Sample records for dnae2 complement dna

  1. Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

    PubMed Central

    Seco, Elena M.

    2017-01-01

    Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

  2. The role of polymerase III in conjugation between E. coli K12 donor and recipient strains carrying dnaE ts mutation.

    PubMed

    Blinkowa, A

    1976-01-01

    The possible role of DNA polimerase III in conjugation was studied in a series of mutants temperature-sensitive for DNA polymerase III synthesis. The temperature-sensitive DNA mutation called dnaE 486 (ts) prohibits vegetative DNA replication at 41-45 degrees. Transfer of episome and chromosome from temperature-sensitive donor, carrying dnaE mutation to wild-type recipient strains, revertants and dnaE recipients was investigated. In the first two cases the number of Lac+ sexductants being even slightly higher at 43 degrees. Conjugational synthesis accompanying transfer involving the combination of dnaE (ts) thymine dependent and thymine independent donor and recipient strains measured by incorporation of 14C thymine was observed at the restrictive temperature. In the case of conjugation with temperaturesensitive recipient strains a drop of Lac+ sexductants and Pro+ recombinants may be as a result of disturbances in the synthesis of complementary strand in recipient, known to be dependent on pol III. However, the episome investigated by centrifugation in neutral CsC1 gradient after its transfer to the recipient with faulty polymerase III was double stranded (replicated) at the restrictive temperature.

  3. Traceless splicing enabled by substrate-induced activation of the Nostoc punctiforme Npu DnaE intein after mutation of a catalytic cysteine to serine.

    PubMed

    Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine

    2014-12-12

    Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.

  4. Comprehensive analysis of DNA polymerase III α subunits and their homologs in bacterial genomes

    PubMed Central

    Timinskas, Kęstutis; Balvočiūtė, Monika; Timinskas, Albertas; Venclovas, Česlovas

    2014-01-01

    The analysis of ∼2000 bacterial genomes revealed that they all, without a single exception, encode one or more DNA polymerase III α-subunit (PolIIIα) homologs. Classified into C-family of DNA polymerases they come in two major forms, PolC and DnaE, related by ancient duplication. While PolC represents an evolutionary compact group, DnaE can be further subdivided into at least three groups (DnaE1-3). We performed an extensive analysis of various sequence, structure and surface properties of all four polymerase groups. Our analysis suggests a specific evolutionary pathway leading to PolC and DnaE from the last common ancestor and reveals important differences between extant polymerase groups. Among them, DnaE1 and PolC show the highest conservation of the analyzed properties. DnaE3 polymerases apparently represent an ‘impaired’ version of DnaE1. Nonessential DnaE2 polymerases, typical for oxygen-using bacteria with large GC-rich genomes, have a number of features in common with DnaE3 polymerases. The analysis of polymerase distribution in genomes revealed three major combinations: DnaE1 either alone or accompanied by one or more DnaE2s, PolC + DnaE3 and PolC + DnaE1. The first two combinations are present in Escherichia coli and Bacillus subtilis, respectively. The third one (PolC + DnaE1), found in Clostridia, represents a novel, so far experimentally uncharacterized, set. PMID:24106089

  5. Mutagenic cost of ribonucleotides in bacterial DNA

    PubMed Central

    Schroeder, Jeremy W.; Randall, Justin R.; Hirst, William G.; O’Donnell, Michael E.; Simmons, Lyle A.

    2017-01-01

    Replicative DNA polymerases misincorporate ribonucleoside triphosphates (rNTPs) into DNA approximately once every 2,000 base pairs synthesized. Ribonucleotide excision repair (RER) removes ribonucleoside monophosphates (rNMPs) from genomic DNA, replacing the error with the appropriate deoxyribonucleoside triphosphate (dNTP). Ribonucleotides represent a major threat to genome integrity with the potential to cause strand breaks. Furthermore, it has been shown in the bacterium Bacillus subtilis that loss of RER increases spontaneous mutagenesis. Despite the high rNTP error rate and the effect on genome integrity, the mechanism underlying mutagenesis in RER-deficient bacterial cells remains unknown. We performed mutation accumulation lines and genome-wide mutational profiling of B. subtilis lacking RNase HII, the enzyme that incises at single rNMP residues initiating RER. We show that loss of RER in B. subtilis causes strand- and sequence-context–dependent GC → AT transitions. Using purified proteins, we show that the replicative polymerase DnaE is mutagenic within the sequence context identified in RER-deficient cells. We also found that DnaE does not perform strand displacement synthesis. Given the use of nucleotide excision repair (NER) as a backup pathway for RER in RNase HII-deficient cells and the known mutagenic profile of DnaE, we propose that misincorporated ribonucleotides are removed by NER followed by error-prone resynthesis with DnaE. PMID:29078353

  6. High-fidelity DNA replication in Mycobacterium tuberculosis relies on a trinuclear zinc center.

    PubMed

    Baños-Mateos, Soledad; van Roon, Anne-Marie M; Lang, Ulla F; Maslen, Sarah L; Skehel, J Mark; Lamers, Meindert H

    2017-10-11

    High-fidelity DNA replication depends on a proofreading 3'-5' exonuclease that is associated with the replicative DNA polymerase. The replicative DNA polymerase DnaE1 from the major pathogen Mycobacterium tuberculosis (Mtb) uses its intrinsic PHP-exonuclease that is distinct from the canonical DEDD exonucleases found in the Escherichia coli and eukaryotic replisomes. The mechanism of the PHP-exonuclease is not known. Here, we present the crystal structure of the Mtb DnaE1 polymerase. The PHP-exonuclease has a trinuclear zinc center, coordinated by nine conserved residues. Cryo-EM analysis reveals the entry path of the primer strand in the PHP-exonuclease active site. Furthermore, the PHP-exonuclease shows a striking similarity to E. coli endonuclease IV, which provides clues regarding the mechanism of action. Altogether, this work provides important insights into the PHP-exonuclease and reveals unique properties that make it an attractive target for novel anti-mycobacterial drugs.The polymerase and histidinol phosphatase (PHP) domain in the DNA polymerase DnaE1 is essential for mycobacterial high-fidelity DNA replication. Here, the authors determine the DnaE1 crystal structure, which reveals the PHP-exonuclease mechanism that can be exploited for antibiotic development.

  7. DNA replication fidelity in Mycobacterium tuberculosis is mediated by an ancestral prokaryotic proofreader

    PubMed Central

    Rock, Jeremy M.; Lang, Ulla F.; Chase, Michael R.; Ford, Christopher B.; Gerrick, Elias R.; Gawande, Richa; Coscolla, Mireia; Gagneux, Sebastien; Fortune, Sarah M.; Lamers, Meindert H.

    2015-01-01

    The DNA replication machinery is an important target for antibiotic development for increasingly drug resistant bacteria including Mycobacterium tuberculosis1. While blocking DNA replication leads to cell death, disrupting the processes used to ensure replication fidelity can accelerate mutation and the evolution of drug resistance. In E. coli, the proofreading subunit of the replisome, the ε-exonuclease, is essential for high fidelity DNA replication2; however, we find that it is completely dispensable in M. tuberculosis. Rather, the mycobacterial replicative polymerase, DnaE1, encodes a novel editing function that proofreads DNA replication, mediated by an intrinsic 3′-5′ exonuclease activity within its PHP domain. Inactivation of the DnaE1 PHP domain increases the mutation rate by greater than 3,000 fold. Moreover, phylogenetic analysis of DNA replication proofreading in the bacterial kingdom suggests that E. coli is a phylogenetic outlier and that PHP-domain mediated proofreading is widely conserved and indeed may be the ancestral prokaryotic proofreader. PMID:25894501

  8. Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication

    PubMed Central

    Lapenta, Fabio; Montón Silva, Alejandro; Brandimarti, Renato; Lanzi, Massimiliano; Gratani, Fabio Lino; Vellosillo Gonzalez, Perceval; Perticarari, Sofia; Hochkoeppler, Alejandro

    2016-01-01

    DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP) domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics. PMID:27050298

  9. DNA replication fidelity in Mycobacterium tuberculosis is mediated by an ancestral prokaryotic proofreader.

    PubMed

    Rock, Jeremy M; Lang, Ulla F; Chase, Michael R; Ford, Christopher B; Gerrick, Elias R; Gawande, Richa; Coscolla, Mireia; Gagneux, Sebastien; Fortune, Sarah M; Lamers, Meindert H

    2015-06-01

    The DNA replication machinery is an important target for antibiotic development in increasingly drug-resistant bacteria, including Mycobacterium tuberculosis. Although blocking DNA replication leads to cell death, disrupting the processes used to ensure replication fidelity can accelerate mutation and the evolution of drug resistance. In Escherichia coli, the proofreading subunit of the replisome, the ɛ exonuclease, is essential for high-fidelity DNA replication; however, we find that the corresponding subunit is completely dispensable in M. tuberculosis. Rather, the mycobacterial replicative polymerase DnaE1 itself encodes an editing function that proofreads DNA replication, mediated by an intrinsic 3'-5' exonuclease activity within its PHP domain. Inactivation of the DnaE1 PHP domain increases the mutation rate by more than 3,000-fold. Moreover, phylogenetic analysis of DNA replication proofreading in the bacterial kingdom suggests that E. coli is a phylogenetic outlier and that PHP domain-mediated proofreading is widely conserved and indeed may be the ancestral prokaryotic proofreader.

  10. Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    PubMed Central

    Zhao, Jian; Giles, Brendan M; Taylor, Rhonda L; Yette, Gabriel A; Lough, Kara M; Ng, Han Leng; Abraham, Lawrence J; Wu, Hui; Kelly, Jennifer A; Glenn, Stuart B; Adler, Adam J; Williams, Adrienne H; Comeau, Mary E; Ziegler, Julie T; Marion, Miranda; Alarcón-Riquelme, Marta E; Alarcón, Graciela S; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Dam; Lee, Hye-Soon; Criswell, Lindsey A; Freedman, Barry I; Gilkeson, Gary S; Guthridge, Joel M; Jacob, Chaim O; James, Judith A; Kamen, Diane L; Merrill, Joan T; Sivils, Kathy Moser; Niewold, Timothy B; Petri, Michelle A; Ramsey-Goldman, Rosalind; Reveille, John D; Scofield, R Hal; Stevens, Anne M; Vilá, Luis M; Vyse, Timothy J; Kaufman, Kenneth M; Harley, John B; Langefeld, Carl D; Gaffney, Patrick M; Brown, Elizabeth E; Edberg, Jeffrey C; Kimberly, Robert P; Ulgiati, Daniela; Tsao, Betty P; Boackle, Susan A

    2016-01-01

    Objectives Systemic lupus erythematosus (SLE; OMIM 152700) is characterised by the production of antibodies to nuclear antigens. We previously identified variants in complement receptor 2 (CR2/CD21) that were associated with decreased risk of SLE. This study aimed to identify the causal variant for this association. Methods Genotyped and imputed genetic variants spanning CR2 were assessed for association with SLE in 15 750 case-control subjects from four ancestral groups. Allele-specific functional effects of associated variants were determined using quantitative real-time PCR, quantitative flow cytometry, electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP)-PCR. Results The strongest association signal was detected at rs1876453 in intron 1 of CR2 (pmeta=4.2×10−4, OR 0.85), specifically when subjects were stratified based on the presence of dsDNA autoantibodies (case-control pmeta=7.6×10−7, OR 0.71; case-only pmeta=1.9×10−4, OR 0.75). Although allele-specific effects on B cell CR2 mRNA or protein levels were not identified, levels of complement receptor 1 (CR1/CD35) mRNA and protein were significantly higher on B cells of subjects harbouring the minor allele (p=0.0248 and p=0.0006, respectively). The minor allele altered the formation of several DNA protein complexes by EMSA, including one containing CCCTC-binding factor (CTCF), an effect that was confirmed by ChIP-PCR. Conclusions These data suggest that rs1876453 in CR2 has long-range effects on gene regulation that decrease susceptibility to lupus. Since the minor allele at rs1876453 is preferentially associated with reduced risk of the highly specific dsDNA autoantibodies that are present in preclinical, active and severe lupus, understanding its mechanisms will have important therapeutic implications. PMID:25180293

  11. MD simulations of papillomavirus DNA-E2 protein complexes hints at a protein structural code for DNA deformation.

    PubMed

    Falconi, M; Oteri, F; Eliseo, T; Cicero, D O; Desideri, A

    2008-08-01

    The structural dynamics of the DNA binding domains of the human papillomavirus strain 16 and the bovine papillomavirus strain 1, complexed with their DNA targets, has been investigated by modeling, molecular dynamics simulations, and nuclear magnetic resonance analysis. The simulations underline different dynamical features of the protein scaffolds and a different mechanical interaction of the two proteins with DNA. The two protein structures, although very similar, show differences in the relative mobility of secondary structure elements. Protein structural analyses, principal component analysis, and geometrical and energetic DNA analyses indicate that the two transcription factors utilize a different strategy in DNA recognition and deformation. Results show that the protein indirect DNA readout is not only addressable to the DNA molecule flexibility but it is finely tuned by the mechanical and dynamical properties of the protein scaffold involved in the interaction.

  12. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  13. Complementation between polymerase- and exonuclease-deficient mitochondrial DNA polymerase mutants in genomically engineered flies

    PubMed Central

    Bratic, Ana; Kauppila, Timo E. S.; Macao, Bertil; Grönke, Sebastian; Siibak, Triinu; Stewart, James B.; Baggio, Francesca; Dols, Jacqueline; Partridge, Linda; Falkenberg, Maria; Wredenberg, Anna; Larsson, Nils-Göran

    2015-01-01

    Replication errors are the main cause of mitochondrial DNA (mtDNA) mutations and a compelling approach to decrease mutation levels would therefore be to increase the fidelity of the catalytic subunit (POLγA) of the mtDNA polymerase. Here we genomically engineer the tamas locus, encoding fly POLγA, and introduce alleles expressing exonuclease- (exo−) and polymerase-deficient (pol−) POLγA versions. The exo− mutant leads to accumulation of point mutations and linear deletions of mtDNA, whereas pol− mutants cause mtDNA depletion. The mutant tamas alleles are developmentally lethal but can complement each other in trans resulting in viable flies with clonally expanded mtDNA mutations. Reconstitution of human mtDNA replication in vitro confirms that replication is a highly dynamic process where POLγA goes on and off the template to allow complementation during proofreading and elongation. The created fly models are valuable tools to study germ line transmission of mtDNA and the pathophysiology of POLγA mutation disease. PMID:26554610

  14. Xeroderma pigmentosum complementation group E and UV-damaged DNA-binding protein

    PubMed Central

    Tang, Jean; Chu, Gilbert

    2010-01-01

    UV-damaged DNA-binding protein (UV-DDB) is composed of two subunits, DDB1 (p127) and DDB2 (p48). Mutations in the DDB2 gene inactivate UV-DDB in individuals from complementation group E of xeroderma pigmentosum (XP-E), an autosomal recessive disease characterized by sun sensitivity, severe risk for skin cancer and defective nucleotide excision repair. UV-DDB is also deficient in many rodent tissues, exposing a shortcoming in rodent models for cancer. In vitro, UV-DDB binds to cyclobutane pyrimidine dimers (CPDs), 6–4 photoproducts and other DNA lesions, stimulating the excision of CPDs, and to a lesser extent, of 6–4 photoproducts. In vivo, UV-DDB plays an important role in the p53-dependent response of mammalian cells to DNA damage. When cells are exposed to UV, the resulting accumulation of p53 activates DDB2 transcription, which leads to increased levels of UV-DDB. Binding of UV-DDB to CPDs targets these lesions for global genomic repair, suppressing mutations without affecting UV survival. Apparently, cells are able to survive with unrepaired CPDs because of the activity of bypass DNA polymerases. Finally, there is evidence that UV-DDB may have roles in the cell that are distinct from DNA repair. PMID:12509284

  15. Correction of xeroderma pigmentosum complementation group D mutant cell phenotypes by chromosome and gene transfer: Involvement of the human ERCC2 DNA repair gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Flejter, W.L.; McDaniel, L.D.; Johns, D.

    1992-01-01

    Cultured cells from individuals afflicted with the genetically heterogeneous autosomal recessive disorder xeroderma pigmentosum (XP) exhibit sensitivity to UV radiation and defective nucleotide excision repair. Complementation of these mutant phenotypes after the introduction of single human chromosomes from repair-proficient cells into XP cells has provided a means of mapping the genes involved in this disease. The authors now report the phenotypic correction of XP cells from genetic complementation group D (XP-D) by a single human chromosome designated Tneo. Detailed molecular characterization of Tneo revealed a rearranged structure involving human chromosomes 16 and 19, including the excision repair cross-complementing 2 (ERCC2)more » gene from the previously described human DNA repair gene cluster at 19q13.2-q13.3. Direct transfer of a cosmid bearing the ERCC2 gene conferred UV resistance to XP-D cells.« less

  16. Synthesis of bacteriophage phiC DNA in dna mutants of Esherichia coli.

    PubMed

    Kodaira, K I; Taketo, A

    1978-06-01

    Host dna functions involved in the replication of microvirid phage phiC DNA were investigated in vivo. Although growth of this phage was markedly inhibited even at 35-37 degrees C even in dna+ host, conversion of the infecting single-stranded DNA into the double-stranded parental replicative form (stage I synthesis) occurred normally at 43 degrees C in dna+, dnaA, dnaB, dnaC(D), and dnaE cells. In dnaG mutant, the stage I synthesis was severely inhibited at 43 degrees C but not at 30 degrees C. The stage I replication of phiC DNA was clearly thermosensitive in dnaZ cells incubated in nutrient broth. In Tris-casamino acids-glucose medium, however, the dnaZ mutant sufficiently supported synthesis of the parental replicative form. At 43 degrees C, synthesis of the progeny replicative form DNA (stage II replication) was significantly inhibited even in dna+ cells and was nearly completely blocked in dnaB or dnaC(D) mutant. At 37 degrees C, the stage II replication proceeded normally in dna+ bacteria.

  17. UV damage-specific DNA-binding protein in xeroderma pigmentosum complementation group E

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kataoka, H.; Fujiwara, Y.

    1991-03-29

    The gel mobility shift assay method revealed a specifically ultraviolet (UV) damage recognizing, DNA-binding protein in nuclear extracts of normal human cells. The resulted DNA/protein complexes caused the two retarded mobility shifts. Four xeroderma pigmentosum complementation group E (XPE) fibroblast strains derived from unrelated Japanese families were not deficient in such a DNA damage recognition/binding protein because of the normal complex formation and gel mobility shifts, although we confirmed the reported lack of the protein in the European XPE (XP2RO and XP3RO) cells. Thus, the absence of this binding protein is not always commonly observed in all the XPE strains,more » and the partially repair-deficient and intermediately UV-hypersensitive phenotype of XPE cells are much similar whether or not they lack the protein.« less

  18. Complementation of DNA repair defect in xeroderma pigmentosum cells of group C by the transfer of human chromosome 5

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaur, G.P.; Athwal, R.S.

    1993-01-01

    Complementation of DNA excision repair defect in xeroderma pigmentosum cells of group C (XP-C) has been achieved by the transfer of human chromosome 5. Individual human chromosomes tagged with a selectable marker were transferred to XP-C cells by microcell fusion from mouse-human hybrid cell lines each bearing a single different human chromosome. Analysis of the chromosome transfer clones revealed that introduction of chromosome 5 into XP-C cells corrected the DNA repair defect as well as UV-sensitive phenotypes, while chromosomes 2, 6, 7, 9, 13, 15, 17, and 21 failed to complement. The introduced chromosome 5 in complemented UV[sup r] clonesmore » was distinguished from the parental XP-C chromosomes by polymorphism for dinucleotide (CA)[sub n] repeats at two loci, D5S117 and D5S209. In addition, an intact marked chromosome 5 was rescued into mouse cells from a complemented UV[sup r] clone by microcell fusion. Five subclones of a complemented clone that had lost the marked chromosome 5 exhibited UV-sensitive and repair-deficient phenotypes identical to parental XP-C cells. Concordant loss of the transferred chromosome and reappearance of XP-C phenotype further confirmed the presence of a DNA repair gene on human chromosome 5. 38 refs., 7 figs., 1 tab.« less

  19. A physical map of the human regulator of complement activation gene cluster linking the complement genes CR1, CR2, DAF, and C4BP

    PubMed Central

    1988-01-01

    We report the organization of the human genes encoding the complement components C4-binding protein (C4BP), C3b/C4b receptor (CR1), decay accelerating factor (DAF), and C3dg receptor (CR2) within the regulator of complement activation (RCA) gene cluster. Using pulsed field gel electrophoresis analysis these genes have been physically linked and aligned as CR1-CR2-DAF-C4BP in an 800-kb DNA segment. The very tight linkage between the CR1 and the C4BP loci, contrasted with the relative long DNA distance between these genes, suggests the existence of mechanisms interfering with recombination within the RCA gene cluster. PMID:2450163

  20. On the molecular mechanism of GC content variation among eubacterial genomes.

    PubMed

    Wu, Hao; Zhang, Zhang; Hu, Songnian; Yu, Jun

    2012-01-10

    As a key parameter of genome sequence variation, the GC content of bacterial genomes has been investigated for over half a century, and many hypotheses have been put forward to explain this GC content variation and its relationship to other fundamental processes. Previously, we classified eubacteria into dnaE-based groups (the dimeric combination of DNA polymerase III alpha subunits), according to a hypothesis where GC content variation is essentially governed by genome replication and DNA repair mechanisms. Further investigation led to the discovery that two major mutator genes, polC and dnaE2, may be responsible for genomic GC content variation. Consequently, an in-depth analysis was conducted to evaluate various potential intrinsic and extrinsic factors in association with GC content variation among eubacterial genomes. Mutator genes, especially those with dominant effects on the mutation spectra, are biased towards either GC or AT richness, and they alter genomic GC content in the two opposite directions. Increased bacterial genome size (or gene number) appears to rely on increased genomic GC content; however, it is unclear whether the changes are directly related to certain environmental pressures. Certain environmental and bacteriological features are related to GC content variation, but their trends are more obvious when analyzed under the dnaE-based grouping scheme. Most terrestrial, plant-associated, and nitrogen-fixing bacteria are members of the dnaE1|dnaE2 group, whereas most pathogenic or symbiotic bacteria in insects, and those dwelling in aquatic environments, are largely members of the dnaE1|polV group. Our studies provide several lines of evidence indicating that DNA polymerase III α subunit and its isoforms participating in either replication (such as polC) or SOS mutagenesis/translesion synthesis (such as dnaE2), play dominant roles in determining GC variability. Other environmental or bacteriological factors, such as genome size, temperature

  1. On the molecular mechanism of GC content variation among eubacterial genomes

    PubMed Central

    2012-01-01

    Background As a key parameter of genome sequence variation, the GC content of bacterial genomes has been investigated for over half a century, and many hypotheses have been put forward to explain this GC content variation and its relationship to other fundamental processes. Previously, we classified eubacteria into dnaE-based groups (the dimeric combination of DNA polymerase III alpha subunits), according to a hypothesis where GC content variation is essentially governed by genome replication and DNA repair mechanisms. Further investigation led to the discovery that two major mutator genes, polC and dnaE2, may be responsible for genomic GC content variation. Consequently, an in-depth analysis was conducted to evaluate various potential intrinsic and extrinsic factors in association with GC content variation among eubacterial genomes. Results Mutator genes, especially those with dominant effects on the mutation spectra, are biased towards either GC or AT richness, and they alter genomic GC content in the two opposite directions. Increased bacterial genome size (or gene number) appears to rely on increased genomic GC content; however, it is unclear whether the changes are directly related to certain environmental pressures. Certain environmental and bacteriological features are related to GC content variation, but their trends are more obvious when analyzed under the dnaE-based grouping scheme. Most terrestrial, plant-associated, and nitrogen-fixing bacteria are members of the dnaE1|dnaE2 group, whereas most pathogenic or symbiotic bacteria in insects, and those dwelling in aquatic environments, are largely members of the dnaE1|polV group. Conclusion Our studies provide several lines of evidence indicating that DNA polymerase III α subunit and its isoforms participating in either replication (such as polC) or SOS mutagenesis/translesion synthesis (such as dnaE2), play dominant roles in determining GC variability. Other environmental or bacteriological factors, such

  2. Inherited mitochondrial DNA variants can affect complement, inflammation and apoptosis pathways: insights into mitochondrial–nuclear interactions

    PubMed Central

    Cristina Kenney, M.; Chwa, Marilyn; Atilano, Shari R.; Falatoonzadeh, Payam; Ramirez, Claudio; Malik, Deepika; Tarek, Mohamed; Cáceres-del-Carpio, Javier; Nesburn, Anthony B.; Boyer, David S.; Kuppermann, Baruch D.; Vawter, Marquis; Michal Jazwinski, S.; Miceli, Michael; Wallace, Douglas C.; Udar, Nitin

    2014-01-01

    Age-related macular degeneration (AMD) is the leading cause of vision loss in developed countries. While linked to genetic polymorphisms in the complement pathway, there are many individuals with high risk alleles that do not develop AMD, suggesting that other ‘modifiers’ may be involved. Mitochondrial (mt) haplogroups, defined by accumulations of specific mtDNA single nucleotide polymorphisms (SNPs) which represent population origins, may be one such modifier. J haplogroup has been associated with high risk for AMD while the H haplogroup is protective. It has been difficult to assign biological consequences for haplogroups so we created human ARPE-19 cybrids (cytoplasmic hybrids), which have identical nuclei but mitochondria of either J or H haplogroups, to investigate their effects upon bioenergetics and molecular pathways. J cybrids have altered bioenergetic profiles compared with H cybrids. Q-PCR analyses show significantly lower expression levels for seven respiratory complex genes encoded by mtDNA. J and H cybrids have significantly altered expression of eight nuclear genes of the alternative complement, inflammation and apoptosis pathways. Sequencing of the entire mtDNA was carried out for all the cybrids to identify haplogroup and non-haplogroup defining SNPs. mtDNA can mediate cellular bioenergetics and expression levels of nuclear genes related to complement, inflammation and apoptosis. Sequencing data suggest that observed effects are not due to rare mtDNA variants but rather the combination of SNPs representing the J versus H haplogroups. These findings represent a paradigm shift in our concepts of mt–nuclear interactions. PMID:24584571

  3. Complementation of a red-light-indifferent cyanobacterial mutant.

    PubMed Central

    Chiang, G G; Schaefer, M R; Grossman, A R

    1992-01-01

    Many cyanobacteria alter their phycobilisome composition in response to changes in light wavelength in a process termed complementary chromatic adaptation. Mutant strains FdR1 and FdR2 of the filamentous cyanobacterium Fremyella diplosiphon are characterized by aberrant chromatic adaptation. Instead of adjusting to different wavelengths of light, FdR1 and FdR2 behave as if they are always in green light; they do not respond to red light. We have previously reported complementation of FdR1 by conjugal transfer of a wild-type genomic library. The complementing DNA has now been localized by genetic analysis to a region on the rescued genomic subclone that contains a gene designated rcaC. This region of DNA is also able to complement FdR2. Southern blot analysis of genomic DNA from FdR1 and FdR2 indicates that these strains harbor DNA insertions within the rcaC sequence that may have resulted from the activity of transposable genetic elements. The predicted amino acid sequence of RcaC shares strong identity to response regulators of bacterial two-component regulatory systems. This relationship is discussed in the context of the signal-transduction pathway mediating regulation of genes encoding phycobilisome polypeptides during chromatic adaptation. Images PMID:1409650

  4. Xeroderma pigmentosum complementation group C protein (XPC) serves as a general sensor of damaged DNA

    PubMed Central

    Shell, Steven M.; Hawkins, Edward K.; Tsai, Miaw-Sheue; Hlaing, Aye Su; Rizzo, Carmelo J.; Chazin, Walter J.

    2013-01-01

    The xeroderma pigmentosum complementation group C protein (XPC) serves as the primary initiating factor in the global genome nucleotide excision repair pathway (GG-NER). Recent reports suggest XPC also stimulates repair of oxidative lesions by base excision repair. However, whether XPC distinguishes among various types of DNA lesions remains unclear. Although the DNA binding properties of XPC have been studied by several groups, there is a lack of consensus over whether XPC discriminates between DNA damaged by lesions associated with NER activity versus those that are not. In this study we report a high-throughput fluorescence anisotropy assay used to measure the DNA binding affinity of XPC for a panel of DNA substrates containing a range of chemical lesions in a common sequence. Our results demonstrate that while XPC displays a preference for binding damaged DNA, the identity of the lesion has little effect on the binding affinity of XPC. Moreover, XPC was equally capable of binding to DNA substrates containing lesions not repaired by GG-NER. Our results support an indirect read-out model for sensing the presence of lesions by human XPC and suggest XPC may act as a general sensor of damaged DNA capable of recognizing DNA containing lesions not repaired by NER. PMID:24051049

  5. [Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

    PubMed

    Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

    1997-02-01

    The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

  6. Complementation of hypersensitivity to DNA interstrand crosslinking agents demonstrates that XRCC2 is a Fanconi anaemia gene.

    PubMed

    Park, Jung-Young; Virts, Elizabeth L; Jankowska, Anna; Wiek, Constanze; Othman, Mohamed; Chakraborty, Sujata C; Vance, Gail H; Alkuraya, Fowzan S; Hanenberg, Helmut; Andreassen, Paul R

    2016-10-01

    Fanconi anaemia (FA) is a heterogeneous inherited disorder clinically characterised by progressive bone marrow failure, congenital anomalies and a predisposition to malignancies. Determine, based on correction of cellular phenotypes, whether XRCC2 is a FA gene. Cells (900677A) from a previously identified patient with biallelic mutation of XRCC2, among other mutations, were genetically complemented with wild-type XRCC2. Wild-type XRCC2 corrects each of three phenotypes characteristic of FA cells, all related to the repair of DNA interstrand crosslinks, including increased sensitivity to mitomycin C (MMC), chromosome breakage and G2-M accumulation in the cell cycle. Further, the p.R215X mutant of XRCC2, which is harboured by the patient, is unstable. This provides an explanation for the pathogenesis of this mutant, as does the fact that 900677A cells have reduced levels of other proteins in the XRCC2-RAD51B-C-D complex. Also, FANCD2 monoubiquitination and foci formation, but not assembly of RAD51 foci, are normal in 900677A cells. Thus, XRCC2 acts late in the FA-BRCA pathway as also suggested by hypersensitivity of 900677A cells to ionising radiation. These cells also share milder sensitivities towards olaparib and formaldehyde with certain other FA cells. XRCC2/FANCU is a FA gene, as is another RAD51 paralog gene, RAD51C/FANCO. Notably, similar to a subset of FA genes that act downstream of FANCD2, biallelic mutation of XRCC2/FANCU has not been associated with bone marrow failure. Taken together, our results yield important insights into phenotypes related to FA and its genetic origins. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  7. Nonrenal and renal activity of systemic lupus erythematosus: a comparison of two anti-C1q and five anti-dsDNA assays and complement C3 and C4.

    PubMed

    Julkunen, Heikki; Ekblom-Kullberg, Susanne; Miettinen, Aaro

    2012-08-01

    Associations of different assays for antibodies to C1q (anti-C1q) and to dsDNA (anti-dsDNA) and of complements C3 and C4 with disease activity in patients with systemic lupus erythematosus (SLE) were studied. The clinical manifestations of 223 SLE patients were recorded, and the disease activity was assessed by the SLEDAI score. Anti-C1q were determined by two enzyme-linked immunosorbent assays (ELISA) and anti-dsDNA by a radioimmunoassay (RIA), a Crithidia immunofluorescence (IF) assay and three ELISA assays using human telomere DNA, plasmid DNA circles, or calf thymus DNA as antigens, respectively. Complement C3 and C4 were determined by nephelometry. Control sera were obtained from 98 blood donors. In patients with SLE, the prevalence of anti-C1q was 17-18% and that of anti-dsDNA was 36-69%. Anti-C1q, anti-dsDNA, and complement C3 and C4 correlated well with the overall activity of SLE (r = 0.323-0.351, 0.353-0.566, and -0.372-0.444, respectively; P < 0.001). Sensitivity, specificity, positive predictive value, and negative predictive value for active lupus nephritis among SLE patients were 40-44, 92, 29, and 91-92% for anti-C1q and 48-68, 29-66, 11-16, and 86-91% for anti-dsDNA, respectively. Patients with active nephritis had higher levels of anti-C1q and lower levels of C3 and C4 than patients with inactive nephritis (P = 0.003-0.018). The corresponding associations of anti-dsDNA were somewhat weaker (P = 0.023-0.198). Hematological parameters reflecting disease activity correlated clearly better with anti-dsDNA and complement C3 and C4 than with anti-C1q. Anti-C1q is inferior to anti-dsDNA as a diagnostic test in SLE and in the evaluation of overall clinical activity of the disease. Anti-C1q together with complement C3 and C4 may offer useful additional information to monitor lupus nephritis activity. There are no practical differences between different assays for anti-C1q and anti-dsDNA.

  8. Alteration in levels of unsaturated fatty acids in mutants of Escherichia coli defective in DNA replication.

    PubMed

    Suzuki, E; Kondo, T; Makise, M; Mima, S; Sakamoto, K; Tsuchiya, T; Mizushima, T

    1998-07-01

    We previously reported that mutations in the dnaA gene which encodes the initiator of chromosomal DNA replication in Escherichia coli caused an alteration in the levels of unsaturated fatty acids of phospholipids in membranes. In this study, we examined fatty acid compositions in other mutants which are defective in DNA replication. As in the case of temperature-sensitive dnaA mutants, temperature-sensitive dnaC and dnaE mutants, which have defects in initiation and elongation, respectively, of DNA replication showed a lower level of unsaturation of fatty acids (ratio of unsaturated to saturated fatty acids) compared with the wild-type strain, especially at high temperatures. On the other hand, temperature-sensitive mutants defective in cellular processes other than DNA replication, such as RNA synthesis and cell division, did not show a lower level of unsaturation of fatty acids compared with the wild-type strain. These results suggest that the inhibition of DNA replication causes a lower level of unsaturation of fatty acids in Escherichia coli cells.

  9. Arabidopsis DNA methyltransferase AtDNMT2 associates with histone deacetylase AtHD2s activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Song, Yuan; Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON, Canada N5V4T3; Wu, Keqiang

    2010-05-28

    DNA methyltransferase2 (DNMT2) is always deemed to be enigmatic, because it contains highly conserved DNA methyltransferase motifs but lacks the DNA methylation catalytic capability. Here we show that Arabidopsis DNA methyltransferase2 (AtDNMT2) is localized in nucleus and associates with histone deacetylation. Bimolecular fluorescence complementation and pull-down assays show AtDNMT2 interacts with type-2 histone deacetylases (AtHD2s), a unique type of histone deacetylase family in plants. Through analyzing the expression of AtDNMT2: ss-glucuronidase (GUS) fusion protein, we demonstrate that AtDNMT2 has the ability to repress gene expression at transcription level. Meanwhile, the expression of AtDNMT2 gene is altered in athd2c mutant plants.more » We propose that AtDNMT2 possibly involves in the activity of histone deacetylation and plant epigenetic regulatory network.« less

  10. cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

    PubMed

    Simon, J W; Slabas, A R

    1998-09-18

    The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

  11. Delimitation of essential genes of cassava latent virus DNA 2.

    PubMed Central

    Etessami, P; Callis, R; Ellwood, S; Stanley, J

    1988-01-01

    Insertion and deletion mutagenesis of both extended open reading frames (ORFs) of cassava latent virus DNA 2 destroys infectivity. Infectivity is restored by coinoculating constructs that contain single mutations within different ORFs. Although frequent intermolecular recombination produces dominant parental-type virus, mutants can be retained within the virus population indicating that they are competent for replication and suggesting that rescue can occur by complementation of trans acting gene products. By cloning specific fragments into DNA 1 coat protein deletion vectors we have delimited the DNA 2 coding regions and provide substantive evidence that both are essential for virus infection. Although a DNA 2 component is unique to whitefly-transmitted geminiviruses, the results demonstrate that neither coding region is involved solely in insect transmission. The requirement for a bipartite genome for whitefly-transmitted geminiviruses is discussed. Images PMID:3387209

  12. Screening and Selection of New Antagonists of the RING-Mediated Hdm2/Hdmx Interaction

    DTIC Science & Technology

    2013-05-01

    efficient production of cyclotides in bacterial cells using protein trans-splicing (PTS) (Fig. 4) (Appendix: paper #7). Using this new approach we have... used for the production of native folded cyclotides. We estimated that in- cell production of cyclotide MCoTI-I was around 10- times more...efficient using Npu DnaE PTS than EPL, and therefore provides an attractive alternative for the recombinant production of these type of

  13. Gene for ataxia-telangiectasia complementation group D (ATDC)

    DOEpatents

    Murnane, John P.; Painter, Robert B.; Kapp, Leon N.; Yu, Loh-Chung

    1995-03-07

    Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for said gene are provided as well as proteins encoded by said gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of said proteins. Further disclosed are methods to detect mutations in said gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups.

  14. The quest for a unified view of bacterial land colonization

    PubMed Central

    Wu, Hao; Fang, Yongjun; Yu, Jun; Zhang, Zhang

    2014-01-01

    Exploring molecular mechanisms underlying bacterial water-to-land transition represents a critical start toward a better understanding of the functioning and stability of the terrestrial ecosystems. Here, we perform comprehensive analyses based on a large variety of bacteria by integrating taxonomic, phylogenetic and metagenomic data, in the quest for a unified view that elucidates genomic, evolutionary and ecological dynamics of the marine progenitors in adapting to nonaquatic environments. We hypothesize that bacterial land colonization is dominated by a single-gene sweep, that is, the emergence of dnaE2 derived from an early duplication event of the primordial dnaE, followed by a series of niche-specific genomic adaptations, including GC content increase, intensive horizontal gene transfer and constant genome expansion. In addition, early bacterial radiation may be stimulated by an explosion of land-borne hosts (for example, plants and animals) after initial land colonization events. PMID:24451209

  15. Gene for ataxia-telangiectasia complementation group D (ATDC)

    DOEpatents

    Murnane, J.P.; Painter, R.B.; Kapp, L.N.; Yu, L.C.

    1995-03-07

    Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for the gene are provided as well as proteins encoded by the gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of the proteins. Further disclosed are methods to detect mutations in the gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups. 30 figs.

  16. Intein-mediated assembly of a functional β-glucuronidase in transgenic plants

    PubMed Central

    Yang, Jianjun; Fox, George C.; Henry-Smith, Tina V.

    2003-01-01

    The DnaE intein in Synechocystis sp. strain PCC6803 is the first and only naturally split intein that has been identified so far. It is capable of catalyzing a protein trans-splicing mechanism to assemble a mature protein from two separate precursors. Therefore, it is a powerful tool for protein modification and engineering. Inteins have not been identified, nor have intein-mediated protein splicing reactions been demonstrated, in plant cells. In this paper, we describe the use of the Ssp DnaE split intein in transgenic plants for reconstitution of a protein trans-splicing reaction. We have synthesized artificial genes that encode for N-terminal half (Int-n) and C-terminal half (Int-c) fragments of Ssp DnaE split intein and divided β-glucuronidase (GUS) gene to encode GUS-n and GUS-c parts of the enzyme as reporter. The in-frame fusions of GUSn/Intn and Intc/GUSc were constructed and transfected into Arabidopsis. We have observed in vivo reassembly of functional β-glucuronidase when both GUSn/Intn and Intc/GUSc constructs were introduced into the same Arabidopsis genome either by cotransformation or through genetic crossing, hereby signifying an intein-mediated protein trans-splicing mechanism reconstituted in plant cells. PMID:12629210

  17. The antigenic complex in HIT binds to B cells via complement and complement receptor 2 (CD21)

    PubMed Central

    Khandelwal, Sanjay; Lee, Grace M.; Hester, C. Garren; Poncz, Mortimer; McKenzie, Steven E.; Sachais, Bruce S.; Rauova, Lubica; Kelsoe, Garnett; Cines, Douglas B.; Frank, Michael

    2016-01-01

    Heparin-induced thrombocytopenia is a prothrombotic disorder caused by antibodies to platelet factor 4 (PF4)/heparin complexes. The mechanism that incites such prevalent anti-PF4/heparin antibody production in more than 50% of patients exposed to heparin in some clinical settings is poorly understood. To investigate early events associated with antigen exposure, we first examined the interaction of PF4/heparin complexes with cells circulating in whole blood. In healthy donors, PF4/heparin complexes bind preferentially to B cells (>90% of B cells bind to PF4/heparin in vitro) relative to neutrophils, monocytes, or T cells. Binding of PF4 to B cells is heparin dependent, and PF4/heparin complexes are found on circulating B cells from some, but not all, patients receiving heparin. Given the high proportion of B cells that bind PF4/heparin, we investigated complement as a mechanism for noncognate antigen recognition. Complement is activated by PF4/heparin complexes, co-localizes with antigen on B cells from healthy donors, and is present on antigen-positive B cells in patients receiving heparin. Binding of PF4/heparin complexes to B cells is mediated through the interaction between complement and complement receptor 2 (CR2 [CD21]). To the best of our knowledge, these are the first studies to demonstrate complement activation by PF4/heparin complexes, opsonization of PF4/heparin to B cells via CD21, and the presence of complement activation fragments on circulating B cells in some patients receiving heparin. Given the critical contribution of complement to humoral immunity, our observations provide new mechanistic insights into the immunogenicity of PF4/heparin complexes. PMID:27412887

  18. Shark complement: an assessment.

    PubMed

    Smith, S L

    1998-12-01

    The classical (CCP) and alternative (ACP) pathways of complement activation have been established for the nurse shark (Ginglymostoma cirratum). The isolation of a cDNA clone encoding a mannan-binding protein-associated serine protease (MASP)-1-like protein from the Japanese dogfish (Triakis scyllia) suggests the presence of a lectin pathway. The CCP consists of six functionally distinct components: C1n, C2n, C3n, C4n, C8n and C9n, and is activated by immune complexes in the presence of Ca++ and Mg++ ions. The ACP is antibody independent, requiring Mg++ ions and a heat-labile 90 kDa factor B-like protein for activity. Proteins considered homologues of C1q, C3 and C4 (C2n) of the mammalian complement system have been isolated from nurse shark serum. Shark C1q is composed of at least two chain types each showing 50% identity to human C1q chains A and B. Partial sequence of the globular domain of one of the chains shows it to be C1q-like rather than like mannan-binding protein. N-terminal amino acid sequences of the alpha and beta chain of shark C3 and C4 molecules show significant identity with corresponding human C3 and C4 chains. A sequence representing shark C4 gamma chain, shows little similarity to human C4 gamma chain. The terminal shark components C8n and C9n are functional analogues of mammalian C8 and C9. Anaphylatoxin activity has been demonstrated in activated shark serum, and porcine C5a desArg induces shark leucocyte chemotaxis. The deduced amino acid sequence of a partial C3 cDNA clone from the nurse shark shows 50%, 30% and 24% homology with the corresponding region of mammalian C3, C4 and alpha 2-macroglobulin. Deduced amino acid sequence data from partial Bf/C2 cDNA clones, two from the nurse shark and one from the Japanese dogfish, suggest that at least one species of elasmobranch has two distinct Bf/C2 genes.

  19. Mechanism of Promoter Melting by the Xeroderma Pigmentosum Complementation Group B Helicase of Transcription Factor IIH Revealed by Protein-DNA Photo-Cross-Linking

    PubMed Central

    Douziech, Maxime; Coin, Frédéric; Chipoulet, Jean-Marc; Arai, Yoko; Ohkuma, Yoshiaki; Egly, Jean-Marc; Coulombe, Benoit

    2000-01-01

    The p89/xeroderma pigmentosum complementation group B (XPB) ATPase-helicase of transcription factor IIH (TFIIH) is essential for promoter melting prior to transcription initiation by RNA polymerase II (RNAPII). By studying the topological organization of the initiation complex using site-specific protein-DNA photo-cross-linking, we have shown that p89/XPB makes promoter contacts both upstream and downstream of the initiation site. The upstream contact, which is in the region where promoter melting occurs (positions −9 to +2), requires tight DNA wrapping around RNAPII. The addition of hydrolyzable ATP tethers the template strand at positions −5 and +1 to RNAPII subunits. A mutation in p89/XPB found in a xeroderma pigmentosum patient impairs the ability of TFIIH to associate correctly with the complex and thereby melt promoter DNA. A model for open complex formation is proposed. PMID:11027286

  20. Raman spectroscopy of DNA-metal complexes. II. The thermal denaturation of DNA in the presence of Sr2+, Ba2+, Mg2+, Ca2+, Mn2+, Co2+, Ni2+, and Cd2+.

    PubMed

    Duguid, J G; Bloomfield, V A; Benevides, J M; Thomas, G J

    1995-12-01

    Differential scanning calorimetry, laser Raman spectroscopy, optical densitometry, and pH potentiometry have been used to investigate DNA melting profiles in the presence of the chloride salts of Ba2+, Sr2+, Mg2+, Ca2+, Mn2+, Co2+, Ni2+, and Cd2+. Metal-DNA interactions have been observed for the molar ratio [M2+]/[PO2-] = 0.6 in aqueous solutions containing 5% by weight of 160 bp mononucleosomal calf thymus DNA. All of the alkaline earth metals, plus Mn2+, elevate the melting temperature of DNA (Tm > 75.5 degrees C), whereas the transition metals Co2+, Ni2+, and Cd2+ lower Tm. Calorimetric (delta Hcal) and van't Hoff (delta HVH) enthalpies of melting range from 6.2-8.7 kcal/mol bp and 75.6-188.6 kcal/mol cooperative unit, respectively, and entropies from 17.5 to 24.7 cal/K mol bp. The average number of base pairs in a cooperative melting unit () varied from 11.3 to 28.1. No dichotomy was observed between alkaline earth and transition DNA-metal complexes for any of the thermodynamic parameters other than their effects on Tm. These results complement Raman difference spectra, which reveal decreases in backbone order, base unstacking, distortion of glycosyl torsion angles, and rupture of hydrogen bonds, which occur after thermal denaturation. Raman difference spectroscopy shows that transition metals interact with the N7 atom of guanine in duplex DNA. A broader range of interaction sites with single-stranded DNA includes ionic phosphates, the N1 and N7 atoms of purines, and the N3 atom of pyrimidines. For alkaline earth metals, very little interaction was observed with duplex DNA, whereas spectra of single-stranded complexes are very similar to those of melted DNA without metal. However, difference spectra reveal some metal-specific perturbations at 1092 cm-1 (nPO2-), 1258 cm-1 (dC, dA), and 1668 cm-1 (nC==O, dNH2 dT, dG, dC). Increased spectral intensity could also be observed near 1335 cm-1 (dA, dG) for CaDNA. Optical densitometry, employed to detect DNA

  1. Genetic Variation in Complement Component 2 of the Classical Complement Pathway is Associated with Increased Mortality and Infection: A Study of 627 Trauma Patients

    PubMed Central

    Morris, John A.; Francois, Cedric; Olson, Paul K.; Cotton, Bryan A.; Summar, Marshall; Jenkins, Judith M.; Norris, Patrick R.; Moore, Jason H.; Williams, Anna E.; McNew, Brent S.; Canter, Jeffrey A.

    2009-01-01

    Trauma is a disease of inflammation. Complement Component 2 (C2) is a protease involved in activation of complement through the classical pathway and has been implicated in a variety of chronic inflammatory diseases. We hypothesized that genetic variation in C2 (E318D) identifies a high-risk subgroup of trauma patients reflecting increased mortality and infection (Ventilator associated pneumonia: VAP). Consequently, genetic variation in C2 may stratify patient risk and illuminate underlying mechanisms for therapeutic intervention. Methods DNA samples from 702 trauma patients were genotyped for C2 E318D and linked with covariates (age: mean 42.8 years, gender: 74% male, ethnicity: 80% Caucasian, mechanism: 84% blunt, ISS: mean 25.0, admission lactate: mean 3.13 mEq/L) and outcomes: mortality 9.9% and VAP: 18.5%. VAP was defined by quantitative bronchoalveolar lavage (>104). Multivariate regression determined the relationship of genotype and covariates to risk of death and VAP. However, patients with ISS ≥ 45 were excluded from the multivariate analysis, as magnitude of injury overwhelms genetics and covariates in determining outcome. Results 52 patients (8.3%) had the high-risk heterozygous genotype, associated with a significant increase in mortality and VAP. Conclusion In 702 trauma patients, 8.3% had a high-risk genetic variation in C2 associated with increased mortality (OR=2.65) and infection (OR=2.00). This variation: 1) Identifies a previously unknown high risk group for infection and mortality; 2) Can be determined on admission; 3) May provide opportunity for early therapeutic intervention; and 4) Requires validation in a distinct cohort of patients. PMID:19430225

  2. Characterization of shark complement factor I gene(s): genomic analysis of a novel shark-specific sequence

    PubMed Central

    Shin, Dong-Ho; Webb, Barbara M.; Nakao, Miki; Smith, Sylvia L.

    2009-01-01

    Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and –d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (≤) amino acid identities with each other, 35.4 ~ 39.6% and 62.8 ~ 65.9% with factor I of mammals and banded houndshark (Triakis scyllium), respectively. The modular structure of the GcIf is similar to that of mammals with one notable exception, the presence of a novel shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1, 2 and 3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082 bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent. PMID:19423168

  3. Characterization of shark complement factor I gene(s): genomic analysis of a novel shark-specific sequence.

    PubMed

    Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L

    2009-07-01

    Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (DNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1-3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent.

  4. Response to DNA damage of CHEK2 missense mutations in familial breast cancer

    PubMed Central

    Roeb, Wendy; Higgins, Jake; King, Mary-Claire

    2012-01-01

    Comprehensive sequencing of tumor suppressor genes to evaluate inherited predisposition to cancer yields many individually rare missense alleles of unknown functional and clinical consequence. To address this problem for CHEK2 missense alleles, we developed a yeast-based assay to assess in vivo CHEK2-mediated response to DNA damage. Of 25 germline CHEK2 missense alleles detected in familial breast cancer patients, 12 alleles had complete loss of DNA damage response, 8 had partial loss and 5 exhibited a DNA damage response equivalent to that mediated by wild-type CHEK2. Variants exhibiting reduced response to DNA damage were found in all domains of the CHEK2 protein. Assay results were in agreement with epidemiologic assessments of breast cancer risk for those variants sufficiently common for case–control studies to have been undertaken. Assay results were largely concordant with consensus predictions of in silico tools, particularly for damaging alleles in the kinase domain. However, of the 25 variants, 6 were not consistently classifiable by in silico tools. An in vivo assay of cellular response to DNA damage by mutant CHEK2 alleles may complement and extend epidemiologic and genetic assessment of their clinical consequences. PMID:22419737

  5. Response to DNA damage of CHEK2 missense mutations in familial breast cancer.

    PubMed

    Roeb, Wendy; Higgins, Jake; King, Mary-Claire

    2012-06-15

    Comprehensive sequencing of tumor suppressor genes to evaluate inherited predisposition to cancer yields many individually rare missense alleles of unknown functional and clinical consequence. To address this problem for CHEK2 missense alleles, we developed a yeast-based assay to assess in vivo CHEK2-mediated response to DNA damage. Of 25 germline CHEK2 missense alleles detected in familial breast cancer patients, 12 alleles had complete loss of DNA damage response, 8 had partial loss and 5 exhibited a DNA damage response equivalent to that mediated by wild-type CHEK2. Variants exhibiting reduced response to DNA damage were found in all domains of the CHEK2 protein. Assay results were in agreement with epidemiologic assessments of breast cancer risk for those variants sufficiently common for case-control studies to have been undertaken. Assay results were largely concordant with consensus predictions of in silico tools, particularly for damaging alleles in the kinase domain. However, of the 25 variants, 6 were not consistently classifiable by in silico tools. An in vivo assay of cellular response to DNA damage by mutant CHEK2 alleles may complement and extend epidemiologic and genetic assessment of their clinical consequences.

  6. Complement C4a inhibits the secretion of hepatitis B virus screened by surface-enhanced laser desorption ionization time-flight mass spectrometry-based ProteinChip analysis.

    PubMed

    Song, Ya-Nan; Zhang, Gui-Biao; Hu, Xue-Qing; Lu, Yi-Yu; Zhao, Yu; Yang, Yang; Yang, Yi-Fu; Zhang, Yong-Yu; Hu, Yi-Yang; Su, Shi-Bing

    2015-12-01

    Chronic hepatitis B (CHB) is a kind of chronic liver disease caused by persistent hepatitis B virus (HBV) infection. The study aims to seek the factors of host resistance to HBV and investigate their roles. Protein profiles of 58 healthy controls and 121 CHB patients were obtained by SELDI-TOF/MS. Predicted protein was validated by ELISA. Protein expression was evaluated by Western blot in the persistently HBV expressing cell line HepG2.2.15 and non-HBV expressing cell line HepG2. The level of HBV DNA was subsequently detected by quantitative real-time PCR in HepG2.2.15 cells with complement C4a treatment. Significantly altered protein peaks were found through statistical analysis, and m/z 4300 was predicted by databases and successfully matched with the fragment of complement C4a. According to ELISA, serum complement C4a was found to be significantly lower in CHB patients compared with healthy controls (p < 0.001) and the area under receiver operating characteristics curve is 0.78. Furthermore, complement C4a showed lower expression in HepG2.2.5 cells and the secretion of HBV DNA was inhibited by complement C4a. The present study implied the important role of complement C4a in inhibiting the HBV DNA secretion in CHB. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Varicella-zoster virus complements herpes simplex virus type 1 temperature-sensitive mutants.

    PubMed Central

    Felser, J M; Straus, S E; Ostrove, J M

    1987-01-01

    Varicella-zoster virus (VZV) can complement temperature-sensitive mutants of herpes simplex virus. Of seven mutants tested, two, carrying mutations in the immediate-early ICP4 and ICP27 proteins, were complemented. This complementation was not seen in coinfections with adenovirus type 5 or cytomegalovirus. Following transfection into CV-1 cells, a DNA fragment containing the VZV short repeat sequence complemented the ICP4 mutant. These data demonstrate a functional relationship between VZV and herpes simplex virus and have allowed localization of a putative VZV immediate-early gene. PMID:3023701

  8. Identification of potential drug targets by subtractive genome analysis of Escherichia coli O157:H7: an in silico approach

    PubMed Central

    Mondal, Shakhinur Islam; Ferdous, Sabiha; Jewel, Nurnabi Azad; Akter, Arzuba; Mahmud, Zabed; Islam, Md Muzahidul; Afrin, Tanzila; Karim, Nurul

    2015-01-01

    Bacterial enteric infections resulting in diarrhea, dysentery, or enteric fever constitute a huge public health problem, with more than a billion episodes of disease annually in developing and developed countries. In this study, the deadly agent of hemorrhagic diarrhea and hemolytic uremic syndrome, Escherichia coli O157:H7 was investigated with extensive computational approaches aimed at identifying novel and broad-spectrum antibiotic targets. A systematic in silico workflow consisting of comparative genomics, metabolic pathways analysis, and additional drug prioritizing parameters was used to identify novel drug targets that were essential for the pathogen’s survival but absent in its human host. Comparative genomic analysis of Kyoto Encyclopedia of Genes and Genomes annotated metabolic pathways identified 350 putative target proteins in E. coli O157:H7 which showed no similarity to human proteins. Further bio-informatic approaches including prediction of subcellular localization, calculation of molecular weight, and web-based investigation of 3D structural characteristics greatly aided in filtering the potential drug targets from 350 to 120. Ultimately, 44 non-homologous essential proteins of E. coli O157:H7 were prioritized and proved to have the eligibility to become novel broad-spectrum antibiotic targets and DNA polymerase III alpha (dnaE) was the top-ranked among these targets. Moreover, druggability of each of the identified drug targets was evaluated by the DrugBank database. In addition, 3D structure of the dnaE was modeled and explored further for in silico docking with ligands having potential druggability. Finally, we confirmed that the compounds N-coeleneterazine and N-(1,4-dihydro-5H-tetrazol-5-ylidene)-9-oxo-9H-xanthene-2-sulfon-amide were the most suitable ligands of dnaE and hence proposed as the potential inhibitors of this target protein. The results of this study could facilitate the discovery and release of new and effective drugs against E

  9. DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.

    PubMed

    Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G

    2012-04-01

    Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

  10. Bioluminescent indicators for Ca2+ based on split Renilla luciferase complementation in living cells.

    PubMed

    Kaihara, Asami; Umezawa, Yoshio; Furukawa, Tetsushi

    2008-01-01

    Genetically encoded bioluminescent indicators for intracellular Ca2+ are described here with CaM-M13 interaction-induced complementation of split Renilla luciferase. The Ca2+-induced interaction between CaM and M13 leads to complementation of the N- and C-terminal halves of split Renilla luciferase in living cells. This intramolecular interaction results in the spontaneous and simultaneous emission of bioluminescence split Renilla luciferase. This is how intracellular Ca2+ is illuminated with the intramolecular complementation of split Renilla luciferase. The Ca2+-dependent spontaneous and simultaneous emission of bioluminescence promises to reveal Ca2+ dynamics in living cells, and also in vivo using the present indicators.

  11. Optical 1's and 2's complement devices using lithium-niobate-based waveguide

    NASA Astrophysics Data System (ADS)

    Pal, Amrindra; Kumar, Santosh; Sharma, Sandeep

    2016-12-01

    Optical 1's and 2's complement devices are proposed with the help of lithium-niobate-based Mach-Zehnder interferometers. It has a powerful capability of switching an optical signal from one port to the other port with the help of an electrical control signal. The paper includes the optical conversion scheme using sets of optical switches. 2's complement is common in computer systems and is used in binary subtraction and logical manipulation. The operation of the circuits is studied theoretically and analyzed through numerical simulations. The truth table of these complement methods is verified with the beam propagation method and MATLAB® simulation results.

  12. Site-targeted complement inhibition by a complement receptor 2-conjugated inhibitor (mTT30) ameliorates post-injury neuropathology in mouse brains.

    PubMed

    Rich, Megan C; Keene, Chesleigh N; Neher, Miriam D; Johnson, Krista; Yu, Zhao-Xue; Ganivet, Antoine; Holers, V Michael; Stahel, Philip F

    2016-03-23

    Intracerebral complement activation after severe traumatic brain injury (TBI) leads to a cascade of neuroinflammatory pathological sequelae that propagate host-mediated secondary brain injury and adverse outcomes. There are currently no specific pharmacological agents on the market to prevent or mitigate the development of secondary cerebral insults after TBI. A novel chimeric CR2-fH compound (mTT30) provides targeted inhibition of the alternative complement pathway at the site of tissue injury. This experimental study was designed to test the neuroprotective effects of mTT30 in a mouse model of closed head injury. The administration of 500 μg mTT30 i.v. at 1 h, 4 h and 24 h after head injury attenuated complement C3 deposition in injured brains, reduced the extent of neuronal cell death, and decreased post-injury microglial activation, compared to vehicle-injected placebo controls. These data imply that site-targeted alternative pathway complement inhibition may represent a new promising therapeutic avenue for the future management of severe TBI. Copyright © 2016. Published by Elsevier Ireland Ltd.

  13. Decreased complement mediated binding of antibody//sup 3/-dsDNA immune complexes to the red blood cells of patients with systemic lupus erythematosus, rheumatoid arthritis, and hematologic malignancies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taylor, R.P.; Horgan, C.; Buschbacher, R.

    1983-06-01

    The complement mediated binding of prepared antibody//sup 3/H-dsDNA immune complexes to the red blood cells obtained from a number of patient populations has been investigated. Patients with solid tumors have binding activity similar to that seen in a normal group of individuals. However, a significant fraction of patients with systemic lupus erythematosus, rheumatoid arthritis, and hematologic malignancies have lowered binding activity compared with normal subjects. Quantitative studies indicate the lowered activity probably arises due to a decrease in complement receptors on the respective red blood cells. The potential importance and implications of these findings are briefly discussed.

  14. An 'instant gene bank' method for gene cloning by mutant complementation.

    PubMed

    Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J

    1994-02-01

    We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.

  15. Complementation for an essential ancillary nonstructural protein function across parvovirus genera

    PubMed Central

    Mihaylov, Ivailo S.; Cotmore, Susan F.; Tattersall, Peter

    2014-01-01

    Parvoviruses encode a small number of ancillary proteins that differ substantially between genera. Within the genus Protoparvovirus, minute virus of mice (MVM) encodes three isoforms of its ancillary protein NS2, while human bocavirus 1 (HBoV1), in the genus Bocaparvovirus, encodes an NP1 protein that is unrelated in primary sequence to MVM NS2. To search for functional overlap between NS2 and NP1, we generated murine A9 cell populations that inducibly express HBoV1 NP1. These were used to test whether NP1 expression could complement specific defects resulting from depletion of MVM NS2 isoforms. NP1 induction had little impact on cell viability or cell cycle progression in uninfected cells, and was unable to complement late defects in MVM virion production associated with low NS2 levels. However, NP1 did relocate to MVM replication centers, and supports both the normal expansion of these foci and overcomes the early paralysis of DNA replication in NS2-null infections. PMID:25194919

  16. Sundanese Complementation

    ERIC Educational Resources Information Center

    Kurniawan, Eri

    2013-01-01

    The focus of this thesis is the description and analysis of clausal complementation in Sundanese, an Austronesian language spoken in Indonesia. The thesis examined a range of clausal complement types in Sundanese, which consists of (i) "yen/(wi)rehna" "that" complements, (ii) "pikeun" "for" complements,…

  17. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    PubMed

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Complement in Lupus Nephritis: New Perspectives.

