The optimal run buffer was determined to be 10mM Bu(4)N(+) in 30 mM phosphate buffer at pH 12 and an applied voltage of 15 kV. The effect of various tetraalkylammonium ions on the peak width and electrophoretic mobility (mu(e)) of alpha-CD-S-AuNP was studied in detail. Bu(4)N(+) ions assist in inter-linking the alpha-CD-S-AuNPs and narrowing the migration peak in CZE. This observation can be explained by the fact that each Bu(4)N(+) ion can simultaneously interact with several hydrophobic cavities of the surface-attached alpha-CDs on AuNPs. The TEM images show that alpha-CD-S-AuNPs with Bu(4)N(+) are linked together but in the absence of Bu(4)N(+), they are more dispersed. The migration mechanism in CZE is based on the formation of inclusion complexes between Bu(4)N(+) and alpha-CD-S-AuNPs which induces changes in the charge-to-size ratio of alpha-CD-S-AuNPs and mu(e). An inverse linear relationship (r(2)>0.998) exists between the mu(e) and size of alpha-CD-S-AuNPs in the core range 1.4-4.1 nm. The CZE analyses are rapid with migration time less than 4 min. A few nanoliters of each of the alpha-CD-S-AuNP samples were injected hydrodynamically at 0.5 psi for 5s. Our work confirms that CZE is an efficient tool for characterizing the sizes of alpha-CD-S-AuNPs using Bu(4)N(+) ions. PMID:19853853

  19. Electric field-induced lateral mobility of photosystem I in the photosynthetic membrane

    PubMed Central

    Brumfeld, Vlad; Miller, Israel R.; Korenstein, Rafi

    1989-01-01

    Electrophoretic movement of photosystem I (PS I) along the photosynthetic membrane of hypotonically swollen thylakoid vesicles was studied by analyzing the electric field-stimulated delayed luminescence (electrophotoluminescence) emitted from PS I. The electrophoretic mobility was inferred from the differences in electrophotoluminescence (EPL) of the photosynthetic vesicles in presence and absence of trains of low amplitude (<80 V/cm) prepulses of 1 ms duration at 4 ms spacing. The average apparent electric mobility, determined from the time course of EPL increase on one hemisphere or its decrease on the other one, as function of prepulse length and intensity was of the order of 3 · 10-5 cm2V-1s-1. The assymetric distribution of the PS I reached a steady state when the diffusional, electrostatic, and elastic forces balanced the electrophoretic driving force. A lateral diffusion coefficient of ∼5 · 10-9 cm2s-1 was found for the PS I complex from the diffusional relaxation after cessation of the electric field pulse train. Experimental conditions such as concentration, temperature, and viscosity of the aqueous solution were not critical for the effect. Between 23 and 150 electron charges per moving particle were estimated from the measured electrophoretic mobility. PMID:19431746

  20. Circular Herpesvirus sylvilagus DNA in spleen cells of experimentally infected cottontail rabbits.

    PubMed

    Medveczky, P; Kramp, W J; Sullivan, J L

    1984-11-01

    Cottontail rabbits (Sylvilagus floridanus) were infected with Herpesvirus sylvilagus, and spleen cells were analyzed for the presence of virus-specific, covalently closed circular, and linear DNA molecules by a simple electrophoretic technique, followed by transfer to nitrocellulose filters and hybridization with cloned viral DNA (Gardella et al., J. Virol. 50:248-254, 1984). Approximately 0.2 copies per cell of circular DNA and 0.2 copies per cell of linear DNA were detected by hybridization with a cloned viral DNA fragment. The size of the viral DNA was estimated at ca. 158 kilobase pairs. Restriction endonuclease patterns suggested structural similarities to cottontail herpesvirus DNA. PMID:6092696

  1. The BR domain of PsrP interacts with extracellular DNA to promote bacterial aggregation; structural insights into pneumococcal biofilm formation.

    PubMed

    Schulte, Tim; Mikaelsson, Cecilia; Beaussart, Audrey; Kikhney, Alexey; Deshmukh, Maya; Wolniak, Sebastian; Pathak, Anuj; Ebel, Christine; Löfling, Jonas; Fogolari, Federico; Henriques-Normark, Birgitta; Dufrêne, Yves F; Svergun, Dmitri; Nygren, Per-Åke; Achour, Adnane

    2016-01-01

    The major human pathogen Streptococcus pneumoniae is a leading cause of disease and death worldwide. Pneumococcal biofilm formation within the nasopharynx leads to long-term colonization and persistence within the host. We have previously demonstrated that the capsular surface-associated pneumococcal serine rich repeat protein (PsrP), key factor for biofilm formation, binds to keratin-10 (KRT10) through its microbial surface component recognizing adhesive matrix molecule (MSCRAMM)-related globular binding region domain (BR187-385). Here, we show that BR187-385 also binds to DNA, as demonstrated by electrophoretic mobility shift assays and size exclusion chromatography. Further, heterologous expression of BR187-378 or the longer BR120-378 construct on the surface of a Gram-positive model host bacterium resulted in the formation of cellular aggregates that was significantly enhanced in the presence of DNA. Crystal structure analyses revealed the formation of BR187-385 homo-dimers via an intermolecular β-sheet, resulting in a positively charged concave surface, shaped to accommodate the acidic helical DNA structure. Furthermore, small angle X-ray scattering and circular dichroism studies indicate that the aggregate-enhancing N-terminal region of BR120-166 adopts an extended, non-globular structure. Altogether, our results suggest that PsrP adheres to extracellular DNA in the biofilm matrix and thus promotes pneumococcal biofilm formation. PMID:27582320

  2. Heterogeneous nuclear ribonucleoprotein K and nucleolin as transcriptional activators of the vascular endothelial growth factor promoter through interaction with secondary DNA structures

    PubMed Central

    Uribe, Diana J.; Guo, Kexiao; Shin, Yoon-Joo; Sun, Daekyu

    2011-01-01

    The human vascular endothelial growth factor (VEGF) promoter contains a polypurine/polypyrimidine (pPu/pPy) tract that is known to play a critical role in its transcriptional regulation. This pPu/pPy tract undergoes a conformational transition between B-DNA, single stranded DNA and atypical secondary DNA structures such as G-quadruplexes and i-motifs. We studied the interaction of the cytosine-rich (C-rich) and guanine-rich (G-rich) strands of this tract with transcription factors heterogeneous nuclear ribonucleoprotein (hnRNP) K and nucleolin, respectively, both in vitro and in vivo and their potential role in the transcriptional control of VEGF. Using chromatin immunoprecipitation (ChIP) assay for our in vivo studies and electrophoretic mobility shift assay (EMSA) for our in vitro studies, we demonstrated that both nucleolin and hnRNP K bind selectively to the G- and C-rich sequences, respectively, in the pPu/pPy tract of the VEGF promoter. The small interfering RNA (siRNA)-mediated silencing of either nucleolin or hnRNP K resulted in the down-regulation of basal VEGF gene, suggesting that they act as activators of VEGF transcription. Taken together, the identification of transcription factors that can recognize and bind to atypical DNA structures within the pPu/pPy tract will provide new insight into mechanisms of transcriptional regulation of the VEGF gene. PMID:21466159

  3. The BR domain of PsrP interacts with extracellular DNA to promote bacterial aggregation; structural insights into pneumococcal biofilm formation

    PubMed Central

    Schulte, Tim; Mikaelsson, Cecilia; Beaussart, Audrey; Kikhney, Alexey; Deshmukh, Maya; Wolniak, Sebastian; Pathak, Anuj; Ebel, Christine; Löfling, Jonas; Fogolari, Federico; Henriques-Normark, Birgitta; Dufrêne, Yves F.; Svergun, Dmitri; Nygren, Per-Åke; Achour, Adnane

    2016-01-01

    The major human pathogen Streptococcus pneumoniae is a leading cause of disease and death worldwide. Pneumococcal biofilm formation within the nasopharynx leads to long-term colonization and persistence within the host. We have previously demonstrated that the capsular surface-associated pneumococcal serine rich repeat protein (PsrP), key factor for biofilm formation, binds to keratin-10 (KRT10) through its microbial surface component recognizing adhesive matrix molecule (MSCRAMM)-related globular binding region domain (BR187–385). Here, we show that BR187–385 also binds to DNA, as demonstrated by electrophoretic mobility shift assays and size exclusion chromatography. Further, heterologous expression of BR187–378 or the longer BR120–378 construct on the surface of a Gram-positive model host bacterium resulted in the formation of cellular aggregates that was significantly enhanced in the presence of DNA. Crystal structure analyses revealed the formation of BR187–385 homo-dimers via an intermolecular β-sheet, resulting in a positively charged concave surface, shaped to accommodate the acidic helical DNA structure. Furthermore, small angle X-ray scattering and circular dichroism studies indicate that the aggregate-enhancing N-terminal region of BR120–166 adopts an extended, non-globular structure. Altogether, our results suggest that PsrP adheres to extracellular DNA in the biofilm matrix and thus promotes pneumococcal biofilm formation. PMID:27582320

  4. Triplex inducer-directed self-assembly of single-walled carbon nanotubes: a triplex DNA-based approach for controlled manipulation of nanostructures

    PubMed Central

    Zhao, Chao; Qu, Konggang; Xu, Can; Ren, Jinsong; Qu, Xiaogang

    2011-01-01

    As a promising strategy for artificially control of gene expression, reversible assembly of nanomaterials and DNA nanomachine, DNA triplex formation has received much attention. Carbon nanotubes as gene and drug delivery vector or as ‘building blocks’ in nano/microelectronic devices have been successfully explored. Therefore, studies on triplex DNA-based carbon nanotube hybrid materials are important for development of smart nanomaterials and for gene therapy. In this report, a small molecule directed single-walled carbon nanotubes (SWNTs) self-assembly assay has been developed by disproportionation of SWNTs–dT22·dA22 duplex into triplex dT22·dA22·dT22 and dA22 by a triplex formation inducer, coralyne. This has been studied by circular dichroism, light scattering (LS) spectroscopy, scanning electron microscopy (SEM), atomic force microscopy (AFM), electrophoretic mobility shift assay and supported by using DNA random sequence. In contrast, SWNTs do not aggregate under the same experimental conditions when the small molecules used can not induce dT22·dA22·dT22 triplex formation. Therefore, this novel small molecule-directed SWNTs self-assembly assay has also been used for screening of triplex inducers in our studies. PMID:21227925

  5. Modulation of pyridinium cationic lipid-DNA complex properties by pyridinium gemini surfactants and its impact on lipoplex transfection properties.

