These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Integrated microdevice for DNA restriction fragment analysis  

SciTech Connect

An integrated monolithic device (8 mm x 10 mm) that performs an automated biochemical procedure is demonstrated. The device mixes a DNA sample with a restriction enzyme in a 0.7-nL reaction chamber and after a digestion period injects the fragments onto a 67-mm-long capillary electrophoresis channel for sizing. Materials are precisely manipulated under computer control within the channel structure using electrokinetic transport. Digestion of the plasmid pBR322 by the enzyme Hinfl and fragment analysis are completed in 5 min using 30 amol of DNA and 2.8 x 10{sup -3} unit of enzyme per run. 29 refs., 7 figs.

Jacobson, S.C.; Ramsey, J.M. [Oak Ridge National Lab., TN (United States)] [Oak Ridge National Lab., TN (United States)

1996-03-01

2

DNA Restriction  

NSDL National Science Digital Library

The discovery of enzymes that could cut and paste DNA made genetic engineering possible. Restriction enzymes, found naturally in bacteria, can be used to cut DNA fragment at specific sequences, while another enzyme, DNA ligase, can attach or rejoin DNA fragments with complementary ends. This animation from Cold Spring Harbor Laboratory's Dolan DNA Learning Center presents DNA restriction through a series of illustrations of processes involved.

2011-11-25

3

Oak chloroplast-DNA polymorphisms detected by restriction fragment length polymorphism (RFLP)  

E-print Network

in the chloroplast (cp) DNA of oak species, would enable us to follow the inheritance of the most con- servative DNANote Oak chloroplast-DNA polymorphisms detected by restriction fragment length polymorphism (RFLP — Petunia hybrida chloroplast (cp) DNA probes were used to find restriction fragment length

Paris-Sud XI, Université de

4

Methods for producing partially digested restriction DNA fragments and for producing a partially modified PCR product  

DOEpatents

The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.

Wong, Kwong-Kwok (Richland, WA)

2000-01-01

5

Methods for producing partially digested restriction DNA fragments and for producing a partially modified PCR product  

SciTech Connect

The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.

Wong, K.K.

2000-04-04

6

Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA  

SciTech Connect

The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

1994-08-01

7

Improved procedure for the preparation of DNA restriction fragments suitable for sequencing  

SciTech Connect

A rapid and integrated procedure was developed for the preparation of small DNA restriction fragments ({le}1000bp) starting from a large cosmid (35,000 bp) containing exogenous DNA. The process is based on restriction enzymatic digestion followed by HPLC separation and fractions collection. All DNA fragments are separated in a single run, detected {open_quotes}on-line{close_quotes} by UV absorption, and straightforward collected with very high recovery. Small fragments can be directly subjected to the sequence procedure, whereas those larger than 1000 bp are redigested with a second enzyme, the fractionated subfragments are separated, ligated to plasmid vector, and sequenced. A human genomic cosmid of 35,000 bp (26H7) has been chosen as a model. 8 refs., 4 figs., 1 tab.

Pietta, P. [Dipartimento Scienze e Tecnologie Biomediche, Milan (Italy); Mauri, P.; Appierto, V. [Istituto Tecnologie Biomediche Avanzate, Milan (Italy)

1994-02-01

8

DNA fingerprinting by random amplified polymorphic DNA and restriction fragment length polymorphism is useful for yeast typing.  

PubMed

Random amplified polymorphic DNA (RAPD) analysis was applied to genomic DNA from nineteen yeast strains belonging to the genera Saccharomyces and Zygosaccharomyces. Results obtained with five primers indicated that this technique is a powerful tool for yeast differentiation and identification. The data were consistent with those derived from restriction fragment length polymorphism (RFLP) using two S. cerevisiae DNA probes. We conclude that RAPD fingerprinting, combined with the analysis of RFLP, can provide unambiguous type assignment in yeasts. PMID:8578000

Paffetti, D; Barberio, C; Casalone, E; Cavalieri, D; Fani, R; Fia, G; Mori, E; Polsinelli, M

1995-09-01

9

Chloroplast DNA variation in Populus . I. Intraspecific restriction fragment diversity within Populus deltoides , P. nigra and P. maximowiczii  

Microsoft Academic Search

We examined intraspecific chloroplast (cp) DNA variation within Populus deltoides, P. nigra, and P. maximowiczii by restriction fragment analysis using 16 restriction endonucleases and six heterologous probes of cloned Petunia cpDNA fragments. All three Populus species showed intraspecific cpDNA variation, which was intra- and inter-varietal in P. deltoides, intervarietal in P. nigra, and origin-specific in P. maximowiczii. Two varieties of

O. P. Rajora; B. P. Dancik

1995-01-01

10

Multi-Niche Crowding in Genetic Algorithms and its Application to the Assembly of DNA Restriction-Fragments  

E-print Network

Multi-Niche Crowding in Genetic Algorithms and its Application to the Assembly of DNA Restriction the optima of a multi-modal function. A genetic algorithm that uses multi-niche crowding permits us to do words: Genetic algorithms, multi-modal functions, DNA restriction fragment assembly, human genome

Vemuri, Rao

11

Chloroplast DNA variation in Populus . II. Interspecific restriction fragment polymorphisms and genetic relationships among Populus deltoides, P. nigra, P. maximowiczii , and P. x canadensis  

Microsoft Academic Search

Restriction fragment analysis was conducted to determine interspecific chloroplast DNA (cpDNA) variation and genetic relationships among Populus deltoides, P. nigra, P. x canadensis (P. deltoides x P. nigra), and P. maximowiczii. Total cellular DNAs of these poplars were digested with 16 restriction endonucleases, and Southern blots of the restriction digests were probed with six different cloned cpDNA fragments from Petunia.

O. P. Rajora; B. P. Dancik

1995-01-01

12

Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling  

SciTech Connect

A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map.

Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O. (Johns Hopkins Univ., School of Hygiene and Public Health, Baltimore, MD (USA))

1990-05-01

13

High transmission of paternal plastid DNA in alfalfa plants demonstrated by restriction fragment polymorphic analysis.  

PubMed

A high frequency of paternal plastid transmission occurred in progeny from crosses among normal green alfalfa plants. Plastid transmission was analyzed by hybridization of radiolabeled alfalfa plastid DNA (cpDNA) probes to Southern blots of restriction digests of the progeny DNA. Each probe revealed a specific polymorphism differentiating the parental plastid genomes. Of 212 progeny, 34 were heteroplastidic, with their cpDNAs ranging from predominantly paternal to predominantly maternal. Regrowth of shoots from heteroplasmic plants following removal of top growth revealed the persistence of mixed plastids in a given plant. However, different shoots within a green heteroplasmic plant exhibited paternal, maternal, or mixed cpDNAs. Evidence of maternal nuclear genomic influence on the frequency of paternal plastid transmission was observed in some reciprocal crosses. A few tetraploid F1 progeny were obtained from tetraploid (2n=4x=32) Medicago sativa ssp. sativa x diploid (2n=2x=16) M. sativa ssp. falcata crosses, and resulted from unreduced gametes. Here more than the maternal genome alone apparently functioned in controlling plastid transmission. Considering all crosses, only 5 of 212 progeny cpDNAs lacked evidence of a definitive paternal plastid fragment. PMID:24226119

Masoud, S A; Johnson, L B; Sorensen, E L

1990-01-01

14

[DNA polymorphism in the Mongolian population. Restriction fragment length polymorphism analysis of DNA at seven loci of the nuclear genome].  

PubMed

Seven DNA markers from five genes and one chromosomal region were analysed in Mongolian population using the polymerase chain reaction. The frequencies of alleles of the polymorphisms detected with HindIII in the HBG-2, AvaII in the HBB, MspI and XbaI in the Apo-B, PstI in the D7S8, HincII in the LDLR and allele frequency of the minisatellite fragment in the AT-3 have been determined. The results of the RELP for Apo-B(MspI), LDLR, D7S8 and AT-3 are obtained for the first time among Mongoloids. DNA markers studied demonstrated high level of polymorphisms in the population of Mongolia, except for XbaI and MspI restriction sites at the Apo-B locus. The data obtained for Mongolian population and the literature data were compared. PMID:1687037

Sambuugi?n, N; Petrishchev, V N; Rychkov, Iu G

1991-12-01

15

Physical mapping of the Hind III, Eco RI, Sal and Sma restriction endonuclease cleavage fragments from bacteriophage T5 DNA  

Microsoft Academic Search

The DNA of bacteriophage T5+ (molecular weight 76×106 dalton) has been dissected by various specific endonucleases. The restriction enzymes HindIII and EcoRI produce 16 and 7 fragments respectively, whereas Sal and Sma produce 4 fragments each. Complete cleavage maps were established for the enzymes EcoRI, Sal and Sma and an almost complete map for HindIII. Furthermore the location and size

Alexander Gabain; Gary S. Hayward; Hermann Bujard

1976-01-01

16

High transmission of paternal plastid DNA in alfalfa plants demonstrated by restriction fragment polymorphic analysis  

Microsoft Academic Search

A high frequency of paternal plastid transmission occurred in progeny from crosses among normal green alfalfa plants. Plastid transmission was analyzed by hybridization of radiolabeled alfalfa plastid DNA (cpDNA) probes to Southern blots of restriction digests of the progeny DNA. Each probe revealed a specific polymorphism differentiating the parental plastid genomes. Of 212 progeny, 34 were heteroplastidic, with their cpDNAs

S. A. Masoud; L. B. Johnson; E. L. Sorensen

1990-01-01

17

Capillary electrophoretic separation of DNA restriction fragments using dilute polymer solutions  

SciTech Connect

Because the mechanism of DNA separation in capillary electrophoresis is not well understood, selection of polymers is a {open_quotes}trial-and-error{close_quotes} procedure. We investigated dilute-solution DNA separations by capillary electrophoresis using solutions of four polymers that differ in size, shape and stiffness. Hydroxyethylcellulose of high molecular weight provides excellent separation of large DNA fragments (2027 bp - 23130 bp). Polyvinylpyrrolidone separates DNA from 72 bp to 23 kbp and star-(polyethylene oxide), like linear poly (ethylene oxide), provides separation of fragments up to 1353 bp.

Braun, B.; Blanch, W.; Prausnitz, J.M.

1997-02-01

18

Fractionation of large mammalian DNA restriction fragments using vertical pulsed-field gradient gel electrophoresis  

Microsoft Academic Search

A new design for pulsed field gradient (PFG) gel electrophoresis of large (>50 kb) DNA fragments is described. The method eliminates distortion of migration of DNA because of the geometry of the applied electric field, requires a single power supply and a simple switching device, and is extremely simple to use. Parameters investigated include variation in pulse time, conditions of

Katheleen Gardiner; William Laas; David Patterson

1986-01-01

19

The ? subunit locus of the human fibronectin receptor: DNA restriction fragment length polymorphism and linkage mapping studies  

Microsoft Academic Search

The beta subunit of the human fibronectin receptor (FNRB) is a transmembrane protein belonging to the VLA (very late antigens of activation) family. Using pGEM-32, a 2.5-kb partial cDNA clone corresponding to the 3' portion of the human FNRB locus, multiple restriction fragment length polymorphisms (RFLPs) were revealed on DNAs from unrelated Caucasians. RFLPs detected by five enzymes, BanII, HinfI,

Jingshi Wu; Luis A. Giuffra; Paul J. Goodfellow; Shirley Myers; Nancy L. Carson; Linda Anderson; L. Suzanne Hoyle; Nancy E. Simpson; Kenneth K. Kidd

1989-01-01

20

Physical map of polyoma viral DNA fragments produced by cleavage with a restriction enzyme from Haemophilus aegyptius, endonuclease R-HaeIII.  

PubMed

Digestion of polyoma viral DNA with a restriction enzyme from Haemophilus aegyptius generates at least 22 unique fragments. The fragments have been characterized with respect to size and physical order on the polyoma genome, and the 5' to 3' orientation of the (+) and (-) strands has been determined. A method for specific radiolabeling of adjacent fragments was employed to establish the fragment order. This technique may be useful for ordering the fragments produced by digestion of complex DNAs. PMID:163927

Summers, J

1975-04-01

21

The fragment structure of a putative HsdR subunit of a type I restriction enzyme from Vibrio vulnificus YJ016: implications for DNA restriction and translocation activity  

PubMed Central

Among four types of bacterial restriction enzymes that cleave a foreign DNA depending on its methylation status, type I enzymes composed of three subunits are interesting because of their unique DNA cleavage and translocation mechanisms performed by the restriction subunit (HsdR). The elucidated N-terminal fragment structure of a putative HsdR subunit from Vibrio vulnificus YJ016 reveals three globular domains. The nucleolytic core within an N-terminal nuclease domain (NTD) is composed of one basic and three acidic residues, which include a metal-binding site. An ATP hydrolase (ATPase) site at the interface of two RecA-like domains (RDs) is located close to the probable DNA-binding site for translocation, which is far from the NTD nucleolytic core. Comparison of relative domain arrangements with other functionally related ATP and/or DNA complex structures suggests a possible translocation and restriction mechanism of the HsdR subunit. Furthermore, careful analysis of its sequence and structure implies that a linker helix connecting two RDs and an extended region within the nuclease domain may play a central role in switching the DNA translocation into the restriction activity. PMID:19625490

Uyen, Nguyen To; Park, Suk-Youl; Choi, Ji-Woo; Lee, Hyun-Ju; Nishi, Kosuke; Kim, Jeong-Sun

2009-01-01

22

Physical mapping of the Xba I, Hinc II, Bgl II, Xho I, Sst I, and Pvu II restriction endonuclease cleavage fragments of mitochondrial DNA of S. cerevisiae  

Microsoft Academic Search

A detailed molecular dissection of the yeast mitochondrial genome can be made with restriction endonucleases that generate site-specific cuts in DNA. The ordering of restriction fragments provides the basis of the physical mapping of mitochondrial transcripts and antibiotic resistance (ant®) loci, and is a means of analyzing the molecular organization of mtDNA of petite and mit- deletion mutants.

Richard Morimoto; Murray Rabinowitz

1979-01-01

23

Characterization of Escherichia hermannii by ribosomal DNA restriction fragment length polymorphism.  

PubMed

Ribosomal DNA polymorphism was used to characterize strains of Escherichia hermannii and to differentiate them from E. coli. DNA from 11 E. hermannii strains previously separated into three zymotypes by enzyme electrophoretic polymorphism was digested with HindIII and EcoRI restriction enzymes and analyzed by Southern blotting. The 10 ribotypes obtained with EcoRI fell into 3 groups which correlated with the corresponding zymotypes, and the 5 ribotypes obtained with HindIII were clearly distinct from those of E. coli strains. PMID:7910695

Picard-Pasquier, N; Picard, B; Krishnamoorthy, R; Goullet, P

1993-01-01

24

Genetic characterization of Epimedium species using random amplified polymorphic DNA (RAPD) and PCR-restriction fragment length polymorphism (RFLP) diagnosis.  

PubMed

Total DNA was extracted from the leaves of seven Epimedium species grown in different places in Japan. Their genetic characterization was performed by DNA analyses of random amplified polymorphic DNA (RAPD) using 32 random primers having 10 base sequences, and by restriction fragment length polymorphism (RFLP). E. sagittatum and E. koreanum were easily distinguished by a representative amplified band pattern. It became evident that E. sagittatum had extremely different genetic composition compared to the other species. A dendrogram obtained from the similarity matrix by cluster analysis indicates that E. sagittatum can be completely isolated from the other species. Moreover, it became evident that E. grandiflorum var. higoense, E. trifoliatobinatum and E. koreanum are independent species, contrary to the previous assumption that they are subspecies or a variety. The geographical variation of E. sempervirens was confirmed by cluster analysis. E. diphyllum showed wide genetic variations, in spite of sampling from the same area. PMID:8820914

Nakai, R; Shoyama, Y; Shiraishi, S

1996-01-01

25

Characterization of highly virulent Escherichia coli strains by ribosomal DNA restriction fragment length polymorphism.  

PubMed

Patterns of ribosomal DNA polymorphism were examined to compare carboxylesterase B type B1 strains and B2 strains of Escherichia coli isolated from extra-intestinal infections. DNA from 14 type B2 strains showing the presence of alpha-haemolysin and mannose-resistant haemagglutinin and lethality to mice and 14 type B1 strains lacking these characteristics, was digested with HindIII, EcoRI, BamHI or BglII restriction enzymes and analysed by Southern blotting. The obtained ribotypes clearly differentiated the B2 strains from the B1 strains. These results indicate that genotypes of the highly virulent B2 strains are different from that of the less virulent B1 strains. PMID:1682207

Picard, B; Picard-Pasquier, N; Krishnamoorthy, R; Goullet, P

1991-08-01

26

Flying squirrel-associated Rickettsia prowazekii (epidemic typhus rickettsiae) characterized by a specific DNA fragment produced by restriction endonuclease digestion.  

PubMed Central

The DNA from flying squirrel-associated Rickettsia prowazekii was characterized by using a specific DNA fragment produced by digestion with the enzyme BamHI. The DNA fragment was cloned into a plasmid vector and used to readily distinguish between available human- and flying squirrel-associated R. prowazekii DNAs derived from crude cytoplasmic extracts. Images PMID:3009528

Regnery, R L; Fu, Z Y; Spruill, C L

1986-01-01

27

Genetic markers in ribosomal DNA for the identification of members of the genus Anisakis (Nematoda: Ascaridoidea) defined by polymerase-chain-reaction-based restriction fragment length polymorphism  

Microsoft Academic Search

Polymerase-chain-reaction-based restriction fragment length polymorphism analysis was performed to establish genetic markers in rDNA, for the identification of the three sibling species of the Anisakis simplex complex and morphologically differentiated Anisakis species, i.e. Anisakis physeteris, Anisakis schupakovi, Anisakis typica and Anisakis ziphidarum. Different restriction patterns were found between A. simplex sensu stricto and Anisakis pegreffii with two of the restriction

S D'Amelio; K. D Mathiopoulos; C. P Santos; O. N Pugachev; S. C Webb; M Picanço; L Paggi

2000-01-01

28

[DNA polymorphism in the Russian population. Analysis of dna restriction fragment length polymorphism in seven loci of the nuclear genome].  

PubMed

Using the method for polymerase chain reaction the polymorphism of eight markers of the nuclear DNA was studied. In a sample of Russians taken at random (N = 118) from predominantly southern and central regions of Russia, allele frequencies were determined for restriction sites HindIII at HBG-2 and PAH loci, AvaII at the HBB locus, MspI at the ApoB locus, PstI at D7S8, HincII at LDLR, TaqI and BamHI at the DSX164. Comparative data for different world regions are presented. PMID:1353471

Petrishchev, V N; Sambuugi?n, N; Zhukova, O V; Rychkov, Iu G

1992-05-01

29

Computer-based image analysis of one-dimensional electrophoretic gels used for the separation of DNA restriction fragments.  

PubMed Central

A stand-alone, interactive computer system has been developed that automates the analysis of ethidium bromide-stained agarose and acrylamide gels on which DNA restriction fragments have been separated by size. High-resolution digital images of the gels are obtained using a camera that contains a one-dimensional, 2048-pixel photodiode array that is mechanically translated through 2048 discrete steps in a direction perpendicular to the gel lanes. An automatic band-detection algorithm is used to establish the positions of the gel bands. A color-video graphics system, on which both the gel image and a variety of operator-controlled overlays are displayed, allows the operator to visualize and interact with critical stages of the analysis. The principal interactive steps involve defining the regions of the image that are to be analyzed and editing the results of the band-detection process. The system produces a machine-readable output file that contains the positions, intensities, and descriptive classifications of all the bands, as well as documentary information about the experiment. This file is normally further processed on a larger computer to obtain fragment-size assignments. Images PMID:6320097

Gray, A J; Beecher, D E; Olson, M V

1984-01-01

30

Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).  

PubMed

The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control. PMID:17367680

Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

2007-08-01

31

Use of rDNA restriction fragment length polymorphisms to differentiate strains of Candida albicans in women with vulvovaginal candidiasis.  

PubMed

Epidemiologic studies in women with recurrent Candida vaginitis have been hampered in the past by the lack of a reproducible typing system. Several molecular probes have now been developed that have the ability to differentiate strains of Candida albicans and give reproducible results. In this investigation, 24 women with Candida vaginitis were studied in a longitudinal fashion for 30 days following short-course antifungal therapy. Seven women with either recurrent vaginitis or with multiple culture-positive sites with C. albicans were included in an epidemiological study. A total of 18 isolates of C. albicans (12 vaginal and six rectal) were typed utilizing restriction fragment length polymorphisms of rDNA. This technique was able to differentiate five different strains of C. albicans. Our epidemiologic study revealed that vaginal and rectal strains recovered from the same women were usually different. None of our patients had a similar vaginal and rectal strain prior to treatment, and only one patient had the same strain isolated from both the rectum and the vagina at the time of recurrence. On the other hand, we found that the same strain of C. albicans was initially and later recovered from the vagina in four of five women who failed treatment or developed recurrent vaginitis. These results suggest that recurrent episodes of C. albicans vaginitis, following short-course antifungal therapy, are often due to relapse of the original infecting strain and not due to autoinoculation from the rectum.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1686996

Stein, G E; Sheridan, V L; Magee, B B; Magee, P T

1991-01-01

32

Repair of x-ray-induced DNA double-strand breaks in specific Not I restriction fragments in human fibroblasts: joining of correct and incorrect ends  

NASA Technical Reports Server (NTRS)

An assay that allows measurement of absolute induction frequencies for DNA double-strand breaks (dsbs) in defined regions of the genome and that quantitates rejoining of correct DNA ends has been used to study repair of dsbs in normal human fibroblasts after x-irradiation. The approach involves hybridization of single-copy DNA probes to Not I restriction fragments separated according to size by pulsed-field gel electrophoresis. Induction of dsbs is quantitated from the decrease in the intensity of the hybridizing restriction fragment and an accumulation of a smear below the band. Rejoining of dsbs results in reconstitution of the intact restriction fragment only if correct DNA ends are joined. By comparing results from this technique with results from a conventional electrophoresis assay that detects all rejoining events, it is possible to quantitate the misrejoining frequency. Three Not I fragments on the long arm of chromosome 21 were investigated with regard to dsb induction, yielding an identical induction rate of 5.8 X 10(-3) break per megabase pair per Gy. Correct dsb rejoining was measured for two of these Not I fragments after initial doses of 80 and 160 Gy. The misrejoining frequency was about 25% for both fragments and was independent of dose. This result appears to be representative for the whole genome as shown by analysis of the entire Not I fragment distribution. The correct rejoining events primarily occurred within the first 2 h, while the misrejoining kinetics included a much slower component, with about half of the events occurring between 2 and 24 h. These misrejoining kinetics are similar to those previously reported for production of exchange aberrations in interphase chromosomes.

Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

1995-01-01

33

Intraspecific variation in Radopholus similis isolates assessed with restriction fragment length polymorphism and DNA sequencing of the internal transcribed spacer region of the ribosomal RNA cistron.  

PubMed

Restriction fragment length polymorphism and direct sequencing of the internal transcribed spacer rDNA region of 19 isolates of Radopholus similis yielded significant diversity, both among isolates and within some individuals. Restriction fragment length polymorphism with HaeIII, AluI and Tru9I yielded two sets of patterns. Digestion with RsaI revealed one or two supernumerary bands in single nematodes from five isolates, and sequencing confirmed microheterogeneity in four of these. Phylogenetic analysis grouped most isolates closely together, except for the five isolates with additional bands for RsaI. Our data reveal more population structure than previously found and lend further support to the synonymy of R. similis and 'Radopholus citrophilus'. PMID:11812497

Elbadri, Gamal A A; De Ley, Paul; Waeyenberge, Lieven; Vierstraete, Andy; Moens, Maurice; Vanfleteren, Jacques

2002-02-01

34

A DNA and restriction enzyme implementation of Turing Machines  

Microsoft Academic Search

Bacteria employ restriction enzymes to cut or restrict DNA at or near specific words in a uniqueway. Many restriction enzymes cut the two strands of double-stranded DNA at different positions leavingoverhangs of single-stranded DNA. Two pieces of DNA may be rejoined or ligated if their terminal overhangsare complementary. Using these operations fragments of DNA, or oligonucleotides, may be inserted anddeleted

Paul Wilhelm Karl Rothemund

1996-01-01

35

Restriction endonuclease analysis of Aspergillus fumigatus DNA  

Microsoft Academic Search

AIMS: To develop a genome based DNA fingerprinting system for Aspergillus fumigatus mould. METHODS: DNA was extracted from 21 isolates obtained from eight patients with an aspergilloma. This was with a freeze-dried mycelial extract fragmented in liquid nitrogen. DNA was subsequently purified by phenol-chloroform extraction followed by ultracentrifugation on a caesium chloride gradient. The DNA was restricted by EcoRI and

J P Burnie; A Coke; R C Matthews

1992-01-01

36

Restriction Enzymes and DNA Fingerprinting  

NSDL National Science Digital Library

The discovery of restriction enzymes and their applications in DNA analysis has proven to be essential for biologists and chemists. This lesson focuses on restriction enzymes and their applications to DNA analysis and DNA fingerprinting. Use this lesson and its associated activity in conjunction with biology lessons on DNA analysis and DNA replication.

National Science Foundation GK-12 and Research Experience for Teachers (RET) Programs,

37

Stock structure and homing fidelity in Gulf of Mexico sturgeon (Acipenser oxyrinchus desotoi) based on restriction fragment length polymorphism and sequence analyses of mitochondrial DNA.  

PubMed

Efforts have been proposed worldwide to restore sturgeon populations through the use of hatcheries to supplement natural reproduction and to reintroduce sturgeon where they have become extinct. We examined the population structure and inferred the extent of homing in the anadromous Gulf of Mexico (Gulf) sturgeon (Acipenser oxyrinchus desotoi). Restriction fragment length polymorphism and control region sequence analyses of mitochondrial DNA (mtDNA) were used to identify haplotypes of Gulf sturgeon specimens obtained from eight drainages spanning the subspecies' entire distribution from Louisiana to Florida. Significant differences in haplotype frequencies indicated substantial geographic structuring of populations. A minimum of four regional or river-specific populations were identified (from west to east): (1) Pearl River, LA and Pascagoula River, MS, (2) Escambia and Yellow rivers, FI, (3) Choctawbatchee River, FL and (4) Apalachicola Ochlockonee, and Suwannee rivers, FL. Estimates of maternally mediated gene flow between any pair of the four regional or river-specific stocks ranged between 0.15 to 1.2. Tandem repeats in the mtDNA control region of Gulf sturgeon were not perfectly conserved. This result, together with an absence of heteroplasmy and length variation in Gulf sturgeon mtDNA, indicates that the molecular mechanisms of mtDNA control region sequence evolution differ among acipenserids. PMID:8889537

Stabile, J; Waldman, J R; Parauka, F; Wirgin, I

1996-10-01

38

Restriction fragment length polymorphisms in genetic improvement: methodologies, mapping and costs  

Microsoft Academic Search

Recently a new class of genetic polymorphism, restriction fragment length polymorphisms (RFLPs), has been uncovered by the use of restriction endonucleases which cleave DNA molecules at specific sites and cloned DNA probes which detect specific homologous DNA fragments. RFLPs promise to be exceedingly numerous and are expected to have genetic characteristics — lack of dominance, multiple allelic forms and absence

J. S. Beckmann; M. Soller

1983-01-01

39

Complexity of Pseudomonas aeruginosa infection in cystic fibrosis: combined results from esterase electrophoresis and rDNA restriction fragment length polymorphism analysis.  

PubMed

Esterase electrophoretic typing and restriction fragment length polymorphism of ribosomal DNA regions (ribotyping) were used to differentiate 102 Pseudomonas aeruginosa clinical isolates obtained from chronic lung infection in 23 patients with cystic fibrosis (CF) and two reference strains (including the type strain ATCC 10145). Twenty-five zymotypes were obtained with the former method and 16 ribotypes with the latter. Combination of the two typing systems led to the finding of 30 different types. Our data highlights the physiopathological complexity of P. aeruginosa infection in CF as, in six individual cases, several types were found among isolates from a given patient. On the other hand, two unique types were found in two and three patients respectively, raising the possibility of cross-infections. PMID:1675610

Denamur, E; Picard, B; Goullet, P; Bingen, E; Lambert, N; Elion, J

1991-06-01

40

DNA sequence analysis and restriction fragment length polymorphisms of the P1 gene of Haemophilus influenzae biogroup aegyptius associated with Brazilian purpuric fever.  

PubMed

Brazilian purpuric fever (BPF) is a fulminant pediatric disease caused by specific strains of Haemophilus influenzae biogroup aegyptius. A conserved epitope on the P1 protein of strains of H. influenzae biogroup aegyptius is seen on most virulent isolates. The P1 protein from a Brazilian case-clone strain of H. influenzae biogroup aegyptius was analyzed by cloning and sequencing the gene. Three major variable regions are present within the P1 gene of the BPF clone in an architecture similar to that of the previously sequenced P1 genes from H. influenzae. The DNA sequence data of the P1 gene provided information for restriction fragment length polymorphism analyses among strains of H. influenzae biogroup aegyptius. Using PCR for amplification of the P1 gene, we found that AlwI restriction of this gene allowed for a highly accurate segregation of virulent strains of H. influenzae biogroup aegyptius associated with BPF. The strong association of virulent phenotypes with specific AlwI restriction patterns of the P1 gene provides a basis for the convenient and accurate identification of strains of H. influenzae biogroup aegyptius which cause BPF. PMID:8751915

Reed, R B; Frost, J B; Kort, K; Myers, S D; Lesse, A J

1996-09-01

41

Fidelity of Select Restriction Endonucleases in Determining Microbial Diversity by Terminal-Restriction Fragment Length Polymorphism  

Microsoft Academic Search

An evaluation of 18 DNA restriction endonucleases for use in terminal-restriction fragment length poly- morphism (T-RFLP) analysis was performed by using richness and density indices in conjunction with computer simulations for 4,603 bacterial small-subunit rRNA gene sequences. T-RFLP analysis has become a commonly used method for screening environmental samples for precursory identification and community comparison studies due to its precision

Jeff J. Engebretson; Craig L. Moyer

2003-01-01

42

Genetic diversity of Mycobacterium africanum clinical isolates based on IS6110-restriction fragment length polymorphism analysis, spoligotyping, and variable number of tandem DNA repeats.  

PubMed

A collection of 105 clinical isolates originally identified as Mycobacterium africanum were characterized using both phenotypic and genotyping methods. The phenotypic methods included routine determination of cultural properties and biochemical tests used to discriminate among the members of the M. tuberculosis complex, whereas genotypic characterization was based on IS6110-restriction fragment length polymorphism (IS6110-RFLP) analysis, IS1081-RFLP analysis, direct repeat-based spacer oligonucleotide typing (spoligotyping), variable number of tandem DNA repeats (VNTR), and the polymorphism of the oxyR, pncA, and mtp40 loci. The results obtained showed that a majority of M. africanum isolates were characterized by a specific spoligotyping pattern that was intermediate between those of M. tuberculosis and M. bovis, which do not hybridize with spacers 33 to 36 and spacers 39 to 43, respectively. A tentative M. africanum-specific spoligotyping signature appeared to be absence of spacers 8, 9, and 39. Based on spoligotyping, as well as the polymorphism of oxyR and pncA, a total of 24 isolates were excluded from the final study (19 were identified as M. tuberculosis, 2 were identified as M. canetti, and 3 were identified as M. bovis). The remaining 81 M. africanum isolates were efficiently subtyped in three distinct subtypes (A1 to A3) by IS6110-RFLP analysis and spoligotyping. The A1 and A2 subgroups were relatively more homogeneous upon spoligotyping than A3. Further analysis of the three subtypes by VNTR corroborated the highly homogeneous nature of the A2 subtype but showed significant variations for subtypes A1 and A3. A phylogenetic tree based on a selection of isolates representing the three subtypes using VNTR and spoligotyping alone or in combination confirmed the subtypes described as well as the heterogeneity of subtype A3. PMID:11136749

Viana-Niero, C; Gutierrez, C; Sola, C; Filliol, I; Boulahbal, F; Vincent, V; Rastogi, N

2001-01-01

43

Molecular epidemiology of Yersinia enterocolitica O:3 infections: use of chromosomal DNA restriction fragment length polymorphisms of rRNA genes.  

PubMed Central

Yersinia enterocolitica is a major enteric pathogen associated with a wide variety of clinical and immunologic manifestations, including transfusion-associated disease, from which there is a high mortality. Although previously rare in the United States, in the late 1980s Y. enterocolitica O:3 emerged as the predominant serotype in the United States, as it has been in Canada, Europe, and Japan. Epidemiologic investigation of this serogroup has been hampered by the limited availability of a phage typing system and the fact that Y. enterocolitica harbors few plasmids that are useful as strain markers. We therefore analyzed whole-cell DNA restriction fragment length polymorphisms of rRNA genes (ribotyping) to study a group of 61 (50 human, 11 porcine) Y. enterocolitica isolates. Initially, 20 different restriction enzymes were used: NciI appeared to give the best discrimination of hybridization banding patterns (ribotypes) within Y. enterocolitica O:3. Ribotyping distinguished seven clones among all the study isolates and four clones within Y. enterocolitica O:3 (53 isolates studied) and clearly differentiated Y. enterocolitica O:3 from Y. enterocolitica O:9; O:1,2,3; O:20; and O:5,27. Most serogroup O:3 isolates belonged to two clones, ribotypes I and II, including 23 of 24 Y. enterocolitica O:3 (13 human, 11 porcine chitterling) isolates recovered from a recent outbreak of Y. enterocolitica in children in Atlanta associated with chitterling preparation and 3 transfusion-associated O:3 isolates from the United States. Y. enterocolitica O:3 ribotypes I and II were also isolated in Japan, ribotypes II and IV were isolated in Belgium, and ribotype I was isolated in Canada. Ribotype patterns I and II corresponded to phage types 9b and 8, respectively. Ribotyping was able to distinguish individual strains of Y. enterocolitica O:3, but suggests that a limited number of clones have disseminated within the United States and globally. The finding of identical ribotype patterns in chitterling and human specimens from the Atlanta outbreak supports epidemiologic evidence that swine were the source of infection and major reservoir for Y. enterocolitica O:3. Images PMID:1723068

Blumberg, H M; Kiehlbauch, J A; Wachsmuth, I K

1991-01-01

44

Genetic Diversity of Mycobacterium africanum Clinical Isolates Based on IS6110Restriction Fragment Length Polymorphism Analysis, Spoligotyping, and Variable Number of Tandem DNA Repeats  

Microsoft Academic Search

A collection of 105 clinical isolates originally identified as Mycobacterium africanum were characterized using both phenotypic and genotyping methods. The phenotypic methods included routine determination of cultural properties and biochemical tests used to discriminate among the members of the M. tuberculosis complex, whereas genotypic characterization was based on IS6110-restriction fragment length polymorphism (IS6110- RFLP) analysis, IS1081-RFLP analysis, direct repeat-based spacer

CRISTINA VIANA-NIERO; CRISTINA GUTIERREZ; CHRISTOPHE SOLA; INGRID FILLIOL; FADILA BOULAHBAL; VERONIQUE VINCENT; NALIN RASTOGI

2001-01-01

45

Characterization of Bacterial Community Diversity in Cystic Fibrosis Lung Infections by Use of 16S Ribosomal DNA Terminal Restriction Fragment Length Polymorphism Profiling  

Microsoft Academic Search

Progressive loss of lung function resulting from the inflammatory response to bacterial colonization is the leading cause of mortality in cystic fibrosis (CF) patients. A greater understanding of these bacterial infections is needed to improve lung disease management. As culture-based diagnoses are associated with fundamental drawbacks, we used terminal restriction fragment (T-RF) length polymorphism profiling and 16S rRNA clone data

G. B. Rogers; M. P. Carroll; D. J. Serisier; P. M. Hockey; G. Jones; K. D. Bruce

2004-01-01

46

Construction of genetic linkage maps in maize and tomato using restriction fragment length polymorphisms  

Microsoft Academic Search

Genetic linkage maps were constructed for both maize and tomato, utilizing restriction fragment length polymorphisms (RFLPs) as the source of genetic markers. In order to detect these RFLPs, unique DNA sequence clones were prepared from either maize or tomato tissue and hybridized to Southern blots containing restriction enzyme-digested genomic DNA from different homozygous lines. A subsequent comparison of the RFLP

T. Helentjaris; M. Slocum; S. Wright; A. Schaefer; J. Nienhuis

1986-01-01

47

Genetic evidence for the existence of cryptic species in the Anopheles albitarsis complex in Brazil: allozymes and mitochondrial DNA restriction fragment length polymorphisms.  

PubMed

Allozyme and mitochondrial DNA (mtDNA) restriction studies were undertaken to determine the extent of genetic divergence among field populations of Anopheles albitarsis in Brazil. Two sympatric species, An. deaneorum and An. marajoara, were identified in collections from Costa Marques (CM), Rondonia. Genetic evidence includes (1) the presence of two types of individuals, each with diagnostic allelic clusters (for Had-1, Pgi-1, Pep-1, Mpi-1, and Idh-1), (2) a deficiency of heterozygotes, and (3) characteristic mtDNA haplotypes. In addition, two allopatric cryptic species of An. marajoara were identified, one from Iguape (An. marajoara form IG), Sao Paulo state, and the other from the Island of Marajo (An. marajoara form MA). Though form IG and form-MA resemble form CM in wing spot morphology, they differ from it in diagnostic allozymes and mtDNA haplotypes. An. marajoara form CM had a higher variability (mean heterozygosity, H = 0.22, and percentage of polymorphic loci, P = 66.7) than did form IG and form MA (H = 0.08 in both, and P = 25.0 and 33.3, respectively). Form MA and form IG are genetically more similar to each other than both are to form CM. Based on wing morphology, estimates of F statistics, and genetic similarities, we propose that An. albitarsis in Brazil is a species complex. It comprises at least two morphologically distinguishable species: (1) An. deaneorum (currently one taxon) and (2) the An. marajoara species complex, which further consists of at least three cryptic forms, marajoara form MA, marajoara form IG, and marajoara form CM. PMID:8097085

Narang, S K; Klein, T A; Perera, O P; Lima, J B; Tang, A T

1993-02-01

48

Regular arrangement of restriction sites in Drosophila DNA.  

PubMed

When DNA of Drosophila melanogaster is digested to completion with Hemophilus aegyptius restriction endonuclease, the majority of the products are DNA segments whose lengths fits a random distribution with an average of 350 base pairs. However, some 10% of the DNA is recovered as various segments of discrete lengths, ranging from 30,000 to 365 base pairs. These segments arise from the regular spacing of the enzyme restriction sites in limited portions of the Drosophila genome. Three segments have been shown to originate from mitochondrial DNA, while all the others can be assigned to one or more isopycnic density classes of nuclear DNA. Five of the discrete fragments display modular lengths, each being an integral multiple of a 365 base pairs subunit. The relative frequencies of these multiple segments suggest that they are derived from DNA originally containing restriction sites every 365 base pairs, and that approximately 25% of these sites have been randomly inactivated. PMID:808273

Manteuil, S; Hamer, D H; Thomas, C A

1975-08-01

49

Population genetics of the yellow fever mosquito in Trinidad: comparisons of amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) markers  

Microsoft Academic Search

Recent development of DNA markers provides powerful tools for population genetic analyses. Amplified fragment length polymorphism (AFLP) markers result from a poly- merase chain reaction (PCR)-based DNA fingerprinting technique that can detect multiple restriction fragments in a single polyacrylamide gel, and thus are potentially useful for population genetic studies. Because AFLP markers have to be analysed as dominant loci in

G. Yan; J. Romero-Severson; M. Walton; D. D. CHADEEand; D. W. Severson

1999-01-01

50

The role of DNA fragmentation in apoptosis  

Microsoft Academic Search

The formation o f distinct DNA fragments of oligonucleosomal size (180–200 by lengths) is a biochemical hallmark of apoptosis in many cells. Recent observations also suggest large DNA fragments and even single-strand cleavage events occur during cell death. These observations have raised many questions. What are the types o f DNA cleavage observed during apoptosis? What are the nucleases involved?

Carl D. Bortner; Nicklas B. E. Oldenburg; John A. Cidlowski

1995-01-01

51

Restriction fragment length polymorphisms associated with substance P gene  

SciTech Connect

Substance P (SP) is an important neuropepetide detected in a variety of locations in the central nervous system. Variations in SP content or SP receptors in psychiatric disorders have been described. Using SP clones as probes the authors have found three restriction fragment length polymorphisms (RFLPs) in the SP gene. The RFLPs are generated by digestion of genomic DNA with the MspI, and RsaI and NcoI restriction endonucleases. The MspI RFLP is detected by two genomic clones mapping to the 5' end of the gene while the RsaI and NcoI rFLPs are both detected by two genomic clones on the 3' end and also by a full-length cDNA clone of the gene. All three RFLPs are characterized by two alleles. For the MspI RFLP the frequency of both alleles is similar, for the Rsa I and NcoI RFLP one of the alleles is significantly more abundant than the other. These RFLPs are now being used to determine whether any of the alleles correlate with either schizophrenia or affective disorder.

de Miguel, C.; Bonner, T.; Detera-Wadleigh, S.

1987-05-01

52

The use of nested polymerase chain reaction and restriction fragment length polymorphism for the detection and typing of mucosal human papillomaviruses in samples containing low copy numbers of viral DNA.  

PubMed

Mucosal human papillomaviruses (HPVs) that infect the genital area have also been shown to infect the oral cavity. In this study a restriction fragment length polymorphism (RFLP) method was developed on a nested polymerase chain reaction (PCR) product to identify ten high risk HPV types 16, 18, 31, 33, 35, 45, 51, 52, 58 and 59 as well as the low risk HPV 11. HPV DNA was detected in 23/31 (74%) of buccal specimens using a sensitive nested PCR employing degenerate consensus primers (Williamson and Rybicki, 1991). Consensus PCR using the PGMy09/11 primers. was able to detect HPV in only 29% of the specimens that had tested positive using the nested HPV PCR primers. HPV 11 type specific primers detected HPV 11 DNA in only 66% of the specimens showing HPV 11 DNA by means of nested PCR and RFLP. A Genbank search revealed that the PCR primers could detect a wide range of mucosal HPV types including types HPV 70, 72 and 73 which have all been isolated from immunocompromised patients. Of the 23 buccal specimens that were positive for HPV DNA, 13 were single infections, five were dual infections and three were triple infections. The HPV types identified by RFLP were: HPV 11 (18/23), HPV 18 (8/23), HPV 16 (3/23), and HPV 33 (1/23). HPV 13 (2/23) was identified by direct sequencing of the inner amplicon of the PCR product. PMID:12176153

Kay, Patti; Meehan, Kathleen; Williamson, Anna-Lise

2002-08-01

53

Radiation of human mitochondria DNA types analyzed by restriction endonuclease cleavage patterns  

Microsoft Academic Search

Summary Human mitochondrial DNA (mtDNA) restriction endonuclease fragment patterns were analyzed using total blood cell DNA isolated from 200 individuals representing five different populations. Thirty-two fragment patterns (morphs) were observed with the enzymes Hpa I, Bam HI, Hae II, Msp I and Ava II yielding thirty-five different combinations of fragment patterns (mt DNA types). The major ethnic groups exhibit quantitative

M. J. Johnson; D. C. Wallace; S. D. Ferris; M. C. Rattazzi; L. L. Cavalli-Sforza

1983-01-01

54

Genetic Variability Among Isolates and Sexual Offspring of the Plant Pathogenic Fungus Calonectria morganii on the Basis of Random Amplification of Polymorphic DNA (RAPD) and Restriction Fragment Length Polymorphism (RFLP)  

PubMed

Thirty-two strains of the phytopathogenic mold Cylindrocladium scoparium (perfect state Calonectria morganii) isolated from ericaceous hosts and two specimens from the ATCC were examined by random amplification of polymorphic DNA (RAPD) and restriction fragment length polymorphism (RFLP). Five oligonucleotides were chosen as primers for differentiation of the isolates. RAPD patterns of the ATCC strains differed significantly from those of the field isolates. Diversity among field isolates was low. Results obtained in RFLP analysis, with telomere repeats of Neurospora crassa as a probe, were highly consistent with the RAPD data. Isolates were paired in all possible combinations; fertile perithecia occurred in only one combination, from which ascospores were analyzed by formal genetics and RAPD. A bipolar mechanism of homogenic incompatibility was found. Ascospore-derived strains were much more variable than field isolates. Phylogenetic trees suggested a correlation to the host plants from which the strains were isolated. PMID:8824171

Overmeyer; Lunnemann; von Wallbrunn C; Meinhardt

1996-10-01

55

An analysis of population genetic structure and species history of Drosophila melanogaster and Drosophila simulans using restriction fragment length polymorphisms of mitochondrial DNA  

Microsoft Academic Search

Animal mitochondrial DNA (mtDNA) has several features that give it great utility in the study of geographic structure of natural populations. Its small size and covalently closed circular conformation make it easy to purify. Strict maternal inheritance and homoplasmy makes the effective copy number of mtDNA as little as 1\\/4 that of nuclear loci; this renders populational complements of mtDNA

Lawrence Richard Hale

1989-01-01

56

Analysis of restriction fragment length polymorphism in the bovine growth hormone gene related to growth performance and carcass quality of Korean Native Cattle  

Microsoft Academic Search

This research was conducted to find restriction fragment length polymorphism (RFLP) markers related to growth performance and meat quality of Korean Native Cattle. DNA was extracted from the blood of Korean Native Cattle steers and Southern blot analysis of genomic DNA digested with restriction enzymes was performed using a bovine growth hormone (GH) cDNA probe. The restriction enzyme that detected

Yun Jaie Choi; Dae Sung Yim; Jaie Soon Cho; Byung D. Cho; Ki Jun Na; Myung Gi Baik

1997-01-01

57

RESTRICTION FRAGMENT LENGTH POLYMORPHISMS DISTINGUISH ECTOMYCORRHIZAL FUNGI  

EPA Science Inventory

Basidiomycetous fungi, two saprophytes and three mycorrhizal, were used to assess the specificity of DNA hybridization for distinguishing genera from one another. nterspecific comparisons were done with several isolates of mycorrhizal fungi, Laccaria bicolor and L. laccata, colle...

58

Isolation of DNA from agarose gels using DEAE-paper. Application to restriction site mapping of adenovirus type 16 DNA.  

PubMed Central

A new method for isolating DNA from agarose gels is described. The method involves the simultaneous transfer of all DNA-fragments from an agarose slab gel onto DEAE-cellulose paper and the elution of the individual fragments from the paper with 1 M NaCl. DNA isolated from agarose gels in this way is susceptible to cleavage with several restriction endonucleases, and can be labeled in vitro with E coli DNA-polymerase I, T4 DNA-polymerase and T4 polynucleotide kinase. We have used the method to construct restriction endonuclease maps of adenovirus type 16 DNA. Images PMID:6252542

Winberg, G; Hammarskjöld, M L

1980-01-01

59

Extranuclear DNA of a Marine Chromophytic Alga : RESTRICTION ENDONUCLEASE ANALYSIS.  

PubMed

Two extranuclear DNA species have been isolated from the marine alga Olisthodiscus luteus. Rapid lysis of cells followed by the immediate addition of CsCl to the lysate was critical to the preservation of these satellite DNA species. Restriction endonuclease analysis demonstrates a molecular weight of 99 x 10(6) for chloroplast DNA and 23 x 10(6) for a second satellite species. The origin of the second satellite is not known. However, this smaller satellite DNA which originates from a nonnuclear, DNAse insensitive cellular component, displays no sequence homology with ctDNA by hybridization experiments. Constancy of restriction endonuclease fragment patterns of chloroplast and second satellite species during all phases of the growth cycle, whether cultures were maintained synchronously or asynchronously, was demonstrated. PMID:16662368

Aldrich, J; Gelvin, S; Cattolico, R A

1982-05-01

60

The Molecular Basis of Genetic Diversity among Cytoplasms of TRITICUM and AEGILOPS Species. II. on the Origin of Polyploid Wheat Cytoplasms as Suggested by Chloroplast DNA Restriction Fragment Patterns.  

PubMed

In attempts to identify the phylogenetic donors of cytoplasm to Emmer-Dinkel and Timopheevi groups of wheat (Triticum), and the Aegilops kotschyi-Ae. variabilis complex, the restriction fragment patterns of chloroplast DNAs of representative species were compared with those of their putative diploid ancestors. The following seven restriction enzymes were used; BamHI, EcoRI, HindIII, KpnI, PstI, SmaI and XhoI. The restriction fragment patterns of an Emmer and a Dinkel (common) wheat were identical with those of Ae. longissima , and different from those of Ae. aucheri, Ae. bicornis, Ae. searsii, Ae. sharonensis, Ae. speltoides, and T. urartu by 4 to 12 fragments. The restriction fragment patterns of a Timopheevi wheat were identical with those of Ae. aucheri, and different from those of all other diploids by four to nine fragments. The restriction fragment patterns of Ae. variabilis were identical to those of Ae. bicornis and Ae. searsii , and different from those of all other species. Thus, we have concluded that Ae. longissima, Ae. aucheri and Ae. bicornis (or Ae. searsii) were the cytoplasm donors to the Emmer-Dinkel and the Timopheevi groups, and the Ae. kotschyi-Ae. variabilis complex, respectively. A diphyletic origin of Emmer and Timopheevi groups is supported by the present results. PMID:17246126

Tsunewaki, K; Ogihara, Y

1983-05-01

61

The Molecular Basis of Genetic Diversity among Cytoplasms of TRITICUM and AEGILOPS Species. II. on the Origin of Polyploid Wheat Cytoplasms as Suggested by Chloroplast DNA Restriction Fragment Patterns  

PubMed Central

In attempts to identify the phylogenetic donors of cytoplasm to Emmer-Dinkel and Timopheevi groups of wheat (Triticum), and the Aegilops kotschyi-Ae. variabilis complex, the restriction fragment patterns of chloroplast DNAs of representative species were compared with those of their putative diploid ancestors. The following seven restriction enzymes were used; BamHI, EcoRI, HindIII, KpnI, PstI, SmaI and XhoI. The restriction fragment patterns of an Emmer and a Dinkel (common) wheat were identical with those of Ae. longissima , and different from those of Ae. aucheri, Ae. bicornis, Ae. searsii, Ae. sharonensis, Ae. speltoides, and T. urartu by 4 to 12 fragments. The restriction fragment patterns of a Timopheevi wheat were identical with those of Ae. aucheri, and different from those of all other diploids by four to nine fragments. The restriction fragment patterns of Ae. variabilis were identical to those of Ae. bicornis and Ae. searsii , and different from those of all other species. Thus, we have concluded that Ae. longissima, Ae. aucheri and Ae. bicornis (or Ae. searsii) were the cytoplasm donors to the Emmer-Dinkel and the Timopheevi groups, and the Ae. kotschyi-Ae. variabilis complex, respectively. A diphyletic origin of Emmer and Timopheevi groups is supported by the present results. PMID:17246126

Tsunewaki, Koichiro; Ogihara, Yasunari

1983-01-01

62

Restriction fragment polymorphisms as probes for plant diversity and their development as tools for applied plant breeding  

Microsoft Academic Search

Maize and tomato cDNA clones have been hybridized in Southern blotting experiments to plant genomic DNA prepared from different lines to detect restriction fragment polymorphisms (RFPs). In maize we have found that a high degree of genetic variability is present, even among domestic inbred lines. Most randomly chosen maize cDNA clones can be used to detect elements of this variability.