    PubMed

    Bao, Lihua; Cunningham, Patrick N; Quigg, Richard J

    2015-09-01

    Systemic lupus erythematosus (SLE) is an autoimmune disorder caused by loss of tolerance to self-antigens, the production of autoantibodies and deposition of complement-fixing immune complexes (ICs) in injured tissues. SLE is characterized by a wide range of clinical manifestations and targeted organs, with lupus nephritis being one of the most serious complications. The complement system consists of three pathways and is tightly controlled by a set of regulatory proteins to prevent injudicious complement activation on host tissue. The involvement of the complement system in the pathogenesis of SLE is well accepted; yet, its exact role is still not clear. Complement plays dual roles in the pathogenesis of SLE. On the one hand, the complement system appears to have protective features in that hereditary homozygous deficiencies of classical pathway components, such as C1q and C4, are associated with an increased risk for SLE. On the other hand, IC-mediated activation of complement in affected tissues is clearly evident in both experimental and human SLE along with pathological features that are logical consequences of complement activation. Studies in genetically altered mice have shown that lack of complement inhibitors, such as complement factor H (CFH) or decay-accelerating factor (DAF) accelerates the development of experimental lupus nephritis, while treatment with recombinant protein inhibitors, such as Crry-Ig, CR2-Crry, CR2-DAF and CR2-CFH, ameliorates the disease development. Complement-targeted drugs, including soluble complement receptor 1 (TP10), C1 esterase inhibitor and a monoclonal anti-C5 antibody (eculizumab), have been shown to inhibit complement safely, and are now being investigated in a variety of clinical conditions. SLE is an autoimmune disorder which targets multiple systems. Complement is centrally involved and plays dual roles in the pathogenesis of SLE. Studies from experimental lupus models and clinical trials support the use of complement

  19. Regulation of DNA repair in serum-stimulated xeroderma pigmentosum cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gupta, P.K.; Sirover, M.A.

    1984-10-01

    The regulation of DNA repair during serum stimulation of quiescent cells was examined in normal human cells, in fibroblasts from three xeroderma pigmentosum complementation groups (A, C, and D), in xeroderma pigmentosum variant cells, and in ataxia telangiectasia cells. The regulation of nucleotide excision repair was examined by exposing cells to ultraviolet irradiation at discrete intervals after cell stimulation. Similarly, base excision repair was quantitated after exposure to methylmethane sulfonate. WI-38 normal human diploid fibroblasts, xeroderma pigmentosum variant cells, as well as ataxia telangiectasia cells enhanced their capacity for both nucleotide excision repair and for base excision repair prior tomore » their enhancement of DNA synthesis. Further, in each cell strain, the base excision repair enzyme uracil DNA glycosylase was increased prior to the induction of DNA polymerase using the identical cells to quantitate each activity. In contrast, each of the three xeroderma complementation groups that were examined failed to increase their capacity for nucleotide excision repair above basal levels at any interval examined. This result was observed using either unscheduled DNA synthesis in the presence of 10 mM hydroxyurea or using repair replication in the absence of hydroxyurea to quantitate DNA repair. However, each of the three complementation groups normally regulated the enhancement of base excision repair after methylmethane sulfonate exposure and each induced the uracil DNA glycosylase prior to DNA synthesis. 62 references, 3 figures, 2 tables.« less

  20. Clinical symptoms and DNA repair characteristics of xeroderma pigmentosum patients from Germany

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thielmann, H.W.; Popanda, O.; Edler, L.

    1991-07-01

    Sixty-one xeroderma pigmentosum (XP) patients living in the Federal Republic of Germany were investigated. Clinical symptoms were correlated with DNA repair parameters measured in fibroblasts grown from skin biopsies. Classification according to the international complementation groups revealed that of the 61 patients 3 belonged to group A, 26 to group C, 16 to group D, 3 to group E, and 2 to group F; 11 were of the XP variant type. A striking clinical aspect was the frequency of histogenetically different skin tumors varying from one XP complementation group to the other: squamous and basal cell carcinomas predominated in XPmore » group C; lentigo maligna melanomas were most frequent in group D; basal cell carcinomas occurred preferentially in group E and XP variants. Three DNA repair parameters were determined for 46 fibroblast strains: colony-forming ability (D0); DNA repair synthesis (G0); and DNA-incising capacity (E0). Dose-response experiments with up to 13 dose levels were performed throughout to achieve sufficient experimental accuracy. DNA-damaging treatments included UV light, the 'UV-like' carcinogen N-acetoxy-2-acetylaminofluorene, and the alkylating carcinogens methyl methanesulfonate and N-methyl-N-nitrosourea. Comparison of clinical signs and repair data was made on the basis of D0, G0, and E0 values of both individual cell strains and weighted means of XP complementation groups. Despite considerable clinical and biochemical heterogeneity within complementation groups distinctive features emerged. In general, D0, G0, and E0 values of all XP strains investigated, including XP variants, were found to be reduced upon treatment with UV light or N-acetoxy-2-acetylaminofluorene.« less

  1. Complementation for an essential ancillary non-structural protein function across parvovirus genera.

    PubMed

    Mihaylov, Ivailo S; Cotmore, Susan F; Tattersall, Peter

    2014-11-01

    Parvoviruses encode a small number of ancillary proteins that differ substantially between genera. Within the genus Protoparvovirus, minute virus of mice (MVM) encodes three isoforms of its ancillary protein NS2, while human bocavirus 1 (HBoV1), in the genus Bocaparvovirus, encodes an NP1 protein that is unrelated in primary sequence to MVM NS2. To search for functional overlap between NS2 and NP1, we generated murine A9 cell populations that inducibly express HBoV1 NP1. These were used to test whether NP1 expression could complement specific defects resulting from depletion of MVM NS2 isoforms. NP1 induction had little impact on cell viability or cell cycle progression in uninfected cells, and was unable to complement late defects in MVM virion production associated with low NS2 levels. However, NP1 did relocate to MVM replication centers, and supports both the normal expansion of these foci and overcomes the early paralysis of DNA replication in NS2-null infections. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Brca2 (XRCC11) Deficiency Results in Radioresistant DNA Synthesis and a Higher Frequency of Spontaneous Deletions

    PubMed Central

    Kraakman-van der Zwet, Maria; Overkamp, Wilhelmina J. I.; van Lange, Rebecca E. E.; Essers, Jeroen; van Duijn-Goedhart, Annemarie; Wiggers, Ingrid; Swaminathan, Srividya; van Buul, Paul P. W.; Errami, Abdellatif; Tan, Raoul T. L.; Jaspers, Nicolaas G. J.; Sharan, Shyam K.; Kanaar, Roland; Zdzienicka, Małgorzata Z.

    2002-01-01

    We show here that the radiosensitive Chinese hamster cell mutant (V-C8) of group XRCC11 is defective in the breast cancer susceptibility gene Brca2. The very complex phenotype of V-C8 cells is complemented by a single human chromosome 13 providing the BRCA2 gene, as well as by the murine Brca2 gene. The Brca2 deficiency in V-C8 cells causes hypersensitivity to various DNA-damaging agents with an extreme sensitivity toward interstrand DNA cross-linking agents. Furthermore, V-C8 cells show radioresistant DNA synthesis after ionizing radiation, suggesting that Brca2 deficiency affects cell cycle checkpoint regulation. In addition, V-C8 cells display tremendous chromosomal instability and a high frequency of abnormal centrosomes. The mutation spectrum at the hprt locus showed that the majority of spontaneous mutations in V-C8 cells are deletions, in contrast to wild-type V79 cells. A mechanistic explanation for the genome instability phenotype of Brca2-deficient cells is provided by the observation that the nuclear localization of the central DNA repair protein in homologous recombination, Rad51, is reduced in V-C8 cells. PMID:11756561

  3. Superimposed Code Theoretic Analysis of DNA Codes and DNA Computing

    DTIC Science & Technology

    2008-01-01

    complements of one another and the DNA duplex formed is a Watson - Crick (WC) duplex. However, there are many instances when the formation of non-WC...that the user’s requirements for probe selection are met based on the Watson - Crick probe locality within a target. The second type, called...AFRL-RI-RS-TR-2007-288 Final Technical Report January 2008 SUPERIMPOSED CODE THEORETIC ANALYSIS OF DNA CODES AND DNA COMPUTING

  4. Therapeutic inhibition of the complement system. Y2K update.

    PubMed

    Asghar, S S; Pasch, M C

    2000-09-01

    Activation of complement is an essential part of the mechanism of pathogenesis of a large number of human diseases; its inhibition by pharmacological means is likely to suppress disease processes in complement mediated diseases. From this point of view low molecular weight synthetic inhibitors of complement are being developed and high molecular weight natural inhibitors of human origin present in plasma or embedded in cell membrane are being purified or produced in their recombinant forms. This review is concerned with high molecular weight inhibitors, some of which are already in clinical use but may be efficacious in many other diseases in which they have not yet been tried. C1-esterase inhibitor (C1-INH) concentrate prepared from human plasma is being successfully used for the treatment of hereditary angioneurotic edema. Recently, C1-INH has been found to be consumed in severe inflammation and has been shown to exert beneficial effects in several inflammatory conditions such as human sepsis, post-operative myocardial dysfunction due to reperfusion injury, severe capillary leakage syndrome after bone marrow transplantation, reperfusion injury after lung transplantation, burn, and cytotoxicity caused by IL-2 therapy in cancer. Factor I has been used for the treatment of factor I deficiency. Recombinant soluble forms of membrane cofactor protein (MCP), and decay accelerating factor (DAF) have not yet been tried in humans but have been shown to be effective in immune complex mediate inflammation in animals. Organs of pigs transgenic for one or more of human membrane regulators of complement namely membrane cofactor protein (MCP), decay accelerating factor (DAF) or CD59, are being produced for transplantation into humans. They have been shown to be resistant to hyperacute rejection in non-human primates; acute vascular rejection is still a problem in their clinical use. It is hoped that these observations together with future developments will make xeno

  5. Uracil DNA glycosylase BKRF3 contributes to Epstein-Barr virus DNA replication through physical interactions with proteins in viral DNA replication complex.

    PubMed

    Su, Mei-Tzu; Liu, I-Hua; Wu, Chia-Wei; Chang, Shu-Ming; Tsai, Ching-Hwa; Yang, Pei-Wen; Chuang, Yu-Chia; Lee, Chung-Pei; Chen, Mei-Ru

    2014-08-01

    Epstein-Barr virus (EBV) BKRF3 shares sequence homology with members of the uracil-N-glycosylase (UNG) protein family and has DNA glycosylase activity. Here, we explored how BKRF3 participates in the DNA replication complex and contributes to viral DNA replication. Exogenously expressed Flag-BKRF3 was distributed mostly in the cytoplasm, whereas BKRF3 was translocated into the nucleus and colocalized with the EBV DNA polymerase BALF5 in the replication compartment during EBV lytic replication. The expression level of BKRF3 increased gradually during viral replication, coupled with a decrease of cellular UNG2, suggesting BKRF3 enzyme activity compensates for UNG2 and ensures the fidelity of viral DNA replication. In immunoprecipitation-Western blotting, BKRF3 was coimmuno-precipitated with BALF5, the polymerase processivity factor BMRF1, and the immediate-early transactivator Rta. Coexpression of BMRF1 appeared to facilitate the nuclear targeting of BKRF3 in immunofluorescence staining. Residues 164 to 255 of BKRF3 were required for interaction with Rta and BALF5, whereas residues 81 to 166 of BKRF3 were critical for BMRF1 interaction in glutathione S-transferase (GST) pulldown experiments. Viral DNA replication was defective in cells harboring BKRF3 knockout EBV bacmids. In complementation assays, the catalytic mutant BKRF3(Q90L,D91N) restored viral DNA replication, whereas the leucine loop mutant BKRF3(H213L) only partially rescued viral DNA replication, coupled with a reduced ability to interact with the viral DNA polymerase and Rta. Our data suggest that BKRF3 plays a critical role in viral DNA synthesis predominantly through its interactions with viral proteins in the DNA replication compartment, while its enzymatic activity may be supplementary for uracil DNA glycosylase (UDG) function during virus replication. Catalytic activities of both cellular UDG UNG2 and viral UDGs contribute to herpesviral DNA replication. To ensure that the enzyme activity executes at

  6. Evaluation of Pasteurella multocida serotype B:2 resistance to immune serum and complement system

    PubMed Central

    Ataei Kachooei, Saeed; Ranjbar, Mohammad Mehdi; Ataei Kachooei, Saba

    2017-01-01

    Members of gram-negative bacteria family Pasteurellaceae, include a large number of important economically human and veterinary pathogens. Organisms belonging to the family can colonize in mucosal surfaces of the respiratory, alimentary, genital tracts and cause diseases in various mammals, birds, and reptiles. Hemorrhagic septicemia is an acute disease of cattle and buffaloes in tropical countries caused by Pasteurella multocida serotype B:2. In the present study, the possible bactericidal activity of immune calf sera in the presence and absence of complement system was investigated. The results showed that P. multocida B:2 is highly resistant to positive serum, containing high levels of IgG and IgM obtained from calves after vaccination, and complement activity in normal fresh calf serum. This organism also grew rapidly in the normal fresh calf serum and the mixture of positive serum as well as normal fresh calf serum. As a control test an E. coli strain was subjected to the same experiment and found completely sensitive to the bactericidal activity of complement in calf and guinea pig fresh sera. Results were indicative of the presence of inhibitory mechanism(s) in P. multocida B:2 against bactericidal activity of immune calf serum and complement system. PMID:29085604

  7. Complement

    MedlinePlus

    ... activity (CH50, CH100) looks at the overall activity of the complement system. In most cases, other tests that are more ... Church SE, Fremeaux-Bacchi V, Roumenina LT. Complement system part I - molecular mechanisms of activation and regulation. Front Immunol . 2015;6:262. ...

  8. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  9. The residual repair capacity of xeroderma pigmentosum complementation group C fibroblasts is highly specific for transcriptionally active DNA.

    PubMed Central

    Venema, J; van Hoffen, A; Natarajan, A T; van Zeeland, A A; Mullenders, L H

    1990-01-01

    We have measured removal of pyrimidine dimers in defined DNA sequences in confluent and actively growing normal human and xeroderma pigmentosum complementation group C (XP-C) fibroblasts exposed to 10 J/m2 UV-irradiation. In normal fibroblasts 45% and 90% of the dimers are removed from the transcriptionally active adenosine deaminase (ADA) gene within 4 and 24 hours after irradiation respectively. Equal repair efficiencies are found in fragments located entirely within the transcription unit or partly in the 3' flanking region of the ADA gene. The rate and extent of dimer removal from the dihydrofolate reductase (DHFR) gene is very similar to that of the ADA gene. Repair of the transcriptionally inactive 754 locus is less efficient: 18% and 52% of the dimers are removed within 4 and 24 hours respectively. In spite of the limited overall repair capacity, confluent XP-C fibroblasts efficiently remove dimers from the ADA and DHFR genes: about 90% and 50% within 24 hours respectively. The 3' end of the ADA gene is repaired as efficiently as in normal human fibroblasts, but less efficient repair occurs in DNA fragments located in the DHFR gene and at the 5' end of the ADA gene. Repair of the inactive 754 locus does not exceed the very slow rate of dimer removal from the genome overall. Confluent and actively growing XP-C cells show similar efficiencies of repair of the ADA, DHFR and 754 genes. Our findings suggest the existence of two independently operating pathways directed towards repair of pyrimidine dimers in either active or inactive chromatin. XP-C cells have lost the capacity to repair inactive chromatin, but are still able to repair active chromatin. Images PMID:2308842

  10. Regulation of humoral immunity by complement.

    PubMed

    Carroll, Michael C; Isenman, David E

    2012-08-24

    The complement system of innate immunity is important in regulating humoral immunity largely through the complement receptor CR2, which forms a coreceptor on B cells during antigen-induced activation. However, CR2 also retains antigens on follicular dendritic cells (FDCs). Display of antigen on FDCs is critical for clonal selection and affinity maturation of activated B cells. This review will discuss the role of complement in adaptive immunity in general with a focus on the interplay between CR2-associated antigen on B cells with CR2 expressed on FDCs. This latter interaction provides an opportunity for memory B cells to sample antigen over prolonged periods. The cocrystal structure of CR2 with its ligand C3d provides insight into how the complement system regulates access of antigen by B cells with implications for therapeutic manipulations to modulate aberrant B cell responses in the case of autoimmunity. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsodikov, Oleg V.; Biswas, Tapan

    An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

  12. Affinity Purification of Proteins in Tag-Free Form: Split Intein-Mediated Ultrarapid Purification (SIRP).

    PubMed

    Guan, Dongli; Chen, Zhilei

    2017-01-01

    Proteins purified using affinity-based chromatography often exploit a recombinant affinity tag. Existing methods for the removal of the extraneous tag, needed for many applications, suffer from poor efficiency and/or high cost. Here we describe a simple, efficient, and potentially low-cost approach-split intein-mediated ultrarapid purification (SIRP)-for both the purification of the desired tagged protein from Escherichia coli lysate and removal of the tag in less than 1 h. The N- and C-fragment of a self-cleaving variant of a naturally split DnaE intein from Nostoc punctiforme are genetically fused to the N-terminus of an affinity tag and a protein of interest (POI), respectively. The N-intein/affinity tag is used to functionalize an affinity resin. The high affinity between the N- and C-fragment of DnaE intein enables the POI to be purified from the lysate via affinity to the resin, and the intein-mediated C-terminal cleavage reaction causes tagless POI to be released into the flow-through. The intein cleavage reaction is strongly inhibited by divalent ions (e.g., Zn 2+ ) under non-reducing conditions and is significantly enhanced by reducing conditions. The POI is cleaved efficiently regardless of the identity of the N-terminal amino acid except in the cases of threonine and proline, and the N-intein-functionalized affinity resin can be regenerated for multiple cycles of use.

  13. Serological and Genetic Evidence for Altered Complement System Functionality in Systemic Lupus Erythematosus: Findings of the GAPAID Consortium.

    PubMed

    Prechl, József; Papp, Krisztián; Hérincs, Zoltán; Péterfy, Hajna; Lóránd, Veronika; Szittner, Zoltán; Estonba, Andone; Rovero, Paolo; Paolini, Ilaria; Del Amo, Jokin; Uribarri, Maria; Alcaro, Maria Claudia; Ruiz-Larrañaga, Otsanda; Migliorini, Paola; Czirják, László

    2016-01-01

    Systemic lupus erythematosus is a chronic autoimmune disease with multifactorial ethiopathogenesis. The complement system is involved in both the early and late stages of disease development and organ damage. To better understand autoantibody mediated complement consumption we examined ex vivo immune complex formation on autoantigen arrays. We recruited patients with SLE (n = 211), with other systemic autoimmune diseases (n = 65) and non-autoimmune control subjects (n = 149). Standard clinical and laboratory data were collected and serum complement levels were determined. The genotype of SNP rs1143679 in the ITGAM gene was also determined. Ex vivo formation of immune complexes, with respect to IgM, IgG, complement C4 and C3 binding, was examined using a functional immunoassay on autoantigen microarray comprising nucleic acids, proteins and lipids. Complement consumption of nucleic acids increased upon binding of IgM and IgG even when serum complement levels were decreased due to consumption in SLE patients. A negative correlation between serum complement levels and ex vivo complement deposition on nucleic acid autoantigens is demonstrated. On the contrary, complement deposition on tested protein and lipid autoantigens showed positive correlation with C4 levels. Genetic analysis revealed that the non-synonymous variant rs1143679 in complement receptor type 3 is associated with an increased production of anti-dsDNA IgG antibodies. Notwithstanding, homozygous carriers of the previously reported susceptible allele (AA) had lower levels of dsDNA specific IgM among SLE patients. Both the non-synonymous variant rs1143679 and the high ratio of nucleic acid specific IgG/IgM were associated with multiple organ involvement. In summary, secondary complement deficiency in SLE does not impair opsonization of nucleic-acid-containing autoantigens but does affect other antigens and potentially other complement dependent processes. Dysfunction of the receptor recognizing complement

  14. The role of complement in myasthenia gravis: serological evidence of complement consumption in vivo.

    PubMed

    Romi, Fredrik; Kristoffersen, Einar K; Aarli, Johan A; Gilhus, Nils Erik

    2005-01-01

    Antibodies to the acetylcholine receptor (AChR) titin and the ryanodine receptor (RyR) occur in myasthenia gravis (MG). These antibodies are capable of complement activation in vitro. The involvement of the complement system should cause consumption of complement components such as C3 and C4 in vivo. Complement components C3 and C4 were assayed in sera from 78 AChR antibody-positive MG patients and 52 healthy controls. Forty-eight of the patient sera contained titin antibodies as well, and 20 were also RyR antibody-positive. MG patients with AChR antibody concentrations above the median (11.2 nmol/l) had significantly lower mean C3 and C4 concentrations in serum compared to those with AChR antibody concentrations below the median. Titin antibody-positive MG patients, titin antibody-negative early-onset MG patients, titin antibody-negative late-onset MG patients, and controls had similar C3 and C4 concentrations. Nor did mean C3 and C4 concentrations differ in MG patients with RyR antibodies. Patients with severe MG (grades 4 and 5) had similar C3 and similar C4 levels compared to those with mild MG (grades 1 and 2). An increased in vivo complement consumption was detected in MG patients with high AChR antibody concentrations, unrelated to MG severity and non-AChR muscle antibodies.

  15. Complement component 4

    MedlinePlus

    ... of a certain protein. This protein is part of the complement system. The complement system is a group of proteins ... system and play a role in the development of inflammation. The complement system protects the body from infections, dead cells and ...

  16. Fanconi Anemia Complementation Group A (FANCA) Protein Has Intrinsic Affinity for Nucleic Acids with Preference for Single-stranded Forms*

    PubMed Central

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-01-01

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614

  17. Fanconi anemia complementation group A (FANCA) protein has intrinsic affinity for nucleic acids with preference for single-stranded forms.

    PubMed

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin

    2012-02-10

    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.

  18. Modular fluorescence complementation sensors for live cell detection of epigenetic signals at endogenous genomic sites.

    PubMed

    Lungu, Cristiana; Pinter, Sabine; Broche, Julian; Rathert, Philipp; Jeltsch, Albert

    2017-09-21

    Investigation of the fundamental role of epigenetic processes requires methods for the locus-specific detection of epigenetic modifications in living cells. Here, we address this urgent demand by developing four modular fluorescence complementation-based epigenetic biosensors for live-cell microscopy applications. These tools combine engineered DNA-binding proteins with domains recognizing defined epigenetic marks, both fused to non-fluorescent fragments of a fluorescent protein. The presence of the epigenetic mark at the target DNA sequence leads to the reconstitution of a functional fluorophore. With this approach, we could for the first time directly detect DNA methylation and histone 3 lysine 9 trimethylation at endogenous genomic sites in live cells and follow dynamic changes in these marks upon drug treatment, induction of epigenetic enzymes and during the cell cycle. We anticipate that this versatile technology will improve our understanding of how specific epigenetic signatures are set, erased and maintained during embryonic development or disease onset.Tools for imaging epigenetic modifications can shed light on the regulation of epigenetic processes. Here, the authors present a fluorescence complementation approach for detection of DNA and histone methylation at endogenous genomic sites allowing following of dynamic changes of these marks by live-cell microscopy.

  19. Pneumococcal polysaccharides complexed with C3d bind to human B lymphocytes via complement receptor type 2.

    PubMed Central

    Griffioen, A W; Rijkers, G T; Janssens-Korpela, P; Zegers, B J

    1991-01-01

    The immunoregulatory function of the complement system has been the focus of many investigations. In particular, fragments of complement factor C3 have been shown to play a role in B-lymphocyte activation and proliferation, lymphokine production, and the generation of in vitro antibody production. Purified pneumococcal polysaccharides (PS) can induce direct activation of C3 via the alternative pathway. Using sera of C1q-deficient patients and healthy subjects, we demonstrated that C3d, a split product of C3 that is generated after degradation of iC3b, can be bound to PS antigens. The binding of C3d to PS can occur in the absence of specific antibodies. Subsequently, we showed that PS complexed with C3d can be recognized by complement receptor type 2 that is expressed on B cells. Treatment of B cells with a monoclonal antibody recognizing the C3d-binding site of complement receptor type 2 reduces the binding of PS-C3d to the cells. In addition, we showed that PS4 complexed with C3d exerted an increased immunogenicity compared with free PS4. Our results show that the complement system plays a role in the activation of PS-specific B cells, carrying membrane receptors for C3d. Consequently, the complement system plays a regulatory role in the antibody response to T-cell-independent type 2 antigens such as PS. PMID:1826897

  20. DNA Sequence Variants in PPARGC1A, a Gene Encoding a Coactivator of the ω-3 LCPUFA Sensing PPAR-RXR Transcription Complex, Are Associated with NV AMD and AMD-Associated Loci in Genes of Complement and VEGF Signaling Pathways

    PubMed Central

    SanGiovanni, John Paul; Chen, Jing; Sapieha, Przemyslaw; Aderman, Christopher M.; Stahl, Andreas; Clemons, Traci E.; Chew, Emily Y.; Smith, Lois E. H.

    2013-01-01

    Background Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs) and use of peroxisome proliferator activator receptor (PPAR)-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG) co-activator 1 alpha (PPARGC1A), a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR) transcription complex, may influence neovascularization (NV) in age-related macular degeneration (AMD). Methods We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A. Results A DNA coding variant (rs3736265) and a 3'UTR-resident regulatory variant (rs3774923) in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs). SNP-SNP interactions existed for NV AMD (P<0.005) with rs3736265 and a AMD-associated variant in complement factor B (CFB, rs512559). PPARGC1A influences activation of the AMD-associated complement component 3 (C3) promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P≤0.003) of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033), a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678) showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P≤0.003). C3 expression was down-regulated 2-fold in retinas of

  1. Complement Evasion by Pathogenic Leptospira.

    PubMed

    Fraga, Tatiana Rodrigues; Isaac, Lourdes; Barbosa, Angela Silva

    2016-01-01

    Leptospirosis is a neglected infectious disease caused by spirochetes from the genus Leptospira . Pathogenic microorganisms, notably those which reach the blood circulation such as Leptospira , have evolved multiple strategies to escape the host complement system, which is important for innate and acquired immunity. Leptospira avoid complement-mediated killing through: (i) recruitment of host complement regulators; (ii) acquisition of host proteases that cleave complement proteins on the bacterial surface; and, (iii) secretion of proteases that inactivate complement proteins in the Leptospira surroundings. The recruitment of host soluble complement regulatory proteins includes the acquisition of Factor H (FH) and FH-like-1 (alternative pathway), C4b-binding protein (C4BP) (classical and lectin pathways), and vitronectin (Vn) (terminal pathway). Once bound to the leptospiral surface, FH and C4BP retain cofactor activity of Factor I in the cleavage of C3b and C4b, respectively. Vn acquisition by leptospires may result in terminal pathway inhibition by blocking C9 polymerization. The second evasion mechanism lies in plasminogen (PLG) binding to the leptospiral surface. In the presence of host activators, PLG is converted to enzymatically active plasmin, which is able to degrade C3b, C4b, and C5 at the surface of the pathogen. A third strategy used by leptospires to escape from complement system is the active secretion of proteases. Pathogenic, but not saprophytic leptospires, are able to secrete metalloproteases that cleave C3 (central complement molecule), Factor B (alternative pathway), and C4 and C2 (classical and lectin pathways). The purpose of this review is to fully explore these complement evasion mechanisms, which act together to favor Leptospira survival and multiplication in the host.

  2. Complement Evasion by Pathogenic Leptospira

    PubMed Central

    Fraga, Tatiana Rodrigues; Isaac, Lourdes; Barbosa, Angela Silva

    2016-01-01

    Leptospirosis is a neglected infectious disease caused by spirochetes from the genus Leptospira. Pathogenic microorganisms, notably those which reach the blood circulation such as Leptospira, have evolved multiple strategies to escape the host complement system, which is important for innate and acquired immunity. Leptospira avoid complement-mediated killing through: (i) recruitment of host complement regulators; (ii) acquisition of host proteases that cleave complement proteins on the bacterial surface; and, (iii) secretion of proteases that inactivate complement proteins in the Leptospira surroundings. The recruitment of host soluble complement regulatory proteins includes the acquisition of Factor H (FH) and FH-like-1 (alternative pathway), C4b-binding protein (C4BP) (classical and lectin pathways), and vitronectin (Vn) (terminal pathway). Once bound to the leptospiral surface, FH and C4BP retain cofactor activity of Factor I in the cleavage of C3b and C4b, respectively. Vn acquisition by leptospires may result in terminal pathway inhibition by blocking C9 polymerization. The second evasion mechanism lies in plasminogen (PLG) binding to the leptospiral surface. In the presence of host activators, PLG is converted to enzymatically active plasmin, which is able to degrade C3b, C4b, and C5 at the surface of the pathogen. A third strategy used by leptospires to escape from complement system is the active secretion of proteases. Pathogenic, but not saprophytic leptospires, are able to secrete metalloproteases that cleave C3 (central complement molecule), Factor B (alternative pathway), and C4 and C2 (classical and lectin pathways). The purpose of this review is to fully explore these complement evasion mechanisms, which act together to favor Leptospira survival and multiplication in the host. PMID:28066433

  3. Dna2 initiates resection at clean DNA double-strand breaks

    PubMed Central

    Paudyal, Sharad C.; Li, Shan; Yan, Hong; Hunter, Tony

    2017-01-01

    Abstract Nucleolytic resection of DNA double-strand breaks (DSBs) is essential for both checkpoint activation and homology-mediated repair; however, the precise mechanism of resection, especially the initiation step, remains incompletely understood. Resection of blocked ends with protein or chemical adducts is believed to be initiated by the MRN complex in conjunction with CtIP through internal cleavage of the 5′ strand DNA. However, it is not clear whether resection of clean DSBs with free ends is also initiated by the same mechanism. Using the Xenopus nuclear extract system, here we show that the Dna2 nuclease directly initiates the resection of clean DSBs by cleaving the 5′ strand DNA ∼10–20 nucleotides away from the ends. In the absence of Dna2, MRN together with CtIP mediate an alternative resection initiation pathway where the nuclease activity of MRN apparently directly cleaves the 5′ strand DNA at more distal sites. MRN also facilitates resection initiation by promoting the recruitment of Dna2 and CtIP to the DNA substrate. The ssDNA-binding protein RPA promotes both Dna2- and CtIP–MRN-dependent resection initiation, but a RPA mutant can distinguish between these pathways. Our results strongly suggest that resection of blocked and clean DSBs is initiated via distinct mechanisms. PMID:28981724

  4. Characterization and expression analysis of a complement component gene in sea cucumber ( Apostichopus japonicus)

    NASA Astrophysics Data System (ADS)

    Chen, Zhong; Zhou, Zunchun; Yang, Aifu; Dong, Ying; Guan, Xiaoyan; Jiang, Bei; Wang, Bai

    2015-12-01

    The complement system plays a crucial role in the innate immune system of animals. It can be activated by distinct yet overlapping classical, alternative and lectin pathways. In the alternative pathway, complement factor B (Bf) serves as the catalytic subunit of complement component 3 (C3) convertase, which plays the central role among three activation pathways. In this study, the Bf gene in sea cucumber ( Apostichopus japonicus), termed AjBf, was obtained by rapid amplification of cDNA ends (RACE). The full-length cDNA of AjBf was 3231 bp in length barring the poly (A) tail. It contained an open reading frame (ORF) of 2742 bp encoding 913 amino acids, a 105 bp 5'-UTR (5'-terminal untranslated region) and a 384 bp 3'-UTR. AjBf was a mosaic protein with six CCP (complement control protein) domains, a VWA (von Willebrand factor A) domain, and a serine protease domain. The deduced molecular weight of AjBf protein was 101 kDa. Quantitative real time PCR (qRT-PCR) analysis indicated that the expression level of AjBf in A. japonicus was obviously higher at larval stage than that at embryonic stage. Expression detection in different tissues showed that AjBf expressed higher in coelomocytes than in other four tissues. In addation, AjBf expression in different tissues was induced significantly after LPS or PolyI:C challenge. These results indicated that AjBf plays an important role in immune responses to pathogen infection.

  5. Phylogenetic aspects of the complement system.

    PubMed

    Zarkadis, I K; Mastellos, D; Lambris, J D

    2001-01-01

    During evolution two general systems of immunity have emerged: innate or, natural immunity and adaptive (acquired), or specific immunity. The innate system is phylogenetically older and is found in some form in all multicellular organisms, whereas the adaptive system appeared about 450 million years ago and is found in all vertebrates except jawless fish. The complement system in higher vertebrates plays an important role as an effector of both the innate and the acquired immune response, and also participates in various immunoregulatory processes. In lower vertebrates complement is activated by the alternative and lectin pathways and is primarily involved in the opsonization of foreign material. The Agnatha (the most primitive vertebrate species) possess the alternative and lectin pathways while cartilaginous fish are the first species in which the classical pathway appears following the emergence of immunoglobulins. The rest of the poikilothermic species, ranging from teleosts to reptilians, appear to contain a well-developed complement system resembling that of the homeothermic vertebrates. It seems that most of the complement components have appeared after the duplication of primordial genes encoding C3/C4/C5, fB/C2, C1s/C1r/MASP-1/MASP-2, and C6/C7/C8/C9 molecules, in a process that led to the formation of distinct activation pathways. However, unlike homeotherms, several species of poikilotherms (e.g. trout) have recently been shown to possess multiple forms of complement components (C3, factor B) that are structurally and functionally more diverse than those of higher vertebrates. We hypothesize that this remarkable diversity has allowed these animals to expand their innate capacity for immune recognition and response. Recent studies have also indicated the possible presence of complement receptors in protochordates and lower vertebrates. In conclusion, there is considerable evidence suggesting that the complement system is present in the entire lineage of

  6. [Polymorphism of genes encoding proteins of DNA repair vs. occupational and environmental exposure to lead, arsenic and pesticides].

    PubMed

    Bukowski, Karol; Woźniak, Katarzyna

    2018-03-09

    Genetic polymorphism is associated with the occurrence of at least 2 different alleles in the locus with a frequency higher than 1% in the population. Among polymorphisms we can find single nucleotide polymorphism (SNP) and polymorphism of variable number of tandem repeats. The presence of certain polymorphisms in genes encoding DNA repair enzymes is associated with the speed and efficiency of DNA repair and can protect or expose humans to the effects provoked by xenobiotics. Chemicals, such as lead, arsenic pesticides are considered to exhibit strong toxicity. There are many different polymorphisms in genes encoding DNA repair enzymes, which determine the speed and efficiency of DNA damage repair induced by these xenobiotics. In the case of lead, the influence of various polymorphisms, such as APE1 (apurinic/apyrimidinic endonuclease 1) (rs1130409), hOGG1 (human 8-oxoguanine glycosylase) (rs1052133), XRCC1 (X-ray repair cross-complementing protein group 1) (rs25487), XRCC1 (rs1799782) and XRCC3 (X-ray repair cross-complementing protein group 3) (rs861539) were described. For arsenic polymorphisms, such as ERCC2 (excision repair cross-complementing) (rs13181), XRCC3 (rs861539), APE1 (rs1130409) and hOGG1 (rs1052133) were examined. As to pesticides, separate and combined effects of polymorphisms in genes encoding DNA repair enzymes, such as XRCC1 (rs1799782), hOGG1 (rs1052133), XRCC4 (X-ray repair cross-complementing protein group 4) (rs28360135) and the gene encoding the detoxification enzyme PON1 paraoxonase (rs662) were reported. Med Pr 2018;69(2):225-235. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

  7. Functions of the high mobility group protein, Abf2p, in mitochondrial DNA segregation, recombination and copy number in Saccharomyces cerevisiae.

    PubMed

    Zelenaya-Troitskaya, O; Newman, S M; Okamoto, K; Perlman, P S; Butow, R A

    1998-04-01

    Previous studies have established that the mitochondrial high mobility group (HMG) protein, Abf2p, of Saccharomyces cerevisiae influences the stability of wild-type (rho+) mitochondrial DNA (mtDNA) and plays an important role in mtDNA organization. Here we report new functions for Abf2p in mtDNA transactions. We find that in homozygous deltaabf2 crosses, the pattern of sorting of mtDNA and mitochondrial matrix protein is altered, and mtDNA recombination is suppressed relative to homozygous ABF2 crosses. Although Abf2p is known to be required for the maintenance of mtDNA in rho+ cells growing on rich dextrose medium, we find that it is not required for the maintenance of mtDNA in p cells grown on the same medium. The content of both rho+ and rho- mtDNAs is increased in cells by 50-150% by moderate (two- to threefold) increases in the ABF2 copy number, suggesting that Abf2p plays a role in mtDNA copy control. Overproduction of Abf2p by > or = 10-fold from an ABF2 gene placed under control of the GAL1 promoter, however, leads to a rapid loss of rho+ mtDNA and a quantitative conversion of rho+ cells to petites within two to four generations after a shift of the culture from glucose to galactose medium. Overexpression of Abf2p in rho- cells also leads to a loss of mtDNA, but at a slower rate than was observed for rho+ cells. The mtDNA instability phenotype is related to the DNA-binding properties of Abf2p because a mutant Abf2p that contains mutations in residues of both HMG box domains known to affect DNA binding in vitro, and that binds poorly to mtDNA in vivo, complements deltaabf2 cells only weakly and greatly lessens the effect of overproduction on mtDNA instability. In vivo binding was assessed by colocalization to mtDNA of fusions between mutant or wild-type Abf2p and green fluorescent protein. These findings are discussed in the context of a model relating mtDNA copy number control and stability to mtDNA recombination.

  8. Erythrocyte-bound C4d in combination with complement and autoantibody status for the monitoring of SLE.

    PubMed

    Merrill, Joan T; Petri, Michelle A; Buyon, Jill; Ramsey-Goldman, Rosalind; Kalunian, Kenneth; Putterman, Chaim; Conklin, John; Furie, Richard A; Dervieux, Thierry

    2018-01-01

    We examined the usefulness of erythrocyte-bound C4d (EC4d) to monitor disease activity in SLE. Data and blood samples were collected from three different studies, each of which included longitudinal evaluations using the Physicians Global Assessment (PGA) of disease activity and the Safety of Estrogens in Lupus Erythematosus National Assessment (SELENA) SLE Disease Activity Index (SLEDAI), which was assessed without anti-double-stranded DNA (dsDNA) and low complement C3/C4 (clinical SELENA-SLEDAI). EC4d levels were determined using flow cytometry; other laboratory measures included antibodies to dsDNA, C3 and C4 proteins. Relationships between clinical SELENA-SLEDAI, PGA and the laboratory measures were analysed using linear mixed effect models. The three studies combined enrolled 124 patients with SLE (mean age 42 years, 97% women, 31% Caucasians and 34% African-Americans) followed for an average of 5 consecutive visits (range 2-13 visits). EC4d levels and low C3/C4 status were significantly associated the clinical SELENA-SLEDAI or PGA in each of the three study groups (p<0.05). Multivariate analysis revealed that EC4d levels (estimate=0.94±0.28) and low complement C3/C4 (estimate=1.24±0.43) were both independently and significantly associated with the clinical SELENA-SLEDAI (p<0.01) and PGA. EC4d levels were also associated with the clinical SELENA-SLEDAI (estimate: 1.20±0.29) and PGA (estimate=0.19±0.04) among patients with chronically low or normal C3/C4 (p<0.01). Anti-dsDNA titres were generally associated with disease activity. These data support the association of EC4d with disease activity regardless of complement C3/C4 status and its usefulness in monitoring SLE disease. Additional studies will be required to support these validation data.

  9. Immunization with a Vaccine Combining Herpes Simplex Virus 2 (HSV-2) Glycoprotein C (gC) and gD Subunits Improves the Protection of Dorsal Root Ganglia in Mice and Reduces the Frequency of Recurrent Vaginal Shedding of HSV-2 DNA in Guinea Pigs Compared to Immunization with gD Alone ▿

    PubMed Central

    Awasthi, Sita; Lubinski, John M.; Shaw, Carolyn E.; Barrett, Shana M.; Cai, Michael; Wang, Fushan; Betts, Michael; Kingsley, Susan; DiStefano, Daniel J.; Balliet, John W.; Flynn, Jessica A.; Casimiro, Danilo R.; Bryan, Janine T.; Friedman, Harvey M.

    2011-01-01

    Attempts to develop a vaccine to prevent genital herpes simplex virus 2 (HSV-2) disease have been only marginally successful, suggesting that novel strategies are needed. Immunization with HSV-2 glycoprotein C (gC-2) and gD-2 was evaluated in mice and guinea pigs to determine whether adding gC-2 to a gD-2 subunit vaccine would improve protection by producing antibodies that block gC-2 immune evasion from complement. Antibodies produced by gC-2 immunization blocked the interaction between gC-2 and complement C3b, and passive transfer of gC-2 antibody protected complement-intact mice but not C3 knockout mice against HSV-2 challenge, indicating that gC-2 antibody is effective, at least in part, because it prevents HSV-2 evasion from complement. Immunization with gC-2 also produced neutralizing antibodies that were active in the absence of complement; however, the neutralizing titers were higher when complement was present, with the highest titers in animals immunized with both antigens. Animals immunized with the gC-2-plus-gD-2 combination had robust CD4+ T-cell responses to each immunogen. Multiple disease parameters were evaluated in mice and guinea pigs immunized with gC-2 alone, gD-2 alone, or both antigens. In general, gD-2 outperformed gC-2; however, the gC-2-plus-gD-2 combination outperformed gD-2 alone, particularly in protecting dorsal root ganglia in mice and reducing recurrent vaginal shedding of HSV-2 DNA in guinea pigs. Therefore, the gC-2 subunit antigen enhances a gD-2 subunit vaccine by stimulating a CD4+ T-cell response, by producing neutralizing antibodies that are effective in the absence and presence of complement, and by blocking immune evasion domains that inhibit complement activation. PMID:21813597

  10. Dynamics and reproductive effects of complement factors in the spontaneous abortion model of CBA/J×DBA/2 mice.

    PubMed

    Takeshita, Ai; Kusakabe, Ken Takeshi; Hiyama, Masato; Kuniyoshi, Nobue; Kondo, Tomohiro; Kano, Kiyoshi; Kiso, Yasuo; Okada, Toshiya

    2014-05-01

    The complement system is one component of innate immunity that could participate in fetal loss. We have already reported that adipsin, a complement activator in the alternative pathway, is stably expressed in the placenta and that an increase in this expression is related to spontaneous abortion. However, complement inhibitor Crry was concurrently expressed in the placenta, and the role of complement factors during pregnancy was not clear. In the present study, we examined the endogenous regulation of complement factors in placenta and serum by using another model mouse for spontaneous abortion and studied the effect of exogenous complement disruption on pregnancy. Compared to control mice, the CBA/J×DBA/2 model mice had higher expression levels of adipsin in the placenta and serum. Adipsin and complement C3 were localized in the metrial gland and labyrinth regions, and both positive reactive ranges were limited in the maternal blood current in normal implantation sites. These results suggest that extrauterine adipsin hematogenously reaches the placenta, activates complement C3, and promotes destruction of the feto-maternal barrier in aborted implantation sites. Crry was consistently expressed in the placenta and serum and reduced in the resorption sites of CBA/J×DBA/2 mice as compared to normal sites. Injection of recombinant adipsin increased the resorption rate and changed the expression of Th-type cytokines toward a Th1 bias. The present study indicates that adipsin could induce the fetal loss that accompanies the Th1 bias and may be a crucial cause of spontaneous abortion. In addition, the local expression of Crry prevents complement activation in placenta in response to a systemic increase of adipsin. Copyright © 2014 Elsevier GmbH. All rights reserved.

  11. 21 CFR 866.5250 - Complement C2 inhibitor (inactivator) immunological test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... the reagents used to measure by immunochemical techniques the complement C1 inhibitor (a plasma protein) in serum. Complement C1 inhibitor occurs normally in plasma and blocks the action of the C1...

  12. 21 CFR 866.5250 - Complement C2 inhibitor (inactivator) immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... the reagents used to measure by immunochemical techniques the complement C1 inhibitor (a plasma protein) in serum. Complement C1 inhibitor occurs normally in plasma and blocks the action of the C1...

  13. 21 CFR 866.5250 - Complement C2 inhibitor (inactivator) immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... the reagents used to measure by immunochemical techniques the complement C1 inhibitor (a plasma protein) in serum. Complement C1 inhibitor occurs normally in plasma and blocks the action of the C1...

  14. 21 CFR 866.5250 - Complement C 2 inhibitor (inactivator) immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... the reagents used to measure by immunochemical techniques the complement C1 inhibitor (a plasma protein) in serum. Complement C1 inhibitor occurs normally in plasma and blocks the action of the C1...

  15. 21 CFR 866.5250 - Complement C 2 inhibitor (inactivator) immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... the reagents used to measure by immunochemical techniques the complement C1 inhibitor (a plasma protein) in serum. Complement C1 inhibitor occurs normally in plasma and blocks the action of the C1...

  16. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    PubMed

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  17. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    PubMed Central

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  18. Analysis of point mutations in an ultraviolet-irradiated shuttle vector plasmid propagated in cells from Japanese xeroderma pigmentosum patients in complementation groups A and F

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yagi, T.; Tatsumi-Miyajima, J.; Sato, M.

    1991-06-15

    To assess the contribution to mutagenesis by human DNA repair defects, a UV-treated shuttle vector plasmid, pZ189, was passed through fibroblasts derived from Japanese xeroderma pigmentosum (XP) patients in two different DNA repair complementation groups (A and F). Patients with XP have clinical and cellular UV hypersensitivity, increased frequency of skin cancer, and defects in DNA repair. The XP DNA repair defects represented by complementation groups A (XP-A) and F (XP-F) are more common in Japan than in Europe or the United States. In comparison to results with DNA repair-proficient human cells (W138-VA13), UV-treated pZ189 passed through the XP-A (XP2OS(SV))more » or XP-F (XP2YO(SV)) cells showed fewer surviving plasmids (XP-A less than XP-F) and a higher frequency of mutated plasmids (XP-A greater than XP-F). Base sequence analysis of more than 200 mutated plasmids showed the major type of base substitution mutation to be the G:C----A:T transition with all three cell lines. The XP-A and XP-F cells revealed a higher frequency of G:C----A:T transitions and a lower frequency of transversions among plasmids with single or tandem mutations and a lower frequency of plasmids with multiple point mutations compared to the normal line. The spectrum of mutations in pZ189 with the XP-A cells was similar to that with the XP-F cells. Seventy-six to 91% of the single base substitution mutations occurred at G:C base pairs in which the 5{prime}-neighboring base of the cytosine was thymine or cytosine. These studies indicate that the DNA repair defects in Japanese XP patients in complementation groups A and F result in different frequencies of plasmid survival and mutagenesis but in similar types of mutagenic abnormalities despite marked differences in clinical features.« less

  19. Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis.

    PubMed Central

    Winnacker, E L

    1975-01-01

    Isolated nuclei from adenovirus type 2-infected HeLa cells catalyze the incorporation of all four deoxyribonucleoside triphosphates into viral DNA. The observed DNA synthesis occurs via a transient formation of DNA fragments with a sedimentation coefficient of 10S. The fragments are precursors to unit-length viral DNA, they are self-complementary to an extent of at least 70%, and they are distributed along most of the viral chromosome. In addition, accumulation of 10S DNA fragments is observed either in intact, virus-infected HeLa cells under conditions where viral DNA synthesis is inhibited by hydroxyurea or in isolated nuclei from virus-infected HeLa cells at low concentrations of deoxyribonucleotides. Under these suboptimal conditions for DNA synthesis in isolated nuclei, ribonucleoside triphosphates determine the size distribution of DNA intermediates. The evidence presented suggests that a ribonucleoside-dependent initiation step as well at two DNA polymerase catalyzed reactions are involved in the discontinuous replication of adenovirus type 2 DNA. PMID:1117487

  20. Complement research in the 18th-21st centuries: Progress comes with new technology.

    PubMed

    Sim, R B; Schwaeble, W; Fujita, T

    2016-10-01

    The complement system has been studied for about 120 years. Progress in defining this large and complex system has been dependent on the research technologies available, but since the introduction of protein chromatography, electrophoresis, and antibody-based assay methods in the 1950s and 60s, and sequencing of proteins and DNA in the 70s and 80s, there has been very rapid accumulation of data. With more recent improvements in 3D structure determination (nmr and X-ray crystallography), the structures of most of the complement proteins have now been solved. Complement research since 1990 has been greatly stimulated by the discoveries of the multiple proteins in the lectin pathway, the strong association of Factor H, C3, Factor B allelic variants with adult macular degeneration and atypical haemolytic uremic syndrome, and the introduction of the anti-C5 monoclonal antibody as a therapy for paroxysmal nocturnal hemoglobinuria and atypical haemolytic uremic syndrome. Potential new roles for complement in tissue development and the search for novel therapeutics suggest a very active future for complement research. Copyright © 2016 Elsevier GmbH. All rights reserved.

  1. Systemic human CR2-targeted complement alternative pathway inhibitor ameliorates mouse laser-induced choroidal neovascularization.

    PubMed

    Rohrer, Bärbel; Coughlin, Beth; Bandyopadhyay, Mausumi; Holers, V Michael

    2012-08-01

    Genetic associations and the presence of complement components within pathological structures of age-related macular degeneration (AMD) have generated the hypothesis that AMD is caused by chronic local complement activation. Since the majority of activity in the common terminal pathway results from engagement of the amplification loop, the alternative pathway has been proposed as a logical therapeutic target. We recently generated a factor H (fH)-based complement inhibitor (CR2-fH) with the capacity to be "targeted" to sites of complement C3 activation. We asked whether the human therapeutic (TT30) is effective in a mouse model of AMD. Choroidal neovascularization (CNV) was induced by argon laser photocoagulation of Bruch's membrane. Every other day, mice received intravenous injections of TT30 or vehicles, and after 6 days, the presence or absence of CNV and CNV-related changes were evaluated. Area of CNV, photoreceptor cell function, gene expression for complement components and cytokines, vascular endothelial growth factor (VEGF) protein levels, and TT30 bioavailability were determined. CNV development, which has previously been shown to require local complement activation, could be reduced by intravenous TT30 delivery. Specific inhibition of the alternative pathway not only reduced angiogenesis in CNV, but also ameliorated changes in several associated disease-related biomarkers, including diminished retinal function and molecular events known to be involved in AMD such as VEGF production. After intravenous injection, TT30 localized to CNV lesion sites in the retinal pigmented epithelium-choroid. Systemic administration of TT30 was found to reduce CNV pathology. These data may open new avenues for novel systemic AMD treatment strategies.

  2. The role of complement system in septic shock.

    PubMed

    Charchaflieh, Jean; Wei, Jiandong; Labaze, Georges; Hou, Yunfang Joan; Babarsh, Benjamin; Stutz, Helen; Lee, Haekyung; Worah, Samrat; Zhang, Ming

    2012-01-01

    Septic shock is a critical clinical condition with a high mortality rate. A better understanding of the underlying mechanisms is important to develop effective therapies. Basic and clinical studies suggest that activation of complements in the common cascade, for example, complement component 3 (C3) and C5, is involved in the development of septic shock. The involvement of three upstream complement pathways in septic shock is more complicated. Both the classical and alternative pathways appear to be activated in septic shock, but the alternative pathway may be activated earlier than the classical pathway. Activation of these two pathways is essential to clear endotoxin. Recent investigations have shed light on the role of lectin complement pathway in septic shock. Published reports suggest a protective role of mannose-binding lectin (MBL) against sepsis. Our preliminary study of MBL-associated serine protease-2 (MASP-2) in septic shock patients indicated that acute decrease of MASP-2 in the early phase of septic shock might correlate with in-hospital mortality. It is unknown whether excessive activation of these three upstream complement pathways may contribute to the detrimental effects in septic shock. This paper also discusses additional complement-related pathogenic mechanisms and intervention strategies for septic shock.

  3. Non-specific adsorption of complement proteins affects complement activation pathways of gold nanomaterials.

    PubMed

    Quach, Quang Huy; Kah, James Chen Yong

    2017-04-01

    The complement system is a key humoral component of innate immunity, serving as the first line of defense against intruders, including foreign synthetic nanomaterials. Although gold nanomaterials (AuNMs) are widely used in nanomedicine, their immunological response is not well understood. Using AuNMs of three shapes commonly used in biomedical applications: spherical gold nanoparticles, gold nanostars and gold nanorods, we demonstrated that AuNMs activated whole complement system, leading to the formation of SC5b-9 complex. All three complement pathways were simultaneously activated by all the AuNMs. Recognition molecules of the complement system interacted with all AuNMs in vitro, except for l-ficolin, but the correlation between these interactions and corresponding complement pathway activation was only observed in the classical and alternative pathways. We also observed the mediating role of complement activation in cellular uptake of all AuNMs by human U937 promonocytic cells, which expresses complement receptors. Taken together, our results highlighted the potential immunological challenges for clinical applications of AuNMs that were often overlooked.

  4. Thermodynamic Signature of DNA Damage: Characterization of DNA with a 5-Hydroxy-2'-deoxycytidine•2'-Deoxyguanosine Base Pair

    PubMed Central

    Ganguly, Manjori; Szulik, Marta W.; Donahue, Patrick S.; Clancy, Kate; Stone, Michael P.; Gold, Barry

    2012-01-01

    Oxidation of DNA due to exposure to reactive oxygen species is a major source of DNA damage. One of the oxidation lesions formed, 5-hydroxy-2'-deoxycytidine, has been shown to miscode by some replicative DNA polymerases but not by error prone polymerases capable of translesion synthesis. The 5-hydroxy-2'-deoxycytidine lesion is repaired by DNA glycosylases that require the 5-hydroxycytidine base to be extrahelical so it can enter into the enzyme's active site where it is excised off the DNA backbone to afford an abasic site. The thermodynamic and NMR results presented herein, describe the effect of a 5-hydroxy-2'-deoxycytidine•2'-deoxyguanosine base pair on the stability of two different DNA duplexes. The results demonstrate that the lesion is highly destabilizing and that the energy barrier for the unstacking of 5-hydroxy-2'-deoxycytidine from the DNA duplex may be low. This could provide a thermodynamic mode of adduct identification by DNA glycosylases that require the lesion to be extrahelical. PMID:22332945

  5. Complement in autoimmune diseases.

    PubMed

    Vignesh, Pandiarajan; Rawat, Amit; Sharma, Madhubala; Singh, Surjit

    2017-02-01

    The complement system is an ancient and evolutionary conserved element of the innate immune mechanism. It comprises of more than 20 serum proteins most of which are synthesized in the liver. These proteins are synthesized as inactive precursor proteins which are activated by appropriate stimuli. The activated forms of these proteins act as proteases and cleave other components successively in amplification pathways leading to exponential generation of final effectors. Three major pathways of complement pathways have been described, namely the classical, alternative and lectin pathways which are activated by different stimuli. However, all the 3 pathways converge on Complement C3. Cleavage of C3 and C5 successively leads to the production of the membrane attack complex which is final common effector. Excessive and uncontrolled activation of the complement has been implicated in the host of autoimmune diseases. But the complement has also been bemusedly described as the proverbial "double edged sword". On one hand, complement is the final effector of tissue injury in autoimmune diseases and on the other, deficiencies of some components of the complement can result in autoimmune diseases. Currently available tools such as enzyme based immunoassays for functional assessment of complement pathways, flow cytometry, next generation sequencing and proteomics-based approaches provide an exciting opportunity to study this ancient yet mysterious element of innate immunity. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Inviability of a DNA2 deletion mutant is due to the DNA damage checkpoint.

    PubMed

    Budd, Martin E; Antoshechkin, Igor A; Reis, Clara; Wold, Barbara J; Campbell, Judith L

    2011-05-15

    Dna2 is a dual polarity exo/endonuclease, and 5' to 3' DNA helicase involved in Okazaki Fragment Processing (OFP) and Double-Strand Break (DSB) Repair. In yeast, DNA2 is an essential gene, as expected for a DNA replication protein. Suppression of the lethality of dna2Δ mutants has been found to occur by two mechanisms: overexpression of RAD27 (scFEN1) , encoding a 5' to 3' exo/endo nuclease that processes Okazaki fragments (OFs) for ligation, or deletion of PIF1, a 5' to 3' helicase involved in mitochondrial recombination, telomerase inhibition and OFP. Mapping of a novel, spontaneously arising suppressor of dna2Δ now reveals that mutation of rad9 and double mutation of rad9 mrc1 can also suppress the lethality of dna2Δ mutants. Interaction of dna2Δ and DNA damage checkpoint mutations provides insight as to why dna2Δ is lethal but rad27Δ is not, even though evidence shows that Rad27 (ScFEN1) processes most of the Okazaki fragments, while Dna2 processes only a subset.

  7. DNA Probe for Lactobacillus delbrueckii

    PubMed Central

    Delley, Michèle; Mollet, Beat; Hottinger, Herbert

    1990-01-01

    From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognizes L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an α-32P-labeled DNA probe. Images PMID:16348233

  8. Correction of both spontaneous and DEB-induced chromosome instability in Fanconi anemia FA-C cells by FACC cDNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stavropoulos, D.J.; Tomkins, D.J.; Allingham-Hawkins, D.J.

    1994-09-01

    Cells from all four Fanconi anemia complementation groups show hypersensitivity to cell-killing by mitomycin C (MMC), diepoxybutane (DEB) and other DNA cross-linking agents, and increased spontaneous and DEB-induced chromosome aberrations (CA). The extent of these phenotypes varies between lymphoblastoid cell lines from different complementation groups. Our data showed that the difference in MMC hypersensitivity and DEB-CA was not always coupled. While 230N (FA-B) had higher DEB-induced CA/cell than 536N (FA-C) (7.42 vs. 4.46 respectively), that latter was much more sensitive to cell-killing by MMC (dose at 10% survival, D{sub 10}: 5.2 vs. 1.2 ng/ml respectively). Strathdes et al. (1992) clonedmore » a cDNA Fanconi anemia complementation group C (FACC) which complemented the hypersensitivity to MMC and DEB cell-killing of FA-C cells (536N) but not cells from the other three complementation groups. The present study was initiated to determine whether chromosome instability in 536N is also complemented by the FACC (FAC3) cDNA. The pREP4-FAC3 vector was transfected into 536N and transfectants selected with hygromycin B. The DEB D{sub 10} of 536N (1.0 {mu}M) was corrected to the control level (16.2 {mu}M for 3TO) by FACC (15.1 {mu}M for 536N-FACC), as previously demonstrated. Chromosome instability (cab, cse, ctb, cte) was determined without and with 0.1 {mu}g/ml DEB treatment. Spontaneous CA of 536N (0.30 aberrations/cell) was corrected to the control level (0.04 for 3TO) by FACC (0.06 for 536N-FACC). Similarly, the DEB-induced CA was corrected (2.74 for 536N vs. 0.06 and 0.02 for 3TO and 536N-FACC respectively). Thus, at least for FA complementation group C, hypersensitivity to cell-killing and chromosome instability are not dissociated and are most likely caused by the same gene defect.« less

  9. A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons.

    PubMed

    Li, Shu-Jing; Vaughan, Alexander; Sturgill, James Fitzhugh; Kepecs, Adam

    2018-06-06

    Retrogradely transported neurotropic viruses enable genetic access to neurons based on their long-range projections and have become indispensable tools for linking neural connectivity with function. A major limitation of viral techniques is that they rely on cell-type-specific molecules for uptake and transport. Consequently, viruses fail to infect variable subsets of neurons depending on the complement of surface receptors expressed (viral tropism). We report a receptor complementation strategy to overcome this by potentiating neurons for the infection of the virus of interest-in this case, canine adenovirus type-2 (CAV-2). We designed AAV vectors for expressing the coxsackievirus and adenovirus receptor (CAR) throughout candidate projection neurons. CAR expression greatly increased retrograde-labeling rates, which we demonstrate for several long-range projections, including some resistant to other retrograde-labeling techniques. Our results demonstrate a receptor complementation strategy to abrogate endogenous viral tropism and thereby facilitate efficient retrograde targeting for functional analysis of neural circuits. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. New Milestones Ahead in Complement-Targeted Therapy

    PubMed Central

    Ricklin, Daniel; Lambris, John D.

    2017-01-01

    The complement system is a powerful effector arm of innate immunity that typically confers protection from microbial intruders and accumulating debris. In many clinical situations, however, the defensive functions of complement can turn against host cells and induce or exacerbate immune, inflammatory, and degenerative conditions. Although the value of inhibiting complement in a therapeutic context has long been recognized, bringing complement-targeted drugs into clinical use has proved challenging. This important milestone was finally reached a decade ago, yet the clinical availability of complement inhibitors has remained limited. Still, the positive long-term experience with complement drugs and their proven effectiveness in various diseases has reinvigorated interest and confidence in this approach. Indeed, a broad variety of clinical candidates that act at almost any level of the complement activation cascade are currently in clinical development, with several of them being evaluated in phase 2 and phase 3 trials. With antibody-related drugs dominating the panel of clinical candidates, the emergence of novel small-molecule, peptide, protein, and oligonucleotide-based inhibitors offers new options for drug targeting and administration. Whereas all the currently approved and many of the proposed indications for complement-targeted inhibitors belong to the rare disease spectrum, these drugs are increasingly being evaluated for more prevalent conditions. Fortunately, the growing experience from preclinical and clinical use of therapeutic complement inhibitors has enabled a more evidence-based assessment of suitable targets and rewarding indications as well as related technical and safety considerations. This review highlights recent concepts and developments in complement-targeted drug discovery, provides an overview of current and emerging treatment options, and discusses the new milestones ahead on the way to the next generation of clinically available complement

  11. Mirror image DNA nanostructures for chiral supramolecular assemblies.

    PubMed

    Lin, Chenxiang; Ke, Yonggang; Li, Zhe; Wang, James H; Liu, Yan; Yan, Hao

    2009-01-01

    L-DNA, the mirror image of natural D-DNA, can be readily self-assembled into designer discrete or periodic nanostructures. The assembly products are characterized by polyacrylamide gel electrophoresis, circular dichroism spectrum, atomic force microscope, and fluorescence microscope. We found that the use of enantiomer DNA as building material leads to the formation of DNA supramolecules with opposite chirality. Therefore, the L-DNA self-assembly is a substantial complement to the structural DNA nanotechnology. Moreover, the L-DNA architectures feature superior nuclease resistance thus are appealing for in vivo medical applications.

  12. Ultraviolet light-resistant primary transfectants of xeroderma pigmentosum cells are also DNA repair-proficient

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stark, M.; Naiman, T.; Canaani, D.

    1989-08-15

    In a previous work, an immortal xeroderma pigmentosum cell line belonging to complementation group C was complemented to a UV-resistant phenotype by transfection with a human cDNA clone library. We now report that the primary transformants selected for UV-resistance also acquired normal levels of DNA repair. This was assessed both by measurement of UV-induced ({sup 3}H)thymidine incorporation and by equilibrium sedimentation analysis of repair-DNA synthesis. Therefore, the transduced DNA element which confers normal UV-resistance also corrects the excision repair defect of the xeroderma pigmentosum group C cell line.