    PubMed

    Sharma, Vishnu Dutt; Lees, Julia; Hoffman, Nicholas E; Brailoiu, Eugen; Madesh, Muniswamy; Wunder, Stephanie L; Ilies, Marc A

    2014-02-01

    The study presents the effects of blending a cationic gemini surfactant into cationic lipid bilayers and its impact on the plasmid DNA compaction and delivery process. Using nanoDSC, dynamic light scattering, zeta potential, and electrophoretic mobility measurements, together with transfection (2D- and 3D-) and viability assays, we identified the main physicochemical parameters of the lipid bilayers, liposomes, and lipoplexes that are affected by the gemini surfactant addition. We also correlated the cationic bilayer composition with the dynamics of the DNA compaction process and with transfection efficiency, cytotoxicity, and the internalization mechanism of the resultant nucleic acid complexes. We found that the blending of gemini surfactant into the cationic bilayers fluidized the supramolecular assemblies, reduced the amount of positive charge required to fully compact the plasmid DNA and, in certain cases, changed the internalization mechanism of the lipoplexes. The transfection efficiency of select ternary lipoplexes derived from cationic gemini surfactants and lipids was several times superior to the transfection efficiency of corresponding binary lipoplexes, also surpassing standard transfection systems. The overall impact of gemini surfactants into the formation and dynamic of cationic bilayers was found to depend heavily on the presence of colipids, their nature, and amount present in lipoplexes. The study confirmed the possibility of combining the specific properties of pyridinium gemini surfactants and cationic lipids synergistically to obtain efficient synthetic transfection systems with negligible cytotoxicity useful for therapeutic gene delivery. PMID:24377350

  6. Modulation of pyridinium cationic lipid-DNA complex properties by pyridinium gemini surfactants and its impact on lipoplex transfection properties

    PubMed Central

    Sharma, Vishnu Dutt; Lees, Julia; Hoffman, Nicholas E.; Brailoiu, Eugen; Madesh, Muniswamy; Wunder, Stephanie L.; Ilies, Marc A.

    2014-01-01

    The study presents the effects of blending a cationic gemini surfactant into cationic lipid bilayers and its impact towards plasmid DNA compaction and delivery process. Using nanoDSC, dynamic light scattering, zeta potential and electrophoretic mobility measurements, together with transfection (2D- and 3D-) and viability assays, we identified the main physicochemical parameters of the lipid bilayers, liposomes and lipoplexes that are affected by the gemini surfactant addition. We also correlated the cationic bilayer composition with the dynamics of the DNA compaction process, and with transfection efficiency, cytotoxicity and internalization mechanism of the resultant nucleic acid complexes. We found that blending of gemini surfactant into the cationic bilayers fluidized the supramolecular assemblies, reduced the amount of positive charge required to fully compact the plasmid DNA and, in certain cases, changed the internalization mechanism of the lipoplexes. Transfection efficiency of select ternary lipoplexes derived from cationic gemini surfactants and lipids was several times superior to transfection efficiency of corresponding binary lipoplexes, also surpassing standard transfection systems. The overall impact of gemini surfactants into the formation and dynamic of cationic bilayers was found to depend heavily on the presence of co-lipids, their nature and amount present into lipoplexes. The study confirmed the possibility of combining the specific properties of pyridinium gemini surfactants and cationic lipids synergistically for obtaining efficient synthetic transfection systems with negligible cytotoxicity useful for therapeutic gene delivery. PMID:24377350

  7. Increased origin activity in transformed versus normal cells: identification of novel protein players involved in DNA replication and cellular transformation

    PubMed Central

    Di Paola, Domenic; Rampakakis, Emmanouil; Chan, Man Kid; Arvanitis, Dina N.; Zannis-Hadjopoulos, Maria

    2010-01-01

    Using libraries of replication origins generated previously, we identified three clones that supported the autonomous replication of their respective plasmids in transformed, but not in normal cells. Assessment of their in vivo replication activity by in situ chromosomal DNA replication assays revealed that the chromosomal loci corresponding to these clones coincided with chromosomal replication origins in all cell lines, which were more active by 2–3-fold in the transformed by comparison to the normal cells. Evaluation of pre-replication complex (pre-RC) protein abundance at these origins in transformed and normal cells by chromatin immunoprecipitation assays, using anti-ORC2, -cdc6 and -cdt1 antibodies, showed that they were bound by these pre-RC proteins in all cell lines, but a 2–3-fold higher abundance was observed in the transformed by comparison to the normal cells. Electrophoretic mobility shift assays (EMSAs) performed on the most efficiently replicating clone, using nuclear extracts from the transformed and normal cells, revealed the presence of a DNA replication complex in transformed cells, which was barely detectable in normal cells. Subsequent supershift EMSAs suggested the presence of transformation-specific complexes. Mass spectrometric analysis of these complexes revealed potential new protein players involved in DNA replication that appear to correlate with cellular transformation. PMID:20064876

  8. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans

    PubMed Central

    Shahin-jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-mohammadi, Shahla

    2015-01-01

    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence. PMID:27081370

  9. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans.

    PubMed

    Shahin-Jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-Mohammadi, Shahla

    2016-05-01

    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence. PMID:27081370

  10. The Intracellular DNA Sensor IFI16 Gene Acts as Restriction Factor for Human Cytomegalovirus Replication

    PubMed Central

    Gariano, Grazia Rosaria; Dell'Oste, Valentina; Bronzini, Matteo; Gatti, Deborah; Luganini, Anna; De Andrea, Marco; Gribaudo, Giorgio; Gariglio, Marisa; Landolfo, Santo

    2012-01-01

    Human interferon (IFN)-inducible IFI16 protein, an innate immune sensor of intracellular DNA, modulates various cell functions, however, its role in regulating virus growth remains unresolved. Here, we adopt two approaches to investigate whether IFI16 exerts pro- and/or anti-viral actions. First, the IFI16 gene was silenced using specific small interfering RNAs (siRNA) in human embryo lung fibroblasts (HELF) and replication of DNA and RNA viruses evaluated. IFI16-knockdown resulted in enhanced replication of Herpesviruses, in particular, Human Cytomegalovirus (HCMV). Consistent with this, HELF transduction with a dominant negative form of IFI16 lacking the PYRIN domain (PYD) enhanced the replication of HCMV. Second, HCMV replication was compared between HELFs overexpressing either the IFI16 gene or the LacZ gene. IFI16 overexpression decreased both virus yield and viral DNA copy number. Early and late, but not immediate-early, mRNAs and proteins were strongly down-regulated, thus IFI16 may exert its antiviral effect by impairing viral DNA synthesis. Constructs with the luciferase reporter gene driven by deleted or site-specific mutated forms of the HCMV DNA polymerase (UL54) promoter demonstrated that the inverted repeat element 1 (IR-1), located between −54 and −43 relative to the transcription start site, is the target of IFI16 suppression. Indeed, electrophoretic mobility shift assays and chromatin immunoprecipitation demonstrated that suppression of the UL54 promoter is mediated by IFI16-induced blocking of Sp1-like factors. Consistent with these results, deletion of the putative Sp1 responsive element from the HCMV UL44 promoter also relieved IFI16 suppression. Together, these data implicate IFI16 as a novel restriction factor against HCMV replication and provide new insight into the physiological functions of the IFN-inducible gene IFI16 as a viral restriction factor. PMID:22291595

  11. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    NASA Astrophysics Data System (ADS)

    Canuto, K. S.; Sergio, L. P. S.; Marciano, R. S.; Guimarães, O. R.; Polignano, G. A. C.; Geller, M.; Paoli, F.; Fonseca, A. S.

    2013-06-01

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase.

  12. LEF-1 recognition of platinated GG sequences within double-stranded DNA. Influence of flanking bases.

    PubMed

    Chválová, Katerina; Sari, Marie-Agnès; Bombard, Sophie; Kozelka, Jirí

    2008-02-01

    The lymphoid enhancer-binding factor 1 (LEF-1) recognizes a double-stranded 9 base-pairs (bp) long motif in DNA which is significantly bent upon binding. This bend is centered at two destacked adenines whose geometry closely resembles that of two adjacent guanines crosslinked by the antitumor drug cisplatin. It has been proposed that cisplatin-GG crosslinks could hijack high mobility group (HMG) box containing transcription factors such as LEF-1. In order to examine such a possibility, we used electrophoretic mobility shift assays to determine the affinity of the HMG box of LEF-1 for a series of 25 oligonucleotides containing a central GG sequence, free or site-specifically modified by cisplatin. The binding affinity of the GG-platinated oligonucleotides was 3-6-fold higher than that determined for the corresponding unplatinated oligonucleotides, however, the binding to all cisplatin-modified oligonucleotides was at least 1 order of magnitude weaker than that to the 25 bp oligonucleotide containing the recognition 9 bp motif. The binding affinity was dependent on the nature of bases flanking the cisplatin-crosslinked G(*)G(*) dinucleotide, the AG(*)G(*)T sequence displaying the strongest affinity and CG(*)G(*)T showing the strongest binding enhancement upon platination. In contrast, modification of the AGGT sequence with the third-generation platinum antitumor drug oxaliplatin did not enhance the affinity significantly. These results suggest that the cisplatin-caused bending of DNA does produce a target for LEF-1 binding, however, the cisplatinated DNA does not appear to be a strong competitor for the LEF-1 recognition sequence. PMID:17961652

  13. Fluorescence-detected DNA sequencing. Final technical report, September 30, 1988--September 29, 1990

    SciTech Connect

    Haugland, R.P.