Tim Helentjaris; Gretchen King; Mary Slocum; Chris Siedenstrang; Sharon Wegman

1985-01-01

63

Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis  

EPA Science Inventory

A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

64

Detection of specific sequences among DNA fragments separated by gel electrophoresis  

Microsoft Academic Search

This paper describes a method of transferring fragments of DNA from agarose gels to cellulose nitrate filters. The fragments can then be hybridized to radioactive RNA and hybrids detected by radioautography or fluorography. The method is illustrated by analyses of restriction fragments complementary to ribosomal RNAs from Escherichia coli and Xenopus laevis, and from several mammals.

E. M. Southern

1975-01-01

65

DNA POLYMORPHISM DETECTABLE BY RESTRICTION ENDONUCLEASES  

Microsoft Academic Search

Data on DNA polymorphisms detected by restriction endonucleases are rapidly accumulating. With the aim of analyzing these data, several different measures of nucleon (DNA segment) diversity within and between popula- tions are proposed, and statistical methods for estimating these quantities are developed. These statistical methods are applicable to both nuclear and non- nuclear DNAs. When evolutionary change of nucleons occurs

MASATOSHI NE; FUMIO TAJIMA

1981-01-01

66

Epidemiologic typing of Staphylococcus aureus by DNA restriction fragment length polymorphisms of rRNA genes: elucidation of the clonal nature of a group of bacteriophage-nontypeable, ciprofloxacin-resistant, methicillin-susceptible S. aureus isolates.  

PubMed Central

Analysis of DNA restriction fragment length polymorphisms of rRNA genes (ribotyping) was employed to assist in the epidemiologic investigation of the emergence and spread of ciprofloxacin-resistant Staphylococcus aureus at the Atlanta VA Medical Center because many isolates of interest were nontypeable by phages and harbored few plasmids useful as strain markers. Chromosomal DNAs of selected S. aureus isolates were digested initially with 20 different restriction enzymes. EcoRI appeared to give the best discrimination of hybridization banding patterns (ribotypes) and was used with all study isolates. Overall, 15 different ribotypes were seen among the 50 S. aureus isolates studied (7 ribotypes among 13 methicillin-susceptible S. aureus [MSSA] isolates and 9 ribotypes among 37 methicillin-resistant S. aureus [MRSA] isolates). Seven of eight ciprofloxacin-resistant MSSA (CR-MSSA) patient isolates had identical antibiograms, were nontypeable by phages, and had a single 22-MDa plasmid. Six of these seven CR-MSSA isolates had an identical ribotype pattern. Ribotyping distinguished this CR-MSSA strain or clone from MRSA and other MSSA isolates, including nontypeable isolates that contained a 22-MDa plasmid. Five ciprofloxacin-susceptible MSSA isolates studied had five ribotypes; one pattern was identical to the CR-MSSA clone. Twenty-three CR-MRSA isolates recovered from the Atlanta VA Medical Center had four different ribotypes. Ribotyping proved to be a useful molecular epidemiologic tool in the study of S. aureus because it differentiated isolates which were indistinguishable by more traditional methods. In addition, this technique demonstrated that at our institution, ciprofloxacin resistance emerged in multiple strains of MRSA, as opposed to primarily a single strain or clone of MSSA. Images PMID:1371517

Blumberg, H M; Rimland, D; Kiehlbauch, J A; Terry, P M; Wachsmuth, I K

1992-01-01

67

DNA fragment sizing and sorting by laser-induced fluorescence  

DOEpatents

A method is provided for sizing DNA fragments using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA piece or the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is linearly related to the fragment length. The distribution of DNA fragment sizes forms a characterization of the DNA piece for use in forensic and research applications.

Hammond, Mark L. (Angier, NC); Jett, James H. (Los Alamos, NM); Keller, Richard A. (Los Alamos, NM); Marrone, Babetta L. (Los Alamos, NM); Martin, John C. (Los Alamos, NM)

1996-01-01

68

Brassica taxonomy based on nuclear restriction fragment length polymorphisms (RFLPs)  

Microsoft Academic Search

Restriction fragment length polymorphisms (RFLPs) of nuclear DNAs have been used to explore the origin and evolution of the six cultivated Brassica species. Extensive RFLP variation was found at the species, subspecies and variety levels. Based on RFLP data from Brassica and related genera, a detailed phylogenetic tree was generated using the PAUP microcomputer program, which permits a quantitative analysis

K. M. Song; T. C. Osborn; P. H. Williams

1988-01-01

69

DNA Sequence from Cretaceous Period Bone Fragments  

Microsoft Academic Search

DNA was extracted from 80-million-year-old bone fragments found in strata of the Upper Cretaceous Blackhawk Formation in the roof of an underground coal mine in eastern Utah. This DNA was used as the template in a polymerase chain reaction that amplified and sequenced a portion of the gene encoding mitochondrial cytochrome b. These sequences differ from all other cytochrome b

Scott R. Woodward; Nathan J. Weyand; Mark Bunnell

1994-01-01

70

RNA-Linked DNA Fragments in vitro  

Microsoft Academic Search

RNA-linked DNA fragments are intermediates in DNA replication in Escherichia coli cells made permeable to nucleoside triphosphates by treatment with toluene. Covalent linkage of a short RNA stretch to the 5' end of the DNA is proved by transfer of 32P from [alpha -32P]dNTP to ribonucleotides upon digestion with alkali or pancreatic RNase, and by a small decrease in the

Akio Sugino; Reiji Okazaki

1973-01-01

71

The use of nested polymerase chain reaction and restriction fragment length polymorphism for the detection and typing of mucosal human papillomaviruses in samples containing low copy numbers of viral DNA  

Microsoft Academic Search

Mucosal human papillomaviruses (HPVs) that infect the genital area have also been shown to infect the oral cavity. In this study a restriction fragment length polymorphism (RFLP) method was developed on a nested polymerase chain reaction (PCR) product to identify ten high risk HPV types 16, 18, 31, 33, 35, 45, 51, 52, 58 and 59 as well as the

Patti Kay; Kathleen Meehan; Anna-Lise Williamson

2002-01-01

72

DNA fragmentation by charged particle tracks.  

PubMed

High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons (60Co) or 125 keV/micrometers nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome. PMID:12530431

Stenerlow, B; Hoglund, E; Carlsson, J

2002-01-01

73

Site-specific cleavage of single-stranded DNA by a Hemophilus restriction endonuclease.  

PubMed

Single-stranded viral DNA of bacteriophage f1 is cleaved into specific fragments by endo R-HaeIII, a restriction endonuclease isolated from Hemophilus aegyptius. The sites of the single strand cleavage correspond to those of the double strand cleavage. A single-stranded DNA fragment containing only one HaeIII site is also cleaved by this enzyme. This observation suggests that the reaction of single-stranded DNA cleavage does not require the formation of a symmetrical double-stranded structure that would result from the intramolecular base-pairing between two different HaeIII sites. Other restriction endonucleases may also cleave single-stranded DNA. PMID:1058473

Horiuchi, K; Zinder, N D

1975-07-01

74

Factors affecting SFHR gene correction efficiency with single-stranded DNA fragment  

SciTech Connect

A 606-nt single-stranded (ss) DNA fragment, prepared by restriction enzyme digestion of ss phagemid DNA, improves the gene correction efficiency by 12-fold as compared with a PCR fragment, which is the conventional type of fragment used in the small fragment homologous replacement method [H. Tsuchiya, H. Harashima, H. Kamiya, Increased SFHR gene correction efficiency with sense single-stranded DNA, J. Gene Med. 7 (2005) 486-493]. To reveal the characteristic features of this gene correction with the ss DNA fragment, the effects on the gene correction in CHO-K1 cells of the chain length, 5'-phosphate, adenine methylation, and transcription were studied. Moreover, the possibility that the ss DNA fragment is integrated into the target DNA was examined with a radioactively labeled ss DNA fragment. The presence of methylated adenine, but not the 5'-phosphate, enhanced the gene correction efficiency, and the optimal length of the ss DNA fragment ({approx}600 nt) was determined. Transcription of the target gene did not affect the gene correction efficiency. In addition, the target DNA recovered from the transfected CHO-K1 cells was radioactive. The results obtained in this study indicate that length and adenine methylation were important factors affecting the gene correction efficiency, and that the ss DNA fragment was integrated into the double-stranded target DNA.

Tsuchiya, Hiroyuki [Graduate School of Pharmaceutical Sciences, Hokkaido University, Kita-12, Nishi-6, Sapporo 060-0812 (Japan); CREST, Japan Science and Technology (Japan); Harashima, Hideyoshi [Graduate School of Pharmaceutical Sciences, Hokkaido University, Kita-12, Nishi-6, Sapporo 060-0812 (Japan); CREST, Japan Science and Technology (Japan); Kamiya, Hiroyuki [Graduate School of Pharmaceutical Sciences, Hokkaido University, Kita-12, Nishi-6, Sapporo 060-0812 (Japan) and CREST, Japan Science and Technology (Japan)]. E-mail: hirokam@pharm.hokudai.ac.jp

2005-11-04

75

Use of restriction fragment length polymorphism as a genetic marker for typing Mycobacterium avium strains.  

PubMed Central

Restriction fragment length polymorphism (RFLP) was used to study 75 clinical isolates identified as Mycobacterium avium. Two repetitive insertion sequences, IS1311 and IS900, were used as DNA probes. Although less than 25% of isolates showed RFLP patterns with IS900, all strains gave banding patterns with IS1311. M. avium strains isolated from patients with AIDS exhibited marked polymorphism with both probes. PMID:7615764

Roiz, M P; Palenque, E; Guerrero, C; Garcia, M J

1995-01-01

76

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease.  

PubMed

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed. PMID:15491153

Liang, Xingguo; Jensen, Kari; Frank-Kamenetskii, Maxim D

2004-10-26

77

RNA-Linked DNA Fragments In Vitro*  

PubMed Central

RNA-linked DNA fragments are intermediates in DNA replication in Escherichia coli cells made permeable to nucleoside triphosphates by treatment with toluene. Covalent linkage of a short RNA stretch to the 5? end of the DNA is proved by transfer of 32P from [?-32P]dNTP to ribonucleotides upon digestion with alkali or pancreatic RNase, and by a small decrease in the molecular size upon alkaline hydrolysis. The 32P transfer experiments reveal a unique structure...p(rPy)p(rA)p(rU or rC)p(dC)p... at the RNA-DNA junction. PMID:4567338

Sugino, Akio; Okazaki, Reiji

1973-01-01

78

Mitochondrial DNA restriction map for the mediterranean fruit fly, Ceratitis capitata  

Microsoft Academic Search

Molecular genetic research on the Mediterranean fruit fly,Ceratitis capitata, will provide tools to permit determination of source populations for new pest infestations. Restriction fragment length polymorphism (RFLP) of mitochondrial DNA provides some interpopulation discrimination. A restriction map, including the informative variableEcoRV andXbaI restriction sites, is constructed for the Mediterranean fruit fly, and several restriction sites are associated with specific gene

Bruce A. McPheron; Gail E. Gasparich; Ho-Yeon Han; Gary J. Steck; Walter S. Sheppard

1994-01-01

79

DNA fingerprinting of human cell lines using PCR amplification of fragment length polymorphisms  

Microsoft Academic Search

Summary  Methods for monitoring cell line identification and authentication include species-specific immunofluorescence, isoenzyme\\u000a phenotyping, chromosome analysis, and DNA fingerprinting. Most previous studies of DNA fingerprinting of cell lines have used\\u000a restriction fragment length polymorphism analysis. In this study, we examined the utility of an alternative and simpler method\\u000a of cell line DNA fingerprinting—polymerase chain reaction (PCR) amplification of fragment length polymorphisms.

Rui Yan; Mark Ottenbreit; Bharati Hukku; Michael Mally; Sharong Chou; Joseph Kaplan

1996-01-01

80

Comparative sodium dodecyl sulfate-polyacrylamide gel electrophoresis and restricted fragment length polymorphism among fenugreek accessions.  

PubMed

Protein and DNA polymorphismswere surveyed among seven accessions of wild fenugreek (Trigonellafoenum-graecum L.) to estimate their genetic diversity and relationships. Samples were obtained from diverse ecogeographical areas in Saudi Arabia and Yemen. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of seed storage protein showed genetic variations among fenugreek germplasms, both quantitatively and qualitatively, generating a total of 168 polypeptide bands with different molecular weights ranging from 4.5 to 300 kDa. Twenty-six of these bands were polymorphic, with a considerable polymorphism value (80.00%). Furthermore, restriction fragment length polymorphism (RFLP) analysis was also employed, which was based on the ability of four restriction enzymes (EagI, EcoRI, FspI, and HindIII) to cleave genomic DNA of the plant materials at specific target nucleotide sequences into different numbers of DNA fragments. RFLP analysis revealed 166 fragments with known sequences and variable lengths ranging from 80 to 4000 bp with a highly degree of polymorphism (88.71%). Data derived from SDS-PAGE or RFLP analyses were used to produce dendrograms, which clustered the studied fenugreek accessions into different groups based on the unweighted pair group method with arithmetic mean (UPGMA). The resulting relationships indicated that these two marker techniques were nearly equivalent, but not identical, with respect to phylogenetic information. In conclusion, SDS-PAGE analysis of seed proteins should be augmented with RFLP analysis of DNA for reliable estimates of genetic diversity among fenugreek germplasms. PMID:24338424

Haliem, E A; Al-Huqail, A A

2013-01-01

81

Bacterial Species Determination from DNA-DNA Hybridization by Using Genome Fragments and DNA Microarrays  

Microsoft Academic Search

Whole genomic DNA-DNA hybridization has been a cornerstone of bacterial species determination but is not widely used because it is not easily implemented. We have developed a method based on random genome fragments and DNA microarray technology that overcomes the disadvantages of whole-genome DNA-DNA hybridization. Reference genomes of four fluorescent Pseudomonas species were fragmented, and 60 to 96 genome fragments

JAE-CHANG CHO; JAMES M. TIEDJE

2001-01-01

82

Random DNA fragmentation with endonuclease V: application to DNA shuffling.  

PubMed

The enzyme endonuclease V nicks uracil-containing DNA at the second or third phosphodiester bond 3' to uracil sites. I applied the enzyme to random fragmentation of DNA to revise the complex DNA shuffling protocol. The merit of using endonuclease V is that cleavage occurs at random sites and the length of the fragments can easily be adjusted by varying the concentration of dUTP in the polymerase chain reaction. Unlike the conventional method using DNase I, no partial digestion or gel separation of fragments is required. Therefore, labor is dramatically reduced and reproducibility ensured. I applied this method to recombine two truncated green fluorescent protein (GFP) genes and demonstrated successful DNA shuffling by the appearance of the fluorescent full-length GFP genes. PMID:12490730

Miyazaki, Kentaro

2002-12-15

83

Genetic Algorithms, Operators, and DNA Fragment Assembly  

Microsoft Academic Search

We study different genetic algorithm operators for one permutation problem associated with the Human Genome Project—the assembly of DNA sequence fragments from a parent clone whose sequence is unknown into a consensus sequence corresponding to the parent sequence. The sorted-order representation, which does not require specialized operators, is compared with a more traditional permutation representation, which does require specialized operators.

Rebecca J. Parsons; Stephanie Forrest; Christian Burks

1995-01-01

84

Regional localization of chromosome 3-specific DNA fragments by using a hybrid cell deletion mapping panel.  

PubMed Central

A series of human chromosome 3-specific DNA fragments isolated and characterized from a lamda phage genomic library were regionally localized on human chromosome 3. This was accomplished using filter hybridization blot analysis of a human chromosome 3 hybrid cell deletion mapping panel. Twenty-three new anonymous DNA fragments were assigned to one of four physical regions of chromosome 3. Seventeen DNA fragments were mapped to the long arm of chromosome 3, including one DNA fragment that demonstrated a restriction fragment length polymorphism (RFLP). Five DNA fragments were assigned to 3p14.2----pter, including one highly polymorphic fragment sublocalized at 3p25----pter by in situ hybridization. This DNA fragment is the second reported distal 3p polymorphic probe. One DNA fragment was localized to 3p14----p14.2. In addition, three fragments previously assigned to chromosome 3 were confirmed. Polymorphic DNA probes DNF15S2 (formerly D1S1) and D3S2 were mapped to 3p14.2----pter. The previous 3p25 in situ localization of the c-raf-1 oncogene was supported by deletion panel mapping. The physical localization of these twenty-three new DNA fragments has more than doubled the number of cloned DNA fragments assigned to chromosome 3. These and future regional assignments of DNA fragment probes will facilitate construction of both a physical and genetic linkage map of chromosome 3. They may also be useful in characterizing the chromosomal and molecular aberrations involved in small-cell lung cancer (SCLC), renal cell carcinoma, other malignancies, and the 3p14.2 common fragile site. Images p[446]-a Figure 2 Figure 3 PMID:2902784

Gerber, M J; Drabkin, H A; Firnhaber, C; Miller, Y E; Scoggin, C H; Smith, D I

1988-01-01

85

Polymerase chain reaction-restriction fragment length polymorphism authentication of raw meats from game birds.  

PubMed

Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis has been applied to the identification of meats from quail (Coturnix coturnix), pheasant (Phasianus colchicus), red-legged partridge (Alectoris rufa), guinea fowl (Numida meleagris), capercaillie (Tetrao urogallus), Eurasian woodcock (Scolopax rusticola), woodpigeon (Columba palumbus), and song thrush (Turdus philomelos). PCR amplification was performed using a set of primers flanking a conserved region of approximately 720 base pairs (bp) from the mitochondrial 12S rRNA gene. Restriction site analysis based on sequence data from this DNA fragment permitted the selection of AluI and BfaI endonucleases for species identification. The restriction profiles obtained when amplicons were digested with the chosen enzymes allowed the unequivocal identification of all game bird species analyzed. However, the use of the PCR-RFLP technique described is limited to raw meat authentication. It is not suitable for cooked products because thermal treatment strongly accelerates DNA degradation leading to difficulties in amplifying the 720 bp fragment. PMID:19202803

Rojas, María; González, Isabel; Fajardo, Violeta; Martín, Irene; Hernández, Pablo E; García, Teresa; Martín, Rosario

2008-01-01

86

Reconstructing DNA replication kinetics from small DNA fragments  

NASA Astrophysics Data System (ADS)

In higher organisms, DNA replicates simultaneously from many origins. Recent in vitro experiments have yielded large amounts of data on the state of replication of DNA fragments. From measurements of the time dependence of the average size of replicated and nonreplicated domains, one can estimate the rate of initiation of DNA replication origins, as well as the average rate at which DNA bases are copied. One problem in making such estimates is that, in the experiments, the DNA is broken up into small fragments, whose finite size can bias downward the measured averages. Here, we present a systematic way of accounting for this bias by deriving theoretical relationships between the original domain-length distributions and fragment-domain length distributions. We also derive unbiased average-domain-length estimators that yield accurate results, even in cases where the replicated (or nonreplicated) domains are larger than the average DNA fragment. Then we apply these estimators to previously obtained experimental data to extract improved estimates of replication kinetics parameters.

Zhang, Haiyang; Bechhoefer, John

2006-05-01

87

Model for how type I restriction enzymes select cleavage sites in DNA  

Microsoft Academic Search

Under appropriate conditions, digestion of phage T7 DNA by the type I restriction enzyme EcoK produces an orderly progression of discrete DNA fragments. All details of the fragmentation pattern can be explained on the basis of the known properties of type I enzymes, together with two further assumptions: (i) in the ATP-stimulated translocation reaction, the enzyme bound at the recognition

F. W. Studier; P. K. Bandyopadhyay

1988-01-01

88

Differentiation of egg drop syndrome virus isolates by restriction endonuclease analysis of virus dna  

Microsoft Academic Search

Thirteen isolates of egg drop syndrome (EDS) virus were compared by restriction endonuclease analysis of the virus DNA. One virus, an Australian chicken isolate, was distinguished from the others using the endonucleases EcoRl, BamUl, Kpnl, Hindlll, Pstl and Pvull, all of which recognise six base pair DNA sequences. Polyacrylamide gel restriction fragment patterns generated by Haelll, Hhall and TaqI, which

D. Todd; M. S. McNulty; Joan A. Smyth

1988-01-01

89

Specific fragments of phi X174 deoxyribonucleic acid produced by a restriction enzyme from Haemophilus aegyptius, endonuclease Z.  

PubMed

A restriction-like enzyme has been purified from Haemophilus aegyptius. This nuclease, endonuclease Z, produces a rapid decrease in the viscosity of native calf thymus and H. influenzae deoxyribonucleic acids (DNA), but does not degrade homologous DNA. The specificity of endonuclease Z is different from that of the similar endonuclease isolated from H. influenzae (endonuclease R). The purified enzyme cleaves the double-stranded replicative form DNA of bacteriophage phiX174 (phiX174 RF DNA) into at least 11 specific limit fragments whose molecular sizes have been estimated by gel electrophoresis. The position of these fragments with respect to the genetic map of phiX174 can be determined by using the genetic assay for small fragments of phiX174 DNA. PMID:4537735

Middleton, J H; Edgell, M H; Hutchison, C A

1972-07-01

90

Inverted Repeated DNA from Chinese Hamster Ovary cells Studied with Cloned DNA Fragments  

Microsoft Academic Search

Fragments from the DNA of Chinese hamster ovary cells produced by restriction endonuclease EcoRI were cloned in Charon 16A lambda bacteriophage and examined for the ability to hybridize in situ with 32P-labeled double-stranded regions from heterogeneous nuclear RNA (hnRNA). Of 235 clones tested, 87 (37%) contained sequences that hybridized with the double-stranded hnRNA. Nine of these were examined for the

Warren R. Jelinek

1978-01-01

91

DNA fragment sizing and sorting by laser-induced fluorescence  

SciTech Connect

A method is provided for obtaining DNA fingerprints using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a selected sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is directly proportional to the fragment length. Additional dyes can be bound to the DNA piece and DNA fragments to provide information additional to length information. Oligonucleotide specific dyes and/or hybridization probes can be bound to the DNA fragments to provide information on oligonucleotide distribution or probe hybridization to DNA fragments of different sizes.

Jett, J.H.; Hammond, M.L.; Keller, R.A.; Marrone, B.L.; Martin, J.C.

1992-12-31

92

Identification of Infectious Agents in Onychomycoses by PCR-Terminal Restriction Fragment Length Polymorphism  

PubMed Central

A fast and reliable assay for the identification of dermatophyte fungi and nondermatophyte fungi (NDF) in onychomycosis is essential, since NDF are especially difficult to cure using standard treatment. Diagnosis is usually based on both direct microscopic examination of nail scrapings and macroscopic and microscopic identification of the infectious fungus in culture assays. In the last decade, PCR assays have been developed for the direct detection of fungi in nail samples. In this study, we describe a PCR-terminal restriction fragment length polymorphism (TRFLP) assay to directly and routinely identify the infecting fungi in nails. Fungal DNA was easily extracted using a commercial kit after dissolving nail fragments in an Na2S solution. Trichophyton spp., as well as 12 NDF, could be unambiguously identified by the specific restriction fragment size of 5?-end-labeled amplified 28S DNA. This assay enables the distinction of different fungal infectious agents and their identification in mixed infections. Infectious agents could be identified in 74% (162/219) of cases in which the culture results were negative. The PCR-TRFLP assay described here is simple and reliable. Furthermore, it has the possibility to be automated and thus routinely applied to the rapid diagnosis of a large number of clinical specimens in dermatology laboratories. PMID:22170903

Verrier, Julie; Pronina, Marina; Peter, Corinne; Bontems, Olympia; Fratti, Marina; Salamin, Karine; Schürch, Stéphanie; Gindro, Katia; Wolfender, Jean-Luc; Harshman, Keith

2012-01-01

93

The nucleotide sequence of two restriction fragments located in the gene AB region of bacteriophage S13.  

PubMed

The nucleotide sequence of a double stranded DNA fragment from the gene AB region of bacteriophage S13 DNA has been determined. The fragment was isolated as two adjacent shorter fragments by cleavage of S13 replicative form (RF) DNA with restriction endonuclease III from Hemophilus aegyptius. The strands of the fragments were separated electrophoretically and hydrolyzed with T4 endonuclease IV to yield short oligonucleotides which were then sequenced by partial exonuclease digestion. The complete nucleotide sequence of the restriction fragments was obtained by ordering the inter- and intrastrand overlapping oligonucleotide sequences. The adjacent fragments were 190 nucleotides in length. The sequences included a HindII site, an AluI site and two sequences which may be possible transcription initiation sequences, one with an adjacent sequence homologous to the canonical promoter site sequence T-A-T-Pu-A-T-Pu. Examination of the three possible reading frames for translation of the sequence revealed only one possible complete translation product. The postulated partial sequence of gene A protein has a highly positively charged arginine-rich area which may have importance in DNA binding. PMID:909772

Grosveld, F G; Spencer, J H

1977-07-01

94

MINI-REVIEW Advances in the use of terminal restriction fragment length  

E-print Network

enzyme digests greatly facilitate the choice of primers and restriction enzymes for T-RFLP analysisMINI-REVIEW Advances in the use of terminal restriction fragment length polymorphism (T restriction fragment length polymor- phism (T-RFLP) analysis is a popular high-throughput fingerprinting

Abdo, Zaid

95

MINI-REVIEW Advances in the use of terminal restriction fragment length  

E-print Network

enzyme digests greatly facilitate the choice of primers and restriction enzymes for T-RFLP analysisMINI-REVIEW Advances in the use of terminal restriction fragment length polymorphism (T-Verlag 2008 Abstract Terminal restriction fragment length polymor- phism (T-RFLP) analysis is a popular high

Forney, Larry J.

96

Optical selection and collection of DNA fragments  

DOEpatents

Optical selection and collection of DNA fragments. The present invention includes the optical selection and collection of large (>.mu.g) quantities of clonable, chromosome-specific DNA from a sample of chromosomes. Chromosome selection is based on selective, irreversible photoinactivation of unwanted chromosomal DNA. Although more general procedures may be envisioned, the invention is demonstrated by processing chromosomes in a conventional flow cytometry apparatus, but where no droplets are generated. All chromosomes in the sample are first stained with at least one fluorescent analytic dye and bonded to a photochemically active species which can render chromosomal DNA unclonable if activated. After passing through analyzing light beam(s), unwanted chromosomes are irradiated using light which is absorbed by the photochemically active species, thereby causing photoinactivation. As desired chromosomes pass this photoinactivation point, the inactivating light source is deflected by an optical modulator; hence, desired chromosomes are not photoinactivated and remain clonable. The selection and photoinactivation processes take place on a microsecond timescale. By eliminating droplet formation, chromosome selection rates 50 times greater than those possible with conventional chromosome sorters may be obtained. Thus, usable quantities of clonable DNA from any source thereof may be collected.

Roslaniec, Mary C. (Los Alamos, NM); Martin, John C. (Los Alamos, NM); Jett, James H. (Los Alamos, NM); Cram, L. Scott (Los Alamos, NM)

1998-01-01

97

Analysis of simian virus 40 DNA with the restriction enzyme of Haemophilus aegyptius, endonuclease Z.  

PubMed

Limited digestion of simian virus 40 (SV40) DNA from both small- and large- plaque strains with the restriction endonuclease Z from Haemophilus aegyptius yielded 10 specific fragments. The number of nucleotide pairs for each fragment, determined by co-electrophoresis with phiX174 RF fragments produced by endonuclease Z, ranges from 2,050 to 80. The difference in the pattern between the large- and small-plaque strains is the disappearance of one fragment containing approximately 255 nucleotide pairs and the appearance of a new fragment with 145 nucleotide pairs. This finding can be explained either by deletions or insertions totaling 110 nucleotide pairs. Complementary RNA synthesized in vitro from the adeno-SV40 hybrid virus, strain ND-1, hybridized preferentially to four of the fragments of SV40 DNA. PMID:4349491

Huang, E S; Newbold, J E; Pagano, J S

1973-04-01

98

IS1245 Restriction Fragment Length Polymorphism Typing of Mycobacterium avium Isolates: Proposal for Standardization  

PubMed Central

Mycobacterium avium has become a major human pathogen, primarily due to the emergence of the AIDS epidemic. Restriction fragment length polymorphism (RFLP) typing, using insertion sequence IS1245 as a probe, provides a powerful tool in the molecular epidemiology of M. avium-related infections and will facilitate well-founded studies into the sources of M. avium infections in animal and environmental reservoirs. The standardization of this technique allows computerization of IS1245 RFLP patterns for comparison on a local level and the establishment of M. avium DNA fingerprint databases for interlaboratory comparison. Moreover, by combining international DNA typing results of M. avium complex isolates from a broad spectrum of sources, long-lasting questions on the epidemiology of this major agent of mycobacterial infections will be answered. PMID:9738067

van Soolingen, Dick; Bauer, Jeanett; Ritacco, Viviana; Leão, Sylvia Cardoso; Pavlik, Ivo; Vincent, Veronique; Rastogi, Nalin; Gori, Andrea; Bodmer, Thomas; Garzelli, Carlo; Garcia, Maria J.

1998-01-01

99

Allopatric Origin of Sympatric Populations of Lake Whitefish (Coregonus clupeaformis) as Revealed by Mitochondrial-DNA Restriction Analysis  

Microsoft Academic Search

Abstract.-In the paper, restriction-fragment length polymorphisms in mitochondria1 DNA (mtDNA) were studied to test the hypothesis that sympatric populations of lake whitefish in the Allegash basin have recently diverged through sympatric speciation. Thirteen restriction enzymes were used to analyze mtDNA of 1 56 specimens representing 1 3 populations from eastern Canada and northern Maine where normal,and dwarf phenotypes,of whitefish exist

Louis Bernatchez; Julian J. Dodson

2007-01-01

100

A method for selective PCR-amplification of genomic DNA fragments (SAGF method)  

SciTech Connect

A method is suggested for dividing into individual sets of the complex mixtures of fragments obtained by DNA cleavage with type IIS and IIN restriction endonucleases producing single-stranded termini with different sequences at the DNA fragment ends. The method is based on the ligation of short double-stranded adapters with single-stranded ends complementary to termini of the selected set of fragments followed by PCR-amplification with the primer representing one of the adapter chains. Using endonucleases BcoKI and Bli736I, recognizing sequences CTCTTC and GGTCTC and producing three- and four nucleotide 5{prime}-termini, respectively, it has been shown that amplification of a set of fragments occurs only upon attachment of the adapters to the DNA fragments with DNA-ligase. Several possible applications of the SAGF method are suggested: obtaining individual bands in DNA fingerprinting; reducing the kinetic complexity of DNA in representative difference analysis (RDA method) of complex genomes; cataloging of DNA fragments; construction of physical genome maps. 13 refs., 3 figs., 2 tabs.

Zheleznaya, L.A.; Menzenyuk, O.Y. [Institute of Theoretical and Experimental Biophysics, Pushchino (Russian Federation); Matvienko, N.N. [Branch of Shemyakin and Ovchinnikov Institute of Bioorganic, Pushchino (Russian Federation); Matvienko, N.I. [Institute of Protein Research, Pushchino (Russian Federation)

1995-09-01

101

THE USE OF RESTRICTION ENDONUCLEASES TO MEASURE MITOCHONDRIAL DNA SEQUENCE RELATEDNESS IN NATURAL POPULATIONS. I. POPULATION STRUCTURE AND EVOLUTION IN THE GENUS PEROMYSCUS  

Microsoft Academic Search

In this study we introduce to natural population analysis a molecular tech- nique that involves the use of restriction endonucleases to compare mitochon- drial DNA (mtDNA) sequences. We have examined the fragment patterns produced by six restriction endonucleases acting upon mtDNA isolated from 23 samples of three species of the rodent Peromyscus. Our observations confirm the following conclusions derived from

JOHN C. AVISE; ROBERT A. LANSMAN

102

Stacking Interactions in Denaturation of DNA Fragments  

E-print Network

A mesoscopic model for heterogeneous DNA denaturation is developed in the framework of the path integral formalism. The base pair stretchings are treated as one-dimensional, time dependent paths contributing to the partition function. The size of the paths ensemble, which measures the degree of cooperativity of the system, is computed versus temperature consistently with the model potential physical requirements. It is shown that the ensemble size strongly varies with the molecule backbone stiffness providing a quantitative relation between stacking and features of the melting transition. The latter is an overall smooth crossover which begins from the \\emph{adenine-thymine} rich portions of the fragment. The harmonic stacking coupling shifts, along the $T$-axis, the occurrence of the multistep denaturation but it does not change the character of the crossover. The methods to compute the fractions of open base pairs versus temperature are discussed: by averaging the base pair displacements over the path ensemb...

Zoli, Marco

2011-01-01

103

Combination of native and denaturing PAGE for the detection of protein binding regions in long fragments of genomic DNA  

PubMed Central

Background In a traditional electrophoresis mobility shift assay (EMSA) a 32P-labeled double-stranded DNA oligonucleotide or a restriction fragment bound to a protein is separated from the unbound DNA by polyacrylamide gel electrophoresis (PAGE) in nondenaturing conditions. An extension of this method uses the large population of fragments derived from long genomic regions (approximately 600 kb) for the identification of fragments containing protein binding regions. With this method, genomic DNA is fragmented by restriction enzymes, fragments are amplified by PCR, radiolabeled, incubated with nuclear proteins and the resulting DNA-protein complexes are separated by two-dimensional PAGE. Shifted DNA fragments containing protein binding sites are identified by using additional procedures, i. e. gel elution, PCR amplification, cloning and sequencing. Although the method allows simultaneous analysis of a large population of fragments, it is relatively laborious and can be used to detect only high affinity protein binding sites. Here we propose an alternative and straightforward strategy which is based on a combination of native and denaturing PAGE. This strategy allows the identification of DNA fragments containing low as well as high affinity protein binding regions, derived from genomic DNA (<10 kb) of known sequence. Results We have combined an EMSA-based selection step with subsequent denaturing PAGE for the localization of protein binding regions in long (up to10 kb) fragments of genomic DNA. Our strategy consists of the following steps: digestion of genomic DNA with a 4-cutter restriction enzyme (AluI, BsuRI, TruI, etc), separation of low and high molecular weight fractions of resultant DNA fragments, 32P-labeling with Klenow polymerase, traditional EMSA, gel elution and identification of the shifted bands (or smear) by denaturing PAGE. The identification of DNA fragments containing protein binding sites is carried out by running the gel-eluted fragments alongside with the full "spectrum" of initial restriction fragments of known size. Here the strategy is used for the identification of protein-binding regions in the 5' region of the rat p75 neurotrophin receptor (p75NTR) gene. Conclusion The developed strategy is based on a combination of traditional EMSA and denaturing PAGE for the identification of protein binding regions in long fragments of genomic DNA. The identification is straightforward and can be applied to shifted bands corresponding to stable DNA-protein complexes as well as unstable complexes, which undergo dissociation during electrophoresis. PMID:18533036

Kaer, Kristel; Mätlik, Kert; Metsis, Madis; Speek, Mart

2008-01-01

104

Paternal inheritance of plastids in interspecific hybrids of the genus Actinidia revealed by PCR-amplification of chloroplast DNA fragments  

Microsoft Academic Search

RFLPs (restriction fragment length polymorphisms) of PCR (polymerase chain reaction) -amplified fragments were used to trace the pattern of plastid DNA inheritance in the genus Actinidia. A total of 51 progeny originating from interspecific crosses between three A. arguta cultivars and A. deliciosa, the kiwifruit, and 12 progeny originating from the cross between A. kolomikta and A. chinensis were analysed

Guido Cipriani; Raffaele Testolin; Michele Morgante

1995-01-01

105

Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods  

PubMed Central

Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based) were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR). Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA. PMID:23406353

2013-01-01

106

A Mechanism of Gene Amplification Driven by Small DNA Fragments  

PubMed Central

DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s). Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA) occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB) external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation in nature. PMID:23271978

Mukherjee, Kuntal; Storici, Francesca

2012-01-01

107

Stacking Interactions in Denaturation of DNA Fragments  

E-print Network

A mesoscopic model for heterogeneous DNA denaturation is developed in the framework of the path integral formalism. The base pair stretchings are treated as one-dimensional, time dependent paths contributing to the partition function. The size of the paths ensemble, which measures the degree of cooperativity of the system, is computed versus temperature consistently with the model potential physical requirements. It is shown that the ensemble size strongly varies with the molecule backbone stiffness providing a quantitative relation between stacking and features of the melting transition. The latter is an overall smooth crossover which begins from the \\emph{adenine-thymine} rich portions of the fragment. The harmonic stacking coupling shifts, along the $T$-axis, the occurrence of the multistep denaturation but it does not change the character of the crossover. The methods to compute the fractions of open base pairs versus temperature are discussed: by averaging the base pair displacements over the path ensemble we find that such fractions signal the multisteps of the transition in good agreement with the indications provided by the specific heat plots.

Marco Zoli

2011-06-21

108

In vivo cleavage of cytosine-containing bacteriophage T4 DNA to genetically distinct, discretely sized fragments  

SciTech Connect

Mutants of bacteriophage T4D that are defective in genes 42 (dCMP hydroxymethylase), 46 (DNA exonuclease), and 56 (dCTPase) produce limited amounts of phage DNA in Escherichia coli B. In this DNA, glucosylated 5-hydroxymethylcytosine is completely replaced by cytosine. It is found that this DNA rapidly becomes fragmented in vivo to at least 16 discrete bands as visualized on agarose gels subjected to electrophoresis. The sizes of the fragments ranged from more than 20 to less than 2 kilobase pairs. When DNAs from two of these bands were radioactively labeled in vitro by nick translation and hybridized to XbaI restiction fragments of cytosine-containing T4 DNA, evidence was obtained that the two bands are genetically distinct, i.e., they contain DNA from different parts of the T4 genome. Mutational inactivation of T4 endonuclease II (gene denA) prevented the fragmentation. Three different mutations in T4 endonuclease IV (gene denB) caused the same minor changes in the pattern of fragments. It is concluded that T4 endonuclease II is required, and endonuclease IV is involved to a minor extent, in the in vivo production of these cytosine-containing T4 DNA fragments. These DNA fragments are viewed as ''restriction fragments'' since they represent degradation products of DNA ''foreign'' to T4, they are of discrete size, and they are genetically distinct.

Carlson, K.; Wiberg, J.S.

1983-10-01

109

Comparison of Control Region Sequencing and Fragment RFLP Analysis for Resolving Mitochondrial DNA Variation and Phylogenetic Relationships among Great Lakes Walleyes  

Microsoft Academic Search

Direct sequencing of 513 base pairs from the control region and restriction fragment length polymorphisms (RFLP) in two fragments totaling 7.6 kilobases (fragment RFLP) that were amplified by polymerase chain reaction were used to assess mitochondrial DNA (mtDNA) variation in Great Lakes walleye Stizostedion vitreum. Our objective was to determine the effectiveness of these mtDNA markers in detecting genetic variation

Michael H. Gatt; Moira M. Ferguson; Arunas P. Liskauskas

2000-01-01

110

Bacterial natural transformation by highly fragmented and damaged DNA  

PubMed Central

DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often <100 bp) and may persist in the environment for more than half a million years. Fragmented DNA is recognized as nutrient source for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (?20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations generated by uptake of short DNA fragments escape mismatch repair. Moreover, double-nucleotide polymorphisms appear more common among genomes of transformable than nontransformable bacteria. Our findings reveal that short and damaged, including truly ancient, DNA molecules, which are present in large quantities in the environment, can be acquired by bacteria through natural transformation. Our findings open for the possibility that natural genetic exchange can occur with DNA up to several hundreds of thousands years old. PMID:24248361

Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic A. A.; Mayar, J. Victor Moreno; Rasmussen, Simon; Dahl, Tais W.; Rosing, Minik T.; Poole, Anthony M.; Sicheritz-Ponten, Thomas; Brunak, Søren; Inselmann, Sabrina; de Vries, Johann; Wackernagel, Wilfried; Pybus, Oliver G.; Nielsen, Rasmus; Johnsen, Pål Jarle; Nielsen, Kaare Magne; Willerslev, Eske

2013-01-01

111

Bacterial natural transformation by highly fragmented and damaged DNA.  

PubMed

DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often <100 bp) and may persist in the environment for more than half a million years. Fragmented DNA is recognized as nutrient source for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (? 20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations generated by uptake of short DNA fragments escape mismatch repair. Moreover, double-nucleotide polymorphisms appear more common among genomes of transformable than nontransformable bacteria. Our findings reveal that short and damaged, including truly ancient, DNA molecules, which are present in large quantities in the environment, can be acquired by bacteria through natural transformation. Our findings open for the possibility that natural genetic exchange can occur with DNA up to several hundreds of thousands years old. PMID:24248361

Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic A A; Mayar, J Victor Moreno; Rasmussen, Simon; Dahl, Tais W; Rosing, Minik T; Poole, Anthony M; Sicheritz-Ponten, Thomas; Brunak, Søren; Inselmann, Sabrina; de Vries, Johann; Wackernagel, Wilfried; Pybus, Oliver G; Nielsen, Rasmus; Johnsen, Pål Jarle; Nielsen, Kaare Magne; Willerslev, Eske

2013-12-01

112

A germline TaqI restriction fragment length polymorphism in the progesterone receptor gene in ovarian carcinoma.  

PubMed Central

Clinical outcome in ovarian carcinoma is predicted by progesterone receptor status, indicating an endocrine aspect to this disease. Peripheral leucocyte genomic DNAs were obtained from 41 patients with primary ovarian carcinoma and 83 controls from Ireland, as well as from 26 primary ovarian carcinoma patients and 101 controls in Germany. Southern analysis using a human progesterone receptor (hPR) cDNA probe identified a germline TaqI restriction fragment length polymorphism (RFLP) defined by two alleles: T1, represented by a 2.7 kb fragment; and T2, represented by a 1.9 kb fragment and characterised by an additional TaqI restriction site with respect to T1. An over-representation of T2 in ovarian cancer patients compared with controls in the pooled Irish/German population (P < 0.025) was observed. A difference (P < 0.02) in the distribution of the RFLP genotypes between Irish and German control populations was also observed. The allele distributions could not be shown to differ significantly from Hardy-Weinberg distribution in any subgroup. Using hPR cDNA region-specific probes, the extra TaqI restriction site was mapped to intron G of the hPR gene. Images Figure 2 Figure 3 Figure 4 PMID:7880723

McKenna, N. J.; Kieback, D. G.; Carney, D. N.; Fanning, M.; McLinden, J.; Headon, D. R.

1995-01-01

113

Intermediate DNA at low added salt: DNA bubbles slow the diffusion of short DNA fragments  

E-print Network

We report a study of DNA (150 bp fragments) conformations in very low added salt $DNA concentration range $0.0015\\leq c \\leq 8$~mM (bp). We found an intermediate DNA conformation in the region $0.05 DNA has the diffusion coefficient, $D_p$ reduced below the values for both ssDNA coils and native dsDNA helices of similar polymerization degree $N$. Thus, this DNA population can not be a simple mix of dsDNA and of ssDNA which results from DNA melting. Here, melting occurs due to a reduction in screening concomitant with DNA concentration being reduced, in already very low salt conditions. The intermediate DNA is rationalized through the well known concept of fluctuational openings (DNA bubbles) which we postulate to form in AT-rich portions of the sequence, without the strands coming apart. Within the bubbles, DNA is locally stretched, while the whole molecule remains rod-like due to very low salt environment. Therefore, such intermediate DNA is elongated, in comparison to dsDNA, which accounts for its reduced $D_p$.

Tomislav Vuletic; Sanja Dolanski Babic; Ticijana Ban; Joachim Raedler; Francoise Livolant; Silvia Tomic

2011-01-05

114

Model for how type I restriction enzymes select cleavage sites in DNA  

SciTech Connect

Under appropriate conditions, digestion of phage T7 DNA by the type I restriction enzyme EcoK produces an orderly progression of discrete DNA fragments. All details of the fragmentation pattern can be explained on the basis of the known properties of type I enzymes, together with two further assumptions: (i) in the ATP-stimulated translocation reaction, the enzyme bound at the recognition sequence translocates DNA toward itself from both directions simultaneously; and (ii) when translocation causes neighboring enzymes to meet, they cut the DNA between them. The kinetics of digestion at 37{degree}C indicates that the rate of translocation of DNA from each side of a bound enzyme is about 200 base pairs per second, and the cuts are completed within 15-25 sec of the time neighboring enzymes meet. The resulting DNA fragments each contain a single recognition site with an enzyme (or subunit) remaining bound to it. At high enzyme concentrations, such fragments can bu further degraded, apparently by cooperation between the specifically bound and excess enzymes. This model is consistent with a substantial body of previous work on the nuclease activity of EcoB and EcoK, and it explains in a simple way how cleavage sites are selected.

Studier, F.W.; Bandyopadhyay, P.K. (Brookhaven National Laboratory, Upton, NY (USA))

1988-07-01

115

Restriction enzyme-mediated DNA integration in Coprinus cinereus  

Microsoft Academic Search

Restriction enzyme-mediated DNA integration (REMI) has recently received attention as a new technique for the generation of mutants by transformation in fungi.\\u000a Here we analyse this method in the basidiomycete Coprinus cinereus using the homologous pab1 gene as a selectable marker and the restriction enzymes BamHI, EcoRI and PstI. Addition of restriction enzymes to transformation mixtures results in an earlier

J. D. Granado; K. Kertesz-Chaloupková; M. Aebi; U. Kües

1997-01-01

116

NEBcutter: a program to cleave DNA with restriction enzymes  

Microsoft Academic Search

NEBcutter, version 1.0, is a program available via a web server (http:\\/\\/tools.neb.com\\/NEBcutter) that will accept an input DNA sequence andprod uce a comprehensive report of the restriction enzymes that will cleave the sequence. It produces a variety of outputs including restriction enzyme maps, theore- tical digests and links into the restriction enzyme database, REBASE (http:\\/\\/www.neb.com\\/rebase). Importantly, its table of recognition

Tamas Vincze; Janos Posfai; Richard J. Roberts

2003-01-01

117

Advanced microinstrumentation for rapid DNA sequencing and large DNA fragment separation  

SciTech Connect

Our efforts to develop novel technology for a rapid DNA sequencer and large fragment analysis system based upon gel electrophoresis are described. We are using microfabrication technology to build dense arrays of high speed micro electrophoresis lanes that will ultimately increase the sequencing rate of DNA by at least 100 times the rate of current sequencers. We have demonstrated high resolution DNA fragment separation needed for sequencing in polyacrylamide microgels formed in glass microchannels. We have built prototype arrays of microchannels having up to 48 channels. Significant progress has also been made in developing a sensitive fluorescence detection system based upon a confocal microscope design that will enable the diagnostics and detection of DNA fragments in ultrathin microchannel gels. Development of a rapid DNA sequencer and fragment analysis system will have a major impact on future DNA instrumentation used in clinical, molecular and forensic analysis of DNA fragments.

Balch, J.; Davidson, J.; Brewer, L.; Gingrich, J.; Koo, J.; Mariella, R.; Carrano, A.

1995-01-25

118

A Computer-Simulated Restriction Fragment Length Polymorphism Analysis of Bacterial Small-Subunit rRNA Genes: Efficacy of Selected Tetrameric Restriction Enzymes for Studies of Microbial Diversity in Nature  

Microsoft Academic Search

An assessment of 10 tetrameric restriction enzymes (TREs) was conducted by using a computer-simulated restriction fragment length polymorphism (RFLP) analysis for over 100 proximally and distally related bacterial small-subunit (SSU) rRNA gene sequences. Screening SSU rDNA clone libraries with TREs has become an effective strategy because of logistic simplicity, commercial availability, and economy. However, the rationale for selecting the type

CRAIG L. MOYER; JAMES M. TIEDJE; FRED C. DOBBS; ANDDAVID M. KARL

119

Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene.  

PubMed

An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA. PMID:24821056

Soares, Vítor Yamashiro Rocha; Silva, Jailthon Carlos da; Silva, Kleverton Ribeiro da; Pires e Cruz, Maria do Socorro; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

2014-06-01

120

Brassica taxonomy based on nuclear restriction fragment length polymorphisms (RFLPs)  

Microsoft Academic Search

RFLPs were used to study genome evolution and phylogeny in Brassica and related genera. Thirtyeight accessions, including 10 accessions of B. rapa (syn. campestris), 9 cultivated types of B. oleracea, 13 nine-chromosome wild brassicas related to B. oleracea, and 6 other species in Brassica and allied genera, were examined with more then 30 random genomic DNA probes, which identified RFLPs

K. Song; T. C. Osborn; P. H. Williams

1990-01-01

121

Web-Based Phylogenetic Assignment Tool for Analysis of Terminal Restriction Fragment Length Polymorphism Profiles of Microbial Communities  

PubMed Central

Culture-independent DNA fingerprints are commonly used to assess the diversity of a microbial community. However, relating species composition to community profiles produced by community fingerprint methods is not straightforward. Terminal restriction fragment length polymorphism (T-RFLP) is a community fingerprint method in which phylogenetic assignments may be inferred from the terminal restriction fragment (T-RF) sizes through the use of web-based resources that predict T-RF sizes for known bacteria. The process quickly becomes computationally intensive due to the need to analyze profiles produced by multiple restriction digests and the complexity of profiles generated by natural microbial communities. A web-based tool is described here that rapidly generates phylogenetic assignments from submitted community T-RFLP profiles based on a database of fragments produced by known 16S rRNA gene sequences. Users have the option of submitting a customized database generated from unpublished sequences or from a gene other than the 16S rRNA gene. This phylogenetic assignment tool allows users to employ T-RFLP to simultaneously analyze microbial community diversity and species composition. An analysis of the variability of bacterial species composition throughout the water column in a humic lake was carried out to demonstrate the functionality of the phylogenetic assignment tool. This method was validated by comparing the results generated by this program with results from a 16S rRNA gene clone library. PMID:14602639

Kent, Angela D.; Smith, Dan J.; Benson, Barbara J.; Triplett, Eric W.

2003-01-01

122

Web-based phylogenetic assignment tool for analysis of terminal restriction fragment length polymorphism profiles of microbial communities.  

PubMed

Culture-independent DNA fingerprints are commonly used to assess the diversity of a microbial community. However, relating species composition to community profiles produced by community fingerprint methods is not straightforward. Terminal restriction fragment length polymorphism (T-RFLP) is a community fingerprint method in which phylogenetic assignments may be inferred from the terminal restriction fragment (T-RF) sizes through the use of web-based resources that predict T-RF sizes for known bacteria. The process quickly becomes computationally intensive due to the need to analyze profiles produced by multiple restriction digests and the complexity of profiles generated by natural microbial communities. A web-based tool is described here that rapidly generates phylogenetic assignments from submitted community T-RFLP profiles based on a database of fragments produced by known 16S rRNA gene sequences. Users have the option of submitting a customized database generated from unpublished sequences or from a gene other than the 16S rRNA gene. This phylogenetic assignment tool allows users to employ T-RFLP to simultaneously analyze microbial community diversity and species composition. An analysis of the variability of bacterial species composition throughout the water column in a humic lake was carried out to demonstrate the functionality of the phylogenetic assignment tool. This method was validated by comparing the results generated by this program with results from a 16S rRNA gene clone library. PMID:14602639

Kent, Angela D; Smith, Dan J; Benson, Barbara J; Triplett, Eric W

2003-11-01

123

[Genetic differentiation of the Mongolian population. Comparative analysis of the geographic distribution of biochemical markers of genes and restriction fragment length polymorphism of nuclear DNA in the Mongolian population].  