  13. The Semantics of Complementation in English: A Cognitive Semantic Account of Two English Complement Constructions

    ERIC Educational Resources Information Center

    Smith, Michael B.

    2009-01-01

    Studies on complementation in English and other languages have traditionally focused on syntactic issues, most notably on the constituent structures of different complement types. As a result, they have neglected the role of meaning in the choice of different complements. This paper investigates the semantics of complementation within the…

  14. Detection of Prostate Cancer Progression by Serum DNA Integrity

    DTIC Science & Technology

    2010-04-01

    qRT) Alu and direct qRT LINE1 is being optimized. We will also continue to develop circulating DNA methylated GSTP1 assay to complement the DNA...developed the LINE1 assay, assembled the manuscript on uLINE1, and performed preliminary analysis of circulating DNA GSTP1 methylation. The goal is to

  15. DNA Damage Induced by Alkylating Agents and Repair Pathways

    PubMed Central

    Kondo, Natsuko; Takahashi, Akihisa; Ono, Koji; Ohnishi, Takeo

    2010-01-01

    The cytotoxic effects of alkylating agents are strongly attenuated by cellular DNA repair processes, necessitating a clear understanding of the repair mechanisms. Simple methylating agents form adducts at N- and O-atoms. N-methylations are removed by base excision repair, AlkB homologues, or nucleotide excision repair (NER). O6-methylguanine (MeG), which can eventually become cytotoxic and mutagenic, is repaired by O6-methylguanine-DNA methyltransferase, and O6MeG:T mispairs are recognized by the mismatch repair system (MMR). MMR cannot repair the O6MeG/T mispairs, which eventually lead to double-strand breaks. Bifunctional alkylating agents form interstrand cross-links (ICLs) which are more complex and highly cytotoxic. ICLs are repaired by complex of NER factors (e.g., endnuclease xeroderma pigmentosum complementation group F-excision repair cross-complementing rodent repair deficiency complementation group 1), Fanconi anemia repair, and homologous recombination. A detailed understanding of how cells cope with DNA damage caused by alkylating agents is therefore potentially useful in clinical medicine. PMID:21113301

  16. Implementation of digital image encryption algorithm using logistic function and DNA encoding

    NASA Astrophysics Data System (ADS)

    Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

    2018-03-01

    Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

  17. Calcineurin inhibitor-induced complement system activation via ERK1/2 signalling is inhibited by SOCS-3 in human renal tubule cells.

    PubMed

    Loeschenberger, Beatrix; Niess, Lea; Würzner, Reinhard; Schwelberger, Hubert; Eder, Iris E; Puhr, Martin; Guenther, Julia; Troppmair, Jakob; Rudnicki, Michael; Neuwirt, Hannes

    2018-02-01

    One factor that significantly contributes to renal allograft loss is chronic calcineurin inhibitor (CNI) nephrotoxicity (CIN). Among other factors, the complement (C-) system has been proposed to be involved CIN development. Hence, we investigated the impact of CNIs on intracellular signalling and the effects on the C-system in human renal tubule cells. In a qPCR array, CNI treatment upregulated C-factors and downregulated SOCS-3 and the complement inhibitors CD46 and CD55. Additionally, ERK1/-2 was required for these regulations. Following knock-down and overexpression of SOCS-3, we found that SOCS-3 inhibits ERK1/-2 signalling. Finally, we assessed terminal complement complex formation, cell viability and apoptosis. Terminal complement complex formation was induced by CNIs. Cell viability was significantly decreased, whereas apoptosis was increased. Both effects were reversed under complement component-depleted conditions. In vivo, increased ERK1/-2 phosphorylation and SOCS-3 downregulation were observed at the time of transplantation in renal allograft patients who developed a progressive decline of renal function in the follow-up compared to stable patients. The progressive cohort also had lower total C3 levels, suggesting higher complement activity at baseline. In conclusion, our data suggest that SOCS-3 inhibits CNI-induced ERK1/-2 signalling, thereby blunting the negative control of C-system activation. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  19. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-01-01

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

  20. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hansson, J.; Keyse, S.M.; Lindahl, T.

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurementsmore » of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links.« less

  1. Complement Activation in Inflammatory Skin Diseases

    PubMed Central

    Giang, Jenny; Seelen, Marc A. J.; van Doorn, Martijn B. A.; Rissmann, Robert; Prens, Errol P.; Damman, Jeffrey

    2018-01-01

    The complement system is a fundamental part of the innate immune system, playing a crucial role in host defense against various pathogens, such as bacteria, viruses, and fungi. Activation of complement results in production of several molecules mediating chemotaxis, opsonization, and mast cell degranulation, which can contribute to the elimination of pathogenic organisms and inflammation. Furthermore, the complement system also has regulating properties in inflammatory and immune responses. Complement activity in diseases is rather complex and may involve both aberrant expression of complement and genetic deficiencies of complement components or regulators. The skin represents an active immune organ with complex interactions between cellular components and various mediators. Complement involvement has been associated with several skin diseases, such as psoriasis, lupus erythematosus, cutaneous vasculitis, urticaria, and bullous dermatoses. Several triggers including auto-antibodies and micro-organisms can activate complement, while on the other hand complement deficiencies can contribute to impaired immune complex clearance, leading to disease. This review provides an overview of the role of complement in inflammatory skin diseases and discusses complement factors as potential new targets for therapeutic intervention. PMID:29713318

  2. Characterization of the complement inhibitory function of rhesus rhadinovirus complement control protein (RCP).

    PubMed

    Okroj, Marcin; Mark, Linda; Stokowska, Anna; Wong, Scott W; Rose, Nicola; Blackbourn, David J; Villoutreix, Bruno O; Spiller, O Brad; Blom, Anna M

    2009-01-02

    Rhesus rhadinovirus (RRV) is currently the closest known, fully sequenced homolog of human Kaposi sarcoma-associated herpesvirus. Both these viruses encode complement inhibitors as follows: Kaposi sarcoma-associated herpesvirus-complement control protein (KCP) and RRV-complement control protein (RCP). Previously we characterized in detail the functional properties of KCP as a complement inhibitor. Here, we performed comparative analyses for two variants of RCP protein, encoded by RRV strains H26-95 and 17577. Both RCP variants and KCP inhibited human and rhesus complement when tested in hemolytic assays measuring all steps of activation via the classical and the alternative pathway. RCP variants from both RRV strains supported C3b and C4b degradation by factor I and decay acceleration of the classical C3 convertase, similar to KCP. Additionally, the 17577 RCP variant accelerated decay of the alternative C3 convertase, which was not seen for KCP. In contrast to KCP, RCP showed no affinity to heparin and is the first described complement inhibitor in which the binding site for C3b/C4b does not interact with heparin. Molecular modeling shows a structural disruption in the region of RCP that corresponds to the KCP-heparin-binding site. This makes RRV a superior model for future in vivo investigations of complement evasion, as RCP does not play a supportive role in viral attachment as KCP does.

  3. Emodin regulating excision repair cross-complementation group 1 through fibroblast growth factor receptor 2 signaling

    PubMed Central

    Chen, Gang; Qiu, Hong; Ke, Shan-Dong; Hu, Shao-Ming; Yu, Shi-Ying; Zou, Sheng-Quan

    2013-01-01

    AIM: To investigate the molecular mechanisms underlying the reversal effect of emodin on platinum resistance in hepatocellular carcinoma. METHODS: After the addition of 10 μmol/L emodin to HepG2/oxaliplatin (OXA) cells, the inhibition rate (IR), 50% inhibitory concentration (IC50) and reversal index (IC50 in experimental group/IC50 in control group) were calculated. For HepG2, HepG2/OXA, HepG2/OXA/T, each cell line was divided into a control group, OXA group, OXA + fibroblast growth factor 7 (FGF7) group and OXA + emodin group, and the final concentrations of FGF7, emodin and OXA in each group were 5 ng/mL, 10 μg/mL and 10 μmol/L, respectively. Single-cell gel electrophoresis was conducted to detect DNA damage, and the fibroblast growth factor receptor 2 (FGFR2), phosphorylated extracellular signal-regulated kinase 1/2 (p-ERK1/2) and excision repair cross-complementing gene 1 (ERCC1) protein expression levels in each group were examined by Western blotting. RESULTS: Compared with the IC50 of 120.78 μmol/L in HepG2/OXA cells, the IC50 decreased to 39.65 μmol/L after treatment with 10 μmol/L emodin; thus, the reversal index was 3.05. Compared with the control group, the tail length and Olive tail length in the OXA group, OXA + FGF7 group and OXA + emodin group were significantly increased, and the differences were statistically significant (P < 0.01). The tail length and Olive tail length were lower in the OXA + FGF7 group than in the OXA group, and this difference was also statistically significant. Compared with the OXA + FGF7 group, the tail extent, the Olive tail moment and the percentage of tail DNA were significantly increased in the OXA + emodin group, and these differences were statistically significant (P < 0.01). In comparison with its parental cell line HepG2, the HepG2/OXA cells demonstrated significantly increased FGFR2, p-ERK1/2 and ERCC1 expression levels, whereas the expression of all three molecules was significantly inhibited in HepG2/OXA

  4. Complement component 3: characterization and association with mastitis resistance in Egyptian water buffalo and cattle.

    PubMed

    El-Halawany, Nermin; Abd-El-Monsif, Shawky A; Al-Tohamy Ahmed, F M; Hegazy, Lamees; Abdel-Shafy, Hamdy; Abdel-Latif, Magdy A; Ghazi, Yasser A; Neuhoff, Christiane; Salilew-Wondim, Dessie; Schellander, Karl

    2017-03-01

    Mastitis is an infectious disease of the mammary gland that leads to reduced milk production and change in milk composition. Complement component C3 plays a major role as a central molecule of the complement cascade involving in killing of microorganisms, either directly or in cooperation with phagocytic cells. C3 cDNA were isolated, from Egyptian buffalo and cattle, sequenced and characterized. The C3 cDNA sequences of buffalo and cattle consist of 5025 and 5019 bp, respectively. Buffalo and cattle C3 cDNAs share 99% of sequence identity with each other. The 4986 bp open reading frame in buffalo encodes a putative protein of 1661 amino acids-as in cattle-and includes all the functional domains. Further, analysis of the C3 cDNA sequences detected six novel single-nucleotide polymorphisms (SNPs) in buffalo and three novel SNPs in cattle. The association analysis of the detected SNPs with milk somatic cell score as an indicator of mastitis revealed that the most significant association in buffalo was found in the C>A substitution (ss: 1752816097) in exon 27, whereas in cattle it was in the C>T substitution (ss: 1752816085) in exon 12. Our findings provide preliminary information about the contribution of C3 polymorphisms to mastitis resistance in buffalo and cattle.

  5. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes

    DTIC Science & Technology

    2007-10-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  6. The renaissance of complement therapeutics

    PubMed Central

    Ricklin, Daniel; Mastellos, Dimitrios C.; Reis, Edimara S.; Lambris, John D.

    2018-01-01

    The increasing number of clinical conditions that involve a pathological contribution from the complement system — many of which affect the kidneys — has spurred a regained interest in therapeutic options to modulate this host defence pathway. Molecular insight, technological advances, and the first decade of clinical experience with the complement-specific drug eculizumab, have contributed to a growing confidence in therapeutic complement inhibition. More than 20 candidate drugs that target various stages of the complement cascade are currently being evaluated in clinical trials, and additional agents are in preclinical development. Such diversity is clearly needed in view of the complex and distinct involvement of complement in a wide range of clinical conditions, including rare kidney disorders, transplant rejection and haemodialysis-induced inflammation. The existing drugs cannot be applied to all complement-driven diseases, and each indication has to be assessed individually. Alongside considerations concerning optimal points of intervention and economic factors, patient stratification will become essential to identify the best complement-specific therapy for each individual patient. This Review provides an overview of the therapeutic concepts, targets and candidate drugs, summarizes insights from clinical trials, and reflects on existing challenges for the development of complement therapeutics for kidney diseases and beyond. PMID:29199277

  7. Chimeras of human complement C9 reveal the site recognized by complement regulatory protein CD59.

    PubMed

    Hüsler, T; Lockert, D H; Kaufman, K M; Sodetz, J M; Sims, P J

    1995-02-24

    CD59 antigen is a membrane glycoprotein that inhibits the activity of the C9 component of the C5b-9 membrane attack complex, thereby protecting human cells from lysis by human complement. The complement-inhibitory activity of CD59 is species-selective and is most effective toward C9 derived from human or other primate plasma. By contrast, rabbit C9, which can substitute for human C9 in the membrane attack complex, mediates unrestricted lysis of human cells. To identify the peptide segment of human C9 that is recognized by CD59, rabbit C9 cDNA clones were isolated, characterized, and used to construct hybrid cDNAs for expression of full-length human/rabbit C9 chimeras in COS-7 cells. All resulting chimeras were hemolytically active, when tested against chicken erythrocytes bearing C5b-8 complexes. Assays performed in the presence or absence of CD59 revealed that this inhibitor reduced the hemolytic activity of those chimeras containing human C9 sequence between residues 334-415, irrespective of whether the remainder of the protein contained human or rabbit sequence. By contrast, when this segment of C9 contained rabbit sequence, lytic activity was unaffected by CD59. These data establish that human C9 residues 334-415 contain the site recognized by CD59, and they suggest that sequence variability within this segment of C9 is responsible for the observed species-selective inhibitory activity of CD59.

  8. C1q-Mediated Complement Activation and C3 Opsonization Trigger Recognition of Stealth Poly(2-methyl-2-oxazoline)-Coated Silica Nanoparticles by Human Phagocytes.

    PubMed

    Tavano, Regina; Gabrielli, Luca; Lubian, Elisa; Fedeli, Chiara; Visentin, Silvia; Polverino De Laureto, Patrizia; Arrigoni, Giorgio; Geffner-Smith, Alessandra; Chen, Fangfang; Simberg, Dmitri; Morgese, Giulia; Benetti, Edmondo M; Wu, Linping; Moghimi, Seyed Moein; Mancin, Fabrizio; Papini, Emanuele

    2018-05-23

    Poly(2-methyl-2-oxazoline) (PMOXA) is an alternative promising polymer to poly(ethylene glycol) (PEG) for design and engineering of macrophage-evading nanoparticles (NPs). Although PMOXA-engineered NPs have shown comparable pharmacokinetics and in vivo performance to PEGylated stealth NPs in the murine model, its interaction with elements of the human innate immune system has not been studied. From a translational angle, we studied the interaction of fully characterized PMOXA-coated vinyltriethoxysilane-derived organically modified silica NPs (PMOXA-coated NPs) of approximately 100 nm in diameter with human complement system, blood leukocytes, and macrophages and compared their performance with PEGylated and uncoated NP counterparts. Through detailed immunological and proteomic profiling, we show that PMOXA-coated NPs extensively trigger complement activation in human sera exclusively through the classical pathway. Complement activation is initiated by the sensing molecule C1q, where C1q binds with high affinity ( K d = 11 ± 1 nM) to NP surfaces independent of immunoglobulin binding. C1q-mediated complement activation accelerates PMOXA opsonization with the third complement protein (C3) through the amplification loop of the alternative pathway. This promoted NP recognition by human blood leukocytes and monocyte-derived macrophages. The macrophage capture of PMOXA-coated NPs correlates with sera donor variability in complement activation and opsonization but not with other major corona proteins, including clusterin and a wide range of apolipoproteins. In contrast to these observations, PMOXA-coated NPs poorly activated the murine complement system and were marginally recognized by mouse macrophages. These studies provide important insights into compatibility of engineered NPs with elements of the human innate immune system for translational steps.

  9. Complementation of a Fanconi anemia group A cell line by UbA{sup 52}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, R.E.; Heina, J.A.; Jakobs, P.M.

    1994-09-01

    Cells from patients with Fanconi anemia (FA) display chromosomal instability and increased sensitivity to mitomycin C (MMC) and diepoxybutane (DEB) relative to normal cells. Several genes act in this pathway of DNA damage processing based upon four known complementation groups in FA. We have made a cDNA expression library in a vector with a G418 selectable marker to identify FA genes other than the FA-C group. Approximately 1 x 10{sup 6} independent cDNA clones were isolated with an average cDNA size of 1.5 kb. Five cell lines resistant to MMC and DEB were isolated from 6 x 10{sup 6} G418-resistantmore » transfectants from 65 individual transfections of the FA-A fibroblast line GM6914. The isolated cell lines also showed normal chromosome stability. The same cDNA (600 bp) was recovered from three independent cell lines by PCR using flanking sequence primers. The gene has sequence identity with a known gene, the ubiquitin fusion gene, UbA{sub 52}. Interestingly, each of the cDNAs were inserted in antisense orientation relative to the cytomegalovirus (CMV) promoter as determined by sequencing and PCR using UbA{sub 52}-specific internal primers. Southern blot analysis indicated the cell lines had distinct chromosomal insertion sites. Mutation analysis by chemical cleavage showed no reading frame mutations, indicating that UbA{sub 52} is not the FA-A gene. Re-transfection with the UbA{sub 52} gene in antisense gave complementation for MMC, DEB and chromosome stability to varying degrees. Re-transfection of the antisense construct with the CMV promotor removed or with a sense construct did not alter the MMC sensitivity. We conclude that the antisense UbA{sub 52} gene has a non-specific effect, perhaps acting by altering the cell cycle or susceptibility to apoptosis.« less

  10. Complement component 3 (C3)

    MedlinePlus

    ... of a certain protein. This protein is part of the complement system. The complement system is a group of proteins ... system and play a role in the development of inflammation. The complement system protects the body from infections, dead cells and ...

  11. Variants in Complement Factor H and Complement Factor H-Related Protein Genes, CFHR3 and CFHR1, Affect Complement Activation in IgA Nephropathy.

    PubMed

    Zhu, Li; Zhai, Ya-Ling; Wang, Feng-Mei; Hou, Ping; Lv, Ji-Cheng; Xu, Da-Min; Shi, Su-Fang; Liu, Li-Jun; Yu, Feng; Zhao, Ming-Hui; Novak, Jan; Gharavi, Ali G; Zhang, Hong

    2015-05-01

    Complement activation is common in patients with IgA nephropathy (IgAN) and associated with disease severity. Our recent genome-wide association study of IgAN identified susceptibility loci on 1q32 containing the complement regulatory protein-encoding genes CFH and CFHR1-5, with rs6677604 in CFH as the top single-nucleotide polymorphism and CFHR3-1 deletion (CFHR3-1∆) as the top signal for copy number variation. In this study, to explore the clinical effects of variation in CFH, CFHR3, and CFHR1 on IgAN susceptibility and progression, we enrolled two populations. Group 1 included 1178 subjects with IgAN and available genome-wide association study data. Group 2 included 365 subjects with IgAN and available clinical follow-up data. In group 1, rs6677604 was associated with mesangial C3 deposition by genotype-phenotype correlation analysis. In group 2, we detected a linkage between the rs6677604-A allele and CFHR3-1∆ and found that the rs6677604-A allele was associated with higher serum levels of CFH and lower levels of the complement activation split product C3a. Furthermore, CFH levels were positively associated with circulating C3 levels and negatively associated with mesangial C3 deposition. Moreover, serum levels of the pathogenic galactose-deficient glycoform of IgA1 were also associated with the degree of mesangial C3 deposition in patients with IgAN. Our findings suggest that genetic variants in CFH, CFHR3, and CFHR1 affect complement activation and thereby, predispose patients to develop IgAN. Copyright © 2015 by the American Society of Nephrology.

  12. Complement system biomarkers in epilepsy.

    PubMed

    Kopczynska, Maja; Zelek, Wioleta M; Vespa, Simone; Touchard, Samuel; Wardle, Mark; Loveless, Samantha; Thomas, Rhys H; Hamandi, Khalid; Morgan, B Paul

    2018-05-24

    To explore whether complement dysregulation occurs in a routinely recruited clinical cohort of epilepsy patients, and whether complement biomarkers have potential to be used as markers of disease severity and seizure control. Plasma samples from 157 epilepsy cases (106 with focal seizures, 46 generalised seizures, 5 unclassified) and 54 controls were analysed. Concentrations of 10 complement analytes (C1q, C3, C4, factor B [FB], terminal complement complex [TCC], iC3b, factor H [FH], Clusterin [Clu], Properdin, C1 Inhibitor [C1Inh] plus C-reactive protein [CRP]) were measured using enzyme linked immunosorbent assay (ELISA). Univariate and multivariate statistical analysis were used to test whether combinations of complement analytes were predictive of epilepsy diagnoses and seizure occurrence. Correlation between number and type of anti-epileptic drugs (AED) and complement analytes was also performed. We found: CONCLUSION: This study adds to evidence implicating complement in pathogenesis of epilepsy and may allow the development of better therapeutics and prognostic markers in the future. Replication in a larger sample set is needed to validate the findings of the study. Copyright © 2018. Published by Elsevier Ltd.

  13. Age-related macular degeneration and modification of systemic complement factor H production through liver transplantation.

    PubMed

    Khandhadia, Samir; Hakobyan, Svetlana; Heng, Ling Z; Gibson, Jane; Adams, David H; Alexander, Graeme J; Gibson, Jonathan M; Martin, Keith R; Menon, Geeta; Nash, Kathryn; Sivaprasad, Sobha; Ennis, Sarah; Cree, Angela J; Morgan, B Paul; Lotery, Andrew J

    2013-08-01

    To investigate whether modification of liver complement factor H (CFH) production, by alteration of liver CFH Y402H genotype through liver transplantation (LT), influences the development of age-related macular degeneration (AMD). Multicenter, cross-sectional study. We recruited 223 Western European patients ≥ 55 years old who had undergone LT ≥ 5 years previously. We determined AMD status using a standard grading system. Recipient CFH Y402H genotype was obtained from DNA extracted from recipient blood samples. Donor CFH Y402H genotype was inferred from recipient plasma CFH Y402H protein allotype, measured using enzyme-linked immunosorbent assays. This approach was verified by genotyping donor tissue from a subgroup of patients. Systemic complement activity was ascertained by measuring levels of plasma complement proteins using an enzyme-linked immunosorbent assay, including substrates (C3, C4), activation products (C3a, C4a, and terminal complement complex), and regulators (total CFH, C1 inhibitor). We evaluated AMD status and recipient and donor CFH Y402H genotype. In LT patients, AMD was associated with recipient CFH Y402H genotype (P = 0.036; odds ratio [OR], 1.6; 95% confidence interval [CI], 1.0-2.4) but not with donor CFH Y402H genotype (P = 0.626), after controlling for age, sex, smoking status, and body mass index. Recipient plasma CFH Y402H protein allotype predicted donor CFH Y402H genotype with 100% accuracy (n = 49). Plasma complement protein or activation product levels were similar in LT patients with and without AMD. Compared with previously reported prevalence figures (Rotterdam Study), LT patients demonstrated a high prevalence of both AMD (64.6% vs 37.1%; OR, 3.09; P<0.001) and the CFH Y402H sequence variation (41.9% vs 36.2%; OR, 1.27; P = 0.014). Presence of AMD is not associated with modification of hepatic CFH production. In addition, AMD is not associated with systemic complement activity in LT patients. These findings suggest that local

  14. DNA probe for lactobacillus delbrueckii

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delley, M.; Mollet, B.; Hottinger, H.

    1990-06-01

    From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognized L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an {alpha}-{sup 32}P-labeled probe.

  15. Variola virus immune evasion design: expression of a highly efficient inhibitor of human complement.

    PubMed

    Rosengard, Ariella M; Liu, Yu; Nie, Zhiping; Jimenez, Robert

    2002-06-25

    Variola virus, the most virulent member of the genus Orthopoxvirus, specifically infects humans and has no other animal reservoir. Variola causes the contagious disease smallpox, which has a 30-40% mortality rate. Conversely, the prototype orthopoxvirus, vaccinia, causes no disease in immunocompetent humans and was used in the global eradication of smallpox, which ended in 1977. However, the threat of smallpox persists because clandestine stockpiles of variola still exist. Although variola and vaccinia share remarkable DNA homology, the strict human tropism of variola suggests that its proteins are better suited than those of vaccinia to overcome the human immune response. Here, we demonstrate the functional advantage of a variola complement regulatory protein over that of its vaccinia homologue. Because authentic variola proteins are not available for study, we molecularly engineered and characterized the smallpox inhibitor of complement enzymes (SPICE), a homologue of a vaccinia virulence factor, vaccinia virus complement control protein (VCP). SPICE is nearly 100-fold more potent than VCP at inactivating human C3b and 6-fold more potent at inactivating C4b. SPICE is also more human complement-specific than is VCP. By inactivating complement components, SPICE serves to inhibit the formation of the C3/C5 convertases necessary for complement-mediated viral clearance. SPICE provides the first evidence that variola proteins are particularly adept at overcoming human immunity, and the decreased function of VCP suggests one reason why the vaccinia virus vaccine was associated with relatively low mortality. Disabling SPICE may be therapeutically useful if smallpox reemerges.

  16. Variola virus immune evasion design: Expression of a highly efficient inhibitor of human complement

    PubMed Central

    Rosengard, Ariella M.; Liu, Yu; Nie, Zhiping; Jimenez, Robert

    2002-01-01

    Variola virus, the most virulent member of the genus Orthopoxvirus, specifically infects humans and has no other animal reservoir. Variola causes the contagious disease smallpox, which has a 30–40% mortality rate. Conversely, the prototype orthopoxvirus, vaccinia, causes no disease in immunocompetent humans and was used in the global eradication of smallpox, which ended in 1977. However, the threat of smallpox persists because clandestine stockpiles of variola still exist. Although variola and vaccinia share remarkable DNA homology, the strict human tropism of variola suggests that its proteins are better suited than those of vaccinia to overcome the human immune response. Here, we demonstrate the functional advantage of a variola complement regulatory protein over that of its vaccinia homologue. Because authentic variola proteins are not available for study, we molecularly engineered and characterized the smallpox inhibitor of complement enzymes (SPICE), a homologue of a vaccinia virulence factor, vaccinia virus complement control protein (VCP). SPICE is nearly 100-fold more potent than VCP at inactivating human C3b and 6-fold more potent at inactivating C4b. SPICE is also more human complement-specific than is VCP. By inactivating complement components, SPICE serves to inhibit the formation of the C3/C5 convertases necessary for complement-mediated viral clearance. SPICE provides the first evidence that variola proteins are particularly adept at overcoming human immunity, and the decreased function of VCP suggests one reason why the vaccinia virus vaccine was associated with relatively low mortality. Disabling SPICE may be therapeutically useful if smallpox reemerges. PMID:12034872

  17. Enhanced susceptibility to acute pneumococcal otitis media in mice deficient in complement C1qa, factor B, and factor B/C2.

    PubMed

    Tong, Hua Hua; Li, Yong Xing; Stahl, Gregory L; Thurman, Joshua M

    2010-03-01

    To define the roles of specific complement activation pathways in host defense against Streptococcus pneumoniae in acute otitis media (AOM), we investigated the susceptibility to AOM in mice deficient in complement factor B and C2 (Bf/C2(-/)(-)), C1qa (C1qa(-/)(-)), and factor B (Bf(-)(/)(-)). Bacterial titers of both S. pneumoniae serotype 6A and 14 in the middle ear lavage fluid samples from Bf/C2(-/)(-), Bf(-)(/)(-), and C1qa(-/)(-) mice were significantly higher than in samples from wild-type mice 24 h after transtympanical infection (P < 0.05) and remained persistently higher in samples from Bf/C2(-/)(-) mice than in samples from wild-type mice. Bacteremia occurred in Bf/C2(-/)(-), Bf(-)(/)(-), and C1qa(-/)(-) mice infected with both strains, but not in wild-type mice. Recruitment of inflammatory cells was paralleled by enhanced production of inflammatory mediators in the middle ear lavage samples from Bf/C2(-/)(-) mice. C3b deposition on both strains was greatest for sera obtained from wild-type mice, followed by C1qa(-)(/)(-) and Bf(-)(/)(-) mice, and least for Bf/C2(-)(/)(-) mice. Opsonophagocytosis and whole-blood killing capacity of both strains were significantly decreased in the presence of sera or whole blood from complement-deficient mice compared to wild-type mice. These findings indicate that both the classical and alternative complement pathways are critical for middle ear immune defense against S. pneumoniae. The reduced capacity of complement-mediated opsonization and phagocytosis in the complement-deficient mice appears to be responsible for the impaired clearance of S. pneumoniae from the middle ear and dissemination to the bloodstream during AOM.

  18. Human DNA2 possesses a cryptic DNA unwinding activity that functionally integrates with BLM or WRN helicases

    PubMed Central

    Pinto, Cosimo; Kasaciunaite, Kristina; Seidel, Ralf; Cejka, Petr

    2016-01-01

    Human DNA2 (hDNA2) contains both a helicase and a nuclease domain within the same polypeptide. The nuclease of hDNA2 is involved in a variety of DNA metabolic processes. Little is known about the role of the hDNA2 helicase. Using bulk and single-molecule approaches, we show that hDNA2 is a processive helicase capable of unwinding kilobases of dsDNA in length. The nuclease activity prevents the engagement of the helicase by competing for the same substrate, hence prominent DNA unwinding by hDNA2 alone can only be observed using the nuclease-deficient variant. We show that the helicase of hDNA2 functionally integrates with BLM or WRN helicases to promote dsDNA degradation by forming a heterodimeric molecular machine. This collectively suggests that the hDNA2 motor promotes the enzyme's capacity to degrade dsDNA in conjunction with BLM or WRN and thus promote the repair of broken DNA. DOI: http://dx.doi.org/10.7554/eLife.18574.001 PMID:27612385

  19. Factor H: A Complement Regulator in Health and Disease, and a Mediator of Cellular Interactions

    PubMed Central

    Kopp, Anne; Hebecker, Mario; Svobodová, Eliška; Józsi, Mihály

    2012-01-01

    Complement is an essential part of innate immunity as it participates in host defense against infections, disposal of cellular debris and apoptotic cells, inflammatory processes and modulation of adaptive immune responses. Several soluble and membrane-bound regulators protect the host from the potentially deleterious effects of uncontrolled and misdirected complement activation. Factor H is a major soluble regulator of the alternative complement pathway, but it can also bind to host cells and tissues, protecting them from complement attack. Interactions of factor H with various endogenous ligands, such as pentraxins, extracellular matrix proteins and DNA are important in limiting local complement-mediated inflammation. Impaired regulatory as well as ligand and cell recognition functions of factor H, caused by mutations or autoantibodies, are associated with the kidney diseases: atypical hemolytic uremic syndrome and dense deposit disease and the eye disorder: age-related macular degeneration. In addition, factor H binds to receptors on host cells and is involved in adhesion, phagocytosis and modulation of cell activation. In this review we discuss current concepts on the physiological and pathophysiological roles of factor H in light of new data and recent developments in our understanding of the versatile roles of factor H as an inhibitor of complement activation and inflammation, as well as a mediator of cellular interactions. A detailed knowledge of the functions of factor H in health and disease is expected to unravel novel therapeutic intervention possibilities and to facilitate the development or improvement of therapies. PMID:24970127

  20. Structure-function analysis of rotavirus NSP2 octamer by using a novel complementation system.

    PubMed

    Taraporewala, Zenobia F; Jiang, Xiaofang; Vasquez-Del Carpio, Rodrigo; Jayaram, Hariharan; Prasad, B V Venkataram; Patton, John T

    2006-08-01

    Viral inclusion bodies, or viroplasms, that form in rotavirus-infected cells direct replication and packaging of the segmented double-stranded RNA (dsRNA) genome. NSP2, one of two rotavirus proteins needed for viroplasm assembly, possesses NTPase, RNA-binding, and helix-unwinding activities. NSP2 of the rotavirus group causing endemic infantile diarrhea (group A) was shown to self-assemble into large doughnut-shaped octamers with circumferential grooves and deep clefts containing nucleotide-binding histidine triad (HIT)-like motifs. Here, we demonstrate that NSP2 of group C rotavirus, a group that fails to reassort with group A viruses, retains the unique architecture of the group A octamer but differs in surface charge distribution. By using an NSP2-dependent complementation system, we show that the HIT-dependent NTPase activity of NSP2 is necessary for dsRNA synthesis, but not for viroplasm formation. The complementation system also showed that despite the retention of the octamer structure and the HIT-like fold, group C NSP2 failed to rescue replication and viroplasm formation in NSP2-deficient cells infected with group A rotavirus. The distinct differences in the surface charges on the Bristol and SA11 NSP2 octamers suggest that charge complementarity of the viroplasm-forming proteins guides the specificity of viroplasm formation and, possibly, reassortment restriction between rotavirus groups.

  1. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)

    DTIC Science & Technology

    2007-01-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  2. Cloning and characterization of the Drosophila homolog of the xeroderma pigmentosum complementation-group B correcting gene, ERCC3.

    PubMed Central

    Koken, M H; Vreeken, C; Bol, S A; Cheng, N C; Jaspers-Dekker, I; Hoeijmakers, J H; Eeken, J C; Weeda, G; Pastink, A

    1992-01-01

    Previously the human nucleotide excision repair gene ERCC3 was shown to be responsible for a rare combination of the autosomal recessive DNA repair disorders xeroderma pigmentosum (complementation group B) and Cockayne's syndrome (complementation group C). The human and mouse ERCC3 proteins contain several sequence motifs suggesting that it is a nucleic acid or chromatin binding helicase. To study the significance of these domains and the overall evolutionary conservation of the gene, the homolog from Drosophila melanogaster was isolated by low stringency hybridizations using two flanking probes of the human ERCC3 cDNA. The flanking probe strategy selects for long stretches of nucleotide sequence homology, and avoids isolation of small regions with fortuitous homology. In situ hybridization localized the gene onto chromosome III 67E3/4, a region devoid of known D.melanogaster mutagen sensitive mutants. Northern blot analysis showed that the gene is continuously expressed in all stages of fly development. A slight increase (2-3 times) of ERCC3Dm transcript was observed in the later stages. Two almost full length cDNAs were isolated, which have different 5' untranslated regions (UTR). The SD4 cDNA harbours only one long open reading frame (ORF) coding for ERCC3Dm. Another clone (SD2), however, has the potential to encode two proteins: a 170 amino acids polypeptide starting at the optimal first ATG has no detectable homology with any other proteins currently in the data bases, and another ORF beginning at the suboptimal second startcodon which is identical to that of SD4. Comparison of the encoded ERCC3Dm protein with the homologous proteins of mouse and man shows a strong amino acid conservation (71% identity), especially in the postulated DNA binding region and seven 'helicase' domains. The ERCC3Dm sequence is fully consistent with the presumed functions and the high conservation of these regions strengthens their functional significance. Microinjection and DNA

  3. FF483–484 motif of human Polη mediates its interaction with the POLD2 subunit of Polδ and contributes to DNA damage tolerance

    PubMed Central

    Baldeck, Nadège; Janel-Bintz, Régine; Wagner, Jérome; Tissier, Agnès; Fuchs, Robert P.; Burkovics, Peter; Haracska, Lajos; Despras, Emmanuelle; Bichara, Marc; Chatton, Bruno; Cordonnier, Agnès M.

    2015-01-01

    Switching between replicative and translesion synthesis (TLS) DNA polymerases are crucial events for the completion of genomic DNA synthesis when the replication machinery encounters lesions in the DNA template. In eukaryotes, the translesional DNA polymerase η (Polη) plays a central role for accurate bypass of cyclobutane pyrimidine dimers, the predominant DNA lesions induced by ultraviolet irradiation. Polη deficiency is responsible for a variant form of the Xeroderma pigmentosum (XPV) syndrome, characterized by a predisposition to skin cancer. Here, we show that the FF483–484 amino acids in the human Polη (designated F1 motif) are necessary for the interaction of this TLS polymerase with POLD2, the B subunit of the replicative DNA polymerase δ, both in vitro and in vivo. Mutating this motif impairs Polη function in the bypass of both an N-2-acetylaminofluorene adduct and a TT-CPD lesion in cellular extracts. By complementing XPV cells with different forms of Polη, we show that the F1 motif contributes to the progression of DNA synthesis and to the cell survival after UV irradiation. We propose that the integrity of the F1 motif of Polη, necessary for the Polη/POLD2 interaction, is required for the establishment of an efficient TLS complex. PMID:25662213

  4. Protein domains connect cell cycle stimulation directly to initiation of DNA replication.

    PubMed Central

    Gjørup, O V; Rose, P E; Holman, P S; Bockus, B J; Schaffhausen, B S

    1994-01-01

    Polyoma large T antigen (LT) is the only viral gene product required for viral DNA replication. LT can be divided into two domains, one N-terminal (NT) spanning residues 1-260 and one C-terminal (CT) comprising approximately residues 264-785. NT is known to immortalize primary cells in a manner dependent on binding of pRB/p107. Here a CT construct comprising residues 264-785 was shown to have independent function in DNA replication. CT is entirely sufficient for driving viral DNA replication in vivo in growing mouse cells at a level approaching that of full-length LT. In contrast, CT is strikingly deficient for replication in serum-starved cells. However, this deficiency can be complemented by coexpression of NT. BrdUrd incorporation in transfected, starved cells showed that NT was sufficient for inducing S phase, suggesting a mechanism for complementation. By contrast, CT was unable to induce S phase when tested in the same assay. NT also promotes phosphorylation of sites in CT that are likely to be important for replication. Other DNA tumor virus gene products such as adenovirus E1A 12S and human papillomavirus 16 E7 could also complement CT for replication. Although NT, E1A 12S, and E7 all bind the retinoblastoma gene product (pRB) and p107, genetic analysis demonstrates an additional function, independent of that binding, is responsible for complementation. Images PMID:7991595

  5. Dimeric, trimeric and tetrameric complexes of immunoglobulin G fix complement.

    PubMed Central

    Wright, J K; Tschopp, J; Jaton, J C; Engel, J

    1980-01-01

    The binding of pure dimers, trimers and tetramers of randomly cross-linked non-immune rabbit immunoglobulin G to the first component and subcomponent of the complement system, C1 and C1q respectively, was studied. These oligomers possessed open linear structures. All three oligomers fixed complement with decreasing affinity in the order: tetramer, trimer, dimer. Complement fixation by dimeric immunoglobulin exhibited the strongest concentration-dependence. No clear distinction between a non-co-operative and a co-operative binding mechanism could be achieved, although the steepness of the complement-fixation curves for dimers and trimers was better reflected by the co-operative mechanism. Intrinsic binding constants were about 10(6)M-1 for dimers, 10(7)M-1 for trimers and 3 X 10(9)M-1 for tetramers, assuming non-co-operative binding. The data are consistent with a maximum valency of complement component C1 for immunoglobulin G protomers in the range 6-18. The binding of dimers to purified complement subcomponent C1q was demonstrated by sedimentation-velocity ultracentrifugation. Mild reduction of the complexes by dithioerythritol caused the immunoglobulin to revert to the monomeric state (S20,w = 6.2-6.5S) with concomitant loss of complement-fixing ability. Images Fig. 2. PMID:6985362

  6. Elevated Properdin and Enhanced Complement Activation in First-Degree Relatives of South Asian Subjects With Type 2 Diabetes

    PubMed Central

    Somani, Riyaz; Richardson, Victoria R.; Standeven, Kristina F.; Grant, Peter J.; Carter, Angela M.

    2012-01-01

    OBJECTIVE Emerging data implicate activation of the complement cascade in the pathogenesis of type 2 diabetes. The objective of the current study was to evaluate the relationships between components of the complement system, metabolic risk factors, and family history of type 2 diabetes in healthy South Asians. RESEARCH DESIGN AND METHODS We recruited 119 healthy, first-degree relatives of South Asian subjects with type 2 diabetes (SARs) and 119 age- and sex-matched, healthy South Asian control subjects (SACs). Fasting blood samples were taken for measurement of complement factors and standard metabolic risk factors. RESULTS SARs were characterized by significantly higher properdin (mean concentration 12.6 [95% CI 12.2–13.1] mg/L vs. SACs 10.1 [9.7–10.5] mg/L, P < 0.0001), factor B (187.4 [180.1–195.0] mg/L vs. SACs 165.0 [158.0–172.2] mg/L, P < 0.0001), and SC5b-9 (92.0 [86.1–98.3] ng/mL vs. SACs 75.3 [71.9–78.9] ng/mL, P < 0.0001) and increased homeostasis model assessment of insulin resistance (2.86 [2.61–3.13] vs. SACs 2.31 [2.05–2.61], P = 0.007). C-reactive protein did not differ between SARs and SACs (P = 0.17). In subgroup analysis of 25 SARs and 25 SACs with normal oral glucose tolerance tests, properdin, factor B, and SC5b-9 remained significantly elevated in SARs. CONCLUSIONS Increased properdin and complement activation are associated with a family history of type 2 diabetes in South Asians independent of insulin resistance, and predate the development of impaired fasting glucose and impaired glucose tolerance. Properdin and SC5b-9 may be novel biomarkers for future risk of type 2 diabetes in this high-risk population and warrant further investigation. PMID:22338105

  7. Proliferating Cell Nuclear Antigen-dependent Rapid Recruitment of Cdt1 and CRL4Cdt2 at DNA-damaged Sites after UV Irradiation in HeLa Cells*

    PubMed Central

    Ishii, Takashi; Shiomi, Yasushi; Takami, Toshihiro; Murakami, Yusuke; Ohnishi, Naho; Nishitani, Hideo

    2010-01-01

    The licensing factor Cdt1 is degraded by CRL4Cdt2 ubiquitin ligase dependent on proliferating cell nuclear antigen (PCNA) during S phase and when DNA damage is induced in G1 phase. Association of both Cdt2 and PCNA with chromatin was observed in S phase and after UV irradiation. Here we used a micropore UV irradiation assay to examine Cdt2 accumulation at cyclobutane pyrimidine dimer-containing DNA-damaged sites in the process of Cdt1 degradation in HeLa cells. Cdt2, present in the nucleus throughout the cell cycle, accumulated rapidly at damaged DNA sites during G1 phase. The recruitment of Cdt2 is dependent on prior PCNA chromatin binding because Cdt2 association was prevented when PCNA was silenced. Cdt1 was also recruited to damaged sites soon after UV irradiation through its PIP-box. As Cdt1 was degraded, the Cdt2 signal at damaged sites was reduced, but PCNA, cyclobutane pyrimidine dimer, and XPA (xeroderma pigmentosum, complementation group A) signals remained at the same levels. These findings suggest that Cdt1 degradation following UV irradiation occurs rapidly at damaged sites due to PCNA chromatin loading and the recruitment of Cdt1 and CRL4Cdt2, before DNA damage repair is completed. PMID:20929861

  8. Complement Inhibition Alleviates Paraquat-Induced Acute Lung Injury

    PubMed Central

    Sun, Shihui; Wang, Hanbin; Zhao, Guangyu; An, Yingbo; Guo, Yan; Du, Lanying; Song, Hongbin; Qiao, Fei; Yu, Hong; Wu, Xiaohong; Atkinson, Carl; Jiang, Shibo; Tomlinson, Stephen

    2011-01-01

    The widely used herbicide, paraquat (PQ), is highly toxic and claims thousands of lives from both accidental and voluntary ingestion. The pathological mechanisms of PQ poisoning–induced acute lung injury (ALI) are not well understood, and the role of complement in PQ-induced ALI has not been elucidated. We developed and characterized a mouse model of PQ-induced ALI and studied the role of complement in the pathogenesis of PQ poisoning. Intraperitoneal administration of PQ caused dose- and time-dependent lung damage and mortality, with associated inflammatory response. Within 24 hours of PQ-induced ALI, there was significantly increased expression of the complement proteins, C1q and C3, in the lung. Expression of the anaphylatoxin receptors, C3aR and C5aR, was also increased. Compared with wild-type mice, C3-deficient mice survived significantly longer and displayed significantly reduced lung inflammation and pathology after PQ treatment. Similar reductions in PQ-induced inflammation, pathology, and mortality were recorded in mice treated with the C3 inhibitors, CR2-Crry, and alternative pathway specific CR2-fH. A similar therapeutic effect was also observed by treatment with either C3a receptor antagonist or a blocking C5a receptor monoclonal antibody. Together, these studies indicate that PQ-induced ALI is mediated through receptor signaling by the C3a and C5a complement activation products that are generated via the alternative complement pathway, and that complement inhibition may be an effective clinical intervention for postexposure treatment of PQ-induced ALI. PMID:21421909

  9. Transcriptome Analysis of the Innate Immunity-Related Complement System in Spleen Tissue of Ctenopharyngodon idella Infected with Aeromonas hydrophila

    PubMed Central

    Dang, Yunfei; Xu, Xiaoyan; Shen, Yubang; Hu, Moyan; Zhang, Meng; Li, Lisen; Lv, Liqun; Li, Jiale

    2016-01-01

    The grass carp (Ctenopharyngodon idella) is an important commercial farmed herbivorous fish species in China, but is susceptible to Aeromonas hydrophila infections. In the present study, we performed de novo RNA-Seq sequencing of spleen tissue from specimens of a disease-resistant family, which were given intra-peritoneal injections containing PBS with or without a dose of A. hydrophila. The fish were sampled from the control group at 0 h, and from the experimental group at 4, 8, 12, 24, 48 and 72 h. 122.18 million clean reads were obtained from the normalized cDNA libraries; these were assembled into 425,260 contigs and then 191,795 transcripts. Of those, 52,668 transcripts were annotated with the NCBI Nr database, and 41,347 of the annotated transcripts were assigned into 90 functional groups. 20,569 unigenes were classified into six main categories, including 38 secondary KEGG pathways. 2,992 unigenes were used in the analysis of differentially expressed genes (DEGs). 89 of the putative DEGs were related to the immune system and 41 of them were involved in the complement and coagulation cascades pathway. This study provides insights into the complement and complement-related pathways involved in innate immunity, through expression profile analysis of the genomic resources in C. idella. We conclude that complement and complement-related genes play important roles during defense against A. hydrophila infection. The immune response is activated at 4 h after the bacterial injections, indicating that the complement pathways are activated at the early stage of bacterial infection. The study has improved our understanding of the immune response mechanisms in C. idella to bacterial pathogens. PMID:27383749

  10. COMPLEMENT FIXATION IN DISEASED TISSUES

    PubMed Central

    Burkholder, Peter M.

    1961-01-01

    An immunohistologic complement fixation test has been used in an effort to detect immune complexes in sections of kidney from rats injected with rabbit anti-rat kidney serum and in sections of biopsied kidneys from four humans with membranous glomerulonephritis. Sections of the rat and human kidneys were treated with fluorescein-conjugated anti-rabbit globulin or antihuman globulin respectively. Adjacent sections in each case were incubated first with fresh guinea pig serum and then in a second step were treated with fluorescein-conjugated antibodies against fixed guinea pig complement to detect sites of fixation of the complement. It was demonstrated that the sites of rabbit globulin in glomerular capillary walls of the rat kidneys and the sites of localized human globulin in thickened glomerular capillary walls and swollen glomerular endothelial cells of the human kidneys were the same sites in which guinea pig complement was fixed in vitro. It was concluded from these studies that rabbit nephrotoxic antibodies localize in rat glomeruli in complement-fixing antigen-antibody complexes. Furthermore, it was concluded that the deposits of human globulin in the glomeruli of the human kidneys behaved like antibody globulin in complement-fixing antigen-antibody complexes. The significance of demonstrating complement-fixing immune complexes in certain diseased tissues is discussed in regard to determination of the causative role of allergic reactions in disease. PMID:19867205

  11. Complement fixation test to C burnetii

    MedlinePlus

    ... complement fixation test; Coxiella burnetii - complement fixation test; C burnetii - complement fixation test ... a specific foreign substance ( antigen ), in this case, C burnetii . Antibodies defend the body against bacteria, viruses, ...

  12. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa.

    PubMed

    Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P

    2015-11-02

    The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5' end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5' but not 3' end, explaining how Rpa regulates cleavage polarity.

  13. Ectromelia virus inhibitor of complement enzymes protects intracellular mature virus and infected cells from mouse complement.

    PubMed

    Moulton, Elizabeth A; Bertram, Paula; Chen, Nanhai; Buller, R Mark L; Atkinson, John P

    2010-09-01

    Poxviruses produce complement regulatory proteins to subvert the host's immune response. Similar to the human pathogen variola virus, ectromelia virus has a limited host range and provides a mouse model where the virus and the host's immune response have coevolved. We previously demonstrated that multiple components (C3, C4, and factor B) of the classical and alternative pathways are required to survive ectromelia virus infection. Complement's role in the innate and adaptive immune responses likely drove the evolution of a virus-encoded virulence factor that regulates complement activation. In this study, we characterized the ectromelia virus inhibitor of complement enzymes (EMICE). Recombinant EMICE regulated complement activation on the surface of CHO cells, and it protected complement-sensitive intracellular mature virions (IMV) from neutralization in vitro. It accomplished this by serving as a cofactor for the inactivation of C3b and C4b and by dissociating the catalytic domain of the classical pathway C3 convertase. Infected murine cells initiated synthesis of EMICE within 4 to 6 h postinoculation. The levels were sufficient in the supernatant to protect the IMV, upon release, from complement-mediated neutralization. EMICE on the surface of infected murine cells also reduced complement activation by the alternative pathway. In contrast, classical pathway activation by high-titer antibody overwhelmed EMICE's regulatory capacity. These results suggest that EMICE's role is early during infection when it counteracts the innate immune response. In summary, ectromelia virus produced EMICE within a few hours of an infection, and EMICE in turn decreased complement activation on IMV and infected cells.

  14. Downregulation of membrane complement inhibitors CD55 and CD59 by siRNA sensitises uterine serous carcinoma overexpressing Her2/neu to complement and antibody-dependent cell cytotoxicity in vitro: implications for trastuzumab-based immunotherapy.

    PubMed

    Bellone, S; Roque, D; Cocco, E; Gasparrini, S; Bortolomai, I; Buza, N; Abu-Khalaf, M; Silasi, D-A; Ratner, E; Azodi, M; Schwartz, P E; Rutherford, T J; Pecorelli, S; Santin, A D

    2012-04-24

    We evaluated the expression of CD46, CD55 and CD59 membrane-bound complement-regulatory proteins (mCRPs) in primary uterine serous carcinoma (USC) and the ability of small interfering RNA (siRNA) against these mCRPs to sensitise USC to complement-dependent cytotoxicity (CDC) and antibody (trastuzumab)-dependent cellular cytotoxicity (ADCC) in vitro. Membrane-bound complement-regulatory proteins expression was evaluated using real-time PCR (RT-PCR) and flow cytometry, whereas Her2/neu expression and c-erbB2 gene amplification were assessed using immunohistochemistry, flow cytometry and fluorescent in-situ hybridisation. The biological effect of siRNA-mediated knockdown of mCRPs on HER2/neu-overexpressing USC cell lines was evaluated in CDC and ADCC 4-h chromium-release assays. High expression of mCRPs was found in USC cell lines when compared with normal endometrial cells (P<0.05). RT-PCR and FACS analyses demonstrated that anti-mCRP siRNAs were effective in reducing CD46, CD55 and CD59 expression on USC (P<0.05). Baseline complement-dependent cytotoxicity (CDC) against USC cell lines was low (mean ± s.e.m.=6.8 ± 0.9%) but significantly increased upon CD55 and CD59 knockdown (11.6 ± 0.8% and 10.7 ± 0.9%, respectively, P<0.05). Importantly, in the absence of complement, both CD55 and CD59, but not CD46, knockdowns significantly augmented ADCC against USC overexpressing Her2/neu. Uterine serous carcinoma express high levels of the mCRPs CD46, CD55 and CD59. Small interfering RNA inhibition of CD55 and CD59, but not CD46, sensitises USC to both CDC and ADCC in vitro, and if specifically targeted to tumour cells, may significantly increase trastuzumab-mediated therapeutic effect in vivo.

  15. The Complement System and Adverse Pregnancy Outcomes

    PubMed Central

    Regal, Jean F.; Gilbert, Jeffrey S.; Burwick, Richard M.

    2015-01-01

    Adverse pregnancy outcomes significantly contribute to morbidity and mortality for mother and child, with lifelong health consequences for both. The innate and adaptive immune system must be regulated to insure survival of the feta allograft, and the complement system is no exception. An intact complement system optimizes placental development and function and is essential to maintain host defense and fetal survival. Complement regulation is apparent at the placental interface from early pregnancy with some degree of complement activation occurring normally throughout gestation. However, a number of pregnancy complications including early pregnancy loss, fetal growth restriction, hypertensive disorders of pregnancy and preterm birth are associated with excessive or misdirected complement activation, and are more frequent in women with inherited or acquired complement system disorders or complement gene mutations. Clinical studies employing complement biomarkers in plasma and urine implicate dysregulated complement activation in components of each of the adverse pregnancy outcomes. In addition, mechanistic studies in rat and mouse models of adverse pregnancy outcomes address the complement pathways or activation products of importance and allow critical analysis of the pathophysiology. Targeted complement therapeutics are already in use to control adverse pregnancy outcomes in select situations. A clearer understanding of the role of the complement system in both normal pregnancy and complicated or failed pregnancy will allow a rational approach to future therapeutic strategies for manipulating complement with the goal of mitigating adverse pregnancy outcomes, preserving host defense, and improving long term outcomes for both mother and child. PMID:25802092

  16. Complement Evasion Strategies of Viruses: An Overview

    PubMed Central

    Agrawal, Palak; Nawadkar, Renuka; Ojha, Hina; Kumar, Jitendra; Sahu, Arvind

    2017-01-01

    Being a major first line of immune defense, the complement system keeps a constant vigil against viruses. Its ability to recognize large panoply of viruses and virus-infected cells, and trigger the effector pathways, results in neutralization of viruses and killing of the infected cells. This selection pressure exerted by complement on viruses has made them evolve a multitude of countermeasures. These include targeting the recognition molecules for the avoidance of detection, targeting key enzymes and complexes of the complement pathways like C3 convertases and C5b-9 formation – either by encoding complement regulators or by recruiting membrane-bound and soluble host complement regulators, cleaving complement proteins by encoding protease, and inhibiting the synthesis of complement proteins. Additionally, viruses also exploit the complement system for their own benefit. For example, they use complement receptors as well as membrane regulators for cellular entry as well as their spread. Here, we provide an overview on the complement subversion mechanisms adopted by the members of various viral families including Poxviridae, Herpesviridae, Adenoviridae, Flaviviridae, Retroviridae, Picornaviridae, Astroviridae, Togaviridae, Orthomyxoviridae and Paramyxoviridae. PMID:28670306

  17. Identification of expressed genes in cDNA library of hemocytes from the RLO-challenged oyster, Crassostrea ariakensis Gould with special functional implication of three complement-related fragments (CaC1q1, CaC1q2 and CaC3).

    PubMed

    Xu, Ting; Xie, Jiasong; Li, Jianming; Luo, Ming; Ye, Shigen; Wu, Xinzhong

    2012-06-01

    A SMARTer™ cDNA library of hemocyte from Rickettsia-like organism (RLO) challenged oyster, Crassostrea ariakensis Gould was constructed. Random clones (400) were selected and single-pass sequenced, resulted in 200 unique sequences containing 96 known genes and 104 unknown genes. The 96 known genes were categorized into 11 groups based on their biological process. Furthermore, we identified and characterized three complement-related fragments (CaC1q1, CaC1q2 and CaC3). Tissue distribution analysis revealed that all of three fragments were ubiquitously expressed in all tissues studied including hemocyte, gills, mantle, digestive glands, gonads and adductor muscle, while the highest level was seen in the hemocyte. Temporal expression profile in the hemocyte monolayers reveled that the mRNA expression levels of three fragments presented huge increase after the RLO incubation at 3 h and 6 h in post-challenge, respectively. And the maximal expression levels at 3 h in post-challenge are about 256, 104 and 64 times higher than the values detected in the control of CaC1q1, CaC1q2 and CaC3, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa

    PubMed Central

    Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P

    2015-01-01

    The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5’ end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5’ but not 3’ end, explaining how Rpa regulates cleavage polarity. DOI: http://dx.doi.org/10.7554/eLife.09832.001 PMID:26491943

  19. The Lectin Pathway of Complement and Rheumatic Heart Disease

    PubMed Central

    Beltrame, Marcia Holsbach; Catarino, Sandra Jeremias; Goeldner, Isabela; Boldt, Angelica Beate Winter; de Messias-Reason, Iara José

    2014-01-01

    The innate immune system is the first line of host defense against infection and is comprised of humoral and cellular mechanisms that recognize potential pathogens within minutes or hours of entry. The effector components of innate immunity include epithelial barriers, phagocytes, and natural killer cells, as well as cytokines and the complement system. Complement plays an important role in the immediate response against microorganisms, including Streptococcus sp. The lectin pathway is one of three pathways by which the complement system can be activated. This pathway is initiated by the binding of mannose-binding lectin (MBL), collectin 11 (CL-K1), and ficolins (Ficolin-1, Ficolin-2, and Ficolin-3) to microbial surface oligosaccharides and acetylated residues, respectively. Upon binding to target molecules, MBL, CL-K1, and ficolins form complexes with MBL-associated serine proteases 1 and 2 (MASP-1 and MASP-2), which cleave C4 and C2 forming the C3 convertase (C4b2a). Subsequent activation of complement cascade leads to opsonization, phagocytosis, and lysis of target microorganisms through the formation of the membrane-attack complex. In addition, activation of complement may induce several inflammatory effects, such as expression of adhesion molecules, chemotaxis and activation of leukocytes, release of reactive oxygen species, and secretion of cytokines and chemokines. In this chapter, we review the general aspects of the structure, function, and genetic polymorphism of lectin-pathway components and discuss most recent understanding on the role of the lectin pathway in the predisposition and clinical progression of Rheumatic Fever. PMID:25654073

  20. STUDIES ON THE ANTIGENIC PROPERTIES OF COMPLEMENT

    PubMed Central

    Klein, Paul G.; Burkholder, Peter M.

    1960-01-01

    Sheep erythrocytes sensitized with amboceptor and persensitized thereafter with guinea pig complement are agglutinated by rabbit anti-guinea pig globulin and by immune sera obtained by injection of rabbits with fixed complement. In this agglutination neither C'1 nor C'2 takes part. Fixed C'4 acts as an agglutinogen. An additional agglutinogen, distinct from C'4, was found on persensitized cells. This additional agglutinogen appears to be distinct from hemolytically active C'3. PMID:14409703

  1. Complement is a central mediator of radiotherapy-induced tumor-specific immunity and clinical response.

    PubMed

    Surace, Laura; Lysenko, Veronika; Fontana, Andrea Orlando; Cecconi, Virginia; Janssen, Hans; Bicvic, Antonela; Okoniewski, Michal; Pruschy, Martin; Dummer, Reinhard; Neefjes, Jacques; Knuth, Alexander; Gupta, Anurag; van den Broek, Maries

    2015-04-21

    Radiotherapy induces DNA damage and cell death, but recent data suggest that concomitant immune stimulation is an integral part of the therapeutic action of ionizing radiation. It is poorly understood how radiotherapy supports tumor-specific immunity. Here we report that radiotherapy induced tumor cell death and transiently activated complement both in murine and human tumors. The local production of pro-inflammatory anaphylatoxins C3a and C5a was crucial to the tumor response to radiotherapy and concomitant stimulation of tumor-specific immunity. Dexamethasone, a drug frequently given during radiotherapy, limited complement activation and the anti-tumor effects of the immune system. Overall, our findings indicate that anaphylatoxins are key players in radiotherapy-induced tumor-specific immunity and the ensuing clinical responses. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. A Zn(II)2Cys6 DNA binding protein regulates the sirodesmin PL biosynthetic gene cluster in Leptosphaeria maculans

    PubMed Central

    Fox, Ellen M.; Gardiner, Donald M.; Keller, Nancy P.; Howlett, Barbara J.

    2008-01-01

    A gene, sirZ, encoding a Zn(II)2Cys6 DNA binding protein is present in a cluster of genes responsible for the biosynthesis of the epipolythiodioxopiperazine (ETP) toxin, sirodesmin PL in the ascomycete plant pathogen, Leptosphaeria maculans. RNA-mediated silencing of sirZ gives rise to transformants that produce only residual amounts of sirodesmin PL and display a decrease in the transcription of several sirodesmin PL biosynthetic genes. This indicates that SirZ is a major regulator of this gene cluster. Proteins similar to SirZ are encoded in the gliotoxin biosynthetic gene cluster of Aspergillus fumigatus (gliZ) and in an ETP-like cluster in Penicillium lilacinoechinulatum (PlgliZ). Despite its high level of sequence similarity to gliZ, PlgliZ is unable to complement the gliotoxin-deficiency of a mutant of gliZ in A. fumigatus. Putative binding sites for these regulatory proteins in the promoters of genes in these clusters were predicted using bioinformatic analysis. These sites are similar to those commonly bound by other proteins with Zn(II)2Cys6 DNA binding domains. PMID:18023597

  3. Recruitment of TRF2 to laser-induced DNA damage sites.

    PubMed

    Huda, Nazmul; Abe, Satoshi; Gu, Ling; Mendonca, Marc S; Mohanty, Samarendra; Gilley, David

    2012-09-01

    Several lines of evidence suggest that the telomere-associated protein TRF2 plays critical roles in the DNA damage response. TRF2 is rapidly and transiently phosphorylated by an ATM-dependent pathway in response to DNA damage and this DNA damage-induced phosphoryation is essential for the DNA-PK-dependent pathway of DNA double-strand break repair (DSB). However, the type of DNA damage that induces TRF2 localization to the damage sites, the requirement for DNA damage-induced phosphorylation of TRF2 for its recruitment, as well as the detailed kinetics of TRF2 accumulation at DNA damage sites have not been fully investigated. In order to address these questions, we used an ultrafast femtosecond multiphoton laser and a continuous wave 405-nm single photon laser to induce DNA damage at defined nuclear locations. Our results showed that DNA damage produced by a femtosecond multiphoton laser was sufficient for localization of TRF2 to these DNA damage sites. We also demonstrate that ectopically expressed TRF2 was recruited to DNA lesions created by a 405-nm laser. Our data suggest that ATM and DNA-PKcs kinases are not required for TRF2 localization to DNA damage sites. Furthermore, we found that phosphorylation of TRF2 at residue T188 was not essential for its recruitment to laser-induced DNA damage sites. Thus, we provide further evidence that a protein known to function in telomere maintenance, TRF2, is recruited to sites of DNA damage and plays critical roles in the DNA damage response. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Keeping It All Going-Complement Meets Metabolism.