    1990-12-31

    Our research effort funded by this grant primarily focused on development of suitable fluorescent dyes for DNA sequencing studies. Prior to our efforts, the dyes being sued in commercial DNA sequencers were various versions of fluorescein dyes for the shorter wavelengths and of rhodamine dyes for the longer wavelengths. Our initial goal was to synthesize a set of four dyes that could all be excited by the 488 and 514 nm line of the argon laser lines and that have emission spectra that minimize spectral overlap. The specific result sought was higher fluorescent intensity, particularly of the longest wavelength dyes than was available using existing dyes. Another important property of the desired set of dyes was uniform ionic charge in order to have minimum interference on the electrophoretic mobility during the sequencing. During the period of this grant we prepared and characterized four types of dyes: fluorescent bifluorophores, derivatives of rhodamine dyes, derivatives of rhodol dyes and derivatives of boron dipyrromethene difluoride (BODIPY{trademark}) dyes.

  14. DNA Aptamers against Taiwan Banded Krait α-Bungarotoxin Recognize Taiwan Cobra Cardiotoxins

    PubMed Central

    Chen, Ying-Jung; Tsai, Chia-Yu; Hu, Wan-Ping; Chang, Long-Sen

    2016-01-01

    Bungarus multicinctus α-bungarotoxin (α-Bgt) and Naja atra cardiotoxins (CTXs) share a common structural scaffold, and their tertiary structures adopt three-fingered loop motifs. Four DNA aptamers against α-Bgt have been reported previously. Given that the binding of aptamers with targeted proteins depends on structural complementarity, in this study, we investigated whether DNA aptamers against α-Bgt could also recognize CTXs. It was found that N. atra cardiotoxin 3 (CTX3) reduced the electrophoretic mobility of aptamers against α-Bgt. Analysis of the changes in the fluorescence intensity of carboxyfluorescein-labeled aptamers upon binding toxin molecules revealed that CTX3 and α-Bgt could bind the tested aptamers. Moreover, the aptamers inhibited the membrane-damaging activity and cytotoxicity of CTX3. In addition to CTX3, other N. atra CTX isotoxins also bound to the aptamer against α-Bgt. Taken together, our data indicate that aptamers against α-Bgt show cross-reactivity with CTXs. The findings that aptamers against α-Bgt also suppress the biological activities of CTX3 highlight the potential utility of aptamers in regard to the broad inhibition of snake venom three-fingered proteins. PMID:26959062

  15. Inhibitory Effects of Bangladeshi Medicinal Plant Extracts on Interactions between Transcription Factors and Target DNA Sequences

    PubMed Central

    Lampronti, Ilaria; Khan, Mahmud T.H.; Borgatti, Monica; Bianchi, Nicoletta

    2008-01-01

    Several transcription factors (TFs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes and inflammation. As far as inflammation, TFs playing pivotal roles are nuclear factor kappa B (NF-kB), activator protein (AP-1), signal transducer and activator of transcription (STATs), cAMP response element binding protein (CREB) and GATA-1 factors. All these TFs regulate the expression of pro-inflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component. Since several medicinal plants can be employed to produce extracts exhibiting biological effects and because alteration of gene transcription represents a very interesting approach to control the expression of selected genes, this study sought to verify the ability of several extracts derived from Bangladeshi medicinal plants in interfering with molecular interactions between different TFs and specific DNA sequences. We first analyzed the antiproliferative activity of 19 medicinal plants on different human cell lines, including erythroleukemia K562, B lymphoid Raji and T lymphoid Jurkat cell lines. Secondly, we employed the electrophoretic mobility shift assay as a suitable technique for a fast screening of plant extracts altering the binding between NF-kB, AP-1, GATA-1, STAT-3, CREB and the relative target DNA elements. PMID:18830455

  16. Three-dimensional Nanowire Structures for Ultra-Fast Separation of DNA, Protein and RNA Molecules

    PubMed Central

    Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

    2015-01-01

    Separation and analysis of biomolecules represent crucial processes for biological and biomedical engineering development; however, separation resolution and speed for biomolecules analysis still require improvements. To achieve separation and analysis of biomolecules in a short time, the use of highly-ordered nanostructures fabricated by top-down or bottom-up approaches have been proposed. Here, we reported on the use of three-dimensional (3D) nanowire structures embedded in microchannels fabricated by a bottom-up approach for ultrafast separation of small biomolecules, such as DNA, protein, and RNA molecules. The 3D nanowire structures could analyze a mixture of DNA molecules (50–1000 bp) within 50 s, a mixture of protein molecules (20–340 kDa) within 5 s, and a mixture of RNA molecules (100–1000 bases) within 25 s. And, we could observe the electrophoretic mobility difference of biomolecules as a function of molecular size in the 3D nanowire structures. Since the present methodology allows users to control the pore size of sieving materials by varying the number of cycles for nanowire growth, the 3D nanowire structures have a good potential for use as alternatives for other sieving materials. PMID:26073192

  17. DNA Aptamers against Taiwan Banded Krait α-Bungarotoxin Recognize Taiwan Cobra Cardiotoxins.

    PubMed

    Chen, Ying-Jung; Tsai, Chia-Yu; Hu, Wan-Ping; Chang, Long-Sen

    2016-03-01

    Bungarus multicinctus α-bungarotoxin (α-Bgt) and Naja atra cardiotoxins (CTXs) share a common structural scaffold, and their tertiary structures adopt three-fingered loop motifs. Four DNA aptamers against α-Bgt have been reported previously. Given that the binding of aptamers with targeted proteins depends on structural complementarity, in this study, we investigated whether DNA aptamers against α-Bgt could also recognize CTXs. It was found that N. atra cardiotoxin 3 (CTX3) reduced the electrophoretic mobility of aptamers against α-Bgt. Analysis of the changes in the fluorescence intensity of carboxyfluorescein-labeled aptamers upon binding toxin molecules revealed that CTX3 and α-Bgt could bind the tested aptamers. Moreover, the aptamers inhibited the membrane-damaging activity and cytotoxicity of CTX3. In addition to CTX3, other N. atra CTX isotoxins also bound to the aptamer against α-Bgt. Taken together, our data indicate that aptamers against α-Bgt show cross-reactivity with CTXs. The findings that aptamers against α-Bgt also suppress the biological activities of CTX3 highlight the potential utility of aptamers in regard to the broad inhibition of snake venom three-fingered proteins. PMID:26959062

  18. A new DNA binding protein highly conserved in diverse crenarchaeal viruses.

    PubMed

    Larson, Eric T; Eilers, Brian J; Reiter, Dirk; Ortmann, Alice C; Young, Mark J; Lawrence, C Martin

    2007-07-01

    Sulfolobus turreted icosahedral virus (STIV) infects Sulfolobus species found in the hot springs of Yellowstone National Park. Its 37 open reading frames (ORFs) generally lack sequence similarity to other genes. One exception, however, is ORF B116. While its function is unknown, orthologs are found in three additional crenarchaeal viral families. Due to the central importance of this protein family to crenarchaeal viruses, we have undertaken structural and biochemical studies of B116. The structure reveals a previously unobserved fold consisting of a five-stranded beta-sheet flanked on one side by three alpha helices. Two subunits come together to form a homodimer with a 10-stranded mixed beta-sheet, where the topology of the central strands resembles an unclosed beta-barrel. Highly conserved loops rise above the surface of the saddle-shaped protein and suggest an interaction with the major groove of DNA. The predicted B116-DNA interaction is confirmed by electrophoretic mobility shift assays. PMID:17336360

  19. Electrophoretic isoenzyme patterns of the pathogenic and non-pathogenic intestinal amoebae of man.

    PubMed

    Sargeaunt, P G; Williams, J E

    1979-01-01

    Cultured stocks of Entamoeba hartmanni, Endolimax nana, Iodamoeba buetschlli and Dientamoeba fragilis were compared with the four Entamoeba histolytical groups already described (SARGEAUNT et al., 1978), by the electrophoretic patterns of three enzymes: glucose phosphate isomerase (GPI), phosphoglucomutase (PGM) and L-malate: NADP+ oxidoreductase (oxalacetate-decarboxylating) (ME). All the species were easily distinguished by their characteristic patterns. PMID:473310

  20. Electrophoretic Deposition for Cholesteric Liquid-Crystalline Devices with Memory and Modulation of Reflection Colors.