PubMed

The geographical distribution of the gene frequencies from loci: Hp, Tf, Gc, Pi, AcP1, GLO1, EsD, 6-PGD, PGM1 and RFLP's of the nuclear DNA of the loci HBG-2 (HindIII), HBB (AvaII), ApoB (XbaI), D7S8 (PstI), LDLR (HincII) and AT-3 was analysed in the Mongolian population. These data revealed the homogeneity of 18 local groups in Mongolia and extremely low genetic differences measured by GST. There was no differences in the average GST values between protein markers and nuclear DNA markers. PMID:1361922

Sambuugi?n, N; Rychkov, Iu G; Petrishchev, V N; Shne?der, Iu V

1992-09-01

124

Increased DNA fragmentation and ultrastructural changes in fibromyalgic muscle fibres  

PubMed Central

Objective: To determine whether there is evidence of increased DNA fragmentation and ultrastructural changes in muscle tissue of patients with fibromyalgia (FM) compared with healthy controls. Methods: Muscle tissues from 10 community residents with FM and 10 age and sex matched healthy controls were examined "blindly" for the presence of DNA fragmentation by two different methods: terminal deoxynucleotidyl transferase (TdT) staining (TUNEL) and the FragEL-Klenow DNA fragmentation detection kit. Ultrastructural analysis of tissue was performed by electron microscopy. Results: DNA fragmentation was detected by both methods in 55.4 (SEM 2.5)% of the nuclei in muscle tissue of patients with FM compared with 16.1 (4.1)% (p<0.001) of the nuclei in healthy controls. Contrary to expectation, no typical features of apoptosis could be detected by electron microscopy. The myofibres and actin filaments were disorganised and lipofuscin bodies were seen; glycogen and lipid accumulation were also found. The number of mitochondria was significantly lower in patients with FM than in controls and seemed to be morphologically altered. Conclusion: The ultrastructural changes described suggest that patients with FM are characterised by abnormalities in muscle tissue that include increased DNA fragmentation and changes in the number and size of mitochondria. These cellular changes are not signs of apoptosis. Persistent focal contractions in muscle may contribute to ultrastructural tissue abnormalities as well as to the induction and/or chronicity of nociceptive transmission from muscle to the central nervous system. PMID:14962957

Sprott, H; Salemi, S; Gay, R; Bradley, L; Alarcon, G; Oh, S; Michel, B; Gay, S

2004-01-01

125

TNF-? is involved in activating DNA fragmentation in skeletal muscle  

PubMed Central

Intraperitoneal administration of 100??g kg?1 (body weight) of tumour necrosis factor-? to rats for 8 consecutive days resulted in a significant decrease in protein content, which was concomitant with a reduction in DNA content. Interestingly, the protein/DNA ratio was unchanged in the skeletal muscle of the tumour necrosis factor-?-treated animals as compared with the non-treated controls. Analysis of muscle DNA fragmentation clearly showed enhanced laddering in the skeletal muscle of tumour necrosis factor-?-treated animals, suggesting an apoptotic phenomenon. In a different set of experiments, mice bearing a cachexia-inducing tumour (the Lewis lung carcinoma) showed an increase in muscle DNA fragmentation (9.8-fold) as compared with their non-tumour-bearing control counterparts as previously described. When gene-deficient mice for tumour necrosis factor-? receptor protein I were inoculated with Lewis lung carcinoma, they were also affected by DNA fragmentation; however the increase was only 2.1-fold. These results suggest that tumour necrosis factor-? partly mediates DNA fragmentation during experimental cancer-associated cachexia. British Journal of Cancer (2002) 86, 1012–1016. DOI: 10.1038/sj/bjc/6600167 www.bjcancer.com © 2002 Cancer Research UK PMID:11953838

Carbó, N; Busquets, S; van Royen, M; Alvarez, B; López-Soriano, F J; Argilés, J M

2002-01-01

126

Fenton fragmentation for faster electrophoretic on chip purification of amplifiable genomic DNA.  

PubMed

With a rapid and simple actuation protocol electrophoretic nucleic acid extraction is easy automatable, requires no moving parts, is easy to miniaturize and furthermore possesses a size dependent cut-off filter adjustable by the pore size of the hydrogel. However electrophoretic nucleic acid extraction from bacteria has so far been applied mainly for short RNA targets. One of the reasons is that electrophoretic processing of unfragmented genomic DNA strands is time-consuming, because of the length. Here DNA fragmentation would accelerate extraction and isolation. We introduce on-chip lysis and non-enzymatic DNA cleavage directly followed by a purifying step for receiving amplifiable DNA fragments from bacteria in less than 25min. In contrast to restriction enzymes the Fenton reaction is known to cleave DNA without nucleotide specificity. The reaction mix contains iron(II) EDTA, sodium ascorbate, hydrogen peroxide and lysozyme. The degree of fragmentation can be adjusted by the concentration of reagents. The results enable electrophoretic extraction methods to unspecifically process long genomic DNA in a short time frame, e.g. for pathogen detection in a lab-on-a-chip format. PMID:24970713

Hakenberg, S; Hügle, M; Meyer, P; Behrmann, O; Dame, G; Urban, G A

2015-05-15

127

A DNA and restriction enzyme implementation of Turing Ma (Turing machines; Universal Turing machines; recombinant DNA; nonpalindromic endonucleases; class IIS  

E-print Network

A DNA and restriction enzyme implementation of Turing Ma­ chines. (Turing machines; Universal://www.ugcs.caltech.edu/~pwkr/oett.html ABSTRACT Bacteria employ restriction enzymes to cut or restrict DNA at or near specific words in a unique way. Many restriction enzymes cut the two strands of double­stranded DNA at different positions

Winfree, Erik

128

Simulation of DNA fragment distributions after irradiation with photons.  

PubMed

The Monte Carlo track structure code PARTRAC has been further improved by implementing electron scattering cross-sections for liquid water and by explicitly modelling the interaction of water radicals with DNA. The model of the genome inside a human cell nucleus in its interphase is based on the atomic coordinates of the DNA double helix with an additional volume for the water shell. The DNA helix is wound around histone complexes, and these nucleosomes are folded into chromatin fibres and further to fibre loops, which are interconnected to build chromosomes with a territorial organisation. Simulations have been performed for the irradiation of human fibroblast cells with carbon K and aluminium K ultrasoft x-rays, 220 kVp x-rays and 60Co gamma-rays. The ratio single-strand breaks to double-strand breaks (ssb/dsb) for both types of ultrasoft x-rays is lower than for gamma-rays by a factor of 2. The contributions of direct and indirect effects to strand break induction are almost independent of photon energy. Strand break patterns from indirect effects reflect differences in the susceptibility of the DNA helix to OH* attack inside the chromatin fibre. Distributions of small DNA fragments (<3 kbp) are determined by the chromatin fibre structure irrespective of whether direct or indirect effects are causing the breaks. In the calculated fragment size distributions for larger DNA fragments (>30 kbp), a substantial deviation from random breakage is found only for carbon K irradiation, and is attributed to its inhomogeneous dose distribution inside the cell nucleus. For the other radiation qualities, the results for larger fragments can be approximated by random breakage distributions calculated for a yield of dsb which is about 10% lower than the average for the whole genome. The excess of DNA fragments detected experimentally in the 8-300 kbp region after x-ray irradiation is not seen in our simulation results. PMID:10384954

Friedland, W; Jacob, P; Paretzke, H G; Merzagora, M; Ottolenghi, A

1999-05-01

129

Selective Microbial Genomic DNA Isolation Using Restriction Endonucleases  

PubMed Central

To improve the metagenomic analysis of complex microbiomes, we have repurposed restriction endonucleases as methyl specific DNA binding proteins. As an example, we use DpnI immobilized on magnetic beads. The ten minute extraction technique allows specific binding of genomes containing the DpnI Gm6ATC motif common in the genomic DNA of many bacteria including ?-proteobacteria. Using synthetic genome mixtures, we demonstrate 80% recovery of Escherichia coli genomic DNA even when only femtogram quantities are spiked into 10 µg of human DNA background. Binding is very specific with less than 0.5% of human DNA bound. Next Generation Sequencing of input and enriched synthetic mixtures results in over 100-fold enrichment of target genomes relative to human and plant DNA. We also show comparable enrichment when sequencing complex microbiomes such as those from creek water and human saliva. The technique can be broadened to other restriction enzymes allowing for the selective enrichment of trace and unculturable organisms from complex microbiomes and the stratification of organisms according to restriction enzyme enrichment. PMID:25279840

Barnes, Helen E.; Liu, Guohong; Weston, Christopher Q.; King, Paula; Pham, Long K.; Waltz, Shannon; Helzer, Kimberly T.; Day, Laura; Sphar, Dan; Yamamoto, Robert T.; Forsyth, R. Allyn

2014-01-01

130

The 40-kDa subunit of DNA fragmentation factor induces DNA fragmentation and chromatin condensation during apoptosis  

Microsoft Academic Search

We report here the reconstitution of a path- way that leads to the apoptotic changes in nuclei by using recombinant DNA fragmentation factor (DFF), a heterodimeric protein of 40 and 45 kDa. Coexpression of DFF40 and DFF45 is required to generate recombinant DFF, which becomes activated when DFF45 is cleaved by caspase-3. The cleaved fragments of DFF45 dissociate from the

Xuesong Liu; Peng Li; Piotr Widlak; Hua Zou; Xu Luo; WILLIAM T. GARRARD; Xiaodong Wang

1998-01-01

131

Restricted pollen flow of Dieffenbachia seguine populations in fragmented and continuous tropical forest.  

PubMed

Habitat fragmentation can change the ecological context of populations, rupturing genetic connectivity among them, changing genetic structure, and increasing the loss of genetic diversity. We analyzed mating system and pollen structure in two population fragments and two continuous forest populations of Dieffenbachia seguine (Araceae), an insect-pollinated understory herb in the tropical rain forest of Los Tuxtlas, México, using nine allozyme loci. Mating system analysis indicated almost complete outcrossing but some inbreeding among the adults. Pollen structure analysis indicated highly restricted pollen flow, both within and among populations. We showed that the effective pollination neighborhood was small in all populations, and slightly (though not significantly) smaller in fragments, partially as a consequence of an increase in density of reproductive individuals in those fragments. Using assignment analysis, we showed that all populations were strongly structured, suggesting that pollen and seed flow across the Los Tuxtlas landscape has been spatially restricted, though sufficient to maintain connectedness. Forest fragmentation at Los Tuxtlas has (so far) had limited impact on pollen dynamics, despite the changing ecological context, with reduced pollinator abundance being partially offset by increased flowering density in fragments. Continued outcrossing and limited pollen immigration, coupled with more extensive seed migration, should maintain genetic connectedness in D. seguine, if fragmentation is not further exacerbated by additional deforestation. PMID:20029453

Cuartas-Hernández, S; Núñez-Farfán, J; Smouse, P E

2010-08-01

132

Meiotic silencing and fragmentation of the male germline restricted chromosome in zebra finch  

PubMed Central

During male meiotic prophase in mammals, X and Y are in a largely unsynapsed configuration, which is thought to trigger meiotic sex chromosome inactivation (MSCI). In avian species, females are ZW, and males ZZ. Although Z and W in chicken oocytes show complete, largely heterologous synapsis, they too undergo MSCI, albeit only transiently. The W chromosome is already inactive in early meiotic prophase, and inactive chromatin marks may spread on to the Z upon synapsis. Mammalian MSCI is considered as a specialised form of the general meiotic silencing mechanism, named meiotic silencing of unsynapsed chromatin (MSUC). Herein, we studied the avian form of MSUC, by analysing the behaviour of the peculiar germline restricted chromosome (GRC) that is present as a single copy in zebra finch spermatocytes. In the female germline, this chromosome is present in two copies, which normally synapse and recombine. In contrast, during male meiosis, the single GRC is always eliminated. We found that the GRC in the male germline is silenced from early leptotene onwards, similar to the W chromosome in avian oocytes. The GRC remains largely unsynapsed throughout meiotic prophase I, although patches of SYCP1 staining indicate that part of the GRC may self-synapse. In addition, the GRC is largely devoid of meiotic double strand breaks. We observed a lack of the inner centromere protein INCENP on the GRC and elimination of the GRC following metaphase I. Subsequently, the GRC forms a micronucleus in which the DNA is fragmented. We conclude that in contrast to MSUC in mammals, meiotic silencing of this single chromosome in the avian germline occurs prior to, and independent of DNA double strand breaks and chromosome pairing, hence we have named this phenomenon meiotic silencing prior to synapsis (MSPS). Electronic supplementary material The online version of this article (doi:10.1007/s00412-010-0258-9) contains supplementary material, which is available to authorized users. PMID:20162291

Schoenmakers, Sam; Wassenaar, Evelyne; Laven, Joop S. E.; Grootegoed, J. Anton

2010-01-01

133

[Research of restriction display technique in cDNA microarrays preparation for detecting of HCV].  

PubMed

The cDNA microarrays for HCV detection was prepared. With the restriction display technique (RD), restriction enzyme Sau3A I was chosen to digest the full-length HCV cDNAs. The products were classified and amplified by RD-PCR. We separated the differential genes through polyacrylamide gel electrophoresis and sliver staining. Single bands were isolated which were cut out from the polyacrylamide gel. The third-round PCR could be performed by using the single bands as PCR template. The RD-PCR fragments were purified and cloned into the pMD18-T vectors. The recombinant plasmids were extracted from positive clones and the target gene fragments were sequenced. The cDNA microarray was prepared by spotting PCR products to the surface of amido modified glass slides by the robotics. We validated the detection of microarray by the hybridization and the results of sequence analysis. A total of 24 different cDNA fragments ranging from 200 to 800 bp were isolated and sequenced, which were the specific gene fragments of HCV. These fragments could be further used as probes in the microarray preparations. From the results of hybridization and sequence date analysis, the specificity, sensitivity, accuracy, reproducibility and linearity in detecting HCV RNA were satisfactory. RD technique is of great value in obtaining a large number of size-comparable gene probes, which provide a swift protocol in generating probes for the preparation of microarrays, and the optimized microarray is sensitive and effective in clinical diagnosis of HCV. PMID:15989266

Sun, Zhao-hui; Zheng, Wen-ling; Peng, Yi-fei; Zhang, Bao; Ma, Wen-Li

2005-04-01

134

Community terminal restriction fragment length polymorphisms reveal insights into the diversity and dynamics of leaf endophytic bacteria  

PubMed Central

Background Plant endophytic bacteria play an important role benefiting plant growth or being pathogenic to plants or organisms that consume those plants. Multiple species of bacteria have been found co-inhabiting plants, both cultivated and wild, with viruses and fungi. For these reasons, a general understanding of plant endophytic microbial communities and their diversity is necessary. A key issue is how the distributions of these bacteria vary with location, with plant species, with individual plants and with plant growing season. Results Five common plant species were collected monthly for four months in the summer of 2010, with replicates from four different sampling sites in the Tallgrass Prairie Preserve in Osage County, Oklahoma, USA. Metagenomic DNA was extracted from ground, washed plant leaf samples, and fragments of the bacterial 16S rDNA genes were amplified for analysis of terminal restriction fragment length polymorphism (T-RFLP). We performed mono-digestion T-RFLP with restriction endonuclease DdeI, to reveal the structures of leaf endophytic bacterial communities, to identify the differences between plant-associated bacterial communities in different plant species or environments, and to explore factors affecting the bacterial distribution. We tested the impacts of three major factors on the leaf endophytic bacterial communities, including host plant species, sampling dates and sampling locations. Conclusions Results indicated that all of the three factors were significantly related (??=?0.05) to the distribution of leaf endophytic bacteria, with host species being the most important, followed by sampling dates and sampling locations. PMID:23286760

2013-01-01

135

Fiber optic system for rapid analysis of amplified DNA fragments  

NASA Astrophysics Data System (ADS)

We have developed a fiber optic sensor for rapid and direct analysis of PCR-amplified DNA fragments with minimal sample processing and real-time data readout. To accomplish this, a novel DNA-recognition system was built onto the surface of fused silica fibers. DNA fragments, labeled with a fluorophore during amplification, are bound to and detected at the fiber surface by means of evanescent wave excitation/emission. Excess unincorporated fluorescent single-stranded oligonucleotide PCR primers make only a small contribution to the signal, as the modified fiber surface only efficiently binds double-stranded DNA with the proper PCR-incorporated terminal nucleotide sequence (5'-ATGACTCAT-3'). The surface- bound double-stranded DNA recognition element utilizes a genetically engineered dimeric sequence-specific DNA binding protein. Self-assembly into the proper conformation for binding DNA occurs by means of specific interactions of the active dimer with the Fc domains of a layer of IgG molecules (antibodies) covalently attached directly to the fiber surface. The modified fiber surface is regenerated between samples by stripping away bound DNA with high salt concentrations.

Mauro, J. Matthew; Cao, Lynn K.; Golden, Joel P.

1996-04-01

136

RNA-Linked Nascent DNA Fragments in Escherichia coli*  

PubMed Central

Nucleic acid that is extracted from E. coli labeled by a brief pulse of [3H]dT and depatured by treatment with heat, formamide, or formaldehyde bands in a region with a density higher than that of single-stranded E. coli DNA in a Cs2SO4 equilibrium density gradient. If treated with alkali or RNase, it then exhibits the density of single-stranded DNA. These results suggest the presence of a short strand of RNA covalently linked to the nascent DNA. Evidence for the presence of covalently linked RNA-DNA molecules is also obtained by pulse labeling with [3H]U. Analyses of nascent nucleic acids from cells pulse labeled for various times, and of the molecules with different sizes, support the hypothesis that the short DNA fragments are formed by extension of even shorter RNA chains, which are synthesized on the parental DNA strands and are removed before ligation of the DNA fragments. The synthesis of the RNA segment of the RNA-DNA molecule is much less sensitive to rifampicin than is the synthesis of bulk RNA. Images PMID:4558661

Sugino, Akio; Hirose, Susumu; Okazaki, Reiji

1972-01-01

137

A novel antitumor compound, NC190, induces topoisomerase II-dependent DNA cleavage and DNA fragmentation  

Microsoft Academic Search

A novel benzophenazine derivative, NC-190, is a potent antitumor compound. NC-190 has been shown to inhibit the DNA strand-passing\\u000a activity of DNA topoisomerase II. We investigated further the mode of action of NC-190 against DNA topoisomerase II and DNA\\u000a fragmentation. NC-190 inhibited the decatenation activity of purified topoisomerase II, but had only a weak inhibitory effect\\u000a against topoisomerase I. A

Takehiro Yamagishi; Shiro Nakaike; Tomotake Ikeda; Hisao Ikeya; Susumu Otomo

1996-01-01

138

Sizing Highly Fragmented DNA in Individual Apoptotic Cells Using the Comet Assay and a DNA Crosslinking Agent  

Microsoft Academic Search

TK6 human B lymphoblast cells exposed to ionizing radiation undergo apoptosis in a time and dose-dependent manner. The resulting highly fragmented DNA is easily detected using the comet assay, a sensitive microscopic gel electrophoresis method capable of measuring DNA strand breaks in individual cells. The degree of DNA fragmentation may be indicative of different stages in the fragmentation process, responses

Peggy L. Olive; Judit P. Banáth

1995-01-01

139

Neuronal nuclear DNA fragmentation in the aged canine brain: apoptosis or nuclear DNA fragility?  

Microsoft Academic Search

Neuronal DNA fragmentation, as revealed with the method of in situ end-labeling of nuclear DNA fragmentation (TUNEL), has\\u000a been reported in both the canine and human brains in normal ageing, and in some human age-related neurodegenerative diseases.\\u000a These results have suggested that apoptosis plays an important role in age-related neuronal loss. It is not clear, however,\\u000a whether the TUNEL method

D. Borràs; M. Pumarola; I. Ferrer

2000-01-01

140

The nucleotide sequence of a DNA fragment, 71 base pairs in length, near the origin of DNA replication of bacteriophage 0X174.  

PubMed

Part of the nucleotide sequence of a restriction fragment covering the origin of phiX174 DNA replication 1 has been determined. The fragment A7c was obtained by digestion of phiX174 RF DNA by the restriction enzyme from Arthrobacter luteus, Alu 1. It was further cleaved into two fragments, one large and one small, by the action of the restriction enzyme from Haemophilus aegyptius, Hae 111. The nucleotide sequence of the small fragment has been determined by analysis of the transcription products obtained by the action of Escherichia coli DNA-dependent RNA polymerase on denaturated template under conditions of low salt. Transcripts longer than the template were found. The whole sequence of 71 nucleotide pairs could be derived from complementary oligonucleotides, obtained after digestion of the transcripts with T1 or pancreatic RNAase. The sequence suggests that at least 4 of the 5 amber mutants 2 that have been mapped on this fragment are identical. On account of this and other evidence a reading frame is proposed. PMID:995652

Mansfeld, A D; Vereijken, J M; Jansz, H S

1976-10-01

141

The molecular weight of the egg drop syndrome (EDS) avian adenovirus (strain B8\\/78) DNA estimated by digestion with restriction endonuclease enzyme R·EcoRI  

Microsoft Academic Search

Summary The restriction endonuclease R·EcoRI cleaved at two sites of the EDS adenovirus (strain B8\\/78) DNA generating 3 fragments with molecular weights of 13.5×106, 5.0×106 and 4.4×106 daltons, respectively. The estimated molecular weight of the whole undigested DNA is about 22.9×106 daltons.

J. Kisary; L. Zsák

1980-01-01

142

Characterization by restriction endonuclease analysis and DNA hybridization using IS 900 of bovine, ovine, caprine and human dependent strains of Mycobacterium paratuberculosis isolated in various localities  

Microsoft Academic Search

DNA of 90 mycobactin-dependent strains of Mycobacterium paratuberculosis, isolated in 9 countries, was digested with restriction endonuclease PstI and hybridized with a DNA fragment containing insertion sequence IS900. Bovine strains (n = 73) were isolated from 61 animals in 17 herds, ovine strains (n = 15) from 13 animals in 3 herds and the set was completed by 1 caprine

I. Pavlík; L. Bej?ková; M. Pavlas; Z. Rozsypalová; S. Kosková

1995-01-01

143

DNA fragment conformations in adducts with Kiteplatin.  

PubMed

The anticancer activity of cisplatin is triggered by its formation of intrastrand adducts involving adjacent G residues of DNA. To obtain information on the different conformers that can be formed, carrier ligands such as 2,2'-bipiperidine, which provide large steric bulk near the platinum coordination plane and decrease the dynamic motion about the Pt-N7 bonds, were introduced ("retro-modelling" approach). In the present study we investigate the effect of cis-1,4-diaminocyclohexane (cis-1,4-DACH) on the formation, stability, and stereochemistry of (cis-1,4-DACH)Pt(ss-oligo) adducts (ss-oligo = d(GpG) with 3'- and/or 5'-substituents). Interesting features of this ligand, absent in previous retro-modelling studies, include the large bite angle (expected to impede the ease of interconversion between possible conformers), the presence of two protons on each nitrogen (a characteristic associated with antitumor activity), and the absence of chiral centres. The use of cis-1,4-DACH has made it possible to detect different conformers in a system containing a primary diamine carrier ligand associated with anticancer activity and to confirm the previous hypothesis that the coexistence of different conformers established in studies of retro models having relatively bulky ligands is not an artefact resulting from carrier-ligand bulk. Moreover, the data for the (cis-1,4-DACH)Pt(d(GpG)) and (cis-1,4-DACH)Pt(d(GGTTT)) adducts indicate that at a temperature close to the physiological one (40 °C) HH1 and ?HT1 conformers are present in comparable amounts. In contrast, at low temperature (close to 0 °C) the equilibrium shifts dramatically toward the more stable HH1 conformer (for the (cis-1,4-DACH)Pt(d(TGGT)) adduct the HH1 conformer is always dominant, even at high temperature). Notably, (cis-1,4-DACH)PtCl2 (Kiteplatin) has been recently reinvestigated and found to be particularly active against colorectal cancer (including oxaliplatin-resistant phenotypes). PMID:25144401

Margiotta, Nicola; Petruzzella, Emanuele; Platts, James A; Mutter, Shaun T; Deeth, Robert J; Ranaldo, Rosa; Papadia, Paride; Marzilli, Patricia A; Marzilli, Luigi G; Hoeschele, James D; Natile, Giovanni

2015-02-10

144

Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay  

PubMed Central

Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction patterns generated with AluI, PacI, and PsiI restriction endonucleases. Results: Variations in the number and size of digested fragments were recorded from treated individuals compared with controls showing that the restriction enzymes created a cut at different locations. In addition, sequences of COII gene from control and treated individuals were also used to confirm the RFLP patterns. From the sequence alignment data, it was found that mutations caused the destruction and generation of restriction sites in the gene sequence of treated individuals. Conclusion: This study indicates that all the three pesticides had potential to induce mutations in the normal sequence of COII gene and also advocates the use of PCR-RFLP assay as an efficient, rapid, and sensitive technique to detect mutagenicity of pesticides. PMID:24403735

Bhinder, Preety; Chaudhry, Asha

2013-01-01

145

Detection of Oxazolidinone-Resistant Enterococcus faecalis and Enterococcus faecium Strains by Real-Time PCR and PCR-Restriction Fragment Length Polymorphism Analysis  

Microsoft Academic Search

A real-time PCR assay identified linezolid-resistant Enterococcus faecalis and Enterococcus faecium isolates with a G2576U rRNA mutation. PCR-restriction fragment length polymorphism analysis of ribosomal DNA amplicons with NheI also detected this mutation. Both assays detected isolates heterozygous at this position. Recognition of isolates with what is presently the most frequent oxazolidinone resistance mutation may aid surveillance and individual case management.

Neil Woodford; Luke Tysall; Cressida Auckland; Mark W. Stockdale; Andrew J. Lawson; Rachel A. Walker; David M. Livermore

2002-01-01

146

Genetic diversity for restriction fragment length polymorphisms and heterosis for two diallel sets of maize inbreds.  

PubMed

Changes that may have occurred over the past 50 years of hybrid breeding in maize (Zea maize L.) with respect to heterosis for yield and heterozygosity at the molecular level are of interest to both maize breeders and quantitative geneticists. The objectives of this study were twofold: The first, to compare two diallels produced from six older maize inbreds released in the 1950's and earlier and six newer inbreds released during the 1970's with respect to (a) genetic variation for restriction fragment length polymorphisms (RFLPs) and (b) the size of heterosis and epistatic effects, and the second, to evaluate the usefulness of RFLP-based genetic distance measures in predicting heterosis and performance of single-cross hybrids. Five generations (parents, F1; F2, and backcrosses) from the 15 crosses in each diallel were evaluated for grain yield and yield components in four Iowa environments. Genetic effects were estimated from generation means by ordinary diallel analyses and by the Eberhart-Gardner model. Newer lines showed significantly greater yield for inbred generations than did older lines but smaller heterosis estimates. In most cases, estimates of additive x additive epistatic effects for yield and yield components were significantly positive for both groups of lines. RFLP analyses of inbred lines included two restriction enzymes and 82 genomic DNA clones distributed over the maize genome. Eighty-one clones revealed polymorphisms with at least one enzyme. In each set, about three different RFLP variants were typically found per RFLP locus. Genetic distances between inbred lines were estimated from RFLP data as Rogers' distance (RD), which was subdivided into general (GRD) and specific (SRD) Rogers' distances within each diallel. The mean and range of RDs were similar for the older and newer lines, suggesting that the level of heterozygosity at the molecular level had not changed. GRD explained about 50% of the variation among RD values in both sets. Cluster analyses, based on modified Rogers' distances, revealed associations among lines that were generally consistent with expectations based on known pedigree and on previous research. Correlations of RD and SRD with f1 performance, specific combining ability, and heterosis for yield and yield components, were generally positive, but too small to be of predictive value. In agreement with previous studies, our results suggest that RFLPs can be used to investigate relationships among maize inbreds, but that they are of limited usefulness for predicting the heterotic performance of single crosses between unrelated lines. PMID:24221007

Melchinger, A E; Lee, M; Lamkey, K R; Hallauer, A R; Woodman, W L

1990-10-01

147

Pulsed field gel electrophoresis and physical mapping of large DNA fragments in the Tm2a region of chromosome 9 in tomato  

Microsoft Academic Search

A method has been developed which allows the isolation of very high molecular weight DNA (>2 million bp) from leaf protoplasts of tomato (Lycopersicon esculentum). The DNA isolated in this manner was digested in agarose with rare-cutting restriction enzymes and separated by pulsed field gel electrophoresis. The size range of the reslting fragments was determined by hybridization to a number

Martin W. Ganal; Nevin D. Young; Steven D. Tanksley

1989-01-01

148

Characterization of Campylobacter jejuni and Campylobacter coli genotypes in poultry flocks by restriction fragment length polymorphism (RFLP) analysis.  

PubMed

We describe a simple, rapid, and discriminatory methodology that allows the routine molecular characterization of Campylobacter jejuni and Campylobacter coli isolates. The proposed approach is built on one of the earliest and simplest molecular typing methods ever, consisting on the analysis of the fragments of different lengths generated by digestion of homologous DNA sequences with specific restriction endonucleases, a process known as restriction fragment length polymorphism (RFLP) analysis. The strategy underneath the workflow reported here is meant to explore the polymorphisms of Campylobacter spp. flaA gene (flaA-RFLP) that allows the local investigation of the genetic diversity and distribution of C. coli and C. jejuni isolates from different sources, namely, chickens' caeca. Although not appropriate for global and long-term epidemiological studies as a single approach, flaA-RFLP analysis can be very useful in surveys limited in space and time and, for specific epidemiological settings, an alternative to more modern and resource-demanding techniques. PMID:25399105

Carreira, Ana Cláudia; Cunha, Mónica V

2015-01-01

149

Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase  

PubMed Central

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

2014-01-01

150

Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase.  

PubMed

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%. PMID:25551825

Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H

2014-01-01

151

CE of Small DNA Fragments Using Linear Polyacrylamide Matrices  

Microsoft Academic Search

Mutations at codons 248 and 249 of p53 gene showed a relatively high incidence in gastric cancer patients. Development of\\u000a novel methods for the detection of codon mutations is of great importance for gastric cancer research. Studies have showed\\u000a that the separation matrix can significantly influence the separation efficiency and resolution of small DNA fragments in\\u000a CE. In order to

Zheng-Ping Jia; Rong Wang; Qiao-Yun Chen; Hua Xie; Jun Ma; Yuan-Yuan Liu; Juan Wang

2009-01-01

152

SOLVING LARGE DOUBLE DIGESTION PROBLEMS FOR DNA RESTRICTION MAPPING BY USING  

E-print Network

SOLVING LARGE DOUBLE DIGESTION PROBLEMS FOR DNA RESTRICTION MAPPING BY USING BRANCH;Solving Large Double Digestion Problems for DNA Restriction Mapping by Using Branch-and-Bound Integer.S.A. Abstract. The double digestion problem for DNA restriction mapping has been proved to be NP

153

Inheritance of restriction fragment length polymorphisms and random amplified polymorphic DNAs in coastal Douglas-fir  

Microsoft Academic Search

A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas-fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29 RAPD loci was demonstrated based on single-locus segregation in a sample of F2 progeny.

K. D. Jermstad; A. M. Reem; J. R. Henifin; N. C. Wheeler; D. B. Neale

1994-01-01

154

Kindred DNA amplification from two distinct populations of cDNA fragments.  

PubMed

Kindred DNA amplification is a novel and cost-effective method developed to isolate common cDNA fragments between two distinct cDNA populations. Unlike subtractive hybridization, which discards common sequences, kindred DNA amplification isolates and amplifies these sequences within a single hybridization procedure. The utility of this method is demonstrated by cloning the genes in common between two different but metabolically homologous muscles, murine ventricular myocardium and soleus. The reliability of kindred DNA amplification was confirmed by Southern hybridization. PMID:12765027

Puurand, Ulo; Kadaja, Lumme; Seppet, Enn K

2003-05-01

155

Variability in desert bighorn and Rambouillet sheep using restriction fragment length polymorphisms  

E-print Network

8 9 10 11 12 13 EcoRI ? 23. 7 kb I ? 19. 6 is. o :4 26 In the restriction pattern produced by EcoRI (Fig. 4), all 13 sheep samples exhibited a 15. 0kb fragment. One desert bighorn NV/TX exhibited an additional fragment of 19. 5kb, and 1...-13 are Canadian Rambouillet sheep. 33 Pst I 2. 9 Icb -2. 7 ? 2. 1 -1. 9 0 9 ~gib~ ~ or- 1 2 3 4 5 6 7 8 9 10 11 12 13 Hind III ~ IP t 10. 1 kb -9. 5 9. 1 34 desert bighorn NV/Tx and 2 desert bighorn AZ/AZ exhibited an additional 9. 1kb fragment...

Lyles, Ingrid Doodeheefver

2012-06-07

156

High-sensitivity capillary electrophoresis of double-stranded DNA fragments using monomeric and dimeric fluorescent intercalating dyes  

SciTech Connect

Fluorescence-detected capillary electrophoresis separations of [phi]X174/HaeIII DNA restriction fragments have been performed using monomeric and dimeric intercalating dyes. Replaceable hydroxyethyl cellulose solutions were used as the separation medium. Confocal fluorescence detection was performed following 488-nm laser excitation. The limits of DNA detection for on-column staining with monomeric dyes (ethidium bromide, two propidium dye derivatives, oxazole yellow, thiazole orange, and a polycationic thiazole orange derivative) were determined. The thiazole orange dyes provide the most sensitive detection with limiting sensitivities of 2-4 amol of DNA base pairs per band, and detection of the 603-bp fragment was successful, injecting from [phi]X174/HaeIII samples containing only 1-2 fg of this fragment per microliter. Separations of preformed DNA-dimeric dye complexes were also performed. The breadth of the bands observed in separations of preformed DNA-dimeric dye complexes is due to the presence of DNA fragments with different numbers of bound dye molecules that can be resolved as closely spaced subbands in many of our separations. The quality of these DNA-dye complex separations can be dramatically improved by performing the electrophoresis with 9-aminoacridine (9AA) in the column and running buffers. 43 refs., 10 figs., 1 tab.

Zhu, H.; Clark, S.M.; Benson, S.C.; Rye, H.S.; Glazer, A.N.; Mathies, R.A. (Univ. of California, Berkeley, CA (United States))

1994-07-01

157

Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQw1 and DQw3 alleles of the HLA-D region.  

PubMed Central

Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQ beta, DQ alpha, and DR beta cDNA probes. Hybridization with the DQ beta probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQ alpha and DR beta probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease. Images PMID:2888115

Szafer, F; Brautbar, C; Tzfoni, E; Frankel, G; Sherman, L; Cohen, I; Hacham-Zadeh, S; Aberer, W; Tappeiner, G; Holubar, K

1987-01-01

158

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.  

PubMed

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields. PMID:20128694

Yan, Guiping; Smiley, Richard W

2010-03-01

159

Characterization of Erwinia chrysanthemi by pectinolytic isozyme polymorphism and restriction fragment length polymorphism analysis of PCR-amplified fragments of pel genes.  

PubMed Central

Conserved regions about 420 bp long of the pelADE cluster specific to Erwinia chrysanthemi were amplified by PCR and used to differentiate 78 strains of E. chrysanthemi that were obtained from different hosts and geographical areas. No PCR products were obtained from DNA samples extracted from other pectinolytic and nonpectinolytic species and genera. The pel fragments amplified from the E. chrysanthemi strains studied were compared by performing a restriction fragment length polymorphism (RFLP) analysis. On the basis of similarity coefficients derived from the RFLP analysis, the strains were separated into 16 PCR RFLP patterns grouped in six clusters, These clusters appeared to be correlated with other infraspecific levels of E. chrysanthemi classification, such as pathovar and biovar, and occasionally with geographical origin. Moreover, the clusters correlated well with the polymorphism of pectate lyase and pectin methylesterase isoenzymes. While the pectin methylesterase profiles correlated with host monocot-dicot classification, the pectate lyase polymorphism might reflect the cell wall microdomains of the plants belonging to these classes. PMID:8779560

Nassar, A; Darrasse, A; Lemattre, M; Kotoujansky, A; Dervin, C; Vedel, R; Bertheau, Y

1996-01-01

160

Lactic acid bacterial population dynamics during fermentation and storage of Thai fermented sausage according to restriction fragment length polymorphism analysis.  

PubMed

This study applied restriction fragment length polymorphism (RFLP) analysis to identify the lactic acid bacteria (LAB) isolated from "mum" Thai fermented sausages during fermentation and storage. A total of 630 lactic acid bacteria were isolated from the sausages prepared using 2 methods. In Method 1, after stuffing, the sausages were stored at 30 °C for 14 days. In Method 2, after stuffing and storage at 30 °C for 3 days, the sausages were vacuum-packed and stored at 4 °C until Day 28. The sausages were sampled on Days 0, 3, 14, and 28 for analyses. The 16S rDNA was amplified and digested using restriction enzymes. Of the restriction enzymes evaluated, Dde I displayed the highest discrimination capacity. The LAB were classified and 7 species were identified For Methods 1 and 2, during fermentation, the Lactobacillus sakei and Lactobacillus plantarum species were dominant. For Method 2, the proportion of Leuconostoc mesenteroides markedly increased during storage, until L. sakei and Ln. mesenteroides represented the dominant species. The identification of LAB in the sausage samples could facilitate the selection of appropriate microorganisms for candidate starter cultures for future controlled mum production. PMID:25005265

Wanangkarn, Amornrat; Liu, Deng-Cheng; Swetwiwathana, Adisorn; Jindaprasert, Aphacha; Phraephaisarn, Chirapiphat; Chumnqoen, Wanwisa; Tan, Fa-Jui

2014-09-01

161

Secuencia parcial de un fragmento de ADN de patos silvestres homólogo al complejo mayor de histocompatibilidad de Gallus gallus Partial sequence of a DNA fragment from wild ducks homologous to the Gallus gallus major histocompatibility complex  

Microsoft Academic Search

In this study, a genomic DNA fragment from domestic duck (Anas domesticus) was amplified by PCR. Such fragment shared 93 % identity to the chicken (Gallus gallus) MHC class II, which correspond to DAB1- (Disabled 1)-like sequence. The DAB1 sequence was also amplified from nine wild duck species of the Anas genus, which after performing a restriction fragment length polymorphism

Sofía González-Guzmán; Elizabeth Loza-Rubio; Virginia León-Régagnonc; Gary García-Espinosa

162

Unbalanced restriction impairs SOS-induced DNA repair effects.  

PubMed

The contribution of a type II restriction-modification system (R-M system) to genome integrity and cell viability was investigated. We established experimental conditions which enabled the achievement of hemimethylated and unmethylated states for the specific bases of the recognition sequences of the host's DNA. To achieve this, we constructed the MboII R-M system containing only one (i.e. M2.MboII) out of two functional MboII methyltransferases found in Moraxella bovis. Using the incomplete R-M system we were able to perturb the balance between methylation and restriction in an inducible manner. We demonstrate that upon the SOS-induced DNA repair in the mitomycin C treated cells, restriction significantly reduces cell viability. Similar results for the well-studied wild type EcoRI R-M system, expressed constitutively in Escherichia coli, were obtained. Our data provide further insights into the benefits and disadvantages of maintaining of a type II R-M system, highlighting its impact on host cell fitness. PMID:20134230

Katna, Anna; Boratynski, Robert; Furmanek-Blaszk, Beata; Zolcinska, Natalia; Sektas, Marian

2010-01-01

163

Short noncoding DNA fragments improve the immune potency of electroporation-mediated HBV DNA vaccination.  

PubMed

Electroporation (EP)-mediated DNA immunization can elicit effective immune responses in a variety of animals, and is widely used in research studies and clinical trials. However, high-pulse voltage, high DNA dose and multiple immunizations are still required to achieve considerable immune responses. To further improve the efficiency of EP-mediated DNA immunization, many parameters have been tried and optimized in recent years. In our early research, we found that the short noncoding DNA fragments (sf-DNA) can significantly enhance EP-mediated transgene expression of reporter genes. In this study, we tested the effect of sf-DNA on the immune potency of EP-mediated hepatitis B virus (HBV) DNA vaccination in a mouse model. The results show that the use of sf-DNA in EP-mediated HBV DNA vaccination leads to an enhanced expression of the HBV surface antigen, resulting in higher cellular and humoral responses. Furthermore, the immune responses in the sf-DNA-mediated 120?V cm(-1) EP immunization group were higher than that of the 200?V?cm(-1) EP without sf-DNA groups. These data suggest that the sf-DNA can be used as an effective helper molecule to improve the immune response of EP-mediated HBV DNA vaccination, which may make the EP-mediated DNA vaccination more effective and suitable for animal and clinical application. PMID:24830435

Peng, J; Shi, S; Yang, Z; Ding, Q; Hai, W; Tang, H; Yang, Y; Bernstein, J R; Peyda, P; Xu, Y

2014-07-01

164

A partial map of the barley genome incorporating restriction fragment length polymorphism, polymerase chain reaction, isozyme, and morphological marker loci.  

PubMed

Nine low copy number genomic DNA clones, a ribosomal sequence, and seven cDNA clones were found to identify polymorphisms in cultivated barley (Hordeum vulgare L.). An F2 population consisting of 100 plants was produced from a cross between a high-yielding two-rowed feed barley cultivar and a genetic marker stock homozygous for nine recessive and one dominant morphological marker genes. Through the use of these 10 well-distributed marker genes, five previously mapped isozyme loci, and two storage-protein loci, the approximate recombinational location for each of 17 restriction fragment length polymorphism loci was estimated. One clone, pMSU21, identified variation that appeared to be the result of a small insertion-deletion event that differentiated two-rowed and six-rowed genotypes. This difference was characterized, and one allele was sequenced. Oligonucleotide primers that flanked the insertion-deletion event were synthesized, and DNA samples from the F2 population were subjected to polymerase chain reaction sequence amplification. The variation identified by this technique was determined to be allelic to the variation identified using pMSU21 in Southern blot analysis. Maps of previously undescribed informative clones are included. PMID:1982275

Shin, J S; Chao, S; Corpuz, L; Blake, T

1990-12-01

165

An overview of the restriction fragment length polymorphism of the HLA-D region: its application to individual D-, DR- typing by computerized analyses.  

PubMed

HLA-D/DR alleles as defined by cellular and serological typing can also be identified by biochemical methods. The Southern blot technique provides an additional typing facility which can be applied to DNA obtained from any source of nucleated cells. The polymorphism revealed by Southern blot analyses, the so-called restriction fragment length polymorphism (RFLP), depends upon the restriction enzyme and cDNA probes used. To identify HLA-DR specificities a protocol was developed based on the use of the results of southern blot analyses with several restriction enzymes and cDNA probes within a panel of HLA-D/DR homozygous cells representing the DR1 to DRw8 alleles. First, hybridizations with the 3' untranslated sequence of the DR beta cDNA probe, after digestion of the DNA with PvuII (PvuII-DR beta 3') allows the selective identification of DR1, DR2 and DRw8; DR3, DR5 and DRw6 are found as one group as well as DR4 and DR7 as another. Second, TaqI-DQ alpha hybridization allows the splitting of DRw6-Dw18, DRw6-Dw19 and DRw6-Dw9 from the DR3, DR5 and DRw6 group. The other alleles DR3, DR4, DR5, DRw6-Dw16 and DR7 are revealed by dehybridization and rehybridization of the blot with a DR beta cDNA probe. This protocol was used to test whether in a panel of 30 randomly chosen individuals the HLA-DR typing could be performed. The results were highly concordant to the serotyping. Furthermore by adding the Pst-DR beta and TaqI-DQ alpha RFLPs, most of the MLC defined Dw specificities could also be identified. An overview of the specific fragments described here has been summarized in matrices which can be used as references for DNA-typing in computerized analyses. PMID:2880410

Tilanus, M G; Hongming, F; van Eggermond, M C; vd Bijl, M; D'Amaro, J; Schreuder, G M; de Vries, R R; Giphart, M J

1986-10-01

166

Correlations between two markers of sperm DNA integrity, DNA denaturation and DNA fragmentation, in fertile and infertile men  

Microsoft Academic Search

Objective: To evaluate two different assays of human sperm DNA integrity, DNA denaturation (DD) and DNA fragmentation (DF), and to correlate these with standard semen parameters.Design: Prospective, observational study.Setting: University infertility clinic.Patient(s): Forty consecutive semen samples from 33 nonazoospermic men presenting for infertility evaluation and 7 fertile men presenting for vasectomy.Intervention(s): Assessment of sperm concentration, motility, morphology, DD and DF.Main

Armand Zini; Ryszard Bielecki; Donna Phang; Maria Teresa Zenzes

2001-01-01

167

Phylogenomics of caspase-activated DNA fragmentation factor  

SciTech Connect

The degradation of nuclear DNA by DNA fragmentation factor (DFF) is a key step in apoptosis of mammalian cells. Using comparative genomics, we have here determined the evolutionary history of the genes encoding the two DFF subunits, DFFA (also known as ICAD) and DFFB (CAD). Orthologs of DFFA and DFFB were identified in Nematostella vectensis, a representative of the primitive metazoan clade cnidarians, and in various vertebrates and insects, but not in representatives of urochordates, echinoderms, and nematodes. The domains mediating the interaction of DFFA and DFFB, a caspase cleavage site in DFFA, and the amino acid residues critical for endonuclease activity of DFFB were conserved in Nematostella. These findings suggest that DFF has been a part of the primordial apoptosis system of the eumetazoan common ancestor and that the ancient cell death machinery has degenerated in several evolutionary lineages, including the one leading to the prototypical apoptosis model, Caenorhabditis elegans.

Eckhart, Leopold [Department of Dermatology, Medical University of Vienna, A-1090 Vienna (Austria)]. E-mail: leopold.eckhart@meduniwien.ac.at; Fischer, Heinz [Department of Dermatology, Medical University of Vienna, A-1090 Vienna (Austria); Tschachler, Erwin [Department of Dermatology, Medical University of Vienna, A-1090 Vienna (Austria)

2007-04-27

168

[Analysis of microbial diversity of nitrifying bacteria by terminal restriction fragment length polymorphism].  

PubMed

We analyzed the microbial diversity and quantity of nitrifying bacteria in the enrichment reactor by Terminal Restriction Fragment Length Polymorphism (T_RFLP), a cultured-independent molecular technique. The result indicated that nitrobacteria enriched the best, and the diversity index decreased 62.80% compared with the initial data. Nitrobacteria were predominant in the reactor. Meanwhile, we studied the microbial diversity before and after adding Nitrobacteria into shrimp ponds, and analyzed several major bacterial species that existed stably in the pond. According to the analysis by T_RFLP program, species including Brevibacillus brevis, Microbacterium lactium, Azoarcus indigens and Bordetella holmesii were the dominant bacteria in the ponds. PMID:20575436

Lin, Weitie; Zhu, Yanan

2010-04-01

169

THE USE OF RESTRICTION ENDONUCLEASES TO MEASURE MITOCHONDRIAL DNA SEQUENCE RELATEDNESS IN NATURAL  

E-print Network

),a restriction enzyme consistently cleaves this sequence in DNA isolated from any organism. Thus, differencesinTHE USE OF RESTRICTION ENDONUCLEASES TO MEASURE MITOCHONDRIAL DNA SEQUENCE RELATEDNESS IN NATURAL introduce to natural population analysis a molecular tech- nique that involves the use of restriction

Avise, John

170

In vitro Mutagenesis of a Circular DNA Molecule by Using Synthetic Restriction Sites  

Microsoft Academic Search

A method for mutagenizing circular DNA molecules has been developed that uses synthetic oligodeoxy-nucleotide restriction sites as mutagens. A single synthetic restriction site is introduced at random by cleaving circular DNA with a nonspecific double-strand endonuclease. The restriction site is then ligated to the ends and the molecule is subsequently recircularized. These small additions to the genome are mapped by

Fred Heffron; Magdalene So; Brian J. McCarthy

1978-01-01

171

Characterization of Bois noir isolates by restriction fragment length polymorphism of a Stolbur-specific putative membrane protein gene.  

PubMed

Bois noir phytoplasma (BNp), widespread in wine-producing areas of Europe and endemic in France and Italy, is classified in the 16SrXII-A subgroup, whose members are referred to as Stolbur phytoplasmas. The 16S rDNA gene of Stolbur phytoplasma shows low variability, and few non-ribosomal genes are available as markers to assess variation among isolates. We used the Stolbur-specific stol-1H10 gene, encoding a putative membrane-exposed protein, to investigate genetic diversity of French and Italian BNp isolates from plants and insects. Amplification of stol-1H10 from infected grapevines, weeds, and Hyalesthes obsoletus produced fragments of three sizes, and restriction fragment length polymorphism analysis divided these amplicons further into 12 profiles (V1 to V12). French BNp isolates were more variable than Italian ones, and different profiles were present in infected grapevines from France and Italy. Isolate V3, most abundant among Italian affected grapes but present among French ones, was found in one Urtica dioica sample and in all H. obsoletus collected on this species. Four Italian-specific profiles were represented among infected Convolvulus arvensis, the most frequent of which (V12) was also detected in H. obsoletus collected on this species. Most of the variability in the stol-1H10 sequence was associated with type II on the tuf gene. PMID:19453230

Pacifico, D; Alma, A; Bagnoli, B; Foissac, X; Pasquini, G; Tessitori, M; Marzachì, C

2009-06-01

172

DNA fragment assembly: an application of graph theory in molecular biology  

E-print Network

DNA fragment assembly: an application of graph theory in molecular biology Martin Mascher Leibniz Technology Since the central importance of the DNA in storing biological informa- tion had been recognised limitations permit scientists only to obtain contigu- ous DNA fragments whose lengths range from a few dozen

Willems, Wolfgang

173

Performance Assessment of DNA Fragment Sizing by High-Sensitivity Flow Cytometry and Pulsed-Field Gel Electrophoresis  

PubMed Central

The sizing of restriction fragments is the chief analytical technique utilized in the production of DNA fingerprints. Few techniques have been able to compete with pulsed-field gel electrophoresis (PFGE), which is capable of discriminating among bacteria at species and strain levels by resolving restriction fragments. However, an ultrasensitive flow cytometer (FCM) developed in our lab has also demonstrated the ability to discriminate bacteria at species and strain levels. The abilities of FCM warrant a quantitative parallel comparison with PFGE to assess and evaluate the accuracy and precision of DNA fragment sizing by both techniques. Replicate samples of Staphylococcus aureus Mu50 were analyzed along with two clinical S. aureus isolates. The absolute fragment sizing accuracy was determined for PFGE (5% ± 2%) and FCM (4% ± 4%), with sequence-predicted Mu50 SmaI fragment sizes used as a reference. Precision was determined by simple arithmetic methods (relative standard deviation for PFGE [RSDPFGE ] = 3% ± 2% and RSDFCM = 1.2% ± 0.8%) as well as by the use of dendrograms derived from Dice coefficient-unweighted pair group method with arithmetic averages (UPGMA) and Pearson-UPGMA analyses. All quantitative measures of PFGE and FCM precision were equivalent, within error. The precision of both methods was not limited by any single sample preparation or analysis step that was tracked in this study. Additionally, we determined that the curve-based clustering of fingerprint data provided a more informative and useful assessment than did traditional band-based methods. PMID:15131156

Ferris, Matthew M.; Yan, Xiaomei; Habbersett, Robbert C.; Shou, Yulin; Lemanski, Cheryl L.; Jett, James H.; Yoshida, Thomas M.; Marrone, Babetta L.

2004-01-01

174

Mitochondrial chaperone DnaJA3 induces Drp1-dependent mitochondrial fragmentation.  

