Science.gov

Sample records for dna synthesis clarification

  1. Translesion DNA synthesis

    PubMed Central

    Vaisman, Alexandra; McDonald, John P.; Woodgate, Roger

    2014-01-01

    All living organisms are continually exposed to agents that damage their DNA, which threatens the integrity of their genome. As a consequence, cells are equipped with a plethora of DNA repair enzymes to remove the damaged DNA. Unfortunately, situations nevertheless arise where lesions persist, and these lesions block the progression of the cell’s replicase. Under these situations, cells are forced to choose between recombination-mediated “damage avoidance” pathways, or use a specialized DNA polymerase (pol) to traverse the blocking lesion. The latter process is referred to as Translesion DNA Synthesis (TLS). As inferred by its name, TLS not only results in bases being (mis)incorporated opposite DNA lesions, but also downstream of the replicase-blocking lesion, so as to ensure continued genome duplication and cell survival. Escherichia coli and Salmonella typhimurium possess five DNA polymerases, and while all have been shown to facilitate TLS under certain experimental conditions, it is clear that the LexA-regulated and damage-inducible pols II, IV and V perform the vast majority of TLS under physiological conditions. Pol V can traverse a wide range of DNA lesions and performs the bulk of mutagenic TLS, whereas pol II and pol IV appear to be more specialized TLS polymerases. PMID:26442823

  2. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  3. Synthesis of chemically modified DNA.

    PubMed

    Shivalingam, Arun; Brown, Tom

    2016-06-15

    Naturally occurring DNA is encoded by the four nucleobases adenine, cytosine, guanine and thymine. Yet minor chemical modifications to these bases, such as methylation, can significantly alter DNA function, and more drastic changes, such as replacement with unnatural base pairs, could expand its function. In order to realize the full potential of DNA in therapeutic and synthetic biology applications, our ability to 'write' long modified DNA in a controlled manner must be improved. This review highlights methods currently used for the synthesis of moderately long chemically modified nucleic acids (up to 1000 bp), their limitations and areas for future expansion. PMID:27284032

  4. SMFM Statement: clarification of recommendations regarding cell-free DNA aneuploidy screening.

    PubMed

    2015-12-01

    The purpose of this statement is to clarify that the Society for Maternal-Fetal Medicine (SMFM) does not recommend that cell-free DNA aneuploidy screening be offered to all pregnant women, nor does it suggest a requirement for insurance coverage for cell-free DNA screening in women at low risk of aneuploidy. However, SMFM believes, due to the ethics of patient autonomy, that the option should be available to women who request additional testing beyond what is currently recommended by professional societies. PMID:26458766

  5. Photoelectrochemical synthesis of DNA microarrays

    PubMed Central

    Chow, Brian Y.; Emig, Christopher J.; Jacobson, Joseph M.

    2009-01-01

    Optical addressing of semiconductor electrodes represents a powerful technology that enables the independent and parallel control of a very large number of electrical phenomena at the solid-electrolyte interface. To date, it has been used in a wide range of applications including electrophoretic manipulation, biomolecule sensing, and stimulating networks of neurons. Here, we have adapted this approach for the parallel addressing of redox reactions, and report the construction of a DNA microarray synthesis platform based on semiconductor photoelectrochemistry (PEC). An amorphous silicon photoconductor is activated by an optical projection system to create virtual electrodes capable of electrochemically generating protons; these PEC-generated protons then cleave the acid-labile dimethoxytrityl protecting groups of DNA phosphoramidite synthesis reagents with the requisite spatial selectivity to generate DNA microarrays. Furthermore, a thin-film porous glass dramatically increases the amount of DNA synthesized per chip by over an order of magnitude versus uncoated glass. This platform demonstrates that PEC can be used toward combinatorial bio-polymer and small molecule synthesis. PMID:19706433

  6. Mechanism for priming DNA synthesis by yeast DNA Polymerase α

    PubMed Central

    Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca

    2013-01-01

    The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895

  7. Values Clarification in EFL.

    ERIC Educational Resources Information Center

    Taylor, Mary S.

    1976-01-01

    This paper briefly outlines the theory and development of Values Clarification and explores its possible applications to English as a foreign language (EFL). The five basic types of Values Clarification exercises are discussed: (1) interviewing, (2) rank-ordering, (3) forced choice, (4) values continuum, and (5) sentence completion. The theory and…

  8. Values Clarification Through Writing.

    ERIC Educational Resources Information Center

    Strugala, Richard A.

    1982-01-01

    An approach to using values clarification exercises in a college freshman composition or a high school English class is presented in this brief article. AUTHOR'S COMMENT (excerpt): Since the integration of writing and thinking is vital in the development of writing abilities, the values clarification experience is a natural bridge for students to…

  9. Initiator RNA in Discontinuous Polyoma DNA Synthesis*

    PubMed Central

    Reichard, Peter; Eliasson, Rolf; Söderman, Gunilla

    1974-01-01

    During replication of polyoma DNA in isolated nuclei, RNA was found attached to the 5′ ends of growing progeny strands. This RNA starts with either ATP or GTP and can be labeled at its 5′ end with 32P from β-labeled nucleotides. Digestion of progeny strands with pancreatic DNase released 32P-labeled RNA that, on gel electrophoresis, gave a distinct peak in the position expected for a decanucleotide. We believe that this short RNA is involved in the initiation of the discontinuous synthesis of DNA and propose the name “initiator RNA” for it. The covalent linkage of initiator RNA to 5′ ends of growing DNA chains was substantiated by the finding that 32P was transferred to ribonucleotides by alkaline hydrolysis of purified initiator RNA obtained by DNase digestion of polyoma progeny strands synthesized from [α-32P]dTTP. While initiator RNA was quite homogeneous in size, it had no unique base sequence since digestion with pancreatic RNase of initiator RNA labeled at its 5′ end with 32P released a variety of different [32P]oligonucleotides. The switch from RNA to DNA synthesis during strand elongation may thus depend on the size of initiator RNA rather than on a specific base sequence. PMID:4373733

  10. DNA Nanoparticles for Improved Protein Synthesis In Vitro

    PubMed Central

    Galinis, Robertas; Stonyte, Greta; Kiseliovas, Vaidotas; Zilionis, Rapolas; Studer, Sabine; Hilvert, Donald; Janulaitis, Arvydas

    2016-01-01

    Abstract The amplification and digital quantification of single DNA molecules are important in biomedicine and diagnostics. Beyond quantifying DNA molecules in a sample, the ability to express proteins from the amplified DNA would open even broader applications in synthetic biology, directed evolution, and proteomics. Herein, a microfluidic approach is reported for the production of condensed DNA nanoparticles that can serve as efficient templates for in vitro protein synthesis. Using phi29 DNA polymerase and a multiple displacement amplification reaction, single DNA molecules were converted into DNA nanoparticles containing up to about 104 clonal gene copies of the starting template. DNA nanoparticle formation was triggered by accumulation of inorganic pyrophosphate (produced during DNA synthesis) and magnesium ions from the buffer. Transcription–translation reactions performed in vitro showed that individual DNA nanoparticles can serve as efficient templates for protein synthesis in vitro. PMID:26821778

  11. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  12. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  13. Function of DNA polymerase I in RNA-primed synthesis of bacteriophage M-13 duplex DNA.

    PubMed Central

    Schneck, P K; Staudenbauer, W L; Hofschneider, P H

    1976-01-01

    Cell-free extracts from Escherichia coli contain a DNA polymerase activity resistant to SH-blocking agents, which is capable of synthesizing complementary strand DNA on a circular M-13 DNA template by extension of RNA primers. This activity is considered to be identical with DNA polymerase I (or some altered form of this enzyme) since it is missing in extracts from po1A- cells. DNA synthesis in the presence of SH-blocking agents occurs at a reduced rate as compared to untreated controls and leads to the formation of DNA chains of defined size (0.4-0.5 genome's length). It is concluded that efficient M-13 duplex DNA synthesis requires the cooperation of both DNA polymerase I and III. PMID:1272793

  14. Mutagenesis in Oocytes of DROSOPHILA MELANOGASTER. I. Scheduled Synthesis of Nuclear and Mitochondrial DNA and Unscheduled DNA Synthesis

    PubMed Central

    Kelley, Mark R.; Lee, William R.

    1983-01-01

    As a model system for studying mutagenesis, the oocyte of Drosophila melanogaster has exhibited considerable complexity. Very few experiments have been conducted on the effect of exposing oocytes to chemical mutagens, presumably due to their lower mutational response relative to sperm and spermatids. This lower response may be due either to a change in probability of mutation induction per adduct due to a change in the type of DNA repair or to a lower dose of the mutagen to the female germ line. To study molecular dosimetry and DNA repair in the oocyte, the large number of intracellular constituents (mtDNA, RNA, nucleic acid precursors and large quantities of proteins and lipids) must be separated from nuclear DNA. In this paper we present results showing reliable separation of such molecules enabling us to detect scheduled nuclear and mitochondrial DNA synthesis. We also, by understanding the precise timing of such events, can detect unscheduled DNA synthesis (UDS) as a measure of DNA repair. Furthermore, by comparing the UDS results in a repair competent (Ore-R) vs. a repair deficient (mei-9L1 ) strain, we have shown the oocyte capable of DNA repair after treatment with ethyl methanesulfonate (EMS). We conclude that the important determinant of mutation induction in oocytes after treatment with EMS is the time interval between DNA alkylation and DNA synthesis after fertilization, i.e., the interruption of continuous DNA repair. PMID:17246137

  15. Clarification Procedure for Gels

    NASA Technical Reports Server (NTRS)

    Barber, Patrick G.; Simpson, Norman R.

    1987-01-01

    Procedure developed to obtain transparent gels with consistencies suitable for crystal growth, by replacing sodium ions in silicate solution with potassium ions. Clarification process uses cation-exchange resin to replace sodium ions in stock solution with potassium ions, placed in 1M solution of soluble potassium salt. Slurry stirred for several hours to allow potassium ions to replace all other cations on resin. Supernatant solution decanted through filter, and beads rinsed with distilled water. Rinsing removes excess salt but leaves cation-exchange beads fully charged with potassium ions.

  16. Translesion DNA synthesis in the context of cancer research

    PubMed Central

    2011-01-01

    During cell division, replication of the genomic DNA is performed by high-fidelity DNA polymerases but these error-free enzymes can not synthesize across damaged DNA. Specialized DNA polymerases, so called DNA translesion synthesis polymerases (TLS polymerases), can replicate damaged DNA thereby avoiding replication fork breakdown and subsequent chromosomal instability. We focus on the involvement of mammalian TLS polymerases in DNA damage tolerance mechanisms. In detail, we review the discovery of TLS polymerases and describe the molecular features of all the mammalian TLS polymerases identified so far. We give a short overview of the mechanisms that regulate the selectivity and activity of TLS polymerases. In addition, we summarize the current knowledge how different types of DNA damage, relevant either for the induction or treatment of cancer, are bypassed by TLS polymerases. Finally, we elucidate the relevance of TLS polymerases in the context of cancer therapy. PMID:22047021

  17. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

    PubMed

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

    2012-03-13

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases. PMID:22320201

  18. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis

    PubMed Central

    2015-01-01

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the “structure elucidation problem”: the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS’s utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 104 molecules/bead and sequencing allowed for elucidation of each compound’s synthetic history. We applied DESPS to the combinatorial synthesis of a 75 645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and

  19. Decreased synthesis of DNA in regenerating rat liver after the administration of reserpine

    PubMed Central

    Ćihák, A.; Vaptzarova, K.

    1973-01-01

    1. Reserpine given to rats before the enhanced synthesis of DNA begins 14h after partial hepatectomy markedly depresses thymidine uptake into DNA at 24 hours. 2. At this time decreased activity of liver thymidine kinase but unchanged thymidine 5′-nucleotidase were observed. 3. Reserpine has no effect on DNA synthesis when administered simultaneously with the labelled thymidine 2 h before killing. 4. With depressed DNA synthesis after reserpine administration there is no significant decrease of liver RNA synthesis. PMID:4793440

  20. Polyaniline nanowire synthesis templated by DNA

    NASA Astrophysics Data System (ADS)

    Nickels, Patrick; Dittmer, Wendy U.; Beyer, Stefan; Kotthaus, Jörg P.; Simmel, Friedrich C.

    2004-11-01

    DNA-templated polyaniline nanowires and networks are synthesized using three different methods. The resulting DNA/polyaniline hybrids are fully characterized using atomic force microscopy, UV-vis spectroscopy and current-voltage measurements. Oxidative polymerization of polyaniline at moderate pH values is accomplished using ammonium persulfate as an oxidant, or alternatively in an enzymatic oxidation by hydrogen peroxide using horseradish peroxidase, or by photo-oxidation using a ruthenium complex as photo-oxidant. Atomic force microscopy shows that all three methods lead to the preferential growth of polyaniline along DNA templates. With ammonium persulfate, polyaniline can be grown on DNA templates already immobilized on a surface. Current-voltage measurements are successfully conducted on DNA/polyaniline networks synthesized by the enzymatic method and the photo-oxidation method. The conductance is found to be consistent with values measured for undoped polyaniline films.

  1. Magnetic isotope and magnetic field effects on the DNA synthesis

    PubMed Central

    Buchachenko, Anatoly L.; Orlov, Alexei P.; Kuznetsov, Dmitry A.; Breslavskaya, Natalia N.

    2013-01-01

    Magnetic isotope and magnetic field effects on the rate of DNA synthesis catalysed by polymerases β with isotopic ions 24Mg2+, 25Mg2+ and 26Mg2+ in the catalytic sites were detected. No difference in enzymatic activity was found between polymerases β carrying 24Mg2+ and 26Mg2+ ions with spinless, non-magnetic nuclei 24Mg and 26Mg. However, 25Mg2+ ions with magnetic nucleus 25Mg were shown to suppress enzymatic activity by two to three times with respect to the enzymatic activity of polymerases β with 24Mg2+ and 26Mg2+ ions. Such an isotopic dependence directly indicates that in the DNA synthesis magnetic mass-independent isotope effect functions. Similar effect is exhibited by polymerases β with Zn2+ ions carrying magnetic 67Zn and non-magnetic 64Zn nuclei, respectively. A new, ion–radical mechanism of the DNA synthesis is suggested to explain these effects. Magnetic field dependence of the magnesium-catalysed DNA synthesis is in a perfect agreement with the proposed ion–radical mechanism. It is pointed out that the magnetic isotope and magnetic field effects may be used for medicinal purposes (trans-cranial magnetic treatment of cognitive deceases, cell proliferation, control of the cancer cells, etc). PMID:23851636

  2. The coordinate induction of DNA synthesis after tuber wounding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tuber wounding induces a cascade of biological responses involved in processes required to heal and protect surviving plant issues. Little is known about the coordination of these processes, including essential wound-induced DNA synthesis, yet they play critical roles in maintaining marketability o...

  3. Seasonal variations of DNA synthesis in intestinal epithelial cells of hibernating animals--I. DNA synthesis in intestinal epithelial cells of ground squirrel (Citellus undulatus) during deep hibernation.

    PubMed

    Kruman, I I; Kolaeva, S G; Iljasova, E N; Zubrikhina, G N; Khachko, V N; Petrova, A S

    1986-01-01

    The conditions for obtaining crypt cells from ground squirrel small intestine were chosen which allow flow-through cytofluorometric analysis of the DNA synthesis of this tissue. DNA synthesis was found to be greatly reduced in the intestinal crypt cells of ground squirrel during deep hibernation in torpid animals, in animals during spontaneous arousals and in animals prevented from hibernation. The conclusion is made about endogenous control of the DNA synthesis in the cells of true hibernators. PMID:3943302

  4. Sickle erythrocytes inhibit human endothelial cell DNA synthesis

    SciTech Connect

    Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K. )

    1990-11-15

    Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling.

  5. Translesion synthesis past acrolein-derived DNA adducts by human mitochondrial DNA polymerase γ.

    PubMed

    Kasiviswanathan, Rajesh; Minko, Irina G; Lloyd, R Stephen; Copeland, William C

    2013-05-17

    Acrolein, a mutagenic aldehyde, is produced endogenously by lipid peroxidation and exogenously by combustion of organic materials, including tobacco products. Acrolein reacts with DNA bases forming exocyclic DNA adducts, such as γ-hydroxy-1,N(2)-propano-2'-deoxyguanosine (γ-HOPdG) and γ-hydroxy-1,N(6)-propano-2'-deoxyadenosine (γ-HOPdA). The bulky γ-HOPdG adduct blocks DNA synthesis by replicative polymerases but can be bypassed by translesion synthesis polymerases in the nucleus. Although acrolein-induced adducts are likely to be formed and persist in mitochondrial DNA, animal cell mitochondria lack specialized translesion DNA synthesis polymerases to tolerate these lesions. Thus, it is important to understand how pol γ, the sole mitochondrial DNA polymerase in human cells, acts on acrolein-adducted DNA. To address this question, we investigated the ability of pol γ to bypass the minor groove γ-HOPdG and major groove γ-HOPdA adducts using single nucleotide incorporation and primer extension analyses. The efficiency of pol γ-catalyzed bypass of γ-HOPdG was low, and surprisingly, pol γ preferred to incorporate purine nucleotides opposite the adduct. Pol γ also exhibited ∼2-fold lower rates of excision of the misincorporated purine nucleotides opposite γ-HOPdG compared with the corresponding nucleotides opposite dG. Extension of primers from the termini opposite γ-HOPdG was accomplished only following error-prone purine nucleotide incorporation. However, pol γ preferentially incorporated dT opposite the γ-HOPdA adduct and efficiently extended primers from the correctly paired terminus, indicating that γ-HOPdA is probably nonmutagenic. In summary, our data suggest that acrolein-induced exocyclic DNA lesions can be bypassed by mitochondrial DNA polymerase but, in the case of the minor groove γ-HOPdG adduct, at the cost of unprecedented high mutation rates. PMID:23543747

  6. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA. PMID:27311715

  7. Association of DNA sequence variation in mitochondrial DNA polymerase with mitochondrial DNA synthesis and risk of oral cancer.

    PubMed

    Datta, Sayantan; Ray, Anindita; Roy, Roshni; Roy, Bidyut

    2016-01-10

    Enzymes responsible for mitochondrial (mt) DNA synthesis and transcription are encoded by nuclear genome and inherited mutations in these genes may play important roles in enhancing risk of precancer and cancer. Here, genetic variations in 23 functionally relevant tagSNPs in 6 genes responsible for mtDNA synthesis and transcription were studied in 522 cancer and 241 precancer (i.e. leukoplakia) patients and 525 healthy controls using Illumina Golden Gate assay to explore association with risk of oral precancer and cancer. Two SNPs, rs41553913 at POLRMT and rs9905016 at POLG2, significantly increased risk of oral leukoplakia and cancer, respectively, at both genotypic and allelic levels. Gene-environment interaction models also revealed that tobacco habits and SNPs at POLG2 and TFAM may modulate risk of both leukoplakia and cancer. In silico analysis of published data-set also revealed that variant heterozygote (TC) significantly increased transcription of POLG2 compared to wild genotype (p=0.03). Cancer tissues having variant allele genotypes (TC+CC) at POLG2 contained 1.6 times (p<0.01) more mtDNA compared to cancer tissues having wild genotype (TT). In conclusion, polymorphisms at POLG2 and POLRMT increased risk of oral cancer and leukoplakia, respectively, probably modulating synthesis and activity of the enzymes. Enhanced synthesis of mtDNA in cancer tissues may have implication in carcinogenesis, but the mechanism is yet to be explored. PMID:26403317

  8. Inaccurate DNA Synthesis in Cell Extracts of Yeast Producing Active Human DNA Polymerase Iota

    PubMed Central

    Makarova, Alena V.; Grabow, Corinn; Gening, Leonid V.; Tarantul, Vyacheslav Z.; Tahirov, Tahir H.; Bessho, Tadayoshi; Pavlov, Youri I.

    2011-01-01

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn2+ ions, can bypass some DNA lesions and misincorporates “G” opposite template “T” more frequently than incorporates the correct “A.” We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of “G” versus “A” method of Gening, abbreviated as “misGvA”). We provide unambiguous proof of the “misGvA” approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The “misGvA” activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts. PMID:21304950

  9. Pif1 helicase and Polδ promote recombination-coupled DNA synthesis via bubble migration

    PubMed Central

    Wilson, Marenda A.; Kwon, YoungHo; Xu, Yuanyuan; Chung, Woo-Hyun; Chi, Peter; Niu, Hengyao; Mayle, Ryan; Chen, Xuefeng; Malkova, Anna; Sung, Patrick; Ira, Grzegorz

    2013-01-01

    During DNA repair by homologous recombination (HR), DNA synthesis copies information from a template DNA molecule. Multiple DNA polymerases have been implicated in repair-specific DNA synthesis1–3, but it has remained unclear whether a DNA helicase is involved in this reaction. A good candidate is Pif1, an evolutionarily conserved helicase in S. cerevisiae important for break-induced replication (BIR)4 as well as HR-dependent telomere maintenance in the absence of telomerase5 found in 10–15% of all cancers6. Pif1 plays a role in DNA synthesis across hard-to-replicate sites7, 8 and in lagging strand synthesis with Polδ9–11. Here we provide evidence that Pif1 stimulates DNA synthesis during BIR and crossover recombination. The initial steps of BIR occur normally in Pif1-deficient cells, but Polδ recruitment and DNA synthesis are decreased, resulting in premature resolution of DNA intermediates into half crossovers. Purified Pif1 protein strongly stimulates Polδ-mediated DNA synthesis from a D-loop made by the Rad51 recombinase. Importantly, Pif1 liberates the newly synthesized strand to prevent the accumulation of topological constraint and to facilitate extensive DNA synthesis via the establishment of a migrating D-loop structure. Our results uncover a novel function of Pif1 and provide insights into the mechanism of HR. PMID:24025768

  10. Replication stress activates DNA repair synthesis in mitosis.

    PubMed

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach. PMID:26633632

  11. Clarification of Workmen's Compensation Insurance.

    ERIC Educational Resources Information Center

    Shapley, Allen E.

    This document attempts to answer questions resulting from the 1972 Michigan Supreme Court Ruling relative to agricultural employees under the Workmen's Compensation Act (WCA). The sections of this paper outline a history of the WCA; employers covered; definition of "regularly employ"; clarification of "thirteen weeks"; employees (minors, partners,…

  12. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    DOEpatents

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  13. Synthesis and dissolution of hemicatenanes by type IA DNA topoisomerases

    PubMed Central

    Lee, Shun-Hsiao; Siaw, Grace Ee-Lu; Willcox, Smaranda; Griffith, Jack D.; Hsieh, Tao-Shih

    2013-01-01

    Type IA DNA topoisomerases work with a unique mechanism of strand passage through an enzyme-bridged, ssDNA gate, thus enabling them to carry out diverse reactions in processing structures important for replication, recombination, and repair. Here we report a unique reaction mediated by an archaeal type IA topoisomerase, the synthesis and dissolution of hemicatenanes. We cloned, purified, and characterized an unusual type IA enzyme from a hyperthermophilic archaeum, Nanoarchaeum equitans, which is split into two pieces. The recombinant heterodimeric enzyme has the expected activities in its preference of relaxing negatively supercoiled DNA. Its amino acid sequence and cleavage site sequence analysis suggest that it is topoisomerase III, and therefore we named it “NeqTop3.” At high enzyme concentrations, NeqTop3 can generate high-molecular-weight DNA networks. Biochemical and electron microscopic data indicate that the DNA networks are connected through hemicatenane linkages. The hemicatenane formation likely is mediated by the single-strand passage through denatured bubbles in the substrate DNA under high temperature. NeqTop3 at lower concentrations can reverse hemicatenanes. A complex of human topoisomerase 3α, Bloom helicase, and RecQ-mediated genome instability protein 1 and 2 can partially disentangle the hemicatenane network. Both the formation and dissolution of hemicatenanes by type IA topoisomerases demonstrate that these enzymes have an important role in regulating intermediates from replication, recombination, and repair. PMID:24003117

  14. Values Clarification: An Issue Related Paper.

    ERIC Educational Resources Information Center

    Corder, Gregory W.

    Values clarification involves presenting a hypothetical situation to students that requires them to make a moral judgment. That moral judgment must be publicly affirmed by the student, but not criticized by others. Values clarification's philosophical context is existentialist. The values clarification philosophies and methods were consistent with…

  15. [The biological effect of Y-family DNA polymerases on the translesion synthesis].

    PubMed

    Gong, Yi; Yang, Jin

    2013-02-01

    A common DNA polymerase can replicate DNA which functions normally. However, if DNA suffers damage, the genome can not be replicated by a common DNA polymerase because DNA lesions will block the replication apparatus. Another kind of DNA polymerases in organism, Y-family DNA polymerases which is also called translesion synthesis (TLS) polymerases, can deal with this problem. Their main functions are bypassing the lesions in DNA, replicating the genome and saving the dying cells. This thesis presents a historical review of the literature pertinent to the structure, functions and roles of Y-family DNA polymerases. PMID:23488167

  16. DNA replication and unscheduled DNA synthesis in lungs of mice exposed to cigarette smoke

    SciTech Connect

    Rasmussen, R.E.; Boyd, C.H.; Dansie, D.R.; Kouri, R.E.; Henry, C.J.

    1981-07-01

    Mice of the hybrid strain BC3F1/Cum (C57BL/Cum X C3H/AnfCum) were chronically exposed to measured amounts of machine-generated whole Kentucky reference 2A1 cigarette smoke. DNA replication and unscheduled DNA synthesis (UDS) were measured in lung tissue in vitro using a short-term organ culture method. Within one week of beginning smoke exposure, DNA replicative activity, as indicated by incorporation of (3H)-thymidine into total lung DNA, was increased more than two-fold over sham-exposed controls and remained elevated as long as smoke exposure was continued. Treatment of lung tissues in vitro with either the lung carcinogen 4-nitroquinoline-1-oxide or methylmethane sulfonate stimulated UDS, measured as incorporation of (3H)thymidine into lung DNA in the presence of hydroxyurea, presumably as the result of DNA repair activity. Until the 10th to 12th week of smoke exposure, at which time the accumulated deposition of total particulate material in the lung was approximately 40 mg, the level of UDS stimulated by the alkylating chemicals declined to approximately 50% of that seen in lung tissue from sham-exposed control mice. If the mice were removed from smoke exposure, DNA replicative activity returned to normal levels within one week, but the UDS response to DNA damage remained depressed up to five months after ending smoke exposure. The results show that both transient and apparently permanent changes are produced in mouse lung as the result of exposure to cigarette smoke. The role of these changes in lung neoplasia is under investigation.

  17. Synthesis of type 2 Adenovirus DNA in the Presence of Cycloheximide

    PubMed Central

    Horwitz, Marshall S.; Brayton, Carol; Baum, Stephen G.

    1973-01-01

    Adenovirus type 2 DNA synthesis, either in permissive human cells or nonpermissive monkey cells, becomes independent of protein synthesis after the appearance of progeny viral DNA. In the presence of cycloheximide, semiconservative replication and initiation of progeny molecules can occur. PMID:4349494

  18. DNA (DEOXYRIBONUCLEIC ACID) SYNTHESIS FOLLOWING MICROINJECTION OF HETEROLOGOUS SPERM AND SOMATIC CELL NUCLEI INTO HAMSTER OOCYTES

    EPA Science Inventory

    The authors have investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in 3H-thymidine after being parthenogenetically activated by sha...

  19. DNA precursor compartmentation in mammalian cells: metabolic and antimetabolic studies of nuclear and mitochondrial DNA synthesis

    SciTech Connect

    Bestwick, R.K.

    1983-01-01

    HeLa cells were used for the quantitation of cellular and mitochondrial deoxyribonucleoside triphosphate (dNTP) and ribonucleoside triphosphate (rNTP) pools and of changes in pools in response to treatment with the antimetabolites methotrexate (mtx) and 5-fluorodeoxyuridine (FUdR). Use of an enzymatic assay of dNTPs and of improved nucleotide extraction methods allowed quantitation of mitochondrial dNTP pools. All four mitochondrial dNTP pools expand following treatment with mtx or FUdR whereas cellular dTTP and dGTP pools are depleted. Mitochrondrial rNTP pools were also found to expand in response to these antimetabolites. Mouse L-cells were used to determine the relative contributions of an exogenously supplied precursor to nuclear and mitochrondrial DNA replication. Cells were labeled to near steady state specific activities with /sup 32/P-orthophosphate and subsequently labeled with (/sup 3/H)uridine, a general pyrimidine precursor, in the continuing presence of /sup 32/P. Deoxyribonucleoside monophosphates derived from these DNAs were separated by HPLC and the /sup 3/H//sup 32/P ratio in each pyrimidine determined. The dCMP residues in mitochondrial DNA (mtDNA) were found to be derived exclusively from the exogenous supplied uridine. The dTMP residues from nuclear and mtDNA and the dCMP residues from nuclear DNA were seen to be synthesized partly from exogenous sources and partly from other sources, presumably de novo pyrimidine synthesis.

  20. ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

    PubMed

    Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

    2016-07-15

    Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria. PMID:27418514

  1. Inhibition of Cellular DNA Synthesis in Cells Infected with Infectious Pancreatic Necrosis Virus

    PubMed Central

    Lothrop, David; Nicholson, Bruce L.

    1974-01-01

    In asynchronous RTG-2 cell cultures infected with infectious pancreatic necrosis (IPN) virus, inhibition of cellular DNA synthesis, but not protein synthesis, was detected 5 to 6 h postinfection and was 80 to 90% complete by 7 to 8 h. Inhibition of DNA synthesis was largely abolished by UV irradiation of the virus. Sedimentation analyses of phenol-extracted DNA indicated that native cellular DNA was not degraded during infection. Sedimentation on alkaline sucrose gradients of DNA from cells pulsed with radioactive thymidine for varying periods indicated that elongation of nascent DNA chains proceeded normally in infected cells. These and previous results suggest that IPN virus infection results in a reduction of the number of chromosomal sites active in DNA synthesis but does not affect the rate of polymerization at active sites. Cells synchronized with excess thymidine and hydroxyurea and infected with virus at the time of release from the block demonstrated an inhibition of DNA synthesis 3 h postinfection. Cells infected 4 h prior to release continued to synthesize normal amounts of DNA for 1 to 2 h after release. These results indicated that DNA synthesis in early synthetic phase is relatively insensitive to inhibition by IPN virus. PMID:4852469

  2. Misincorporation during DNA synthesis, analyzed by gel electrophoresis.

    PubMed Central

    Hillebrand, G G; McCluskey, A H; Abbott, K A; Revich, G G; Beattie, K L

    1984-01-01

    A method has been developed for simultaneous comparison of the propensity of a DNA polymerase to misincorporate at different points on a natural template-primer. In this method elongation of a [5'-32P] primer, annealed to a bacteriophage template strand, is carried out in the presence of only three dNTPs (highly purified by HPLC). Under these conditions the rate of primer elongation (monitored by gel electrophoresis/autoradiography) is limited by the rate of misincorporation at template positions complementary to the missing dNTP. Variations in the rate of elongation (revealed by autoradiographic banding patterns) reflect variations in the propensity for misincorporation at different positions along the template. The effect on primer elongation produced by addition of a chemically modified dNTP to 'minus' reactions reveals the mispairing potential of the modified nucleotide during DNA synthesis. By use of this electrophoretic assay of misincorporation we have demonstrated that the fidelity of E. coli DNA polymerase I varies greatly at different positions along a natural template, and that BrdUTP and IodUTP can be incorporated in place of dCTP during chain elongation catalyzed by this enzyme. Images PMID:6326053

  3. Membrane clarification of tea extracts.

    PubMed

    Subramanian, R; Kumar, Chandini S; Sharma, Pankaj

    2014-01-01

    The ready-to-drink (RTD) tea beverages are becoming increasingly popular owing to the health benefits associated with tea polyphenols, but instability due to development of haze and formation of tea cream is a common problem encountered in the product. Membrane technology provides a scope to produce natural, additive-free RTD teas while overcoming the major disadvantages associated with the conventional decreaming methods. Approaches employing membranes for the clarification of extracts from black and green tea have been discussed together with their relative advantages and limitations. The article also outlines the concerns to be addressed in the future attempts employing membrane technology. PMID:24499147

  4. In vivo measurement of unscheduled DNA synthesis and S-phase synthesis as an indicator of hepatocarcinogenesis in rodents.

    PubMed

    Mirsalis, J C

    1987-06-01

    Measurement of chemically induced DNA repair as unscheduled DNA synthesis in rodent liver following in vivo treatment is a useful screen for potential hepatocarcinogens. In addition to measurement of unscheduled DNA synthesis, examination of S-phase synthesis provides an indicator of chemically induced cell proliferation in the liver, which may be a basis for hepatic tumor promotion. Several chemicals and classes of chemicals have been examined using these end points. The pyrrolizidine alkaloid riddelline is a potent genotoxic agent in vitro, and in vivo studies confirm this response as riddelline induces significant elevations in unscheduled DNA synthesis and S-phase synthesis in rat liver. Conversely, H.C. Blue dyes #1 and #2 are both potent genotoxic agents in vitro but fail to express this genotoxicity in vivo. H.C. Blue #1 induces significant increases in S-phase synthesis in B6C3F1 mouse liver, which correlates with the observed carcinogenicity of this compound. Halogenated hydrocarbons likewise fail to induce unscheduled DNA synthesis in vivo, but many of these compounds do increase hepatic cell proliferation in mice, which may be the principal mechanism of hepatocarcinogenesis in this species. PMID:3507253

  5. Structural basis of high-fidelity DNA synthesis by yeast DNA polymerase [delta

    SciTech Connect

    Swan, Michael K.; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2009-09-25

    DNA polymerase {delta} (Pol {delta}) is a high-fidelity polymerase that has a central role in replication from yeast to humans. We present the crystal structure of the catalytic subunit of yeast Pol {delta} in ternary complex with a template primer and an incoming nucleotide. The structure, determined at 2.0-{angstrom} resolution, catches the enzyme in the act of replication, revealing how the polymerase and exonuclease domains are juxtaposed relative to each other and how a correct nucleotide is selected and incorporated. The structure also reveals the 'sensing' interactions near the primer terminus, which signal a switch from the polymerizing to the editing mode. Taken together, the structure provides a chemical basis for the bulk of DNA synthesis in eukaryotic cells and a framework for understanding the effects of cancer-causing mutations in Pol {delta}.

  6. Relationship between DNA adduct formation and unscheduled DNA synthesis (UDS) in cultured mouse epidermal keratinocytes

    SciTech Connect

    Gill, R.D.; Nettikumara, A.N.; DiGiovanni, J. ); Butterworth, B.E. )

    1991-01-01

    Primary cultures of mouse epidermal keratinocytes from SENCAR mice were treated with 7,12-dimethylbenz(a)anthracene (DMBA), benzo(a)pyrene (B(a)P), ({plus minus}) 7{beta}-8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus}) anti-BPDE), and ({plus minus}) 7{beta},8{alpha}-dihydroxy-9{beta},10{beta}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus})syn-BPDE) to examine the relationship between DNA adduct formation and the induction of unscheduled DNA synthesis (UDS). DNA adducts were measured as pmol hydrocarbon bound per mg of DNA, and UDS was quantitated autoradiographically as net grains per nucleus. A good correlation was observed between the levels of UDS detected and the amount of DNA adducts present int he cell population when comparing similar compounds within the linear dose-response range of 0.005 {mu}g/ml-0.25 {mu}g/ml. These results suggest that the present UDS assay with MEKs is a useful assay for the rapid screening of potential genotoxic agents. However, the limits of sensitivity are such that the current assay may be unable to detect a low level of DNA damage induced by some weakly genotoxic (carcinogenic) agents. In addition, while the limits of sensitivity determined in these experiments apply to the polycyclic aromatic hydrocarbon class, other classes of genotoxic compounds such as alkylating agents or crosslinking agents may exhibit different thresholds of detection.

  7. Synthesis and self-assembly of DNA-chromophore hybrid amphiphiles.

    PubMed

    Albert, Shine K; Golla, Murali; Thelu, Hari Veera Prasad; Krishnan, Nithiyanandan; Deepak, Perapaka; Varghese, Reji

    2016-08-01

    DNA based spherical nanostructures are one of the promising nanostructures for several biomedical and biotechnological applications due to their excellent biocompatibility and DNA-directed surface addressability. Herein, we report the synthesis and amphiphilicity-driven self-assembly of two classes of DNA (hydrophilic)-chromophore (hydrophobic) hybrid amphiphiles into spherical nanostructures. A solid-phase "click" chemistry based modular approach is demonstrated for the synthesis of DNA-chromophore amphiphiles. Various spectroscopic and microscopic analyses reveal the self-assembly of the amphiphiles into vesicular and micellar assemblies with the corona made of hydrophilic DNA and the hydrophobic chromophoric unit as the core of the spherical nanostructures. PMID:27241196

  8. Integrating S-phase Checkpoint Signaling with Trans-Lesion Synthesis of Bulky DNA Adducts

    PubMed Central

    Barkley, Laura R.; Ohmori, Haruo; Vaziri, Cyrus

    2011-01-01

    Bulky adducts are DNA lesions generated in response to environmental agents including benzo[a]pyrene (a combustion product) and solar ultraviolet radiation. Error-prone replication of adducted DNA can cause mutations, which may result in cancer. To minimize the detrimental effects of bulky adducts and other DNA lesions, S-phase checkpoint mechanisms sense DNA damage and integrate DNA repair with ongoing DNA replication. The essential protein kinase Chk1 mediates the S-phase checkpoint, inhibiting initiation of new DNA synthesis and promoting stabilization and recovery of stalled replication forks. Here we review the mechanisms by which Chk1 is activated in response to bulky adducts and potential mechanisms by which Chk1 signaling inhibits the initiation stage of DNA synthesis. Additionally, we discuss mechanisms by which Chk1 signaling facilitates bypass of bulky lesions by specialized Y-family DNA polymerases, thereby attenuating checkpoint signaling and allowing resumption of normal cell cycle progression. PMID:17652783

  9. Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

    SciTech Connect

    Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

    1982-12-01

    Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-dalton DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.

  10. Unscheduled DNA Synthesis: The Clinical and Functional Assay for Global Genomic DNA Nucleotide Excision Repair

    PubMed Central

    Latimer, Jean J.; Kelly, Crystal M.

    2016-01-01

    The unscheduled DNA synthesis (UDS) assay measures the ability of a cell to perform global genomic nucleotide excision repair (NER). This chapter provides instructions for the application of this technique by creating 6-4 photoproducts and pyrimidine dimers using UV-C irradiation. This procedure is designed specifically for quantification of the 6-4 photoproducts. Repair is quantified by the amount of radioactive thymidine incorporated during repair synthesis after this insult, and radioactivity is evaluated by grain counting after autoradiography. The results are used to clinically diagnose human DNA repair deficiency disorders and provide a basis for investigation of repair deficiency in human tissues or tumors. No other functional assay is available that directly measures the capacity to perform NER on the entire genome without the use of specific antibodies. Since live cells are required for this assay, explant culture techniques must be previously established. Host cell reactivation (HCR), as discussed in Chapter 37, is not an equivalent technique, as it measures only transcription-coupled repair (TCR) at active genes, a small subset of total NER. PMID:24623250

  11. Synthesis and properties of mirror-image DNA.

    PubMed Central

    Urata, H; Ogura, E; Shinohara, K; Ueda, Y; Akagi, M

    1992-01-01

    We have investigated the conformations of the hexadeoxyribonucleotide, L-d(CGCGCG) composed of L-deoxyribose, the mirror image molecule of natural D-deoxyribose. In this paper, we report the synthesis of four L-deoxynucleosides and the L-oligonucleotide-ethidium bromide interactions. The L-deoxyribose synthon 9 was synthesized from L-arabinose with an over all yield of 28.5% via the Barton-McCombie reaction. The L-deoxynucleosides were obtained by a glycosylation of appropriate nucleobase derivatives with the 1-chloro sugar 9. After derivatization to nucleoside phosphoramidites, L-deoxycytidine and L-deoxyguanosine were incorporated into a hexadeoxynucleotide, L-d(CGCGCG) by a solid-phase beta-cyanoethylphosphoramidite method. This L-hexanucleotide was resistant to digestion with nuclease P1. The conformations of L-d(CGCGCG) were an exact mirror image of that of the corresponding natural one as described previously, and the conformations of the L-d(CGCGCG)-ethidium bromide complex were also the mirror images of those of the D-d(CGCGCG)-ethidium bromide complex under both low and high salt conditions. These results suggest that ethidium bromide prefers not a right-handed helical sense, but the base-base stacking geometry of the B-form rather than that of the Z-form. Thus, L-DNA would be a useful tool for studying DNA-drug interactions. PMID:1630904

  12. Method and apparatus for synthesis of arrays of DNA probes

    DOEpatents

    Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland

    2002-04-23

    The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.

  13. Sequence rearrangement and duplication of double stranded fibronectin cDNA probably occurring during cDNA synthesis by AMV reverse transcriptase and Escherichia coli DNA polymerase I.

    PubMed Central

    Fagan, J B; Pastan, I; de Crombrugghe, B

    1980-01-01

    Two cloned cDNAs derived from the mRNA for cell fibronectin have been sequenced, providing evidence that transcription with AMV reverse transcriptase or Escherichia coli DNA polymerase I may not always result in double stranded cDNA that is exactly homologous with its mRNA template. Instead, the sequences of these cloned cDNAs are consistent with the duplication and rearrangement of sequences during synthesis of double stranded cDNA. PMID:6159581

  14. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells.

    PubMed

    Canitrot, Y; Hoffmann, J S; Calsou, P; Hayakawa, H; Salles, B; Cazaux, C

    2000-09-01

    The nucleotide excision repair pathway contributes to genetic stability by removing a wide range of DNA damage through an error-free reaction. When the lesion is located, the altered strand is incised on both sides of the lesion and a damaged oligonucleotide excised. A repair patch is then synthesized and the repaired strand is ligated. It is assumed that only DNA polymerases delta and/or epsilon participate to the repair DNA synthesis step. Using UV and cisplatin-modified DNA templates, we measured in vitro that extracts from cells overexpressing the error-prone DNA polymerase beta exhibited a five- to sixfold increase of the ultimate DNA synthesis activity compared with control extracts and demonstrated the specific involvement of Pol beta in this step. By using a 28 nt gapped, double-stranded DNA substrate mimicking the product of the incision step, we showed that Pol beta is able to catalyze strand displacement downstream of the gap. We discuss these data within the scope of a hypothesis previously presented proposing that excess error-prone Pol beta in cancer cells could perturb the well-defined specific functions of DNA polymerases during error-free DNA transactions. PMID:10973926

  15. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  16. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  17. Radiation effects on DNA synthesis in a defined chromosomal replicon

    SciTech Connect

    Larner, J.M.; Lee, H.; Hamlin, J.L. )

    1994-03-01

    It has recently been shown that the tumor suppressor p53 mediates a signal transduction pathway that responds to DNA damage by arresting cells in the late G[sub 1] period of the cell cycle. However, the operation of this pathway alone cannot explain the 50% reduction in the rate of DNA synthesis that occurs within 30 min of irradiation of an asynchronous cell population. The authors are using the amplified dihydrofolate reductase (DHFR) domain in the methotrexate-resistance CHO cell line, CHOC 400, as a model replicon in which to study this acute radiation effect. They first show that the CHOC-400 cell line retains the classical acute-phase response but does not display the late G[sub 1] arrest that characterizes the p53-mediated checkpoint. Using a two-dimensional gel replicon-mapping method, they then show that when asynchronous cultures are irradiated with 900 cGy, initiation in the DHFR locus is completely inhibited within 30 min and does not resume for 3 to 4 h. Since initiation in this locus occurs throughout the first 2 h of the S period, this result implies the existence of a p53-independent S-phase damage-sensing pathway that functions at the level of individual origins. Results obtained with the replication inhibitor mimosine define a position near the G[sub 1]/S boundary beyond which cells are unable to prevent initiation at early-firing origins in response to irradiation. This is the first direct demonstration at a defined chromosomal origin that radiation quantitatively down-regulates initiation. 42 refs., 9 figs.

  18. DNA synthesis in yeast cell-free extracts dependent on recombinant DNA plasmids purified from Escherichia coli.

    PubMed Central

    Jong, A Y; Scott, J F

    1985-01-01

    In our attempts to establish a cell-free DNA replication system for the yeast Saccharomyces cerevisiae, we have observed that recombinant DNA plasmids purified from Escherichia coli by a common procedure (lysozyme-detergent lysis and equilibrium banding in cesium chloride ethidium bromide gradients) often serve as templates for DNA synthesis by elongation enzymes. The templates could be elongated equally well by enzymes present in the yeast cell-free extracts, by the large proteolytic fragment of E. coli DNA polymerase I or by T4 DNA polymerase. The template activity of the purified plasmids was dependent on the presence of heterologous DNA segments in the bacterial vectors. The template activity could be diminished by treatment with alkali. We propose that the ability of recombinant plasmids isolated from bacterial hosts to serve as elongation templates may lead to erroneous conclusions when these plasmids are used as templates for in vitro replication or transcription reactions. Images PMID:3889851

  19. Short-step chemical synthesis of DNA by use of MMTrS group for protection of 5'-hydroxyl group.

    PubMed

    Shiraishi, Miyuki; Utagawa, Eri; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

    2007-01-01

    4-methoxytrithylthio (MMTrS) group was applied for the appropriately protected four canonical nucleosides. We prepared the phosphoroamidite units by use of these nucleosides and developed the synthesis of oligodeoxynucleotides without any acidic treatment. Moreover, the new DNA synthesis protocol was applied to an automated DNA synthesizer for the synthesis of longer oligodeoxynucleotides. PMID:18029620

  20. RecG Directs DNA Synthesis during Double-Strand Break Repair

    PubMed Central

    Azeroglu, Benura; Mawer, Julia S. P.; Cockram, Charlotte A.; White, Martin A.; Hasan, A. M. Mahedi; Filatenkova, Milana; Leach, David R. F.

    2016-01-01

    Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR) that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300), arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability. PMID:26872352

  1. Inhibitory effect of benzene metabolites on nuclear DNA synthesis in bone marrow cells

    SciTech Connect

    Lee, E.W.; Johnson, J.T.; Garner, C.D. )

    1989-01-01

    Effects of endogenously produced and exogenously added benzene metabolites on the nuclear DNA synthetic activity were investigated using a culture system of mouse bone marrow cells. Effects of the metabolites were evaluated by a 30-min incorporation of ({sup 3}H)thymidine into DNA following a 30-min interaction with the cells in McCoy's 5a medium with 10% fetal calf serum. Phenol and muconic acid did not inhibit nuclear DNA synthesis. However, catechol, 1,2,4-benzenetriol, hydroquinone, and p-benzoquinone were able to inhibit 52, 64, 79, and 98% of the nuclear DNA synthetic activity, respectively, at 24 {mu}M. In a cell-free DNA synthetic system, catechol and hydroquinone did not inhibit the incorporation of ({sup 3}H)thymidine triphosphate into DNA up to 24 {mu}M but 1,2,4-benzenetriol and p-benzoquinone did. The effect of the latter two benzene metabolites was completely blocked in the presence of 1,4-dithiothreitol (1 mM) in the cell-free assay system. Furthermore, when DNA polymerase {alpha}, which requires a sulfhydryl (SH) group as an active site, was replaced by DNA polymerase 1, which does not require an SH group for its catalytic activity, p-benzoquinone and 1,2,4-benzenetriol were unable to inhibit DNA synthesis. Thus, the data imply the p-benzoquinone and 1,2,4-benzenetriol inhibited DNA polymerase {alpha}, consequently resulting in inhibition of DNA synthesis in both cellular and cell-free DNA synthetic systems. The present study identifies catechol, hydroquinone, p-benzoquinone, and 1,2,4-benzenetriol as toxic benzene metabolites in bone marrow cells and also suggests that their inhibitory action on DNA synthesis is mediated by mechanism(s) other than that involving DNA damage as a primary cause.

  2. Inhibition of mouse peritoneal macrophage DNA synthesis by infection with the arenavirus Pichinde.

    PubMed Central

    Friedlander, A M; Jahrling, P B; Merrill, P; Tobery, S

    1984-01-01

    Macrophage DNA synthesis and proliferation occur during the development of cell-mediated immunity and in the early nonspecific reaction to infection. Arenaviruses have a predilection for infection of cells of the reticuloendothelial system, and in this study we have examined the effect of the arenavirus Pichinde on macrophage DNA synthesis. We have found that infection of mouse peritoneal macrophages with Pichinde caused a profound dose-dependent inhibition of the DNA synthesis induced by macrophage growth factor-colony stimulating factor. At a multiplicity of inoculum of 5, there is a 75 to 95% inhibition of DNA synthesis. Viable virus is necessary for inhibition since Pichinde inactivated by heat or cobalt irradiation had no effect. Similarly, virus pretreated with an antiserum to Pichinde was without inhibitory effect. Inhibition was demonstrated by measuring DNA synthesis spectrofluorometrically as well as by [3H]thymidine incorporation. The inhibition of DNA synthesis was not associated with any cytopathology. There was no evidence that the inhibition was due to soluble factors, such as prostaglandins or interferon, released by infected cells. These studies demonstrate, for the first time in vitro, a significant alteration in macrophage function caused by infection with an arenavirus. It is possible that inhibition of macrophage proliferation represents a mechanism by which some microorganisms interfere with host resistance. PMID:6690404

  3. Values Clarification: Your Job or Mine?

    ERIC Educational Resources Information Center

    McGough, Kris

    1977-01-01

    The author criticizes values clarification techniques done without parental consent in non-elective courses because they invade privacy, lead to ethical relativism, and have the potential to damage children's ego-strength. (Author/AV)

  4. Synthesis, integration, and restriction and modification of mycoplasma virus L2 DNA

    SciTech Connect

    Dybvig, K.

    1981-01-01

    Mycoplasma virus L2 is an enveloped, nonlytic virus containing double-stranded, superhelical DNA. The L2 virion contains about 7 to 8 major proteins identified by SDS-polyacrylamide gel electrophoresis, but the virion has no discernible capsid structure. It has been suggested that the L2 virion is a DNA-protein condensation surrounded by a lipid-protein membrane. The host for mycoplasma virus L2 is Acholeplasma laidlawii. A. laidlawii has no cell wall and contains a small genome, 1 x 10/sup 9/ daltons, which is two to three times smaller than that of most bacteria. Infection of A. laidlawii by L2 is nonlytic. The studies in this thesis show that L2 DNA synthesis begins at about 1 hour of infection and lasts throughout the infection. Viral DNA synthesis is inhibited by chloramphenicol, streptomycin, and novobiocin. Packaging of L2 DNA into progeny virus is also inhibited by chloramphenicol and novobiocin. It is concluded that protein synthesis and probably DNA gyrase activity are required for L2 DNA synthesis, and for packaging of L2 DNA into progeny virus. DNA-DNA hybridization studies demonstrate that L2 DNA integrates into the host cell during infection, and subsequent to infection the cells are mycoplasma virus L2 lysogens. The viral site of integration has been roughly mapped. L2 virus is restricted and modified by A. laidlawii strains JA1 and K2. The nature of the modification in strain K2 has been elucidated. Two L2 variants containing insertions in the viral DNA were identified in these studies. Restriction endonuclease cleavage maps of these variants have been determined. DNA from L2 and another isolate of L2, MV-Lg-L 172, are compared in these studies. 74 references, 33 figures, 6 tables. (ACR)

  5. DNA SYNTHESIS IN THE FERTILIZING HAMSTER SPERM NUCLEUS: SPERM TEMPLATE AVAILABILITY AND EGG CYTOPLASMIC CONTROL

    EPA Science Inventory

    To assess the role of sperm template availability in the regulation of DNA synthesis, the morphological status of the fertilizing hamster sperm nucleus was correlated with its ability to synthesize DNA after in vivo and in vitro fertilization. Fertilized hamster eggs were incubat...

  6. Requirement of E. coli DNA synthesis functions for the lytic replication of bacteriophage P1.

    PubMed

    Hay, N; Cohen, G

    1983-11-01

    P1 lytic growth was examined in a number of different temperature sensitive mutants of E. coli that affect chromosomal replication. Growth was analyzed by measurements of phage burst sizes and specific DNA synthesis. Efficient P1 growth required each of the bacterial elongation functions dnaE (polC), dnaZ (sub units of E. coli polymerase III holoenzyme), and dnaG (primase) but was not dependent on the elongation function dnaB (mobile promoter). Of two initiation functions tested the dnaA function was found to be dispensable for normal growth whereas the dnaC function was essential. Temperature shift experiments with different dnaC mutants showed that the initiation component of the dnaC function was needed continuously throughout at least the first half of the lytic cycle, while the dnaC elongation activity was probably required during the entire cycle for normal phage yields. In two respects the dependence of P1 lytic growth on E. coli DNA synthesis functions was significantly different from that reported for P1 plasmid replication (Scott and Vapnek, 1980). Thus, lytic replication was far more dependent on a functional polC gene product than was plasmid replication and did not require the bacterial dnaB product. PMID:6359668

  7. Cellular integrity is required for inhibition of initiation of cellular DNA synthesis by reovirus type 3.

    PubMed Central

    Roner, M R; Cox, D C

    1985-01-01

    Synchronized HeLa cells, primed for entry into the synthesis phase by amethopterin, were prevented from initiating DNA synthesis 9 h after infection with reovirus type 3. However, nuclei isolated from synchronized cells infected with reovirus for 9 or 16 h demonstrated a restored ability to synthesize DNA. The addition of enucleated cytoplasmic extracts from infected or uninfected cells did not affect this restored capacity for synthesis. The addition of ribonucleotide triphosphates to nuclei isolated from infected cells stimulated additional DNA synthesis, suggesting that these nuclei were competent to initiate new rounds of DNA replication. Permeabilization of infected cells did not restore the ability of these cells to synthesize DNA. Nucleoids isolated from intact or permeabilized cells, infected for 9 or 16 h displayed an increased rate of sedimentation when compared with nucleoids isolated from uninfected cells. Nucleoids isolated from the nuclei of infected cells demonstrated a rate of sedimentation similar to that of nucleoids isolated from the nuclei of uninfected cells. The inhibition of initiation of cellular DNA synthesis by reovirus type 3 appears not to have been due to a permanent alteration of the replication complex, but this inhibition could be reversed by the removal of that complex from factors unique to the structural or metabolic integrity of the infected cell. Images PMID:3968718

  8. Effects of 3-aminobenzamide on DNA synthesis and cell cycle progression in Chinese hamster ovary cells

    SciTech Connect

    Schwartz, J.L.; Morgan, W.F.; Kapp, L.N.; Wolff, S.

    1983-01-01

    3-Aminobenzamide (3AB), in inhibitor of poly(ADP-ribose) polymerase, is a potent inducer of sister chromatid exchanges (SCEs). Because of the possible relation between SCEs and DNA synthesis, the effects of 3AB on DNA synthesis and cell cycle progression in Chinese hamster ovary (CHO) cells were examined. Unlike all other SCE-inducing agents whose effects on DNA synthesis have been studied, short term exposures (30-120 min) of 3AB did not inhibit the overall rate of DNA synthesis and this result was independent of the amount of bromodeoxyuridine (BrdU) in the DNA. Longer exposure times (>24 h) did result in an extended S phase, but this was not due to an effect on the rate of DNA chain elongation. 3AB also delayed the entry of cells into S phase. The overall cell cycle delay was dose dependent, approaching 9 h after a 54 h exposure to 10 mM 3AB. Earlier reports that 3AB is neither mutagenic nor cytotoxic were confirmed. Thus 3AB acts to increase SCE frequency by a mechanism distinct from that which causes cytotoxicity and mutagenicity, and does not involve any inhibition in the rate of DNA chain growth. 25 references, 3 figures, 2 tables.

  9. Long-lived crowded-litter mice have an age-dependent increase in protein synthesis to DNA synthesis ratio and mTORC1 substrate phosphorylation

    PubMed Central

    Bruns, Danielle R.; Peelor, Frederick F.; Biela, Laurie M.; Miller, Richard A.; Hamilton, Karyn L.; Miller, Benjamin F.

    2014-01-01

    Increasing mouse litter size [crowded litter (CL)] presumably imposes a transient nutrient stress during suckling and extends lifespan through unknown mechanisms. Chronic calorically restricted and rapamycin-treated mice have decreased DNA synthesis and mTOR complex 1 (mTORC1) signaling but maintained protein synthesis, suggesting maintenance of existing cellular structures. We hypothesized that CL would exhibit similar synthetic and signaling responses to other long-lived models and, by comparing synthesis of new protein to new DNA, that insight may be gained into the potential preservation of existing cellular structures in the CL model. Protein and DNA synthesis was assessed in gastroc complex, heart, and liver of 4- and 7-mo CL mice. We also examined mTORC1 signaling in 3- and 7-mo aged animals. Compared with controls, 4-mo CL had greater DNA synthesis in gastroc complex with no differences in protein synthesis or mTORC1 substrate phosphorylation across tissues. Seven-month CL had less DNA synthesis than controls in heart and greater protein synthesis and mTORC1 substrate phosphorylation across tissues. The increased new protein-to-new DNA synthesis ratio suggests that new proteins are synthesized more so in existing cells at 7 mo, differing from 4 mo, in CL vs. controls. We propose that, in CL, protein synthesis shifts from being directed toward new cells (4 mo) to maintenance of existing cellular structures (7 mo), independently of decreased mTORC1. PMID:25205819

  10. The DNA intercalating alkaloid cryptolepine interferes with topoisomerase II and inhibits primarily DNA synthesis in B16 melanoma cells.

    PubMed

    Bonjean, K; De Pauw-Gillet, M C; Defresne, M P; Colson, P; Houssier, C; Dassonneville, L; Bailly, C; Greimers, R; Wright, C; Quetin-Leclercq, J; Tits, M; Angenot, L

    1998-04-14

    Cryptolepine hydrochloride is an indoloquinoline alkaloid isolated from the roots of Cryptolepis sanguinolenta. It is characterized by a multiplicity of host-mediated biological activities, including antibacterial, antiviral, and antimalarial properties. To date, the molecular basis for its diverse biological effects remains largely uncertain. Several lines of evidence strongly suggest that DNA might correspond to its principal cellular target. Consequently, we studied the strength and mode of binding to DNA of cryptolepine by means of absorption, fluorescence, circular, and linear dichroism, as well as by a relaxation assay using DNA topoisomerases. The results of various optical and gel electrophoresis techniques converge to reveal that the alkaloid binds tightly to DNA and behaves as a typical intercalating agent. In DNAase I footprinting experiments it was found that the drug interacts preferentially with GC-rich sequences and discriminates against homo-oligomeric runs of A and T. This study has also led to the discovery that cryptolepine is a potent topoisomerase II inhibitor and a promising antitumor agent. It stabilizes topoisomerase II-DNA covalent complexes and stimulates the cutting of DNA at a subset of preexisting topoisomerase II cleavage sites. Taking advantage of the fluorescence of the indoloquinoline chromophore, fluorescence microscopy was used to map cellular uptake of the drug. Cryptolepine easily crosses the cell membranes and accumulates selectively into the nuclei rather than in the cytoplasm of B16 melanoma cells. Quantitative analyses of DNA in cells after Feulgen reaction and image cytometry reveal that the drug blocks the cell cycle in G2/M phases. It is also shown that the alkaloid is more potent at inhibiting DNA synthesis rather than RNA and protein synthesis. Altogether, the results provide direct evidence that DNA is the primary target of cryptolepine and suggest that this alkaloid is a valid candidate for the development of tumor

  11. Fractional synthesis rates of DNA and protein in rabbit skin are not correlated.

    PubMed

    Zhang, Xiao-jun; Chinkes, David L; Wu, Zhanpin; Martini, Wenjun Z; Wolfe, Robert R

    2004-09-01

    We developed a method for measurement of skin DNA synthesis, reflecting cell division, in conscious rabbits by infusing D-[U-(13)C(6)]glucose and L-[(15)N]glycine. Cutaneous protein synthesis was simultaneously measured by infusion of L-[ring-(2)H(5)]phenylalanine. Rabbits were fitted with jugular venous and carotid arterial catheters, and were studied during the infusion of an amino acid solution (10% Travasol). The fractional synthetic rate (FSR) of DNA from the de novo nucleotide synthesis pathway, a reflection of total cell division, was 3.26 +/- 0.59%/d in whole skin and 3.08 +/- 1.86%/d in dermis (P = 0.38). The de novo base synthesis pathway accounted for 76 and 60% of the total DNA FSR in whole skin and dermis, respectively; the contribution from the base salvage pathway was 24% in whole skin and 40% in dermis. The FSR of protein in whole skin was 5.35 +/- 4.42%/d, which was greater (P < 0.05) than that in dermis (2.91 +/- 2.52%/d). The FSRs of DNA and protein were not correlated (P = 0.33), indicating that cell division and protein synthesis are likely regulated by different mechanisms. This new approach enables investigations of metabolic disorders of skin diseases and regulation of skin wound healing by distinguishing the 2 principal components of skin metabolism, which are cell division and protein synthesis. PMID:15333735

  12. Human CD4+ T cells require exogenous cystine for glutathione and DNA synthesis

    PubMed Central

    Levring, Trine B.; Kongsbak, Martin; Rode, Anna K. O.; Woetmann, Anders; Ødum, Niels; Bonefeld, Charlotte Menné; Geisler, Carsten

    2015-01-01

    Adaptive immune responses require activation and expansion of antigen-specific T cells. Whereas early T cell activation is independent of exogenous cystine (Cys2), T cell proliferation is dependent of Cys2. However, the exact roles of Cys2 in T cell proliferation still need to be determined. The aim of this study was to elucidate why activated human T cells require exogenous Cys2 in order to proliferate. We activated purified naïve human CD4+ T cells and found that glutathione (GSH) levels and DNA synthesis were dependent on Cys2 and increased in parallel with increasing concentrations of Cys2. Vice-versa, the GSH synthesis inhibitor L-buthionine-sulfoximine (BSO) and inhibition of Cys2 uptake with glutamate inhibited GSH and DNA synthesis in parallel. We further found that thioredoxin (Trx) can partly substitute for GSH during DNA synthesis. Finally, we show that GSH or Trx is required for the activity of ribonucleotide reductase (RNR), the enzyme responsible for generation of the deoxyribonucleotide DNA building blocks. In conclusion, we show that activated human T cells require exogenous Cys2 to proliferate and that this is partly explained by the fact that Cys2 is required for production of GSH, which in turn is required for optimal RNR-mediated deoxyribonucleotide synthesis and DNA replication. PMID:26392411

  13. DNA-Based Synthesis and Assembly of Organized Iron Oxide Nanostructures

    NASA Astrophysics Data System (ADS)

    Khomutov, Gennady B.

    Organized bio-inorganic and hybrid bio-organic-inorganic nanostructures consisting of iron oxide nanoparticles and DNA complexes have been formed using methods based on biomineralization, interfacial and bulk phase assembly, ligand exchange and substitution, Langmuir-Blodgett technique, DNA templating and scaffolding. Interfacially formed planar DNA complexes with water-insoluble amphiphilic polycation or intercalator Langmuir monolayers were prepared and deposited on solid substrates to form immobilized DNA complexes. Those complexes were then used for the synthesis of organized DNA-based iron oxide nanostructures. Planar net-like and circular nanostructures of magnetic Fe3O4 nanoparticles were obtained via interaction of cationic colloid magnetite nanoparticles with preformed immobilized DNA/amphiphilic polycation complexes of net-like and toroidal morphologies. The processes of the generation of iron oxide nanoparticles in immobilized DNA complexes via redox synthesis with various iron sources of biological (ferritin) and artificial (FeCl3) nature have been studied. Bulk-phase complexes of magnetite nanoparticles with biomolecular ligands (DNA, spermine) were formed and studied. Novel nano-scale organized bio-inorganic nanostructures - free-floating sheet-like spermine/magnetite nanoparticle complexes and DNA/spermine/magnetite nanoparticle complexes were synthesized in bulk aqueous phase and the effect of DNA molecules on the structure of complexes was discovered.

  14. Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

    SciTech Connect

    Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

    1985-01-01

    Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.

  15. Further Studies on Bacteriophage T4 DNA Synthesis in Sucrose-Plasmolyzed Cells

    PubMed Central

    Stafford, Mary E.; Reddy, G. Prem Veer; Mathews, Christopher K.

    1977-01-01

    This paper describes several technical improvements in the sucrose-plasmolyzed cell system used in earlier experiments on DNA synthesis in situ with Escherichia coli infected by DNA-defective mutants of bacteriophage T4 (W. L. Collinsworth and C. K. Mathews, J. Virol. 13:908-915, 1974). Using this system, which is based primarily on that of M. G. Wovcha et al. (Proc. Natl. Acad. Sci. U.S.A. 70:2196-2200, 1973), we reinvestigated the properties of mutants bearing lesions in genes 1, 41, and 62, and we resolved some disagreements with data reported from that laboratory. We also asked whether the DNA-delay phenotype of T4 mutants is related to possible early leakage of DNA precursors from infected cells. Such cells display defective DNA synthesis in situ, even when ample DNA precursors are made available. Thus, the lesions associated with these mutations seem to manifest themselves at the level of macromolecular metabolism. Similarly, we examined an E. coli mutant defective in its ability to support T4 production, apparently because of a lesion affecting DNA synthesis (L. Simon et al., Nature [London] 252:451-455). In the plasmolyzed cell system, reduced nucleotide incorporation is seen, indicating also that the genetic defect does not involve DNA precursor synthesis. The plasmolyzed cell system incorporates deoxynucleotide 5′-monophosphates into DNA severalfold more rapidly than the corresponding 5′-triphosphates. This is consistent with the idea that DNA precursor-synthesizing enzymes are functionally organized to shuttle substrates to their sites of utilization. PMID:328926

  16. Genomic assay reveals tolerance of DNA damage by both translesion DNA synthesis and homology-dependent repair in mammalian cells.

    PubMed

    Izhar, Lior; Ziv, Omer; Cohen, Isadora S; Geacintov, Nicholas E; Livneh, Zvi

    2013-04-16

    DNA lesions can block replication forks and lead to the formation of single-stranded gaps. These replication complications are mitigated by DNA damage tolerance mechanisms, which prevent deleterious outcomes such as cell death, genomic instability, and carcinogenesis. The two main tolerance strategies are translesion DNA synthesis (TLS), in which low-fidelity DNA polymerases bypass the blocking lesion, and homology-dependent repair (HDR; postreplication repair), which is based on the homologous sister chromatid. Here we describe a unique high-resolution method for the simultaneous analysis of TLS and HDR across defined DNA lesions in mammalian genomes. The method is based on insertion of plasmids carrying defined site-specific DNA lesions into mammalian chromosomes, using phage integrase-mediated integration. Using this method we show that mammalian cells use HDR to tolerate DNA damage in their genome. Moreover, analysis of the tolerance of the UV light-induced 6-4 photoproduct, the tobacco smoke-induced benzo[a]pyrene-guanine adduct, and an artificial trimethylene insert shows that each of these three lesions is tolerated by both TLS and HDR. We also determined the specificity of nucleotide insertion opposite these lesions during TLS in human genomes. This unique method will be useful in elucidating the mechanism of DNA damage tolerance in mammalian chromosomes and their connection to pathological processes such as carcinogenesis. PMID:23530190

  17. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases.

    PubMed

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-03-15

    New types of double-headed 2'-deoxycytidine 5'-O-triphosphates (dC(XC)TPs) bearing another cytosine or 5-fluorocytosine linked through a flexible propargyl, homopropargyl or pent-1-ynyl linker to position 5 were prepared by the aqueous Sonogashira cross-coupling reactions of 5-iodo-dCTP with the corresponding (fluoro)cytosine-alkynes. The modified dC(XC)TPs were good substrates for DNA polymerases and were used for enzymatic synthesis of cytosine-functionalized DNA by primer extension or PCR. The cytosine- or fluorocytosine-linked DNA probes did not significantly inhibit DNA methyltransferases and did not cross-link to these proteins. PMID:26899597

  18. Regulation of chloroplast number and DNA synthesis in higher plants. Final report, August 1995--August 1996

    SciTech Connect

    Mullet, J.E.