    PubMed

    Tokunaga, Shoichi; Itoh, Yoshimitsu; Yaguchi, Yuya; Tanaka, Hiroyuki; Araoka, Fumito; Takezoe, Hideo; Aida, Takuzo

    2016-06-01

    The first design strategy that allows both memorization and modulation of the liquid-crystalline reflection color is reported. Electrophoretic deposition of a tailored ionic chiral dopant is key to realizing this unprecedented function, which may pave the way for the development of full-color e-paper that can operate without the need of color filters. PMID:27027423

  1. Effect of lipid composition on the structure and theoretical phase diagrams of DC-Chol/DOPE-DNA lipoplexes.

    PubMed

    Muñoz-Ubeda, Mónica; Rodríguez-Pulido, Alberto; Nogales, Aurora; Martín-Molina, Alberto; Aicart, Emilio; Junquera, Elena

    2010-12-13

    Lipoplexes constituted by calf-thymus DNA (CT-DNA) and mixed cationic liposomes consisting of varying proportions of the cationic lipid 3β-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-Chol) and the zwitterionic lipid, 1,2-dioleoyl-sn-glycero-3-phosphoetanolamine (DOPE) have been analyzed by means of electrophoretic mobility, SAXS, and fluorescence anisotropy experiments, as well as by theoretically calculated phase diagrams. Both experimental and theoretical studies have been run at several liposome and lipoplex compositions, defined in terms of cationic lipid molar fraction, α, and either the mass or charge ratios of the lipoplex, respectively. The experimental electrochemical results indicate that DC-Chol/DOPE liposomes, with a mean hydrodynamic diameter of around (120 ± 10) nm, compact and condense DNA fragments at their cationic surfaces by means of a strong entropically driven electrostatic interaction. Furthermore, the positive charges of cationic liposomes are compensated by the negative charges of DNA phosphate groups at the isoneutrality L/D ratio, (L/D)(ϕ), which decreases with the cationic lipid content of the mixed liposome, for a given DNA concentration. This inversion of sign process has been also studied by means of the phase diagrams calculated with the theoretical model, which confirms all the experimental results. SAXS diffractograms, run at several lipoplex compositions, reveal that, irrespectively of the lipoplex charge ratio, DC-Chol/DOPE-DNA lipoplexes show a lamellar structure, L(α), when the cationic lipid content on the mixed liposomes α ≥ 0.4, while for a lower content (α = 0.2) the lipoplexes show an inverted hexagonal structure, H(II), usually related with improved cell transfection efficiency. A similar conclusion is reached from fluorescence anisotropy results, which indicate that the fluidity on liposome and lipoplexes membrane, also related with better transfection results, increases as long as the

  2. DNA Methylation in the Neuropeptide S Receptor 1 (NPSR1) Promoter in Relation to Asthma and Environmental Factors

    PubMed Central

    Reinius, Lovisa E.; Gref, Anna; Sääf, Annika; Acevedo, Nathalie; Joerink, Maaike; Kupczyk, Maciej; D'Amato, Mauro; Bergström, Anna; Melén, Erik; Scheynius, Annika; Dahlén, Sven-Erik; Pershagen, Göran; Söderhäll, Cilla; Kere, Juha

    2013-01-01

    Asthma and allergy are complex disorders influenced by both inheritance and environment, a relationship that might be further clarified by epigenetics. Neuropeptide S Receptor 1 (NPSR1) has been associated with asthma and allergy and a study suggested modulation of the genetic risk by environmental factors. We aimed to study DNA methylation in the promoter region of NPSR1 in relation to asthma and environmental exposures. Electrophoretic Mobility Shift Assay (EMSA) was used to investigate potential functional roles of both genotypes and methylation status in the NPSR1 promoter. DNA methylation was analysed using EpiTYPER in blood samples from two well-characterized cohorts; the BIOAIR study of severe asthma in adults and the Swedish birth cohort BAMSE. We observed that DNA methylation and genetic variants in the promoter influenced the binding of nuclear proteins to DNA, suggesting functional relevance. Significant, although small, differences in methylation were related to both adult severe asthma (p = 0.0001) and childhood allergic asthma (p = 0.01). Furthermore, DNA methylation was associated with exposures such as current smoking in adults for two CpG sites (p = 0.005 and 0.04), parental smoking during infancy in the children (p = 0.02) and in which month the sample was taken (p = 0.01). In summary, DNA methylation levels in the promoter of NPSR1 showed small but significant associations with asthma, both in adults and in children, and to related traits such as allergy and certain environmental exposures. Both genetic variation and the methylated state of CpG sites seem to have an effect on the binding of nuclear proteins in the regulatory region of NPSR1 suggesting complex regulation of this gene in asthma and allergy. PMID:23372674

  3. DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel

    PubMed Central

    2013-01-01

    A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements. PMID:23414121

  4. Retrotransposon-microsatellite amplified polymorphism, an electrophoretic approach for studying genetic variability among Schistosoma japonicum geographical isolates.

    PubMed

    Li, Juan; Zhao, Guang-Hui; Zhou, Dong-Hui; Sugiyama, Hiromu; Nisbet, Alasdair J; Li, Xiao-Yan; Zou, Feng-Cai; Li, Hai-Long; Ai, Lin; Zhu, Xing-Quan

    2012-09-01

    In the present study, retrotransposon-microsatellite amplified polymorphism (REMAP) was used to examine genetic variability among Schistosoma japonicum isolates from different endemic provinces in mainland China, using S. japonicum from Japan and the Philippines for comparison. Of the 50 primer combinations screened, eight produced highly reproducible REMAP fragments. Using these primers, 190 distinct DNA fragments were generated in total, of which 147 (77.37%) were polymorphic, indicating considerable genetic variation among the 43 S. japonicum isolates examined. The percentage of polymorphic bands (PPB) among S. japonicum isolates from mainland China, Japan, and the Philippines was 77.37%; PPB values of 18.42% and 53.68% were found among isolates from southwestern (SW) China and the lower Yangtze/Zhejiang province in eastern (E) China, respectively. Based on REMAP profiles, unweighted pair-group method with arithmetic averages (UPGMA) dendrogram analysis revealed that all of the S. japonicum samples grouped into three distinct clusters: parasites from mainland China, Japan, and the Philippines were clustered in each individual clade. Within the mainland China cluster, SW China isolates (from Sichuan and Yunnan provinces) grouped together, whereas worms from E China (Zhejiang, Anhui, Jiangxi, Jiangsu, Hunan, and Hubei provinces) grouped together. These results demonstrated that the REMAP marker system provides a reliable electrophoretic technique for studying genetic diversity and population structures of S. japonicum isolates from mainland China, and could be applied to other pathogens of human and animal health significance. PMID:23019103

  5. Congenital dyserythropoiesis and progressive alopecia in Polled Hereford calves: hematologic, biochemical, bone marrow cytologic, electrophoretic, and flow cytometric findings.

    PubMed

    Steffen, D J; Elliott, G S; Leipold, H W; Smith, J E

    1992-01-01

    Congenital dyserythropoiesis with dyskeratosis is a slow, progressive, and often fatal disease in Polled Hereford calves. Affected calves have a macrocytic normochromic anemia with a mild reticulocytosis. Studies indicate that calves are hyperferremic with increased saturation of serum total iron binding capacity, which rules out iron deficiency as a cause. Other secondary causes of dyserythropoiesis, including cobalamin and folate deficiencies, are unlikely because serum cobalamin and folate levels of affected calves were normal. Virus isolation was negative, and failure to identify bovine retroviral antigens or antibodies from several calves suggested that viral agents were not involved. Bone marrow cytologic findings were similar to those in congenital hereditary dyserythropoiesis in humans and included occasional multinucleate cells, internuclear chromatin bridging between nuclei of partially divided cells, and, more frequently, irregular nuclear shapes and chromatin patterns. DNA content and cell cycle distribution of erythroid cells appeared normal, and no electrophoretic abnormalities were detected in erythrocyte membrane proteins. The Polled Hereford syndrome is similar in many ways to type I congenital dyserythropoiesis in humans and may be an appropriate biomedical model for studying erythroid proliferation during dyserythropoiesis. PMID:1348189

  6. Electrophoretic Particle Guidance Significantly Enhances Olfactory Drug Delivery: A Feasibility Study

    PubMed Central

    Xi, Jinxiang; Si, Xiuhua A.; Gaide, Rachel

    2014-01-01

    Background Intranasal olfactory drug delivery provides a non-invasive method that bypasses the Blood-Brain-Barrier and directly delivers medication to the brain and spinal cord. However, a device designed specifically for olfactory delivery has not yet been found. Methods In this study, a new delivery method was proposed that utilized electrophoretic forces to guide drug particles to the olfactory region. The feasibility of this method was numerically evaluated in both idealized 2-D and anatomically accurate 3-D nose models. The influence of nasal airflow, electrode strength, and drug release position were also studied on the olfactory delivery efficiency. Findings Results showed that by applying electrophoretic forces, the dosage to the olfactory region was significantly enhanced. In both 2-D and 3-D cases, electrophoretic-guided delivery achieved olfactory dosages nearly two orders of magnitude higher than that without electrophoretic forces. Furthermore, releasing drugs into the upper half of the nostril (i.e., partial release) led to olfactory dosages two times higher than releasing drugs over the entire area of the nostril. By combining the advantages of pointed drug release and appropriate electrophoretic guidance, olfactory dosages of more than 90% were observed as compared to the extremely low olfactory dosage (<1%) with conventional inhaler devices. Conclusion Results of this study have important implications in developing personalized olfactory delivery protocols for the treatment of neurological disorders. Moreover, a high sensitivity of olfactory dosage was observed in relation to different pointed release positions, indicating the importance of precise particle guidance for effective olfactory delivery. PMID:24497957

  7. Nanolaminate microfluidic device for mobility selection of particles

    SciTech Connect

    Surh, Michael P.; Wilson, William D.; Barbee, Jr., Troy W.; Lane, Stephen M.

    2006-10-10

    A microfluidic device made from nanolaminate materials that are capable of electrophoretic selection of particles on the basis of their mobility. Nanolaminate materials are generally alternating layers of two materials (one conducting, one insulating) that are made by sputter coating a flat substrate with a large number of layers. Specific subsets of the conducting layers are coupled together to form a single, extended electrode, interleaved with other similar electrodes. Thereby, the subsets of conducting layers may be dynamically charged to create time-dependent potential fields that can trap or transport charge colloidal particles. The addition of time-dependence is applicable to all geometries of nanolaminate electrophoretic and electrochemical designs from sinusoidal to nearly step-like.

  8. Structural basis for discriminatory recognition of Plasmodium lactate dehydrogenase by a DNA aptamer

    PubMed Central

    Cheung, Yee-Wai; Kwok, Jane; Law, Alan W. L.; Watt, Rory M.; Kotaka, Masayo; Tanner, Julian A.