PubMed

Mitochondrial morphology is dynamic and controlled by coordinated fusion and fission pathways. The role of mitochondrial chaperones in mitochondrial morphological changes and pathology is currently unclear. Here we report that altered levels of DnaJA3 (Tid1/mtHsp40) a mitochondrial member of the DnaJ protein family, and heat shock protein (Hsp) co-chaperone of matrix 70 kDa Hsp70 (mtHsp70/mortalin/HSPA9), induces mitochondrial fragmentation. Suppression of DnaJA3 induced mitochondrial fragmentation in HeLa cells. Elevated levels of DnaJA3 in normal Hs68 fibroblast cells and HeLa, SKN-SH, U87 and U251 cancer cell lines induces mitochondrial fragmentation. Mitochondrial fragmentation induction was not observed in HeLa cells when other DnaJA family members, or mitochondrial DnaJ protein HSC20, were ectopically expressed, indicating that the effects on mitochondrial morphology were specific to DnaJA3. We show that the DnaJ domain (amino acids 88-168) of DnaJA3 is sufficient for the induction of mitochondrial fragmentation. Furthermore, an H121Q point mutation of the DnaJ domain, which abrogates interaction and activation of mtHsp70 ATPase, eliminates fragmentation induced by DnaJA3. This suggests that DnaJA3 interaction with mtHsp70 may be critical in mitochondrial morphological changes. DnaJA3-induced mitochondrial fragmentation was dependent on fission factor dynamin-related protein 1 (Drp1). Ectopic expression of the mitofusins (Mfn1 and Mfn2), however, does not rescue DnaJA3-induced mitochondrial fragmentation. Lastly, elevated levels of DnaJA3 inducing mitochondrial fragmentation were associated with reduction in cell viability. Taken together, elevated DnaJA3 induces Drp1-depedendent mitochondrial fragmentation and decreased cell viability. PMID:22595283

Elwi, Adam N; Lee, Byoungchun; Meijndert, H Christopher; Braun, Janice E A; Kim, Sung-Woo

2012-08-01

175

Novel Endophytic Nitrogen-Fixing Clostridia from the Grass Miscanthus sinensis as Revealed by Terminal Restriction Fragment Length Polymorphism Analysis  

PubMed Central

Anaerobic nitrogen-fixing consortia consisting of N2-fixing clostridia and diverse nondiazotrophic bacteria were previously isolated from various gramineous plants (K. Minamisawa, K. Nishioka, T. Miyaki, B. Ye, T. Miyamoto, M. You, A. Saito, M. Saito, W. Barraquio, N. Teaumroong, T. Sein, and T. Tadashi, Appl. Environ. Microbiol. 70:3096-3102, 2004). For this work, clostridial populations and their phylogenetic structures in a stand of the grass Miscanthus sinensis in Japan were assessed by a 16S rRNA gene-targeted terminal restriction fragment length polymorphism (TRFLP) analysis combined with most-probable-number (MPN) counts. PCR primers and restriction enzymes were optimized for analyses of the plant clostridia. Clostridia were detected in strongly surface-sterilized leaves, stems, and roots of the plants at approximately 104 to 105 cells/g of fresh weight; they made up a large proportion of N2-fixing bacterial populations, as determined by MPN counts associated with an acetylene reduction assay. Phylogenetic grouping by MPN-TRFLP analysis revealed that the clostridial populations belonged to group II of cluster XIVa and groups IV and V of cluster I; this result was supported by a culture-independent TRFLP analysis using direct DNA extraction from plants. When phylogenetic populations from M. sinensis and the soil around the plants were compared, group II clostridia were found to exist exclusively in M. sinensis. PMID:15528521

Miyamoto, Takuya; Kawahara, Makoto; Minamisawa, Kiwamu

2004-01-01

176

Dependence on radiation quality of DNA fragmentation spectra  

NASA Astrophysics Data System (ADS)

Energy deposition by radiation initially gives rise to cellular critical lesions such as DNA doublestrand breaks (DSB), that later lead to the formation of relevant biological endpoints. Studies on fragment size distributions induced by radiations of various qualities can be of great help in linking the characteristics of radiation to cellular endpoints, providing information for understanding the main mechanisms of cell damage. Here we are concerned with the damage induced by heavy charged particles; this issue is very important in the field of radioprotection of astronauts participating in long term space missions, besides being relevant also in other fields, like hadrontherapy. Galactic Cosmic Rays contain a large component of high-LET particles (HZE), e.g. helium and carbon ions, as well as highcharge particles such as iron ions. These particles are characterized by complex track structures with energy depositions not only along the path of the primary particle, but also at relatively large distance form the path, due to the presence of high energy secondary electrons. In this work we have simulated the irradiation of human fibroblasts with ?-rays, protons, helium, carbon and iron ions at a fixed dose with the biophysical Monte Carlo code PARTRAC,and calculated the induction of DSB. The PARTRAC code includes accurate representation of the chromatin geometry and of the physical and physico-chemical processes associated with the energy deposition by radiation. The results of a first validation of the code have been reported in A. Campa et al. (2005) and D. Alloni et al. (2007a, 2007b). DNA fragment spectra were calculated based on the DSB induction patterns and compared in particular for particles of the same specific energy and for particles of the same LET. Special emphasis has been directed to the calculation of very small fragments (< 1 kbp) that are not detectable by the most common experimental techniques and that can significantly influence the RBE (Relative Biological Effectiveness) of high LET radiation. This work was partially supported by EU ("RISC-RAD" project, Contract no. FI6R-CT 2003- 508842, and "NOTE" project, Contract no. FI6R-036465) and ASI (Italian Space Agency, "Mo-Ma/COUNT" project). References A. Campa, F. Ballarini, M. Belli, R. Cherubini, V. Dini, G. Esposito, W.Friedland, S. Gerardi, S. Molinelli, A. Ottolenghi, H. G. Paretzke, G. Simone and M. A. Tabocchini. DNA DSB induced in human cells by charged particles and gamma rays: experimental results and theoretical approaches. Int. J. Radiat.Biol. 81, 841-854 (2005). D. Alloni, F. Ballarini, M. Belli, A. Campa, G. Esposito, W. Friedland, M.Liotta, A. Ottolenghi and H. G. Paretzke. Modeling of DNA fragmentation induced in human fibroblasts by 56 Fe ions. Adv. Space Res. 40, 1401-1407 (2007a). D. Alloni, F. Antonelli, F. Ballarini, M. Belli, A. Campa, V. Dini, G.Esposito, W. Friedland, M. Liotta, A. Ottolenghi, H. G. Paretzke, G. Simone, E. Sorrentino and M. A. Tabocchini. Small DNA fragments induced in human fibroblasts by 56 Fe ions: experimental data and MC simulations. Proc. "Ion Beams in biology and medicine", Heidelberg, 26-29 September 2007, edited by J. Debus, K. Henrichs, G. Kraft, p. 164 (2207b).

Campa, Alessandro; Ottolenghi, Andrea; Alloni, Daniele; Ballarini, Francesca; Belli, Mauro; Esposito, Giuseppe; Facoetti, Angelica; Friedland, Werner; Liotta, Marco; Paretzke, Herwig

177

A restriction endonuclease cleavage map of mouse mitochondrial DNA.  

PubMed Central

A restriction endonuclease cleavage map is presented for mouse mitochondrial DNA. This map was constructed by electron microscopic measurements on partial digests containing fixed D-loops, and by electrophoretic analysis of partial and complete single enzyme digests, and of double digests. No map differences were detected between mitochondrial DNA from cultured LA9 cells and an inbred mouse line for the six endonucleases used. Three cleavage sites recognized by HpaI, five sites recognized by HincII, two sites recognized PstI and four sites recognized by BamI were located with respect to the origin of replication and the EcoRI and HinIII sites previously determined by others. No cleavages were produced by KpnI or SalI. The migration of linear DNA with a molecular weight greater than 1 X 10(6) was not a linear function of log molecular weight in 1% agarose gels run at 6.6 volts/cm. Images PMID:331253

Moore, K H; Johnson, P H; Chandler, S E; Grossman, L I

1977-01-01

178

Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism  

PubMed Central

A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b), t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA) on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin. PMID:24936911

Bounamous, Azzedine; Lehrter, Véronique; Hadj-Henni, Leila; Delecolle, Jean-Claude; Depaquit, Jérôme

2014-01-01

179

TeloTool: a new tool for telomere length measurement from terminal restriction fragment analysis with improved probe intensity correction.  

PubMed

Telomeres comprise the protective caps of natural chromosome ends and function in the suppression of DNA damage signaling and cellular senescence. Therefore, techniques used to determine telomere length are important in a number of studies, ranging from those investigating telomeric structure to effects on human disease. Terminal restriction fragment (TRF) analysis has for a long time shown to be one of the most accurate methods for quantification of absolute telomere length and range from a number of species. As this technique centers on standard Southern blotting, telomeric DNA is observed on resulting autoradiograms as a heterogeneous smear. Methods to accurately determine telomere length from telomeric smears have proven problematic, and no reliable technique has been suggested to obtain mean telomere length values. Here, we present TeloTool, a new program allowing thorough statistical analysis of TRF data. Using this new method, a number of methodical biases are removed from previously stated techniques, including assumptions based on probe intensity corrections. This program provides a standardized mean for quick and reliable extraction of quantitative data from TRF autoradiograms; its wide application will allow accurate comparison between datasets generated in different laboratories. PMID:24366880

Göhring, Janett; Fulcher, Nick; Jacak, Jaroslaw; Riha, Karel

2014-02-01

180

Amplified Restriction Fragment Length Polymorphism-Based mRNA Fingerprinting Using a Single Restriction Enzyme That Recognizes a 4-bp Sequence  

Microsoft Academic Search

Using amplified restriction fragment length polymorphism (AFLP) technology, we have developed a new protocol for the fingerprinting of mRNA that allows systematic comparison of the differential expression of genes between mRNA samples. The major advantage of our protocol is the use of only a single restriction enzyme that recognizes a 4-bp sequence but allows screening of large numbers of different

Yoshiki Habu; Sachiko Fukada-Tanaka; Yasuyo Hisatomi; Shigeru Iida

1997-01-01

181

Bovine mitochondrial DNA polymorphism in restriction endonuclease cleavage patterns and the location of the polymorphic sites  

Microsoft Academic Search

Cleavage patterns of mitochondrial DNA (mtDNA) by restriction endonuclease analysis were examined in four Japanese Black cows, three Japanese Shorthorn cows, and six Holstein cows. Seventeen restriction enzymes which recognize six base pairs and two restriction enzymes which recognize four base pairs were used in this study. Polymorphism was observed with three restriction enzymes, HindIII, TaqI, and MspI, and was

Tomomasa Watanabe; Yukimasa Hayashi; Reiji Semba; Nobuaki Ogasawara

1985-01-01

182

Phylogenetics of freshwater black basses (Centrarchidae: Micropterus) inferred from restriction endonuclease analysis of mitochondrial DNA.  

PubMed

Geographic isolation and habitat specialization has aided in the evolution and genetic integrity of the micropterid bass species of North America. Members of the genus Micropterus form a close natural unit with little morphologic and meristic variation. Our goals were to measure the genetic characteristics of and distances between six black bass species by using mitochondrial DNA analysis. Mitochondrial DNA restriction fragment length polymorphisms were examined in Guadalupe bass (M. treculi), largemouth bass (M. salmoides), shoal bass (M. cataractae), smallmouth bass (M. dolomieu), spotted bass (M. punctulatus), and Suwannee bass (M. notius), using 15 restriction endonucleases. The bluegill (Lepomis macrochirus) was used as an outgroup. The phylogeny inferred from Dollo parsimony cladistic analysis concurred with published results from allozyme analyses, yet it was inconsistent with published meristic analyses. Genetic distances between species ranged from 0.0659 to 0.2145, with the largemouth and Suwannee basses showing the greatest divergence from the other black basses. The Guadalupe, smallmouth, and spotted basses were most diverged from the bluegill. The black basses diverged over a broad time frame, with estimated black bass speciation occurring during late Miocene-early Pliocene (3.30-10.73 MYA). PMID:11860202

Johnson, R L; Magee, J B; Hodge, T A

2001-12-01

183

A Time-Efficient and User-Friendly Method for Plasmid DNA Restriction Analysis.  

ERIC Educational Resources Information Center

Describes an experiment in which plasmid DNA is digested with restriction enzymes that cleave the plasmid either once or twice. The DNA is stained, loaded on a gel, electrophoresed, and viewed under normal laboratory conditions during electrophoresis. (DDR)

LaBanca, Frank; Berg, Claire M.

1998-01-01

184

Restriction fragment length polymorphism and polymerase chain reaction: HLA-DQA1 and polymarker analysis of blood samples from transfusion recipients.  

PubMed

The effect of blood transfusion on DNA profiles of an individual is a significant issue in the forensic context. In the present study, the effects of blood transfusion in 5 recipients were studied by performing restriction fragment length polymorphism and polymerase chain reaction HLA-DQA1 and Polymarker (LDLR, GYPA, HBGG, D7S8, and GC) assays (Roche Molecular Systems, Branchburg, NJ) on serial posttransfusion blood samples. Pretransfusion and posttransfusion DNA profiles of all 5 recipients were consistent with no evidence of the donor genetic material. Currently used DNA profiling techniques in forensic science are reliable and informative for paternity and identity purposes in situations involving transfusion of 1 or 2 U of blood up to 24 hours posttransfusion. PMID:12219780

Giroti, Rajiv I; Biswas, Rajesh; Mukherjee, Kanchan

2002-09-01

185

Effect of site-specific modification on restriction endonucleases and DNA modification methyltransferases.  

PubMed Central

Restriction endonucleases have site-specific interactions with DNA that can often be inhibited by site-specific DNA methylation and other site-specific DNA modifications. However, such inhibition cannot generally be predicted. The empirically acquired data on these effects are tabulated for over 320 restriction endonucleases. In addition, a table of known site-specific DNA modification methyltransferases and their specificities is presented along with EMBL database accession numbers for cloned genes. PMID:7937074

McClelland, M; Nelson, M; Raschke, E

1994-01-01

186

Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection  

NASA Technical Reports Server (NTRS)

The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

Rydberg, B.; Chatterjee, A. (Principal Investigator)

1996-01-01

187

Comparative study of Mycobacterium paratuberculosis strains isolated from Crohn's disease and Johne's disease using restriction fragment length polymorphism and arbitrarily primed polymerase chain reaction.  

PubMed Central

To obtain insights into the pathogenic mechanisms involving Mycobacterium paratuberculosis in Crohn's disease (CD) we questioned if the strains of M. paratuberculosis isolated from CD are distinguishable from those involved in Johne's disease (JD), a chronic granulomatous enteritis in cattle. Accordingly we compared human and animal strains at the DNA level, both by the analysis of restriction fragment length polymorphism (RFLP) in and around the insertion sequence IS 900 and by the arbitrarily primed chain reaction (AP-PCR). Results are in favour of a common clonal origin for the 4 strains isolated from CD and for 8 of the 11 strains isolated from cattle and sheep JD. PMID:9207733

François, B.; Krishnamoorthy, R.; Elion, J.

1997-01-01

188

Genome of hepatitis B virus: restriction enzyme cleavage and structure of DNA extracted from Dane particles.  

PubMed

DNA extracted from Dane particles has been characterized by gel electrophoresis and restriction enzyme cleavage with endonuclease R-HaeIII (from Hemophilus aegyptius). Dane particle DNA is proposed to be a double-stranded circular DNA approximately 3600 nucleotides in length containing a single-stranded gap of 600-2100 nucleotides. The endogenous DNA polymerase (DNA nucleotidyl-transferase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase; EC 2.7.7.7) reaction appears to repair this single-stranded gap. PMID:1060140

Summers, J; O'Connell, A; Millman, I

1975-11-01

189

Genome of Hepatitis B Virus: Restriction Enzyme Cleavage and Structure of DNA Extracted from Dane Particles  

Microsoft Academic Search

DNA extracted from Dane particles has been characterized by gel electrophoresis and restriction enzyme cleavage with endonuclease R\\\\cdot HaeIII (from Hemophilus aegyptius). Dane particle DNA is proposed to be a double-stranded circular DNA approximately 3600 nucleotides in length containing a single-stranded gap of 600-2100 nucleotides. The endogenous DNA polymerase (DNA nucleotidyltransferase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase; EC 2.7.7.7) reaction appears to repair this

Jesse Summers; Anna O'Connell; Irving Millman

1975-01-01

190

Caffeine overcomes a restriction point associated with DNA replication, but does not accelerate mitosis  

PubMed Central

Mitotic chromosome condensation is normally dependent on the previous completion of replication. Caffeine spectacularly deranges cell cycle controls after DNA polymerase inhibition or DNA damage; it induces the condensation, in cells that have not completed replication, of fragmented nuclear structures, analogous to the S-phase prematurely condensed chromosomes seen when replicating cells are fused with mitotic cells. Caffeine has been reported to induce S-phase condensation in cells where replication is arrested, by accelerating cell cycle progression as well as by uncoupling it from replication; for, in BHK or CHO hamster cells arrested in early S-phase and given caffeine, condensed chromosomes appear well before the normal time at which mitosis occurs in cells released from arrest. However, we have found that this apparent acceleration depends on the technique of synchrony and cell line employed. In other cells, and in synchronized hamster cells where the cycle has not been subjected to prolonged continual arrest, condensation in replication-arrested cells given caffeine occurs at the same time as normal mitosis in parallel populations where replication is allowed to proceed. This caffeine- induced condensation is therefore "premature" with respect to the chromatin structure of the S-phase nucleus, but not with respect to the timing of the normal cycle. Caffeine in replication-arrested cells thus overcomes the restriction on the formation of mitotic condensing factors that is normally imposed during DNA replication, but does not accelerate the timing of condensation unless cycle controls have previously been disturbed by synchronization procedures. PMID:2161852

1990-01-01

191

Inhibition of apoptosis-associated DNA fragmentation activity in nonapoptotic cells: the role of DNA fragmentation factor-45 (DFF45/ICAD).  

PubMed

We have investigated the mechanism whereby nuclear DNA fragmentation activity emerging during early apoptosis is inhibited during normal cell life. In a cell-free system, cytosol fractions from diverse nonapoptotic human cell lines (Jurkat T-cell leukemia, HeLa carcinoma, SK-N-MC neuroblastoma, and WI-38 embryonic lung fibroblast) potently neutralized the nuclear DNA fragmentation activity of cytosol from apoptotic anti-Fas treated Jurkat cells. Recombinant human DNA fragmentation factor 45 kDa subunit (DFF45/ICAD), an inhibitor of the caspase-activated DNase DFF40/CAD, substituted for healthy cytosol in inhibiting DNA fragmentation. An antiserum against human DFF45 detected 44 and 34 kDa proteins (major and minor, respectively) in the cytosols but not in the nuclear or membrane fractions of various cultured human cells. Cytosols depleted of DFF45/ICAD by immunoadsorption had little or no inhibitor of nuclear DNA fragmentation activity and no caspase-activated DNA fragmentation activity. We conclude that immunoreactive DFF45/ICAD is the principal inhibitor of apoptotic DNase activity in the cytosol of healthy cells. PMID:9875236

Sabol, S L; Li, R; Lee, T Y; Abdul-Khalek, R

1998-12-01

192

Gene expression profile of human bone marrow stromal cells determined by restriction fragment differential display analysis.  

PubMed

Using an in vitro osteogenic culture system, we carried out a restriction fragment differential display (RFDD-PCR) to identify genes expressed by these cells in their undifferentiated stage and not expressed, or expressed at a lower level, in a closely related but distinct cell type: bone marrow stromal cells (BMSC)-derived osteoblasts (BDO). Forty-seven candidate regulated genes, selected by RFDD, were analyzed by RT-PCR analysis in three cell clones and in primary cultures from seven different donors. A subset of three genes were confirmed as upregulated in BMSC relative to BDO in every primary culture and cloned population examined: betaIG-h3, IGFbp3, and LOXL2. Their differential expression was confirmed by Northern analysis and the corresponding proteins were detected by immunolocalization in BMSC. PMID:15211571

Monticone, Massimiliano; Liu, Yi; Tonachini, Laura; Mastrogiacomo, Maddalena; Parodi, Stefano; Quarto, Rodolfo; Cancedda, Ranieri; Castagnola, Patrizio

2004-07-01

193

Cerebral Ischemia Produces Laddered DNA Fragments Distinct From Cardiac Ischemia and Archetypal Apoptosis  

Microsoft Academic Search

The electrophoretic pattern of laddered DNA fragments which has been observed after cerebral ischemia is considered to indicate that neurons are dying by apoptosis. Herein the authors directly demonstrate using ligation-mediated polymerase chain reaction methods that 99% of the DNA fragments produced after either global or focal ischemia in adult rats, or produced after hypoxia-ischemia in neonatal rats, have staggered

John P. MacManus; Henry Fliss; Edward Preston; Ingrid Rasquinha; Ursula Tuor

1999-01-01

194

Nanopore-based assay for detection of methylation in double-stranded DNA fragments.  

PubMed

DNA methylation is an epigenetic modification of DNA in which methyl groups are added at the 5-carbon position of cytosine. Aberrant DNA methylation, which has been associated with carcinogenesis, can be assessed in various biological fluids and potentially can be used as markers for detection of cancer. Analytically sensitive and specific assays for methylation targeting low-abundance and fragmented DNA are needed for optimal clinical diagnosis and prognosis. We present a nanopore-based direct methylation detection assay that circumvents bisulfite conversion and polymerase chain reaction amplification. Building on our prior work, we used methyl-binding proteins (MBPs), which selectively label the methylated DNA. The nanopore-based assay selectively detects methylated DNA/MBP complexes through a 19 nm nanopore with significantly deeper and prolonged nanopore ionic current blocking, while unmethylated DNA molecules were not detectable due to their smaller diameter. Discrimination of hypermethylated and unmethylated DNA on 90, 60, and 30 bp DNA fragments was demonstrated using sub-10 nm nanopores. Hypermethylated DNA fragments fully bound with MBPs are differentiated from unmethylated DNA at 2.1- to 6.5-fold current blockades and 4.5- to 23.3-fold transport durations. Furthermore, these nanopore assays can detect the CpG dyad in DNA fragments and could someday profile the position of methylated CpG sites on DNA fragments. PMID:25569824

Shim, Jiwook; Kim, Younghoon; Humphreys, Gwendolyn I; Nardulli, Ann M; Kosari, Farhad; Vasmatzis, George; Taylor, William R; Ahlquist, David A; Myong, Sua; Bashir, Rashid

2015-01-27

195

Saccharin consumption increases sperm DNA fragmentation and apoptosis in mice  

PubMed Central

Background: Saccharin is an artificial non-caloric sweetener that used to sweeten products such as drinks, candies, medicines, and toothpaste, but our bodies cannot metabolize it. Sodium saccharin is considered as an important factor in tumor promotion in male rats but not in humans. Objective: The objective of this study was to investigate the effect of saccharin consumption on sperm parameters and apoptosis in adult mice. Materials and Methods: Totally 14 adult male mice were divided into 2 groups. Group 1 served as control fed on basal diet and group 2 or experimental animals received distilled water containing saccharin (0.2% w/v) for 35 days. After that, the left cauda epididymis of each mouse was cut and placed in Ham’s F10. Swimmed-out spermatozoa were used to analyze count, motility, morphology (Pap-staining) and viability (eosin-Y staining). Sperm DNA integrity, as an indicator of apoptosis, was assessed by SCD (sperm chromatin dispersion) and terminal deoxynucleotidyl transferase (TUNEL) assay. Results: Following saccharin consumption, we had a reduction in sperm motility with respect to control animals (p=0.000). In addition, the sperm count diminished (17.70±1.11 in controls vs. 12.80±2.79 in case group, p=0.003) and the rate of sperm normal morphology decreased from 77.00±6.40 in control animals into 63.85±6.81 in saccharin-treated mice (p=0.001). Also, we saw a statistically significant increase in rates of sperm DNA damage and apoptosis in experimental group when compared to control one (p=0.001, p=0.002 respectively). Conclusion: Saccharin consumption may have negative effects on sperm parameters, and increases the rate of sperm DNA fragmentation and apoptosis in mice. PMID:25031574

Rahimipour, Marzieh; Talebi, Ali Reza; Anvari, Morteza; Abbasi Sarcheshmeh, Abolghasem; Omidi, Marjan

2014-01-01

196

Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay  

Microsoft Academic Search

BACKGROUND: Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs) by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP)-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused

María Tamayo; Rebeca Santiso; Jaime Gosalvez; Germán Bou; José Luis Fernández

2009-01-01

197

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy  

SciTech Connect

Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two genomes is demonstrated and which evaluates systematically the impact of DNA degradation on quantification of mtDNA copy number.

Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)] [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)] [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

2012-07-06

198

Characterization of the 5-hydroxymethylcytosine-specific DNA restriction endonucleases  

PubMed Central

In T4 bacteriophage, 5-hydroxymethylcytosine (5hmC) is incorporated into DNA during replication. In response, bacteria may have developed modification-dependent type IV restriction enzymes to defend the cell from T4-like infection. PvuRts1I was the first identified restriction enzyme to exhibit specificity toward hmC over 5-methylcytosine (5mC) and cytosine. By using PvuRts1I as the original member, we identified and characterized a number of homologous proteins. Most enzymes exhibited similar cutting properties to PvuRts1I, creating a double-stranded cleavage on the 3? side of the modified cytosine. In addition, for efficient cutting, the enzymes require two cytosines 21–22-nt apart and on opposite strands where one cytosine must be modified. Interestingly, the specificity determination unveiled a new layer of complexity where the enzymes not only have specificity for 5-?-glucosylated hmC (5?ghmC) but also 5-?-glucosylated hmC (5?ghmC). In some cases, the enzymes are inhibited by 5?ghmC, whereas in others they are inhibited by 5?ghmC. These observations indicate that the position of the sugar ring relative to the base is a determining factor in the substrate specificity of the PvuRts1I homologues. Lastly, we envision that the unique properties of select PvuRts1I homologues will permit their use as an additive or alternative tool to map the hydroxymethylome. PMID:23482393

Borgaro, Janine G.; Zhu, Zhenyu

2013-01-01

199

A microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis  

E-print Network

A microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization online 16 May 2012 Keywords: Electrochemical impedance spectroscopy DNA hybridization biosensor Biochip, a diffusion-restriction model was applied to a miniaturized biochip nanovolume reactor to accurately

Ghodssi, Reza

200

Innate Structure of DNA Foci Restricts the Mixing of DNA from Different Chromosome Territories  

PubMed Central

The distribution of chromatin within the mammalian nucleus is constrained by its organization into chromosome territories (CTs). However, recent studies have suggested that promiscuous intra- and inter-chromosomal interactions play fundamental roles in regulating chromatin function and so might define the spatial integrity of CTs. In order to test the extent of DNA mixing between CTs, DNA foci of individual CTs were labeled in living cells following incorporation of Alexa-488 and Cy-3 conjugated replication precursor analogues during consecutive cell cycles. Uniquely labeled chromatin domains, resolved following random mitotic segregation, were visualized as discrete structures with defined borders. At the level of resolution analysed, evidence for mixing of chromatin from adjacent domains was only apparent within the surface volumes where neighboring CTs touched. However, while less than 1% of the nuclear volume represented domains of inter-chromosomal mixing, the dynamic plasticity of DNA foci within individual CTs allows continual transformation of CT structure so that different domains of chromatin mixing evolve over time. Notably, chromatin mixing at the boundaries of adjacent CTs had little impact on the innate structural properties of DNA foci. However, when TSA was used to alter the extent of histone acetylation changes in chromatin correlated with increased chromatin mixing. We propose that DNA foci maintain a structural integrity that restricts widespread mixing of DNA and discuss how the potential to dynamically remodel genome organization might alter during cell differentiation. PMID:22205925

Fennessy, Dorota; Jackson, Dean A.

2011-01-01

201

IS6110 Restriction Fragment Length Polymorphism Typing of Drug-resistant Mycobacterium tuberculosis Strains from Northeast South Africa  

PubMed Central

Tuberculosis (TB) remains a deadly infectious disease affecting millions of people worldwide; 95% of TB cases, with 98% of death occur in developing countries. The situation in South Africa merits special attention. A total of 21,913 sputum specimens of suspected TB patients from three provinces of South Africa routinely submitted to the TB laboratory of Dr. George Mukhari (DGM) Hospital were assayed for Mycobacterium tuberculosis (MTB) growth and antibiotic susceptibility. The genetic diversity of 338 resistant strains were also studied. DNA isolated from the strains were restricted with Pvu II, transferred on to a nylon membrane and hybridized with a PCR-amplified horseradish peroxidase 245 bp IS6110 probe. Of the 338 resistant strains, 2.09% had less than 5 bands of IS6110, and 98% had 5 or more bands. Unique restriction fragment length polymorphism (RFLP) patterns were observed in 84.3% of the strains, showing their epidemiological independence, and 15.7% were grouped into 22 clusters. Thirty-two strains (61.5%) from the 52 that clustered were from Mpumalanga, 16/52 (30.8%) from Gauteng, and 4/52 (9.6%) from Limpopo province. Clustering was not associated with age. However, strains from male patients in Mpumalanga were more likely to be clustered than strains from male patients in Limpopo and/or Gauteng province. The minimum estimate for the proportion of resistant TB that was due to transmission is 9.06% (52-22=30/331). Our results indicate that transmission of drug-resistant strains may contribute substantially to the emergence of drug-resistant tuberculosis in South Africa. PMID:23617199

Green, Ezekiel; Obi, Lawrence C.; Okoh, Anthony I.; Nchabeleng, Maphoshane; Villiers, Babsie E. De; Letsoalo, Tomas; Hoosen, Anwar A.; Bessong, Pascal O.

2013-01-01

202

Restriction fragment length polymorphism of the caprine beta-globin gene cluster associated with the Hb beta-globin variants in Norwegian dairy goats.  

PubMed

Restriction fragment length polymorphism (RFLP) analysis was used to characterize the beta-globin cluster in Norwegian dairy goats. In 122 individuals, different RFLP patterns were detected after BglII and PstI digestion and hybridization with a caprine beta-globin probe. The location of the polymorphic BglII and PstI sites were determined. The different RFLPs were in linkage disequilibrium with each other and with the beta-globin locus as studied at the protein level. A preferential association between certain RFLP haplotypes and beta-globin variants was observed. Polymorphic DNA fragments in the epsilon-globin genes were detected after MspI digestion and hybridization with a caprine epsilon-probe, and eight different band patterns were observed. Correlation between different MspI haplotypes and the beta-globin variants was determined. PMID:1673827

Bergersen, O; Braend, M

1991-01-01

203

Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling  

NASA Technical Reports Server (NTRS)

We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA.

Holley, W. R.; Chatterjee, A.

1996-01-01

204

DNA restriction patterns and DNA-DNA solution hybridization studies of Frankia isolates from Myrica pennsylvanica (bayberry).  

PubMed Central

Sixteen Frankia strains were isolated from Myrica pennsylvanica (bayberry) root nodules collected at diverse sites in New Jersey. Restriction pattern analysis of total genomic DNA was used to group the isolates into gel groups, and the genetic relatedness among the isolates was evaluated by DNA-DNA solution hybridization studies. Restriction pattern analysis provided a distinctive reproducible fingerprint for each isolate. Isolates fell into nine separate groups (strain types). More than one strain type was isolated from most sites. Isolates from two different gel groups were found in 3 of 10 nodules examined. Of the 16 isolates, 10 contained extrachromosomal DNA. Six different extrachromosomal DNA banding patterns were found. Genomically similar isolates carried related, but different, banding patterns. DNA hybridization studies indicated that isolates from a single plant species can be minimally related as determined by total genome homology. Homology ranged from 12 to 99%. Highly divergent strains were isolated from the same plant and found to cohabit the same nodule. Thus, this study demonstrated that Frankia strains which infect the same host plant are not only phenotypically different but also genetically diverse. Images PMID:2802599

Bloom, R A; Mullin, B C; Tate, R L

1989-01-01

205

Identification of raw and heat-processed meats from game bird species by polymerase chain reaction-restriction fragment length polymorphism of the mitochondrial D-loop region.  

PubMed

Polymerase chain reaction-RFLP analysis has been applied to the identification of meats from quail (Coturnix coturnix), pheasant (Phasianus colchicus), red-legged partridge (Alectoris rufa), chukar partridge (Alectoris chukar), guinea fowl (Numida meleagris), capercaillie (Tetrao urogallus), Eurasian woodcock (Scolopax rusticola), and woodpigeon (Columba palumbus). Polymerase chain reaction amplification was carried out using a set of primers flanking a conserved region of approximately 310 bp from the mitochondrial D-loop region. Restriction site analysis based on sequence data from this DNA fragment permitted the selection of HinfI, MboII, and Hpy188III endonucleases for species identification. The restriction profiles obtained when amplicons were digested with the chosen enzymes allowed the unequivocal identification of all game bird species analyzed. Consistent results were obtained with both raw and heat-processed meats. PMID:19211540

Rojas, M; González, I; Fajardo, V; Martín, I; Hernández, P E; García, T; Martín, R

2009-03-01

206

GB Virus C/Hepatitis G Virus Groups and Subgroups: Classification by a Restriction Fragment Length Polymorphism Method Based on Phylogenetic Analysis of the 5? Untranslated Region  

PubMed Central

A phylogenetic tree based on 150 5? untranslated region sequences deposited in GenBank database allowed segregation of the sequences into three major groups, including two subgroups, i.e., 1, 2a, 2b, and 3, supported by bootstrap analysis. Restriction site analysis of these sequences predicted that HinfI and either AatII or AciI could be used for genomic typing with 99.4% accuracy. cDNA sequencing and subsequent alignment of 21 Argentine GB virus C/hepatitis G virus strains confirmed restriction fragment length polymorphism patterns theoretically predicted. This method may be useful for a rapid screening of samples when either epidemiological or transmission studies of this agent are carried out. PMID:10203483

Quarleri, J. F.; Mathet, V. L.; Feld, M.; Ferrario, D.; della Latta, M. P.; Verdun, R.; Sánchez, D. O.; Oubiña, J. R.

1999-01-01

207

Rapid discrimination among dermatophytes, Scytalidium spp., and other fungi with a PCR-restriction fragment length polymorphism ribotyping method.  

PubMed

Dermatomycoses are very common infections caused mainly by dermatophytes. Scytalidiosis is a differential mycological diagnosis, especially in tropical and subtropical areas. Since a culture-based diagnosis takes 2 to 3 weeks, we set up a PCR-restriction fragment length polymorphism (RFLP) method for rapid discrimination of these fungi in clinical samples. The hypervariable V4 domain of the small ribosomal subunit 18S gene was chosen as the target for PCR. The corresponding sequences from 19 fungal species (9 dermatophytes, 2 Scytalidium species, 6 other filamentous fungi, and 2 yeasts) were obtained from databases or were determined in the laboratory. Sequences were aligned to design primers for dermatophyte-specific PCR and to identify digestion sites for RFLP analysis. The reliability of PCR-RFLP for the diagnosis of dermatomycosis was assessed on fungal cultures and on specimens from patients with suspected dermatomycosis. Two sets of primers preferentially amplified fungal DNA from dermatophytes (DH1L and DH1R) or from Scytalidium spp. (DH2L and DH1R) relative to DNA from bacteria, yeasts, some other filamentous fungi, and humans. Digestion of PCR products with EaeI or BamHI discriminated between dermatophytes and Scytalidium species, as shown with cultures of 31 different fungal species. When clinical samples were tested by PCR-RFLP, blindly to mycological findings, the results of the two methods agreed for 74 of 75 samples. Dermatophytes and Scytalidium spp. can thus be readily discriminated by PCR-RFLP within 24 h. This method can be applied to clinical samples and is suited to rapid etiologic diagnosis and treatment selection for patients with dermatomycosis. PMID:11158128

Machouart-Dubach, M; Lacroix, C; de Chauvin, M F; Le Gall, I; Giudicelli, C; Lorenzo, F; Derouin, F

2001-02-01

208

Rapid Discrimination among Dermatophytes, Scytalidium spp., and Other Fungi with a PCR-Restriction Fragment Length Polymorphism Ribotyping Method  

PubMed Central

Dermatomycoses are very common infections caused mainly by dermatophytes. Scytalidiosis is a differential mycological diagnosis, especially in tropical and subtropical areas. Since a culture-based diagnosis takes 2 to 3 weeks, we set up a PCR-restriction fragment length polymorphism (RFLP) method for rapid discrimination of these fungi in clinical samples. The hypervariable V4 domain of the small ribosomal subunit 18S gene was chosen as the target for PCR. The corresponding sequences from 19 fungal species (9 dermatophytes, 2 Scytalidium species, 6 other filamentous fungi, and 2 yeasts) were obtained from databases or were determined in the laboratory. Sequences were aligned to design primers for dermatophyte-specific PCR and to identify digestion sites for RFLP analysis. The reliability of PCR-RFLP for the diagnosis of dermatomycosis was assessed on fungal cultures and on specimens from patients with suspected dermatomycosis. Two sets of primers preferentially amplified fungal DNA from dermatophytes (DH1L and DH1R) or from Scytalidium spp. (DH2L and DH1R) relative to DNA from bacteria, yeasts, some other filamentous fungi, and humans. Digestion of PCR products with EaeI or BamHI discriminated between dermatophytes and Scytalidium species, as shown with cultures of 31 different fungal species. When clinical samples were tested by PCR-RFLP, blindly to mycological findings, the results of the two methods agreed for 74 of 75 samples. Dermatophytes and Scytalidium spp. can thus be readily discriminated by PCR-RFLP within 24 h. This method can be applied to clinical samples and is suited to rapid etiologic diagnosis and treatment selection for patients with dermatomycosis. PMID:11158128

Machouart-Dubach, Marie; Lacroix, Claire; de Chauvin, Martine Feuilhade; Le Gall, Isabelle; Giudicelli, Catherine; Lorenzo, Frédéric; Derouin, Francis

2001-01-01

209

A novel host-specific restriction system associated with DNA backbone S-modification in Salmonella  

PubMed Central

A novel, site-specific, DNA backbone S-modification (phosphorothioation) has been discovered, but its in vivo function(s) have remained obscure. Here, we report that the enteropathogenic Salmonella enterica serovar Cerro 87, which possesses S-modified DNA, restricts DNA isolated from Escherichia coli, while protecting its own DNA by site-specific phosphorothioation. A cloned 15-kb gene cluster from S. enterica conferred both host-specific restriction and DNA S-modification on E. coli. Mutational analysis of the gene cluster proved unambiguously that the S-modification prevented host-specific restriction specified by the same gene cluster. Restriction activity required three genes in addition to at least four contiguous genes necessary for DNA S-modification. This functional overlap ensures that restriction of heterologous DNA occurs only when the host DNA is protected by phosphorothioation. Meanwhile, this novel type of host-specific restriction and modification system was identified in many diverse bacteria. As in the case of methylation-specific restriction systems, targeted inactivation of this gene cluster should facilitate genetic manipulation of these bacteria, as we demonstrate in Salmonella. PMID:20627870

Xu, Tiegang; Yao, Fen; Zhou, Xiufen; Deng, Zixin; You, Delin

2010-01-01

210

Genetic Interrelatedness among Clover Proliferation Mycoplasmalike Organisms (MLOs) and Other MLOs Investigated by Nucleic Acid Hybridization and Restriction Fragment Length Polymorphism Analyses.  

PubMed

DNA was isolated from clover proliferation (CP) mycoplasmalike organism (MLO)-diseased periwinkle plants (Catharanthus roseus (L.) G. Don.) and cloned into pSP6 plasmid vectors. CP MLO-specific recombinant DNA clones were biotin labeled and used as probes in dot hybridization and restriction fragment length polymorphism analyses to study the genetic interrelatedness among CP MLO and other MLOs, including potato witches'-broom (PWB) MLO. Results from dot hybridization analyses indicated that both a Maryland strain of aster yellows and a California strain of aster yellows are distantly related to CP MLO. Elm yellows, paulownia witches'-broom, peanut witches'-broom, loofah witches'-broom, and sweet potato witches'-broom may be very distantly related, if at all, to CP MLO. A new Jersey strain of aster yellows MLO, tomato big bud MLO, clover phyllody MLO, beet leafhopper-transmitted virescence MLO, and ash yellows MLO are related to CP MLO, but PWB MLO is the most closely related. Similarity coefficients derived from restriction fragment length polymorphism analyses revealed that PWB and CP MLOs are closely related strains and thus provided direct evidence of their relatedness in contrast to reliance solely on biological characterization. PMID:16348604

Lee, I M; Davis, R E; Hiruki, C

1991-12-01

211

Knotting probability of DNA molecules confined in restricted volumes: DNA knotting in phage capsids  

NASA Astrophysics Data System (ADS)

When linear double-stranded DNA is packed inside bacteriophage capsids, it becomes highly compacted. However, the phage is believed to be fully effective only if the DNA is not entangled. Nevertheless, when DNA is extracted from a tailless mutant of the P4 phage, DNA is found to be cyclic and knotted (probability of 0.95). The knot spectrum is very complex, and most of the knots have a large number of crossings. We quantified the frequency and crossing numbers of these knots and concluded that, for the P4 tailless mutant, at least half the knotted molecules are formed while the DNA is still inside the viral capsid rather than during extraction. To analyze the origin of the knots formed inside the capsid, we compared our experimental results to Monte Carlo simulations of random knotting of equilateral polygons in confined volumes. These simulations showed that confinement of closed chains to tightly restricted volumes results in high knotting probabilities and the formation of knots with large crossing numbers. We conclude that the formation of the knots inside the viral capsid is driven mainly by the effects of confinement.

Arsuaga, Javier; Vázquez, Mariel; Trigueros, Sonia; Witt Sumners, De; Roca, Joaquim

2002-04-01

212

Paternal inheritance of plastids in interspecific hybrids of the genus Actinidia revealed by PCR-amplification of chloroplast DNA fragments.  

PubMed

RFLPs (restriction fragment length polymorphisms) of PCR (polymerase chain reaction) -amplified fragments were used to trace the pattern of plastid DNA inheritance in the genus Actinidia. A total of 51 progeny originating from interspecific crosses between three A. arguta cultivars and A. deliciosa, the kiwifruit, and 12 progeny originating from the cross between A. kolomikta and A. chinensis were analysed together with their parents. No reciprocal crosses could be tested since they all failed to set viable seeds. Attempts to rescue immature embryos failed in all cases as well. The A. argutaXA. deliciosa crosses were checked for the RFLP patterns of a sequence encoding part of the Rubisco large subunit (rbcL), using either AluI or MseI, and for a sequence encoding part of the photosystem II D1 protein (psbA), using HinfI. The A. kolomiktaXA. chinensis cross was checked for the RFLP patterns of sequences encoding the spacers between trnT and the 5'-trnL exon (a-b spacer DNA) and the trnL 3' exon and trnF (e-f spacer DNA), respectively. The first spacer revealed a natural polymorphism between the two parent species due to a large deletion occurring in A. kolomikta detectable without further restriction enzyme treatment. The e-f spacer DNA was digested with HinfI. The comparison of the RFLP patterns in the parents and their progeny showed a strictly paternal inheritance of chloroplast DNA in Actinidia, with no exception found in any of the crosses examined. As the reciprocal crosses were not available, we do not know whether paternal inheritance of plastids is restricted to the crosses we analysed or if this is the general rule for plastid inheritance in the genus Actinidia. Actinidia is dioecious and is the first purely outbreeding species for which a paternal plastid inheritance has so far been documented. PMID:7616960

Cipriani, G; Testolin, R; Morgante, M

1995-06-25

213

Forensic identification of ungulate species using restriction digests of PCR-amplified mitochondrial DNA.  

PubMed

A survey of mitochondrial D-loop variation in 15 species of ungulates was conducted via amplification by the polymerase chain reaction followed by restriction fragment length polymorphism analysis. This survey included moose (Alces alces), caribou (Rangifer tarandus), mule deer (Odocoileus hemionus hemionus), black-tailed deer (O. h. columbianus), white-tailed deer (O. virginianus), waipiti (Cervus elaphus), pronghorn antelope (Antilocapra americana), bighorn sheep (Ovis canadensis), Stone's sheep (O. dalli), domestic sheep (O. aries), moulflon sheep (O. musimon), mountain goat (Oreamnos americanus), domestic goat (Capra hircus), domestic cattle (Bos taurus), and bison (Bison bison). The results of this preliminary survey indicate that there may be sufficient species specific variation in the D-loop region of the mitochondrial genome of the ungulate species examined here, with the exception of deer (Odocoileus) species, to establish the species origin of the mitochondrial haplotypes of this group. The Odocoileus species are known to hybridize and sharing of mtDNA haplotypes was observed. The chelex DNA extraction technique was successfully used on small blood stains. PMID:8522926

Murray, B W; McClymont, R A; Strobeck, C

1995-11-01

214

Improved Genotyping Vaccine and Wild-Type Poliovirus Strains by Restriction Fragment Length Polymorphism Analysis: Clinical Diagnostic Implications  

Microsoft Academic Search

The combination of preventive vaccination and diagnostic typing of viral isolates from patients with clinical poliomyelitis constitutes our main protective shield against polioviruses. The restriction fragment length polymorphism (RFLP) adaptation of the reverse transcriptase (RT)-PCR methodology has advanced diagnos- tic genotyping of polioviruses, although further improvements are definitely needed. We report here on an improved RFLP procedure for the genotyping

AMALIA GEORGOPOULOU; PANAYOTIS MARKOULATOS; NIKI SPYROU

215

Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.  

PubMed

Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. PMID:23830775

Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

2013-09-27

216

Parallel algorithms for the DNA Fragment Assembly Problem Team ParaCore  

E-print Network

the complete DNA sequence of a living organism. Image from www.bristol.k12.ct.us #12;II. Shotgun sequencingParallel algorithms for the DNA Fragment Assembly Problem Team ParaCore ·Artur, Braga ·Igor Pelvain Science ­ Rochester Institute of Technology #12;Outline I. Overview: DNA as the support of genetic

Kaminsky, Alan

217

Restriction Fragment Length Polymorphism Analysis of Some Flagellin Genes of Salmonella enterica  

PubMed Central

Salmonellae often have the ability to express two different flagellar antigen specificities (phase 1 and phase 2). At the cell level, only one flagellar phase is expressed at a time. Two genes, fliC, encoding phase-1 flagellin, and fljB, encoding phase-2 flagellin, are alternatively expressed. Flagellin genes from 264 serovars of Salmonella enterica were amplified by two phase-specific PCR systems. Amplification products were subjected to restriction fragment length polymorphism (RFLP) analysis by using endonucleases HhaI and HphI. RFLP with HhaI and HphI yielded 64 and 42 different restriction profiles, respectively, among 329 flagellin genes coding for 26 antigens. The phase-1 gene showed 46 patterns with HhaI and 30 patterns with HphI. The phase-2 gene showed 23 patterns with HhaI and 17 patterns with HphI. When the data from both enzymes were combined, 116 patterns were obtained: 74 for fliC, 47 for fljB, and 5 shared by both genes. Of these combined patterns, 80% were specifically associated with one flagellar antigen and 20% were associated with more than one antigen. Each flagellar antigen was divided into 2 to 18 different combined patterns. In the sample of strains used, determination of the phase-1 and phase-2 flagellin gene RFLP, added to the knowledge of the O antigen, allowed identification of all diphasic serovars. Overall, the diversity uncovered by flagellin gene RFLP did not precisely match that evidenced by flagellar agglutination. PMID:9738029

Dauga, Catherine; Zabrovskaia, Anna; Grimont, Patrick A. D.

1998-01-01

218

Linear mtDNA fragments and unusual mtDNA rearrangements associated with pathological deficiency of MGME1 exonuclease  

PubMed Central

MGME1, also known as Ddk1 or C20orf72, is a mitochondrial exonuclease found to be involved in the processing of mitochondrial DNA (mtDNA) during replication. Here, we present detailed insights on the role of MGME1 in mtDNA maintenance. Upon loss of MGME1, elongated 7S DNA species accumulate owing to incomplete processing of 5? ends. Moreover, an 11-kb linear mtDNA fragment spanning the entire major arc of the mitochondrial genome is generated. In contrast to control cells, where linear mtDNA molecules are detectable only after nuclease S1 treatment, the 11-kb fragment persists in MGME1-deficient cells. In parallel, we observed characteristic mtDNA duplications in the absence of MGME1. The fact that the breakpoints of these mtDNA rearrangements do not correspond to either classical deletions or the ends of the linear 11-kb fragment points to a role of MGME1 in processing mtDNA ends, possibly enabling their repair by homologous recombination. In agreement with its functional involvement in mtDNA maintenance, we show that MGME1 interacts with the mitochondrial replicase PolgA, suggesting that it is a constituent of the mitochondrial replisome, to which it provides an additional exonuclease activity. Thus, our results support the viewpoint that MGME1-mediated mtDNA processing is essential for faithful mitochondrial genome replication and might be required for intramolecular recombination of mtDNA. PMID:24986917

Nicholls, Thomas J.; Zsurka, Gábor; Peeva, Viktoriya; Schöler, Susanne; Szczesny, Roman J.; Cysewski, Dominik; Reyes, Aurelio; Kornblum, Cornelia; Sciacco, Monica; Moggio, Maurizio; Dziembowski, Andrzej; Kunz, Wolfram S.; Minczuk, Michal

2014-01-01

219

Chain reaction cloning: a one-step method for directional ligation of multiple DNA fragments.  

PubMed

A novel DNA assembly method, chain reaction cloning (CRC), is described. CRC enables the ordered assembly of multiple DNA fragments in a single step. The power of the technique was demonstrated by the directed in vitro assembly of a plasmid comprised of six DNA fragments from a pool of 12 available fragments. The odds of obtaining the correct plasmid clone in a single step, using conventional techniques, is less than 1 in 191000000. Using CRC, the desired plasmid was recovered at a frequency of one in two. Ligation is no longer the rate limiting step in cloning, and limitless possibilities exist for the reconstruction of complex genomes. PMID:10675609

Pachuk, C J; Samuel, M; Zurawski, J A; Snyder, L; Phillips, P; Satishchandran, C

2000-02-01

220

Effect of different restriction enzymes, probe source, and probe length on detecting restriction fragment length polymorphism in tomato  

Microsoft Academic Search

Since the construction and use of RFLP genetic maps depends on the ability of cloned sequences to detect polymorphism, we have attempted to determine conditions under which maximum levels of polymorphism can be detected. Forty cloned nuclear sequences from three different libraries (cDNA, EcoRI genomic, and Pstl genomic) were hybridized to total DNA from 149 plants representing eight species of

J. C. Miller; S. D. Tanksley

1990-01-01

221

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism.  

PubMed

The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993

Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph

2013-06-01

222

Optimizing Restriction Site Placement for Synthetic Genomes  

E-print Network

in microbiology. · Uses restriction enzymes to cut plasmids for insertion/removal of DNA fragments. · To use a restriction enzyme, the place where it cuts must be unique. · Unique restriction sites regularly distributedOptimizing Restriction Site Placement for Synthetic Genomes Pablo Montes1 Heraldo Memelli1 Charles

Lonardi, Stefano

223

Characterization of fastidious adenovirus types 40 and 41 by DNA restriction enzyme analysis and by neutralizing monoclonal antibodies  

Microsoft Academic Search

The DNA of 48 strains of adenovirus type 40 (Ad40) and of 128 strains of adenovirus type 41 (Ad41), isolated between 1971 and 1986 from various countries, was characterized by restriction enzyme analysis using nine and ten restriction endonucleases respectively. Five new DNA variants of Ad40 and 18 new DNA variants of Ad41 were detected. Most of the restriction sites

Avoort van der H. G. A. M; Anton G. Wermenbol; Timo P. L. Zomerdijk; John A. F. W. Kleijne; P. Jensma; A. D. M. E. Osterhaus; A. H. Kidd; Jong de J. C; J DEJONG

1989-01-01

224

DNA digestion protocol & hints Overview: Although it is pretty standard to digest DNA with restriction enzymes, here  

E-print Network

with restriction enzymes, here are a standardized protocol and some hints... References: *Current protocols · restriction enzyme · DNA loading buffer · Agarose gel 0.8% (or different depending on expected band sizes.1 to 4 µg 10x Digestion buffer 2 µl 5 µl Enzyme ? ? Water Rest of volume Rest of volume 2. Add the enzyme

Doering, Tamara

225

The origin and genetic relationships of the Baikal seal, Phoca sibirica, by restriction analysis of mitochondrial DNA.  