    1997-06-17

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focused on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The research focused on the isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  19. DNA synthesis in mouse brown adipose tissue is under. beta. -adrenergic control

    SciTech Connect

    Rehnmark, S.; Nedergaard, J. )

    1989-02-01

    The rate of DNA synthesis in mouse brown adipose tissue was followed with injections of ({sup 3}H)thymidine. Cold exposure led to a large increase in the rate of ({sup 3}H)thymidine incorporation, reaching a maximum after 8 days, after which the activity abruptly ceased. A series of norepinephrine injections was in itself able to increase ({sup 3}H)thymidine incorporation. When norepinephrine was injected in combination with the {alpha}-adrenergic antagonist phentolamine or with the {beta}-adrenergic antagonist propranolol, the stimulation was fully blocked by propranolol. It is suggested that stimulation of DNA synthesis in brown adipose tissue is a {beta}-adrenergically mediated process and that the tissue is an interesting model for studies of physiological control of DNA synthesis.

  20. CGG repeats associated with DNA instability and chromosome fragility form structures that block DNA synthesis in vitro.

    PubMed Central

    Usdin, K; Woodford, K J

    1995-01-01

    A large increase in the length of a CGG tandem array is associated with a number of triplet expansion diseases, including fragile X syndrome, the most common cause of heritable mental retardation in humans. Expansion results in the appearance of a fragile site on the X chromosome in the region of the CGG array. We show here that CGG repeats readily form a series of barriers to DNA synthesis in vitro. There barriers form only when the (CGG)n strand is used as the template, are K(+)-dependent, template concentration-independent, and involve hydrogen bonding between guanines. Chemical modification experiments suggest these blocks to DNA synthesis result from the formation of a series of intrastrand tetraplexes. A number of lines of evidence suggest that both triplet expansion and chromosome fragility are the result of replication defects. Our data are discussed in the light of such evidence. Images PMID:7479085

  1. Efficient Synthesis of Topologically Linked Three-Ring DNA Catenanes.

    PubMed

    Li, Qi; Wu, Guangqi; Wu, Wei; Liang, Xingguo

    2016-06-16

    Topologically controlled DNA catenanes are promising elements for the construction of molecular machines but present a significant effort in DNA nanotechnology. We report an efficient approach for preparing linear three-ring catenanes (L3C) composed of single-stranded DNA. The linking number was strictly controlled by using short complementary regions (6 nt) between each two DNA rings. High efficiency of forming three-ring catenanes (yield as high as 63 %) was obtained by using an 80 nt oligonucleotide as the scaffold to draw close the three pre-rings for hybridization between short complementary DNA. After assembly, three pre-rings were closed by DNA ligation using three 12 nt oligonucleotides as splints to form interlocked three-ring catenanes. L3C nanostructures were imaged in air by AFM: the catenane exhibited a smooth circular shape and was arranged in a line with well-defined structure, as expected. PMID:27214092

  2. Isolation of Chinese hamster ovary cells with reduced unscheduled DNA synthesis after UV irradiation

    SciTech Connect

    Stefanini, M.; Reuser, A.; Bootsma, D.

    1982-09-01

    A simple procedure has been worked out to obtain UV-sensitive mutants of Chinese hamster ovary (CHO) cells. In this procedure, conventional mutagenesis is followed by BrdU--light treatment to enrich the population for UV-sensitive cells. Colonies that are allowed to form subsequently are duplicated by replica plating and screened on the master plate for their UV sensitivity and their capacity to carry out UV-induced DNA repair synthesis. Putative mutants are isolated from the replica. With this combination of methods, we succeeded in isolating CHO mutants with an 85-95% reduced level of UV-induced DNA synthesis in combination with an increased UV sensitivity.

  3. Stimulation of adrenal DNA synthesis in cadmium-treated male rats

    SciTech Connect

    Nishiyama, S.; Nakamura, K.

    1984-07-01

    Cadmium chloride (CdCl2) at a dose of 1 mg/kg body wt was injected into male rats of the Wistar strain, weighing 250 g on the average, twice a day (12-hr intervals) for 7 consecutive days. DNA and RNA contents and (/sup 3/H)-thymidine and (/sup 3/H)-uridine incorporation into the acid-insoluble fraction significantly increased in the adrenals of rats treated with Cd for 2 and 7 consecutive days. Adrenal protein content and weight also significantly increased. These results indicate that continued treatment with Cd stimulates DNA and RNA synthesis in the adrenal cortex, which in turn results in the increase of the total protein contents of the adrenal gland and subsequently in the enlargement of the gland. Serum adrenocorticotrophin (ACTH) and insulin levels in Cd-treated rats were not higher than control levels, suggesting that the stimulation of DNA synthesis in the adrenals of Cd-treated rats is due to factor(s) other than serum ACTH and insulin. Treatment with Cd inhibited DNA synthesis in cultured adrenocortical cells at concentrations of 10(-4) to 10(-8) M, suggesting that Cd does not directly stimulate DNA synthesis in the adrenal gland in vivo. Although the adrenal gland became enlarged, the total adrenal corticosterone content decreased significantly. The decrease of total adrenal corticosterone content may be due to the fall in serum ACTH level of Cd-treated rats.

  4. In vivo measurement of DNA synthesis rates of colon epithelial cells in carcinogenesis

    SciTech Connect

    Kim, Sylvia Jeewon; Turner, Scott; Killion, Salena; Hellerstein, Marc K. . E-mail: march@nature.berkeley.edu

    2005-05-27

    We describe here a highly sensitive technique for measuring DNA synthesis rates of colon epithelial cells in vivo. Male SD rats were given {sup 2}H{sub 2}O (heavy water). Colon epithelial cells were isolated, DNA was extracted, hydrolyzed to deoxyribonucleosides, and the deuterium enrichment of the deoxyribose moiety was determined by gas chromatographic/mass spectrometry. Turnover time of colon crypts and the time for migration of cells from basal to top fraction of the crypts were measured. These data were consistent with cell cycle analysis and bromodeoxyuridine labeling. By giving different concentrations of a promoter, dose-dependent increases in DNA synthesis rates were detected, demonstrating the sensitivity of the method. Administration of a carcinogen increased DNA synthesis rates cell proliferation in all fractions of the crypt. In conclusion, DNA synthesis rates of colon epithelial cells can be measured directly in vivo using stable-isotope labeling. Potential applications in humans include use as a biomarker for cancer chemoprevention studies.

  5. The Transcription Factor TFII-I Promotes DNA Translesion Synthesis and Genomic Stability

    PubMed Central

    Fattah, Farjana J.; Hara, Kodai; Fattah, Kazi R.; Yang, Chenyi; Wu, Nan; Warrington, Ross; Chen, David J.; Zhou, Pengbo; Boothman, David A.; Yu, Hongtao

    2014-01-01

    Translesion synthesis (TLS) enables DNA replication through damaged bases, increases cellular DNA damage tolerance, and maintains genomic stability. The sliding clamp PCNA and the adaptor polymerase Rev1 coordinate polymerase switching during TLS. The polymerases Pol η, ι, and κ insert nucleotides opposite damaged bases. Pol ζ, consisting of the catalytic subunit Rev3 and the regulatory subunit Rev7, then extends DNA synthesis past the lesion. Here, we show that Rev7 binds to the transcription factor TFII-I in human cells. TFII-I is required for TLS and DNA damage tolerance. The TLS function of TFII-I appears to be independent of its role in transcription, but requires homodimerization and binding to PCNA. We propose that TFII-I bridges PCNA and Pol ζ to promote TLS. Our findings extend the general principle of component sharing among divergent nuclear processes and implicate TLS deficiency as a possible contributing factor in Williams-Beuren syndrome. PMID:24922507

  6. Solid-phase synthesis of DNA binding polyamides on oxime resin.

    PubMed

    Belitsky, J M; Nguyen, D H; Wurtz, N R; Dervan, Peter B

    2002-08-01

    Control of the energetics and specificity of DNA binding polyamides is necessary for inhibition of protein-DNA complex formation and gene regulation studies. Typically, solid-phase methods using Boc monomers for synthesis have depended on Boc-beta-Ala-PAM resin which affords a beta-alanine-Dp tail at the C-terminus, after cleavage with N,N-dimethylaminopropylamine (Dp). To address the energetic consequences of this tail for DNA minor groove binding, we describe an alternative solid phase method employing the Kaiser oxime resin which allows the synthesis of polyamides with incrementally shortened C-terminal tails. Polyamides without Dp and having methyl amide tails rather than beta-alanine show similar affinity relative to the standard beta-Dp tail. The truncated tail diminishes the A,T base pair energetic preference of the beta-Dp tail which will allow a greater variety of DNA sequences to be targeted by hairpin polyamides. PMID:12057666

  7. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics

    PubMed Central

    Yehezkel, Tuval Ben; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-01-01

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  8. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics.

    PubMed

    Ben Yehezkel, Tuval; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-02-29

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  9. Capture of a third Mg²⁺ is essential for catalyzing DNA synthesis.

    PubMed

    Gao, Yang; Yang, Wei

    2016-06-10

    It is generally assumed that an enzyme-substrate (ES) complex contains all components necessary for catalysis and that conversion to products occurs by rearrangement of atoms, protons, and electrons. However, we find that DNA synthesis does not occur in a fully assembled DNA polymerase-DNA-deoxynucleoside triphosphate complex with two canonical metal ions bound. Using time-resolved x-ray crystallography, we show that the phosphoryltransfer reaction takes place only after the ES complex captures a third divalent cation that is not coordinated by the enzyme. Binding of the third cation is incompatible with the basal ES complex and requires thermal activation of the ES for entry. It is likely that the third cation provides the ultimate boost over the energy barrier to catalysis of DNA synthesis. PMID:27284197

  10. Accurate multiplex gene synthesis from programmable DNA microchips

    NASA Astrophysics Data System (ADS)

    Tian, Jingdong; Gong, Hui; Sheng, Nijing; Zhou, Xiaochuan; Gulari, Erdogan; Gao, Xiaolian; Church, George

    2004-12-01

    Testing the many hypotheses from genomics and systems biology experiments demands accurate and cost-effective gene and genome synthesis. Here we describe a microchip-based technology for multiplex gene synthesis. Pools of thousands of `construction' oligonucleotides and tagged complementary `selection' oligonucleotides are synthesized on photo-programmable microfluidic chips, released, amplified and selected by hybridization to reduce synthesis errors ninefold. A one-step polymerase assembly multiplexing reaction assembles these into multiple genes. This technology enabled us to synthesize all 21 genes that encode the proteins of the Escherichia coli 30S ribosomal subunit, and to optimize their translation efficiency in vitro through alteration of codon bias. This is a significant step towards the synthesis of ribosomes in vitro and should have utility for synthetic biology in general.

  11. A euryarchaeal histone modulates strand displacement synthesis by replicative DNA polymerases.

    PubMed

    Sun, Fei; Huang, Li

    2016-07-01

    Euryarchaeota and Crenarchaeota, the two main lineages of the domain Archaea, encode different chromatin proteins and differ in the use of replicative DNA polymerases. Crenarchaea possess a single family B DNA polymerase (PolB), which is capable of strand displacement modulated by the chromatin proteins Cren7 and Sul7d. Euryarchaea have two distinct replicative DNA polymerases, PolB and PolD, a family D DNA polymerase. Here we characterized the strand displacement activities of PolB and PolD from the hyperthermophilic euryarchaeon Pyrococcus furiosus and investigated the influence of HPfA1, a homolog of eukaryotic histones from P. furiosus, on these activities. We showed that both PolB and PolD were efficient in strand displacement. HPfA1 inhibited DNA strand displacement by both DNA polymerases but exhibited little effect on the displacement of a RNA strand annealed to single-stranded template DNA. This is consistent with the finding that HPfA1 bound more tightly to double-stranded DNA than to a RNA:DNA hybrid. Our results suggest that, although crenarchaea and euryarchaea differ in chromosomal packaging, they share similar mechanisms in modulating strand displacement by DNA polymerases during lagging strand DNA synthesis. PMID:27333783

  12. The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

    PubMed

    Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

    2016-05-17

    Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. PMID:27053724

  13. Role of amidation in bile acid effect on DNA synthesis by regenerating mouse liver.

    PubMed

    Barbero, E R; Herrera, M C; Monte, M J; Serrano, M A; Marin, J J

    1995-06-01

    Effect of bile acids on DNA synthesis by the regenerating liver was investigated in mice in vivo after partial hepatectomy (PH). Radioactivity incorporation into DNA after [14C]thymidine intraperitoneal administration peaked at 48 h after PH. At this time a significant taurocholate-induced dose-dependent reduction in DNA synthesis without changes in total liver radioactivity content was found (half-maximal effect at approximately 0.1 mumol/g body wt). Effect of taurocholate (0.5 mumol/g body wt) was mimicked by chocolate, ursodeoxycholate, deoxycholate, dehydrocholate, tauroursodeoxycholate, taurochenodeoxycholate, and taurodeoxycholate. In contrast, chenodeoxycholate, glycocholate, glycochenodeoxycholate, glycoursodeoxycholate, glycodeoxycholate, 5 beta-cholestane, bromosulfophthalein, and free taurine lacked this effect. No relationship between hydrophobic-hydrophilic balance and inhibitory effect was observed. Analysis by high-performance liquid chromatography indicated that inhibition of thymidine incorporation into DNA was not accompanied by an accumulation of phosphorylated DNA precursors in the liver but rather by a parallel increase in nucleotide catabolism. Bile acid-induced modifications in DNA synthesis were observed in vivo even in the absence of changes in toxicity tests, which suggests that the inhibitory effect shared by most unconjugated and tauroconjugated bile acids but not by glycoconjugated bile acids should be accounted for by mechanisms other than nonselective liver cell injury. PMID:7611405

  14. 77 FR 73620 - Procurement List; Additions; Clarification

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-11

    ... SUPPLEMENTARY INFORMATION: The Committee's Notice in the Federal Register of Friday, October 26, 2012 (77 FR 65365-65366), concerning additions to the Procurement List, specified ``Eyewear'' with coverage for 100... PEOPLE WHO ARE BLIND OR SEVERELY DISABLED Procurement List; Additions; Clarification AGENCY:...

  15. 48 CFR 339.201 - Clarification.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY Electronic and Information Technology 339.201 Clarification. FAR Subpart 39.2, Electronic and Information Technology, requires Federal agencies to ensure that... have access to and use of information and data that is comparable to individuals without...

  16. 48 CFR 339.201 - Clarification.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY Electronic and Information Technology 339.201 Clarification. FAR Subpart 39.2, Electronic and Information Technology, requires Federal agencies to ensure that... have access to and use of information and data that is comparable to individuals without...

  17. Bias and Obfuscation in Kendler's (2005) "Clarification"

    ERIC Educational Resources Information Center

    Schneider, Kirk J.

    2006-01-01

    This paper comments on the article "Psychology and Phenomenology: A Clarification" by H. H. Kendler. In this article, Kendler misrepresented contemporary existential-humanistic psychology and conventional (or natural) scientific psychology. With regard to the former, he presented a confused, unwittingly biased, and all-too-stereotypic picture.…

  18. Synthesis of novel MMT/acyl-protected nucleo alanine monomers for the preparation of DNA/alanyl-PNA chimeras

    PubMed Central

    Roviello, G. N.; Gröschel, S.; Pedone, C.

    2009-01-01

    Alanyl-peptide nucleic acid (alanyl-PNA)/DNA chimeras are oligomers envisaged to be beneficial in efficient DNA diagnostics based on an improved molecular beacon concept. A synthesis of alanyl-PNA/DNA chimera can be based on the solid phase assembly of the oligomer with mixed oligonucleotide/peptide backbone under DNA synthesis conditions, in which the nucleotides are introduced as phosphoramidites, whereas the nucleo amino acids make use of the acid labile monomethoxytrityl (MMT) group for temporary protection of the α-amino groups and acyl protecting groups for the exocyclic amino functions of the nucleobases. In this work, we realized for the first time the synthesis of all four MMT/acyl-protected nucleo alanines, achieved by deprotection/reprotection of the newly synthesized Boc/acyl intermediates, useful monomers for the obtainment of (alanyl-PNA)/DNA chimeras by conditions fully compatible with the standard phosphoramidite DNA synthesis strategy. PMID:19629638

  19. Values Clarification: An Aid to Adolescent Religious Education.

    ERIC Educational Resources Information Center

    McEniry, Robert

    1982-01-01

    Focuses on the contribution that values clarification can make to adolescent religious education. Summarizes the tenets of humanistic psychology that provided the matrix for values clarification and describes the substance of values clarification as expressed in its terminology, theory, process and strategies. (JAC)

  20. Effects of starvation and hormones on DNA synthesis in silk gland cells of the silkworm, Bombyx mori.

    PubMed

    Li, Yao-Feng; Chen, Xiang-Yun; Zhang, Chun-Dong; Tang, Xiao-Fang; Wang, La; Liu, Tai-Hang; Pan, Min-Hui; Lu, Cheng

    2016-08-01

    Silk gland cells of silkworm larvae undergo multiple cycles of endomitosis for the synthesis of silk proteins during the spinning phase. In this paper, we analyzed the endomitotic DNA synthesis of silk gland cells during larval development, and found that it was a periodic fluctuation, increasing during the vigorous feeding phase and being gradually inhibited in the next molting phase. That means it might be activated by a self-regulating process after molting. The expression levels of cyclin E, cdt1 and pcna were consistent with these developmental changes. Moreover, we further examined whether these changes in endomitotic DNA synthesis resulted from feeding or hormonal stimulation. The results showed that DNA synthesis could be inhibited by starvation and re-activated by re-feeding, and therefore appears to be dependent on nutrition. DNA synthesis was suppressed by in vivo treatment with 20-hydroxyecdysone (20E). However, there was no effect on DNA synthesis by in vitro 20E treatment or by either in vivo or in vitro juvenile hormone treatment. The levels of Akt and 4E-BP phosphorylation in the silk glands were also reduced by starvation and in vivo treatment with 20E. These results indicate that the activation of endomitotic DNA synthesis during the intermolt stages is related to feeding and DNA synthesis is inhibited indirectly by 20E. PMID:25558018

  1. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.

    PubMed

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A

    2015-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER. PMID:25483071

  2. Assessment of potential damage to DNA in urine of coke oven workers: an assay of unscheduled DNA synthesis.

    PubMed Central

    Roos, F; Renier, A; Ettlinger, J; Iwatsubo, Y; Letourneux, M; Haguenoer, J M; Jaurand, M C; Pairon, J C

    1997-01-01

    OBJECTIVES: A study was conducted in coke oven workers to evaluate the biological consequences of the exposure of these workers, particularly production of potential genotoxic factors. METHODS: 60 coke oven workers and 40 controls were recruited in the same iron and steel works. Exposure to polycyclic aromatic hydrocarbons (PAHs) was assessed by job and measurement of 1-hydroxypyrene (1OHP) in urine samples. An unscheduled DNA synthesis assay was performed on rat pleural mesothelial cells used as a test system to evaluate the effect of the workers' filtered urine on the DNA repair capacity of rat cells to determine whether DNA damaging agents are present in the urine of these workers. RESULTS: Urinary concentrations of 1OHP ranged from 0.06 to 24.2 (mean (SD) 2.1 (3.6)) mumol/mol creatinine in exposed coke oven workers, and from 0.01 to 0.9 in controls (0.12 (0.15)). These high concentrations in coke oven workers reflected recent exposure to PAHs and were in agreement with the assessment of exposure by job. No significant difference was found between coke oven workers and controls in the DNA repair level of rat cells treated with urine samples. However, the rat cell repair capacity decreased with increasing 1OHP concentrations in the exposed population (r = -0.28, P < 0.05). CONCLUSIONS: As high concentrations of 1OHP were found in the urine of some workers, a more stringent control of exposures to PAHs in the workplace is required. Exposure to PAHs was not associated with a clear cut modification of the urinary excretion of DNA damaging factors in this test, as shown by the absence of increased unscheduled DNA synthesis in rat cells. However, impairment of some repair mechanisms by urinary constituents is suspected. PMID:9470892

  3. Lability of DNA polymerase alpha correlated with decreased DNA synthesis and increased age in human cells

    SciTech Connect

    Busbee, D.; Sylvia, V.; Stec, J.; Cernosek, Z.; Norman, J.

    1987-12-01

    DNA excision repair and mitogen-initiated blastogenesis in human cells declined in efficiency as an apparent function of decreased DNA polymerase alpha specific activity with increased age of the cell donor. DNA polymerase alpha isolated from fetal cells contained a single, high-specific-activity enzyme form that could not be further activated and that was stable with regard to enzyme activity and affinity for DNA template-primer. DNA polymerase alpha isolated from adult-derived cells contained both low-specific-activity and high-specific-activity forms. The low-activity enzyme form, which showed low affinity of binding to DNA template-primer, was activated by treatment with phosphatidylinositol, /sup 32/P-ATP, and phosphatidylinositol kinase, resulting in a /sup 32/P-labeled enzyme that exhibited high affinity of binding to DNA template-primer. The activated enzyme was unstable, exhibiting a loss of /sup 32/P-label correlated with the loss of both specific activity and high affinity of binding to DNA template-primer. The data suggest that DNA polymerase alpha isolated from adult-derived human cells has low-activity and high-activity forms. Decreased specific activity of DNA polymerase alpha correlated with increased age of the donor appears to be a function of loss of an enzyme activator molecule resulting in diminished ability of the enzyme to bind DNA template-primer.

  4. Synthesis and characterization of DNA nano-meso-microspheres as drug delivery carriers for intratumoral chemotherapy

    NASA Astrophysics Data System (ADS)

    Enriquez Schumacher, Iris Vanessa

    Conventional cancer chemotherapy results in systemic toxicity which severely limits effectiveness and often adversely affects patient quality of life. There is a need to find new drugs and delivery methods for less toxic therapy. Previous studies concerning DNA complexing with chemotherapy drugs suggest unique opportunities for DNA as a mesosphere drug carrier. The overall objective of this research was devoted to the synthesis and evaluation of novel DNA-drug nano-mesospheres designed for localized chemotherapy via intratumoral injection. My research presents DNA nano-meso-microspheres (DNA-MS) that were prepared using a modified steric stabilization method originally developed in this lab for the preparation of albumin MS. DNA-MS were prepared with glutaraldehyde covalent crosslinking (genipin crosslinking was attempted) through the DNA base pairs. In addition, novel crosslinking of DNA-MS was demonstrated using chromium, gadolinium, or iron cations through the DNA phosphate groups. Covalent and ionic crosslinked DNA-MS syntheses yielded smooth and spherical particle morphologies with multimodal size distributions. Optimized DNA-MS syntheses produced particles with narrow and normal size distributions in the 50nm to 5mum diameter size range. In aqueous dispersions approximately 200% swelling was observed with dispersion stability for more than 48 hours. Typical process conditions included a 1550rpm initial mixing speed and particle filtration through 20mum filters to facilitate preparation. DNA-MS were in situ loaded during synthesis for the first time with mitoxantrone, 5-fluorouracil, and methotrexate. DNA-MS drug incorporation was 12%(w/w) for mitoxantrone, 9%(w/w) for methotrexate, and 5%(w/w) for 5-fluorouracil. In vitro drug release into phosphate buffered saline was observed for over 35 days by minimum sink release testing. The effect of gadolinium crosslink concentration on mitoxantrone release was evaluated at molar equivalences in the range of 20% to

  5. NOREPINEPHRINE AND EPIDERMAL GROWTH FACTOR: DYNAMICS OF THEIR INTERACTION IN THE STIMULATION OF HEPATOCYTE DNA SYNTHESIS

    EPA Science Inventory

    Primary cultures of adult rat hepatocytes are stimulated to enter DNA synthesis by norepinephrine (NE). This stimulation is maximal if the hepatocytes are incubated with NE for more than 12 hr, beginning no later than 2-4 hr after the cells are first plated. After 24 hr in cultur...

  6. EFFECT OF NONGENOTOXIC ENVIRONMENTAL CONTAMINATION ON CHOLESTEROL AND DNA SYNTHESIS IN CULTURED PRIMARY RAT HEPATOCYTES

    EPA Science Inventory

    The effect of certain reputedly non genotoxic agents on cholesterol and DNA synthesis was investigated in cultured rat primary hepatocytes and liver slices. epatocytes in culture were incubated for 48, 60, and 72 hrs with one of the following chemicals; namely, chloroform (CHCl3)...

  7. Heparin effect on DNA synthesis in a murine fibrosarcoma cell line: influence of anionic density

    SciTech Connect

    Piepkorn, M.W.; Daynes, R.A.

    1983-09-01

    The effects of heparin subfractions on DNA synthesis in a murine cutaneous fibrosarcoma cell line were examined. Porcine mucosal heparin was preparatively fractionated for anionic charge density by DEAE-Sephadex chromatography and for molecular weight by Sephadex G-100 filtration. The cell line was plated from confluent monolayer cultures and grown in medium and fetal bovine serum, with or without a heparin fraction at a final concentration of 10 micrograms/ml. At intervals thereafter, the cells were pulsed with (/sup 3/H)thymidine. A low-charge density heparin fraction stimulated (/sup 3/H)thymidine incorporation (cpm/mg protein and cpm/cell) during the first 3 days of growth compared to control values without added heparin, whereas a high-charge density heparin fraction had little of this effect (186 +/- 35% of control vs. 101 +/- 14%, respectively; P less than .05). The augmentation of DNA synthesis observed with the low-charge density fraction correlated with increased proportions of cells in S and G2 phases compared with those of the controls, as determined by flow cytofluorometry. Low- and high-molecular-weight heparin fractions did not significantly alter DNA synthesis. Heparin subfractions are thus heterogeneous with respect to their effect on cellular DNA synthesis in this tumor line.

  8. Synthesis and Properties of Novel Silver-Containing DNA Molecules.

    PubMed

    Eidelshtein, Gennady; Fardian-Melamed, Natalie; Gutkin, Vitaly; Basmanov, Dmitry; Klinov, Dmitry; Rotem, Dvir; Levi-Kalisman, Yael; Porath, Danny; Kotlyar, Alexander

    2016-06-01

    Migration of silver atoms from silver nano-particles selectively to a double-stranded poly(dG)-poly(dC) polymer leads to metallization of the DNA. As a result the DNA molecules become shorter and thicker (higher), as evident from the atomic force microscopy imaging analysis. The metalized molecules can be detected by transmission and scanning electron microscopy in contrast to the initial non-metalized ones. PMID:27116695

  9. Deoxyribonucleotide synthesis and the emergence of DNA in molecular evolution

    NASA Astrophysics Data System (ADS)

    Follmann, Hartmut

    1982-02-01

    DNA replication requires monomeric deoxyribonucleotides, which cannot be regarded as primary products of organic syntheses on a primitive earth. However, the present biosynthetic pathway — reductive elimination of the 2'-OH group from ribonucleotides, catalyzed by ribonucleotide reductases and thioredoxins — suggests an early, polyphyletic combination of protein-nucleotide interactions and metal catalysis. That key process had to precede the upcome of RNA-DNA dualism on the way from RNA-protein protocells to true organisms.

  10. Purification, characterization and biological activity of tulipin, a novel inhibitor of DNA synthesis of plant origin.

    PubMed

    Gasperi-Campani, A; Lorenzoni, E; Abbondanza, A; Perocco, P; Falasca, A I

    1987-01-01

    A DNA synthesis-inhibiting protein (for which the term tulipin is proposed) was isolated from the bulbs of Tulipa sp. The yield ranged from 3.4 to 4.1 per cent of total protein content of the crude extract. Mr, isoelectric point, neutral and amino sugar and amino acid composition were determined. Inhibition of DNA synthesis varied in intact cells according to the cellular types studied, with a minimum ID 50% (concentration giving 50% inhibition) of 400 ng/ml in neuroblastoma cells. The effect was reversible. No effect was obtained in cell-lysate. RNA and protein synthesis were unaffected. The acute toxicity, evaluated in Swiss mice, gave an LD of 6.1 mg/kg body wt. Results of electron microscopy are also given. A second protein, called tulipin 2, has been isolated and partially characterized. PMID:3592627

  11. DNA polymerases drive DNA sequencing-by-synthesis technologies: both past and present

    PubMed Central

    Chen, Cheng-Yao

    2014-01-01

    Next-generation sequencing (NGS) technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. Escherichia coli DNA polymerase I proteolytic (Klenow) fragment was originally utilized in Sanger’s dideoxy chain-terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today’s standard capillary electrophoresis (CE) and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ϕ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ϕ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies. PMID:25009536

  12. Synthesis and evaluation of new spacers for use as dsDNA endcaps

    PubMed Central

    Ng, Pei-Sze; Laing, Brian M.; Balasundarum, Ganesan; Pingle, Maneesh; Friedman, Alan; Bergstrom, Donald E.

    2010-01-01

    A series of aliphatic and aromatic spacer molecules designed to cap the ends of DNA duplexes have been synthesized. The spacers were converted into dimethoxytrityl protected phosphoramidites as synthons for oligonucleotides synthesis. The effect of the spacers on the stability of short DNA duplexes was assessed by melting temperature studies. Endcaps containing amide groups were found to be less stabilizing than the hexaethylene glycol spacer. Endcaps containing either a terthiophene or a naphthalene tetracarboxylic acid dimide were found to be significantly more stabilizing. The former showed a preference for stacking above an A•T base pair. Spacers containing only methylene (-CH2-) and amide (-CONH-) groups interact weakly with DNA and consequently may be optimal for applications that require minimal influence on DNA structure but require a way to hold the ends of double-stranded DNA together. PMID:20715857

  13. DNA (deoxyribonucleic acid) synthesis following microinjection of heterologous sperm and somatic cell nuclei into hamster oocytes

    SciTech Connect

    Naish, S.J.; Perreault, S.D.; Zirkin, B.R.

    1987-01-01

    The authors investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in /sup 3/H-thymidine after being parthenogenetically activated by sham microinjection, or microinjected with hamster, mouse, rabbit, or fish sperm nuclei, or hamster hepatocyte nuclei. Within 6 hr of sham or nucleus microinjection, nuclei of each type underwent transformation into pronuclei and synthesized DNA. These results demonstrated that the hamster egg can access and utilize its own and each type of template provided, whether homologous or heterologous. However, pronuclei derived from hamster sperm nuclei were more likely to be synthesizing DNA at 6 hr than pronuclei derived from sperm nuclei of other species. The authors conclude that the mechanisms employed by the hamster oocyte to transform hamster sperm nuclei into pronuclei and to effect DNA synthesis in these nuclei are not specific for the hamster sperm nucleus. Nevertheless, these mechanisms apparently operate more efficiently when the hamster sperm nucleus, rather than a heterologous sperm nucleus, is present.

  14. In vivo effects of T-2 mycotoxin on synthesis of proteins and DNA in rat tissues

    SciTech Connect

    Thompson, W.L.; Wannemacher, R.W. Jr. )

    1990-09-15

    Rats were given an ip injection of T-2 mycotoxin (T-2), the T-2 metabolite, T-2 tetraol (tetraol), or cycloheximide. Serum, liver, heart, kidney, spleen, muscle, and intestine were collected at 3, 6, and 9 hr postinjection after a 2-hr pulse at each time with (14C)leucine and (3H)thymidine. Protein and DNA synthesis levels in rats were determined by dual-label counting of the acid-precipitable fraction of tissue homogenates. Rats given a lethal dose of T-2, tetraol, or cycloheximide died between 14 and 20 hr. Maximum inhibition of protein synthesis at the earliest time period was observed in additional rats given the same lethal dose of the three treatments and continued for the duration of the study (9 hr). With sublethal doses of T-2 or tetraol, the same early decrease in protein synthesis was observed but, in most of the tissues, recovery was seen with time. In the T-2-treated rats. DNA synthesis in the six tissues studied was also suppressed, although to a lesser degree. With sublethal doses, complete recovery of DNA synthesis took place in four of the six tissues by 9 hr after toxin exposure. The appearance of newly translated serum proteins did not occur in the animals treated with T-2 mycotoxin or cycloheximide, as evidenced by total and PCA-soluble serum levels of labeled leucine. An increase in tissue-pool levels of free leucine and thymidine in response to T-2 mycotoxin was also noted. T-2 mycotoxin, its metabolite, T-2 tetraol, and cycloheximide cause a rapid inhibition of protein and DNA synthesis in all tissue types studied. These results are compared with the responses seen in in vitro studies.

  15. Structural specificity of steroids in stimulating DNA synthesis and protooncogene expression in primary rat hepatocyte cultures.

    PubMed

    Lee, C H; Edwards, A M

    2002-05-01

    Among the chemical compounds of varied structure which possess liver tumour-promoting are steroids, such as estrogens, pregnenolone derivatives and anabolic steroids. Although the mechanism(s) of tumour promotion in liver by these xenobiotics is not well understood, it is clear that growth stimulation is one important element in their action. As a basis for better defining whether steroids stimulate growth by a common mechanism or fall into sub-groups with differing actions, the effects of 46 steroids on DNA synthesis and the expression of protooncogenes c-fos and c-myc were examined in primary cultures of normal rat hepatocytes. Tentative groupings of steroids have been identified based on apparent structural requirements for stimulation of DNA synthesis, and effects of auxiliary factors in modulating this growth stimulus. For a "progestin" group, insulin appeared to be permissive for stimulation of DNA synthesis, and presence of an ester or hydroxyl group at 17alpha-position in combination with a non-polar group at C(6) appeared to be required for stimulation. For the pregnenes, dexamethasone was stimulatory. Structural requirements include a non-polar substitution at 16alpha-position and presence of a 6alpha-methyl group. Androgens were weak or ineffective stimulators of DNA synthesis. Anabolic steroids were weak to strong stimulators and alteration to A ring structure in combination with non-polar substitution at 17alpha-position appeared to be required for the activity. With the exception of the anabolic steroid, dianabol, there do not appear to be strong correlation between ability to stimulate DNA synthesis and ability to induce protooncogene expression among the steroids. This study provides a starting point for future more detailed examination of growth-stimulatory mechanism(s) of action of steroids in the liver. PMID:12127039

  16. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    PubMed

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction. PMID:26815240

  17. L-arginine improves DNA synthesis in LPS-challenged enterocytes.

    PubMed

    Tan, Bi'e; Xiao, Hao; Xiong, Xia; Wang, Jing; Li, Guangran; Yin, Yulong; Huang, Bo; Hou, Yongqing; Wu, Guoyao

    2015-01-01

    The neonatal small intestine is susceptible to damage by endotoxin, and this cytotoxicity may involve intracellular generation of reactive oxygen species (ROS), resulting in DNA damage and mitochondrial dysfunction. L-Arginine (Arg) confers a cytoprotective effect on lipopolysaccharide (LPS)-treated enterocytes through activation of the mammalian target of the rapamycin (mTOR) signaling pathway. Arg improves DNA synthesis and mitochondrial bioenergetics, which may also be responsible for beneficial effects of Arg on intestinal mucosal cells. In support of this notion, results of recent studies indicate that elevated Arg concentrations enhances DNA synthesis, cell-cycle progression, and mitochondrial bioenergetics in LPS-treated intestinal epithelial cells through mechanisms involving activation of the PI3K-Akt pathway. These findings provide a biochemical basis for dietary Arg supplementation to improve the regeneration and repair of the small-intestinal mucosa in both animals and humans. PMID:25961538

  18. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    SciTech Connect

    Jones, R.A.

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  19. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  20. Design and Synthesis of Triangulated DNA Origami Trusses.

    PubMed

    Matthies, Michael; Agarwal, Nayan P; Schmidt, Thorsten L

    2016-03-01

    DNA nanotechnology offers unique control over matter on the nanoscale. Here, we extend the DNA origami method to cover a range of wireframe truss structures composed of equilateral triangles, which use less material per volume than standard multiple-helix bundles. From a flat truss design, we folded tetrahedral, octahedral, or irregular dodecahedral trusses by exchanging few connector strands. Other than standard origami designs, the trusses can be folded in low-salt buffers that make them compatible with cell culture buffers. The structures also have defined cavities that may in the future be used to precisely position functional elements such as metallic nanoparticles or enzymes. Our graph routing program and a simple design pipeline will enable other laboratories to make use of this valuable and potent new construction principle for DNA-based nanoengineering. PMID:26883285

  1. Synthesis of DNA Oligodeoxynucleotides Containing Site-Specific 1,3-Butadiene- Deoxyadenosine Lesions

    PubMed Central

    Wickramaratne, Susith; Seiler, Christopher L.

    2016-01-01

    Post-oligomerization synthesis is a useful technique for preparing site-specifically modified DNA oligomers. This approach involves site-specific incorporation of inherently reactive halogenated nucleobases into DNA strands using standard solid phase synthesis, followed by post-oligomerization nucleophilic aromatic substitution (SNAr) reactions with carcinogen-derived synthons. In these reactions, the inherent reactivities of DNA and carcinogen-derived species are reversed: the modified DNA nucleobase acts as an electrophile, while the carcinogen-derived species acts as a nucleophile. In the present protocol, we describe the use of the post-oligomerization approach to prepare DNA strands containing site- and stereospecific N6-adenine and N1, N6-adenine adducts induced by epoxide metabolites of the known human and animal carcinogen, 1,3-butadiene (BD). The resulting oligomers containing site specific, structurally defined DNA adducts can be used in structural and biological studies to reveal the roles of specific BD adducts in carcinogenesis and mutagenesis. PMID:26344227

  2. Structural Basis of High-Fidelity DNA Synthesis by Yeast DNA Polymerase δ

    SciTech Connect

    Swan, M.; Johnson, R; Prakash, L; Prakash, S; Aggarwal, A

    2009-01-01

    DNA polymerase ? (Pol ?) has a crucial role in eukaryotic replication. Now the crystal structure of the yeast DNA Pol ? catalytic subunit in complex with template primer and incoming nucleotide is presented at 2.0-A resolution, providing insight into its high fidelity and a framework to understand the effects of mutations involved in tumorigenesis.

  3. Synthesis of site-specific DNA-protein conjugates and their effects on DNA replication.

    PubMed

    Yeo, Jung Eun; Wickramaratne, Susith; Khatwani, Santoshkumar; Wang, Yen-Chih; Vervacke, Jeffrey; Distefano, Mark D; Tretyakova, Natalia Y

    2014-08-15

    DNA-protein cross-links (DPCs) are bulky, helix-distorting DNA lesions that form in the genome upon exposure to common antitumor drugs, environmental/occupational toxins, ionizing radiation, and endogenous free-radical-generating systems. As a result of their considerable size and their pronounced effects on DNA-protein interactions, DPCs can interfere with DNA replication, transcription, and repair, potentially leading to mutagenesis, genotoxicity, and cytotoxicity. However, the biological consequences of these ubiquitous lesions are not fully understood due to the difficulty of generating DNA substrates containing structurally defined, site-specific DPCs. In the present study, site-specific cross-links between the two biomolecules were generated by copper-catalyzed [3 + 2] Huisgen cycloaddition (click reaction) between an alkyne group from 5-(octa-1,7-diynyl)-uracil in DNA and an azide group within engineered proteins/polypeptides. The resulting DPC substrates were subjected to in vitro primer extension in the presence of human lesion bypass DNA polymerases η, κ, ν, and ι. We found that DPC lesions to the green fluorescent protein and a 23-mer peptide completely blocked DNA replication, while the cross-link to a 10-mer peptide was bypassed. These results indicate that the polymerases cannot read through the larger DPC lesions and further suggest that proteolytic degradation may be required to remove the replication block imposed by bulky DPC adducts. PMID:24918113

  4. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  5. Remote Activation of Host Cell DNA Synthesis in Uninfected Cells Signaled by Infected Cells in Advance of Virus Transmission

    PubMed Central

    Schmidt, Nora; Hennig, Thomas; Serwa, Remigiusz A.; Marchetti, Magda

    2015-01-01

    ABSTRACT Viruses modulate cellular processes and metabolism in diverse ways, but these are almost universally studied in the infected cell itself. Here, we study spatial organization of DNA synthesis during multiround transmission of herpes simplex virus (HSV) using pulse-labeling with ethynyl nucleotides and cycloaddition of azide fluorophores. We report a hitherto unknown and unexpected outcome of virus-host interaction. Consistent with the current understanding of the single-step growth cycle, HSV suppresses host DNA synthesis and promotes viral DNA synthesis in spatially segregated compartments within the cell. In striking contrast, during progressive rounds of infection initiated at a single cell, we observe that infection induces a clear and pronounced stimulation of cellular DNA replication in remote uninfected cells. This induced DNA synthesis was observed in hundreds of uninfected cells at the extended border, outside the perimeter of the progressing infection. Moreover, using pulse-chase analysis, we show that this activation is maintained, resulting in a propagating wave of host DNA synthesis continually in advance of infection. As the virus reaches and infects these activated cells, host DNA synthesis is then shut off and replaced with virus DNA synthesis. Using nonpropagating viruses or conditioned medium, we demonstrate a paracrine effector of uninfected cell DNA synthesis in remote cells continually in advance of infection. These findings have significant implications, likely with broad applicability, for our understanding of the ways in which virus infection manipulates cell processes not only in the infected cell itself but also now in remote uninfected cells, as well as of mechanisms governing host DNA synthesis. IMPORTANCE We show that during infection initiated by a single particle with progressive cell-cell virus transmission (i.e., the normal situation), HSV induces host DNA synthesis in uninfected cells, mediated by a virus-induced paracrine

  6. Synthesis and Characterization of DNA Minor Groove Binding Alkylating Agents

    PubMed Central

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K.; Mascara, Gerard P.; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W.; Bobola, Michael S.; Silber, John R.; Gold, Barry

    2012-01-01

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases the N-terminus was appended with a O-methyl sulfonate ester while the C-terminus group was varied with non-polar and polar sidechains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) vs. major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is > 10-fold higher than the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells over-expressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  7. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  8. Antibacterial activity and inhibition of protein synthesis in Escherichia coli by antisense DNA analogs.

    PubMed

    Rahman, M A; Summerton, J; Foster, E; Cunningham, K; Stirchak, E; Weller, D; Schaup, H W

    1991-01-01

    Protein synthesis, which takes place within ribosomes, is essential for the survival of any living organism. Ribosomes are composed of both proteins and RNA. Specific interaction between the 3' end CCUCC sequence of prokaryotic 16S rRNA and a partially complementary sequence preceding the initiating codon of mRNA is believed to be a prerequisite for initiation of protein synthesis. Here we report the use of short (three to six nucleotides) synthetic DNA analogs complementary to this sequence to block protein synthesis in vitro and in vivo in Escherichia coli. In the DNA analogs the normal phosphodiester bond in the antisense DNA was replaced by methylcarbamate internucleoside linkages to enhance transport across plasma membranes. Of the analogs tested, those with the sequence AGG and GGA inhibit protein synthesis and colony formation by E. coli strains lacking an outer cell wall. Polyethylene glycol 1000 (PEG 1000) was attached to the 5' end of some of the test methylcarbamate DNAs to enhance solubility. Analogs of AGG and GGAG with PEG 1000 attached inhibited colony formation in normal E. coli. These analogs may be useful food additives to control bacterial spoilage and biomedically as antibiotics. PMID:1821653

  9. An improved method of gene synthesis based on DNA works software and overlap extension PCR.

    PubMed

    Dong, Bingxue; Mao, Runqian; Li, Baojian; Liu, Qiuyun; Xu, Peilin; Li, Gang

    2007-11-01

    A bottleneck in recent gene synthesis technologies is the high cost of oligonucleotide synthesis and post-synthesis sequencing. In this article, a simple and rapid method for low-cost gene synthesis technology was developed based on DNAWorks program and an improved single-step overlap extension PCR (OE-PCR). This method enables any DNA sequence to be synthesized with few errors, then any mutated sites could be corrected by site-specific mutagenesis technology or PCR amplification-assembly method, which can amplify different DNA fragments of target gene followed by assembly into an entire gene through their overlapped region. Eventually, full-length DNA sequence without error was obtained via this novel method. Our method is simple, rapid and low-cost, and also easily amenable to automation based on a DNAWorks design program and defined set of OE-PCR reaction conditions suitable for different genes. Using this method, several genes including Manganese peroxidase gene (Mnp) of Phanerochaete chrysosporium (P. chrysosporium), Laccase gene (Lac) of Trametes versicolor (T. versicolor) and Cip1 peroxidase gene (cip 1) of Coprinus cinereus (C. cinereus) with sizes ranging from 1.0 kb to 1.5 kb have been synthesized successfully. PMID:17952664

  10. Induction of DNA synthesis in isolated nuclei by cytoplasmic factors: inhibition by protease inhibitors.

    PubMed Central

    Wong, R L; Gutowski, J K; Katz, M; Goldfarb, R H; Cohen, S

    1987-01-01

    Cytoplasmic extracts from spontaneously proliferating and mitogen-activated lymphoid cells contain a protein factor called ADR (activator of DNA replication) that induces DNA synthesis in isolated quiescent nuclei. ADR-containing preparations have proteolytic activity, as indicated by their ability to degrade fibrin in a plasminogen-independent and plasminogen-dependent manner. In addition, aprotinin, a nonspecific protease inhibitor, abrogates ADR-induced DNA synthesis in a dose-dependent fashion. Preincubation studies demonstrated that the effect of aprotinin is not due to its suppressive effects on the nuclei themselves. Other protease inhibitors such as leupeptin, p-aminobenzamidine, and N-alpha-tosyllysine chloromethyl ketone are also inhibitory, but soybean trypsin inhibitor is without effect. ADR activity can be removed from active extracts by adsorption with aprotinin-conjugated agarose beads and can be recovered by elution with an acetate buffer (pH 5). These findings are consistent with the interpretation that the initiation of DNA synthesis in resting nuclei may be protease dependent and, further, that the cytoplasmic stimulatory factor we have called ADR may be a protease itself. PMID:3540956

  11. Synthesis of Cross-Linked DNA Containing Oxidized Abasic Site Analogues

    PubMed Central

    2015-01-01

    DNA interstrand cross-links are an important family of DNA damage that block replication and transcription. Recently, it was discovered that oxidized abasic sites react with the opposing strand of DNA to produce interstrand cross-links. Some of the cross-links between 2′-deoxyadenosine and the oxidized abasic sites, 5′-(2-phosphoryl-1,4-dioxobutane) (DOB) and the C4-hydroxylated abasic site (C4-AP), are formed reversibly. Chemical instability hinders biochemical, structural, and physicochemical characterization of these cross-linked duplexes. To overcome these limitations, we developed methods for preparing stabilized analogues of DOB and C4-AP cross-links via solid-phase oligonucleotide synthesis. Oligonucleotides of any sequence are attainable by synthesizing phosphoramidites in which the hydroxyl groups of the cross-linked product were orthogonally protected using photochemically labile and hydrazine labile groups. Selective unmasking of a single hydroxyl group precedes solid-phase synthesis of one arm of the cross-linked DNA. The method is compatible with commercially available phosphoramidites and other oligonucleotide synthesis reagents. Cross-linked duplexes containing as many as 54 nt were synthesized on solid-phase supports. Subsequent enzyme ligation of one cross-link product provided a 60 bp duplex, which is suitable for nucleotide excision repair studies. PMID:24949656

  12. A new paradigm of DNA synthesis: three-metal-ion catalysis.

    PubMed

    Yang, Wei; Weng, Peter J; Gao, Yang

    2016-01-01

    Enzyme catalysis has been studied for over a century. How it actually occurs has not been visualized until recently. By combining in crystallo reaction and X-ray diffraction analysis of reaction intermediates, we have obtained unprecedented atomic details of the DNA synthesis process. Contrary to the established theory that enzyme-substrate complexes and transition states have identical atomic composition and catalysis occurs by the two-metal-ion mechanism, we have discovered that an additional divalent cation has to be captured en route to product formation. Unlike the canonical two metal ions, which are coordinated by DNA polymerases, this third metal ion is free of enzyme coordination. Its location between the α- and β-phosphates of dNTP suggests that the third metal ion may drive the phosphoryltransfer from the leaving group opposite to the 3'-OH nucleophile. Experimental data indicate that binding of the third metal ion may be the rate-limiting step in DNA synthesis and the free energy associated with the metal-ion binding can overcome the activation barrier to the DNA synthesis reaction. PMID:27602203

  13. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N.; Mariella, Jr., Raymond P.; Christian, Allen T.; Young, Jennifer A.; Clague, David S.

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  14. Endotoxin or cytokines attenuate ozone-induced DNA synthesis in rat nasal transitional epithelium

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R. )

    1992-06-01

    Pretreatment of rats with endotoxin (E), a potent inducer of tumor necrosis factor alpha (TNF), and interleukin 1 beta (IL 1), or a combination of TNF and IL1, has been shown to increase levels of lung antioxidant enzymes and protect against pulmonary toxicity associated with hyperoxia. Inhalation of ozone (O3) induces cell injury, followed by increased DNA synthesis, cell proliferation, and secretory cell metaplasia in rat nasal transitional epithelium (NTE). This study was designed to test the effects of E, TNF, and IL1 pretreatment on acute O3-induced NTE cell injury as measured by changes in NTE cell DNA synthesis. Rats were exposed to either 0.8 ppm O3 or air for 6 hr in whole-body inhalation chambers. Immediately before exposure, rats in each group were injected intraperitoneally (ip) with either saline alone or saline containing E, TNF, IL1, or both TNF and IL1. Eighteen hours postexposure, rats were injected ip with bromodeoxyuridine to label cells undergoing DNA synthesis and were euthanized 2 hr later. NTE was processed for light microscopy and immunochemically stained to identify cells that had incorporated BrdU into nuclear DNA. The number of BrdU-labeled NTE nuclei per millimeter of basal lamina was quantitated. There were no significant differences in the number of BrdU-labeled NTE nuclei in air-exposed rats that were injected with E, TNF, IL1, or TNF/IL1 compared with those in saline-injected, air-exposed controls. Rats that were injected with saline and exposed to O3 had approximately 10 times the number of BrdU-labeled NTE nuclei than saline-injected, air-exposed control rats. O3 exposure also induced a significant increase in labeled nuclei in rats that were pretreated with TNF alone. In contrast, pretreatment with E, IL1, or TNF/IL1 attenuated the O3-induced increase in NTE DNA synthesis.

  15. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  16. The POLD3 subunit of DNA polymerase δ can promote translesion synthesis independently of DNA polymerase ζ.

    PubMed

    Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E; Takeda, Shunichi

    2015-02-18

    The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356

  17. Synthesis, characterization and chemoprotective activity of polyoxovanadates against DNA alkylation.

    PubMed

    Nunes, Giovana G; Bonatto, Ana C; de Albuquerque, Carla G; Barison, Andersson; Ribeiro, Ronny R; Back, Davi F; Andrade, André Vitor C; de Sá, Eduardo L; Pedrosa, Fábio de O; Soares, Jaísa F; de Souza, Emanuel M

    2012-03-01

    The alkylation of pUC19 plasmid DNA has been employed as a model reaction for the first studies on chemoprotective action by a mixed-valence (+IV/+V) polyoxovanadate. A new, non-hydrothermal route for the high yield preparation of the test compound is described. The deep green, microcrystalline solid A was isolated after a three-day reaction in water at 80°C and 1 atm, while the reaction at 100°C gave green crystals of B. Both solids were structurally characterized by X-ray diffractometry and FTIR, EPR, NMR and Raman spectroscopies. Product A was identified as (NH(4))(2)V(3)O(8), while B corresponds to the spherical polyoxoanion [V(15)O(36)(Cl)](6-), isolated as the NMe(4)(+) salt. The lack of solubility of A in water and buffers prevented its use in DNA interaction studies, which were then carried out with B. Complex B was also tested for its ability to react with DNA alkylating agents by incubation with diethylsulphate (DES) and dimethylsulphate (DMS) in both the absence and presence of pUC19. For DMS, the best results were obtained with 10 mM of B (48% protection); with DES, this percentage increased to 70%. The direct reaction of B with increasing amounts of DMS in both buffered (PIPES 50 mM) and non-buffered aqueous solutions revealed the sequential formation of several vanadium(IV), vanadium(V) and mixed-valence aggregates of different nuclearities, whose relevance to the DNA-protecting activity is discussed. PMID:22265837

  18. Nuclear reorganization of mammalian DNA synthesis prior to cell cycle exit.

    PubMed

    Barbie, David A; Kudlow, Brian A; Frock, Richard; Zhao, Jiyong; Johnson, Brett R; Dyson, Nicholas; Harlow, Ed; Kennedy, Brian K

    2004-01-01

    In primary mammalian cells, DNA replication initiates in a small number of perinucleolar, lamin A/C-associated foci. During S-phase progression in proliferating cells, replication foci distribute to hundreds of sites throughout the nucleus. In contrast, we find that the limited perinucleolar replication sites persist throughout S phase as cells prepare to exit the cell cycle in response to contact inhibition, serum starvation, or replicative senescence. Proteins known to be involved in DNA synthesis, such as PCNA and DNA polymerase delta, are concentrated in perinucleolar foci throughout S phase under these conditions. Moreover, chromosomal loci are redirected toward the nucleolus and overlap with the perinucleolar replication foci in cells poised to undergo cell cycle exit. These same loci remain in the periphery of the nucleus during replication under highly proliferative conditions. These results suggest that mammalian cells undergo a large-scale reorganization of chromatin during the rounds of DNA replication that precede cell cycle exit. PMID:14701733

  19. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    PubMed

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  20. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  1. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailing description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  2. Synthesis and hybridization properties of an acyclic achiral phosphonate DNA analogue.

    PubMed

    Kehler, J; Henriksen, U; Vejbjerg, H; Dahl, O

    1998-03-01

    Protected N-(2-hydroxyethyl)-N-(nucleobase-acetyl)aminomethanephosphonic+ ++ acid (6a-d) of all four DNA nucleobases have been prepared and oligomerized by solid-phase synthesis. Four DNA decamers containing 1-10 of these 'PPNA' monomers were prepared and evaluated by Tm measurements (medium salt) for binding to their DNA and RNA complements. One central modification reduced the binding strongly (delta Tm = -10 degrees C), but contiguous PPNA monomers gave smaller effects, and the all-PPNA decamer bound to RNA with a delta Tm of -1.2 degrees C per modification. Thus PPNA oligomers are inferior DNA and RNA binders compared to the closely related and strongly binding PNA oligomers. PMID:9568285

  3. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  4. Synthesis, photochemical properties and DNA binding studies of dna cleaving agents based on chiral dipyridine dihydrodioxins salts

    NASA Astrophysics Data System (ADS)

    Shamaev, Alexei

    activated by UV-light. The mechanism of o-quinone release and intramolecular ET was studied in detail by methods of Ultrafast Transient Absortion Spectroscopy and supported by high-level quantum mechanical calculations. The binding properties of chiral intercalators based on PDHD to various DNA oligonucleotides were studied by various methods and DNA cleavage properties indicating strong binding and cleaving ability of the synthesized PDHDs. Also, a new method for synthesis of cyclohexa[e]pyrenes which possibly capable of intramolecular ET and electron transfer-oxidative stress (ET-OS) DNA cleavage was developed and partially accomplished.

  5. Self-assembled catalytic DNA nanostructures for synthesis of para-directed polyaniline.

    PubMed

    Wang, Zhen-Gang; Zhan, Pengfei; Ding, Baoquan

    2013-02-26

    Templated synthesis has been considered as an efficient approach to produce polyaniline (PANI) nanostructures. The features of DNA molecules enable a DNA template to be an intriguing template for fabrication of emeraldine PANI. In this work, we assembled HRP-mimicking DNAzyme with different artificial DNA nanostructures, aiming to manipulate the molecular structures and morphologies of PANI nanostructures through the controlled DNA self-assembly. UV-vis absorption spectra were used to investigate the molecular structures of PANI and monitor kinetic growth of PANI. It was found that PANI was well-doped at neutral pH and the redox behaviors of the resultant PANI were dependent on the charge density of the template, which was controlled by the template configurations. CD spectra indicated that the PANI threaded tightly around the helical DNA backbone, resulting in the right handedness of PANI. These reveal the formation of the emeraldine form of PANI that was doped by the DNA. The morphologies of the resultant PANI were studied by AFM and SEM. It was concluded from the imaging and spectroscopic kinetic results that PANI grew preferably from the DNAzyme sites and then expanded over the template to form 1D PANI nanostructures. The strategy of the DNAzyme-DNA template assembly brings several advantages in the synthesis of para-coupling PANI, including the region-selective growth of PANI, facilitating the formation of a para-coupling structure and facile regulation. We believe this study contributes significantly to the fabrication of doped PANI nanopatterns with controlled complexity, and the development of DNA nanotechnology. PMID:23272944

  6. Synthesis of Mitochondrial DNA Precursors during Myogenesis, an Analysis in Purified C2C12 Myotubes*

    PubMed Central

    Frangini, Miriam; Franzolin, Elisa; Chemello, Francesco; Laveder, Paolo; Romualdi, Chiara; Bianchi, Vera; Rampazzo, Chiara

    2013-01-01

    During myogenesis, myoblasts fuse into multinucleated myotubes that acquire the contractile fibrils and accessory structures typical of striated skeletal muscle fibers. To support the high energy requirements of muscle contraction, myogenesis entails an increase in mitochondrial (mt) mass with stimulation of mtDNA synthesis and consumption of DNA precursors (dNTPs). Myotubes are quiescent cells and as such down-regulate dNTP production despite a high demand for dNTPs. Although myogenesis has been studied extensively, changes in dNTP metabolism have not been examined specifically. In differentiating cultures of C2C12 myoblasts and purified myotubes, we analyzed expression and activities of enzymes of dNTP biosynthesis, dNTP pools, and the expansion of mtDNA. Myotubes exibited pronounced post-mitotic modifications of dNTP synthesis with a particularly marked down-regulation of de novo thymidylate synthesis. Expression profiling revealed the same pattern of enzyme down-regulation in adult murine muscles. The mtDNA increased steadily after myoblast fusion, turning over rapidly, as revealed after treatment with ethidium bromide. We individually down-regulated p53R2 ribonucleotide reductase, thymidine kinase 2, and deoxyguanosine kinase by siRNA transfection to examine how a further reduction of these synthetic enzymes impacted myotube development. Silencing of p53R2 had little effect, but silencing of either mt kinase caused 50% mtDNA depletion and an unexpected decrease of all four dNTP pools independently of the kinase specificity. We suggest that during development of myotubes the shortage of even a single dNTP may affect all four pools through dysregulation of ribonucleotide reduction and/or dissipation of the non-limiting dNTPs during unproductive elongation of new DNA chains. PMID:23297407

  7. Translesion synthesis is the main component of SOS repair in bacteriophage lambda DNA.

    PubMed Central

    Defais, M; Lesca, C; Monsarrat, B; Hanawalt, P

    1989-01-01

    Agents that interfere with DNA replication in Escherichia coli induce physiological adaptations that increase the probability of survival after DNA damage and the frequency of mutants among the survivors (the SOS response). Such agents also increase the survival rate and mutation frequency of irradiated bacteriophage after infection of treated bacteria, a phenomenon known as Weigle reactivation. In UV-irradiated single-stranded DNA phage, Weigle reactivation is thought to occur via induced, error-prone replication through template lesions (translesion synthesis [P. Caillet-Fauquet, M: Defais, and M. Radman, J. Mol. Biol. 117:95-112, 1977]). Weigle reactivation occurs with higher efficiency in double-stranded DNA phages such as lambda, and we therefore asked if another process, recombination between partially replicated daughter molecules, plays a major role in this case. To distinguish between translesion synthesis and recombinational repair, we studied the early replication of UV-irradiated bacteriophage lambda in SOS-induced and uninduced bacteria. To avoid complications arising from excision of UV lesions, we used bacterial uvrA mutants, in which such excision does not occur. Our evidence suggests that translesion synthesis is the primary component of Weigle reactivation of lambda phage in the absence of excision repair. The greater efficiency in Weigle reactivation of double-stranded DNA phage could thus be attributed to some inducible excision repair unable to occur on single-stranded DNA. In addition, after irradiation, lambda phage replication seems to switch prematurely from the theta mode to the rolling circle mode. Images PMID:2527845

  8. Mutagenicity and pausing of HIV reverse transcriptase during HIV plus-strand DNA synthesis.

    PubMed Central

    Ji, J; Hoffmann, J S; Loeb, L

    1994-01-01

    The unusually high frequency of misincorporation by HIV-1 reverse transcriptase (HIV RT) is likely to be the major factor in the rapid accumulation of viral mutations in AIDS, especially in the env gene. To investigate the ability of HIV RT to copy the env gene, we subcloned an HIV env gene fragment into a single-stranded DNA vector and measured the progression of synthesis by HIV RT. We observed that HIV RT, but not RT from avian myeloblastosis virus, DNA polymerase-alpha or T7 DNA polymerase, pauses specifically at poly-deoxyadenosine stretches within the env gene. The frequency of bypassing the polyadenosine stretches by HIV RT is enhanced by increasing the ratio of enzyme to template. We measured the fidelity of DNA synthesis within a segment of the hypervariable region 1 of the env gene (V-1) containing a poly-deoxyadenosine sequence by repetitively copying the DNA by HIV RT, and then cloning and sequencing the copied fragments. We found that 27% of the errors identified in V-1 sequence were frameshift mutations opposite the poly-adenosine tract, a site where strong pausing was observed. Pausing of HIV RT at the polyadenosine tract could be enhanced by either distamycin A or netropsin, (A-T)-rich minor groove binding peptides. Moreover, netropsin increases the frequency of frameshift mutations in experiments in which HIV RT catalyzes gap filling synthesis within the lacZ gene in double-stranded circular M13mp2 DNA. These combined results suggest that the enhanced mutation frequency may be due to increased pausing at netropsin-modified polyadenosine tracts. Therefore, netropsin and related A-T binding chemicals may selectively enhance frameshift mutagenesis induced by HIV RT and yield predominantly non-viable virus. Images PMID:7510388

  9. Synthesis of a duplex oligonucleotide containing a nitrogen mustard interstrand DNA-DNA cross-link.

    PubMed

    Ojwang, J O; Grueneberg, D A; Loechler, E L

    1989-12-01

    Many cancer chemotherapeutic agents react with DNA and give adducts that block DNA replication, which is thought to result in cytotoxicity, especially in rapidly proliferating cells such as cancer cells. One class of these agents is bifunctionally reactive (e.g., the nitrogen mustards) and forms DNA-DNA cross-links. It is unknown whether inter- or intrastrand cross-links are more effective at blocking DNA replication. To evaluate this, a DNA shuttle vector is being constructed with an interstrand cross-link at a unique site. In the first step of this project, a duplex oligonucleotide containing an interstrand cross-link is isolated by denaturing polyacrylamide gel electrophoresis from the reaction of nitrogen mustard with two partially complementary oligodeoxynucleotides. The purified oligonucleotide product is characterized and shown to be cross-linked in a 5'-GAC-3' 3'-CTG-5' sequence by a nitrogen mustard moiety that is bound at the N(7)-position of the guanines in the opposing strands; the glycosylic bonds of these guanine adducts are stabilized in their corresponding imidazole ring-opened form. Nitrogen mustard is shown to react with a variety of oligonucleotides and, based upon these results, its preferred targets for interstrand cross-linking are 5'-GXC-3' sequences, where X can be any of the four deoxyribonucleotide bases. PMID:2819709

  10. On-Flow Synthesis of Co-Polymerizable Oligo-Microspheres and Application in ssDNA Amplification

    PubMed Central

    Lee, Se Hee; Lee, Jae Ha; Lee, Ho Won; Kim, Yang-Hoon; Jeong, Ok Chan; Ahn, Ji-Young

    2016-01-01

    We fabricated droplet-based microfluidic platform for copolymerizable microspheres with acrydite modified DNA probe. The copolymerizable 3-D polyacrylamide microspheres were successfully produced from microcontinuous-flow synthesis with on-channel solidification. DNA copolymerization activity, surface presentation and thermostability were assessed by using fluorescent labeled complementary probe. The binding performance was only visible on the surface area of oligo-microspheres. We show that the resulting oligo-microspheres can be directly integrated into a streamlined microsphere-PCR protocol for amplifying ssDNA. Our microspheres could be utilized as a potential material for ssDNA analysis such as DNA microarray and automatic DNA SELEX process. PMID:27447941

  11. Design and synthesis of efficient fluorescent dyes for incorporation into DNA backbone and biomolecule detection.

    PubMed

    Wang, Wei; Li, Alexander D Q

    2007-01-01

    We report here the design and synthesis of a series of pi-conjugated fluorescent dyes with D-A-D (D, donor; A, acceptor), D-pi-D, A-pi-A, and D-pi-A for applications as the signaling motif in biological-synthetic hybrid foldamers for DNA detection. The Horner-Wadsworth-Emmons (HWE) reaction and Knoevenagel condensation were demonstrated as the optimum ways for construction of long pi-conjugated systems. Such rodlike chromophores have distinct advantages, as their fluorescence properties are not quenched by the presence of DNA. To be incorporated into the backbone of DNA, the chromophores need to be reasonably soluble in organic solvent for solid-phase synthesis, and therefore a strategy of using flexible tetraethylene glycol (TEG) linkers at either end of these rodlike dyes was developed. The presence of TEG facilitates the protection of the chain-growing hydroxyl group with DMTrCl (dimethoxytrityl chloride) as well as the activation of the coupling step with phosphoramidite chemistry on an automated DNA synthesizer. To form fluorescence resonance energy transfer (FRET) pairs, six synthetic chromophores with blue to red fluorescence have been developed, and those with orthogonal fluorescent emission were chosen for incorporation into DNA-chromophore hybrid foldamers. PMID:17508711

  12. Recent Advances in the Synthesis and Functions of Reconfigurable Interlocked DNA Nanostructures.

    PubMed

    Lu, Chun-Hua; Cecconello, Alessandro; Willner, Itamar

    2016-04-27

    Interlocked circular DNA nanostructures, e.g., catenanes or rotaxanes, provide functional materials within the area of DNA nanotechnology. Specifically, the triggered reversible reconfiguration of the catenane or rotaxane structures provides a means to yield new DNA switches and to use them as dynamic scaffolds for controlling chemical functions and positioning functional cargoes. The synthesis of two-ring catenanes and their switchable reconfiguration by pH, metal ions, or fuel/anti-fuel stimuli are presented, and the functions of these systems, as pendulum or rotor devices or as switchable catalysts, are described. Also, the synthesis of three-, five-, and seven-ring catenanes is presented, and their switchable reconfiguration using fuel/anti-fuel strands is addressed. Implementation of the dynamically reconfigured catenane structures for the programmed organization of Au nanoparticle (NP) assemblies, which allows the plasmonic control of the fluorescence properties of Au NP/fluorophore loads associated with the scaffold, and for the operation of logic gates is discussed. Interlocked DNA rotaxanes and their different synthetic approaches are presented, and their switchable reconfiguration by means of fuel/anti-fuel strands or photonic stimuli is described. Specifically, the use of the rotaxane as a scaffold to organize Au NP assemblies, and the control of the fluorescence properties with Au NP/fluorophore hybrids loaded on the rotaxane scaffold, are introduced. The future prospectives and challenges in the field of interlocked DNA nanostructures and the possible applications are discussed. PMID:27019201

  13. Synthesis, DNA-binding and biological activity of a double intercalating analog of ethidium bromide.

    PubMed Central

    Kuhlmann, K F; Charbeneau, N J; Mosher, C W

    1978-01-01

    A bis-phenanthridinium salt has been synthesized and its DNA-binding studied. Evidence provided by UV and CD spectra, by thermal denaturation profiles and by equilibrium dialysis of the drug-DNA complex lead to the conclusion that both phenanthridine moieties intercalate in the helix. The double intercalator appears to be less potent than ethidium chloride as an inhibitor of nucleic acid synthesis in cultured L1210 cells, though it is more potent than a monomeric analog. The low potency may be due to a low cell influx rate. PMID:673863

  14. Synthesis of peptide-conjugated light-driven molecular motors and evaluation of their DNA-binding properties.

    PubMed

    Nagatsugi, Fumi; Takahashi, Yusuke; Kobayashi, Maiko; Kuwahara, Shunsuke; Kusano, Shuhei; Chikuni, Tomoko; Hagihara, Shinya; Harada, Nobuyuki

    2013-05-01

    Synthetic light-driven molecular motors are molecular machines capable of rotation under photo-irradiation. In this paper, we report the synthesis of peptide-conjugated molecular motors and evaluate their DNA-binding properties. PMID:23324812

  15. STRUCTURE-ACTIVITY STUDY OF PARACETAMOL ANALOGUES: INHIBITION OF REPLICATIVE DNA SYNTHESIS IN V79 CHINESE HAMSTER CELLS

    EPA Science Inventory

    Experimental and theoretical evidence pertaining to cytotoxic and genotoxic activity of paracetamol in biological systems was used to formulate a simple mechanistic hypothesis to explain the relative inhibition of replicative DNA synthesis by a series of 19 structurally similar p...