    2013-01-01

    DNA aptamers have significant potential as diagnostic and therapeutic agents, but the paucity of DNA aptamer-target structures limits understanding of their molecular binding mechanisms. Here, we report a distorted hairpin structure of a DNA aptamer in complex with an important diagnostic target for malaria: Plasmodium falciparum lactate dehydrogenase (PfLDH). Aptamers selected from a DNA library were highly specific and discriminatory for Plasmodium as opposed to human lactate dehydrogenase because of a counterselection strategy used during selection. Isothermal titration calorimetry revealed aptamer binding to PfLDH with a dissociation constant of 42 nM and 2:1 protein:aptamer molar stoichiometry. Dissociation constants derived from electrophoretic mobility shift assays and surface plasmon resonance experiments were consistent. The aptamer:protein complex crystal structure was solved at 2.1-Å resolution, revealing two aptamers bind per PfLDH tetramer. The aptamers showed a unique distorted hairpin structure in complex with PfLDH, displaying a Watson–Crick base-paired stem together with two distinct loops each with one base flipped out by specific interactions with PfLDH. Aptamer binding specificity is dictated by extensive interactions of one of the aptamer loops with a PfLDH loop that is absent in human lactate dehydrogenase. We conjugated the aptamer to gold nanoparticles and demonstrated specificity of colorimetric detection of PfLDH over human lactate dehydrogenase. This unique distorted hairpin aptamer complex provides a perspective on aptamer-mediated molecular recognition and may guide rational design of better aptamers for malaria diagnostics. PMID:24043813

  9. Preliminary study on the DNA-binding properties of phage ΦC31 integrase.

    PubMed

    Li, Zhihui; Fang, Yuxiang; Wang, Rencheng; Xue, Jinglun; Chen, Jinzhong

    2011-09-15

    ΦC31 integrase is a member of the large serine subfamily and is required for the recombination of the phage genome into the host chromosome, either to establish or exit from the lysogenic state. This enzyme can also mediate site-specific integration in mammalian cells in a cofactor-independent manner and has been considered as a potentially powerful tool for gene therapy. It has previously been reported that DAXX interacts with ΦC31 integrase and markedly inhibits its integration efficiency, and the 451RFGK454 tetramer of ΦC31 integrase has been identified as the interacting motif. Here, we report that both the deletion of the tetramer or the replacement of Arg with His greatly reduced the recombination activity of the ΦC31 integrase. Electrophoretic mobility shift assays further demonstrated that the DNA-binding ability and binding specificity of the two mutants were dramatically reduced. Bioinformatic analysis indicated a probable helix-turn-helix-like DNA-binding motif between residues 415-525, a region that contains the tetramer motif. However, neither truncated Int(415-525) nor Int(△415-525) alone could bind to the attB target sequence. Results of a circular dichroism spectroscopy assay indicated that Int(415-525) did not fold correctly into a helix-turn-helix-like structure, which may be one of the reasons for its lack of DNA-binding ability. Thus, the identification and confirmation of four key amino acids in the DNA-binding specificity and recombination activity of ΦC31 integrase provide information about the domain structure and function of the large C-terminal region and suggest important implications for the more efficient use of integrase in gene transfer and gene therapy. PMID:21679753

  10. Development of immunoblotting techniques for DNA radical detection

    PubMed Central

    Summers, Fiona A.; Mason, Ronald P.; Ehrenshaft, Marilyn

    2012-01-01

    Radical damage to DNA has been implicated in cell death, cellular dysfunction and cancer. A recently developed method for detecting DNA radicals uses the nitrone spin trap DMPO (5,5-dimethyl-1-pyrroline N-oxide) to trap radicals. The trapped radicals then decay into stable nitrone adducts detectable with anti-DMPO antibodies and quantifiable by ELISA or dot blot assays. However, the sequences of DNA that are damaged are likely to be as important as the total level of damage. Therefore, we have developed immunoblotting methods for detection of DNA nitrone adducts on electrophoretically separated DNA, comparable to Western blotting for proteins. These new techniques not only allow the assessment of relative radical adduct levels, but can reveal specific DNA fragments, and ultimately nucleotides, as radical targets. Moreover, we have determined that denaturation of samples into single-stranded DNA enhances the detection of DNA-DMPO adducts in our new blotting methods and also ELISA assays. PMID:23142572

  11. The transcription factors ATF-1 and CREB-1 bind constitutively to the hypoxia-inducible factor-1 (HIF-1) DNA recognition site.

    PubMed

    Kvietikova, I; Wenger, R H; Marti, H H; Gassmann, M

    1995-11-25

    The hypoxia-inducible factor-1 (HIF-1) was first described as a DNA binding activity that specifically recognizes an 8 bp motif known to be essential for hypoxia-inducible erythropoietin gene transcription. Subsequently HIF-1 activity has also been found in cell lines which do not express erythropoietin, suggesting that HIF-1 is part of a widespread oxygen sensing mechanism. In electrophoretic mobility shift assays HIF-1 DNA binding activity is only detectable in nuclear extracts of cells cultivated in a low oxygen atmosphere. In addition to HIF-1, a constitutive DNA binding activity also specifically binds the HIF1 probe. Here we report that CRE and AP1 oligonucleotides efficiently competed for binding of the HIF1 probe to this constitutive factor, whereas HIF-1 activity itself remained unaffected. Monoclonal antibodies raised against the CRE binding factors ATF-1 and CREB-1 supershifted the constitutive factors ATF-1 and CREB-1 supershifted the constitutive factor, while Jun and Fos family members, which constitute the AP-1 factor, were immunologically undetectable. Recombinant ATF-1 and CREB-1 proteins bound HIF1 probes either as homodimers or as heterodimers, indicating a new binding specificity for ATF-1/CREB-1. Finally, reporter gene assays in HeLa cells treated with either a cAMP analogue or a phorbol ester suggest that the PKA, but not the PKC signalling pathway is involved in oxygen sensing. PMID:8524640

  12. S phase-specific DNA-binding proteins interacting with the Hex and Oct motifs in type I element of the wheat histone H3 promoter.

    PubMed

    Minami, M; Meshi, T; Iwabuchi, M

    2000-01-11

    The type I element (CCACGTCANCGATCCGCG), consisting of the Hex motif (CCACGTCA) and the reverse-oriented Oct motif (GATCCGCG), is necessary and sufficient to confer the S phase-specific transcription of the wheat histone H3 (TH012) gene. The transcriptional regulation via the type I element is thought to occur through interactions between transcription factors which bind specifically to the Hex and Oct motifs. Here we report S phase-specific DNA-binding proteins interacting with the type I element in partially synchronized wheat cultured cells. Hex motif-binding proteins found here resembled HBP-1a, as reported previously in terms of DNA-binding specificity. DNA-binding activities of the HBP-1a-like proteins were modulated by phosphorylation/dephosphorylation. In the electrophoretic mobility shift assay of the wheat nuclear extract, we also found three Oct motif-specific binding proteins, named OBRF (octamer-binding regulatory factor)-1, -2 and -3. One of the HBP-1a-like proteins and OBRF-1 appeared predominantly at the S phase. Thus, it was supposed that these two factors play a crucial role in the S phase-specific regulation of wheat histone gene expression. PMID:10675046

  13. The transcription factors ATF-1 and CREB-1 bind constitutively to the hypoxia-inducible factor-1 (HIF-1) DNA recognition site.

    PubMed Central

    Kvietikova, I; Wenger, R H; Marti, H H; Gassmann, M

    1995-01-01

    The hypoxia-inducible factor-1 (HIF-1) was first described as a DNA binding activity that specifically recognizes an 8 bp motif known to be essential for hypoxia-inducible erythropoietin gene transcription. Subsequently HIF-1 activity has also been found in cell lines which do not express erythropoietin, suggesting that HIF-1 is part of a widespread oxygen sensing mechanism. In electrophoretic mobility shift assays HIF-1 DNA binding activity is only detectable in nuclear extracts of cells cultivated in a low oxygen atmosphere. In addition to HIF-1, a constitutive DNA binding activity also specifically binds the HIF1 probe. Here we report that CRE and AP1 oligonucleotides efficiently competed for binding of the HIF1 probe to this constitutive factor, whereas HIF-1 activity itself remained unaffected. Monoclonal antibodies raised against the CRE binding factors ATF-1 and CREB-1 supershifted the constitutive factors ATF-1 and CREB-1 supershifted the constitutive factor, while Jun and Fos family members, which constitute the AP-1 factor, were immunologically undetectable. Recombinant ATF-1 and CREB-1 proteins bound HIF1 probes either as homodimers or as heterodimers, indicating a new binding specificity for ATF-1/CREB-1. Finally, reporter gene assays in HeLa cells treated with either a cAMP analogue or a phorbol ester suggest that the PKA, but not the PKC signalling pathway is involved in oxygen sensing. Images PMID:8524640

  14. Adjusting the DNA Interaction and Anticancer Activity of Pt(II) N-Heterocyclic Carbene Complexes by Steric Shielding of the Trans Leaving Group.