PubMed

The origin and genetic relationships of the Baikal seal, Phoca sibirica, were studied by restriction fragment length polymorphism analysis of mitochondrial DNA (mtDNA). Using 17 different six-base recognition restriction endonucleases, we examined 98 Baikal seals, and two other related species, the ringed seal, P. hispida, (n=87), and the Caspian seal, P. caspica, (n=94). Analysis revealed the existence of 87 mtDNA haplotypes in the total of 279 specimens. The haplotypes of each species were divided into different clusters on a dendrogram obtained by UPGMA based on haplotype frequency and mtDNA base substitution. No common haplotypes were found among the species examined. The Baikal seal is much more closely related to the ringed seal than the Caspian seal. The amount of divergence suggested that an ancestor of the Baikal seal came down to the lake approximately 0.4 million years ago as was previously indicated by paleontological studies. The seals examined here showed lower variabilities. PMID:14624043

Sasaki, Hiroyuki; Numachi, Ken-ichi; Grachev, Mikhail A

2003-11-01

226

No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus.  

PubMed

It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses. PMID:23444031

Kaspersen, M D; Bungum, M; Fedder, J; Bonde, J; Larsen, P B; J Ingerslev, H; Höllsberg, P

2013-05-01

227

Comparison of DNA fragmentation and color thresholding for objective quantitation of apoptotic cells  

NASA Technical Reports Server (NTRS)

Apoptosis is a process of cell death characterized by distinctive morphological changes and fragmentation of cellular DNA. Using video imaging and color thresholding techniques, we objectively quantitated the number of cultured CD4+ T-lymphoblastoid cells (HUT78 cells, RH9 subclone) displaying morphological signs of apoptosis before and after exposure to gamma-irradiation. The numbers of apoptotic cells measured by objective video imaging techniques were compared to numbers of apoptotic cells measured in the same samples by sensitive apoptotic assays that quantitate DNA fragmentation. DNA fragmentation assays gave consistently higher values compared with the video imaging assays that measured morphological changes associated with apoptosis. These results suggest that substantial DNA fragmentation can precede or occur in the absence of the morphological changes which are associated with apoptosis in gamma-irradiated RH9 cells.

Plymale, D. R.; Ng Tang, D. S.; Fermin, C. D.; Lewis, D. E.; Martin, D. S.; Garry, R. F.

1995-01-01

228

Impact of sperm DNA fragmentation on the outcome of IVF with own or donated oocytes  

Microsoft Academic Search

A prospective study was performed to assess the impact of sperm DNA fragmentation on the outcome of IVF with own or donated oocytes. The study population included 178 couples (62 cycles of IVF, 116 of intracytoplasmic sperm injection (ICSI)) with own (n=77) and donor (n=101) oocytes. DNA fragmentation was evaluated by TdT (terminal deoxynucleotidyl transferase)-mediated dUDP nick-end labelling assay. Correlation

Marga Esbert; Alberto Pacheco; Francesca Vidal; Mireia Florensa; Marissa Riqueros; Agustín Ballesteros; Nicolás Garrido; Gloria Calderón

229

Direct Random Mutagenesis of Gene-Sized DNA Fragments Using Polymerase Chain Reaction  

Microsoft Academic Search

The polymerase chain reaction (PCR) can be used to amplify a DNA fragment with the concomitant creation of numerous mutations provided that one dNTP substrate is in excess over the three others. Advantage was taken of this behavior to systematically mutagenize a 291-bp-long DNA fragment and to define the rules relating the frequencies of each possible bp substitution to the

M. Fromant; S. Blanquet

1995-01-01

230

Intestinal Microbiota is Different in Women with Preterm Birth: Results from Terminal Restriction Fragment Length Polymorphism Analysis  

PubMed Central

Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP), we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group) (n?=?20), those who had preterm labor but delivered term babies (PTL group) (n?=?11), and those who had preterm birth (PTB group) (n?=?10). Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method. PMID:25372390

Shiozaki, Arihiro; Yoneda, Satoshi; Yoneda, Noriko; Yonezawa, Rika; Matsubayashi, Takamichi; Seo, Genichiro; Saito, Shigeru

2014-01-01

231

Genetic Diversity of African and Worldwide Strains of Ralstonia solanacearum as Determined by PCR-Restriction Fragment Length Polymorphism Analysis of the hrp Gene Region  

Microsoft Academic Search

The genetic diversity among a worldwide collection of 120 strains of Ralstonia solanacearum was assessed by restriction fragment length polymorphism (RFLP) analysis of amplified fragments from the hrp gene region. Five amplified fragments appeared to be specific to R. solanacearum. Fifteen different profiles were identified among the 120 bacterial strains, and a hierarchical cluster analysis distributed them into eight clusters.

STEPHANE POUSSIER; PEGGY VANDEWALLE; JACQUES LUISETTI

1999-01-01

232

Restriction Enzyme Analysis  

NSDL National Science Digital Library

Restriction mapping is a cornerstone of modern-day biotechnology. During this three-day exercise, students will digest samples of DNA with three different restriction enzymes. The DNA samples will be electrophoresed and the resulting fragments photographed under and ultraviolet transilluminator. Attached readings and activities will help explain the process of restriction enzyme analysis and how it is used in the DNA fingerprinting procedure. This 17-page pdf contains teacher information for presenting the activity, the complete procedure of the laboratory, and two student activities.

2008-08-13

233

Typing and Clustering of Yersinia pseudotuberculosis Isolates by Restriction Fragment Length Polymorphism Analysis Using Insertion Sequences  

PubMed Central

Yersinia pseudotuberculosis is an enteropathogen that has an animal reservoir and causes human infections, mostly in temperate and cold countries. Most of the methods previously used to subdivide Y. pseudotuberculosis were performed on small numbers of isolates from a specific geographical area. One aim of this study was to evaluate the typing efficiency of restriction fragment length polymorphism of insertion sequence hybridization patterns (IS-RFLP) compared to other typing methods, such as serotyping, ribotyping, and multilocus sequence typing (MLST), on the same set of 80 strains of Y. pseudotuberculosis of global origin. We found that IS100 was not adequate for IS-RFLP but that both IS285 and IS1541 efficiently subtyped Y. pseudotuberculosis. The discriminatory index (DI) of IS1541-RFLP (0.980) was superior to those of IS285-RFLP (0.939), ribotyping (0.944), MLST (0.861), and serotyping (0.857). The combination of the two IS (2IS-RFLP) further increased the DI to 0.998. Thus, IS-RFLP is a powerful tool for the molecular typing of Y. pseudotuberculosis and has the advantage of exhibiting well-resolved banding patterns that allow for a reliable comparison of strains of worldwide origin. The other aim of this study was to assess the clustering power of IS-RFLP. We found that 2IS-RFLP had a remarkable capacity to group strains with similar genotypic and phenotypic markers, thus identifying robust populations within Y. pseudotuberculosis. Our study thus demonstrates that 2IS- and even IS1541-RFLP alone might be valuable tools for the molecular typing of global isolates of Y. pseudotuberculosis and for the analysis of the population structure of this species. PMID:24671793

Voskresenskaya, E.; Savin, C.; Leclercq, A.; Tseneva, G.

2014-01-01

234

A new estimate of sequence divergence of mitochondrial DNA using restriction endonuclease mappings  

Microsoft Academic Search

Summary A new estimate of the sequence divergence of mitochondrial DNA in related species using restriction enzyme maps is constructed. The estimate is derived assuming a simple Posisson-like model for the evolutionary process and is chosen to maximize an expression which is a reasonable approximation to the true likelihood of the restriction map data. Using this estimate, four sets of

Norman Kaplan; Charles H. Langley

1979-01-01

235

Definition of restriction, Paul BergSite: DNA Interactive (www.dnai.org)  

NSDL National Science Digital Library

Interviewee: Paul Berg DNAi Location:Manipulation>Techniques>Cutting & Pasting>On the phenomenon of restriction On the phenomenon of restriction Paul Berg speaks about Herbert Boyer's research into the process by which an organism, such as a bacterium, can recognize and destroy foreign DNA.

2008-03-26

236

Bacterial natural transformation by highly fragmented and damaged DNA  

E-print Network

bacterium Acinetobacter baylyi through natural transformation. With uptake of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA mole

Nielsen, Rasmus

237

Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†  

PubMed Central

We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916

Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

2000-01-01

238

Restriction fragment length polymorphism of the L-myc gene is not a prognostic factor in bladder cancer patients  

PubMed Central

The L-myc restriction fragment length polymorphism has been suggested to be of prognostic significance in some types of primary tumours. We examined the prognostic and susceptibility significance of the L-myc genotype in a group of 98 bladder cancer patients. The L-myc genotype did not correlate with any pathologic parameter and does not offer any clinical utility in patients with bladder cancer. © 1999 Cancer Research Campaign PMID:10206304

Ejarque, M J; Vicente, M; Bernués, M; Oliver, A; Vicente, J; Capellá, G; Lluís, F; Chéchile, G

1999-01-01

239

Comparison of Restriction Fragment Length Polymorphisms of Proto-Oncogenes in Native Hawaiians and Other Ethnic Groups in Hawaii  

Microsoft Academic Search

The relative genetic diversity of selected proto-oncogenes in the native Hawaiian gene pool was examined by comparing the restriction fragment length polymorphisms of these genes in a group of 23 individuals with at least part Hawaiian ancestry, and in 20 individuals from other ethnic groups. Twenty-one combinations of the proto-oncogenes, c-fms, c-myc, L-myc, c-Ha-ras, and c-Ki-ras, tested with 1 or

Henry D. Riley; Alan F. Lau; Tom Humphreys

1992-01-01

240

Characterization of Microbial Diversity by Determining Terminal Restriction Fragment Length Polymorphisms of Genes Encoding 16S rRNA  

Microsoft Academic Search

A quantitative molecular technique was developed for rapid analysis of microbial community diversity in various environments. The technique employed PCR in which one of the two primers used was fluorescently labeled at the 5* end and was used to amplify a selected region of bacterial genes encoding 16S rRNA from total community DNA. The PCR product was digested with restriction

WEN-TSO LIU; TERENCE L. MARSH; HANS CHENG; LARRY J. FORNEY

1997-01-01

241

Mitochondrial and nuclear DNA base excision repair are affected differently by caloric restriction1  

E-print Network

. Caloric restriction lowers DNA repair activity in brain and kidney but not liver mitochondria Most DNA was assessed by measuring BER activity in mito- chondrial extracts prepared from liver, brain, and kidney and kidney mitochon- dria, CR resulted in 30% reductions of BER activity (t test; P 0.06) compared with PF

Stuart, Jeffrey A.

242

Damage to Model DNA Fragments from Very Low-Energy (<1 eV) Electrons  

E-print Network

Damage to Model DNA Fragments from Very Low-Energy ( excite DNA have long been known to cause strand breaks (i.e., bond cleavages), only recently has it been and subsequently undergo phosphate-sugar O-C bond cleavage, it is highly unlikely (in contrast to recent

Simons, Jack

243

Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation  

Microsoft Academic Search

Programmed cell death (PCD) plays a key role in developmental biology and in maintenance of the steady state in continuously renewing tissues. Cur- rently, its existence is inferred mainly from gel elec- trophoresis of a pooled DNA extract as PCD was shown to be associated with DNA fragmentation. Based on this observation, we describe here the devel- opment of a

Yael Gavrieli; Yoav Sherman; Shmuel A. Ben-Sasson

1992-01-01

244

Restricted gene flow in fragmented populations of a wind-pollinated tree  

Microsoft Academic Search

Fragmentation of natural populations can have negative effects at the genetic level, thus threatening their evolutionary potential.\\u000a Many of the negative genetic impacts of population fragmentation can be ameliorated by gene flow and it has been suggested\\u000a that in wind-pollinated tree species, high or even increased levels of gene flow are a feature of fragmented populations,\\u000a although several studies have

Jim Provan; Gemma E. Beatty; Andrea M. Hunter; Robbie A. McDonald; Emma McLaughlin; S. Jane Preston; Siân Wilson

2008-01-01

245

Cloning of a DNA fragment encoding a heme-repressible hemoglobin-binding outer membrane protein from Haemophilus influenzae.  

PubMed

Haemophilus influenzae is able to use hemoglobin as a sole source of heme, and heme-repressible hemoglobin binding to the cell surface has been demonstrated. Using an affinity purification methodology, a hemoglobin-binding protein of approximately 120 kDa was isolated from H. influenzae type b strain HI689 grown in heme-restricted but not in heme-replete conditions. The isolated protein was subjected to N-terminal amino acid sequencing, and the derived amino acid sequence was used to design corresponding oligonucleotides. The oligonucleotides were used to probe a Southern blot of EcoRI-digested HI689 genomic DNA. A hybridizing band of approximately 4.2 kb was successfully cloned into pUC19. Using a 1.9-kb internal BglII fragment of the 4.2-kb clone as a probe, hybridization was seen in both typeable and nontypeable H. influenzae but not in other bacterial species tested. Following partial nucleotide sequencing of the 4.2-kb insert, a putative open reading frame was subcloned into an expression vector. The host Escherichia coli strain in which the cloned fragment was expressed bound biotinylated human hemoglobin, whereas binding of hemoglobin was not detected in E. coli with the vector alone. In conclusion, we hypothesize that the DNA fragment encoding an approximately 120-kDa heme-repressible hemoglobin-binding protein mediates one step in the acquisition of hemoglobin by H. influenzae in vivo. PMID:8757844

Jin, H; Ren, Z; Pozsgay, J M; Elkins, C; Whitby, P W; Morton, D J; Stull, T L

1996-08-01

246

Cloning of a DNA fragment encoding a heme-repressible hemoglobin-binding outer membrane protein from Haemophilus influenzae.  

PubMed Central

Haemophilus influenzae is able to use hemoglobin as a sole source of heme, and heme-repressible hemoglobin binding to the cell surface has been demonstrated. Using an affinity purification methodology, a hemoglobin-binding protein of approximately 120 kDa was isolated from H. influenzae type b strain HI689 grown in heme-restricted but not in heme-replete conditions. The isolated protein was subjected to N-terminal amino acid sequencing, and the derived amino acid sequence was used to design corresponding oligonucleotides. The oligonucleotides were used to probe a Southern blot of EcoRI-digested HI689 genomic DNA. A hybridizing band of approximately 4.2 kb was successfully cloned into pUC19. Using a 1.9-kb internal BglII fragment of the 4.2-kb clone as a probe, hybridization was seen in both typeable and nontypeable H. influenzae but not in other bacterial species tested. Following partial nucleotide sequencing of the 4.2-kb insert, a putative open reading frame was subcloned into an expression vector. The host Escherichia coli strain in which the cloned fragment was expressed bound biotinylated human hemoglobin, whereas binding of hemoglobin was not detected in E. coli with the vector alone. In conclusion, we hypothesize that the DNA fragment encoding an approximately 120-kDa heme-repressible hemoglobin-binding protein mediates one step in the acquisition of hemoglobin by H. influenzae in vivo. PMID:8757844

Jin, H; Ren, Z; Pozsgay, J M; Elkins, C; Whitby, P W; Morton, D J; Stull, T L

1996-01-01

247

SAMHD1 Restricts Herpes Simplex Virus 1 in Macrophages by Limiting DNA Replication  

PubMed Central

Macrophages play important roles in host immune defense against virus infection. During infection by herpes simplex virus 1 (HSV-1), macrophages acquire enhanced antiviral potential. Restriction of HSV-1 replication and progeny production is important to prevent viral spread, but the cellular mechanisms that inhibit the DNA virus in macrophages are unknown. SAMHD1 was recently identified as a retrovirus restriction factor highly expressed in macrophages. The SAMHD1 protein is expressed in both undifferentiated monocytes and differentiated macrophages, but retroviral restriction is limited to differentiated cells by modulation of SAMHD1 phosphorylation. It is proposed to block reverse transcription of retroviral RNA into DNA by depleting cellular deoxynucleotide triphosphates (dNTPs). Viruses with DNA genomes do not employ reverse transcription during infection, but replication of their viral genomes is also dependent on intracellular dNTP concentrations. Here, we demonstrate that SAMHD1 restricts replication of the HSV-1 DNA genome in differentiated macrophage cell lines. Depleting SAMHD1 in THP-1 cells enhanced HSV-1 replication, while ectopic overexpression of SAMHD1 in U937 cells repressed HSV-1 replication. SAMHD1 did not impact viral gene expression from incoming HSV-1 viral genomes. HSV-1 restriction involved the dNTP triphosphohydrolase activity of SAMHD1 and was partially overcome by addition of exogenous deoxynucleosides. Unlike retroviruses, restriction of HSV-1 was not affected by SAMHD1 phosphorylation status. Our results suggest that SAMHD1 functions broadly to inhibit replication of DNA viruses in nondividing macrophages. PMID:24067963

Kim, Eui Tae; White, Tommy E.; Brandariz-Núñez, Alberto; Diaz-Griffero, Felipe

2013-01-01

248

[Subcloning and sequencing of DNA fragment related to salt tolerance in Sinorhizobium meliloti 042B].  

PubMed

A 4 kb ClaI DNA fragment related to salt tolerance from S. meliloti 042B was digested by HindIII down 2.4 kb fragment, and a 1.6 kb ClaII-HindIII fragment was retained on plasmid pML122. Then, the 2.4 kb DNA fragment was ligated with plasmid pBBR1-MCS2, and the recombinant plasmid was transformed to E. coli DH5 alpha, and transformant GS2 was obtained. Three-parental mating experiments were carried out with transformant GS2 as donor, salt sensitive strains GZ17 as recipient and pRK2013 as helper plasmid, then the transconjugant GG2 was selected on FY plates containing kanamycin and 0.4 mol/L NaCl. The remaining DNA fragment was self ligated with pML122 and then transformed into E. coli S17-1 and transformat GS0 was obtained. Two-parental mating experiment was carried out with transformant GS0 as donor and salt sensitive strain GZ17 as recipient, but no transconjugant was obtained on the FY plates. Then, the 2.4 kb HindIII DNA fragment was ligated into sequencing vector pGEM-7Zf(+) for sequencing. The result of sequencing and analysis showed that the 2.4 kb DNA fragment contained three ORFs. According to the result of sequencing, further subcloning was conducted and 1.9 kb HindIII-Sac II DNA fragment related to salt tolerance was obtained. PMID:12549182

Ge, S; Fan, Z; Chen, X; Yang, S

2001-02-01

249

A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students  

PubMed Central

Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104

DiBartolomeis, Susan M.

2011-01-01

250

Unique P Spectral Response to the Formation of a Specific Restriction Enzyme–DNA Complex  

Microsoft Academic Search

Protein-induced distortion is a dramatic but not universally observed feature of sequence-specific DNA interactions. This is illustrated by the crystal structures of restriction enzyme–DNA complexes: While some of these structures exhibit DNA distortion, others do not. Among the latter is PvuII endonuclease, a small enzyme that is also amenable to NMR spectroscopic studies. Here P NMR spectroscopy is applied to

Cynthia M. Dupureur

2006-01-01

251

Restricted gene flow and genetic drift in recently fragmented populations of an endangered steppe bird  

Microsoft Academic Search

Identifying the genetic processes derived from habitat fragmentation is critical for the conservation of endangered species. We conducted an integrated analysis of genetic patterns in the endangered Dupont’s lark (Chersophilus duponti), a circum-Mediterranean songbird threatened by the loss and fragmentation of natural steppes in recent decades. After sampling all the remaining Spanish populations and the two closest North African ones,

María Méndez; José L. Tella; José A. Godoy

2011-01-01

252

Nearly all single base substitutions in DNA fragments joined to a GC-clamp can be detected by denaturing gradient gel electrophoresis.  

PubMed Central

Duplex DNA fragments differing by single base substitutions can be separated by electrophoresis in denaturing gradient polyacrylamide gels, but only substitutions in a restricted part of the molecule lead to a separation (1). In an effort to circumvent this problem, we demonstrated that the melting properties and electrophoretic behavior of a 135 base pair DNA fragment containing a beta-globin promoter are changed by attaching a GC-rich sequence, called a 'GC-clamp' (2). We predicted that these changes should make it possible to resolve most, if not all, single base substitutions within fragments attached to the clamp. To test this possibility we examined the effect of several different single base substitutions on the electrophoretic behavior of the beta-globin promoter fragment in denaturing gradient gels. We find that the GC-clamp allows the separation of fragments containing substitutions throughout the promoter fragment. Many of these substitutions do not lead to a separation when the fragment is not attached to the clamp. Theoretical calculations and analysis of a large number of different mutations indicate that approximately 95% of all possible single base substitutions should be separable when attached to a GC-clamp. Images PMID:4000972

Myers, R M; Fischer, S G; Lerman, L S; Maniatis, T

1985-01-01

253

Molecular Scissors: Restriction Enzymes 2009 1 Minority Science Programs School of Biological Sciences University of California, Irvine  

E-print Network

Molecular Scissors: Restriction Enzymes 2009 1 Minority Science Programs a group of enzymes (proteins that aid chemical reactions) in bacteria, which when added to any DNA result fragmented. These "molecular scissors" are called restriction enzymes (RE) How Restriction Enzymes

Rose, Michael R.

254

APPLICATION OF POLYMERASE CHAIN REACTION (PCR) AND PCR BASED RESTRICTION FRAGMENT LENGTH POLYMORPHISM FOR DETECTION AND IDENTIFICATION OF DERMATOPHYTES FROM DERMATOLOGICAL SPECIMENS  

PubMed Central

Objective: To develop and optimize polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) targeting 18S rDNA and internal transcribed spacer (ITS) region of fungi for rapid detection and identification of dermatophytes. Materials and Methods: Two PCR-RFLP methods targeting 18S rDNA and ITS regions of fungi were optimized using standard and laboratory isolates of dermatophytes and other fungi. Sixty-eight dermatological clinical specimens (nail clippings (56), material obtained from blisters (8), hair root (2), scraping from scaly plaque of foot (1) and skin scraping (1) collected by the dermatologist were subjected to both the optimized PCR-RFLP and conventional mycological (smear and culture) methods. Results: PCRs targeting 18S rDNA and the ITS region were sensitive to detect 10 picograms and 1 femtogram of T. rubrum DNA, respectively. PCR targeting 18S rDNA was specific for dermatophytes and subsequent RFLP identified them to species level. PCR-RFLP targeting the ITS region differentiated dermatophytes from other fungi with identification to species level. Among the 68 clinical specimens tested, both PCR-RFLP methods revealed the presence of dermatophytes in 27 cases (39.7%), whereas culture revealed the same only in 2 cases (7.40%), increasing the clinical sensitivity by 32.3%. Among 20 smear positive specimens, both PCR-RFLP methods detected dermatophytes in 12 (17.6%). Both the methods detected the presence of dermatophytes in 13 (19.11%) smear and culture negative specimens, increasing the clinical sensitivity by 36.1%. Conclusion: PCR-RFLP methods targeting 18S rDNA and the ITS regions of fungi were specific and highly sensitive for detection and speciation of dermatophytes. PMID:19967012

Bagyalakshmi, R; Senthilvelan, B; Therese, K L; Murugusundram, S; Madhavan, H N

2008-01-01

255

A New Large-DNA-Fragment Delivery System Based on Integrase Activity from an Integrative and Conjugative Element  

PubMed Central

During the past few decades, numerous plasmid vectors have been developed for cloning, gene expression analysis, and genetic engineering. Cloning procedures typically rely on PCR amplification, DNA fragment restriction digestion, recovery, and ligation, but increasingly, procedures are being developed to assemble large synthetic DNAs. In this study, we developed a new gene delivery system using the integrase activity of an integrative and conjugative element (ICE). The advantage of the integrase-based delivery is that it can stably introduce a large DNA fragment (at least 75 kb) into one or more specific sites (the gene for glycine-accepting tRNA) on a target chromosome. Integrase recombination activity in Escherichia coli is kept low by using a synthetic hybrid promoter, which, however, is unleashed in the final target host, forcing the integration of the construct. Upon integration, the system is again silenced. Two variants with different genetic features were produced, one in the form of a cloning vector in E. coli and the other as a mini-transposable element by which large DNA constructs assembled in E. coli can be tagged with the integrase gene. We confirmed that the system could successfully introduce cosmid and bacterial artificial chromosome (BAC) DNAs from E. coli into the chromosome of Pseudomonas putida in a site-specific manner. The integrase delivery system works in concert with existing vector systems and could thus be a powerful tool for synthetic constructions of new metabolic pathways in a variety of host bacteria. PMID:23686268

van der Meer, Jan Roelof

2013-01-01

256

Differentiation of eleven Fusarium spp. isolated from sugar beet, using restriction fragment analysis of a polymerase chain reaction-amplified translation elongation factor 1alpha gene fragment.  

PubMed

Sugar beet in Europe is commonly grown in wheat and maize crop rotations and subsequently pile-stored for several weeks. Beet is threatened by the colonization of saprophytic as well as pathogenic Fusarium spp. A tool for reliable identification based on sequence information of the translation elongation factor 1alpha (TEF-1alpha) gene was developed for the numerous Fusarium spp. being isolated from sugar beets. In all, 65 isolates from different species (Fusarium avenaceum, F. cerealis, F. culmorum, F. equiseti, F. graminearum, F. oxysporum, F. proliferatum, F. redolens, F. solani, F. tricinctum, and F. venenatum) were obtained from sugar beet at different developmental stages from locations worldwide. Database sequences for additional species (F. sporotrichioides, F. poae, F. torulosum, F. hostae, F. sambucinum, F. subglutinans, and F. verticillioides), isolated from sugar beets in previous studies, were included in the analysis. Molecular sequence analysis of the partial TEF-1alpha gene fragment revealed sufficient variability to differentiate between the Fusarium spp., resulting in species-dependent separation of the isolates analyzed. This interspecific divergence could be translated into a polymerase chain reaction restriction fragment length polymorphism assay using only two subsequent restriction digests for the differentiation of 17 of 18 species. PMID:19594311

Nitschke, Elke; Nihlgard, Maria; Varrelmann, Mark

2009-08-01

257

Purification of a 24-kD protease from apoptotic tumor cells that activates DNA fragmentation  

PubMed Central

We report the purification of a protease from tumor cells undergoing apoptosis that is involved in activating DNA fragmentation. Initial studies revealed that two inhibitors of serine proteases, N-1- tosylamide-2-phenylethylchloromethyl ketone and carbobenzoxy-Ala-Ala- borophe (DK120), suppressed tumor necrosis factor or ultraviolet (UV) light-induced DNA fragmentation in the U937 histiocytic lymphoma as well as UV light-induced DNA fragmentation in the BT-20 breast carcinoma, HL-60 myelocytic leukemia, and 3T3 fibroblasts. The protease was purified by affinity chromatography with DK120 as ligand and showed high activity on a synthetic substrate preferred by elastase-like enzymes (Ala-Ala-Pro-Val p-nitroanilide), but was inactive on the trypsin substrate, N-alpha-benzyloxycarbonyl-L-lysine thiobenzyl ester, or the chymotrypsin substrate, Ala-Ala-Pro-Phe p-nitroanilide. The activity of the DK120-binding protease purified from U937 cells undergoing apoptosis was increased approximately 10-fold over that recovered from normal cells. Further purification to homogeneity by heparin-Sepharose affinity chromatography followed by reverse phase high-performance liquid chromatography revealed a single band of 24 kD on a silver-stained sodium dodecyl sulfate gel. In addition to protease activity, the purified enzyme induced DNA fragmentation into multiples of 180 basepairs in isolated U937 nuclei. These findings suggest the 24- kD protease is a novel enzyme that activates DNA fragmentation in U937 cells undergoing apoptosis. PMID:7964487

1994-01-01

258

BIBAC and TAC clones containing potato genomic DNA fragments larger than 100 kb are not stable in Agrobacterium  

Microsoft Academic Search

Development of efficient methods to transfer large DNA fragments into plants will greatly facilitate the map-based cloning of genes. The recently developed BIBAC and TAC vectors have shown potential to deliver large DNA fragments into plants via Agrobacterium-mediated transformation. Here we report that BIBAC and TAC clones containing potato genomic DNA fragments larger than 100 kb are not stable in Agrobacterium.

J. Song; J. M. Bradeen; S. K. Naess; J. P. Helgeson; J. Jiang

2003-01-01

259

Fast multiple gene fragment ligation method based on Type IIs restriction enzyme DraIII  

E-print Network

With the established BioBrick Assembly standards, ligation of different parts has to be accomplished step by step. It can be time-consuming when dealing with multiple fragment ligation. BBF RFC 61 is developed aimed at ...

Shi, Zhenyu

2010-10-31

260

Nature Macmillan Publishers Ltd 1997 a 260-bp restriction fragment, and end-labelled. Immunochemical assays  

E-print Network

from cells infected with Ad-p53 were western-blotted with an anti-PARP antibody and the cleavage fragments quantified by densitometry4 . Received 27 May; accepted 1 July 1997. 1. Waldman, T., Kinzler, K. W

Maggs, Anthony

261

Role of finite-size fragments in analysis of DNA replication  

NASA Astrophysics Data System (ADS)

In higher organisms, DNA replicates simultaneously from many origins. Recent in- vitro experiments have yielded large amounts of data on the state of replication of DNA fragments. From measurements of the time dependence of the average size of replicated and non-replicated domains, one can estimate the rate of initiation of DNA replication origins, as well as the average rate at which DNA bases are copied. One problem in making such estimates is that, in the experiments, the DNA is broken up into small fragments, whose finite size can bias downwards the measured averages. Here, we present a systematic way of accounting for this bias by deriving theoretical relationships between the original domain-length distributions and fragment-domain length distributions. We also derive unbiased average-domain-length estimators that yield accurate results even in cases where the replicated (or non-replicated) domains are larger than the average DNA fragment. Then we apply these estimators to previously obtained experimental data to extract improved estimates of replication kinetics parameters.

Bechhoefer, John; Zhang, Haiyang

2006-03-01

262

Ribosomal RNA genes in Euglena gracilis mitochondrial DNA: fragmented genes in a seemingly fragmented genome  

Microsoft Academic Search

Because relatively little information is available about mtDNA in the euglenid protozoa, distant relatives of the kinetoplastid\\u000a protozoa, we investigated mitochondrial genome structure and expression in Euglena gracilis. We found that isolated E. gracilis mtDNA comprises a heterodisperse collection of short molecules (modal size ~4 kbp) and that the mitochondrial large subunit\\u000a (LSU) and small subunit (SSU) rRNAs are each split

David F. Spencer; Michael W. Gray

2011-01-01

263

RNA-Linked Nascent DNA Fragments in Escherichia coli  

Microsoft Academic Search

Nucleic acid that is extracted from E. coli labeled by a brief pulse of [3H]dT and denatured by treatment with heat, formamide, or formaldehyde bands in a region with a density higher than that of single-stranded E. coli DNA in a Cs2SO4 equilibrium density gradient. If treated with alkali or RNase, it then exhibits the density of single-stranded DNA. These

Akio Sugino; Susumu Hirose; Reiji Okazaki

1972-01-01

264

Cleavage of adenine-modified functionalized DNA by type II restriction endonucleases  

PubMed Central

A set of 6 base-modified 2?-deoxyadenosine derivatives was incorporated to diverse DNA sequences by primer extension using Vent (exo-) polymerase and the influence of the modification on cleavage by diverse restriction endonucleases was studied. While 8-substituted (Br or methyl) adenine derivatives were well tolerated by the restriction enzymes and the corresponding sequences were cleaved, the presence of 7-substituted 7-deazaadenine in the recognition sequence resulted in blocking of cleavage by some enzymes depending on the nature and size of the 7-substituent. All sequences with modifications outside of the recognition sequence were perfectly cleaved by all the restriction enzymes. The results are useful both for protection of some sequences from cleavage and for manipulation of functionalized DNA by restriction cleavage. PMID:19820117

Mací?ková-Cahová, Hana; Hocek, Michal

2009-01-01

265

Highlights of the DNA cutters: a short history of the restriction enzymes  

PubMed Central

In the early 1950’s, ‘host-controlled variation in bacterial viruses’ was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine. PMID:24141096

Loenen, Wil A. M.; Dryden, David T. F.; Raleigh, Elisabeth A.; Wilson, Geoffrey G.; Murray, Noreen E.

2014-01-01

266

DNA assisted fragmentation of nickel nanoparticle clusters and their spectral properties.  

PubMed

Nickel nanoparticle (NiNP) clusters in the range of 60-70 nm size on interaction with herring-sperm DNA (B-DNA) form a self-assembled duplex helix DNA structure with fragmented NiNPs as small as 5-15 nm, as evident from atomic force microscopic studies. Scanning electron microscope (SEM) and transmission electron microscope (TEM) images also corroborate the findings. The properties of these self-assembled NiNPs-DNA structures have been further investigated by UV-visible, emission and circular dichroic (CD) spectral studies. PMID:20398942

Prabakaran, Natarajan; Athappan, Periakaruppan

2010-07-01

267

Tagging Developmental Genes in Dictyostelium by Restriction Enzyme-Mediated Integration of Plasmid DNA  

Microsoft Academic Search

Introduction of restriction enzyme along with linearized plasmid results in integration of plasmid DNA at genomic restriction sites in a high proportion of the resulting transformants. We have found that electroporating BamHI or EcoRI together with pyr5-6 plasmids cut with the same enzyme stimulates the efficiency of transformation in Dictyostelium discoideum more than 20-fold over the rate seen when plasmid

Adam Kuspa; William F. Loomis

1992-01-01

268

Spermatozoal sensitive biomarkers to defective protaminosis and fragmented DNA  

PubMed Central

Human sperm DNA damage may have adverse effects on reproductive outcome. Infertile men possess substantially more spermatozoa with damaged DNA compared to fertile donors. Although the extent of this abnormality is closely related to sperm function, the underlying etiology of ensuing male infertility is still largely controversial. Both intra-testicular and post-testicular events have been postulated and different mechanisms have been proposed to explain the presence of damaged DNA in human spermatozoa. Three among them, i.e. abnormal chromatin packaging, oxidative stress and apoptosis, are the most studied and discussed in the present review. Furthermore, results from numerous investigations are presented, including our own findings on these pathological conditions, as well as the techniques applied for their evaluation. The crucial points of each methodology on the successful detection of DNA damage and their validity on the appraisal of infertile patients are also discussed. Along with the conventional parameters examined in the standard semen analysis, evaluation of damaged sperm DNA seems to complement the investigation of factors affecting male fertility and may prove an efficient diagnostic tool in the prediction of pregnancy outcome. PMID:17760963

Angelopoulou, Roxani; Plastira, Konstantina; Msaouel, Pavlos

2007-01-01

269

Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing  

PubMed Central

The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the ?- and ?-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). ?-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control. PMID:15066796

Lagacé, L.; Pitre, M.; Jacques, M.; Roy, D.

2004-01-01

270

[Cloning of the Bacillus subtilis DNA fragment containing the genes for lysine and riboflavin biosynthesis].  

PubMed

The SalI fragment of chromosomal DNA of Bacillus subtilis carrying the gene for lysine biosynthesis and the regulatory operator region (ribO) from the riboflavin gene was cloned into Escherichia coli cells. This fragment was shown to contain the gene coding for lysine synthesizing enzyme. Localization of this gene in Bac. subtili was determined. New plasmids pLRS33 and pLRB4 were constructed using pBR322; they carry a fragment homologous to pLP102 plasmid containing the operon for riboflavin biosynthesis. PMID:6432632

Okunev, O V; Shevchenko, T N; Maliuta, S S

1984-07-01

271

Development of procedures for the identification of human papilloma virus DNA fragments in laser plume  

NASA Astrophysics Data System (ADS)

For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

1996-01-01

272

RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF PCR-AMPLIFIED NIFH SEQUENCES FROM WETLAND PLANT RHIZOSPHERE COMMUNITIES  

EPA Science Inventory

We describe a method to assess the community structure of N2-fixing bacteria in the rhizosphere. Total DNA was extracted from Spartina alterniflora and Sesbania macrocarpa root zones by bead-beating and purified by CsCl-EtBr gradient centrifugation. The average DNA yield was 5.5 ...

273

Identification of unintegrated forms of Kirsten murine sarcoma viral DNA and restriction endonuclease cleavage map of linear DNA.  

PubMed Central

We detected unintegrated linear 7.0-kilobase pair DNA and covalently closed circular DNA species in NIH3T3 cells recently infected with Kirsten murine sarcoma virus. Using the linear DNA, we constructed a restriction endonuclease cleavage map and compared it with the map of Harvey murine sarcoma virus. The restriction endonuclease maps of two segments, one 1.2 kilobase pairs (SmaI site) to 3.7 kilobase pairs (HindIII site) from the right end (corresponding to the viral 3' side) and the other 0.5 kilobase pair (SmaI and KpnI sites) to 0.9 kilobase pair (KpnI site) from the left end, were identical in the two virus types. Images PMID:6264147

Tsuchida, N; Kominami, R; Hatanaka, M; Uesugi, S

1981-01-01

274

DNA Fingerprinting by Sampled Sequencing  

Microsoft Academic Search

We describe a method for characterizing DNA segments that combines limited sequencing with size separation of restriction fragments. As part of a multistep procedure, 5' overhangs of unknown sequence are generated by cleavage with a class IIS restriction enzyme. After labeling of these ends by using dideoxynucleotides tagged with distinctive fluorescent dyes, the restriction fragments are analyzed by polyacrylamide gel

Sydney Brenner; Kenneth J. Livak

1989-01-01

275

A restriction enzyme-powered autonomous DNA walking machine: its application for a highly sensitive electrochemiluminescence assay of DNA  

NASA Astrophysics Data System (ADS)

The construction of a restriction enzyme (Nt.AlwI)-powered DNA walking machine and its application for highly sensitive detection of DNA are described. DNA nanostructure tracks containing four overhang sequences with electrochemiluminescence (ECL) labels and complementary to the walker (target DNA) are self-assembled on the sensing electrode. The walker hybridizes with the complementary sequences on the tracks and forms specific recognition sites for Nt.AlwI, which cleaves the overhang sequences, releases the ECL labels and enables directional movement of the walker along the tracks. The formation of the nanostructure tracks and the Nt.AlwI-assisted cleavage of the overhang sequences in the presence of the walker are verified by using polyacrylamide gel electrophoresis analysis and cyclic voltammetry. The successive movement of the walker on the nanostructure tracks leads to continuous removal of massive ECL labels from the sensing electrode, which results in a significantly amplified suppression of the ECL emission for highly sensitive detection of sequence-specific DNA down to 0.19 pM. Results show that this DNA walking machine can also offer single-base mismatch discrimination capability. The successful application of the DNA walking machine for sequence-specific DNA detection can thus offer new opportunities for molecular machines in biosensing applications.The construction of a restriction enzyme (Nt.AlwI)-powered DNA walking machine and its application for highly sensitive detection of DNA are described. DNA nanostructure tracks containing four overhang sequences with electrochemiluminescence (ECL) labels and complementary to the walker (target DNA) are self-assembled on the sensing electrode. The walker hybridizes with the complementary sequences on the tracks and forms specific recognition sites for Nt.AlwI, which cleaves the overhang sequences, releases the ECL labels and enables directional movement of the walker along the tracks. The formation of the nanostructure tracks and the Nt.AlwI-assisted cleavage of the overhang sequences in the presence of the walker are verified by using polyacrylamide gel electrophoresis analysis and cyclic voltammetry. The successive movement of the walker on the nanostructure tracks leads to continuous removal of massive ECL labels from the sensing electrode, which results in a significantly amplified suppression of the ECL emission for highly sensitive detection of sequence-specific DNA down to 0.19 pM. Results show that this DNA walking machine can also offer single-base mismatch discrimination capability. The successful application of the DNA walking machine for sequence-specific DNA detection can thus offer new opportunities for molecular machines in biosensing applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05387g

Chen, Ying; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

2014-12-01

276

Accurate phylogenetic classification of DNA fragments based onsequence composition  

SciTech Connect

Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

2006-05-01

277

Leishmania spp. identification by polymerase chain reaction-restriction fragment length polymorphism analysis and its applications in French Guiana.  

PubMed

Leishmania (Viannia) guyanensis was for many years the only species commonly identified in French Guiana, but precise species identifications were quite rare. We describe a new restriction fragment length polymorphism-polymerase chain reaction technique using a 615-bp fragment of the RNA polymerase II gene and 2 restriction enzymes, TspRI and HgaI. Seven reference strains (Leishmania (Leishmania) amazonensis, Leishmania (Viannia) lainsoni, Leishmania (Viannia) braziliensis, L. (V.) guyanensis, Leishmania (Viannia) naiffi, Leishmania (Leishmania) major, Leishmania (Leishmania) infantum) and 112 clinical samples from positive lesions were used for the development of the technique. The rates of positive species identification were 85.7% for punch skin biopsy specimens, 93.1% for positive Giemsa-stained smears, and 100% for positive culture supernatants. In the framework of cutaneous leishmaniasis species surveillance for the 2006 to 2008 period, parasite identification was carried out for 199 samples from different patients. The prevalence of the various Leishmania spp. was 84.4% for L. (V.) guyanensis, 8.0% for L. (V.) braziliensis, 5.0% for L. (L.) amazonensis, and 2.6% for L. (V.) lainsoni. L. (V.) braziliensis seems to be locally an emerging pathogen. PMID:19782495

Simon, Stéphane; Veron, Vincent; Carme, Bernard

2010-02-01

278

A nomenclature for restriction enzymes, DNA methyltransferases, homing endonucleases and their genes  

Microsoft Academic Search

A nomenclature is described for restriction endonucleases, DNA methyltransferases, homing endonucleases and related genes and gene products. It provides explicit categories for the many different Type II enzymes now identified and provides a system for naming the putative genes found by sequence analysis of microbial genomes.

Richard J. Roberts; Martin G. Marinus

2003-01-01

279

Two DNA Recognition Domains of the Specificity Polypeptides of a Family of Type I Restriction Enzymes  

Microsoft Academic Search

The hsd genes of Salmonella typhimurium and Salmonella potsdam encode related type I restriction and modification systems designated SB and SP, respectively; the polypeptide encoded by the hsdS gene dictates the DNA sequence recognized. The hsdS genes of the SB and SP systems have a conserved sequence of around 100 base pairs flanked by two nonhomologous (variable) regions of around

Frances V. Fuller-Pace; Noreen E. Murray

1986-01-01

280

Influence of PMMA shielding on DNA fragmentation induced in human fibroblasts by iron and titanium ions.  

PubMed

In the framework of a collaborative project on the influence of the shielding on the biological effectiveness of space radiation, we studied DNA fragmentation induced by 1 GeV/nucleon iron ions and titanium ions with and without a 197-mm-thick polymethylmethacrylate (PMMA) shield in AG1522 human fibroblasts. Pulsed- and constant-field gel electrophoresis were used to analyze DNA fragmentation in the size range 1-5700 kbp. The results show that, mainly owing to a higher production of small fragments (1-23 kbp), titanium ions are more effective than iron ions at inducing DNA double-strand breaks (DSBs), their RBE being 2.4 and 1.5, respectively. The insertion of a PMMA shield decreases DNA breakage, with shielding protection factors (ratio of the unshielded/shielded cross sections for DSB production) of about 1.6 for iron ions and 2.1 for titanium ions. However, the DSB yield (no. of DSBs per unit mass per unit dose) is almost unaffected by the presence of the shield, and the relative contributions of the fragments in the different size ranges are almost the same with or without shielding. This indicates that, under our conditions, the effect of shielding is mainly to reduce the dose per unit incident fluence, leaving radiation quality practically unaffected. PMID:16187791

Dini, Valentina; Antonelli, Francesca; Belli, Mauro; Campa, Alessandro; Esposito, Giuseppe; Simone, Giustina; Sorrentino, Eugenio; Tabocchini, Maria Antonella

2005-10-01

281

A WHEAT DNA FRAGMENT EXHIBITS REDUCED POLLEN TRANSMISSION IN TRANSGENIC MAIZE  

Technology Transfer Automated Retrieval System (TEKTRAN)

An 8.2 kb fragment of wheat genomic DNA containing the Glu1-Dx5 gene has been transferred to maize using biolistic transformation. The Glu1-Dx5 gene encodes the 1Dx5 high molecular weight glutenin subunit, a seed storage protein associated with good bread making properties. The transgenic maize plan...

282

A study on the relationship between antisense EGFR cDNA fragments and nuclear matrix proteins in glioblastoma cells.  

PubMed

The association of antisense epidermal growth factor receptor (EGFR) cDNA fragments with nuclear matrix from EGFR-antisense transfected glioblastoma cell lines U343 and U87 was investigated. A 1015 bp DNA fragment (primer I-II) was amplified in both genomic DNA and nuclear matrix-associated DNA (NM DNA) from EGFR-antisense transfected glioblastoma cell lines U343E and U87E. Two different DNA fragments (940 bp and 110 bp) were amplified by primer I-III in both genomic DNA and NM DNA of U343E, while one 110 bp PCR product was shown with the same primer in both genomic DNA and NM DNA of U87E only. After EGFR-antisense transfection, the binding property of the 110 bp DNA fragment (primer IV-V) to nuclear matrix was not affected. Southwestern blotting demonstrated the presence of antisense EGFR cDNA binding nuclear matrix proteins. Our findings demonstrate that not only EGFR DNA is associated with nuclear matrix, but the transfected antisense EGFR cDNA also binds to nuclear matrix proteins. The nuclear matrix is most likely involved in the replication and transcription of antisense EGFR cDNA or hybridisation with sense mRNA in vitro. PMID:9857227

Wang, Z H; Yam, G H; Tian, X X; Ng, H K; Chew-Cheng, S B; Ding, M X; Chew, E C

1998-10-01

283

Ultrasensitive electrochemical biosensing for DNA using quantum dots combined with restriction endonuclease.  

PubMed

A universal and sensitive electrochemical biosensing platform for the detection and identification of DNA using CdSe quantum dots (CdSe QDs) as signal markers was designed. The detection mechanism was based on the specific recognition of MspI endonuclease combined with the signal amplification of gold nanoparticles (AuNPs). MspI endonuclease could recognize its specific sequence in the double-strand DNA (dsDNA) and cleave the dsDNA fragments linked with CdSe QDs from the electrode. The remaining attached CdSe QDs can be easily read out by square-wave voltammetry using an electrodeposited bismuth (Bi) film-modified glass carbon electrode. The concentrations of target DNA could be simultaneously detected by the signal of metal markers. Using mycobacterium tuberculosis (Mtb) DNA as a model, under the optimal conditions, the proposed biosensor could detect Mtb DNA down to 8.7 × 10(-15) M with a linear range of 5 orders of magnitude (from 1.0 × 10(-14) to 1.0 × 10(-9) M) and discriminate mismatched DNA with high selectivity. This strategy presented a universal and convenient biosensing platform for DNA assay, and its satisfactory performances make it a potential candidate for the early diagnosis of gene-related diseases. PMID:25408952

Zhang, Can; Lou, Jing; Tu, Wenwen; Bao, Jianchun; Dai, Zhihui

2015-01-21

284

Crystal structure of restriction endonuclease BglI bound to its interrupted DNA recognition sequence.  

PubMed Central

The crystal structure of the type II restriction endonuclease BglI bound to DNA containing its specific recognition sequence has been determined at 2.2 A resolution. This is the first structure of a restriction endonuclease that recognizes and cleaves an interrupted DNA sequence, producing 3' overhanging ends. BglI is a homodimer that binds its specific DNA sequence with the minor groove facing the protein. Parts of the enzyme reach into both the major and minor grooves to contact the edges of the bases within the recognition half-sites. The arrangement of active site residues is strikingly similar to other restriction endonucleases, but the co-ordination of two calcium ions at the active site gives new insight into the catalytic mechanism. Surprisingly, the core of a BglI subunit displays a striking similarity to subunits of EcoRV and PvuII, but the dimer structure is dramatically different. The BglI-DNA complex demonstrates, for the first time, that a conserved subunit fold can dimerize in more than one way, resulting in different DNA cleavage patterns. PMID:9736624

Newman, M; Lunnen, K; Wilson, G; Greci, J; Schildkraut, I; Phillips, S E

1998-01-01

285

A restriction enzyme-powered autonomous DNA walking machine: its application for a highly sensitive electrochemiluminescence assay of DNA.  

PubMed

The construction of a restriction enzyme (Nt.AlwI)-powered DNA walking machine and its application for highly sensitive detection of DNA are described. DNA nanostructure tracks containing four overhang sequences with electrochemiluminescence (ECL) labels and complementary to the walker (target DNA) are self-assembled on the sensing electrode. The walker hybridizes with the complementary sequences on the tracks and forms specific recognition sites for Nt.AlwI, which cleaves the overhang sequences, releases the ECL labels and enables directional movement of the walker along the tracks. The formation of the nanostructure tracks and the Nt.AlwI-assisted cleavage of the overhang sequences in the presence of the walker are verified by using polyacrylamide gel electrophoresis analysis and cyclic voltammetry. The successive movement of the walker on the nanostructure tracks leads to continuous removal of massive ECL labels from the sensing electrode, which results in a significantly amplified suppression of the ECL emission for highly sensitive detection of sequence-specific DNA down to 0.19 pM. Results show that this DNA walking machine can also offer single-base mismatch discrimination capability. The successful application of the DNA walking machine for sequence-specific DNA detection can thus offer new opportunities for molecular machines in biosensing applications. PMID:25465224

Chen, Ying; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

2015-01-21

286

Chromosomal aneuploidies and DNA fragmentation of human spermatozoa from patients exposed to perfluorinated compounds.  