  16. Synthesis of Programmable Reaction-Diffusion Fronts Using DNA Catalyzers

    NASA Astrophysics Data System (ADS)

    Zadorin, Anton S.; Rondelez, Yannick; Galas, Jean-Christophe; Estevez-Torres, André

    2015-02-01

    We introduce a DNA-based reaction-diffusion (RD) system in which reaction and diffusion terms can be precisely and independently controlled. The effective diffusion coefficient of an individual reaction component, as we demonstrate on a traveling wave, can be reduced up to 2.7-fold using a self-assembled hydrodynamic drag. The intrinsic programmability of this RD system allows us to engineer, for the first time, orthogonal autocatalysts that counterpropagate with minimal interaction. Our results are in excellent quantitative agreement with predictions of the Fisher-Kolmogorov-Petrovskii-Piscunov model. These advances open the way for the rational engineering of pattern formation in pure chemical RD systems.

  17. [Intensity of DNA synthesis in animal organs after a flight on the Kosmos-782 biosatellite].

    PubMed

    Guseĭnov, F T; Egorov, I A; Komolova, G S; Tigranian, R A

    1979-01-01

    With respect to H3-thymidine incorporation the rate of DNA synthesis in the liver, spleen and thymus of rats was determined in flight and synchronous rats. Six hours post-flight the rate of H3-thymidine incorporation into the liver of flight rats did not differ from the normal (vivarium controls) and was 50% higher than in the synchronous rats. In the spleen and thymus of flight animals this parameter was 60 and 33% below the norm. Similar but less pronounced changes in the spleen were found in the synchronous rats. Twenty-five days postflight the rate of DNA synthesis in lymph organs recovered completely and tended to increase, whereas in the liver it remained significantly below the norm. PMID:459398

  18. Protein synthesis directly from PCR: progress and applications of cell-free protein synthesis with linear DNA.

    PubMed

    Schinn, Song-Min; Broadbent, Andrew; Bradley, William T; Bundy, Bradley C

    2016-06-25

    A rapid, versatile method of protein expression and screening can greatly facilitate the future development of therapeutic biologics, proteomic drug targets and biocatalysts. An attractive candidate is cell-free protein synthesis (CFPS), a cell-lysate-based in vitro expression system, which can utilize linear DNA as expression templates, bypassing time-consuming cloning steps of plasmid-based methods. Traditionally, such linear DNA expression templates (LET) have been vulnerable to degradation by nucleases present in the cell lysate, leading to lower yields. This challenge has been significantly addressed in the recent past, propelling LET-based CFPS as a useful tool for studying, screening and engineering proteins in a high-throughput manner. Currently, LET-based CFPS has promise in fields such as functional proteomics, protein microarrays, and the optimization of complex biological systems. PMID:27085957

  19. Synthesis, characterization and DNA cleaving studies of new organocobaloxime derivatives.

    PubMed

    Erdem-Tuncmen, Mukadder; Karipcin, Fatma; Ozmen, Ismail

    2013-01-01

    Dioxime ligand (H2L) was synthesized by condensation reaction between 4-biphenylchloroglyoxime and 4-chloroaniline. The metal complexes of the types, [Co(HL)2(i-Pr)Py], [CoL2(i-Pr)PyB2F4] and [CoL2(i-Pr)Py(Cu(phen))2](ClO4)2 [H2L = 4-(4-chlorophenylamino)biphenylglyoxime; phen = 1,10-phenanthroline; i-Pr = isopropyl; Py = pyridine] were synthesized and characterized by elemental analysis, FT-IR, 1H NMR and magnetic susceptibility, conductivity measurements. The results of elemental analyses, IR and NMR confirmed the stoichiometry of the complexes and the formation of ligand frameworks around the metal ions. The magnetic moment measurements of the complexes indicated that the complexes are diamagnetic (low-spin d6 octahedral) except trinuclear complex. Furthermore the interaction between the dioxime ligand and its complexes with DNA has also been investigated by agarose gel electrophoresis. The trinuclear Cu2Co complex with H2O2 as a cooxidant exhibited the strongest DNA cleaving activity. PMID:23841342

  20. The Foundry: the DNA synthesis and construction Foundry at Imperial College

    PubMed Central

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-01-01

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  1. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  2. The adenovirus E1A protein overrides the requirement for cellular ras in initiating DNA synthesis.

    PubMed Central

    Stacey, D W; Dobrowolski, S F; Piotrkowski, A; Harter, M L

    1994-01-01

    The adenovirus E1A protein can induce cellular DNA synthesis in growth-arrested cells by interacting with the cellular protein p300 or pRb. In addition, serum- and growth factor-dependent cells require ras activity to initiate DNA synthesis and recently we have shown that Balb/c 3T3 cells can be blocked in either early or late G1 following microinjection of an anti-ras antibody. In this study, the E1A 243 amino acid protein is shown through microinjection not only to shorten the G0 to S phase interval but, what is more important, to override the inhibitory effects exerted by the anti-ras antibody in either early or late G1. Specifically, whether E1A is co-injected with anti-ras into quiescent cells or injected 18 h following a separate injection of anti-ras after serum stimulation, it efficiently induces cellular DNA synthesis in cells that would otherwise be blocked in G0/G1. Moreover, injection of a mutant form of E1A that can no longer associate with p300 is just as efficient as wild-type E1A in stimulating DNA synthesis in cells whose ras activity has been neutralized by anti-ras. The results presented here show that E1A is capable of overriding the requirement of cellular ras activity in promoting the entry of cells into S phase. Moreover, the results suggest the possibility that pRb and/or pRb-related proteins may function in a ras-dependent pathway that enables E1A to achieve this activity. Images PMID:7813447

  3. The Foundry: the DNA synthesis and construction Foundry at Imperial College.

    PubMed

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-06-15

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  4. Bombesin stimulation of DNA synthesis and cell division in cultures of Swiss 3T3 cells.

    PubMed Central

    Rozengurt, E; Sinnett-Smith, J

    1983-01-01

    Bombesin is shown to be a potent mitogen for Swiss 3T3 cells. At nanomolar concentrations the peptide markedly enhances the ability of fresh serum to stimulate DNA synthesis in confluent and quiescent cultures of these cells. In the presence of a low concentration (3.5%) of serum, bombesin stimulates 3T3 cell proliferation. In serum-free medium, bombesin induces DNA synthesis in the absence of any other added growth factor; half-maximal effect is obtained at 1 nM. The mitogenic effect of bombesin is dependent on dose and time, is mimicked by litorin, and is markedly potentiated by insulin, colchicine, platelet-derived growth factor, and fibroblast-derived growth factor. These mitogens increase the maximal response elicited by bombesin and decrease the bombesin concentration required to produce half-maximal effect (from 1 nM to 0.3 nM). In contrast, vasopressin, phorbol esters, or cAMP increasing agents fail to enhance the maximal level of DNA synthesis induced by bombesin. Bombesin and litorin may provide useful model peptides for studies on the mechanism(s) by which extracellular ligands control cell proliferation. PMID:6344074

  5. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis

    PubMed Central

    Burkovics, Peter; Sebesta, Marek; Sisakova, Alexandra; Plault, Nicolas; Szukacsov, Valeria; Robert, Thomas; Pinter, Lajos; Marini, Victoria; Kolesar, Peter; Haracska, Lajos; Gangloff, Serge; Krejci, Lumir

    2013-01-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. PMID:23395907

  6. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis.

    PubMed

    Burkovics, Peter; Sebesta, Marek; Sisakova, Alexandra; Plault, Nicolas; Szukacsov, Valeria; Robert, Thomas; Pinter, Lajos; Marini, Victoria; Kolesar, Peter; Haracska, Lajos; Gangloff, Serge; Krejci, Lumir

    2013-03-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. PMID:23395907

  7. Stimulation of DNA synthesis in human epidermis by UVB radiation and its inhibition by difluoromethylornithine

    SciTech Connect

    Eshbaugh, W.G. Jr.; Forley, B.G.; Ritter, E.F.; Serafin, D.; Klitzman, B. )

    1990-04-01

    The purpose of this study was to determine whether the rate of DNA synthesis in human skin could be increased by UVB radiation and to determine the potential for reversing the stimulatory effects of UVB radiation by alpha-difluoromethylornithine (DFMO). Split-thickness facial skin was grafted onto athymic CD-1 Nu/Nu mice on the anterolateral dorsal surface. Following graft healing for 6 weeks, grafts were treated with 0%, 2%, or 5% DFMO (a potent inhibitor of polyamine biosynthesis) and subsequently irradiated with 0.15 J/cm2 of UVB light. Two days after UVB exposure, ({sup 3}H)thymidine was injected and the grafts were dissected and counted. Ultraviolet radiation significantly increased thymidine incorporation, indicating increased DNA synthesis. The stimulatory effects of UV radiation were significantly reduced by topical application of 5% DFMO. Thus administration of DFMO most likely decreased the polyamine level and decreased the rate of DNA synthesis, which may have caused a decreased rate of epidermal proliferation. Thus the topical application of DFMO may prove beneficial for UVB exposure and other hyperproliferative states where a decrease in the rate of cell turnover might be desirable.

  8. Deoxyadenosine family: improved synthesis, DNA damage and repair, analogs as drugs.

    PubMed

    Biswas, Himadri; Kar, Indrani; Chattopadhyaya, Rajagopal

    2013-08-01

    Improved synthesis of 2'-deoxyadenosine using Escherichia coli overexpressing some enzymes and gram-scale chemical synthesis of 2'-deoxynucleoside 5'-triphosphates reported recently are described in this review. Other topics include DNA damage induced by chromium(VI), Fenton chemistry, photoinduction with lumazine, or by ultrasound in neutral solution; 8,5'-cyclo-2'-deoxyadenosine isomers as potential biomarkers; and a recapitulation of purine 5',8-cyclonucleoside studies. The mutagenicities of some products generated by oxidizing 2'-deoxyadenosine 5'-triphosphate, nucleotide pool sanitization, and translesion synthesis are also reviewed. Characterizing cross-linking between nucleosides in opposite strands of DNA and endonuclease V-mediated deoxyinosine excision repair are discussed. The use of purine nucleoside analogs in the treatment of rarer chronic lymphoid leukemias is reviewed. Some analogs at the C8 position induced delayed polymerization arrest during HIV-1 reverse transcription. The susceptibility of clinically metronidazole-resistant Trichomonas vaginalis to two analogs, toyocamycin and 2-fluoro-2'-deoxyadenosine, were tested in vitro. GS-9148, a dAMP analog, was translocated to the priming site in a complex with reverse transcriptase and double-stranded DNA to gain insight into the mechanism of reverse transcriptase inhibition. PMID:25436589

  9. Stimulation of DNA synthesis in rat and mouse liver by various tumor promoters.

    PubMed

    Büsser, M T; Lutz, W K

    1987-10-01

    In order to investigate whether the stimulation of liver DNA synthesis might be used to detect one class of hepatic tumor promoters, the incorporation of orally administered radiolabelled thymidine into liver DNA was determined in rats and mice 24 h after a single oral gavage of test compounds at various dose levels. Three DNA-binding hepatocarcinogens, aflatoxin B1, benzidine and carbon tetrachloride, did not stimulate but rather inhibited DNA synthesis (not for CCl4). Four hepatic tumor promoters, clofibrate, DDT, phenobarbital and thioacetamide, gave rise to a stimulation in a dose-dependent manner. Single oral doses between 0.02 and 0.3 mmol/kg were required to double the level of thymidine incorporation into liver DNA (= doubling dose, DD). Differences between species or sex as observed in long-term carcinogenicity studies were reflected by a different stimulation of liver DNA synthesis. In agreement with the bioassay data, aldrin was positive only in male mice (DD = 0.007 mmol/kg) but not in male rats of female mice. 2,3,7,8-TCDD was positive in male mice (DD = 10(-6) mmol/kg) and in female rats (DD = 2 X 10(-6) mmol/kg) but not in male rats. The assay was also able to distinguish between structural isomers with different carcinogenicities. [alpha]Hexachlorocyclohexane stimulated liver DNA synthesis with a doubling dose of about 0.2 mmol/kg in male rats whereas the [gamma]-isomer was ineffective even at 1 mmol/kg. So far, only one result was inconsistent with carcinogenicity bioassay data. The different carcinogenicity of di(2-ethylhexyl)adipate (negative in rats) and di(2-ethylhexyl)phthalate (positive) was not detectable. Both plasticizers were positive in this short-term system with DD's of 0.7 mmol/kg for DEHA and 0.5 mmol/kg for DEHP. The proposed assay is discussed as an attempt to devise short-term assays for carcinogens not detected by the routine genotoxicity test systems. PMID:2443263

  10. Clarification on the Clarification on the April 8th Memorandum from H.E.W.

    ERIC Educational Resources Information Center

    Journal of the National Association for Bilingual Education, 1976

    1976-01-01

    The clarification of the April 8th memorandum is that "the Lau remedies are minimum requirements and that in cases depending on student language dominance, grade level, and academic achievement, a bilingual program 'is' the remedy, and the only educationally sound way of ensuring effective participation in the instructional program." (NQ)

  11. Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

    PubMed Central

    Horn, T; Chang, C A; Urdea, M S

    1997-01-01

    The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

  12. A Transcriptional Repressor ZBTB1 Promotes Chromatin Remodeling and Translesion DNA Synthesis

    PubMed Central

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A.; D’Andrea, Alan D.

    2014-01-01

    SUMMARY Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for PCNA monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for PCNA monoubiquitination, by localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a new ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair. PMID:24657165

  13. Centrosomal Localization of Cyclin E-Cdk2 is Required for Initiation of DNA Synthesis

    PubMed Central

    Ferguson, Rebecca L.; Maller, James L.

    2010-01-01

    Summary Cyclin E-Cdk2 is known to regulate both DNA replication and centrosome duplication during the G1-S transition in the cell cycle [1–4], and disruption of centrosomes results in a G1 arrest in some cell types [5–7]. Localization of cyclin E on centrosomes is mediated by a 20 amino acid domain termed the centrosomal localization sequence (CLS), and expression of the GFP-tagged CLS displaces both cyclin E and cyclin A from the centrosome [8]. In asynchronous cells CLS expression inhibits the incorporation of bromodeoxyuridine (BrdU) into DNA, an effect proposed to reflect a G1 arrest. Here we show in synchronized cells that the reduction in BrdU incorporation reflects not a G1 arrest but rather direct inhibition of the initiation of DNA replication in S phase. The loading of essential DNA replication factors such as Cdc45 and PCNA onto chromatin is blocked by CLS expression, but DNA synthesis can be rescued by retargeting active cyclin E-Cdk2 to the centrosome. These results suggest that initial steps of DNA replication require centrosomally localized Cdk activity and link the nuclear cycle with the centrosome cycle at the G1-S transition. PMID:20399658

  14. Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

    SciTech Connect

    Lovrinovic, Marina; Niemeyer, Christof M. . E-mail: christof.niemeyer@uni-dortmund.de

    2005-09-30

    We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter were ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.

  15. In vitro synthesis of large peptide molecules using glucosylated single-stranded bacteriophage T4D DNA template.

    PubMed Central

    Hulen, C; Legault-Demare, J

    1975-01-01

    Denatured Bacteriophage T4D DNA is able to stimulate aminoacid incorporation into TCA-precipitable material in an in vitro protein synthesis system according to base DNA sequences. Newly synthesized polypeptides remain associated with ribosomes and have a molecular weight in range of 15,000 to 45,000 Daltons. PMID:1052527

  16. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  17. A versatile biosensing system for DNA-related enzyme activity assay via the synthesis of silver nanoclusters using enzymatically-generated DNA as template.

    PubMed

    Yuan, Yijia; Li, Wenhua; Liu, Zhuoliang; Nie, Zhou; Huang, Yan; Yao, Shouzhuo

    2014-11-15

    In the present day, oligonucleotide-encapsulated silver clusters (DNA-AgNCs) have been widely applied into bio-analysis as a signal producer. Herein, we developed a novel method to synthesize DNA-AgNCs encapsulated by long-chain cytosine (C)-rich DNA. Such DNA was polymerized in a template-free way by terminal deoxynucleotidyl transferase (TdT). We demonstrated that TdT-polymerized long chain C-rich DNA can serve as an excellent template for AgNCs synthesis. Based on this novel synthesis strategy, we developed a label-free and turn-on fluorescence assay to detect TdT activity with ultralow limit of detection (LOD) of 0.0318 U and ultrahigh signal to background (S/B) of 46.7. Furthermore, our proposed method was extended to a versatile biosensing strategy for turn-on nucleases activity assay based on the enzyme-activated TdT polymerization. Two nucleases, EcoRI and ExoIII as model of endonuclease and exonuclease, respectively, have been detected with high selectivity and competitive low LOD of 0.0629 U and 0.00867 U, respectively. Our work demonstrates the feasibility of TdT polymerization-based DNA-AgNCs synthesis strategy as a versatile and potent biosensing platform to detect the activity of DNA-related enzymes. PMID:24907540

  18. Simultaneous measurement of unscheduled and replicating DNA synthesis by means of a new cell culture insert DNA retention method: rapid induction of replicating DNA synthesis in response to genotoxic carcinogens.

    PubMed

    Okumura, A; Tanaka, T; Mori, H

    1996-08-01

    In order to measure simultaneously replicating DNA synthesis (RDS) and unscheduled DNA synthesis (UDS) in rat hepatocytes responding to exposure to carcinogens, a new method, namely the "cell culture insert DNA retention (CDR)" method, was developed. All CDR procedures for cell culture, digestion of cytoplasm and retention of DNA were performed on membranes attached to cell culture containers. Four subgroups of primary cultures of hepatocytes prepared from rats were exposed to a genotoxic or non-genotoxic carcinogen with or without 10 mM hydroxyurea and incubated for 4 h with 10 microCi/ml [3H]thymidine. The membranes were then processed for both liquid scintillation and autoradiography. Among seven tested chemicals, three genotoxic agents, 3,2'-dimethyl-4-aminobiphenyl, 2-acetylaminofluorene and diethylnitrosamine, and two non-genotoxic carcinogens, nafenopin and phenobarbital, induced RDS within 4 h after the exposure, indicating that these carcinogenic agents induce cell proliferation is non-proliferating rat hepatocytes prior to the emergence of genotoxic changes. Several indices were devised to characterize the genotoxicity of the tested chemicals. The induction patterns obtained showed a wide variation in the individual characteristics of carcinogen-induced genotoxicity and mitogenicity in the early phase of initiation. This is the first report of simultaneous measurement, by using a combination of autoradiography and liquid scintillation, of UDS and RDS induced in rat hepatocytes. The described CDR approach will be useful for risk assessment and characterization of carcinogenic and tumor-promoting agents. PMID:8797886

  19. Timing of initiation of macronuclear DNA synthesis is set during the preceding cell cycle in Paramecium tetraurelia: analysis of the effects of abrupt changes in nutrient level

    SciTech Connect

    Ching, A.S.L.; Berger, J.D.

    1986-11-01

    In many eukaryotic organisms, initiation of DNA synthesis is associated with a major control point within the cell cycle and reflects the commitment of the cell to the DNA replication-division portion of the cell cycle. In paramecium, the timing of DNA synthesis initiation is established prior to fission during the preceding cell cycle. DNA synthesis normally starts at 0.25 in the cell cycle. When dividing cells are subjected to abrupt nutrient shift-up by transfer from a chemostat culture to medium with excess food, or shift-down from a well-fed culture to exhausted medium, DNA synthesis initiation in the post-shift cell cycle occurs at 0.25 of the parental cell cycle and not at either 0.25 in the post-shift cell cycle or at 0.25 in the equilibrium cell cycle produced under the post-shift conditions. The long delay prior to initiation of DNA synthesis following nutritional shift-up is not a consequence of continued slow growth because the rate of protein synthesis increases rapidly to the normal level after shift-up. Analysis of the relation between increase in cell mass and initiation of DNA synthesis following nutritional shifts indicates that increase in cell mass, per se, is neither a necessary nor a sufficient condition for initiation of DNA synthesis, in spite of the strong association between accumulation of cell mass and initiation of DNA synthesis in cells growing under steady-state conditions.

  20. DNA synthesis and tritiated thymidine incorporation by heterotrophic freshwater bacteria in continuous culture

    SciTech Connect

    Ellenbroek, F.M.; Cappenberg, T.E. )

    1991-06-01

    Continuous cultivation of heterotrophic freshwater bacteria was used to assess the relationship between DNA synthesis and tritiated thymidine incorporation. In six different continuous cultures, each inoculated with a grazer-free mixed bacterial sample from Lake Vechten (The Netherlands), tritiated thymidine incorporation into a cold trichloroacetic acid precipitate and bacterial cell production were measured simultaneously. Empirical conversion factors were determined by division of both parameters. They ranged from 0.25 {times} 10{sup 18} to 1.31 {times} 10{sup 18} cells mol of tritiated thymidine{sup {minus}1}. In addition, DNA concentrations were measured by fluorometry with Heochst 33258. The validity of this technique was confirmed. Down to a generation time of 0.67 day, bacterial DNA content showed little variation, with values of 3.8 to 4.9 fg of DNA cell{sup {minus}1}. Theoretical conversion factors, which can be derived from DNA content under several assumptions, were between 0.26 {times} 10{sup 18} and 0.34 {times} 10{sup 18} cells mol of thymidine{sup {minus}1}. Isotope dilution was considered the main factor in the observed discrepancy between the conversion factors. In all experiments, a tritiated thymidine concentration of 20 nM was used. It was concluded that the observed difference resulted from intracellular isotope dilution which cannot be detected by current techniques for isotope dilution analysis.

  1. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions

    PubMed Central

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G.

    2015-01-01

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa–Atr–Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  2. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions.

    PubMed

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G; de Wind, Niels

    2015-04-13

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa-Atr-Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  3. Temporal and topographic changes in DNA synthesis after induced follicular atresia

    SciTech Connect

    Greenwald, G.S. )

    1989-07-01

    Hamsters were hypophysectomized on the morning of estrus (Day 1) and injected immediately with 30 IU pregnant mare's serum (PMS). This was followed on Day 4 by the injection of an antiserum to PMS (PMS-AS) that initiated follicular atresia (Time zero). From 0 to 72 h after PMS-AS, the animals were injected with (3H)thymidine and killed 4 h later. One ovary was saved for autoradiography and histology; from the other ovary, 5-10 large antral follicles were dissected and pooled, and incorporation into DNA was determined by scintillation counting. DNA synthesis dropped sharply between 12 and 18 h, coinciding with a fall in labeling index of the cumulus oophorus and thecal endothelial cells and a sharp fall in thecal vascularity. In contrast, for the mural granulosa cells bordering on the antral cavity, labeling index dropped sharply between 8 and 12 h when thecal vascularity was still high. The earliest sign of atresia was evident by 4 h in cumulus cells when, paradoxically, DNA synthesis was still high. It took 3 days for atresia of the antral follicles to progress to advanced stages, as evidenced by pseudo-pronuclei in the free floating ovum, further erosion of the mural granulosa, and minimal DNA/follicle. However, the theca still retained its histological integrity and contained no pyknotic cells. Although by 48 h the granulosal compartment was in disarray (DNA/follicle significantly different from earlier values), the egg was still viable, as judged by maximal fluorescence after the addition of fluoroscein diacetate.

  4. Inhibition by 2-deoxy-D-ribose of DNA synthesis and growth in Raji cells

    SciTech Connect

    Ulrich, F.

    1988-04-01

    When Raji cells were cultured for 3 days in serum-free medium, addition of 2-deoxy-D-ribose at the start of culture inhibited incorporation of (/sup 3/H)thymidine and cell division. At deoxyribose concentrations between 1 and 5 mM, viability was 80% or greater after 3 days of culture even though 5 mM deoxyribose inhibited thymidine incorporation 95-99%. Inhibition by deoxyribose could be completely reversed if the culture medium was replaced with fresh medium up to 8 hr after the start of culture. The inhibition was specific for deoxyribose since other monosaccharides had no effect. Inhibition of DNA synthesis did not appear to be due to depletion of essential nutrients in the medium since the percentage inhibition of thymidine incorporation by cells cultured either in suboptimal serum-free media or in media supplemented with 0.025-5% human AB serum was similar. When DNA repair synthesis was measured as hydroxyurea-resistant thymidine incorporation, addition of deoxyribose to Raji cultures caused increased thymidine incorporation. These results, together with data from others,suggest that deoxyribose damages DNA.

  5. Microinjection of fos-specific antibodies blocks DNA synthesis in fibroblast cells

    SciTech Connect

    Riabowol, K.T.; Vosatka, R.J.; Ziff, E.B.; Lamb, N.J.; Feramisco, J.R.

    1988-04-01

    Transcription of the protooncogene c-fos is increased >10-fold within minutes of treatment of fibroblasts with serum or purified growth factors. Recent experiments with mouse 3T3 cell lines containing inducible fos antisense RNA constructs have shown that induced fos antisense RNA transcripts cause either a marked inhibition of growth in continuously proliferating cells or, conversely, a minimal effect except during the transition from a quiescent (G/sub o/) state into the cell cycle. Since intracellular production of large amounts of antisense RNA does not completely block gene expression, the authors microinjected affinity-purified antibodies raised against fos to determine whether and when during the cell cycle c-fos expression was required for cell proliferation. Using this independent method, they found that microinjected fos antibodies efficiently blocked serum-stimulated DNA synthesis when injected up to 6 to 8 h after serum stimulation of quiescent REF-52 fibroblasts. Furthermore, when fos antibodies were injected into asynchronously growing cells, a consistently greater number of cells was prevented from synthesizing DNA than when cells were injected with nonspecific immunoglobulins. Thus, whereas the activity of c-fos may be necessary for transition of fibroblasts from G/sub o/ to G/sub 1/ of the cell cycle, its function is also required during the early G/sub 1/ portion of the cell cycle to allow subsequent DNA synthesis.

  6. Non-transcriptional action of oestradiol and progestin triggers DNA synthesis.

    PubMed Central

    Castoria, G; Barone, M V; Di Domenico, M; Bilancio, A; Ametrano, D; Migliaccio, A; Auricchio, F

    1999-01-01

    The recent findings that oestradiol and progestins activate the Src/Ras/Erks signalling pathway raise the question of the role of this stimulation. Microinjection experiments of human mammary cancer-derived cells (MCF-7 and T47D) with cDNA of catalytically inactive Src or anti-Ras antibody prove that Src and Ras are required for oestradiol and progestin-dependent progression of cells through the cell cycle. The antitumoral ansamycin antibiotic, geldanamycin, disrupts the steroid-induced Ras-Raf-1 association and prevents Raf-1 activation and steroid-induced DNA synthesis. Furthermore, the selective MEK 1 inhibitor, PD 98059, inhibits oestradiol and progestin stimulation of Erk-2 and the steroid-dependent S-phase entry. The MDA-MB231 cells, which do not express oestradiol receptor, fail to respond to oestradiol in terms of Erk-2 activation and S-phase entry. Fibroblasts are made equally oestradiol-responsive in terms of DNA synthesis by transient transfection with either the wild-type or the transcriptionally inactive mutant oestradiol receptor (HE241G). Co-transfection of catalytically inactive Src as well as treatment with PD98059 inhibit the oestradiol-dependent S-phase entry of fibroblasts expressing either the wild-type oestrogen receptor or its transcriptionally inactive mutant. The data presented support the view that non-transcriptional action of the two steroids plays a major role in cell cycle progression. PMID:10228164

  7. Enhanced unscheduled DNA synthesis in UV-irradiated human skin explants treated with T4N5 liposomes

    SciTech Connect

    Yarosh, D.B.; Kibitel, J.T.; Green, L.A.; Spinowitz, A. )

    1991-07-01

    Epidermal keratinocytes cultured from explants of skin cancer patients, including biopsies from xeroderma pigmentosum patients, were ultraviolet light-irradiated and DNA repair synthesis was measured. Repair capacity was much lower in xeroderma pigmentosum patients than in normal patients. The extent of DNA repair replication did not decline with the age of the normal patient. Treatment with T4N5 liposomes containing a DNA repair enzyme enhanced repair synthesis in both normal and xeroderma pigmentosum keratinocytes in an irradiation- and liposome-dose dependent manner. These results provide no evidence that aging people or skin cancer patients are predisposed to cutaneous malignancy by a DNA repair deficiency, but do demonstrate that T4N5 liposomes enhance DNA repair in the keratinocytes of the susceptible xeroderma pigmentosum and skin cancer population.

  8. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. PMID:24571086

  9. Assessment of DNA synthesis in Islet-1{sup +} cells in the adult murine heart

    SciTech Connect

    Weinberger, Florian Mehrkens, Dennis Starbatty, Jutta Nicol, Philipp Eschenhagen, Thomas

    2015-01-02

    Highlights: • Islet-1 was expressed in the adult heart. • Islet-1-positive cells did not proliferate in the adult heart. • Sinoatrial node cells did not proliferate in the adult heart. - Abstract: Rationale: Islet-1 positive (Islet-1{sup +}) cardiac progenitor cells give rise to the right ventricle, atria and outflow tract during murine cardiac development. In the adult heart Islet-1 expression is limited to parasympathetic neurons, few cardiomyocytes, smooth muscle cells, within the proximal aorta and pulmonary artery and sinoatrial node cells. Its role in these cells is unknown. Here we tested the hypothesis that Islet-1{sup +} cells retain proliferative activity and may therefore play a role in regenerating specialized regions in the heart. Methods and results: DNA synthesis was analyzed by the incorporation of tritiated thymidine ({sup 3}H-thymidine) in Isl-1-nLacZ mice, a transgenic model with an insertion of a nuclear beta-galactosidase in the Islet-1 locus. Mice received daily injections of {sup 3}H-thymidine for 5 days. DNA synthesis was visualized throughout the heart by dipping autoradiography of cryosections. Colocalization of an nLacZ-signal and silver grains would indicate DNA synthesis in Islet-1{sup +} cells. Whereas Islet{sup −} non-myocyte nuclei were regularly marked by accumulation of silver grains, colocalization with nLacZ-signals was not detected in >25,000 cells analyzed. Conclusions: Islet-1{sup +} cells are quiescent in the adult heart, suggesting that, under normal conditions, even pacemaking cells do not proliferate at higher rates than normal cardiac myocytes.

  10. Modulation of the equilibrative nucleoside transporter by inhibitors of DNA synthesis.

    PubMed Central

    Pressacco, J.; Wiley, J. S.; Jamieson, G. P.; Erlichman, C.; Hedley, D. W.

    1995-01-01

    Expression of the equilibrative, S-(p-nitrobenzyl)-6-thioinosine (NBMPR)-sensitive nucleoside transporter (es), a component of the nucleoside salvage pathway, was measured during unperturbed growth and following exposure to various antimetabolites at growth-inhibitory concentrations. The probe 5-(SAENTA-x8)-fluorescein is a highly modified form of adenosine incorporating a fluorescein molecule. It binds. with high affinity and specificity to the (es) nucleoside transporter at a 1:1 stoichiometry, allowing reliable estimates of es expression by flow cytometry. Using a dual labelling technique which combined the vital DNA dye Hoechst-33342 and 5-(SAENTA-x8)-fluorescein, we found that surface expression of es approximately doubled between G1 and G2 + M phases of the cell cycle. To address the question of whether es expression could be modulated in cells exposed to drugs which inhibit de novo synthesis of nucleotides, cells were exposed to antimetabolite drugs having different modes of action. Hydroxyurea and 5-fluorouracil (5-FU), which inhibit the de novo synthesis of DNA precursors, produced increases in the expression of es. In contrast, cytosine arabinoside (ara-C) and aphidicolin, which directly inhibit DNA synthesis, produced no significant increase in es expression. Thymidine (TdR), which is an allosteric inhibitor of ribonucleotide reductase that depletes dATP, dCTP and dGTP pools while repleting the dTTP pool, had no significant effect on es expression. These data suggest that surface expression of the es nucleoside transporter is regulated by a mechanism which is sensitive to the supply of deoxynucleotides. Because 5-FU (which specifically depletes dTTP pools) causes a large increase in expression whereas TdR (which depletes all precursors except dTTP) does not, this mechanism might be particularly sensitive to dTTP pools. PMID:7547244

  11. Nicotine inhibits collagen synthesis and alkaline phosphatase activity, but stimulates DNA synthesis in osteoblast-like cells

    SciTech Connect

    Ramp, W.K.; Lenz, L.G.; Galvin, R.J. )

    1991-05-01

    Use of smokeless tobacco is associated with various oral lesions including periodontal damage and alveolar bone loss. This study was performed to test the effects of nicotine on bone-forming cells at concentrations that occur in the saliva of smokeless tobacco users. Confluent cultures of osteoblast-like cells isolated from chick embryo calvariae were incubated for 2 days with nicotine added to the culture medium (25-600 micrograms/ml). Nicotine inhibited alkaline phosphatase in the cell layer and released to the medium, whereas glycolysis (as indexed by lactate production) was unaffected or slightly elevated. The effects on medium and cell layer alkaline phosphatase were concentration dependent with maximal inhibition occurring at 600 micrograms nicotine/ml. Nicotine essentially did not affect the noncollagenous protein content of the cell layer, but did inhibit collagen synthesis (hydroxylation of ({sup 3}H)proline and collagenase-digestible protein) at 100, 300, and 600 micrograms/ml. Release of ({sup 3}H)hydroxyproline to the medium was also decreased in a dose-dependent manner, as was the collagenase-digestible protein for both the medium and cell layer. In contrast, DNA synthesis (incorporation of ({sup 3}H)thymidine) was more than doubled by the alkaloid, whereas total DNA content was slightly inhibited at 600 micrograms/ml, suggesting stimulated cell turnover. Morphologic changes occurred in nicotine-treated cells including rounding up, detachment, and the occurrence of numerous large vacuoles. These results suggest that steps to reduce the salivary concentration of nicotine in smokeless tobacco users might diminish damaging effects of this product on alveolar bone.

  12. Enhanced GSH synthesis by Bisphenol A exposure promoted DNA methylation process in the testes of adult rare minnow Gobiocypris rarus.

    PubMed

    Yuan, Cong; Zhang, Yingying; Liu, Yan; Zhang, Ting; Wang, Zaizhao

    2016-09-01

    DNA methylation is a commonly studied epigenetic modification. The mechanism of BPA on DNA methylation is poorly understood. The present study aims to explore whether GSH synthesis affects DNA methylation in the testes of adult male rare minnow Gobiocypris rarus in response to Bisphenol A (BPA). Male G. rarus was exposed to 1, 15 and 225μgL(-1) BPA for 7 days. The levels of global DNA methylation, hydrogen peroxide (H2O2) and glutathione (GSH) in the testes were analyzed. Meanwhile, the levels of enzymes involved in DNA methylation and de novo GSH synthesis, and the substrate contents for GSH production were measured. Furthermore, gene expression profiles of the corresponding genes of all studied enzymes were analyzed. Results indicated that BPA at 15 and 225μgL(-1) caused hypermethylation of global DNA in the testes. The 15μgL(-1) BPA resulted in significant decrease of ten-eleven translocation proteins (TETs) while 225μgL(-1) BPA caused significant increase of DNA methyltransferase proteins (DNMTs). Moreover, 225μgL(-1) BPA caused significant increase of H2O2 and GSH levels, and the de novo GSH synthesis was enhanced. These results indicated that the significant decrease of the level of TETs may be sufficient to cause the DNA hypermethylation by 15μgL(-1) BPA. However, the significantly increased of DNMTs contributed to the significant increase of DNA methylation levels by 225μgL(-1) BPA. Moreover, the elevated de novo GSH synthesis may promote the DNA methylation process. PMID:27474941

  13. Delayed clarification: information, clarification and ethical decisions in critical care in Norway.

    PubMed

    Bunch, E H

    2000-12-01

    Following the analysis of about 150 hours of field observation on a critical care unit in Norway a theory was generated to explain the actual ethical decision-making process. This was grounded in the empirical reality of physicians, nurses and family. The core theme in this study was a delayed clarification in assessing the prognosis of accident victims with neurosurgical traumas. The physicians, nurses and family had to wait for the clinical picture to clarify, during which time there was an exchange and emergence of information. Exchanging information, a subprocess to delayed clarification, involved a continuous flow of collecting and dispersing information about the clinical status of the patient. The nurses engaged in two useful strategies: grading information to family when the patient prognosis was poor, and providing grieving strategies for themselves, colleagues and family members. The core variable, delayed clarification has three dimensions: clinical, psychological and ethical. The nurses participated in the decision-making process to discontinue treatment as passive participants, they did not engage in collegial deliberations with the physicians. Ethical dilemmas were end of life questions, resource allocations, and questions of justice and organ transplants. PMID:11136417

  14. Fabrication of polyurethane molecular stamps for the synthesis of DNA microarray

    NASA Astrophysics Data System (ADS)

    Liu, Zhengchun; He, Quanguo; Xiao, Pengfeng; He, Nongyao; Lu, Zuhong; Bo, Liang

    2001-10-01

    Polyurethane based on polypropylene glycol (PPG) and Toluene diisocyanate (TDI) using 3,3'-dichloride-4,4'- methylenedianiline (MOCA) as the crosslinker is presented for the first time to fabricate molecular stamps (PU stamps) for the synthesis of DNA microarray with contact procedure. The predictability of the process is achieved by utilizing commercially available starting materials. SEM analysis of the morphology of PU stamps and master showed that PU elastometer could replicate subtly the motherboard's patterns with high fidelity. It was proved from the contact angle measurement that PU stamps surface has good affinity with acetonitrile, which guarantee the well-distribution of DNA monomers on patterned stamps. Laser confocal fluorescence microscopy images of oligonucleotide arrays confirmed polyurethane is an excellent material for molecular stamps.

  15. Inositol stimulates DNA and protein synthesis, and expansion by rabbit blastocysts in vitro.

    PubMed

    Fahy, M M; Kane, M T

    1992-04-01

    The effect of different concentrations (0, 0.6, 3, 15, 75 and 375 microM) of myo-inositol on the development of rabbit morulae to expanded blastocysts was investigated in terms of blastocyst expansion and synthesis of DNA and protein, as measured by incorporation of [3H]thymidine and [14C]amino acids into acid-precipitable material. A concentration of 15 microM inositol caused a 2.8-fold increase in blastocyst expansion (P less than 0.01), a 9.9-fold increase in thymidine incorporation into DNA (P less than 0.01) and a 3.6-fold increase in amino acid incorporation into protein (P less than 0.01). There were no significant differences in the range from 15 to 375 microM inositol. PMID:1522201

  16. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    PubMed Central

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai

    2014-01-01

    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  17. Radiofrequency (microwave) radiation exposure of mammalian cells during UV-induced DNA repair synthesis

    SciTech Connect

    Meltz, M.L.; Walker, K.A.; Erwin, D.N.

    1987-05-01

    The effect of continuous-wave (CW) and pulsed-wave (PW) radiofrequency radiation (RFR) in the microwave range on UV-induced DNA repair has been investigated in MRC-5 normal human diploid fibroblasts. RFR exposure at power densities of 1 (or 5) and 10 mW/cm2 gave a maximum specific absorption rate (SAR) (at 10 mW/cm2) of 0.39 +/- 0.15 W/kg for 350 MHz RFR, 4.5 +/- 3.0 W/kg for 850 MHz RFR, and 2.7 +/- 1.6 W/kg for 1.2 GHz RFR. RFR exposures for 1 to 3 h at 37 degrees C, in either continuous-wave or pulsed-wave modes, had no effect on the rate of repair replication label incorporated into preexisting UV-damaged DNA. RFR exposures (PW), with a constant medium temperature of 39 degrees C at 350 and 850 MHz during the repair period after UV damage, also had no effect. Assay for induction of repair synthesis by RFR exposure alone in non-UV irradiated cells was negative for the 350-, 850-, and 1200-MHz CW and PW RFR at 37 degrees C and the 350- and 850-MHz PW RFR at 39 degrees C. RFR does not induce DNA repair under these exposure conditions. In preliminary experiments--with the tissue culture medium maintained at 39 degrees C and RFR exposures (PW) at the frequencies of 350, 850, and 1200 MHz--no effect on incorporation of (/sup 3/H)thymidine into DNA undergoing semiconservative synthesis was observed.

  18. Convergent DNA synthesis: a non-enzymatic dimerization approach to circular oligodeoxynucleotides.

    PubMed Central

    Rubin, E; Rumney, S; Wang, S; Kool, E T

    1995-01-01

    We report a novel convergent approach to the construction of circular DNA oligonucleotides from two smaller linear precursors. Circular DNAs 34-74 nucleotides (nt) in size are constructed non-enzymatically in a single step from two half-length oligomers. A DNA template is used to assemble the constituent parts into a triple helical complex which brings the four reactive ends together for chemical ligation with BrCN/imidazole/Ni2+. A homodimerization reaction strategy is successfully used on a small scale to construct circles 42, 58 and 74 nt in size. In addition, a heterodimerization strategy is successfully used in two cases to construct circular 34mers from different 16mer and 18mer precursors. Measurement of preparative yields for one biologically active 34mer circle shows that the dimerization strategy gives a yield higher than that from conventional cyclization and nearly as high as that for a normally synthesized linear DNA, establishing that there is not necessarily a yield penalty for circle construction. Six additional preparative circle constructions, giving conversions of approximately 33-85% from precursors to circular product, are also described. Convergent strategies allow the construction of medium and large size DNA molecules in higher yields than can be achieved by standard linear synthesis alone. Images PMID:7567468

  19. Replication Protein A: Single-stranded DNA's first responder : Dynamic DNA-interactions allow Replication Protein A to direct single-strand DNA intermediates into different pathways for synthesis or repair

    PubMed Central

    Chen, Ran; Wold, Marc S.

    2015-01-01

    Summary Replication Protein A (RPA), the major single-stranded DNA-binding protein in eukaryotic cells, is required for processing of single-stranded DNA (ssDNA) intermediates found in replication, repair and recombination. Recent studies have shown that RPA binding to ssDNA is highly dynamic and that more than high-affinity binding is needed for function. Analysis of DNA binding mutants identified forms of RPA with reduced affinity for ssDNA that are fully active, and other mutants with higher affinity that are inactive. Single molecule studies showed that while RPA binds ssDNA with high affinity, the RPA complex can rapidly diffuse along ssDNA and be displaced by other proteins that act on ssDNA. Finally, dynamic DNA binding allows RPA to prevent error-prone repair of double-stranded breaks and promote error-free repair. Together, these findings suggest a new paradigm where RPA acts as a first responder at sites with ssDNA, thereby actively coordinating DNA repair and DNA synthesis. PMID:25171654

  20. Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.

    PubMed

    Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus

    2012-10-01

    Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. PMID:22766489

  1. In vivo evidence for translesion synthesis by the replicative DNA polymerase δ

    PubMed Central

    Hirota, Kouji; Tsuda, Masataka; Mohiuddin; Tsurimoto, Toshiki; Cohen, Isadora S.; Livneh, Zvi; Kobayashi, Kaori; Narita, Takeo; Nishihara, Kana; Murai, Junko; Iwai, Shigenori; Guilbaud, Guillaume; Sale, Julian E.; Takeda, Shunichi

    2016-01-01

    The intolerance of DNA polymerase δ (Polδ) to incorrect base pairing contributes to its extremely high accuracy during replication, but is believed to inhibit translesion synthesis (TLS). However, chicken DT40 cells lacking the POLD3 subunit of Polδ are deficient in TLS. Previous genetic and biochemical analysis showed that POLD3 may promote lesion bypass by Polδ itself independently of the translesion polymerase Polζ of which POLD3 is also a subunit. To test this hypothesis, we have inactivated Polδ proofreading in pold3 cells. This significantly restored TLS in pold3 mutants, enhancing dA incorporation opposite abasic sites. Purified proofreading-deficient human Polδ holoenzyme performs TLS of abasic sites in vitro much more efficiently than the wild type enzyme, with over 90% of TLS events resulting in dA incorporation. Furthermore, proofreading deficiency enhances the capability of Polδ to continue DNA synthesis over UV lesions both in vivo and in vitro. These data support Polδ contributing to TLS in vivo and suggest that the mutagenesis resulting from loss of Polδ proofreading activity may in part be explained by enhanced lesion bypass. PMID:27185888

  2. Protein, RNA, and DNA synthesis in cultures of skin fibroblasts from healthy subjects and patients with rheumatic diseases

    SciTech Connect

    Abakumova, O.Y.; Kutsenko, N.G.; Panasyuk, A.F.

    1985-07-01

    To study the mechanism of the lasting disturbance of fibroblast function, protein, RNA and DNA synthesis was investigated in skin fibroblasts from patients with rheumatoid arthritis (RA) and systemic scleroderma (SS). The labeled precursors used to analyze synthesis of protein, RNA, and DNA were /sup 14/C-protein hydrolysate, (/sup 14/C)uridine, and (/sup 14/C) thymidine. Stimulation was determined by measuring incorporation of (/sup 14/C)proline into fibroblast proteins. During analysis of stability of fast-labeled RNA tests were carried out to discover whether all measurable radioactivity belonged to RNA molecules.

  3. Synergistic template-free synthesis of dsDNA by Thermococcus nautili primase PolpTN2, DNA polymerase PolB, and pTN2 helicase.

    PubMed

    Béguin, Pierre; Gill, Sukhvinder; Charpin, Nicole; Forterre, Patrick

    2015-01-01

    A combination of three enzymes from the hyperthermophilic archaeon Thermococcus nautili, DNA primase PolpTN2, DNA polymerase PolB, and pTN2 DNA helicase, was found to synthesize up to 300-400 ng/µl dsDNA from deoxynucleotide triphosphates in less than 30 min in the absence of added template DNA and oligonucleotide primer. The reaction did not occur below 64 °C. No synthesis was observed if PolpTN2 or PolB were left out; helicase was not essential but accelerated the reaction. The DNA synthesized consisted of highly reiterated palindromic sequences reaching up to more that 10 kb. Sequence analysis of three independent reaction products synthesized at different temperatures showed that the palindromes shared a common pentanucleotide core, suggesting that random nucleic acid fragments were not responsible for priming the reaction. When enzymes were added sequentially, preincubation with primase plus helicase followed by PolB led to a shorter delay before the onset of the reaction as compared to preincubation with PolB plus helicase followed by primase. This suggests that the primase generates seeds that are subsequently amplified and elongated in synergy with PolB by a mechanism involving hairpin formation and slippage synthesis. PMID:25420601

  4. Induction of unscheduled DNA synthesis in suspensions of rat hepatocytes by an environmental toxicant, 3,3'4,4'-tetrachloroazobenzene.

    PubMed

    Hsia, M T; Kreamer, B L

    1979-04-01

    Unscheduled DNA synthesis was induced by 3,3'4,4'-tetrachloroazobenzene (TCAB)) in freshly isolated suspensions of rat hepatocytes. A dose-dependent response was demonstrated. Hepatocellular DNA was obtained after the chloroform-isoamyl alchohol-phenol extraction of the isolated nuclei. The induction of unscheduled DNA synthesis was measured by the incorporation of [3H]-thymidine in the presence of hydroxyurea as determined by the scintillation counting assay. DNA repair data obtained in this study on benzo[a]pyrene and methyl methanesulfonate are comparable to a previous report using primary cultures of hepatocytes and cesium chloride gradients. Hence, the present method offers promise as a rapid and sensitive screen for chemical carcinogens. PMID:436117

  5. Estrogen-induced DNA synthesis in vascular endothelial cells is mediated by ROS signaling

    PubMed Central

    Felty, Quentin

    2006-01-01

    Background Since estrogen is known to increase vascular endothelial cell growth, elevated estrogen exposure from hormone replacement therapy or oral contraceptives has the potential to contribute in the development of abnormal proliferative vascular lesions and subsequent thickening of the vasculature. How estrogen may support or promote vascular lesions is not clear. We have examined in this study whether estrogen exposure to vascular endothelial cells increase the formation of reactive oxygen species (ROS), and estrogen-induced ROS is involved in the growth of endothelial cells. Methods The effect of estrogen on the production of intracellular oxidants and the role of estrogen-induced ROS on cell growth was studied in human umbilical vein endothelial cells. ROS were measured by monitoring the oxidation of 2'7'-dichlorofluorescin by spectrofluorometry. Endothelial cell growth was measured by a colorimetric immunoassay based on BrdU incorporation into DNA. Results Physiological concentrations of estrogen (367 fmol and 3.67 pmol) triggered a rapid 2-fold increase in intracellular oxidants in endothelial cells. E2-induced ROS formation was inhibited to basal levels by cotreatment with the mitochondrial inhibitor rotenone (2 μM) and xanthine oxidase inhibitor allopurinol (50 μM). Inhibitors of NAD(P)H oxidase, apocynin and DPI, did not block E2-induced ROS formation. Furthermore, the NOS inhibitor, L-NAME, did not prevent the increase in E2-induced ROS. These findings indicate both mitochondria and xanthine oxidase are the source of ROS in estrogen treated vascular endothelial cells. E2 treated cells showed a 2-fold induction of BrdU incorporation at 18 h which was not observed in cells exposed to vehicle alone. Cotreatment with ebselen (20 μM) and NAC (1 mM) inhibited E2-induced BrdU incorporation without affecting the basal levels of DNA synthesis. The observed inhibitory effect of NAC and ebselen on E2-induced DNA synthesis was also shown to be dose dependent

  6. Insights into eukaryotic primer synthesis from structures of the p48 subunit of human DNA primase

    PubMed Central

    Vaithiyalingam, Sivaraja; Arnett, Diana R.; Aggarwal, Amit; Eichman, Brandt F.; Fanning, Ellen; Chazin, Walter J.

    2013-01-01

    DNA replication in all organisms requires polymerases to synthesize copies of the genome. DNA polymerases are unable to function on a bare template and require a primer. Primases are crucial RNA polymerases that perform the initial de novo synthesis, generating the first 8–10 nucleotides of the primer. Although structures of archaeal and bacterial primases have provided insights into general priming mechanisms, these proteins are not well conserved with heterodimeric (p48/p58) primases in eukaryotes. Here, we present X-ray crystal structures of the catalytic engine of a eukaryotic primase, which is contained in the p48 subunit. The structures of p48 reveal eukaryotic primases maintain the conserved catalytic prim fold domain, but with a unique sub-domain not found in the archaeal and bacterial primases. Calorimetry experiments reveal Mn2+ but not Mg2+ significantly enhances the binding of nucleotide to primase, which correlates with in vitro higher catalytic efficiency. The structure of p48 with bound UTP and Mn2+ provides insights into the mechanism of nucleotide synthesis by primase. Substitution of conserved residues involved in either metal or nucleotide binding altered nucleotide binding affinities, and yeast strains containing the corresponding Pri1p substitutions were not viable. Our results revealed two residues (S160 and H166) in direct contact with the nucleotide that were previously unrecognized as critical to the human primase active site. Comparing p48 structures to those of similar polymerases in different states of action suggests changes that would be required to attain a catalytically competent conformation capable of initiating dinucleotide synthesis. PMID:24239947

  7. Measuring DNA synthesis rates with [1-13C]glycine.

    PubMed

    Chen, P; Abramson, F P

    1998-05-01

    We have devised and evaluated a stable-isotopic method for measuring DNA synthesis rates. The probe is [1-13C]-glycine that is incorporated into purines via de novo biosynthesis. The human hepatoma cell line HEP G2 was grown in medium containing [1-13C]glycine, the cells were harvested at various times, and the DNA was extracted. Following hydrolysis to the nucleosides, a reversed-phase HPLC separation was used to provide separate peaks for deoxythymidine (dT), deoxyadenosine (dA), and deoxyguanosine (dG). The HPLC effluent was continuously fed into a chemical reaction interface and an isotope ratio mass spectrometer (HPLC/CRI/IRMS). The isotope ratio of the CO2 produced in the CRI was used to monitor for enrichment. The cells were grown continuously for 5 days in labeled medium and also in a 1-day pulse labeling experiment where the washout of label was observed for the subsequent 9 days. As predicted from the role of glycine in de novo purine biosynthesis, the isotope ratio of the pyrimidine dT did not change. However, for the two purines, dA and dG, the characteristic log growth behavior of the cells was observed in their 13C/12C ratios and good agreement in the doubling time was obtained for each type of experiment. Parallel experiments that measured the HEP G2 doubling time in culture using tritiated thymidine incorporation and direct cell counts were carried out compare to our new method with established ones. We believe that the use of [1-13C]-glycine and the HPLC/CRI/IRMS is a highly sensitive and selective approach that forms the basis of a method that can measure DNA synthesis rates using a nonradioactive, nontoxic tracer. PMID:9599574

  8. Incidence and Prevalence: Confusion in Need of Clarification.

    ERIC Educational Resources Information Center

    Marozas, Donald S.; And Others

    1980-01-01

    Confusing definitions presented in textbooks are reviewed. Many texts used the terms incidence and prevalence interchangeably, some did not define the terms at all, and others presented completely contradictory definitions. A definition is recommended for use and clarification. (Author)

  9. Robust depth filter sizing for centrate clarification.

    PubMed

    Lutz, Herb; Chefer, Kate; Felo, Michael; Cacace, Benjamin; Hove, Sarah; Wang, Bin; Blanchard, Mark; Oulundsen, George; Piper, Rob; Zhao, Xiaoyang

    2015-01-01

    Cellulosic depth filters embedded with diatomaceous earth are widely used to remove colloidal cell debris from centrate as a secondary clarification step during the harvest of mammalian cell culture fluid. The high cost associated with process failure in a GMP (Good Manufacturing Practice) environment highlights the need for a robust process scale depth filter sizing that allows for (1) stochastic batch-to-batch variations from filter media, bioreactor feed and operation, and (2) systematic scaling differences in average performance between filter sizes and formats. Matched-lot depth filter media tested at the same conditions with consecutive batches of the same molecule were used to assess the sources and magnitudes of process variability. Depth filter sizing safety factors of 1.2-1.6 allow a filtration process to compensate for random batch-to-batch process variations. Matched-lot depth filter media in four different devices tested simultaneously at the same conditions was used with a common feed to assess scaling effects. All filter devices showed <11% capacity difference and the Pod format devices showed no statistically different capacity differences. PMID:26518411

  10. Involvement of budding yeast Rad5 in translesion DNA synthesis through physical interaction with Rev1

    PubMed Central

    Xu, Xin; Lin, Aiyang; Zhou, Cuiyan; Blackwell, Susan R.; Zhang, Yiran; Wang, Zihao; Feng, Qianqian; Guan, Ruifang; Hanna, Michelle D.; Chen, Zhucheng; Xiao, Wei

    2016-01-01

    DNA damage tolerance (DDT) is responsible for genomic stability and cell viability by bypassing the replication block. In Saccharomyces cerevisiae DDT employs two parallel branch pathways to bypass the DNA lesion, namely translesion DNA synthesis (TLS) and error-free lesion bypass, which are mediated by sequential modifications of PCNA. Rad5 has been placed in the error-free branch of DDT because it contains an E3 ligase domain required for PCNA polyubiquitination. Rad5 is a multi-functional protein and may also play a role in TLS, since it interacts with the TLS polymerase Rev1. In this study we mapped the Rev1-interaction domain in Rad5 to the amino acid resolution and demonstrated that Rad5 is indeed involved in TLS possibly through recruitment of Rev1. Genetic analyses show that the dual functions of Rad5 can be separated and reconstituted. Crystal structure analysis of the Rad5–Rev1 interaction reveals a consensus RFF motif in the Rad5 N-terminus that binds to a hydrophobic pocket within the C-terminal domain of Rev1 that is highly conserved in eukaryotes. This study indicates that Rad5 plays a critical role in pathway choice between TLS and error-free DDT. PMID:27001510

  11. Enzymatic synthesis of modified oligonucleotides by PEAR using Phusion and KOD DNA polymerases.

    PubMed

    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong

    2015-02-01

    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase-endonuclease amplification reaction (PEAR) for amplification of natural and 5'-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2'-deoxy-2'-fluoro-(2'-F) and 2'-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with one or two modified nucleotides, and KOD DNA polymerase is more suitable than Phusion DNA polymerase for PEAR amplification of 2'-F and 2'-F/S double modified oligonucleotides. The composition of PEAR products were analyzed by electrospray ionization liquid chromatography mass spectrometry (ESI/LC/MS) detection and showed that the sequence of the PEAR products are maintained at an extremely high accuracy (>99.9%), and after digestion the area percent of full-length modified oligonucleotides reaches 89.24%. PEAR is suitable for synthesis of modified oligonucleotides efficiently and with high purity. PMID:25517220

  12. Involvement of budding yeast Rad5 in translesion DNA synthesis through physical interaction with Rev1.

    PubMed

    Xu, Xin; Lin, Aiyang; Zhou, Cuiyan; Blackwell, Susan R; Zhang, Yiran; Wang, Zihao; Feng, Qianqian; Guan, Ruifang; Hanna, Michelle D; Chen, Zhucheng; Xiao, Wei

    2016-06-20

    DNA damage tolerance (DDT) is responsible for genomic stability and cell viability by bypassing the replication block. In Saccharomyces cerevisiae DDT employs two parallel branch pathways to bypass the DNA lesion, namely translesion DNA synthesis (TLS) and error-free lesion bypass, which are mediated by sequential modifications of PCNA. Rad5 has been placed in the error-free branch of DDT because it contains an E3 ligase domain required for PCNA polyubiquitination. Rad5 is a multi-functional protein and may also play a role in TLS, since it interacts with the TLS polymerase Rev1. In this study we mapped the Rev1-interaction domain in Rad5 to the amino acid resolution and demonstrated that Rad5 is indeed involved in TLS possibly through recruitment of Rev1. Genetic analyses show that the dual functions of Rad5 can be separated and reconstituted. Crystal structure analysis of the Rad5-Rev1 interaction reveals a consensus RFF motif in the Rad5 N-terminus that binds to a hydrophobic pocket within the C-terminal domain of Rev1 that is highly conserved in eukaryotes. This study indicates that Rad5 plays a critical role in pathway choice between TLS and error-free DDT. PMID:27001510

  13. Antiproliferative activity of bicyclic benzimidazole nucleosides: synthesis, DNA-binding and cell cycle analysis.

    PubMed

    Sontakke, Vyankat A; Lawande, Pravin P; Kate, Anup N; Khan, Ayesha; Joshi, Rakesh; Kumbhar, Anupa A; Shinde, Vaishali S

    2016-04-26

    An efficient route was developed for synthesis of bicyclic benzimidazole nucleosides from readily available d-glucose. The key reactions were Vörbruggen glycosylation and ring closing metathesis (RCM). Primarily, to understand the mode of DNA binding, we performed a molecular docking study and the binding was found to be in the minor groove region. Based on the proposed binding model, UV-visible and fluorescence spectroscopic techniques using calf thymus DNA (CT-DNA) demonstrated a non-intercalative mode of binding. Antiproliferative activity of nucleosides was tested against MCF-7 and MDA-MB-231 breast cancer cell lines and found to be active at low micromolar concentrations. Compounds and displayed significant antiproliferative activity as compared to and with the reference anticancer drug, doxorubicin. Cell cycle analysis showed that nucleoside induced cell cycle arrest at the S-phase. Confocal microscopy has been performed to validate the induction of cellular apoptosis. Based on these findings, such modified bicyclic benzimidazole nucleosides will make a significant contribution to the development of anticancer drugs. PMID:27074628

  14. Divalent ions attenuate DNA synthesis by human DNA polymerase α by changing the structure of the template/primer or by perturbing the polymerase reaction.

    PubMed

    Zhang, Yinbo; Baranovskiy, Andrey G; Tahirov, Emin T; Tahirov, Tahir H; Pavlov, Youri I

    2016-07-01

    DNA polymerases (pols) are sophisticated protein machines operating in the replication, repair and recombination of genetic material in the complex environment of the cell. DNA pol reactions require at least two divalent metal ions for the phosphodiester bond formation. We explore two understudied roles of metals in pol transactions with emphasis on polα, a crucial enzyme in the initiation of DNA synthesis. We present evidence that the combination of many factors, including the structure of the template/primer, the identity of the metal, the metal turnover in the pol active site, and the influence of the concentration of nucleoside triphosphates, affect DNA pol synthesis. On the poly-dT70 template, the increase of Mg(2+) concentration within the range typically used for pol reactions led to the severe loss of the ability of pol to extend DNA primers and led to a decline in DNA product sizes when extending RNA primers, simulating the effect of "counting" of the number of nucleotides in nascent primers by polα. We suggest that a high Mg(2+) concentration promotes the dynamic formation of unconventional DNA structure(s), thus limiting the apparent processivity of the enzyme. Next, we found that Zn(2+) supported robust polα reactions when the concentration of nucleotides was above the concentration of ions; however, there was only one nucleotide incorporation by the Klenow fragment of DNA pol I. Zn(2+) drastically inhibited polα, but had no effect on Klenow, when Mg(2+) was also present. It is possible that Zn(2+) perturbs metal-mediated transactions in pol active site, for example affecting the step of pyrophosphate removal at the end of each pol cycle necessary for continuation of polymerization. PMID:27235627

  15. Unscheduled deoxyribonucleic acid (DNA) synthesis assays for toxicological studies. May 1977-March 1990 (A Bibliography from the NTIS data base). Report for May 1977-March 1990

    SciTech Connect

    Not Available

    1990-04-01

    This bibliography contains citations concerning the unscheduled DNA synthesis (UDS) assay for toxicological studies. UDS assays provide very sensitive measures of damage to DNA by detecting induction of DNA synthesis in non-S-phase cells. UDS toxicological studies analyzing gamma radiation, drugs, pesticides, nerve gas, jet engine fuels, ultraviolet light, chlorated organic compounds, and aromatic compounds are discussed. UDS studies using both human and animal tissue cultures are described. (Contains 57 citations fully indexed and including a title list.)

  16. Repair synthesis by human cell extracts in cisplatin-damaged DNA is preferentially determined by minor adducts.

    PubMed Central

    Calsou, P; Frit, P; Salles, B

    1992-01-01

    During reaction of cis-diamminedichloroplatinum(II) (cis-DDP) with DNA, a number of adducts are formed which may be discriminated by the excision-repair system. An in vitro excision-repair assay with human cell-free extracts has been used to assess the relative repair extent of monofunctional adducts, intrastrand and interstrand cross-links of cis-DDP on plasmid DNA. Preferential removal of cis-DDP 1,2-intrastrand diadducts occurred in the presence of cyanide ions. In conditions where cyanide treatment removed 85% of total platinum adducts while approximately 70% of interstrand cross-links remained in plasmid DNA, no significant variation in repair synthesis by human cell extracts was observed. Then, we constructed three types of plasmid DNA substrates containing mainly either monoadducts, 1,2-intrastrand cross-links or interstrand cross-links lesions. The three plasmid species were modified in order to obtain the same extent of total platinum DNA adducts per plasmid. No DNA repair synthesis was detected with monofunctional adducts during incubation with human whole cell extracts. However, a two-fold increase in repair synthesis was found when the proportion of interstrand cross-links in plasmid DNA was increased by 2-3 fold. These findings suggest that (i) cis-DDP 1,2-intrastrand diadducts are poorly repaired by human cell extracts in vitro, (ii) among other minor lesions potentially cyanide-resistant, cis-DDP interstrand cross-links represent a major lesion contributing to the repair synthesis signal in the in vitro assay. These results could account for the drug efficiency in vivo. Images PMID:1475197

  17. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  18. Synthesis of herpes simplex virus, vaccinia virus, and adenovirus DNA in isolated HeLa cell nuclei. I. Effect of viral-specific antisera and phosphonoacetic acid.

    PubMed Central

    Bolden, A; Aucker, J; Weissbach, A

    1975-01-01

    Purified nuclei, isolated from appropriately infected HeLa cells, are shown to synthesize large amounts of either herpes simplex virus (HSV) or vaccinia virus DNA in vitro. The rate of synthesis of DNA by nuclei from infected cells is up to 30 times higher than the synthesis of host DNA in vitro by nuclei isolated from uninfected HeLa cells. Thus HSV nuclei obtained from HSV-infected cells make DNA in vitro at a rate comparable to that seen in the intact, infected cell. Molecular hybridization studies showed that 80% of the DNA sequences synthesized in vitro by nuclei from herpesvirus-infected cells are herpesvirus specific. Vaccinia virus nuclei from vaccinia virus-infected cells, also produce comparable percentages of vaccinia virus-specific DNA sequences. Adenovirus nuclei from adenovirus 2-infected HeLa cells, which also synthesize viral DNA in vitro, have been included in this study. Synthesis of DNA by HSV or vaccinia virus nuclei is markedly inhibited by the corresponding viral-specific antisera. These antisera inhibit in a similar fashion the purified herpesvirus-induced or vaccinia virus-induced DNA polymerase isolated from infected cells. Phosphonoacetic acid, reported to be a specific inhibitor of herpesvirus formation and the herpesvirus-induced DNA polymerase, is equally effective as an inhibitor of HSV DNA synthesis in isolated nuclei in vitro. However, we also find phosphonoacetic acid to be an effective inhibitor of vaccinia virus nuclear DNA synthesis and the purified vaccinia virus-induced DNA polymerase. In addition, this compound shows significant inhibition of DNA synthesis in isolated nuclei obtained from adenovirus-infected or uninfected cells and is a potent inhibitor of HeLa cell DNA polymerase alpha. PMID:172658

  19. The structure-based design, synthesis and biological evaluation of DNA-binding bisintercalating bisanthrapyrazole anticancer compounds

    PubMed Central

    Hasinoff, Brian B.; Liang, Hong; Wu, Xing; Guziec, Lynn J.; Guziec, Frank S.; Marshall, Kyle; Yalowich, Jack C.

    2008-01-01

    Anticancer drugs that bind to DNA and inhibit DNA-processing enzymes represent an important class of anticancer drugs. In order to find stronger DNA binding and more potent cytotoxic compounds, a series of ester-coupled bisanthrapyrazole derivatives of 7-chloro-2-[2-[(2-hydroxyethyl)methylamino]ethyl]anthra[1,9-cd]pyrazol-6(2H)-one (AP9) were designed and evaluated by molecular docking techniques. Because the anthrapyrazoles are unable to be reductively activated like doxorubicin and other anthracyclines, they should not be cardiotoxic like the anthracyclines. Based on the docking scores of a series of bisanthrapyrazoles with different numbers of methylene linkers (n) that were docked into an X-ray structure of double-stranded DNA, five bisanthrapyrazoles (n = 1 to 5) were selected for synthesis and physical and biological evaluation. The synthesized compounds were evaluated for DNA binding and bisintercalation by measuring the DNA melting temperature increase, for growth inhibitory effects on the human erythroleukemic K562 cell line, and for DNA topoisomerase IIα-mediated cleavage of DNA and inhibition of DNA topoisomerase IIα decatenation activities. The results suggest that the bisanthrapyrazoles with n = 2 to 5 formed bisintercalation complexes with DNA. In conclusion, a novel group of bisintercalating anthrapyrazole compounds have been designed, synthesized and biologically evaluated as possible anticancer agents. PMID:18258442

  20. SYNTHESIS, IN VITRO METABOLISM, MUTAGENICITY, AND DNA-ADDUCTION OF NAPHTHO[1,2-E]PYRENE

    EPA Science Inventory

    SYNTHESIS, IN V1TRO METABOLISM, MUTAGENICITY , AND DNA-ADDUCnON OF NAPHTHO[l ,2-e ]PYRENE

    Literature data, although limited, underscore the contribution of C24HI4 polycyclic aromatic hydrocarbons to the biological activity of the extracts of complex environmental samples....