    PubMed

    Kolev, Martin; Kemper, Claudia

    2017-01-01

    The complement system is an evolutionary old and crucial component of innate immunity, which is key to the detection and removal of invading pathogens. It was initially discovered as a liver-derived sentinel system circulating in serum, the lymph, and interstitial fluids that mediate the opsonization and lytic killing of bacteria, fungi, and viruses and the initiation of the general inflammatory responses. Although work performed specifically in the last five decades identified complement also as a critical instructor of adaptive immunity-indicating that complement's function is likely broader than initially anticipated-the dominant opinion among researchers and clinicians was that the key complement functions were in principle defined. However, there is now a growing realization that complement activity goes well beyond "classic" immune functions and that this system is also required for normal (neuronal) development and activity and general cell and tissue integrity and homeostasis. Furthermore, the recent discovery that complement activation is not confined to the extracellular space but occurs within cells led to the surprising understanding that complement is involved in the regulation of basic processes of the cell, particularly those of metabolic nature-mostly via novel crosstalks between complement and intracellular sensor, and effector, pathways that had been overlooked because of their spatial separation. These paradigm shifts in the field led to a renaissance in complement research and provide new platforms to now better understand the molecular pathways underlying the wide-reaching effects of complement functions in immunity and beyond. In this review, we will cover the current knowledge about complement's emerging relationship with the cellular metabolism machinery with a focus on the functional differences between serum-circulating versus intracellularly active complement during normal cell survival and induction of effector functions. We will also

  5. Recruitment of DNA polymerase eta by FANCD2 in the early response to DNA damage.

    PubMed

    Fu, Dechen; Dudimah, Fred Duafalia; Zhang, Jun; Pickering, Anna; Paneerselvam, Jayabal; Palrasu, Manikandan; Wang, Hong; Fei, Peiwen

    2013-03-01

    How Fanconi anemia (FA) protein D2 (FANCD2) performs DNA damage repair remains largely elusive. We report here that translesion synthesis DNA polymerase (pol) eta is a novel mediator of FANCD2 function. We found that wild type (wt) FANCD2, not K561R (mt) FANCD2, can interact with pol eta. Upon DNA damage, the interaction of pol eta with FANCD2 occurs earlier than that with PCNA, which is in concert with our finding that FANCD2 monoubiquitination peaks at an earlier time point than that of PCNA monoubiquitination. FANCD2-null FA patient cells (PD20) carrying histone H2B-fused pol eta and wtFANCD2, respectively, show a similar tendency of low Mitomycin C (MMC) sensitivity, while cells transfected with empty vector control or pol eta alone demonstrate a similar high level of MMC sensitivity. It therefore appears that FANCD2 monoubiquitination plays a similar anchor role as histone to bind DNA in regulating pol eta. Collectively, our study indicates that, in the early phase of DNA damage response, FANCD2 plays crucial roles in recruiting pol eta to the sites of DNA damage for repair.

  6. Recruitment of DNA polymerase eta by FANCD2 in the early response to DNA damage

    PubMed Central

    Fu, Dechen; Dudimah, Fred Duafalia; Zhang, Jun; Pickering, Anna; Paneerselvam, Jayabal; Palrasu, Manikandan; Wang, Hong; Fei, Peiwen

    2013-01-01

    How Fanconi anemia (FA) protein D2 (FANCD2) performs DNA damage repair remains largely elusive. We report here that translesion synthesis DNA polymerase (pol) eta is a novel mediator of FANCD2 function. We found that wild type (wt) FANCD2, not K561R (mt) FANCD2, can interact with pol eta. Upon DNA damage, the interaction of pol eta with FANCD2 occurs earlier than that with PCNA, which is in concert with our finding that FANCD2 monoubiquitination peaks at an earlier time point than that of PCNA monoubiquitination. FANCD2-null FA patient cells (PD20) carrying histone H2B-fused pol eta and wtFANCD2, respectively, show a similar tendency of low Mitomycin C (MMC) sensitivity, while cells transfected with empty vector control or pol eta alone demonstrate a similar high level of MMC sensitivity. It therefore appears that FANCD2 monoubiquitination plays a similar anchor role as histone to bind DNA in regulating pol eta. Collectively, our study indicates that, in the early phase of DNA damage response, FANCD2 plays crucial roles in recruiting pol eta to the sites of DNA damage for repair. PMID:23388460

  7. Infinitivals at the End-State: Evidence for L2 Acquisition of English Non-Finite Complementation

    ERIC Educational Resources Information Center

    Heil, Jeanne

    2015-01-01

    This dissertation investigates the knowledge of English non-finite complement constructions by near-native L1 Spanish/L2 English learners. In particular, this study concerns Object Control, Raising to Object, and "for"-type constructions. Although the three constructions look identical on the surface, they are in fact distinct syntactic…

  8. Intracistronic complementation in the simian virus 40 A gene.

    PubMed Central

    Tornow, J; Cole, C N

    1983-01-01

    A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452

  9. A stable shuttle vector system for efficient genetic complementation of Helicobacter pylori strains by transformation and conjugation.

    PubMed

    Heuermann, D; Haas, R

    1998-03-01

    A versatile plasmid shuttle vector system was constructed, which is useful for genetic complementation of Helicobacter pylori strains or mutants with cloned genes of homologous or heterologous origin. The individual plasmid vectors consist of the minimal essential genetic elements, including an origin of replication for Escherichia coli, a H. pylori-specific replicon originally identified on a small cryptic H. pylori plasmid, an oriT sequence and a multiple cloning site. Shuttle plasmid pHel2 carries a chloramphenicol resistance cassette (catGC) and pHel3 contains a kanamycin resistance gene (aphA-3) as the selectable marker; both are functional in E. coli and H. pylori. The shuttle plasmids were introduced into the H. pylori strain P1 by natural transformation. A efficiency of 7.0 x 10(-7) and 4.7 x 10(-7) transformants per viable recipient was achieved with pHel2 and pHel3, respectively, and both vectors showed stable, autonomous replication in H. pylori. An approximately 100-fold higher H. pylori transformation rate was obtained when the shuttle vectors for transformation were isolated from the homologous H. pylori strain, rather than E. coli, indicating that DNA restriction and modification mechanisms play a crucial role in plasmid transformation. Interestingly, both shuttle vectors could also be mobilized efficiently from E. coli into different H. pylori recipients, with pHel2 showing an efficiency of 2.0 x 10(-5) transconjugants per viable H. pylori P1 recipient. Thus, DNA restriction seems to be strongly reduced or absent during conjugal transfer. The functional complementation of a recA-deficient H. pylori mutant by the cloned H. pylori recA+ gene, and the expression of the heterologous green fluorescent protein (GFP) in H. pylori demonstrate the general usefulness of this system, which will significantly facilitate the molecular analysis of H. pylori virulence factors in the future.

  10. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  11. Progress and trends in complement therapeutics.

    PubMed

    Ricklin, Daniel; Lambris, John D

    2013-01-01

    The past few years have proven to be a highly successful and exciting period for the field of complement-directed drug discovery and development. Driven by promising experiences with the first marketed complement drugs, increased knowledge about the involvement of complement in health and disease, and improvements in structural and analytical techniques as well as animal models of disease, the field has seen a surge in creative approaches to therapeutically intervene at various stages of the cascade. An impressive panel of compounds that show promise in clinical trials is meanwhile being lined up in the pipelines of both small biotechnology and big pharmaceutical companies. Yet with this new focus on complement-targeted therapeutics, important questions concerning target selection, point and length of intervention, safety, and drug delivery emerge. In view of the diversity of the clinical disorders involving abnormal complement activity or regulation, which include both acute and chronic diseases and affect a wide range of organs, diverse yet specifically tailored therapeutic approaches may be needed to shift complement back into balance. This chapter highlights the key changes in the field that shape our current perception of complement-targeted drugs and provides a brief overview of recent strategies and emerging trends. Selected examples of complement-related diseases and inhibitor classes are highlighted to illustrate the diversity and creativity in field.

  12. Progress and Trends in Complement Therapeutics.

    PubMed

    Ricklin, Daniel; Lambris, John D

    2013-01-01

    The past few years have proven to be a highly successful and exciting period for the field of complement-directed drug discovery and development. Driven by promising experiences with the first marketed complement drugs, increased knowledge about the involvement of complement in health and disease, and improvements in structural and analytical techniques as well as animal models of disease, the field has seen a surge in creative approaches to therapeutically intervene at various stages of the cascade. An impressive panel of compounds that show promise in clinical trials is meanwhile being lined up in the pipelines of both small biotechnology and big pharmaceutical companies. Yet with this new focus on complement-targeted therapeutics, important questions concerning target selection, point and length of intervention, safety, and drug delivery emerge. In view of the diversity of the clinical disorders involving abnormal complement activity or regulation, which include both acute and chronic diseases and affect a wide range of organs, diverse yet specifically tailored therapeutic approaches may be needed to shift complement back into balance. This chapter highlights the key changes in the field that shape our current perception of complement-targeted drugs and provides a brief overview of recent strategies and emerging trends. Selected examples of complement-related diseases and inhibitor classes are highlighted to illustrate the diversity and creativity in field.

  13. Mutations participating in interallelic complementation in propionic acidemia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gravel, R.A.; Akerman, B.R.; Lamhonwah, A.M.

    1994-07-01

    Deficiency of propionyl-CoA carboxylase (PCC; [alpha][sub 4][beta][sub 4]) results in the rare, autosomal recessive disease propionic acidemia. Cell fusion experiments have revealed two complementation groups, pccA and pccB, corresponding to defects of the PCCA ([alpha]-subunit) and PCCB ([beta]-subunit) genes, respectively. The pccBCC group includes subgroups, pccB and pccC, which are thought to reflect interallelic complementation between certain mutations of the PCCB gene. In this study, the authors have identified the mutations in two pccB, one pccC, and two pccBC cell lines and have deduced those alleles participating in interallelic complementation. One pccB line was a compound hetrozygote of Pro228Leu andmore » Asn536Asp. The latter mutation was also detected in a noncomplementing pccBC line. This leaves Pro228Leu responsible for complementation in the pccB cells. The second pccB line contained an insertional duplication, dupKICK140-143, and a splice mutation IVS+1 G[yields]T, located after Lys466. The authors suggest that the dupKICK mutation is the complementing allele, since the second allele is incompatible with normal splicing. The pccC line studied was homozygous for Arg410Trp, which is necessarily the complementing allele in that line. For a second pccC line, they previously had proposed that [Delta]Ile408 was the complementing allele. They now show that its second allele, [open quotes]Ins[center dot]Del[close quotes], a 14-bp deletion replaced by a 12-bp insertion beginning at codon 407, fails to complement in homozygous form. The authors conclude that the interallelic complementation results from mutations in domains that can interact between [beta]-subunits in the PCC heteromer to restore enzymatic function. On the basis of sequence homology with the Propionibacterium shermanii transcarboxylase 12S subunit, they suggest that the pccC domain, defined by Ile408 and Arg410, may involve the propionyl-CoA binding site. 37 refs., 5 figs., 2 tabs.« less

  14. [Fanconi Anemia, Complementation Group D1 Caused by Biallelic Mutations of BRCA2 Gene--Case Report].

    PubMed

    Puchmajerová, A; Švojgr, K; Novotná, D; Macháčková, E; Sumerauer, D; Smíšek, P; Kodet, R; Kynčl, M; Křepelová, A; Foretová, L

    2016-01-01

    Fanconi anemia is a rare autosomal recessive disorder, clinically and genetically heterogeneous, characterized by typical clinical features, such as short stature, microcephaly, skeletal abnormalities, abnormal skin pigmentations, developmental delay and congenital heart, kidney anomalies etc. Pancytopenia leading to bone marrow failure occurs in the first decade. Patients with Fanconi anemia have a high risk of hematologic malignancies and solid tumors. The diagnosis of Fanconi anemia is based on cytogenetic testing for increased rates of spontaneous chromosomal breakage and increased sensitivity to diepoxybutane or mitomycin C. Fanconi anemia is a heterogeneous disorder, at least 15 complementation groups are described, and 15 genes in which mutations are responsible for all of the 15 Fanconi anemia complementation groups have been identified. Unlike other Fanconi anemia complementation groups, for complementation group D1 (FANCD1), the bone marrow failure is not a typical feature, but early-onset leukemia and specific solid tumors, most often medulloblastoma and Wilms tumor, are typical for this complementation group.

  15. Coagulation cascade and complement system in systemic lupus erythematosus

    PubMed Central

    Liang, Yan; Xie, Shang-Bo; Wu, Chang-Hao; Hu, Yuan; Zhang, Qin; Li, Si; Fan, Yin-Guang; Leng, Rui-Xue; Pan, Hai-Feng; Xiong, Hua-Bao; Ye, Dong-Qing

    2018-01-01

    This study was conducted to (1) characterize coagulation cascade and complement system in systemic lupus erythematosus (SLE); (2) evaluate the associations between coagulation cascade, complement system, inflammatory response and SLE disease severity; (3) test the diagnostic value of a combination of D-dimer and C4 for lupus activity. Transcriptomics, proteomics and metabolomics were performed in 24 SLE patients and 24 healthy controls. The levels of ten coagulations, seven complements and three cytokines were measured in 112 SLE patients. Clinical data were collected from 2025 SLE patients. The analysis of multi-omics data revealed the common links for the components of coagulation cascade and complement system. The results of ELISA showed coagulation cascade and complement system had an interaction effect on SLE disease severity, this effect was pronounced among patients with excess inflammation. The analysis of clinical data revealed a combination of D-dimer and C4 provided good diagnostic performance for lupus activity. This study suggested that coagulation cascade and complement system become ‘partners in crime’, contributing to SLE disease severity and identified the diagnostic value of D-dimer combined with C4for lupus activity. PMID:29599912

  16. Architecture and DNA Recognition Elements of the Fanconi Anemia FANCM-FAAP24 Complex

    PubMed Central

    Coulthard, Rachel; Deans, Andrew J.; Swuec, Paolo; Bowles, Maureen; Costa, Alessandro; West, Stephen C.; McDonald, Neil Q.

    2013-01-01

    Summary Fanconi anemia (FA) is a disorder associated with a failure in DNA repair. FANCM (defective in FA complementation group M) and its partner FAAP24 target other FA proteins to sites of DNA damage. FANCM-FAAP24 is related to XPF/MUS81 endonucleases but lacks endonucleolytic activity. We report a structure of an FANCM C-terminal fragment (FANCMCTD) bound to FAAP24 and DNA. This S-shaped structure reveals the FANCM (HhH)2 domain is buried, whereas the FAAP24 (HhH)2 domain engages DNA. We identify a second DNA contact and a metal center within the FANCM pseudo-nuclease domain and demonstrate that mutations in either region impair double-stranded DNA binding in vitro and FANCM-FAAP24 function in vivo. We show the FANCM translocase domain lies in proximity to FANCMCTD by electron microscopy and that binding fork DNA structures stimulate its ATPase activity. This suggests a tracking model for FANCM-FAAP24 until an encounter with a stalled replication fork triggers ATPase-mediated fork remodeling. PMID:23932590

  17. γH2AX foci formation in the absence of DNA damage: mitotic H2AX phosphorylation is mediated by the DNA-PKcs/CHK2 pathway.

    PubMed

    Tu, Wen-Zhi; Li, Bing; Huang, Bo; Wang, Yu; Liu, Xiao-Dan; Guan, Hua; Zhang, Shi-Meng; Tang, Yan; Rang, Wei-Qing; Zhou, Ping-Kun

    2013-11-01

    Phosphorylated H2AX is considered to be a biomarker for DNA double-strand breaks (DSB), but recent evidence suggests that γH2AX does not always indicate the presence of DSB. Here we demonstrate the bimodal dynamic of H2AX phosphorylation induced by ionizing radiation, with the second peak appearing when G2/M arrest is induced. An increased level of γH2AX occurred in mitotic cells, and this increase was attenuated by DNA-PKcs inactivation or Chk2 depletion, but not by ATM inhibition. The phosphorylation-mimic CHK2-T68D abrogated the attenuation of mitotic γH2AX induced by DNA-PKcs inactivation. Thus, the DNA-PKcs/CHK2 pathway mediates the mitotic phosphorylation of H2AX in the absence of DNA damage. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  18. Cyclosporine Induces Endothelial Cell Release of Complement-Activating Microparticles

    PubMed Central

    Renner, Brandon; Klawitter, Jelena; Goldberg, Ryan; McCullough, James W.; Ferreira, Viviana P.; Cooper, James E.; Christians, Uwe

    2013-01-01

    Defective control of the alternative pathway of complement is an important risk factor for several renal diseases, including atypical hemolytic uremic syndrome. Infections, drugs, pregnancy, and hemodynamic insults can trigger episodes of atypical hemolytic uremic syndrome in susceptible patients. Although the mechanisms linking these clinical events with disease flares are unknown, recent work has revealed that each of these clinical conditions causes cells to release microparticles. We hypothesized that microparticles released from injured endothelial cells promote intrarenal complement activation. Calcineurin inhibitors cause vascular and renal injury and can trigger hemolytic uremic syndrome. Here, we show that endothelial cells exposed to cyclosporine in vitro and in vivo release microparticles that activate the alternative pathway of complement. Cyclosporine-induced microparticles caused injury to bystander endothelial cells and are associated with complement-mediated injury of the kidneys and vasculature in cyclosporine-treated mice. Cyclosporine-induced microparticles did not bind factor H, an alternative pathway regulatory protein present in plasma, explaining their complement-activating phenotype. Finally, we found that in renal transplant patients, the number of endothelial microparticles in plasma increases 2 weeks after starting tacrolimus, and treatment with tacrolimus associated with increased C3 deposition on endothelial microparticles in the plasma of some patients. These results suggest that injury-associated release of endothelial microparticles is an important mechanism by which systemic insults trigger intravascular complement activation and complement-dependent renal diseases. PMID:24092930

  19. DNA repair pathways and mitochondrial DNA mutations in gastrointestinal carcinogenesis.

    PubMed

    Basso, Daniela; Navaglia, Filippo; Fogar, Paola; Zambon, Carlo-Federico; Greco, Eliana; Schiavon, Stefania; Fasolo, Michela; Stranges, Alessia; Falda, Alessandra; Padoan, Andrea; Fadi, Elisa; Pedrazzoli, Sergio; Plebani, Mario

    2007-05-01

    This work focuses on the main DNA repair pathways, highlighting their role in gastrointestinal carcinogenesis and the role of mitochondrial DNA (mtDNA), mutations being described in several tumor types, including those of the gastrointestinal tract. The mismatch repair (MMR) system is inherently altered in patients with hereditary non-polyposis colorectal cancer, and plays a role in carcinogenesis in a subset of sporadic colorectal, gastric and esophageal cancers. Alterations in homologous recombination (HR) and non-homologous end-joining (NHEJ) also contribute to the development of pancreatic cancer. Gene polymorphisms of some X-ray cross-complementing (XRCCs), cofactor proteins involved in the base excision repair pathway, have been investigated in relation to gastric, colorectal and pancreatic cancer. Yet only one polymorphism, XRCC1 Arg194Trp, appears to be involved in smoking-related cancers and in early onset pancreatic cancer. Although evidence in the literature indicates that mtDNA somatic mutations play a role in gastric and colorectal carcinogenesis, no sound conclusions have yet been drawn regarding this issue in pancreatic cancer, although an mtDNA variant at 16519 is believed to worsen the outcome of pancreatic cancer patients, possibly because it is involved in altering cellular metabolism.

  20. Magnetic studies of Co2+, Ni2+, and Zn2+-modified DNA double-crossover lattices

    NASA Astrophysics Data System (ADS)

    Dugasani, Sreekantha Reddy; Oh, Young Hoon; Gnapareddy, Bramaramba; Park, Tuson; Kang, Won Nam; Park, Sung Ha

    2018-01-01

    We fabricated divalent-metal-ion-modified DNA double-crossover (DX) lattices on a glass substrate and studied their magnetic characteristics as a function of ion concentrations [Co2+], [Ni2+] and [Zn2+]. Up to certain critical concentrations, the DNA DX lattices with ions revealed discrete S-shaped hysteresis, i.e. characteristics of strong ferromagnetism, with significant changes in the coercive field, remanent magnetization, and susceptibility. Induced magnetic dipoles formed by metal ions in DNA duplex in the presence of a magnetic field imparted ferromagnetic behaviour. By considering hysteresis and the magnitude of magnetization in a magnetization-magnetic field curve, Co2+-modified DNA DX lattices showed a relatively strong ferromagnetic nature with an increasing (decreasing) trend of coercive field and remanent magnetization when [Co2+] ≤ 1 mM ([Co2+] > 1 mM). In contrast, Ni2+ and Zn2+-modified DNA DX lattices exhibited strong and weak ferromagnetic behaviours at lower (≤1 mM for Ni2+ and ≤0.5 mM for Zn2+) and higher (>1 mM for Ni2+ and >0.5 mM for Zn2+) concentrations of ions, respectively. About 1 mM of [Co2+], [Ni2+] and [Zn2+] in DNA DX lattices was of special interest with regard to physical characteristics and was identified to be an optimum concentration of each ion. Finally, we measured the temperature-dependent magnetic characteristics of the metal-ion-modified DNA DX lattices. Nonzero magnetization and inverse susceptibility with almost constant values were observed between 25 and 300 K, with no indication of a magnetic transition. This indicated that the magnetic Curie temperatures of Co2+, Ni2+ and Zn2+-modified DNA DX lattices were above 300 K.

  1. Xeroderma pigmentosum complementation group G associated with Cockayne syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vermeulen, W.; Jaspers, N.G.J.; Bootsma, D.

    1993-07-01

    Xeroderma pigmentosum (XP) and Cockayne syndrome (CS) are two rare inherited disorders with a clinical and cellular hypersensitivity to the UV component of the sunlight spectrum. Although the two traits are generally considered as clinically and genetically distinct entities, on the biochemical level a defect in the nucleotide excision-repair (NER) pathway is involved in both. Classical CS patients are primarily deficient in the preferential repair of DNA damage in actively transcribed genes, whereas in most XP patients the genetic defect affects both [open quotes]preferential[close quotes] and [open quotes]overall[close quotes] NER modalities. Here the authors report a genetic study of twomore » unrelated, severely affected patients with the clinical characteristics of CS but with a biochemical defect typical of XP. By complementation analysis, using somatic cell fusion and nuclear microinjection of cloned repair genes, they assign these two patients to XP complementation group G, which previously was not associated with CS. This observation extends the earlier identification of two patients with a rare combined XP/CS phenotype within XP complementation groups B and D, respectively. It indicates that some mutations in at least three of the seven genes known to be involved in XP also can result in a picture of partial or even full-blown CS. It is concluded that the syndromes XP and CS are biochemically closely related and may be part of a broader clinical disease spectrum. The authors suggest, as a possible molecular mechanism underlying this relation, that the XPGC repair gene has an additional vital function, as shown for some other NER genes. 33 refs., 5 tabs.« less

  2. The role of complement receptor positive and complement receptor negative B cells in the primary and secondary immune response to thymus independent type 2 and thymus dependent antigens.

    PubMed

    Lindsten, T; Yaffe, L J; Thompson, C B; Guelde, G; Berning, A; Scher, I; Kenny, J J

    1985-05-01

    Both complement receptor positive (CR+) and complement receptor negative (CR-) B cells have been shown to be involved in the primary immune response to PC-Hy (phosphocholine conjugated hemocyanin), a thymus dependent (TD) antigen which preferentially induces antibody secretion in Lyb-5+ B cells during a primary adoptive transfer assay. CR+ and CR- B cells also responded in a primary adoptive transfer assay to TNP-Ficoll, a thymus independent type 2 (TI-2) antigen which activates only Lyb-5+ B cells. When the secondary immune response to PC-Hy and TNP-Ficoll were analyzed, it was found that most of the immune memory to both antigens was present in the CR- B cell subset. The CR- B cell subset also dominated the secondary immune response to PC-Hy in immune defective (CBA/N X DBA/2N)F1 male mice. These data indicate that CR- B cells dominate the memory response in both the Lyb-5+ and Lyb-5- B cell subsets of normal and xid immune defective mice and suggest that Lyb-5+ and Lyb-5- B cells can be subdivided into CR+ and CR- subsets.

  3. Optical Voltage Sensing Using DNA Origami

    PubMed Central

    2018-01-01

    We explore the potential of DNA nanotechnology for developing novel optical voltage sensing nanodevices that convert a local change of electric potential into optical signals. As a proof-of-concept of the sensing mechanism, we assembled voltage responsive DNA origami structures labeled with a single pair of FRET dyes. The DNA structures were reversibly immobilized on a nanocapillary tip and underwent controlled structural changes upon application of an electric field. The applied field was monitored through a change in FRET efficiency. By exchanging the position of a single dye, we could tune the voltage sensitivity of our DNA origami structure, demonstrating the flexibility and versatility of our approach. The experimental studies were complemented by coarse-grained simulations that characterized voltage-dependent elastic deformation of the DNA nanostructures and the associated change in the distance between the FRET pair. Our work opens a novel pathway for determining the mechanical properties of DNA origami structures and highlights potential applications of dynamic DNA nanostructures as voltage sensors. PMID:29430924

  4. Expression of recombinant CD59 with an N-terminal peptide epitope facilitates analysis of residues contributing to its complement-inhibitory function.

    PubMed

    Zhou, Q; Zhao, J; Hüsler, T; Sims, P J

    1996-10-01

    CD59 is a plasma membrane-anchored glycoprotein that serves to protect human cells from lysis by the C5b-9 complex of complement. The immunodominant epitopes of CD59 are known to be sensitive to disruption of native tertiary structure, complicating immunological measurement of expressed mutant constructs for structure function analysis. In order to quantify cell-surface expression of wild-type and mutant forms of this complement inhibitor, independent of CD59 antigen, an 11-residue peptide (TAG) recognized by monoclonal antibody (mAb) 9E10 was inserted before the N-terminal codon (L1) of mature CD59, in a pcDNA3 expression plasmid. SV-T2 cells were transfected with this plasmid, yielding cell lines expressing 0 to > 10(5) CD59/cell. The TAG-CD59 fusion protein was confirmed to be GPI-anchored, N-glycosylated and showed identical complement-inhibitory function to wild-type CD59, lacking the TAG peptide sequence. Using this construct, the contribution of each of four surface-localized aromatic residues (4Y, 47F, 61Y, and 62Y) to CD59's complement-inhibitory function was examined. These assays revealed normal surface expression with complete loss of complement-inhibitory function in the 4Y --> S, 47F --> G and 61Y --> S mutants. By contrast, 62Y --> S mutants retained approximately 40% of function of wild-type CD59. These studies confirmed the utility of the TAG-CD59 construct for quantifying CD59 surface expression and activity, and implicate surface aromatic residues 4Y, 47F, 61Y and 62Y as essential to maintenance of CD59's normal complement-regulatory function.

  5. RAD25 (SSL2), the yeast homolog of the human xeroderma pigmentosum group B DNA repair gene, is essential for viability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, E.; Prakash, L.; Guzder, S.N.

    1992-12-01

    Xeroderma pigmentosum (XP) patients are extremely sensitive to ultraviolet (UV) light and suffer from a high incidence of skin cancers, due to a defect in nucleotide excision repair. The disease is genetically heterogeneous, and seven complementation groups, A-G, have been identified. Homologs of human excision repair genes ERCC1, XPDC/ERCC2, and XPAC have been identified in the yeast Saccharomyces cerevisiae. Since no homolog of human XPBC/ERCC3 existed among the known yeast genes, we cloned the yeast homolog by using XPBC cDNA as a hybridization probe. The yeast homolog, RAD25 (SSL2), encodes a protein of 843 amino acids (M[sub r] 95,356). Themore » RAD25 (SSL2)- and XPCX-encoded proteins share 55% identical and 72% conserved amino acid residues, and the two proteins resemble one another in containing the conserved DNA helicase sequence motifs. A nonsense mutation at codon 799 that deletes the 45 C-terminal amino acid residues in RAD25 (SSL2) confers UV sensitivity. This mutation shows epistasis with genes in the excision repair group, whereas a synergistic increase in UN sensitivity occurs when it is combined with mutations in genes in other DNA repair pathways, indicating that RAD25 (SSL2) functions in excision repair but not in other repair pathways. We also show that RAD25 (SSL2) is an essential gene. A mutation of the Lys[sup 392] residue to arginine in the conserved Walker type A nucleotide-binding motif is lethal, suggesting an essential role of the putative RAD 25 (SSL2) ATPase/DNA helicase activity in viability. 40 refs., 3 figs., 1 tab.« less

  6. A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.

    PubMed

    Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu

    2015-05-01

    Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. DNA-targeted 2-nitroimidazoles: studies of the influence of the phenanthridine-linked nitroimidazoles, 2-NLP-3 and 2-NLP-4, on DNA damage induced by ionizing radiation.

    PubMed

    Buchko, Garry W; Weinfeld, Michael

    2002-09-01

    The nitroimidazole-linked phenanthridines 2-NLP-3 (5-[3-(2-nitro-1-imidazoyl)-propyl]-phenanthridinium bromide) and 2-NLP-4 (5-[3-(2-nitro-1-imidazoyl)-butyl]-phenanthridinium bromide) are composed of the radiosensitizer, 2-nitroimidazole, attached to the DNA intercalator phenanthridine by a 3- and 4-carbon linker, respectively. Previous in vitro assays showed both compounds to be 10-100 times more efficient as hypoxic cell radiosensitizers (based on external drug concentrations) than the untargeted 2-nitroimidazole radiosensitizer, misonidazole (Cowan et al., Radiat. Res. 127, 81-89, 1991). Here we have used a (32)P postlabeling assay and 5'-end-labeled oligonucleotide assay to compare the radiation-induced DNA damage generated in the presence of 2-NLP-3, 2-NLP-4, phenanthridine and misonidazole. After irradiation of the DNA under anoxic conditions, we observed a significantly greater level of 3'-phosphoglycolate DNA damage in the presence of 2-NLP-3 or 2-NLP-4 compared to irradiation of the DNA in the presence of misonidazole. This may account at least in part for the greater cellular radiosensitization shown by the nitroimidazole-linked phenanthridines over misonidazole. Of the two nitroimidazole-linked phenanthridines, the better in vitro radiosensitizer, 2-NLP-4, generated more 3'-phosphoglycolate in DNA than did 2-NLP-3. At all concentrations, phenanthridine had little effect on the levels of DNA damage, suggesting that the enhanced radiosensitization displayed by 2-NLP-3 and 2-NLP-4 is due to the localization of the 2-nitroimidazole to the DNA by the phenanthridine substituent and not to radiosensitization by the phenanthridine moiety itself.

  8. High-throughput selection for cellulase catalysts using chemical complementation.

    PubMed

    Peralta-Yahya, Pamela; Carter, Brian T; Lin, Hening; Tao, Haiyan; Cornish, Virginia W

    2008-12-24

    Efficient enzymatic hydrolysis of lignocellulosic material remains one of the major bottlenecks to cost-effective conversion of biomass to ethanol. Improvement of glycosylhydrolases, however, is limited by existing medium-throughput screening technologies. Here, we report the first high-throughput selection for cellulase catalysts. This selection was developed by adapting chemical complementation to provide a growth assay for bond cleavage reactions. First, a URA3 counter selection was adapted to link chemical dimerizer activated gene transcription to cell death. Next, the URA3 counter selection was shown to detect cellulase activity based on cleavage of a tetrasaccharide chemical dimerizer substrate and decrease in expression of the toxic URA3 reporter. Finally, the utility of the cellulase selection was assessed by isolating cellulases with improved activity from a cellulase library created by family DNA shuffling. This application provides further evidence that chemical complementation can be readily adapted to detect different enzymatic activities for important chemical transformations for which no natural selection exists. Because of the large number of enzyme variants that selections can now test as compared to existing medium-throughput screens for cellulases, this assay has the potential to impact the discovery of improved cellulases and other glycosylhydrolases for biomass conversion from libraries of cellulases created by mutagenesis or obtained from natural biodiversity.

  9. FANCJ Helicase Operates in the Fanconi Anemia DNA Repair Pathway and the Response to Replicational Stress

    PubMed Central

    Wu, Yuliang; Brosh, Robert M.

    2009-01-01

    Fanconi anemia (FA) is an autosomal recessive disorder characterized by multiple congenital anomalies, progressive bone marrow failure, and high cancer risk. Cells from FA patients exhibit spontaneous chromosomal instability and hypersensitivity to DNA interstrand cross-linking (ICL) agents. Although the precise mechanistic details of the FA/BRCA pathway of ICL-repair are not well understood, progress has been made in the identification of the FA proteins that are required for the pathway. Among the 13 FA complementation groups from which all the FA genes have been cloned, only a few of the FA proteins are predicted to have direct roles in DNA metabolism. One of the more recently identified FA proteins, shown to be responsible for complementation of the FA complementation group J, is the BRCA1 Associated C-terminal Helicase (BACH1, designated FANCJ), originally identified as a protein associated with breast cancer. FANCJ has been proposed to function downstream of FANCD2 monoubiquitination, a critical event in the FA pathway. Evidence supports a role for FANCJ in a homologous recombination (HR) pathway of double strand break (DSB) repair. In this review, we will summarize the current knowledge in terms of FANCJ functions through its enzymatic activities and protein interactions. The molecular roles of FANCJ in DNA repair and the response to replicational stress will be discussed. PMID:19519404

  10. The Complement System in Dialysis: A Forgotten Story?

    PubMed Central

    Poppelaars, Felix; Faria, Bernardo; Gaya da Costa, Mariana; Franssen, Casper F. M.; van Son, Willem J.; Berger, Stefan P.; Daha, Mohamed R.; Seelen, Marc A.

    2018-01-01

    Significant advances have lead to a greater understanding of the role of the complement system within nephrology. The success of the first clinically approved complement inhibitor has created renewed appreciation of complement-targeting therapeutics. Several clinical trials are currently underway to evaluate the therapeutic potential of complement inhibition in renal diseases and kidney transplantation. Although, complement has been known to be activated during dialysis for over four decades, this area of research has been neglected in recent years. Despite significant progress in biocompatibility of hemodialysis (HD) membranes and peritoneal dialysis (PD) fluids, complement activation remains an undesired effect and relevant issue. Short-term effects of complement activation include promoting inflammation and coagulation. In addition, long-term complications of dialysis, such as infection, fibrosis and cardiovascular events, are linked to the complement system. These results suggest that interventions targeting the complement system in dialysis could improve biocompatibility, dialysis efficacy, and long-term outcome. Combined with the clinical availability to safely target complement in patients, the question is not if we should inhibit complement in dialysis, but when and how. The purpose of this review is to summarize previous findings and provide a comprehensive overview of the role of the complement system in both HD and PD. PMID:29422906

  11. Evasion of Complement-Mediated Lysis and Complement C3 Deposition Are Regulated by Francisella tularensis Lipopolysaccharide O Antigen1

    PubMed Central

    Clay, Corey D.; Soni, Shilpa; Gunn, John S.; Schlesinger, Larry S.

    2009-01-01

    The bacterium Francisella tularensis (Ft) is a potential weapon of bioterrorism when aerosolized. Macrophage infection is necessary for disease progression and efficient phagocytosis by human macrophages requires serum opsonization by complement. Microbial complement activation leads to surface deposition of a highly regulated protein complex resulting in opsonization or membrane lysis. The nature of complement component C3 deposition, i.e., C3b (opsonization and lysis) or C3bi (opsonization only) fragment deposition, is central to the outcome of activation. In this study, we examine the mechanisms of Ft resistance to complement-mediated lysis, C3 component deposition on the Ft surface, and complement activation. Upon incubation in fresh nonimmune human serum, Schu S4 (Ft subsp. tularensis), Fn (Ft subsp. novicida), and LVS (Ft subsp. holarctica live vaccine strain) were resistant to complement-mediated lysis, but LVSG and LVSR (LVS strains altered in surface carbohydrate structures) were susceptible. C3 deposition, however, occurred on all strains. Complement-susceptible strains had markedly increased C3 fragment deposition, including the persistent presence of C3b compared with C3bi, which indicates that C3b inactivation results in survival of complement-resistant strains. C1q, an essential component of the classical activation pathway, was necessary for lysis of complement-susceptible strains and optimal C3 deposition on all strains. Finally, use of Francisella LPS mutants confirmed O Ag as a major regulator of complement resistance. These data provide evidence that pathogenic Francisella activate complement, but are resistant to complement-mediated lysis in part due to limited C3 deposition, rapid conversion of surface-bound C3b to C3bi, and the presence of LPS O Ag. PMID:18832715

  12. Molecular and cellular analysis of the DNA repair defect in a patient in Xeroderma pigmentosum complementation group D who has the clinical features of Xeroderma pigmentosum and Cockayne syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Broughton, B.C.; Thompson, A.F.; Harcourt, S.A.

    1995-01-01

    Xeroderma pigmentosum (XP) and Cockayne syndrome (CS) are quite distinct genetic disorders that are associated with defects in excision repair of UV-induced DNA damage. A few patients have been described previously with the clinical features of both disorders. In this paper we describe an individual in this category who has unusual cellular responses to UV light. We show that his cultured fibroblasts and lymphocytes are extremely sensitive to irradiation with UV-C, despite a level of nucleotide excision repair that is 30%-40% that of normal cells. The deficiency is assigned to the XP-D complementation group, and we have identified two causativemore » mutations in the XPD gene: a gly{yields}arg change at amino acid 675 in the allele inherited from the patient`s mother and a -1 frameshift at amino acid 669 in the allele inherited from his father. These mutations are in the C-terminal 20% of the 760-amino-acid XPD protein, in a region where we have recently identified several mutations in patients with trichothiodystrophy. 44 refs., 5 figs., 2 tabs.« less

  13. 28 CFR 812.2 - Individuals subject to DNA collection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Individuals subject to DNA collection... DISTRICT OF COLUMBIA COLLECTION AND USE OF DNA INFORMATION § 812.2 Individuals subject to DNA collection. CSOSA is responsible for collecting a DNA sample from each individual under its supervision who is, or...

  14. 28 CFR 812.2 - Individuals subject to DNA collection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Individuals subject to DNA collection... DISTRICT OF COLUMBIA COLLECTION AND USE OF DNA INFORMATION § 812.2 Individuals subject to DNA collection. CSOSA is responsible for collecting a DNA sample from each individual under its supervision who is, or...

  15. 28 CFR 812.2 - Individuals subject to DNA collection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Individuals subject to DNA collection... DISTRICT OF COLUMBIA COLLECTION AND USE OF DNA INFORMATION § 812.2 Individuals subject to DNA collection. CSOSA is responsible for collecting a DNA sample from each individual under its supervision who is, or...

  16. 28 CFR 812.2 - Individuals subject to DNA collection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Individuals subject to DNA collection... DISTRICT OF COLUMBIA COLLECTION AND USE OF DNA INFORMATION § 812.2 Individuals subject to DNA collection. CSOSA is responsible for collecting a DNA sample from each individual under its supervision who is, or...

  17. 28 CFR 812.2 - Individuals subject to DNA collection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Individuals subject to DNA collection... DISTRICT OF COLUMBIA COLLECTION AND USE OF DNA INFORMATION § 812.2 Individuals subject to DNA collection. CSOSA is responsible for collecting a DNA sample from each individual under its supervision who is, or...

  18. Structural dynamics and interactions of Xeroderma pigmentosum complementation group A (XPA98-210) with damaged DNA.

    PubMed

    Pradhan, Sushmita; Mattaparthi, Venkata Satish Kumar

    2017-10-25

    Nucleotide excision repair (NER) in higher organisms repair massive DNA abrasions caused by ultraviolet rays, and various mutagens, where Xeroderma pigmentosum group A (XPA) protein is known to be involved in damage recognition step. Any mutations in XPA cause classical Xeroderma pigmentosum disease. The extent to which XPA is required in the NER is still unclear. Here, we present the comparative study on the structural and conformational changes in globular DNA binding domain of XPA 98-210 in DNA bound and DNA free state. Atomistic molecular dynamics simulation was carried out for both XPA 98-210 systems using AMBER force fields. We observed that XPA 98-210 in presence of damaged DNA exhibited more structural changes compared to XPA 98-210 in its free form. When XPA is in contact with DNA, we found marked stability of the complex due to the formation of characteristic longer antiparallel β-sheets consisting mainly lysine residues.

  19. Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

    PubMed Central

    Fadrosh, Douglas W.; Andrews-Pfannkoch, Cynthia; Williamson, Shannon J.

    2011-01-01

    Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community’s genetic signature. Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using

  20. Complement activation promotes muscle inflammation during modified muscle use

    NASA Technical Reports Server (NTRS)

    Frenette, J.; Cai, B.; Tidball, J. G.

    2000-01-01

    Modified muscle use can result in muscle inflammation that is triggered by unidentified events. In the present investigation, we tested whether the activation of the complement system is a component of muscle inflammation that results from changes in muscle loading. Modified rat hindlimb muscle loading was achieved by removing weight-bearing from the hindlimbs for 10 days followed by reloading through normal ambulation. Experimental animals were injected with the recombinant, soluble complement receptor sCR1 to inhibit complement activation. Assays for complement C4 or factor B in sera showed that sCR1 produced large reductions in the capacity for activation of the complement system through both the classical and alternative pathways. Analysis of complement C4 concentration in serum in untreated animals showed that the classical pathway was activated during the first 2 hours of reloading. Analysis of factor B concentration in untreated animals showed activation of the alternative pathway at 6 hours of reloading. Administration of sCR1 significantly attenuated the invasion of neutrophils (-49%) and ED1(+) macrophages (-52%) that occurred in nontreated animals after 6 hours of reloading. The presence of sCR1 also reduced significantly the degree of edema by 22% as compared to untreated animals. Together, these data show that increased muscle loading activated the complement system which then briefly contributes to the early recruitment of inflammatory cells during modified muscle loading.

  1. Neutrophil extracellular traps can activate alternative complement pathways.

    PubMed

    Wang, H; Wang, C; Zhao, M-H; Chen, M

    2015-09-01

    The interaction between neutrophils and activation of alternative complement pathway plays a pivotal role in the pathogenesis of anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV). ANCAs activate primed neutrophils to release neutrophil extracellular traps (NETs), which have recently gathered increasing attention in the development of AAV. The relationship between NETs and alternative complement pathway has not been elucidated. The current study aimed to investigate the relationship between NETs and alternative complement pathway. Detection of components of alternative complement pathway on NETs in vitro was assessed by immunostain and confocal microscopy. Complement deposition on NETs were detected after incubation with magnesium salt ethyleneglycol tetraacetic acid (Mg-EGTA)-treated human serum. After incubation of serum with supernatants enriched in ANCA-induced NETs, levels of complement components in supernatants were measured by enzyme-linked immunosorbent assay (ELISA). Complement factor B (Bb) and properdin deposited on NETs in vitro. The deposition of C3b and C5b-9 on NETs incubated with heat-inactivated normal human serum (Hi-NHS) or EGTA-treated Hi-NHS (Mg-EGTA-Hi-NHS) were significantly less than that on NETs incubated with NHS or EGTA-treated NHS (Mg-EGTA-NHS). NETs induced by ANCA could activate the alternative complement cascade in the serum. In the presence of EGTA, C3a, C5a and SC5b-9 concentration decreased from 800·42 ± 244·81 ng/ml, 7·68 ± 1·50 ng/ml, 382·15 ± 159·75 ng/ml in the supernatants enriched in ANCA induced NETs to 479·07 ± 156·2 ng/ml, 4·86 ± 1·26 ng/ml, 212·65 ± 44·40 ng/ml in the supernatants of DNase I-degraded NETs (P < 0·001, P = 0·008, P < 0·001, respectively). NETs could activate the alternative complement pathway, and might thus participate in the pathogenesis of AAV. © 2015 British Society for Immunology.

  2. Complement System Part II: Role in Immunity

    PubMed Central

    Merle, Nicolas S.; Noe, Remi; Halbwachs-Mecarelli, Lise; Fremeaux-Bacchi, Veronique; Roumenina, Lubka T.

    2015-01-01

    The complement system has been considered for a long time as a simple lytic cascade, aimed to kill bacteria infecting the host organism. Nowadays, this vision has changed and it is well accepted that complement is a complex innate immune surveillance system, playing a key role in host homeostasis, inflammation, and in the defense against pathogens. This review discusses recent advances in the understanding of the role of complement in physiology and pathology. It starts with a description of complement contribution to the normal physiology (homeostasis) of a healthy organism, including the silent clearance of apoptotic cells and maintenance of cell survival. In pathology, complement can be a friend or a foe. It acts as a friend in the defense against pathogens, by inducing opsonization and a direct killing by C5b–9 membrane attack complex and by triggering inflammatory responses with the anaphylatoxins C3a and C5a. Opsonization plays also a major role in the mounting of an adaptive immune response, involving antigen presenting cells, T-, and B-lymphocytes. Nevertheless, it can be also an enemy, when pathogens hijack complement regulators to protect themselves from the immune system. Inadequate complement activation becomes a disease cause, as in atypical hemolytic uremic syndrome, C3 glomerulopathies, and systemic lupus erythematosus. Age-related macular degeneration and cancer will be described as examples showing that complement contributes to a large variety of conditions, far exceeding the classical examples of diseases associated with complement deficiencies. Finally, we discuss complement as a therapeutic target. PMID:26074922

  3. Immunogenicity of an HPV-16 L2 DNA vaccine

    PubMed Central

    Hitzeroth, Inga I.; Passmore, Jo-Ann S.; Shephard, Enid; Stewart, Debbie; Müller, Martin; Williamson, Anna-Lise; Rybicki, Edward P.; Kast, W. Martin

    2009-01-01

    The ability to elicit cross-neutralizing antibodies makes human papillomavirus (HPV) L2 capsid protein a possible HPV vaccine. We examined and compared the humoral response of mice immunised with a HPV-16 L2 DNA vaccine or with HPV-16 L2 protein. The L2 DNA vaccine elicited a non-neutralising antibody response unlike the L2 protein. L2 DNA vaccination suppressed the growth of L2-expressing C3 tumor cells, which is a T cell mediated effect, demonstrating that the lack of non-neutralizing antibody induction by L2 DNA was not caused by lack of T cell immunogenicity of the construct. PMID:19559114

  4. Structural insights into the functions of the FANCM-FAAP24 complex in DNA repair

    PubMed Central

    Yang, Hui; Zhang, Tianlong; Tao, Ye; Wang, Fang; Tong, Liang; Ding, Jianping

    2013-01-01

    Fanconi anemia (FA) is a genetically heterogeneous disorder associated with deficiencies in the FA complementation group network. FA complementation group M (FANCM) and FA-associated protein 24 kDa (FAAP24) form a stable complex to anchor the FA core complex to chromatin in repairing DNA interstrand crosslinks. Here, we report the first crystal structure of the C-terminal segment of FANCM in complex with FAAP24. The C-terminal segment of FANCM and FAAP24 both consist of a nuclease domain at the N-terminus and a tandem helix-hairpin-helix (HhH)2 domain at the C-terminus. The FANCM-FAAP24 complex exhibits a similar architecture as that of ApXPF. However, the variations of several key residues and the electrostatic property at the active-site region render a catalytically inactive nuclease domain of FANCM, accounting for the lack of nuclease activity. We also show that the first HhH motif of FAAP24 is a potential binding site for DNA, which plays a critical role in targeting FANCM-FAAP24 to chromatin. These results reveal the mechanistic insights into the functions of FANCM-FAAP24 in DNA repair. PMID:24003026

  5. Damage-dependent regulation of MUS81-EME1 by Fanconi anemia complementation group A protein

    PubMed Central

    Benitez, Anaid; Yuan, Fenghua; Nakajima, Satoshi; Wei, Leizhen; Qian, Liangyue; Myers, Richard; Hu, Jennifer J.; Lan, Li; Zhang, Yanbin

    2014-01-01

    MUS81-EME1 is a DNA endonuclease involved in replication-coupled repair of DNA interstrand cross-links (ICLs). A prevalent hypothetical role of MUS81-EME1 in ICL repair is to unhook the damage by incising the leading strand at the 3′ side of an ICL lesion. In this study, we report that purified MUS81-EME1 incises DNA at the 5′ side of a psoralen ICL residing in fork structures. Intriguingly, ICL repair protein, Fanconi anemia complementation group A protein (FANCA), greatly enhances MUS81-EME1-mediated ICL incision. On the contrary, FANCA exhibits a two-phase incision regulation when DNA is undamaged or the damage affects only one DNA strand. Studies using truncated FANCA proteins indicate that both the N- and C-moieties of the protein are required for the incision regulation. Using laser-induced psoralen ICL formation in cells, we find that FANCA interacts with and recruits MUS81 to ICL lesions. This report clarifies the incision specificity of MUS81-EME1 on ICL damage and establishes that FANCA regulates the incision activity of MUS81-EME1 in a damage-dependent manner. PMID:24170812

  6. Complement anaphylatoxins as immune regulators in cancer.

    PubMed

    Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

    2014-08-01

    The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  7. Targeting complement-mediated immunoregulation for cancer immunotherapy.

    PubMed

    Kolev, Martin; Markiewski, Maciej M

    2018-06-01

    Complement was initially discovered as an assembly of plasma proteins "complementing" the cytolytic activity of antibodies. However, our current knowledge places this complex system of several plasma proteins, receptors, and regulators in the center of innate immunity as a bridge between the initial innate responses and adaptive immune reactions. Consequently, complement appears to be pivotal for elimination of pathogens, not only as an early response defense, but by directing the subsequent adaptive immune response. The discovery of functional intracellular complement and its roles in cellular metabolism opened novel avenues for research and potential therapeutic implications. The recent studies demonstrating immunoregulatory functions of complement in the tumor microenvironment and the premetastatic niche shifted the paradigm on our understanding of functions of the complement system in regulating immunity. Several complement proteins, through their interaction with cells in the tumor microenvironment and in metastasis-targeted organs, contribute to modulating tumor growth, antitumor immunity, angiogenesis, and therefore, the overall progression of malignancy and, perhaps, responsiveness of cancer to different therapies. Here, we focus on recent progress in our understanding of immunostimulatory vs. immunoregulatory functions of complement and potential applications of these findings to the design of novel therapies for cancer patients. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Protection of host cells by complement regulators.

    PubMed

    Schmidt, Christoph Q; Lambris, John D; Ricklin, Daniel

    2016-11-01

    The complement cascade is an ancient immune-surveillance system that not only provides protection from pathogen invasion but has also evolved to participate in physiological processes to maintain tissue homeostasis. The alternative pathway (AP) of complement activation is the evolutionarily oldest part of this innate immune cascade. It is unique in that it is continuously activated at a low level and arbitrarily probes foreign, modified-self, and also unaltered self-structures. This indiscriminate activation necessitates the presence of preformed regulators on autologous surfaces to spare self-cells from the undirected nature of AP activation. Although the other two canonical complement activation routes, the classical and lectin pathways, initiate the cascade more specifically through pattern recognition, their activity still needs to be tightly controlled to avoid excessive reactivity. It is the perpetual duty of complement regulators to protect the self from damage inflicted by inadequate complement activation. Here, we review the role of complement regulators as preformed mediators of defense, explain their common and specialized functions, and discuss selected cases in which alterations in complement regulators lead to disease. Finally, rational engineering approaches using natural complement inhibitors as potential therapeutics are highlighted. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Complement Test

    MedlinePlus

    ... Salicylates Semen Analysis Serotonin Serum Free Light Chains Sex Hormone Binding Globulin (SHBG) Shiga toxin-producing Escherichia ... and forming complexes that respond to infections, non-self tissues (transplants), dead cells ... KJ. Complement determinations in human disease. Ann Allergy Asthma Immunol . 2004; ...

  10. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  11. DNA transformation via local heat shock

    NASA Astrophysics Data System (ADS)

    Li, Sha; Meadow Anderson, L.; Yang, Jui-Ming; Lin, Liwei; Yang, Haw

    2007-07-01

    This work describes transformation of foreign DNA into bacterial host cells by local heat shock using a microfluidic system with on-chip, built-in platinum heaters. Plasmid DNA encoding ampicillin resistance and a fluorescent protein can be effectively transformed into the DH5α chemically competent E. coli using this device. Results further demonstrate that only one-thousandth of volume is required to obtain transformation efficiencies as good as or better than conventional practices. As such, this work complements other lab-on-a-chip technologies for potential gene cloning/therapy and protein expression applications.

  12. Guilty as charged: all available evidence implicates complement's role in fetal demise.

    PubMed

    Girardi, Guillermina

    2008-03-01

    Appropriate complement inhibition is an absolute requirement for normal pregancy. Uncontrolled complement activation in the maternal-fetal interface leads to fetal death. Here we show that complement activation is a crucial and early mediator of pregnancy loss in two different mouse models of pregnancy loss. Using a mouse model of fetal loss and growth restriction (IUGR) induced by antiphospholipid antibodies (aPL), we examined the role of complement activation in fetal loss and IUGR. We found that C5a-C5aR interaction and neutrophils are key mediators of fetal injury. Treatment with heparin, the standard therapy for pregnant patients with aPL, prevents complement activation and protects mice from pregnancy complications induced by aPL, and anticoagulants that do not inhibit complement do not protect pregnancies. In an antibody-independent mouse model of spontaneous miscarriage and IUGR (CBA/JxDBA/2) we also identified C5a as an essential mediator. Complement activation caused dysregulation of the angiogenic factors required for normal placental development. In CBA/JxDBA/2 mice, we observed inflammatory infiltrates in placentas, functional deficiency of free vascular endothelial growth factor (VEGF), elevated levels of soluble VEGF receptor-1 (sVEGFR-1, also known as sFlt-1; a potent anti-angiogenic molecule), and defective placental development. Inhibition of complement activation blocked the increase in sVEGFR-1 and rescued pregnancies. Our studies in antibody-dependent and antibody-independent models of pregnancy complications identified complement activation as the key mediator of damage and will allow development of new interventions to prevent pregnancy loss and IUGR.

  13. Electrochemical DNA probe for Hg(2+) detection based on a triple-helix DNA and Multistage Signal Amplification Strategy.

    PubMed

    Wang, Huan; Zhang, Yihe; Ma, Hongmin; Ren, Xiang; Wang, Yaoguang; Zhang, Yong; Wei, Qin

    2016-12-15

    In this work, an ultrasensitive electrochemical sensor was developed for detection of Hg(2+). Gold nanoparticles decorated bovine serum albumin reduction of graphene oxide (AuNP-BSA-rGO) were used as subsurface material for the immobilization of triple-helix DNA. The triple-helix DNA containing a thiol labelled single-stranded DNA (sDNA) and a thymine-rich DNA (T-rich DNA), which could be unwinded in the present of Hg(2+) to form more stable thymine-Hg(2+)-thymine (T-Hg(2+)-T) complex. T-Hg(2+)-T complex was then removed and the sDNA was left on the electrode. At this time, gold nanoparticle carrying thiol labelled cytosine-rich complementary DNA (cDNA-AuNP) could bind with the free sDNA. Meanwhile, the other free cDNA on AuNP could bind with each other in the present of Ag(+) to form the stable cytosine-Ag(+)-cytosine (C-Ag(+)-C) complex and circle amplification. Plenty of C-Ag(+)-C could form silver nanoclusters by electrochemical reduction and the striping signal of Ag could be measured for purpose of the final electrochemical detection of Hg(2+). This sensor could detect Hg(2+) over a wide concentration range from 0.1 to 130nM with a detection limit of 0.03nM. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Inhibition of HMGA2 binding to DNA by netropsin

    PubMed Central

    Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

    2008-01-01

    The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

  15. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    PubMed

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  16. Identification of a central role for complement in osteoarthritis

    PubMed Central

    Wang, Qian; Rozelle, Andrew L.; Lepus, Christin M.; Scanzello, Carla R.; Song, Jason J.; Larsen, D. Meegan; Crish, James F.; Bebek, Gurkan; Ritter, Susan Y.; Lindstrom, Tamsin M.; Hwang, Inyong; Wong, Heidi H.; Punzi, Leonardo; Encarnacion, Angelo; Shamloo, Mehrdad; Goodman, Stuart B.; Wyss-Coray, Tony; Goldring, Steven R.; Banda, Nirmal K.; Thurman, Joshua M.; Gobezie, Reuben; Crow, Mary K.; Holers, V. Michael; Lee, David M.; Robinson, William H.

    2011-01-01

    Osteoarthritis, characterized by the breakdown of articular cartilage in synovial joints, has long been viewed as the result of “wear and tear”1. Although low-grade inflammation is detected in osteoarthritis, its role is unclear2–4. Here we identify a central role for the inflammatory complement system in the pathogenesis of osteoarthritis. Through proteomic and transcriptomic analyses of synovial fluids and membranes from individuals with osteoarthritis, we find that expression and activation of complement is abnormally high in human osteoarthritic joints. Using mice genetically deficient in C5, C6, or CD59a, we show that complement, and specifically the membrane attack complex (MAC)-mediated arm of complement, is critical to the development of arthritis in three different mouse models of osteoarthritis. Pharmacological modulation of complement in wild-type mice confirmed the results obtained with genetically deficient mice. Expression of inflammatory and degradative molecules was lower in chondrocytes from destabilized joints of C5-deficient mice than C5-sufficient mice, and MAC induced production of these molecules in cultured chondrocytes. Furthermore, MAC co-localized with matrix metalloprotease (MMP)-13 and with activated extracellular signal-regulated kinase (ERK) around chondrocytes in human osteoarthritic cartilage. Our findings indicate that dysregulation of complement in synovial joints plays a critical role in the pathogenesis of osteoarthritis. PMID:22057346

  17. 21 CFR 866.5240 - Complement components immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    .... 866.5240 Section 866.5240 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... complement components C1q, C1r, C1s, C2, C3, C4, C5, C6, C7, C8, and C9, in serum, other body fluids, and tissues. Complement is a group of serum proteins which destroy infectious agents. Measurements of these...

  18. 21 CFR 866.5240 - Complement components immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    .... 866.5240 Section 866.5240 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... complement components C1q, C1r, C1s, C2, C3, C4, C5, C6, C7, C8, and C9, in serum, other body fluids, and tissues. Complement is a group of serum proteins which destroy infectious agents. Measurements of these...

  19. 21 CFR 866.5240 - Complement components immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    .... 866.5240 Section 866.5240 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... complement components C1q, C1r, C1s, C2, C3, C4, C5, C6, C7, C8, and C9, in serum, other body fluids, and tissues. Complement is a group of serum proteins which destroy infectious agents. Measurements of these...

  20. 21 CFR 866.5240 - Complement components immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    .... 866.5240 Section 866.5240 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... complement components C1q, C1r, C1s, C2, C3, C4, C5, C6, C7, C8, and C9, in serum, other body fluids, and tissues. Complement is a group of serum proteins which destroy infectious agents. Measurements of these...

  1. Construction of a Schizosaccharomyces pombe gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation.

    PubMed

    Beach, D; Piper, M; Nurse, P

    1982-01-01

    A gene bank of partial Sau3A restriction fragments of S. pombe DNA has been constructed in the plasmid vector, pDB248', which is capable of high frequency transformation of S. pombe. Procedures are described which enable plasmids to be recovered from S. pombe by their reintroduction into E. coli. These methods have been used to detect the S. pombe genes lys 1+, ade 6+ and his 2+ in the gene bank by complementation of mutant gene functions, and to physically isolate the lys 1+ gene.

  2. DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

    PubMed Central

    Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

    2000-01-01

    The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

  3. Development of DNA biosensor based on TiO2 nanoparticles

    NASA Astrophysics Data System (ADS)

    Nadzirah, Sh.; Hashim, U.; Rusop, M.

    2018-05-01

    A novel technique of DNA hybridization on the TiO2 nanoparticles film was developed by dropping a single droplet of target DNA onto the surface of TiO2 for the study of various concentrations of target DNA. The surface of TiO2 nanoparticle film was functionalized with APTES and covalently immobilized with 1 µM probe DNA on the silanized TiO2 nanoparticles surface. The effect of silanization, immobilization and hybridization were quantitatively measured by the output current signal obtained using a picoammeter. The 1 µM target DNA was found to be the most effective target towards the 1 µM probe DNA as the output current signal was within range; while the output current signal of the 10 µM target DNA was observed to beyond the range of the probe DNA control due to the excessive concentration as compared to the probe DNA. This approach has several advantages such as rapid, simple, low cost, and sensitive current signal during detection of different target DNA concentrations.

  4. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tuskan, Gerald A; Gunter, Lee E; DiFazio, Stephen P

    The 18S-28S rDNA and 5S rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 18S-28S rDNA sites and one 5S rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis -type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones selected from 2 linkage groups based on genome sequence assembly (LG-I and LG-VI) were localized on 2 chromosomes, as expected. BACs from LG-I hybridized to the longest chromosome in the complement. All BAC positions were found to be concordant with sequencemore » assembly positions. BAC-FISH will be useful for delineating each of the Populus trichocarpa chromosomes and improving the sequence assembly of this model angiosperm tree species.« less

  5. Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion.

    PubMed

    Hovingh, Elise S; van den Broek, Bryan; Jongerius, Ilse

    2016-01-01

    The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed.

  6. Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion

    PubMed Central

    Hovingh, Elise S.; van den Broek, Bryan; Jongerius, Ilse

    2016-01-01

    The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed. PMID:28066340

  7. Targeted transgenic overexpression of mitochondrial thymidine kinase (TK2) alters mitochondrial DNA (mtDNA) and mitochondrial polypeptide abundance: transgenic TK2, mtDNA, and antiretrovirals.