PubMed

This study investigated chromosomal aneuploidies and DNA damage in spermatozoa from male patients contaminated by perfluorinated compounds (PFCs) in whole blood and seminal plasma. Sperm aneuploidy and diploidy rate for chromosomes 18, X and Y were evaluated by FISH; sperm DNA fragmentation was assessed by terminal deoxynucleotidyl transferase-mediated dUTP nick end-labelling technique coupled to flow cytometry. Our results indicated that PFC contamination was present in 58% of subjects included in the study. A significant increase in alterations of sperm parameters was observed in PFC-positive subjects compared to PFC-negative subjects. As regards the sperm aneuploidy, both disomy and diploidy rates resulted significantly increased in subjects positive for PFC contamination compared to PFC-negative samples. In addition, sperm DNA fragmentation index resulted significantly increased in PFC-contaminated subjects compared to PFC-non-contaminated subjects, with a significant increased level of dimmer DNA fragmentation index. Our results clearly indicate that PFC contamination may detrimentally affect spermatogenesis, disturbing both meiotic segregation and DNA integrity. We could therefore suggest cautions to reduce or eliminate any contact with these compounds because the long-term effects of PFC accumulation in the body are not predictable. PMID:25382683

Governini, L; Guerranti, C; De Leo, V; Boschi, L; Luddi, A; Gori, M; Orvieto, R; Piomboni, P

2014-11-01

287

Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments  

PubMed Central

Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp. PMID:24019490

Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

2013-01-01

288

Types, Causes, Detection and Repair of DNA Fragmentation in Animal and Human Sperm Cells  

PubMed Central

Concentration, motility and morphology are parameters commonly used to determine the fertilization potential of an ejaculate. These parameters give a general view on the quality of sperm but do not provide information about one of the most important components of the reproductive outcome: DNA. Either single or double DNA strand breaks can set the difference between fertile and infertile males. Sperm DNA fragmentation can be caused by intrinsic factors like abortive apoptosis, deficiencies in recombination, protamine imbalances or oxidative stress. Damage can also occur due to extrinsic factors such as storage temperatures, extenders, handling conditions, time after ejaculation, infections and reaction to medicines or post-testicular oxidative stress, among others. Two singular characteristics differentiate sperm from somatic cells: Protamination and absence of DNA repair. DNA repair in sperm is terminated as transcription and translation stops post-spermiogenesis, so these cells have no mechanism to repair the damage occurred during their transit through the epididymis and post-ejaculation. Oocytes and early embryos have been shown to repair sperm DNA damage, so the effect of sperm DNA fragmentation depends on the combined effects of sperm chromatin damage and the capacity of the oocyte to repair it. In this contribution we review some of these issues. PMID:23203048

González-Marín, Clara; Gosálvez, Jaime; Roy, Rosa

2012-01-01

289

Microscopic Varicocelectomy Significantly Decreases the Sperm DNA Fragmentation Index in Patients with Infertility  

PubMed Central

Background. Varicocele is associated with high levels of DNA damage in spermatozoa due to oxidative stress and elevated levels of sperm DNA fragmentation, which has been currently proposed to be an essential additional diagnostic test to be recommended for patients with clinical varicocele. The aim of this study was to evaluate the parameters of semen and the DNA fragmentation index (DFI) in patients with varicocele before and after varicocelectomy. Methods. The details of 92 consecutive patients were retrospectively analyzed from January 2010 to December 2012. The sperm samples were evaluated according to the World Health Organization Guidelines. Sperm DNA damage, characterized as DFI, was evaluated by sperm chromatin structure assay using flow cytometry. Results. There was a statistically significant improvement in the semen concentration, the total motile count, the total normal sperm count, and the sperm DNA fragmentation index (DFI; the percentage of sperm with denatured DNA) after varicocelectomy. There was a large decrease in DFI from a preoperative mean of 42.6% to a postoperative mean of 20.5% (P < 0.001). A higher preoperative DFI was associated with a larger decrease in postoperative DFI, and significant negative correlations were observed between the DFI and sperm motility (r = ?0.42, P < 0.01). Conclusion. Our data suggest that varicocelectomy can improve multiple semen parameters and sperm DNA damage in infertile men with varicocele. The patients with preoperative defects in those parameters showed greater improvement postoperatively. Further research in this area is needed to understand the exact mechanisms of DNA damage in infertile men with varicocele. PMID:24712000

Kadioglu, Teoman Cem; Aliyev, Emin; Celtik, Murad

2014-01-01

290

Detection of Low-Abundance KRAS Mutations in Colorectal Cancer Using Microfluidic Capillary Electrophoresis-Based Restriction Fragment Length Polymorphism Method with Optimized Assay Conditions  

PubMed Central

Constitutively active KRAS mutations have been found to be involved in various processes of cancer development, and render tumor cells resistant to EGFR-targeted therapies. Mutation detection methods with higher sensitivity will increase the possibility of choosing the correct individual therapy. Here, we established a highly sensitive and efficient microfluidic capillary electrophoresis-based restriction fragment length polymorphism (µCE-based RFLP) platform for low-abundance KRAS genotyping with the combination of µCE and RFLP techniques. By using our self-built sensitive laser induced fluorescence (LIF) detector and a new DNA intercalating dye YOYO-1, the separation conditions of µCE for ?X174 HaeIII DNA marker were first optimized. Then, a Mav I digested 107-bp KRAS gene fragment was directly introduced into the microfluidic device and analyzed by µCE, in which field amplified sample stacking (FASS) technique was employed to obtain the enrichment of the RFLP digestion products and extremely improved the sensitivity. The accurate analysis of KRAS statuses in HT29, LS174T, CCL187, SW480, Clone A, and CX-1 colorectal cancer (CRC) cell lines by µCE-based RFLP were achieved in 5 min with picoliter-scale sample consumption, and as low as 0.01% of mutant KRAS could be identified from a large excess of wild-type genomic DNA (gDNA). In 98 paraffin-embedded CRC tissues, KRAS codon 12 mutations were discovered in 28 (28.6%), significantly higher than that obtained by direct sequencing (13, 13.3%). Clone sequencing confirmed these results and showed this system could detect at least 0.4% of the mutant KRAS in CRC tissue slides. Compared with direct sequencing, the new finding of the µCE-based RFLP platform was that KRAS mutations in codon 12 were correlated with the patient’s age. In conclusion, we established a sensitive, fast, and cost-effective screening method for KRAS mutations, and successfully detected low-abundance KRAS mutations in clinical samples, which will allow provision of more precise individualized cancer therapy. PMID:23355875

Ren, Hui; Xu, Zhangrun; Wang, Xiaonan; Shan, Lianfeng; Fang, Jin

2013-01-01

291

ADVANCES IN APPLIED MATtlEMATIC3 12, 412-427 (1991) Multiple Solutions of DNA Restriction  

E-print Network

enzymes cut double stranded molecules of DNA. For example, the restriction enzyme Hhal cuts at the sequence GCGC. Almost all of the several hundred known restriction enzymes cut at sequences of length 4, 6. Here we will concern ourselves the problem of mapping positions of the sites of two restriction enzymes

Waterman, Michael S.

292

Comparative typing of Pseudomonas aeruginosa by random amplification of polymorphic DNA or pulsed-field gel electrophoresis of DNA macrorestriction fragments.  

PubMed Central

Eighty-seven strains of Pseudomonas aeruginosa were typed by random amplification of polymorphic DNA (RAPD) and pulsed-field gel electrophoresis (PFGE) of macrorestriction fragments. Stains were clustered on the basis of interpretative criteria as presented previously for the PFGE analysis. Clusters of strains were also defined on the basis of epidemiological data and subsequently reanalyzed by RAPD. It was found that in an RAPD assay employing the enterobacterial repetitive intergenic consensus sequence ERIC2 as a primer, single band differences can be ignored; in this case, clonally related strains could be grouped as effectively and reliably as with PFGE. These data could be corroborated by the use of other primer species. However, some primers either showed reduced resolution or, in contrast, identified DNA polymorphisms beyond epidemiologically and PFGE-defined limits. Apparently, different primers define different windows of genetic variation. It is suggested that criteria for interpretation of the ERIC2 PCR fingerprints can be simple and straightforward: when single band differences are ignored, RAPD-determined grouping of P. aeruginosa is congruent with that obtained by PFGE. Consequently, this implies that RAPD can be used with trust as a first screen in epidemiological characterization of P. aeruginosa. The ability to measure the rate of molecular evolution of the P. aeruginosa genome clearly depends on the choice of restriction enzyme or primer when RAPD or PFGE, respectively, is applied for the detection of DNA polymorphisms. PMID:8940470

Renders, N; Römling, Y; Verbrugh, H; van Belkum, A

1996-01-01

293

Differentiation of Burkholderia Species by PCR-Restriction Fragment Length Polymorphism Analysis of the 16S rRNA Gene and Application to Cystic Fibrosis Isolates  

PubMed Central

Burkholderia cepacia, which is an important pathogen in cystic fibrosis (CF) owing to the potential severity of the infections and the high transmissibility of some clones, has been recently shown to be a complex of five genomic groups, i.e., genomovars I, II (B. multivorans), III, and IV and B. vietnamiensis. B. gladioli is also involved, though rarely, in CF. Since standard laboratory procedures fail to provide an accurate identification of these organisms, we assessed the ability of restriction fragment length polymorphism (RFLP) analysis of amplified 16S ribosomal DNA (rDNA), with the combination of the patterns obtained with six endonucleases, to differentiate Burkholderia species. This method was applied to 16 type and reference strains of the genus Burkholderia and to 51 presumed B. cepacia clinical isolates, each representative of one clone previously determined by PCR ribotyping. The 12 Burkholderia type strains tested were differentiated, including B. cepacia, B. multivorans, B. vietnamiensis, and B. gladioli, but neither the genomovar I and III reference strains nor the genomovar IV reference strain and B. pyrrociniaT were distinguishable. CF clinical isolates were mainly distributed in RFLP group 2 (which includes B. multivoransT) and RFLP group 1 (which includes B. cepacia genomovar I and III reference strains, as well as nosocomial clinical isolates). Two of the five highly transmissible clones in French CF centers belonged to RFLP group 2, and three belonged to RFLP group 1. The remaining isolates either clustered with other Burkholderia species (B. cepacia genomovar IV or B. pyrrocinia, B. vietnamiensis, and B. gladioli) or harbored unique combinations of patterns. Thus, if further validated by hybridization studies, PCR-RFLP of 16S rDNA could be an interesting identification tool and contribute to a better evaluation of the respective clinical risks associated with each Burkholderia species or genomovar in patients with CF. PMID:10364586

Segonds, Christine; Heulin, Thierry; Marty, Nicole; Chabanon, Gerard

1999-01-01

294

Restriction fragment length polymorphism associated with the pro alpha 2(I) gene of human type I procollagen. Application to a family with an autosomal dominant form of osteogenesis imperfecta.  

PubMed Central

One cloned complementary DNA and one genomic subclone were used to detect restriction fragment length polymorphism associated with the pro alpha 2(I) gene for human type I procollagen. The restriction fragments obtained from examination of 30-122 chromosomes confirmed previous indications that the pro alpha 2(I) gene is found in a single copy in the human haploid genome. One highly polymorphic site was detected with EcoRI in the 5'-half of the gene. The restriction site polymorphism at the site had an allelic frequency of 0.38, and it generated two fragments of 10.5 and 3.5 kilobase in homozygous individuals. The restriction fragment length polymorphism generated at the EcoRI site was used to study affected and non-affected individuals in four generations of a family with an autosomal dominant form of osteogenesis imperfecta. The data demonstrated a linkage of the phenotype to a pro alpha 2(I) allele with a lod score of 2.41 at a recombination fraction (theta) of 0. The data therefore provided presumptive evidence that osteogenesis imperfecta in this family is caused by a mutation in the pro alpha 2(I) gene or some contiguous region of the genome. The relatively high frequency of polymorphism at the EcoRI site makes it useful for studying a broad range of genetic disorders in which mutations in type I procollagen are suspected. In addition, the polymorphic site should provide useful markers for linkage studies with other loci located on human chromosome 7. Images PMID:6313757

Tsipouras, P; Myers, J C; Ramirez, F; Prockop, D J

1983-01-01

295

DNA vaccination with VP2 gene fragment confers protection against Infectious Bursal Disease Virus in chickens.  

PubMed

Infectious Bursal Disease Virus (IBDV) causes immunosuppression in young chickens by destruction of antibody producing B cells in the Bursa of Fabricius and poses a potential threat to the poultry industry. We have examined the protective efficacy of a subunit DNA vaccine against IBDV infection in chickens in this study. An immunodominant VP2 gene fragment (VP252-417) was cloned into CMV promoter based DNA vaccine vector pVAX1 and in vitro expression of the DNA encoded antigens was confirmed by transfection of CHO cells with vaccine constructs followed by RT-PCR and western blot analysis using IBDV-antiserum. Two weeks old chickens were immunized intramuscularly with pVAXVP252-417 and the in vivo transcription of the plasmid DNA was confirmed by RT-PCR analysis of DNA injected muscle tissue at different intervals of post immunization. Tissue distribution analysis revealed that the plasmid DNA was extensively distributed in muscle, spleen, kidney, liver, and bursa tissues. Chickens immunized with pVAXVP252-417 developed high titer (1:12,000) of anti-VP252-417 antibodies. Further, chicken splenocytes from pVAXVP252-417 immunized group showed a significantly high proliferation to the whole viral and recombinant antigen (P<0.01) compared to control groups, which implies that pVAXVP252-417 codes for immunogenic fragment which has epitopes capable of eliciting both B and T cell responses. This is evident by the fact that, pVAXVP252-417 immunized chicken conferred 75% protection against virulent IBDV (vIBDV) challenge compared to the control group. Thus, the present study confirms that the immunodominant VP2 fragment can be used as a potential DNA vaccine against IBDV infection in chickens. PMID:24745626

Pradhan, Satya Narayan; Prince, Prabhu Rajaiah; Madhumathi, Jayaprakasam; Arunkumar, Chakkaravarthy; Roy, Parimal; Narayanan, Rangarajan Badri; Antony, Usha

2014-06-25

296

Chromosomal assignment of human genomic NotI restriction fragments in a two-dimensional electrophoresis profile  

SciTech Connect

Using DNA from sorted human chromosomes and two-dimensional gel electrophoresis, we assigned 2295 NotI sites, 43% of the total, to specific chromosomes and designated the procedure CA-RLGS (chromosome-assigned restriction landmark genomic scanning). Although the NotI enzyme is sensitive to DNA methylation, our results suggested that the majority of the spots did not seem to be affected by this modification. The NotI sites were distributed at higher levels in chromosomes 17, 19, and 22, suggesting higher gene content in these chromosomes. Most spots were assigned to unique chromosomes, but some spots were found on two or more chromosomes. Quantitative analysis revealed the intensity of the DNA spots on the sex chromosomes to be haploid and that of the chromosome 21 spots in DNA from a male with Down syndrome to be trisomic, although there were exceptions. We report here the first-generation CA-RLGS map of the human genome. 23 refs., 4 figs.

Yoshikawa, Hirohide; Nagai, Hisaki; Matsubara, Kenichi [Osaka Univ. (Japan)] [and others] [Osaka Univ. (Japan); and others

1996-01-01

297

Human Sperm DNA Fragmentation and its Correlation with Conventional Semen Parameters  

PubMed Central

Background The initial step in the diagnostic investigation of male infertility has been traditionally based on the conventional seminal profile. However, there are significant limitations regarding its ability to determine the underlying mechanisms that cause the disorder. Sperm DNA fragmentation has emerged as a potential causative factor of reproductive failure and its assessment has been suggested as a useful adjunct to the laboratory methodology of male infertility evaluation, especially before the application of assisted reproduction technology (ART). Methods A review of recent bibliography was carried out in PubMed by the use of relevant keywords, in order to evaluate the possible correlation between the conventional seminal parameters and sperm DNA fragmentation assessment as diagnostic tools in male infertility evaluation. Results A comprehensive diagnostic approach of male infertility should be based on a combination of diagnostic attributes, derived from the conventional semen analysis, as well as the investigation of genomic integrity testing. Conclusion Due to its strong correlation with several aspects of ART procedures and further consequences for the offspring, sperm DNA fragmentation is a parameter worth integrating in routine clinical practice. However, additional large scale studies focusing on specific subgroups of infertile men who may benefit from an efficient therapeutic management based on the optimization of sperm DNA integrity are needed. PMID:24696791

Evgeni, Evangelini; Charalabopoulos, Konstantinos; Asimakopoulos, Byron

2014-01-01

298

[Level of DNA fragmentation in human sperm cells in varicocele and prostatitis].  

PubMed

Varicocele and prostatitis are the most common andrological diseases, which may be accompanied by a decrease in the production of sperm cells, the deterioration of their quality and increased risk of infertility. This work was aimed to the evaluation of sperm DNA fragmentation index (DFI) and main indices of sperm fertility (concentration, motility and morphology), and the relationship between these parameters in the men of active reproductive age suffering from prostatitis or varicocele. Assessment of sperm DNA fragmentation was performed by SCSA (sperm chromatin structure assay) using flow cytometry; sperm parameters were evaluated according to WHO recommendations. It was shown that men with prostatitis (n = 9) and varicocele (n = 22) had significantly higher DFI compared with men in the control group (n = 22). Negative influence of these diseases on the concentration and the percentage of motile sperm cells in the ejaculate was revealed. These data suggest that the deterioration in the quality of semen in varicocele and prostatitis may be caused not only by pathospermia, but also, at least partially, by violation of the integrity of the sperm DNA. Evaluation of sperm DNA fragmentation can be recommended for use in laboratory diagnostics for prediction of fertility in infertile men. PMID:25211925

Osadchuk, L V; Erkovich, A A; Tataru, D A; Markova, E V; Svetlakov, A V

2014-01-01

299

Role of Magnesium Ions in DNA Recognition by the EcoRV Restriction Endonuclease  

SciTech Connect

The restriction endonuclease EcoRV binds two magnesium ions. One of these ions, Mg2+A, binds to the phosphate group where the cleavage occurs and is required for catalysis, but the role of the other ion, Mg2+B is debated. Here, multiple independent molecular dynamics simulations suggest that Mg2+B is crucial for achieving a tightly bound protein DNA complex and stabilizing a conformation that allows cleavage. In the absence of Mg2+B in all simulations the protein DNA hydrogen bond network is significantly disrupted and the sharp kink at the central base pair step of the DNA, which is observed in the two-metal complex, is not present. Also, the active site residues rearrange in such a way that the formation of a nucleophile, required for DNA hydrolysis, is unlikely.

Zahran, Mai [ORNL; Berezniak, Tomasz [University of Heidelberg; Imhof, Petra [University of Heidelberg; Smith, Jeremy C [ORNL

2011-01-01

300

Overcoming restriction as a barrier to DNA transformation in Caldicellulosiruptor species results in efficient marker replacement  

PubMed Central

Background Thermophilic microorganisms have special advantages for the conversion of plant biomass to fuels and chemicals. Members of the genus Caldicellulosiruptor are the most thermophilic cellulolytic bacteria known. They have the ability to grow on a variety of non-pretreated biomass substrates at or near ~80°C and hold promise for converting biomass to bioproducts in a single step. As for all such relatively uncharacterized organisms with desirable traits, the ability to genetically manipulate them is a prerequisite for making them useful. Metabolic engineering of pathways for product synthesis is relatively simple compared to engineering the ability to utilize non-pretreated biomass. Results Here we report the construction of a deletion of cbeI (Cbes2438), which encodes a restriction endonuclease that is as a major barrier to DNA transformation of C. bescii. This is the first example of a targeted chromosomal deletion generated by homologous recombination in this genus and the resulting mutant, JWCB018 (?pyrFA ?cbeI), is readily transformed by DNA isolated from E. coli without in vitro methylation. PCR amplification and sequencing suggested that this deletion left the adjacent methyltransferase (Cbes2437) intact. This was confirmed by the fact that DNA isolated from JWCB018 was protected from digestion by CbeI and HaeIII. Plasmid DNA isolated from C. hydrothermalis transformants were readily transformed into C. bescii. Digestion analysis of chromosomal DNA isolated from seven Caldicellulosiruptor species by using nine different restriction endonucleases was also performed to identify the functional restriction-modification activities in this genus. Conclusion Deletion of the cbeI gene removes a substantial barrier to routine DNA transformation and chromosomal modification of C. bescii. This will facilitate the functional analyses of genes as well as metabolic engineering for the production of biofuels and bioproducts from biomass. An analysis of restriction-modification activities in members of this genus suggests a way forward to eliminating restriction as a barrier to DNA transformation and efficient genetic manipulation of this important group of hyperthermophiles. PMID:23714229

2013-01-01

301

Characterization of psychrotrophic bacterial communities in modified atmosphere-packed meat with terminal restriction fragment length polymorphism.  

PubMed

Characterization of psychrotrophic lactic acid bacteria (LAB) and Brochothrix thermosphacta communities is needed to understand the microbial ecology of spoilage of modified atmosphere-packed (MAP) meats. To overcome the limitations of the currently used methods for the characterization of psychrotrophic bacterial communities in meat, we developed a culture-independent, 16S rRNA gene-targeted terminal restriction fragment length polymorphism (T-RFLP) method. An identification library consisting of 100 Gram-positive and 30 Gram-negative meat-associated bacterial strains was set up to identify the terminal restriction fragments derived from the communities. The taxonomic resolution level of the T-RFLP method was in between genus and species within the investigated LAB strains and within family and genus within the investigated Gram-negative strains. The established library was applied to identify the members of bacterial communities in MAP minced meat at the end of the shelf life. The T-RFLP results and plate counts on Man-Rogosa-Sharpe, Violet Red Bile Glucose, and Streptomycin sulfate thallium acetate actidione agars indicated that LAB and B. thermosphacta predominated in meat. The bacterial taxa associated with the T-RFLP results were compared to those identified among plate-grown LAB isolates by numerical ribopattern analysis. Both methods agreed that Leuconostoc spp. and Carnobacterium spp. prevailed in the LAB community in minced meat followed by Lactobacillus algidus, Lactococcus spp. and Weissella spp. Colony identification revealed that Leuconostoc gasicomitatum, L. gelidum, Carnobacterium divergens and C. maltaromaticum were the predominant LAB species. The T-RFLP results were shown to correlate with viable counts of Leuconostoc spp. and B. thermosphacta. The T-RFLP method was found to be a useful tool enabling rapid and high-throughput characterization of psychrotrophic bacteria prevailing in MAP meat. PMID:21093087

Nieminen, T T; Vihavainen, E; Paloranta, A; Lehto, J; Paulin, L; Auvinen, P; Solismaa, M; Björkroth, K J

2011-01-01

302

16S rRNA Terminal Restriction Fragment Length Polymorphism for the Characterization of the Nasopharyngeal Microbiota  

PubMed Central

A novel non-culture based 16S rRNA Terminal Restriction Fragment Length Polymorphism (T-RFLP) method using the restriction enzymes Tsp509I and Hpy166II was developed for the characterization of the nasopharyngeal microbiota and validated using recently published 454 pyrosequencing data. 16S rRNA gene T-RFLP for 153 clinical nasopharyngeal samples from infants with acute otitis media (AOM) revealed 5 Tsp509I and 6 Hpy166II terminal fragments (TFs) with a prevalence of >10%. Cloning and sequencing identified all TFs with a prevalence >6% allowing a sufficient description of bacterial community changes for the most important bacterial taxa. The conjugated 7-valent pneumococcal polysaccharide vaccine (PCV-7) and prior antibiotic exposure had significant effects on the bacterial composition in an additive main effects and multiplicative interaction model (AMMI) in concordance with the 16S rRNA 454 pyrosequencing data. In addition, the presented T-RFLP method is able to discriminate S. pneumoniae from other members of the Mitis group of streptococci, which therefore allows the identification of one of the most important human respiratory tract pathogens. This is usually not achieved by current high throughput sequencing protocols. In conclusion, the presented 16S rRNA gene T-RFLP method is a highly robust, easy to handle and a cheap alternative to the computationally demanding next-generation sequencing analysis. In case a lot of nasopharyngeal samples have to be characterized, it is suggested to first perform 16S rRNA T-RFLP and only use next generation sequencing if the T-RFLP nasopharyngeal patterns differ or show unknown TFs. PMID:23284951

Brugger, Silvio D.; Frei, Laurence; Frey, Pascal M.; Aebi, Suzanne; Mühlemann, Kathrin; Hilty, Markus

2012-01-01

303

DNA Detectives  

NSDL National Science Digital Library

Many of the revolutionary changes that have occurred in biology since 1970 can be attributed directly to the ability to manipulate DNA in defined ways. The principal tools for this recombinant DNA technology are enzymes that can "cut and "paste" DNA. Restriction enzymes are the "chemical scissors" of the molecular biologist; these enzymes cut DNA at specific nucleotide sequences. A sample of someone's DNA, incubated with restriction enzymes, is reduced to millions of DNA fragments of varying sizes. A DNA sample from a different person would have a different nucleotide sequence and would thus be enzymatically "chopped up" into a very different collection of fragments. We have been asked to apply DNA fingerprinting to determine which suspect should be charged with a crime perpetrated in our city.

BEGIN:VCARD VERSION:2.1 FN:Suzanne Black N:Black;Suzanne ORG:Inglemoor High School REV:2005-04-09 END:VCARD

1995-06-30

304

Comparison of three methods of DNA extraction from peripheral blood mononuclear cells and lung fragments of equines.  

PubMed

We compared three different protocols for DNA extraction from horse peripheral blood mononuclear cells (PBMC) and lung fragments, determining average final DNA concentration, purity, percentage of PCR amplification using beta-actin, and cost. Thirty-four samples from PBMC, and 33 samples from lung fragments were submitted to DNA extraction by three different protocols. Protocol A consisted of a phenol-chloroform and isoamylic alcohol extraction, Protocol B used alkaline extraction with NaOH, and Protocol C used the DNAzol((R)) reagent kit. Protocol A was the best option for DNA extraction from lung fragments, producing high DNA concentrations, with high sensitivity in PCR amplification (100%), followed by Protocols C and B. On the other hand, for PBMC samples, Protocol B gave the highest sensitivity in PCR amplification (100%), followed by Protocols C and A. We conclude that Protocol A should be used for PCR diagnosis from lung fragment samples, while Protocol B should be used for PBMC. PMID:20730710

Santos, E M; Paula, J F R; Motta, P M C; Heinemann, M B; Leite, R C; Haddad, J P A; Del Puerto, H L; Reis, J K P

2010-01-01

305

Molecular Epidemiology of Mycobacterium avium subsp. paratuberculosis: IS900 Restriction Fragment Length Polymorphism and IS1311 Polymorphism Analyses of Isolates from Animals and a Human in Australia  

PubMed Central

The distribution and prevalence of strains of Mycobacterium avium subsp. paratuberculosis were determined among sheep, cattle, and other species with Johne's disease in Australia. A total of 328 isolates were evaluated from numerous farms in New South Wales, Victoria, Tasmania, and South Australia, Australia. Restriction fragment length polymorphism (RFLP) analysis of genomic DNA using BstEII and an IS900 probe and IS1311 polymorphism analysis using PCR and restriction endonuclease analysis (PCR-REA) was used to classify isolates as cattle (C) or sheep (S) strains. IS1311 PCR-REA provided similar information to IS900 RFLP analysis but was more useful than RFLP analysis where DNA was degraded or scarce. Twelve IS900 RFLP types were found. Johne's disease in sheep was always due to S strains, while cattle were infected only with C strains. RFLP type S1 was the dominant strain in sheep in New South Wales (97% of isolates) and was the only strain found in sheep from Victoria. Seven RFLP types were present in cattle. RFLP types C3 and C1 were most common (collectively, 85% of isolates), but C1 was not found in New South Wales and C3 was present in dairy cattle but not in beef cattle in Victoria. These differences may be explained by restricted livestock trading patterns between different segments of the cattle industry. Up to five RFLP types were present in some geographic regions in Victoria, while up to three RFLP types were found among cattle on some farms. Individual cattle usually were infected with only one RFLP type, but one animal was infected with both C5 and CU4. Two isolates from goats were C type as were three from alpacas, one from a rhinoceros, and two from a human with Crohn's disease. The prevalences of specific RFLP types in Australia differ from those reported in Europe and elsewhere. Given the existence of geographical and farm enterprise differences in IS900 RFLP type, this technique may be applied selectively to trace the spread of Johne's disease, at least in the cattle industries. As these observations reflect past exposure of livestock to M. avium subsp. paratuberculosis, the monitoring of strains present in animals in Australia is continuing. PMID:10970365

Whittington, R. J.; Hope, A. F.; Marshall, D. J.; Taragel, C. A.; Marsh, I.

2000-01-01

306

Programmed Protection of Foreign DNA from Restriction Allows Pathogenicity Island Exchange during Pneumococcal Transformation  

PubMed Central

In bacteria, transformation and restriction-modification (R-M) systems play potentially antagonistic roles. While the former, proposed as a form of sexuality, relies on internalized foreign DNA to create genetic diversity, the latter degrade foreign DNA to protect from bacteriophage attack. The human pathogen Streptococcus pneumoniae is transformable and possesses either of two R-M systems, DpnI and DpnII, which respectively restrict methylated or unmethylated double-stranded (ds) DNA. S. pneumoniae DpnII strains possess DpnM, which methylates dsDNA to protect it from DpnII restriction, and a second methylase, DpnA, which is induced during competence for genetic transformation and is unusual in that it methylates single-stranded (ss) DNA. DpnA was tentatively ascribed the role of protecting internalized plasmids from DpnII restriction, but this seems unlikely in light of recent results establishing that pneumococcal transformation was not evolved to favor plasmid exchange. Here we validate an alternative hypothesis, showing that DpnA plays a crucial role in the protection of internalized foreign DNA, enabling exchange of pathogenicity islands and more generally of variable regions between pneumococcal isolates. We show that transformation of a 21.7 kb heterologous region is reduced by more than 4 logs in dpnA mutant cells and provide evidence that the specific induction of dpnA during competence is critical for full protection. We suggest that the integration of a restrictase/ssDNA-methylase couplet into the competence regulon maintains protection from bacteriophage attack whilst simultaneously enabling exchange of pathogenicicy islands. This protective role of DpnA is likely to be of particular importance for pneumococcal virulence by allowing free variation of capsule serotype in DpnII strains via integration of DpnI capsule loci, contributing to the documented escape of pneumococci from capsule-based vaccines. Generally, this finding is the first evidence for a mechanism that actively promotes genetic diversity of S. pneumoniae through programmed protection and incorporation of foreign DNA. PMID:23459610

Johnston, Calum; Martin, Bernard; Granadel, Chantal; Polard, Patrice; Claverys, Jean-Pierre

2013-01-01

307

DNA fragmentation induced by Fe ions in human cells: shielding influence on spatially correlated damage  

NASA Technical Reports Server (NTRS)

Outside the magnetic field of the Earth, high energy heavy ions constitute a relevant part of the biologically significant dose to astronauts during the very long travels through space. The typical pattern of energy deposition in the matter by heavy ions on the microscopic scale is believed to produce spatially correlated damage in the DNA which is critical for radiobiological effects. We have investigated the influence of a lucite shielding on the initial production of very small DNA fragments in human fibroblasts irradiated with 1 GeV/u iron (Fe) ions. We also used gamma rays as reference radiation. Our results show: (1) a lower effect per incident ion when the shielding is used; (2) an higher DNA Double Strand Breaks (DSB) induction by Fe ions than by gamma rays in the size range 1-23 kbp; (3) a non-random DNA DSB induction by Fe ions. c2004 COSPAR. Published by Elsevier Ltd. All rights reserved.

Antonelli, F.; Belli, M.; Campa, A.; Chatterjee, A.; Dini, V.; Esposito, G.; Rydberg, B.; Simone, G.; Tabocchini, M. A.

2004-01-01

308

Cleavage of Phosphorothioated DNA and Methylated DNA by the Type IV Restriction Endonuclease ScoMcrA  

PubMed Central

Many taxonomically diverse prokaryotes enzymatically modify their DNA by replacing a non-bridging oxygen with a sulfur atom at specific sequences. The biological implications of this DNA S-modification (phosphorothioation) were unknown. We observed that simultaneous expression of the dndA-E gene cluster from Streptomyces lividans 66, which is responsible for the DNA S-modification, and the putative Streptomyces coelicolor A(3)2 Type IV methyl-dependent restriction endonuclease ScoA3McrA (Sco4631) leads to cell death in the same host. A His-tagged derivative of ScoA3McrA cleaved S-modified DNA and also Dcm-methylated DNA in vitro near the respective modification sites. Double-strand cleavage occurred 16–28 nucleotides away from the phosphorothioate links. DNase I footprinting demonstrated binding of ScoA3McrA to the Dcm methylation site, but no clear binding could be detected at the S-modified site under cleavage conditions. This is the first report of in vitro endonuclease activity of a McrA homologue and also the first demonstration of an enzyme that specifically cleaves S-modified DNA. PMID:21203499

Liu, Guang; Ou, Hong-Yu; Wang, Tao; Li, Li; Tan, Huarong; Zhou, Xiufen; Rajakumar, Kumar; Deng, Zixin; He, Xinyi

2010-01-01

309

Cutting and pasting DNA, 2D animationSite: DNA Interactive (www.dnai.org)  

NSDL National Science Digital Library

The discovery of enzymes that could cut and paste DNA made genetic engineering possible. Restriction enzymes, found naturally in bacteria, can be used to cut DNA fragments at specific sequences, while another enzyme, DNA ligase, can attach or rejoin DNA fragments with complementary ends.

2008-10-06

310

REBASE-a database for DNA restriction and modification: enzymes, genes and genomes.  

PubMed

REBASE is a comprehensive and fully curated database of information about the components of restriction-modification (RM) systems. It contains fully referenced information about recognition and cleavage sites for both restriction enzymes and methyltransferases as well as commercial availability, methylation sensitivity, crystal and sequence data. All genomes that are completely sequenced are analyzed for RM system components, and with the advent of PacBio sequencing, the recognition sequences of DNA methyltransferases (MTases) are appearing rapidly. Thus, Type I and Type III systems can now be characterized in terms of recognition specificity merely by DNA sequencing. The contents of REBASE may be browsed from the web http://rebase.neb.com and selected compilations can be downloaded by FTP (ftp.neb.com). Monthly updates are also available via email. PMID:25378308

Roberts, Richard J; Vincze, Tamas; Posfai, Janos; Macelis, Dana

2015-01-28

311

A simple polymerase chain reaction/restriction fragment length polymorphism assay capable of identifying medically relevant filamentous fungi.  

PubMed

Because of the accumulating evidence that suggests that numerous unhealthy conditions in the indoor environment are the result of abnormal growth of the filamentous fungi (mold) in and on building surfaces, it is necessary to accurately reflect the organisms responsible for these maladies and to identify them in precise and timely manner. To this end, we have developed a method that is cost effective, easy to perform, and accurate. We performed a simple polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) analysis on multiple members of species known to negatively influence the indoor environment. The genera analyzed were Stachybotrys, Penicillium, Aspergillus, and Cladosporium. Each organism underwent PCR with universal primers that amplified ribosomal sequences generating products from 550 to 600 bp followed by enzymatic digestion with EcoRI, HaeIII, MspI, and HinfI. Our results show that using this combination of restriction enzymes enables the identification of these fungal organisms at the species level. PMID:16118412

Dean, Timothy R; Kohan, Michael; Betancourt, Doris; Menetrez, Marc Y

2005-09-01

312

Dynamics of sperm DNA fragmentation in domestic animals II. The stallion.  

PubMed

The mixed success of equine artificial insemination programs using chilled and frozen-thawed semen is most likely associated with the variable response of the sperm cell to the preservation process and the fact that stallions are not selected on the basis of reproductive performance. We propose that the traditional indicators of sperm viability do not fully account for male factor infertility in the stallion and that knowledge of sperm DNA damage in the original semen sample and during semen processing may provide a more informed explanation of an individual stallion's reproductive potential. This study reports on the validation of a sperm DNA fragmentation test based on the sperm chromatin dispersion test (SCD) for stallion spermatozoa and on its application to semen that was chilled (4 degrees C; n=10) or frozen-thawed (n=13). Semen samples were collected by artificial vagina and the proportion of sperm with fragmented DNA determined. Seminal plasma was then removed by centrifugation and the sperm pellet re-suspended in commercial extenders prior to being chilled or cryopreserved using standard industry protocols. Chilled semen was cooled slowly to 4 degrees C and stored for 1h before commencing the analysis; cryopreserved semen was thawed and immediately analyzed. Following chilling or cryopreservation, the semen samples were incubated at 37 degrees C and analyzed for SCD after 0, 4, 6, 24 and 48 h storage. The results of this investigation revealed that there was no significant difference in the sperm DNA fragmentation index (sDFI) of sperm evaluated initially after collection compared to those tested immediately after chilling or cryopreservation. However, within 1h of incubation at 37 degrees C, both chilled and frozen-thawed spermatozoa showed a significant increase in the proportion of sDFI; after 6h the sDFI had increased to over 50% and by 48 h, almost 100% of the sperm showed DNA damage. While the sDFI of individual stallions at equivalent times of incubation was variable, an analysis of the rate of change of sDFI revealed no difference between stallions or the way in which the semen was preserved. In terms of sperm DNA fragmentation dynamics, the highest intensity of sperm DNA damage occurred in the first 6h of incubation. We suggest that the SCD test can be used as a routine assessment tool for the development and refinement of preservation protocols designed to reduce stallion sperm DNA damage. PMID:17919715

López-Fernández, C; Crespo, F; Arroyo, F; Fernández, J L; Arana, P; Johnston, S D; Gosálvez, J

2007-12-01

313

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing  

SciTech Connect

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

314

DNase ? Is the Effector Endonuclease for Internucleosomal DNA Fragmentation in Necrosis  

PubMed Central

Apoptosis and necrosis, two major forms of cell death, can be distinguished morphologically and biochemically. Internucleosomal DNA fragmentation (INDF) is a biochemical hallmark of apoptosis, and caspase-activated DNase (CAD), also known as DNA fragmentation factor 40 kDa (DFF40), is one of the major effector endonucleases. DNase ?, a Mg2+/Ca2+-dependent endonuclease, is also known to generate INDF but its role among other apoptosis-associated endonucleases in cell death is unclear. Here we show that (i) INDF occurs even during necrosis in cell lines, primary cells, and in tissues of mice in vivo, and (ii) DNase ?, but not CAD, is the effector endonuclease for INDF in cells undergoing necrosis. These results document a previously unappreciated role for INDF in necrosis and define its molecular basis. PMID:24312463

Mizuta, Ryushin; Araki, Shinsuke; Furukawa, Makoto; Furukawa, Yuki; Ebara, Syota; Shiokawa, Daisuke; Hayashi, Katsuhiko; Tanuma, Sei-ichi; Kitamura, Daisuke

2013-01-01

315

[Identification of SHV-type extended spectrum beta-lactamase genes in Pseudomonas aeruginosa by PCR-restriction fragment length polymorphism and insertion site restriction-PCR].  

PubMed

We propose a simple and rapid method to discriminate SHV-type extended spectrum beta-lactamase (ESBL) genes in P. aeruginosa based on PCR techniques (PCR-RFLP and RSI-PCR). We studied 22 producing ESBL P. aeruginosa strains isolated from seven immunocompromised patients (19 isolates) and from environmental swabs (three isolates) at the Bone Marrow Transplantation Center of Tunis. Screening PCR with primer pairs designed to detect gene encoding TEM, SHV, OXA group I, OXA group II, OXA-18 and PER-1 ESBL was positive for bla(OXA18) and bla(SHV) genes in all isolates. Pulsed field gel electrophoresis using SpeI endonuclease defined five genotypic groups. For at least one isolate corresponding to each genotype observed, restriction of PCR products by DdeI and BsrI revealed the same restriction pattern that the bla(SHV-1) negative control; in the same way, RSI-PCR products digestion by NruI, thus excluding 35, 238 and 240 mutations characterizing reported ESBL in P. aeruginosa (SHV-2a, SHV5 et SHV12), and suggesting that studied bla(SHV) genes were not ESBL ones. Genomic DNA hybridization by southern blot with probe consisting in bla(SHV-1) gene was positive in these isolates. Sequencing the full-length open reading frame revealed nucleotide sequence of the bla(SHV-1). PCR-RFLP and RSI-PCR results were then confirmed. This approach is effective for screening P. aeruginosa for ESBL genes carriage in epidemiological studies and for detecting new variants. PMID:18838231

Kalai Blagui, S; Achour, W; Abdeladhim, A; Ben Hassen, A

2009-07-01

316

Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm  

Microsoft Academic Search

The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples\\u000a were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after\\u000a hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is\\u000a twice higher for

N. N. Vtyurina; S. L. Grokhovski; I. V. Filimonov; O. I. Medvedkov; D. Yu. Nechipurenko; S. A. Vasiliev; Yu. D. Nechipurenko

2011-01-01

317

DNA vaccination using the fragment C of botulinum neurotoxin type A provided protective immunity in mice  

Microsoft Academic Search

Botulinum neurotoxin (BoNT) is one of the most toxic substances known to produce severe neuromuscular paralysis. The currently used vaccine is prepared mainly from biohazardous toxins. Thus, we studied an alternative method and demonstrated that DNA immunization provided sufficient protection against botulism in a murine model. A plasmid of pBoNT\\/A-Hc, which encodes the fragment C gene of type A botulinum

Rong-Hwa Shyu; Men-Fang Shaio; Shiao-Shek Tang; Huey-Fen Shyu; Chi-Feng Lee; Meng-Hung Tsai; Jason E. Smith; Hsin-Hsien Huang; Jiunn-Jye Wey; Jan-Ling Huang; Hsin-Hou Chang

2000-01-01

318

Structures of the rare-cutting restriction endonuclease NotI reveal a novel metal binding fold involved in DNA recognition  

PubMed Central

The structure of the rare-cutting restriction endonuclease NotI, which recognizes the 8 basepair target 5?-GCGGCCGC-3?, has been solved with and without bound DNA. Because of its specificity (recognizing a site that occurs once per 65kb), NotI is used to generate large genomic fragments and to map DNA methylation status. NotI contains a unique metal-binding fold, found in a variety of putative endonucleases, occupied by an iron atom coordinated within a tetrahedral Cys4 motif. This domain positions nearby structural elements for DNA recognition, and serves a structural role. While recognition of the central six basepairs of the target is accomplished via a saturated hydrogen bond network typical of restriction enzymes, the most peripheral basepairs are engaged in a single direct contact in the major groove, reflecting reduced pressure to recognize those positions. NotI may represent an evolutionary intermediate between mobile endonucleases (which recognize longer target sites) and canonical restriction endonucleases. PMID:18400177

Lambert, Abigail R.; Sussman, Django; Shen, Betty; Maunus, Robert; Nix, Jay; Samuelson, James; Xu, Shuang-yong; Stoddard, Barry L.

2008-01-01

319

Genetic linkage of two intragenic restriction fragment length polymorphisms with von Willebrand's disease type IIA. Evidence for a defect in the von Willebrand factor gene.  

PubMed Central

Restriction fragment length polymorphisms (RFLPs), using the enzymes Bgl II and Xba I in conjunction with human von Willebrand factor (vWF) cDNA probes, have been described previously. In the present study we demonstrate the localization of both genetic markers within the vWF gene. The RFLPs were used to study the segregation of alleles associated with von Willebrand's disease (vWD) type IIA in a comprehensive, affected family. Individuals of this family were tested for their bleeding time and their plasma was analyzed for vWF antigen concentration and vWF ristocetin-cofactor activity. Based on these data, the affected members were diagnosed as vWD type-IIA patients; this conclusion was confirmed by the analysis of the multimeric vWF pattern of some of the patients. It was demonstrated that both RFLPs are completely linked with the vWD type-IIA trait. From this finding, we conclude that the defect that causes the vWD type IIA is most likely due to a mutation in the vWF gene and not to a mutation in a gene involved in posttranslational processing of the vWF protein. Images PMID:2895123

Verweij, C L; Quadt, R; Briët, E; Dubbeldam, K; van Ommen, G B; Pannekoek, H

1988-01-01

320

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins  

SciTech Connect

Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)] [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia) [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia)] [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)] [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

2012-04-20

321

Long-fragment DNA as a potential marker for stool-based detection of colorectal cancer.  

PubMed

Neoplastic cells that are exfoliated from the colorectal epithelium exhibit dysfunctional apoptotic mechanisms, and thus it is possible to identify high-molecular-weight DNA fragments (long DNA) in feces. In the present study, the sensitivity and specificity of fecal-based long DNA assays were evaluated for the detection of colorectal cancer (CRC). Feces were collected from 54 healthy volunteers and 130 patients with CRC prior to surgical treatment. The presence of long DNA of the adenomatosis polyposis coli, Kirsten rat sarcoma viral oncogene homolog (KRAS), B-raf proto-oncogene, serine/threonine kinase and p53 genes was assessed by polymerase chain reaction followed by electrophoresis. The identification of long DNA in feces was found to exhibit a sensitivity of 56.2% and specificity of 96.3% for CRC detection. In addition, long DNA was identified in the feces of 58/90 (64.4%) patients with distal CRC and 15/40 (37.5%) patients with proximal CRC. This study indicates the potential of the fecal long DNA assay as a non-invasive and easily performed method for the detection of individuals with CRC. PMID:25436008

Zhang, Yibo; Suehiro, Yutaka; Shindo, Yoshitaro; Sakai, Kouhei; Hazama, Shoichi; Higaki, Shingo; Sakaida, Isao; Oka, Masaaki; Yamasaki, Takahiro

2015-01-01

322

Validation of meat inspection results for Taenia saginata cysticercosis by PCR-restriction fragment length polymorphism.  

PubMed

Bovine cysticercosis is a zoonosis caused by the larval stage (cysticercus) of the human tapeworm Taenia saginata. Infected cattle is an important food safety issue besides an economic concern. Humans get infected by eating raw or undercooked meat containing viable cysticerci. Visual meat inspection of bovines is the only public health measure implemented to control transmission to humans, but it lacks sensitivity and objectivity. It may underestimate the prevalence of the disease by a factor 3 to 10. Furthermore, the success of the method depends on the expertise of the meat inspector as well as on the stage of development of the cysticerci. The focus of this study was to develop and explore the usefulness of a PCR assay as an objective alternative to evaluate the meat inspector's visual inspection results. Hereto, a PCR was developed for the detection of T. saginata DNA in muscle lesions. Based on the laboratory classification of lesions, almost 97% of viable cysts were confirmed by PCR, while for dead cysts, the percentage was approximately 73%. Taken together, these data demonstrate the difficulties of visual meat inspection and their objective interpretation, emphasizing the need to improve current assays to strengthen the control of bovine cysticercosis. PMID:17265888

Geysen, Dirk; Kanobana, Kirezi; Victor, Bjorn; Rodriguez-Hidalgo, Richar; De Borchgrave, Jean; Brandt, Jef; Dorny, Pierre

2007-01-01

323

Isolation and comparative restriction endonuclease DNA fingerprinting of equine herpesvirus-1 from cattle.  

PubMed

Deoxyribonucleic acid fingerprinting analyses with 4 restriction endonucleases (EcoRI, BamHI, BglII, and HindIII) and serotest results have definitively indicated that 5 herpesviruses isolated from 1974 to 1986 from aborted bovine fetuses and from bovine tissues and nasal secretions were abortigenic subtypes of equine herpesvirus type 1 (EHV-1). The herpesviruses, designated BH1247, 3M20-3, G118, H1753, and 9BSV4, were neutralized by EHV-1-specific antiserum and could be propagated in cultures of either bovine or equine cells. Only minor differences in restriction endonuclease patterns were detected from the pattern of an Army 183 isolate of EHV-1 subtype 1 that had been passaged only in equine cells and from that of an attenuated EHV-1 subtype 1 (RQ) strain that had been passaged several hundred times in non-equine cells. The individual differences in the restriction endonuclease fragments of the 5 bovine isolates and the Army 183 and RQ strains mainly were attributable to alterations in the terminally repeated and the unique short nucleotide sequences of the EHV-1 genomes, which are known to be hot spots for deletions and tandem repeats. The BamHI restriction endonuclease pattern of the 1977 bovine isolate H1753 was identical to that of EHV-1 subtype-1 strains responsible for most of the virus abortions in vaccinated horses since 1981. Abortigenic EHV-1 strains have the ability to infect cattle and cause disease under natural conditions. PMID:2854705

Crandell, R A; Ichimura, H; Kit, S

1988-11-01

324

Fragmentation of condensed-phase DNA components by hyperthermal He{sup +} impact  

SciTech Connect

We have observed severe damage to films of DNA components (thymine, D-ribose, 2-deoxy-D-ribose, and thymidine) induced by 10 to 100 eV He{sup +} ions (2.5-25 eV/amu). The damage is attributed to the kinetic and potential energies, as well as the chemical reactivity of the He{sup +} projectiles. Hyperthermal He{sup +} ion impact on these films results in the complete destruction of the molecules via fragmentation, and direct and indirect (secondary fragment) reactive scattering, all of which leads to the desorption of abundant cation and anion fragments. The chemical composition of the fragments is identified, and the fragmentation patterns are compared to those produced by Ar{sup +} irradiation. While the lower mass of He{sup +} ions causes less efficient desorption of very heavy fragments, several reactive collisions are also observed, including hydrogen abstraction by incident He{sup +} from any of the molecules studied to yield desorbing HeH{sup +}. This process likely occurs via the formation of an intermediate molecular ion (He-H-R)*{sup +}, which decays to HeH{sup +}+R . Compared to Ar{sup +}, here a significant (x23) enhancement in H{sup +} desorption is observed during He{sup +} ion irradiation, which likely involves (a) the decay of the intermediate (He-H-R)*{sup +}, or desorbing HeH{sup +}, and (b) Auger or quasiresonant excitations of C, N, or O atom centers (or C-H, N-H, or O-H bonds) by the incident He{sup +} ion. The formation of several molecular cations, e.g., H{sub 3}O{sup +}, also requires hydrogen abstraction from its parent or adjacent molecules by initial cation fragments prior to desorption.

Deng Zongwu; Imhoff, Marjorie; Bald, Ilko; Illenberger, Eugen; Huels, Michael A. [Department of Nuclear Medicine and Radiobiology, Ion Reaction Laboratory, Faculty of Medicine and Health Sciences, University of Sherbrooke, Sherbrooke, Quebec, J1H 5N4 (Canada)

2006-07-15

325

DNA electrochemical sensor for detection of PRSS1 point mutation based on restriction endonuclease technique.  

PubMed

To construct a restriction endonuclease based biosensor technology for PRSS1 genotyping. We designed a thiol-modified hairpin probe where the neck has EcoRI endonuclease recognition sites according to the PRSS1 gene c.410 C>T (p.T137 M) mutation and it was fixed on the gold electrode. Different charge generated by the binding of MB to phosphate groups of DNA before and after hybridization was used for distinguishing the different genotypes and quantity. This showed that the novel sensor can better distinguish the complementary sequence, single-base mismatches, and completely noncomplementary sequences, and the linear range for the logarithm was Y=-0.0242 X+0.1574, R=0.9912(Y=current, X=log target DNA concentration); the detection limit for DNA detection is estimated to be 50 fM. PMID:25037001

Qicai, Liu; Qiang, Yi; Wennan, Wu; Yu, Wang; Liqing, Lin; Chengfei, Zhao; Xinhua, Lin

2015-01-01

326

Does quantum entanglement in DNA synchronize the catalytic centers of type II restriction endonucleases?  

E-print Network

Several living systems have been examined for their apparent optimization of structure and function for quantum behavior at biological length scales. Orthodox type II endonucleases, the largest class of restriction enzymes, recognize four-to-eight base pair sequences of palindromic DNA, cut both strands symmetrically, and act without an external metabolite such as ATP. While it is known that these enzymes induce strand breaks by attacking phosphodiester bonds, what remains unclear is the mechanism by which cutting occurs in concert at the catalytic centers. Previous studies indicate the primacy of intimate DNA contacts made by the specifically bound enzyme in coordinating the two synchronized cuts. We propose that collective electronic behavior in the DNA helix generates coherent oscillations, quantized through boundary conditions imposed by the endonuclease, that provide the energy required to break two phosphodiester bonds. Such quanta may be preserved in the presence of thermal noise and electromagnetic in...

Kurian, P; Lindesay, J

2014-01-01

327

Design and evaluation of PCR primers to amplify bacterial 16S ribosomal DNA fragments used for community fingerprinting  

Microsoft Academic Search

Denaturing gradient gel electrophoresis of PCR-amplified 16S ribosomal DNA (rDNA) fragments has frequently been applied to the fingerprinting of natural bacterial populations (PCR\\/DGGE). In this study, sequences of bacterial universal primers frequently used in PCR\\/DGGE were compared with 16S rDNA sequences that represent recently proposed divisions in the domain Bacteria. We found mismatches in 16S rDNA sequences from some groups

Kazuya Watanabe; Yumiko Kodama; Shigeaki Harayama

2001-01-01

328

EndoG Links Bnip3-Induced Mitochondrial Damage and Caspase-Independent DNA Fragmentation in Ischemic Cardiomyocytes  

PubMed Central

Mitochondrial dysfunction, caspase activation and caspase-dependent DNA fragmentation are involved in cell damage in many tissues. However, differentiated cardiomyocytes repress the expression of the canonical apoptotic pathway and their death during ischemia is caspase-independent. The atypical BH3-only protein Bnip3 is involved in the process leading to caspase-independent DNA fragmentation in cardiomyocytes. However, the pathway by which DNA degradation ensues following Bnip3 activation is not resolved. To identify the mechanism involved, we analyzed the interdependence of Bnip3, Nix and EndoG in mitochondrial damage and DNA fragmentation during experimental ischemia in neonatal rat ventricular cardiomyocytes. Our results show that the expression of EndoG and Bnip3 increases in the heart throughout development, while the caspase-dependent machinery is silenced. TUNEL-positive DNA damage, which depends on caspase activity in other cells, is caspase-independent in ischemic cardiomyocytes and ischemia-induced DNA high and low molecular weight fragmentation is blocked by repressing EndoG expression. Ischemia-induced EndoG translocation and DNA degradation are prevented by silencing the expression of Bnip3, but not Nix, or by overexpressing Bcl-xL. These data establish a link between Bnip3 and EndoG-dependent, TUNEL-positive, DNA fragmentation in ischemic cardiomyocytes in the absence of caspases, defining an alternative cell death pathway in postmitotic cells. PMID:21437288

Zhang, Jisheng; Ye, Junmei; Altafaj, Albert; Cardona, Maria; Bahi, Núria; Llovera, Marta; Cañas, Xavier; Cook, Stuart A.; Comella, Joan X.; Sanchis, Daniel

2011-01-01

329

EndoG links Bnip3-induced mitochondrial damage and caspase-independent DNA fragmentation in ischemic cardiomyocytes.  