  1. Synthesis of DNA templated trifunctional electrically conducting, optical, and magnetic nanochain of Nicore-Aushell for biodevice

    NASA Astrophysics Data System (ADS)

    Mandal, Madhuri; Mandal, Kalyan

    2009-07-01

    Synthesis of trifunctional, e.g., electrically conducting, optical, and magnetic nanochains of Nicore-Aushell, has been discussed here. Properties of the materials were investigated from the view of its application in bionanodevice. Our investigation indicates that such material attached to biomolecule "DNA chain" and having three main properties in one material will have great potentiality in medical instrumentation and biocomputer device.

  2. UAP56 is a novel interacting partner of Bcr in regulating vascular smooth muscle cell DNA synthesis

    SciTech Connect

    Sahni, Abha; Wang, Nadan; Alexis, Jeffrey D.

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer UAP56 is an important regulator of DNA synthesis in vascular smooth muscle cells. Black-Right-Pointing-Pointer UAP56 binds to Bcr. Black-Right-Pointing-Pointer Interaction between Bcr and UAP56 is critical for Bcr induced DNA synthesis. -- Abstract: Bcr is a serine/threonine kinase that is a critical regulator of vascular smooth muscle cell inflammation and proliferation. We have previously demonstrated that Bcr acts in part via phosphorylation and inhibition of PPAR{gamma}. We have identified the RNA helicase UAP56 as another substrate of Bcr. In this report we demonstrate that knockdown of UAP56 blocks Bcr induced DNA synthesis in vascular smooth muscle cells (VSMC). We also found that over expression of Bcr increased the expression of cyclin E and decreased the expression of p27. Knockdown of UAP56 reversed the effect of Bcr on cyclin E and p27 expression. Furthermore, we found that Bcr binds to UAP56 and demonstrate that binding of UAP56 to Bcr is critical for Bcr induced DNA synthesis in VSMC. Our data identify UAP56 as an important binding partner of Bcr and a novel target for inhibiting vascular smooth muscle cell proliferation.

  3. PROLINE IS REQUIRED FOR THE STIMULATION OF DNA SYNTHESIS IN HEPATOCYTE CULTURES BY EGF (EPIDERMAL GROWTH FACTOR)

    EPA Science Inventory

    Epidermal growth factor (EGF) has been shown to stimulate DNA synthesis in rat parenchymal hepatocytes both in vivo and in vitro (4,9). The authors report here that this response in vitro is dependent on the amino acids present in the media. Of all the amino acids, proline has th...

  4. Knockdown of prolactin receptors in a pancreatic beta cell line: effects on DNA synthesis, apoptosis, and gene expression.

    PubMed

    Arumugam, Ramamani; Fleenor, Don; Freemark, Michael

    2014-08-01

    Prolactin (PRL) and placental lactogen stimulate beta cell replication and insulin production in vitro and in vivo. The molecular mechanisms by which lactogens promote beta cell expansion are unclear. We treated rat insulinoma cells with a PRL receptor (PRLR) siRNA to determine if PRLR signaling is required for beta cell DNA synthesis and cell survival and to identify beta cell cycle genes whose expression depends upon lactogen action. Effects of PRLR knockdown were compared with those of PRL treatment. PRLR knockdown (-80 %) reduced DNA synthesis, increased apoptosis, and inhibited expression of cyclins D2 and B2, IRS-2, Tph1, and the anti-apoptotic protein PTTG1; p21 and BCL6 mRNAs increased. Conversely, PRL treatment increased DNA synthesis, reduced apoptosis, and enhanced expression of A, B and D2 cyclins, CDK1, IRS-2, FoxM1, BCLxL, and PTTG1; BCL6 declined. PRLR signaling is required for DNA synthesis and survival of rat insulinoma cells. The effects of lactogens are mediated by down-regulation of cell cycle inhibitors (BCL6, p21) and induction of A, B, and D2 cyclins, IRS-2, Tph1, FoxM1, and the anti-apoptotic proteins BCLxL and PTTG1. PMID:24114406

  5. Rational design, synthesis, and DNA binding properties of novel sequence-selective peptidyl congeners of ametantrone.

    PubMed

    Gianoncelli, Alessandra; Basili, Serena; Scalabrin, Matteo; Sosic, Alice; Moro, Stefano; Zagotto, Giuseppe; Palumbo, Manlio; Gresh, Nohad; Gatto, Barbara

    2010-07-01

    Natural and synthetic compounds characterized by an anthraquinone nucleus represent an important class of anti-neoplastic agents, the mechanism of action of which is related to intercalation into DNA. Ametantrone (AM) is a synthetic 9,10-anthracenedione bearing two (hydroxyethylamino)ethylamino residues at positions 1 and 4; along with other anthraquinones and anthracyclines, it shares a polycyclic intercalating moiety and charged side chains that stabilize DNA binding. All these drugs elicit adverse side effects, which represent a challenge for antitumor chemotherapy. In the present work the structure of AM was augmented with appropriate groups that target well-defined base pairs in the major groove. These should endow AM with DNA sequence selectivity. We describe the rationale for the synthesis and the evaluation of activity of a new series of compounds in which the planar anthraquinone is conjugated at positions 1 and 4 through the side chains of AM or other bioisosteric linkers to appropriate dipeptides. The designed novel AM derivatives were shown to selectively stabilize two oligonucleotide duplexes that both have a palindromic GC-rich hexanucleotide core, but their stabilizing effects on a random DNA sequence was negligible. In the case of the most effective compound, the 1,4-bis-[Gly-(L-Lys)] derivative of AM, the experimental results confirm the predictions of earlier theoretical computations. In contrast, AM had equal stabilizing effects on all three sequences and showed no preferential binding. This novel peptide derivative can be classified as a strong binder regarding the sequences that it selectively targets, possibly opening the exploitation of less cytotoxic conjugates of AM to the targeted treatment of oncological and viral diseases. PMID:20458714

  6. Ab initio DNA synthesis by Bst polymerase in the presence of nicking endonucleases Nt.AlwI, Nb.BbvCI, and Nb.BsmI.

    PubMed

    Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V

    2014-08-01

    In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence. PMID:24965874

  7. Simple, efficient protocol for enzymatic synthesis of uniformly 13C, 15N-labeled DNA for heteronuclear NMR studies.

    PubMed Central

    Masse, J E; Bortmann, P; Dieckmann, T; Feigon, J

    1998-01-01

    The use of uniformly 13C,15N-labeled RNA has greatly facilitated structural studies of RNA oligonucleotides by NMR. Application of similar methodologies for the study of DNA has been limited, primarily due to the lack of adequate methods for sample preparation. Methods for both chemical and enzymatic synthesis of DNA oligonucleotides uniformly labeled with 13C and/or 15N have been published, but have not yet been widely used. We have developed a modified procedure for preparing uniformly 13C,15N-labeled DNA based on enzymatic synthesis using Taq DNA polymerase. The highly efficient protocol results in quantitative polymerization of the template and approximately 80% incorporation of the labeled dNTPs. Procedures for avoiding non-templated addition of nucleotides or for their removal are given. The method has been used to synthesize several DNA oligonucleotides, including two complementary 15 base strands, a 32 base DNA oligonucleotide that folds to form an intramolecular triplex and a 12 base oligonucleotide that dimerizes and folds to form a quadruplex. Heteronuclear NMR spectra of the samples illustrate the quality of the labeled DNA obtained by these procedures. PMID:9592146

  8. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

    PubMed

    Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

    2016-01-21

    Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  9. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  10. Peptide Nucleic Acid with a Lysine Side Chain at the β-Position: Synthesis and Application for DNA Cleavage.

    PubMed

    Sugiyama, Toru; Kuwata, Keiko; Imamura, Yasutada; Demizu, Yosuke; Kurihara, Masaaki; Takano, Masashi; Kittaka, Atsushi

    2016-01-01

    This paper reports the synthesis of new β-Lys peptide nucleic acid (PNA) monomers and their incorporation into a 10-residue PNA sequence. PNA containing β-Lys PNA units formed a stable hybrid duplex with DNA. However, incorporation of β-Lys PNA units caused destabilization of PNA-DNA duplexes to some extent. Electrostatic attractions between β-PNA and DNA could reduce this destabilization effect. Subsequently, bipyridine-conjugated β-Lys PNA was prepared and exhibited sequence selective cleavage of DNA. Based on the structures of the cleavage products and molecular modeling, we reasoned that bipyridine moiety locates within the minor groove of the PNA-DNA duplexes. The lysine side chain of β-PNA is a versatile handle for attaching various functional molecules. PMID:27373637

  11. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

    SciTech Connect

    Kim, Sunyoung; Baltimore, D. Massachusetts Institute of Technology, Cambridge ); Byrn, R.; Groopman, J. )

    1989-09-01

    The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4{sup +} lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes.

  12. An Integrated System for DNA Sequencing by Synthesis Using Novel Nucleotide Analogues

    PubMed Central

    Guo, Jia; Yu, Lin; Turro, Nicholas J.; Ju, Jingyue

    2010-01-01

    Conspectus The Human Genome Project has concluded, but its successful completion has increased, rather than decreased, the need for high-throughput DNA sequencing technologies. The possibility of clinically screening a full genome for an individual's mutations offers tremendous benefits, both for pursuing personalized medicine as well as uncovering the genomic contributions to diseases. The Sanger sequencing method—although enormously productive for more than 30 years—requires an electrophoretic separation step that, unfortunately, remains a key technical obstacle for achieving economically acceptable full-genome results. Alternative sequencing approaches thus focus on innovations that can reduce costs. The DNA sequencing by synthesis (SBS) approach has shown great promise as a new sequencing platform, with particular progress reported recently. The general fluorescent SBS approach involves (i) incorporation of nucleotide analogs bearing fluorescent reporters, (ii) identification of the incorporated nucleotide by its fluorescent emissions, and (iii) cleavage of the fluorophore, along with the reinitiation of the polymerase reaction for continuing sequence determination. In this Account, we review the construction of a DNA-immobilized chip and the development of novel nucleotide reporters for the SBS sequencing platform. Click chemistry, with its high selectivity and coupling efficiency, was explored for surface immobilization of DNA. The first generation (G-1) modified nucleotides for SBS feature a small chemical moiety capping the 3′-OH and a fluorophore tethered to the base through a chemically cleavable linker; the design ensures that the nucleotide reporters are good substrates for the polymerase. The 3′-capping moiety and the fluorophore on the DNA extension products, generated by the incorporation of the G-1 modified nucleotides, are cleaved simultaneously to reinitiate the polymerase reaction. The sequence of a DNA template immobilized on a surface

  13. Different activities of unscheduled DNA synthesis in human melanoma and bone marrow cells

    SciTech Connect

    Lewensohn, R.; Ringborg, U.; Hansson, J.

    1982-01-01

    Unscheduled DNA synthesis (UDS) indicated by melphalan was studied in freshly collected tumor cells from human melanoma metastases. Comparative studies were done on human bone marrow blast cells. Significant levels of UDS comparable with those in myeloblasts were found in only two of eight melanoma cell populations. This difference between melanoma and blast cells was not related to different cellular uptake of melphalan. When UDS was induced by ultraviolet irradiation, significant levels of UDS were found in all melanoma and blast cell populations studied. Also, in a human melanoma cell line, high levels of UDS were found after exposure to ultraviolet irradiation, while treatment with melphalan did not result in detectable levels of UDS. Possible explanations for the divergent results of UDS in melphalan-exposed melanoma cells are discussed.

  14. The trypanocidal activity of the alkaloid oliverine involves inhibition of DNA synthesis.

    PubMed

    Garro, H A; Juri Ayub, M; Nieto, M; Lucero Estrada, C; Pungitore, C R; Tonn, C E

    2010-01-01

    The Trypanosoma cruzi parasite is an etiologic agent of the American trypanosomiasis called Chagas disease. This pathology affects more than 24 million persons and represents one of the most important public health problems in Latin America. Taking into account this, it is necessary the search of new antitrypanosomal agents that show a major level of efficacy and minor indexes of toxicity in affected patients. Vast source of them are the natural products from plants with enormous structural diversity. A particular type of these compounds is represented by aporphinoid alkaloids. In our experiments, anonaine (2), oliverine (3) and guatterine (5) displayed antitrypanosomal activity. The compound 3 showed the most important activity with an IC50 = 12.00 ± 0.36 μM. Its mechanism of action may include inhibition of DNA synthesis. PMID:20937218

  15. Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links

    PubMed Central

    Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.

    2014-01-01

    The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636

  16. Synthesis and characterization of monomolecular DNA G-quadruplexes formed by tetra-end-linked oligonucleotides.

    PubMed

    Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Galeone, Aldo; Petraccone, Luigi; Varra, Michela; Piccialli, Gennaro; Mayol, Luciano

    2006-01-01

    Guanine-rich DNA sequences are widely dispersed in the eukaryotic genome and are abundant in regions with relevant biological significance. They can form quadruplex structures stabilized by guanine quartets. These structures differ for number and strand polarity, loop composition, and conformation. We report here the syntheses and the structural studies of a set of interconnected d(TG(4)T) fragments which are tethered, with different orientations, to a tetra-end-linker in an attempt to force the formation of specific four-stranded DNA quadruplex structures. Two synthetic strategies have been used to obtain oligodeoxyribonucleotide (ODN) strands linked with their 3'- or 5'-ends to each of the four arms of the linker. The first approach allowed the synthesis of tetra-end-linked ODN (TEL-ODN) containing the four ODN strands with a parallel orientation, while the latter synthetic pathway led to the synthesis of TEL-ODNs each containing antiparallel ODN pairs. The influence of the linker at 3'- or 5'-ODN, on the quadruplex typology and stability, in the presence of sodium or potassium ions, has been investigated by circular dichroism (CD), CD thermal denaturation, (1)H NMR experiments at variable temperature, and molecular modeling. All synthesized TEL-ODNs formed parallel G-quadruplex structures. Particularly, the TEL-ODN containing all parallel ODN tracts formed very stable parallel G-quadruplex complexes, whereas the TEL-ODNs containing antiparallel ODN pairs led to relatively less stable parallel G-quadruplexes. The molecular modeling data suggested that the above antiparallel TEL-ODNs can adopt parallel G-quadruplex structures thanks to a considerable folding of the tetra-end-linker around the whole quadruplex scaffold. PMID:16848394

  17. Long conducting polymer nanonecklaces with a `beads-on-a-string' morphology: DNA nanotube-template synthesis and electrical properties

    NASA Astrophysics Data System (ADS)

    Chen, Guofang; Mao, Chengde

    2016-05-01

    Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties.Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01603k

  18. Induction of unscheduled DNA synthesis in HeLa cells by allylic compounds.

    PubMed

    Schiffmann, D; Eder, E; Neudecker, T; Henschler, D

    1983-10-01

    Thirteen allylic compounds, mostly with close structural relationship, were tested for their ability to induce unscheduled DNA synthesis (UDS) in HeLa cells and mutations in the Ames test; 11 induced UDS in dose dependence. Allyl isothiocyanate was negative in UDS (borderline in the Ames test) and acrolein (positive in the Ames test) proved toxic to HeLa cells, therefore UDS measurement was excluded. In general, positive qualitative and quantitative correlation between UDS, Ames test and alkylating properties (as measured in the 4-nitrobenzyl-pyridine test, NBP) were found. Among structural analogs and typical allylic compounds with various leaving groups, the amount of induced DNA repair at equimolar concentrations decreased in the same order as the mutagenic and alkylating activities in the other 2 test systems: 1,3-dichloropropene (cis) greater than 1,3-dichloropropene (trans) greater than 2,3-dichloro-1-propene; 1-chloro-2-butene greater than 3-chloro-1-butene greater than 3-chloro-2-methyl-1-propene greater than allyl chloride; allyl-methane-sulfonate greater than -iodide greater than -bromide greater than -chloride. PMID:6627227

  19. Synthesis, crystal structures, DNA binding and photoluminescence properties of [Cu(pzta)2Cl]Cl⋅H2O for DNA detection.

    PubMed

    Duan, Ran-ran; Wang, Lu; Huo, Wei-qiang; Chen, Shi; Zhou, Xiao-hua

    2014-07-15

    We report here the synthesis of a new copper(II) complex of 2,4-diamino-6-(2'-pyrazin)-1,3,5-triazine [Cu(pzta)2Cl]Cl·H2O and its characterization using UV and IR spectroscopy, elemental analysis, and X-ray diffraction. Fluorescence spectroscopy revealed that the complex was sensitive to oxygen and to the polarity of nonaqueous solvents. Binding of the complex to DNA was investigated using UV spectroscopy, ethidium bromide displacement from DNA, cyclic voltammetry, and viscometry. The results revealed the DNA binding mode was intercalation together with external static-electricity. However, the complex can be also used to DNA detection as DNA fluorescence probe with a LOD of 4.21 ng mL(-1) for the relative wide linear range between 0.2 and 17 μg mL(-1). In conclusion, that synthetic method of the complex was easy with low expense and was relatively rapid and sensitive compared to most toxic fluorescence dyes. This finding would indicate the complex may be a potential DNA-targeted probes and optical probes for oxygen-free environments in nonaqueous form. PMID:24691376

  20. Agrobacterium rhizogenes pRi8196 T-DNA: mapping and DNA sequence of functions involved in mannopine synthesis and hairy root differentiation.

    PubMed Central

    Hansen, G; Larribe, M; Vaubert, D; Tempé, J; Biermann, B J; Montoya, A L; Chilton, M D; Brevet, J

    1991-01-01

    This paper presents the map and DNA sequence analysis of pRi8196 transferred DNA (T-DNA) genes encoding root-inducing and mannopine synthesis functions. A canonical 24-base-pair border repeat as well as two "pseudoborders" are present at the functional right T-DNA border. To the left of this border are homologs of the mas1' and mas2' genes of TR pRiA4. Next to these are five open reading frames (ORFs) homologous to ORFs 10-14 of TL of pRiA4. ORFs 10-12 (rolA, rolB, and rolC) are less related to their pRiA4 homologs than are the other large ORFs analyzed here. In contrast to T-DNA genes of pRiA4, pRi8196 T-DNA ORFs 11 and 12 (rolB and rolC) are sufficient to induce hairy roots on carrot disks. Images PMID:1909028

  1. Effects of DNA synthesis inhibitors on post-traumatic glial cell proliferation

    SciTech Connect

    Billingsley, M.L.; Mandel, H.G.

    1982-09-01

    This study attempts to inhibit post-traumatic glial cell scarring in rats lesioned in the frontal cortex, by treatment with several antiproliferative drugs. (/sup 3/H)Thymidine ((/sup 3/H)TdR) incorporation into DNA served as the biochemical index of glial cell proliferation and histological observations confirmed the biochemical effects. Cytosine arabinoside (ara-C), given i.p. at a total daily dosage of 15 to 100 mg/kg, was found to inhibit the incorporation of (/sup 3/H)TdR into cortical DNA and also inhibited the proliferation of glial cells after cortical trauma. Treatment using ara-C induced marked histological changes in glial cells near the lesion, indicating that the inhibition by the drug of DNA synthesis correlated with cytotoxicity to proliferating glial cells. Experiments using (/sup 3/H)ara-C confirmed that this drug entered lesioned brain tissue, although at levels considerably lower than those found in the periphery. Cyclophosphamide also reduced (/sup 3/H)TdR incorporation into both lesioned and control cortices; however, this effect, unlike that of ara-C, was not proportionately greater in the lesioned cortex. Vincristine, but not vinblastine, also inhibited (/sup 3/H)TdR incorporation into the lesioned cortex, possibly reflecting differences in the neuronal uptake of the vinca alkaloids. We propose that ara-C can inhibit the proliferation of glial cells after neural trauma and that judicious use of this agent may lessen scarring in the injured central nervous system, possibly enhancing the regenerative capacity of the brain.

  2. Rabies RNA synthesis, detected with cDNA probes, as a marker for virus transport in the rat nervous system.

    PubMed

    Ermine, A; Ceccaldi, P E; Masson, G; Tsiang, H

    1993-02-01

    The kinetics of viral RNA synthesis in different parts of the rat brain, infected with fixed or street rabies virus strains, is correlated with their anatomical neuronal connections with the masseter muscles, using hybridization with rabies cDNA probes. Viral RNA synthesis is first detected in the brain-stem and in the pons where the direct anatomical projection of the masseter muscle nervous arborization into the sensory and motor nuclei is located, through the trigeminus nerve. Rabies RNA detection is delayed in the other regions of the rat brain depending on the time course of virus transport from the trigeminal nuclei through multiple nervous connections. PMID:7681151

  3. Synthesis, interaction with DNA, cytotoxicity, cell cycle arrest and apoptotic inducing properties of ruthenium(II) molecular "light switch" complexes.

    PubMed

    Shobha Devi, C; Anil Kumar, D; Singh, Surya S; Gabra, Nazar; Deepika, N; Kumar, Y Praveen; Satyanarayana, S

    2013-06-01

    In an endeavor toward the development of metal-based anticancer drugs, we present here the design, synthesis and characterization of three ruthenium(II) functionalized phenanthroline complexes with extended π-conjugation. These complexes have been shown to act as promising CT-DNA intercalators as evidenced by UV-visible, luminescence, emission quenching by [Fe(CN)6](4-), DNA competitive binding with ethidium bromide and salt dependent studies. All three complexes [Ru(Hdpa)2PPIP](2+) (1), [Ru(Hdpa)2PIP](2+) (2), [Ru(Hdpa)24HEPIP](2+) (3) clearly demonstrated that they can bind to DNA through the intercalation mode. Cell viability experiments indicated that all complexes showed significant dose dependent cytotoxicity in selected cell lines. The apoptosis and cell cycle arrest were also investigated. The complexes were docked into DNA-base-pairs using the 'GOLD' (Genetic Optimization for Ligand Docking), docking program. PMID:23665797

  4. UV-assisted photocatalytic synthesis of highly dispersed Ag nanoparticles supported on DNA decorated graphene for quantitative iodide analysis.

    PubMed

    Kong, Fen-Ying; Li, Wei-Wei; Wang, Jing-Yi; Wang, Wei

    2015-07-15

    Herein, we report, for the first time, the synthesis of reduced graphene oxide-DNA-Ag (RGO-DNA-Ag) nanohybrids by ultraviolet (UV) irradiation of aqueous solutions of GO and Ag ions in the presence of DNA. The morphology and microstructure characterizations of the resultant nanohybrids reveal that the proposed method leads to the simultaneous reduction of GO and Ag ions together with efficient dispersion of Ag nanoparticles on the surface of RGO sheets. This simple and fast synthesis route is carried out at ambient conditions without using any additional chemical reducing agents, which has the potential to provide new avenues for the green fabrication of various RGO-based nanomaterials. Additionally, the RGO-DNA-Ag nanohybrids can be utilized as a novel sensing interfacial for direct determination of iodide by simple differential pulse voltammetry (DPV), without requiring any preceding preconcentration of the analyte. Based on the RGO-DNA-Ag nanohybrids modified electrode, a wide linear range of 1μM-1mM and a low detection limit of 0.2μM were obtained. This sensitive and direct method of analysis can be applied successfully to the determination of iodide in real samples. PMID:25747505

  5. DNA polymerase beta-catalyzed-PCNA independent long patch base excision repair synthesis: a mechanism for repair of oxidatively damaged DNA ends in post-mitotic brain.

    PubMed

    Wei, Wei; Englander, Ella W

    2008-11-01

    Oxidative DNA damage incidental to normal respiratory metabolism poses a particular threat to genomes of highly metabolic-long lived cells. We show that post-mitotic brain has capacity to repair oxidatively damaged DNA ends, which are targets of the long patch (LP) base excision repair (BER) subpathway. LP-BER relies, in part, on proteins associated with DNA replication, including proliferating cell nuclear antigen and is inherent to proliferating cells. Nonetheless, repair products are generated with brain extracts, albeit at slow rates, in the case of 5'-DNA ends modeled with tetrahydrofuran (THF). THF at this position is refractory to DNA polymerase beta 5'-deoxyribose 5-phosphate lyase activity and drives repair into the LP-BER subpathway. Comparison of repair of 5'-THF-blocked termini in the post-mitotic rat brain and proliferative intestinal mucosa, revealed that in mucosa, resolution of damaged 5'-termini is accompanied by formation of larger repair products. In contrast, adducts targeted by the single nucleotide BER are proficiently repaired with both extracts. Our findings reveal mechanistic differences in BER processes selective for the brain versus proliferative tissues. The differences highlight the physiological relevance of the recently proposed 'Hit and Run' mechanism of alternating cleavage/synthesis steps, in the proliferating cell nuclear antigen-independent LP-BER process. PMID:18752643

  6. DNA-Metalization: Synthesis and Properties of Novel Silver-Containing DNA Molecules (Adv. Mater. 24/2016).

    PubMed

    Eidelshtein, Gennady; Fardian-Melamed, Natalie; Gutkin, Vitaly; Basmanov, Dmitry; Klinov, Dmitry; Rotem, Dvir; Levi-Kalisman, Yael; Porath, Danny; Kotlyar, Alexander

    2016-06-01

    D. Porath, A. Kotlyar, and co-workers transform DNA to a conducting material by metalization through coating or chemical modifications, as described on page 4839. Specific and reversible metalization of poly(dG)-poly(dC) DNA by migration of atoms from silver nanoparticles to the DNA is demonstrated. As the transformation occurs gradually, novel, truly hybrid molecular structures are obtained, paving the way to their usage as nanowires in programmable molecular electronic devices and circuits. PMID:27311096

  7. Pyridine and p-Nitrophenyl Oxime Esters with Possible Photochemotherapeutic Activity: Synthesis, DNA Photocleavage and DNA Binding Studies.

    PubMed

    Pasolli, Milena; Dafnopoulos, Konstantinos; Andreou, Nicolaos-Panagiotis; Gritzapis, Panagiotis S; Koffa, Maria; Koumbis, Alexandros E; Psomas, George; Fylaktakidou, Konstantina C

    2016-01-01

    Compared to standard treatments for various diseases, photochemotherapy and photo-dynamic therapy are less invasive approaches, in which DNA photocleavers represent promising tools for novel "on demand" chemotherapeutics. A series of p-nitrobenzoyl and p-pyridoyl ester conjugated aldoximes, amidoximes and ethanone oximes were subjected to UV irradiation at 312 nm with supercoiled circular plasmid DNA. The compounds which possessed appropriate properties were additionally subjected to UVA irradiation at 365 nm. The ability of most of the compounds to photocleave DNA was high at 312 nm, whereas higher concentrations were required at 365 nm as a result of their lower UV absorption. The affinity of selected compounds to calf-thymus (CT) DNA was studied by UV spectroscopy, viscosity experiments and competitive studies with ethidium bromide (EB) revealing that all compounds interacted with CT DNA. The fluorescence emission spectra of the pre-treated EB-DNA exhibited a moderate to significant quenching in the presence of the compounds indicating the binding of the compounds to CT DNA via intercalation as concluded also by DNA-viscosity experiments. For the oxime esters the DNA photocleavage and affinity studies aimed to clarify the role of the oxime nature (aldoxime, ketoxime, amidoxime) and the role of the pyridine and p-nitrophenyl moieties both as oxime substituents and ester conjugates. PMID:27376258

  8. Further verification of the isotope dilution approach for estimating the degree of participation of (/sup 3/H)thymidine in DNA synthesis in studies of aquatic bacterial production

    SciTech Connect

    Bell, R.T.

    1986-11-01

    The optimal concentration of (/sup 3/H)thymidine (i.e., the maximal degree of participation in DNA synthesis) as determined by adding increasing amounts of labeled thymidine at the same specific activity was similar to the concentration of thymidine inhibiting the de novo pathway as determined by isotope dilution plots. These experiments provide further verification of the isotope dilution approach for determining the degree of participation of (/sup 3/H)thymidine in DNA synthesis.

  9. DNA polymerase kappa microsatellite synthesis: two distinct mechanisms of slippage-mediated errors.

    PubMed

    Baptiste, Beverly A; Eckert, Kristin A

    2012-12-01

    Microsatellite tandem repeats are frequent sites of strand slippage mutagenesis in the human genome. Microsatellite mutations often occur as insertion/deletion of a repeat motif (unit-based indels), and increase in frequency with increasing repeat length after a threshold is reached. We recently demonstrated that DNA polymerase κ (Pol κ) produces fewer unit-based indel errors within dinucleotide microsatellites than does polymerase δ. Here, we examined human Pol κ's error profile within microsatellite alleles of varying sequence composition and length, using an in vitro HSV-tk gap-filling assay. We observed that Pol κ displays relatively accurate synthesis for unit-based indels, using di- and tetranucleotide repeat templates longer than the threshold length. We observed an abrupt increase in the unit-based indel frequency when the total microsatellite length exceeds 28 nucleotides, suggesting that extended Pol κ protein-DNA interactions enhance fidelity of the enzyme when synthesizing these microsatellite alleles. In contrast, Pol κ is error-prone within the HSV-tk coding sequence, producing frequent single-base errors in a manner that is highly biased with regard to sequence context. Single-nucleotide errors are also created by Pol κ within di- and tetranucleotide repeats, independently of the microsatellite allele length and at a frequency per nucleotide similar to the frequency of single base errors within the coding sequence. These single-base errors represent the mutational signature of Pol κ, and we propose them a mechanism independent of homology-stabilized slippage. Pol κ's dual fidelity nature provides a unique research tool to explore the distinct mechanisms of slippage-mediated mutagenesis. PMID:22965905

  10. Scorpion (Odontobuthus doriae) venom induces apoptosis and inhibits DNA synthesis in human neuroblastoma cells.

    PubMed

    Zargan, Jamil; Sajad, Mir; Umar, Sadiq; Naime, M; Ali, Shakir; Khan, Haider A

    2011-02-01

    Scorpion and its organs have been used to cure epilepsy, rheumatism, and male impotency since medieval times. Scorpion venom which contains different compounds like enzyme and non-enzyme proteins, ions, free amino acids, and other organic inorganic substances have been reported to posses antiproliferative, cytotoxic, apoptogenic, and immunosuppressive properties. We for the first time report the apoptotic and antiproliferative effects of scorpion venom (Odontobuthus doriae) in human neuroblastoma cells. After exposure of cells to medium containing varying concentrations of venom (10, 25, 50, 100, and 200 μg/ml), cell viability decreased to 90.75, 75.53, 55.52, 37.85, and 14.30%, respectively, after 24 h. Cells expressed morphological changes like swelling, inhibition of neurite outgrowth, irregular shape, aggregation, rupture of membrane, and release of cytosolic contents after treatment with venom. Lactate dehydrogenase (LDH) level increased in 50 and 100 μg/ml as compared to control, but there was no significant increase in LDH level at a dose of 10 and 20 μg/ml. Two concentrations viz. 50 and 100 μ/ml were selected because of the profound effect of these concentrations on the cellular health and population. Treatment with these two concentrations induced reactive nitrogen intermediates and depolarization in mitochondria. While caspase-3 activity increased in a concentration-dependent manner, only 50 μg/ml was able to fragment DNA. It was interesting to note that at higher dose, i.e., 100 μg/ml, the cells were killed, supposedly by acute necrosis. DNA synthesis evidenced by bromodeoxyuridine (BrdU) incorporation was inhibited in a concentration-dependent manner. The cells without treatment incorporated BrdU with high affinity confirming their cancerous nature whereas very less incorporation was noticed in treated cells. Our results show apoptotic and antiproliferative potential of scorpion venom (O. doriae) in human neuroblastoma cells. These properties

  11. 75 FR 71151 - Technical Correction and Clarification for Prohibited Transaction Exemption (PTE) 2010-26, PNC...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-22

    ... FR 56564, which is an administrative exemption from the prohibited transaction provisions of the... 75 FR 22853 on April 30, 2010. This document will provide corrections and clarifications with respect... Benefits Security Administration Technical Correction and Clarification for Prohibited...

  12. 77 FR 429 - Clarification and Further Guidance on the Fireworks Approvals Policy

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-05

    ... June 29, 2011 (76 FR 38053). Specifically, this document provides clarification and additional guidance... Pipeline and Hazardous Materials Safety Administration 49 CFR Part 173 Clarification and Further Guidance on the Fireworks Approvals Policy AGENCY: Pipeline and Hazardous Materials Safety...

  13. Psoralen covalently linked to oligodeoxyribonucleotides: synthesis, sequence specific recognition of DNA and photo-cross-linking to pyrimidine residues of DNA.

    PubMed Central

    Pieles, U; Englisch, U

    1989-01-01

    The psoralen derivative 4,5',8-trimethylpsoralen was covalently linked to the 5'-terminus of an 18mer oligodeoxyribonucleotide in the course of solid phase synthesis using phosphoroamidite chemistry. The derivative was introduced as a phosphitylation compound in the last cycle of the oligomer synthesis. The reagent was prepared by 4'-chloromethylation of 4,5',8-trimethylpsoralen, introduction of a linker by ethanediol and phosphitylation with chloro-[(beta-cyanoethoxy)-N,N-diisopropylamino]-phosphine. After oxydation and deprotection the 5'-psoralen modified oligodeoxyribonucleotide was characterised by HPLC. Hybridisation of the psoralen-modified oligomer to a complementary single stranded 21mer followed by irradiation at 350 nm revealed a photo-cross-linked double-stranded DNA fragment analysed on denaturing polyacrylamide gels. The cross-link could be reversed upon irradiation at 254nm. Images PMID:2911468

  14. Psoralen covalently linked to oligodeoxyribonucleotides: synthesis, sequence specific recognition of DNA and photo-cross-linking to pyrimidine residues of DNA.

    PubMed

    Pieles, U; Englisch, U

    1989-01-11

    The psoralen derivative 4,5',8-trimethylpsoralen was covalently linked to the 5'-terminus of an 18mer oligodeoxyribonucleotide in the course of solid phase synthesis using phosphoroamidite chemistry. The derivative was introduced as a phosphitylation compound in the last cycle of the oligomer synthesis. The reagent was prepared by 4'-chloromethylation of 4,5',8-trimethylpsoralen, introduction of a linker by ethanediol and phosphitylation with chloro-[(beta-cyanoethoxy)-N,N-diisopropylamino]-phosphine. After oxydation and deprotection the 5'-psoralen modified oligodeoxyribonucleotide was characterised by HPLC. Hybridisation of the psoralen-modified oligomer to a complementary single stranded 21mer followed by irradiation at 350 nm revealed a photo-cross-linked double-stranded DNA fragment analysed on denaturing polyacrylamide gels. The cross-link could be reversed upon irradiation at 254nm. PMID:2911468

  15. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A–T phosphoramidite building blocks

    PubMed Central

    Schmidtgall, Boris; Höbartner, Claudia

    2015-01-01

    Summary Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T–T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X–T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A–T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  16. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

    PubMed

    Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

    2015-01-01

    Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  17. Interacting RNA polymerase motors on a DNA track: effects of traffic congestion and intrinsic noise on RNA synthesis.

    PubMed

    Tripathi, Tripti; Chowdhury, Debashish

    2008-01-01

    RNA polymerase (RNAP) is an enzyme that synthesizes a messenger RNA (mRNA) strand which is complementary to a single-stranded DNA template. From the perspective of physicists, an RNAP is a molecular motor that utilizes chemical energy input to move along the track formed by DNA. In many circumstances, which are described in this paper, a large number of RNAPs move simultaneously along the same track; we refer to such collective movements of the RNAPs as RNAP traffic. Here we develop a theoretical model for RNAP traffic by incorporating the steric interactions between RNAPs as well as the mechanochemical cycle of individual RNAPs during the elongation of the mRNA. By a combination of analytical and numerical techniques, we calculate the rates of mRNA synthesis and the average density profile of the RNAPs on the DNA track. We also introduce, and compute, two different measures of fluctuations in the synthesis of RNA. Analyzing these fluctuations, we show how the level of intrinsic noise in mRNA synthesis depends on the concentrations of the RNAPs as well as on those of some of the reactants and the products of the enzymatic reactions catalyzed by RNAP. We suggest appropriate experimental systems and techniques for testing our theoretical predictions. PMID:18351890

  18. Chemical synthesis of human papillomavirus type 16 E7 oncoprotein: autonomous protein domains for induction of cellular DNA synthesis and for trans activation.

    PubMed

    Rawls, J A; Pusztai, R; Green, M

    1990-12-01

    The human papillomavirus type 16 E7 protein belongs to a family of nuclear oncoproteins that share amino acid sequences and functional homology. To localize biochemical activities associated with E7, we chemically synthesized the full-length 98-amino-acid polypeptide and several deletion mutant peptides. We show that the E7 polypeptide is biologically active and possesses at least two functional domains; the first induces cellular DNA synthesis in quiescent rodent cells, and the second trans activates the adenovirus E1A-inducible early E2 promoter and binds zinc. Further, each domain is autonomous and can function on separate peptides. DNA synthesis induction activity maps within the N-terminal portion of the molecule, which contains sequences related to adenovirus E1A conserved domains 1 and 2 required for cell transformation and binding of the retinoblastoma gene product. trans-Activation and Zn-binding activities map within the C-terminal portion of the molecule, a region which contains Cys-X-X-Cys motifs. trans Activation does not require protein synthesis, implying a mechanism that involves interaction with a preexisting cellular factor(s). E7 trans activates the adenovirus E2 promoter but not other E1A-inducible viral promoters, suggesting the possibility that E7 trans activation involves interaction, directly or indirectly, with cellular transcription factor E2F. PMID:2173783

  19. Stimulators and inhibitors of lymphocyte DNA synthesis in supernatants from human lymphoid cell lines.

    PubMed

    Vesole, D H; Goust, J M; Fett, J W; Fudenberg, H H

    1979-09-01

    Some T and B lymphoid cell lines (LCL) were found to secrete into their supernatants a substance able to stimulate lymphocyte proliferation. This substance produced an increase in [3H]thymidine uptake by mononuclear cells when added to unstimulated cultures (mitogenic effect) or when added to cultures stimulated with phytohemagglutinin (PHA) or pokeweed mitogen (PWM) (potentiating effect). When complete supernatants were used, the potentiating effect was sometimes masked by an inhibitor of DNA synthesis. Fractionation on Sephadex G-100 separated these two activities. The stimulatory substance eluted at a m.w. range of 15,000 to 30,000, and the inhibitor eluted with the albumin peak. B cells with or without monocytes were the most sensitive to the mitogenic effect, whereas T cells were unaffected. Responses to PHA and PWM were potentiated when T cells were present, but the maximum effect was observed when the proportion of T cells was less than 50%. The stimulatory material may be similar to lymphocyte mitogenic factor and may function as a T cell-replacing factor in B cell stimulation. PMID:313950

  20. The mechanism of inhibition of endothelin-1-induced stimulation of DNA synthesis in rat articular chondrocytes.

    PubMed

    Khatib, A M; Ribault, D; Quintero, M; Barbara, A; Fiet, J; Mitrovic, D R

    1997-09-19

    Endothelin-1 (ET-1) is a potent mitogen for rat articular chondrocytes (AC) in short term culture (24 h). Prolonged incubation (72 h) of AC with ET-1 resulted in inhibition of [3H]thymidine incorporation. This inhibition seemed to be mediated by prostaglandins (PGs) released in response to ET-1, since indomethacin (INDO) enhanced ET-1-induced [3H]thymidine incorporation. In agreement with this hypothesis, exogenous prostaglandins (PGE2, PGF2alpha and TxB2) blocked all basal, ET-1-induced and ET-1 induced-INDO-enhanced [3H]thymidine incorporation and ET-1 stimulated PGE2 release in a time and concentration-dependent manner. INDO also blocked cGMP production and 6-anilino-5,8-quinolinedione, a relatively specific inhibitor of cGMP formation, enhanced the stimulation and suppressed the inhibition of ET-1-induced DNA synthesis. In addition, 8-bromo-cGMP, an analogue of cGMP, blocked at all time periods studied, both basal and ET-1-induced incorporations of [3H]thymidine. Thus, PGs produced in response to ET-1 counteract the ET-1-induced stimulation of [3H]thymidine incorporation into rat AC by increasing cGMP production. PMID:9324043

  1. The DNA methylation inhibitor 5-azacytidine decreases melanin synthesis by inhibiting CREB phosphorylation.

    PubMed

    Shin, Jun Seob; Jeong, Hyo-Soon; Kim, Myo-Kyoung; Yun, Hye-Young; Baek, Kwang Jin; Kwon, Nyoun Soo; Kim, Dong-Seok

    2015-10-01

    Here we examined the effects of a DNA methylation inhibitor, 5-azacytidine, on melanogenesis in Mel-Ab cells. We found that 5-azacytidine decreased the melanin content and tyrosinase activity in these cells in a dose-dependent manner; importantly, 5-azacytidine was not cytotoxic at the concentrations used in these experiments. On the other hand, 5-azacytidine did not affect tyrosinase activity in a cell-free system, indicating that 5-azacytidine is not a direct tyrosinase inhibitor. Instead, 5-azacytidine decreased the protein levels of microphthalmia-associated transcription factor (MITF) and tyrosinase. Thus, we investigated the effects of 5-azacytidine on signal transduction pathways related to melanogenesis. However, 5-azacytidine did not have any effect on either Akt or glycogen synthase kinase 3β (GSK3β) phosphorylation. The phosphorylation of cAMP response element-binding protein (CREB) is well known to regulate MITF expression, thereby also regulating tyrosinase expression. We found that 5-azacytidine decreased the phosphorylation of CREB. Therefore, we propose that 5-azacytidine may decrease melanin synthesis by downregulating MITF and tyrosinase via CREB inactivation. PMID:26601420

  2. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173. PMID:15543522

  3. Regulation of translesion DNA synthesis: posttranslational modification of lysine residues in key proteins

    PubMed Central

    McIntyre, Justyna; Woodgate, Roger

    2015-01-01

    Posttranslational modification of proteins often controls various aspects of their cellular function. Indeed, over the past decade or so, it has been discovered that posttranslational modification of lysine residues plays a major role in regulating translesion DNA synthesis (TLS) and perhaps the most appreciated lysine modification is that of ubiquitination. Much of the recent interest in ubiquitination stems from the fact that proliferating cell nuclear antigen (PCNA) was previously shown to be specifically ubiquitinated at K164 and that such ubiquitination plays a key role in regulating TLS. In addition, TLS polymerases themselves are now known to be ubiquitinated. In the case of human polymerase η, ubiquitination at four lysine residues in its C-terminus appears to regulate its ability to interact with PCNA and modulate TLS. Within the past few years, advances in global proteomic research has revealed that many proteins involved in TLS are, in fact, subject to a previously underappreciated number of lysine modifications. In this review, we will summarize the known lysine modifications of several key proteins involved in TLS; PCNA and Y-family polymerases η, ι, κ and Rev1 and we will discuss the potential regulatory effects of such modification in controlling TLS in vivo. PMID:25743599

  4. Synthesis, spectroscopic characterization, biological screenings, DNA binding study and POM analyses of transition metal carboxylates

    NASA Astrophysics Data System (ADS)

    Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman

    2015-04-01

    This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

  5. Dihydrochelerythrine and its derivatives: Synthesis and their application as potential G-quadruplex DNA stabilizing agents.

    PubMed

    Malhotra, Rajesh; Rarhi, Chhanda; Diveshkumar, K V; Barik, Rajib; D'cunha, Ruhee; Dhar, Pranab; Kundu, Mrinalkanti; Chattopadhyay, Subrata; Roy, Subho; Basu, Sourav; Pradeepkumar, P I; Hajra, Saumen

    2016-07-01

    A convenient route was envisaged toward the synthesis of dihydrochelerythrine (DHCHL), 4 by intramolecular Suzuki coupling of 2-bromo-N-(2-bromobenzyl)-naphthalen-1-amine derivative 5 via in situ generated arylborane. This compound was converted to (±)-6-acetonyldihydrochelerythrine (ADC), 3 which was then resolved by chiral prep-HPLC. Efficiency of DHCHL for the stabilization of promoter quadruplex DNA structures and a comparison study with the parent natural alkaloid chelerythrine (CHL), 1 was performed. A thorough investigation was carried out to assess the quadruplex binding affinity by using various biophysical and biochemical studies and the binding mode was explained by using molecular modeling and dynamics studies. Results clearly indicate that DHCHL is a strong G-quadruplex stabilizer with affinity similar to that of the parent alkaloid CHL. Compounds ADC and DHCHL were also screened against different human cancer cell lines. Among the cancer cells, (±)-ADC and its enantiomers showed varied (15-48%) inhibition against human colorectal cell line HCT116 and breast cancer cell line MDA-MB-231 albeit low enantio-specificity in the inhibitory effect; whereas DHCHL showed 30% inhibition against A431 cell line only, suggesting the compounds are indeed cancer tissue specific. PMID:27234888

  6. Synthesis, spectroscopic characterization, biological screenings, DNA binding study and POM analyses of transition metal carboxylates.

    PubMed

    Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman

    2015-04-01

    This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out. PMID:25646895

  7. 75 FR 13066 - Hazardous Waste Technical Corrections and Clarifications Rule

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-18

    ... Technical Corrections and Clarifications Rule AGENCY: Environmental Protection Agency (EPA). ACTION... technical changes that would correct or clarify several parts of the hazardous waste regulations that relate... EPA cannot read your comment due to technical difficulties and cannot contact you for...

  8. 78 FR 12233 - Policy Clarification on Charitable Medical Flights

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-22

    ... Federal Aviation Administration 14 CFR Part 61 Policy Clarification on Charitable Medical Flights AGENCY... notice of policy to describe its policy for volunteer pilots operating charitable medical flights. Charitable medical flights are flights where a pilot, aircraft owner, and/or operator provides...

  9. 28 CFR 513.12 - Inmate request for record clarification.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... record is incorrect or inaccurate, the inmate may follow procedures outlined in 28 CFR 16.34. The procedures in 28 CFR 16.34 also apply for the clarification of an inmate's NCIC/III record. ... MANAGEMENT AND ADMINISTRATION ACCESS TO RECORDS Production or Disclosure of FBI/NCIC Information §...

  10. 28 CFR 513.12 - Inmate request for record clarification.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... record is incorrect or inaccurate, the inmate may follow procedures outlined in 28 CFR 16.34. The procedures in 28 CFR 16.34 also apply for the clarification of an inmate's NCIC/III record. ... MANAGEMENT AND ADMINISTRATION ACCESS TO RECORDS Production or Disclosure of FBI/NCIC Information §...

  11. 28 CFR 513.12 - Inmate request for record clarification.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... record is incorrect or inaccurate, the inmate may follow procedures outlined in 28 CFR 16.34. The procedures in 28 CFR 16.34 also apply for the clarification of an inmate's NCIC/III record. ... MANAGEMENT AND ADMINISTRATION ACCESS TO RECORDS Production or Disclosure of FBI/NCIC Information §...

  12. 28 CFR 513.12 - Inmate request for record clarification.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... record is incorrect or inaccurate, the inmate may follow procedures outlined in 28 CFR 16.34. The procedures in 28 CFR 16.34 also apply for the clarification of an inmate's NCIC/III record. ... MANAGEMENT AND ADMINISTRATION ACCESS TO RECORDS Production or Disclosure of FBI/NCIC Information §...

  13. 28 CFR 513.12 - Inmate request for record clarification.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... record is incorrect or inaccurate, the inmate may follow procedures outlined in 28 CFR 16.34. The procedures in 28 CFR 16.34 also apply for the clarification of an inmate's NCIC/III record. ... MANAGEMENT AND ADMINISTRATION ACCESS TO RECORDS Production or Disclosure of FBI/NCIC Information §...

  14. 76 FR 80831 - Clarification of Policy Regarding Approved Training Programs

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-27

    ... the Federal Register published on April 11, 2000 (65 FR 19477-19478), as well as at http://DocketsInfo... Federal Aviation Administration 14 CFR Part 135 Clarification of Policy Regarding Approved Training... Notice that would require FAA inspectors to review 14 CFR part 135 approved training programs to...

  15. 78 FR 35874 - Procurement List; Additions and Deletions; Clarification

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-14

    ... . SUPPLEMENTARY INFORMATION: The Committee's Notice in the Federal Register of Friday, May 10, 2013 (77 FR 27369... PEOPLE WHO ARE BLIND OR SEVERELY DISABLED Procurement List; Additions and Deletions; Clarification AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Notice. SUMMARY:...

  16. 75 FR 31716 - Hazardous Waste Technical Corrections and Clarifications Rule

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-04

    ... Final rule entitled, Hazardous Waste Technical Corrections and Clarifications Rule (75 FR 12989). This...-HSWA RCRA authority and the authority of the Hazardous Materials Transportation Act: 40 CFR 262.23, 40...) under the federal hazardous materials transportation laws, the manifest changes will be...

  17. DNA interstrand crosslinking agents: synthesis, DNA interactions, and cytotoxicity of dimeric achiral seco-amino-CBI and conjugates of achiral seco-amino-CBI with pyrrolobenzodiazepine (PBD).

    PubMed

    Purnell, Bethany; Sato, Atsushi; O'kelley, Amanda; Price, Carly; Summerville, Kaitlin; Hudson, Stephen; O'hare, Caroline; Kiakos, Konstantinos; Asao, Tetsuji; Lee, Moses; Hartley, John A

    2006-11-01

    The design and synthesis of three novel bisalkylating agents derived from the achiral seco-duocarmycin or CC-1065 analogs and pyrrolobenzodiazepines (PBDs) are described: achiral seco-CBI (cyclopropanebenz[e]indoline)-PBD 11, achiral seco-CI-PBD 12, and achiral seco-CBI dimer 13. Compounds 11 and 12 demonstrated enhanced cytotoxicity over the monomer counterparts against the growth of P815 murine mastocytoma cells in culture. Conjugate 11 was found to covalently react with adenine-N3 positions within the minor groove at AT-rich sequences and to produce DNA interstrand crosslinks. Both compounds were found to induce apoptosis in P815 cells. Due to its poor water solubility, dimer 13 did not give any appreciable DNA binding or cytotoxicity. PMID:16919946

  18. The PCNA-associated protein PARI negatively regulates homologous recombination via the inhibition of DNA repair synthesis.

    PubMed

    Burkovics, Peter; Dome, Lili; Juhasz, Szilvia; Altmannova, Veronika; Sebesta, Marek; Pacesa, Martin; Fugger, Kasper; Sorensen, Claus Storgaard; Lee, Marietta Y W T; Haracska, Lajos; Krejci, Lumir

    2016-04-20

    Successful and accurate completion of the replication of damage-containing DNA requires mainly recombination and RAD18-dependent DNA damage tolerance pathways. RAD18 governs at least two distinct mechanisms: translesion synthesis (TLS) and template switching (TS)-dependent pathways. Whereas TS is mainly error-free, TLS can work in an error-prone manner and, as such, the regulation of these pathways requires tight control to prevent DNA errors and potentially oncogenic transformation and tumorigenesis. In humans, the PCNA-associated recombination inhibitor (PARI) protein has recently been shown to inhibit homologous recombination (HR) events. Here, we describe a biochemical mechanism in which PARI functions as an HR regulator after replication fork stalling and during double-strand break repair. In our reconstituted biochemical system, we show that PARI inhibits DNA repair synthesis during recombination events in a PCNA interaction-dependent way but independently of its UvrD-like helicase domain. In accordance, we demonstrate that PARI inhibits HRin vivo, and its knockdown suppresses the UV sensitivity of RAD18-depleted cells. Our data reveal a novel human regulatory mechanism that limits the extent of HR and represents a new potential target for anticancer therapy. PMID:26792895

  19. The PCNA-associated protein PARI negatively regulates homologous recombination via the inhibition of DNA repair synthesis

    PubMed Central

    Burkovics, Peter; Dome, Lili; Juhasz, Szilvia; Altmannova, Veronika; Sebesta, Marek; Pacesa, Martin; Fugger, Kasper; Sorensen, Claus Storgaard; Lee, Marietta Y.W.T.; Haracska, Lajos; Krejci, Lumir

    2016-01-01

    Successful and accurate completion of the replication of damage-containing DNA requires mainly recombination and RAD18-dependent DNA damage tolerance pathways. RAD18 governs at least two distinct mechanisms: translesion synthesis (TLS) and template switching (TS)-dependent pathways. Whereas TS is mainly error-free, TLS can work in an error-prone manner and, as such, the regulation of these pathways requires tight control to prevent DNA errors and potentially oncogenic transformation and tumorigenesis. In humans, the PCNA-associated recombination inhibitor (PARI) protein has recently been shown to inhibit homologous recombination (HR) events. Here, we describe a biochemical mechanism in which PARI functions as an HR regulator after replication fork stalling and during double-strand break repair. In our reconstituted biochemical system, we show that PARI inhibits DNA repair synthesis during recombination events in a PCNA interaction-dependent way but independently of its UvrD-like helicase domain. In accordance, we demonstrate that PARI inhibits HR in vivo, and its knockdown suppresses the UV sensitivity of RAD18-depleted cells. Our data reveal a novel human regulatory mechanism that limits the extent of HR and represents a new potential target for anticancer therapy. PMID:26792895

  20. Exploration of cellular DNA lesion, DNA-binding and biocidal ordeal of novel curcumin based Knoevenagel Schiff base complexes incorporating tryptophan: Synthesis and structural validation

    NASA Astrophysics Data System (ADS)

    Chandrasekar, Thiravidamani; Raman, Natarajan

    2016-07-01

    A few novel Schiff base transition metal complexes of general formula [MLCl] (where, L = Schiff base, obtained by the condensation reaction of Knoevenagel condensate of curcumin, L-tryptophan and M = Cu(II), Ni(II), Co(II), and Zn(II)), were prepared by stencil synthesis. They were typified using UV-vis, IR, EPR spectral techniques, micro analytical techniques, magnetic susceptibility and molar conductivity. Geometry of the metal complexes was examined and recognized as square planar. DNA binding and viscosity studies revealed that the metal(II) complexes powerfully bound via an intercalation mechanism with the calf thymus DNA. Gel-electrophoresis technique was used to investigate the DNA cleavage competence of the complexes and they establish to approve the cleavage of pBR322 DNA in presence of oxidant H2O2. This outcome inferred that the synthesized complexes showed better nuclease activity. Moreover, the complexes were monitored for antimicrobial activities. The results exposed that the synthesized compounds were forceful against all the microbes under exploration.

  1. Exploration of cellular DNA lesion, DNA-binding and biocidal ordeal of novel curcumin based Knoevenagel Schiff base complexes incorporating tryptophan: Synthesis and structural validation

    NASA Astrophysics Data System (ADS)

    Chandrasekar, Thiravidamani; Raman, Natarajan

    2016-07-01

    A few novel Schiff base transition metal complexes of general formula [MLCl] (where, L = Schiff base, obtained by the condensation reaction of Knoevenagel condensate of curcumin, L-tryptophan and M = Cu(II), Ni(II), Co(II), and Zn(II)), were prepared by stencil synthesis. They were typified using UV-vis, IR, EPR spectral techniques, micro analytical techniques, magnetic susceptibility and molar conductivity. Geometry of the metal complexes was examined and recognized as square planar. DNA binding and viscosity studies revealed that the metal(II) complexes powerfully bound via an intercalation mechanism with the calf thymus DNA. Gel-electrophoresis technique was used to investigate the DNA cleavage competence of the complexes and they establish to approve the cleavage of pBR322 DNA in presence of oxidant H2O2. This outcome inferred that the synthesized complexes showed better nuclease activity. Moreover, the complexes were monitored for antimicrobial activities. The results exposed that the synthesized compounds were forceful against all the microbes under exploration.

  2. Mutations for Worse or Better: Low-Fidelity DNA Synthesis by SOS DNA Polymerase V Is a Tightly Regulated Double-Edged Sword.

    PubMed

    Jaszczur, Malgorzata; Bertram, Jeffrey G; Robinson, Andrew; van Oijen, Antoine M; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

    2016-04-26

    1953, the year of Watson and Crick, bore witness to a less acclaimed yet highly influential discovery. Jean Weigle demonstrated that upon infection of Escherichia coli, λ phage deactivated by UV radiation, and thus unable to form progeny, could be reactivated by irradiation of the bacterial host. Evelyn Witkin and Miroslav Radman later revealed the presence of the SOS regulon. The more than 40 regulon genes are repressed by LexA protein and induced by the coproteolytic cleavage of LexA, catalyzed by RecA protein bound to single-stranded DNA, the RecA* nucleoprotein filament. Several SOS-induced proteins are engaged in repairing both cellular and extracellular damaged DNA. There's no "free lunch", however, because error-free repair is accompanied by error-prone translesion DNA synthesis (TLS), involving E. coli DNA polymerase V (UmuD'2C) and RecA*. This review describes the biochemical mechanisms of pol V-mediated TLS. pol V is active only as a mutasomal complex, pol V Mut = UmuD'2C-RecA-ATP. RecA* donates a single RecA subunit to pol V. We highlight three recent insights. (1) pol V Mut has an intrinsic DNA-dependent ATPase activity that governs polymerase binding and dissociation from DNA. (2) Active and inactive states of pol V Mut are determined at least in part by the distinct interactions between RecA and UmuC. (3) pol V is activated by RecA*, not at a blocked replisome, but at the inner cell membrane. PMID:27043933

  3. Synthesis of eight-arm, branched oligonucleotide hybrids and studies on the limits of DNA-driven assembly.

    PubMed

    Schwenger, Alexander; Gerlach, Claudia; Griesser, Helmut; Richert, Clemens

    2014-12-01

    Oligonucleotide hybrids with organic cores as rigid branching elements and four or six CG dimer strands have been shown to form porous materials from dilute aqueous solution. In order to explore the limits of this form of DNA-driven assembly, we prepared hybrids with three or eight DNA arms via solution-phase syntheses, using H-phosphonates of protected dinucleoside phosphates. This included the synthesis of (CG)8TREA, where TREA stands for the tetrakis[4-(resorcin-5-ylethynyl)phenyl]adamantane core. The ability of the new compounds to assemble in a DNA-driven fashion was studied by UV-melting analysis and NMR, using hybrids with self-complementary CG zipper arms or non-self-complementary TC dimer arms. The three-arm hybrid failed to form a material under conditions where four-arm hybrids did so. Further, the assembly of TREA hybrids appears to be dominated by hydrophobic interactions, not base pairing of the DNA arms. These results help in the design of materials forming by multivalent DNA-DNA interactions. PMID:25407332

  4. Baculovirus DNA Replication-Specific Expression Factors Trigger Apoptosis and Shutoff of Host Protein Synthesis during Infection▿

    PubMed Central

    Schultz, Kimberly L. W.; Friesen, Paul D.

    2009-01-01

    Apoptosis is an important antivirus defense. To define the poorly understood pathways by which invertebrates respond to viruses by inducing apoptosis, we have identified replication events that trigger apoptosis in baculovirus-infected cells. We used RNA silencing to ablate factors required for multiplication of Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV). Transfection with double-stranded RNA (dsRNA) complementary to the AcMNPV late expression factors (lefs) that are designated as replicative lefs (lef-1, lef-2, lef-3, lef-11, p143, dnapol, and ie-1/ie-0) blocked virus DNA synthesis and late gene expression in permissive Spodoptera frugiperda cells. dsRNAs specific to designated nonreplicative lefs (lef-8, lef-9, p47, and pp31) blocked late gene expression without affecting virus DNA replication. Thus, both classes of lefs functioned during infection as defined. Silencing the replicative lefs prevented AcMNPV-induced apoptosis of Spodoptera cells, whereas silencing the nonreplicative lefs did not. Thus, the activity of replicative lefs or virus DNA replication is sufficient to trigger apoptosis. Confirming this conclusion, AcMNPV-induced apoptosis was suppressed by silencing the replicative lefs in cells from a divergent species, Drosophila melanogaster. Silencing replicative but not nonreplicative lefs also abrogated AcMNPV-induced shutdown of host protein synthesis, suggesting that virus DNA replication triggers inhibition of host biosynthetic processes and that apoptosis and translational arrest are linked. Our findings suggest that baculovirus DNA replication triggers a host cell response similar to the DNA damage response in vertebrates, which causes translational arrest and apoptosis. Pathways for detecting virus invasion and triggering apoptosis may therefore be conserved between insects and mammals. PMID:19706708

  5. Effects of 8-halo-7-deaza-2'-deoxyguanosine triphosphate on DNA synthesis by DNA polymerases and cell proliferation.

    PubMed

    Yin, Yizhen; Sasaki, Shigeki; Taniguchi, Yosuke

    2016-08-15

    8-OxodG (8-oxo-2'-deoxyguanosine) is representative of nucleoside damage and shows a genotoxicity. To significantly reveal the contributions of 7-NH and C8-oxygen to the mutagenic effect of 8-oxodG by DNA polymerases, we evaluated the effects of the 8-halo-7-deaza-dG (8-halogenated 7-deaza-2'-deoxyguanosine) derivatives by DNA polymerases. 8-Halo-7-deaza-dGTPs were poorly incorporated by both KF(exo(-)) and human DNA polymerase β opposite dC or dA into the template DNA. Furthermore, it was found that KF(exo(-)) was very sensitive to the introduction of the C8-halogen, while polymerase β can accommodate the C8-halogen resulting in an efficient dCTP insertion opposite the 8-halo-7-deaza-dG in the template DNA. These results indicate that strong hydrogen bonding between 7-NH in the 8-oxo-G nucleobase and 1-N in the adenine at the active site of the DNA polymerase is required for the mutagenic effects. Whereas, I-deaza-dGTP shows an antiproliferative effect for the HeLa cells, suggesting that it could become a candidate as a new antitumor agent. PMID:27372838

  6. The Affinity of EBNA1 for Its Origin of DNA Synthesis Is a Determinant of the Origin's Replicative Efficiency▿ †

    PubMed Central

    Lindner, Scott E.; Zeller, Krisztina; Schepers, Aloys; Sugden, Bill

    2008-01-01

    Epstein-Barr virus (EBV) replicates its genome as a licensed plasmid in latently infected cells. Although replication of this plasmid is essential for EBV latent infection, its synthesis still fails for 16% of the templates in S phase. In order to understand these failures, we sought to determine whether the affinity of the initiator protein (EBNA1) for its binding sites in the origin affects the efficiency of plasmid replication. We have answered this question by using several engineered origins modeled upon the arrangement of EBNA1-binding sites found in DS, the major plasmid origin of EBV. The human TRF2 protein also binds to half-sites in DS and increases EBNA1's affinity for its own sites; we therefore also tested origin efficiency in the presence or absence of these sites. We have found that if TRF2-half-binding sites are present, the efficiency of supporting the initiation of DNA synthesis and of establishing a plasmid bearing that origin directly correlates with the affinity of EBNA1 for that origin. Moreover, the presence of TRF2-half-binding sites also increases the average level of EBNA1 and ORC2 bound to those origins in vivo, as measured by chromatin immunoprecipitation. Lastly, we have created an origin of DNA synthesis from high-affinity EBNA1-binding sites and TRF2-half-binding sites that functions severalfold more efficiently than does DS. This finding indicates that EBV has selected a submaximally efficient origin of DNA synthesis for the latent phase of its life cycle. This enhanced origin could be used practically in human gene vectors to improve their efficiency in therapy and basic research. PMID:18385243

  7. Effects of cryopreservation on sperm viability, synthesis of reactive oxygen species, and DNA damage of bovine sperm.

    PubMed

    Gürler, H; Malama, E; Heppelmann, M; Calisici, O; Leiding, C; Kastelic, J P; Bollwein, H

    2016-07-15

    The objective was to examine if there are relationships between alterations in sperm viability, reactive oxygen species (ROS) synthesis, and DNA integrity induced by cryopreservation of bovine sperm. Four ejaculates were collected from each of six bulls. Each ejaculate was diluted and divided into two aliquots; one was incubated for 24 hours at 37 °C, and the other frozen, thawed, and incubated for 24 hours at 37 °C. Analyses of quality of sperm were performed after 0, 3, 6, 12, and 24 hours of incubation. Progressive motile sperm was determined with computer assisted sperm analysis. Percentages of plasma membrane- and acrosome-intact sperm, sperm with a high mitochondrial membrane potential, sperm showing a high degree of DNA fragmentation (%DFI), and their reactive oxygen species content were assessed with dichlorofluorescein-diacetate, dihydrorhodamine, diaminofluorescein diacetate, and mitochondrial superoxide indicator using flow cytometry. Although all other sperm parameters showed alterations (P < 0.05) during the 24-hour incubation time, %DFI stayed constant (P > 0.05, 0.91 ± 0.23) in nonfrozen sperm. Cryopreservation induced changes of all sperm parameters (P < 0.05). In contrast to all other sperm parameters, dichlorofluorescein-diacetate-fluoroescence indicating the synthesis of H2O2 showed a similar exponential rise (P < 0.05) like the %DFI values in frozen sperm. In conclusion, changes of DNA integrity in frozen sperm seem to be related to synthesis of H2O2 but not to sperm viability and synthesis of other reactive oxygen species. PMID:27039074

  8. Compaction agent clarification of microbial lysates

    NASA Technical Reports Server (NTRS)

    DeWalt, Brad W.; Murphy, Jason C.; Fox, George E.; Willson, Richard C.

    2003-01-01

    Recombinant proteins are often purified from microbial lysates containing high concentrations of nucleic acids. Pre-purification steps such as nuclease addition or precipitation with polyethyleneimine or ammonium sulfate are normally required to reduce viscosity and to eliminate competing polyanions before anion exchange chromatography. We report that small polycationic compaction agents such as spermine selectively precipitate nucleic acids during or after Escherichia coli lysis, allowing DNA and RNA to be pelleted with the insoluble cell debris. Analysis by spectrophotometry and protein assay confirmed a significant reduction in the concentration of nucleic acids present, with preservation of protein. Lysate viscosity is greatly reduced, facilitating subsequent processing. We have used 5mM spermine to remove nucleic acids from E. coli lysate in the purification of a hexahistidine-tagged HIV reverse transcriptase.

  9. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  10. Nerve growth factor inhibits the synthesis of a single-stranded DNA binding protein in pheochromocytoma cells (clone PC12).

    PubMed Central

    Biocca, S; Cattaneo, A; Calissano, P

    1984-01-01

    Arrest of mitosis and neurite outgrowth induced by nerve growth factor (NGF) in rat pheochromocytoma cells (clone PC12) is accompanied by a progressive inhibition of the synthesis of a protein that binds to single-stranded but not to double-stranded DNA. Time course experiments show that this inhibition is already apparent after a 2-day incubation with NGF and is maximum (85-95%) upon achievement of complete PC12 cell differentiation. Inhibition of the synthesis of this single-stranded DNA binding protein after 48 hr of incubation with NGF is potentiated by concomitant treatment of PC12 cells with antimitotic drugs acting at different levels of DNA replication. Purification on a preparative scale of this protein and analysis of its major physicochemical properties show that: (i) it constitutes 0.5% of total soluble proteins of naive PC12 cells; (ii) its molecular weight measured by NaDodSO4/PAGE is Mr 34,000 (sucrose gradient centrifugation under nondenaturing conditions yields a sedimentation coefficient s20,w of 8.1 S, indicating that the native protein is an oligomer); (iii) amino acid analysis demonstrates a preponderance of acidic over basic residues, while electrofocusing experiments show that it has an isoelectric point around 8.0; (iv) approximately 15% of the protein is phosphorylated in vivo. It is postulated that control of the synthesis of this protein is connected with activation of a differentiative program triggered by NGF in the PC12 neoplastic cell line at some step(s) of DNA activity. Images PMID:6585787

  11. Synthesis of bisphosphonate derivatives of ATP by T4 DNA ligase, ubiquitin activating enzyme (E1) and other ligases.

    PubMed

    Günther Sillero, María A; de Diego, Anabel; Pérez-Zúñiga, Francisco J; Sillero, Antonio

    2008-05-15

    T4 DNA ligase and the ubiquitin activating enzyme (E1), catalyze the synthesis of ATP beta,gamma-bisphosphonate derivatives. Concerning T4 DNA ligase: (i) etidronate (pC(OH)(CH(3))p) displaced the AMP moiety of the complex E-AMP in a concentration dependent manner; (ii) the K(m) values and the rate of synthesis k(cat) (s(-1)), determined for the following compounds were, respectively: etidronate, 0.73+/-0.09 mM and (70+/-10)x10(-3) s(-1); clodronate (pCCl(2)p), 0.08+/-0.01 mM and (4.1+/-0.3)x10(-3) s(-1); methylenebisphosphonate (pCH(2)p), 0.024+/-0.001 mM and (0.6+/-0.1)x10(-3) s(-1); tripolyphosphate (P(3)) (in the synthesis of adenosine 5'-tetraphosphate, p(4)A), 1.30+/-0.30 mM and (6.2+/-1.1)x10(-3) s(-1); (iii) in the presence of GTP and ATP, inhibition of the synthesis of Ap(4)G was observed with clodronate but not with pamidronate (pC(OH)(CH(2)-CH(2)-NH(3))p). Concerning the ubiquitin activating enzyme (E1): methylenebisphosphonate was the only bisphosphonate, out of the ones tested, that served as substrate for the synthesis of an ATP derivative (K(m)=0.36+/-0.09 mM and k(cat)=0.15+/-0.02 s(-1)). None of the above bisphosphonates were substrates of the reaction catalyzed by luciferase or by acyl-CoA synthetase. The ability of acetyl-CoA synthetase to use methylenebisphosphonate as substrate depended on the commercial source of the enzyme. In our view this report widens our knowledge of the enzymes able to metabolize bisphosphonates, a therapeutic tool widely used in the treatment of osteoporosis. PMID:18378215

  12. Ultrastructural Studies of H-1 Parvovirus Replication VI. Simultaneous Autoradiographic and Immunochemical Intranuclear Localization of Viral DNA Synthesis and Protein Accumulation

    PubMed Central

    Singer, Irwin I.; Rhode, Solon L.