    PubMed

    Hosseini, Seyed H; Kohler, James J; Haase, Chad P; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William

    2007-03-01

    Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-gamma. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK1) were used to study NRTI mitochondrial toxicity. Echocardiography and nuclear magnetic resonance imaging defined cardiac performance and structure. TK gene copy and enzyme activity, mitochondrial (mt) DNA and polypeptide abundance, succinate dehydrogenase and cytochrome oxidase histochemistry, and electron microscopy correlated with transgenesis, mitochondrial structure, and biogenesis. Antiretroviral combinations simulated therapy. Untreated hTK1 or TK2 TGs exhibited normal left ventricle mass. In TK2 TGs, cardiac TK2 gene copy doubled, activity increased 300-fold, and mtDNA abundance doubled. Abundance of the 17-kd subunit of complex I, succinate dehydrogenase histochemical activity, and cristae density increased. NRTIs increased left ventricle mass 20% in TK2 TGs. TK activity increased 3 logs in hTK1 TGs, but no cardiac phenotype resulted. NRTIs abrogated functional effects of transgenically increased TK2 activity but had no effect on TK2 mtDNA abundance. Thus, NRTI mitochondrial phosphorylation by TK2 is integral to clinical NRTI mitochondrial toxicity.

  8. Complement in Non-Antibody-Mediated Kidney Diseases

    PubMed Central

    Angeletti, Andrea; Reyes-Bahamonde, Joselyn; Cravedi, Paolo; Campbell, Kirk N.

    2017-01-01

    The complement system is part of the innate immune response that plays important roles in protecting the host from foreign pathogens. The complement components and relative fragment deposition have long been recognized to be strongly involved also in the pathogenesis of autoantibody-related kidney glomerulopathies, leading to direct glomerular injury and recruitment of infiltrating inflammation pathways. More recently, unregulated complement activation has been shown to be associated with progression of non-antibody-mediated kidney diseases, including focal segmental glomerulosclerosis, C3 glomerular disease, thrombotic microangiopathies, or general fibrosis generation in progressive chronic kidney diseases. Some of the specific mechanisms associated with complement activation in these diseases were recently clarified, showing a dominant role of alternative activation pathway. Over the last decade, a growing number of anticomplement agents have been developed, and some of them are being approved for clinical use or already in use. Therefore, anticomplement therapies represent a realistic choice of therapeutic approaches for complement-related diseases. Herein, we review the complement system activation, regulatory mechanisms, their involvement in non-antibody-mediated glomerular diseases, and the recent advances in complement-targeting agents as potential therapeutic strategies. PMID:28748184

  9. Caffeine impairs resection during DNA break repair by reducing the levels of nucleases Sae2 and Dna2

    PubMed Central

    Tsabar, Michael; Eapen, Vinay V.; Mason, Jennifer M.; Memisoglu, Gonen; Waterman, David P.; Long, Marcus J.; Bishop, Douglas K.; Haber, James E.

    2015-01-01

    In response to chromosomal double-strand breaks (DSBs), eukaryotic cells activate the DNA damage checkpoint, which is orchestrated by the PI3 kinase-like protein kinases ATR and ATM (Mec1 and Tel1 in budding yeast). Following DSB formation, Mec1 and Tel1 phosphorylate histone H2A on serine 129 (known as γ-H2AX). We used caffeine to inhibit the checkpoint kinases after DSB induction. We show that prolonged phosphorylation of H2A-S129 does not require continuous Mec1 and Tel1 activity. Unexpectedly, caffeine treatment impaired homologous recombination by inhibiting 5′ to 3′ end resection, independent of Mec1 and Tel1 inhibition. Caffeine treatment led to the rapid loss, by proteasomal degradation, of both Sae2, a nuclease that plays a role in early steps of resection, and Dna2, a nuclease that facilitates one of two extensive resection pathways. Sae2's instability is evident in the absence of DNA damage. A similar loss is seen when protein synthesis is inhibited by cycloheximide. Caffeine treatment had similar effects on irradiated HeLa cells, blocking the formation of RPA and Rad51 foci that depend on 5′ to 3′ resection of broken chromosome ends. Our findings provide insight toward the use of caffeine as a DNA damage-sensitizing agent in cancer cells. PMID:26019182

  10. The Syntax of Sentential Complementation in Turkish

    ERIC Educational Resources Information Center

    Predolac, Esra

    2017-01-01

    This dissertation examines primarily the syntactic, but also the semantic/pragmatic behavior of sentential complement clauses in Turkish and proposes a new classification of such complements. A head-final language, Turkish lacks an overt, lexical complementizer akin to English "that". The most frequent types of sentential complementation…

  11. Evidence for a repair enzyme complex involving ERCC1 and complementing activities of ERCC4, ERCC11 and xeroderma pigmentosum group F.

    PubMed Central

    van Vuuren, A J; Appeldoorn, E; Odijk, H; Yasui, A; Jaspers, N G; Bootsma, D; Hoeijmakers, J H

    1993-01-01

    Nucleotide excision repair (NER), one of the major cellular DNA repair systems, removes a wide range of lesions in a multi-enzyme reaction. In man, a NER defect due to a mutation in one of at least 11 distinct genes, can give rise to the inherited repair disorders xeroderma pigmentosum (XP), Cockayne's syndrome or PIBIDS, a photosensitive form of the brittle hair disease trichothiodystrophy. Laboratory-induced NER-deficient mutants of cultured rodent cells have been classified into 11 complementation groups (CGs). Some of these have been shown to correspond with human disorders. In cell-free extracts prepared from rodent CGs 1-5 and 11, but not in a mutant from CG6, we find an impaired repair of damage induced in plasmids by UV light and N-acetoxy-acetylaminofluorene. Complementation analysis in vitro of rodent CGs is accomplished by pairwise mixing of mutant extracts. The results show that mutants from groups 2, 3, 5 and XP-A can complement all other CGs tested. However, selective non-complementation in vitro was observed in mutual mixtures of groups 1, 4, 11 and XP-F, suggesting that the complementing activities involved somehow affect each other. Depletion of wild-type human extracts from ERCC1 protein using specific anti-ERCC1 antibodies concomitantly removed the correcting activities for groups 4, 11 and XP-F, but not those for the other CGs. Furthermore, we find that 33 kDa ERCC1 protein sediments as a high mol. wt species of approximately 120 kDa in a native glycerol gradient.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8253091

  12. Dengue-Immune Humans Have Higher Levels of Complement-Independent Enhancing Antibody than Complement-Dependent Neutralizing Antibody.

    PubMed

    Yamanaka, Atsushi; Konishi, Eiji

    2017-09-25

    Dengue is the most important arboviral disease worldwide. We previously reported that most inhabitants of dengue-endemic countries who are naturally immune to the disease have infection-enhancing antibodies whose in vitro activity does not decrease in the presence of complement (complement-independent enhancing antibodies, or CiEAb). Here, we compared levels of CiEAb and complement-dependent neutralizing antibodies (CdNAb) in dengue-immune humans. A typical antibody dose-response pattern obtained in our assay system to measure the balance between neutralizing and enhancing antibodies showed both neutralizing and enhancing activities depending on serum dilution factor. The addition of complement to the assay system increased the activity of neutralizing antibodies at lower dilutions, indicating the presence of CdNAb. In contrast, similar dose-response curves were obtained with and without complement at higher dilutions, indicating higher levels of CiEAb than CdNAb. For experimental support for the higher CiEAb levels, a cocktail of mouse monoclonal antibodies against dengue virus type 1 was prepared. The antibody dose-response curves obtained in this assay, with or without complement, were similar to those obtained with human serum samples when a high proportion of D1-V-3H12 (an antibody exhibiting only enhancing activity and thus a model for CiEAb) was used in the cocktail. This study revealed higher-level induction of CiEAb than CdNAb in humans naturally infected with dengue viruses.

  13. Evolutionary Analysis of Heterochromatin Protein Compatibility by Interspecies Complementation in Saccharomyces

    PubMed Central

    Zill, Oliver A.; Scannell, Devin R.; Kuei, Jeffrey; Sadhu, Meru; Rine, Jasper

    2012-01-01

    The genetic bases for species-specific traits are widely sought, but reliable experimental methods with which to identify functionally divergent genes are lacking. In the Saccharomyces genus, interspecies complementation tests can be used to evaluate functional conservation and divergence of biological pathways or networks. Silent information regulator (SIR) proteins in S. bayanus provide an ideal test case for this approach because they show remarkable divergence in sequence and paralog number from those found in the closely related S. cerevisiae. We identified genes required for silencing in S. bayanus using a genetic screen for silencing-defective mutants. Complementation tests in interspecies hybrids identified an evolutionarily conserved Sir-protein-based silencing machinery, as defined by two interspecies complementation groups (SIR2 and SIR3). However, recessive mutations in S. bayanus SIR4 isolated from this screen could not be complemented by S. cerevisiae SIR4, revealing species-specific functional divergence in the Sir4 protein despite conservation of the overall function of the Sir2/3/4 complex. A cladistic complementation series localized the occurrence of functional changes in SIR4 to the S. cerevisiae and S. paradoxus branches of the Saccharomyces phylogeny. Most of this functional divergence mapped to sequence changes in the Sir4 PAD. Finally, a hemizygosity modifier screen in the interspecies hybrids identified additional genes involved in S. bayanus silencing. Thus, interspecies complementation tests can be used to identify (1) mutations in genetically underexplored organisms, (2) loci that have functionally diverged between species, and (3) evolutionary events of functional consequence within a genus. PMID:22923378

  14. A High-throughput Selection for Cellulase Catalysts Using Chemical Complementation

    PubMed Central

    Peralta-Yahya, Pamela; Carter, Brian T.; Lin, Hening; Tao, Haiyan; Cornish, Virginia W.

    2010-01-01

    Efficient enzymatic hydrolysis of lignocellulosic material remains one of the major bottlenecks to cost-effective conversion of biomass to ethanol. Improvement of glycosylhydrolases however is limited by existing medium-throughput screening technologies. Here, we report the first high-throughput selection for cellulase catalysts. This selection was developed by adapting chemical complementation to provide a growth assay for bond cleavage reactions. First, a URA3 counter selection was adapted to link chemical dimerizer activated gene transcription to cell death. Next, the URA3 counter selection was shown to detect cellulase activity based on cleavage of a tetrasaccharide chemical dimerizer substrate and decrease in expression of the toxic URA3 reporter. Finally, the utility of the cellulase selection was assessed by isolating cellulases with improved activity from a cellulase library created by family DNA shuffling. This application provides further evidence that chemical complementation can be readily adapted to detect different enzymatic activities for important chemical transformations for which no natural selection exists. Due to the large number of enzyme variants selections can test compared to existing medium-throughput screens for cellulases, this assay has the potential to impact the discovery of improved cellulases and other glycosylhydrolases for biomass conversion from libraries of cellulases created by mutagenesis or obtained from natural biodiversity. PMID:19053460

  15. DNA Gyrase Is Involved in Chloroplast Nucleoid Partitioning

    PubMed Central

    Cho, Hye Sun; Lee, Sang Sook; Kim, Kwang Dong; Hwang, Inhwan; Lim, Jong-Seok; Park, Youn-Il; Pai, Hyun-Sook

    2004-01-01

    DNA gyrase, which catalyzes topological transformation of DNA, plays an essential role in replication and transcription in prokaryotes. Virus-induced gene silencing of NbGyrA or NbGyrB, which putatively encode DNA gyrase subunits A and B, respectively, resulted in leaf yellowing phenotypes in Nicotiana benthamiana. NbGyrA and NbGyrB complemented the gyrA and gyrB temperature-sensitive mutations of Escherichia coli, respectively, which indicates that the plant and bacterial subunits are functionally similar. NbGyrA and NbGyrB were targeted to both chloroplasts and mitochondria, and depletion of these subunits affected both organelles by reducing chloroplast numbers and inducing morphological and physiological abnormalities in both organelles. Flow cytometry analysis revealed that the average DNA content in the affected chloroplasts and mitochondria was significantly higher than in the control organelles. Furthermore, 4′,6-diamidino-2-phenylindole staining revealed that the abnormal chloroplasts contained one or a few large nucleoids instead of multiple small nucleoids dispersed throughout the stroma. Pulse-field gel electrophoresis analyses of chloroplasts demonstrated that the sizes and/or structure of the DNA molecules in the abnormal chloroplast nucleoids are highly aberrant. Based on these results, we propose that DNA gyrase plays a critical role in chloroplast nucleoid partitioning by regulating DNA topology. PMID:15367714

  16. Effect of SOS-induced levels of imuABC on spontaneous and damage-induced mutagenesis in Caulobacter crescentus.

    PubMed

    Alves, Ingrid R; Lima-Noronha, Marco A; Silva, Larissa G; Fernández-Silva, Frank S; Freitas, Aline Luiza D; Marques, Marilis V; Galhardo, Rodrigo S

    2017-11-01

    imuABC (imuAB dnaE2) genes are responsible for SOS-mutagenesis in Caulobacter crescentus and other bacterial species devoid of umuDC. In this work, we have constructed operator-constitutive mutants of the imuABC operon. We used this genetic tool to investigate the effect of SOS-induced levels of these genes upon both spontaneous and damage-induced mutagenesis. We showed that constitutive expression of imuABC does not increase spontaneous or damage-induced mutagenesis, nor increases cellular resistance to DNA-damaging agents. Nevertheless, the presence of the operator-constitutive mutation rescues mutagenesis in a recA background, indicating that imuABC are the only genes required at SOS-induced levels for translesion synthesis (TLS) in C. crescentus. Furthermore, these data also show that TLS mediated by ImuABC does not require RecA, unlike umuDC-dependent mutagenesis in E. coli. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Bacteriophage P2 ogr and P4 delta genes act independently and are essential for P4 multiplication.

    PubMed Central

    Halling, C; Calendar, R

    1990-01-01

    Satellite bacteriophage P4 requires the products of the late genes of a helper phage such as P2 for lytic growth. Expression of the P2 late genes is positively regulated by the P2 ogr gene in a process requiring P2 DNA replication. Transactivation of P2 late gene expression by P4 requires the P4 delta gene product and works even in the absence of P2 DNA replication. We have made null mutants of the P2 ogr and P4 delta genes. In the absence of the P4 delta gene product, P4 multiplication required both the P2 ogr protein and P2 DNA replication. In the absence of the P2 ogr gene product, P4 multiplication required the P4 delta protein. In complementation experiments, we found that the P2 ogr protein was made in the absence of P2 DNA replication but could not function unless P2 DNA replicated. We produced P4 delta protein from a plasmid and found that it complemented the null P4 delta and P2 ogr mutants. Images PMID:2193911

  18. Chromosomal Mapping of Repetitive DNA Sequences in the Genus Bryconamericus (Characidae) and DNA Barcoding to Differentiate Populations.

    PubMed

    Santos, Angélica Rossotti Dos; Usso, Mariana Campaner; Gouveia, Juceli Gonzalez; Araya-Jaime, Cristian; Frantine-Silva, Wilson; Giuliano-Caetano, Lucia; Foresti, Fausto; Dias, Ana Lúcia

    2017-06-01

    The mapping of repetitive DNA sites by fluorescence in situ hybridization has been widely used for karyotype studies in different species of fish, especially when dealing with related species or even genera presenting high chromosome variability. This study analyzed three populations of Bryconamericus, with diploid number preserved, but with different karyotype formulae. Bryconamericus ecai, from the Forquetinha river/RS, presented three new cytotypes, increasing the number of karyotype forms to seven in this population. Other two populations of Bryconamericus sp. from the Vermelho stream/PR and Cambuta river/PR exhibited interpopulation variation. The chromosome mapping of rDNA sites revealed unique markings among the three populations, showing inter- and intrapopulation variability located in the terminal region. The molecular analysis using DNA barcoding complementing the cytogenetic analysis also showed differentiation among the three populations. The U2 small nuclear DNA repetitive sequence exhibited conserved features, being located in the interstitial region of a single chromosome pair. This is the first report on its occurrence in the genus Bryconamericus. Data obtained revealed a karyotype variability already assigned to the genus, along with polymorphism of ribosomal sites, demonstrating that this group of fish can be undergoing a divergent evolutionary process, constituting a substantive model for studies of chromosomal evolution.

  19. Human Fanconi Anemia Complementation Group A Protein Stimulates the 5’ Flap Endonuclease Activity of FEN1

    PubMed Central

    Qian, Liangyue; Yuan, Fenghua; Rodriguez-Tello, Paola; Padgaonkar, Suyog; Zhang, Yanbin

    2013-01-01

    In eukaryotic cells, Flap endonuclease 1 (FEN1) is a major structure-specific endonuclease that processes 5’ flapped structures during maturation of lagging strand DNA synthesis, long patch base excision repair, and rescue of stalled replication forks. Here we report that fanconi anemia complementation group A protein (FANCA), a protein that recognizes 5’ flap structures and is involved in DNA repair and maintenance of replication forks, constantly stimulates FEN1-mediated incision of both DNA and RNA flaps. Kinetic analyses indicate that FANCA stimulates FEN1 by increasing the turnover rate of FEN1 and altering its substrate affinity. More importantly, six pathogenic FANCA mutants are significantly less efficient than the wild-type at stimulating FEN1 endonuclease activity, implicating that regulation of FEN1 by FANCA contributes to the maintenance of genomic stability. PMID:24349332

  20. Inactivation of complement by Loxosceles reclusa spider venom.

    PubMed

    Gebel, H M; Finke, J H; Elgert, K D; Cambell, B J; Barrett, J T

    1979-07-01

    Zymosan depletion of serum complement in guinea pigs rendered them highly resistant to lesion by Loxosceles reclusa spider venom. Guinea pigs deficient in C4 of the complement system are as sensitive to the venom as normal guinea pigs. The injection of 35 micrograms of whole recluse venom intradermally into guinea pigs lowered their complement level by 35.7%. Brown recluse spider venom in concentrations as slight as 0.02 micrograms protein/ml can totally inactivate one CH50 of guinea pig complement in vitro. Bee, scorpion, and other spider venoms had no influence on the hemolytic titer of complement. Fractionation of recluse spider venom by Sephadex G-200 filtration separated the complement-inactivating property of the venom into three major regions which could be distinguished on the basis of heat stability as well as size. None was neutralized by antivenom. Polyacrylamide gel electrophoresis of venom resolved the complement inactivators into five fractions. Complement inactivated by whole venom or the Sephadex fractions could be restored to hemolytic activity by supplements of fresh serum but not by heat-inactivated serum, pure C3, pure C5, or C3 and C5 in combination.

  1. The Pathway of Oligomeric DNA Melting Investigated by Molecular Dynamics Simulations

    PubMed Central

    Wong, Ka-Yiu; Pettitt, B. Montgomery

    2008-01-01

    Details of the reaction coordinate for DNA melting are fundamental to much of biology and biotechnology. Recently, it has been shown experimentally that there are at least three states involved. To clarify the reaction mechanism of the melting transition of DNA, we perform 100-ns molecular dynamics simulations of a homo-oligomeric, 12-basepair DNA duplex, d(A12)·d(T12), with explicit salt water at 400 K. Analysis of the trajectory reveals the various biochemically important processes that occur on different timescales. Peeling (including fraying from the ends), searching for Watson-Crick complements, and dissociation are recognizable processes. However, we find that basepair searching for Watson-Crick complements along a strand is not mechanistically tied to or directly accessible from the dissociation steps of strand melting. A three-step melting mechanism is proposed where the untwisting of the duplex is determined to be the major component of the reaction coordinate at the barrier. Though the observations are limited to the characteristics of the system being studied, they provide important insight into the mechanism of melting of other more biologically relevant forms of DNA, which will certainly differ in details from those here. PMID:18952784

  2. Role of CYP2E1 immunoglobulin G4 subclass antibodies and complement in pathogenesis of idiosyncratic drug-induced hepatitis.

    PubMed

    Njoku, Dolores B; Mellerson, Jenelle L; Talor, Monica V; Kerr, Douglas R; Faraday, Nauder R; Outschoorn, Ingrid; Rose, Noel R

    2006-02-01

    Idiosyncratic drug-induced hepatitis (IDDIH) is the third most common cause for acute liver failure in the United States. Previous studies have attempted to identify susceptible patients or early stages of disease with various degrees of success. To determine if total serum immunoglobulin subclasses, CYP2E1-specific subclass autoantibodies, complement components, or immune complexes could distinguish persons with IDDIH from others exposed to drugs, we studied persons exposed to halogenated volatile anesthetics, which have been associated with IDDIH and CYP2E1 autoantibodies. We found that patients with anesthetic-induced IDDIH had significantly elevated levels of CYP2E1-specific immunoglobulin G4 (IgG4) autoantibodies, while anesthetic-exposed healthy persons had significantly elevated levels of CYP2E1-specific IgG1 autoantibodies. Anesthetic IDDIH patients had significantly lower levels of C4a, C3a, and C5a compared to anesthetic-exposed healthy persons. C1q- and C3d-containing immune complexes were significantly elevated in anesthetic-exposed persons. In conclusion, our data suggest that anesthetic-exposed persons develop CYP2E1-specific IgG1 autoantibodies which may form detectable circulating immune complexes subsequently cleared by classical pathway activation of the complement system. Persons susceptible to anesthetic-induced IDDIH develop CYP2E1-specific IgG4 autoantibodies which form small, nonprecipitating immune complexes that escape clearance because of their size or by direct inhibition of complement activation.

  3. Role of CYP2E1 Immunoglobulin G4 Subclass Antibodies and Complement in Pathogenesis of Idiosyncratic Drug-Induced Hepatitis

    PubMed Central

    Njoku, Dolores B.; Mellerson, Jenelle L.; Talor, Monica V.; Kerr, Douglas R.; Faraday, Nauder R.; Outschoorn, Ingrid; Rose, Noel R.

    2006-01-01

    Idiosyncratic drug-induced hepatitis (IDDIH) is the third most common cause for acute liver failure in the United States. Previous studies have attempted to identify susceptible patients or early stages of disease with various degrees of success. To determine if total serum immunoglobulin subclasses, CYP2E1-specific subclass autoantibodies, complement components, or immune complexes could distinguish persons with IDDIH from others exposed to drugs, we studied persons exposed to halogenated volatile anesthetics, which have been associated with IDDIH and CYP2E1 autoantibodies. We found that patients with anesthetic-induced IDDIH had significantly elevated levels of CYP2E1-specific immunoglobulin G4 (IgG4) autoantibodies, while anesthetic-exposed healthy persons had significantly elevated levels of CYP2E1-specific IgG1 autoantibodies. Anesthetic IDDIH patients had significantly lower levels of C4a, C3a, and C5a compared to anesthetic-exposed healthy persons. C1q- and C3d-containing immune complexes were significantly elevated in anesthetic-exposed persons. In conclusion, our data suggest that anesthetic-exposed persons develop CYP2E1-specific IgG1 autoantibodies which may form detectable circulating immune complexes subsequently cleared by classical pathway activation of the complement system. Persons susceptible to anesthetic-induced IDDIH develop CYP2E1-specific IgG4 autoantibodies which form small, nonprecipitating immune complexes that escape clearance because of their size or by direct inhibition of complement activation. PMID:16467335

  4. Staphylococcus aureus SdrE captures complement factor H's C-terminus via a novel 'close, dock, lock and latch' mechanism for complement evasion.

    PubMed

    Zhang, Yingjie; Wu, Minhao; Hang, Tianrong; Wang, Chengliang; Yang, Ye; Pan, Weimin; Zang, Jianye; Zhang, Min; Zhang, Xuan

    2017-05-04

    Complement factor H (CFH) is a soluble complement regulatory protein essential for the down-regulation of the alternative pathway on interaction with specific markers on the host cell surface. It recognizes the complement component 3b (C3b) and 3d (C3d) fragments in addition to self cell markers (i.e. glycosaminoglycans, sialic acid) to distinguish host cells that deserve protection from pathogens that should be eliminated. The Staphylococcus aureus surface protein serine-aspartate repeat protein E (SdrE) was previously reported to bind human CFH as an immune-evasion tactic. However, the molecular mechanism underlying SdrE-CFH-mediated immune evasion remains unknown. In the present study, we identified a novel region at CFH's C-terminus (CFH 1206-1226 ), which binds SdrE N2 and N3 domains (SdrE N2N3 ) with high affinity, and determined the crystal structures of apo-SdrE N2N3 and the SdrE N2N3 -CFH 1206-1226 complex. Comparison of the structure of the CFH-SdrE complex with other CFH structures reveals that CFH's C-terminal tail flips from the main body to insert into the ligand-binding groove of SdrE. In addition, SdrE N2N3 adopts a 'close' state in the absence of CFH, which undergoes a large conformational change on CFH binding, suggesting a novel 'close, dock, lock and latch' (CDLL) mechanism for SdrE to recognize its ligand. Our findings imply that SdrE functions as a 'clamp' to capture CFH's C-terminal tail via a unique CDLL mechanism and sequesters CFH on the surface of S. aureus for complement evasion. © 2017 The Author(s).

  5. Correction of the DNA repair defect in xeroderma pigmentosum group E by injection of a DNA damage-binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keeney, S.; Brody, T.; Linn, S.

    1994-04-26

    Cells from a subset of patients with the DNA-repair-defective disease xeroderma pigmentosum complementation group E (XP-E) are known to lack a DNA damage-binding (DDB) activity. Purified human DDB protein was injected into XP-E cells to test whether the DNA-repair defect in these cells is caused by a defect in DDB activity. Injected DDB protein stimulated DNA repair to normal levels in those strains that lack the DDB activity but did not stimulate repair in cells from other xeroderma pigmentosum groups or in XP-E cells that contain the activity. These results provide direct evidence that defective DDB activity causes the repairmore » defect in a subset of XP-E patients, which in turn establishes a role for this activity in nucleotide-excision repair in vivo.« less

  6. Regulated Eukaryotic DNA Replication Origin Firing with Purified Proteins

    PubMed Central

    Yeeles, Joseph T.P.; Deegan, Tom D.; Janska, Agnieszka; Early, Anne; Diffley, John F. X.

    2016-01-01

    Eukaryotic cells initiate DNA replication from multiple origins, which must be tightly regulated to promote precise genome duplication in every cell cycle. To accomplish this, initiation is partitioned into two temporally discrete steps: a double hexameric MCM complex is first loaded at replication origins during G1 phase, and then converted to the active CMG (Cdc45, MCM, GINS) helicase during S phase. Here we describe the reconstitution of budding yeast DNA replication initiation with 16 purified replication factors, made from 42 polypeptides. Origin-dependent initiation recapitulates regulation seen in vivo. Cyclin dependent kinase (CDK) inhibits MCM loading by phosphorylating the origin recognition complex (ORC) and promotes CMG formation by phosphorylating Sld2 and Sld3. Dbf4 dependent kinase (DDK) promotes replication by phosphorylating MCM, and can act either before or after CDK. These experiments define the minimum complement of proteins, protein kinase substrates and co-factors required for regulated eukaryotic DNA replication. PMID:25739503

  7. Regulated eukaryotic DNA replication origin firing with purified proteins.

    PubMed

    Yeeles, Joseph T P; Deegan, Tom D; Janska, Agnieszka; Early, Anne; Diffley, John F X

    2015-03-26

    Eukaryotic cells initiate DNA replication from multiple origins, which must be tightly regulated to promote precise genome duplication in every cell cycle. To accomplish this, initiation is partitioned into two temporally discrete steps: a double hexameric minichromosome maintenance (MCM) complex is first loaded at replication origins during G1 phase, and then converted to the active CMG (Cdc45-MCM-GINS) helicase during S phase. Here we describe the reconstitution of budding yeast DNA replication initiation with 16 purified replication factors, made from 42 polypeptides. Origin-dependent initiation recapitulates regulation seen in vivo. Cyclin-dependent kinase (CDK) inhibits MCM loading by phosphorylating the origin recognition complex (ORC) and promotes CMG formation by phosphorylating Sld2 and Sld3. Dbf4-dependent kinase (DDK) promotes replication by phosphorylating MCM, and can act either before or after CDK. These experiments define the minimum complement of proteins, protein kinase substrates and co-factors required for regulated eukaryotic DNA replication.

  8. Xeroderma pigmentosum, complementation group D expression in H1299 lung cancer cells following benzo[a]pyrene exposure as well as in head and neck cancer patients.

    PubMed

    Lin, Chang-Shen; Chiou, Wen-Yen; Lee, Ka-Wo; Chen, Tzu-Fen; Lin, Yuan-Jen; Huang, Jau-Ling

    2016-01-01

    DNA repair genes play critical roles in response to carcinogen-induced and anticancer therapy-induced DNA damage. Benzo[a]pyrene (BaP), the most carcinogenic polycyclic aromatic hydrocarbon (PAH), is classified as a group 1 carcinogen by International Agency for Research on Cancer. The aims of this study were to (1) evaluate the effects of BaP on DNA repair activity and expression of DNA repair genes in vitro and (2) examine the role of xeroderma pigmentosum, complementation group D (XPD) mRNA expression in human head and neck cancers. Host cell reactivation assay showed that BaP inhibited nucleotide excision repair in H1299 lung cancer cells. DNA repair through the non-homologous end-joining pathway was not affected by BaP. Real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR) and Western blot demonstrated that XPD was downregulated by BaP treatment. BaP exposure did not apparently affect expression of another 11 DNA repair genes. BaP treatment increased the DNA damage marker γ-H2AX and ultraviolet (UV) sensitivity, supporting an impairment of DNA repair in BaP-treated cells. XPD expression was also examined by quantitative RT-PCR in 68 head and neck cancers, and a lower XPD mRNA level was found in smokers' cancer specimens. Importantly, reduced XPD expression was correlated with patient 5-year overall survival rate (35 vs. 56%) and was an independent prognostic factor (hazard ratio: 2.27). Data demonstrated that XPD downregulation was correlated with BaP exposure and human head and neck cancer survival.

  9. Specificity of EIA immunoassay for complement factor Bb testing.

    PubMed

    Pavlov, Igor Y; De Forest, Nikol; Delgado, Julio C

    2011-01-01

    During the alternative complement pathway activation, factor B is cleaved in two fragments, Ba and Bb. Concentration of those fragments is about 2 logs lower than of factor B present in the blood, which makes fragment detection challenging because of potential cross-reactivity. Lack of information on Bb assay cross-reactivity stimulated the authors to investigate this issue. We ran 109 healthy donor EDTA plasmas and 80 sera samples with both factor B immunodiffusion (The Binding Site) and Quidel Bb EIA assays. During the study it was shown that physiological concentrations of gently purified factor B demonstrated approximately 0.15% cross-reactivity in the Quidel Bb EIA assay. We also observed that Bb concentration in serum is higher than in plasma due to complement activation during clot formation which let us use sera as samples representing complement activated state. Our study demonstrated that despite the potential 0.15% cross-reactivity between endogenous factor B and cleaved Bb molecule, measuring plasma concentrations of factor Bb is adequate to evaluate the activation of the alternative complement pathway.

  10. Interaction of antitumor drug Sn(CH 3) 2Cl 2 with DNA and RNA

    NASA Astrophysics Data System (ADS)

    Nafisi, Shohreh; Sobhanmanesh, Amir; Esm-Hosseini, Majid; Alimoghaddam, Kamran; Tajmir-Riahi, Heidar Ali

    2005-08-01

    Sn(CH3)2Cl2 exerts its antitumor activity in a specific way. Unlike anticancer cis-Pt(NH3)2Cl2 drug which binds strongly to the nitrogen atoms of DNA bases, Sn(CH3)2Cl2 shows no major affinity towards base binding. Thus, the mechanism of action by which tinorganometallic compounds exert antitumor activity would be different from that of the cisplatin drug. The aim of this study was to examine the binding of Sn(CH3)2Cl2 with calf thymus DNA and yeast RNA in aqueous solutions at pH 7.1-6.6 with constant concentrations of DNA and RNA and various molar ratios of Sn(CH3)2Cl2/DNA (phosphate) and Sn(CH3)2Cl2/RNA of 1/40, 1/20, 1/10, 1/5. Fourier transform infrared (FTIR) and UV-visible difference spectroscopic methods were used to determine the Sn(CH3)2Cl2 binding mode, binding constant, sequence selectivity and structural variations of Sn(CH3)2Cl2/DNA and Sn(CH3)2Cl2/RNA complexes in aqueous solution. Sn(CH3)2Cl2 hydrolyzes in water to give Sn(CH3)2(OH)2 and [Sn(CH3)2(OH)(H2O)n]+ species. Spectroscopic evidence showed that interaction occurred mainly through (CH3)2Sn(IV) hydroxide and polynucleotide backbone phosphate group with overall binding constant of K(Sn(CH3)2Cl2-DNA)=1.47×105 M-1 and K(Sn(CH3)2Cl2-RNA)=7.33×105 M-1. Sn(CH3)2Cl2 induced no biopolymer conformational changes with DNA remaining in the B-family structure and RNA in A-conformation upon drug complexation.

  11. Anti-complement activities of human breast-milk.

    PubMed

    Ogundele, M O

    1999-08-01

    It has long been observed that the human milk possesses significant anti-inflammatory properties, while simultaneously protecting the infant against many intestinal and respiratory pathogens. There is, however, a paucity of information on the degree and extent of this anti-inflammatory activity. In the present study, the inhibitory effects of different fractions of human milk on serum complement activity were analysed. Colostrum and milk samples from healthy voluntary lactating donors at different postpartum ages were obtained and pooled normal human serum was used as source of complement in a modified CH50 assay. Inherent complement activity in human milk was also investigated by measuring the deposition of an activated C3 fragment on a serum-sensitive bacteria, and by haemolytic assays. Most whole- and defatted-milk samples consistently showed a dose-dependent inhibition of the serum complement activity. This inhibition was greater in mature milk compared to transitional milk samples. It was enhanced by inactivation of milk complement, and diminished by centrifugation of milk samples, which partly removed fat and larger protein components including casein micelles. Inherent complement activity in human milk was also demonstrated by haemolysis of sensitised sheep erythrocytes and deposition of C3 fragments on solid-phase bacteria. These activities were highest in the colostrum and gradually decreased as lactation proceeded. Several natural components abundant in the fluid phase of the human breast-milk have been shown to be inhibitors of complement activation in vitro. Their physiological significance probably reside in their ability to prevent inflammatory-induced tissue damage of the delicate immature gastrointestinal tract of the new-born as well as the mammary gland itself, which may arise from ongoing complement activation.

  12. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    PubMed

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  13. Cryo-EM structure of Mcm2-7 double hexamer on DNA suggests a lagging-strand DNA extrusion model.

    PubMed

    Noguchi, Yasunori; Yuan, Zuanning; Bai, Lin; Schneider, Sarah; Zhao, Gongpu; Stillman, Bruce; Speck, Christian; Li, Huilin

    2017-11-07

    During replication initiation, the core component of the helicase-the Mcm2-7 hexamer-is loaded on origin DNA as a double hexamer (DH). The two ring-shaped hexamers are staggered, leading to a kinked axial channel. How the origin DNA interacts with the axial channel is not understood, but the interaction could provide key insights into Mcm2-7 function and regulation. Here, we report the cryo-EM structure of the Mcm2-7 DH on dsDNA and show that the DNA is zigzagged inside the central channel. Several of the Mcm subunit DNA-binding loops, such as the oligosaccharide-oligonucleotide loops, helix 2 insertion loops, and presensor 1 (PS1) loops, are well defined, and many of them interact extensively with the DNA. The PS1 loops of Mcm 3, 4, 6, and 7, but not 2 and 5, engage the lagging strand with an approximate step size of one base per subunit. Staggered coupling of the two opposing hexamers positions the DNA right in front of the two Mcm2-Mcm5 gates, with each strand being pressed against one gate. The architecture suggests that lagging-strand extrusion initiates in the middle of the DH that is composed of the zinc finger domains of both hexamers. To convert the Mcm2-7 DH structure into the Mcm2-7 hexamer structure found in the active helicase, the N-tier ring of the Mcm2-7 hexamer in the DH-dsDNA needs to tilt and shift laterally. We suggest that these N-tier ring movements cause the DNA strand separation and lagging-strand extrusion. Copyright © 2017 the Author(s). Published by PNAS.

  14. An improved host-vector system for Candida maltosa using a gene isolated from its genome that complements the his5 mutation of Saccharomyces cerevisiae.

    PubMed

    Hikiji, T; Ohkuma, M; Takagi, M; Yano, K

    1989-10-01

    The host-vector system of an n-alkane-assimilating-yeast, Candida maltosa, which we previously constructed using an autonomously replicating sequence (ARS) region isolated from the genome of this yeast, utilizes C. maltosa J288 (leu2-) as a host. As this host had a serious growth defect on n-alkane, we developed an improved host-vector system using C. maltosa CH1 (his-) as host. The vectors were constructed with the Candida ARS region and a DNA fragment isolated from the genome of C. maltosa. Since this DNA fragment could complement histidine auxotrophy of both C. maltosa CH1 and S. cerevisiae (his5-), we termed the gene contained in this DNA fragment C-HIS5. The vectors were characterized in terms of transformation frequency and stability, and the nucleotide sequence of C-HIS5 was determined. The deduced amino acid sequence (389 residues) shared 51% homology with that of HIS5 of S. cerevisiae (384 residues; Nishiwaki et al. 1987).

  15. Chromosome-based genetic complementation system for Xylella fastidiosa.

    PubMed

    Matsumoto, Ayumi; Young, Glenn M; Igo, Michele M

    2009-03-01

    Xylella fastidiosa is a xylem-limited, gram-negative bacterium that causes Pierce's disease of grapevine. Here, we describe the construction of four vectors that facilitate the insertion of genes into a neutral site (NS1) in the X. fastidiosa chromosome. These vectors carry a colE1-like (pMB1) replicon and DNA sequences from NS1 flanking a multiple-cloning site and a resistance marker for one of the following antibiotics: chloramphenicol, erythromycin, gentamicin, or kanamycin. In X. fastidiosa, vectors with colE1-like (pMB1) replicons have been found to result primarily in the recovery of double recombinants rather than single recombinants. Thus, the ease of obtaining double recombinants and the stability of the resulting insertions at NS1 in the absence of selective pressure are the major advantages of this system. Based on in vitro and in planta characterizations, strains carrying insertions within NS1 are indistinguishable from wild-type X. fastidiosa in terms of growth rate, biofilm formation, and pathogenicity. To illustrate the usefulness of this system for complementation analysis, we constructed a strain carrying a mutation in the X. fastidiosa cpeB gene, which is predicted to encode a catalase/peroxidase, and showed that the sensitivity of this mutant to hydrogen peroxide could be overcome by the introduction of a wild-type copy of cpeB at NS1. Thus, this chromosome-based complementation system provides a valuable genetic tool for investigating the role of specific genes in X. fastidiosa cell physiology and virulence.

  16. STUDIES ON THE ANTIGENIC PROPERTIES OF COMPLEMENT

    PubMed Central

    Klein, Paul G.; Burkholder, Peter M.

    1960-01-01

    Evidence is presented to show that guinea pig complement fixed on sensitized sheep red cells acts as a specific agglutinogen. Agglutinating antibodies that react with cell-fixed complement can be produced by immunizing rabbits with a complex of stromata-amboceptor-complement or with guinea pig serum globulin. These agglutinins can be removed by precipitation with guinea pig serum. They are, therefore, distinct from immunoconglutinins. PMID:14409702

  17. DNA damage induced by ascorbate in the presence of Cu2+.

    PubMed

    Kobayashi, S; Ueda, K; Morita, J; Sakai, H; Komano, T

    1988-01-25

    DNA damage induced by ascorbate in the presence of Cu2+ was investigated by use of bacteriophage phi X174 double-stranded supercoiled DNA and linear restriction fragments as substrates. Single-strand cleavage was induced when supercoiled DNA was incubated with 5 microM-10 mM ascorbate and 50 microM Cu2+ at 37 degrees C for 10 min. The induced DNA damage was analyzed by sequencing of fragments singly labeled at their 5'- or 3'-end. DNA was cleaved directly and almost uniformly at every nucleotide by ascorbate and Cu2+. Piperidine treatment after the reaction showed that ascorbate and Cu2+ induced another kind of DNA damage different from the direct cleavage. The damage proceeded to DNA cleavage by piperidine treatment and was sequence-specific rather than random. These results indicate that ascorbate induces two classes of DNA damage in the presence of Cu2+, one being direct strand cleavage, probably via damage to the DNA backbone, and the other being a base modification labile to alkali treatment. These two classes of DNA damage were inhibited by potassium iodide, catalase and metal chelaters, suggesting the involvement of radicals generated from ascorbate hydroperoxide.

  18. Effect of the anti-neoplastic drug doxorubicin on XPD-mutated DNA repair-deficient human cells.

    PubMed

    Saffi, Jenifer; Agnoletto, Mateus H; Guecheva, Temenouga N; Batista, Luís F Z; Carvalho, Helotonio; Henriques, João A P; Stary, Anne; Menck, Carlos F M; Sarasin, Alain

    2010-01-02

    Doxorubicin (DOX), a member of the anthracycline group, is a widely used drug in cancer therapy. The mechanisms of DOX action include topoisomerase II-poisoning, free radical release, DNA adducts and interstrand cross-link (ICL) formation. Nucleotide excision repair (NER) is involved in the removal of helix-distorting lesions and chemical adducts, however, little is known about the response of NER-deficient cell lines to anti-tumoral drugs like DOX. Wild type and XPD-mutated cells, harbouring mutations in different regions of this gene and leading to XP-D, XP/CS or TTD diseases, were treated with this drug and analyzed for cell cycle arrest and DNA damage by comet assay. The formation of DSBs was also investigated by determination of gammaH2AX foci. Our results indicate that all three NER-deficient cell lines tested are more sensitive to DOX treatment, when compared to wild type cells or XP cells complemented by the wild type XPD cDNA, suggesting that NER is involved in the removal of DOX-induced lesions. The cell cycle analysis showed the characteristic G2 arrest in repair-proficient MRC5 cell line after DOX treatment, whereas the repair-deficient cell lines presented significant increase in sub-G1 fraction. The NER-deficient cell lines do not show different patterns of DNA damage formation as assayed by comet assay and phosphorylated H2AX foci formation. Knock-down of topoisomerase IIalpha with siRNA leads to increased survival in both MRC5 and XP cells, however, XP cell line still remained significantly more sensitive to the treatment by DOX. Our study suggests that the enhanced sensitivity is due to DOX-induced DNA damage that is subject to NER, as we observed decreased unscheduled DNA synthesis in XP-deficient cells upon DOX treatment. Furthermore, the complementation of the XPD-function abolished the observed sensitivity at lower DOX concentrations, suggesting that the XPD helicase activity is involved in the repair of DOX-induced lesions. Copyright (c) 2009

  19. Staphylococcus aureus SdrE captures complement factor H's C-terminus via a novel ‘close, dock, lock and latch' mechanism for complement evasion

    PubMed Central

    Zhang, Yingjie; Wu, Minhao; Hang, Tianrong; Wang, Chengliang; Yang, Ye; Pan, Weimin; Zang, Jianye

    2017-01-01

    Complement factor H (CFH) is a soluble complement regulatory protein essential for the down-regulation of the alternative pathway on interaction with specific markers on the host cell surface. It recognizes the complement component 3b (C3b) and 3d (C3d) fragments in addition to self cell markers (i.e. glycosaminoglycans, sialic acid) to distinguish host cells that deserve protection from pathogens that should be eliminated. The Staphylococcus aureus surface protein serine–aspartate repeat protein E (SdrE) was previously reported to bind human CFH as an immune-evasion tactic. However, the molecular mechanism underlying SdrE–CFH-mediated immune evasion remains unknown. In the present study, we identified a novel region at CFH's C-terminus (CFH1206–1226), which binds SdrE N2 and N3 domains (SdrEN2N3) with high affinity, and determined the crystal structures of apo-SdrEN2N3 and the SdrEN2N3–CFH1206–1226 complex. Comparison of the structure of the CFH–SdrE complex with other CFH structures reveals that CFH's C-terminal tail flips from the main body to insert into the ligand-binding groove of SdrE. In addition, SdrEN2N3 adopts a ‘close’ state in the absence of CFH, which undergoes a large conformational change on CFH binding, suggesting a novel ‘close, dock, lock and latch' (CDLL) mechanism for SdrE to recognize its ligand. Our findings imply that SdrE functions as a ‘clamp' to capture CFH's C-terminal tail via a unique CDLL mechanism and sequesters CFH on the surface of S. aureus for complement evasion. PMID:28258151

  20. DNA barcoding of five common stored-product pest species of genus Cryptolestes (Coleoptera: Laemophloeidae).

    PubMed

    Wang, Y J; Li, Z H; Zhang, S F; Varadínová, Z; Jiang, F; Kučerová, Z; Stejskal, V; Opit, G; Cao, Y; Li, F J

    2014-10-01

    Several species of the genus Cryptolestes Ganglbauer, 1899 (Coleoptera: Laemophloeidae) are commonly found in stored products. In this study, five species of Cryptolestes, with almost worldwide distribution, were obtained from laboratories in China, Czech Republic and the USA: Cryptolestes ferrugineus (Stephens, 1831), Cryptolestes pusillus (Schönherr, 1817), Cryptolestes turcicus (Grouvelle, 1876), Cryptolestes pusilloides (Steel & Howe, 1952) and Cryptolestes capensis (Waltl, 1834). Molecular identification based on a 658 bp fragment from the mitochondrial DNA cytochrome c oxidase subunit I (COI) was adopted to overcome some problems of morphological identification of Cryptolestes species. The utility of COI sequences as DNA barcodes in discriminating the five Cryptolestes species was evaluated on adults and larvae by analysing Kimura 2-parameter distances, phylogenetic tree and haplotype networks. The results showed that molecular approaches based on DNA barcodes were able to accurately identify these species. This is the first study using DNA barcoding to identify Cryptolestes species and the gathered DNA sequences will complement the biological barcode database.

  1. DNA ELECTROPHORESIS AT SURFACES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    RAFAILOVICH, MIRIAM; SOKOLOV, JONATHAN; GERSAPPE, DILIP

    2003-09-01

    During this year we performed two major projects: I. We developed a detailed theoretical model which complements our experiments on surface DNA electrophoresis. We found that it was possible to enhance the separation of DNA chains by imposing a chemical nanoscale pattern on the surface. This approach utilized the surface interaction effect of the DNA chains with the substrate and is a refinement to our previous method in which DNA chains were separated on homogeneous flat surfaces. By introducing the nano-patterns on the surface, the conformational changes of DNA chains of different lengths can be amplified, which results in themore » different friction strengths with the substrate surface. Our results also show that, when compared to the DNA electrophoresis performed on homogeneous flat surfaces, nanopatterned surfaces offer a larger window in choosing different surface interactions to achieve separation. II. In collaboration with a large international manufacturer of skin care products we also embarked on a project involving photo toxicity of titanium dioxide nanoparticles, which are a key ingredient in sunscreen and cosmetic lotions. The results clearly implicated the nanoparticles in catalyzing damage to chromosomal DNA. We then used this knowledge to develop a polymer/anti-oxidant coating which prevented the photocatalytic reaction on DNA while still retaining the UV absorptive properties of the nanoparticles. The standard gel electrophoresis was not sufficient in determining the extent of the DNA damage. The conclusions of this study were based predominantly on analysis obtained with the surface electrophoresis method.« less

  2. Role of Complement on Broken Surfaces After Trauma.

    PubMed

    Huber-Lang, Markus; Ignatius, Anita; Brenner, Rolf E

    2015-01-01

    Activation of both the complement and coagulation cascade after trauma and subsequent local and systemic inflammatory response represent a major scientific and clinical problem. After severe tissue injury and bone fracture, exposure of innate immunity to damaged cells and molecular debris is considered a main trigger of the posttraumatic danger response. However, the effects of cellular fragments (e.g., histones) on complement activation remain enigmatic. Furthermore, direct effects of "broken" bone and cartilage surfaces on the fluid phase response of complement and its interaction with key cells of connective tissues are still unknown. Here, we summarize data suggesting direct and indirect complement activation by extracellular and cellular danger associated molecular patterns. In addition, key complement components and the corresponding receptors (such as C3aR, C5aR) have been detected on "exposed surfaces" of the damaged regions. On a cellular level, multiple effects of complement activation products on osteoblasts, osteoclasts, chondrocytes and mesenchymal stem cells have been found.In conclusion, the complement system may be activated by trauma-altered surfaces and is crucially involved in connective tissue healing and posttraumatic systemic inflammatory response.

  3. A conserved function for pericentromeric satellite DNA

    PubMed Central

    Jagannathan, Madhav; Cummings, Ryan

    2018-01-01

    A universal and unquestioned characteristic of eukaryotic cells is that the genome is divided into multiple chromosomes and encapsulated in a single nucleus. However, the underlying mechanism to ensure such a configuration is unknown. Here, we provide evidence that pericentromeric satellite DNA, which is often regarded as junk, is a critical constituent of the chromosome, allowing the packaging of all chromosomes into a single nucleus. We show that the multi-AT-hook satellite DNA-binding proteins, Drosophila melanogaster D1 and mouse HMGA1, play an evolutionarily conserved role in bundling pericentromeric satellite DNA from heterologous chromosomes into ‘chromocenters’, a cytological association of pericentromeric heterochromatin. Defective chromocenter formation leads to micronuclei formation due to budding from the interphase nucleus, DNA damage and cell death. We propose that chromocenter and satellite DNA serve a fundamental role in encapsulating the full complement of the genome within a single nucleus, the universal characteristic of eukaryotic cells. PMID:29578410

  4. Hepatic macrophage complement receptor clearance function following injury.

    PubMed

    Cuddy, B G; Loegering, D J; Blumenstock, F A; Shah, D M

    1986-03-01

    Previous work has demonstrated that in vivo hepatic macrophage complement receptor clearance function is depressed following thermal injury. The present study was carried out to determine if complement receptor function depression is associated with other states of depressed host defense. Hepatic complement receptor clearance function was determined from the hepatic uptake of rat erythrocytes coated with antierythrocyte IgM (EIgM) in rats. Receptor function was determined following cannulation of a carotid artery, laparotomy plus enterotomy, hemorrhagic shock, trauma, thermal injury, acute bacteremia, acute endotoxemia, and injection of erythrocyte stroma, gelatinized lipid emulsion, or colloidal carbon. Hepatic uptake of EIgM was depressed following each of these experimental interventions except arterial cannulation. This effect was shown not to be due to a decrease in hepatic blood flow or depletion of complement and was therefore due to a depression in hepatic macrophage complement receptor clearance function. Thus, impairment of hepatic macrophage complement receptor function is associated with several states of depressed host defense.

  5. Effects of TiO2 crystal structure on the luminescence quenching of [Ru(bpy)2(dppz)]2 +-intercalated into DNA

    NASA Astrophysics Data System (ADS)

    Chen, Linlin; Wang, Yi; Huang, Minggao; Li, Xiaodan; Zhu, Licai; Li, Hong

    2017-06-01

    The intercalation of [Ru(bpy)2(dppz)]2 + labeled as Ru(II) (bpy = 2,2‧-bipyridine and dppz = dipyrido[3,2,-a:2‧,3‧-c]phenazine) into herring sperm DNA leads to the formation of emissive Ru(II)-DNA dyads, which can be quenched by TiO2 nanoparticles (NPs) and sol-gel silica matrices at heterogeneous interfaces. The calcinations temperature exhibits a remarkable influence on the luminescence quenching of the Ru(II)-DNA dyads by TiO2 NPs. With increasing calcinations temperature in the range from 200 to 850 °C, the anatase-to-rutile TiO2 crystal structure transformation increases the average particle size and hydrodynamic diameter of TiO2 and DNA@TiO2. The anatase TiO2 has the stronger ability to unbind the Ru(II)-DNA dyads than the rutile TiO2 at room temperature. The TiO2 NPs and sol-gel silica matrices can quench the luminescence of the Ru(II) complex intercalated into DNA by selectively capturing the negatively DNA and positively charged Ru(II) complex to unbind the dyads, respectively. This present results provide new insights into the luminescence quenching and competitive binding of dye-labeled DNA dyads by inorganic NPs.

  6. Crk1/2 and CrkL form a hetero-oligomer and functionally complement each other during podocyte morphogenesis

    PubMed Central

    Zhang, Jidong; Verma, Rakesh; Park, Tae-Ju; Wong, Hetty; Curran, Tom; Nihalani, Deepak; Holzman, Lawrence B.

    2014-01-01

    Activation of the slit diaphragm protein Nephrin induces actin cytoskeletal remodeling resulting in lamellipodia formation in podocytes in vitro in a phosphatidylinositol-3 kinase, focal adhesion kinase, Cas, and Crk1/2-dependent fashion. In mice, podocyte-specific deletion of Crk1/2 prevents or attenuates foot process effacement in two models of podocyte injury. This suggests that cellular mechanisms governing lamellipodial protrusion in vitro are similar to those in vivo during foot process effacement. Since Crk1/2 null mice develop and aged normally, we tested whether the Crk1/2 paralog, CrkL, functionally complements Crk1/2 in a podocyte-specific context. Podocyte-specific CrkL null mice, like podocyte-specific Crk1/2 null mice, developed and aged normally but were protected from protamine sulfate-induced foot process effacement. Simultaneous podocyte-specific deletion of Crk1/2 and CrkL resulted in albuminuria detected by six weeks post-partum and associated with altered podocyte process architecture. Nephrin-induced lamellipodia formation in podocytes in vitro was CrkL-dependent. CrkL formed a heterooligomer with Crk2 and, like Crk2, was recruited to tyrosine phosphorylated Nephrin. Thus, Crk1/2 and CrkL are physically-linked, functionally complement each other during podocyte foot process spreading, and together are required for developing typical foot process architecture. PMID:24499776

  7. [Renal risks of dietary complements: a forgotten cause].

    PubMed

    Dori, Olympia; Humbert, Antoine; Burnier, Michel; Teta, Daniel

    2014-02-26

    The use of dietary complements like vitamins, minerals, trace elements, proteins, aminoacids and plant-derived agents is prevalent in the general population, in order to promote health and treat diseases. Dietary complements are considered as safe natural products and are easily available without prescription. However, these can lead to severe renal toxicity, especially in cases of unknown pre-existing chronic kidney disease (CKD). In particular, Chinese herbs including aristolochic acid, high doses of vitamine C, creatine and protein complements may lead to acute and chronic renal failure, sometimes irreversible. Dietary complement toxicity should be suspected in any case of unexplained renal impairement. In the case of pre-existing CKD, the use of potentially nephrotoxic dietary complements should be screened for.

  8. The second chance story of HIV-1 DNA: Unintegrated? Not a problem!

    PubMed

    Wu, Yuntao

    2008-07-09

    Accumulation of high levels of unintegrated viral DNA is a common feature of retroviral infection. It was recently discovered that coinfection of cells with integrated and unintegrated HIV-1 can result in complementation, allowing viral replication in the absence of integration. This new mode of HIV-1 replication has numerous implications for the function of unintegrated viral DNA and its application as a therapeutic vector.

  9. Systematic analysis of enzymatic DNA polymerization using oligo-DNA templates and triphosphate analogs involving 2',4'-bridged nucleosides.

    PubMed

    Kuwahara, Masayasu; Obika, Satoshi; Nagashima, Jun-ichi; Ohta, Yuki; Suto, Yoshiyuki; Ozaki, Hiroaki; Sawai, Hiroaki; Imanishi, Takeshi

    2008-08-01

    In order to systematically analyze the effects of nucleoside modification of sugar moieties in DNA polymerase reactions, we synthesized 16 modified templates containing 2',4'-bridged nucleotides and three types of 2',4'-bridged nucleoside-5'-triphospates with different bridging structures. Among the five types of thermostable DNA polymerases used, Taq, Phusion HF, Vent(exo-), KOD Dash and KOD(exo-), the KOD Dash and KOD(exo-) DNA polymerases could smoothly read through the modified templates containing 2'-O,4'-C-methylene-linked nucleotides at intervals of a few nucleotides, even at standard enzyme concentrations for 5 min. Although the Vent(exo-) DNA polymerase also read through these modified templates, kinetic study indicates that the KOD(exo-) DNA polymerase was found to be far superior to the Vent(exo-) DNA polymerase in accurate incorporation of nucleotides. When either of the DNA polymerase was used, the presence of 2',4'-bridged nucleotides on a template strand substantially decreased the reaction rates of nucleotide incorporations. The modified templates containing sequences of seven successive 2',4'-bridged nucleotides could not be completely transcribed by any of the DNA polymerases used; yields of longer elongated products decreased in the order of steric bulkiness of the modified sugars. Successive incorporation of 2',4'-bridged nucleotides into extending strands using 2',4'-bridged nucleoside-5'-triphospates was much more difficult. These data indicate that the sugar modification would have a greater effect on the polymerase reaction when it is adjacent to the elongation terminus than when it is on the template as well, as in base modification.

  10. Structure and DNA-binding of meiosis-specific protein Hop2

    NASA Astrophysics Data System (ADS)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  11. Immunoserological parameters in SLE: high-avidity anti-dsDNA detected by ELISA are the most closely associated with the disease activity.