    PubMed

    Muenzner, Julienne K; Rehm, Tobias; Biersack, Bernhard; Casini, Angela; de Graaf, Inge A M; Worawutputtapong, Pawida; Noor, Awal; Kempe, Rhett; Brabec, Viktor; Kasparkova, Jana; Schobert, Rainer

    2015-08-13

    Five platinum(II) complexes bearing a (1,3-dibenzyl)imidazol-2-ylidene ligand but different leaving groups trans to it were examined for cytotoxicity, DNA and cell cycle interference, vascular disrupting properties, and nephrotoxicity. The cytotoxicity of complexes 3a-c increased with the steric shielding of their leaving chloride ligand, and complex 3c, featuring two triphenylphosphanes, was the most efficacious, with submicromolar IC50 concentrations. Complexes 3a-c interacted with DNA in electrophoretic mobility shift and ethidium bromide binding assays. The cationic complex 3c did not bind coordinatively to DNA but led to its aggregation, damage that is not amenable to the usual repair mechanisms. Accordingly, it arrested the cell cycle of melanoma cells in G1 phase, whereas cis-dichlorido[(1,3-dibenzyl)imidazol-2-ylidene](dimethyl sulfoxide) platinum(II) 3a induced G2/M phase arrest. Complex 3c also disrupted the blood vessels in the chorioallantoic membrane of fertilized chicken eggs. Ex vivo studies using precision-cut tissue slices suggested the nephrotoxicities of 3a-c to be clinically manageable. PMID:26182125

  15. Electrophoretic analysis of proteins from single bovine muscle fibres.

    PubMed Central

    Young, O A; Davey, C L

    1981-01-01

    A number of single fibres were isolated by dissection of four bovine masseter (ma) muscles, three rectus abdominis (ra) muscles and eight sternomandibularis (sm) muscles. By histochemical criteria these muscles contain respectively, solely slow fibres (often called type I), predominantly fast fibres (type II), and a mixture of fast and slow. The fibres were analysed by conventional sodium dodecyl sulphate/polyacrylamide-gel electrophoresis and the gels stained with Coomassie Blue. Irrespective of the muscle, every fibre could be classed into one of two broad groups based on the mobility of proteins in the range 135000-170000 daltons. When zones containing myosin heavy chain were cut from the single-fibre gel tracks and 'mapped' [Cleveland, Fischer, Kirschner & Laemmli (1977) J. Biol. Chem. 252, 1102-1106] with Staphylococcus proteinase, it was found that one group always contained fast myosin heavy chain, whereas the second group always contained the slow form. Moreover, a relatively fast-migrating alpha-tropomyosin was associated with the fast myosin group and a slow-migrating form with the slow myosin group. All fibres also contained beta-tropomyosin; the coexistence of alpha- and beta-tropomyosin is at variance with evidence that alpha-tropomyosin is restricted to fast fibres [Dhoot & Perry (1979) Nature (London) 278, 714-718]. Fast fibres containing the expected fast light chains and troponins I and C fast were identified in the three ra muscles, but in only four sm muscles. In three other sm muscles, all the fast fibres contained two troponins I and an additional myosin light chain that was more typical of myosin light chain 1 slow. The remaining sm muscle contained a fast fibre type that was similar to the first type, except that its myosin light chain 1 was more typical of the slow polymorph. Troponin T was bimorphic in all fast fibres from a ra muscles and in at least some fast fibres from one sm muscle. Peptide 'mapping' revealed two forms of fast myosin

  16. Nuclear receptors modulate the interaction of Sp1 and GC-rich DNA via ternary complex formation.

    PubMed Central

    Husmann, M; Dragneva, Y; Romahn, E; Jehnichen, P

    2000-01-01

    Binding sites for transcription factor Sp1 have been implicated in the transcriptional regulation of several genes by hormones or vitamins, and here we show that a GC-rich element contributes to the retinoic acid response of the interleukin 1beta promoter. To explain such observations, it has been proposed that nuclear receptors can interact with Sp1 bound to GC-rich DNA. However, evidence supporting this model has remained indirect. So far, nuclear receptors have not been detected in a complex with Sp1 and GC-rich DNA, and the expected ternary complexes in non-denaturing gels were not seen. In search for these missing links we found that nuclear receptors [retinoic acid receptor (RAR), thyroid hormone receptor (TR), vitamin D(3) receptor, peroxisome-proliferator-activated receptor and retinoic X receptor] induce an electrophoretic mobility increase of Sp1-GC-rich DNA complexes. Concomitantly, binding of Sp1 to the GC-box is enhanced. It is proposed that nuclear receptors may partially replace Sp1 in homo-oligomers at the GC-box. RARs and Sp1 can also combine into a complex with a retinoic acid-response element. The presence of RAR and Sp1 in complexes with either cognate site was revealed in supershift experiments. The C-terminus of Sp1 interacts with nuclear receptors. Both the ligand- and DNA-binding domains of the receptor are important for complex formation with Sp1 and GC-rich DNA. In spite of similar capacity to form ternary complexes, RAR but not TR up-regulated an Sp1-driven reporter in a ligand-dependent way. Thus additional factors limit the transcriptional response mediated by nuclear receptors and Sp1. PMID:11104684

  17. DNA polymorphisms and mutations of the tumor necrosis factor-alpha (TNF-alpha) promoter in Langerhans cell histiocytosis (LCH).

    PubMed

    Wu, W S; McClain, K L

    1997-10-01

    Langerhans cell histiocytosis (LCH) is a clonal proliferation of dendritic histiocytes expressing elevated levels of tumor necrosis factor-alpha (TNF-alpha), interferon-gamma (IFN-gamma) granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-1 (IL-1), and leukemia inhibitory factor (LIF). The cause of the increased cytokine levels is unknown, but DNA sequence changes in promoters could alter expression. The TNF-alpha and IFN-gamma promoter DNA sequences of 12 LCH patients were studied and compared with normal individuals by dideoxy fingerprinting and DNA sequencing. Functional consequences of polymorphic or mutated sequences were assessed by cloning altered and control promoter sequences into a luciferase reporter gene vector. Electrophoretic mobility shifts (EMSA) after binding of nuclear extracts from a macrophage cell line (U-937) by mutated promoters were compared with controls. Five of 12 LCH patients had alterations in the TNF-alpha promoter DNA sequence. None were found in the IFN-gamma gene promoter. Of the 5 with TNF-alpha DNA alterations, 2 were at position -308, which has been described as a G-A polymorphism associated with upregulation of TNF-alpha in some patients with infections or immune-mediated diseases. The polymorphism at -308 but not the other TNF-alpha promoter mutations caused a 3-fold to 7-fold increased production of the luciferase reporter gene. EMSA showed that the -308 mutant promoters bound fewer nuclear proteins than normals. Polymorphisms of the TNF-alpha promoter in LCH patients could increase the production of that cytokine. PMID:9355965

  18. Electric field-induced lateral mobility of photosystem I in the photosynthetic membrane: A study by electrophotoluminescence.

    PubMed

    Brumfeld, V; Miller, I R; Korenstein, R

    1989-09-01

    Electrophoretic movement of photosystem I (PS I) along the photosynthetic membrane of hypotonically swollen thylakoid vesicles was studied by analyzing the electric field-stimulated delayed luminescence (electrophotoluminescence) emitted from PS I. The electrophoretic mobility was inferred from the differences in electrophotoluminescence (EPL) of the photosynthetic vesicles in presence and absence of trains of low amplitude (<80 V/cm) prepulses of 1 ms duration at 4 ms spacing. The average apparent electric mobility, determined from the time course of EPL increase on one hemisphere or its decrease on the other one, as function of prepulse length and intensity was of the order of 3 . 10(-5) cm(2)V(-1)s(-1). The assymetric distribution of the PS I reached a steady state when the diffusional, electrostatic, and elastic forces balanced the electrophoretic driving force. A lateral diffusion coefficient of approximately 5 . 10(-9) cm(2)s(-1) was found for the PS I complex from the diffusional relaxation after cessation of the electric field pulse train. Experimental conditions such as concentration, temperature, and viscosity of the aqueous solution were not critical for the effect. Between 23 and 150 electron charges per moving particle were estimated from the measured electrophoretic mobility. PMID:19431746

  19. C-terminal extension of calmodulin-like 3 protein from Oryza sativa L.: interaction with a high mobility group target protein.

    PubMed

    Chinpongpanich, Aumnart; Phean-O-Pas, Srivilai; Thongchuang, Mayura; Qu, Li-Jia; Buaboocha, Teerapong

    2015-11-01

    A large number of calmodulin-like (CML) proteins are present in plants, but there is little detailed information on the functions of these proteins in rice (Oryza sativa L.). Here, the CML3 protein from rice (OsCML3) and its truncated form lacking the C-terminal extension (OsCML3m) were found to exhibit a Ca2+-binding property and subsequent conformational change, but the ability to bind the CaM kinase II peptide was only observed for OsCML3m. Changes in their secondary structure upon Ca2+-binding measured by circular dichroism revealed that OsCML3m had a higher helical content than OsCML3. Moreover, OsCML3 was mainly localized in the plasma membrane, whereas OsCML3m was found in the nucleus. The rice high mobility group B1 (OsHMGB1) protein was identified as one of the putative OsCML3 target proteins. Bimolecular fluorescence complementation analysis revealed that OsHMGB1 bound OsCML3, OsCML3m or OsCML3s (cysteine to serine mutation at the prenylation site) in the nucleus presumably through the methionine and phenylalanine-rich hydrophobic patches, confirming that OsHMGB1 is a target protein in planta. The effect of OsCML3 or OsCML3m on the DNA-binding ability of OsHMGB1 was measured using an electrophoretic mobility shift assay. OsCML3m decreased the level of OsHMGB1 binding to pUC19 double-stranded DNA whereas OsCML3 did not. Taken together, OsCML3 probably provides a mechanism for manipulating the DNA-binding ability of OsHMGB1 in the nucleus and its C-terminal extension provides an intracellular Ca2+ regulatory switch. PMID:26423116

  20. Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

    SciTech Connect

    Verebová, Valéria; Adamcik, Jozef; Danko, Patrik; Podhradský, Dušan; Miškovský, Pavol; Staničová, Jana

    2014-01-31

    Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.

  1. Stabilization of green bodies via sacrificial gelling agent during electrophoretic deposition

    DOEpatents

    Worsley, Marcus A.; Kuntz, Joshua D.; Rose, Klint A.

    2016-03-22

    In one embodiment, a method for electrophoretic deposition of a three-dimensionally patterned green body includes suspending a first material in a gelling agent above a patterned electrode of an electrophoretic deposition (EPD) chamber, and gelling the suspension while applying a first electric field to the suspension to cause desired patterning of the first material in a resulting gelation. In another embodiment, a ceramic, metal, or cermet includes a plurality of layers, wherein each layer includes a gradient in composition, microstructure, and/or density in an x-y plane oriented parallel to a plane of deposition of the plurality of layers along a predetermined distance in a z-direction perpendicular to the plane of deposition.