PubMed

Mitochondrial dysfunction, caspase activation and caspase-dependent DNA fragmentation are involved in cell damage in many tissues. However, differentiated cardiomyocytes repress the expression of the canonical apoptotic pathway and their death during ischemia is caspase-independent. The atypical BH3-only protein Bnip3 is involved in the process leading to caspase-independent DNA fragmentation in cardiomyocytes. However, the pathway by which DNA degradation ensues following Bnip3 activation is not resolved. To identify the mechanism involved, we analyzed the interdependence of Bnip3, Nix and EndoG in mitochondrial damage and DNA fragmentation during experimental ischemia in neonatal rat ventricular cardiomyocytes. Our results show that the expression of EndoG and Bnip3 increases in the heart throughout development, while the caspase-dependent machinery is silenced. TUNEL-positive DNA damage, which depends on caspase activity in other cells, is caspase-independent in ischemic cardiomyocytes and ischemia-induced DNA high and low molecular weight fragmentation is blocked by repressing EndoG expression. Ischemia-induced EndoG translocation and DNA degradation are prevented by silencing the expression of Bnip3, but not Nix, or by overexpressing Bcl-x(L). These data establish a link between Bnip3 and EndoG-dependent, TUNEL-positive, DNA fragmentation in ischemic cardiomyocytes in the absence of caspases, defining an alternative cell death pathway in postmitotic cells. PMID:21437288

Zhang, Jisheng; Ye, Junmei; Altafaj, Albert; Cardona, Maria; Bahi, Núria; Llovera, Marta; Cañas, Xavier; Cook, Stuart A; Comella, Joan X; Sanchis, Daniel

2011-01-01

330

Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])  

SciTech Connect

Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to {approx}1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated sperm DNA fragmentation. Extensive DNA fragmentation probably cannot be repaired by the egg and the spontaneous abortion rate is {approx}2x higher if a man has more than 30% of sperm showing DNA fragmentation. DNA fragmentation is an excellent marker for exposure to potential reproductive toxicants and a diagnostic/prognostic tool for potential male infertility.

Evenson, Donald P. [HCLD, Department of Chemistry and Biochemistry, South Dakota State University, Brookings, SD 57007 (United States) and SCSA Diagnostics, 807 32nd Avenue, Brookings, SD 57007 (United States)]. E-mail: scsa@brookings.net; Wixon, Regina [SCSA Diagnostics, 807 32nd Avenue, Brookings, SD 57007 (United States)

2005-09-01

331

The mechanism and pattern of banding induced by restriction endonucleases in human chromosomes  

Microsoft Academic Search

The mechanism of chromosome banding induced by restriction endonucleases was analyzed by measuring the amount of radioactivity extracted from [14C]thymidine-labeled chromosomes digested first with restriction enzymes and subsequently with proteinase K and DNase I. Restriction enzymes with a high frequency of recognition sites in the DNA produced a large number of short DNA fragments, which were extracted from chromosomes during

Martha S. Bianchi; Néstor O. Bianchi; Gabriel E. Pantelias; Sheldon Wolff

1985-01-01

332

A conserved interaction between the replicative clamp loader and DNA ligase in eukaryotes: implications for Okazaki fragment joining.  

PubMed

The recruitment of DNA ligase I to replication foci and the efficient joining of Okazaki fragments is dependent on the interaction between DNA ligase I and proliferating cell nuclear antigen (PCNA). Although the PCNA sliding clamp tethers DNA ligase I to nicked duplex DNA circles, the interaction does not enhance DNA joining. This suggests that other factors may be involved in the joining of Okazaki fragments. In this study, we describe an association between replication factor C (RFC), the clamp loader, and DNA ligase I in human cell extracts. Subsequently, we demonstrate that there is a direct physical interaction between these proteins that involves both the N- and C-terminal domains of DNA ligase I, the N terminus of the large RFC subunit p140, and the p36 and p38 subunits of RFC. Although RFC inhibited DNA joining by DNA ligase I, the addition of PCNA alleviated inhibition by RFC. Notably, the effect of PCNA on ligation was dependent on the PCNA-binding site of DNA ligase I. Together, these results provide a molecular explanation for the key in vivo role of the DNA ligase I/PCNA interaction and suggest that the joining of Okazaki fragments is coordinated by pairwise interactions among RFC, PCNA, and DNA ligase I. PMID:15502161

Levin, David S; Vijayakumar, Sangeetha; Liu, Xiuping; Bermudez, Vladimir P; Hurwitz, Jerard; Tomkinson, Alan E

2004-12-31

333

Direct calculation of the sizes of DNA fragments separated by gel electrophoresis using programmes written for a pocket calculator.  

PubMed Central

In order to facilitate the direct computation of the sizes of DNA fragments separated by gel electrophoresis, we have written and evaluated programmes for the Hewlett-Packard 41C programmable calculator. The sizes estimated for DNA fragments of known length using some of these programmes were found to be more accurate than the estimates obtained by conventional graphical procedures. These programmes should be adaptable to other programmable calculators. Images PMID:6320110

Gough, E J; Gough, N M

1984-01-01

334

Assessment of genetic diversity among strains of Pseudomonas syringae by PCR-restriction fragment length polymorphism analysis of rRNA operons with special emphasis on P. syringae pv. tomato.  

PubMed Central

Phylogenetic relationships among 77 bacterial strains belonging to Pseudomonas syringae and Pseudomonas viridiflava species were assessed by analysis of the PCR-restriction fragment length polymorphism (RFLP) patterns of three DNA fragments corresponding to rrs and rrl genes and the internal transcribed spacer, ITS1. No difference among all strains in rrs and rrl genes was observed with 14 restriction enzymes, which confirms the close relationships existing between these two species. The nucleotidic sequence of the internal transcripted spacer (ITS1) between rrs and rrl for the P. syringae pv. syringae strain CFBP1392 was determined. Restriction maps of the PCR-amplified ITS1 region were prepared and compared for all 77 strains. Seventeen RFLP patterns, forming three main clusters, were distinguished. One contained all strains of P. syringae pv. tomato and of other pathovars which had been previously described as closely related by either pathogenicity studies or biochemical analyses. This cluster was equally far from P. viridiflava and from other P. syringae pathovars. These other pathovars of P. syringae formed a less coherent taxon. PMID:9023928

Manceau, C; Horvais, A

1997-01-01

335

Geographic distribution and evolution of yellow fever viruses based on direct sequencing of genomic cDNA fragments  

Microsoft Academic Search

We have compared the nucleotide sequence of an envelope protein gene fragment encoding amino acids 291 to 406 of 22 yellow fever (YF) virus strains of diverse geographic and host origins isolated over a 63 year time span. The nucleotide fragment of viral RNA was examined by direct sequencing ofa PCR product derived from complementary DNA. Alignment with the proto-

Loic Lepiniec; Lynn Dalgarno; V. T. Q. Huong; T. P. Monath; J.-P. Digoutte; V. Deubel

1994-01-01

336

Allopatric Origin of Sympatric Populations of Lake Whitefish (Coregonus clupeaformis) as Revealed by Mitochondrial-DNA Restriction Analysis  

E-print Network

Allopatric Origin of Sympatric Populations of Lake Whitefish (Coregonus clupeaformis) as Revealed WHITEFISH (COREGONUS CLUPEAFORMIS) AS REVEALED BY MITOCHONDRIAL-DNA RESTRICTION ANALYSIS, sympatric populations of ever, species recognition of sympatric pop- lake whitefish (Coregonus clupeaformis

Bernatchez, Louis

337

GENETIC DIVERSITY OF FLAVOBACTERIUM COLUMNARE EXAMINED BY RESTRICTION FRAGMENT LENGTH POLYMORPHISM AND SEQUENCING OF THE 16S RIBOSOMAL RNA GENE AND THE 16S-23S RDNA SPACER  

Technology Transfer Automated Retrieval System (TEKTRAN)

Genetic variability among strains of Flavobacterium columnare, isolated in the United States, was characterized by restriction fragment length polymorphism (RFLP) and phylogenetic analysis based on the sequence of the 16S rRNA gene. Twenty-seven isolates of F. columnare were differentiated into thr...

338

Apoptotic death in epithelial cells: cleavage of DNA to 300 and/or 50 kb fragments prior to or in the absence of internucleosomal fragmentation.  

PubMed Central

To date, apoptosis has been characterized biochemically by the production of 180-200 bp internucleosomal DNA fragments resulting from the activation of an endonuclease(s). The principal morphological feature of apoptosis is the condensation of chromatin and it has been assumed that this may reflect the oligonucleosomal fragmentation pattern. We have re-examined this dogma by comparing the biochemical and morphological features of cell death in several epithelial cell types (HT-29-I1 colon adenocarcinoma, CC164 mink lung, DU-145 human prostatic carcinoma and MCF-7 human breast adenocarcinoma) and one mesenchymal cell line (H11ras-R3 ras-transformed rat fibroblasts). Cell death was induced either by serum deprivation, TGF-beta 1 or etoposide, or by leaving cells to reach confluence. Cell death was assessed with respect to detachment from monolayers, morphological changes and DNA integrity. The DNA-binding fluorophore Hoechst 33258 revealed chromatin condensation patterns consistent with apoptotic cell death in all cell types except MCF-7 cells. Using field inversion gel electrophoresis in conjunction with conventional 2% agarose gel electrophoresis, cleavage of DNA to 50 kbp fragments was observed in all cases except MCF-7 cells. This preceded the appearance of oligonucleosomal fragments in HT-29-I1, CC164 and H11ras-R3 cells. Although the DNA of DU-145 cells fragmented into 50 kbp units, and although the cells exhibited classical apoptotic morphology, no subsequent internucleosomal cleavage was observed. These results suggest that changes in the integrity of DNA indicative of the release of chromatin loop domains occur before cleavage at internucleosomal sites is initiated and that the latter is not an essential step in the apoptotic process. Images PMID:8253089

Oberhammer, F; Wilson, J W; Dive, C; Morris, I D; Hickman, J A; Wakeling, A E; Walker, P R; Sikorska, M

1993-01-01

339

Fragmentation of DNA components by hyperthermal heavy ion (Ar+ and Xe+) impact in the condensed phase  

NASA Astrophysics Data System (ADS)

The overriding environmental factor that presently limits human endeavors in space is exposure to heavy ion radiation. While knowledge of its damage to living tissue is essential for radiation protection and risk estimates for astronauts, very little data exists at the molecular level regarding the nascent DNA damage by the primary particle track, or by secondary species during subsequent reaction cascades. This persistent lack of a basic understanding of nascent damage induced by such low dose, high LET radiation, introduces unacceptable errors in radiation risk estimates (based mainly on extrapolation from high dose, low LET radiation), particularly for long term exposure. Mutagenic effects induced by heavy ion radiation to cells are largely due to DNA damage by secondary transient species, i.e. secondary ballistic ions, electrons and radicals generated along the ion tracks; the secondary ions have hyperthermal energies up to several 100 eV, which they will deposit within a few nm in the surrounding medium; thus their LET is very high, and yields lethal clustered DNA lesions. We present measurements of molecular damage induced in films of DNA components by ions with precisely such low energies (1-100 eV) and compare results to conventional electron impact measurements. Experiments are conducted in UHV using a mass selected low energy ion source, and a high-resolution quadrupole MS to monitor ion yields desorbing from molecular films. Among the major fragments, NH4 + is identified in the desorption mass spectra of irradiated films of Adenine, Guanine, Cytosine, indicating efficient deamination; in cells this results in pre-mutagenic lesions. Experiments with 5-amino-Uracil, and comparison to previous results on uracil and thymine show that deamination is a key step in the NH4 + fragment formation. For Adenine, we also observe formation of amine aducts in the films, viz. amination of Adenine, and global fragmentation in all ion impact mass spectra, attributed mainly to kinetic & potential ion scattering.[Funded by NSERC and the Canadian Space Agency].

Sarabipour, Sarvenaz; Sarvenaz Sarabipour, Ms; Michaud, Marc; Deng, Zongwu; Huels, Michael A.

340

DNA Barcoding for Identification of ‘Candidatus Phytoplasmas’ Using a Fragment of the Elongation Factor Tu Gene  

PubMed Central

Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology/Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter?/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases. Conclusions/Significance This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification. PMID:23272216

Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta; Kawube, Geofrey; Bertaccini, Assunta; Nicolaisen, Mogens

2012-01-01

341

Evaluation of the applicability of amplified rDNA-restriction analysis (ARDRA) to identification of species of the genus Corynebacterium  

Microsoft Academic Search

The 16S rRNA genes (rDNA) of 50 strains belonging to 26 different coryneform bacterial species and genomospecies and of the type strain of Rhodococcus equi were enzymatically amplified. Amplified rDNA restriction analysis (ARDRA) with the enzymes Alul, Cfol and Rsal was carried out. The combination of the ARDRA patterns obtained after restriction with these three different enzymes enabled the differentiation

M Vaneechoutte; P Riegel; D de Briel; H Monteil; G Verschraegen; A De Rouck; G Claeys

1995-01-01

342

PyroTRF-ID: a novel bioinformatics methodology for the affiliation of terminal-restriction fragments using 16S rRNA gene pyrosequencing data  

PubMed Central

Background In molecular microbial ecology, massive sequencing is gradually replacing classical fingerprinting techniques such as terminal-restriction fragment length polymorphism (T-RFLP) combined with cloning-sequencing for the characterization of microbiomes. Here, a bioinformatics methodology for pyrosequencing-based T-RF identification (PyroTRF-ID) was developed to combine pyrosequencing and T-RFLP approaches for the description of microbial communities. The strength of this methodology relies on the identification of T-RFs by comparison of experimental and digital T-RFLP profiles obtained from the same samples. DNA extracts were subjected to amplification of the 16S rRNA gene pool, T-RFLP with the HaeIII restriction enzyme, 454 tag encoded FLX amplicon pyrosequencing, and PyroTRF-ID analysis. Digital T-RFLP profiles were generated from the denoised full pyrosequencing datasets, and the sequences contributing to each digital T-RF were classified to taxonomic bins using the Greengenes reference database. The method was tested both on bacterial communities found in chloroethene-contaminated groundwater samples and in aerobic granular sludge biofilms originating from wastewater treatment systems. Results PyroTRF-ID was efficient for high-throughput mapping and digital T-RFLP profiling of pyrosequencing datasets. After denoising, a dataset comprising ca. 10?000 reads of 300 to 500 bp was typically processed within ca. 20 minutes on a high-performance computing cluster, running on a Linux-related CentOS 5.5 operating system, enabling parallel processing of multiple samples. Both digital and experimental T-RFLP profiles were aligned with maximum cross-correlation coefficients of 0.71 and 0.92 for high- and low-complexity environments, respectively. On average, 63±18% of all experimental T-RFs (30 to 93 peaks per sample) were affiliated to phylotypes. Conclusions PyroTRF-ID profits from complementary advantages of pyrosequencing and T-RFLP and is particularly adapted for optimizing laboratory and computational efforts to describe microbial communities and their dynamics in any biological system. The high resolution of the microbial community composition is provided by pyrosequencing, which can be performed on a restricted set of selected samples, whereas T-RFLP enables simultaneous fingerprinting of numerous samples at relatively low cost and is especially adapted for routine analysis and follow-up of microbial communities on the long run. PMID:23270314

2012-01-01

343

Onset of apoptotic DNA fragmentation can precede cell elimination by days in the small intestinal villus.  

PubMed

DNA fragmentation is a hallmark of apoptosis, and has been viewed as a short-lived process (fragmentation and cell elimination could be longer (days). To address this possibility, we used a model system of cell death and replacement, the murine small intestinal villus. Pulses of 5-bromo-2'-deoxyuridine were used to follow quantitatively cohorts of cells from their generation in the crypts to their elimination at the villus tips, resulting in a temporal 'yard-stick' where position on the villus indicated time before cell elimination; these data allowed a mathematical description of cell movement and clearance. Combining these data with ISEL+ quantitation, enterocytes were found to commence and maintain DNA fragmentation 2 - 3 days before elimination, a phenomenon that likely has relevance to studies on apoptosis also in other systems. PMID:10200526

Pompeiano, M; Hvala, M; Chun, J

1998-08-01

344

Novel extraction method of genomic DNA suitable for long-fragment amplification from small amounts of milk.  

PubMed

Isolation of genomic DNA is a prerequisite for assessment of milk quality. As a source of genomic DNA, milk somatic cells from milking ruminants are practical, animal friendly, and cost-effective sources. Extracting DNA from milk can avoid the stress response caused by blood and tissue sampling of cows. In this study, we optimized a novel DNA extraction method for amplifying long (>1,000 bp) DNA fragments and used it to evaluate the isolation of DNA from small amounts of milk. The techniques used for the separation of milk somatic cell were explored and combined with a sodium dodecyl sulfate (SDS)-phenol method for optimizing DNA extraction from milk. Spectrophotometry was used to determine the concentration and purity of the extracted DNA. Gel electrophoresis and DNA amplification technologies were used for to determine DNA size and quality. The DNA of 112 cows was obtained from milk (samples of 13 ± 1 mL) and the corresponding optical density ratios at 260:280 nm were between 1.65 and 1.75. Concentrations were between 12 and 45 ?g/?L and DNA size and quality were acceptable. The specific PCR amplification of 1,019- and 729-bp bovine DNA fragments was successfully carried out. This novel method can be used as a practical, fast, and economical mean for long genomic DNA extraction from a small amount of milk. PMID:25218756

Liu, Y F; Gao, J L; Yang, Y F; Ku, T; Zan, L S

2014-11-01

345

Single molecular investigation of DNA looping and aggregation by restriction endonuclease BspMI.  

PubMed

DNA looping and aggregation induced by restriction endonuclease BspMI are studied by atomic force microscopy (AFM) and magnetic tweezers (MT). With Ca(2+) substituted for the normal enzyme cofactor Mg(2+) and enzyme concentration below the critical concentration of 6 units/mL, AFM images of DNA-BspMI complex show that the number of binding and looping events increases with enzyme concentration. At the critical concentration 6 of units/mL, all the BspMI binding sites are saturated. It is worth noting that nonspecific BspMI binding to DNA at saturation concentration represents more than 8% of the total BspMI-DNA complexes directly observed in AFM images. Furthermore, we used MT to prove that additional loops can form when enzyme concentration is higher than its saturation valueand the complex is incubated for a long time (>2 hrs). We ascribe this phenomenon to the aggregation of enzymes. The force spectroscopy of the BspMI-DNA complex shows that the pulling force required to open the loop of the complex at less than saturation concentration has a peak at about 3 pN, which is lower than the force required to open additional loops due to enzyme aggregation at higher than saturation concentration (>6 pN). PMID:25077775

Wang, Yanwei; Ran, Shiyong; Yang, Guangcan

2014-01-01

346

DNA Methylation Pattern in Overweight Women under an Energy-Restricted Diet Supplemented with Fish Oil  

PubMed Central

Dietary factors modulate gene expression and are able to alter epigenetic signatures in peripheral blood mononuclear cells (PBMC). However, there are limited studies about the effects of omega-3 polyunsaturated fatty acids (n-3 PUFA) on the epigenetic mechanisms that regulate gene expression. This research investigates the effects of n-3-rich fish oil supplementation on DNA methylation profile of several genes whose expression has been reported to be downregulated by n-3 PUFA in PBMC: CD36, FFAR3, CD14, PDK4, and FADS1. Young overweight women were supplemented with fish oil or control in a randomized 8-week intervention trial following a balanced diet with 30% energy restriction. Fatty acid receptor CD36 decreased DNA methylation at CpG +477 due to energy restriction. Hypocaloric diet-induced weight loss also reduced the methylation percentages of CpG sites located in CD14, PDK4, and FADS1. The methylation patterns of these genes were only slightly affected by the fish oil supplementation, being the most relevant to the attenuation of the weight loss-induced decrease in CD36 methylation after adjusting by baseline body weight. These results suggest that the n-3 PUFA-induced changes in the expression of these genes in PBMC are not mediated by DNA methylation, although other epigenetic mechanisms cannot be discarded. PMID:24579084

do Amaral, Cátia Lira; Milagro, Fermín I.; Curi, Rui; Martínez, J. Alfredo

2014-01-01

347

Chloroplast DNA inheritance in the Stellaria longipes complex (Caryophyllaceae)  

Microsoft Academic Search

Inheritance of chloroplast DNA (cpDNA) was examined in F1 progenies derived from three crosses and three corresponding reciprocal crosses betweenStellaria porsildii andS. longifolia. Chloroplast DNA restriction fragments were analyzed using methods of nonradioactive digoxigenin-11-dUTP labeling and chemiluminescent detection with Lumi-Phos 530. Distinct interspecific restriction fragment polymorphisms were identified and used to demonstrate the mode of cpDNA inheritance. Mode of cpDNA

D. K. X. Chong; C. C. Chinnappa; F. C. Yeh; S. Chuong

1994-01-01

348

A baculovirus alkaline nuclease knockout construct produces fragmented DNA and aberrant capsids  

SciTech Connect

DNA replication of bacmid-derived constructs of the Autographa californica multiple nucleocapsid nucleopolyhedrovirus (AcMNPV) was analyzed by field inversion gel electrophoresis (FIGE) in combination with digestion at a unique Eco81I restriction enzyme site. Three constructs were characterized: a parental bacmid, a bacmid deleted for the alkaline nuclease gene, and a bacmid from which the gp64 gene had been deleted. The latter was employed as a control for comparison with the alkaline nuclease knockout because neither yields infectious virus and their replication is limited to the initially transfected cells. The major difference between DNA replicated by the different constructs was the presence in the alkaline nuclease knockout of high concentrations of relatively small, subgenome length DNA in preparations not treated with Eco81I. Furthermore, upon Eco81I digestion, the alkaline nuclease knockout bacmid also yielded substantially more subgenome size DNA than the other constructs. Electron microscopic examination of cells transfected with the alkaline nuclease knockout indicated that, in addition to a limited number of normal-appearing electron-dense nucleocapsids, numerous aberrant capsid-like structures were observed indicating a defect in nucleocapsid maturation or in a DNA processing step that is necessary for encapsidation. Because of the documented role of the baculovirus alkaline nuclease and its homologs from other viruses in homologous recombination, these data suggest that DNA recombination may play a major role in the production of baculovirus genomes.

Okano, Kazuhiro [Department of Microbiology, Nash Hall Room 220, Oregon State University, Corvallis, OR 97331-3804 (United States); Vanarsdall, Adam L. [Department of Microbiology, Nash Hall Room 220, Oregon State University, Corvallis, OR 97331-3804 (United States); Rohrmann, George F. [Department of Microbiology, Nash Hall Room 220, Oregon State University, Corvallis, OR 97331-3804 (United States)]. E-mail: rohrmanng@orst.edu

2007-03-01

349

Assaying multiple restriction endonucleases functionalities and inhibitions on DNA microarray with multifunctional gold nanoparticle probes.  

PubMed

Herein, a double-stranded (ds) DNA microarray-based resonance light scattering (RLS) assay with multifunctional gold nanoparticle (GNP) probes has been developed for studying restriction endonuclease functionality and inhibition. Because of decreasing significantly melting temperature, the enzyme-cleaved dsDNAs easily unwind to form single-stranded (ss) DNAs. The ssDNAs are hybridized with multiplex complementary ssDNAs functionalized GNP probes followed by silver enhancement and RLS detection. Three restriction endonucleases (EcoRI, BamHI and EcoRV) and three potential inhibitors (doxorubicin hydrochloride (DOX), ethidium bromide (EB) and an EcoRI-derived helical peptide (?4)) were selected to demonstrate capability of the assay. Enzyme activities of restriction endonucleases are detected simultaneously with high specificity down to the limits of 2.0 × 10(-2)U/mL for EcoRI, 1.1 × 10(-2)U/mL for BamHI and 1.6 × 10(-2)U/mL for EcoRV, respectively. More importantly, the inhibitory potencies of three inhibitors are showed quantitatively, indicating that our approach has great promise for high-throughput screening of restriction endonuclease inhibitors. PMID:24035855

Ma, Lan; Zhu, Zhijun; Li, Tao; Wang, Zhenxin

2014-02-15

350

An Improved PCR-Restriction Fragment Length Polymorphism (RFLP) Method for the Identification of cry1-Type Genes  

PubMed Central

The cry1-type genes of Bacillus thuringiensis represent the largest cry gene family, which contains 50 distinct holotypes. It is becoming more and more difficult to identify cry1-type genes using current methods because of the increasing number of cry1-type genes. In the present study, an improved PCR-restriction fragment length polymorphism (PCR-RFLP) method which can distinguish 41 holotypes of cry1-type genes was developed. This improved method was used to identify cry1-type genes in 20 B. thuringiensis strains that are toxic to lepidoptera. The results showed that the improved method can efficiently identify single and clustered cry1-type genes and can be used to evaluate cry1-type genes in novel strain collections of B. thuringiensis. Among the detected cry1-type genes, we identified four novel genes, cry1Ai, cry1Bb, cry1Ja, and cry1La. The bioassay results from the expressed products of the four novel cry genes showed that Cry1Ai2, Cry1Bb2, and Cry1Ja2 were highly toxic against Plutella xylostella, whereas Cry1La2 exhibited no activity. Moreover, Cry1Ai2 had good lethal activity against Ostrinia furnacalis, Hyphantria cunea, Chilo suppressalis, and Bombyx mori larvae and considerable weight loss activity against Helicoverpa armigera. PMID:23995930

Shu, Changlong; Liu, Dongming; Zhou, Zishan; Cai, Jilin; Peng, Qi; Gao, Jiguo; Song, Fuping

2013-01-01

351

IS900 Restriction Fragment Length Polymorphism (RFLP) Analysis of Mycobacterium avium subsp. paratuberculosis Isolates from Goats and Cattle in Norway  

PubMed Central

In Norway, paratuberculosis has been frequently diagnosed in goats, while cattle have been almost free of the infection. This difference in prevalence between goats and cattle has led to speculations about the existence of a Mycobacterium avium subsp. paratuberculosis (M. a. paratuberculosis) isolate that is non-pathogenic for cattle. There is little information available on genotypic variation of M. a. paratuberculosis isolated from animals in Norway. In the present study, genotypic information on 51 isolates from goats and four isolates from cattle in Norway was obtained by use of IS900 restriction fragment length polymorphism (RFLP) analysis. All isolates from cattle and 84% of the isolates from goats had the same RFLP pattern (B-C1). Five RFLP patterns not previously detected were found. No genotypic variation that could explain a difference in host origin was found between the isolates from cattle and the majority of the Norwegian goat isolates. This lack of difference indicates that the most common M. a. paratuberculosis isolates in Norway may infect both cattle and goats. PMID:16108208

Djønne, B; Pavlik, I; Svastova, P; Bartos, M; Holstad, G

2005-01-01

352

Assessment of microbial dynamics in the Pearl River Estuary by 16S rRNA terminal restriction fragment analysis  

NASA Astrophysics Data System (ADS)

We have evaluated the feasibility of using the terminal restriction fragment length polymorphism (T-RFLP) pattern of polymerase chain reaction (PCR) amplified 16S rRNA sequences to track the changes of the free-living bacterial community for the Pearl River Estuary surface waters. The suitability of specific PCR primers, PCR bias induced by thermal cycles, and field-sampling volumes were critically evaluated in laboratory tests. We established a workable protocol and obtained TRF patterns that reflected the changes in the bacterial population. The temporal dynamics over a 24 h period were examined at one anchored station, as well as the spatial distribution pattern of the bacterial community at several stations, covering the transects along the river discharge direction and across the river plume. The TRF pattern revealed 9 dominant bacterial groups. Changes in their relative abundance reflecting the changes in the bacterial community composition were documented. Many culturable species were isolated from each field sample and a portion of the 16S rRNA gene for each species was sequenced. The species was identified based on sequence data comparison. In this region, the dominant species belong to the ?-subdivision of proteobacteria and the Bacillus/Clostridium group of Firmicutes. We also detected the wide spread distribution of Acinetobacter spp.; many of these species are known nosocomial pathogen for humans.

Wu, Madeline; Song, Liansheng; Ren, Jianping; Kan, Jianjun; Qian, Pei-Yuan

2004-10-01

353

Restriction fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the mosquito Aedes aegypti  

SciTech Connect

Susceptibility of the mosquito Aedes aegypti to the malarial parasite Plasmodium gallinaceum was investigated as a quantitative trait using restriction fragment length polymorphisms (RFLP). Two F{sub 2} populations of mosquitoes were independently prepared from pairwise matings between a highly susceptible and a refractory strain of A. aegypti. RFLP were tested for association with oocyst development on the mosquito midgut. Two putative quantitative trait loci (QTL) were identified that significantly affect susceptibility. One QTL, pgs [2,LF98], is located on chromosome 2 and accounted for 65 and 49% of the observed phenotypic variance in the two populations, respectively. A second QTL, pgs[3,MalI], is located on chromosome 3 and accounted for 14 and 10% of the observed phenotypic variance in the two populations, respectively. Both QTL exhibit a partial dominance effect on susceptibility, wherein the dominance effect is derived from the refractory parent. No indication of epistasis between these QTL was detected. Evidence suggests that either a tightly linked cluster of independent genes or a single locus affecting susceptibility to various mosquito-borne parasites and pathogens has evolved near the LF98 locus; in addition to P. gallinaceum susceptibility, this general genome region has previously been implicated in susceptibility to the filaria nematode Brugia malayi and the yellow fever virus. 35 refs., 2 figs., 3 tabs.

Severson, D.W.; Thathy, V.; Mori, A. [Univ. of Wisconsin, Madison, WI (United States)] [and others

1995-04-01

354

Data mining analysis of terminal restriction fragment length polymorphism shows geographical differences in the human gut microbiota  

PubMed Central

Environmental factors are important for shaping the gut microbiota. In this study, terminal-restriction fragment length polymorphism (T-RFLP) analysis was performed, and data mining analysis was applied to investigate the geographical differences in the gut microbiota in Japan. A total of 121 healthy individuals living in four different districts (Shiga, Hyogo, Fukuoka and Chiba prefectures) in Japan were enrolled. Their gut microbiota profiles were evaluated by T-RFLP analysis, and data mining analysis using the Classification and Regression Tree (C&RT) approach was performed. Data mining analysis provided a decision tree that clearly identified the various groups of subjects (nodes). Some nodes characterized the subjects from the four geographically distinct regions. Overall, 21 of the 35 subjects from the Hyogo Prefecture were mainly included in Node 21, 11 of the 16 subjects from the Shiga Prefecture were mainly included in Node 19, 37 of 40 subjects from the Chiba Prefecture were mainly included in Node 6 and 28 of 30 subjects from the Fukuoka Prefecture were included in Node 3. Only eight operational taxonomic units (OTUs) of the total 100 OTUs contributed to the characterization of the gut microbiota of the four geographically distinct districts in Japan. Geographical differences in the human gut microbiota were identified in Japan. Data mining analysis appears to be one of the optimal tools for characterization of the human gut microbiota. PMID:24648986

ANDOH, AKIRA; KOBAYASHI, TOSHIO; KUZUOKA, HIROYUKI; SUZUKI, YASUO; MATSUI, TOSHIYUKI; NAKAMURA, SHIRO; MATSUMOTO, TAKAYUKI; FUJIYAMA, YOSHIHIDE; BAMBA, TADAO

2013-01-01

355

Mechanism of DNA Recognition by the Restriction Enzyme EcoRV  

SciTech Connect

EcoRV, a restriction enzyme in Escherichia coli, destroys invading foreign DNA by cleaving it at the center step of a GATATC sequence. In the EcoRV-cognate DNA crystallographic complex, a sharp kink of 50 degrees has been found at the center base-pair step (TA). Here, we examine the interplay between the intrinsic propensity of the cognate sequence to kink and the induction by the enzyme by performing all-atom molecular dynamics simulations of EcoRV unbound and interacting with three DNA sequences: the cognate sequence, GATATC (TA); the non-cognate sequence, GAATTC (AT); and with the cognate sequence methylated on the first adenine GA(CH(3))TATC (TA-CH(3)). In the unbound EcoRV, the cleft between the two C-terminal subdomains is found to be open. Binding to AT narrows the cleft and forms a partially bound state. However, the intrinsic bending propensity of AT is insufficient to allow tight binding. In contrast, the cognate TA sequence is easier to bend, allowing specific, high-occupancy hydrogen bonds to form in the complex. The absence of cleavage for this methylated sequence is found to arise from the loss of specific hydrogen bonds between the first adenine of the recognition sequence and Asn185. On the basis of the results, we suggest a three-step recognition mechanism. In the first step, EcoRV, in an open conformation, binds to the DNA at a random sequence and slides along it. In the second step, when the two outer base pairs, GAxxTC, are recognized, the R loops of the protein become more ordered, forming strong hydrogen-bonding interactions, resulting in a partially bound EcoRV-DNA complex. In the third step, the flexibility of the center base pair is probed, and in the case of the full cognate sequence the DNA bends, the complex strengthens and the protein and DNA interact more closely, allowing cleavage.

Zahran, Mai [ORNL; Daidone, Isabella [University of Heidelberg; Smith, Jeremy C [ORNL; Imhof, Petra [University of Heidelberg

2010-08-01

356

Dynamics of enzymatic interactions during short flap human Okazaki fragment processing by two forms of human DNA polymerase ?.  

PubMed

Lagging strand DNA replication requires the concerted actions of DNA polymerase ?, Fen1 and DNA ligase I for the removal of the RNA/DNA primers before ligation of Okazaki fragments. To better understand this process in human cells, we have reconstituted Okazaki fragment processing by the short flap pathway in vitro with purified human proteins and oligonucleotide substrates. We systematically characterized the key events in Okazaki fragment processing: the strand displacement, Pol ?/Fen1 combined reactions for removal of the RNA/DNA primer, and the complete reaction with DNA ligase I. Two forms of human DNA polymerase ? were studied: Pol ?4 and Pol ?3, which represent the heterotetramer and the heterotrimer lacking the p12 subunit, respectively. Pol ?3 exhibits very limited strand displacement activity in contrast to Pol ?4, and stalls on encounter with a 5'-blocking oligonucleotide. Pol ?4 and Pol ?3 exhibit different characteristics in the Pol ?/Fen1 reactions. While Pol ?3 produces predominantly 1 and 2 nt cleavage products irrespective of Fen1 concentrations, Pol ?4 produces cleavage fragments of 1-10 nts at low Fen1 concentrations. Pol ?3 and Pol ?4 exhibit comparable formation of ligated products in the complete system. While both are capable of Okazaki fragment processing in vitro, Pol ?3 exhibits ideal characteristics for a role in Okazaki fragment processing. Pol ?3 readily idles and in combination with Fen1 produces primarily 1 nt cleavage products, so that nick translation predominates in the removal of the blocking strand, avoiding the production of longer flaps that require additional processing. These studies represent the first analysis of the two forms of human Pol ? in Okazaki fragment processing. The findings provide evidence for the novel concept that Pol ?3 has a role in lagging strand synthesis, and that both forms of Pol ? may participate in DNA replication in higher eukaryotic cells. PMID:24035200

Lin, Szu Hua Sharon; Wang, Xiaoxiao; Zhang, Sufang; Zhang, Zhongtao; Lee, Ernest Y C; Lee, Marietta Y W T

2013-11-01

357

Association of Self-DNA Mediated TLR9-Related Gene, DNA Methyltransferase, and Cytokeratin Protein Expression Alterations in HT29-Cells to DNA Fragment Length and Methylation Status  

PubMed Central

To understand the biologic role of self-DNA bound to Toll-like Receptor 9 (TLR9), we assayed its effect on gene and methyltransferase expressions and cell differentiation in HT29 cells. HT29 cells were incubated separately with type-1 (normally methylated/nonfragmented), type-2 (normally methylated/fragmented), type-3 (hypermethylated/nonfragmented), or type-4 (hypermethylated/fragmented) self-DNAs. Expression levels of TLR9-signaling and proinflammatory cytokine-related genes were assayed by qRT-PCR. Methyltransferase activity and cell differentiation were examined by using DNA methyltransferase (DNMT1, -3A, -3B) and cytokeratin (CK) antibodies. Treatment with type-1 DNA resulted in significant increase in TLR9 expression. Type-2 treatment resulted in the overexpression of TLR9-related signaling molecules (MYD88A, TRAF6) and the IL8 gene. In the case of type-3 treatment, significant overexpression of NFkB, IRAK2, and IL8 as well as downregulation of TRAF6 was detected. Using type-4 DNA, TRAF6 and MYD88A gene expression was upregulated, while MYD88B, IRAK2, IL8, and TNFSF10 were all underexpressed. CK expression was significantly higher only after type-1 DNA treatment. DNMT3A expression could also be induced by type-1 DNA treatment. DNA structure may play a significant role in activation of the TLR9-dependent and even independent proinflammatory pathways. There may be a molecular link between TLR9 signaling and DNMT3A. The mode of self-DNA treatment may influence HT29 cell differentiation. PMID:24459426

F?ri, István; Sipos, Ferenc; Spisák, Sándor; Kiszner, Gerg?; Wichmann, Barnabás; Schöller, Andrea; Tulassay, Zsolt; M?zes, Györgyi; Molnár, Béla

2013-01-01

358

Influence of bovine sperm DNA fragmentation and oxidative stress on early embryo in vitro development outcome.  

PubMed

Sperm chromatin fragmentation may be caused by a number of factors, the most significant of which is reactive oxygen species. However, little is known about the effect of sperm oxidative stress (OS) on DNA integrity, fertilization, and embryonic development in cattle. Therefore, the goal of this study was to evaluate the influence of sperm OS susceptibility on the DNA fragmentation rate and in vitro embryo production (IVP) in a population of bulls. Groups of cryopreserved sperm samples were divided into four groups, based on their susceptibility to OS (G1, low OS; G2, average OS; G3, high OS; and G4, highest OS). Our results demonstrated that the sperm DNA integrity was compromised in response to increased OS susceptibility. Furthermore, semen samples with lower susceptibility to OS were also less susceptible to DNA damage (G1, 4.06%; G2, 6.09%; G3, 6.19%; and G4, 6.20%). In addition, embryo IVP provided evidence that the embryo cleavage rate decreased as the OS increased (G1, 70.18%; G2, 62.24%; G3, 55.85%; and G4, 50.93%), but no significant difference in the blastocyst rate or the number of blastomeres was observed among the groups. The groups with greater sensitivity to OS were also associated with a greater percentage of apoptotic cells (G1, 2.6%; G2, 2.76%; G3, 5.59%; and G4, 4.49%). In conclusion, we demonstrated that an increased susceptibility to OS compromises sperm DNA integrity and consequently reduces embryo quality. PMID:23940385

Simões, Renata; Feitosa, Weber Beringui; Siqueira, Adriano Felipe Perez; Nichi, Marcilio; Paula-Lopes, Fabíola Freitas; Marques, Mariana Groke; Peres, Maria Angélica; Barnabe, Valquíria Hyppolito; Visintin, José Antônio; Assumpção, Mayra Elena Ortiz

2013-01-01

359

Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments  

SciTech Connect

The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA approx. TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA.

Sage, E.; Moustacchi, E.

1987-06-16

360

PCR and restriction fragment length polymorphism of a pel gene as a tool to identify Erwinia carotovora in relation to potato diseases.  

PubMed Central

Using a sequenced pectate lyase-encoding gene (pel gene), we developed a PCR test for Erwinia carotovora. A set of primers allowed the amplification of a 434-bp fragment in E. carotovora strains. Among the 89 E. carotovora strains tested, only the Erwinia carotovora subsp. betavasculorum strains were not detected. A restriction fragment length polymorphism (RFLP) study was undertaken on the amplified fragment with seven endonucleases. The Sau3AI digestion pattern specifically identified the Erwinia carotovora subsp. atroseptica strains, and the whole set of data identified the Erwinia carotovora subsp. wasabiae strains. However, Erwinia carotovora subsp. carotovora and Erwinia carotovora subsp. odorifera could not be separated. Phenetic and phylogenic analyses of RFLP results showed E. carotovora subsp. atroseptica as a homogeneous group while E. carotovora subsp. carotovora and E. carotovora subsp. odorifera strains exhibited a genetic diversity that may result from a nonmonophyletic origin. The use of RFLP on amplified fragments in epidemiology and for diagnosis is discussed. Images PMID:7912502

Darrasse, A; Priou, S; Kotoujansky, A; Bertheau, Y

1994-01-01

361

Comparative assessment of next-generation sequencing, denaturing gradient gel electrophoresis, clonal restriction fragment length polymorphism and cloning-sequencing as methods for characterizing commercial microbial consortia.  

PubMed

Characterization of commercial microbial consortia products for human and environmental health risk assessment is a major challenge for regulatory agencies. As a means to develop an approach to assess the potential environmental risk of these products, research was conducted to compare four genomics methods for characterizing bacterial communities; (i) Denaturing Gradient Gel Electrophoresis (DGGE), (ii) Clonal-Restriction Fragment Length Polymorphism (C/RFLP), (iii) partial 16S rDNA amplification, cloning followed by Sanger sequencing (PRACS) and (iv) Next-Generation Sequencing (NGS) based on Ion Torrent technology. A commercially available microbial consortium, marketed as a remediation agent for degrading petroleum hydrocarbon contamination in soil and water, was assessed. The bacterial composition of the commercial microbial product was characterized using the above four methods. PCR amplification of 16S rDNA was performed targeting the variable region V6 for DGGE, C/RFLP and PRACS and V5 for Ion Torrent sequencing. Ion Torrent technology was shown to be a promising tool for initial screening by detecting the majority of bacteria in the consortium that were also detected by DGGE, C/RFLP and PRACS. Additionally, Ion Torrent sequencing detected some of the bacteria that were claimed to be in the product, while three other methods failed to detect these specific bacteria. However, the relative proportions of the microbial composition detected by Ion Torrent were found to be different from DGGE, C/RFLP and PRACS, which gave comparable results across these three methods. The discrepancy of the Ion Torrent results may be due to the short read length generated by this technique and the targeting of different variable regions on the 16S rRNA gene used in this study. Arcobacter spp. a potential pathogenic bacteria was detected in the product by all methods, which was further confirmed using genus and species-specific PCR, RFLP and DNA-based sequence analyses. However, the viability of Arcobacter spp. was not confirmed. This study suggests that a combination of two or more methods may be required to ascertain the microbial constituents of a commercial microbial consortium reliably and for the presence of potentially human pathogenic contaminants. PMID:25479430

Samarajeewa, A D; Hammad, A; Masson, L; Khan, I U H; Scroggins, R; Beaudette, L A

2015-01-01

362

Crystal structure of the ???-Me type II restriction endonuclease Hpy99I with target DNA  

PubMed Central

The ???-Me restriction endonuclease (REase) Hpy99I recognizes the CGWCG target sequence and cleaves it with unusual stagger (five nucleotide 5?-recessed ends). Here we present the crystal structure of the specific complex of the dimeric enzyme with DNA. The Hpy99I protomer consists of an antiparallel ?-barrel and two ?4?2 repeats. Each repeat coordinates a structural zinc ion with four cysteine thiolates in two CXXC motifs. The ???-Me region of the second ?4?2 repeat holds the catalytic metal ion (or its sodium surrogate) via Asp148 and Asn165 and activates a water molecule with the general base His149. In the specific complex, Hpy99I forms a ring-like structure around the DNA that contacts DNA bases on the major and minor groove sides via the first and second ?4?2 repeats, respectively. Hpy99I interacts with the central base pair of the recognition sequence only on the minor groove side, where A:T resembles T:A and G:C is similar to C:G. The Hpy99I–DNA co-crystal structure provides the first detailed illustration of the ???-Me site in REases and complements structural information on the use of this active site motif in other groups of endonucleases such as homing endonucleases (e.g. I-PpoI) and Holliday junction resolvases (e.g. T4 endonuclease VII). PMID:19380375

Sokolowska, Monika; Czapinska, Honorata; Bochtler, Matthias

2009-01-01

363

Classifying seedlots of Picea sitchensis and P. glauca in zones of introgression using restriction analysis of chloroplast DNA  

Microsoft Academic Search

Chloroplast DNA (cpDNA) restriction analysis was used to classify five reforestation seedlots as to species. The material included two Sitka spruce (Picea sitchensis (Bong.) Carr.), one white spruce (P. glauca (Moench) Voss) from interior British Columbia, and two putative hybrid seedlots from the coast-interior introgression zone in British Columbia. The cpDNA patterns generated by Bam-HI and Bc1-I from individual trees

A. Sigurgeirsson; Y. A. El-Kassaby; T. Aldèn; D. Lindgren; J.-E. Hällgren

1988-01-01

364

Chromosomal location of PCR fragments as a source of DNA markers linked to aluminium tolerance genes in rye  

Microsoft Academic Search

To identify and locate rye DNA sequences homologous to three wheat c-DNAs (wali1, wali2 and wali5) whose expression is induced by aluminium (Al) stress, we designed three pairs of specific primers. They were used in the\\u000a amplification of genomic DNA from wheat-rye disomic addition lines. The wali2 pair of primers amplified a 878-bp rye DNA fragment (rali2) located on chromosomes

F. J. Gallego; E. López-Solanilla; A. M. Figueiras; C. Benito

1998-01-01

365

Manning free counterions fraction for a rod-like polyion - short DNA fragments in very low salt  

E-print Network

We quantified the Manning free (uncondensed) counterions fraction $\\theta$ for dilute solutions of rod-like polyions - 150bp DNA fragments, in very low salt $salt environment, with the decrease in DNA concentration itself. The extremes of the experimental $\\theta(c)$ range occur towards the highest, above 1 mM and the lowest, below 0.05 mM, DNA concentrations, and correspond to the theoretical $\\theta$ values for dsDNA and ssDNA, respectively. Therefore, we confirmed Manning condensation and conductivity models to be valuable in description of dilute solutions of rod-like polyions.

Tomislav Vuletic; Sanja Dolanski Babic; Danijel Grgicin; Damir Aumiler; Joachim Raedler; Francoise Livolant; Silvia Tomic

2010-10-04

366

Variation of Clonal, Mesquite-Associated Rhizobial and Bradyrhizobial Populations from Surface and Deep Soils by Symbiotic Gene Region Restriction Fragment Length Polymorphism and Plasmid Profile Analysis  

PubMed Central

Genetic characteristics of 14 Rhizobium and 9 Bradyrhizobium mesquite (Prosopis glandulosa)-nodulating strains isolated from surface (0- to 0.5-m) and deep (4- to 6-m) rooting zones were determined in order to examine the hypothesis that surface- and deep-soil symbiont populations were related but had become genetically distinct during adaptation to contrasting soil conditions. To examine genetic diversity, Southern blots of PstI-digested genomic DNA were sequentially hybridized with the nodDABC region of Rhizobium meliloti, the Klebsiella pneumoniae nifHDK region encoding nitrogenase structural genes, and the chromosome-localized ndvB region of R. meliloti. Plasmid profile and host plant nodulation assays were also made. Isolates from mesquite nodulated beans and cowpeas but not alfalfa, clover, or soybeans. Mesquite was nodulated by diverse species of symbionts (R. meliloti, Rhizobium leguminosarum bv. phaseoli, and Parasponia bradyrhizobia). There were no differences within the groups of mesquite-associated rhizobia or bradyrhizobia in cross-inoculation response. The ndvB hybridization results showed the greatest genetic diversity among rhizobial strains. The pattern of ndvB-hybridizing fragments suggested that surface and deep strains were clonally related, but groups of related strains from each soil depth could be distinguished. Less variation was found with nifHDK and nodDABC probes. Large plasmids (>1,500 kb) were observed in all rhizobia and some bradyrhizobia. Profiles of plasmids of less than 1,000 kb were related to the soil depth and the genus of the symbiont. We suggest that interacting selection pressures for symbiotic competence and free-living survival, coupled with soil conditions that restrict genetic exchange between surface and deep-soil populations, led to the observed patterns of genetic diversity. Images PMID:16349226

Thomas, P. M.; Golly, K. F.; Zyskind, J. W.; Virginia, R. A.

1994-01-01

367

Variation of clonal, mesquite-associated rhizobial and bradyrhizobial populations from surface and deep soils by symbiotic gene region restriction fragment length polymorphism and plasmid profile analysis.  

PubMed

Genetic characteristics of 14 Rhizobium and 9 Bradyrhizobium mesquite (Prosopis glandulosa)-nodulating strains isolated from surface (0- to 0.5-m) and deep (4- to 6-m) rooting zones were determined in order to examine the hypothesis that surface- and deep-soil symbiont populations were related but had become genetically distinct during adaptation to contrasting soil conditions. To examine genetic diversity, Southern blots of PstI-digested genomic DNA were sequentially hybridized with the nodDABC region of Rhizobium meliloti, the Klebsiella pneumoniae nifHDK region encoding nitrogenase structural genes, and the chromosome-localized ndvB region of R. meliloti. Plasmid profile and host plant nodulation assays were also made. Isolates from mesquite nodulated beans and cowpeas but not alfalfa, clover, or soybeans. Mesquite was nodulated by diverse species of symbionts (R. meliloti, Rhizobium leguminosarum bv. phaseoli, and Parasponia bradyrhizobia). There were no differences within the groups of mesquite-associated rhizobia or bradyrhizobia in cross-inoculation response. The ndvB hybridization results showed the greatest genetic diversity among rhizobial strains. The pattern of ndvB-hybridizing fragments suggested that surface and deep strains were clonally related, but groups of related strains from each soil depth could be distinguished. Less variation was found with nifHDK and nodDABC probes. Large plasmids (>1,500 kb) were observed in all rhizobia and some bradyrhizobia. Profiles of plasmids of less than 1,000 kb were related to the soil depth and the genus of the symbiont. We suggest that interacting selection pressures for symbiotic competence and free-living survival, coupled with soil conditions that restrict genetic exchange between surface and deep-soil populations, led to the observed patterns of genetic diversity. PMID:16349226

Thomas, P M; Golly, K F; Zyskind, J W; Virginia, R A

1994-04-01

368

The mechanism underlying acetaminophen-induced hepatotoxicity in humans and mice involves mitochondrial damage and nuclear DNA fragmentation  

PubMed Central

Acetaminophen (APAP) overdose is the predominant cause of acute liver failure in the United States. Toxicity begins with a reactive metabolite that binds to proteins. In rodents, this leads to mitochondrial dysfunction and nuclear DNA fragmentation, resulting in necrotic cell death. While APAP metabolism is similar in humans, the later events resulting in toxicity have not been investigated in patients. In this study, levels of biomarkers of mitochondrial damage (glutamate dehydrogenase [GDH] and mitochondrial DNA [mtDNA]) and nuclear DNA fragments were measured in plasma from APAP-overdose patients. Overdose patients with no or minimal hepatic injury who had normal liver function tests (LTs) (referred to herein as the normal LT group) and healthy volunteers served as controls. Peak GDH activity and mtDNA concentration were increased in plasma from patients with abnormal LT. Peak nuclear DNA fragmentation in the abnormal LT cohort was also increased over that of controls. Parallel studies in mice revealed that these plasma biomarkers correlated well with tissue injury. Caspase-3 activity and cleaved caspase-3 were not detectable in plasma from overdose patients or mice, but were elevated after TNF-induced apoptosis, indicating that APAP overdose does not cause apoptosis. Thus, our results suggest that mitochondrial damage and nuclear DNA fragmentation are likely to be critical events in APAP hepatotoxicity in humans, resulting in necrotic cell death. PMID:22378043

McGill, Mitchell R.; Sharpe, Matthew R.; Williams, C. David; Taha, Mohammad; Curry, Steven C.; Jaeschke, Hartmut

2012-01-01

369

Validation of a field based chromatin dispersion assay to assess sperm DNA fragmentation in the bottlenose dolphin (Tursiops truncatus).  