    PubMed

    Andrejevic, Sladjana; Jeremic, Ivica; Sefik-Bukilica, Mirjana; Nikolic, Milos; Stojimirovic, Biljana; Bonaci-Nikolic, Branka

    2013-11-01

    We assessed the relationship between the serum levels of antibodies against double-stranded DNA (dsDNA), C1q, nucleosomes, histones, C3 and C4 complement components with one another, with organ involvement and overall disease activity in patients with systemic lupus erythematosus (SLE). One hundred seventy-five sera from 99 patients with SLE, 31 sera of patients with other connective tissue diseases, and 20 sera from healthy blood donors were tested. SLE disease activity was assessed by modified SLEDAI-2K (M-SLEDAI-2K), not including complement and anti-dsDNA descriptors. Anti-dsDNA antibodies were measured by indirect immunofluorescence on Crithidia luciliae (CLIFT), standard enzyme-linked immunosorbent assay (ELISA) and ELISA for high-avidity antibodies. The most significant risk factor for renal involvement were anti-C1q antibodies (OR = 3.88, p < 0.05), high-avidity anti-dsDNA antibodies for polyserositis (OR = 7.99, p < 0.01), anti-histone antibodies for joint involvement (OR = 2.75, p < 0.05), and low C3 for cytopenia (OR = 11.96, p < 0.001) and mucocutaneous lesions (OR = 3.32, p < 0.01). Multiple linear regression analysis showed that disease activity in SLE could be predicted by the levels of antibodies against dsDNA determined by standard (p < 0.05) and high-avidity (p < 0.001) ELISA, and inversely associated with concentration of C3 (p < 0.001). Using stepwise method, high-avidity anti-dsDNA antibodies were found to be in the closest association to M-SLEDAI-2K. Moreover, positive test for high-avidity anti-dsDNA antibodies appeared as an independent risk factor for moderately to severely active disease (M-SLEDAI-2K>5) (OR = 5.5, p < 0.01). The presence of high-avidity anti-dsDNA antibodies represented a risk for renal, joint, and most importantly for serosal involvement. Our results suggest that simple and reliable ELISA for high-avidity anti-dsDNA antibodies is the test of good clinical utility

  12. Oxidative Stress, DNA Damage and DNA Repair in Female Patients with Diabetes Mellitus Type 2

    PubMed Central

    Grindel, Annemarie; Guggenberger, Bianca; Eichberger, Lukas; Pöppelmeyer, Christina; Gschaider, Michaela; Tosevska, Anela; Mare, George; Briskey, David; Brath, Helmut; Wagner, Karl-Heinz

    2016-01-01

    Background Diabetes mellitus type 2 (T2DM) is associated with oxidative stress which in turn can lead to DNA damage. The aim of the present study was to analyze oxidative stress, DNA damage and DNA repair in regard to hyperglycemic state and diabetes duration. Methods Female T2DM patients (n = 146) were enrolled in the MIKRODIAB study and allocated in two groups regarding their glycated hemoglobin (HbA1c) level (HbA1c≤7.5%, n = 74; HbA1c>7.5%, n = 72). In addition, tertiles according to diabetes duration (DD) were created (DDI = 6.94±3.1 y, n = 49; DDII = 13.35±1.1 y, n = 48; DDIII = 22.90±7.3 y, n = 49). Oxidative stress parameters, including ferric reducing ability potential, malondialdehyde, oxidized and reduced glutathione, reduced thiols, oxidized LDL and F2-Isoprostane as well as the activity of antioxidant enzymes superoxide dismutase, catalase and glutathione peroxidase were measured. Damage to DNA was analyzed in peripheral blood mononuclear cells and whole blood with single cell gel electrophoresis. DNA base excision repair capacity was tested with the modified comet repair assay. Additionally, mRNA expressions of nine genes related to base excision repair were analyzed in a subset of 46 matched individuals. Results No significant differences in oxidative stress parameters, antioxidant enzyme activities, damage to DNA and base excision repair capacity, neither between a HbA1c cut off />7.5%, nor between diabetes duration was found. A significant up-regulation in mRNA expression was found for APEX1, LIG3 and XRCC1 in patients with >7.5% HbA1c. Additionally, we observed higher total cholesterol, LDL-cholesterol, LDL/HDL-cholesterol, triglycerides, Framingham risk score, systolic blood pressure, BMI and lower HDL-cholesterol in the hyperglycemic group. Conclusion BMI, blood pressure and blood lipid status were worse in hyperglycemic individuals. However, no major disparities regarding oxidative stress, damage to DNA and DNA repair were present which

  13. Oxidative Stress, DNA Damage and DNA Repair in Female Patients with Diabetes Mellitus Type 2.

    PubMed

    Grindel, Annemarie; Guggenberger, Bianca; Eichberger, Lukas; Pöppelmeyer, Christina; Gschaider, Michaela; Tosevska, Anela; Mare, George; Briskey, David; Brath, Helmut; Wagner, Karl-Heinz

    2016-01-01

    Diabetes mellitus type 2 (T2DM) is associated with oxidative stress which in turn can lead to DNA damage. The aim of the present study was to analyze oxidative stress, DNA damage and DNA repair in regard to hyperglycemic state and diabetes duration. Female T2DM patients (n = 146) were enrolled in the MIKRODIAB study and allocated in two groups regarding their glycated hemoglobin (HbA1c) level (HbA1c≤7.5%, n = 74; HbA1c>7.5%, n = 72). In addition, tertiles according to diabetes duration (DD) were created (DDI = 6.94±3.1 y, n = 49; DDII = 13.35±1.1 y, n = 48; DDIII = 22.90±7.3 y, n = 49). Oxidative stress parameters, including ferric reducing ability potential, malondialdehyde, oxidized and reduced glutathione, reduced thiols, oxidized LDL and F2-Isoprostane as well as the activity of antioxidant enzymes superoxide dismutase, catalase and glutathione peroxidase were measured. Damage to DNA was analyzed in peripheral blood mononuclear cells and whole blood with single cell gel electrophoresis. DNA base excision repair capacity was tested with the modified comet repair assay. Additionally, mRNA expressions of nine genes related to base excision repair were analyzed in a subset of 46 matched individuals. No significant differences in oxidative stress parameters, antioxidant enzyme activities, damage to DNA and base excision repair capacity, neither between a HbA1c cut off />7.5%, nor between diabetes duration was found. A significant up-regulation in mRNA expression was found for APEX1, LIG3 and XRCC1 in patients with >7.5% HbA1c. Additionally, we observed higher total cholesterol, LDL-cholesterol, LDL/HDL-cholesterol, triglycerides, Framingham risk score, systolic blood pressure, BMI and lower HDL-cholesterol in the hyperglycemic group. BMI, blood pressure and blood lipid status were worse in hyperglycemic individuals. However, no major disparities regarding oxidative stress, damage to DNA and DNA repair were present which might be due to good medical treatment

  14. Identification of Plasmodium falciparum DNA Repair Protein Mre11 with an Evolutionarily Conserved Nuclease Function

    PubMed Central

    Badugu, Sugith Babu; Nabi, Shaik Abdul; Vaidyam, Pratap; Laskar, Shyamasree; Bhattacharyya, Sunanda; Bhattacharyya, Mrinal Kanti

    2015-01-01

    The eukaryotic Meiotic Recombination protein 11 (Mre11) plays pivotal roles in the DNA damage response (DDR). Specifically, Mre11 senses and signals DNA double strand breaks (DSB) and facilitates their repair through effector proteins belonging to either homologous recombination (HR) or non-homologous end joining (NHEJ) repair mechanisms. In the human malaria parasite Plasmodium falciparum, HR and alternative-NHEJ have been identified; however, little is known about the upstream factors involved in the DDR of this organism. In this report, we identify a putative ortholog of Mre11 in P. falciparum (PfalMre11) that shares 22% sequence similarity to human Mre11. Homology modeling reveals striking structural resemblance of the predicted PfalMre11 nuclease domain to the nuclease domain of Saccharomyces cerevisiae Mre11 (ScMre11). Complementation analyses reveal functional conservation of PfalMre11 nuclease activity as demonstrated by the ability of the PfalMre11 nuclease domain, in conjunction with the C-terminal domain of ScMre11, to functionally complement an mre11 deficient yeast strain. Functional complementation was virtually abrogated by an amino acid substitution in the PfalMre11 nuclease domain (D398N). PfalMre11 is abundant in the mitotically active trophozoite and schizont stages of P. falciparum and is up-regulated in response to DNA damage, suggesting a role in the DDR. PfalMre11 exhibits physical interaction with PfalRad50. In addition, yeast 2-hybrid studies show that PfalMre11 interacts with ScRad50 and ScXrs2, two important components of the well characterized Mre11-Rad50-Xrs2 complex which is involved in DDR signaling and repair in S. cerevisiae, further supporting a role for PfalMre11 in the DDR. Taken together, these findings provide evidence that PfalMre11 is an evolutionarily conserved component of the DDR in Plasmodium. PMID:25938776

  15. EHMT2 directs DNA methylation for efficient gene silencing in mouse embryos

    PubMed Central

    Auclair, Ghislain; Borgel, Julie; Sanz, Lionel A.; Vallet, Judith; Guibert, Sylvain; Dumas, Michael; Cavelier, Patricia; Girardot, Michael; Forné, Thierry; Feil, Robert; Weber, Michael

    2016-01-01

    The extent to which histone modifying enzymes contribute to DNA methylation in mammals remains unclear. Previous studies suggested a link between the lysine methyltransferase EHMT2 (also known as G9A and KMT1C) and DNA methylation in the mouse. Here, we used a model of knockout mice to explore the role of EHMT2 in DNA methylation during mouse embryogenesis. The Ehmt2 gene is expressed in epiblast cells but is dispensable for global DNA methylation in embryogenesis. In contrast, EHMT2 regulates DNA methylation at specific sequences that include CpG-rich promoters of germline-specific genes. These loci are bound by EHMT2 in embryonic cells, are marked by H3K9 dimethylation, and have strongly reduced DNA methylation in Ehmt2−/− embryos. EHMT2 also plays a role in the maintenance of germline-derived DNA methylation at one imprinted locus, the Slc38a4 gene. Finally, we show that DNA methylation is instrumental for EHMT2-mediated gene silencing in embryogenesis. Our findings identify EHMT2 as a critical factor that facilitates repressive DNA methylation at specific genomic loci during mammalian development. PMID:26576615

  16. Donor Brain Death Exacerbates Complement-Dependent Ischemia Reperfusion Injury in Transplanted Hearts

    PubMed Central

    Atkinson, Carl; Floerchinger, Bernhard; Qiao, Fei; Casey, Sarah; Williamson, Tucker; Moseley, Ellen; Stoica, Serban; Goddard, Martin; Ge, Xupeng; Tullius, Stefan G.; Tomlinson, Stephen

    2013-01-01

    Background Brain death (BD) can immunologically prime the donor organ and is thought to lead to exacerbated ischemia reperfusion injury (IRI) post-transplantation. Using a newly developed mouse model of BD, we investigated the effect of donor BD on post transplant cardiac IRI. We further investigated the therapeutic effect of a targeted complement inhibitor in recipients of BD donor hearts, and addressed the clinical relevance of these studies by analysis of human heart biopsies from BD and domino (living) donors. Methods and Results Hearts from living or brain dead donor C57BL/6 mice were transplanted into C57BL/6 or BALB/c recipients. Recipient mice were treated with the complement inhibitor CR2-Crry or vehicle control (n=6). Isografts were analyzed 48 hours post-transplant for injury, inflammation and complement deposition, and allografts monitored for graft survival. Human cardiac biopsies were analyzed for complement deposition and inflammatory cell infiltration. In the murine model, donor BD exacerbated IRI and graft rejection as demonstrated by increased myocardial injury, serum cardiac troponin, cellular infiltration, inflammatory chemokine and cytokine levels, complement deposition, and decreased graft survival. CR2-Crry treatment of recipients significantly reduced all measured outcomes in grafts from both BD and living donors compared to controls. Analysis of human samples documented the relevance of our experimental findings and revealed exacerbated complement deposition and inflammation in grafts from BD donors compared to grafts from living donors. Conclusions BD exacerbates post-transplant cardiac IRI in mice and humans, and decreases survival of mouse allografts. Further, targeted complement inhibition in recipient mice ameliorates BD-exacerbated IRI. PMID:23443736

  17. A programming language for composable DNA circuits.

    PubMed

    Phillips, Andrew; Cardelli, Luca

    2009-08-06

    Recently, a range of information-processing circuits have been implemented in DNA by using strand displacement as their main computational mechanism. Examples include digital logic circuits and catalytic signal amplification circuits that function as efficient molecular detectors. As new paradigms for DNA computation emerge, the development of corresponding languages and tools for these paradigms will help to facilitate the design of DNA circuits and their automatic compilation to nucleotide sequences. We present a programming language for designing and simulating DNA circuits in which strand displacement is the main computational mechanism. The language includes basic elements of sequence domains, toeholds and branch migration, and assumes that strands do not possess any secondary structure. The language is used to model and simulate a variety of circuits, including an entropy-driven catalytic gate, a simple gate motif for synthesizing large-scale circuits and a scheme for implementing an arbitrary system of chemical reactions. The language is a first step towards the design of modelling and simulation tools for DNA strand displacement, which complements the emergence of novel implementation strategies for DNA computing.

  18. A programming language for composable DNA circuits

    PubMed Central

    Phillips, Andrew; Cardelli, Luca

    2009-01-01

    Recently, a range of information-processing circuits have been implemented in DNA by using strand displacement as their main computational mechanism. Examples include digital logic circuits and catalytic signal amplification circuits that function as efficient molecular detectors. As new paradigms for DNA computation emerge, the development of corresponding languages and tools for these paradigms will help to facilitate the design of DNA circuits and their automatic compilation to nucleotide sequences. We present a programming language for designing and simulating DNA circuits in which strand displacement is the main computational mechanism. The language includes basic elements of sequence domains, toeholds and branch migration, and assumes that strands do not possess any secondary structure. The language is used to model and simulate a variety of circuits, including an entropy-driven catalytic gate, a simple gate motif for synthesizing large-scale circuits and a scheme for implementing an arbitrary system of chemical reactions. The language is a first step towards the design of modelling and simulation tools for DNA strand displacement, which complements the emergence of novel implementation strategies for DNA computing. PMID:19535415

  19. Ultrahigh-resolution crystal structures of Z-DNA in complex with Mn(2+) and Zn(2+) ions.

    PubMed

    Drozdzal, Pawel; Gilski, Miroslaw; Kierzek, Ryszard; Lomozik, Lechoslaw; Jaskolski, Mariusz

    2013-06-01

    X-ray crystal structures of the spermine(4+) form of the Z-DNA duplex with the self-complementary d(CG)3 sequence in complexes with Mn(2+) and Zn(2+) cations have been determined at the ultrahigh resolutions of 0.75 and 0.85 Å, respectively. Stereochemical restraints were only used for the sperminium cation (in both structures) and for nucleotides with dual conformation in the Zn(2+) complex. The Mn(2+) and Zn(2+) cations at the major site, designated M(2+)(1), bind at the N7 position of G6 by direct coordination. The coordination geometry of this site was octahedral, with complete hydration shells. An additional Zn(2+)(2) cation was bis-coordinated in a tetrahedral fashion by the N7 atoms of G10 and G12 from a symmetry-related molecule. The coordination distances of Zn(2+)(1) and Zn(2+)(2) to the O6 atom of the guanine residues were 3.613 (6) and 3.258 (5) Å, respectively. Moreover, a chloride ion was also identified in the coordination sphere of Zn(2+)(2). Alternate conformations were observed in the Z-DNA-Zn(2+) structure not only at internucleotide linkages but also at the terminal C3'-OH group of G12. The conformation of the sperminium chain in the Z-DNA-Mn(2+) complex is similar to the spermine(4+) conformation in analogous Z-DNA-Mg(2+) structures. In the Z-DNA-Zn(2+) complex the sperminium cation is disordered and partially invisible in electron-density maps. In the Z-DNA-Zn(2+) complex the sperminium cation only interacts with the phosphate groups of the Z-DNA molecules, while in the Z-DNA-Mn(2+) structure it forms hydrogen bonds to both the phosphate groups and DNA bases.

  20. Irc3 is a mitochondrial DNA branch migration enzyme

    PubMed Central

    Gaidutšik, Ilja; Sedman, Tiina; Sillamaa, Sirelin; Sedman, Juhan

    2016-01-01

    Integrity of mitochondrial DNA (mtDNA) is essential for cellular energy metabolism. In the budding yeast Saccharomyces cerevisiae, a large number of nuclear genes influence the stability of mitochondrial genome; however, most corresponding gene products act indirectly and the actual molecular mechanisms of mtDNA inheritance remain poorly characterized. Recently, we found that a Superfamily II helicase Irc3 is required for the maintenance of mitochondrial genome integrity. Here we show that Irc3 is a mitochondrial DNA branch migration enzyme. Irc3 modulates mtDNA metabolic intermediates by preferential binding and unwinding Holliday junctions and replication fork structures. Furthermore, we demonstrate that the loss of Irc3 can be complemented with mitochondrially targeted RecG of Escherichia coli. We suggest that Irc3 could support the stability of mtDNA by stimulating fork regression and branch migration or by inhibiting the formation of irregular branched molecules. PMID:27194389

  1. Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links

    PubMed Central

    Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.

    2014-01-01

    The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636

  2. Carnivorous Nutrition in Pitcher Plants (Nepenthes spp.) via an Unusual Complement of Endogenous Enzymes.

    PubMed

    Lee, Linda; Zhang, Ye; Ozar, Brittany; Sensen, Christoph W; Schriemer, David C

    2016-09-02

    Plants belonging to the genus Nepenthes are carnivorous, using specialized pitfall traps called "pitchers" that attract, capture, and digest insects as a primary source of nutrients. We have used RNA sequencing to generate a cDNA library from the Nepenthes pitchers and applied it to mass spectrometry-based identification of the enzymes secreted into the pitcher fluid using a nonspecific digestion strategy superior to trypsin in this application. This first complete catalog of the pitcher fluid subproteome includes enzymes across a variety of functional classes. The most abundant proteins present in the secreted fluid are proteases, nucleases, peroxidases, chitinases, a phosphatase, and a glucanase. Nitrogen recovery involves a particularly rich complement of proteases. In addition to the two expected aspartic proteases, we discovered three novel nepenthensins, two prolyl endopeptidases that we name neprosins, and a putative serine carboxypeptidase. Additional proteins identified are relevant to pathogen-defense and secretion mechanisms. The full complement of acid-stable enzymes discovered in this study suggests that carnivory in the genus Nepenthes can be sustained by plant-based mechanisms alone and does not absolutely require bacterial symbiosis.

  3. Relative Contribution of Cellular Complement Inhibitors CD59, CD46, and CD55 to Parainfluenza Virus 5 Inhibition of Complement-Mediated Neutralization

    PubMed Central

    Li, Yujia; Parks, Griffith D.

    2018-01-01

    The complement system is a part of the innate immune system that viruses need to face during infections. Many viruses incorporate cellular regulators of complement activation (RCA) to block complement pathways and our prior work has shown that Parainfluenza virus 5 (PIV5) incorporates CD55 and CD46 to delay complement-mediated neutralization. In this paper, we tested the role of a third individual RCA inhibitor CD59 in PIV5 interactions with complement pathways. Using a cell line engineered to express CD59, we show that small levels of functional CD59 are associated with progeny PIV5, which is capable of blocking assembly of the C5b-C9 membrane attack complex (MAC). PIV5 containing CD59 (PIV5-CD59) showed increased resistance to complement-mediated neutralization in vitro comparing to PIV5 lacking regulators. Infection of A549 cells with PIV5 and RSV upregulated CD59 expression. TGF-beta treatment of PIV5-infected cells also increased cell surface CD59 expression and progeny virions were more resistant to complement-mediated neutralization. A comparison of individual viruses containing only CD55, CD46, or CD59 showed a potency of inhibiting complement-mediated neutralization, which followed a pattern of CD55 > CD46 > CD59. PMID:29693588

  4. A fluorescent bimolecular complementation screen reveals MAF1, RNF7 and SETD3 as PCNA-associated proteins in human cells

    PubMed Central

    Cooper, Simon E; Hodimont, Elsie; Green, Catherine M

    2015-01-01

    The proliferating cell nuclear antigen (PCNA) is a conserved component of DNA replication factories, and interactions with PCNA mediate the recruitment of many essential DNA replication enzymes to these sites of DNA synthesis. A complete description of the structure and composition of these factories remains elusive, and a better knowledge of them will improve our understanding of how the maintenance of genome and epigenetic stability is achieved. To fully characterize the set of proteins that interact with PCNA we developed a bimolecular fluorescence complementation (BiFC) screen for PCNA-interactors in human cells. This 2-hybrid type screen for interactors from a human cDNA library is rapid and efficient. The fluorescent read-out for protein interaction enables facile selection of interacting clones, and we combined this with next generation sequencing to identify the cDNAs encoding the interacting proteins. This method was able to reproducibly identify previously characterized PCNA-interactors but importantly also identified RNF7, Maf1 and SetD3 as PCNA-interacting proteins. We validated these interactions by co-immunoprecipitation from human cell extracts and by interaction analyses using recombinant proteins. These results show that the BiFC screen is a valuable method for the identification of protein-protein interactions in living mammalian cells. This approach has potentially wide application as it is high throughput and readily automated. We suggest that, given this interaction with PCNA, Maf1, RNF7, and SetD3 are potentially involved in DNA replication, DNA repair, or associated processes. PMID:26030842

  5. Relationship of the Xeroderma Pigmentosum Group E DNA Repair Defect to the Chromatin and DNA Binding Proteins UV-DDB and Replication Protein A

    PubMed Central

    Rapić Otrin, Vesna; Kuraoka, Isao; Nardo, Tiziana; McLenigan, Mary; Eker, A. P. M.; Stefanini, Miria; Levine, Arthur S.; Wood, Richard D.

    1998-01-01

    Cells from complementation groups A through G of the heritable sun-sensitive disorder xeroderma pigmentosum (XP) show defects in nucleotide excision repair of damaged DNA. Proteins representing groups A, B, C, D, F, and G are subunits of the core recognition and incision machinery of repair. XP group E (XP-E) is the mildest form of the disorder, and cells generally show about 50% of the normal repair level. We investigated two protein factors previously implicated in the XP-E defect, UV-damaged DNA binding protein (UV-DDB) and replication protein A (RPA). Three newly identified XP-E cell lines (XP23PV, XP25PV, and a line formerly classified as an XP variant) were defective in UV-DDB binding activity but had levels of RPA in the normal range. The XP-E cell extracts did not display a significant nucleotide excision repair defect in vitro, with either UV-irradiated DNA or a uniquely placed cisplatin lesion used as a substrate. Purified UV-DDB protein did not stimulate repair of naked DNA by DDB− XP-E cell extracts, but microinjection of the protein into DDB− XP-E cells could partially correct the repair defect. RPA stimulated repair in normal, XP-E, or complemented extracts from other XP groups, and so the effect of RPA was not specific for XP-E cell extracts. These data strengthen the connection between XP-E and UV-DDB. Coupled with previous results, the findings suggest that UV-DDB has a role in the repair of DNA in chromatin. PMID:9584159

  6. Synthesis, characterization and DNA-binding studies of mono and heterobimetallic complexes Cu sbnd Sn 2/Zn sbnd Sn 2 and their DNA cleavage activity

    NASA Astrophysics Data System (ADS)

    Arjmand, Farukh; Sayeed, Fatima

    2010-02-01

    Heterobimetallic complexes C 6H 24N 4O 6CuSn 2Cl 63, C 6H 24N 4O 6ZnSn 2Cl 64 have been synthesized from their monometallic analogs C 6H 16N 4O 2CuCl 21, C 6H 16N 4O 2ZnCl 22, and were characterized by various spectroscopic and analytical methods. The complexes 1-4 reveal an octahedral geometry for both central metal ions Cu/Zn as well as for Sn metal ion. The interaction of complexes 1-4 with CT-DNA, were investigated by using absorption, emission, cyclic voltammetry, viscometry and DNA cleavage studies. The emission quenching of 3 and 4 by [Fe(CN) 6] 4- depressed greatly when bound to CT-DNA. The results of spectroscopic, viscometric and cyclic voltammetry of complexes 3 and 4 revealed electrostatic mode of binding of the complexes with CT-DNA. These results revealed that 4 bind more avidly in comparison to 3 with CT-DNA. Gel electrophoresis of DNA with complexes 3 and 4 demonstrated that the complexes exhibit excellent cleavage activity under physiological conditions.

  7. Enzymatic Reaction with Unnatural Substrates: DNA Photolyase (Escherichia coli) Recognizes and Reverses Thymine [2+2] Dimers in the DNA Strand of a DNA/PNA Hybrid Duplex

    NASA Astrophysics Data System (ADS)

    Ramaiah, Danaboyina; Kan, Yongzhi; Koch, Troels; Orum, Henrik; Schuster, Gary B.

    1998-10-01

    Peptide nucleic acids (PNA) are mimics with normal bases connected to a pseudopeptide chain that obey Watson--Crick rules to form stable duplexes with itself and natural nucleic acids. This has focused attention on PNA as therapeutic or diagnostic reagents. Duplexes formed with PNA mirror some but not all properties of DNA. One fascinating aspect of PNA biochemistry is their reaction with enzymes. Here we show an enzyme reaction that operates effectively on a PNA/DNA hybrid duplex. A DNA oligonucleotide containing a cis, syn-thymine [2+2] dimer forms a stable duplex with PNA. The hybrid duplex is recognized by photolyase, and irradiation of the complex leads to the repair of the thymine dimer. This finding provides insight into the enzyme mechanism and provides a means for the selective repair of thymine photodimers.

  8. Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.

    PubMed

    Lam, Kathy N; Martens, Eric C; Charles, Trevor C

    2018-01-01

    Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be

  9. ERCC2/XPD Lys751Gln alter DNA repair efficiency of platinum-induced DNA damage through P53 pathway.

    PubMed

    Zhang, Guopei; Guan, Yangyang; Zhao, Yuejiao; van der Straaten, Tahar; Xiao, Sha; Xue, Ping; Zhu, Guolian; Liu, Qiufang; Cai, Yuan; Jin, Cuihong; Yang, Jinghua; Wu, Shengwen; Lu, Xiaobo

    2017-02-01

    Platinum-based treatment causes Pt-DNA adducts which lead to cell death. The platinum-induced DNA damage is recognized and repaired by the nucleotide excision repair (NER) system of which ERCC2/XPD is a critical enzyme. Single nucleotide polymorphisms in ERCC2/XPD have been found to be associated with platinum resistance. The aim of the present study was to investigate whether ERCC2/XPD Lys751Gln (rs13181) polymorphism is causally related to DNA repair capacity of platinum-induced DNA damage. First, cDNA clones expressing different genotypes of the polymorphism was transfected to an ERCC2/XPD defective CHO cell line (UV5). Second, all cells were treated with cisplatin. Cellular survival rate were investigated by MTT growth inhibition assay, DNA damage levels were investigated by comet assay and RAD51 staining. The distribution of cell cycle and the change of apoptosis rates were detected by a flow cytometric method (FCM). Finally, P53mRNA and phospho-P53 protein levels were further investigated in order to explore a possible explanation. As expected, there was a significantly increased in viability of UV5 ERCC2 (AA) as compared to UV5 ERCC2 (CC) after cisplatin treatment. The DNA damage level of UV5 ERCC2 (AA) was significant decreased compared to UV5 ERCC2 (CC) at 24 h of treatment. Mutation of ERCC2rs13181 AA to CC causes a prolonged S phase in cell cycle. UV5 ERCC2 (AA) alleviated the apoptosis compared to UV5 ERCC2 (CC) , meanwhile P53mRNA levels in UV ERCC2 (AA) was also lower when compared UV5 ERCC2 (CC) . It co-incides with a prolonged high expression of phospho-P53, which is relevant for cell cycle regulation, apoptosis, and the DNA damage response (DDR). We concluded that ERCC2/XPD rs13181 polymorphism is possibly related to the DNA repair capacity of platinum-induced DNA damage. This functional study provides some clues to clarify the relationship between cisplatin resistance and ERCC2/XPDrs13181 polymorphism. Copyright © 2016 Elsevier Ireland Ltd. All

  10. E2F1 and E2F2 induction in response to DNA damage preserves genomic stability in neuronal cells.

    PubMed

    Castillo, Daniela S; Campalans, Anna; Belluscio, Laura M; Carcagno, Abel L; Radicella, J Pablo; Cánepa, Eduardo T; Pregi, Nicolás

    2015-01-01

    E2F transcription factors regulate a wide range of biological processes, including the cellular response to DNA damage. In the present study, we examined whether E2F family members are transcriptionally induced following treatment with several genotoxic agents, and have a role on the cell DNA damage response. We show a novel mechanism, conserved among diverse species, in which E2F1 and E2F2, the latter specifically in neuronal cells, are transcriptionally induced after DNA damage. This upregulation leads to increased E2F1 and E2F2 protein levels as a consequence of de novo protein synthesis. Ectopic expression of these E2Fs in neuronal cells reduces the level of DNA damage following genotoxic treatment, while ablation of E2F1 and E2F2 leads to the accumulation of DNA lesions and increased apoptotic response. Cell viability and DNA repair capability in response to DNA damage induction are also reduced by the E2F1 and E2F2 deficiencies. Finally, E2F1 and E2F2 accumulate at sites of oxidative and UV-induced DNA damage, and interact with γH2AX DNA repair factor. As previously reported for E2F1, E2F2 promotes Rad51 foci formation, interacts with GCN5 acetyltransferase and induces histone acetylation following genotoxic insult. The results presented here unveil a new mechanism involving E2F1 and E2F2 in the maintenance of genomic stability in response to DNA damage in neuronal cells.

  11. E2F1 and E2F2 induction in response to DNA damage preserves genomic stability in neuronal cells

    PubMed Central

    Castillo, Daniela S; Campalans, Anna; Belluscio, Laura M; Carcagno, Abel L; Radicella, J Pablo; Cánepa, Eduardo T; Pregi, Nicolás

    2015-01-01

    E2F transcription factors regulate a wide range of biological processes, including the cellular response to DNA damage. In the present study, we examined whether E2F family members are transcriptionally induced following treatment with several genotoxic agents, and have a role on the cell DNA damage response. We show a novel mechanism, conserved among diverse species, in which E2F1 and E2F2, the latter specifically in neuronal cells, are transcriptionally induced after DNA damage. This upregulation leads to increased E2F1 and E2F2 protein levels as a consequence of de novo protein synthesis. Ectopic expression of these E2Fs in neuronal cells reduces the level of DNA damage following genotoxic treatment, while ablation of E2F1 and E2F2 leads to the accumulation of DNA lesions and increased apoptotic response. Cell viability and DNA repair capability in response to DNA damage induction are also reduced by the E2F1 and E2F2 deficiencies. Finally, E2F1 and E2F2 accumulate at sites of oxidative and UV-induced DNA damage, and interact with γH2AX DNA repair factor. As previously reported for E2F1, E2F2 promotes Rad51 foci formation, interacts with GCN5 acetyltransferase and induces histone acetylation following genotoxic insult. The results presented here unveil a new mechanism involving E2F1 and E2F2 in the maintenance of genomic stability in response to DNA damage in neuronal cells. PMID:25892555

  12. Solution Structures of 2 : 1 And 1 : 1 DNA Polymerase - DNA Complexes Probed By Ultracentrifugation And Small-Angle X-Ray Scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, K.H.; /Ohio State U.; Niebuhr, M.

    2009-04-30

    We report small-angle X-ray scattering (SAXS) and sedimentation velocity (SV) studies on the enzyme-DNA complexes of rat DNA polymerase {beta} (Pol {beta}) and African swine fever virus DNA polymerase X (ASFV Pol X) with one-nucleotide gapped DNA. The results indicated formation of a 2 : 1 Pol {beta}-DNA complex, whereas only 1 : 1 Pol X-DNA complex was observed. Three-dimensional structural models for the 2 : 1 Pol {beta}-DNA and 1 : 1 Pol X-DNA complexes were generated from the SAXS experimental data to correlate with the functions of the DNA polymerases. The former indicates interactions of the 8 kDamore » 5{prime}-dRP lyase domain of the second Pol {beta} molecule with the active site of the 1 : 1 Pol {beta}-DNA complex, while the latter demonstrates how ASFV Pol X binds DNA in the absence of DNA-binding motif(s). As ASFV Pol X has no 5{prime}-dRP lyase domain, it is reasonable not to form a 2 : 1 complex. Based on the enhanced activities of the 2 : 1 complex and the observation that the 8 kDa domain is not in an optimal configuration for the 5{prime}-dRP lyase reaction in the crystal structures of the closed ternary enzyme-DNA-dNTP complexes, we propose that the asymmetric 2 : 1 Pol {beta}-DNA complex enhances the function of Pol {beta}.« less

  13. The Complement System in Flavivirus Infections

    PubMed Central

    Conde, Jonas N.; Silva, Emiliana M.; Barbosa, Angela S.; Mohana-Borges, Ronaldo

    2017-01-01

    The incidence of flavivirus infections has increased dramatically in recent decades in tropical and sub-tropical climates worldwide, affecting hundreds of millions of people each year. The Flaviviridae family includes dengue, West Nile, Zika, Japanese encephalitis, and yellow fever viruses that are typically transmitted by mosquitoes or ticks, and cause a wide range of symptoms, such as fever, shock, meningitis, paralysis, birth defects, and death. The flavivirus genome is composed of a single positive-sense RNA molecule encoding a single viral polyprotein. This polyprotein is further processed by viral and host proteases into three structural proteins (C, prM/M, E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5) that are involved in viral replication and pathogenicity. The complement system has been described to play an important role in flavivirus infection either by protecting the host and/or by influencing disease pathogenesis. In this mini-review, we will explore the role of complement system inhibition and/or activation against infection by the Flavivirus genus, with an emphasis on dengue and West Nile viruses. PMID:28261172

  14. Arabidopsis thaliana DNA gyrase is targeted to chloroplasts and mitochondria.

    PubMed

    Wall, Melisa K; Mitchenall, Lesley A; Maxwell, Anthony

    2004-05-18

    DNA gyrase is the bacterial DNA topoisomerase (topo) that supercoils DNA by using the free energy of ATP hydrolysis. The enzyme, an A(2)B(2) tetramer encoded by the gyrA and gyrB genes, catalyses topological changes in DNA during replication and transcription, and is the only topo that is able to introduce negative supercoils. Gyrase is essential in bacteria and apparently absent from eukaryotes and is, consequently, an important target for antibacterial agents (e.g., quinolones and coumarins). We have identified four putative gyrase genes in the model plant Arabidopsis thaliana; one gyrA and three gyrB homologues. DNA gyrase protein A (GyrA) has a dual translational initiation site targeting the mature protein to both chloroplasts and mitochondria, and there are individual targeting sequences for two of the DNA gyrase protein B (GyrB) homologues. N-terminal fusions of the organellar targeting sequences to GFPs support the hypothesis that one enzyme is targeted to the chloroplast and another to the mitochondrion, which correlates with supercoiling activity in isolated organelles. Treatment of seedlings and cultured cells with gyrase-specific drugs leads to growth inhibition. Knockout of A. thaliana gyrA is embryo-lethal whereas knockouts in the gyrB genes lead to seedling-lethal phenotypes or severely stunted growth and development. The A. thaliana genes have been cloned in Escherichia coli and found to complement gyrase temperature-sensitive strains. This report confirms the existence of DNA gyrase in eukaryotes and has important implications for drug targeting, organelle replication, and the evolution of topos in plants.

  15. DDB2 promotes chromatin decondensation at UV-induced DNA damage

    PubMed Central

    Lindh, Michael; Acs, Klara; Vrouwe, Mischa G.; Pines, Alex; van Attikum, Haico; Mullenders, Leon H.

    2012-01-01

    Nucleotide excision repair (NER) is the principal pathway that removes helix-distorting deoxyribonucleic acid (DNA) damage from the mammalian genome. Recognition of DNA lesions by xeroderma pigmentosum group C (XPC) protein in chromatin is stimulated by the damaged DNA-binding protein 2 (DDB2), which is part of a CUL4A–RING ubiquitin ligase (CRL4) complex. In this paper, we report a new function of DDB2 in modulating chromatin structure at DNA lesions. We show that DDB2 elicits unfolding of large-scale chromatin structure independently of the CRL4 ubiquitin ligase complex. Our data reveal a marked adenosine triphosphate (ATP)–dependent reduction in the density of core histones in chromatin containing UV-induced DNA lesions, which strictly required functional DDB2 and involved the activity of poly(adenosine diphosphate [ADP]–ribose) polymerase 1. Finally, we show that lesion recognition by XPC, but not DDB2, was strongly reduced in ATP-depleted cells and was regulated by the steady-state levels of poly(ADP-ribose) chains. PMID:22492724

  16. Small RNA-mediated repair of UV-induced DNA lesions by the DNA DAMAGE-BINDING PROTEIN 2 and ARGONAUTE 1

    PubMed Central

    Schalk, Catherine; Cognat, Valérie; Graindorge, Stéfanie; Vincent, Timothée; Voinnet, Olivier; Molinier, Jean

    2017-01-01

    As photosynthetic organisms, plants need to prevent irreversible UV-induced DNA lesions. Through an unbiased, genome-wide approach, we have uncovered a previously unrecognized interplay between Global Genome Repair and small interfering RNAs (siRNAs) in the recognition of DNA photoproducts, prevalently in intergenic regions. Genetic and biochemical approaches indicate that, upon UV irradiation, the DNA DAMAGE-BINDING PROTEIN 2 (DDB2) and ARGONAUTE 1 (AGO1) of Arabidopsis thaliana form a chromatin-bound complex together with 21-nt siRNAs, which likely facilitates recognition of DNA damages in an RNA/DNA complementary strand-specific manner. The biogenesis of photoproduct-associated siRNAs involves the noncanonical, concerted action of RNA POLYMERASE IV, RNA-DEPENDENT RNA POLYMERASE-2, and DICER-LIKE-4. Furthermore, the chromatin association/dissociation of the DDB2-AGO1 complex is under the control of siRNA abundance and DNA damage signaling. These findings reveal unexpected nuclear functions for DCL4 and AGO1, and shed light on the interplay between small RNAs and DNA repair recognition factors at damaged sites. PMID:28325872

  17. Streptococcus pyogenes Endopeptidase O Contributes to Evasion from Complement-mediated Bacteriolysis via Binding to Human Complement Factor C1q*

    PubMed Central

    Honda-Ogawa, Mariko; Sumitomo, Tomoko; Mori, Yasushi; Hamd, Dalia Talat; Ogawa, Taiji; Yamaguchi, Masaya; Nakata, Masanobu; Kawabata, Shigetada

    2017-01-01

    Streptococcus pyogenes secretes various virulence factors for evasion from complement-mediated bacteriolysis. However, full understanding of the molecules possessed by this organism that interact with complement C1q, an initiator of the classical complement pathway, remains elusive. In this study, we identified an endopeptidase of S. pyogenes, PepO, as an interacting molecule, and investigated its effects on complement immunity and pathogenesis. Enzyme-linked immunosorbent assay and surface plasmon resonance analysis findings revealed that S. pyogenes recombinant PepO bound to human C1q in a concentration-dependent manner under physiological conditions. Sites of inflammation are known to have decreased pH levels, thus the effects of PepO on bacterial evasion from complement immunity was analyzed in a low pH condition. Notably, under low pH conditions, PepO exhibited a higher affinity for C1q as compared with IgG, and PepO inhibited the binding of IgG to C1q. In addition, pepO deletion rendered S. pyogenes more susceptible to the bacteriocidal activity of human serum. Also, observations of the morphological features of the pepO mutant strain (ΔpepO) showed damaged irregular surfaces as compared with the wild-type strain (WT). WT-infected tissues exhibited greater severity and lower complement activity as compared with those infected by ΔpepO in a mouse skin infection model. Furthermore, WT infection resulted in a larger accumulation of C1q than that with ΔpepO. Our results suggest that interaction of S. pyogenes PepO with C1q interferes with the complement pathway, which enables S. pyogenes to evade complement-mediated bacteriolysis under acidic conditions, such as seen in inflammatory sites. PMID:28154192

  18. Streptococcus pyogenes Endopeptidase O Contributes to Evasion from Complement-mediated Bacteriolysis via Binding to Human Complement Factor C1q.

    PubMed

    Honda-Ogawa, Mariko; Sumitomo, Tomoko; Mori, Yasushi; Hamd, Dalia Talat; Ogawa, Taiji; Yamaguchi, Masaya; Nakata, Masanobu; Kawabata, Shigetada

    2017-03-10

    Streptococcus pyogenes secretes various virulence factors for evasion from complement-mediated bacteriolysis. However, full understanding of the molecules possessed by this organism that interact with complement C1q, an initiator of the classical complement pathway, remains elusive. In this study, we identified an endopeptidase of S. pyogenes , PepO, as an interacting molecule, and investigated its effects on complement immunity and pathogenesis. Enzyme-linked immunosorbent assay and surface plasmon resonance analysis findings revealed that S. pyogenes recombinant PepO bound to human C1q in a concentration-dependent manner under physiological conditions. Sites of inflammation are known to have decreased pH levels, thus the effects of PepO on bacterial evasion from complement immunity was analyzed in a low pH condition. Notably, under low pH conditions, PepO exhibited a higher affinity for C1q as compared with IgG, and PepO inhibited the binding of IgG to C1q. In addition, pepO deletion rendered S. pyogenes more susceptible to the bacteriocidal activity of human serum. Also, observations of the morphological features of the pepO mutant strain (Δ pepO ) showed damaged irregular surfaces as compared with the wild-type strain (WT). WT-infected tissues exhibited greater severity and lower complement activity as compared with those infected by Δ pepO in a mouse skin infection model. Furthermore, WT infection resulted in a larger accumulation of C1q than that with Δ pepO. Our results suggest that interaction of S. pyogenes PepO with C1q interferes with the complement pathway, which enables S. pyogenes to evade complement-mediated bacteriolysis under acidic conditions, such as seen in inflammatory sites. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. A De Novo Deletion in the Regulators of Complement Activation Cluster Producing a Hybrid Complement Factor H/Complement Factor H-Related 3 Gene in Atypical Hemolytic Uremic Syndrome.

    PubMed

    Challis, Rachel C; Araujo, Geisilaine S R; Wong, Edwin K S; Anderson, Holly E; Awan, Atif; Dorman, Anthony M; Waldron, Mary; Wilson, Valerie; Brocklebank, Vicky; Strain, Lisa; Morgan, B Paul; Harris, Claire L; Marchbank, Kevin J; Goodship, Timothy H J; Kavanagh, David

    2016-06-01

    The regulators of complement activation cluster at chromosome 1q32 contains the complement factor H (CFH) and five complement factor H-related (CFHR) genes. This area of the genome arose from several large genomic duplications, and these low-copy repeats can cause genome instability in this region. Genomic disorders affecting these genes have been described in atypical hemolytic uremic syndrome, arising commonly through nonallelic homologous recombination. We describe a novel CFH/CFHR3 hybrid gene secondary to a de novo 6.3-kb deletion that arose through microhomology-mediated end joining rather than nonallelic homologous recombination. We confirmed a transcript from this hybrid gene and showed a secreted protein product that lacks the recognition domain of factor H and exhibits impaired cell surface complement regulation. The fact that the formation of this hybrid gene arose as a de novo event suggests that this cluster is a dynamic area of the genome in which additional genomic disorders may arise. Copyright © 2016 by the American Society of Nephrology.

  20. Complement Interaction with Trypanosomatid Promastigotes in Normal Human Serum

    PubMed Central

    Domínguez, Mercedes; Moreno, Inmaculada; López-Trascasa, Margarita; Toraño, Alfredo

    2002-01-01

    In normal human serum (NHS), axenic promastigotes of Crithidia, Phytomonas, and Leishmania trigger complement activation, and from 1.2 to 1.8 × 105 C3 molecules are deposited per promastigote within 2.5 min. In Leishmania, promastigote C3 binding capacity remains constant during in vitro metacyclogenesis. C3 deposition on promastigotes activated through the classical complement pathway reaches a 50% maximum after ∼50 s, and represents >85% of total C3 bound. In C1q- and C2-deficient human sera, promastigotes cannot activate the classical pathway (CP) unless purified C1q or C2 factors, respectively, are supplemented, demonstrating a requirement for CP factor in promastigote C3 opsonization. NHS depleted of natural anti-Leishmania antibodies cannot trigger promastigote CP activation, but IgM addition restores C3 binding. Furthermore, Leishmania binds natural antibodies in ethylenediaminetetracetic acid (EDTA)-treated NHS; after EDTA removal, promastigote-bound IgM triggers C3 deposition in natural antibody-depleted NHS. Serum collectins and pentraxins thus do not participate significantly in NHS promastigote C3 opsonization. Real-time kinetic analysis of promastigote CP-mediated lysis indicates that between 85–95% of parasites are killed within 2.5 min of serum contact. These data indicate that successful Leishmania infection in man must immediately follow promastigote transmission, and that Leishmania evasion strategies are shaped by the selective pressure exerted by complement. PMID:11854358

  1. Genetic control of enhanced mutability of mitochondrial DNA and gamma-ray sensitivity in Saccharomyces cerevisiae.

    PubMed Central

    Foury, F; Goffeau, A

    1979-01-01

    Five nuclear mutants enhancing the spontaneous mutation rate of mtDNA have been isolated in Saccharomyces cerevisiae. These mutators fall into five complementation groups and are located at five genetic loci different from rad50 to rad57 loci. Three mutants (gam1, gam2, and gam4), insensitive or weakly sensitive to gamma-rays, exhibit increased frequency of spontaneous production of mutants with large deletions of the mtDNA (p-) and of all tested mitochondrial drug-resistant mutants. Two other mutants (gam3 and gam5), highly sensitive to gamma-rays, increase only the mutation rate of particular alleles of the mtDNA. The mutant gam5 enhances only the production of p- and erythromycin-resistant clones. The mutant gam3 exhibits an enhanced rate of oligomycin-resistant clones as well as a collateral increase of nuclear mutability. The existence of gam3 and gam5 mutants indicates that at least two common steps control both nuclear DNA repair and the mutability of particular alleles of the mtDNA. However, the general spontaneous mutability of the mtDNA includes at least three steps not involved in the repair of nuclear DNA, as revealed by the gam1, gam2, and gam4 mutations. PMID:392521

  2. Kupffer cell complement receptor clearance function and host defense.

    PubMed

    Loegering, D J

    1986-01-01

    Kupffer cells are well known to be important for normal host defense function. The development of methods to evaluate the in vivo function of specific receptors on Kupffer cells has made it possible to assess the role of these receptors in host defense. The rationale for studying complement receptors is based on the proposed important role of these receptors in host defense and on the observation that the hereditary deficiency of a complement receptor is associated with recurrent severe bacterial infections. The studies reviewed here demonstrate that forms of injury that are associated with depressed host defense including thermal injury, hemorrhagic shock, trauma, and surgery also cause a decrease in complement receptor clearance function. This decrease in Kupffer cell receptor clearance function was shown not to be the result of depressed hepatic blood flow or depletion of complement components. Complement receptor function was also depressed following the phagocytosis of particulates that are known to depress Kupffer cell host defense function. Endotoxemia and bacteremia also were associated with a depression of complement receptor function. Complement receptor function was experimentally depressed in uninjured animals by the phagocytosis of IgG-coated erythrocytes. There was a close association between the depression of complement receptor clearance function and increased susceptibility to the lethal effects of endotoxin and bacterial infection. These studies support the hypotheses that complement receptors on Kupffer cells are important for normal host defense and that depression of the function of these receptors impairs host defense.

  3. [Dynamics of complement hemolytic activity in experimental Ebola infection].

    PubMed

    Zabavichene, N M; Chepurnov, A A

    2004-01-01

    The dynamic hemolytic activity of complements (HAC) was investigated in blood of guinea pigs in lethal and non-lethal Ebola infection. The increasing HAC dynamic activity in the animal blood was found to correlate with the infection lethal course. HAC as observed in animals with lethal infection was sweepingly increasing after they, were infected with Ebola virus, and yet after 15 hours from the infection time the complement activity parameters topped 2-fold the basic values in 100% of guinea pigs. They began to be dropping by the end of day 1, their decrease reached, when the incubation time was over (days 3-4 after infection) the basic value, after which they continued to go down to the zero value in 2-3 days before the lethal outcome. The described phenomenon, like the phenomenon of accelerated death, was even more pronounced, when the animals were infected after a single immunization by activated Ebola virus. In case, guinea pigs were infected by a non-lethal Ebola virus strain, the compliment synthesis was observed to be activated only at the end of the incubation period; the process was accompanied with a gradual raise and with a plateau-type or wave-type increase of the complement during the treatment time--it was equally accompanied with normalizing activity parameters during recovery. The detected specificity could be important in prognosticating a disease outcome. A reliable correlation was demonstrated between the complement hemolytic activity and the level of circulating immune complexes in blood of experimental animals, which can be traced both in lethal and non-lethal infection.

  4. Plasma complement and vascular complement deposition in patients with coronary artery disease with and without inflammatory rheumatic diseases

    PubMed Central

    2017-01-01

    Purpose Inflammatory rheumatic diseases (IRD) are associated with accelerated coronary artery disease (CAD), which may result from both systemic and vascular wall inflammation. There are indications that complement may be involved in the pathogenesis of CAD in Systemic Lupus Erythematosus (SLE) and Rheumatoid Arthritis (RA). This study aimed to evaluate the associations between circulating complement and complement activation products with mononuclear cell infiltrates (MCI, surrogate marker of vascular inflammation) in the aortic media and adventitia in IRDCAD and non-IRDCAD patients undergoing coronary artery bypass grafting (CABG). Furthermore, we compared complement activation product deposition patterns in rare aorta adventitial and medial biopsies from SLE, RA and non-IRD patients. Methods We examined plasma C3 (p-C3) and terminal complement complexes (p-TCC) in 28 IRDCAD (SLE = 3; RA = 25), 52 non-IRDCAD patients, and 32 IRDNo CAD (RA = 32) from the Feiring Heart Biopsy Study. Aortic biopsies taken from the CAD only patients during CABG were previously evaluated for adventitial MCIs. The rare aortic biopsies from 3 SLE, 3 RA and 3 non-IRDCAD were assessed for the presence of C3 and C3d using immunohistochemistry. Results IRDCAD patients had higher p-TCC than non-IRDCAD or IRDNo CAD patients (p<0.0001), but a similar p-C3 level (p = 0.42). Circulating C3 was associated with IRD duration (ρ, p-value: 0.46, 0.03). In multiple logistic regression analysis, IRD remained significantly related to the presence and size of MCI (p<0.05). C3 was present in all tissue samples. C3d was detected in the media of all patients and only in the adventitia of IRD patients (diffuse in all SLE and focal in one RA). Conclusion The independent association of IRD status with MCI and the observed C3d deposition supports the unique relationship between rheumatic disease, and, in particular, SLE with the complement system. Exaggerated systemic and vascular complement activation may

  5. Infectivity of porcine circovirus type 2 DNA in semen from experimentally-infected boars

    PubMed Central

    Madson, Darin M.; Ramamoorthy, Sheela; Kuster, Chris; Pal, Narinder; Meng, Xiang-Jin; Halbur, Patrick G.; Opriessnig, Tanja

    2009-01-01

    Porcine circovirus type 2 (PCV2) is an economically important pathogen. It has been demonstrated that PCV2 DNA can be detected in boar semen by PCR; however, the biological relevance of this is unknown. The objectives of this study were to determine if semen positive for PCV2 DNA is infectious (1) in a swine bioassay, or (2) when used for artificial insemination. For the first objective, 4-week-old pigs were inoculated intraperitoneally with PCV2 DNA-negative (bioassay-control; n = 3), PCV2a DNA-positive (bioassay-PCV2a; n = 3), or PCV2b DNA-positive (bioassay-PCV2b; n = 3) raw semen, or PCV2 live virus (bioassay-positive; n = 3), respectively. Pigs inoculated with PCV2 DNA-positive semen and PCV2 live virus became viremic and developed anti-PCV2 antibodies indicating that the PCV2 DNA present in semen was infectious. For the second objective, three Landrace gilts were inseminated with PCV2 DNA-negative semen (gilts-controls) from experimentally-infected boars, and six gilts were artificially inseminated with semen positive for PCV2a DNA (gilts-PCV2a; n = 3) or PCV2b DNA (gilts-PCV2b; n = 3). Serum samples collected from the gilts in all groups remained negative for anti-PCV2 antibodies for the duration of the experiment. In addition, fetal serum samples from all 105-day-gestation fetuses were negative for anti-PCV2 antibodies or PCV2 DNA. Under the conditions of this study, PCV2 DNA-positive semen was not infectious when used to artificially inseminate gilts; however, it was demonstrated to be infectious in a swine bioassay model and therefore is a potential means of PCV2 transmission amongst swine herds. PMID:18973743

  6. Novel Evasion Mechanisms of the Classical Complement Pathway

    PubMed Central

    Garcia, Brandon L.; Zwarthoff, Seline A.; Rooijakkers, Suzan H. M.; Geisbrecht, Brian V.

    2016-01-01

    Complement is a network of soluble and cell surface-associated proteins which gives rise to a self-amplifying, yet tightly regulated system with fundamental roles in immune surveillance and clearance. Complement becomes activated on the surface of ‘non-self’ cells by one of three initiating mechanisms known as the classical, lectin, or alternative pathways. Evasion of complement function is a hallmark of invasive pathogens and hematophagous organisms. While many complement inhibition strategies hinge on hijacking activities of endogenous complement regulatory proteins, an increasing number of uniquely evolved evasion molecules have been discovered over the past decade. In this review we focus on several recent investigations which have revealed mechanistically distinct inhibitors of the classical pathway. Because the classical pathway is an important and specific mediator of various autoimmune and inflammatory disorders, in-depth knowledge of novel evasion mechanisms could direct future development of therapeutic anti-inflammatory molecules. PMID:27591336

  7. The number of reduced alignments between two DNA sequences

    PubMed Central

    2014-01-01

    Background In this study we consider DNA sequences as mathematical strings. Total and reduced alignments between two DNA sequences have been considered in the literature to measure their similarity. Results for explicit representations of some alignments have been already obtained. Results We present exact, explicit and computable formulas for the number of different possible alignments between two DNA sequences and a new formula for a class of reduced alignments. Conclusions A unified approach for a wide class of alignments between two DNA sequences has been provided. The formula is computable and, if complemented by software development, will provide a deeper insight into the theory of sequence alignment and give rise to new comparison methods. AMS Subject Classification Primary 92B05, 33C20, secondary 39A14, 65Q30 PMID:24684679

  8. 21 CFR 866.5240 - Complement components immunological test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5240 Complement components immunological test system. (a) Identification. A complement components... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Complement components immunological test system...

  9. Molecular characterization of a nuclear topoisomerase II from Nicotiana tabacum that functionally complements a temperature-sensitive topoisomerase II yeast mutant.

    PubMed

    Singh, B N; Mudgil, Yashwanti; Sopory, S K; Reddy, M K

    2003-07-01

    We have successfully expressed enzymatically active plant topoisomerase II in Escherichia coli for the first time, which has enabled its biochemical characterization. Using a PCR-based strategy, we obtained a full-length cDNA and the corresponding genomic clone of tobacco topoisomerase II. The genomic clone has 18 exons interrupted by 17 introns. Most of the 5' and 3' splice junctions follow the typical canonical consensus dinucleotide sequence GU-AG present in other plant introns. The position of introns and phasing with respect to primary amino acid sequence in tobacco TopII and Arabidopsis TopII are highly conserved, suggesting that the two genes are evolved from the common ancestral type II topoisomerase gene. The cDNA encodes a polypeptide of 1482 amino acids. The primary amino acid sequence shows a striking sequence similarity, preserving all the structural domains that are conserved among eukaryotic type II topoisomerases in an identical spatial order. We have expressed the full-length polypeptide in E. coli and purified the recombinant protein to homogeneity. The full-length polypeptide relaxed supercoiled DNA and decatenated the catenated DNA in a Mg(2+)- and ATP-dependent manner, and this activity was inhibited by 4'-(9-acridinylamino)-3'-methoxymethanesulfonanilide (m-AMSA). The immunofluorescence and confocal microscopic studies, with antibodies developed against the N-terminal region of tobacco recombinant topoisomerase II, established the nuclear localization of topoisomerase II in tobacco BY2 cells. The regulated expression of tobacco topoisomerase II gene under the GAL1 promoter functionally complemented a temperature-sensitive TopII(ts) yeast mutant.

  10. Geometry-dependent DNA-TiO2 immobilization mechanism: A spectroscopic approach

    NASA Astrophysics Data System (ADS)

    Silva-Moraes, M. O.; Garcia-Basabe, Y.; de Souza, R. F. B.; Mota, A. J.; Passos, R. R.; Galante, D.; Fonseca Filho, H. D.; Romaguera-Barcelay, Y.; Rocco, M. L. M.; Brito, W. R.

    2018-06-01

    DNA nucleotides are used as a molecular recognition system on electrodes modified to be applied in the detection of various diseases, but immobilization mechanisms, as well as, charge transfers are not satisfactorily described in the literature. An electrochemical and spectroscopic study was carried out to characterize the molecular groups involved in the direct immobilization of DNA structures on the surface of nanostructured TiO2 with the aim of evaluating the influence of the geometrical aspects. X-ray photoelectron spectroscopy at O1s and P2p core levels indicate that immobilization of DNA samples occurs through covalent (Psbnd Osbnd Ti) bonds. X-ray absorption spectra at the Ti2p edge reinforce this conclusion. A new species at 138.5 eV was reported from P2p XPS spectra analysis which plays an important role in DNA-TiO2 immobilization. The Psbnd Osbnd Ti/Osbnd Ti ratio showed that quantitatively the DNA immobilization mechanism is dependent on their geometry, becoming more efficient for plasmid ds-DNA structures than for PCR ds-DNA structures. The analysis of photoabsorption spectra at C1s edge revealed that the molecular groups that participate in the C1s → LUMO electronic transitions have different pathways in the charge transfer processes at the DNA-TiO2 interface. Our results may contribute to additional studies of immobilization mechanisms understanding the influence of the geometry of different DNA molecules on nanostructured semiconductor and possible impact to the charge transfer processes with application in biosensors or aptamers.

  11. Is complement good, bad, or both? New functions of the complement factors associated with inflammation mechanisms in the central nervous system.

    PubMed

    Tahtouh, Muriel; Croq, Françoise; Lefebvre, Christophe; Pestel, Joël

    2009-09-01

    The complement system is well known as an enzyme cascade that helps to defend against infections. Indeed, this ancestral system bridges innate and adaptive immunity. Its implication in diseases of the central nervous system (CNS), has led to an increased number of studies. Complement activation in the CNS has been generally considered to contribute to tissue damage. However, recent studies suggest that complement may be neuroprotective, and can participate in maintenance and repair of the adult brain. Here, we will review this dual role of complement proteins and some of their functional interactions with part of the chemokine and cytokine network associated with the protection of CNS integrity.

  12. Novel Evasion Mechanisms of the Classical Complement Pathway.

    PubMed

    Garcia, Brandon L; Zwarthoff, Seline A; Rooijakkers, Suzan H M; Geisbrecht, Brian V

    2016-09-15

    Complement is a network of soluble and cell surface-associated proteins that gives rise to a self-amplifying, yet tightly regulated system with fundamental roles in immune surveillance and clearance. Complement becomes activated on the surface of nonself cells by one of three initiating mechanisms known as the classical, lectin, and alternative pathways. Evasion of complement function is a hallmark of invasive pathogens and hematophagous organisms. Although many complement-inhibition strategies hinge on hijacking activities of endogenous complement regulatory proteins, an increasing number of uniquely evolved evasion molecules have been discovered over the past decade. In this review, we focus on several recent investigations that revealed mechanistically distinct inhibitors of the classical pathway. Because the classical pathway is an important and specific mediator of various autoimmune and inflammatory disorders, in-depth knowledge of novel evasion mechanisms could direct future development of therapeutic anti-inflammatory molecules. Copyright © 2016 by The American Association of Immunologists, Inc.

  13. Merely two mutations switch a DNA-hydrolyzing deoxyribozyme from heterobimetallic (Zn2+/Mn2+) to monometallic (Zn2+-only) behavior

    PubMed Central

    Xiao, Ying; Allen, Emily C.

    2012-01-01

    A deoxyribozyme that hydrolyzes DNA phosphodiester linkages with a requirement for both Zn2+ and Mn2+ is switched by only two nucleotide mutations to require Zn2+ alone, demonstrating that DNA-catalyzed DNA hydrolysis can be achieved using only one metal ion cofactor. PMID:21125108

  14. Complement Constructions in English: Fairly Difficult for EFL Language Learners

    ERIC Educational Resources Information Center

    Fazeli, Fatemeh; Shokrpour, Nasrin

    2012-01-01

    Complement constructions vary significantly in English and Persian. There are more complementation structures in English than in Persian and a complement structure in Persian might have more than one equivalent in English. Producing complement structures (CSs) in English is very difficult for native speakers of Persian, especially in an EFL…

  15. The Lectin Complement Pathway Is Involved in Protection Against Enteroaggregative Escherichia coli Infection.

    PubMed

    Adler Sørensen, Camilla; Rosbjerg, Anne; Hebbelstrup Jensen, Betina; Krogfelt, Karen Angeliki; Garred, Peter

    2018-01-01

    Enteroaggregative Escherichia coli (EAEC) causes acute and persistent diarrhea worldwide. Still, the involvement of host factors in EAEC infections is unresolved. Binding of recognition molecules from the lectin pathway of complement to EAEC strains have been observed, but the importance is not known. Our aim was to uncover the involvement of these molecules in innate complement dependent immune protection toward EAEC. Binding of mannose-binding lectin, ficolin-1, -2, and -3 to four prototypic EAEC strains, and ficolin-2 binding to 56 clinical EAEC isolates were screened by a consumption-based ELISA method. Flow cytometry was used to determine deposition of C4b, C3b, and the bactericidal C5b-9 membrane attack complex (MAC) on the bacteria in combination with different complement inhibitors. In addition, the direct serum bactericidal effect was assessed. Screening of the prototypic EAEC strains revealed that ficolin-2 was the major binder among the lectin pathway recognition molecules. However, among the clinical EAEC isolates only a restricted number ( n  = 5) of the isolates bound ficolin-2. Using the ficolin-2 binding isolate C322-17 as a model, we found that incubation with normal human serum led to deposition of C4b, C3b, and to MAC formation. No inhibition of complement deposition was observed when a C1q inhibitor was added, while partial inhibition was observed when ficolin-2 or factor D inhibitors were used separately. Combining the inhibitors against ficolin-2 and factor D led to virtually complete inhibition of complement deposition and protection against direct bacterial killing. These results demonstrate that ficolin-2 may play an important role in innate immune protection against EAEC when an appropriate ligand is exposed, but many EAEC strains evade lectin pathway recognition and may, therefore, circumvent this strategy of innate host immune protection.

  16. Role of Complement in a Rat Model of Paclitaxel-Induced Peripheral Neuropathy.

    PubMed

    Xu, Jijun; Zhang, Lingjun; Xie, Mian; Li, Yan; Huang, Ping; Saunders, Thomas L; Fox, David A; Rosenquist, Richard; Lin, Feng

    2018-06-15

    Chemotherapy-induced peripheral neuropathy (CIPN) is a painful and debilitating side effect of cancer chemotherapy with an unclear pathogenesis. Consequently, the available therapies for this neuropathic pain syndrome are inadequate, leading to a significantly reduced quality of life in many patients. Complement, a key component of the innate immune system, has been associated with neuroinflammation, a potentially important trigger of some types of neuropathic pain. However, the role of complement in CIPN remains unclear. To address this issue, we developed a C3 knockout (KO) rat model and induced CIPN in these KO rats and wild-type littermates via the i.p. administration of paclitaxel, a chemotherapeutic agent associated with CIPN. We then compared the severity of mechanical allodynia, complement activation, and intradermal nerve fiber loss between the groups. We found that 1) i.p. paclitaxel administration activated complement in wild-type rats, 2) paclitaxel-induced mechanical allodynia was significantly reduced in C3 KO rats, and 3) the paclitaxel-induced loss of intradermal nerve fibers was markedly attenuated in C3 KO rats. In in vitro studies, we found that paclitaxel-treated rat neuronal cells activated complement, leading to cellular injury. Our findings demonstrate a previously unknown but pivotal role of complement in CIPN and suggest that complement may be a new target for the development of novel therapeutics to manage this painful disease. Copyright © 2018 by The American Association of Immunologists, Inc.

  17. The Surface-Exposed Protein SntA Contributes to Complement Evasion in Zoonotic Streptococcus suis.

    PubMed

    Deng, Simin; Xu, Tong; Fang, Qiong; Yu, Lei; Zhu, Jiaqi; Chen, Long; Liu, Jiahui; Zhou, Rui

    2018-01-01

    Streptococcus suis is an emerging zoonotic pathogen causing streptococcal toxic shock like syndrome (STSLS), meningitis, septicemia, and even sudden death in human and pigs. Serious septicemia indicates this bacterium can evade the host complement surveillance. In our previous study, a functionally unknown protein SntA of S. suis has been identified as a heme-binding protein, and contributes to virulence in pigs. SntA can interact with the host antioxidant protein AOP2 and consequently inhibit its antioxidant activity. In the present study, SntA is identified as a cell wall anchored protein that functions as an important player in S. suis complement evasion. The C3 deposition and membrane attack complex (MAC) formation on the surface of sntA -deleted mutant strain Δ sntA are demonstrated to be significantly higher than the parental strain SC-19 and the complementary strain CΔ sntA . The abilities of anti-phagocytosis, survival in blood, and in vivo colonization of Δ sntA are obviously reduced. SntA can interact with C1q and inhibit hemolytic activity via the classical pathway. Complement activation assays reveal that SntA can also directly activate classical and lectin pathways, resulting in complement consumption. These two complement evasion strategies may be crucial for the pathogenesis of this zoonotic pathogen. Concerning that SntA is a bifunctional 2',3'-cyclic nucleotide 2'-phosphodiesterase/3'-nucleotidase in many species of Gram-positive bacteria, these complement evasion strategies may have common biological significance.

  18. Enhanced photoelectrochemical DNA sensor based on TiO2/Au hybrid structure.

    PubMed

    Liu, Xing-Pei; Chen, Jing-Shuai; Mao, Chang-Jie; Niu, He-Lin; Song, Ji-Ming; Jin, Bao-Kang

    2018-05-23

    A novel enhanced photoelectrochemical DNA sensor, based on a TiO 2 /Au hybrid electrode structure, was developed to detect target DNA. The sensor was developed by successively modifying fluorine-tin oxide (FTO) electrodes with TiO 2 nanoparticles, gold (Au) nanoparticles, hairpin DNA (DNA1), and CdSe-COOH quantum dots (QDs), which acted as signal amplification factors. In the absence of target DNA, the incubated DNA1 hairpin and the CdSe-COOH QDs were in close contact with the TiO 2 /Au electrode surface, leading to an enhanced photocurrent intensity due to the sensitization effect. After incubation of the modified electrode with the target DNA, the hairpin DNA changed into a double helix structure, and the CdSe QDs moved away from the TiO 2 /Au electrode surface, leading to a decreased sensitization effect and photoelectrochemical signal intensity. This novel DNA sensor exhibited stable, sensitive and reproducible detection of DNA from 0.1 μM to 10 fM, with a lower detection limit of 3 fM. It provided good specificity, reproducibility, stability and is a promising strategy for the detection of a variety of other DNA targets, for early clinical diagnosis of various diseases. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Reaction of glyoxal with 2'-deoxyguanosine, 2'-deoxyadenosine, 2'-deoxycytidine, cytidine, thymidine, and calf thymus DNA: identification of DNA adducts.