  2. Fabrication of nanoelectrodes for neurophysiology: cathodic electrophoretic paint insulation and focused ion beam milling

    PubMed Central

    Qiao, Yi; Chen, Jie; Guo, Xiaoli; Cantrell, Donald; Ruoff, Rodney; Troy, John

    2005-01-01

    The fabrication and characterization of tungsten nanoelectrodes insulated with cathodic electrophoretic paint is described together with their application within the field of neurophysiology. The tip of a 127 μm diameter tungsten wire was etched down to less than 100 nm and then insulated with cathodic electrophoretic paint. Focused ion beam (FIB) polishing was employed to remove the insulation at the electrode’s apex, leaving a nanoscale sized conductive tip of 100–1000 nm. The nanoelectrodes were examined by scanning electron microscopy (SEM) and their electrochemical properties characterized by steady state linear sweep voltammetry. Electrode impedance at 1 kHz was measured too. The ability of a 700 nm tipped electrode to record well-isolated action potentials extracellularly from single visual neurons in vivo was demonstrated. Such electrodes have the potential to open new populations of neurons to study. PMID:16467926

  3. Amaranth seed proteins: effect of defatting on extraction yield and on electrophoretic patterns.

    PubMed

    Leyva-Lopez, N E; Vasco, N; Barba de la Rosa, A P; Paredes-Lopez, O

    1995-01-01

    Acetone and hexane were used to know the effect of defatting amaranth flour on the extraction yield of protein fractions and on the electrophoretic patterns. It was found that albumins (33%) and globulins (20%) did not present yield changes when using these two solvents, but it was noted that with hexane compared to acetone, prolamins extraction was reduced by half (3.0 to 1.6%) whereas glutelins increased from 26.5 to 30%. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) patterns of prolamins extracted with acetone and hexane showed one band of low molecular weight (22 KDa) and five bands between 52 to 22 KDa, respectively. No electrophoretic changes were observed in the remaining fractions. PMID:7784397

  4. Frequency of private electrophoretic variants and indirect estimates of mutation rate in Papua New Guinea.

    PubMed Central

    Bhatia, K K; Blake, N M; Serjeantson, S W; Kirk, R L

    1981-01-01

    Data on rare and private electrophoretic variants have been used to estimate mutation rates for populations belonging to 55 language groups in Papua New Guinea. Three different methods yield values of 1.42 x 10(-6), 1.40 x 10(-6), and 5.58 x 10(-6)/locus per generation. The estimates for three islands populations off the north coast of New Guinea--Manus, Karkar, and Siassi--are much lower. The variability in mutation rates estimated from rare electrophoretic variants as a function of population size is discussed. The mean mutation rate in Papua New Guinea is less than half the estimates obtained for Australian Aborigines and Amerindians. PMID:7468589

  5. Fabrication of nanoelectrodes for neurophysiology: cathodic electrophoretic paint insulation and focused ion beam milling

    NASA Astrophysics Data System (ADS)

    Qiao, Yi; Chen, Jie; Guo, Xiaoli; Cantrell, Donald; Ruoff, Rodney; Troy, John

    2005-09-01

    The fabrication and characterization of tungsten nanoelectrodes insulated with cathodic electrophoretic paint is described together with their application within the field of neurophysiology. The tip of a 127 µm diameter tungsten wire was etched down to less than 100 nm and then insulated with cathodic electrophoretic paint. Focused ion beam (FIB) polishing was employed to remove the insulation at the electrode's apex, leaving a nanoscale sized conductive tip of 100-1000 nm. The nanoelectrodes were examined by scanning electron microscopy (SEM) and their electrochemical properties characterized by steady state linear sweep voltammetry. Electrode impedance at 1 kHz was measured too. The ability of a 700 nm tipped electrode to record well-isolated action potentials extracellularly from single visual neurons in vivo was demonstrated. Such electrodes have the potential to open new populations of neurons to study.

  6. Electrophoretic deposition and mechanistic studies of nano-Al/CuO thermites

    NASA Astrophysics Data System (ADS)

    Sullivan, K. T.; Kuntz, J. D.; Gash, A. E.

    2012-07-01

    Electrophoretic deposition was used to deposit thin films (˜10-200 μm) of nano-aluminum/copper oxide thermites, with a density of 29% the theoretical maximum. The reaction propagation velocity was examined using fine-patterned electrodes (0.25 × 20 mm), and the optimum velocity was found to correspond to a fuel-rich equivalence ratio of 1.7. This value did not correlate with the calculated maximum in gas production or temperature, and it is suggested that it is a result of enhanced condensed-phase transport, which is speculated to increase for fuel-rich conditions. A ˜25% drop in propagation velocity occurred above an equivalence ratio of 2.0, where Al2O3 is predicted to undergo a phase change from liquid to solid. This is expected to hinder the kinetics by decreasing the mobility of condensed-phase reacting species. The effect of film thickness on propagation velocity was investigated, using the optimum equivalence ratio. The velocity was seen to exhibit a two-plateau behavior, with one plateau between 13 and 50 μm film thickness, and the other above ˜120 μm. The latter had nearly an order of magnitude faster velocity than the former, 36 m/s vs. 4 m/s, respectively. For film thicknesses in the 50-120 μm range, a linear transitional regime was observed. Images from the combustion studies showed an increase in forward-transported particles as the film thickness increased, along with more turbulent behavior of the flame. It was suggested that the two-plateau behavior indicated a shift in the energy transport mechanism. While nanocomposite thermites have been traditionally thought to exhibit convective energy transport, we find in this work that particle advection may also be important. The velocity of particles ejected through a thin slit mounted above a thermite strip was measured, and was found to be even faster (˜2-3×) than the flame propagation velocity. The morphology of captured particles was examined with an electron microscope, and indicated that

  7. Summary electrophoretic data base on human embryonic kidney cell strain 8514

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Arquiza, M. V.; Morrison, D. R.; Todd, P. W.

    1985-01-01

    To properly plan the electrophoresis equipment verification test (EEVT) and continuous flow electrophoresis system (CFES) experiments with human embryonic kidney cells, first a candidate cell lot had to be chosen on the basis of electrophoretic heterogeneity, growth potential, cytogenetics, and urokinase production. Cell lot 8514 from MA Bioproducts, Inc. was chosen for this purpose, and several essential analytical electrophoresis experiments were performed to test its final suitability for these experiments.

  8. Theory of electrophoretic separations. II - Construction of a numerical simulation scheme and its applications

    NASA Technical Reports Server (NTRS)

    Palusinski, O. A.; Graham, A.; Mosher, R. A.; Bier, M.; Saville, D. A.

    1986-01-01

    The implementation of a previously derived model describing electrophoretic transport processes is reformulated, and its usefulness is demonstrated by simulating moving boundary electrophoresis and isoelectric focusing with immobilized species. The resulting solution is stable, evolves smoothly when suitable small step sizes are used, and has a loosely defined convergence as the step sizes are made smaller. The major computational problem involves a need to use small spatial step sizes at high current levels.

  9. Investigation of the free flow electrophoretic process. Volume 1: Executive summary

    NASA Technical Reports Server (NTRS)

    Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.

    1979-01-01

    The effect of gravity on the free flow electrophoretic process was investigated. The demonstrated effects were then compared with predictions made by mathematical models. Results show that the carrier buffer flow was affected by gravity induced thermal convection and that the movement of the separating particle streams was affected by gravity induced buoyant forces. It was determined that if gravity induced buoyant forces were included in the mathematical models, then effective predictions of electrophoresis chamber separation performance were possible.

  10. Differential electrophoretic separation of cells and its effect on cell viability

    NASA Technical Reports Server (NTRS)

    Leise, E. M.; Lesane, F.

    1974-01-01

    An electrophoretic separation method was applied to the separation of cells. To determine the efficiency of the separation, it was necessary to apply existing methodology and develop new methods to assess the characteristics and functions of the separated subpopulations. Through appropriate application of the widely used isoelectric focusing procedure, a reproducible separation method was developed. Cells accumulated at defined pH and 70-80% remained viable. The cells were suitable for further biologic, biochemical and immunologic studies.

  11. Electrophoretic display technologies for e-book readers: system integration aspects

    NASA Astrophysics Data System (ADS)

    Gentric, Philippe

    2011-03-01

    Emerging screen technologies, such as Electrophoretic Displays (EPD) used in E-book Readers, are changing product power requirements due to their advantageous properties such as bi-stability (effective "zero power" static display) and reflective mode of operation (no backlight). We will first review the emerging screen technologies under the angle of system and IC design impact. We will explain power management consequences for IC design, with a focus on Application Engine SOCs for the wireless/portable markets.

  12. Bimodality in the dodecylpyridinium bromide-sodium dextran sulfate system as observed by an electrophoretic method

    SciTech Connect

    Shirahama, Keishiro; Kameyama, Keiichi; Takagi, Toshio

    1992-08-06

    This paper discusses how a DDPB-SDS binding isotherm was analyzed using an electrophoretic method to reveal evidence in support of Hill`s theory predicting that two species are observed when ligands are bound highly cooperatively to a polymer which could accommodate a small number of binding sites to the ligand -- {open_quotes}bimodality in a small system{close_quotes}. 16 refs., 7 figs.

  13. A high-mobility group box 1 that binds to DNA, enhances pro-inflammatory activity, and acts as an anti-infection molecule in black rockfish, Sebastes schlegelii.