    1978-01-01

    The localization of H-1 viral replicative-form double-stranded DNA and progeny single-stranded DNA replication in parasynchronously infected, simian virus 40-transformed newborn human kidney cells was studied with high-resolution electron microscope autoradiography (80-nm silver grains). We analyzed wild-type H-1 and ts1 H-1 (a conditional mutant defective in progeny single-stranded DNA synthesis). The proportion of the total DNA synthesis that was viral was estimated to be >90% by comparing the amount of [3H]thymidine uptake in cultures infected with wild-type H-1 versus ts14 (an H-1 mutant defective in DNA replication). Simultaneous staining with cytochrome c-conjugated anti-H-1 immunoglobulin G was performed to ensure that cells incorporating [3H]thymidine (2- to 60-min pulses) were H-1 infected. The sites of H-1 replicative-form (in ts1-infected cells) and progeny (in wild-type-infected cells) DNA synthesis were identical. Immunospecifically labeled nuclei at the earliest stages of infection exhibited dense clusters of silver grains over material extruded from nucleolar fibrillar centers. These foci became larger with increasing cellular damage, forming a limited number of H-1 DNA synthetic centers in the euchromatin. Each island-like focus was surrounded by tufts of heterochromatin containing high concentrations of unassembled H-1 capsid proteins. In late phases of infection, the heterochromatin became completely marginated, and the nucleoplasm contained only euchromatin that exhibited randomly distributed sites of H-1 DNA replication. This indicates that H-1 DNA synthesis begins at localized euchromatic or nucleolar sites and then spreads outward. Immunostained heterochromatin and nucleolar chromatin never incorporated [3H]thymidine. Our results suggest that H-1 proteins and cellular cofactors associated with the fibrillar component of the nucleolus and the euchromatin may play a role in the regulation of H-1 DNA synthesis. Images PMID:340710

  13. Optimizing stem-loop qPCR assays through multiplexed cDNA synthesis of U6 and miRNAs

    PubMed Central

    Turner, Marie; Adhikari, Sajag; Subramanian, Senthil

    2013-01-01

    We recently reported that hairpin (or stem-loop) priming is better-suited than polyA tailing to generate cDNA for plant microRNA qPCR. One major limitation of this method is the need to perform individual cDNA synthesis reactions for the reference gene and test miRNAs. Here, we report a novel fusion primer that allows multiplexed hairpin cDNA synthesis of the most-commonly used reference gene, nucleolar small RNA U6, together with test miRNAs. We also propose the use of miR1515 as a house keeping control for tropical legumes. We show that multiplexed cDNA synthesis does not result in loss of sensitivity and reduces the amount of RNA required for miRNA gene expression assays. PMID:23673353

  14. Dithiocarbamate/piperazine bridged pyrrolobenzodiazepines as DNA-minor groove binders: synthesis, DNA-binding affinity and cytotoxic activity.

    PubMed

    Kamal, Ahmed; Sreekanth, Kokkonda; Shankaraiah, Nagula; Sathish, Manda; Nekkanti, Shalini; Srinivasulu, Vunnam

    2015-04-01

    A new series of C8-linked dithiocarbamate/piperazine bridged pyrrolo[2,1-c][1,4]benzodiazepine conjugates (5a-c, 6a,b) have been synthesized and evaluated for their cytotoxic potential and DNA-binding ability. The representative conjugates 5a and 5b have been screened for their cytotoxicity against a panel of 60 human cancer cell lines. Compound 5a has shown promising cytotoxic activity on selected cancer cell lines that display melanoma, leukemia, CNS, ovarian, breast and renal cancer phenotypes. The consequence of further replacement of the 3-cyano-3,3-diphenylpropyl 1-piperazinecarbodithioate in 5b and 5c with 4-methylpiperazine-1-carbodithioate yielded new conjugates 6a and 6b respectively. In addition, the compounds 5c and 6a,b have been evaluated for their in vitro cytotoxicity on some of the selected human cancer cell lines and these conjugates have exhibited significant cytotoxic activity. Further, the DNA-binding ability of these new conjugates has been evaluated by using thermal denaturation (ΔTm) studies. The correlation between structure and DNA-binding ability has been investigated by molecular modeling studies which predicted that 6b exhibits superior DNA-binding ability and these are in agreement with the experimental DNA-binding studies. PMID:25665519

  15. Hydrogenase synthesis in Bradyrhizobium japonicum Hupc mutants is altered in sensitivity to DNA gyrase inhibitors.

    PubMed Central

    Novak, P D; Maier, R J

    1989-01-01

    In the Hupc mutants of Bradyrhizobium japonicum SR, regulation of expression of hydrogenase is altered; the mutants synthesize hydrogenase constitutively in the presence of atmospheric levels of oxygen. The DNA gyrase inhibitors nalidixic acid, novobiocin, and coumermycin were used to inhibit growth of wild-type and mutant cells. For each inhibitor tested, growth of mutant and wild-type strains was equally sensitive. However, in contrast to the wild type, the Hupc mutants synthesized hydrogenase in the presence of high levels of any inhibitor. Cells were incubated with the drugs and simultaneously labeled with 14C-labeled amino acids, and hydrogenase was immunoprecipitated with antibody to the large subunit of the enzyme. Fluorograms of antibody blots then were scanned to determine the relative amount of hydrogenase (large subunit) synthesized in the presence or absence of the gyrase inhibitors. The amount of hydrogenase synthesized by the Hupc mutants in the presence of 300 micrograms of nalidixic acid per ml was near the level of enzyme synthesized in the absence of the inhibitor. No hydrogenase was detected in antibody blots of wild-type cultures which were derepressed for hydrogenase in the presence of 100 micrograms of coumermycin or novobiocin per ml. In contrast, hydrogenase was synthesized by the Hupc mutants in the presence of 100 micrograms of either drug per ml. The amount synthesized ranged from 5 to 32% and 20 to 49%, respectively, of that in the absence of those inhibitors, but nevertheless, hydrogenase synthesis was detected in all of the mutants examined.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:2547335

  16. In vivo effects of endotoxin on DNA synthesis in rat nasal epithelium

    SciTech Connect

    Harkema, J.R.; Hotchkiss, J.A. )

    1993-12-01

    Airway inflammation in bacterial infections is characterized by the presence of neutrophils and often epithelial injury and repair. Release of endotoxin from bacteria may contribute to these processes. The purpose of this study was to determine the in vivo effects of repeated endotoxin exposure on DNA synthesis in rat nasal epithelium in the presence and absence of neutrophilic influx. Rats were intranasally instilled, once a day for 3 days, with endotoxin or saline (controls). Before the first and third instillations, half of the saline and endotoxin-instilled animals were depleted of circulating blood neutrophils by administering a rabbit anti-rat neutrophil antiserum. Rats were sacrificed 6 or 24 h after the last instillation. Two hours prior to sacrifice, rats were intraperitoneally injected with bromodeoxyuridine (BrdU), an analog of thymidine that is incorporated in the nucleus of cells in the S-phase of the cell cycle. Nasal tissues were processed for light microscopy and immunohistochemical detection of BrdU in nasal epithelial cells. The numbers of nasal epithelial cells, BrdU-labeled epithelial nuclei, and neutrophils per millimeter of basal lamina in the epithelium lining the nasal turbinates in the proximal nasal passages were determined by morphometric analysis. The authors did not observe a neutrophilic influx in the nasal tissues of neutrophil-depleted rats at 6 or 24 h after the last endotoxin instillation; however, the numbers of nasal epithelial cells and the BrdU-labeling index were significantly increased compared to saline-instilled controls. In contrast, non-neutrophil-depleted rats instilled with endotoxin had a marked neutrophilic influx, but no significant differences in the number of nasal epithelial cells at 6 or 24 h, compared to controls. In addition, the BrdU-labeling index in neutrophil-sufficient rats was increased only 6 h after the last instillation, compared to controls.

  17. DNA sequencing by synthesis using 3′-O-azidomethyl nucleotide reversible terminators and surface-enhanced Raman spectroscopic detection

    PubMed Central

    Palla, Mirkó; Guo, Wenjing; Shi, Shundi; Li, Zengmin; Wu, Jian; Jockusch, Steffen; Guo, Cheng; Russo, James J.; Turro, Nicholas J.; Ju, Jingyue

    2014-01-01

    As an alternative to fluorescence-based DNA sequencing by synthesis (SBS), we report here an approach using an azido moiety (N3) that has an intense, narrow and unique Raman shift at 2125 cm−1, where virtually all biological molecules are transparent, as a label for SBS. We first demonstrated that the four 3′-O-azidomethyl nucleotide reversible terminators (3′-O-azidomethyl-dNTPs) displayed surface enhanced Raman scattering (SERS) at 2125 cm−1. Using these 4 nucleotide analogues as substrates, we then performed a complete 4-step SBS reaction. We used SERS to monitor the appearance of the azide-specific Raman peak at 2125 cm−1 as a result of polymerase extension by a single 3′-O-azidomethyl-dNTP into the growing DNA strand and disappearance of this Raman peak with cleavage of the azido label to permit the next nucleotide incorporation, thereby continuously determining the DNA sequence. Due to the small size of the azido label, the 3′-O-azidomethyl-dNTPs are efficient substrates for the DNA polymerase. In the SBS cycles, the natural nucleotides are restored after each incorporation and cleavage, producing a growing DNA strand that bears no modifications and will not impede further polymerase reactions. Thus, with further improvements in SERS for the azido moiety, this approach has the potential to provide an attractive alternative to fluorescence-based SBS. PMID:25396047

  18. Excision of ultraviolet damage and the effect of irradiation on DNA synthesis in a strain of Bloom's syndrome fibroblasts

    SciTech Connect

    Henson, P.; Selsky, C.A.; Little, J.B.

    1981-03-01

    Researchers have studied repair of ultraviolet light-induced damage in a strain of Bloom's syndrome cells which we have shown to be defective in host cell reactivation of uv-irradiated herpes simplex virus. Excision repair was monitored by following loss of sensitivity of DNA in permeabilized cells to digestion by the Micrococcus luteus uv endonuclease preparation. The Bloom's syndrome fibroblasts apparently removed endonuclease-sensitive sites from the DNA slightly less efficiently than did normal strains. After 24 h, 38% of the sites remained in the Bloom's syndrome cells in comparison with 16% in normal fibroblasts. DNA newly synthesized in uv-irradiated Bloom's syndrome cells sedimented less far into alkaline sucrose gradients than did DNA from similarly treated normal cells. In other respects, including the effect of caffeine exposure, DNA synthesis in Bloom's syndrome cells was indistinguishable from that in normal cells. We were therefore able to detect only minor defects in the repair of uv-induced damage in Bloom's syndrome fibroblasts. This is consistent with the normal survival exhibited by these cells. The defect in excision repair may, however, be sufficient to allow the cellular repair capacity to become saturated at high infecting multiplicities of uv-irradiated herpes simplex virus.

  19. Macrophages do not inhibit the participation of the nuclei of nonmalignant proliferating cells in DNA synthesis in heterokaryons

    SciTech Connect

    Egorov, E.E.; Prudovskii, I.A.; Zelenin, A.V.

    1985-07-01

    The authors continue their investigations into types of heterokaryons in an effort to detect an inhibition of nondividing macrophages (differentiated cells) on the entry of the nuclei of proliferating cells into replication. For the experiments described in this paper, the authors used asynchronous cultures of mouse diploid fibroblasts (MDF), 3T3 mouse cells from continuous culture, and malignant SV3T3 cells (3T3 cells transformed by SV40). Fusion of the cells of the cultures with macrophages was performed using PEG at various periods after deposition (2, 8, 12, and 20 h). The authors used double isotope marking to identify DNA synthesis in the heterokaryons. For this purpose, the nuclei of the culture cells were labeled with (/sup 3/H)thymidine before fusion with macrophages. All the nuclei of the culture cells intensively incorporated the label. After fusion, (/sup 14/C)thymidine was introduced into the incubation medium. If the cell nucleus began to synthesize DNA, it incorporated (/sup 14/C)thymidine, and a supplementary relatively weak label appeared on the auto-radiographic preparations, both above the nuclei themselves and next to them. The nuclei of macrophages in which DNA synthesis was reactivated contained only the (/sup 14/C)label. Fixation was performed 26 h after stimulation (in the case of 3T3) or 35 h after stimulation (for MDF). The percentages of nuclei of culture cells labeled with (/sup 14/C)thymidine were determined in the heterokaryons and free-lying cells.

  20. A model of binding on DNA microarrays: understanding the combined effect of probe synthesis failure, cross-hybridization, DNA fragmentation and other experimental details of affymetrix arrays

    PubMed Central

    2012-01-01

    Background DNA microarrays are used both for research and for diagnostics. In research, Affymetrix arrays are commonly used for genome wide association studies, resequencing, and for gene expression analysis. These arrays provide large amounts of data. This data is analyzed using statistical methods that quite often discard a large portion of the information. Most of the information that is lost comes from probes that systematically fail across chips and from batch effects. The aim of this study was to develop a comprehensive model for hybridization that predicts probe intensities for Affymetrix arrays and that could provide a basis for improved microarray analysis and probe development. The first part of the model calculates probe binding affinities to all the possible targets in the hybridization solution using the Langmuir isotherm. In the second part of the model we integrate details that are specific to each experiment and contribute to the differences between hybridization in solution and on the microarray. These details include fragmentation, wash stringency, temperature, salt concentration, and scanner settings. Furthermore, the model fits probe synthesis efficiency and target concentration parameters directly to the data. All the parameters used in the model have a well-established physical origin. Results For the 302 chips that were analyzed the mean correlation between expected and observed probe intensities was 0.701 with a range of 0.88 to 0.55. All available chips were included in the analysis regardless of the data quality. Our results show that batch effects arise from differences in probe synthesis, scanner settings, wash strength, and target fragmentation. We also show that probe synthesis efficiencies for different nucleotides are not uniform. Conclusions To date this is the most complete model for binding on microarrays. This is the first model that includes both probe synthesis efficiency and hybridization kinetics/cross-hybridization. These

  1. Models and strategies for value clarification in population education.

    PubMed

    Villanueva, C L

    1976-01-01

    Teachers, principals, supervisiors, superintendents, policymakers, and researchers all agree that value clarification is the most effective method for teaching value-laden population issues. It has been recognized that cultural attitudes and beliefs that are negative to family planning block acceptance of the population program. Education can become an effective vehicle in raising the level of awareness and acceptance of population practices. Teachers and students must 1st critically examine a set of alternative population values, for then they can weigh the pros and cons in order to arrive at value decisions regarding fertility behavior. Discussion and recommendations for practice and policy are presented for 9 problem areas: defining value clarification, affective versus cognitive process, teacher participation, open-ended versus closed-ended approach, use of resources and devices, target group, teacher personality, selecting appropriate issues, and dealing with controversial subjects. PMID:12336126

  2. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  3. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    PubMed

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  4. TWINKLE is an essential mitochondrial helicase required for synthesis of nascent D-loop strands and complete mtDNA replication

    PubMed Central

    Milenkovic, Dusanka; Matic, Stanka; Kühl, Inge; Ruzzenente, Benedetta; Freyer, Christoph; Jemt, Elisabeth; Park, Chan Bae; Falkenberg, Maria; Larsson, Nils-Göran

    2013-01-01

    Replication of the mammalian mitochondrial DNA (mtDNA) is dependent on the minimal replisome, consisting of the heterotrimeric mtDNA polymerase (POLG), the hexameric DNA helicase TWINKLE and the tetrameric single-stranded DNA-binding protein (mtSSB). TWINKLE has been shown to unwind DNA during the replication process and many disease-causing mutations have been mapped to its gene. Patients carrying Twinkle mutations develop multiple deletions of mtDNA, deficient respiratory chain function and neuromuscular symptoms. Despite its importance in human disease, it has been unclear whether TWINKLE is the only replicative DNA helicase in mammalian mitochondria. Furthermore, a substantial portion of mtDNA replication events is prematurely terminated at the end of mitochondrial control region (D-loop) and it is unknown whether TWINKLE also has a role in this abortive replication. Here, we present a conditional mouse knockout for Twinkle and demonstrate that TWINKLE is essential for mouse embryonic development and thus is the only replicative DNA helicase in mammalian mitochondria. Conditional knockout of Twinkle results in severe and rapid mtDNA depletion in heart and skeletal muscle. No replication intermediates or deleted mtDNA molecules are observed after Twinkle knockout, suggesting that TWINKLE once loaded is very processive. We also demonstrate that TWINKLE is essential for nascent H-strand synthesis in the D-loop, thus showing that there is no separate DNA helicase responsible for replication of this region. Our data thus suggest that the relative levels of abortive D-loop synthesis versus complete mtDNA replication are regulated and may provide a mechanism to control progression to complete mtDNA replication. PMID:23393161

  5. High-rate stormwater clarification with polymeric flocculant addition.

    PubMed

    Wood, J; He, C; Rochfort, Q; Marsalek, J; Seto, P; Yang, M; Chessie, P; Kok, S

    2005-01-01

    Treatment of urban stormwater by clarification, with flocculant addition, was studied in Toronto, Canada using a pilot-scale clarifier with removable lamellar plates. Almost 90 stormwater runoff events were characterised at the study site and found fairly polluted. The previous research phase indicated good treatability of this stormwater by lamellar clarification with flocculant addition (total suspended solids, TSS, removal of 84%, at a surface load of 15 m/h), but there were concerns about cleaning plates after storm events. With the aid of numerical modelling, hydraulic improvements to the clarifier inlet zone were retrofitted in 2004 and permitted the removal of the lamellar pack without a loss in treatment efficiency. In the modified clarifier, a cationic polymeric flocculant dosage of 4 mg/L with conventional clarification provided a TSS removal of 77%, at surface loads up to 43 m/h. The use of the polymer did not increase the acute toxicity of the treated effluent. The clarifier sludge was severely polluted by several heavy metals and would require special disposal. The treatment process tested could be well applied in projects requiring intensive stormwater treatment at compact sites. PMID:15790231

  6. Evaluation of predictive tools for cell culture clarification performance.

    PubMed

    Senczuk, Anna; Petty, Krista; Thomas, Anne; McNerney, Thomas; Moscariello, John; Yigzaw, Yinges

    2016-03-01

    Recent advances in the productivity of industrial mammalian cell culture processes have resulted in part in increased cell density. This increase and the associated increase in cellular debris are known to challenge harvest operations, however this understanding is limited and largely qualitative. Part of the issue arises from the heterogeneous size and composition of cellular debris, which makes harvest feed stream extremely difficult to characterize. Improved characterization methods would facilitate the development of clarification approaches that are consistent and scalable. This work describes how both particle size and cholesterol analysis can be used to characterize the feed stream. Particle size analysis by focused beam reflectance and dynamic light scattering are shown to be predictive of centrate filterability under certain harvest conditions. Because of the particle size range limitations of each detector, their applicability is limited to a particular stage or method of clarification. The measurement of cholesterol present in the cell culture supernatant or centrate was successfully used in providing relative amount of lysed cellular debris and enabled us to predict clarification performance of acid precipitated harvest regardless of particle size distribution profile. PMID:26332572

  7. Complementation of defective translesion synthesis and UV light sensitivity in xeroderma pigmentosum variant cells by human and mouse DNA polymerase eta.

    PubMed

    Yamada, A; Masutani, C; Iwai, S; Hanaoka, F

    2000-07-01

    Defects in the human gene XPV result in the variant form of the genetic disease xeroderma pigmentosum (XP-V). XPV encodes DNA polymerase eta, a novel DNA polymerase that belongs to the UmuC/DinB/Rad30 superfamily. This polymerase catalyzes the efficient and accurate translesion synthesis of DNA past cis-syn cyclobutane di-thymine lesions. In this report we present the cDNA sequence and expression profiles of the mouse XPV gene and demonstrate its ability to complement defective DNA synthesis in XP-V cells. The mouse XPV protein shares 80.3% amino acid identity and 86.9% similarity with the human XPV protein. The recombinant mouse XPV protein corrected the inability of XP-V cell extracts to carry out DNA replication, by bypassing thymine dimers on template DNA. Transfection of the mouse or human XPV cDNA into human XP-V cells corrected UV sensitivity. Northern blot analysis revealed that the mouse XPV gene is expressed ubiquitously, but at a higher level in testis, liver, skin and thymus compared to other tissues. Although the mouse XPV gene was not induced by UV irradiation, its expression was elevated approximately 4-fold during cell proliferation. These results suggest that DNA polymerase eta plays a role in DNA replication, though the enzyme is not essential for viability. PMID:10871396

  8. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  9. Cucurbitacin I blocks cerebrospinal fluid and platelet derived growth factor-BB stimulation of leptomeningeal and meningioma DNA synthesis

    PubMed Central

    2013-01-01

    Background Currently, there are no consistently effective chemotherapies for recurrent and inoperable meningiomas. Recently, cucurbitacin I (JSI-124), a naturally occurring tetracyclic triterpenoid compound used as folk medicines has been found to have cytoxic and anti-proliferative properties in several malignancies thru inhibition of activator of transcription (STAT3) activation. Previously, we have found STAT3 to be activated in meningiomas, particularly higher grade tumors. Methods Primary leptomeningeal cultures were established from 17, 20 and 22 week human fetuses and meningioma cell cultures were established from 6 World Health Organization (WHO) grade I or II meningiomas. Cells were treated with cerebrospinal fluid from patients without neurologic disease. The effects of cucurbitacin I on cerebrospinal fluid stimulation of meningioma cell DNA synthesis phosphorylation/activation of JAK1, STAT3, pMEK1/2, p44/42MAPK, Akt, mTOR, Rb and caspase 3 activation were analyzed in human leptomeningeal and meningioma cells. Results Cerebrospinal fluid significantly stimulated DNA synthesis in leptomeningeal cells. Co-administration of cucurbitacin I (250 nM) produces a significant blockade of this effect. Cucurbitacin I alone also produced a significant reduction in basal DNA synthesis. In grade I and II meningiomas, cerebrospinal fluid also significantly stimulated DNA synthesis. Co-administration of cucurbitacin I (250 nM) blocked this effect. In the leptomeningeal cultures, cerebrospinal fluid stimulated STAT3 phosphorylation but not p44/42MAPK, Akt or mTOR. Cucurbitacin I had no effect on basal STAT3 phosphorylation but co-administration with cerebrospinal fluid blocked cerebrospinal fluid stimulation of STAT3 phosphorylation in each. In the grade I meningiomas, cerebrospinal fluid stimulated phosphorylation of STAT3 and decreased MEK1/2 and cucurbitacin I had no effect on basal STAT3, p44/42MAPK, Akt, JAK1, mTOR, or Rb phosphorylation. In the grade II

  10. Induction of maturation of human B-cell lymphomas in vitro. Morphologic changes in relation to immunoglobulin and DNA synthesis.

    PubMed Central

    Beiske, K.; Ruud, E.; Drack, A.; Marton, P. F.; Godal, T.

    1984-01-01

    In vitro stimulation of cells from 8 non-Hodgkin's lymphomas comprising several histologic types with a tumor promotor (TPA) and with or without anti-immunoglobulins directed against the surface immunoglobulin of the tumor cells is reported. Morphologic transformation to immunoblastic and plasmablastic cells, but not to plasma cells, and induction of Ig and DNA synthesis were observed. A comparative analysis, including flow cytofluorometry, light microscopy combined with immunocytochemistry, and electron microscopy, suggests that the three events may not always be associated phenomena at the single-cell level even in monoclonal cell populations. Images Figure 1 Figure 3 Figure 4 Figure 5 Figure 6 PMID:6375389

  11. Sequence identity of the terminal redundancies on the minus-strand DNA template is necessary but not sufficient for the template switch during hepadnavirus plus-strand DNA synthesis.

    PubMed Central

    Loeb, D D; Gulya, K J; Tian, R

    1997-01-01

    The template for hepadnavirus plus-strand DNA synthesis is a terminally redundant minus-strand DNA. An intramolecular template switch during plus-strand DNA synthesis, which permits plus-strand DNA elongation, has been proposed to be facilitated by this terminal redundancy, which is 7 to 9 nucleotides long. The aim of this study was to determine whether the presence of identical copies of the redundancy on the minus-strand DNA template was necessary and/or sufficient for the template switch and at what position(s) within the redundancy the switch occurs for duck hepatitis B virus. When dinucleotide insertions were placed within the copy of the redundancy at the 3' end of the minus-strand DNA template, novel sequences were copied into plus-strand DNA. The generation of these novel sequences could be explained by complete copying of the redundancy at the 5' end of the minus-strand DNA template followed by a template switch and then extension from a mismatched 3' terminus. In a second set of experiments, it was found that when one copy of the redundancy had either three or five nucleotides replaced the template switch was inhibited. When the identical, albeit mutant, sequences were restored in both copies of the redundancy, template switching was not necessarily restored. Our results indicate that the terminal redundancy on the minus-strand DNA template is necessary but not sufficient for template switching. PMID:8985334

  12. Photoinduced interactions of supramolecular ruthenium(II) complexes with plasmid DNA: synthesis and spectroscopic, electrochemical, and DNA photocleavage studies.

    PubMed

    Swavey, Shawn; DeBeer, Madeleine; Li, Kaiyu

    2015-04-01

    Two new bridging ligands have been synthesized by combining substituted benzaldehydes with phenanthrolinopyrrole (php), resulting in new polyazine bridging ligands. The ligands have been characterized by (1)H NMR, mass spectroscopy, and elemental analysis. These new ligands display π-π* transitions above 500 nm with modest molar absorptivities. Upon excitation at the ligand-centered charge-transfer transition, weak emission with a maximum wavelength of 612 nm is observed. When coordinated to two ruthenium(II) bis(bipyridyl) groups, the new bimetallic complexes generated give an overall 4+ charge. The electronic transitions of the bimetallic ruthenium(II) complexes display traditional π-π* transitions at 287 nm and metal-to-ligand charge-transfer transitions at 452 nm with molar absorptivities greater than 30000 M(-1) cm(-1). Oxidation of the ruthenium(II) metal centers to ruthenium(III) occurs at potentials above 1.4 V versus the Ag/AgCl reference electrode. Spectroscopic and electrochemical measurements indicate that the ruthenium(II) moieties behave independently. Both complexes are water-soluble and show the ability to photonick plasmid DNA when irradiated with low-energy light above 550 nm. In addition, one of the complexes, [Ru(bpy)2php]2Van(4+), shows the ability to linearize plasmid DNA and gives evidence, by gel electrophoresis, of photoinduced binding to plasmid DNA. PMID:25798576

  13. A new synthesis in epigenetics: towards a unified function of DNA methylation from invertebrates to vertebrates.

    PubMed

    Mandrioli, M

    2007-10-01

    DNA methylation is generally limited to CpG doublets located at the gene promoter with an involvement in gene silencing. Surprisingly, two recent papers showed an extensive methylation affecting coding portions of transcriptionally active genes in human and plants prompting a rethink of DNA methylation in eukaryotes. Actually, gene body methylation is not surprising since it has been repeatedly reported in invertebrates, where it interferes with transcriptional elongation preventing aberrant transcription initiations. As a whole, the published data suggest that the most ancestral function of DNA methylation is the control of genes that are susceptible to transcriptional interference and not to gene silencing. The recruitment of DNA methylation for silencing represents a successive tinkered use. In view of this additional function, the invertebrate-vertebrate transition has been accompanied by new constraints on DNA methylation that resulted in the strong conservation of the DNA methylation machinery in vertebrates and in the non-viability of mutants lacking DNA methylation. PMID:17712527

  14. Synthesis of linear and cyclic peptide-PEG-lipids for stabilization and targeting of cationic liposome-DNA complexes.

    PubMed

    Ewert, Kai K; Kotamraju, Venkata Ramana; Majzoub, Ramsey N; Steffes, Victoria M; Wonder, Emily A; Teesalu, Tambet; Ruoslahti, Erkki; Safinya, Cyrus R

    2016-03-15

    Because nucleic acids (NAs) have immense potential value as therapeutics, the development of safe and effective synthetic NA vectors continues to attract much attention. In vivo applications of NA vectors require stabilized, nanometer-scale particles, but the commonly used approaches of steric stabilization with a polymer coat (e.g., PEGylation; PEG=poly(ethylene glycol)) interfere with attachment to cells, uptake, and endosomal escape. Conjugation of peptides to PEG-lipids can improve cell attachment and uptake for cationic liposome-DNA (CL-DNA) complexes. We present several synthetic approaches to peptide-PEG-lipids and discuss their merits and drawbacks. A lipid-PEG-amine building block served as the common key intermediate in all synthetic routes. Assembling the entire peptide-PEG-lipid by manual solid phase peptide synthesis (employing a lipid-PEG-carboxylic acid) allowed gram-scale synthesis but is mostly applicable to linear peptides connected via their N-terminus. Conjugation via thiol-maleimide or strain-promoted (copper-free) azide-alkyne cycloaddition chemistry is highly amenable to on-demand preparation of peptide-PEG-lipids, and the appropriate PEG-lipid precursors are available in a single chemical step from the lipid-PEG-amine building block. Azide-alkyne cycloaddition is especially suitable for disulfide-bridged peptides such as iRGD (cyclic CRGDKGPDC). Added at 10 mol% of a cationic/neutral lipid mixture, the peptide-PEG-lipids stabilize the size of CL-DNA complexes. They also affect cell attachment and uptake of nanoparticles in a peptide-dependent manner, thereby providing a platform for preparing stabilized, affinity-targeted CL-DNA nanoparticles. PMID:26874401

  15. Validity of the tritiated thymidine method for estimating bacterial growth rates: measurement of isotope dilution during DNA synthesis

    SciTech Connect

    Pollard, P.C.; Moriarty, D.J.W.

    1984-12-01

    The rate of tritiated thymidine incorporation into DNA was used to estimate bacterial growth rates in aquatic environments. To be accurate, the calculation of growth rates has to include a factor for the dilution of isotope before incorporation. The validity of an isotope dilution analysis to determine this factor was verified in experiments reported here with cultures of a marine bacterium growing in a chemostat. Growth rates calculated from data on chemostat dilution rates and cell density agreed well with rates calculated by tritiated thymidine incorporation into DNA and isotope dilution analysis. With sufficiently high concentrations of exogenous thymidine, de novo synthesis of deoxythymidine monophosphate was inhibited, thereby preventing the endogenous dilution of isoope. The thymidine technique was also shown to be useful for measuring growth rates of mixed suspensions of bacteria growing anaerobically. Thymidine was incorporated into the DNA of a range of marine pseudomonads that were investigated. Three species did not take up thymidine. The common marine cyanobacterium Synechococcus species did not incorporate thymidine into DNA.

  16. DNA-templated microwave-hydrothermal synthesis of nanostructured hydroxyapatite for storing and sustained release of an antibacterial protein.

    PubMed

    Chen, Xi; Yang, Bin; Qi, Chao; Sun, Tuan-Wei; Chen, Feng; Wu, Jin; Feng, Xi-Ping; Zhu, Ying-Jie

    2016-01-28

    Hydroxyapatite (HA) is promising in various biomedical applications owing to its similar chemical composition, structure and properties to the inorganic component in natural hard tissues. Herein, we report a DNA-templated microwave-assisted hydrothermal strategy for the preparation of HA nanostructured materials. As a kind of natural biomacromolecule, DNA molecules open up a new way to the synthesis of HA nanostructured materials with well-defined structures and morphologies. The HA nanostructured materials with a nanosheet-assembled hierarchical structure and a HA nanorod ordered structure are successfully prepared. The important roles of DNA molecules and pH values in the formation of HA nanostructured materials are investigated, and a possible formation mechanism is proposed. The as-prepared HA nanostructured materials exhibit a relatively high adsorption ability for chicken immunoglobulin Y (IgY) protein and a sustained protein release behavior. The as-prepared HA nanostructured materials after loading the IgY protein show a high antimicrobial activity. Thus, the HA nanostructured materials prepared by the DNA-templated microwave hydrothermal method are promising for the applications in various areas such as the prevention and treatment of dental caries. PMID:26696032

  17. Synthesis of amino-rich silica-coated magnetic nanoparticles for the efficient capture of DNA for PCR.

    PubMed

    Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming

    2016-09-01

    Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR. PMID:27187190

  18. Synthesis, antiproliferative activity and DNA binding properties of novel 5-aminobenzimidazo[1,2-a]quinoline-6-carbonitriles.

    PubMed

    Perin, Nataša; Nhili, Raja; Ester, Katja; Laine, William; Karminski-Zamola, Grace; Kralj, Marijeta; David-Cordonnier, Marie-Hélène; Hranjec, Marijana

    2014-06-10

    The synthesis of 5-amino substituted benzimidazo[1,2-a]quinolines prepared by microwave assisted amination from halogeno substituted precursor was described. The majority of compounds were active at micromolar concentrations against colon, lung and breast carcinoma cell lines in vitro. The N,N-dimethylaminopropyl 9 and piperazinyl substituted derivative 19 showed the most pronounced activity towards all of the three tested tumor cell lines, which could be correlated to the presence of another N heteroatom and its potential interactions with biological targets. The DNA binding studies, consisting of UV/Visible absorbency, melting temperature studies, and fluorescence and circular dichroism titrations, revealed that compounds 9, 19 and 20 bind to DNA as strong intercalators. The cellular distribution analysis, based on compounds' intrinsic fluorescence, showed that compound 20 does not enter the cell, while compounds 9 and 19 do, which is in agreement with their cytotoxic effects. Compound 9 efficiently targets the nucleus whereas 19, which also showed DNA intercalating properties in vitro, was mostly localised in the cytoplasm suggesting that the antitumor mechanism of action is DNA-independent. PMID:24780599

  19. SYNTHESIS OF THE FULLY PROTECTED PHOSPHORAMIDITE OF THE BENZENE-DNA ADDUCT, N2- (4-HYDROXYPHENYL)-2'-DEOXYGUANOSINE AND INCORPORATION OF THE LATER INTO DNA OLIGOMERS

    SciTech Connect

    Chenna, Ahmed; Gupta, Ramesh C.; Bonala, Radha R.; Johnson, Francis; Huang, Bo

    2008-06-09

    N2-(4-Hydroxyphenyl)-2'-deoxyguanosine-5'-O-DMT-3'-phosphoramidite has been synthesized and used to incorporate the N2-(4-hydroxyphenyl)-2'-dG (N2-4-HOPh-dG) into DNA, using solid-state synthesis technology. The key step to obtaining the xenonucleoside is a palladium (Xantphos-chelated) catalyzed N2-arylation (Buchwald-Hartwig reaction) of a fully protected 2'-deoxyguanosine derivative by 4-isobutyryloxybromobenzene. The reaction proceeded in good yield and the adduct was converted to the required 5'-O-DMT-3'-O-phosphoramidite by standard methods. The latter was used to synthesize oligodeoxynucleotides in which the N2-4-HOPh-dG adduct was incorporated site-specifically. The oligomers were purified by reverse-phase HPLC. Enzymatic hydrolysis and HPLC analysis confirmed the presence of this adduct in the oligomers.

  20. Synthesis and in vitro characterization of antigen-conjugated polysaccharide as a CpG DNA carrier.

    PubMed

    Shimada, Naohiko; Ishii, Ken J; Takeda, Yoichi; Coban, Cevayir; Torii, Yuichi; Shinkai, Seiji; Akira, Shizuo; Sakurai, Kazuo

    2006-01-01

    Oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNAs) are known as an immune adjuvant. CpG DNAs coupled with a particular antigen enabling both CpG DNA and antigen delivery to the same antigen-presenting cell have been shown to be more effective. Based on our previous finding that beta-(1-->3)-D-glucan schizophyllan (SPG) can be used as a CpG DNA carrier, here we present the synthesis of an antigen-conjugated SPG and the characterization of the conjugate. Ovalbumin (OVA, 43 kDa) was used as a model antigen, and two OVA were conjugated to one SPG molecule (M(w) = 150,000), denoted by OVA-SPG. Circular dichroism and gel electrophoresis showed that OVA-SPG could form a complex with a (dA)(40)-tailed CpG DNA at the 3' end (1,668-(dA)(40)). When OVA-SPG was added to macrophages (J774.A1), the amount of the ingested OVA-SPG was increased compared with that of OVA itself, suggesting that Dectin-1 (proinflammatory nonopsonic receptor for beta-glucans) is involved to ingest OVA-SPG. Furthermore, the complex of the conjugate and DNA was co-localized in the same vesicles, implying that OVA (antigen) and CpG DNA (adjuvant) were ingested into the cell at the same time. This paper shows that OVA-SPG can be used as a CpG DNA carrier to induce antigen-specific immune responses. PMID:16984120

  1. Amplified and multiplexed detection of DNA using the dendritic rolling circle amplified synthesis of DNAzyme reporter units.

    PubMed

    Wang, Fuan; Lu, Chun-Hua; Liu, Xiaoqing; Freage, Lina; Willner, Itamar

    2014-02-01

    The amplified, highly sensitive detection of DNA using the dendritic rolling circle amplification (RCA) is introduced. The analytical platform includes a circular DNA and a structurally tailored hairpin structure. The circular nucleic acid template includes a recognition sequence for the analyte DNA (the Tay-Sachs mutant gene), a complementary sequence to the Mg(2+)-dependent DNAzyme, and a sequence identical to the loop region of the coadded hairpin structure. The functional hairpin in the system consists of the analyte-sequence that is caged in the stem region and a single-stranded loop domain that communicates with the RCA product. The analyte activates the RCA process, leading to DNA chains consisting of the Mg(2+)-dependent DNAzyme and sequences that are complementary to the loop of the functional hairpin structure. Opening of the coadded hairpin releases the caged analyte sequence, resulting in the dendritic RCA-induced synthesis of the Mg(2+)-dependent DNAzyme units. The DNAzyme-catalyzed cleavage of a fluorophore/quencher-modified substrate leads to a fluorescence readout signal. The method enabled the analysis of the target DNA with a detection limit corresponding to 1 aM. By the design of two different circular DNAs that include recognition sites for two different target genes, complementary sequences for two different Mg(2+)-dependent DNAzyme sequences and two different functional hairpin structures, the dendritic RCA-stimulated multiplexed analysis of two different genes is demonstrated. The amplified dendritic RCA detection of DNA is further implemented to yield the hemin/G-quadruplex horseradish peroxidase (HRP)-mimicking DNAzyme as catalytic labels that provide colorimetric or chemiluminescent readout signals. PMID:24377284

  2. PATTERNS OF RNA SYNTHESIS IN T5-INFECTED CELLS I. AS STUDIED BY THE TECHNIQUE OF DNA-RNA HYBRIDIZATION-COMPETITION*

    PubMed Central

    Moyer, Richard W.; Buchanan, John M.

    1969-01-01

    The RNA-labeling patterns obtained after T5 infection of Escherichia coli F agree with the patterns of protein labeling published by McCorquodale and Buchanan.1 Three distinct classes of RNA formed sequentially during the period of viral development can be recognized by the DNA-RNA hybridization-competition technique. Class I RNA is formed within 5 minutes after the beginning of viral metabolism and corresponds to the RNA synthesized in response to infection with the 8 per cent segment of T5 DNA. Protein synthesis directed by this 8 per cent segment is required in some capacity for the cessation of class I synthesis and the beginning of the synthesis of class II at 4 to 5 min after infection. Class III RNA synthesis begins between 9 and 12 minutes. Its appearance is prevented when chloramphenicol is added immediately after complete expression of class I functions. PMID:4916923

  3. Induction of human beta-interferon synthesis with poly(rI . rC) in mouse cells transfected with cloned cDNA plasmids.

    PubMed Central

    Pitha, P M; Ciufo, D M; Kellum, M; Raj, N B; Reyes, G R; Hayward, G S

    1982-01-01

    Human genomic DNA and plasmids carrying portions of the cDNA gene for human beta-interferon have been introduced into mouse Ltk- cells by cotransfection with a herpes simplex virus thymidine kinase (TK) gene. One plasmid contains 840 base pairs of human DNA complementary to pre-beta-interferon mRNA inserted into pBR322, whereas the other plasmids have hybrid genes containing only the 560-base pair coding region inserted under the transcriptional control of the TK promoter. Constitutive interferon production could not be detected in any of the mouse TK+ cell lines tested. Nevertheless, synthesis of interferon could be induced by poly(rI . rC) treatment in at least 16 of these cell lines, including clones transfected with genomic DNA, the beta-interferon cDNA, and the TK-beta-interferon cDNA hybrid gene. The interferon produced was specific for human cells and could be neutralized by antiserum against human beta-interferon. In contrast to human fibroblast cells, in which the synthesis of induced beta-interferon is transient, the poly(rI . rC)-induced TK+ lines continued to produce beta-interferon for prolonged periods of time and did not respond to superinduction conditions. Therefore, in transfected mouse cells, the coding DNA sequence from the human beta-interferon gene, without any of the adjacent 3' or 5' flanking human DNA sequences, was sufficient both to direct synthesis of biologically active product and to respond to the specific induction system that operates in human cells. However, the mechanism that switches off the synthesis of induced interferon in human cells appears not to operate in mouse cells transfected with beta-interferon cDNA. PMID:6956863

  4. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  5. Mitochondrial transcription terminator family members mTTF and mTerf5 have opposing roles in coordination of mtDNA synthesis.

    PubMed

    Jõers, Priit; Lewis, Samantha C; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J; Jacobs, Howard T

    2013-01-01

    All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis. PMID:24068965

  6. DNA synthesis and microtubule assembly-related events in fertilized Paracentrotus lividus eggs: reversible inhibition by 10 mM procaine.

    PubMed

    Raymond, M N; Foucault, G; Coffe, G; Pudles, J

    1986-04-01

    This report describes the effects of 10 mM procaine on microtubule assembly and on DNA synthesis, as followed by [3H]colchicine binding assays and [3H]thymidine incorporation respectively, in fertilized Paracentrotus lividus eggs. In the absence of microtubule assembly inhibitors, about 25% of the total egg tubulin is submitted to two cycles of polymerization prior to the first cell division, this polymerization process precedes DNA synthesis. If the zygotes are treated with 10 mM procaine in the course of the cell cycle, tubulin polymerization is inhibited or microtubules are disassembled. DNA synthesis is inhibited when procaine treatment is performed 10 min, before the initiation of the S-period. However, when the drug is applied in the course of this synthetic period, the process is normally accomplished, but the next S-period becomes inhibited. Moreover, procaine treatment increases the cytoplasmic pH of the fertilized eggs by about 0.6 to 0.8 pH units. This pH increase precedes microtubule disassembly and inhibition of DNA synthesis. Washing out the drug induces a decrease of the intracellular pH which returns to about the same value as that of the fertilized egg controls. This pH change is then followed by the reinitiation of microtubule assembly, DNA synthesis and cell division. Our results show that the inhibition of both tubulin polymerization and DNA synthesis in fertilized eggs treated with 10 mM procaine, appears to be related to the drug-induced increase in cytoplasmic pH. PMID:3709552

  7. Novel Organotin(IV)-Schiff Base Complexes: Synthesis, Characterization, Antimicrobial Activity, and DNA Interaction Studies

    PubMed Central

    Prasad, K. Shiva; Kumar, L. Shiva; Prasad, Melvin; Revanasiddappa, Hosakere D.

    2010-01-01

    Four organotin(IV) complexes with 2-(2-hydroxybenzylideneamino)isoindoline-1,3-dione (L1), and 4-(4-hydroxy-3-methoxybenzylideneamino-N-(pyrimidin-2-yl)benzenesulfonamide (L2) were synthesized and well characterized by analytical and spectral studies. The synthesized compounds were tested for antimicrobial activity by disc diffusion method. The DNA binding of the complexes 1 and 3 with CT-DNA has been performed with absorption spectroscopy, which showed that both the complexes are avid binders of CT-DNA. Also the nuclease activity of complexes 1 and 3 with plasmid DNA (pUC19) was studied using agarose gel electrophoresis. The complex 1 can act as effective DNA cleaving agent when compared to complex 3 resulting in the nicked form of DNA under physiological conditions. The gel was run both in the absence and presence of the oxidizing agent. PMID:21253533

  8. A Novel Styryldehydropyridocolinium Homodimer: Synthesis and Fluorescence Properties Upon Interaction with DNA.

    PubMed

    Yao, Huirong; Chang, Lifang; Liu, Chang; Jiao, Xiaojie; He, Song; Liu, Haijun; Zeng, Xianshun

    2015-11-01

    A novel homodimer of the styryldehydropyridocolinium dye (TPTP) has been synthesized and characterized. Free TPTP exhibited low fluorescence quantum yield and large Stokes shift (over 160 nm) in water. However, it showed a significant fluorescence turn-on effect upon intercalation into DNA base pairs. Meanwhile, the fluorescence intensity of the intercalated structures formed by TPTP and DNA decreased quickly upon addition of deoxyribonuclease I, indicating that the dye can be used to monitor deoxyribonuclease I activity and DNA hydrolysis. Electrophoresis analysis revealed that the dye had intercalative binding to DNA and can potentially be used for DNA staining in electrophoresis. Thus, the innate nature of large Stokes shift and excellent fluorescence turn on effect upon interaction with DNA endue the dye with a wide range of applications. PMID:26384336

  9. Inhibition of human carcinoma cell growth and DNA synthesis by silibinin, an active constituent of milk thistle: comparison with silymarin.

    PubMed

    Bhatia, N; Zhao, J; Wolf, D M; Agarwal, R

    1999-12-01

    Several studies from our laboratory have shown the cancer chemopreventive and anti-carcinogenic effects of silymarin, a flavonoid antioxidant isolated from milk thistle, in long-term tumorigenesis models and in human prostate, breast and cervical carcinoma cells. Since silymarin is composed mainly of silibinin with small amounts of other stereoisomers of silibinin, in the present communication, studies were performed to assess whether the cancer preventive and anti-carcinogenic effects of silymarin are due to its major component silibinin. Treatment of different prostate, breast, and cervical human carcinoma cells with silibinin resulted in a highly significant inhibition of both cell growth and DNA synthesis in a time-dependent manner with large loss of cell viability only in case of cervical carcinoma cells. When compared with silymarin, these effects of silibinin were consistent and comparable in terms of cell growth and DNA synthesis inhibition, and loss of cell viability. Based on the comparable results of silibinin and silymarin, we suggest that the cancer chemopreventive and anti-carcinogenic effects of silymarin reported earlier are due to the main constituent silibinin. PMID:10660092

  10. Mitochondrial DNA, RNA and protein synthesis in normal, hypothyroid and mildly hyperthyroid rat liver during cold exposure.

    PubMed

    Goglia, F; Liverini, G; Lanni, A; Barletta, A

    1988-02-01

    We have examined in isolated liver mitochondria the effect of cold exposure on DNA, RNA and protein synthesis in normal, hypothyroid and mildly hyperthyroid rats. In normal rats DNA polymerase activity increased from the first day of cold exposure remaining high up to the fifteenth day. RNA polymerase and protein synthesis were stimulated from the fifth day of cold exposure, maintaining a high level up to the fifteenth day. These activities were related to serum triiodothyronine (T3) levels. Indeed propylthiouracil (PTU) administration to cold-exposed rats drastically depressed the above activities, whereas T3 administration to PTU-treated cold-exposed rats restored them to about the values prevalent in normal cold-exposed rats. The translation products analyzed by gel electrophoresis showed that different effects may be exerted by T3 depending on whether its circulating levels are physiologically or pharmacologically modified. These findings suggest that T3 may be involved in the regulation of the acclimation process by acting, presumably with a permissive role, on those activities which determine a modification of the mitochondrial morphometric features and an increase in mitochondria number and turnover. PMID:2451625

  11. ES936 stimulates DNA synthesis in HeLa cells independently on NAD(P)H:quinone oxidoreductase 1 inhibition, through a mechanism involving p38 MAPK.

    PubMed

    González-Aragón, David; Alcaín, Francisco J; Ariza, Julia; Jódar, Laura; Barbarroja, Nuria; López-Pedrera, Chary; Villalba, José M

    2010-07-30

    The indolequinone ES936 (5-methoxy-1,2-dimethyl-3-[(4-nitrophenol)methyl]-indole-4,7-dione) is a potent mechanism-based inhibitor of NAD(P)H:quinone oxidoreductase 1 (NQO1). Here, we report that ES936 significantly stimulated thymidine incorporation in sparse cultures of human adenocarcinoma HeLa cells, but was without effect in dense cultures. Stimulation of DNA synthesis was not related with a DNA repair response because an increase in thymidine incorporation was not observed in cells treated with 2,5 bis-[1-aziridyl]-1,4 benzoquinone, a well-established antitumor quinone that causes DNA damage. Conversely, it was related with an increase of cell growth. NQO1 inhibition was not involved in ES936 stimulation of DNA synthesis, because the same response was observed in cells where NQO1 expression had been knocked down by small interfering RNA. Stimulation of DNA synthesis was reverted by treatment with ambroxol, a SOD mimetic, and by pyruvate, an efficient peroxide scavenger, supporting the involvement of alterations in cellular redox state. Pharmacological inhibition of p38 with either SB203580 or PD169316 completely abolished ES936-stimulated DNA synthesis, indicating the requirement of p38 activity. This is the first report that demonstrates the existence of an ES936-sensitive system which is separate from NQO1, modulating the redox state and cell growth in HeLa cells through a p38-dependent mechanism. Our results show that the effect ES936 exerts on DNA synthesis may be either positive or negative depending on the cellular context and growth conditions. PMID:20433816

  12. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives.

    PubMed

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; da Silva, Lúcia Patrícia Bezerra Gomes; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Ruiz, Ana Lucia Tasca Gois; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a-h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 10(4) to 1.0 × 10(6) M(-1) and quenching constants from -0.2 × 10(4) to 2.18 × 10(4) M(-1) indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N- (4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  13. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    PubMed Central

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  14. Synthesis of a novel water-soluble zinc phthalocyanine and its CT DNA-damaging studies

    NASA Astrophysics Data System (ADS)

    Wang, Tianhui; Wang, Ao; Zhou, Lin; Lu, Shan; Jiang, Weiwei; Lin, Yun; Zhou, Jiahong; Wei, Shaohua

    2013-11-01

    A novel 3-(4-methoxybenzylamino) propanoic acid substituted water-soluble zinc phthalocyanine (CNPcZn) was synthesized. The interaction between CNPcZn with calf thymus DNA (CT DNA) was studied using spectroscopic methods. The studies indicated that CNPcZn has strong affinity to CT DNA, and furthermore, CNZnPc showed excellent photodamaging activity to CT DNA. Above results indicated that such CNPcZn has great potential to be used as an effective photosensitizer in the field of photodynamic therapy.

  15. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools. PMID:26494264

  16. Complex Multiple-Nucleotide Substitution Mutations Causing Human Inherited Disease Reveal Novel Insights into the Action of Translesion Synthesis DNA Polymerases.

    PubMed

    Chen, Jian-Min; Férec, Claude; Cooper, David N

    2015-11-01

    Translesion synthesis (TLS) DNA polymerases allow the bypass of unrepaired lesions during DNA replication. Based upon mutational signatures of a subtype of multiple-nucleotide substitution (MNS) mutations causing human inherited disease, we have recently postulated two properties of TLS DNA polymerases in DNA repair, namely, the generation of neo-microhomologies potentiating strand-misalignment, and additional microlesions within the templated inserts when recruited to stalled replication forks. To provide further support for this postulate, we analyzed the mutational signatures of a new and complex subtype of pathogenic MNS mutation. Several mutations containing long templated inserts (8-19 bp) that are highly informative with regard to their underlying mutational mechanisms, harbor imprints of TLS DNA polymerase action. Dissecting the mechanism underlying the generation of the 19-bp insert implicated repeated participation of TLS DNA polymerases in the conversion of a damaged base into a complex MNS lesion through a process of successive template switching and bypass repair. PMID:26172832

  17. The Effects of Magnesium Ions on the Enzymatic Synthesis of Ligand-Bearing Artificial DNA by Template-Independent Polymerase

    PubMed Central

    Takezawa, Yusuke; Kobayashi, Teruki; Shionoya, Mitsuhiko

    2016-01-01

    A metal-mediated base pair, composed of two ligand-bearing nucleotides and a bridging metal ion, is one of the most promising components for developing DNA-based functional molecules. We have recently reported an enzymatic method to synthesize hydroxypyridone (H)-type ligand-bearing artificial DNA strands. Terminal deoxynucleotidyl transferase (TdT), a template-independent DNA polymerase, was found to oligomerize H nucleotides to afford ligand-bearing DNAs, which were subsequently hybridized through copper-mediated base pairing (H–CuII–H). In this study, we investigated the effects of a metal cofactor, MgII ion, on the TdT-catalyzed polymerization of H nucleotides. At a high MgII concentration (10 mM), the reaction was halted after several H nucleotides were appended. In contrast, at lower MgII concentrations, H nucleotides were further appended to the H-tailed product to afford longer ligand-bearing DNA strands. An electrophoresis mobility shift assay revealed that the binding affinity of TdT to the H-tailed DNAs depends on the MgII concentration. In the presence of excess MgII ions, TdT did not bind to the H-tailed strands; thus, further elongation was impeded. This is possibly because the interaction with MgII ions caused folding of the H-tailed strands into unfavorable secondary structures. This finding provides an insight into the enzymatic synthesis of longer ligand-bearing DNA strands. PMID:27338351

  18. Boron Clusters as a Platform for New Materials: Synthesis of Functionalized o-Carborane (C2 B10 H12 ) Derivatives Incorporating DNA Fragments.

    PubMed

    Janczak, Slawomir; Olejniczak, Agnieszka; Balabańska, Sandra; Chmielewski, Marcin K; Lupu, Marius; Viñas, Clara; Lesnikowski, Zbigniew J

    2015-10-19

    A synthetic strategy for functionalization of the three vertices of o-carborane and the attachment of the obtained triped to the solid support was developed. Further functionalization of the triped with short DNA sequences by automated DNA synthesis was achieved. The proposed methodology is a first example of boron cluster chemistry on a solid support opening new perspectives in boron cluster functionalization. PMID:26346614

  19. Microtubule configurations and nuclear DNA synthesis during initiation of suspensor-bearing embryos from Brassica napus cv. Topas microspores.

    PubMed

    Dubas, Ewa; Custers, Jan; Kieft, Henk; Wędzony, Maria; van Lammeren, André A M

    2011-11-01

    In the new Brassica napus microspore culture system, wherein embryos with suspensors are formed, ab initio mimics zygotic embryogenesis. The system provides a powerful in vitro tool for studying the diverse developmental processes that take place during early stages of plant embryogenesis. Here, we studied in this new culture system both the temporal and spatial distribution of nuclear DNA synthesis places and the organization of the microtubular (MT) cytoskeleton, which were visualized with a refined whole mount immunolocalization technology and 3D confocal laser scanning microscopy. A 'mild' heat stress induced microspores to elongate, to rearrange their MT cytoskeleton and to re-enter the cell cycle and perform a predictable sequence of divisions. These events led to the formation of a filamentous suspensor-like structure, of which the distal tip cell gave rise to the embryo proper. Cells of the developing pro-embryo characterized endoplasmic (EMTs) and cortical microtubules (CMTs) in various configurations in the successive stages of the cell cycle. However, the most prominent changes in MT configurations and nuclear DNA replication concerned the first sporophytic division occurring within microspores and the apical cell of the pro-embryo. Microspore embryogenesis was preceded by pre-prophase band formation and DNA synthesis. The apical cell of the pro-embryo exhibited a random organization of CMTs and, in relation to this, isotropic expansion occurred, mimicking the development of the apical cell of the zygotic situation. Moreover, the apical cell entered the S phase shortly before it divided transversally at the stage that the suspensor was 3-8 celled. PMID:21779827

  20. 76 FR 54497 - Compliance Testing Program Administrative Clarification to National Institute of Justice Standard...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-01

    ... Justice Standard-0101.06, Ballistic Resistance of Body Armor AGENCY: National Institute of Justice... administrative clarification of NIJ Standard 0101.06, ``Ballistic Resistance Body Armor'' (hereinafter,...

  1. Synthesis of Sequence-Specific DNA-Protein Conjugates via a Reductive Amination Strategy

    PubMed Central

    Wickramaratne, Susith; Mukherjee, Shivam; Villalta, Peter W.; Schärer, Orlando D.; Tretyakova, Natalia

    2013-01-01

    DNA-protein cross-links (DPCs) are ubiquitous, structurally diverse DNA lesions formed upon exposure to bis-electrophiles, transition metals, UV light, and reactive oxygen species. Because of their super-bulky, helix distorting nature, DPCs interfere with DNA replication, transcription, and repair, potentially contributing to mutagenesis and carcinogenesis. However, the biological implications of DPC lesions have not been fully elucidated due to the difficulty of generating site-specific DNA substrates representative of DPC lesions formed in vivo. In the present study, a novel approach involving post-synthetic reductive amination has been developed to prepare a range of hydrolytically stable lesions structurally mimicking the DPCs produced between the N7 position of guanine in DNA and basic lysine or arginine side chains of proteins and peptides. PMID:23885807

  2. Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

    PubMed

    Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

    2016-10-01

    A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone. PMID:27139727

  3. Alteration of mitochondrial DNA and RNA level in human fibroblasts with impaired vitamin B12 coenzyme synthesis.

    PubMed

    Cantatore, P; Petruzzella, V; Nicoletti, C; Papadia, F; Fracasso, F; Rustin, P; Gadaleta, M N

    1998-08-01

    Alterations of mitochondrial (mt) nucleic acid metabolism in methylmalonic aciduria (MMA) were studied in two cell lines from skin fibroblasts of patients with mitochondrial (GM00595) or cytosolic (GM10011) defects in the biosynthesis pathways of cobalamin coenzymes. The mtDNA level increased two-fold in GM00595 cells, which carry a mt defect in the adenosylcobalamin synthesis, whereas no appreciable change was found in GM10011 cells. The content of the two rRNAs 16S and 12S mtRNAs, normalized for the mtDNA copy number, decreased by 70% and 50% in GM00595 and GM10011, respectively. The normalized content of ND1, ND2 and CO I mRNAs decreased in GM00595, but was unchanged in GM10011. Respiratory chain complex activities measured in these two cell lines were not different from control activities. These data suggest that the maintenance of the mt function is due to doubling of mtDNA and that this compensatory response takes place only in those cells in which the greater reduction of the level of rRNA might have brought the content of these transcripts below the threshold value for optimal expression of the mt genome. PMID:9720919

  4. Gas-phase synthesis of solid state DNA nanoparticles stabilized by l-leucine.

    PubMed

    Raula, Janne; Hanzlíková, Martina; Rahikkala, Antti; Hautala, Juho; Kauppinen, Esko I; Urtti, Arto; Yliperttula, Marjo

    2013-02-28

    Aerosol flow reactor is used to generate solid-state nanoparticles in a one-step process that is based on drying of aerosol droplets in continuous flow. We investigated the applicability of aerosol flow reactor method to prepare solid state DNA nanoparticles. Precursor solutions of plasmid DNA with or without complexing agent (polyethylenimine), coating material (l-leucine) and mannitol (bulking material) were dispersed to nanosized droplets and instantly dried in laminar heat flow. Particle morphology, integrity and stability were studied by scanning electron microscopy. The stability of DNA was studied by gel electrophoresis. Plasmid DNA as such degraded in the aerosol flow process. Complexing agent protected DNA from degradation and coating material enabled production of dispersed, non-aggregated, nanoparticles. The resulting nanoparticles were spherical and their mean diameter ranged from 65 to 125nm. The nanoparticles were structurally stable at room temperature and their DNA content was about 10%. We present herein the proof of principle for the production of dispersed solid state nanoparticles with relevant size and intact plasmid DNA. PMID:23352859

  5. The carbocyclic analog of 2'-deoxyguanosine induces a prolonged inhibition of duck hepatitis B virus DNA synthesis in primary hepatocyte cultures and in the liver.

    PubMed Central

    Fourel, I; Saputelli, J; Schaffer, P; Mason, W S

    1994-01-01

    The carbocyclic analog of 2'-deoxyguanosine (2'-CDG) is a strong inhibitor of hepatitis B virus (HBV) DNA synthesis in HepG2 cells (P.M. Price, R. Banerjee, and G. Acs, Proc. Natl. Acad. USA 86:8543-8544, 1989). We now report that 2'-CDG inhibited duck hepatitis B virus (DHBV) DNA synthesis in primary cultures of duck hepatocytes and in experimentally infected ducks. Like foscarnet (phosphonoformic acid [PFA]) and 2'-,3'-dideoxycytidine (ddC), 2'-CDG blocked viral DNA replication in primary hepatocyte cultures when present during an infection but failed to inhibit the DNA repair reaction that occurs during the initiation of infection to convert virion relaxed circular DNA to covalently closed circular DNA, the template for viral mRNA transcription. Moreover, as for PFA and ddC, viral RNA synthesis was detected when infection was initiated in the presence 2'-CDG. In another respect, however, 2'-CDG exhibited antiviral activity unlike that of ddC or PFA: a single 1-day treatment of hepatocytes with 2'-CDG blocked initiation of viral DNA synthesis for at least 8 days, irrespective of whether DHBV infection was carried out at the time of drug treatment or several days later. Furthermore, orally administered 2'-CDG was long-acting against DHBV in experimentally infected ducklings. Virus replication was delayed by up to 4 days in ducklings infected after administration of 2'-CDG. These observations of long-lasting efficacy in vitro and in vivo even after oral administration suggest that this inhibitor or a nucleoside with similar pharmacological properties may be ideal for reducing virus replication in patients with chronic HBV infection. Images PMID:8289335

  6. A magnetic tri-enzyme nanobiocatalyst for fruit juice clarification.

    PubMed

    Sojitra, Uttam V; Nadar, Shamraja S; Rathod, Virendra K

    2016-12-15

    The major complications in fruit juice quality improvement are the presence of polysaccharides components in the form of disrupted fruit cell wall and cell materials. Hence, breakdown of cellulose along with pectin and starch is important for the juice processing. In this context, magnetic tri-enzyme nanobiocatalyst was prepared by simultaneously co-immobilizing three enzymes; α-amylase, pectinase and cellulase onto amino-functionalized magnetic nanoparticle by 60mM glutaraldehyde concentration with 10h cross-linking time for one pot juice clarification. The prepared nanobiocatalyst was characterized by FT-IR, SEM and XRD. The thermal (50-70°C) and pH (3-6) stability studies indicated more than two folds increment in half-life and enhanced tolerance to lower pH. The immobilized enzymes retained up to 75% of residual activity even after eight consecutive cycles of reuse. Finally, the clarification of apple, grapes and pineapple juices using magnetic tri-enzyme showed 41%, 46% and 53% respective reduction in turbidity till 150min treatment. PMID:27451184

  7. Clarification process: Resolution of decision-problem conditions

    NASA Technical Reports Server (NTRS)

    Dieterly, D. L.

    1980-01-01

    A model of a general process which occurs in both decisionmaking and problem-solving tasks is presented. It is called the clarification model and is highly dependent on information flow. The model addresses the possible constraints of individual indifferences and experience in achieving success in resolving decision-problem conditions. As indicated, the application of the clarification process model is only necessary for certain classes of the basic decision-problem condition. With less complex decision problem conditions, certain phases of the model may be omitted. The model may be applied across a wide range of decision problem conditions. The model consists of two major components: (1) the five-phase prescriptive sequence (based on previous approaches to both concepts) and (2) the information manipulation function (which draws upon current ideas in the areas of information processing, computer programming, memory, and thinking). The two components are linked together to provide a structure that assists in understanding the process of resolving problems and making decisions.

  8. Process cost and facility considerations in the selection of primary cell culture clarification technology.

    PubMed

    Felo, Michael; Christensen, Brandon; Higgins, John

    2013-01-01

    The bioreactor volume delineating the selection of primary clarification technology is not always easily defined. Development of a commercial scale process for the manufacture of therapeutic proteins requires scale-up from a few liters to thousands of liters. While the separation techniques used for protein purification are largely conserved across scales, the separation techniques for primary cell culture clarification vary with scale. Process models were developed to compare monoclonal antibody production costs using two cell culture clarification technologies. One process model was created for cell culture clarification by disc stack centrifugation with depth filtration. A second process model was created for clarification by multi-stage depth filtration. Analyses were performed to examine the influence of bioreactor volume, product titer, depth filter capacity, and facility utilization on overall operating costs. At bioreactor volumes <1,000 L, clarification using multi-stage depth filtration offers cost savings compared to clarification using centrifugation. For bioreactor volumes >5,000 L, clarification using centrifugation followed by depth filtration offers significant cost savings. For bioreactor volumes of ∼ 2,000 L, clarification costs are similar between depth filtration and centrifugation. At this scale, factors including facility utilization, available capital, ease of process development, implementation timelines, and process performance characterization play an important role in clarification technology selection. In the case study presented, a multi-product facility selected multi-stage depth filtration for cell culture clarification at the 500 and 2,000 L scales of operation. Facility implementation timelines, process development activities, equipment commissioning and validation, scale-up effects, and process robustness are examined. PMID:23847160

  9. Fluorescent DNA Nanotags Featuring Covalently Attached Intercalating Dyes: Synthesis, Antibody Conjugation and Intracellular Imaging

    PubMed Central

    Stadler, Andrea L.; Santos, Junriz Delos; Stensrud, Elizabeth S.; Dembska, Anna; Silva, Gloria L.; Liu, Shengpeng; Shank, Nathaniel I.; Kunttas-Tatli, Ezgi; Sobers, Courtney J.; Gramlich, Philipp M. E.; Carell, Thomas; Peteanu, Linda A.; McCartney, Brooke M.; Armitage, Bruce A.

    2011-01-01

    We have synthesized fluorescent DNA duplexes featuring multiple thiazole orange (TO) intercalating dyes covalently attached to the DNA via a triazole linkage. The intercalating dyes stabilize the duplex against thermal denaturation and show bright fluorescence in the green. The emission color can be changed to orange or red by addition of energy-accepting Cy3 or Cy5 dyes attached covalently to the DNA duplex. The dye-modified DNA duplexes were then attached to a secondary antibody for intracellular fluorescence imaging of centrosomes in Drosophila embryos. Bright fluorescent foci were observed at the centrosomes in both the donor (TO) and acceptor (Cy5) channels, due to the fact that the energy transfer efficiency is moderate. Monitoring the Cy5 emission channel significantly minimized the background signal due to the large shift in emission wavelength allowed by energy transfer. PMID:21755981

  10. Cell division and subsequent radicle protrusion in tomato seeds are inhibited by osmotic stress but DNA synthesis and formation of microtubular cytoskeleton are not.