    PubMed

    Olsen, Raymond; Molander, Paal; Øvrebø, Steinar; Ellingsen, Dag G; Thorud, Syvert; Thomassen, Yngvar; Lundanes, Elsa; Greibrokk, Tyge; Backman, Josefin; Sjöholm, Rainer; Kronberg, Leif

    2005-04-01

    Glyoxal (ethanedial) is an increasingly used industrial chemical that has been found to be mutagenic in bacteria and mammalian cells. In this study, the reactions of glyoxal with 2'-deoxyguanosine, 2'-deoxyadenosine, 2'-deoxycytidine, cytidine, thymidine, and calf thymus DNA have been studied in aqueous buffered solutions. The nucleoside adducts were isolated by reversed-phase liquid chromatography and characterized by their UV absorbance and 1H and 13C NMR spectroscopic and mass spectrometric features. The reaction with 2'-deoxyguanosine gave one adduct, the previously known 3-(2'-deoxy-beta-D-erythro-pentofuranosyl)-5,6,7-trihydro-6,7-dihydroxyimidazo[1,2-a]purine-9-one adduct. The reaction of 2'-deoxyadenosine with glyoxal resulted in the formation of a previously not reported N6-(hydroxyacetyl)-2'-deoxyadenosine adduct. In the reaction of glyoxal with 2'-deoxycytidine and cytidine at neutral conditions and 37 degrees C, 5-hydroxyacetyl pyrimidine derivatives were obtained. When the cytidine reaction was performed at pH 4.5 and 50 degrees C, the 5-hydroxyacetyl derivative of uridine was formed through deamination of cytidine-glyoxal. Adducts in the thymidine reaction could not be detected. In the reaction of glyoxal with calf thymus DNA, the 2'-deoxyguanosine-glyoxal and 2'-deoxyadenosine-glyoxal adducts were obtained, the former being the major adduct.

  20. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator.

    PubMed

    Bahia El Idrissi, Nawal; Das, Pranab K; Fluiter, Kees; Rosa, Patricia S; Vreijling, Jeroen; Troost, Dirk; Morgan, B Paul; Baas, Frank; Ramaglia, Valeria

    2015-05-01

    Peripheral nerve damage is the hallmark of leprosy pathology but its etiology is unclear. We previously identified the membrane attack complex (MAC) of the complement system as a key determinant of post-traumatic nerve damage and demonstrated that its inhibition is neuroprotective. Here, we determined the contribution of the MAC to nerve damage caused by Mycobacterium leprae and its components in mouse. Furthermore, we studied the association between MAC and the key M. leprae component lipoarabinomannan (LAM) in nerve biopsies of leprosy patients. Intraneural injections of M. leprae sonicate induced MAC deposition and pathological changes in the mouse nerve, whereas MAC inhibition preserved myelin and axons. Complement activation occurred mainly via the lectin pathway and the principal activator was LAM. In leprosy nerves, the extent of LAM and MAC immunoreactivity was robust and significantly higher in multibacillary compared to paucibacillary donors (p = 0.01 and p = 0.001, respectively), with a highly significant association between LAM and MAC in the diseased samples (r = 0.9601, p = 0.0001). Further, MAC co-localized with LAM on axons, pointing to a role for this M. leprae antigen in complement activation and nerve damage in leprosy. Our findings demonstrate that MAC contributes to nerve damage in a model of M. leprae-induced nerve injury and its inhibition is neuroprotective. In addition, our data identified LAM as the key pathogen associated molecule that activates complement and causes nerve damage. Taken together our data imply an important role of complement in nerve damage in leprosy and may inform the development of novel therapeutics for patients.

  1. False Belief, Complementation Language, and Contextual Bias in Preschoolers

    ERIC Educational Resources Information Center

    Ng, Lisa; Cheung, Him; Xiao, Wen

    2010-01-01

    In the present study, we address two questions concerning the relation between children's false belief and their understanding of complex object complements. The first question is whether the previously demonstrated association between tensed complements and false belief generalizes to infinitival complements (de Villiers & Pyers, 2002). The…

  2. Characterization of the gene encoding component C3 of the complement system from the spider Loxosceles laeta venom glands: Phylogenetic implications.

    PubMed

    Myamoto, D T; Pidde-Queiroz, G; Pedroso, A; Gonçalves-de-Andrade, R M; van den Berg, C W; Tambourgi, D V

    2016-09-01

    A transcriptome analysis of the venom glands of the spider Loxosceles laeta, performed by our group, in a previous study (Fernandes-Pedrosa et al., 2008), revealed a transcript with a sequence similar to the human complement component C3. Here we present the analysis of this transcript. cDNA fragments encoding the C3 homologue (Lox-C3) were amplified from total RNA isolated from the venom glands of L. laeta by RACE-PCR. Lox-C3 is a 5178 bps cDNA sequence encoding a 190kDa protein, with a domain configuration similar to human C3. Multiple alignments of C3-like proteins revealed two processing sites, suggesting that Lox-C3 is composed of three chains. Furthermore, the amino acids consensus sequences for the thioester was found, in addition to putative sequences responsible for FB binding. The phylogenetic analysis showed that Lox-C3 belongs to the same group as two C3 isoforms from the spider Hasarius adansoni (Family Salcitidae), showing 53% homology with these. This is the first characterization of a Loxosceles cDNA sequence encoding a human C3 homologue, and this finding, together with our previous finding of the expression of a FB-like molecule, suggests that this spider species also has a complement system. This work will help to improve our understanding of the innate immune system in these spiders and the ancestral structure of C3. Copyright © 2016 Elsevier GmbH. All rights reserved.

  3. Complement-Mediated Regulation of Metabolism and Basic Cellular Processes.

    PubMed

    Hess, Christoph; Kemper, Claudia

    2016-08-16

    Complement is well appreciated as a critical arm of innate immunity. It is required for the removal of invading pathogens and works by directly destroying them through the activation of innate and adaptive immune cells. However, complement activation and function is not confined to the extracellular space but also occurs within cells. Recent work indicates that complement activation regulates key metabolic pathways and thus can impact fundamental cellular processes, such as survival, proliferation, and autophagy. Newly identified functions of complement include a key role in shaping metabolic reprogramming, which underlies T cell effector differentiation, and a role as a nexus for interactions with other effector systems, in particular the inflammasome and Notch transcription-factor networks. This review focuses on the contributions of complement to basic processes of the cell, in particular the integration of complement with cellular metabolism and the potential implications in infection and other disease settings. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Inhibition of murine DNA methyltransferase Dnmt3a by DNA duplexes containing pyrimidine-2(1H)-one.

    PubMed

    Cherepanova, N A; Zhuze, A L; Gromova, E S

    2010-09-01

    Here we studied the inhibition of the catalytic domain of Dnmt3a methyltransferase (Dnmt3a-CD) by DNA duplexes containing the mechanism-based inhibitor pyrimidine-2(1H)-one (P) instead of the target cytosine. It has been shown that conjugates of Dnmt3a-CD with P-DNA (DNA containing pyrimidine-2(1H)-one) are not stable to heating at 65°C in 0.1% SDS. The yield of covalent intermediate increases in the presence of the regulatory factor Dnmt3L. The importance of the DNA minor groove for covalent intermediate formation during the methylation reaction catalyzed by Dnmt3a-CD has been revealed. P-DNA was shown to inhibit Dnmt3a-CD; the IC(50) is 830 nM. The competitive mechanism of inhibition of Dnmt3a-CD by P-DNA has been elucidated. It is suggested that therapeutic effect of zebularine could be achieved by inhibition of not only Dnmt1 but also Dnmt3a.

  5. Complement evasion by Bordetella pertussis: implications for improving current vaccines.

    PubMed

    Jongerius, Ilse; Schuijt, Tim J; Mooi, Frits R; Pinelli, Elena

    2015-04-01

    Bordetella pertussis causes whooping cough or pertussis, a highly contagious disease of the respiratory tract. Despite high vaccination coverage, reported cases of pertussis are rising worldwide and it has become clear that the current vaccines must be improved. In addition to the well-known protective role of antibodies and T cells during B. pertussis infection, innate immune responses such as the complement system play an essential role in B. pertussis killing. In order to evade this complement activation and colonize the human host, B. pertussis expresses several molecules that inhibit complement activation. Interestingly, one of the known complement evasion proteins, autotransporter Vag8, is highly expressed in the recently emerged B. pertussis isolates. Here, we describe the current knowledge on how B. pertussis evades complement-mediated killing. In addition, we compare this to complement evasion strategies used by other bacterial species. Finally, we discuss the consequences of complement evasion by B. pertussis on adaptive immunity and how identification of the bacterial molecules and the mechanisms involved in complement evasion might help improve pertussis vaccines.

  6. Structural basis for complement evasion by Lyme disease pathogen Borrelia burgdorferi.

    PubMed

    Bhattacharjee, Arnab; Oeemig, Jesper S; Kolodziejczyk, Robert; Meri, Taru; Kajander, Tommi; Lehtinen, Markus J; Iwaï, Hideo; Jokiranta, T Sakari; Goldman, Adrian

    2013-06-28

    Borrelia burgdorferi spirochetes that cause Lyme borreliosis survive for a long time in human serum because they successfully evade the complement system, an important arm of innate immunity. The outer surface protein E (OspE) of B. burgdorferi is needed for this because it recruits complement regulator factor H (FH) onto the bacterial surface to evade complement-mediated cell lysis. To understand this process at the molecular level, we used a structural approach. First, we solved the solution structure of OspE by NMR, revealing a fold that has not been seen before in proteins involved in complement regulation. Next, we solved the x-ray structure of the complex between OspE and the FH C-terminal domains 19 and 20 (FH19-20) at 2.83 Å resolution. The structure shows that OspE binds FH19-20 in a way similar to, but not identical with, that used by endothelial cells to bind FH via glycosaminoglycans. The observed interaction of OspE with FH19-20 allows the full function of FH in down-regulation of complement activation on the bacteria. This reveals the molecular basis for how B. burgdorferi evades innate immunity and suggests how OspE could be used as a potential vaccine antigen.

  7. Does Tyrosyl DNA Phosphodiesterase-2 Play a Role in Hepatitis B Virus Genome Repair?

    PubMed Central

    Boregowda, Rajeev; Sohn, Ji A.; Ledesma, Felipe Cortes; Caldecott, Keith W.; Seeger, Christoph; Hu, Jianming

    2015-01-01

    Hepatitis B virus (HBV) replication and persistence are sustained by a nuclear episome, the covalently closed circular (CCC) DNA, which serves as the transcriptional template for all viral RNAs. CCC DNA is converted from a relaxed circular (RC) DNA in the virion early during infection as well as from RC DNA in intracellular progeny nucleocapsids via an intracellular amplification pathway. Current antiviral therapies suppress viral replication but cannot eliminate CCC DNA. Thus, persistence of CCC DNA remains an obstacle toward curing chronic HBV infection. Unfortunately, very little is known about how CCC DNA is formed. CCC DNA formation requires removal of the virally encoded reverse transcriptase (RT) protein from the 5’ end of the minus strand of RC DNA. Tyrosyl DNA phosphodiesterase-2 (Tdp2) was recently identified as the enzyme responsible for cleavage of tyrosyl-5’ DNA linkages formed between topoisomerase II and cellular DNA. Because the RT-DNA linkage is also a 5’ DNA-phosphotyrosyl bond, it has been hypothesized that Tdp2 might be one of several elusive host factors required for CCC DNA formation. Therefore, we examined the role of Tdp2 in RC DNA deproteination and CCC DNA formation. We demonstrated Tdp2 can cleave the tyrosyl-minus strand DNA linkage using authentic HBV RC DNA isolated from nucleocapsids and using RT covalently linked to short minus strand DNA produced in vitro. On the other hand, our results showed that Tdp2 gene knockout did not block CCC DNA formation during HBV infection of permissive human hepatoma cells and did not prevent intracellular amplification of duck hepatitis B virus CCC DNA. These results indicate that although Tdp2 can remove the RT covalently linked to the 5’ end of the HBV minus strand DNA in vitro, this protein might not be required for CCC DNA formation in vivo. PMID:26079492

  8. Involvement of the host DNA-repair enzyme TDP2 in formation of the covalently closed circular DNA persistence reservoir of hepatitis B viruses.

    PubMed

    Königer, Christian; Wingert, Ida; Marsmann, Moritz; Rösler, Christine; Beck, Jürgen; Nassal, Michael

    2014-10-07

    Hepatitis B virus (HBV), the causative agent of chronic hepatitis B and prototypic hepadnavirus, is a small DNA virus that replicates by protein-primed reverse transcription. The product is a 3-kb relaxed circular DNA (RC-DNA) in which one strand is linked to the viral polymerase (P protein) through a tyrosyl-DNA phosphodiester bond. Upon infection, the incoming RC-DNA is converted into covalently closed circular (ccc) DNA, which serves as a viral persistence reservoir that is refractory to current anti-HBV treatments. The mechanism of cccDNA formation is unknown, but the release of P protein is one mandatory step. Structural similarities between RC-DNA and cellular topoisomerase-DNA adducts and their known repair by tyrosyl-DNA-phosphodiesterase (TDP) 1 or TDP2 suggested that HBV may usurp these enzymes for its own purpose. Here we demonstrate that human and chicken TDP2, but only the yeast ortholog of TDP1, can specifically cleave the Tyr-DNA bond in virus-adapted model substrates and release P protein from authentic HBV and duck HBV (DHBV) RC-DNA in vitro, without prior proteolysis of the large P proteins. Consistent with TPD2's having a physiological role in cccDNA formation, RNAi-mediated TDP2 depletion in human cells significantly slowed the conversion of RC-DNA to cccDNA. Ectopic TDP2 expression in the same cells restored faster conversion kinetics. These data strongly suggest that TDP2 is a first, although likely not the only, host DNA-repair factor involved in HBV cccDNA biogenesis. In addition to establishing a functional link between hepadnaviruses and DNA repair, our results open new prospects for directly targeting HBV persistence.

  9. Resistance of Spiroplasma citri Lines to the Virus SVTS2 Is Associated with Integration of Viral DNA Sequences into Host Chromosomal and Extrachromosomal DNA.

    PubMed

    Sha, Y; Melcher, U; Davis, R E; Fletcher, J

    1995-11-01

    Spiroplasmavirus SVTS2, isolated from Spiroplasma melliferum TS2, produces plaques when inoculated onto lawns of Spiroplasma citri M200H, a derivative of the type strain Maroc R8A2. S. citri strains MR2 and MR3, originally selected as colonies growing within plaques on a lawn of M200H inoculated with SVTS2, were resistant to SVTS2. Genomic DNA fingerprints and electrophoretic protein profiles of M200H, MR2, and MR3 were similar, but three proteins present in M200H were missing or significantly reduced in both resistant lines. None of these three polypeptides reacted with antiserum against S. citri membrane proteins, indicating that they probably are not surface-located virus receptors. Electroporation with SVTS2 DNA produced 1.5 x 10(sup5) transfectants per (mu)g of DNA in M200H but none in MR2 or MR3, suggesting that resistance may result from inhibition of viral replication. The digestion patterns of the extrachromosomal double-stranded (ds) DNA of these lines were similar. Three TaqI fragments of MR2 extrachromosomal DNA that were not present in M200H extrachromosomal DNA hybridized strongly to an SVTS2 probe, and two of these fragments plus an additional one hybridized with the MR3 extrachromosomal DNA, indicating that a fragment of SVTS2 DNA was present in the extrachromosomal ds DNA of MR2 and MR3 but not of M200H. When the restricted genomes of all three lines were probed with SVTS2 DNA, strong hybridization to two EcoRI fragments of chromosomal MR2 and MR3 DNA but not M200H DNA indicated that SVTS2 DNA had integrated into the genomes of MR2 and MR3 but not of M200H. When MR3 extrachromosomal ds DNA containing a 2.1-kb SVTS2 DNA fragment was transfected into M200H, the transformed spiroplasmas were resistant to SVTS2. These results suggest that SVTS2 DNA fragments, possibly integrated into the chromosomal or extrachromosomal DNA of a previously susceptible spiroplasma, may function as viral incompatibility elements, providing resistance to superinfection by

  10. Differential mechanisms of complement-mediated neutralization of the closely related paramyxoviruses simian virus 5 and mumps virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, John B.; Capraro, Gerald A.; Parks, Griffith D.

    2008-06-20

    The complement system is an important component of the innate immune response to virus infection. The role of human complement pathways in the in vitro neutralization of three closely related paramyxoviruses, Simian Virus 5 (SV5), Mumps virus (MuV) and Human Parainfluenza virus type 2 (HPIV2) was investigated. Sera from ten donors showed high levels of neutralization against HPIV2 that was largely complement-independent, whereas nine of ten donor sera were found to neutralize SV5 and MuV only in the presence of active complement pathways. SV5 and MuV neutralization proceeded through the alternative pathway of the complement cascade. Electron microscopy studies andmore » biochemical analyses showed that treatment of purified SV5 with human serum resulted in C3 deposition on virions and the formation of massive aggregates, but there was relatively little evidence of virion lysis. Treatment of MuV with human serum also resulted in C3 deposition on virions, however in contrast to SV5, MuV particles were lysed by serum complement and there was relatively little aggregation. Assays using serum depleted of complement factors showed that SV5 and MuV neutralization in vitro was absolutely dependent on complement factor C3, but was not dependent on downstream complement factors C5 or C8. Our results indicate that even though antibodies exist that recognize both SV5 and MuV, they are mostly non-neutralizing and viral inactivation in vitro occurs through the alternative pathway of complement. The implications of our work for development of paramyxovirus vectors and vaccines are discussed.« less

  11. The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

    NASA Astrophysics Data System (ADS)

    Knight, Jonathan D.; Li, Rong; Botchan, Michael

    1991-04-01

    The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

  12. Cycling with BRCA2 from DNA repair to mitosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Hyunsook, E-mail: HL212@snu.ac.kr

    Genetic integrity in proliferating cells is guaranteed by the harmony of DNA replication, appropriate DNA repair, and segregation of the duplicated genome. Breast cancer susceptibility gene BRCA2 is a unique tumor suppressor that is involved in all three processes. Hence, it is critical in genome maintenance. The functions of BRCA2 in DNA repair and homology-directed recombination (HDR) have been reviewed numerous times. Here, I will briefly go through the functions of BRCA2 in HDR and focus on the emerging roles of BRCA2 in telomere homeostasis and mitosis, then discuss how BRCA2 exerts distinct functions in a cell-cycle specific manner inmore » the maintenance of genomic integrity. - Highlights: • BRCA2 is a multifaceted tumor suppressor and is crucial in genetic integrity. • BRCA2 exerts distinct functions in cell cycle-specific manner. • Mitotic kinases regulate diverse functions of BRCA2 in mitosis and cytokinesis.« less

  13. On the Functional Overlap between Complement and Anti-Microbial Peptides.

    PubMed

    Zimmer, Jana; Hobkirk, James; Mohamed, Fatima; Browning, Michael J; Stover, Cordula M

    2014-01-01

    Intriguingly, activated complement and anti-microbial peptides share certain functionalities; lytic, phagocytic, and chemo-attractant activities and each may, in addition, exert cell instructive roles. Each has been shown to have distinct LPS detoxifying activity and may play a role in the development of endotoxin tolerance. In search of the origin of complement, a functional homolog of complement C3 involved in opsonization has been identified in horseshoe crabs. Horseshoe crabs possess anti-microbial peptides able to bind to acyl chains or phosphate groups/saccharides of endotoxin, LPS. Complement activity as a whole is detectable in marine invertebrates. These are also a source of anti-microbial peptides with potential pharmaceutical applicability. Investigating the locality for the production of complement pathway proteins and their role in modulating cellular immune responses are emerging fields. The significance of local synthesis of complement components is becoming clearer from in vivo studies of parenchymatous disease involving specifically generated, complement-deficient mouse lines. Complement C3 is a central component of complement activation. Its provision by cells of the myeloid lineage varies. Their effector functions in turn are increased in the presence of anti-microbial peptides. This may point to a potentiating range of activities, which should serve the maintenance of health but may also cause disease. Because of the therapeutic implications, this review will consider closely studies dealing with complement activation and anti-microbial peptide activity in acute inflammation (e.g., dialysis-related peritonitis, appendicitis, and ischemia).

  14. Complement-Mediated Enhancement of Monocyte Adhesion to Endothelial Cells by HLA Antibodies, and Blockade by a Specific Inhibitor of the Classical Complement Cascade, TNT003

    PubMed Central

    Valenzuela, Nicole M.; Thomas, Kimberly A.; Mulder, Arend; Parry, Graham C.; Panicker, Sandip; Reed, Elaine F.

    2017-01-01

    Background Antibody-mediated rejection (AMR) of most solid organs is characterized by evidence of complement activation and/or intragraft macrophages (C4d + and CD68+ biopsies). We previously demonstrated that crosslinking of HLA I by antibodies triggered endothelial activation and monocyte adhesion. We hypothesized that activation of the classical complement pathway at the endothelial cell surface by HLA antibodies would enhance monocyte adhesion through soluble split product generation, in parallel with direct endothelial activation downstream of HLA signaling. Methods Primary human aortic endothelial cells (HAEC) were stimulated with HLA class I antibodies in the presence of intact human serum complement. C3a and C5a generation, endothelial P-selectin expression, and adhesion of human primary and immortalized monocytes (Mono Mac 6) were measured. Alternatively, HAEC or monocytes were directly stimulated with purified C3a or C5a. Classical complement activation was inhibited by pretreatment of complement with an anti-C1s antibody (TNT003). Results Treatment of HAEC with HLA antibody and human complement increased the formation of C3a and C5a. Monocyte recruitment by human HLA antibodies was enhanced in the presence of intact human serum complement or purified C3a or C5a. Specific inhibition of the classical complement pathway using TNT003 or C1q-depleted serum significantly reduced adhesion of monocytes in the presence of human complement. Conclusions Despite persistent endothelial viability in the presence of HLA antibodies and complement, upstream complement anaphylatoxin production exacerbates endothelial exocytosis and leukocyte recruitment. Upstream inhibition of classical complement may be therapeutic to dampen mononuclear cell recruitment and endothelial activation characteristic of microvascular inflammation during AMR. PMID:28640789

  15. Resistance to DNA-damaging treatment in non-small cell lung cancer tumor-initiating cells involves reduced DNA-PK/ATM activation and diminished cell cycle arrest

    PubMed Central

    Lundholm, L; Hååg, P; Zong, D; Juntti, T; Mörk, B; Lewensohn, R; Viktorsson, K

    2013-01-01

    Increasing evidence suggests that tumor-initiating cells (TICs), also called cancer stem cells, are partly responsible for resistance to DNA-damaging treatment. Here we addressed if such a phenotype may contribute to radio- and cisplatin resistance in non-small cell lung cancer (NSCLC). We showed that four out of eight NSCLC cell lines (H125, A549, H1299 and H23) possess sphere-forming capacity when cultured in stem cell media and three of these display elevated levels of CD133. Indeed, sphere-forming NSCLC cells, hereafter called TICs, showed a reduced apoptotic response and increased survival after irradiation (IR), as compared with the corresponding bulk cell population. Decreased cytotoxicity and apoptotic signaling manifested by diminished poly (ADP-ribose) polymerase (PARP) cleavage and caspase 3 activity was also evident in TICs after cisplatin treatment. Neither radiation nor cisplatin resistance was due to quiescence as H125 TICs proliferated at a rate comparable to bulk cells. However, TICs displayed less pronounced G2 cell cycle arrest and S/G2-phase block after IR and cisplatin, respectively. Additionally, we confirmed a cisplatin-refractory phenotype of H125 TICs in vivo in a mouse xenograft model. We further examined TICs for altered expression or activation of DNA damage repair proteins as a way to explain their increased radio- and/or chemotherapy resistance. Indeed, we found that TICs exhibited increased basal γH2AX (H2A histone family, member X) expression and diminished DNA damage-induced phosphorylation of DNA-dependent protein kinase (DNA-PK), ataxia telangiectasia-mutated (ATM), Krüppel-associated protein 1 (KAP1) and monoubiquitination of Fanconi anemia, complementation group D2 (FANCD2). As a proof of principle, ATM inhibition in bulk cells increased their cisplatin resistance, as demonstrated by reduced PARP cleavage. In conclusion, we show that reduced apoptotic response, altered DNA repair signaling and cell cycle perturbations in NSCLC

  16. A damaged DNA binding protein 2 mutation disrupting interaction with proliferating-cell nuclear antigen affects DNA repair and confers proliferation advantage.

    PubMed

    Perucca, Paola; Mocchi, Roberto; Guardamagna, Isabella; Bassi, Elisabetta; Sommatis, Sabrina; Nardo, Tiziana; Prosperi, Ennio; Stivala, Lucia Anna; Cazzalini, Ornella

    2018-06-01

    In mammalian cells, Nucleotide Excision Repair (NER) plays a role in removing DNA damage induced by UV radiation. In Global Genome-NER subpathway, DDB2 protein forms a complex with DDB1 (UV-DDB), recognizing photolesions. During DNA repair, DDB2 interacts directly with PCNA through a conserved region in N-terminal tail and this interaction is important for DDB2 degradation. In this work, we sought to investigate the role of DDB2-PCNA association in DNA repair and cell proliferation after UV-induced DNA damage. To this end, stable clones expressing DDB2 Wt and DDB2 PCNA- were used. We have found that cells expressing a mutant DDB2 show inefficient photolesions removal, and a concomitant lack of binding to damaged DNA in vitro. Unexpected cellular behaviour after DNA damage, such as UV-resistance, increased cell growth and motility were found in DDB2 PCNA- stable cell clones, in which the most significant defects in cell cycle checkpoint were observed, suggesting a role in the new cellular phenotype. Based on these findings, we propose that DDB2-PCNA interaction may contribute to a correct DNA damage response for maintaining genome integrity. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Non-Finite Complements in Russian, Serbian/Croatian, and Macedonian

    ERIC Educational Resources Information Center

    Kim, Bo Ra

    2010-01-01

    This study investigates the coherence properties of non-finite complements in Russian, Serbian/Croatian, and Macedonian. I demonstrate that Slavic non-finite complements do not project a uniform syntactic structure. The maximal projection of non-finite complements is not fixed but depends on the selectional properties of the matrix verb. I present…

  18. Parameters of oxidative stress, DNA damage and DNA repair in type 1 and type 2 diabetes mellitus.

    PubMed

    Pácal, Lukáš; Varvařovská, Jana; Rušavý, Zdeněk; Lacigová, Silva; Stětina, Rudolf; Racek, Jaroslav; Pomahačová, Renata; Tanhäuserová, Veronika; Kaňková, Kateřina

    2011-10-01

    (i) to determine the extent of oxidative stress and DNA damage and repair using a panel of selected markers in patients with type 1 and type 2 diabetes mellitus (T1DM, T2DM), (ii) to find their possible relationships with diabetes compensation and duration, and finally (iii) to test for the effect of functional polymorphisms in the 8-oxoguanin DNA glycosylase (rs1052133), catalase (rs1001179) and superoxide dismutase (rs4880) genes on respective intermediate phenotypes. A total of 207 subjects (23 children and 44 adults with T1DM, 52 adult patients with T2DM and 88 healthy adult control subjects) were enrolled in the study. The following markers of redox state were determined in participants: erythrocyte superoxide dismutase (Ery-SOD), whole blood glutathione peroxidase (WB-GPx), erythrocyte glutathione (Ery-GSH), plasma total antioxidant capacity (P-tAOC) and plasma malondialdehyde (P-MDA). Furthermore, the extent of DNA damage and repair was ascertained using the following parameters: DNA single strand breaks (DNAssb), DNA repair capacity (DNArc) and DNA repair index (DNRI). Comparison of T1DM vs. T2DM patients revealed significantly higher Ery-GSH content (P < 0.0001) and significantly lower Ery-SOD activity (P = 0.0006) and P-tAOC level (P < 0.0001) in T1DM subjects. T2DM diabetics exhibited a significant increase in DNAssb (P < 0.0001) and significant decrease in both DNArc (P < 0.0001) and DNRI (P <  .0001) compared with T1DM patients. Patient's age (irrespective of DM type) significantly correlated with DNAssb (r = 0.48, P < 0.0001), DNArc (r = -0.67, P < 0.0001) and DNRI (r = -0.7, P < 0.0001). Allele frequencies of all studied polymorphisms did not exhibit any significant association with the investigated parameters. We demonstrated significant age- and DM type-related changes of oxidative DNA modification and capacity for its repair in subjects with T1DM and T2DM.

  19. Platelet-mediated transformation of mtDNA-less human cells: Analysis of phenotypic variability among clones from normal individuals-and complementation behavior of the tRNA[sup Lys] mutation causing myoclonic epilepsy and ragged red fibers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chomyn, A.; Lai, S.T.; Shakeley, R.

    1994-06-01

    In the present work, the authors demonstrate the possibility of using human blood platelets as mitochondrial donors for the repopulation of mtDNA-less ([rho][sup o]) cells. The noninvasive nature of platelet isolation, combined with the prolonged viability of platelet mitochondria and the simplicity and efficiency of the mitochondria-transfer procedure, has substantially increased the applicability of the [rho][sup o] cell transformation approach for mitochondrial genetic analysis and for the study of mtDNA-linked diseases. This approach has been applied to platelets from several normal human individuals and one individual affected by the myoclonic-epilepsy-and-ragged-red-fibers (MERRF) encephalomyopathy. A certain variability in respiratory capacity was observedmore » among the platelet-derived [rho][sup o] cell transformants from a given normal subject, and it was shown to be unrelated to their mtDNA content. The results of sequential transfer of mitochondria from selected transformants into a [rho][sup o] cell line different from the first [rho][sup o] acceptor strongly suggest that this variability reflected, at least in part, differences in nuclear gene content and/or activity among the original recipient cells. A much greater variability in respiratory capacity was observed among the transformants derived from the MERRF patient and was found to be related to the presence and amount of the mitochondrial tRNA[sup Lys] mutation associated with the MERRF syndrome. An analysis of the relationship between proportion of mtDNA carrying the MERRF mutation and degree of respiratory activity in various transformations derived from the MERRF patient revealed an unusual complementation behavior of the tRNA[sup Lys] mutation, possibly reflecting the distribution of mutant mtDNA among the platelet mitochondria. 29 refs., 4 figs., 1 tab.« less

  20. Sublytic complement protects prostate cancer cells from tumour necrosis factor-α-induced cell death.

    PubMed

    Liu, L; Li, W; Li, Z; Kirschfink, M

    2012-08-01

    Inflammation is a critical component of tumour progression. Although complement and tumour necrosis factor (TNF)-α potentially exert significant anti-tumour effects, both mediators may also promote tumour progression. It has been demonstrated that sublytic complement confers resistance on tumour cells not only against lytic complement, but also other danger molecules such as perforin. In low concentrations, TNF promotes survival of malignant cells rather than exerting cytotoxic activity. In this study, we tested if sublytic complement is able to interfere with TNF-mediated tumour cell killing. Our results demonstrate that either subcytotoxic concentrations of TNF or sublytic complement rescue prostate carcinoma cells (DU145) from TNF-α-mediated cell death. Upon pretreatment with low-dose TNF-α, but not upon pre-exposure to sublytic complement, TNF resistance was associated with the down-regulation of TNF receptor 1 (TNF-R1) expression. Complement-induced protection against TNF-mediated apoptosis accompanied the induction of anti-apoptotic proteins [B cell leukaemia/lymphoma (Bcl)-2 and Bcl-xL] at an early stage followed by inhibition of the TNF-induced decrease in the amount of Bcl-2 and Bcl-xL. Cell protection also accompanied the inhibition of caspase-8 activation, poly (ADP-ribose) polymerase (PARP)-1 cleavage and the activation of nuclear factor (NF)-κB. Our data extend our current view on the induction of tumour cell resistance against cytotoxic mediators supporting the role of the tumour microenvironment in mediating protection against the anti-cancer immune response. © 2012 The Authors. Clinical and Experimental Immunology © 2012 British Society for Immunology.

  1. DNA methylation of loci within ABCG1 and PHOSPHO1 in blood DNA is associated with future type 2 diabetes risk.

    PubMed

    Dayeh, Tasnim; Tuomi, Tiinamaija; Almgren, Peter; Perfilyev, Alexander; Jansson, Per-Anders; de Mello, Vanessa D; Pihlajamäki, Jussi; Vaag, Allan; Groop, Leif; Nilsson, Emma; Ling, Charlotte

    2016-07-02

    Identification of subjects with a high risk of developing type 2 diabetes (T2D) is fundamental for prevention of the disease. Consequently, it is essential to search for new biomarkers that can improve the prediction of T2D. The aim of this study was to examine whether 5 DNA methylation loci in blood DNA (ABCG1, PHOSPHO1, SOCS3, SREBF1, and TXNIP), recently reported to be associated with T2D, might predict future T2D in subjects from the Botnia prospective study. We also tested if these CpG sites exhibit altered DNA methylation in human pancreatic islets, liver, adipose tissue, and skeletal muscle from diabetic vs. non-diabetic subjects. DNA methylation at the ABCG1 locus cg06500161 in blood DNA was associated with an increased risk for future T2D (OR = 1.09, 95% CI = 1.02-1.16, P-value = 0.007, Q-value = 0.018), while DNA methylation at the PHOSPHO1 locus cg02650017 in blood DNA was associated with a decreased risk for future T2D (OR = 0.85, 95% CI = 0.75-0.95, P-value = 0.006, Q-value = 0.018) after adjustment for age, gender, fasting glucose, and family relation. Furthermore, the level of DNA methylation at the ABCG1 locus cg06500161 in blood DNA correlated positively with BMI, HbA1c, fasting insulin, and triglyceride levels, and was increased in adipose tissue and blood from the diabetic twin among monozygotic twin pairs discordant for T2D. DNA methylation at the PHOSPHO1 locus cg02650017 in blood correlated positively with HDL levels, and was decreased in skeletal muscle from diabetic vs. non-diabetic monozygotic twins. DNA methylation of cg18181703 (SOCS3), cg11024682 (SREBF1), and cg19693031 (TXNIP) was not associated with future T2D risk in subjects from the Botnia prospective study.

  2. DNA damage induces nuclear actin filament assembly by Formin -2 and Spire-½ that promotes efficient DNA repair. [corrected].

    PubMed

    Belin, Brittany J; Lee, Terri; Mullins, R Dyche

    2015-08-19

    Actin filaments assemble inside the nucleus in response to multiple cellular perturbations, including heat shock, protein misfolding, integrin engagement, and serum stimulation. We find that DNA damage also generates nuclear actin filaments-detectable by phalloidin and live-cell actin probes-with three characteristic morphologies: (i) long, nucleoplasmic filaments; (ii) short, nucleolus-associated filaments; and (iii) dense, nucleoplasmic clusters. This DNA damage-induced nuclear actin assembly requires two biologically and physically linked nucleation factors: Formin-2 and Spire-1/Spire-2. Formin-2 accumulates in the nucleus after DNA damage, and depletion of either Formin-2 or actin's nuclear import factor, importin-9, increases the number of DNA double-strand breaks (DSBs), linking nuclear actin filaments to efficient DSB clearance. Nuclear actin filaments are also required for nuclear oxidation induced by acute genotoxic stress. Our results reveal a previously unknown role for nuclear actin filaments in DNA repair and identify the molecular mechanisms creating these nuclear filaments.

  3. Effect of 2',3'-dideoxythymidine-5'-triphosphate on HeLa cell in vitro DNA synthesis: evidence that DNA polymerase alpha is the only polymerase required for cellular DNA replication.

    PubMed Central

    Waqar, M A; Evans, M J; Huberman, J A

    1978-01-01

    We have studied the effects of the nucleotide analogue, 2',3'-dideoxythymidine-5'-triphosphate (ddTTP) on replicative DNA synthesis in HeLa cell lysates. As previously demonstrated (1), such lysates carry out extensive DNA synthesis in vitro, at rates and in a fashion similar to in vivo DNA replication. We report here that all aspects of DNA synthesis in such lysates (total dNTP incorporation, elongation of continuous nascent strands, and the initiation, elongation, and joining of Okazaki pieces) are only slightly inhibited by concentrations of ddTTP as high as 100-500 micrometer when the dTTP concentration is maintained at 10 micrometer. This finding is consistent with the report by Edenberg, Anderson, and DePamphilis (2) that all aspects of replicative in vitro simian virus 40 DNA synthesis are also resistant to ddTTP. We also find, in agreement with Edenberg, Anderson, and DePamphilis (2), that DNA synthesis catalyzed by DNA polymerases beta or gamma is easily inhibited by ddTTP, while synthesis catalyzed by DNA polymerase alpha is very resistant. These observations suggest that DNA polymerase alpha may be the only DNA polymerase required for all aspects of cellular DNA synthesis. PMID:673840

  4. Trinucleotide's quadruplet symmetries and natural symmetry law of DNA creation ensuing Chargaff's second parity rule.

    PubMed

    Rosandić, Marija; Vlahović, Ines; Glunčić, Matko; Paar, Vladimir

    2016-07-01

    For almost 50 years the conclusive explanation of Chargaff's second parity rule (CSPR), the equality of frequencies of nucleotides A=T and C=G or the equality of direct and reverse complement trinucleotides in the same DNA strand, has not been determined yet. Here, we relate CSPR to the interstrand mirror symmetry in 20 symbolic quadruplets of trinucleotides (direct, reverse complement, complement, and reverse) mapped to double-stranded genome. The symmetries of Q-box corresponding to quadruplets can be obtained as a consequence of Watson-Crick base pairing and CSPR together. Alternatively, assuming Natural symmetry law for DNA creation that each trinucleotide in one strand of DNA must simultaneously appear also in the opposite strand automatically leads to Q-box direct-reverse mirror symmetry which in conjunction with Watson-Crick base pairing generates CSPR. We demonstrate quadruplet's symmetries in chromosomes of wide range of organisms, from Escherichia coli to Neanderthal and human genomes, introducing novel quadruplet-frequency histograms and 3D-diagrams with combined interstrand frequencies. These "landscapes" are mutually similar in all mammals, including extinct Neanderthals, and somewhat different in most of older species. In human chromosomes 1-12, and X, Y the "landscapes" are almost identical and slightly different in the remaining smaller and telocentric chromosomes. Quadruplet frequencies could provide a new robust tool for characterization and classification of genomes and their evolutionary trajectories.

  5. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    PubMed

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Complement System in Dermatological Diseases – Fire Under the Skin

    PubMed Central

    Panelius, Jaana; Meri, Seppo

    2015-01-01

    The complement system plays a key role in several dermatological diseases. Overactivation, deficiency, or abnormality of the control proteins are often related to a skin disease. Autoimmune mechanisms with autoantibodies and a cytotoxic effect of the complement membrane attack complex on epidermal or vascular cells can cause direct tissue damage and inflammation, e.g., in systemic lupus erythematosus (SLE), phospholipid antibody syndrome, and bullous skin diseases like pemphigoid. By evading complement attack, some microbes like Borrelia spirochetes and staphylococci can persist in the skin and cause prolonged symptoms. In this review, we present the most important skin diseases connected to abnormalities in the function of the complement system. Drugs having an effect on the complement system are also briefly described. On one hand, drugs with free hydroxyl on amino groups (e.g., hydralazine, procainamide) could interact with C4A, C4B, or C3 and cause an SLE-like disease. On the other hand, progress in studies on complement has led to novel anti-complement drugs (recombinant C1-inhibitor and anti-C5 antibody, eculizumab) that could alleviate symptoms in diseases associated with excessive complement activation. The main theme of the manuscript is to show how relevant the complement system is as an immune effector system in contributing to tissue injury and inflammation in a broad range of skin disorders. PMID:25688346

  7. Detection and characterisation of Complement protein activity in bovine milk by bactericidal sequestration assay.

    PubMed

    Maye, Susan; Stanton, Catherine; Fitzgerald, Gerald F; Kelly, Philip M

    2015-08-01

    While the Complement protein system in human milk is well characterised, there is little information on its presence and activity in bovine milk. Complement forms part of the innate immune system, hence the importance of its contribution during milk ingestion to the overall defences of the neonate. A bactericidal sequestration assay, featuring a Complement sensitive strain, Escherichia coli 0111, originally used to characterise Complement activity in human milk was successfully applied to freshly drawn bovine milk samples, thus, providing an opportunity to compare Complement activities in both human and bovine milks. Although not identical in response, the levels of Complement activity in bovine milk were found to be closely comparable with that of human milk. Differential counts of Esch. coli 0111 after 2 h incubation were 6.20 and 6.06 log CFU/ml, for raw bovine and human milks, respectively - the lower value representing a stronger Complement response. Exposing bovine milk to a range of thermal treatments e.g. 42, 45, 65, 72, 85 or 95 °C for 10 min, progressively inhibited Complement activity by increasing temperature, thus confirming the heat labile nature of this immune protein system. Low level Complement activity was found, however, in 65 and 72 °C heat treated samples and in retailed pasteurised milk which highlights the outer limit to which high temperature, short time (HTST) industrial thermal processes should be applied if retention of activity is a priority. Concentration of Complement in the fat phase was evident following cream separation, and this was also reflected in the further loss of activity recorded in low fat variants of retailed pasteurised milk. Laboratory-based churning of the cream during simulated buttermaking generated an aqueous (buttermilk) phase with higher levels of Complement activity than the fat phase, thus pointing to a likely association with the milk fat globule membrane (MFGM) layer.

  8. Diagnosis of eight groups of xeroderma pigmentosum by genetic complementation using recombinant adenovirus vectors.

    PubMed

    Yamashita, Toshiharu; Okura, Masae; Ishii-Osai, Yasue; Hida, Tokimasa

    2016-10-01

    Because patients with xeroderma pigmentosum (XP) must avoid ultraviolet (UV) light from an early age, an early diagnosis of this disorder is essential. XP is composed of seven genetic complementation groups, XP-A to -G, and a variant type (XP-V). To establish an easy and accurate diagnosis of the eight disease groups, we constructed recombinant adenoviruses that expressed one of the XP cDNA. When fibroblasts derived from patients with XP-A, -B, -C, -D, -F or -G were infected with the adenovirus expressing XPA, XPB, XPC, XPD, XPF or XPG, respectively, and UV-C at 5-20 J/m 2 was irradiated, cell viability was clearly recovered by the corresponding recombinant adenoviruses. In contrast, XP-E and XP-V cells were not significantly sensitive to UV irradiation and were barely complemented by the matched recombinant adenoviruses. However, co-infection of Ad-XPA with Ad-XPE increased survival rate of XP-E cells after UV-C exposure. When XP-V cell strains, including one derived from a Japanese patient, were infected with Ad-XPV, exposed to UV-B and cultured with 1 mmol/L of caffeine, flow cytometry detected a characteristic decrease in the S phase in all the XP-V cell strains. From these results, the eight groups of XP could be differentiated by utilizing a set of recombinant adenoviruses, indicating that our procedure provides a convenient and correct diagnostic method for all the XP groups including XP-E and XP-V. © 2016 Japanese Dermatological Association.

  9. Mg2+ in the Major Groove Modulates B-DNA Structure and Dynamics

    PubMed Central

    Guéroult, Marc; Boittin, Olivier; Mauffret, Oliver; Etchebest, Catherine; Hartmann, Brigitte

    2012-01-01

    This study investigates the effect of Mg2+ bound to the DNA major groove on DNA structure and dynamics. The analysis of a comprehensive dataset of B-DNA crystallographic structures shows that divalent cations are preferentially located in the DNA major groove where they interact with successive bases of (A/G)pG and the phosphate group of 5′-CpA or TpG. Based on this knowledge, molecular dynamics simulations were carried out on a DNA oligomer without or with Mg2+ close to an ApG step. These simulations showed that the hydrated Mg2+ forms a stable intra-strand cross-link between the two purines in solution. ApG generates an electrostatic potential in the major groove that is particularly attractive for cations; its intrinsic conformation is well-adapted to the formation of water-mediated hydrogen bonds with Mg2+. The binding of Mg2+ modulates the behavior of the 5′-neighboring step by increasing the BII (ε-ζ>0°) population of its phosphate group. Additional electrostatic interactions between the 5′-phosphate group and Mg2+ strengthen both the DNA-cation binding and the BII character of the 5′-step. Cation binding in the major groove may therefore locally influence the DNA conformational landscape, suggesting a possible avenue for better understanding how strong DNA distortions can be stabilized in protein-DNA complexes. PMID:22844516

  10. Exploring the Feasibility of a DNA Computer: Design of an ALU Using Sticker-Based DNA Model.

    PubMed

    Sarkar, Mayukh; Ghosal, Prasun; Mohanty, Saraju P

    2017-09-01

    Since its inception, DNA computing has advanced to offer an extremely powerful, energy-efficient emerging technology for solving hard computational problems with its inherent massive parallelism and extremely high data density. This would be much more powerful and general purpose when combined with other existing well-known algorithmic solutions that exist for conventional computing architectures using a suitable ALU. Thus, a specifically designed DNA Arithmetic and Logic Unit (ALU) that can address operations suitable for both domains can mitigate the gap between these two. An ALU must be able to perform all possible logic operations, including NOT, OR, AND, XOR, NOR, NAND, and XNOR; compare, shift etc., integer and floating point arithmetic operations (addition, subtraction, multiplication, and division). In this paper, design of an ALU has been proposed using sticker-based DNA model with experimental feasibility analysis. Novelties of this paper may be in manifold. First, the integer arithmetic operations performed here are 2s complement arithmetic, and the floating point operations follow the IEEE 754 floating point format, resembling closely to a conventional ALU. Also, the output of each operation can be reused for any next operation. So any algorithm or program logic that users can think of can be implemented directly on the DNA computer without any modification. Second, once the basic operations of sticker model can be automated, the implementations proposed in this paper become highly suitable to design a fully automated ALU. Third, proposed approaches are easy to implement. Finally, these approaches can work on sufficiently large binary numbers.

  11. Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

    PubMed

    Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco

    2017-01-01

    Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (<20%), she presents a slower and less severe evolution of the disease. In conclusion, our data confirm the role of TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.

  12. Comparison of potential protection conferred by three immunization strategies (protein/protein, DNA/DNA, and DNA/protein) against Brucella infection using Omp2b in BALB/c Mice.

    PubMed

    Golshani, Maryam; Rafati, Sima; Nejati-Moheimani, Mehdi; Ghasemian, Melina; Bouzari, Saeid

    2016-12-25

    In the present study, immunogenicity and protective efficacy of the Brucella outer membrane protein 2b (Omp2b) was evaluated in BALB/c mice using Protein/Protein, DNA/DNA and DNA/Protein vaccine strategies. Immunization of mice with three vaccine regimens elicited a strong specific IgG response (higher IgG2a titers over IgG1 titers) and provided Th1-oriented immune response. Vaccination of BALB/c mice with the DNA/Pro regimen induced higher levels of IFN-γ/IL-2 and conferred more protection levels against B. melitenisis and B. abortus challenge than did the protein or DNA alone. In conclusion, Omp2b is able to stimulate specific immune responses and to confer cross protection against B. melitensis and B. abortus infection. Therefore, it could be introduced as a new potential candidate for the development of a subunit vaccine against Brucella infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Human Pol ζ purified with accessory subunits is active in translesion DNA synthesis and complements Pol η in cisplatin bypass.

    PubMed

    Lee, Young-Sam; Gregory, Mark T; Yang, Wei

    2014-02-25

    DNA polymerase ζ (Pol ζ) is a eukaryotic B-family DNA polymerase that specializes in translesion synthesis and is essential for normal embryogenesis. At a minimum, Pol ζ consists of a catalytic subunit Rev3 and an accessory subunit Rev7. Mammalian Rev3 contains >3,000 residues and is twice as large as the yeast homolog. To date, no vertebrate Pol ζ has been purified for biochemical characterization. Here we report purification of a series of human Rev3 deletion constructs expressed in HEK293 cells and identification of a minimally catalytically active human Pol ζ variant. With a tagged form of an active Pol ζ variant, we isolated two additional accessory subunits of human Pol ζ, PolD2 and PolD3. The purified four-subunit Pol ζ4 (Rev3-Rev7-PolD2-PolD3) is much more efficient and more processive at bypassing a 1,2-intrastrand d(GpG)-cisplatin cross-link than the two-subunit Pol ζ2 (Rev3-Rev7). We show that complete bypass of cisplatin lesions requires Pol η to insert dCTP opposite the 3' guanine and Pol ζ4 to extend the primers.

  14. Molecular and expression analysis of complement component C5 in the nurse shark (Ginglymostoma cirratum) and its predicted functional role.

    PubMed

    Graham, Matthew; Shin, Dong-Ho; Smith, Sylvia L

    2009-07-01

    We present the complete cDNA sequence of shark (Ginglymostoma cirratum) pro-C5 and its molecular characterization with a descriptive analysis of the structural elements necessary for its potential functional role as a potent mediator of inflammation (fragment C5a) and initiator molecule (fragment C5b) for the assembly of the membrane attack complex (MAC) upon activation by C5 convertase. In mammals the three complement activation cascades, the classical, alternative and lectin pathways, converge at the activation of C3, a pivotal complement protein. It is, however, the subsequent activation of the next complement component, C5, which is the focal point at which the initiation of the terminal lytic pathway takes place and involves the stepwise assembly of the MAC. The effector cytolytic function of complement occurs with the insertion of MAC into target membranes causing dough-nut like holes and cell leakage. The lytic activity of shark complement results in structurally similar holes in target membranes suggesting the assembly of a shark MAC that likely involves a functional analogue of C5. The composition of shark MAC remains unresolved and to date conclusive evidence has been lacking for shark C5. The gene has not been cloned nor has the serum protein been characterized for any elasmobranch species. This report is the first to confirm the presence of C5 homologue in the shark. GcC5 is remarkably similar to human C5 in overall structure and domain arrangement. The GcC5 cDNA measured 5160-bp with 5' and 3' UTRs of 35 bp and 79 bp, respectively. Structural analysis of the derived protein sequence predicts a molecule that is a two-chain structure which lacks a thiolester bond and contains a C5 convertase cleavage site indicating that activation will generate two peptides, akin to C5b and C5a. The putative GcC5 molecule also contains the C-terminal C345C/Netrin module that characterizes C3, C4 and C5. Multiple alignment of deduced amino acid sequences shows that GcC5

  15. Molecular and expression analysis of complement component C5 in the nurse shark (Ginglymostoma cirratum) and its predicted functional role

    PubMed Central

    Graham, Matthew; Shin, Dong-Ho; Smith, Sylvia L.

    2009-01-01

    We present the complete cDNA sequence of shark (Ginglymostoma cirratum) pro-C5 and its molecular characterization with a descriptive analysis of the structural elements necessary for its potential functional role as a potent mediator of inflammation (fragment C5a) and initiator molecule (fragment C5b) for the assembly of the membrane attack complex (MAC) upon activation by C5 convertase. In mammals the three complement activation cascades, the classical, alternative and lectin pathways, converge at the activation of C3, a pivotal complement protein. It is, however, the subsequent activation of the next complement component, C5, which is the focal point at which the initiation of the terminal lytic pathway takes place and involves the stepwise assembly of the MAC. The effector cytolytic function of complement occurs with the insertion of MAC into target membranes causing dough-nut like holes and cell leakage. The lytic activity of shark complement results in structurally similar holes in target membranes suggesting the assembly of a shark MAC that likely involves a functional analogue of C5. The composition of shark MAC remains unresolved and to date conclusive evidence has been lacking for shark C5. The gene has not been cloned nor has the serum protein been characterized for any elasmobranch species. This report is the first to confirm the presence of C5 homologue in the shark. GcC5 is remarkably similar to human C5 in overall structure and domain arrangement. The GcC5 cDNA measured 5160-bp with 5′ and 3′ UTRs of 35bp and 79bp, respectively. Structural analysis of the derived protein sequence predicts a molecule that is a two-chain structure which lacks a thiolester bond and contains a C5 convertase cleavage site indicating that activation will generate two peptides, akin to C5b and C5a. The putative GcC5 molecule also contains the C-terminal C345C/Netrin module that characterizes C3, C4 and C5. Multiple alignment of deduced amino acid sequences show that GcC5

  16. Complement component C5a mediates hemorrhage-induced intestinal damage

    PubMed Central

    Fleming, Sherry D.; Phillips, Lauren M.; Lambris, John D.; Tsokos, George C.

    2008-01-01

    Background Complement has been implicated in the pathogenesis of intestinal damage and inflammation in multiple animal models. Although the exact mechanism is unknown, inhibition of complement prevents hemodynamic alterations in hemorrhage. Materials/Methods C57Bl/6, complement 5 deficient (C5−/−) and sufficient (C5+/+) mice were subjected to 25% blood loss. In some cases, C57Bl/6 mice were treated with C5a receptor antagonist (C5aRa) post-hemorrhage. Intestinal injury, leukotriene B4, and myeloperoxidase production were assessed for each treatment group of mice. Results Mice subjected to significant blood loss without major trauma develop intestinal inflammation and tissue damage within two hours. We report here that complement 5 (C5) deficient mice are protected from intestinal tissue damage when subjected to hemorrhage (Injury score = 0.36 compared to wildtype hemorrhaged animal injury score = 2.89; p<0.05). We present evidence that C5a represents the effector molecule because C57Bl/6 mice treated with a C5a receptor antagonist displayed limited intestinal injury (Injury score = 0.88), leukotriene B4 (13.16 pg/mg tissue) and myeloperoxidase (115.6 pg/mg tissue) production compared to hemorrhaged C57Bl/6 mice (p<0.05). Conclusion Complement activation is important in the development of hemorrhage-induced tissue injury and C5a generation is critical for tissue inflammation and damage. Thus, therapeutics targeting C5a may be useful therapeutics for hemorrhage-associated injury. PMID:18639891

  17. Complement, a target for therapy in inflammatory and degenerative diseases.

    PubMed

    Morgan, B Paul; Harris, Claire L

    2015-12-01

    The complement system is a key innate immune defence against infection and an important driver of inflammation; however, these very properties can also cause harm. Inappropriate or uncontrolled activation of complement can cause local and/or systemic inflammation, tissue damage and disease. Complement provides numerous options for drug development as it is a proteolytic cascade that involves nine specific proteases, unique multimolecular activation and lytic complexes, an arsenal of natural inhibitors, and numerous receptors that bind to activation fragments. Drug design is facilitated by the increasingly detailed structural understanding of the molecules involved in the complement system. Only two anti-complement drugs are currently on the market, but many more are being developed for diseases that include infectious, inflammatory, degenerative, traumatic and neoplastic disorders. In this Review, we describe the history, current landscape and future directions for anti-complement therapies.

  18. Molecular analysis of a mutant defective in photosynthetic oxygen evolution and isolation of a complementing clone by a novel screening procedure.

    PubMed Central

    Dzelzkalns, V A; Bogorad, L

    1988-01-01

    Photosynthesis-defective mutants of the transformable cyanobacterium Synechocystis 6803 have been isolated following nitrosoguanidine mutagenesis. The photosystem II- phenotype of one of these mutants is shown by DNA sequencing to be attributable to a short deletion in psbC, the gene encoding the 44-kd, chlorophyll-binding protein of photosystem II. Although not a component of the reaction center of photosystem II, the 44-kd protein is none the less shown to be essential in vivo for photosystem II activity. The deletion in psbC also results in greatly diminished levels of D-2 (a component of the reaction center of photosystem II) indicating that the loss of the product of the psbC gene affects the assembly or stability of the photosystem II reaction center. The isolation of a clone capable of restoring both photosystem II activity and photoautotrophy to the mutant cells was aided by the observation that restriction fragments or cloned Synechocystis 6803 DNA applied in liquid or in melted agarose directly onto a lawn of Synechocystis 6803 will lead to the transformation of the cells. This in situ 'dot' transformation procedure provides a convenient method for the rapid identification of fractions or clones containing complementing Synechocystis 6803 DNA. Images PMID:3130247

  19. [Complement deficiencies and meningococcal disease in The Netherlands].

    PubMed

    Swart, A G; Fijen, C A; te Bulte, M T; Daha, M R; Dankert, J; Kuijper, E J

    1993-06-05

    To determine the prevalence of complement system deficiencies in patients who have survived a Neisseria meningitidis infection. Retrospective. Reference laboratory for bacterial meningitis of the University of Amsterdam and the National Institute of Public Health and Environmental Protection. Out of the files of the laboratory 187 patients who had experienced a meningococcal infection in the Netherlands between 1959-1990 were selected in two groups according to the infecting bacterial strain: 97 patients with a serogroup X, Y, Z, W135, 29E, or non-groupable strains and 90 patients with an infection due to serogroup A or C. The patients were asked for their cooperation by their family doctor and one of us visited the patients at home to take blood samples. The complement activity was studied with a haemolysis in gel test and with an assay of haemolytic activity in free solution. Complement deficiency was present in 18% of the 187 patients who had experienced a meningococcal infection. The highest prevalence was found in patients older than 10 years who had developed infections due to serogroups X, Y, W135, or non-groupable strains (45%). Of the patients with a serogroup A or C infection, 3% had an complement deficiency. Of the complement deficiencies, 42% concerned a component of the alternative pathway, 12% a deficiency of C3, and 46% a component of the terminal route. The most commonly found deficiencies were properdin deficiency (39%) and C8 deficiency (18%). 30% of the complement deficient patients reported other family members having experienced meningitis. Recurrent meningitis was only observed in patients with terminal route deficiencies. We recommend that patients with a meningococcal infection due to serogroups X, Y, W135 or non-groupable strains should be screened for complement deficiency.

  20. Synthesis and characterization of 6,6’-bis(2-hydroxyphenyl)-2,2’-bipyridine ligand and its interaction with ct-DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Selamat, Norhidayah; Heng, Lee Yook; Hassan, Nurul Izzaty

    2015-09-25

    The tetradentate ligand with four donor atoms OONN was synthesized. Bis(phenoxy)bipyridine ligand was prepared by Suzuki coupling reaction between 6,6’-dibromo-2,2’-bipyridyl and 2-hydroxyphenylboronic acid with presence of palladium (II) acetate. Bis(phenoxy)bipyridine ligand was also synthesized by demethylating of 6,6’-bis(2-methoxyphenyl)-2,2’-bipyridyl ligand through solvent free reaction using pyridine hydrocloride. The formation of both phenoxy and methoxy ligands was confirmed by {sup 1}H, 2D cosy and {sup 13}C NMR spectroscopy, ESI-MS spectrometry, FTIR spectroscopy. The purity of the ligand was confirmed by melting point. Binding studies of small molecules with DNA are useful to understand the reaction mechanism and to provide guidance for themore » application and design of new and more efficient drugs targeted to DNA. In this study, the binding interaction between the synthesized ligand with calf thymus-DNA (ct-DNA) has been investigated by UV/Vis DNA titration study. From the UV/Vis DNA study, it shows that bis(phenoxy)bipyridine ligand bind with ct-DNA via outside binding with binding contant K{sub b} = 1.19 × 10{sup 3} ± 0.08 M{sup −1}.« less

  1. Human L-ficolin, a recognition molecule of the lectin activation pathway of complement, activates complement by binding to pneumolysin, the major toxin of Streptococcus pneumoniae.

    PubMed

    Ali, Youssif M; Kenawy, Hany I; Muhammad, Adnan; Sim, Robert B; Andrew, Peter W; Schwaeble, Wilhelm J

    2013-01-01

    The complement system is an essential component of the immune response, providing a critical line of defense against different pathogens including S. pneumoniae. Complement is activated via three distinct pathways: the classical (CP), the alternative (AP) and the lectin pathway (LP). The role of Pneumolysin (PLY), a bacterial toxin released by S. pneumoniae, in triggering complement activation has been studied in vitro. Our results demonstrate that in both human and mouse sera complement was activated via the CP, initiated by direct binding of even non-specific IgM and IgG3 to PLY. Absence of CP activity in C1q(-/-) mouse serum completely abolished any C3 deposition. However, C1q depleted human serum strongly opsonized PLY through abundant deposition of C3 activation products, indicating that the LP may have a vital role in activating the human complement system on PLY. We identified that human L-ficolin is the critical LP recognition molecule that drives LP activation on PLY, while all of the murine LP recognition components fail to bind and activate complement on PLY. This work elucidates the detailed interactions between PLY and complement and shows for the first time a specific role of the LP in PLY-mediated complement activation in human serum.

  2. Human L-ficolin, a Recognition Molecule of the Lectin Activation Pathway of Complement, Activates Complement by Binding to Pneumolysin, the Major Toxin of Streptococcus pneumoniae

    PubMed Central

    Ali, Youssif M.; Kenawy, Hany I.; Muhammad, Adnan; Sim, Robert B.

    2013-01-01

    The complement system is an essential component of the immune response, providing a critical line of defense against different pathogens including S. pneumoniae. Complement is activated via three distinct pathways: the classical (CP), the alternative (AP) and the lectin pathway (LP). The role of Pneumolysin (PLY), a bacterial toxin released by S. pneumoniae, in triggering complement activation has been studied in vitro. Our results demonstrate that in both human and mouse sera complement was activated via the CP, initiated by direct binding of even non-specific IgM and IgG3 to PLY. Absence of CP activity in C1q−/− mouse serum completely abolished any C3 deposition. However, C1q depleted human serum strongly opsonized PLY through abundant deposition of C3 activation products, indicating that the LP may have a vital role in activating the human complement system on PLY. We identified that human L-ficolin is the critical LP recognition molecule that drives LP activation on PLY, while all of the murine LP recognition components fail to bind and activate complement on PLY. This work elucidates the detailed interactions between PLY and complement and shows for the first time a specific role of the LP in PLY-mediated complement activation in human serum. PMID:24349316

  3. Arabidopsis thaliana GYRB3 Does Not Encode a DNA Gyrase Subunit

    PubMed Central

    Evans-Roberts, Katherine M.; Breuer, Christian; Wall, Melisa K.; Sugimoto-Shirasu, Keiko; Maxwell, Anthony

    2010-01-01

    Background DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3. Methodology/Principal Findings We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer. Conclusions/Significance These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen. PMID:20360860

  4. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    PubMed

    Evans-Roberts, Katherine M; Breuer, Christian; Wall, Melisa K; Sugimoto-Shirasu, Keiko; Maxwell, Anthony

    2010-03-26

    DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3. We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer. These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  5. Assessment of environmental DNA for detecting presence of imperiled aquatic amphibian species in isolated wetlands

    USGS Publications Warehouse

    Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C

    2015-01-01

    Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations

  6. Alpha-fetoprotein and Fanconi Anemia: Relevance to DNA Repair and Breast Cancer Susceptibility.

    PubMed

    Lakhi, Nisha A; Mizejewski, Gerald J

    2017-02-01

    Elevations of serum alpha-fetoprotein (sAFP) have been reported in fetal and infant states of anemia. Fanconi anemia (FA) belongs to a family of genetic instability disorders which lack the capability to repair DNA breaks. The lesion occurs at a checkpoint regulatory step of the G2 to mitotic transition, allowing FA cells to override cell-cycle arrest. FA DNA repair pathways contain complementation groups known as FANC proteins. FANC proteins form multi-protein complexes with BRCA proteins and are involved in homologous DNA repair. An impaired cascade in these events imparts an increased breast cancer susceptibility to female FA patients. Elevations of sAFP have availed this fetal protein to serve as a biomarker for FA disease. However, the origin of the synthesis of sAFA has not been determined in FA patients. We hypothesize that hematopoietic multipotent progenitor stem cells in the bone marrow are the source of sAFP production in FA patients.