    PubMed

    Xin-Peng, Zhao; Yong-Hua, Hu; Yong, Liu; Jing-Jing, Wang; Guang-Hua, Wang; Ren-Jie, Wang; Min, Zhang

    2016-09-01

    High-mobility group box (HMGB) 1 is a chromosomal protein that plays critical roles in DNA transcription, replication and repair. In addition, HMGB1 functions as a pro-inflammatory molecule in many vertebrates and invertebrates. In teleosts, very limited studies of HMGB1 have been reported. In this study, we identified a HMGB1 homologue (SsHMGB1) from black rockfish (Sebastes schlegelii) and analyzed its structure, expression and biological function. The open reading frame of SsHMGB1 is 621 bp, with a 5'-untranslated region (UTR) of 62 bp and a 3'-UTR of 645 bp. SsHMGB1 contains two typical HMG boxes and an acidic C-terminal tail. The deduced amino acid sequence of SsHMGB1 shares the highest overall identity (89.4%) with the HMGB1 of Anoplopoma fimbria. The expression of SsHMGB1 occurred in multiple tissues and was highest in the brain. Moreover, the mRNA level of SsHMGB1 in head kidney (HK) macrophages could be induced by Listonella anguillarum in a time-dependent manner. Recombinant SsHMGB1 purified from Escherichia coli (i) bound DNA fragments in a dose-dependent manner; and (ii) induced the expression of cytokines in HK macrophages, including a significant increase in TNF-α activity and enhanced mRNA level of TNF13B and IL-1 β, which are known to be involved in antibacterial defense; moreover, (iii) significantly improved the macrophage bactericidal activity together with reduced pathogen dissemination and replication of bacteria in fish kidney. These results indicated that SsHMGB1 is a novel HMGB1 that possesses apparent immunoregulatory properties and is likely to be involved in fighting bacterial infection. PMID:27492120

  14. Particle sizer and DNA sequencer

    DOEpatents

    Olivares, Jose A.; Stark, Peter C.

    2005-09-13

    An electrophoretic device separates and detects particles such as DNA fragments, proteins, and the like. The device has a capillary which is coated with a coating with a low refractive index such as Teflon.RTM. AF. A sample of particles is fluorescently labeled and injected into the capillary. The capillary is filled with an electrolyte buffer solution. An electrical field is applied across the capillary causing the particles to migrate from a first end of the capillary to a second end of the capillary. A detector light beam is then scanned along the length of the capillary to detect the location of the separated particles. The device is amenable to a high throughput system by providing additional capillaries. The device can also be used to determine the actual size of the particles and for DNA sequencing.

  15. Determination of the Median Lethal Dose and Electrophoretic Pattern of Hottentotta saulcyi (Scorpiones, Buthidae) Scorpion Venom

    PubMed Central

    Yağmur, Ersen Aydın; Özkan, Özcan; Karaer, K Zafer

    2015-01-01

    Background: In this study, we investigated the lethal potency, electrophoretic protein pattern and in vivo effects of Hottentotta saulcyi scorpion venom in mice. Methods: Scorpions were collected at night, by using a UV lamp from Mardin Province, Turkey. Venom was obtained from mature H. saulcyi scorpions by electrical stimulation of the telson. The lethality of the venom was determined by i.v. injections using Swiss mice. In vivo effects of the venom were assessed by using the intraperitoneal route (ip) injections into mice (20±1g) and monitored for 24 h. The protein profiles of the scorpion venom were analyzed by NuPAGE® Novex® 4–12 % gradient Bis-Tris gel followed by Coomassie blue staining. Results: The lethal assay of the venom was 0.73 mg/kg in mice. We determined the electrophoretic protein pattern of this scorpion venom to be 4, 6, 9, 31, 35, 40, 46 and 69 kDa by SDS-PAGE. Analysis of electrophoresis indicated that H. saulcyi scorpion intoxicated mice exhibited autonomic nervous system symptoms (tachypnea, restlessness, hyperexcitability, convulsions, salivation, lacrimation, weakness). Conclusions: Hottentotta saulcyi scorpion venom includes short-chain neurotoxins and long-chain neurotoxins according to the electrophoretic protein patterns. The stings of H. saulcyi scorpion must be considered of risk for humans in the southeastern region, Turkey. PMID:26623435

  16. Effect of molecular weight on the electrophoretic deposition of carbon black nanoparticles in moderately viscous systems.

    PubMed

    Modi, Satyam; Panwar, Artee; Mead, Joey L; Barry, Carol M F

    2013-08-01

    Electrophoretic deposition from viscous media has the potential to produce in-mold assembly of nanoparticles onto three-dimensional parts in high-rate, polymer melt-based processes like injection molding. The effects of the media's molecular weight on deposition behavior were investigated using a model system of carbon black and polystyrene in tetrahydrofuran. Increases in molecular weight reduced the electrophoretic deposition of the carbon black particles due to increases in suspension viscosity and preferential adsorption of the longer polystyrene chains on the carbon black particles. At low deposition times (≤5 s), only carbon black deposited onto the electrodes, but the deposition decreased with increasing molecular weight and the resultant increases in suspension viscosity. For longer deposition times, polystyrene codeposited with the carbon black, with the amount of polystyrene increasing with molecular weight and decreasing with greater charge on the polystyrene molecules. This deposition behavior suggests that use of lower molecular polymers and control of electrical properties will permit electrophoretic deposition of nanoparticles from polymer melts for high-rate, one-step fabrication of nano-optical devices, biochemical sensors, and nanoelectronics. PMID:23848316

  17. Finger-powered electrophoretic transport of discrete droplets for portable digital microfluidics.

    PubMed

    Peng, Cheng; Wang, Yide; Sungtaek Ju, Y

    2016-07-01

    We report a finger-powered digital microfluidic device based on the electrophoretic transport of discrete droplets (EPD). An array of piezoelectric elements is connected in parallel to metal electrodes immersed in dielectric fluids. When deflected in a controlled sequence via human finger power, the piezoelectric elements charge and actuate droplets across each electrode pair through electrophoretic force. Successful droplet transportation requires the piezoelectric elements to provide both sufficient charge and voltage pulse duration. We quantify these requirements using numerical models to predict the electrical charges induced on the droplets and the corresponding electrophoretic forces. The models are experimentally validated by comparing the predicted and measured droplet translational velocities. We successfully demonstrated transport and merging of aqueous droplets over a range of droplet radii (0.6-0.9 mm). We further showed direct manipulation of body fluids, including droplets of saliva and urine, using our finger-powered EPD device. To facilitate practical implementation of multistep assays based on the approach, a hand/finger-rotated drum system with a programmable pattern of protrusions is designed to induce deflections of multiple piezoelectric elements and demonstrate programmable fluidic functions. An electrode-to-piezoelectric element connection scheme to minimize the number of piezoelectric elements necessary for a sequence of microfluidic functions is also explored. The present work establishes an engineering foundation to enable design and implementation of finger-powered portable EPD microfluidic devices. PMID:27292054

  18. Electrophoretic deposited TiO2 pigment-based back reflectors for thin film solar cells

    DOE PAGESBeta

    Bills, Braden; Morris, Nathan; Dubey, Mukul; Wang, Qi; Fan, Qi Hua

    2015-01-16

    Highly reflective coatings with strong light scattering effect have many applications in optical components and optoelectronic devices. This paper reports titanium dioxide (TiO2) pigment-based reflectors that have 2.5 times higher broadband diffuse reflection than commercially produced aluminum or silver based reflectors and result in efficiency enhancements of a single-junction amorphous Si solar cell. Electrophoretic deposition is used to produce pigment-based back reflectors with high pigment density, controllable film thickness and site-specific deposition. Electrical conductivity of the pigment-based back reflectors is improved by creating electrical vias throughout the pigment-based back reflector by making holes using an electrical discharge / dielectric breakdownmore » approach followed by a second electrophoretic deposition of conductive nanoparticles into the holes. While previous studies have demonstrated the use of pigment-based back reflectors, for example white paint, on glass superstrate configured thin film Si solar cells, this work presents a scheme for producing pigment-based reflectors on complex shape and flexible substrates. Finally, mechanical durability and scalability are demonstrated on a continuous electrophoretic deposition roll-to-roll system which has flexible metal substrate capability of 4 inch wide and 300 feet long.« less

  19. DNA sequences from two SSRs (CIR316 and MUCS088) linked to root-knot nematode resistance genes from diverse cottons (Gossypium spp).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We investigated DNA sequencing information from alleles (DNA amplified fragments) of two previously reported SSR markers (CIR316 and MUCS088) linked to root-knot nematode (RKN) resistance genes. Markers based on electrophoretic differences, including RFLPs, AFLPs and SSRs can sometimes mask underlyi...

  20. New methodology for capillary electrophoresis with ESI-MS detection: Electrophoretic focusing on inverse electromigration dispersion gradient. High-sensitivity analysis of sulfonamides in waters.

    PubMed

    Malá, Zdena; Gebauer, Petr; Boček, Petr

    2016-09-01

    This article describes for the first time the combination of electrophoretic focusing on inverse electromigration dispersion (EMD) gradient, a new separation principle described in 2010, with electrospray-ionization (ESI) mass spectrometric detection. The separation of analytes along the electromigrating EMD profile proceeds so that each analyte is focused and concentrated within the profile at a particular position given by its pKa and ionic mobility. The proposed methodology combines this principle with the transport of the focused zones to the capillary end by superimposed electromigration, electroosmotic flow and ESI suction, and their detection by the MS detector. The designed electrolyte system based on maleic acid and 2,6-lutidine is suitable to create an inverse EMD gradient of required properties and its components are volatile enough to be compatible with the ESI interface. The characteristic properties of the proposed electrolyte system and of the formed inverse gradient are discussed in detail using calculated diagrams and computer simulations. It is shown that the system is surprisingly robust and allows sensitive analyses of trace amounts of weak acids in the pKa range between approx. 6 and 9. As a first practical application of electrophoretic focusing on inverse EMD gradient, the analysis of several sulfonamides in waters is reported. It demonstrates the potential of the developed methodology for fast and high-sensitivity analyses of ionic trace analytes, with reached LODs around 3 × 10(-9) M (0.8 ng mL(-1)) of sulfonamides in spiked drinking water without any sample pretreatment. PMID:27543034