    PubMed

    de Castro, R D; van Lammeren, A A; Groot, S P; Bino, R J; Hilhorst, H W

    2000-02-01

    We studied cell cycle events in embryos of tomato (Lycopersicon esculentum Mill. cv Moneymaker) seeds during imbibition in water and during osmoconditioning ("priming") using both quantitative and cytological analysis of DNA synthesis and beta-tubulin accumulation. Most embryonic nuclei of dry, untreated control seeds were arrested in the G(1) phase of the cell cycle. This indicated the absence of DNA synthesis (the S-phase), as confirmed by the absence of bromodeoxyuridine incorporation. In addition, beta-tubulin was not detected on western blots and microtubules were not present. During imbibition in water, DNA synthesis was activated in the radicle tip and then spread toward the cotyledons, resulting in an increase in the number of nuclei in G(2). Concomitantly, beta-tubulin accumulated and was assembled into microtubular cytoskeleton networks. Both of these cell cycle events preceded cell expansion and division and subsequent growth of the radicle through the seed coat. The activation of DNA synthesis and the formation of microtubular cytoskeleton networks were also observed throughout the embryo when seeds were osmoconditioned. However, this pre-activation of the cell cycle appeared to become arrested in the G(2) phase since no mitosis was observed. The pre-activation of cell cycle events in osmoconditioned seeds appeared to be correlated with enhanced germination performance during re-imbibition in water. PMID:10677426

  11. DNA Synthesis during Endomitosis Is Stimulated by Insulin via the PI3K/Akt and TOR Signaling Pathways in the Silk Gland Cells of Bombyx mori

    PubMed Central

    Li, Yaofeng; Chen, Xiangyun; Tang, Xiaofang; Zhang, Chundong; Wang, La; Chen, Peng; Pan, Minhui; Lu, Cheng

    2015-01-01

    Silk gland cells undergo multiple endomitotic cell cycles during silkworm larval ontogeny. Our previous study demonstrated that feeding is required for continued endomitosis in the silk gland cells of silkworm larvae. Furthermore, the insulin signaling pathway is closely related to nutritional signals. To investigate whether the insulin signaling pathway is involved in endomitosis in silk gland cells, in this study, we initially analyzed the effects of bovine insulin on DNA synthesis in endomitotic silk gland cells using 5-bromo-2'-deoxyuridine (BrdU) labeling technology, and found that bovine insulin can stimulate DNA synthesis. Insulin signal transduction is mainly mediated via phosphoinositide 3-kinase (PI3K)/Akt, the target of rapamycin (TOR) and the extracellular signal-regulated kinase (ERK) pathways in vertebrates. We ascertained that these three pathways are involved in DNA synthesis in endomitotic silk gland cells using specific inhibitors against each pathway. Moreover, we investigated whether these three pathways are involved in insulin-stimulated DNA synthesis in endomitotic silk gland cells, and found that the PI3K/Akt and TOR pathways, but not the ERK pathway, are involved in this process. These results provide an important theoretical foundation for the further investigations of the mechanism underlying efficient endomitosis in silk gland cells. PMID:25794286

  12. DNA synthesis during endomitosis is stimulated by insulin via the PI3K/Akt and TOR signaling pathways in the silk gland cells of Bombyx mori.

    PubMed

    Li, Yaofeng; Chen, Xiangyun; Tang, Xiaofang; Zhang, Chundong; Wang, La; Chen, Peng; Pan, Minhui; Lu, Cheng

    2015-01-01

    Silk gland cells undergo multiple endomitotic cell cycles during silkworm larval ontogeny. Our previous study demonstrated that feeding is required for continued endomitosis in the silk gland cells of silkworm larvae. Furthermore, the insulin signaling pathway is closely related to nutritional signals. To investigate whether the insulin signaling pathway is involved in endomitosis in silk gland cells, in this study, we initially analyzed the effects of bovine insulin on DNA synthesis in endomitotic silk gland cells using 5-bromo-2'-deoxyuridine (BrdU) labeling technology, and found that bovine insulin can stimulate DNA synthesis. Insulin signal transduction is mainly mediated via phosphoinositide 3-kinase (PI3K)/Akt, the target of rapamycin (TOR) and the extracellular signal-regulated kinase (ERK) pathways in vertebrates. We ascertained that these three pathways are involved in DNA synthesis in endomitotic silk gland cells using specific inhibitors against each pathway. Moreover, we investigated whether these three pathways are involved in insulin-stimulated DNA synthesis in endomitotic silk gland cells, and found that the PI3K/Akt and TOR pathways, but not the ERK pathway, are involved in this process. These results provide an important theoretical foundation for the further investigations of the mechanism underlying efficient endomitosis in silk gland cells. PMID:25794286

  13. Effects of platelet-derived growth factor and other polypeptide mitogens on DNA synthesis and growth of cultured rat liver fat-storing cells.

    PubMed Central

    Pinzani, M; Gesualdo, L; Sabbah, G M; Abboud, H E

    1989-01-01

    In vitro and in vivo studies suggest that liver fat-storing cells (FSC) may play an important role in the development of liver fibrosis. We explored the effects of platelet-derived growth factor (PDGF), epidermal growth factor (EGF), transforming growth factor (TGF)-alpha and TGF-beta, and basic fibroblast growth factor (bFGF) on DNA synthesis and growth of rat liver FSC. PDGF, EGF, TGF-alpha, and bFGF induced a dose-dependent increase in DNA synthesis with a peak effect at 24 h. PDGF produced the most striking effect with a maximum 18-fold increase over control. EGF, TGF-alpha, and bFGF elicited a maximum three- to fourfold increase in DNA synthesis. Analysis of growth curves revealed a similar pattern of potency of the growth factors. TGF-beta did not affect DNA synthesis of FSC; however, TGF-beta markedly potentiated the stimulatory effects of both EGF and PDGF. FSC showed high specific binding of 125I-PDGF and Scatchard analysis revealed high affinity receptors with an apparent Kd of 2.3 x 10(-10) M. Our data suggest that PDGF is a key mitogen for FSC and that the coordinate release of other growth factors together with PDGF by inflammatory cells represents a potent potential stimulus for FSC proliferation in conditions of chronic self-perpetuating liver inflammation. Images PMID:2592560

  14. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  15. Urinary tract infection drives genome instability in uropathogenic Escherichia coli and necessitates translesion synthesis DNA polymerase IV for virulence

    PubMed Central

    Gawel, Damian

    2011-01-01

    Uropathogenic Escherichia coli (UPEC) produces ∼80% of community-acquired UTI, the second most common infection in humans. During UTI, UPEC has a complex life cycle, replicating and persisting in intracellular and extracellular niches. Host and environmental stresses may affect the integrity of the UPEC genome and threaten its viability. We determined how the host inflammatory response during UTI drives UPEC genome instability and evaluated the role of multiple factors of genome replication and repair for their roles in the maintenance of genome integrity and thus virulence during UTI. The urinary tract environment enhanced the mutation frequency of UPEC ∼100-fold relative to in vitro levels. Abrogation of inflammation through a host TLR4-signaling defect significantly reduced the mutation frequency, demonstrating in the importance of the host response as a driver of UPEC genome instability. Inflammation induces the bacterial SOS response, leading to the hypothesis that the UPEC SOS-inducible translesion synthesis (TLS) DNA polymerases would be key factors in UPEC genome instability during UTI. However, while the TLS DNA polymerases enhanced in vitro, they did not increase in vivo mutagenesis. Although it is not a source of enhanced mutagenesis in vivo, the TLS DNA polymerase IV was critical for the survival of UPEC during UTI during an active inflammatory assault. Overall, this study provides the first evidence of a TLS DNA polymerase being critical for UPEC survival during urinary tract infection and points to independent mechanisms for genome instability and the maintenance of genome replication of UPEC under host inflammatory stress. PMID:21597325

  16. Design, synthesis, physicochemical studies, solvation, and DNA damage of quinoline-appended chalcone derivative: comprehensive spectroscopic approach toward drug discovery.

    PubMed

    Kumar, Himank; Chattopadhyay, Anjan; Prasath, R; Devaraji, Vinod; Joshi, Ritika; Bhavana, P; Saini, Praveen; Ghosh, Sujit Kumar

    2014-07-01

    The present study epitomizes the design, synthesis, photophysics, solvation, and interaction with calf-thymus DNA of a potential antitumor, anticancer quinoline-appended chalcone derivative, (E)-3-(anthracen-10-yl)-1-(6,8-dibromo-2-methylquinolin-3-yl)prop-2-en-1-one (ADMQ) using steady state absorption and fluorescence spectroscopy, molecular modeling, molecular docking, Fourier-transform infrared spectroscopy (FTIR), molecular dynamics (MD) simulation, and gel electrophoresis studies. ADMQ shows an unusual photophysical behavior in a variety of solvents of different polarity. The dual emission has been observed along with the formation of twisted intramolecular charge transfer (TICT) excited state. The radiationless deactivation of the TICT state is found to be promoted strongly by hydrogen bonding. Quantum mechanical (DFT, TDDFT, and ZINDO-CI) calculations show that the ADMQ is sort of molecular rotor which undergoes intramolecular twist followed by a complete charge transfer in the optimized excited state. FTIR studies reveals that ADMQ undergoes important structural change from its native structure to a β-hydroxy keto form in water at physiological pH. The concentration-dependent DNA cleavage has been identified in agarose gel DNA electrophoresis experiment and has been further supported by MD simulation. ADMQ forms hydrogen bond with the deoxyribose sugar attached with the nucleobase adenine DA-17 (chain A) and result in significant structural changes which potentially cleave DNA double helix. The compound does not exhibit any deleterious effect or toxicity to the E. coli strain in cytotoxicity studies. The consolidated spectroscopic research described herein can provide enormous information to open up new avenues for designing and synthesizing chalcone derivatives with low systematic toxicity for medicinal chemistry research. PMID:24962605

  17. Study of DNA light switch Ru(II) complexes: synthesis, characterization, photocleavage and antimicrobial activity.

    PubMed

    Yata, Praveen Kumar; Shilpa, M; Nagababu, P; Reddy, M Rajender; Kotha, Laxma Reddy; Gabra, Nazar Md; Satyanarayana, S

    2012-05-01

    The three Ru(II) complexes of [Ru(phen)(2)dppca](2+) (1) [Ru(bpy)(2)dppca](2+) (2) and [Ru(dmb)(2)dppca](2+) (3) (where phen = 1,10 phenanthroline, bpy = 2,2-bipyridine, dmb = 2 ,2-dimethyl 2',2'-bipyridine and polypyridyl ligand containing a single carboxylate functionality dppca ligand (dipyridophenazine-11-carboxylic acid) have been synthesized and characterized. These complexes have been shown to act as promising calf thymus DNA intercalators and a new class of DNA light switches, as evidenced by UV-visible and luminescence titrations with Co(2+) and EDTA, steady-state emission quenching by [Fe(CN)(6)](4-) and KI, DNA competitive binding with ethidium bromide, viscosity measurements, and DNA melting experiments. The results suggest that 1, 2, and 3 complexes bind to CT-DNA through intercalation and follows the order 1 > 2 > 3. Under irradiation at 365 nm, the three complexes have also been found to promote the photocleavage of plasmid pBR322 DNA. PMID:22194001

  18. Synthesis of Site-Specific DNA–Protein Conjugates and Their Effects on DNA Replication

    PubMed Central

    2015-01-01

    DNA–protein cross-links (DPCs) are bulky, helix-distorting DNA lesions that form in the genome upon exposure to common antitumor drugs, environmental/occupational toxins, ionizing radiation, and endogenous free-radical-generating systems. As a result of their considerable size and their pronounced effects on DNA–protein interactions, DPCs can interfere with DNA replication, transcription, and repair, potentially leading to mutagenesis, genotoxicity, and cytotoxicity. However, the biological consequences of these ubiquitous lesions are not fully understood due to the difficulty of generating DNA substrates containing structurally defined, site-specific DPCs. In the present study, site-specific cross-links between the two biomolecules were generated by copper-catalyzed [3 + 2] Huisgen cycloaddition (click reaction) between an alkyne group from 5-(octa-1,7-diynyl)-uracil in DNA and an azide group within engineered proteins/polypeptides. The resulting DPC substrates were subjected to in vitro primer extension in the presence of human lesion bypass DNA polymerases η, κ, ν, and ι. We found that DPC lesions to the green fluorescent protein and a 23-mer peptide completely blocked DNA replication, while the cross-link to a 10-mer peptide was bypassed. These results indicate that the polymerases cannot read through the larger DPC lesions and further suggest that proteolytic degradation may be required to remove the replication block imposed by bulky DPC adducts. PMID:24918113

  19. UvrD Participation in Nucleotide Excision Repair Is Required for the Recovery of DNA Synthesis following UV-Induced Damage in Escherichia coli.

    PubMed

    Newton, Kelley N; Courcelle, Charmain T; Courcelle, Justin

    2012-01-01

    UvrD is a DNA helicase that participates in nucleotide excision repair and several replication-associated processes, including methyl-directed mismatch repair and recombination. UvrD is capable of displacing oligonucleotides from synthetic forked DNA structures in vitro and is essential for viability in the absence of Rep, a helicase associated with processing replication forks. These observations have led others to propose that UvrD may promote fork regression and facilitate resetting of the replication fork following arrest. However, the molecular activity of UvrD at replication forks in vivo has not been directly examined. In this study, we characterized the role UvrD has in processing and restoring replication forks following arrest by UV-induced DNA damage. We show that UvrD is required for DNA synthesis to recover. However, in the absence of UvrD, the displacement and partial degradation of the nascent DNA at the arrested fork occur normally. In addition, damage-induced replication intermediates persist and accumulate in uvrD mutants in a manner that is similar to that observed in other nucleotide excision repair mutants. These data indicate that, following arrest by DNA damage, UvrD is not required to catalyze fork regression in vivo and suggest that the failure of uvrD mutants to restore DNA synthesis following UV-induced arrest relates to its role in nucleotide excision repair. PMID:23056919

  20. Kinetics of mouse jejunum radiosensitization by 2',2'-difluorodeoxycytidine (gemcitabine) and its relationship with pharmacodynamics of DNA synthesis inhibition and cell cycle redistribution in crypt cells.

    PubMed Central

    Grégoire, V.; Beauduin, M.; Rosier, J. F.; De Coster, B.; Bruniaux, M.; Octave-Prignot, M.; Scalliet, P.

    1997-01-01

    Gemcitabine (dFdC), a deoxycitidine nucleoside analogue, inhibits DNA synthesis and repair of radiation-induced chromosome breaks in vitro, radiosensitizes various human and mouse cells in vitro and shows clinical activity in several tumours. Limited data are however available on the effect of dFdC on normal tissue radiotolerance and on factors associated with dFdC's radiosensitization in vivo. The purpose of this study was to determine the effect of dFdC on mouse jejunum radiosensitization and to investigate the kinetics of DNA synthesis inhibition and cell cycle redistribution in the jejunal crypts as surrogates of radiosensitization in vivo. For assessment of jejunum tolerance, the mice were irradiated on the whole body with 60Co gamma rays (3.5-18 Gy single dose) with or without prior administration of dFdC (150 mg kg-1). Jejunum tolerance was evaluated by the number of regenerated crypts per circumference at 86 h after irradiation. For pharmacodynamic studies, dFdC (150 or 600 mg kg-1) was given i.p. and jejunum was harvested at various times (0-48 h), preceded by a pulse BrdUrd labelling. Labelled cells were detected by immunohistochemistry on paraffin-embedded sections. DNA synthesis was inhibited within 3 h after dFdC administration. After an early wave of apoptosis (3-6 h), DNA synthesis recovered by 6 h, and crypt cells became synchronized. At 48 h, the labelling index returned almost to background level. At a level of 40 regenerated crypts, radiosensitization was observed for a 3 h time interval (dose modification factor of 1.3) and was associated with DNA synthesis inhibition, whereas a slight radioprotection was observed for a 48-h time interval (dose modification factor of 0.9) when DNA synthesis has reinitiated. In conclusion, dFdC altered the radioresponse of the mouse jejunum in a schedule-dependent fashion. Our data tend to support the hypothesis that DNA synthesis inhibition and cell cycle redistribution are surrogates for radiosensitization

  1. Novel sphingosine-containing analogues selectively inhibit sphingosine kinase (SK) isozymes, induce SK1 proteasomal degradation and reduce DNA synthesis in human pulmonary arterial smooth muscle cells

    PubMed Central

    Byun, Hoe-Sup; Pyne, Susan; MacRitchie, Neil; Pyne, Nigel J.

    2013-01-01

    Sphingosine 1-phosphate (S1P) is involved in hyper-proliferative diseases such as cancer and pulmonary arterial hypertension. We have synthesized inhibitors that are selective for the two isoforms of sphingosine kinase (SK1 and SK2) that catalyze the synthesis of S1P. A thiourea adduct of sphinganine (F02) is selective for SK2 whereas the 1-deoxysphinganines 55-21 and 77-7 are selective for SK1. (2S,3R)-1-Deoxysphinganine (55-21) induced the proteasomal degradation of SK1 in human pulmonary arterial smooth muscle cells and inhibited DNA synthesis, while the more potent SK1 inhibitors PF-543 and VPC96091 failed to inhibit DNA synthesis. These findings indicate that moderate potency inhibitors such as 55-21 are likely to have utility in unraveling the functions of SK1 in inflammatory and hyperproliferative disorders. PMID:24396570

  2. DNA synthesis in alveolar macrophages and other changes in lavaged cells following exposure of CBA/H mice to cigarette smoke

    SciTech Connect

    Hornby, S.B.; Kellington, J.P. )

    1990-04-01

    Traditional methods to determine the proportion of cells in S-phase use radiolabeled precursors of DNA, such as {sup 3}H-thymidine, which become incorporated into DNA during its synthesis and are visualized either in tissue sections or in cell preparations by autoradiography. At the Harwell Laboratory the effects of inhaled {alpha}-emitting actinides on the pulmonary alveolar macrophage population of the rodent lung are being studied. For this research the use of an autoradiographic technique to determine the proportion of cells in S-phase is inappropriate, because of the possible presence of competing sources of radioactivity in the cells under investigation. Consequently, an alternative method has been developed. In this method, 5-bromodeoxyuridine (BrdU), an analogue of thymidine, is incorporated into cells undergoing DNA synthesis. Fluorescein-conjugated monoclonal antibodies, highly specific for BrdU substituted DNA, are available commercially and may be used as a probe for BrdU-labeled cells. This technique for identifying cells in S-phase has been described previously for the flow cytometric analysis of cell suspensions and for cells in tissue sections. An adaptation of this technique for use on cytocentrifuge preparations of cells recovered from mouse lung by bronchoalveolar lavage has been developed and its use is described. Some preliminary results of a short-term experiment with CBA/H mice to determine the effects of exposure to cigarette smoke on the DNA synthesis of alveolar macrophages are also included.

  3. Simulated Screens of DNA Encoded Libraries: The Potential Influence of Chemical Synthesis Fidelity on Interpretation of Structure-Activity Relationships.

    PubMed

    Satz, Alexander L

    2016-07-11

    Simulated screening of DNA encoded libraries indicates that the presence of truncated byproducts complicates the relationship between library member enrichment and equilibrium association constant (these truncates result from incomplete chemical reactions during library synthesis). Further, simulations indicate that some patterns observed in reported experimental data may result from the presence of truncated byproducts in the library mixture and not structure-activity relationships. Potential experimental methods of minimizing the presence of truncates are assessed via simulation; the relationship between enrichment and equilibrium association constant for libraries of differing purities is investigated. Data aggregation techniques are demonstrated that allow for more accurate analysis of screening results, in particular when the screened library contains significant quantities of truncates. PMID:27116029

  4. Purification of a Factor from Human Placenta That Stimulates Capillary Endothelial Cell Protease Production, DNA Synthesis, and Migration

    NASA Astrophysics Data System (ADS)

    Moscatelli, David; Presta, Marco; Rifkin, Daniel B.

    1986-04-01

    A protein that stimulates the production of plasminogen activator and latent collagenase in cultured bovine capillary endothelial cells has been purified 106-fold from term human placenta by using a combination of heparin affinity chromatography, ion-exchange chromatography, and gel chromatography. The purified molecule has a molecular weight of 18,700 as determined by NaDodSO4/PAGE under both reducing and nonreducing conditions. The purified molecule stimulates the production of plasminogen activator and latent collagenase in a dose-dependent manner between 0.1 and 10 ng of protein/ml. The purified protein also stimulates DNA synthesis and chemotaxis in capillary endothelial cells in the same concentration range. Thus, this molecule has all of the properties predicted for an angiogenic factor.

  5. The application of the AMB protective group in the solid-phase synthesis of methylphosphonate DNA analogues.

    PubMed Central

    Kuijpers, W H; Kuyl-Yeheskiely, E; van Boom, J H; van Boeckel, C A

    1993-01-01

    Partially methylphosphonate-modified oligodeoxynucleotides were synthesized on solid-phase by employing the easily removable 2-(acetoxymethyl)benzoyl (AMB) group as base-protecting group. Although a rapid AMB deprotection can be accomplished in methanolic potassium carbonate, the lability of the methylphosphonate linkage towards potassium carbonate/methanol excludes the use of this deprotection reagent. Thus, saturated ammonia solution in methanol was investigated as an alternative reagent for AMB removal. It is demonstrated that the combination of the AMB protective group and ammonia/methanol as deprotection reagent significantly improves the synthesis of methylphosphonate-modified DNA fragments. A mild overnight treatment at room temperature is sufficient for complete removal of the AMB group, whereas deprotection of conventionally protected oligonucleotides requires much longer exposure to basic conditions at elevated temperatures. PMID:8346028

  6. 43 CFR 2.51 - What if the bureau needs clarification about fee issues?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 1 2014-10-01 2014-10-01 false What if the bureau needs clarification about fee issues? 2.51 Section 2.51 Public Lands: Interior Office of the Secretary of the Interior FREEDOM OF INFORMATION ACT; RECORDS AND TESTIMONY Fees § 2.51 What if the bureau needs clarification...

  7. Requests for Clarification and Children's Speech Responses: Changing "Pasghetti" to "Spaghetti"

    ERIC Educational Resources Information Center

    Gozzard, Haley; Baker, Elise; McCabe, Patricia

    2008-01-01

    One way children improve their pronunciation of monosyllabic words is via clarification requests, specifically, the adult saying an incorrect production that differs from the child's incorrect production (Weiner and Ostrowski, 1979). The aim of this study was to investigate children's responses to clarification requests when producing polysyllabic…

  8. Strategies of Clarification in Judges' Use of Language: From the Written to the Spoken.

    ERIC Educational Resources Information Center

    Philips, Susan U.

    1985-01-01

    Reports on a study of judges' strategies in clarifying their verbal explanations of constitutional rights to criminal defendants. Identifies six clarification processes and compares them with other studies of clarification processes and with the properties of simplified registers, particularly speech addressed to first- and second-language…

  9. Implementation and Evaluation of a Values Clarification Activity for a Large Undergraduate Human Sexuality Course

    ERIC Educational Resources Information Center

    Lederer, Alyssa M.

    2016-01-01

    Values clarification is an important tool that helps individuals to clarify their beliefs about sexuality-related issues. This lesson plan provides instructions for a 1-hour values clarification activity for a large undergraduate human sexuality course that serves as an introduction to course content and tone, stimulates students' initial thinking…

  10. 78 FR 70905 - Extension of Comment Period for the Water Quality Standards Regulatory Clarifications Proposed Rule

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-27

    ... Regulatory Clarifications'' in the Federal Register (78 FR 54517). In the proposed rulemaking, EPA is... AGENCY 40 CFR Part 131 Extension of Comment Period for the Water Quality Standards Regulatory... proposed rule ``Water Quality Standards Regulatory Clarifications''. EPA is extending the comment period...

  11. Stimulation by endothelin-1 of mitogen-activated protein kinases and DNA synthesis in bovine tracheal smooth muscle cells.

    PubMed Central

    Malarkey, K.; Chilvers, E. R.; Lawson, M. F.; Plevin, R.

    1995-01-01

    1. In cultures of bovine tracheal smooth muscle cells, platelet-derived growth factor-BB (PDGF), bradykinin (BK) and endothelin-1 (ET-1) stimulated the tyrosine phosphorylation and activation of both pp42 and pp44 kDa forms of mitogen-activated protein (MAP) kinase. 2. Both ET-1 and PDGF stimulated a sustained activation of MAP kinase whilst the response to BK was transient. 3. Activation of MAP kinase occurred in a concentration-dependent manner (EC50 values: ET-1, 2.3 +/- 1.3 nM; BK, 8.7 +/- 4.1 nM, PDGF, 9.7 +/- 3.2 ng ml-1). 4. Pretreatment with the protein kinase C (PKC) inhibitor Ro-318220, significantly reduced ET-1 activation of MAP kinase at 2 and 5 min but enhanced MAP kinase activation at 60 min. 5. Following chronic phorbol ester pretreatment, BK-stimulated activation of MAP kinase was abolished whilst the responses to PDGF and ET-1 were only partly reduced (80 and 45% inhibition respectively). 6. Pretreatment with pertussis toxin reduced ET-1 stimulated activation of MAP kinase particularly at later times (60 min), but left the responses to both PDGF and BK unaffected. 7. ET-1 also stimulated a 3 fold increase in [3H]-thymidine incorporation which was abolished by pertussis toxin pretreatment. In contrast, PDGF stimulated a 131 fold increase in [3H]-thymidine incorporation which was not affected by pertussis toxin. 8. These results suggest that a pertussis toxin-sensitive activation of MAP kinase may play an important role in ET-1-stimulated DNA synthesis but that activation of MAP kinase alone is not sufficient to induce the magnitude of DNA synthesis observed in response to PDGF. Images Figure 1 Figure 2 Figure 5 Figure 6 Figure 7 PMID:8564258

  12. Synthesis, characterization; DNA binding and antitumor activity of ruthenium(II) polypyridyl complexes.

    PubMed

    Srishailam, A; Gabra, Nazar Mohammed; Kumar, Yata Praveen; Reddy, Kotha Laxma; Devi, C Shobha; Anil Kumar, D; Singh, Surya S; Satyanarayana, S

    2014-12-01

    Three new ruthenium(II) polypyridyl complexes [Ru(phen)2BrIPC](2+) (1), [Ru(bpy)2 BrIPC](2+) (2) and [Ru(dmb)2BrIPC](2+) (3) where, BrIPC = (6-bromo-3-(1H-imidazo[4,5-f] [1,10]-phenanthroline, phen = 1,10-phenanthroline, bpy = 2,2' bipyridine, dmb = 4,4'-dimethyl 2,2' bipyridine, were synthesised and characterised. DNA-binding nature was investigated by spectroscopic titrations and mode of binding was assessed by viscosity measurements. The DNA-binding constants Kb of complexes 1, 2 and 3 were determined to be in the order of 10(5). Experimental results showed that these complexes interact with CT-DNA by intercalative mode. Photocleavage and antimicrobial activities were complex concentration dependent, at high concentration, high activity and vice versa. MTT assay was performed on HeLa cell lines, IC50 values of complexes in the order of 3 > 2 > 1 > cisplatin. From comet assay, cellular uptake studies, we observed that complexes could enter into the cell membrane and accumulate inside the nucleus. Molecular docking studies support the DNA binding affinity with hydrogen bonding and van der Waals attractions between base pairs and phosphate backbone of DNA with metal complexes. PMID:25318017

  13. Synthesis, Characterization, Molecular Modeling, and DNA Interaction Studies of Copper Complex Containing Food Additive Carmoisine Dye.

    PubMed

    Shahabadi, Nahid; Akbari, Alireza; Jamshidbeigi, Mina; Khodarahmi, Reza

    2016-06-01

    A copper complex of carmoisine dye; [Cu(carmoisine)2(H2O)2]; was synthesized and characterized by using physico-chemical and spectroscopic methods. The binding of this complex with calf thymus (ct) DNA was investigated by circular dichroism, absorption studies, emission spectroscopy, and viscosity measurements. UV-vis results confirmed that the Cu complex interacted with DNA to form a ground-state complex and the observed binding constant (2× 10(4) M(-1)) is more in keeping with the groove bindings with DNA. Furthermore, the viscosity measurement result showed that the addition of complex causes no significant change on DNA viscosity and it indicated that the intercalation mode is ruled out. The thermodynamic parameters are calculated by van't Hoff equation, which demonstrated that hydrogen bonds and van der Waals interactions played major roles in the reaction. The results of circular dichroism (CD) suggested that the complex can change the conformation of DNA from B-like form toward A-like conformation. The cytotoxicity studies of the carmoisine dye and its copper complex indicated that both of them had anticancer effects on HT-29 (colon cancer) cell line and they may be new candidates for treatment of the colon cancer. PMID:27152751

  14. Synthesis and evaluation of gold(III) complexes as efficient DNA binders and cytotoxic agents

    NASA Astrophysics Data System (ADS)

    Patel, Mohan N.; Bhatt, Bhupesh S.; Dosi, Promise A.

    2013-06-01

    In recent years, great interest has been focused on gold(III) complexes as cytotoxic and antitumor drugs. Recent studies demonstrated that simple bidentate or polydentate ligands containing nitrogen donor atoms may offer sufficient redox stabilization to produce viable Au(III) anticancer drug targets under physiologic conditions. So, we have synthesized square planer Au(III) complexes of type [Au(An)Clx]·Cly and characterized them using UV-Vis absorption, C, H, N elemental analysis, FT-IR, LC-MS, 1H and 13C NMR spectroscopy. These compounds manifested significant cytotoxic properties in vitro for brine shrimp lethality bioassay. The metal complexes were screened for series of DNA binding activity using UV-Vis absorption titration, hydrodynamic measurement and thermal DNA denaturation study. The nucleolytic activity was performed on plasmid pUC19 DNA. The Michaelis-Menten kinetic studies were performed to evaluate rate of enhancement in metal complexes mediated DNA cleavage over the non-catalyzed DNA cleavage.

  15. Translesion synthesis mechanisms depend on the nature of DNA damage in UV-irradiated human cells

    PubMed Central

    Quinet, Annabel; Martins, Davi Jardim; Vessoni, Alexandre Teixeira; Biard, Denis; Sarasin, Alain; Stary, Anne; Menck, Carlos Frederico Martins

    2016-01-01

    Ultraviolet-induced 6-4 photoproducts (6-4PP) and cyclobutane pyrimidine dimers (CPD) can be tolerated by translesion DNA polymerases (TLS Pols) at stalled replication forks or by gap-filling. Here, we investigated the involvement of Polη, Rev1 and Rev3L (Polζ catalytic subunit) in the specific bypass of 6-4PP and CPD in repair-deficient XP-C human cells. We combined DNA fiber assay and novel methodologies for detection and quantification of single-stranded DNA (ssDNA) gaps on ongoing replication forks and postreplication repair (PRR) tracts in the human genome. We demonstrated that Rev3L, but not Rev1, is required for postreplicative gap-filling, while Polη and Rev1 are responsible for TLS at stalled replication forks. Moreover, specific photolyases were employed to show that in XP-C cells, CPD arrest replication forks, while 6-4PP are responsible for the generation of ssDNA gaps and PRR tracts. On the other hand, in the absence of Polη or Rev1, both types of lesion block replication forks progression. Altogether, the data directly show that, in the human genome, Polη and Rev1 bypass CPD and 6-4PP at replication forks, while only 6-4PP are also tolerated by a Polζ-dependent gap-filling mechanism, independent of S phase. PMID:27095204

  16. Translesion synthesis mechanisms depend on the nature of DNA damage in UV-irradiated human cells.

    PubMed

    Quinet, Annabel; Martins, Davi Jardim; Vessoni, Alexandre Teixeira; Biard, Denis; Sarasin, Alain; Stary, Anne; Menck, Carlos Frederico Martins

    2016-07-01

    Ultraviolet-induced 6-4 photoproducts (6-4PP) and cyclobutane pyrimidine dimers (CPD) can be tolerated by translesion DNA polymerases (TLS Pols) at stalled replication forks or by gap-filling. Here, we investigated the involvement of Polη, Rev1 and Rev3L (Polζ catalytic subunit) in the specific bypass of 6-4PP and CPD in repair-deficient XP-C human cells. We combined DNA fiber assay and novel methodologies for detection and quantification of single-stranded DNA (ssDNA) gaps on ongoing replication forks and postreplication repair (PRR) tracts in the human genome. We demonstrated that Rev3L, but not Rev1, is required for postreplicative gap-filling, while Polη and Rev1 are responsible for TLS at stalled replication forks. Moreover, specific photolyases were employed to show that in XP-C cells, CPD arrest replication forks, while 6-4PP are responsible for the generation of ssDNA gaps and PRR tracts. On the other hand, in the absence of Polη or Rev1, both types of lesion block replication forks progression. Altogether, the data directly show that, in the human genome, Polη and Rev1 bypass CPD and 6-4PP at replication forks, while only 6-4PP are also tolerated by a Polζ-dependent gap-filling mechanism, independent of S phase. PMID:27095204

  17. The Chemical Synthesis of DNA/RNA: Our Gift to Science

    PubMed Central

    Caruthers, Marvin H.

    2013-01-01

    It is a great privilege to contribute to the Reflections essays. In my particular case, this essay has allowed me to weave some of my major scientific contributions into a tapestry held together by what I have learned from three colleagues (Robert Letsinger, Gobind Khorana, and George Rathmann) who molded my career at every important junction. To these individuals, I remain eternally grateful, as they always led by example and showed many of us how to break new ground in both science and biotechnology. Relative to my scientific career, I have focused primarily on two related areas. The first is methodologies we developed for chemically synthesizing DNA and RNA. Synthetic DNA and RNA continue to be an essential research tool for biologists, biochemists, and molecular biologists. The second is developing new approaches for solving important biological problems using synthetic DNA, RNA, and their analogs. PMID:23223445

  18. Structural Insight into Processive Human Mitochondrial DNA Synthesis and Disease-Related Polymerase Mutations

    SciTech Connect

    Lee, Young-Sam; Kennedy, W. Dexter; Yin, Y. Whitney

    2010-09-07

    Human mitochondrial DNA polymerase (Pol {gamma}) is the sole replicase in mitochondria. Pol {gamma} is vulnerable to nonselective antiretroviral drugs and is increasingly associated with mutations found in patients with mitochondriopathies. We determined crystal structures of the human heterotrimeric Pol {gamma} holoenzyme and, separately, a variant of its processivity factor, Pol {gamma}B. The holoenzyme structure reveals an unexpected assembly of the mitochondrial DNA replicase where the catalytic subunit Pol {gamma}A interacts with its processivity factor primarily via a domain that is absent in all other DNA polymerases. This domain provides a structural module for supporting both the intrinsic processivity of the catalytic subunit alone and the enhanced processivity of holoenzyme. The Pol {gamma} structure also provides a context for interpreting the phenotypes of disease-related mutations in the polymerase and establishes a foundation for understanding the molecular basis of toxicity of anti-retroviral drugs targeting HIV reverse transcriptase.

  19. Synthesis of a new conjugated polymer for DNA alkylation and gene regulation.

    PubMed

    Nie, Chenyao; Zhu, Chunlei; Feng, Liheng; Lv, Fengting; Liu, Libing; Wang, Shu

    2013-06-12

    A new polyfluorene derivative containing pendent alkylating chlorambucil (PFP-Cbl) was synthesized and characterized. Under direct incubation with DNA in vitro, PFP-Cbl could undergo an efficient DNA alkylating reaction and induce DNA cross-linking. In vitro transcription and translation experiment exhibited that the PFP-Cbl significantly down-regulated the gene expression of luciferase reporter plasmid. The down-regulation of gene expression was also verified through the transfection experiment of p-EGFP plasmid, which showed decreased green fluorescent protein (GFP) in cells. Meanwhile, the self-luminous property of PFP-Cbl could make it able to trace the internalized PFP-Cbl and plasmid complexes resulted from cross-linking in cells by fluorescent microscopy. Combining the features of alkylating function, multivalent binding sites, and fluorescent characteristics, PFP-Cbl provides a new insight in the area of gene regulation and extends the new applications of conjugated polymers (CPs). PMID:23548104

  20. Synthesis and characterisation of platinum (II) salphen complex and its interaction with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Sukri, Shahratul Ain Mohd; Heng, Lee Yook; Karim, Nurul Huda Abd

    2014-09-01

    A platinum (II) salphen complex was synthesised by condensation reaction of 2,4-dihydroxylbenzaldehyde and o-phenylenediamine with potassium tetrachloroplatinate to obtain N,N'-Bis-4-(hydroxysalicylidene)-phenylenediamine-platinum (II). The structure of the complex was confirmed by 1H and 13C NMR spectroscopy, FTIR spectroscopy, CHN elemental analyses and ESI-MS spectrometry. The platinum (II) salphen complex with four donor atoms N2O2 from its salphen ligand coordinated to platinum (II) metal centre were determined. The binding mode and interaction of this complex with calf thymus DNA was determined by UV/Vis DNA titration and emission titration. The intercalation between the DNA bases by π-π stacking due to its square planar geometry and aromatic rings structures was proposed.

  1. Synthesis and characterisation of platinum (II) salphen complex and its interaction with calf thymus DNA

    SciTech Connect

    Sukri, Shahratul Ain Mohd; Heng, Lee Yook; Karim, Nurul Huda Abd

    2014-09-03

    A platinum (II) salphen complex was synthesised by condensation reaction of 2,4-dihydroxylbenzaldehyde and o-phenylenediamine with potassium tetrachloroplatinate to obtain N,N′-Bis-4-(hydroxysalicylidene)-phenylenediamine-platinum (II). The structure of the complex was confirmed by {sup 1}H and {sup 13}C NMR spectroscopy, FTIR spectroscopy, CHN elemental analyses and ESI-MS spectrometry. The platinum (II) salphen complex with four donor atoms N{sub 2}O{sub 2} from its salphen ligand coordinated to platinum (II) metal centre were determined. The binding mode and interaction of this complex with calf thymus DNA was determined by UV/Vis DNA titration and emission titration. The intercalation between the DNA bases by π-π stacking due to its square planar geometry and aromatic rings structures was proposed.

  2. Metal-based biologically active compounds: synthesis, characterization, DNA interaction, antibacterial, cytotoxic and SOD mimic activities.

    PubMed

    Patel, Mohan N; Patel, Chintan R; Joshi, Hardik N

    2013-02-01

    The square pyramidal copper(II) complexes of N, O- donor ligand and ciprofloxacin have been synthesized. Synthesized complexes were characterized by physicochemical parameters like elemental analysis, electronic, FT-IR and LC-MS spectra. The complexes were screened for their antimicrobial activity against Gram(+Ve), i.e. Staphylococcus aureus, Bacillus subtilis, and Gram(-Ve), i.e. Serratia marcescens, Pseudomonas aeruginosa and Escherichia coli, microorganisms in terms of minimum inhibitory concentration and colony-forming unit. To determine the binding mode of complexes with Herring Sperm DNA, absorption titration and viscosity measurement were employed. DNA cleavage activity was carried out by gel electrophoresis experiment using supercoiled form of pUC19 DNA. The complexes were tested for their superoxide dismutase mimic activity in terms of IC(50) value. Synthesized complexes were also screened for their cytotoxicity using brine shrimp lethality assay method. PMID:23306896

  3. Synthesis, characterization, DNA binding and cleavage studies of chiral Ru(II) salen complexes

    NASA Astrophysics Data System (ADS)

    Khan, Noor-ul H.; Pandya, Nirali; Kureshy, Rukhsana I.; Abdi, Sayed H. R.; Agrawal, Santosh; Bajaj, Hari C.; Pandya, Jagruti; Gupte, Akashya

    2009-09-01

    Interaction of chiral Ru(II) salen complexes (S)-1 and (R)-1 with Calf Thymus DNA (CT-DNA) was studied by absorption spectroscopy, competitive binding study, viscosity measurements, CD measurements, thermal denaturation study and cleavage studies by agarose gel electrophoresis. The DNA binding affinity of (S)-1 (6.25 × 10 3 M -1) was found to be greater than (R)-1 (3.0 × 10 3 M -1). The antimicrobial studies of these complexes on five different gram (+)/(-) bacteria and three different fungal organisms showed selective inhibition of the growth of gram (+) bacteria and were not affective against gram (-) and fungal organisms. Further, the (S)-1 enantiomer inhibited the growth of organisms to a greater extent as compared to (R)-1 enantiomer.

  4. Synthesis, antioxidant, enzyme inhibition and DNA binding studies of novel N-benzylated derivatives of sulfonamide

    NASA Astrophysics Data System (ADS)

    Abbas, Aadil; Murtaza, Shahzad; Tahir, Muhammad Nawaz; Shamim, Saima; Sirajuddin, Muhammad; Rana, Usman Ali; Naseem, Khadija; Rafique, Hummera

    2016-08-01

    A series of novel N-benzylated derivatives of sulfonamide were synthesized and characterized by FT-IR, NMR and XRD analysis. The synthesized compounds were assayed for their biological potential. The biological studies involved antioxidant, enzyme inhibition, and DNA interaction studies. Antioxidant potential was investigated by Ferric Reducing Antioxidant Power assay (FRAP) and DPPH free radical scavenging method, the capacity of synthesized compounds to inhibit the enzyme's activity was assayed by using the well-known Elman method whereas DNA interaction studies were carried out with the help UV-Vis absorption titration method. Moreover, a direct correlation between enzyme inhibition activity and concentration of the compounds was observed both in experimental and molecular docking studies. DNA interaction studies of the synthesized compounds showed weak interaction.

  5. Measurement of unscheduled DNA synthesis and S-phase synthesis in rodent hepatocytes following in vivo treatment: testing of 24 compounds.

    PubMed

    Mirsalis, J C; Tyson, C K; Steinmetz, K L; Loh, E K; Hamilton, C M; Bakke, J P; Spalding, J W

    1989-01-01

    The in vivo-in vitro hepatocyte DNA repair assay has been shown to be useful for studying genotoxic hepatocarcinogens. In addition, measurement of S-phase synthesis (SPS) provides an indirect indicator of hepatocellular proliferation, which may be an important mechanism in rodent carcinogenesis. This assay was used to examine 24 chemicals for their ability to induce unscheduled DNA synthesis (UDS) or SPS in Fischer-344 rats or B6C3F1 mice following in vivo treatment. Hepatocytes were isolated by liver perfusion and incubated with 3H-thymidine following in vivo treatment by gavage. UDS was measured by quantitative autoradiography as net grains/nucleus (NG). Controls from both sexes of both species yielded less than 0.0 NG. Chemicals chosen for testing were from the National Toxicology Program (NTP) genetic toxicology testing program and most were also evaluated in long-term animal studies conducted by the NTP. 11-Aminoundecanoic acid, benzyl acetate, bis(2-chloro-1-methylethyl)ether (BCMEE), C.I. Solvent Yellow 14, cinnamaldehyde, cinnamyl anthranilate, dichloromethane, dichlorvos, glutaraldehyde, 4,4'-methylenedianiline (MDA), 4-nitrotoluene, 4,4'-oxydianiline, a polybrominated biphenyl mixture (PBB), reserpine, 1,1,2,2-tetrachloroethane, 1,1,2-trichloroethane, trichloroethylene, and 2,6-xylidine all failed to induce UDS in rats and/or mice. Dinitrotoluene and Michler's Ketone induced positive UDS response in rat, while N-nitrosodiethanolamine and selenium sulfide induced equivocal UDS results in mouse and rat, respectively. BCMEE, bromoform, chloroform, PBB, 1,1,2-trichloroethane, and trichloroethylene were all potent inducers of SPS in mouse liver, while C.I. Solvent Yellow 14, and 1,1,2,2-tetrachloroethane yielded equivocal SPS results in rat and mouse, respectively. These results indicate that most of the test compounds do not induce UDS in the liver; however, the significant S-phase responses induced by many of these compounds, especially the halogenated

  6. Solid-phase synthesis, thermal denaturation studies, nuclease resistance, and cellular uptake of (oligodeoxyribonucleoside)methylborane phosphine-DNA chimeras.

    PubMed

    Krishna, Heera; Caruthers, Marvin H

    2011-06-29

    The major hurdle associated with utilizing oligodeoxyribonucleotides for therapeutic purposes is their poor delivery into cells coupled with high nuclease susceptibility. In an attempt to combine the nonionic nature and high nuclease stability of the P-C bond of methylphosphonates with the high membrane permeability, low toxicity, and improved gene silencing ability of borane phosphonates, we have focused our research on the relatively unexplored methylborane phosphine (Me-P-BH(3)) modification. This Article describes the automated solid-phase synthesis of mixed-backbone oligodeoxynucleotides (ODNs) consisting of methylborane phosphine and phosphate or thiophosphate linkages (16-mers). Nuclease stability assays show that methylborane phosphine ODNs are highly resistant to 5' and 3' exonucleases. When hybridized to a complementary strand, the ODN:RNA duplex was more stable than its corresponding ODN:DNA duplex. The binding affinity of ODN:RNA duplex increased at lower salt concentration and approached that of a native DNA:RNA duplex under conditions close to physiological saline, indicating that the Me-P-BH(3) linkage is positively charged. Cellular uptake measurements indicate that these ODNs are efficiently taken up by cells even when the strand is 13% modified. Treatment of HeLa cells and WM-239A cells with fluorescently labeled ODNs shows significant cytoplasmic fluorescence when viewed under a microscope. Our results suggest that methylborane phosphine ODNs may prove very valuable as potential candidates in antisense research and RNAi. PMID:21585202

  7. Impaired coenzyme A synthesis in fission yeast causes defective mitosis, quiescence-exit failure, histone hypoacetylation and fragile DNA

    PubMed Central

    Nakamura, Takahiro; Pluskal, Tomáš; Nakaseko, Yukinobu; Yanagida, Mitsuhiro

    2012-01-01

    Biosynthesis of coenzyme A (CoA) requires a five-step process using pantothenate and cysteine in the fission yeast Schizosaccharomyces pombe. CoA contains a thiol (SH) group, which reacts with carboxylic acid to form thioesters, giving rise to acyl-activated CoAs such as acetyl-CoA. Acetyl-CoA is essential for energy metabolism and protein acetylation, and, in higher eukaryotes, for the production of neurotransmitters. We isolated a novel S. pombe temperature-sensitive strain ppc1-537 mutated in the catalytic region of phosphopantothenoylcysteine synthetase (designated Ppc1), which is essential for CoA synthesis. The mutant becomes auxotrophic to pantothenate at permissive temperature, displaying greatly decreased levels of CoA, acetyl-CoA and histone acetylation. Moreover, ppc1-537 mutant cells failed to restore proliferation from quiescence. Ppc1 is thus the product of a super-housekeeping gene. The ppc1-537 mutant showed combined synthetic lethal defects with five of six histone deacetylase mutants, whereas sir2 deletion exceptionally rescued the ppc1-537 phenotype. In synchronous cultures, ppc1-537 cells can proceed to the S phase, but lose viability during mitosis failing in sister centromere/kinetochore segregation and nuclear division. Additionally, double-strand break repair is defective in the ppc1-537 mutant, producing fragile broken DNA, probably owing to diminished histone acetylation. The CoA-supported metabolism thus controls the state of chromosome DNA. PMID:23091701

  8. Targeted expression of transforming growth factor-beta 1 in intracardiac grafts promotes vascular endothelial cell DNA synthesis.

    PubMed Central

    Koh, G Y; Kim, S J; Klug, M G; Park, K; Soonpaa, M H; Field, L J

    1995-01-01

    Intracardiac grafts comprised of genetically modified skeletal myoblasts were assessed for their ability to effect long-term delivery of recombinant transforming growth factor-beta (TGF-beta) to the heart. C2C12 myoblasts were stably transfected with a construct comprised of an inducible metallothionein promoter fused to a modified TGF-beta 1 cDNA. When cultured in medium supplemented with zinc sulfate, cells carrying this transgene constitutively secrete active TGF-beta 1. These genetically modified myoblasts were used to produce intracardiac grafts in syngeneic C3Heb/FeJ hosts. Viable grafts were observed as long as three months after implantation, and immunohistological analyses of mice maintained on water supplemented with zinc sulfate revealed the presence of grafted cells which stably expressed TGF-beta 1. Regions of apparent neovascularization, as evidenced by tritiated thymidine incorporation into vascular endothelial cells, were observed in the myocardium which bordered grafts expressing TGF-beta 1. The extent of vascular endothelial cell DNA synthesis could be modulated by altering dietary zinc. Similar effects on the vascular endothelial cells were not seen in mice with grafts comprised of nontransfected cells. This study indicates that genetically modified skeletal myoblast grafts can be used to effect the local, long-term delivery of recombinant molecules to the heart. Images PMID:7529257

  9. Preclinical activity of 8-chloroadenosine with mantle cell lymphoma: roles of energy depletion and inhibition of DNA and RNA synthesis.

    PubMed

    Dennison, Jennifer B; Balakrishnan, Kumudha; Gandhi, Varsha

    2009-11-01

    8-Chloroadenosine (8-Cl-Ado), an RNA-directed nucleoside analogue, is currently under evaluation in phase I clinical trials for treatment of chronic lymphocytic leukaemia. In the current study, the efficacy of 8-Cl-Ado was evaluated using mantle cell lymphoma (MCL) cell lines: Granta 519, JeKo, Mino, and SP-53. After continuous exposure to 10 mumol/l 8-Cl-Ado for 24 h, loss of mitochondrial transmembrane potential and poly [adenosine diphosphate (ADP)-ribose] polymerase (PARP) cleavage were detected in three of four cell lines. Reduced ATP levels (30-60% reduction) and concurrent 8-Cl-ATP accumulation were highly associated with cell death (P < 0.01). The intracellular 8-Cl-ATP concentrations were also highly correlated with inhibition of global transcription (50-90%, r(2) = 0.90, P < 0.01). However, the inhibition of transcription only accounted for 30-40% of cell death as determined by equivalent inhibition with actinomycin D. Likewise, short-lived mRNAs, those encoding cyclin D1 and Mcl-1, were not consistently reduced after treatment. Unique to MCL as compared to other haematological malignancies, 8-Cl-Ado inhibited the rates of DNA synthesis and selectively depleted dATP pools (50-80%). We conclude that the DNA and RNA directed actions of 8-Cl-Ado in combination with depleted energetics may promote cell death and inhibit growth of MCL cell lines. PMID:19709085

  10. Optimization of enzymatic clarification of sapodilla juice: a statistical perspective.

    PubMed

    Jacob, Nicemol; Sukumaran, R K; Prema, P

    2008-12-01

    Response surface methodology (RSM) was employed to establish optimum conditions for enzymatic clarification of sapodilla juice. Polygalacturonase obtained from Streptomyces lydicus had been purified to homogeneity and was used for the treatment. The independent variables were temperature (30-45 degrees C), enzyme concentration (0.5-1.5 U), and treatment time (30-90 min), whose effects on viscosity and clarity of the juice were evaluated using a Box-Behnken design. Significant regression models describing the changes of viscosity and clarity with respect to the independent variables were obtained, with the coefficient of determination, R (2) , greater than 0.8. Based on response surfaces and contour plots, the optimum conditions for clarifying sapodilla juice were enzyme concentration 1.15 U, incubation temperature 34 degrees C, and incubation time 70 min. PMID:18670739

  11. Clarification of Some Important Issues in Basic Thermoacoustic Theory

    NASA Astrophysics Data System (ADS)

    Dai, W.; Luo, E. C.

    2006-04-01

    The past two decades have seen great development in thermoacoustic heat engines from standing wave thermoacoustic refrigerators to traveling wave thermoacoustic engines, from small scale thermoacoustically driven pulse tube coolers to large scale gas liquefiers, etc. In the meantime, thermoacoustic theory has also improved, which may be used to generalize the working principles in all oscillating flow heat engines. While thermoacoustic theory has been proved to be very useful in analyzing and modeling thermoacoustic heat engines, there are still some important basic points which are misleading or ambiguous and easily cause confusion. This article clarifies these issues by discussing enthalpy flow, entropy flow, work flow and Gedeon DC flow loss. The clarification is important because it helps one to understand the thermodynamics in thermoacoustic systems and to correctly simulate the system performance, especially when the thermoacoustic theory is extended into a non-linear field considering gas non-linearity, high order thermoacoustic terms, etc.

  12. Steroidal pyrimidines: Synthesis, characterization, molecular docking studies with DNA and in vitro cytotoxicity

    NASA Astrophysics Data System (ADS)

    Shamsuzzaman; Dar, Ayaz Mahmood; Yaseen, Zahid; Alam, Khursheed; Hussain, Altaf; Gatoo, Manzoor Ahmad

    2013-08-01

    A series of new steroid pyrimidines (7-9) were synthesized by reacting steroidal thiosemicarbazones (4-6) with diethyl malonate. The new compounds were characterized by IR, 1H NMR, 13C NMR, MS and analytical data. The interaction studies of compounds (7-9) with DNA were carried out by employing gel electrophoresis, UV-vis and fluorescence spectroscopy. The acting force between the compounds (7-9) and DNA was mainly hydrophobic while the other interactions like van der Waals, hydrogen bonding cannot be ruled out. The gel electrophoresis pattern also demonstrated that the compound 7 alone or in presence of Cu (II) causes the nicking of supercoiled pBR322 and it seems to follow the mechanistic pathway involving generation of hydroxyl radicals that are responsible for initiating DNA strand scission. The docking study of compounds (7-9) suggested that the intercalation of compounds in between the nucleotide base pairs might be due to the presence of pyrimidine moiety in steroid molecule. MTT assay was carried out to check the toxicity of new compounds (7-9) against the different human cancer as well as non-cancer cell lines A545, MCF-7, HeLa, HL-60, SW480, HepG2, HT-29, A549, 184B5, MCF10A, NL-20, HPC and HPLF. Apoptotic degradation of DNA in presence of steroidal pyrimidines (7-9) was analyzed by agarose gel electrophoresis and visualized by ethidium bromide staining (comet assay).

  13. Imidazolium tagged acridines: Synthesis, characterization and applications in DNA binding and anti-microbial activities

    NASA Astrophysics Data System (ADS)

    Raju, Gembali; Vishwanath, S.; Prasad, Archana; Patel, Basant K.; Prabusankar, Ganesan

    2016-03-01

    New water soluble 4,5-bis imidazolium tagged acridines have been synthesized and structurally characterized by multinuclear NMR and single crystal X-ray diffraction techniques. The DNA binding and anti-microbial activities of these acridine derivatives were investigated by fluorescence and far-UV circular dichroism studies.

  14. BLOCKAGE OF A-1 ADRENERGIC RECEPTOR INHIBOTS HEPATIC DNA SYNTHESIS STIMULATED BY TUMOR PROMOTERS

    EPA Science Inventory

    Studies with regenerating liver and hepatocyte cultures have shown that the a-1 adrenergic receptor (A1AR) is involved in the early events which transmit a mitogenic signal to hepatocytes after 2/3 partial hepatectomy. n this study, we investigated the role of A1AR in DNA synthes...

  15. Synthesis, crystal structure, DNA interaction and anticancer activity of tridentate copper(II) complexes.

    PubMed

    Li, Guan-Ying; Du, Ke-Jie; Wang, Jin-Quan; Liang, Jie-Wen; Kou, Jun-Feng; Hou, Xiao-Juan; Ji, Liang-Nian; Chao, Hui

    2013-02-01

    Three new tridentate copper(II) complexes [Cu(dthp)Cl(2)] (1) (dthp=2,6-di(thiazol-2-yl)pyridine), [Cu(dmtp)Cl(2)] (2) (dmtp=2,6-di(5-methyl-4H-1,2,4-triazol-3-yl)pyridine) and [Cu(dtp)Cl(2)] (3) (dtp=2,6-di(4H-1,2,4-triazol-3-yl)pyridine) have been synthesized and characterized. Crystal structure of complex 1 shows that the complex existed as distorted square pyramid with five co-ordination sites occupied by the tridentate ligand and the two chlorine anions. Ethidium bromide displacement assay, viscosity measurements, circular dichroism studies and cyclic voltammetric experiments suggested that these complexes bound to DNA via an intercalative mode. Three Cu(II) complexes were found to efficiently cleave DNA in the presence of sodium ascorbate, and singlet oxygen ((1)O(2)) and hydrogen peroxide were proved to contribute to the DNA cleavage process. They exhibited anticancer activity against HeLa, Hep-G2 and BEL-7402 cell lines. Nuclear chromatin cleavage has also been observed with AO/EB staining assay and the alkaline single-cell gel electrophoresis (comet assay). The results demonstrated that three Cu(II) complexes cause DNA damage that can induce the apoptosis of BEL-7402 cells. PMID:23186647

  16. Clarification of Orange Press Liquors by PVDF Hollow Fiber Membranes

    PubMed Central

    Simone, Silvia; Conidi, Carmela; Ursino, Claudia; Cassano, Alfredo; Figoli, Alberto

    2016-01-01

    Press liquors are typical by-products of the citrus juice processing characterized by a high content of organic compounds and associated problems of environmental impact, which imply high treatment costs. However, these wastes contain a great number of health promoting substances, including fibers, carotenoids and phenolic compounds (mainly flavonoids), whose recovery against waste-destruction technologies is very attractive for new business opportunities. In this work, the clarification of orange press liquor by using microfiltration (MF) membranes is studied as a preliminary step to obtain a permeate stream enriched in antioxidant compounds which can be further processed to produce extracts of nutraceutical and/or pharmaceutical interest. MF poly(vinylidene fluoride) (PVDF) hollow fibers were prepared by the dry/wet spinning technique. A series of fibers was produced from the same polymeric dope, in order to investigate the effect of selected spinning parameters, i.e., bore fluid composition and flowrate, on their properties. The morphology of the produced fibers was analyzed by Scanning Electron Microscopy (SEM). Fibers were further characterized for their mechanical properties, porosity, bubble point, pore size distribution and pure water permeability (PWP). Some of the produced fibers exhibited high permeability (pure water permeability ~530 L/m2·h·bar), coupled to good mechanical resistance and pore size in the range of MF membranes. These fibers were selected and used for the clarification of press liquor from orange peel processing. In optimized operating conditions, the selected fibers produced steady-state fluxes of about 41 L/m2·h with rejections towards polyphenols and total antioxidant activity of 4.1% and 1.4%, respectively. PMID:26805899

  17. Effect of adsorbent addition on floc formation and clarification.

    PubMed

    Younker, Jessica M; Walsh, Margaret E

    2016-07-01

    Adding adsorbent into the coagulation process is an emerging treatment solution for targeting hard-to-remove dissolved organic compounds from both drinking water and industrial wastewater. The impact of adding powdered activated carbon (PAC) or organoclay (OC) adsorbents with ferric chloride (FeCl3) coagulant was investigated in terms of potential changes to the coagulated flocs formed with respect to size, structure, and breakage and regrowth properties. The ability of dissolved air flotation (DAF) and sedimentation (SED) clarification processes to remove hybrid adsorbent-coagulant flocs was also evaluated through clarified water quality analysis of samples collected in bench-scale jar test experiments. The jar tests were conducted using both a synthetic fresh water and oily wastewater test water spiked with dissolved aromatic compounds phenol and naphthalene. Results of the study demonstrated that addition of adsorbent reduced the median coagulated floc size by up to 50% but did not affect floc strength or regrowth potential after application of high shear. Experimental results in fresh water demonstrated that sedimentation was more effective than DAF for clarification of both FeCl3-PAC and FeCl3-OC floc aggregates. However, experimental tests performed on the synthetic oily wastewater showed that coagulant-adsorbent floc aggregates were effectively removed with both DAF and sedimentation treatment, with lower residual turbidity achieved in clarified water samples than with coagulation treatment alone. Addition of OC or PAC into the coagulation process resulted in removals of over half, or nearly all of the dissolved aromatics, respectively. PMID:27064206

  18. Clarification of Orange Press Liquors by PVDF Hollow Fiber Membranes.

    PubMed

    Simone, Silvia; Conidi, Carmela; Ursino, Claudia; Cassano, Alfredo; Figoli, Alberto

    2016-01-01

    Press liquors are typical by-products of the citrus juice processing characterized by a high content of organic compounds and associated problems of environmental impact, which imply high treatment costs. However, these wastes contain a great number of health promoting substances, including fibers, carotenoids and phenolic compounds (mainly flavonoids), whose recovery against waste-destruction technologies is very attractive for new business opportunities. In this work, the clarification of orange press liquor by using microfiltration (MF) membranes is studied as a preliminary step to obtain a permeate stream enriched in antioxidant compounds which can be further processed to produce extracts of nutraceutical and/or pharmaceutical interest. MF poly(vinylidene fluoride) (PVDF) hollow fibers were prepared by the dry/wet spinning technique. A series of fibers was produced from the same polymeric dope, in order to investigate the effect of selected spinning parameters, i.e., bore fluid composition and flowrate, on their properties. The morphology of the produced fibers was analyzed by Scanning Electron Microscopy (SEM). Fibers were further characterized for their mechanical properties, porosity, bubble point, pore size distribution and pure water permeability (PWP). Some of the produced fibers exhibited high permeability (pure water permeability ~530 L/m²·h·bar), coupled to good mechanical resistance and pore size in the range of MF membranes. These fibers were selected and used for the clarification of press liquor from orange peel processing. In optimized operating conditions, the selected fibers produced steady-state fluxes of about 41 L/m²·h with rejections towards polyphenols and total antioxidant activity of 4.1% and 1.4%, respectively. PMID:26805899

  19. Synthesis of a drug delivery vehicle for cancer treatment utilizing DNA-functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Brann, Tyler

    The treatment of cancer with chemotherapeutic agents has made great strides in the last few decades but still introduces major systemic side effects. The potent drugs needed to kill cancer cells often cause irreparable damage to otherwise healthy organs leading to further morbidity and mortality. A therapy with intrinsic selective properties and/or an inducible activation has the potential to change the way cancer can be treated. Gold nanoparticles (GNPs) are biocompatible and chemically versatile tools that can be readily functionalized to serve as molecular vehicles. The ability of these particles to strongly absorb light with wavelengths in the therapeutic window combined with the heating effect of surface plasmon resonance makes them uniquely suited for noninvasive heating in biologic applications. Specially designed DNA aptamers have shown their ability to serve as drug carriers through intercalation as well as directly acting as therapeutic agents. By combining these separate molecules a multifaceted drug delivery vehicle can be created with great potential as a selective and controllable treatment for cancer. Oligonucleotide-coated GNPs have been created using spherical GNPs but little work has been reported using gold nanoplates in this way. Using the Diasynth method gold nanoplates were produced to absorb strongly in the therapeutic near infrared (nIR) window. These particles were functionalized with two DNA oligonucleotides: one serving as an intercalation site for doxorubicin, and another, AS1411, serving directly as an anticancer targeting/therapeutic agent. These functional particles were fully synthesized and processed along with confirmation of DNA functionalization and doxorubicin intercalation. Doxorubicin is released via denaturation of the DNA structure into which doxorubicin is intercalated upon the heating of the gold nanoplate well above the DNA melting temperature. This temperature increase, due to light stimulation of surface plasmon

  20. Synthesis, characterization, DNA-binding and cleavage studies of polypyridyl copper(II) complexes

    NASA Astrophysics Data System (ADS)

    Gubendran, Ammavasi; Rajesh, Jegathalaprathaban; Anitha, Kandasamy; Athappan, Periyakaruppan

    2014-10-01

    Six new mixed-ligand copper(II) complexes were synthesized namely [Cu(phen)2OAc]ClO4ṡH2O(1), [Cu(bpy)2OAc]ClO4ṡH2O(2), [Cu(o-ampacac)(phen)]ClO4(3), [Cu(o-ampbzac)(phen)]ClO4(4), [Cu(o-ampacac)(bpy)]ClO4(5), and [Cu(o-ampbzac)(bpy)]ClO4(6) (phen = 1,10-phenanthroline, bpy = 2, 2‧-bipyridine, o-ampacac = (Z)-4-(2-hydroxylamino)pent-3-ene-2-one,o-ampbzac = (Z)-4-(2-hydroxylamino)-4-phenylbut-3-ene-2-one)and characterized by UV-Vis, IR, EPR and cyclic voltammetry. Ligands were characterized by NMR spectra. Single crystal X-ray studies of the complex 1 shows Cu(II) ions are located in a highly distorted octahedral environment. Absorption spectral studies reveal that the complexes 1-6 exhibit hypochromicity during the interaction with DNA and binding constant values derived from spectral and electrochemical studies indicate that complexes 1, 2 and 3 bind strongly with DNA possibly by an intercalative mode. Electrochemical studies reveal that the complexes 1-4 prefer to bind with DNA in Cu(I) rather than Cu(II) form. The shift in the formal potentials E1/2 and CD spectral studies suggest groove or electrostatic binding mode for the complexes 4-6. Complex 1 can cleave supercoiled (SC) pUC18 DNA efficiently into nicked form II under photolytic conditions and into an open circular form (form II) and linear form (form III) in the presence of H2O2 at pH 8.0 and 37 °C, while the complex 2 does not cleave DNA under similar conditions.

  1. Synthesis and Functionalization of Gold Nanoparticles Using Chemically Modified ssDNA

    NASA Astrophysics Data System (ADS)

    Calabrese, P. G.

    In the first part of this thesis, methods for functionalizing spherical gold nanoparticles with nucleic acid binding ligands (aptamers) that target the VEGF receptor complex were developed. In order to provide a multiplexed labeling strategy for imaging the VEGF receptor complex in electron microscopy, gold nanoparticles of distinct sizes were conjugated to modified ssDNA aptamers that target the VEGF-A cytokine, the VEGFR-2 RTK receptor and a membrane associated co-receptor, Nrp-1. The modified ssDNA gold nanoparticle conjugates were applied to a human lung carcinoma cell line (A549) which has been shown to express each of these proteins and used as a model system for VEGF signaling. Binding constants for the modified aptamers were also determined using a fluorescence polarization anisotropy assay to determine KD and KOFF for the aptamers with their respective proteins. In the latter part of this thesis, a modied ssDNA SELEX protocol was also developed in order to evolve imidazole modied ssDNA sequences that assemble gold nanoparticles from Au3+ precursor ions in aqueous solution. Active sequences bound to nanoparticles were partitioned from inactive sequences based on density via ultracentrifugation through a discontinuous sucrose gradient. Colloidal gold solutions produced by the evolved pool had a distinct absorbance spectra and produced nanoparticles with a narrower distribution of sizes compared to colloidal gold solutions produced by the starting randomized pool of imidazole modified ssDNA. Sequencing data from the evolved pool shows that conserved 5 and 6 nt motifs were shared amongst many of the isolates, which indicates that these motifs could serve as chelation sites for gold atoms or help stabilize colloidal gold solutions in a base specific manner.

  2. Templated synthesis of monodisperse mesoporous maghemite/silica microspheres for magnetic separation of genomic DNA

    NASA Astrophysics Data System (ADS)

    Chen, Feng; Shi, Ruobing; Xue, Yun; Chen, Lei; Wan, Qian-Hong

    2010-08-01

    A novel method is described for the preparation of superparamagnetic mesoporous maghemite (γ-Fe 2O 3)/silica (SiO 2) composite microspheres to allow rapid magnetic separation of DNA from biological samples. With magnetite (Fe 3O 4) and silica nanoparticles as starting materials, such microspheres were synthesized by the following two consecutive steps: (1) formation of monodispersed organic/inorganic hybrid microspheres through urea-formaldedyde (UF) polymerization and (2) removal of the organic template and phase transformation of Fe 3O 4 to γ-Fe 2O 3 by calcination at elevated temperatures. The as-synthesized particles obtained by heating at temperature 300 °C feature spherical shape and uniform particle size ( dparticle=1.72 μm), high saturation magnetization ( Ms=17.22 emu/g), superparamagnetism ( Mr/ Ms=0.023), high surface area ( SBET=240 m 2/g), and mesoporosity ( dpore=6.62 nm). The composite microsphere consists of interlocked amorphous SiO 2 nanoparticles, in which cubic γ-Fe 2O 3 nanocrystals are homogeneously dispersed and thermally stable against γ- to α-phase transformation at temperatures up to 600 °C. With the exposed iron oxide nanoparticles coated with a thin layer of silica shell, the magnetic microspheres were used as a solid-phase adsorbent for rapid extraction of genomic DNA from plant samples. The results show that the DNA templates isolated from pea and green pepper displayed single bands with molecular weights greater than 8 kb and A260/ A280 values of 1.60-1.72. The PCR amplification of a fragment encoding the endogenous chloroplast ndhB gene confirmed that the DNA templates obtained were inhibitor-free and amenable to sensitive amplification-based DNA technologies.