PubMed

Over the last two decades, there have been significant advances in the use of assisted reproductive technology for genetic and reproductive management of captive dolphin populations, including evaluation of sperm DNA quality. This study validated a customized sperm chromatin dispersion test (SCDt) for the bottlenose dolphin (Tursiops truncatus) as a means of assessing sperm DNA damage both in the field and in the laboratory. After performing the SCDt, two different sperm morphotypes were identified: (i) sperm with fragmented DNA showed large haloes of dispersed DNA fragments emerging from a compact sperm nucleoid core and (ii) sperm containing non-fragmented DNA displayed small compact haloes surrounded by a dense core of non-dispersed DNA and protein complex. Estimates of sperm DNA fragmentation by means of SCDt were directly comparable to results obtained following a two-tailed comet assay and showed a significant degree of correlation (r = 0.961; p < 0.001). This investigation also revealed that the SCDt, with minor modifications to the standard protocol, can be successfully conducted in the field using a LED florescence microscopy obtaining a high correlation (r = 0.993; p = 0.01) between the data obtained in the laboratory and in the field. PMID:25130370

Sánchez-Calabuig, M-J; López-Fernández, C; Martínez-Nevado, E; Pérez-Gutiérrez, J F; de la Fuente, J; Johnston, S D; Blyde, D; Harrison, K; Gosálvez, J

2014-10-01

370

The structural basis of differential DNA sequence recognition by restriction–modification controller proteins  

PubMed Central

Controller (C) proteins regulate the expression of restriction–modification (RM) genes in a wide variety of RM systems. However, the RM system Esp1396I is of particular interest as the C protein regulates both the restriction endonuclease (R) gene and the methyltransferase (M) gene. The mechanism of this finely tuned genetic switch depends on differential binding affinities for the promoters controlling the R and M genes, which in turn depends on differential DNA sequence recognition and the ability to recognize dual symmetries. We report here the crystal structure of the C protein bound to the M promoter, and compare the binding affinities for each operator sequence by surface plasmon resonance. Comparison of the structure of the transcriptional repression complex at the M promoter with that of the transcriptional activation complex at the R promoter shows how subtle changes in protein–DNA interactions, underpinned by small conformational changes in the protein, can explain the molecular basis of differential regulation of gene expression. PMID:22941636

Ball, N. J.; McGeehan, J. E.; Streeter, S. D.; Thresh, S.-J.; Kneale, G. G.

2012-01-01

371

ERp57/PDIA3 binds specific DNA fragments in a melanoma cell line.  

PubMed

ERp57/PDIA3 is a ubiquitously expressed disulfide isomerase protein, which acts in concert with calreticulin and calnexin in the folding of glycoproteins destined to the plasma membrane or to be secreted. Its canonical compartment is the endoplasmic reticulum, where it acts as a chaperone and redox catalyst, but non canonical locations have been described as well, and ERp57 has been found associated with DNA and nuclear proteins. In previous work performed in HeLa cells, ERp57 has been demonstrated to bind specific DNA sequences involved in the stress response. The direct interaction with the DNA sequences identified as ERp57-targeted regions in HeLa cells has now been confirmed in a melanoma cell line. Furthermore, the ERp57 silencing, achieved by RNA interference, has produced a significant down-regulation of the expression of target genes. The possible involvement of other proteins in complex with ERp57 has been studied by an in vitro biotin-streptavidin based binding assay and the interacting protein APE/Ref-1 has been also assessed for its direct association with the ERp57 target regions. In conclusion, nuclear ERp57 interacts in vivo with DNA fragments in melanoma cells and is potentially involved in the transcriptional regulation of its target genes. PMID:23587917

Aureli, Cristina; Gaucci, Elisa; Arcangeli, Valentina; Grillo, Caterina; Eufemi, Margherita; Chichiarelli, Silvia

2013-07-25

372

Rumen bacterial community evaluated by 454 pyrosequencing and terminal restriction fragment length polymorphism analyses in dairy sheep fed marine algae.  

PubMed

Developing novel strategies to increase the content of bioactive unsaturated fatty acids (FA) in ruminant-derived products requires a deeper understanding of rumen biohydrogenation and bacteria involved in this process. Although high-throughput pyrosequencing may allow for a great coverage of bacterial diversity, it has hardly been used to investigate the microbiology of ruminal FA metabolism. In this experiment, 454 pyrosequencing and a molecular fingerprinting technique (terminal restriction fragment length polymorphism; T-RFLP) were used concurrently to assess the effect of diet supplementation with marine algae (MA) on the rumen bacterial community of dairy sheep. Eleven lactating ewes were divided in 2 lots and offered a total mixed ration based on alfalfa hay and concentrate (40:60), supplemented with 0 (control) or 8 (MA) g of MA/kg of dry matter. After 54 d on treatments, animals were slaughtered and samples of rumen content and fluid were collected separately for microbial analysis. Pyrosequencing yielded a greater coverage of bacterial diversity than T-RFLP and allowed the identification of low abundant populations. Conversely, both molecular approaches pointed to similar conclusions and showed that relevant changes due to MA addition were observed within the major ruminal phyla, namely Bacteroidetes, Firmicutes, and Proteobacteria. Decreases in the abundance of unclassified Bacteroidales, Porphyromonadaceae, and Ruminococcaceae and increases in as-yet uncultured species of the family Succinivibrionaceae, might be related to a potential role of these groups in different pathways of rumen FA metabolism. Diet supplementation with MA, however, had no effect on the relative abundance of Butyrivibrio and Pseudobutyrivibrio genera. In addition, results from both 454 pyrosequencing and T-RFLP indicate that the effect of MA was rather consistent in rumen content or fluid samples, despite inherent differences between these fractions in their bacterial composition. PMID:24440247

Castro-Carrera, T; Toral, P G; Frutos, P; McEwan, N R; Hervás, G; Abecia, L; Pinloche, E; Girdwood, S E; Belenguer, A

2014-03-01

373

Paternal inheritance of chloroplast DNA and maternal inheritance of mitochondrial DNA in the genus Actinidia  

Microsoft Academic Search

PCR amplification of four chloroplast DNA (cpDNA) and two mitochondrial DNA (mtDNA) regions followed by restriction of the\\u000a amplified products was used to identify restriction fragment length polymorphisms in 21 Actinidia taxa. Subsequently, the mode of organelle inheritance was investigated in both interspecific and intraspecific controlled\\u000a crosses made between genotypes showing different cpDNA and\\/or mtDNA haplotypes. Fifty-six seedlings produced from

R. Testolin; G. Cipriani

1997-01-01

374

Prevalence of high DNA fragmentation index in male partners of unexplained infertile couples.  

PubMed

The sperm chromatin structure assay (SCSA) parameter DNA fragmentation Index (DFI) is a valuable tool for prediction of fertility in vivo. Clinical data show that a DFI above 30% is associated with very low chance for achieving pregnancy by natural conception or by insemination. Already when DFI is above 20% the chance of natural pregnancy is reduced, this despite normal conventional semen parameters. The aim of the present study was to investigate the prevalence of high DFI in male partners of unexplained infertile couples to further identification of male factors contributing to subfertility. Among 212 consecutive men under infertility investigation, 122 cases with the diagnosis 'unexplained infertility' were identified. For all but three, SCSA data were available. The percentage of couples with diagnosis 'unexplained infertility' in which the male partner has DFI >20% or DFI >30% was calculated. In the group diagnosed with 'unexplained infertility' 17.7% of the men (95% CI 10.8-24.5) presented with 20 ?DFI <30 and 8.4% (95% CI 3.40-13.4) had DFI ?30%. A significant part of men diagnosed as unexplained infertile according to traditional diagnostic methods has remarkably high degrees of fragmented sperm DNA. Apart from adding to our understanding of biology of infertility our finding has clinical implications. Couples in which the DFI of the male partner is high can avoid prolonged attempts to become spontaneously pregnant or referral for intrauterine insemination, both having low chances of leading to conception. PMID:23596042

Oleszczuk, K; Augustinsson, L; Bayat, N; Giwercman, A; Bungum, M

2013-05-01

375

Monte Carlo predictions of DNA fragment-size distributions for large sizes after HZE particle irradiation  

NASA Technical Reports Server (NTRS)

DSBs (double-strand breaks) produced by densely ionizing space radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. DSB clustering at large scales, from >100 Mbp down to approximately 2 kbp, is modeled using a Monte-Carlo algorithm. A random-walk model of chromatin is combined with a track model, that predicts the radial distribution of energy from an ion, and the RLC (randomly-located-clusters) formalism, in software called DNAbreak. This model generalizes the random-breakage model, whose broken-stick fragment-size distribution is applicable to low-LET radiation. DSB induction due to track interaction with the DNA volume depends on the radiation quality parameter Q. This dose-independent parameter depends only weakly on LET. Multi-track, high-dose effects depend on the cluster intensity parameter lambda, proportional to fluence as defined by the RLC formalism. After lambda is determined by a numerical experiment, the model reduces to one adjustable parameter Q. The best numerical fits to the experimental data, determining Q, are obtained. The knowledge of lambda and Q allows us to give biophysically based extrapolations of high-dose DNA fragment-size data to low doses or to high LETs.

Ponomarev, A. L.; Cucinotta, F. A.; Sachs, R. K.; Brenner, D. J.

2001-01-01

376

Bayesian Network Classi cation of Binarized DNA Fingerprinting Patterns  

E-print Network

, the closer the cleavage pattern. The DNA #12;ngerprinting technique known as AFLP (=Ampli#12;ed Frag- ment Length Polymorphism) [1] is based on the selective ampli#12;cation of genomic restriction fragments of restriction halfsite-speci#12;c adaptors to al restriction fragments. (b) Selective ampli#12;cation

Koski, Timo

377

Does quantum entanglement in DNA synchronize the catalytic centers of type II restriction endonucleases?  

E-print Network

Several living systems have been examined for their apparent optimization of structure and function for quantum behavior at biological length scales. Orthodox type II endonucleases, the largest class of restriction enzymes, recognize four-to-eight base pair sequences of palindromic DNA, cut both strands symmetrically, and act without an external metabolite such as ATP. While it is known that these enzymes induce strand breaks by attacking phosphodiester bonds, what remains unclear is the mechanism by which cutting occurs in concert at the catalytic centers. Previous studies indicate the primacy of intimate DNA contacts made by the specifically bound enzyme in coordinating the two synchronized cuts. We propose that collective electronic behavior in the DNA helix generates coherent oscillations, quantized through boundary conditions imposed by the endonuclease, that provide the energy required to break two phosphodiester bonds. Such quanta may be preserved in the presence of thermal noise and electromagnetic interference through decoherence shielding, the specific complex's exclusion of water and ions surrounding the helix. Clamping energy imparted by the enzyme decoherence shield is comparable with zero-point modes of the dipole-dipole oscillations in the DNA recognition sequence. The palindromic mirror symmetry of this sequence should conserve parity during the process. Experimental data corroborate that symmetric bond-breaking ceases when the symmetry of the endonuclease complex is violated, or when environmental parameters are perturbed far from biological optima. Persistent correlation between states in DNA sequence across spatial separations of any length--a characteristic signature of quantum entanglement--may be explained by such a physical mechanism.

P. Kurian; G. Dunston; J. Lindesay

2014-03-21

378

Transfer of recombinant plasmids containing the gene for DpnII DNA methylase into strains of Streptococcus pneumoniae that produce DpnI or DpnII restriction endonucleases  

SciTech Connect

Plasmid transfer via the transformation pathway of Streptococcus pneumoniae was weakly restricted by the DpnI or DpnII restriction endonuclease, either of which gave a reduction only to 0.4, compared with phage infection, which was restricted to 10/sup -5/. The greater sensitivity of plasmid transfer compared with chromosomal transformation, which was not at all restricted, can be attributed to partially double-stranded intermediates formed from two complementary donor fragments. However, clustering of potential restriction sites in the plasmids increased the probability of escape from restriction. The recombinant plasmid pMP10, in which the gene for the DpnII DNA methylase was cloned, can be transferred to strains that contain neither restriction enzyme or that contain DpnII as readily as can the vector pMP5. Introduction of pMP10 raised the level of methylase by five times the level normally present in DpnII strains. Transfer of pMP10 to DpnI-containing strains was infrequent, presumably owing to the suicidal methylation of DNA which rendered it susceptible to the host endonuclease. The few clones in which pMP10 was established had lost DpnI. Loss of the plasmid after curing of the cell eliminated the methylase but did not restore DpnI. Although this loss of DpnI could result from spontaneous mutations, its relatively high frequency, 0.1% suggested that the loss was due to a regulatory shift.

Lacks, S.A.; Springhorn, S.S.

1984-06-01

379

A microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.  

PubMed

DNA hybridization detection in microfluidic devices can reduce sample volumes, processing times, and can be integrated with other measurements. However, as device footprints decrease and their complexity increase, the signal-to-noise ratio in these systems also decreases and the sensitivity is thereby compromised. Device miniaturization produces distinct properties and phenomena with greater influence at the micro-scale than at the macro-scale. Here, a diffusion-restriction model was applied to a miniaturized biochip nanovolume reactor to accurately characterize DNA hybridization events that contribute to shifts in both charge transfer resistance and diffusional resistance. These effects are shown to play a significant role in electrochemical impedance spectroscopy (EIS) analyses at these length scales. Our highly functional microfluidic biosensor enables the detection of ssDNA targets selectively, with a calculated detection limit of 3.8 nM, and cross-reactivity of 13% following 20 min incubation with the target. This new biosensing approach can be further modeled and tested elucidating diffusion behavior in miniaturized devices and improving the performance of biosensors. PMID:22651970

Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza

2012-01-01

380

Infant growth restriction is associated with distinct patterns of DNA methylation in human placentas  

PubMed Central

The placenta acts not only as a conduit of nutrient and waste exchange between mother and developing fetus, but also functions as a regulator of the intrauterine environment. Recent work has identified changes in the expression of candidate genes, often through epigenetic alteration, which alter the placenta's function and impact fetal growth. In this study, we used the Illumina Infinium HumanMethylation27 BeadChip array to examine genome-wide DNA methylation patterns in 206 term human placentas. Semi-supervised recursively partitioned mixture modeling was implemented to identify specific patterns of placental DNA methylation that could differentially classify intrauterine growth restriction (IUGR) and small for gestational age (SGA) placentas from appropriate for gestational age (AGA) placentas, and these associations were validated in a masked testing series of samples. Our work demonstrates that patterns of DNA methylation in human placenta are reliably and significantly associated with infant growth and serve as a proof of principle that methylation status in the human term placenta can function as a marker for the intrauterine environment, and could potentially play a critical functional role in fetal development. PMID:21758004

Banister, Carolyn E; Koestler, Devin C; Maccani, Matthew A; Padbury, James F; Houseman, E Andres

2011-01-01

381

Regulated restriction endonuclease expression: A novel, radiomimetic model of DNA double strand break induction  

SciTech Connect

Exposure of mammalian cells to ionizing radiations (IR) produces a plethora of damages in DNA and non-DNA targets. Although DNA double strand breaks (DSB) are thought to be the critical lesion generated by IR with respect to conventional cytotoxicity, it is clear that signaling events regulating cellular responses to IR arise from multiple other lesions in addition to these. The authors are interested in identifying cellular signaling events that derive from DSB specifically, as well as the distal effects (e.g., repair, apoptosis, cell cycle delay) of such signaling. Although electroporation of restriction enzymes might afford an approach to such studies, serious concerns would be raised by the non-uniformity of enzyme transfer and general disruption of the intracellular environment (with the possibility of associated signaling processes) when using this method. The authors have established a radiomimetic model for DSB induction, based upon expression of a hybrid steroid hormone receptor: this system is subject to tight, rapid postranslational regulation of endonuclease activity via addition or withdrawl of the cognate hormone ligand. In preliminary experiments, The authors have demonstrated ligand dose and exposure time-dependent cytotoxicity and DSB induction (the latter assayed by PFGE). Cytogenetic characterization of this system, as well as studies of the interaction between enzyme- and IR-generated DSB are in progress. RNA differential display and subtractive enrichment cloning approaches will ultimately be used to identify genes whose expression changes as a consequence of isolated DSB induction.

Radany, E.H.; Pu, A.T. [Univ. of Michigan School of Medicine, Ann Arbor, MI (United States)

1997-10-01

382

Molecular Fingerprinting of Mycobacterium tuberculosis Isolates Obtained in Havana, Cuba, by IS6110 Restriction Fragment Length Polymorphism Analysis and by the Double Repetitive-Element PCR Method  

Microsoft Academic Search

Mycobacterium tuberculosis sputum isolates from 38 patients, obtained in the first 6 months of 1997 in Havana, Cuba, were characterized by IS6110 restriction fragment length polymorphism (RFLP) analysis and the double-repetitive-element PCR (DRE-PCR) method. Among 41 strains from 38 patients, 24 and 25 unique patterns, and 5 and 4 cluster patterns, were found by the RFLP and DRE-PCR methods, respectively.

ERNESTO MONTORO; SYLVIA CARDOSO LEAO; Pedro Kouri ´

383

Molecular identification of larval stages of Otiorhynchus (Coleoptera: Curculionidae) species based on polymerase chain reaction-restriction fragment length polymorphism analysis.  

PubMed

A couple of different members of the coleopteran genus Otiorhynchus (Coleoptera: Curculionidae) are becoming increasingly important as pests of nursery and ornamental plants in global horticulture. Although adult weevils are morphologically distinguishable by skilled personnel, high potential for misidentification is given for cryptic larval stages. For developing and applying efficient pest management strategies the determination of the respective species is however a prerequisite, because each species may have a different phenology or a varying susceptibility to pesticides. Here, we report on the development of a diagnostic polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for differentiation among 16 Otiorhynchus and seven other weevil species independent of their developmental stage. An approximately 780-bp fragment of the mitochondrial cytochrome oxidase subunit II was amplified and subsequently digested with at most four restriction enzymes generating species-specific fragment patterns. The assay was validated on a total of 127 individuals and the obtained fragment patterns correctly identified 23 different weevil species. The PCR-RFLP method reported here is cost-effective, robust, and fast and could be used in the future by plant protection services for diagnostic purposes. PMID:20568637

Hirsch, Jacqueline; Sprick, Peter; Reineke, Annette

2010-06-01

384

DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).  

PubMed

The study of the transmission of leprosy is particularly difficult since the causative agent, Mycobacterium leprae, cannot be cultured in the laboratory. The only sources of the bacteria are leprosy patients, and experimentally infected armadillos and nude mice. Thus, many of the methods used in modern epidemiology are not available for the study of leprosy. Despite an extensive global drug treatment program for leprosy implemented by the WHO, leprosy remains endemic in many countries with approximately 250,000 new cases each year. The entire M. leprae genome has been mapped and many loci have been identified that have repeated segments of 2 or more base pairs (called micro- and minisatellites). Clinical strains of M. leprae may vary in the number of tandem repeated segments (short tandem repeats, STR) at many of these loci. Variable number tandem repeat (VNTR) analysis has been used to distinguish different strains of the leprosy bacilli. Some of the loci appear to be more stable than others, showing less variation in repeat numbers, while others seem to change more rapidly, sometimes in the same patient. While the variability of certain VNTRs has brought up questions regarding their suitability for strain typing, the emerging data suggest that analyzing multiple loci, which are diverse in their stability, can be used as a valuable epidemiological tool. Multiple locus VNTR analysis (MLVA) has been used to study leprosy evolution and transmission in several countries including China, Malawi, the Philippines, and Brazil. MLVA involves multiple steps. First, bacterial DNA is extracted along with host tissue DNA from clinical biopsies or slit skin smears (SSS). The desired loci are then amplified from the extracted DNA via polymerase chain reaction (PCR). Fluorescently-labeled primers for 4-5 different loci are used per reaction, with 18 loci being amplified in a total of four reactions. The PCR products may be subjected to agarose gel electrophoresis to verify the presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types. PMID:21775969

Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

2011-01-01

385

Novel apparatus to measure hyperthermal heavy ion damage to DNA: Strand breaks, base loss, and fragmentation  

SciTech Connect

We have developed a novel apparatus that allows us to irradiate nonvolatile organic films of high mass (1-100 {mu}g range) spread out over a large surface area (42 cm{sup 2}) with low energy (kT-100 eV) heavy ions and to quantitatively analyze the film substance via standard biochemical techniques afterwards. Here we discuss the details of the apparatus and method and show that it allows us to measure substantial damage to double stranded DNA molecules (plasmids) and its fundamental subunits induced by heavy ions with unprecedented low energies, i.e., 2.5 eV/amu; these energies correspond to track end energies of stopping ions or secondary ions created along primary ion tracks. We find that hyperthermal Ar{sup +} ions interacting with plasmid DNA will lead to the formation of single and double strand breaks, as well as fragmentation of nucleosides, which also involve chemical modifications and site specific rupture along the N1-C1 glycosidic bond, resulting in base release. In cells, such localized clustered damage will enhance the severity of DNA strand lesions, thus making them harder to repair.

Sellami, L.; Lacombe, S.; Hunting, D.; Wagner, R. J.; Huels, M. A. [Ion Reaction Laboratory, Department of Nuclear Medicine and Radiobiology, Faculty of Medicine and Health Sciences, University of Sherbrooke, Sherbrooke, Quebec J1H 5N4 (Canada)

2007-08-15

386

Diagnosis of Schistosoma haematobium by Detection of Specific DNA Fragments from Filtered Urine Samples  

PubMed Central

Definitive diagnosis of Schistosoma haematobium infection in adult patients is a clinically important challenge. Chronically infected adults pass few eggs in the urine, which are often missed when current diagnostic methods are used. In the work presented here, we report on an alternative diagnostic method based on presence of the S. haematobium-specific Dra 1, 121 bp repeat fragment in human urine. A novel method of collecting the urine specimens in the field and filtering them through heavy Whatman No. 3 paper was introduced. After drying, the samples remained viable for several months at room temperature. To test the potential use of this method, 89 urine specimens from school children in Kollo District, Niger, were examined. In all, 52 of 89 (58.4%) were positive for hematuria, 4 of 89 (49.4%) were positive for eggs, and 51 of 89 (57.3%) showed parasite-specific DNA. These were compared with 60 filtered urine specimens obtained from random samples of adults from two study sites in Nigeria, one endemic and one non-endemic for S. haematobium. In the 30 patients from the endemic site, all 10 samples with detectable eggs and 7 of the 20 egg-negative samples were DNA positive. It was concluded that the urine filter paper method was sufficiently sensitive to detect low and cryptic infections, that DNA detection was more sensitive than egg detection, and that the filtration method facilitated specimen collection and transport from the field. PMID:21633040

Ibironke, Olufunmilola A.; Phillips, Anna E.; Garba, Amadou; Lamine, Sani M.; Shiff, Clive

2011-01-01

387

Diagnosis of Schistosoma haematobium by detection of specific DNA fragments from filtered urine samples.  

PubMed

Definitive diagnosis of Schistosoma haematobium infection in adult patients is a clinically important challenge. Chronically infected adults pass few eggs in the urine, which are often missed when current diagnostic methods are used. In the work presented here, we report on an alternative diagnostic method based on presence of the S. haematobium-specific Dra 1, 121 bp repeat fragment in human urine. A novel method of collecting the urine specimens in the field and filtering them through heavy Whatman No. 3 paper was introduced. After drying, the samples remained viable for several months at room temperature. To test the potential use of this method, 89 urine specimens from school children in Kollo District, Niger, were examined. In all, 52 of 89 (58.4%) were positive for hematuria, 4 of 89 (49.4%) were positive for eggs, and 51 of 89 (57.3%) showed parasite-specific DNA. These were compared with 60 filtered urine specimens obtained from random samples of adults from two study sites in Nigeria, one endemic and one non-endemic for S. haematobium. In the 30 patients from the endemic site, all 10 samples with detectable eggs and 7 of the 20 egg-negative samples were DNA positive. It was concluded that the urine filter paper method was sufficiently sensitive to detect low and cryptic infections, that DNA detection was more sensitive than egg detection, and that the filtration method facilitated specimen collection and transport from the field. PMID:21633040

Ibironke, Olufunmilola A; Phillips, Anna E; Garba, Amadou; Lamine, Sani M; Shiff, Clive

2011-06-01

388

Cloning of the spoT Gene of “Candidatus Phlomobacter fragariae” and Development of a PCR-Restriction Fragment Length Polymorphism Assay for Detection of the Bacterium in Insects  

PubMed Central

Marginal chlorosis is a new disease of strawberry in which the uncultured phloem-restricted proteobacterium “Candidatus Phlomobacter fragariae” is involved. In order to identify the insect(s) vector(s) of this bacterium, homopteran insects have been captured. Because a PCR test based on the 16S rRNA gene (rDNA) applied to these insects was unable to discriminate between “P. fragariae” and other insect-associated proteobacteria, isolation of “P. fragariae” genes other than 16S rDNA was undertaken. Using comparative randomly amplified polymorphic DNAs, an amplicon was specifically amplified from “P. fragariae”-infected strawberry plants. It encodes part of a “P. fragariae” open reading frame sharing appreciable homology with the spoT gene from other proteobacteria. A spoT-based PCR test combined with restriction fragment length polymorphisms was developed and was able to distinguish “P. fragariae” from other insect bacteria. None of the many leafhoppers and psyllids captured during several years in and around infected strawberry fields was found to carry “P. fragariae.” Interestingly however, the “P. fragariae” spoT sequence could be easily detected in whiteflies proliferating on “P. fragariae”-infected strawberry plants under confined greenhouse conditions but not on control whiteflies, indicating that these insects can become infected with the bacterium. PMID:10919809

Foissac, Xavier; Danet, Jean-Luc; Zreik, Leyla; Gandar, Jeanne; Nourrisseau, Jean-Georges; Bové, Joseph-Marie; Garnier, Monique

2000-01-01

389

A set of inter-Alu PCR markers for chromosome 21 generated from pulsed-field gel-fractionated NotI restriction fragments  

SciTech Connect

Genomic probes can be efficiently obtained for specific chromosomal regions by PCR amplification of gel slices containing fractionated restriction enzyme-cleaved DNA. Here, single-copy, human-specific DNA sequences were amplified using inter-Alu PCR on gel slices containing a NotI digest of DNA from hybrid cell line WAV17. Rodent cell line WAV17 contains human chromosome 21. About 75% of the 0.15- to 3-kb inter-Alu PCR products could be regionally assigned, en masse, by hybridization experiments using inter-Alu PCR probes generated from cell lines containing portions of chromosome 21. This work produced 10 new chromosome 21 markers that came from regions of 21q containing few useful markers. These markers were needed to finish a NotI restriction map for 21q. This approach provides markers needed to close map gaps and for top-down mapping approaches. 52 refs., 5 figs., 2 tabs.

Wang, D.; Zhu, Y.; Smith, C.L. [Boston Univ., MA (United States)] [Boston Univ., MA (United States)

1995-03-20

390

Restriction analysis and partial sequencing of the 16S rRNA gene as index for rapid identification of Bacillus species  

Microsoft Academic Search

Restriction fragment length analysis of PCR amplified 16S rDNA with AluI revealed the presence of a 265 bp fragment in all species of Bacillus with the exception of B. cereus and B. thuringiensis, which contains two restriction sites within this fragment which results in three smaller fragments totalling to 265 bp.\\u000a Some distant species of Bacillus with no evidence of this fragment

S. Vardhan; R. Kaushik; A. K. Saxena; D. K. Arora

2011-01-01

391

In vitro DNA fragmentation of mitochondrial DNA caused by single-stranded breakage related to macroplasmodial senescence of the true slime mold, Physarum polycephalum  

Microsoft Academic Search

We found that mitochondrial DNA (mtDNA) isolated from Physarum polycephalum fragmented itself in weak ionic solutions. The mtDNA was dissolved in STE (saline Tris-EDTA: 150?mM NaCl, 10?mM Tris-HCl,\\u000a 1?mM EDTA), TE (10?mM Tris-HCl, 1?mM EDTA) and DW, and then electrophoresed in an agarose gel. The intact 86-kbp mtDNA band\\u000a was seen in STE, but several novel bands appeared in TE

Takashi Abe; Hiroyoshi Takano; Narie Sasaki; Kimie Mori; Shigeyuki Kawano

2000-01-01

392

A PCR-free cloning method for the targeted ?80 Int-mediated integration of any long DNA fragment, bracketed with meganuclease recognition sites, into the Escherichia coli chromosome.  

PubMed

The genetic manipulation of cells is the most promising strategy for designing microorganisms with desired traits. The most widely used approaches for integrating specific DNA-fragments into the Escherichia coli genome are based on bacteriophage site-specific and Red/ET-mediated homologous recombination systems. Specifically, the recently developed Dual In/Out integration strategy enables the integration of DNA fragments directly into specific chromosomal loci (Minaeva et al., 2008). To develop this strategy further, we designed a method for the precise cloning of any long DNA fragments from the E. coli chromosome and their targeted insertion into the genome that does not require PCR. In this method, the region of interest is flanked by I-SceI rare-cutting restriction sites, and the I-SceI-bracketed region is cloned into the unique I-SceI site of an integrative plasmid vector that then enables its targeted insertion into the E. coli chromosome via bacteriophage ?80 Int-mediated specialized recombination. This approach allows any long specific DNA fragment from the E. coli genome to be cloned without a PCR amplification step and reproducibly inserted into any chosen chromosomal locus. The developed method could be particularly useful for the construction of marker-less and plasmid-less recombinant strains in the biotechnology industry. PMID:22484061

Ublinskaya, Anna A; Samsonov, Valeriy V; Mashko, Sergey V; Stoynova, Nataliya V

2012-06-01

393

Increased circulating cell-free DNA levels and mtDNA fragments in interventional cardiologists occupationally exposed to low levels of ionizing radiation.  

PubMed

Circulating cell-free DNA (ccf-DNA) and mtDNA (ccf-mtDNA) have often been used as indicators of cell death and tissue damage in acute and chronic disorders, but little is known about changes in ccf-DNA and ccf-mtDNA concentrations following radiation exposure. The aim of the study was to investigate the impact of chronic low-dose radiation exposure on serum ccf-DNA levels and ccf-mtDNA fragments (mtDNA-79 and mtDNA-230) of interventional cardiologists working in high-volume cardiac catheterization laboratory to assess their possible role as useful radiation biomarkers. We enrolled 50 interventional cardiologists (26 males; age?=?48.4?±?10 years) and 50 age- and gender-matched unexposed controls (27 males; age?=?47.6?±?8.3 years). Quant-iT™ dsDNA High-Sensitivity assay was used to measure circulating ccf-DNA isolated from serum samples. Quantitative analysis of mtDNA fragments was performed by real-time PCR. No significant relationships were found between ccf-DNA and ccf-mtDNA, and age, gender, smoking, or other clinical parameters. Ccf-DNA levels (44.2?±?31.1 vs. 30.6?±?19.2 ng/ml, P?=?0.013), ccf-mtDNA-79 (2.6?±?2.1 vs. 1.1?±?0.8, P < 0.01), and ccf-mtDNA-230 copies (2.0?±?1.8 vs. 1.04?±?0.9, P?=?0.02) were significantly higher in interventional cardiologists compared with the non-exposed group. In a subset (n?=?15) of interventional cardiologists with a reliable reconstruction of cumulative professional exposure (59.7?±?48.4 mSv; range: 1.4-182 mS), ccf-DNA (53.2?±?41.3 vs. 36.4?±?22.9 and 32.2?±?20.5, P?=?0.08), mtDNA-79 (2.4?±?2.1 vs. 2.03?±?1.7 and 1.09?±?0.82, P?=?0.05), and mtDNA-230 (2.0?±?2.2 vs. 1.5?±?1.4 and 1.04?±?0.9, P?=?0.09) tended to be significantly increased in high-exposure subjects compared with both low-exposure interventional cardiologists and controls. Our results provide evidence for a possible role of circulating DNA as a relevant biomarker of cellular damage induced by exposure to chronic low-dose radiation. Environ. Mol. Mutagen., 2014. © 2014 Wiley Periodicals, Inc. PMID:25327629

Borghini, Andrea; Mercuri, Antonella; Turchi, Stefano; Chiesa, Maria Rosa; Piccaluga, Emanuela; Andreassi, Maria Grazia

2014-10-18

394

Presence of DNA fragmentation and lack of neuroprotective effect in DFF45 knockout mice subjected to traumatic brain injury.  

PubMed Central

BACKGROUND: Apoptosis plays an important pathophysiologic role in neuronal cell loss and associated neurologic deficits following traumatic brain injury (TBI). DNA fragmentation represents one of the characteristic biochemical features of neuronal apoptosis and is observed after experimental TBI. DFF45 and DFF40 are essential for DNA fragmentation in various models of apoptosis. MATERIALS AND METHODS: We used mice deficient in DFF45 and wild-type controls. Oligonucleosomal DNA fragmentation induced by TBI was analyzed using in vivo and in vitro assays. Expression and integrity of DFF45 and DFF40 proteins was assessed by Western analysis. Other outcome measurements included neurologic scoring, learning/memory tests, lesion volume measurements (MRI), and assessment of cell viability in vitro among others. RESULTS: We compared the effects of controlled cortical impact (CCI) trauma in DFF45 knockout mice and wild-type controls. Analysis of TBI-induced DNA fragmentation in brain cortex from wild-type and DFF45 knockout mice indicates that, although somewhat delayed, oligonucleosomal cleavage of DNA occurs after TBI in DFF45 knockout mice. DFF45 knockouts showed no significant differences in behavioral outcomes or lesion volumes after TBI as compared to wild-type controls. Using an in vitro reconstitution system, we also demonstrated that cleavage of DFF45 by caspase-3 is not sufficient for DNA fragmentation induced by protein extracts from rat brain cortex. We found that endonuclease activity induced in rat brain cortex following TBI depends on the presence of Mg2+ and Ca2+, but is not inhibited by Zn2+. Primary neuronal cultures from DFF45 knockouts failed to show DNA laddering in response to staurosporine, but did show prominent, albeit delayed, DNA fragmentation following treatment with etoposide. In contrast, primary neurons from wild-type animals demonstrated marked DNA fragmentation following treatment with staurosporine or etoposide. CONCLUSIONS: The results of this study suggest that, in addition to DFF45/40, other endonucleases may be essential for chromatin degradation during neuronal apoptosis in adult brain after TBI. PMID:11471558

Yakovlev, A. G.; Di, X.; Movsesyan, V.; Mullins, P. G.; Wang, G.; Boulares, H.; Zhang, J.; Xu, M.; Faden, A. I.

2001-01-01

395

Characterization of Neisseria meningitidis serogroup C by multilocus enzyme electrophoresis and ribosomal DNA restriction profiles (ribotyping).  

PubMed Central

We compared multilocus enzyme electrophoresis (MEE) and ribosomal DNA fingerprinting (ribotyping) for subtyping 44 strains of Neisseria meningitidis serogroup C that were isolated in Los Angeles County, California, between December 1985 and July 1986. The isolates were divided into six enzyme types (ETs) by MEE, but 36 of the isolates were clustered in one ET, 3. The same isolates were divided into 17 ribotypes by use of restriction endonucleases ClaI, EcoRI, and XhoI. Twenty of the 36 ET 3 isolates were divided into 17 ribotypes by use of restriction endonucleases ClaI, EcoRI, and XhoI. Twenty of the 36 ET 3 isolates were grouped in a single ribotype, J. The rate of infection with ribotype J strains was higher in the southern part of the study area than in the northern part. Isolates from each of eight pairs (each isolate pair was cultured from the same patient from the same or different sites) were found identical by MEE, but ribotyping revealed a difference in one pair. In this study, ribotyping showed a greater discriminating capacity than MEE for subtyping N. meningitidis serogroup C, but the epidemiologic relevance of this increased sensitivity needs further assessment. Images PMID:1734044

Woods, T C; Helsel, L O; Swaminathan, B; Bibb, W F; Pinner, R W; Gellin, B G; Collin, S F; Waterman, S H; Reeves, M W; Brenner, D J

1992-01-01

396

A simple test using restricted PCR-amplified mitochondrial DNA to study the genetic structure of Apis mellifera L  

Microsoft Academic Search

The COI-COII intergenic region ofApis mellifera mitochondrial DNA contains an important length polymorphism based on a variable number of copies of a 192–196 bp sequence (Q) and the completer or partial deletion of 67 pb sequence (Po). This length variability has been combined with a restriction site polymorphism to produce a rapid and simple test for the characterization of mtDNA

L. Garnery; M. Solignac; G. Celebrano; J.-M. Cornuet

1993-01-01

397

A DNA Metabarcoding Study of a Primate Dietary Diversity and Plasticity across Its Entire Fragmented Range  

PubMed Central

In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli), an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i) describe the species diet across its entire range and (ii) evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the distribution and the dispersal ability of this species. PMID:23527060

Quéméré, Erwan; Hibert, Fabrice; Miquel, Christian; Lhuillier, Emeline; Rasolondraibe, Emmanuel; Champeau, Julie; Rabarivola, Clément; Nusbaumer, Louis; Chatelain, Cyrille; Gautier, Laurent; Ranirison, Patrick; Crouau-Roy, Brigitte; Taberlet, Pierre; Chikhi, Lounès

2013-01-01

398

Characterization of HIFU ablation using DNA fragmentation labeling as apoptosis stain  

NASA Astrophysics Data System (ADS)

The goal of this work was to compare modalities to precisely quantify the extent of thermally induced lesions: gross pathology vs. histopathology vs. devascularization. Liver areas of 14 rabbits were targeted with HIFU and RF ablations in an acute study. Contrast enhanced computorized tomography (CE-CT) scan images were acquired two hours after HIFU and RF treatment to obtain the devascularized volumes of the livers. The animals were then euthanized and deep frozen. The livers were sliced and each slice was photographed and stacked yielding a volume of gross pathology. The volume VGP of the HIFU lesions were derived. The area AGP of the lesions were computed on a particular slice. The lesions were segmented as hypo intense (devascularized) regions on CE-CT images and their volumes VC were computed. The ratios VC/VGP were computed for all the HIFU lesions on all the 14 subjects with a mean value of 1.2. Histology was performed on the livers using Hematoxyline Eosine Staining (HES) and DNA Fragmentation labeling (TUNEL® technology) which characterizes apoptosis. Apoptotic regions of area AT were segmented on the images stained by TUNEL®. No necrosis was identified on the HES data. While TUNEL® did not mark the cores of the RF lesions as apoptotic, the periphery of HIFU and RF lesions was always recognized with TUNEL® as apoptotic. The ratio AGP/AT was computed. The mean value was 0.95 and 0.25 for HIFU and RF lesions respectively. These findings show that the devascularized territory seen on CE-CT scan coincide with the coagulated territories seen with gross pathology. Those actually correspond to cells in apoptosis. It is confirmed that HES stain does not show necrosis 2 hours after thermal ablation. TUNEL® technology for DNA fragmentation labeling appears as a useful marker for thermally induced acute lesions in the liver.

Anquez, Jeremie; Corréas, Jean-Michel; Pau, Bernard; Lacoste, François; Yon, Sylvain

2012-11-01

399

Ultrastructural and DNA fragmentation analyses in swim-up selected human sperm.  

PubMed

Seventeen sperm samples were evaluated by transmission electron microscopy (TEM) before and after swim-up separation. DNA-fragmentation was tested by terminal d-UTP nick end labeling (TUNEL) in unselected and selected semen samples, and the results were analyzed in relation to sperm ultrastructural characteristics detected by TEM. A significant improvement in mean numbers and percentages of structurally normal sperm was observed after swim-up selection, corresponding to a significant decrease in the percentage of necrotic and apoptotic sperm, while the percentage of sperm with immature nuclei did not change significantly. TUNEL indicated a significant decrease in chromatin-fragmented sperm after swim-up. Swim up selection based on sperm motility excludes many sperm with ultrastructural evidence of necrosis (absent or reacted acrosome, disrupted chromatin, broken plasma membrane) and apoptosis (misshapen nuclei with marginated chromatin), as confirmed by TUNEL analysis. Nevertheless, immature sperm with elliptical or roundish nuclei, misshapen acrosomes and uncondensed chromatin remain part of fertilizing pool. PMID:16338870

Piomboni, P; Bruni, E; Capitani, S; Gambera, L; Moretti, E; La Marca, A; De Leo, V; Baccetti, B

2006-01-01

400

Telomere dysfunction triggers extensive DNA fragmentation and evolution of complex chromosome abnormalities in human malignant tumors  

PubMed Central

Although mechanisms for chromosomal instability in tumors have been described in animal and in vitro models, little is known about these processes in man. To explore cytogenetic evolution in human tumors, chromosomal breakpoint profiles were constructed for 102 pancreatic carcinomas and 140 osteosarcomas, two tumor types characterized by extensive genomic instability. Cases with few chromosomal alterations showed a preferential clustering of breakpoints to the terminal bands, whereas tumors with many changes showed primarily interstitial and centromeric breakpoints. The terminal breakpoint frequency was negatively correlated to telomeric TTAGGG repeat length, and fluorescence in situ hybridization with telomeric TTAGGG probes consistently indicated shortened telomeres and >10% of chromosome ends lacking telomeric signals. Because telomeric dysfunction may lead to formation of unstable ring and dicentric chromosomes, mitotic figures were also evaluated. Anaphase bridges were found in all cases, and fluorescence in situ hybridization demonstrated extensive structural rearrangements of chromosomes, with terminal transferase detection showing fragmented DNA in 5–20% of interphase cells. Less than 2% of cells showed evidence of necrosis or apoptosis, and telomerase was expressed in the majority of cases. Telomeric dysfunction may thus trigger chromosomal fragmentation through persistent bridge-breakage events in pancreatic carcinomas and osteosarcomas, leading to a continuous reorganization of the tumor genome. Telomerase expression is not sufficient for completely stabilizing the chromosome complement but may be crucial for preventing complete genomic deterioration and maintaining cellular survival. PMID:11675499

Gisselsson, David; Jonson, Tord; Petersén, ?sa; Strömbeck, Bodil; Dal Cin, Paola; Höglund, Mattias; Mitelman, Felix; Mertens, Fredrik; Mandahl, Nils

2001-01-01

401

Targeting individual subunits of the FokI restriction endonuclease to specific DNA strands  

PubMed Central

Many restriction endonucleases are dimers that act symmetrically at palindromic DNA sequences, with each active site cutting one strand. In contrast, FokI acts asymmetrically at a non-palindromic sequence, cutting ‘top’ and ‘bottom’ strands 9 and 13 nucleotides downstream of the site. FokI is a monomeric protein with one active site and a single monomer covers the entire recognition sequence. To cut both strands, the monomer at the site recruits a second monomer from solution, but it is not yet known which DNA strand is cut by the monomer bound to the site and which by the recruited monomer. In this work, mutants of FokI were used to show that the monomer bound to the site made the distal cut in the bottom strand, whilst the recruited monomer made in parallel the proximal cut in the top strand. Procedures were also established to direct FokI activity, either preferentially to the bottom strand or exclusively to the top strand. The latter extends the range of enzymes for nicking specified strands at specific sequences, and may facilitate further applications of FokI in gene targeting. PMID:19223323

Sanders, Kelly L.; Catto, Lucy E.; Bellamy, Stuart R. W.; Halford, Stephen E.

2009-01-01

402

Selective propagation of functional mtDNA during oogenesis restricts the transmission of a deleterious mitochondrial variant  

PubMed Central

Though mitochondrial DNA is prone to mutation and few mtDNA repair mechanisms exist1, crippling mitochondrial mutations are exceedingly rare2. Recent studies demonstrated strong purifying selection in the mouse female germline3,4. However, the mechanisms underlying the positive selection of healthy mitochondria remain to be elucidated. We visualized mtDNA replication during Drosophila oogenesis. We found that mtDNA replication commenced prior to oocyte determination during the late germarium stage, and was dependent on mitochondrial fitness. We isolated a temperature-sensitive lethal mtDNA mutation, mt:CoIT300I, which displayed reduced mtDNA replication in the germarium at the restrictive temperature. Additionally, the frequency of mt:CoIT300I in heteroplasmic flies was decreased both through oogenesis and over multiple generations at the restrictive temperature. Furthermore, we determined that selection against mt:CoIT300I overlaps with the timing of selective replication of mtDNA in the germarium. These findings establish a previously uncharacterized developmental mechanism for selective amplification of healthy mtDNA, which may be evolutionarily conserved to limit transmission of deleterious mutations. PMID:24614072

Hill, Jahda H.; Chen, Zhe; Xu, Hong

2014-01-01

403

Restriction enzyme analysis of American region dengue viruses  

Microsoft Academic Search

Summary Restriction fragment heterogeneity of Hae III digestion products of cDNA to virion RNA was used to map the distribution of dengue virus topotypes found in the American region. By comparing the electrophoretic patterns of fragments produced, dengue virus isolates were placed in groups that agreed with those previously determined by oligonucleotide fingerprinting. Dengue-1 and dengue-4 viruses occur throughout the

V. Vorndam; R. M. R. Nogueira; D. W. Trent

1994-01-01

404

Towards standardisation of cell-free DNA measurement in plasma: controls for extraction efficiency, fragment size bias and quantification.  

PubMed

Circulating cell-free DNA (cfDNA) is becoming an important clinical analyte for prenatal testing, cancer diagnosis and cancer monitoring. The extraction stage is critical in ensuring clinical sensitivity of analytical methods measuring minority nucleic acid fractions, such as foetal-derived sequences in predominantly maternal cfDNA. Consequently, quality controls are required for measurement of extraction efficiency, fragment size bias and yield for validation of cfDNA methods. We evaluated the utility of an external DNA spike for monitoring these parameters in a study comparing three specific cfDNA extraction methods [QIAamp circulating nucleic acid (CNA) kit, NucleoSpin Plasma XS (NS) kit and FitAmp plasma/serum DNA isolation (FA) kit] with the commonly used QIAamp DNA blood mini (DBM) kit. We found that the extraction efficiencies of the kits ranked in the order CNA kit > DBM kit > NS kit > FA kit, and the CNA and NS kits gave a better representation of smaller DNA fragments in the extract than the DBM kit. We investigated means of improved reporting of cfDNA yield by comparing quantitative PCR measurements of seven different reference gene assays in plasma samples and validating these with digital PCR. We noted that the cfDNA quantities based on measurement of some target genes (e.g. TERT) were, on average, more than twofold higher than those of other assays (e.g. ERV3). We conclude that analysis and averaging of multiple reference genes using a GeNorm approach gives a more reliable estimate of total cfDNA quantity. PMID:24853859

Devonshire, Alison S; Whale, Alexandra S; Gutteridge, Alice; Jones, Gerwyn; Cowen, Simon; Foy, Carole A; Huggett, Jim F

2014-10-01

405

Amplified fragment length polymorphism versus random amplified polymorphic DNA markers: clonal diversity in Saxifraga cernua.  

PubMed

Random amplified polymorphic DNA (RAPD) markers are sensitive to changes in reaction conditions and may express polymorphisms of nongenetic origin. Taxa with variable chromosome numbers are particularly challenging cases, as differences in DNA content may also influence marker reproducibility. We addressed these problems by comparing RAPD and amplified fragment length polymorphism (AFLP) analyses of clonal identity and relationships in a chromosomally variable arctic plant, the polyploid Saxifraga cernua, which has been thought to be monoclonal over large geographical distances. Fifty-seven plants from four Greenland populations were analysed using a conservative scoring approach. In total, 26 AFLP and 32 RAPD multilocus phenotypes (putative clones) were identified, of which 21 were identical and each of the remaining five AFLP clones was split into two to three very similar RAPD clones. This minor difference can be explained by sampling error and stochastic variation. The pattern observed in Greenland corroborates our previous results from Svalbard, suggesting that rare sexual events in S. cernua are sufficient to maintain high levels of clonal diversity even at small spatial scales. We conclude that although AFLP analysis is superior in terms of efficiency, RAPDs may still be used as reliable markers in small low-tech laboratories. PMID:14653790

Kjølner, S; Såstad, S M; Taberlet, P; Brochmann, C

2004-01-01

406

Retroviral Restriction Factor APOBEC3G Delays the Initiation of DNA Synthesis by HIV-1 Reverse Transcriptase  

PubMed Central

It is well established that the cytosine deaminase APOBEC3G can restrict HIV-1 virions in the absence of the virion infectivity factor (Vif) by inducing genome mutagenesis through deamination of cytosine to uracil in single-stranded HIV-1 (?)DNA. However, whether APOBEC3G is able to restrict HIV-1 using a deamination-independent mode remains an open question. In this report we use in vitro primer extension assays on primer/templates that model (?)DNA synthesis by reverse transcriptase from the primer binding site (PBS) and within the protease gene of HIV-1. We find that APOBEC3G is able to decrease the initiation of DNA synthesis by reverse transcriptase approximately 2-fold under conditions where reverse transcriptase is in excess to APOBEC3G, as found in HIV-1 virions. However, the delay in the initiation of DNA synthesis on RNA templates up to 120 nt did not decrease the total amount of primer extended after extended incubation unless the concentration of reverse transcriptase was equal to or less than that of APOBEC3G. By determining apparent Kd values of reverse transcriptase and APOBEC3G for the primer/templates and of reverse transcriptase binding to APOBEC3G we conclude that APOBEC3G is able to decrease the efficiency of reverse transcriptase-mediated DNA synthesis by binding to the RNA template, rather than by physically interacting with reverse transcriptase. All together the data support a model in which this deamination-independent mode of APOBEC3G would play a minor role in restricting HIV-1. We propose that the deamination-independent inhibition of reverse transcriptase we observed can be a mechanism used by APOBEC3G to slow down proviral DNA formation and increase the time in which single-stranded (?)DNA is available for deamination by APOBEC3G, rather than a direct mechanism used by APOBEC3G for HIV-1 restriction. PMID:23717565

Adolph, Madison B.; Webb, Jonathon; Chelico, Linda

2013-01-01

407

Using Restriction Mapping to Teach Basic Skills in the Molecular Biology Lab  

ERIC Educational Resources Information Center

Digestion of DNA with restriction enzymes, calculation of volumes and concentrations of reagents for reactions, and the separation of DNA fragments by agarose gel electrophoresis are common molecular biology techniques that are best taught through repetition. The following open-ended, investigative laboratory exercise in plasmid restriction

Walsh, Lauren; Shaker, Elizabeth; De Stasio, Elizabeth A.

2007-01-01

408

Classification of Lactobacillus plantarum by Restriction Endonuclease Analysis of Total Chromosomal DNA Using Conventional Agarose Gel Electrophoresis  

Microsoft Academic Search

A total of 17 Lactobacillus plantarum strains that originated from different environments and 24 reference strains were classified by performing a restriction endonuclease analysis of total chromosomal DNAs digested with EcolRI, HindIII, and ClaI, and the resulting patterns were visualized after the fragments were separated according to size by agarose gel electrophoresis. The patterns were analyzed by using the Pearson

M.-L. JOHANSSON; M. QUEDNAU; G. MOLIN