  3. Inhibition of macrophage DNA synthesis by immunomodulators. II. Characterization of the suppression by muramyl dipeptide or lipopolysaccharide (/sup 3/H)thymidine incorporation into macrophages

    SciTech Connect

    Nagao, S.; Ikegami, S.; Tanaka, A.

    1984-12-01

    Guinea pig peritoneal exudate macrophages actively incorporated (/sup 3/H)thymidine into trichloroacetic acid-insoluble fraction in vitro. The incorporation of (/sup 3/H)thymidine was almost completely inhibited by aphidicolin, an inhibitor of DNA polymerase alpha and an autoradiograph showed heavy labeling in nuclei of 15% of macrophage populations. These results indicate that the observed thymidine incorporation was due to a nuclear DNA synthesis. The (/sup 3/H)thymidine incorporation was markedly suppressed when macrophages were activated by immunoadjuvants such as muramyl dipeptide (MDP) or bacterial lipopolysaccharide (LPS). The suppression of (/sup 3/H)thymidine incorporation by MDP was neither due to the decrease in thymidine transport through the cell membrane, nor due to dilution by newly synthesized cold thymidine. An autoradiograph revealed that MDP markedly decreased the number of macrophages the nuclei of which were labeled by (/sup 3/H)thymidine. These results suggest that the suppression of (/sup 3/H)thymidine incorporation by the immunoadjuvants reflects a true inhibition of DNA synthesis. The inhibition of DNA synthesis by MDP was also observed in vivo. Further, it was strongly suggested that the inhibition was not caused by some mediators, such as prostaglandin E2, released from macrophages stimulated by the immunoadjuvants but caused by a direct triggering of the adjuvants at least at the early stage of activation. Cyclic AMP appears to be involved in the inhibitory reaction.

  4. cis-Acting sequences in addition to donor and acceptor sites are required for template switching during synthesis of plus-strand DNA for duck hepatitis B virus.

    PubMed Central

    Havert, M B; Loeb, D D

    1997-01-01

    A characteristic of all hepadnaviruses is the relaxed-circular conformation of the DNA genome within an infectious virion. Synthesis of the relaxed-circular genome by reverse transcription requires three template switches. These template switches, as for the template switches or strand transfers of other reverse-transcribing genetic elements, require repeated sequences (the donor and acceptor sites) between which a complementary strand of nucleic acid is transferred. The mechanism for each of the template switches in hepadnaviruses is poorly understood. To determine whether sequences other than the donor and acceptor sites are involved in the template switches of duck hepatitis B virus (DHBV), a series of molecular clones which express viral genomes bearing deletion mutations were analyzed. We found that three regions of the DHBV genome, which are distinct from the donor and acceptor sites, are required for the synthesis of relaxed-circular DNA. One region, located near the 3' end of the minus-strand template, is required for the template switch that circularizes the genome. The other two regions, located in the middle of the genome and near DR2, appear to be required for plus-strand primer translocation. We speculate that these cis-acting sequences may play a role in the organization of the minus-strand DNA template within the capsid particle so that it supports efficient template switching during plus-strand DNA synthesis. PMID:9188603

  5. Suppression of dexamethasone-stimulated DNA synthesis in an oncogene construct containing rat cell line by a DNA site-oriented ligand of poly-ADP-ribose polymerase: 6-amino-1,2-benzopyrone

    SciTech Connect

    Kirsten, E.; Bauer, P.I.; Kun, E. San Francisco State Univ., CA )

    1991-03-01

    The cellular inhibitory effects of 6-amino-1,2-benzopyrone (6-ABP), a DNA site-specific ligand of adenosine diphosphoribosyl transferase (ADPRT), were determined in a dexamethasone-sensitive EJ-ras gene construct containing cell line (14C cells). Dexamethansone in vitro transforms these cells to a tumorigenic phenotype and also stimulates cell replication. AT a nontoxic concentration 6-ABP treatment of intact cells for 4 days inhibits the dexamethasone-stimulated increment of cellular DNA content, depresses replicative DNA synthesis as assayed by thymidine incorporation to the level of cells that were not exposed to dexamethasone, and in permeabilized cells reduces the dexamethasone-stimulated increase of deoxyribonucleotide incorporation into DNA to the level of untreated cells. In situ pulse labeling of cells pretreated with 6-ABP indicated an inhibition of DNA synthesis at a stage prior to the formation of the 10-kb intermediate species. Neither dexamethasone nor the drug influenced the cellular quantity of ADPRT molecules, tested immunochemically.

  6. TrfA-Dependent Inner Membrane-Associated Plasmid RK2 DNA Synthesis and Association of TrfA with Membranes of Different Gram-Negative Hosts

    PubMed Central

    Banack, Trevor; Kim, Peter D.; Firshein, William

    2000-01-01

    TrfA, the replication initiator protein of broad-host-range plasmid RK2, was tested for its ability to bind to the membrane of four different gram-negative hosts in addition to Escherichia coli: Pseudomonas aeruginosa, Pseudomonas putida, Salmonella enterica serovar Typhimurium, and Rhodobacter sphaeroides. Cells harboring TrfA-encoding plasmids were fractionated into soluble, inner membrane, and outer membrane fractions. The fractions were subjected to Western blotting, and the blots were probed with antibody to the TrfA proteins. TrfA was found to fractionate with the cell membranes of all species tested. When the two membrane fractions of these species were tested for their ability to synthesize plasmid DNA endogenously (i.e., without added template or enzymes), only the inner membrane fraction was capable of extensive synthesis that was inhibited by anti-TrfA antibody in a manner similar to that of the original host species, E. coli. In addition, although DNA synthesis did occur in the outer membrane fraction, it was much less extensive than that exhibited by the inner membrane fraction and only slightly affected by anti-TrfA antibody. Plasmid DNA synthesized by the inner membrane fraction of one representative species, P. aeruginosa, was characteristic of supercoil and intermediate forms of the plasmid. Extensive DNA synthesis was observed in the soluble fraction of another representative species, R. sphaeroides, but it was completely unaffected by anti-TrfA antibody, suggesting that such synthesis was due to repair and/or nonspecific chain extension of plasmid DNA fragments. PMID:10913068

  7. Synthesis of isatin thiosemicarbazones derivatives: In vitro anti-cancer, DNA binding and cleavage activities

    NASA Astrophysics Data System (ADS)

    Ali, Amna Qasem; Teoh, Siang Guan; Salhin, Abdussalam; Eltayeb, Naser Eltaher; Khadeer Ahamed, Mohamed B.; Majid, A. M. S. Abdul

    New derivatives of thiosemicarbazone Schiff base with isatin moiety were synthesized L1-L6. The structures of these compounds were characterized based on the spectroscopic techniques. Compound L6 was further characterized by XRD single crystal. The interaction of these compounds with calf thymus (CT-DNA) exhibited high intrinsic binding constant (kb = 5.03-33.00 × 105 M-1) for L1-L3 and L5 and (6.14-9.47 × 104 M-1) for L4 and L6 which reflect intercalative activity of these compounds toward CT-DNA. This result was also confirmed by the viscosity data. The electrophoresis studies reveal the higher cleavage activity of L1-L3 than L4-L6. The in vitro anti-proliferative activity of these compounds against human colon cancer cell line (HCT 116) revealed that the synthesized compounds (L3, L6 and L2) exhibited good anticancer potency.

  8. Synthesis, DNA binding and antiviral activity of new uracil, xanthine, and pteridine derivatives.

    PubMed

    El-Sabbagh, Osama I; El-Sadek, Mohamed E; El-Kalyoubi, Samar; Ismail, Ibrahim

    2007-01-01

    Some new 6-amino-1,3-dimethyl-5-(substituted methylidene)aminouracils were synthesized. Most of them were cyclized with triethyl orthoformate as a one-carbon source to afford 1,3-dime-thyl-6-substituted pteridine derivatives. Certain uracils gave xanthine instead of the expected pteridine derivatives upon using another one-carbon source such as triethyl orthoacetate or triethyl orthobenzoate. The nucleic acid binding assay revealed that some new compounds showed high affinity, chelation, and fragmentation of nucleic acids whether DNA or RNA contrary to acyclovir that has affinity to DNA only. The antiviral activity of these novel compounds showed that compounds 2e and 2f reduced the cytopathogencity of Peste des petits ruminant virus (PPRV) on Vero cell culture by 60 and 50%, respectively. PMID:17206606

  9. Inhibition of de novo NAD(+) synthesis by oncogenic URI causes liver tumorigenesis through DNA damage.

    PubMed

    Tummala, Krishna S; Gomes, Ana L; Yilmaz, Mahmut; Graña, Osvaldo; Bakiri, Latifa; Ruppen, Isabel; Ximénez-Embún, Pilar; Sheshappanavar, Vinayata; Rodriguez-Justo, Manuel; Pisano, David G; Wagner, Erwin F; Djouder, Nabil

    2014-12-01

    Molecular mechanisms responsible for hepatocellular carcinoma (HCC) remain largely unknown. Using genetically engineered mouse models, we show that hepatocyte-specific expression of unconventional prefoldin RPB5 interactor (URI) leads to a multistep process of HCC development, whereas its genetic reduction in hepatocytes protects against diethylnitrosamine (DEN)-induced HCC. URI inhibits aryl hydrocarbon (AhR)- and estrogen receptor (ER)-mediated transcription of enzymes implicated in L-tryptophan/kynurenine/nicotinamide adenine dinucleotide (NAD(+)) metabolism, thereby causing DNA damage at early stages of tumorigenesis. Restoring NAD(+) pools with nicotinamide riboside (NR) prevents DNA damage and tumor formation. Consistently, URI expression in human HCC is associated with poor survival and correlates negatively with L-tryptophan catabolism pathway. Our results suggest that boosting NAD(+) can be prophylactic or therapeutic in HCC. PMID:25453901

  10. Synthesis, spectroscopic characterization, DNA interaction and antibacterial study of metal complexes of tetraazamacrocyclic Schiff base

    NASA Astrophysics Data System (ADS)

    Shakir, Mohammad; Khanam, Sadiqa; Firdaus, Farha; Latif, Abdul; Aatif, Mohammad; Al-Resayes, Saud I.

    The template condensation reaction between benzil and 3,4-diaminotoulene resulted mononuclear 12-membered tetraimine macrocyclic complexes of the type, [MLCl2] [M = Co(II), Ni(II), Cu(II) and Zn(II)]. The synthesized complexes have been characterized on the basis of the results of elemental analysis, molar conductance, magnetic susceptibility measurements and spectroscopic studies viz. FT-IR, 1H and 13C NMR, FAB mass, UV-vis and EPR. An octahedral geometry has been envisaged for all these complexes, while a distorted octahedral geometry has been noticed for Cu(II) complex. Low conductivity data of all these complexes suggest their non-ionic nature. The interactive studies of these complexes with calf thymus DNA showed that the complexes are avid binders of calf thymus DNA. The in vitro antibacterial studies of these complexes screened against pathogenic bacteria proved them as growth inhibiting agents.

  11. Synthesis, Cytotoxicity, DNA Binding and Apoptosis of Rhein-Phosphonate Derivatives as Antitumor Agents

    PubMed Central

    Ye, Man-Yi; Yao, Gui-Yang; Wei, Jing-Chen; Pan, Ying-Ming; Liao, Zhi-Xin; Wang, Heng-Shan

    2013-01-01

    Several rhein-phosphonate derivatives (5a–c) were synthesized and evaluated for in vitro cytotoxicity against HepG-2, CNE, Spca-2, Hela and Hct-116 cell lines. Some compounds showed relatively high cytotoxicity. Especially compounds 5b exhibited the strongest cytotoxicity against HepG-2 and Spca-2 cells (IC50 was 8.82 and 9.01 μM), respectively. All the synthesized compounds exhibited low cytotoxicity against HUVEC cells. Further experiments proved that 5b could disturb the cell cycle in HepG-2 cells and induce apoptosis. In addition, the binding properties of a model conjugate 5b to DNA were investigated by methods (UV-Vis, fluorescence, CD spectroscopy). Results indicated that 5b showed moderate ability to interact ct-DNA. PMID:23629673

  12. The Eukaryotic Mismatch Recognition Complexes Track with the Replisome during DNA Synthesis

    PubMed Central

    Haye, Joanna E.; Gammie, Alison E.

    2015-01-01

    During replication, mismatch repair proteins recognize and repair mispaired bases that escape the proofreading activity of DNA polymerase. In this work, we tested the model that the eukaryotic mismatch recognition complex tracks with the advancing replisome. Using yeast, we examined the dynamics during replication of the leading strand polymerase Polε using Pol2 and the eukaryotic mismatch recognition complex using Msh2, the invariant protein involved in mismatch recognition. Specifically, we synchronized cells and processed samples using chromatin immunoprecipitation combined with custom DNA tiling arrays (ChIP-chip). The Polε signal was not detectable in G1, but was observed at active origins and replicating DNA throughout S-phase. The Polε signal provided the resolution to track origin firing timing and efficiencies as well as replisome progression rates. By detecting Polε and Msh2 dynamics within the same strain, we established that the mismatch recognition complex binds origins and spreads to adjacent regions with the replisome. In mismatch repair defective PCNA mutants, we observed that Msh2 binds to regions of replicating DNA, but the distribution and dynamics are altered, suggesting that PCNA is not the sole determinant for the mismatch recognition complex association with replicating regions, but may influence the dynamics of movement. Using biochemical and genomic methods, we provide evidence that both MutS complexes are in the vicinity of the replisome to efficiently repair the entire spectrum of mutations during replication. Our data supports the model that the proximity of MutSα/β to the replisome for the efficient repair of the newly synthesized strand before chromatin reassembles. PMID:26684201

  13. Association between early inhibition of DNA synthesis and the MICs and MBCs of carboxyquinolone antimicrobial agents for wild-type and mutant [gyrA nfxB(ompF) acrA] Escherichia coli K-12.

    PubMed Central

    Chow, R T; Dougherty, T J; Fraimow, H S; Bellin, E Y; Miller, M H

    1988-01-01

    Quinolone antimicrobial agents are known to interact with DNA gyrase, but the mechanism by which bacterial cell death occurs is not fully understood. In order to determine whether there is a correlation between quinolone-induced inhibition of early (i.e., 10 to 15 min) DNA synthesis and potency (MICs and MBCs), we measured the rate of DNA synthesis in log-phase Escherichia coli K-12 by using [3H]thymidine incorporation. Three quinolones (ciprofloxacin, norfloxacin, and difloxacin) were selected based on their decreasing activity against reference strain KL16. All three quinolones caused an early 50% inhibition of DNA synthesis which was proportional to MICs and MBCs (r greater than 0.99). Furthermore, 50% inhibition of DNA synthesis and MICs were nearly identical for mutant strains with an altered quinolone target (gyrA) or with decreased [nfxB(ompF)] or increased (acrA) permeability. There were significant differences (P less than 0.001) between individual quinolones in the degree of DNA synthesis inhibition in nalidixic acid-resistant gyrA and nfxB(ompF) mutant strains. The comparison of the three mutants with the wild-type strain permitted an in vivo examination of the effects of alterations of the drug target or entry on the activity determined by DNA synthesis inhibition and MICs. PMID:3056251

  14. Click Reaction on Solid Phase Enables High Fidelity Synthesis of Nucleobase-Modified DNA.

    PubMed

    Tolle, Fabian; Rosenthal, Malte; Pfeiffer, Franziska; Mayer, Günter

    2016-03-16

    The post-synthetic functionalization of nucleic acids via click chemistry (CuAAC) has seen tremendous implementation, extending the applicability of nucleobase-modified nucleic acids in fields like fluorescent labeling, nanotechnology, and in vitro selection. However, the production of large quantities of high-density functionalized material via solid phase synthesis has been hampered by oxidative by-product formation associated with the alkaline workup conditions. Herein, we describe a rapid and cost-effective protocol for the high fidelity large-scale production of nucleobase-modified nucleic acids, exemplified with a recently described nucleobase-modified aptamer. PMID:26850226

  15. Synthesis, G-quadruplexes DNA binding, and photocytotoxicity of novel cationic expanded porphyrins.

    PubMed

    Jin, Shu-fang; Zhao, Ping; Xu, Lian-cai; Zheng, Min; Lu, Jia-zheng; Zhao, Peng-liang; Su, Qiu-lan; Chen, Hui-xian; Tang, Ding-tong; Chen, Jiong; Lin, Jia-qi

    2015-06-01

    Intensive reports allowed the conclusion that molecules with extended aromatic surfaces always do good jobs in the DNA interactions. Inspired by the previous successful researches, herein, we designed a series of cationic porphyrins with expanded planar substituents, and evaluated their binding behaviors to G-quadruplex DNA using the combination of surface-enhanced raman, circular dichroism, absorption spectroscopy and fluorescence resonance energy transfer melting assays. Asymmetrical tetracationic porphyrin with one phenyl-4-N-methyl-4-pyridyl group and three N-methyl-4-pyridyl groups exhibit the best G4-DNA binding affinities among all the designed compounds, suggesting that the bulk of the substituents should be matched to the width of the grooves they putatively lie in. Theoretical calculations applying the density functional theory have been carried out and explain the binding properties of these porphyrins reasonably. Meanwhile, these porphyrins were proved to be potential photochemotherapeutic agents since they have photocytotoxic activities against both myeloma cell (Ag8.653) and gliomas cell (U251) lines. PMID:25989424

  16. Copper(II) complexes of substituted salicylaldehyde dibenzyl semicarbazones: synthesis, cytotoxicity and interaction with quadruplex DNA.

    PubMed

    Munira Haidad Ali, Siti; Yan, Yaw-Kai; Lee, Peter P F; Khong, Kenny Zhi Xiang; Alam Sk, Mahasin; Lim, Kok Hwa; Klejevskaja, Beata; Vilar, Ramon

    2014-01-21

    A series of substituted salicylaldehyde dibenzyl semicarbazones [RC6H3(OH)CH=N-NHCON(CH2Ph)2] and their copper(II) complexes were synthesized and characterized. The chloridocopper(II) complexes of the 4-OH and 5-OH substituted ligands (complexes 9 and 7) show modest affinity and good selectivity (over duplex DNA) for the quadruplex formed from the human telomeric (HTelo) DNA sequence. Substitution of the chlorido ligands of these two complexes with pyridine yielded derivatives (7-py and 9-py) with increased affinity for HTelo. These derivatives also show good selectivity for HTelo over calf-thymus DNA (170- and 211-fold, respectively). The X-ray crystal structures of 9 and 9-py were determined. Molecular docking studies based on these structures show that the complexes stack on the 5'-end of the HTelo quadruplex, with the hydroxyl group forming a hydrogen bond with a guanine residue. Complexes 7, 9, 7-py and 9-py display significant cytotoxicity against MOLT-4 human leukaemia cells. Interestingly, they have low to negligible cytotoxicity against the non-cancerous IMR-90 human fibroblasts. PMID:24202733

  17. RNA involvement in T4 DNA synthesis in toluene-treated cells.

    PubMed

    Dicou, E

    1980-01-01

    In T4-infected cells made permeable with toluene, pulses with [(alpha-32P deoxyribonucleoside triphosphates demonstrated covalent linkage of RNA to DNA of the Okazaki fragments. Analysis of the transfer of the 32P label to the 2'(3') ribonucleoside monophosphates indicated that the 3'-end of the RNA primer is heterogeneous. The most frequently encountered ribonucleotide was rCMP, but also transfer to rUMP, rAMP and rGMP occurred at different frequencies. In contrast, no heterogeneity was observed for the deoxyribonucleoside at the RNA-DNA junction. Of all the [to-32P] deoxyribonucleoside triphosphates tested, transfer of the 32P label to 2'(3') rNMPs was predominant when [alpha32P] dGTP was the substrate, indicating that the deoxyribonucleoside most frequently encountered at the RNA-DNA linkage is dG. These observations suggest that the starts for the Okazaki fragments may occur at unique sites of the T4 genome. PMID:17941178

  18. Synthesis, spectral characterization, DNA interaction, radical scavenging and cytotoxicity studies of ruthenium(II) hydrazone complexes.

    PubMed

    Mohanraj, Maruthachalam; Ayyannan, Ganesan; Raja, Gunasekaran; Jayabalakrishnan, Chinnasamy

    2016-05-01

    Three new ruthenium(II) complexes with hydrazone ligands, furan-2-carboxylic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL(1)), furan-2-carboxylic acid [4-(ethyl-propyl-amino)-2-hydroxy-benzylidene]-hydrazide (HL(2)) and furan-2-carboxylic acid (3-ethoxy-2-hydroxy-benzylidene)-hydrazide (HL(3)) were synthesized and characterized by various spectro-analytical techniques. The hydrazone ligands act as a tridendate ligand with ONO as the donor sites and are preferably found in the enol form in all the complexes. The molecular structure of the ligands was determined by single crystal X-ray diffraction technique. The interaction of the ligands and the complexes with CT-DNA were evaluated by an absorption titration method which revealed that the compounds interact with CT-DNA through intercalation. Gel electrophoresis assay demonstrated the ability of the complexes to cleave the calf thymus DNA hydrolytically. Antioxidant studies showed that the ruthenium(II) complexes have a strong radical-scavenging properties. Further, the cytotoxic effect of the compounds examined on cancerous cell lines showed that the complexes exhibited substantial anticancer activity. PMID:26974577

  19. DNA synthesis in generation 1 in x-irradiated HeLa cells

    SciTech Connect

    Hawkins, R.B.; Tolmach, L.J.; Griffiths, T.D.

    1981-01-01

    Measurements of DNA replication in a line of HeLa S3 cells during the generation (Generation 1) following that in which the cells are irradiated with 500 rad of 220-kV x rays (Generation 0) were carried out according to a number of different experimental protocols. These involved preirradiation labeling of the cells with low levels of (/sup 14/C) thymidine in Generation-1 to provide a measure of the template DNA, synchronization by mitotic collection in Generation 0, resynchronization by either mitotic recollection or temporary drug-induced blockages in Generation 1, and either labeled-thymidine incorporation or density-label transfer during Generation 1. The results show that those cells that progress through S phase of Generation 1 and divide at the next mitosis replicate a full complement of DNA. However, apparent deficits of as much as 45% are measured if resynchronization in Generation 1 is effected by drug tretment following manipulations of the culture in the presence of particular media and drugs during Generation 0. These are attributed to combined radiation- and drug-induced disturbances in cell progression.

  20. Peptidyl anthraquinones as potential antineoplastic drugs: synthesis, DNA binding, redox cycling, and biological activity.

    PubMed

    Gatto, B; Zagotto, G; Sissi, C; Cera, C; Uriarte, E; Palù, G; Capranico, G; Palumbo, M

    1996-08-01

    A series of new compounds containing a 9,10-anthracenedione moiety and one or two peptide chains at position 1 and/or 4 have been synthesized. The amino acid residues introduced are glycine (Gly), lysine (Lys), and tryptophan (Trp), the latter two in both the L- and D-configurations. The peptidyl anthraquinones maintain the ability of intercalating efficiently into DNA, even though the orientation within the base-pair pocket may change somewhat with reference to the parent drugs mitoxantrone (MX) and ametantrone (AM). The interaction constants of the mono-, di-, and triglycyl derivatives are well comparable to those found for AM but 5-10 times lower than the value reported for MX. On the other hand, the glycyl-lysyl compounds bind DNA to the same extent as (L-isomer) or even better than (D-isomer) MX. As for the parent drugs without peptidyl chains, the new compounds prefer alternating CG binding sites, although to different extents. The bis-Gly-Lys derivatives are the least sensitive to base composition, which may be due to extensive aspecific charged interactions with the polynucleotide backbone. As far as redox properties are concerned, all peptidyl anthraquinones show a reduction potential very close to that of AM and 60-80 mV less negative than that of MX; hence, they can produce free-radical-damaging species to an extent similar to the parent drugs. The biological activity has been tested in human tumor and murine leukemia cell lines. Most of the test anthraquinones exhibit cytotoxic properties close to those of AM and considerably lower than those of MX. Stimulation of topoisomerase-mediated DNA cleavage is moderately present in representatives of the glycylanthraquinone family, whereas inhibition of the background cleavage occurs when Lys is present in the peptide chain. For most of the test anthraquinones, the toxicity data are in line with the DNA affinity scale and the topoisomerase II stimulation activity. However, in the lysyl derivatives, for which

  1. p53-dependent but ATM-independent inhibition of DNA synthesis and G2 arrest in cadmium-treated human fibroblasts

    SciTech Connect

    Cao Feng |; Zhou Tong; Simpson, Dennis; Zhou Yingchun; Boyer, Jayne; Chen Bo |; Jin Taiyi; Cordeiro-Stone, Marila; Kaufmann, William . E-mail: wkarlk@med.unc.edu

    2007-01-15

    This study focused on the activation of cell cycle checkpoint responses in diploid human fibroblasts that were treated with cadmium chloride and the potential roles of ATM and p53 signaling pathways in cadmium-induced responses. The alkaline comet assay indicated that cadmium caused a dose-dependent increase in DNA damage. Cells that were rendered p53-defective by expression of a dominant-negative p53 allele or knockdown of p53 mRNA were more resistant to cadmium-induced inactivation of colony formation than normal and ataxia telangiectasia (AT) cells. Synchronized fibroblasts in S were more sensitive to cadmium toxicity than cells in G1, suggesting that cadmium may target some element of DNA replication. Cadmium produced a dose- and time-dependent inhibition of DNA synthesis. An immediate inhibition was associated with severe delay in progression through S phase and a delayed inhibition seen 24 h after treatment was associated with accumulation of cells in G2. AT and normal cells displayed similar patterns of inhibition of DNA synthesis and G2 delay after treatment with cadmium, while p53-defective cells displayed significantly less of the delayed inhibition of DNA synthesis and accumulation in G2 post-treatment. Total p53 protein and ser15-phosphorylated p53 were induced by cadmium in normal and AT cells. The p53 transactivation target Gadd45{alpha} was induced in both p53-effective and p53-defective cells after 4 h cadmium treatment, and this was associated with an acute inhibition of mitosis. Cadmium produced a very unusual pattern of toxicity in human fibroblasts, inhibiting DNA replication and inducing p53-dependent growth arrest but without induction of p21{sup Cip1/Waf1} or activation of Chk1.

  2. A robust two-step PCR method of template DNA production for high-throughput cell-free protein synthesis.

    PubMed

    Yabuki, Takashi; Motoda, Yoko; Hanada, Kazuharu; Nunokawa, Emi; Saito, Miyuki; Seki, Eiko; Inoue, Makoto; Kigawa, Takanori; Yokoyama, Shigeyuki

    2007-12-01

    A two-step PCR method has been developed for the robust, high-throughput production of linear templates ready for cell-free protein synthesis. The construct made from the cDNA expresses a target protein region with N- and/or C-terminal tags. The procedure consists only of mixing, dilution, and PCR steps, and is free from cloning and purification steps. In the first step of the two-step PCR, a target region within the coding sequence is amplified using two gene-specific forward and reverse primers, which contain the linker sequences and the terminal sequences of the target region. The second PCR concatenates the first PCR product with the N- and C-terminal double-stranded fragments, which contain the linker sequences as well as the sequences for the tag(s) and the initiation and termination, respectively, for T7 transcription and ribosomal translation, and amplifies it with the universal primer. Proteins can be fused with a variety of tags, such as natural poly-histidine, glutathione-S-transferase, maltose-binding protein, and/or streptavidin-binding peptide. The two-step PCR method was successfully applied to 42 human target protein regions with various GC contents (38-77%). The robustness of the two-step PCR method against possible fluctuations of experimental conditions in practical use was explored. The second PCR product was obtained at 60-120 microg/ml, and was used without purification as a template at a concentration of 2-4 microg/ml in an Escherichia coli coupled transcription-translation system. This combination of two-step PCR with cell-free protein synthesis is suitable for the rapid production of proteins in milligram quantities for genome-scale studies. PMID:18167031

  3. Phylogenomically Guided Identification of Industrially Relevant GH1 β-Glucosidases through DNA Synthesis and Nanostructure-Initiator Mass Spectrometry

    PubMed Central

    2015-01-01

    Harnessing the biotechnological potential of the large number of proteins available in sequence databases requires scalable methods for functional characterization. Here we propose a workflow to address this challenge by combining phylogenomic guided DNA synthesis with high-throughput mass spectrometry and apply it to the systematic characterization of GH1 β-glucosidases, a family of enzymes necessary for biomass hydrolysis, an important step in the conversion of lignocellulosic feedstocks to fuels and chemicals. We synthesized and expressed 175 GH1s, selected from over 2000 candidate sequences to cover maximum sequence diversity. These enzymes were functionally characterized over a range of temperatures and pHs using nanostructure-initiator mass spectrometry (NIMS), generating over 10,000 data points. When combined with HPLC-based sugar profiling, we observed GH1 enzymes active over a broad temperature range and toward many different β-linked disaccharides. For some GH1s we also observed activity toward laminarin, a more complex oligosaccharide present as a major component of macroalgae. An area of particular interest was the identification of GH1 enzymes compatible with the ionic liquid 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), a next-generation biomass pretreatment technology. We thus searched for GH1 enzymes active at 70 °C and 20% (v/v) [C2mim][OAc] over the course of a 24-h saccharification reaction. Using our unbiased approach, we identified multiple enzymes of different phylogentic origin with such activities. Our approach of characterizing sequence diversity through targeted gene synthesis coupled to high-throughput screening technologies is a broadly applicable paradigm for a wide range of biological problems. PMID:24984213

  4. Phylogenomically guided identification of industrially relevant GH1 β-glucosidases through DNA synthesis and nanostructure-initiator mass spectrometry.

    PubMed

    Heins, Richard A; Cheng, Xiaoliang; Nath, Sangeeta; Deng, Kai; Bowen, Benjamin P; Chivian, Dylan C; Datta, Supratim; Friedland, Gregory D; D'Haeseleer, Patrik; Wu, Dongying; Tran-Gyamfi, Mary; Scullin, Chessa S; Singh, Seema; Shi, Weibing; Hamilton, Matthew G; Bendall, Matthew L; Sczyrba, Alexander; Thompson, John; Feldman, Taya; Guenther, Joel M; Gladden, John M; Cheng, Jan-Fang; Adams, Paul D; Rubin, Edward M; Simmons, Blake A; Sale, Kenneth L; Northen, Trent R; Deutsch, Samuel

    2014-09-19

    Harnessing the biotechnological potential of the large number of proteins available in sequence databases requires scalable methods for functional characterization. Here we propose a workflow to address this challenge by combining phylogenomic guided DNA synthesis with high-throughput mass spectrometry and apply it to the systematic characterization of GH1 β-glucosidases, a family of enzymes necessary for biomass hydrolysis, an important step in the conversion of lignocellulosic feedstocks to fuels and chemicals. We synthesized and expressed 175 GH1s, selected from over 2000 candidate sequences to cover maximum sequence diversity. These enzymes were functionally characterized over a range of temperatures and pHs using nanostructure-initiator mass spectrometry (NIMS), generating over 10,000 data points. When combined with HPLC-based sugar profiling, we observed GH1 enzymes active over a broad temperature range and toward many different β-linked disaccharides. For some GH1s we also observed activity toward laminarin, a more complex oligosaccharide present as a major component of macroalgae. An area of particular interest was the identification of GH1 enzymes compatible with the ionic liquid 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), a next-generation biomass pretreatment technology. We thus searched for GH1 enzymes active at 70 °C and 20% (v/v) [C2mim][OAc] over the course of a 24-h saccharification reaction. Using our unbiased approach, we identified multiple enzymes of different phylogentic origin with such activities. Our approach of characterizing sequence diversity through targeted gene synthesis coupled to high-throughput screening technologies is a broadly applicable paradigm for a wide range of biological problems. PMID:24984213

  5. Macrocyclic nickel(II) complexes: Synthesis, characterization, superoxide scavenging activity and DNA-binding

    NASA Astrophysics Data System (ADS)

    Ramadan, Abd El-Motaleb M.

    2012-05-01

    A new series of nickel(II) complexes with the tetraaza macrocyclic ligand have been synthesized as possible functional models for nickel-superoxide dismutase enzyme. The reaction of 5-amino-3-methyl-1-phenylpyrazole-4-carbaldehyde (AMPC) with itself in the presence of nickel(II) ion yields, the new macrocyclic cationic complex, [NiL(NO3)2], containing a ligand composed of the self-condensed AMPC (4 mol) bound to a single nickel(II) ion. A series of metathetical reactions have led to the isolation of a number of newly complexes of the types [NiL]X2; X = ClO4 and BF4, [NiLX2], X = Cl and Br (Scheme 1). Structures and characterizations of these complexes were achieved by several physicochemical methods namely, elemental analysis, magnetic moment, conductivity, and spectral (IR and UV-Vis) measurements. The electrochemical properties and thermal behaviors of these chelates were investigated by using cyclic voltammetry and thermogravimetric analysis (TGA and DTG) techniques. A distorted octahedral stereochemistry has been proposed for the six-coordinate nitrato, and halogeno complexes. For the four-coordinate, perchlorate and fluoroborate, complex species a square-planar geometry is proposed. The measured superoxide dismutase mimetic activities of the complexes indicated that they are potent NiSOD mimics and their activities are compared with those obtained previously for nickel(II) complexes. The probable mechanistic implications of the catalytic dismutation of O2rad - by the synthesized nickel(II) complexes are discussed. The DNA-binding properties of representative complexes [NiLCl2] and [NiL](PF4)2 have been investigated by the electronic absorption and fluorescence measurements. The results obtained suggest that these complexes bind to DNA via an intercalation binding mode and the binding affinity for DNA follows the order: [NiLCl2] □ [NiL](PF4)2.

  6. Synthesis, cytotoxicity, DNA interaction and cell cycle studies of trans-diiodophosphine Pt(II) complexes.

    PubMed

    Medrano, Angeles; Dennis, Stephen M; Alvarez-Valdés, Amparo; Perles, Josefina; McGregor Mason, Tracey; Quiroga, Adoracion G

    2015-02-28

    Platinum complexes, bearing aliphatic amines and phosphine ligands in trans configuration with iodide as leaving groups, are synthesized and characterized. The crystal structure of trans-PtI2(isopropylamine)(PPh3) is reported. The complex bearing isopropylamine is demonstrated to be the best candidate as its cytotoxic activity is comparable to or better than cisplatin. A remarkably higher interaction of the complexes with DNA is reported as compared to the parent chlorido series. Cell cycle studies of the complexes in six human cell lines are performed and also compared with the previous series. PMID:25310702

  7. Synthesis, DNA-binding, photocleavage, cytotoxicity and antioxidant activity of ruthenium (II) polypyridyl complexes.

    PubMed

    Liu, Yun-Jun; Zeng, Cheng-Hui; Huang, Hong-Liang; He, Li-Xin; Wu, Fu-Hai

    2010-02-01

    Two new ligands maip (1a), paip (1b) with their ruthenium (II) complexes [Ru(bpy)(2)(maip)](ClO(4))(2) (2a) and [Ru(bpy)(2)(paip)](ClO(4))(2) (2b) have been synthesized and characterized. The results show that complexes 2a and 2b interact with DNA through intercalative mode. The cytotoxicity of these compounds has been evaluated by MTT assay. The experiments on antioxidant activity show that these compounds exhibit good antioxidant activity against hydroxyl radical (OH). PMID:19932529

  8. DNA Three Way Junction Core Decorated with Amino Acids-Like Residues-Synthesis and Characterization.

    PubMed

    Addamiano, Claudia; Gerland, Béatrice; Payrastre, Corinne; Escudier, Jean-Marc

    2016-01-01

    Construction and physico-chemical behavior of DNA three way junction (3WJ) functionalized by protein-like residues (imidazole, alcohol and carboxylic acid) at unpaired positions at the core is described. One 5'-C(S)-propargyl-thymidine nucleotide was specifically incorporated on each strand to react through a post synthetic CuACC reaction with either protected imidazolyl-, hydroxyl- or carboxyl-azide. Structural impacts of 5'-C(S)-functionalization were investigated to evaluate how 3WJ flexibility/stability is affected. PMID:27563857

  9. Regulation of DNA synthesis at the first cell cycle in the sea urchin in vivo.

    PubMed

    Kisielewska, Jolanta; Whitaker, Michael

    2014-01-01

    Using fluorescent and non-fluorescent recombinant proteins has proved to be a very successful technique for following postfertilization events, in both male and female pronuclei during the first cell cycle of sea urchin in vivo. Proteins and dyes are introduced by microinjection into the unfertilized egg, and their function can be monitored by fluorescence or confocal/two-photon (2P) and transmitted light microscopy after insemination. Here, we describe expression and purification of GFP/RFP-tagged proteins involved in regulation of DNA replication. We also explain the techniques used to introduce recombinant proteins and fluorescent tubulin into sea urchin eggs and embryos. PMID:24567218

  10. Synthesis of DNA containing the simian virus 40 origin of replication by the combined action of DNA polymerases alpha and delta.

    PubMed Central

    Lee, S H; Eki, T; Hurwitz, J

    1989-01-01

    Proliferating-cell nuclear antigen (PCNA) mediates the replication of simian virus 40 (SV40) DNA by reversing the effects of a protein that inhibits the elongation reaction. Two other protein fractions, activator I and activator II, were also shown to play important roles in this process. We report that activator II isolated from HeLa cell extracts is a PCNA-dependent DNA polymerase delta that is required for efficient replication of DNA containing the SV40 origin of replication. PCNA-dependent DNA polymerase delta on a DNA singly primed phi X174 single-stranded circular DNA template required PCNA, a complex of the elongation inhibitor and activator I, and the single-stranded DNA-binding protein essential for SV40 DNA replication. DNA polymerase delta, in contrast to DNA polymerase alpha, hardly used RNA-primed DNA templates. These results indicate that both DNA polymerase alpha and delta are involved in SV40 DNA replication in vitro and their activity depends on PCNA, the elongation inhibitor, and activator I. Images PMID:2571990

  11. Novel Coumarin-Containing Aminophosphonatesas Antitumor Agent: Synthesis, Cytotoxicity, DNA-Binding and Apoptosis Evaluation.

    PubMed

    Li, Ya-Jun; Wang, Cai-Yi; Ye, Man-Yi; Yao, Gui-Yang; Wang, Heng-Shan

    2015-01-01

    A series of novel coumarin-containing α-aminophosphonates were synthesized and evaluated for their antitumor activities against Human colorectal (HCT-116), human nasopharyngeal carcinoma (human KB) and human lung adenocarcinoma (MGC-803) cell lines in vitro. Compared with 7-hydroxy-4-methylcoumarin (4-MU), most of the derivatives showed an improved antitumor activity. Compound 8j (diethyl 1-(3-(4-methyl-2-oxo-2H-chromen-7-yloxy) propanamido)-1-phenylethyl-Phosphonate), with IC50 value of 8.68 μM against HCT-116 cell lines, was about 12 fold than that of unsubstituted parent compound. The mechanism investigation proved that 8c, 8d, 8f and 8j were achieved through the induction of cell apoptosis by G1 cell-cycle arrest. In addition, the further mechanisms of compound 8j-induced apoptosis in HCT-116 cells demonstrated that compound 8j induced the activations of caspase-9 and caspase-3 for causing cell apoptosis, and altered anti- and pro-apoptotic proteins. DNA-binding experiments suggested that some derivatives bind to DNA through intercalation. The results seem to imply the presence of an important synergistic effect between coumarin and aminophosphonate, which could contribute to the strong chelating properties of aminophosphonate moiety. PMID:26287139

  12. Novel Pt(II) complexes containing pyrrole oxime; synthesis, characterization and DNA binding studies

    NASA Astrophysics Data System (ADS)

    Erdogan, Deniz Altunoz; Özalp-Yaman, Şeniz

    2014-05-01

    Since the discovery of anticancer activity and subsequent clinical success of cisplatin (cis-[PtCl2(NH3)2]), platinum-based compounds have since been widely synthesized and studied as potential chemotherapeutic agents. In this sense, three novel nuclease active Pt(II) complexes with general formula; [Pt(NH3)Cl(L)] (1), [Pt(L)2] (2), and K[PtCl2(L)] (3) in which L is 1-H-pyrrole-2-carbaldehyde oxime were synthesized. Characterization of complexes was performed by elemental analysis, FT-IR, 1H NMR and mass spectroscopy measurements. Interaction of complexes (1-3) with calf thymus deoxyribonucleic acid (ct-DNA) was investigated by using electrochemical, spectroelectrochemical methods and cleavage studies. The hyperchromic change in the electronic absorption spectrum of the Pt(II) complexes indicates an electrostatic interaction between the complexes and ct-DNA. Binding constant values between 4.42 × 103 and 5.09 × 103 M-1 and binding side size values between 2 and 3 base pairs were determined from cyclic voltammetry (CV) and differential pulse voltammetry (DPV) studies.

  13. Synthesis, structural characterization, cytotoxic properties and DNA binding of a dinuclear copper(II) complex.

    PubMed

    Ferreira, B J M Leite; Brandão, P; Meireles, M; Martel, Fátima; Correia-Branco, Ana; Fernandes, Diana M; Santos, T M; Félix, V

    2016-08-01

    In this study a novel dinuclear copper(II) complex with adenine and phenanthroline has been synthesized and its structure determined by single crystal X-ray diffraction. In the dinuclear complex [Cu₂(μ-adenine)₂(phen)₂(H2O)2](NO3)4·0.5H2O (phen=1,10-phenanthroline) (1) the two Cu(II) centres exhibit a distorted square pyramidal coordination geometry linked by two nitrogen donors from adenine bridges leading to a Cu-Cu distance of 3.242(3)Å. Intramolecular and intermolecular π⋯π interactions as well as an H-bonding network were observed. The antitumor capacity of the complex has been tested in vitro against human cancer cell lines, cervical carcinoma (HeLa) and colorectal adenocarcinoma (Caco-2), by metabolic tests, using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide as reagent. The complex 1 has remarkable low IC50 values of 0.87±0.06μM (HeLa) and 0.44±0.06μM (Caco-2), when compared with values for cisplatin against the same cell lines. The interaction of complex 1 with calf thymus DNA (CT DNA) was further investigated by absorption and fluorescence spectroscopic methods. A binding constant of 5.09×10(5)M(-1) was obtained from UV-vis absorption studies. PMID:27157979

  14. Regulating the anticancer properties of organometallic dendrimers using pyridylferrocene entities: synthesis, cytotoxicity and DNA binding studies.

    PubMed

    Govender, Preshendren; Riedel, Tina; Dyson, Paul J; Smith, Gregory S

    2016-06-21

    A new series of eight first- and second-generation heterometallic ferrocenyl-derived metal-arene metallodendrimers, containing ruthenium(ii)-p-cymene, ruthenium(ii)-hexamethylbenzene, rhodium(iii)-cyclopentadienyl or iridium(iii)-cyclopentadienyl moieties have been prepared. The metallodendrimers were synthesized by first reacting DAB-(NH2)n (where n = 4 or 8, DAB = diaminobutane) with salicylaldehyde, and then the Schiff-base dendritic ligands were reacted in a one-pot reaction with the appropriate [(η(6)-p-iPrC6H4Me)RuCl2]2, [(η(6)-C6Me6)RuCl2]2, [(η(5)-C5Me5)IrCl2]2 or [(η(5)-C5Me5)RhCl2]2 dimers, in the presence of 4-pyridylferrocene. Heterometallic binuclear analogues were prepared as models of the larger metallodendrimers. All complexes have been characterized using analytical and spectroscopic methods. The cytotoxicity of the heterometallic metallodendrimers and their binuclear analogues were evaluated against A2780 cisplatin-sensitive and A2780cisR cisplatin-resistant human ovarian cancer cell lines and against a non-tumorigenic HEK-293 human embryonic kidney cell line. The second generation Ru(ii)-η(6)-C6Me6 metallodendrimer is the most cytotoxic and selective compound. DNA binding experiments reveal that a possible mode-of-action of these compounds involves non-covalent interactions with DNA. PMID:27193373

  15. Metformin inhibition of mTORC1 activation, DNA synthesis and proliferation in pancreatic cancer cells: Dependence on glucose concentration and role of AMPK

    SciTech Connect

    Sinnett-Smith, James; Kisfalvi, Krisztina; Kui, Robert; Rozengurt, Enrique

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Metformin inhibits cancer cell growth but the mechanism(s) are not understood. Black-Right-Pointing-Pointer We show that the potency of metformin is sharply dependent on glucose in the medium. Black-Right-Pointing-Pointer AMPK activation was enhanced in cancer cells incubated in physiological glucose. Black-Right-Pointing-Pointer Reciprocally, metformin potently inhibited mTORC1, DNA synthesis and proliferation. Black-Right-Pointing-Pointer Metformin, at low concentrations, inhibited DNA synthesis through AMPK. -- Abstract: Metformin, a widely used anti-diabetic drug, is emerging as a potential anticancer agent but the mechanisms involved remain incompletely understood. Here, we demonstrate that the potency of metformin induced AMPK activation, as shown by the phosphorylation of its substrates acetyl-CoA carboxylase (ACC) at Ser{sup 79} and Raptor at Ser{sup 792}, was dramatically enhanced in human pancreatic ductal adenocarcinoma (PDAC) cells PANC-1 and MiaPaCa-2 cultured in medium containing physiological concentrations of glucose (5 mM), as compared with parallel cultures in medium with glucose at 25 mM. In physiological glucose, metformin inhibited mTORC1 activation, DNA synthesis and proliferation of PDAC cells stimulated by crosstalk between G protein-coupled receptors and insulin/IGF signaling systems, at concentrations (0.05-0.1 mM) that were 10-100-fold lower than those used in most previous reports. Using siRNA-mediated knockdown of the {alpha}{sub 1} and {alpha}{sub 2} catalytic subunits of AMPK, we demonstrated that metformin, at low concentrations, inhibited DNA synthesis through an AMPK-dependent mechanism. Our results emphasize the importance of using medium containing physiological concentrations of glucose to elucidate the anticancer mechanism of action of metformin in pancreatic cancer cells and other cancer cell types.

  16. Irreversible repression of DNA synthesis in Fanconi anemia cells is alleviated by the product of a novel cyclin-related gene.

    PubMed Central

    Digweed, M; Günthert, U; Schneider, R; Seyschab, H; Friedl, R; Sperling, K

    1995-01-01

    Primary fibroblasts from patients with the genetic disease Fanconi anemia, which are hypersensitive to cross-linking agents, were used to screen a cDNA library for sequences involved in their abnormal cellular response to a cross-linking challenge. By using library partition and microinjection of in vitro-transcribed RNA, a cDNA clone, pSPHAR (S-phase response), which is able to correct the permanent repression of semiconservative DNA synthesis rates characteristic of these cells, was isolated. Wild-type SPHAR mRNA is expressed in all fibroblasts so far analyzed, including those of Fanconi anemia patients. Correction of the abnormal response in these cells appears therefore to be due to overexpression after cDNA transfer rather than to genetic complementation. The cDNA contains an open reading frame coding for a polypeptide of 7.5 kDa. Rabbit antiserum directed against a SPHAR peptide detects a protein of 7.9 kDa in Western blots (immunoblots) of whole-cell extracts from proliferating, but not resting, fibroblasts. The deduced amino acid sequence of SPHAR contains a motif found in the cyclins, and it is proposed that SPHAR acts within the injected cell by interfering with the cyclin-controlled maintenance of S phase. In agreement with this proposal, normal cells transfected with an antisense SPHAR expression vector have a significantly reduced rate of DNA synthesis during S phase and a prolonged G2 phase, reflecting the need for postreplicative DNA processing before entry into mitosis. PMID:7799938

  17. Kinetics of the inhibition and recovery of semiconservative DNA synthesis following the induction of non-dimer DNA damages by solar ultraviolet radiation in ICR 2A frog cells

    SciTech Connect

    Rosenstein, B.S.

    1985-01-01

    The purpose of the work presented in this paper was to investigate the kinetics of inhibition and recovery of DNA synthesis in cells following the solar UV induction of non-dimer DNA damages. This work was accomplished by exposing cells to the Mylar-filtered solar UV wavelengths produced by fluorescent sunlamps. The ICR 2A frog cell line was chosen for this study because it is highly proficient in enzymatic photoreactivation. Hence, it was possible to induce a relatively pure population of non-dimer DNA photoproducts by exposing the sunlamp-irradiated cells to photoreactivating light (PRL), which specifically eliminates most of the small yield of dimers induced by the solar UV irradiation.

  18. Synthesis, structure elucidation, DNA-PK and PI3K and anti-cancer activity of 8- and 6-aryl-substituted-1-3-benzoxazines.

    PubMed

    Morrison, Rick; Al-Rawi, Jasim M A; Jennings, Ian G; Thompson, Philip E; Angove, Michael J

    2016-03-01

    The synthesis of 6-aryl, 8- aryl, and 8-aryl-6-chloro-2-morpholino-1,3-benzoxazines with potent activity against PI3K and DNA-PK is described. Synthesis of thirty one analogues was facilitated by an improved synthesis of 3-bromo-2-hydroxybenzoic acid 13 by de-sulphonation of 3-bromo-2-hydroxy-5-sulfobenzoic acid 12 en route to 2-methylthio-substituted-benzoxazine intermediates 17-19. From this series, compound 20k (LTURM34) (dibenzo[b,d]thiophen-4-yl) (IC50 = 0.034 μM) was identified as a specific DNA-PK inhibitor, 170 fold more selective for DNA-PK activity compared to PI3K activity. Other compounds of the series show markedly altered selectivity for various PI3K isoforms including compound 20i (8-(naphthalen-1-yl) a potent and quite selective PI3Kδ inhibitor (IC50 = 0.64 μM). Finally, nine compounds were evaluated and showed antiproliferative activity against an NCI panel of cancer cell lines. Compound 20i (8-(naphthalen-1-yl) showed strong anti-proliferative activity against A498 renal cancer cells that warrants further investigation. PMID:26854431

  19. 77 FR 39798 - Clarification Policy on Initial Fitness Review for Classification Approvals

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-05

    ... Pipeline and Hazardous Materials Safety Administration Clarification Policy on Initial Fitness Review for... fitness reviews of applicants for classification approvals, including Fireworks, Explosives, Organic...., Washington, DC 20590. SUPPLEMENTARY INFORMATION: Effective immediately, Initial Fitness Reviews (IFR) will...

  20. 75 FR 1382 - Wireless Telecommunications Bureau Seeks Comment on Petition for Reconsideration or Clarification...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-11

    ... of Documents in Rulemaking Proceedings, 63 FR 24121 (1998). \\8\\ Filers should follow the instructions... COMMISSION Wireless Telecommunications Bureau Seeks Comment on Petition for Reconsideration or Clarification... Division, Wireless Telecommunications Bureau, Federal Communications Commission, 445 12th Street,...

  1. Ruthenium(II) complexes containing quinone based ligands: Synthesis, characterization, catalytic applications and DNA interaction

    NASA Astrophysics Data System (ADS)

    Anitha, P.; Manikandan, R.; Endo, A.; Hashimoto, T.; Viswanathamurthi, P.

    2012-12-01

    1,2-Naphthaquinone reacts with amines such as semicarbazide, isonicotinylhydrazide and thiosemicarbazide in high yield procedure with the formation of tridentate ligands HLn (n = 1-3). By reaction of ruthenium(II) starting complexes and quinone based ligands HLn (n = 1-3), a series of ruthenium complexes were synthesized and characterized by elemental and spectroscopic methods (FT-IR, electronic, 1H, 13C, 31P NMR and ESI-MS). The ligands were coordinated to ruthenium through quinone oxygen, imine nitrogen and enolate oxygen/thiolato sulfur. On the basis of spectral studies an octahedral geometry may be assigned for all the complexes. Further, the catalytic oxidation of primary, secondary alcohol and transfer hydrogenation of ketone was carried out. The DNA cleavage efficiency of new complexes has also been tested.

  2. Synthesis, spectral characterization and eukaryotic DNA degradation of thiosemicarbazones and their platinum(IV) complexes

    NASA Astrophysics Data System (ADS)

    Al-Hazmi, G. A.; El-Metwally, N. M.; El-Gammal, O. A.; El-Asmy, A. A.

    2008-01-01

    The condensation products of acetophenone (or its derivatives), salicylaldehyde and o-hydroxy- p-methoxybenzophenone with thiosemicarbazide and ethyl- or phenyl-thiosemicarbazide are the investigated thiosemicarbazones. Their reactions with H 2PtCl 6 produced Pt(IV) complexes characterized by elemental, thermal, mass, IR and electronic spectral studies. The coordination modes were found mononegative bidentate in the acetophenone derivatives and binegative tridentate in the salicylaldehyde derivatives. The complexes were analyzed thermogravimetrically and found highly stable. Some ligands and their complexes were screened against Sarcina sp. and E. coli using the cup-diffusion technique. [Pt( oHAT)(OH)Cl] shows higher activity against E. coli than the other compounds. The degradation power of the tested compounds on the calf thymus DNA supports their selectivity against bacteria and not against the human or related eukaryotic organisms.

  3. Microwave assisted synthesis, spectroscopic, electrochemical and DNA cleavage studies of lanthanide(III) complexes with coumarin based imines

    NASA Astrophysics Data System (ADS)

    Kapoor, Puja; Fahmi, Nighat; Singh, R. V.

    2011-12-01

    The present work stems from our interest in the synthesis, characterization and biological evaluation of lanthanide(III) complexes of a class of coumarin based imines which have been prepared by the interaction of hydrated lanthanide(III) chloride with the sodium salts of 3-acetylcoumarin thiosemicarbazone (ACTSZH) and 3-acetylcoumarin semicarbazone (ACSZH) in 1:3 molar ratio using thermal as well as microwave method. Characterization of the ligands as well as the metal complexes have been carried out by elemental analysis, melting point determinations, molecular weight determinations, magnetic moment, molar conductance, IR, 1H NMR, 13C NMR, electronic, EPR, X-ray powder diffraction and mass spectral studies. Spectral studies confirm ligands to be monofunctional bidentate and octahedral environment around metal ions. The redox behavior of one of the synthesized metal complex was investigated by cyclic voltammetry. Further, free ligands and their metal complexes have been screened for their antimicrobial as well as DNA cleavage activity. The results of these findings have been presented and discussed.

  4. Effect of mode of administration of methyl methanesulfonate and triethylenemelamine on induction of unscheduled DNA synthesis in mouse germ cells

    SciTech Connect

    Sheu, C.W.; Sega, G.A.; Owens, J.G.

    1987-01-01

    The effect of route of administration on induction of unscheduled DNA synthesis (UDS) in mouse germ cells in vivo was studied using two germ cell mutagens, methyl methanesulfonate (MMS) and triethylenemelamine (TEM). The chemicals were administered to male mice (C3Hf x 101)F/sub 1/ by IP injection or gavage using acute or 5-day subacute regimens. After completion of dosing, methyl-(/sup 3/H)thymidine ((/sup 3/H)TdR) was injected into the testes, and spermatozoa were collected 16 days later. The sperm heads were isolated, and UDS was determined by the amount of (/sup 3/H)TdR incorporated. Acute administration of MMS (2-100 mg/kg) induced a strong, dose-related UDS response. The response was slightly higher with IP injection than with gavage. Acute administration of TEM (0.05-4.0 mg/kg) by IP injection or gavage induced weak and variable responses. The study showed that gavage, as well as IP injection, can be used for the administration of test chemicals and that the subacute 5-day regimen induced a higher UDS response than the acute regimen. Furthermore, the testicular route may enhance the detection of weak UDS inducers.

  5. Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate

    NASA Astrophysics Data System (ADS)

    Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Muhammad, Niaz; Shah, Naseer Ali; Sohail, Manzar; Pandarinathan, Vedapriya

    2015-08-01

    A new binuclear O-bridged Cu(II) complex with 4-chlorophenyl acetate and 2,2‧-bipyridine has been synthesized and characterized using FT-IR, powder and single crystal XRD and electrochemical solution studies. The results revealed that the two penta-coordinated Cu(II) centers are linked by two carboxylate ligands in end-on bonding fashion. The coordination geometry is slightly distorted square pyramidal (SP) with bridging oxygen atoms occupying the apical position and other ligands lying in the equatorial plane. The striking difference in Cu-O bond distance of the bridging oxygen atom in the complex may be responsible for the SP geometry of Cu(II) ion. The complex gave rise to metal centered irreversible electro-activity where one electron Cu(II)/Cu(III) oxidation process and a single step two electron Cu(II)/Cu(0) reduction process was observed. The redox processes were found predominantly adsorption controlled. The values of diffusion coefficient and heterogeneous rate constant for oxidation process were 6.98 × 10-7 cm2 s-1 and 4.60 × 10-5 cm s-1 while the corresponding values for reduction were 5.30 × 10-8 cm2 s-1 and 5.41 × 10-6 cm s-1, respectively. The formal potential and charge transfer coefficient were also calculated. The DNA-binding ability was explored through cyclic voltammetry and UV-Visible spectroscopy. Diminution in the value of Do for oxidation indicated the binding of the complex with DNA corresponding to Kb = 8.58 × 104 M-1. UV-Visible spectroscopy yielded ε = 49 L mol-1 cm-1 and Kb = 2.96 × 104 M-1. The data of both techniques support each other. The self-induced redox activation of the complex, as indicated by cyclic voltammetry heralds its potential applications in redox catalysis and anticancer activity.

  6. WR-1065 and radioprotection of vascular endothelial cells. I. Cell proliferation, DNA synthesis and damage

    SciTech Connect

    Rubin, D.B.; Drab, E.A.; Kang, H.J.; Baumann, F.E.; Blazek, E.R.

    1996-02-01

    Normal tissue toxicity limits radiation therapy and could depend on the extent of damage to the vascular endothelium. Aminothiols such as WR-1065 [N-(2-mercaptoethyl)-1,3-diaminopropane] provide radioprotection for normal tissues, but little is known about how the aminothiols specifically affect the endothelium. Bovine aortic endothelial cells in culture were exposed to WR-1065 for 2 h before irradiation ({sup 137}Cs {gamma} rays, 1 Gy/min). Alone, WR-1065 demonstrated an antiproliferative effect that was related to dose (0.5-4 mM) and was evident by lowered counts of adherent cells 48 h after exposure. WR-1065 was clearly radioprotective when assessed by colony formation and incorporation of [{sup 3}H]thymidine. However, when the number of adherent cells was evaluated, radioprotection appeared to be slight and evident only in logarithmically growing cells. WR-1065 at 2 mM suppressed single-strand DNA breaks after 3 Gy by 22% and double-strand breaks after 9 Gy by 47%. Also in the irradiated cells, WR-1065 more than doubled the rate of progression of cells from G{sub 1} to S phase. WR-1065 pretreatment elevated cellular glutathione (GSH) content more than twofold. Although pretreatment with buthionine sulfoximine inhibited the elevation of GSH, the radioprotective impact of WR-1065 on total DNA strand breaks and colony formation was unaffected. These results suggest that WR-1065 may enable tissue recovery from irradiation by promoting the replication of endothelial cells, possibly by mechanisms independent of GSH. 46 refs., 6 figs., 2 tabs.

  7. Clarification of vaccines: An overview of filter based technology trends and best practices.

    PubMed

    Besnard, Lise; Fabre, Virginie; Fettig, Michael; Gousseinov, Elina; Kawakami, Yasuhiro; Laroudie, Nicolas; Scanlan, Claire; Pattnaik, Priyabrata

    2016-01-01

    Vaccines are derived from a variety of sources including tissue extracts, bacterial cells, virus particles, recombinant mammalian, yeast and insect cell produced proteins and nucleic acids. The most common method of vaccine production is based on an initial fermentation process followed by purification. Production of vaccines is a complex process involving many different steps and processes. Selection of the appropriate purification method is critical to achieving desired purity of the final product. Clarification of vaccines is a critical step that strongly impacts product recovery and subsequent downstream purification. There are several technologies that can be applied for vaccine clarification. Selection of a harvesting method and equipment depends on the type of cells, product being harvested, and properties of the process fluids. These techniques include membrane filtration (microfiltration, tangential-flow filtration), centrifugation, and depth filtration (normal flow filtration). Historically vaccine harvest clarification was usually achieved by centrifugation followed by depth filtration. Recently membrane based technologies have gained prominence in vaccine clarification. The increasing use of single-use technologies in upstream processes necessitated a shift in harvest strategies. This review offers a comprehensive view on different membrane based technologies and their application in vaccine clarification, outlines the challenges involved and presents the current state of best practices in the clarification of vaccines. PMID:26657051

  8. Insulin-like growth factor binding protein-2 mediates the inhibition of DNA synthesis by transforming growth factor-beta in mink lung epithelial cells.

    PubMed

    Dong, Feng; Wu, Hai-Bin; Hong, Jiang; Rechler, Matthew M

    2002-01-01

    Insulin-like growth factor binding protein-3 (IGFBP-3) has been proposed to mediate the growth inhibitory effects of transforming growth factor (TGF)-beta in breast and prostate cancer cells. Both TGF-beta and exogenous IGFBP-3 inhibit DNA synthesis in Mv1 mink lung epithelial cells (CCL64). The present study asks whether IGFBPs synthesized by CCL64 cells mediate growth inhibition by TGF-beta. CCL64 cells synthesize and secrete a single 34-kDa IGFBP that was identified as IGFBP-2 by immunoprecipitation and immunodepletion. Recombinant bovine IGFBP-2 inhibited CCL64 DNA synthesis in serum-free media in an IGF-independent manner. Coincubation with Leu(60)-IGF-I, an IGF-I analog that binds to IGFBPs with higher affinity than to IGF-I receptors, decreased the inhibition by bIGFBP-2. Leu(60)-IGF-I also decreased the inhibition of CCL64 DNA synthesis by TGF-beta by up to 70%, whereas Long-R3-IGF-I, an IGF-I analog with higher affinity for IGF-I receptors than for IGFBPs, did not decrease inhibition, suggesting that the effect of Leu(60)-IGF-I resulted from its forming complexes with endogenous IGFBPs. Leu(60)-IGF-I did not decrease TGF-beta stimulation of a Smad3-dependent reporter gene. Following incubation of intact CCL64 cells with bIGFBP-2 at 0 degrees C, bIGFBP-2 was recovered in membrane fractions; membrane association was abolished by coincubation with Leu(60)-IGF-I. If exogenous and secreted IGFBP-2 must bind to CCL64 cells to inhibit DNA synthesis, Leu(60)-IGF-I might reduce the inhibition of DNA synthesis by bIGFBP-2 or TGF-beta by inhibiting the association of IGFBP-2 in the media with CCL64 cells. Since TGF-beta does not increase IGFBP-2 abundance, we propose that TGF-beta sensitizes CCL64 cells to the latent growth inhibitory activity of endogenous IGFBP-2 by potentiating an intracellular IGFBP-2 signaling pathway or by promoting the association of secreted IGFBP-2 with the plasma membrane. PMID:11807812

  9. Detecting DNA synthesis of neointimal formation after catheter balloon injury in GK and in Wistar rats: using 5-ethynyl-2'-deoxyuridine

    PubMed Central

    2012-01-01

    Background Neointimal formation plays an important role in the pathogenesis of coronary restenosis after percutaneous coronary intervention (PCI), especially in patients with diabetes mellitus. Recently, some studies have shown that 5-ethynyl-2'-deoxyuridine (EdU) incorporation can serve as a novel alternative to the 5-bromo-2'-deoxyuridine (BrdU) antibody detection method for detection of DNA synthesis in regenerating avian cochlea, chick embryo and the adult nervous system. However, few studies have been performed to assess the suitability of EdU for detecting DNA synthesis in vascular neointima. Methods The carotid artery balloon injury model was established in Goto-Kakizaki (GK) and Wistar rats. A Cell-LightTM EdU Kit was used to detect EdU-labeled cell nuclei of common carotid arteries at day 7 after catheter balloon injury. Different methods of injecting EdU were tested. The protein levels of proliferating cell nuclear antigen (PCNA) and p-Akt (Ser473), as well as the mRNA levels of PCNA were evaluated by Western blotting and quantitative real-time PCR (qRT-PCR), respectively. Immunohistochemical staining was also employed to visualize PCNA-positive cells. Results At day 7 after catheter balloon injury, far more EdU-positive and PCNA-positive cells were observed in GK rats. When comparing groups that received different EdU doses, it was found that the percentage of EdU-positive cells at a dose of 100 mg/kg body weight was than at doses of 25 mg/kg and 50 mg/kg. The number of positive cells was significantly higher in the repeated injection group compared to the single injection group. Further, after balloon injury DNA synthesis in GK rats was more notable than in Wistar rats. Neointimal formation in GK rats was more obvious than in Wistar rats. The protein levels of PCNA and p-Akt (Ser473) and the mRNA levels of PCNA were increased in injured rats as compared to uninjured rats, and were significantly higher in GK rats than in Wistar rats. Conclusion By

  10. Lack of effect of furfural on unscheduled DNA synthesis in the in vivo rat and mouse hepatocyte DNA repair assays and in precision-cut human liver slices.

    PubMed

    Lake, B G; Edwards, A J; Price, R J; Phillips, B J; Renwick, A B; Beamand, J A; Adams, T B

    2001-10-01

    The ability of furfural to induce unscheduled DNA synthesis (UDS) in hepatocytes of male and female B6C3F(1) mice and male F344 rats after in vivo administration and in vitro in precision-cut human liver slices has been studied. Preliminary toxicity studies established the maximum tolerated dose (MTD) of furfural to be 320 and 50 mg/kg in the mouse and rat, respectively. Furfural was dosed by gavage at levels of 0 (control), 50, 175 and 320 mg/kg to male and female mice and 0, 5, 16.7 and 50 mg/kg to male rats. Hepatocytes were isolated by liver perfusion either 2-4 h or 12-16 h after treatment, cultured in medium containing [3H]thymidine for 4 h and assessed for UDS by grain counting of autoradiographs. Furfural treatment did not produce any statistically significant increase or any dose-related effects on UDS in mouse and rat hepatocytes either 2-4 h or 12-16 h after dosing. In contrast, UDS was markedly induced in mice and rats 2-4 h after treatment with 20 mg/kg dimethylnitrosamine and 12-16 h after treatment of mice and rats with 200 mg/kg o-aminoazotoluene and 50 mg/kg 2-acetylaminofluorene (2-AAF), respectively. Precision-cut human liver slices from four donors were cultured for 24 h in medium containing [3H]thymidine and 0-10 mM furfural. Small increases in the net grain count (i.e. nuclear grain count less mean cytoplasmic grain count) observed with 2-10 mM furfural were not due to any increase in the nuclear grain count. Rather, it was the result of concentration-dependent decreases in the mean cytoplasmic grain counts and to a lesser extent in nuclear grain counts, due to furfural-induced cytotoxicity. In contrast, marked increases in UDS (both net grain and nuclear grain counts) were observed in human liver slices treated with 0.02 and 0.05 mM 2-AAF, 0.002 and 0.02 mM aflatoxin B(1) and 0.005 and 0.05 mM 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. This study demonstrates that furfural does not induce UDS in the hepatocytes of male and female B6C3F

  11. Synthesis of an oligonucleotide with a nicotinamide mononucleotide residue and its molecular recognition in DNA helices.

    PubMed

    Göckel, A; Richert, C

    2015-11-01

    Nicotinamide adenine dinucleotide (NAD) is a pivotal redox cofactor of primary metabolism. Its redox reactivity is based on the nicotinamide mononucleotide (NMN) moiety. We investigated whether NMN(+) can engage in pairing interactions, when incorporated into an oligonucleotide. Here we describe the incorporation of NMN(+) at the 3'-terminus of an oligodeoxynucleotide via a phosphoramidate coupling in solution. The stability of duplexes and triplexes with the NMN(+)-containing strand was measured in UV-melting curves. While the melting points of duplexes with different bases facing the nicotinamide were similar, triplex stabilities varied greatly between different base combinations, suggesting specific pairing. The most stable triplexes were found when a guanine and an adenine were facing the NMN(+) residue. Their triplex melting points were higher than those of the corresponding triplexes with a thymidine residue at the same position. These results show that NMN(+) residues can be recognized selectively in DNA helices and are thus compatible with the molecular recognition in nucleic acids. PMID:26371420

  12. Synthesis, DNA Polymerase Incorporation, and Enzymatic Phosphate Hydrolysis of Formamidopyrimidine Nucleoside Triphosphates

    PubMed Central

    Imoto, Shuhei; Patro, Jennifer N.; Jiang, Yu Lin; Oka, Natsuhisa; Greenberg, Marc M.

    2007-01-01

    The nucleoside triphosphates of N6-(2-deoxy-α,β-d-erythro-pentofuranosyl)-2,6-diamino-4-hydroxy-5-formamidopyrimidine (Fapy·dGTP) and its C-nucleoside analogue (β-C-Fapy·dGTP) were synthesized. The lability of the formamide group required that nucleoside triphosphate formation be carried out using an umpolung strategy in which pyrophosphate was activated toward nucleophilic attack. The Klenow fragment of DNA polymerase I from Escherichia coli accepted Fapy·dGTP and β-C-Fapy·dGTP as substrates much less efficiently than it did dGTP. Subsequent extension of a primer containing either modified nucleotide was less affected compared to when the native nucleotide is present at the 3′-terminus. The specificity constants are sufficiently large that nucleoside triphosphate incorporation could account for the level of Fapy·dG observed in cells if 1% of the dGTP pool is converted to Fapy·dGTP. Similarly, polymerase-mediated introduction of β-C-Fapy·dG could be useful for incorporating useful amounts of this nonhydrolyzable analogue for use as an inhibitor of base excision repair. The kinetic viability of these processes is enhanced by inefficient hydrolysis of Fapy·dGTP and β-C-Fapy·dGTP by MutT, the E. coli enzyme that releases pyrophosphate and the corresponding nucleoside monophosphate upon reaction with structurally related nucleoside triphosphates. PMID:17090045

  13. Bio-inspired benzo[k,l]xanthene lignans: synthesis, DNA-interaction and antiproliferative properties.

    PubMed

    Spatafora, Carmela; Barresi, Vincenza; Bhusainahalli, Vedamurthy M; Di Micco, Simone; Musso, Nicolò; Riccio, Raffaele; Bifulco, Giuseppe; Condorelli, Daniele; Tringali, Corrado

    2014-05-01

    In this work twelve benzo[k,l]xanthene lignans were synthesized by biomimetic, Mn-mediated oxidative coupling of caffeic esters and amides. These compounds, bearing different flexible pendants at position C1/C2 of the aromatic core, interact with DNA in a dual mode, as confirmed by DF-STD NMR analysis and molecular docking: the planar core acts as a base pair intercalant, whereas the flexible pendants act as minor groove binders. Their antiproliferative activity was evaluated on a panel of six tumor cell lines: HT-29, Caco-2, HCT-116 (human colon carcinoma), H226, A549 (human lung carcinoma), and SH-SY5Y (human neuroblastoma). All compounds under study, except 29, resulted in activity against one or more cell lines, and the markedly lipophilic esters 13 and 28 showed the highest activity. Compound 13 was more active than the anticancer drug 5-fluorouracil (5-FU) towards HCT-116 (colon, GI50 = 3.16 μM) and H226 (lung, GI50 = 4.33 μM) cell lines. PMID:24647864

  14. Synthesis, characterization, DNA binding and cleavage studies of Ru(II) complexes containing oxime ligands

    NASA Astrophysics Data System (ADS)

    Chitrapriya, Nataraj; Mahalingam, Viswanathan; Zeller, Matthias; Lee, Hyosun; Natarajan, Karuppannan

    2010-12-01

    The Ru(II) precursors, [RuHCl(CO)(EPh 3) 3] (E = P or As) when reacted with some well known monoxime and dioxime ligands in ethanolic solution afforded the new complexes of the types [RuCl(CO)(EPh 3) 2L1], [RuH(CO)(EPh 3) 2L2] and [RuCl(CO)(EPh 3) 2L3] ((H 1L1) = diacetylmonoxime, (H 1L2) = dimethylglyoxime and (H 2L3) = benzoiloxime). The ligands coordinated in a bidentate chelate mode forming a five membered chelate ring. The molecular structures of two of the complexes have been determined by single crystal X-ray diffraction study. The structural determination confirms the deprotonation of the oxime function. Examination of all the complexes by cyclic voltammetry showed the occurrence of some quasi-reversible redox reactions owing to changes in the oxidation state of the central metal atoms. Structural assignments are supported by combination of IR, UV-Vis, 1H NMR and elemental analyses. In addition, the DNA binding properties and cleavage efficiency of new complexes have been tested.

  15. Synthesis and structural characterization of stable branched DNA g-quadruplexes using the trebler phosphoramidite.

    PubMed

    Ferreira, Rubén; Alvira, Margarita; Aviñó, Anna; Gómez-Pinto, Irene; González, Carlos; Gabelica, Valérie; Eritja, Ramon

    2012-04-01

    Guanine (G)-rich sequences can form a noncanonical four-stranded structure known as the G-quadruplex. G-quadruplex structures are interesting because of their potential biological properties and use in nanosciences. Here, we describe a method to prepare highly stable G-quadruplexes by linking four G-rich DNA strands to form a monomolecular G-quadruplex. In this method, one strand is synthesized first, and then a trebler molecule is added to simultaneously assemble the remaining three strands. This approach allows the introduction of specific modifications in only one of the strands. As a proof of concept, we prepared a quadruplex where one of the chains includes a change in polarity. A hybrid quadruplex is observed in ammonium acetate solutions, whereas in the presence of sodium or potassium, a parallel G-quadruplex structure is formed. In addition to the expected monomolecular quadruplexes, we observed the presence of dimeric G-quadruplex structures. We also applied the method to prepare G-quadruplexes containing a single 8-aminoguanine substitution and found that this single base stabilizes the G-quadruplex structure when located at an internal position. PMID:24551498

  16. Synthesis, characterization, DNA binding and catalytic applications of Ru(III) complexes.

    PubMed

    Shoair, A F; El-Shobaky, A R; Azab, E A

    2015-12-01

    A new series of azodye ligands 5-chloro-3-hydroxy-4-(aryldiazenyl)pyridin-2(1H)-one (HLn) were synthesized by coupling of 5-chloro-3-hydroxypyridin-2(1H)-one with aniline and its p-derivatives. These ligands and their Ru(III) complexes of the type trans-[Ru(Ln)2(AsPh3)2]Cl were characterized by elemental analyses, IR, (1)H NMR and UV-Visible spectra as well as magnetic and thermal measurements. The molar conductance measurements proved that all the complexes are electrolytes. IR spectra show that the ligands (HLn) acts as a monobasic bidentate ligand by coordinating via the nitrogen atom of the azo group (NN) and oxygen atom of the deprotonated phenolic OH group, thereby forming a six-membered chelating ring and concomitant formation of an intramolecular hydrogen bond. The molecular and electronic structures of the investigated compounds (HLn) were also studied using quantum chemical calculations. The calf thymus DNA binding activity of the ligands (HLn) and their Ru(III) complexes were studied by absorption spectra and viscosity measurements. The mechanism and the catalytic oxidation of benzyl alcohol by trans-[Ru(Ln)2(AsPh3)2]Cl with hydrogen peroxide as co-oxidant were described. PMID:26143325

  17. DNA-binding affinity and anticancer activity of β-carboline-chalcone conjugates as potential DNA intercalators: Molecular modelling and synthesis.

    PubMed

    Shankaraiah, Nagula; Siraj, K P; Nekkanti, Shalini; Srinivasulu, Vunnam; Sharma, Pankaj; Senwar, Kishna Ram; Sathish, Manda; Vishnuvardhan, M V P S; Ramakrishna, Sistla; Jadala, Chetna; Nagesh, Narayana; Kamal, Ahmed

    2015-04-01

    A new series of DNA-interactive β-carboline-chalcone conjugates have been synthesized and evaluated for their in vitro cytotoxicity and DNA-binding affinity. It has been observed that most of these new hybrids have shown potent cytotoxic activities on A-549 (lung adenocarcinoma) cell lines with IC50 values lower than 10 μM. The hybrid 7b is more effective against some of the selected cancer cell lines with IC50 values less than 50 μM. In addition, compounds 7e, 7k, 7p-u has displayed significant elevation in ΔTm of DNA in comparison to Adriamycin, suggesting significant interaction and remarkable DNA stabilization. The DNA intercalation of these new hybrids has been investigated by fluorescence titration, DNA viscosity measurements, molecular docking as well as molecular dynamics and the results are in agreement with the thermal denaturation studies. PMID:25771335

  18. Research integrity and misconduct: a clarification of the concepts.

    PubMed

    Khanyile, T D; Duma, S; Fakude, L P; Mbombo, N; Daniels, F; Sabone, M S

    2006-03-01

    The commercialization of research and the ever changing scientific environment has led scholars to shift the focus from promoting research integrity to regulating misconduct. As a result, most literature explains research integrity in terms of avoidance of misconduct. The purpose of the paper is to stimulate reflection and discussion on research integrity and research misconduct. This article explores the meaning of research integrity and research misconduct, and how research integrity can be promoted to ensure safer research and scholarship. We believe that the discussion can help clarify some hazy areas in the research and publication processes, and appreciate some crucial aspects that they may have seen taken for granted. The purpose of this article is to share with the readers some clarification or analysis of the two concepts namely: research integrity and misconduct. The objectives are: (1) To explore and analyse the concepts of research integrity and research misconduct from the educational or developmental perspective and not the legal perspective as others in literature have done. (2) To stimulate the reflection and discussion on strategies to promote research integrity and thus prevent research misconduct Literature review and concept analysis was undertaken to clarify the two concepts. We argue that the two concepts can be viewed along a continuum, i.e. where research integrity ends, research misconduct starts. We also argue that it is the responsibility of the research community at large to always ensure that the scientific ethics balance is maintained throughout the research process to ensure research integrity and avoid research misconduct. We also argue that research integrity is interlinked with morality while misconduct is interlinked with immorality. PMID:16817491

  19. Defining nonvalvular atrial fibrillation: A quest for clarification.

    PubMed

    Martins, Raphaël P; Galand, Vincent; Colette, Edouard; Behar, Nathalie; Pavin, Dominique; Leclercq, Christophe; Daubert, Jean-Claude; Mabo, Philippe

    2016-08-01

    Non-vitamin K oral anticoagulants (NOACs) are currently recommended for patients with nonvalvular atrial fibrillation since the publication of the 4 major pivotal trials evaluating the efficacy and safety of factor IIa and factor Xa inhibitors. The definition of nonvalvular atrial fibrillation is unclear, varying from one trial to another and even between North American and European guidelines, which is a source of uncertainties in clinical practice. However, many patients with atrial fibrillation present signs of valvular involvement, and clarification of this term is needed to not deny NOACs to patients based on the wrong perception that they may have valvular atrial fibrillation. The currently unique contraindications to NOACs are patients with mechanical heart valves and those with moderate-to-severe mitral stenosis, as stated by the recent 2015 position paper of the European Heart Rhythm Association. Patients with native heart valve involvement, regardless of their severity, are suitable for NOAC therapy. Patients with bioprosthetic heart valves and mitral valve repair may be suitable for NOACs except for the first 3 and the first 3-6 months postoperatively, respectively. Patients with transaortic valve implantation or percutaneous transluminal aortic valvuloplasty are also considered as being eligible for NOACs, although the bleeding risk has to be carefully considered in this population often requiring a combination with antiplatelet therapy. Future studies are warranted to increase the level of evidence of use of NOACs, particularly in patients with transaortic valve implantation and valvular surgery, and to determine whether they could be used in the future in the only 2 remaining contraindications. PMID:27502864

  20. Peer-assisted learning: time for nomenclature clarification

    PubMed Central

    Olaussen, Alexander; Reddy, Priya; Irvine, Susan; Williams, Brett

    2016-01-01

    Background Peer-assisted learning (PAL) is used throughout all levels of healthcare education. Lack of formalised agreement on different PAL programmes may confuse the literature. Given the increasing interest in PAL as an education philosophy, the terms need clarification. The aim of this review is to 1) describe different PAL programmes, 2) clarify the terminology surrounding PAL, and 3) propose a simple pragmatic way of defining PAL programmes based on their design. Methods A review of current PAL programmes within the healthcare setting was conducted. Each programme was scrutinised based on two aspects: the relationship between student and teacher, and the student to teacher ratio. The studies were then shown to fit exclusively into the novel proposed classification. Results The 34 programmes found, demonstrate a wide variety in terms used. We established six terms, which exclusively applied to the programmes. The relationship between student and teacher was categorised as peer-to-peer or near-peer. The student to teacher ratio suited three groupings, named intuitively ‘Mentoring’ (1:1 or 1:2), ‘Tutoring’ (1:3–10), and ‘Didactic’ (1:>10). From this, six novel terms – all under the heading of PAL – are suggested: ‘Peer Mentoring’, ‘Peer Tutoring’, ‘Peer Didactic’, ‘Near-Peer Mentoring’, ‘Near-Peer Tutoring’, and ‘Near-Peer Didactic’. Conclusions We suggest herein a simple pragmatic terminology to overcome ambiguous terminology. Academically, clear terms will allow effective and efficient research, ensuring furthering of the educational philosophy. PMID:27415590

  1. Origin of nascent lineages and the mechanisms used to prime second-strand DNA synthesis in the R1 and R2 retrotransposons of Drosophila

    PubMed Central

    Stage, Deborah E; Eickbush, Thomas H

    2009-01-01

    Background Most arthropods contain R1 and R2 retrotransposons that specifically insert into the 28S rRNA genes. Here, the sequencing reads from 12 Drosophila genomes have been used to address two questions concerning these elements. First, to what extent is the evolution of these elements subject to the concerted evolution process that is responsible for sequence homogeneity among the different copies of rRNA genes? Second, how precise are the target DNA cleavages and priming of DNA synthesis used by these elements? Results Most copies of R1 and R2 in each species were found to exhibit less than 0.2% sequence divergence. However, in many species evidence was obtained for the formation of distinct sublineages of elements, particularly in the case of R1. Analysis of the hundreds of R1 and R2 junctions with the 28S gene revealed that cleavage of the first DNA strand was precise both in location and the priming of reverse transcription. Cleavage of the second DNA strand was less precise within a species, differed between species, and gave rise to variable priming mechanisms for second strand synthesis. Conclusions These findings suggest that the high sequence identity amongst R1 and R2 copies is because all copies are relatively new. However, each active element generates its own independent lineage that can eventually populate the locus. Independent lineages occur more often with R1, possibly because these elements contain their own promoter. Finally, both R1 and R2 use imprecise, rapidly evolving mechanisms to cleave the second strand and prime second strand synthesis. PMID:19416522

  2. Subnuclear localization, rates and effectiveness of UVC-induced unscheduled DNA synthesis visualized by fluorescence widefield, confocal and super-resolution microscopy.

    PubMed

    Pierzyńska-Mach, Agnieszka; Szczurek, Aleksander; Cella Zanacchi, Francesca; Pennacchietti, Francesca; Drukała, Justyna; Diaspro, Alberto; Cremer, Christoph; Darzynkiewicz, Zbigniew; Dobrucki, Jurek W

    2016-04-17

    Unscheduled DNA synthesis (UDS) is the final stage of the process of repair of DNA lesions induced by UVC. We detected UDS using a DNA precursor, 5-ethynyl-2'-deoxyuridine (EdU). Using wide-field, confocal and super-resolution fluorescence microscopy and normal human fibroblasts, derived from healthy subjects, we demonstrate that the sub-nuclear pattern of UDS detected via incorporation of EdU is different from that when BrdU is used as DNA precursor. EdU incorporation occurs evenly throughout chromatin, as opposed to just a few small and large repair foci detected by BrdU. We attribute this difference to the fact that BrdU antibody is of much larger size than EdU, and its accessibility to the incorporated precursor requires the presence of denatured sections of DNA. It appears that under the standard conditions of immunocytochemical detection of BrdU only fragments of DNA of various length are being denatured. We argue that, compared with BrdU, the UDS pattern visualized by EdU constitutes a more faithful representation of sub-nuclear distribution of the final stage of nucleotide excision repair induced by UVC. Using the optimized integrated EdU detection procedure we also measured the relative amount of the DNA precursor incorporated by cells during UDS following exposure to various doses of UVC. Also described is the high degree of heterogeneity in terms of the UVC-induced EdU incorporation per cell, presumably reflecting various DNA repair efficiencies or differences in the level of endogenous dT competing with EdU within a population of normal human fibroblasts. PMID:27097376

  3. Bub1 in Complex with LANA Recruits PCNA To Regulate Kaposi's Sarcoma-Associated Herpesvirus Latent Replication and DNA Translesion Synthesis

    PubMed Central

    Sun, Zhiguo; Jha, Hem Chandra

    2015-01-01

    ABSTRACT Latent DNA replication of Kaposi's sarcoma-associated herpesvirus (KSHV) initiates at the terminal repeat (TR) element and requires trans-acting elements, both viral and cellular, such as ORCs, MCMs, and latency-associated nuclear antigen (LANA). However, how cellular proteins are recruited to the viral genome is not very clear. Here, we demonstrated that the host cellular protein, Bub1, is involved in KSHV latent DNA replication. We show that Bub1 constitutively interacts with proliferating cell nuclear antigen (PCNA) via a highly conserved PIP box motif within the kinase domain. Furthermore, we demonstrated that Bub1 can form a complex with LANA and PCNA in KSHV-positive cells. This strongly indicated that Bub1 serves as a scaffold or molecular bridge between LANA and PCNA. LANA recruited PCNA to the KSHV genome via Bub1 to initiate viral replication in S phase and interacted with PCNA to promote its monoubiquitination in response to UV-induced damage for translesion DNA synthesis. This resulted in increased survival of KSHV-infected cells. IMPORTANCE During latency in KSHV-infected cells, the viral episomal DNA replicates once each cell cycle. KSHV does not express DNA replication proteins during latency. Instead, KSHV LANA recruits the host cell DNA replication machinery to the replication origin. However, the mechanism by which LANA mediates replication is uncertain. Here, we show that LANA is able to form a complex with PCNA, a critical protein for viral DNA replication. Furthermore, our findings suggest that Bub1, a spindle checkpoint protein, serves as a scaffold or molecular bridge between LANA and PCNA. Our data further support a role for Bub1 and LANA in PCNA-mediated cellular DNA replication processes as well as monoubiquitination of PCNA in response to UV damage. These data reveal a therapeutic target for inhibition of KSHV persistence in malignant cells. PMID:26223641

  4. Alterations of nuclear DNA synthesis after irradiation of the cellular slime mold Dictyostelium discoideum: studies performed in a mutant strain displaying enhanced thymidine uptake

    SciTech Connect

    Hurley, D.L.

    1986-01-01

    The auxotrophic Dictyostelium discoideum strain HPS 401 was studied. Thymidine at 8 ..mu..g/ml or thymidylate at 50 ..mu..g/ml supported growth to maximal cell densities. Thin layer chromatography of cell extracts showed rapid intracellular accumulation of thymidine in HPS 401 vs slightly detectable accumulation in wild-type cells. Measurements showed that methionine and thymidylate were taken into all strains at a low rate, but HPS 401 had enhanced uptake of thymidine and uridine compared to wild-type. The HPS 401 phenotype is due to the efficient utilization of thymidine as a result of increased nucleoside uptake. Rapid nuclear purification removed mitochondrial DNA without decreasing the single-strand molecular weight of the nuclear DNA. The nuclear DNA peaks on alkaline sucrose gradients were identified using filter hybridization to cloned probes. As measured by pulse-chase labelling, production of full-sized main band DNA required 45-50 minutes. Pulse labelling of the cells immediately after ultraviolet irradiation caused the single-strand molecular weight of the DNA synthesized to decrease from 8 x 10/sup 6/ daltons at O J/m/sup 2/ to 3.9 x 10/sup 6/ daltons at 50 J/m/sup 2/ to 2.6 x 10/sup 6/ daltons at 200 J/m/sup 2/. The time required for maturation into full-sized DNA increased from 1 hour at O J/m/sup 2/ to 4 hours at 20 J/m/sup 2/ and to 21 hours at 200 J/m/sup 2/. Measured amounts of DNA synthesis at times after ultraviolet irradiation showed a period of reduced incorporation, followed by the resumption of control levels. The lag period ended at the same time as the production of full-sized DNA resumed.

  5. Reinitiation of DNA Synthesis and Cell Division in Senescent Human Fibroblasts by Microinjection of Anti-p53 Antibodies

    PubMed Central

    Gire, Veronique; Wynford-Thomas, David

    1998-01-01

    In human fibroblasts, growth arrest at the end of the normal proliferative life span (induction of senescence) is dependent on the activity of the tumor suppressor protein p53. In contrast, once senescence has been established, it is generally accepted that reinitiation of DNA synthesis requires loss of multiple suppressor pathways, for example, by expression of Simian virus 40 (SV40) large T antigen, and that even this will not induce complete cell cycle traverse. Here we have used microinjection of monoclonal antibodies to the N terminus of p53, PAb1801 and DO-1, to reinvestigate the effect of blocking p53 function in senescent human fibroblasts. Unexpectedly, we found that both antibodies induce senescent cells to reenter S phase almost as efficiently as SV40, accompanied by a reversion to the “young” morphology. Furthermore, this is followed by completion of the cell division cycle, as shown by the appearance of mitoses, and by a four- to fivefold increase in cell number 9 days after injection. Immunofluorescence analysis showed that expression of the p53-inducible cyclin/kinase inhibitor p21sdi1/WAF1 was greatly diminished by targeting p53 with either PAb1801 or DO-1 but remained high and, moreover, still p53 dependent in cells expressing SV40 T antigen. As previously observed for induction, the maintenance of fibroblast senescence therefore appears to be critically dependent on functional p53. We suggest that the previous failure to observe this by using SV40 T-antigen mutants to target p53 was most probably due to incomplete abrogation of p53 function. PMID:9488478

  6. Synthesis, characterization and crystal structure of cobalt(III) complexes containing 2-acetylpyridine thiosemicarbazones: DNA/protein interaction, radical scavenging and cytotoxic activities.

    PubMed

    Manikandan, Rajendran; Viswanathamurthi, Periasamy; Velmurugan, Krishnaswamy; Nandhakumar, Raju; Hashimoto, Takeshi; Endo, Akira

    2014-01-01

    The synthesis, structure and biological studies of cobalt(III) complexes supported by NNS-tridentate ligands are reported. Reactions of 2-acetylpyridine N-substituted thiosemicarbazone (HL(1-3)) with [CoCl2(PPh3)2] resulted [Co(L(1-3))2]Cl (1-3) which were characterized by elemental analysis and various spectral studies. The molecular structure of the complex 1 has been determined by single crystal X-ray diffraction studies. In vitro DNA binding studies of complexes 1-3 carried out by fluorescence studies and the results revealed the binding of complexes to DNA via intercalation. The binding constant (Kb) values of complexes 1-3 from fluorescence experiments showed that the complex 3 has greater binding propensity for DNA. The DNA cleavage activity of the complexes 1 and 3 were ascertained by gel electrophoresis assay which revealed that the complexes are good DNA cleavage agents. Further, the interactions of the complexes with bovine serum albumin (BSA) were also investigated using fluorescence spectroscopic method, which showed that the complexes 1-3 could bind strongly with BSA. The antioxidant property of the complexes was evaluated to test their free-radical scavenging ability. Furthermore, in vitro cytotoxicity of the complexes against MCF-7 and A431 cell lines was assayed which showed higher activity and efficiently vanished the cancer cells even at low concentrations. PMID:24342132

  7. Solid-phase synthesis of amidine-substituted phenylbenzimidazoles and incorporation of this DNA binding and recognition motif into amino acid and peptide conjugates.

    PubMed

    Garner, Matthew L; Georgiadis, Taxiarchis M; Li, Jessica Bo; Wang, Tianxiu; Long, Eric C

    2014-05-01

    Amidine-substituted phenylbenzimidazoles are well-established DNA-binding structural motifs that have contributed to the development of diverse classes of DNA-targeted agents; this ring system not only assists in increasing the overall DNA affinity of an agent, but can also influence its site selectivity. Seeking a means to conveniently exploit these attributes, a protocol for the on-resin synthesis of amino acid- and peptide-phenylbenzimidazole-amidine conjugates was developed to facilitate installation of phenylbenzimidazole-amidines into peptide chains during the course of standard solid-phase syntheses. Building from a resin-bound amino acid or peptide on Rink amide resin, 4-formyl benzoic acid was coupled to the resin-bound free amine followed by introduction of 3,4-diamino-N'-hydroxybenzimidamide (in the presence of 1,4-benzoquinone) to construct the benzimidazole heterocycle. Finally, the resin-bound N'-hydroxybenzimidamide functionality was reduced to an amidine via 1 M SnCl2·2H2O in DMF prior to resin cleavage to release final product. This procedure permits the straightforward synthesis of amino acids or peptides that are N-terminally capped by a phenylbenzimidazole-amidine ring system. Employing this protocol, a series of amino acid-phenylbenzimidazole-amidine (Xaa-R) conjugates was synthesized as well as dipeptide conjugates of the general form Xaa-Gly-R (where R is the phenylbenzimidazole-amidine and Xaa is any amino acid). PMID:24562478

  8. Application of Escherichia coli phage K1E DNA-dependent RNA polymerase for in vitro RNA synthesis and in vivo protein production in Bacillus megaterium.

    PubMed

    Stammen, Simon; Schuller, Franziska; Dietrich, Sylvia; Gamer, Martin; Biedendieck, Rebekka; Jahn, Dieter

    2010-09-01

    Gene "7" of Escherichia coli phage K1E was proposed to encode a novel DNA-dependent RNA polymerase (RNAP). The corresponding protein was produced recombinantly, purified to apparent homogeneity via affinity chromatography, and successfully employed for in vitro RNA synthesis. Optimal assay conditions (pH 8, 37 degrees C, 10 mM magnesium chloride and 1.3 mM spermidine) were established. The corresponding promoter regions were identified on the phage genome and summarized in a sequence logo. Surprisingly, next to K1E promoters, the SP6 promoter was also recognized efficiently in vitro by K1E RNAP, while the T7 RNAP promoter was not recognized at all. Based on these results, a system for high-yield in vitro RNA synthesis using K1E RNAP was established. The template plasmid is a pUC18 derivative, which enables blue/white screening for positive cloning of the target DNA. Production of more than 5 microg of purified RNA per microgram plasmid DNA was achieved. Finally, in vivo protein production systems for Bacillus megaterium were established based on K1E and SP6 phage RNAP transcription. Up to 61.4 mg g (CDW) (-1) (K1E RNAP) of the reporter protein Gfp was produced in shaking flask cultures of B. megaterium. PMID:20596705

  9. [Mechanisms of targeted frameshift mutations--insertion formation under error-prone or SOS synthesis of DNA containing CIS-SYN cyncyclobutane thymine dimers].

    PubMed

    Grebneva, E A

    2014-01-01

    Up to now the mechanism of formation of frameshift mutations caused by cyclobutane pyrimidine dimers has not been yet explained satisfactorily. Mechanisms of different mutations are usually considered in polymerase model. Here, the alternative polymerase-tautomer model of ultraviolet mutagenesis is developed. The mechanism of targeted insertion formation caused by cis-syn cyclobutane thymine dimers is proposed. Insertions are mutations when one or several DNA bases are inserted.Targeted insertions are mutations of a frameshift type--when one or severalnucleotides are inserted opposite damageswhich may stop synthesis of DNA. Targeted insertions are induced bycyclobutane pyrimidine dimmers. Ultraviolet irradiation may result in a change of tautomer state of DNA bases. A thymine base may form 5 rare tautomer forms that are stable if the base is a part of cyclobutane dimer. As it was shown by structural analysis, one rare tautomeric form of thymine forms hydrogen bonds with no one canonical DNA base. Therefore, under SOS or error-prone synthesis of DNA containing cis-syn cyclobutane thymine dimers with such rare tautomeric_form a specialize or modified DNA polymerase leaves a single nucleotide gap opposite the cis-syn cyclobutane thymine dimer. According to Streisinger model, if the DNA composition within this region is homogeneous, the end of the growing DNA strand can slip and form complementary pairs with a template nucleotide neighboring to the dimer of such type a loop is formed. Further elongation of the daughter strand leads to the appearance of targeted insertion in the daughter strand. Here, it is first shown that cis-syn cyclobutane thymine dimers with one or both bases in the specific tautomer conformation--opposite which it is impossible to insert a canonical base with a hydrogen bond formation--results in targeted insertions. Moreover, the model of forming targeted single--and several-base insertions is developed. The polymerase-tautomer model of

  10. AzaHx, a novel fluorescent, DNA minor groove and G·C recognition element: Synthesis and DNA binding properties of a p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (azaHx-PI) polyamide.

    PubMed

    Satam, Vijay; Babu, Balaji; Patil, Pravin; Brien, Kimberly A; Olson, Kevin; Savagian, Mia; Lee, Megan; Mepham, Andrew; Jobe, Laura Beth; Bingham, John P; Pett, Luke; Wang, Shuo; Ferrara, Maddi; Bruce, Chrystal D; Wilson, W David; Lee, Moses; Hartley, John A; Kiakos, Konstantinos

    2015-09-01

    The design, synthesis, and DNA binding properties of azaHx-PI or p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (5) are described. AzaHx, 2-(p-anisyl)-4-aza-benzimidazole-5-carboxamide, is a novel, fluorescent DNA recognition element, derived from Hoechst 33258 to recognize G·C base pairs. Supported by theoretical data, the results from DNase I footprinting, CD, ΔT(M), and SPR studies provided evidence that an azaHx/IP pairing, formed from antiparallel stacking of two azaHx-PI molecules in a side-by-side manner in the minor groove, selectively recognized a C-G doublet. AzaHx-PI was found to target 5'-ACGCGT-3', the Mlu1 Cell Cycle Box (MCB) promoter sequence with specificity and significant affinity (K(eq) 4.0±0.2×10(7) M(-1)). PMID:26122210

  11. In situ DNA-templated synthesis of silver nanoclusters for ultrasensitive and label-free electrochemical detection of microRNA.

    PubMed

    Yang, Cuiyun; Shi, Kai; Dou, Baoting; Xiang, Yun; Chai, Yaqin; Yuan, Ruo

    2015-01-21

    On the basis of the use of silver nanoclusters (AgNCs) in situ synthesized by cytosine (C)-rich loop DNA templates as signal amplification labels, the development of a label-free and highly sensitive method for electrochemical detection of microRNA (miRNA-199a) is described. The target miRNA-199a hybridizes with the partial dsDNA probes to initiate the target-assisted polymerization nicking reaction (TAPNR) amplification to produce massive intermediate sequences, which can be captured on the sensing electrode by the self-assembled DNA secondary probes. These surface-captured intermediate sequences further trigger the hybridization chain reaction (HCR) amplification to form dsDNA polymers with numerous C-rich loop DNA templates on the electrode surface. DNA-templated synthesis of AgNCs can be realized by subsequent incubation of the dsDNA polymer-modified electrode with AgNO3 and sodium borohydride. With this integrated TAPNR and HCR dual amplification strategy, the amount of in situ synthesized AgNCs is dramatically enhanced, leading to substantially amplified current response for highly sensitive detection of miRNA-199a down to 0.64 fM. In addition, the developed method also shows high selectivity toward the target miRNA-199a. Featured with high sensitivity and label-free capability, the proposed sensing scheme can thus offer new opportunities for achieving sensitive, selective, and simple detection of different types of microRNA targets. PMID:25537119

  12. The DNA gyrase inhibitors, nalidixic acid and oxolinic acid, prevent iron-mediated repression of catechol siderophore synthesis in Azotobacter vinelandii.

    PubMed

    Page, W J; Patrick, J

    1988-01-01

    Low concentrations of nalidixic acid and oxolinic acid that were just inhibitory to Azotobacter vinelandii growth promoted the production of the catechol siderophores azotochelin and aminochelin, in the presence of normally repressive concentrations of Fe3+. There was a limited effect on the pyoverdin siderophore, azotobactin, where low concentrations of Fe3+ were rendered less repressive, but the repression by higher concentrations of Fe3+ was normal. These drugs did not induce high-molecular-mass iron-repressible outer-membrane proteins and similar effects on the regulation of catechol siderophore synthesis were not produced by novobiocin, coumermycin, or ethidium bromide. The timing of nalidixic acid and Fe3+ addition to iron-limited cells was critical. Nalidixic acid had to be added before iron-repression of catechol siderophore synthesis and before the onset of iron-sufficient growth. Continued production of the catechol siderophores, however, was not due to interference with normal iron uptake. These data indicated that nalidixic acid prevented normal iron-repression of catechol siderophore synthesis but could not reverse iron repression once it had occurred. The possible roles of DNA gyrase activity in the regulation of catechol siderophore synthesis is discussed. PMID:2856355

  13. Synthesis of TiO2 nanorods in the presence of linear DNA plasmid pBR322 by a sol gel process

    NASA Astrophysics Data System (ADS)

    Monreal-Romero, H. A.; Martínez-Villafañe, A.; Chacon-Nava, J. G.; Glossman-Mitnik, D.; García-Casillas, P. E.; Martínez-Pérez, C. A.

    2005-08-01

    In this work, we have synthesized titanium dioxide nanorods ranging in size from 20 to 40 nm by means of the linear plasmid pBR322 and using titanium isopropoxide as a precursor through the sol-gel process. The resulting gels were calcined and the resulting powders were characterized by means of scanning electron microscopy, energy dispersive spectroscopy, transmission electron microscopy, x-ray diffraction, thermogravimetric analysis and differential thermal analysis. The results show that the synthesis in vitro of nanorods in the presence of DNA can be achieved. Thus, we report the synthesis of hybrids made of nucleic acids in inorganic materials that may have several applications as catalytic systems, biomaterials and nanostructured materials.

  14. Dose-Dependent AMPK-Dependent and Independent Mechanisms of Berberine and Metformin Inhibition of mTORC1, ERK, DNA Synthesis and Proliferation in Pancreatic Cancer Cells

    PubMed Central

    Ming, Ming; Sinnett-Smith, James; Wang, Jia; Soares, Heloisa P.; Young, Steven H.; Eibl, Guido; Rozengurt, Enrique

    2014-01-01

    Natural products represent a rich reservoir of potential small chemical molecules exhibiting anti-proliferative and chemopreventive properties. Here, we show that treatment of pancreatic ductal adenocarcinoma (PDAC) cells (PANC-1, MiaPaCa-2) with the isoquinoline alkaloid berberine (0.3–6 µM) inhibited DNA synthesis and proliferation of these cells and delay the progression of their cell cycle in G1. Berberine treatment also reduced (by 70%) the growth of MiaPaCa-2 cell growth when implanted into the flanks of nu/nu mice. Mechanistic studies revealed that berberine decreased mitochondrial membrane potential and intracellular ATP levels and induced potent AMPK activation, as shown by phosphorylation of AMPK α subunit at Thr-172 and acetyl-CoA carboxylase (ACC) at Ser79. Furthermore, berberine dose-dependently inhibited mTORC1 (phosphorylation of S6K at Thr389 and S6 at Ser240/244) and ERK activation in PDAC cells stimulated by insulin and neurotensin or fetal bovine serum. Knockdown of α1 and α2 catalytic subunit expression of AMPK reversed the inhibitory effect produced by treatment with low concentrations of berberine on mTORC1, ERK and DNA synthesis in PDAC cells. However, at higher concentrations, berberine inhibited mitogenic signaling (mTORC1 and ERK) and DNA synthesis through an AMPK-independent mechanism. Similar results were obtained with metformin used at doses that induced either modest or pronounced reductions in intracellular ATP levels, which were virtually identical to the decreases in ATP levels obtained in response to berberine. We propose that berberine and metformin inhibit mitogenic signaling in PDAC cells through dose-dependent AMPK-dependent and independent pathways. PMID:25493642

  15. Mosaicism in female hybrid hares heterozygous for glucose-6-phosphate dehydrogenase. V. The recovery of DNA synthesis of hare fibroblasts after ultraviolet irradiation

    SciTech Connect

    Janakidevi, K.; Lee, K.T.; Thomas, W.A.; Kroms, M.; Murray, C.D.

    1984-12-01

    The effect of uv irradiation on the recovery of DNA synthesis is examined in a population of hare fibroblasts exhibiting heterozygosity with reference to the X-linked enzyme, glucose-6-phosphate-dehydrogenase (G-6-PD). These cells have been grown from skin explants of a hybrid female cross between Lepus timidus (female) and L. europaeus (male), the former carrying the G-6-PD gene for the slow-moving T variant and the latter with the fast-moving E variant gene. The hybrid, therefore, exhibits genetic mosaicism due to random inactivation in each cell, of one of the two X chromosomes in the embryonic stage. Exponentially growing cells from 13 fibroblast strains, comprising a wide range of E to T ratios, were exposed to moderately low dose of uv irradiation (6 J/m2). The recovery in DNA synthesis during the 2- to 8-h postirradiation period was calculated as the mean percentage rates of (/sup 3/H)thymidine incorporated during the time as compared to the unirradiated zero-time controls. The results show a statistically significant positive correlation as determined by linear regression analysis between the levels of E and the rate of recovery in DNA synthesis. This is valid also at the higher dose of uv (21 J/m2). These results strengthen our earlier observations with 25-hydroxycholesterol that in the in vitro system the cell expressing the E variant is perhaps more resistant to cytotoxic agents. This also indicates that various factors contribute to the development of monotypism which include cell growth, cell death, mutation, and selection, to name a few.

  16. Contribution of permeability and sensitivity to inhibition of DNA synthesis in determining susceptibilities of Escherichia coli, Pseudomonas aeruginosa, and Alcaligenes faecalis to ciprofloxacin.

    PubMed

    Bedard, J; Chamberland, S; Wong, S; Schollaardt, T; Bryan, L E

    1989-09-01

    To examine the correlation between bacterial cell susceptibility to ciprofloxacin and the magnitude of uptake and cell target sensitivity, the relative contribution of ciprofloxacin accumulation in intact cells and its ability to inhibit DNA synthesis were investigated among strains of Escherichia coli, Pseudomonas aeruginosa, and Alcaligenes faecalis. Uptake studies of [14C]ciprofloxacin demonstrated diffusion kinetics for P. aeruginosa and E. coli. Ciprofloxacin was more readily removed from E. coli J53 and A. faecalis ATCC 19018 by washing than from P. aeruginosa PAO503. These results indicate that the process of cell accumulation is different for P. aeruginosa in that the drug is firmly bound at an extracellular site. Whatever the washing conditions, A. faecalis accumulated less drug than either of the other two bacteria. Magnesium chloride (10 mM) caused a substantial decrease of ciprofloxacin accumulated and an increase in the MIC, depending upon the nature of the medium. The addition of carbonyl cyanide m-chlorophenylhydrazone caused a variable increase in drug accumulated, depending on the medium and the bacterial strain. The concentration of ciprofloxacin required to obtain 50% inhibition (ID50) of DNA synthesis for P. aeruginosa PAO503 and A. faecalis ATCC 19018 did not correlate with their corresponding MICs but did for E. coli J53. Treatment with EDTA decreased the ID50 of ciprofloxacin for P. aeruginosa PAO503 and its gyrA derivative by 5- and 2-fold, respectively, and decreased the ID50 for E. coli JB5R, a strain with a known decrease in OmpF, by 1.4-fold but did not decrease the ID50 for the normally susceptible E. coli J53. The ID(50) for P. aeruginosa obtained after EDTA treatment or in ether-permeabilized cells was higher than that obtained for the other two strains. The protonophore carbonyl cyanide m-chlorophenylhydrazone prevented killing by low ciprofloxacin concentrtaions, but sodium azide did not. The latter compound did not enhance killing

  17. Cytokinetic studies reveal etiology of cytogenetic genotoxicity produced by a series of angiotensin II (AII) receptor antagonists may be perturbed DNA synthesis

    SciTech Connect

    Selden, J.R.; Miller, J.E.; Dolbeare, F.; Galloway, S.M.; Nichols, W.W. Lawrence Livermore National Lab., CA )

    1993-01-01

    Six of 13 AII receptor antagonists produced chromosomal aberrations in CHO cells. In addition, these six compounds perturbed cellular kinetics (i.e., reduced mitotic indices and cell yields). It was hypothesized that the mechanism of clastogenesis was not due to a direct genotoxic effect, but may result from disruption of DNA replication. Flow cytokinetic studies, using the BrdUrd-FITC/propidium iodide technique, were performed on all six clastogenic compounds, and a seventh candidate from this group. All seven altered CHO cell kinetics as follows: (1) The amount of BrdUrd per S phase cell was reduced; (2) Cell movement within S phase was inhibited; and (3) Lowest doses perturbing CHO cell kinetics were below minimum concentrations producing aberrations. These data provide evidence that this cytogenetic damage is mediated by a mechanism which disrupts cellular DNA synthesis.

  18. Pseudomonas sp. xylanase for clarification of Mausambi and Orange fruit juice

    NASA Astrophysics Data System (ADS)

    Sharma, Pawan Kumar; Chand, Duni

    2012-07-01

    Xylanase can be usd for many Industrial applications and juice clarification is one of them. Pseudomonas sp. xylanase was used for fruit juice clarification in free State. Maximum amount of juice clarification was in case of Mausambi juice was observed at 40 C∞ and 52 hours, in case of free enzyme treated juice there is 46.9% increase in clarity and 1.7 fold increase in reducing sugars of the juice and enzyme dose was optimized as 8U with maximum flow rate of 6 ml/min at this dose. In case of orange juice in free enzyme treated juice maximum clarity was observed at 40 C∞ and 52 hours, juice was found to be 42.14 % clear with increase of 1.9 fold of reducing sugars, enzyme dose optimized was 8.06U with maximum flow rate of 0.86 ml/min.

  19. Choosing and Using a Plant DNA Barcode

    PubMed Central

    Hollingsworth, Peter M.; Graham, Sean W.; Little, Damon P.

    2011-01-01

    The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1 (CO1) mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. In this paper, we review the process of selecting and refining a plant barcode; evaluate the factors which influence the discriminatory power of the approach; describe some early applications of plant barcoding and summarise major emerging projects; and outline tool development that will be necessary for plant DNA barcoding to advance. PMID:21637336

  20. DNA polymerase-mediated synthesis of unbiased threose nucleic acid (TNA) polymers requires 7-deazaguanine to suppress G:G mispairing during TNA transcription.

    PubMed

    Dunn, Matthew R; Larsen, Andrew C; Zahurancik, Walter J; Fahmi, Nour Eddine; Meyers, Madeline; Suo, Zucai; Chaput, John C

    2015-04-01

    Threose nucleic acid (TNA) is an unnatural genetic polymer capable of undergoing Darwinian evolution to generate folded molecules with ligand-binding activity. This property, coupled with a nuclease-resistant backbone, makes TNA an attractive candidate for future applications in biotechnology. Previously, we have shown that an engineered form of the Archaean replicative DNA polymerase 9°N, known commercially as Therminator DNA polymerase, can copy a three-letter genetic alphabet (A,T,C) from DNA into TNA. However, our ability to transcribe four-nucleotide libraries has been limited by chain termination events that prevent the synthesis of full-length TNA products. Here, we show that chain termination is caused by tG:dG mispairing in the enzyme active site. We demonstrate that the unnatural base analogue 7-deazaguanine (7dG) will suppress tGTP misincorporation by inhibiting the formation of Hoogsteen tG:dG base pairs. DNA templates that contain 7dG in place of natural dG residues replicate with high efficiency and >99% overall fidelity. Pre-steady-state kinetic measurements indicate that the rate of tCTP incorporation is 5-fold higher opposite 7dG than dG and only slightly lower than dCTP incorporation opposite either 7dG or dG. These results provide a chemical solution to the problem of how to synthesize large, unbiased pools of TNA molecules by polymerase-mediated synthesis. PMID:25785966

  1. Variants of mouse DNA polymerase κ reveal a mechanism of efficient and accurate translesion synthesis past a benzo[a]pyrene dG adduct

    PubMed Central

    Liu, Yang; Yang, Yeran; Tang, Tie-Shan; Zhang, Hui; Wang, Zhifeng; Friedberg, Errol; Yang, Wei; Guo, Caixia

    2014-01-01

    DNA polymerase κ (Polκ) is the only known Y-family DNA polymerase that bypasses the 10S (+)-trans-anti-benzo[a]pyrene diol epoxide (BPDE)-N2-deoxyguanine adducts efficiently and accurately. The unique features of Polκ, a large structure gap between the catalytic core and little finger domain and a 90-residue addition at the N terminus known as the N-clasp, may give rise to its special translesion capability. We designed and constructed two mouse Polκ variants, which have reduced gap size on both sides [Polκ Gap Mutant (PGM) 1] or one side flanking the template base (PGM2). These Polκ variants are nearly as efficient as WT in normal DNA synthesis, albeit with reduced accuracy. However, PGM1 is strongly blocked by the 10S (+)-trans-anti-BPDE-N2-dG lesion. Steady-state kinetic measurements reveal a significant reduction in efficiency of dCTP incorporation opposite the lesion by PGM1 and a moderate reduction by PGM2. Consistently, Polκ-deficient cells stably complemented with PGM1 GFP-Polκ remained hypersensitive to BPDE treatment, and complementation with WT or PGM2 GFP-Polκ restored BPDE resistance. Furthermore, deletion of the first 51 residues of the N-clasp in mouse Polκ (mPolκ52–516) leads to reduced polymerization activity, and the mutant PGM252–516 but not PGM152–516 can partially compensate the N-terminal deletion and restore the catalytic activity on normal DNA. However, neither WT nor PGM2 mPolκ52–516 retains BPDE bypass activity. We conclude that the structural gap physically accommodates the bulky aromatic adduct and the N-clasp is essential for the structural integrity and flexibility of Polκ during translesion synthesis. PMID:24449898

  2. Effects of large and small T antigens on DNA synthesis and cell division in simian virus 40-transformed BALB/c 3T3 cells.

    PubMed Central

    Christensen, J B; Brockman, W W

    1982-01-01

    The roles of the large T and small t antigens of simian virus 40 in cellular DNA synthesis and cell division were analyzed in BALB/c 3T3 mouse cells transformed by wild-type, temperature-sensitive A (tsA), or tsA-deletion (tsA/dl) double mutants. Assessment of DNA replication and cell cycle distribution by radioautography of [3H]thymidine-labeled nuclei and by flow microfluorimetry indicate that tsA transformants do not synthesize DNA or divide at the restrictive temperature to the same extent as they do at the permissive temperature or as wild-type transformants do at the restrictive temperature. This confirms earlier studies suggesting that large T induces DNA synthesis and mitosis in transformed cells. Inhibition of replication in tsA transformants at the restrictive temperature, however, is not complete. Some residual cell division does occur but is in large part offset by cell detachment and death. This failure to revert completely to the parental 3T3 phenotype, as indicated by residual cell cycling at the restrictive temperature, was also observed in cells transformed by tsA/dl double mutants which, in addition to producing a ts large T, make no small t protein. Small t, therefore, does not appear to be responsible for the residual cell cycling and plays no demonstrable role in the induction of DNA synthesis or cell division in stably transformed BALB/c 3T3 cells. Comparison of cell cycling in tsA and tsA/dl transformants, normal 3T3 cells, and a transformation revertant suggests that the failure of tsA transformants to revert completely may be due to leakiness of the tsA mutation as well as to a permanent cellular alteration induced during viral transformation. Finally, analysis of cells transformed by tsA/dl double mutants indicates that small t is not required for full expression of growth properties characteristic of transformed cells. Images PMID:6292518

  3. Calcium phosphate flocs and the clarification of sugar cane juice from whole of crop harvesting.

    PubMed

    Thai, Caroline C D; Moghaddam, Lalehvash; Doherty, William O S

    2015-02-11

    Sugar cane biomass is one of the most viable feedstocks for the production of renewable fuels and chemicals. Therefore, processing the whole of crop (WC) (i.e., stalk and trash, instead of stalk only) will increase the amount of available biomass for this purpose. However, effective clarification of juice expressed from WC for raw sugar manufacture is a major challenge because of the amounts and types of non-sucrose impurities (e.g., polysaccharides, inorganics, proteins, etc.) present. Calcium phosphate flocs are important during sugar cane juice clarification because they are responsible for the removal of impurities. Therefore, to gain a better understanding of the role of calcium phosphate flocs during the juice clarification process, the effects of impurities on the physicochemical properties of calcium phosphate flocs were examined using small-angle laser light scattering technique, attenuated total reflectance Fourier transformed infrared spectroscopy, and X-ray powder diffraction. Results on synthetic sugar juice solutions showed that the presence of SiO2 and Na(+) ions affected floc size and floc structure. Starch and phosphate ions did not affect the floc structure; however, the former reduced the floc size, whereas the latter increased the floc size. The study revealed that high levels of Na(+) ions would negatively affect the clarification process the most, as they would reduce the amount of suspended particles trapped by the flocs. A complementary study on prepared WC juice using cold and cold/intermediate liming techniques was conducted. The study demonstrated that, in comparison to the one-stage (i.e., conventional) clarification process, a two-stage clarification process using cold liming removed more polysaccharides (≤19%), proteins (≤82%), phosphorus (≤53%), and SiO2 (≤23%) in WC juice but increased Ca(2+) (≤136%) and sulfur (≤200%). PMID:25574835

  4. Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes.

    PubMed

    Ren, Xiaomei; El-Sagheer, Afaf H; Brown, Tom

    2016-05-01

    A sterically undemanding azide analogue of dTTP (AHP dUTP) with an alkyl chain and ethynyl attachment to the nucleobase was designed and incorporated into DNA by primer extension, reverse transcription and polymerase chain reaction (PCR). An azide-modified 523 bp PCR amplicon with all 335 thymidines replaced by AHP dU was shown to be a perfect copy of the template from which it was amplified. Replacement of thymidine with AHP dU increases duplex stability, accounting in part for the high incorporation efficiency of the azide-modified triphosphate. Single-stranded azide-labelled DNA was conveniently prepared from PCR products by λ-exonuclease digestion and streptavidin magnetic bead isolation. Efficient fluorescent labelling of single and double-stranded DNA was carried out using dyes functionalized with bicyclo[6.1.0]non-4-yne (BCN) via the strain-promoted alkyne-azide cycloaddition (SPAAC) reaction. This revealed that the degree of labelling must be carefully controlled to achieve optimum fluorescence and avoid fluorescence quenching. Dual-coloured probes were obtained in a single tube fluorescent labelling reaction; and varying the ratios of the two dyes provides a simple method to prepare DNA probes with unique fluorescent signatures. AHP dUTP is a versatile clickable nucleotide with potentially wide applications in biology and nanotechnology including single molecule studies and synthesis of modified aptamer libraries via SELEX. PMID:26819406

  5. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(A)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of know chemical and physical mutagens. Neither retinol or retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 ..mu..M to 50 ..mu..M. Retinol and retinoic acid did not significantly affect 200..mu..g/mL ethyl methanesulfonate (EMS)- or 32 J/m/sup 2/ ultraviolet light (UV)-induced UDS at concentrations ranging from 1..mu..M to 50 ..mu..M. In contrast, retinol and retinoic acid significantly inhibited 2.5 ..mu..g/mL and 5.0 ..mu..g/mL 7,12-dimethyl-benz(a)-anthracene(DMBA)-induced UDS at concentrations of 1..mu..M or greater. Retinol-and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 ..mu..M and 100 ..mu..M. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  6. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(a)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of known chemical and physical mutagens. Neither retinol nor retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 microM to 50 microM. Retinol and retinoic acid did not significantly affect 200 micrograms/mL ethyl methanesulfonate(EMS)- or 32 J/m2 ultraviolet light(UV)-induced UDS at concentrations ranging from 1 microM to 50 microM. In contrast, retinol and retinoic acid significantly inhibited 2.5 micrograms/mL and 5.0 micrograms/mL 7,12-dimethyl-benz(a)anthracene(DMBA)-induced UDS at concentrations of 1 microM or greater. Retinol- and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 microM and 100 microM. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  7. Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes

    PubMed Central

    Ren, Xiaomei; El-Sagheer, Afaf H.; Brown, Tom

    2016-01-01

    A sterically undemanding azide analogue of dTTP (AHP dUTP) with an alkyl chain and ethynyl attachment to the nucleobase was designed and incorporated into DNA by primer extension, reverse transcription and polymerase chain reaction (PCR). An azide-modified 523 bp PCR amplicon with all 335 thymidines replaced by AHP dU was shown to be a perfect copy of the template from which it was amplified. Replacement of thymidine with AHP dU increases duplex stability, accounting in part for the high incorporation efficiency of the azide-modified triphosphate. Single-stranded azide-labelled DNA was conveniently prepared from PCR products by λ-exonuclease digestion and streptavidin magnetic bead isolation. Efficient fluorescent labelling of single and double-stranded DNA was carried out using dyes functionalized with bicyclo[6.1.0]non-4-yne (BCN) via the strain-promoted alkyne-azide cycloaddition (SPAAC) reaction. This revealed that the degree of labelling must be carefully controlled to achieve optimum fluorescence and avoid fluorescence quenching. Dual-coloured probes were obtained in a single tube fluorescent labelling reaction; and varying the ratios of the two dyes provides a simple method to prepare DNA probes with unique fluorescent signatures. AHP dUTP is a versatile clickable nucleotide with potentially wide applications in biology and nanotechnology including single molecule studies and synthesis of modified aptamer libraries via SELEX. PMID:26819406

  8. RECIST 1.1-Update and clarification: From the RECIST committee.

    PubMed

    Schwartz, Lawrence H; Litière, Saskia; de Vries, Elisabeth; Ford, Robert; Gwyther, Stephen; Mandrekar, Sumithra; Shankar, Lalitha; Bogaerts, Jan; Chen, Alice; Dancey, Janet; Hayes, Wendy; Hodi, F Stephen; Hoekstra, Otto S; Huang, Erich P; Lin, Nancy; Liu, Yan; Therasse, Patrick; Wolchok, Jedd D; Seymour, Lesley

    2016-07-01

    The Response Evaluation Criteria in Solid Tumours (RECIST) were developed and published in 2000, based on the original World Health Organisation guidelines first published in 1981. In 2009, revisions were made (RECIST 1.1) incorporating major changes, including a reduction in the number of lesions to be assessed, a new measurement method to classify lymph nodes as pathologic or normal, the clarification of the requirement to confirm a complete response or partial response and new methodologies for more appropriate measurement of disease progression. The purpose of this paper was to summarise the questions posed and the clarifications provided as an update to the 2009 publication. PMID:27189322

  9. Design and Synthesis of Heterocyclic Cations for Specific DNA Recognition: From AT-Rich to Mixed-Base-Pair DNA Sequences

    PubMed Central

    2015-01-01

    The compounds synthesized in this research were designed with the goal of establishing a new paradigm for mixed-base-pair DNA sequence-specific recognition. The design scheme starts with a cell-permeable heterocyclic cation that binds to AT base pair sites in the DNA minor groove. Modifications were introduced in the original compound to include an H-bond accepting group to specifically recognize the G-NH that projects into the minor groove. Therefore, a series of heterocyclic cations substituted with an azabenzimidazole ring has been designed and synthesized for mixed-base-pair DNA recognition. The most successful compound, 12a, had an azabenzimidazole to recognize G and additional modifications for general minor groove interactions. It binds to the DNA site −AAAGTTT– more strongly than the −AAATTT– site without GC and indicates the design success. Structural modifications of 12a generally weakened binding. The interactions of the new compound with a variety of DNA sequences with and without GC base pairs were evaluated by thermal melting analysis, circular dichroism, fluorescence emission spectroscopy, surface plasmon resonance, and molecular modeling. PMID:24422528

  10. The Development of Value Clarification Skills: Initial Efforts in an Eighth Grade Social Studies Class. Occasional Paper 74-3.

    ERIC Educational Resources Information Center

    Kingman, Barry

    Most materials on value clarification techniques have been written by professionals working at university schools of education. To examine value clarification from another view, to see what difficulties teachers are having in translating new techniques into classroom realities, an eighth grade social studies teacher relates his classroom…

  11. Using Task Clarification, Goal Setting, and Feedback to Decrease Table Busing Times in a Franchise Pizza Restaurant

    ERIC Educational Resources Information Center

    Amigo, Seth; Smith, Andrew; Ludwig, Timothy

    2008-01-01

    The current study investigated the effects of task-clarification, and manager verbal and graphic feedback on employee busing times at a pizza restaurant. Using an ABC design, task-clarification was provided in a memo, which described the process, priority, and goal time of busing. The busing time decreased slightly, from an average of 315 seconds…

  12. Clarification of Reconstituted Frozen Orange Juice Concentrate by Continuous Flow Centrifugation for Limonin Glucoside Solid Phase Extraction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The clarification of reconstituted frozen orange juice concentrate by continuous-flow centrifugation in preparation to being applied to a solid phase extraction column for the isolation of limonin glucoside has been evaluated. Clarification experiments spanning over three different flow rates (325,...

  13. Effects of 2',3'-dideoxynucleosides on proliferation and differentiation of human pluripotent progenitors in liquid culture and their effects on mitochondrial DNA synthesis.

    PubMed Central

    Faraj, A; Fowler, D A; Bridges, E G; Sommadossi, J P

    1994-01-01

    2',3'-Dideoxynucleosides (ddNs) including 3'-azido-3'-deoxythymidine (AZT), 3'-fluoro-3'-deoxythymidine (FLT), 3'-amino-3'-deoxythymidine (AMT), 2',3'-dideoxycytidine (ddC), and 2',3'-didehydro-3'-deoxythymidine (D4T) were tested for their effects on proliferation and differentiation of pluripotent progenitor cells (CD34+) purified from human bone marrow cells grown in liquid cultures. These highly purified progenitor cells undergo extensive proliferation during 14 days, with a marked differentiation during the last 7 days. These differentiated cells exhibit normal morphological features in response to specific hematopoietic growth factors of both erythroid and granulocyte-macrophage lineages, as demonstrated by flow cytometry cell phenotyping. The potencies of these ddNs in inhibiting proliferation of granulocyte-macrophage lineage cells were in the order FLT > AMT = ddC > AZT >> D4T, and the potencies in inhibiting proliferation of erythroid lineage cultures were in the order FLT > AMT > AZT > ddC >> D4T. The toxic effects of ddNs assessed in these liquid cultures were in agreement with data obtained by using semisolid cultures, demonstrating the consistency of these two in vitro hematopoietic systems toward ddN toxicity. ddC was toxic to CD34+ progenitor cells and/or cells in the early stages of differentiation, whereas the inhibitory effect of AZT on the erythroid lineage was predominantly observed on a more mature population of erythroid progenitors during the differentiation process. Slot blot analysis of granulocyte-macrophage cultures demonstrated that exposure to ddC and FLT was associated with a decrease in total mitochondrial DNA (mtDNA) content, suggesting that these two ddNs inhibit mtDNA synthesis. In contrast, no difference in the ratio of nuclear DNA to mtDNA was observed in cells exposed to toxic concentrations of AZT and AMT is not associated with an inhibition of mtDNA synthesis. This human pluripotent progenitor liquid culture system should

  14. UAP56 is an important mediator of Angiotensin II/platelet derived growth factor induced vascular smooth muscle cell DNA synthesis and proliferation

    SciTech Connect

    Sahni, Abha; Wang, Nadan; Alexis, Jeffrey

    2013-02-15

    Highlights: ► Knockdown of UAP56 inhibits Angiotensin II/PDGF induced vascular smooth muscle cell proliferation. ► UAP56 is a positive regulator of E2F transcriptional activation. ► UAP56 is present in the vessel wall of low flow carotid arteries. -- Abstract: Angiotensin (Ang) II and platelet-derived growth factor (PDGF) are important mediators of pathologic vascular smooth muscle cell (VSMC) proliferation. Identifying downstream mediators of Ang II and PDGF signaling may provide insights for therapies to improve vascular proliferative diseases. We have previously demonstrated that breakpoint cluster region (Bcr) is an important mediator of Ang II/PDGF signaling in VSMC. We have recently reported that the DExD/H box protein UAP56 is an interacting partner of Bcr in regulating VSMC DNA synthesis. We hypothesized that UAP56 itself is an important regulator of VSMC proliferation. In this report we demonstrate that knockdown of UAP56 inhibits Ang II/PDGF induced VSMC DNA synthesis and proliferation, and inhibits E2F transcriptional activity. In addition, we demonstrate that UAP56 is present in the vessel wall of low-flow carotid arteries. These findings suggest that UAP56 is a regulator of VSMC proliferation and identify UAP56 as a target for preventing vascular proliferative disease.

  15. Synergistic effects of tethered growth factors and adhesion ligands on DNA synthesis and function of primary hepatocytes cultured on soft synthetic hydrogels

    PubMed Central

    Mehta, Geeta; Williams, Courtney M.; Alvarez, Luis; Lesniewski, Martha; Kamm, Roger D.; Griffith, Linda G.

    2010-01-01

    The composition, presentation, and spatial orientation of extracellular matrix molecules and growth factors are key regulators of cell behavior. Here, we used self-assembling peptide nanofiber gels as a modular scaffold to investigate how fibronectin-derived adhesion ligands and different modes of epidermal growth factor (EGF) presentation synergistically regulate multiple facets of primary rat hepatocyte behavior in the context of a soft gel. In the presence of soluble EGF, inclusion of dimeric RGD and the heparin binding domain from fibronectin (HB) increased hepatocyte aggregation, spreading, and metabolic function compared to unmodified gels or gels modified with a single motif, but unlike rigid substrates, gels failed to induce DNA synthesis. Tethered EGF dramatically stimulated cell aggregation and spreading under all adhesive ligand conditions and also preserved metabolic function. Surprisingly, tethered EGF elicited DNA synthesis on gels with RGD and HB. Phenotypic differences between soluble and tethered EGF stimulation of cells on peptide gels are correlated with differences in expression and phosphorylation the EGF receptor and its heterodimerization partner ErbB2, and activation of the downstream signaling node ERK1/2. These modular matrices reveal new facets of hepatocellular biology in culture and may be more broadly useful in culture of other soft tissues. PMID:20304480

  16. DNA synthesis and cell proliferation C{sub 6} glioma and primary glial cells exposed to a 836.55 MHz modulated radiofrequency field

    SciTech Connect

    Stagg, R.B.; Thomas, W.J.; Jones, R.A.; Adey, W.R.

    1997-05-01

    The authors have tested the hypothesis that modulated radiofrequency (RF) fields may act as a tumor-promoting agent by altering DNA synthesis, leading to increased cell proliferation. In vitro tissue cultures of transformed and normal rat glial cells were exposed to an 836.55 MHz, packet-modulated RF field at three power densities: 0.09, 0.9, and 9 mW/cm{sup 2}, resulting in specific absorption rates (SARs) ranging from 0.15 to 59 {micro}W/g. TEM-mode transmission-line cells were powered by a prototype time-domain multiple-access (TDMA) transmitter that conforms to the North American digital cellular telephone standard. One sham and one energized TEM cell were placed in standard incubators maintained at 37 C and 5% CO{sub 2}. DNA synthesis experiments at 0.59--59 {micro}W/g SAR were performed on log-phase and serum-starved semiquiescent cultures after 24 h exposure. Cell growth at 0.15--15 {micro}W/g SAR was determined by cell counts of log-phase cultures on days 0, 1, 5, 7, 9, 12, and 14 of a 2 week protocol.

  17. Effects of Glyprolines on DNA Synthesis and Free Radical Oxidation in Mouse Gastric Mucosa Under Physiological Conditions and During Therapy with Oral Non-Steroid Anti-Inflammatory Drugs.

    PubMed

    Fleishman, M Yu; Tolstenok, I V; Lebed'ko, O A; Andreeva, L A; Myasoedov, N F; Timoshin, S S

    2015-08-01

    Studies by (3)H-thymidin autoradiography showed that injections of Pro-Gly-Pro and Arg-Gly-Pro peptides caused no changes in the DNA synthesis processes in the gastric mucosa. Both peptides induced a reduction of free radical oxidation activity, which was shown by chemiluminescence. Indomethacin induced lesions in the gastric mucosa, triggered oxidative stress, and reduced proliferative activity. Injection of Pro-Gly-Pro peptide before indomethacin corrected disorders in oxidative status and normalized DNA synthesis. Preinjection of Arg-Gly-Pro led to enlargement (by 4.6 times) of the focus of lesions in animals treated by indomethacin and augmented oxidative stress. PMID:26388565

  18. All Values Are Equal, But Some Are More Equal Than Others: A Critique and Redefinition of Values Clarification. Monograph Series No. 102 Code C-9.

    ERIC Educational Resources Information Center

    McKnight, Richard

    This literature review presents the essentials of the theory of Values Clarification and its fundamental terms, and makes a critical analysis of the Values Clarification Theory of Valuation. (Author/JLL)

  19. Mucopolysaccharidosis VI in cats - clarification regarding genetic testing.

    PubMed

    Lyons, Leslie A; Grahn, Robert A; Genova, Francesca; Beccaglia, Michela; Hopwood, John J; Longeri, Maria

    2016-01-01

    The release of new DNA-based diagnostic tools has increased tremendously in companion animals. Over 70 different DNA variants are now known for the cat, including DNA variants in disease-associated genes and genes causing aesthetically interesting traits. The impact genetic tests have on animal breeding and health management is significant because of the ability to control the breeding of domestic cats, especially breed cats. If used properly, genetic testing can prevent the production of diseased animals, causing the reduction of the frequency of the causal variant in the population, and, potentially, the eventual eradication of the disease. However, testing of some identified DNA variants may be unwarranted and cause undo strife within the cat breeding community and unnecessary reduction of gene pools and availability of breeding animals. Testing for mucopolysaccharidosis Type VI (MPS VI) in cats, specifically the genetic testing of the L476P (c.1427T>C) and the D520N (c.1558G>A) variants in arylsulfatase B (ARSB), has come under scrutiny. No health problems are associated with the D520N (c.1558G>A) variant, however, breeders that obtain positive results for this variant are speculating as to possible correlation with health concerns. Birman cats already have a markedly reduced gene pool and have a high frequency of the MPS VI D520N variant. Further reduction of the gene pool by eliminating cats that are heterozygous or homozygous for only the MPS VI D520N variant could lead to more inbreeding depression effects on the breed population. Herein is debated the genetic testing of the MPS VI D520N variant in cats. Surveys from different laboratories suggest the L476P (c.1427T>C) disease-associated variant should be monitored in the cat breed populations, particularly breeds with Siamese derivations and outcrosses. However, the D520N has no evidence of association with disease in cats and testing is not recommended in the absence of L476P genotyping. Selection

  20. Thermodynamic and mechanistic insights into translesion DNA synthesis catalyzed by Y-family DNA polymerase across a bulky double-base lesion of an antitumor platinum drug.

    PubMed

    Brabec, Viktor; Malina, Jaroslav; Margiotta, Nicola; Natile, Giovanni; Kasparkova, Jana

    2012-11-26

    To determine how the Y-family translesion DNA polymerase η (Polη) processes lesions remains fundamental to understanding the molecular origins of the mutagenic translesion bypass. We utilized model systems employing a DNA double-base lesion derived from 1,2-GG intrastrand cross-links of a new antitumor Pt(II) complex containing a bulky carrier ligand, namely [PtCl(2)(cis-1,4-dach)] (DACH=diaminocyclohexane). The catalytic efficiency of Polη for the insertion of correct dCTP, with respect to the other incorrect nucleotides, opposite the 1,2-GG cross-link was markedly reduced by the DACH carrier ligand. This reduced efficiency of Polη to incorporate the correct dCTP could be due to a more extensive DNA unstacking and deformation of the minor groove induced in the DNA by the cross-link of bulky [PtCl(2)(cis-1,4-dach)]. The major products of the bypass of this double-base lesion produced by [PtCl(2)(cis-1,4-dach)] by Polη resulted from misincorporation of dATP opposite the platinated G residues. The results of the present work support the thesis that this misincorporation could be due to sterical effects of the bulkier 1,4-DACH ligand hindering the formation of the Polη-DNA-incoming nucleotide complex. Calorimetric analysis suggested that thermodynamic factors may contribute to the forces that governed enhanced incorporation of the incorrect dATP by Polη as well. PMID:23065963