  7. ITS1: a DNA barcode better than ITS2 in eukaryotes?

    PubMed

    Wang, Xin-Cun; Liu, Chang; Huang, Liang; Bengtsson-Palme, Johan; Chen, Haimei; Zhang, Jian-Hui; Cai, Dayong; Li, Jian-Qin

    2015-05-01

    A DNA barcode is a short piece of DNA sequence used for species determination and discovery. The internal transcribed spacer (ITS/ITS2) region has been proposed as the standard DNA barcode for fungi and seed plants and has been widely used in DNA barcoding analyses for other biological groups, for example algae, protists and animals. The ITS region consists of both ITS1 and ITS2 regions. Here, a large-scale meta-analysis was carried out to compare ITS1 and ITS2 from three aspects: PCR amplification, DNA sequencing and species discrimination, in terms of the presence of DNA barcoding gaps, species discrimination efficiency, sequence length distribution, GC content distribution and primer universality. In total, 85 345 sequence pairs in 10 major groups of eukaryotes, including ascomycetes, basidiomycetes, liverworts, mosses, ferns, gymnosperms, monocotyledons, eudicotyledons, insects and fishes, covering 611 families, 3694 genera, and 19 060 species, were analysed. Using similarity-based methods, we calculated species discrimination efficiencies for ITS1 and ITS2 in all major groups, families and genera. Using Fisher's exact test, we found that ITS1 has significantly higher efficiencies than ITS2 in 17 of the 47 families and 20 of the 49 genera, which are sample-rich. By in silico PCR amplification evaluation, primer universality of the extensively applied ITS1 primers was found superior to that of ITS2 primers. Additionally, shorter length of amplification product and lower GC content was discovered to be two other advantages of ITS1 for sequencing. In summary, ITS1 represents a better DNA barcode than ITS2 for eukaryotic species. © 2014 John Wiley & Sons Ltd.

  8. Complement activation in the tubulointerstitium: AKI, CKD, and in between.

    PubMed

    Brar, Jyoti E; Quigg, Richard J

    2014-10-01

    Complement activation is actively regulated to prevent injudicious activation, such as on peritubular endothelia and basolateral aspects of tubules. Miao et al. studied mice in which the key complement regulator, Crry, was deleted from tubular cells. This lacked functional consequence in unmanipulated animals. Yet, following ischemia-reperfusion, there was greater injury due to alternative pathway activation of C5. When the balance between complement activation and regulation is tipped towards the former, pathologic complement activation can ensue.

  9. Complement inhibition decreases early fibrogenic events in the lung of septic baboons.

    PubMed

    Silasi-Mansat, Robert; Zhu, Hua; Georgescu, Constantin; Popescu, Narcis; Keshari, Ravi S; Peer, Glenn; Lupu, Cristina; Taylor, Fletcher B; Pereira, Heloise Anne; Kinasewitz, Gary; Lambris, John D; Lupu, Florea

    2015-11-01

    Acute respiratory distress syndrome (ARDS) induced by severe sepsis can trigger persistent inflammation and fibrosis. We have shown that experimental sepsis in baboons recapitulates ARDS progression in humans, including chronic inflammation and long-lasting fibrosis in the lung. Complement activation products may contribute to the fibroproliferative response, suggesting that complement inhibitors are potential therapeutic agents. We have been suggested that treatment of septic baboons with compstatin, a C3 convertase inhibitor protects against ARDS-induced fibroproliferation. Baboons challenged with 10(9) cfu/kg (LD50) live E. coli by intravenous infusion were treated or not with compstatin at the time of challenge or 5 hrs thereafter. Changes in the fibroproliferative response at 24 hrs post-challenge were analysed at both transcript and protein levels. Gene expression analysis showed that sepsis induced fibrotic responses in the lung as early as 24 hrs post-bacterial challenge. Immunochemical and biochemical analysis revealed enhanced collagen synthesis, induction of profibrotic factors and increased cell recruitment and proliferation. Specific inhibition of complement with compstatin down-regulated sepsis-induced fibrosis genes, including transforming growth factor-beta (TGF-β), connective tissue growth factor (CTGF), tissue inhibitor of metalloproteinase 1 (TIMP1), various collagens and chemokines responsible for fibrocyte recruitment (e.g. chemokine (C-C motif) ligand 2 (CCL2) and 12 (CCL12)). Compstatin decreased the accumulation of myofibroblasts and proliferating cells, reduced the production of fibrosis mediators (TGF-β, phospho-Smad-2 and CTGF) and inhibited collagen deposition. Our data demonstrate that complement inhibition effectively attenuates collagen deposition and fibrotic responses in the lung after severe sepsis. Inhibiting complement could prove an attractive strategy for preventing sepsis-induced fibrosis of the lung. © 2015 The Authors

  10. The Role of Complement in Cnidarian-Dinoflagellate Symbiosis and Immune Challenge in the Sea Anemone Aiptasia pallida

    PubMed Central

    Poole, Angela Z.; Kitchen, Sheila A.; Weis, Virginia M.

    2016-01-01

    The complement system is an innate immune pathway that in vertebrates, is responsible for initial recognition and ultimately phagocytosis and destruction of microbes. Several complement molecules including C3, Factor B, and mannose binding lectin associated serine proteases (MASP) have been characterized in invertebrates and while most studies have focused on their conserved role in defense against pathogens, little is known about their role in managing beneficial microbes. The purpose of this study was to (1) characterize complement pathway genes in the symbiotic sea anemone Aiptasia pallida, (2) investigate the evolution of complement genes in invertebrates, and (3) examine the potential dual role of complement genes Factor B and MASP in the onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge using qPCR based studies. The results demonstrate that A. pallida has multiple Factor B genes (Ap_Bf-1, Ap_Bf-2a, and Ap_Bf-2b) and one MASP gene (Ap_MASP). Phylogenetic analysis indicates that the evolutionary history of complement genes is complex, and there have been many gene duplications or gene loss events, even within members of the same phylum. Gene expression analyses revealed a potential role for complement in both onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge. Specifically, Ap_Bf-1 and Ap_MASP are significantly upregulated in the light at the onset of symbiosis and in response to challenge with the pathogen Serratia marcescens suggesting that they play a role in the initial recognition of both beneficial and harmful microbes. Ap_Bf-2b in contrast, was generally downregulated during the onset and maintenance of symbiosis and in response to challenge with S. marcescens. Therefore, the exact role of Ap_Bf-2b in response to microbes remains unclear, but the results suggest that the presence of microbes leads to repressed expression. Together, these results indicate functional divergence between Ap_Bf-1

  11. The Role of Complement in Cnidarian-Dinoflagellate Symbiosis and Immune Challenge in the Sea Anemone Aiptasia pallida.

    PubMed

    Poole, Angela Z; Kitchen, Sheila A; Weis, Virginia M

    2016-01-01

    The complement system is an innate immune pathway that in vertebrates, is responsible for initial recognition and ultimately phagocytosis and destruction of microbes. Several complement molecules including C3, Factor B, and mannose binding lectin associated serine proteases (MASP) have been characterized in invertebrates and while most studies have focused on their conserved role in defense against pathogens, little is known about their role in managing beneficial microbes. The purpose of this study was to (1) characterize complement pathway genes in the symbiotic sea anemone Aiptasia pallida, (2) investigate the evolution of complement genes in invertebrates, and (3) examine the potential dual role of complement genes Factor B and MASP in the onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge using qPCR based studies. The results demonstrate that A. pallida has multiple Factor B genes (Ap_Bf-1, Ap_Bf-2a, and Ap_Bf-2b) and one MASP gene (Ap_MASP). Phylogenetic analysis indicates that the evolutionary history of complement genes is complex, and there have been many gene duplications or gene loss events, even within members of the same phylum. Gene expression analyses revealed a potential role for complement in both onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge. Specifically, Ap_Bf-1 and Ap_MASP are significantly upregulated in the light at the onset of symbiosis and in response to challenge with the pathogen Serratia marcescens suggesting that they play a role in the initial recognition of both beneficial and harmful microbes. Ap_Bf-2b in contrast, was generally downregulated during the onset and maintenance of symbiosis and in response to challenge with S. marcescens. Therefore, the exact role of Ap_Bf-2b in response to microbes remains unclear, but the results suggest that the presence of microbes leads to repressed expression. Together, these results indicate functional divergence between Ap_Bf-1

  12. Complement mutations in diacylglycerol kinase-ε-associated atypical hemolytic uremic syndrome.

    PubMed

    Sánchez Chinchilla, Daniel; Pinto, Sheila; Hoppe, Bernd; Adragna, Marta; Lopez, Laura; Justa Roldan, Maria Luisa; Peña, Antonia; Lopez Trascasa, Margarita; Sánchez-Corral, Pilar; Rodríguez de Córdoba, Santiago

    2014-09-05

    Atypical hemolytic uremic syndrome is characterized by vascular endothelial damage caused by complement dysregulation. Consistently, complement inhibition therapies are highly effective in most patients with atypical hemolytic uremic syndrome. Recently, it was shown that a significant percentage of patients with early-onset atypical hemolytic uremic syndrome carry mutations in diacylglycerol kinase-ε, an intracellular protein with no obvious role in complement. These data support an alternative, complement-independent mechanism leading to thrombotic microangiopathy that has implications for treatment of early-onset atypical hemolytic uremic syndrome. To get additional insights into this new form of atypical hemolytic uremic syndrome, the diacylglycerol kinase-ε gene in a cohort with atypical hemolytic uremic syndrome was analyzed. Eighty-three patients with early-onset atypical hemolytic uremic syndrome (<2 years) enrolled in the Spanish atypical hemolytic uremic syndrome registry between 1999 and 2013 were screened for mutations in diacylglycerol kinase-ε. These patients were also fully characterized for mutations in the genes encoding factor H, membrane cofactor protein, factor I, C3, factor B, and thrombomodulin CFHRs copy number variations and rearrangements, and antifactor H antibodies. Four patients carried mutations in diacylglycerol kinase-ε, one p.H536Qfs*16 homozygote and three compound heterozygotes (p.W322*/p.P498R, two patients; p.Q248H/p.G484Gfs*10, one patient). Three patients also carried heterozygous mutations in thrombomodulin or C3. Extensive plasma infusions controlled atypical hemolytic uremic syndrome recurrences and prevented renal failure in the two patients with diacylglycerol kinase-ε and thrombomodulin mutations. A positive response to plasma infusions and complement inhibition treatment was also observed in the patient with concurrent diacylglycerol kinase-ε and C3 mutations. Data suggest that complement dysregulation influences

  13. Complement Mutations in Diacylglycerol Kinase-ε–Associated Atypical Hemolytic Uremic Syndrome

    PubMed Central

    Sánchez Chinchilla, Daniel; Pinto, Sheila; Hoppe, Bernd; Adragna, Marta; Lopez, Laura; Justa Roldan, Maria Luisa; Peña, Antonia; Lopez Trascasa, Margarita; Sánchez-Corral, Pilar; Rodríguez de Córdoba, Santiago

    2014-01-01

    Background and objectives Atypical hemolytic uremic syndrome is characterized by vascular endothelial damage caused by complement dysregulation. Consistently, complement inhibition therapies are highly effective in most patients with atypical hemolytic uremic syndrome. Recently, it was shown that a significant percentage of patients with early-onset atypical hemolytic uremic syndrome carry mutations in diacylglycerol kinase-ε, an intracellular protein with no obvious role in complement. These data support an alternative, complement-independent mechanism leading to thrombotic microangiopathy that has implications for treatment of early-onset atypical hemolytic uremic syndrome. To get additional insights into this new form of atypical hemolytic uremic syndrome, the diacylglycerol kinase-ε gene in a cohort with atypical hemolytic uremic syndrome was analyzed. Design, setting, participants, & measurements Eighty-three patients with early-onset atypical hemolytic uremic syndrome (<2 years) enrolled in the Spanish atypical hemolytic uremic syndrome registry between 1999 and 2013 were screened for mutations in diacylglycerol kinase-ε. These patients were also fully characterized for mutations in the genes encoding factor H, membrane cofactor protein, factor I, C3, factor B, and thrombomodulin CFHRs copy number variations and rearrangements, and antifactor H antibodies. Results Four patients carried mutations in diacylglycerol kinase-ε, one p.H536Qfs*16 homozygote and three compound heterozygotes (p.W322*/p.P498R, two patients; p.Q248H/p.G484Gfs*10, one patient). Three patients also carried heterozygous mutations in thrombomodulin or C3. Extensive plasma infusions controlled atypical hemolytic uremic syndrome recurrences and prevented renal failure in the two patients with diacylglycerol kinase-ε and thrombomodulin mutations. A positive response to plasma infusions and complement inhibition treatment was also observed in the patient with concurrent diacylglycerol

  14. Effect of complement and its regulation on myasthenia gravis pathogenesis

    PubMed Central

    Kusner, Linda L; Kaminski, Henry J; Soltys, Jindrich

    2015-01-01

    Myasthenia gravis (MG) is primarily caused by antibodies directed towards the skeletal muscle acetylcholine receptor, leading to muscle weakness. Although these antibodies may induce compromise of neuromuscular transmission by blocking acetylcholine receptor function or antigenic modulation, the predominant mechanism of injury to the neuromuscular junction is complement-mediated lysis of the postsynaptic membrane. The vast majority of data to support the role of complement derives from experimentally acquired MG (EAMG). In this article, we review studies that demonstrate the central role of complement in EAMG and MG pathogenesis along with the emerging role of complement in T- and B-cell function, as well as the potential for complement inhibitor-based therapy to treat human MG. PMID:20477586

  15. Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, S.S.

    1987-01-01

    In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

  16. XRN2 Links Transcription Termination to DNA Damage and Replication Stress

    PubMed Central

    Patidar, Praveen L.; Motea, Edward A.; Dang, Tuyen T.; Manley, James L.

    2016-01-01

    XRN2 is a 5’-3’ exoribonuclease implicated in transcription termination. Here we demonstrate an unexpected role for XRN2 in the DNA damage response involving resolution of R-loop structures and prevention of DNA double-strand breaks (DSBs). We show that XRN2 undergoes DNA damage-inducible nuclear re-localization, co-localizing with 53BP1 and R loops, in a transcription and R-loop-dependent process. XRN2 loss leads to increased R loops, genomic instability, replication stress, DSBs and hypersensitivity of cells to various DNA damaging agents. We demonstrate that the DSBs that arise with XRN2 loss occur at transcriptional pause sites. XRN2-deficient cells also exhibited an R-loop- and transcription-dependent delay in DSB repair after ionizing radiation, suggesting a novel role for XRN2 in R-loop resolution, suppression of replication stress, and maintenance of genomic stability. Our study highlights the importance of regulating transcription-related activities as a critical component in maintaining genetic stability. PMID:27437695

  17. XRN2 Links Transcription Termination to DNA Damage and Replication Stress.

    PubMed

    Morales, Julio C; Richard, Patricia; Patidar, Praveen L; Motea, Edward A; Dang, Tuyen T; Manley, James L; Boothman, David A

    2016-07-01

    XRN2 is a 5'-3' exoribonuclease implicated in transcription termination. Here we demonstrate an unexpected role for XRN2 in the DNA damage response involving resolution of R-loop structures and prevention of DNA double-strand breaks (DSBs). We show that XRN2 undergoes DNA damage-inducible nuclear re-localization, co-localizing with 53BP1 and R loops, in a transcription and R-loop-dependent process. XRN2 loss leads to increased R loops, genomic instability, replication stress, DSBs and hypersensitivity of cells to various DNA damaging agents. We demonstrate that the DSBs that arise with XRN2 loss occur at transcriptional pause sites. XRN2-deficient cells also exhibited an R-loop- and transcription-dependent delay in DSB repair after ionizing radiation, suggesting a novel role for XRN2 in R-loop resolution, suppression of replication stress, and maintenance of genomic stability. Our study highlights the importance of regulating transcription-related activities as a critical component in maintaining genetic stability.

  18. Human alpha2-macroglobulin is composed of multiple domains, as predicted by homology with complement component C3.

    PubMed

    Doan, Ninh; Gettins, Peter G W

    2007-10-01

    Human alpha2M (alpha2-macroglobulin) and the complement components C3 and C4 are thiol ester-containing proteins that evolved from the same ancestral gene. The recent structure determination of human C3 has allowed a detailed prediction of the location of domains within human alpha2M to be made. We describe here the expression and characterization of three alpha(2)M domains predicted to be involved in the stabilization of the thiol ester in native alpha2M and in its activation upon bait region proteolysis. The three newly expressed domains are MG2 (macroglobulin domain 2), TED (thiol ester-containing domain) and CUB (complement protein subcomponents C1r/C1s, urchin embryonic growth factor and bone morphogenetic protein 1) domain. Together with the previously characterized RBD (receptor-binding domain), they represent approx. 42% of the alpha2M polypeptide. Their expression as folded domains strongly supports the predicted domain organization of alpha2M. An X-ray crystal structure of MG2 shows it to have a fibronectin type-3 fold analogous to MG1-MG8 of C3. TED is, as predicted, an alpha-helical domain. CUB is a spliced domain composed of two stretches of polypeptide that flank TED in the primary structure. In intact C3 TED interacts with RBD, where it is in direct contact with the thiol ester, and with MG2 and CUB on opposite, flanking sides. In contrast, these alpha2M domains, as isolated species, show negligible interaction with one another, suggesting that the native conformation of alpha2M, and the consequent thiol ester-stabilizing domain-domain interactions, result from additional restraints imposed by the physical linkage of these domains or by additional domains in the protein.

  19. Human α2-macroglobulin is composed of multiple domains, as predicted by homology with complement component C3

    PubMed Central

    Doan, Ninh; Gettins, Peter G. W.

    2007-01-01

    Human α2M (α2-macroglobulin) and the complement components C3 and C4 are thiol ester-containing proteins that evolved from the same ancestral gene. The recent structure determination of human C3 has allowed a detailed prediction of the location of domains within human α2M to be made. We describe here the expression and characterization of three α2M domains predicted to be involved in the stabilization of the thiol ester in native α2M and in its activation upon bait region proteolysis. The three newly expressed domains are MG2 (macroglobulin domain 2), TED (thiol ester-containing domain) and CUB (complement protein subcomponents C1r/C1s, urchin embryonic growth factor and bone morphogenetic protein 1) domain. Together with the previously characterized RBD (receptor-binding domain), they represent approx. 42% of the α2M polypeptide. Their expression as folded domains strongly supports the predicted domain organization of α2M. An X-ray crystal structure of MG2 shows it to have a fibronectin type-3 fold analogous to MG1–MG8 of C3. TED is, as predicted, an α-helical domain. CUB is a spliced domain composed of two stretches of polypeptide that flank TED in the primary structure. In intact C3 TED interacts with RBD, where it is in direct contact with the thiol ester, and with MG2 and CUB on opposite, flanking sides. In contrast, these α2M domains, as isolated species, show negligible interaction with one another, suggesting that the native conformation of α2M, and the consequent thiol ester-stabilizing domain–domain interactions, result from additional restraints imposed by the physical linkage of these domains or by additional domains in the protein. PMID:17608619

  20. Investigations of the Binding of [Pt2(DTBPA)Cl2](II) and [Pt2(TPXA)Cl2](II) to DNA via Various Cross-Linking Modes

    PubMed Central

    Yue, Hongwei; Yang, Bo; Wang, Yan; Chen, Guangju

    2013-01-01

    We have constructed models for a series of platinum-DNA adducts that represent the binding of two agents, [Pt2(DTBPA)Cl2](II) and [Pt2(TPXA)Cl2](II), to DNA via inter- and intra-strand cross-linking, and carried out molecular dynamics simulations and DNA conformational dynamics calculations. The effects of trans- and cis-configurations of the centers of these di-nuclear platinum agents, and of different bridging linkers, have been investigated on the conformational distortions of platinum-DNA adducts formed via inter- and intra-strand cross-links. The results demonstrate that the DNA conformational distortions for the various platinum-DNA adducts with differing cross-linking modes are greatly influenced by the difference between the platinum-platinum distance for the platinum agent and the platinum-bound N7–N7 distance for the DNA molecule, and by the flexibility of the bridging linkers in the platinum agent. However, the effects of trans/cis-configurations of the platinum-centers on the DNA conformational distortions in the platinum-DNA adducts depend on the inter- and intra-strand cross-linking modes. In addition, we discuss the relevance of DNA base motions, including opening, shift and roll, to the changes in the parameters of the DNA major and minor grooves caused by binding of the platinum agent. PMID:24077126

  1. The Effect of Ionic Strength on the Haemolytic Activity of Complement

    PubMed Central

    Wardlaw, A. C.; Walker, H. G.

    1963-01-01

    The haemolytic activity of guinea-pig complement has been measured in isotonic solutions of various ionic strengths in the range 0.034–0.28 and shown to be maximum at an ionic strength close to 0.08. Haemolytic activity was virtually abolished at ionic strength 0.034, while at 0.28, the complement titre was only about 20 per cent of the value found at the physiological ionic strength 0.155. NaCl, KCl, LiBr and K2SO4 were the electrolytes used to provide ionic strength, and sucrose, mannitol and inositol the non-electrolytes used to maintain isotonicity. Nine permutations of the four electrolytes with the three non-electrolytes were tested and gave similar results. Human and rabbit complements also showed optimum haemolytic activity at ionic strength 0.08–0.10. PMID:13998876

  2. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

    PubMed

    Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

    2016-10-24

    DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Eye-Tracking and Corpus-Based Analyses of Syntax-Semantics Interactions in Complement Coercion

    PubMed Central

    Lowder, Matthew W.; Gordon, Peter C.

    2016-01-01

    Previous work has shown that the difficulty associated with processing complex semantic expressions is reduced when the critical constituents appear in separate clauses as opposed to when they appear together in the same clause. We investigated this effect further, focusing in particular on complement coercion, in which an event-selecting verb (e.g., began) combines with a complement that represents an entity (e.g., began the memo). Experiment 1 compared reading times for coercion versus control expressions when the critical verb and complement appeared together in a subject-extracted relative clause (SRC) (e.g., The secretary that began/wrote the memo) compared to when they appeared together in a simple sentence. Readers spent more time processing coercion expressions than control expressions, replicating the typical coercion cost. In addition, readers spent less time processing the verb and complement in SRCs than in simple sentences; however, the magnitude of the coercion cost did not depend on sentence structure. In contrast, Experiment 2 showed that the coercion cost was reduced when the complement appeared as the head of an object-extracted relative clause (ORC) (e.g., The memo that the secretary began/wrote) compared to when the constituents appeared together in an SRC. Consistent with the eye-tracking results of Experiment 2, a corpus analysis showed that expressions requiring complement coercion are more frequent when the constituents are separated by the clause boundary of an ORC compared to when they are embedded together within an SRC. The results provide important information about the types of structural configurations that contribute to reduced difficulty with complex semantic expressions, as well as how these processing patterns are reflected in naturally occurring language. PMID:28529960

  4. Plasticity of BRCA2 Function in Homologous Recombination: Genetic Interactions of the PALB2 and DNA Binding Domains

    PubMed Central

    Siaud, Nicolas; Lam, Isabel; Christ, Nicole; Schlacher, Katharina; Xia, Bing; Jasin, Maria

    2011-01-01

    The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR). Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations. PMID:22194698

  5. Auditory analysis of xeroderma pigmentosum 1971-2012: hearing function, sun sensitivity and DNA repair predict neurological degeneration.

    PubMed

    Totonchy, Mariam B; Tamura, Deborah; Pantell, Matthew S; Zalewski, Christopher; Bradford, Porcia T; Merchant, Saumil N; Nadol, Joseph; Khan, Sikandar G; Schiffmann, Raphael; Pierson, Tyler Mark; Wiggs, Edythe; Griffith, Andrew J; DiGiovanna, John J; Kraemer, Kenneth H; Brewer, Carmen C

    2013-01-01

    To assess the role of DNA repair in maintenance of hearing function and neurological integrity, we examined hearing status, neurological function, DNA repair complementation group and history of acute burning on minimal sun exposure in all patients with xeroderma pigmentosum, who had at least one complete audiogram, examined at the National Institutes of Health from 1971 to 2012. Seventy-nine patients, aged 1-61 years, were diagnosed with xeroderma pigmentosum (n = 77) or xeroderma pigmentosum/Cockayne syndrome (n = 2). A total of 178 audiograms were included. Clinically significant hearing loss (>20 dB) was present in 23 (29%) of 79 patients. Of the 17 patients with xeroderma pigmentosum-type neurological degeneration, 13 (76%) developed hearing loss, and all 17 were in complementation groups xeroderma pigmentosum type A or type D and reported acute burning on minimal sun exposure. Acute burning on minimal sun exposure without xeroderma pigmentosum-type neurological degeneration was present in 18% of the patients (10/55). Temporal bone histology in a patient with severe xeroderma pigmentosum-type neurological degeneration revealed marked atrophy of the cochlear sensory epithelium and neurons. The 19-year mean age of detection of clinically significant hearing loss in the patients with xeroderma pigmentosum with xeroderma pigmentosum-type neurological degeneration was 54 years younger than that predicted by international norms. The four frequency (0.5/1/2/4 kHz) pure-tone average correlated with degree of neurodegeneration (P < 0.001). In patients with xeroderma pigmentosum, aged 4-30 years, a four-frequency pure-tone average ≥10 dB hearing loss was associated with a 39-fold increased risk (P = 0.002) of having xeroderma pigmentosum-type neurological degeneration. Severity of hearing loss parallels neurological decline in patients with xeroderma pigmentosum-type neurological degeneration. Audiometric findings, complementation group, acute burning on minimal sun

  6. The Role of Frequency on the Acquisition of L2 English Infinitive and Gerund Complements by L1 Thai Learners

    ERIC Educational Resources Information Center

    Keawchaum, Raksina; Pongpairoj, Nattama

    2017-01-01

    This study investigated how frequency influenced acquisition of L2 English infinitive and gerund complements among L1 Thai learners. Participants were separated into low and high proficiency groups based on their CU-TEP scores. Each group consisted of 30 participants. Data were collected using the Word Selection Task (WST) and the Grammaticality…

  7. Modulation of post-stroke degenerative and regenerative processes and subacute protection by site-targeted inhibition of the alternative pathway of complement.

    PubMed

    Alawieh, Ali; Elvington, Andrew; Zhu, Hong; Yu, Jin; Kindy, Mark S; Atkinson, Carl; Tomlinson, Stephen

    2015-12-30

    Complement promotes neuroinflammation and injury in models of stroke. However, complement is also being increasingly implicated in repair and regeneration after central nervous system (CNS) injury, and some complement deficiencies have been shown to provide acute, but not subacute, protection after murine stroke. Here, we investigate the dual role of complement in injury and repair after cerebral ischemia and reperfusion. We used complement-deficient mice and different complement inhibitors in a model of transient middle cerebral artery occlusion to investigate complement-dependent cellular and molecular changes that occur through the subacute phase after stroke. C3 deficiency and site-targeted complement inhibition with either CR2-Crry (inhibits all pathways) or CR2-fH (inhibits alternative pathway) significantly reduced infarct size, reduced apoptotic cell death, and improved neurological deficit score in the acute phase after stroke. However, only in CR2-fH-treated mice was there sustained protection with no evolution of injury in the subacute phase. Whereas both inhibitors significantly reduced microglia/macrophage activation and astrogliosis in the subacute phase, only CR2-fH improved neurological deficit and locomotor function, maintained neurogenesis markers, enhanced neuronal migration, and increased VEGF expression. These findings in CR2-fH-treated mice correlated with improved performance in spatial learning and passive avoidance tasks. The complement anaphylatoxins have been implicated in repair and regenerative mechanisms after CNS injury, and in this context CR2-fH significantly reduced, but did not eliminate the generation of C5a within the brain, unlike CR2-Crry that completely blocked C5a generation. Gene expression profiling revealed that CR2-fH treatment downregulated genes associated with apoptosis, TGFβ signaling, and neutrophil activation, and decreased neutrophil infiltration was confirmed by immunohistochemistry. CR2-fH upregulated genes for

  8. Protective immune responses against West Nile virus are primed by distinct complement activation pathways.

    PubMed

    Mehlhop, Erin; Diamond, Michael S

    2006-05-15

    West Nile virus (WNV) causes a severe infection of the central nervous system in several vertebrate animals including humans. Prior studies have shown that complement plays a critical role in controlling WNV infection in complement (C) 3(-/-) and complement receptor 1/2(-/-) mice. Here, we dissect the contributions of the individual complement activation pathways to the protection from WNV disease. Genetic deficiencies in C1q, C4, factor B, or factor D all resulted in increased mortality in mice, suggesting that all activation pathways function together to limit WNV spread. In the absence of alternative pathway complement activation, WNV disseminated into the central nervous system at earlier times and was associated with reduced CD8+ T cell responses yet near normal anti-WNV antibody profiles. Animals lacking the classical and lectin pathways had deficits in both B and T cell responses to WNV. Finally, and somewhat surprisingly, C1q was required for productive infection in the spleen but not for development of adaptive immune responses after WNV infection. Our results suggest that individual pathways of complement activation control WNV infection by priming adaptive immune responses through distinct mechanisms.

  9. humpty dumpty is required for developmental DNA amplification and cell proliferation in Drosophila.

    PubMed

    Bandura, Jennifer L; Beall, Eileen L; Bell, Maren; Silver, Hannah R; Botchan, Michael R; Calvi, Brian R

    2005-04-26

    The full complement of proteins required for the proper regulation of genome duplication are yet to be described. We employ a genetic DNA-replication model system based on developmental amplification of Drosophila eggshell (chorion) genes [1]. Hypomorphic mutations in essential DNA replication genes result in a distinct thin-eggshell phenotype owing to reduced amplification [2]. Here, we molecularly identify the gene, which we have named humpty dumpty (hd), corresponding to the thin-eggshell mutant fs(3)272-9 [3]. We confirm that hd is essential for DNA amplification in the ovary and show that it also is required for cell proliferation during development. Mosaic analysis of hd mutant cells during development and RNAi in Kc cells reveal that depletion of Hd protein results in severe defects in genomic replication and DNA damage. Most Hd protein is found in nuclear foci, and some may traverse the nuclear envelope. Consistent with a role in DNA replication, expression of Hd protein peaks during late G1 and S phase, and it responds to the E2F1/Dp transcription factor. Hd protein sequence is conserved from plants to humans, and published microarrays indicate that expression of its putative human ortholog also peaks at G1/S [4]. Our data suggest that hd defines a new gene family likely required for cell proliferation in all multicellular eukaryotes.

  10. Phylogenetic and Complementation Analysis of a Single-Stranded DNA Binding Protein Family from Lactococcal Phages Indicates a Non-Bacterial Origin

    PubMed Central

    Mariadassou, Mahendra; Bardowski, Jacek K.; Bidnenko, Elena

    2011-01-01

    Background The single-stranded-nucleic acid binding (SSB) protein superfamily includes proteins encoded by different organisms from Bacteria and their phages to Eukaryotes. SSB proteins share common structural characteristics and have been suggested to descend from an ancestor polypeptide. However, as other proteins involved in DNA replication, bacterial SSB proteins are clearly different from those found in Archaea and Eukaryotes. It was proposed that the corresponding genes in the phage genomes were transferred from the bacterial hosts. Recently new SSB proteins encoded by the virulent lactococcal bacteriophages (Orf14bIL67-like proteins) have been identified and characterized structurally and biochemically. Methodology/Principal Findings This study focused on the determination of phylogenetic relationships between Orf14bIL67-like proteins and other SSBs. We have performed a large scale phylogenetic analysis and pairwise sequence comparisons of SSB proteins from different phyla. The results show that, in remarkable contrast to other phage SSBs, the Orf14bIL67–like proteins form a distinct, self-contained and well supported phylogenetic group connected to the archaeal SSBs. Functional studies demonstrated that, despite the structural and amino acid sequence differences from bacterial SSBs, Orf14bIL67 protein complements the conditional lethal ssb-1 mutation of Escherichia coli. Conclusions/Significance Here we identified for the first time a group of phages encoded SSBs which are clearly distinct from their bacterial counterparts. All methods supported the recognition of these phage proteins as a new family within the SSB superfamily. Our findings suggest that unlike other phages, the virulent lactococcal phages carry ssb genes that were not acquired from their hosts, but transferred from an archaeal genome. This represents a unique example of a horizontal gene transfer between Archaea and bacterial phages. PMID:22073223

  11. [DNA barcoding and its utility in commonly-used medicinal snakes].

    PubMed

    Huang, Yong; Zhang, Yue-yun; Zhao, Cheng-jian; Xu, Yong-li; Gu, Ying-le; Huang, Wen-qi; Lin, Kui; Li, Li

    2015-03-01

    Identification accuracy of traditional Chinese medicine is crucial for the traditional Chinese medicine research, production and application. DNA barcoding based on the mitochondrial gene coding for cytochrome c oxidase subunit I (COI), are more and more used for identification of traditional Chinese medicine. Using universal barcoding primers to sequence, we discussed the feasibility of DNA barcoding method for identification commonly-used medicinal snakes (a total of 109 samples belonging to 19 species 15 genera 6 families). The phylogenetic trees using Neighbor-joining were constructed. The results indicated that the mean content of G + C(46.5%) was lower than that of A + T (53.5%). As calculated by Kimera-2-parameter model, the mean intraspecies genetic distance of Trimeresurus albolabris, Ptyas dhumnades and Lycodon rufozonatus was greater than 2%. Further phylogenetic relationship results suggested that identification of one sample of T. albolabris was erroneous. The identification of some samples of P. dhumnades was also not correct, namely originally P. korros was identified as P. dhumnades. Factors influence on intraspecific genetic distance difference of L. rufozonatus need to be studied further. Therefore, DNA barcoding for identification of medicinal snakes is feasible, and greatly complements the morphological classification method. It is necessary to further study in identification of traditional Chinese medicine.

  12. FANCI-FANCD2 stabilizes the RAD51-DNA complex by binding RAD51 and protects the 5′-DNA end

    PubMed Central

    Sato, Koichi; Shimomuki, Mayo; Katsuki, Yoko; Takahashi, Daisuke; Kobayashi, Wataru; Ishiai, Masamichi; Miyoshi, Hiroyuki; Takata, Minoru; Kurumizaka, Hitoshi

    2016-01-01

    The FANCI-FANCD2 (I-D) complex is considered to work with RAD51 to protect the damaged DNA in the stalled replication fork. However, the means by which this DNA protection is accomplished have remained elusive. In the present study, we found that the I-D complex directly binds to RAD51, and stabilizes the RAD51-DNA filament. Unexpectedly, the DNA binding activity of FANCI, but not FANCD2, is explicitly required for the I-D complex-mediated RAD51-DNA filament stabilization. The RAD51 filament stabilized by the I-D complex actually protects the DNA end from nucleolytic degradation by an FA-associated nuclease, FAN1. This DNA end protection is not observed with the RAD51 mutant from FANCR patient cells. These results clearly answer the currently enigmatic question of how RAD51 functions with the I-D complex to prevent genomic instability at the stalled replication fork. PMID:27694619

  13. Identification of hot spots in the variola virus complement inhibitor (SPICE) for human complement regulation.

    PubMed

    Yadav, Viveka Nand; Pyaram, Kalyani; Mullick, Jayati; Sahu, Arvind

    2008-04-01

    Variola virus, the causative agent of smallpox, encodes a soluble complement regulator named SPICE. Previously, SPICE has been shown to be much more potent in inactivating human complement than the vaccinia virus complement control protein (VCP), although they differ only in 11 amino acid residues. In the present study, we have expressed SPICE, VCP, and mutants of VCP by substituting each or more of the 11 non-variant VCP residues with the corresponding residue of SPICE to identify hot spots that impart functional advantage to SPICE over VCP. Our data indicate that (i) SPICE is approximately 90-fold more potent than VCP in inactivating human C3b, and the residues Y98, Y103, K108 and K120 are predominantly responsible for its enhanced activity; (ii) SPICE is 5.4-fold more potent in inactivating human C4b, and residues Y98, Y103, K108, K120 and L193 mainly dictate this increase; (iii) the classical pathway decay-accelerating activity of activity is only twofold higher than that of VCP, and the 11 mutations in SPICE do not significantly affect this activity; (iv) SPICE possesses significantly greater binding ability to human C3b compared to VCP, although its binding to human C4b is lower than that of VCP; (v) residue N144 is largely responsible for the increased binding of SPICE to human C3b; and (vi) the human specificity of SPICE is dictated primarily by residues Y98, Y103, K108, and K120 since these are enough to formulate VCP as potent as SPICE. Together, these results suggest that principally 4 of the 11 residues that differ between SPICE and VCP partake in its enhanced function against human complement.

  14. Identification of Hot Spots in the Variola Virus Complement Inhibitor (SPICE) for Human Complement Regulation▿

    PubMed Central

    Yadav, Viveka Nand; Pyaram, Kalyani; Mullick, Jayati; Sahu, Arvind

    2008-01-01

    Variola virus, the causative agent of smallpox, encodes a soluble complement regulator named SPICE. Previously, SPICE has been shown to be much more potent in inactivating human complement than the vaccinia virus complement control protein (VCP), although they differ only in 11 amino acid residues. In the present study, we have expressed SPICE, VCP, and mutants of VCP by substituting each or more of the 11 non-variant VCP residues with the corresponding residue of SPICE to identify hot spots that impart functional advantage to SPICE over VCP. Our data indicate that (i) SPICE is ∼90-fold more potent than VCP in inactivating human C3b, and the residues Y98, Y103, K108 and K120 are predominantly responsible for its enhanced activity; (ii) SPICE is 5.4-fold more potent in inactivating human C4b, and residues Y98, Y103, K108, K120 and L193 mainly dictate this increase; (iii) the classical pathway decay-accelerating activity of activity is only twofold higher than that of VCP, and the 11 mutations in SPICE do not significantly affect this activity; (iv) SPICE possesses significantly greater binding ability to human C3b compared to VCP, although its binding to human C4b is lower than that of VCP; (v) residue N144 is largely responsible for the increased binding of SPICE to human C3b; and (vi) the human specificity of SPICE is dictated primarily by residues Y98, Y103, K108, and K120 since these are enough to formulate VCP as potent as SPICE. Together, these results suggest that principally 4 of the 11 residues that differ between SPICE and VCP partake in its enhanced function against human complement. PMID:18216095

  15. Complement factor H protects mice from ischemic acute kidney injury but is not critical for controlling complement activation by glomerular IgM.

    PubMed

    Goetz, Lindsey; Laskowski, Jennifer; Renner, Brandon; Pickering, Matthew C; Kulik, Liudmila; Klawitter, Jelena; Stites, Erik; Christians, Uwe; van der Vlag, Johan; Ravichandran, Kameswaran; Holers, V Michael; Thurman, Joshua M

    2018-05-01

    Natural IgM binds to glomerular epitopes in several progressive kidney diseases. Previous work has shown that IgM also binds within the glomerulus after ischemia/reperfusion (I/R) but does not fully activate the complement system. Factor H is a circulating complement regulatory protein, and congenital or acquired deficiency of factor H is a strong risk factor for several types of kidney disease. We hypothesized that factor H controls complement activation by IgM in the kidney after I/R, and that heterozygous factor H deficiency would permit IgM-mediated complement activation and injury at this location. We found that mice with targeted heterozygous deletion of the gene for factor H developed more severe kidney injury after I/R than wild-type controls, as expected, but that complement activation within the glomeruli remained well controlled. Furthermore, mice that are unable to generate soluble IgM were not protected from renal I/R, even in the setting of heterozygous factor H deficiency. These results demonstrate that factor H is important for limiting injury in the kidney after I/R, but it is not critical for controlling complement activation by immunoglobulin within the glomerulus in this setting. IgM binds to glomerular epitopes after I/R, but it is not a significant source of injury. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Novel roles of complement in renal diseases and their therapeutic consequences.

    PubMed

    Wada, Takehiko; Nangaku, Masaomi

    2013-09-01

    The complement system functions as a part of the innate immune system. Inappropriate activation of the complement pathways has a deleterious effect on kidneys. Recent advances in complement research have provided new insights into the pathogenesis of glomerular and tubulointerstitial injury associated with complement activation. A new disease entity termed 'C3 glomerulopathy' has recently been proposed and is characterized by isolated C3 deposition in glomeruli without positive staining for immunoglobulins. Genetic and functional studies have demonstrated that several different mutations and disease variants, as well as the generation of autoantibodies, are potentially associated with its pathogenesis. The data from comprehensive analyses suggest that complement dysregulation can also be associated with hemolytic uremic syndrome and more common glomerular diseases, such as IgA nephropathy and diabetic kidney disease. In addition, animal studies utilizing genetically modified mice have begun to elucidate the molecular pathomechanisms associated with the complement system. From a diagnostic point of view, a noninvasive, MRI-based method for detecting C3 has recently been developed to serve as a novel tool for diagnosing complement-mediated kidney diseases. While novel therapeutic tools related to complement regulation are emerging, studies evaluating the precise roles of the complement system in kidney diseases will still be useful for developing new therapeutic approaches.

  17. Evaluation of Acridine Orange Derivatives as DNA-Targeted Radiopharmaceuticals for Auger Therapy: Influence of the Radionuclide and Distance to DNA

    PubMed Central

    Pereira, Edgar; do Quental, Letícia; Palma, Elisa; Oliveira, Maria Cristina; Mendes, Filipa; Raposinho, Paula; Correia, Isabel; Lavrado, João; Di Maria, Salvatore; Belchior, Ana; Vaz, Pedro; Santos, Isabel; Paulo, António

    2017-01-01

    A new family of 99mTc(I)- tricarbonyl complexes and 125I-heteroaromatic compounds bearing an acridine orange (AO) DNA targeting unit was evaluated for Auger therapy. Characterization of the DNA interaction, performed with the non-radioactive Re and 127I congeners, confirmed that all compounds act as DNA intercalators. Both classes of compounds induce double strand breaks (DSB) in plasmid DNA but the extent of DNA damage is strongly dependent on the linker between the Auger emitter (99mTc or 125I) and the AO moiety. The in vitro evaluation was complemented with molecular docking studies and Monte Carlo simulations of the energy deposited at the nanometric scale, which corroborated the experimental data. Two of the tested compounds, 125I-C5 and 99mTc-C3, place the corresponding radionuclide at similar distances to DNA and produce comparable DSB yields in plasmid and cellular DNA. These results provide the first evidence that 99mTc can induce DNA damage with similar efficiency to that of 125I, when both are positioned at comparable distances to the double helix. Furthermore, the high nuclear retention of 99mTc-C3 in tumoral cells suggests that 99mTc-labelled AO derivatives are more promising for the design of Auger-emitting radiopharmaceuticals than the 125I-labelled congeners. PMID:28211920

  18. Induction of Cervical Neoplasia in the Mouse by Herpes Simplex Virus Type 2 DNA

    NASA Astrophysics Data System (ADS)

    Anthony, Donald D.; Budd Wentz, W.; Reagan, James W.; Heggie, Alfred D.

    1989-06-01

    Induction of cervical neoplasia in the mouse cervix by herpes simplex virus types 1 (HSV-1) and 2 (HSV-2) has been reported. The present study was done to determine if transfection with DNA of HSV-2 can induce carcinogenesis in this animal model. Genomic HSV-2 DNA was isolated from infected HEp-2 cells and separated from host cell DNA by cesium chloride density gradient centrifugation. The DNA was applied to mouse cervix for periods of 80-100 weeks. Experimental controls were treated with uninfected genomic HEp-2 cell DNA or with calf thymus DNA. Vaginal cytological preparations from all animals were examined monthly to detect epithelial abnormalities. Animals were sacrificed and histopathology studies were done when cellular changes indicative of premalignant or malignant lesions were seen on vaginal smears. Cytologic and histologic materials were coded and evaluated without knowledge of whether they were from animals treated with virus or control DNA. Premalignant and malignant cervical lesions similar to those that occur in women were detected in 61% of the histologic specimens obtained from animals exposed to HSV-2 DNA. The yield of invasive cancers was 21% in animals treated with HSV-2 DNA. No cancers were detected in mice treated with either HEp-2 or calf thymus DNA. Dysplasia was detected in only one of these control animals.

  19. The Complement C3a-C3aR Axis Promotes Development of Thoracic Aortic Dissection via Regulation of MMP2 Expression.

    PubMed

    Ren, Weihong; Liu, Yan; Wang, Xuerui; Piao, Chunmei; Ma, Youcai; Qiu, Shulan; Jia, Lixin; Chen, Boya; Wang, Yuan; Jiang, Wenjian; Zheng, Shuai; Liu, Chang; Dai, Nan; Lan, Feng; Zhang, Hongjia; Song, Wen-Chao; Du, Jie

    2018-03-01

    Thoracic aortic dissection (TAD), once ruptured, is devastating to patients, and no effective pharmaceutical therapy is available. Anaphylatoxins released by complement activation are involved in a variety of diseases. However, the role of the complement system in TAD is unknown. We found that plasma levels of C3a, C4a, and C5a were significantly increased in patients with TAD. Elevated circulating C3a levels were also detected in the developmental process of mouse TAD, which was induced by β-aminopropionitrile monofumarate (BAPN) treatment, with enhanced expression of C1q and properdin in mouse dissected aortas. These findings indicated activation of classical and alternative complement pathways. Further, expression of C3aR was obviously increased in smooth muscle cells of human and mouse dissected aortas, and knockout of C3aR notably inhibited BAPN-induced formation and rupture of TAD in mice. C3aR antagonist administered pre- and post-BAPN treatment attenuated the development of TAD. We found that C3aR knockout decreased matrix metalloproteinase 2 (MMP2) expression in BAPN-treated mice. Additionally, recombinant C3a stimulation enhanced MMP2 expression and activation in smooth muscle cells that were subjected to mechanical stretch. Finally, we generated MMP2-knockdown mice by in vivo MMP2 short hairpin RNA delivery using recombinant adeno-associated virus and found that MMP2 deficiency significantly reduced the formation of TAD. Therefore, our study suggests that the C3a - C3aR axis contributes to the development of TAD via regulation of MMP2 expression. Targeting the C3a-C3aR axis may represent a strategy for inhibiting the formation of TAD. Copyright © 2018 by The American Association of Immunologists, Inc.

  20. Activated complement components and complement activator molecules on the surface of cell‐derived microparticles in patients with rheumatoid arthritis and healthy individuals

    PubMed Central

    Biró, Éva; Nieuwland, Rienk; Tak, Paul P; Pronk, Loes M; Schaap, Marianne C L; Sturk, Augueste; Hack, C Erik

    2007-01-01

    Objectives In vitro, microparticles can activate complement via the classical pathway. If demonstrable ex vivo, this mechanism may contribute to the pathogenesis of rheumatoid arthritis (RA). We therefore investigated the presence of activated complement components and complement activator molecules on the surface of cell‐derived microparticles of RA patients and healthy individuals. Methods Microparticles from synovial fluid (n = 8) and plasma (n = 9) of 10 RA patients and plasma of sex‐ and age‐matched healthy individuals (n = 10) were analysed by flow cytometry for bound complement components (C1q, C4, C3) and complement activator molecules (C‐reactive protein (CRP), serum amyloid P component (SAP), immunoglobulin (Ig) M, IgG). Results Microparticles with bound C1q, C4, and/or C3 were abundant in RA synovial fluid, while in RA and control plasma much lower levels were present. Microparticles with bound C1q correlated with those with bound C3 in synovial fluid (r = 0.961, p = 0.0001), and with those with bound C4 in plasma (RA: r = 0.908, p = 0.0007; control: r = 0.632, p = 0.0498), indicating classical pathway activation. In synovial fluid, microparticles with IgM and IgG correlated with those with C1q (r = 0.728, p = 0.0408; r = 0.952, p = 0.0003, respectively), and in plasma, microparticles with CRP correlated with those with C1q (RA: r = 0.903, p = 0.0021; control: r = 0.683, p = 0.0296), implicating IgG and IgM in the classical pathway activation in RA synovial fluid, and CRP in the low level classical pathway activation in plasma. Conclusions This study demonstrates the presence of bound complement components and activator molecules on microparticles ex vivo, and supports their role in low grade complement activation in plasma and increased complement activation in RA synovial fluid. PMID:17261534

  1. Human Pol ζ purified with accessory subunits is active in translesion DNA synthesis and complements Pol η in cisplatin bypass

    PubMed Central

    Lee, Young-Sam; Gregory, Mark T.; Yang, Wei

    2014-01-01

    DNA polymerase ζ (Pol ζ) is a eukaryotic B-family DNA polymerase that specializes in translesion synthesis and is essential for normal embryogenesis. At a minimum, Pol ζ consists of a catalytic subunit Rev3 and an accessory subunit Rev7. Mammalian Rev3 contains >3,000 residues and is twice as large as the yeast homolog. To date, no vertebrate Pol ζ has been purified for biochemical characterization. Here we report purification of a series of human Rev3 deletion constructs expressed in HEK293 cells and identification of a minimally catalytically active human Pol ζ variant. With a tagged form of an active Pol ζ variant, we isolated two additional accessory subunits of human Pol ζ, PolD2 and PolD3. The purified four-subunit Pol ζ4 (Rev3–Rev7–PolD2–PolD3) is much more efficient and more processive at bypassing a 1,2-intrastrand d(GpG)-cisplatin cross-link than the two-subunit Pol ζ2 (Rev3–Rev7). We show that complete bypass of cisplatin lesions requires Pol η to insert dCTP opposite the 3′ guanine and Pol ζ4 to extend the primers. PMID:24449906

  2. Spontaneous Transport of Single-Stranded DNA through Graphene-MoS2 Heterostructure Nanopores.

    PubMed

    Luan, Binquan; Zhou, Ruhong

    2018-04-24

    The effective transport of a single-stranded DNA (ssDNA) molecule through a solid-state nanopore is essential to the future success of high-throughput and low-cost DNA sequencing. Compatible with current electric sensing technologies, here, we propose and demonstrate by molecular dynamics simulations the ssDNA transport through a quasi-two-dimensional nanopore in a heterostructure stacked together with different 2D materials, such as graphene and molybdenum disulfide (MoS 2 ). Due to different chemical potentials, U, of DNA bases on different 2D materials, it is energetically favorable for a ssDNA molecule to move from the low- U MoS 2 surface to the high- U graphene surface through a nanopore. With the proper attraction between the negatively charged phosphate group in each nucleotide and the positively charged Mo atoms exposed on the pore surface, the ssDNA molecule can be temporarily seized and released thereafter through a thermal activation, that is, a slow and possible nucleotide-by-nucleotide transport. A theoretical formulation is then developed for the free energy of the ssDNA transiting a heterostructure nanopore to properly characterize the non-equilibrium stick-slip-like motion of a ssDNA molecule.

  3. Constitutive role of the Fanconi anemia D2 gene in the replication stress response.

    PubMed

    Tian, Yanyan; Shen, Xi; Wang, Rui; Klages-Mundt, Naeh L; Lynn, Erica J; Martin, Sara K; Ye, Yin; Gao, Min; Chen, Junjie; Schlacher, Katharina; Li, Lei

    2017-12-08

    In response to DNA cross-linking damage, the Fanconi anemia (FA) core complex activates the FA pathway by monoubiquitinating Fanconi anemia complementation group D2 (FANCD2) for the initiation of the nucleolytic processing of the DNA cross-links and stabilization of stalled replication forks. Given that all the classic FA proteins coordinately monoubiquitinate FANCD2, it is unclear why losses of individual classic FA genes yield varying cellular sensitivities to cross-linking damage. To address this question, we generated cellular knock-out models of FA core complex components and FANCD2 and found that FANCD2-null mutants display higher levels of spontaneous chromosomal damage and hypersensitivity to replication-blocking lesions than Fanconi anemia complementation group L (FANCL)-null mutants, suggesting that FANCD2 provides a basal level of DNA protection countering endogenous lesions in the absence of monoubiquitination. FANCD2's ubiquitination-independent function is likely involved in optimized recruitment of nucleolytic activities for the processing and protection of stressed replication forks. Our results reveal that FANCD2 has a ubiquitination-independent role in countering endogenous levels of replication stress, a function that is critical for the maintenance of genomic stability. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Charge Transport in 2D DNA Tunnel Junction Diodes.

    PubMed

    Yoon, Minho; Min, Sung-Wook; Dugasani, Sreekantha Reddy; Lee, Yong Uk; Oh, Min Suk; Anthopoulos, Thomas D; Park, Sung Ha; Im, Seongil

    2017-12-01

    Recently, deoxyribonucleic acid (DNA) is studied for electronics due to its intrinsic benefits such as its natural plenitude, biodegradability, biofunctionality, and low-cost. However, its applications are limited to passive components because of inherent insulating properties. In this report, a metal-insulator-metal tunnel diode with Au/DNA/NiO x junctions is presented. Through the self-aligning process of DNA molecules, a 2D DNA nanosheet is synthesized and used as a tunneling barrier, and semitransparent conducting oxide (NiO x ) is applied as a top electrode for resolving metal penetration issues. This molecular device successfully operates as a nonresonant tunneling diode, and temperature-variable current-voltage analysis proves that Fowler-Nordheim tunneling is a dominant conduction mechanism at the junctions. DNA-based tunneling devices appear to be promising prototypes for nanoelectronics using biomolecules. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Complement-Related Regulates Autophagy in Neighboring Cells.

    PubMed

    Lin, Lin; Rodrigues, Frederico S L M; Kary, Christina; Contet, Alicia; Logan, Mary; Baxter, Richard H G; Wood, Will; Baehrecke, Eric H

    2017-06-29

    Autophagy degrades cytoplasmic components and is important for development and human health. Although autophagy is known to be influenced by systemic intercellular signals, the proteins that control autophagy are largely thought to function within individual cells. Here, we report that Drosophila macroglobulin complement-related (Mcr), a complement ortholog, plays an essential role during developmental cell death and inflammation by influencing autophagy in neighboring cells. This function of Mcr involves the immune receptor Draper, suggesting a relationship between autophagy and the control of inflammation. Interestingly, Mcr function in epithelial cells is required for macrophage autophagy and migration to epithelial wounds, a Draper-dependent process. This study reveals, unexpectedly, that complement-related from one cell regulates autophagy in neighboring cells via an ancient immune signaling program. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Complementing asteroseismology with 4MOST spectroscopy

    NASA Astrophysics Data System (ADS)

    de Jong, R. S.; 4MOST Consortium; 4MOST Spectroscopy Consortium

    2016-09-01

    4MOST is a wide-field, high-multiplex spectroscopic survey facility under development for the VISTA telescope of the European Southern Observatory (ESO). Its main science drivers are in the areas of galactic archeology, high-energy physics, galaxy evolution and cosmology. 4MOST will in particular provide the spectroscopic complements to the large area surveys coming from space missions like Gaia, eROSITA, Euclid, and PLATO. 4MOST will have an unique operations concept in which 5-years public surveys from both the consortium and the ESO community will be combined and observed in parallel during each exposure, resulting in more than 25 million spectra of targets spread over a large fraction of the southern sky. As a dedicated spectroscopic survey facility with a large field-of-view, a high multiplex that can be reconfigured quickly, and with a broad wavelength coverage, 4MOST is particularly well suited to complement the upcoming asteroseismology space missions like TESS and PLATO. Here we show that, by dedicating the observing time during twilight and poor observing conditions to bright stars, 4MOST will obtain resolution {R>18 000} spectra of nearly all stars brighter than ˜ 12th magnitude at Dec < 30o every ˜ 2 years. 4MOST is also expected to spectroscopically complement any fainter asteroseismology target to be observed with PLATO. These observations will provide a chemical characterization of nearly all stars to be observed with the TESS and PLATO missions and place any planets found in a full chemo-dynamical context of the star formation history of the Galaxy, yield very accurate ages and masses for all stars that can be characterized with asteroseismology, and allow removal of contaminants from target samples (e.g., spectroscopic binaries).

  7. Expression of an Atriplex nummularia gene encoding a protein homologous to the bacterial molecular chaperone DnaJ.

    PubMed Central

    Zhu, J K; Shi, J; Bressan, R A; Hasegawa, P M

    1993-01-01

    DnaJ is a 36-kD heat shock protein that functions together with Dnak (Hsp70) as a molecular chaperone in Escherichia coli. We have obtained a cDNA clone from the higher plant Atriplex nummularia that encodes a 46.6-kD polypeptide (ANJ1) with an overall 35.2% amino acid sequence identity with the E. coli DnaJ. ANJ1 has 43.4% overall sequence identity with the Saccharomyces cerevisiae cytoplasmic DnaJ homolog YDJ1/MAS5. Complementation of the yeast mas5 mutation indicated that ANJ1 is a functional homolog of YDJ1/MAS5. The presence of other DnaJ homologs in A. nummularia was demonstrated by the detection of proteins that are antigenically related to the yeast mitochondrial DnaJ homolog SCJ1 and the yeast DnaJ-related protein Sec63. Expression of the ANJ1 gene was compared with that of an A. nummularia Hsp70 gene. Expression of both ANJ1 and Hsp70 transcripts was coordinately induced by heat shock. However, noncoordinate accumulation of ANJ1 and Hsp70 mRNAs occurred during the cell growth cycle and in response to NaCl stress. PMID:8467224

  8. Expression of an Atriplex nummularia gene encoding a protein homologous to the bacterial molecular chaperone DnaJ.

    PubMed

    Zhu, J K; Shi, J; Bressan, R A; Hasegawa, P M

    1993-03-01

    DnaJ is a 36-kD heat shock protein that functions together with Dnak (Hsp70) as a molecular chaperone in Escherichia coli. We have obtained a cDNA clone from the higher plant Atriplex nummularia that encodes a 46.6-kD polypeptide (ANJ1) with an overall 35.2% amino acid sequence identity with the E. coli DnaJ. ANJ1 has 43.4% overall sequence identity with the Saccharomyces cerevisiae cytoplasmic DnaJ homolog YDJ1/MAS5. Complementation of the yeast mas5 mutation indicated that ANJ1 is a functional homolog of YDJ1/MAS5. The presence of other DnaJ homologs in A. nummularia was demonstrated by the detection of proteins that are antigenically related to the yeast mitochondrial DnaJ homolog SCJ1 and the yeast DnaJ-related protein Sec63. Expression of the ANJ1 gene was compared with that of an A. nummularia Hsp70 gene. Expression of both ANJ1 and Hsp70 transcripts was coordinately induced by heat shock. However, noncoordinate accumulation of ANJ1 and Hsp70 mRNAs occurred during the cell growth cycle and in response to NaCl stress.

  9. Complement activation and interleukin response in major abdominal surgery.

    PubMed

    Kvarnström, A L; Sarbinowski, R T; Bengtson, J-P; Jacobsson, L M; Bengtsson, A L

    2012-05-01

    The objective of this study was to evaluate whether major abdominal surgery leads to complement activation and interleukin response and whether the kind of anaesthesia influence complement activation and the release of inflammatory interleukins. The study design was prospective and randomised. Fifty patients undergoing open major colorectal surgery due to cancer disease or inflammatory bowel disease were studied. Twenty-five patients were given total intravenous anaesthesia (TIVA) with propofol and remifentanil, and 25 patients were given inhalational anaesthesia with sevoflurane and fentanyl. To determine complement activation (C3a and SC5b-9) and the release of pro- and anti-inflammatory interleukins (tumour necrosis factor-a (TNF-a)), interleukin-1b (IL-1b), IL-6, IL-8, IL-4 and IL-10), blood samples were drawn preoperatively, 60 minutes after start of surgery, 30 minutes after end of surgery and 24 hours postoperatively. Complement was activated and pro-inflammatory interleukins (IL-6 and IL-8) and anti-inflammatory interleukins (IL-10) were released during major colorectal surgery. There was no significant difference between TIVA and inhalational anaesthesia regarding complement activation and cytokine release. Major colorectal surgery leads to activation of the complement cascade and the release of both pro-inflammatory and anti-inflammatory cytokines. There are no significant differences between total intravenous anaesthesia (TIVA) with propofol and remifentanil and inhalational anaesthesia with sevoflurane and fentanyl regarding complement activation and the release of pro- and anti-inflammatory interleukins. © 2012 The Authors. Scandinavian Journal of Immunology © 2012 Blackwell Publishing Ltd. Scandinavian Journal of Immunology.

  10. A DNA enzyme with Mg(2+)-Dependent RNA Phosphoesterase Activity

    NASA Technical Reports Server (NTRS)

    Breaker, Ronald R.; Joyce, Gerald F.

    1995-01-01

    Previously we demonstrated that DNA can act as an enzyme in the Pb(2+)-dependent cleavage of an RNA phosphoester. This is a facile reaction, with an uncatalyzed rate for a typical RNA phosphoester of approx. 10(exp -4)/ min in the presence of 1 mM Pb(OAc)2 at pH 7.0 and 23 C. The Mg(2+) - dependent reaction is more difficult, with an uncatalyzed rate of approx. 10(exp -7)/ min under comparable conditions. Mg(2+) - dependent cleavage has special relevance to biology because it is compatible with intracellular conditions. Using in vitro selection, we sought to develop a family of phosphoester-cleaving DNA enzymes that operate in the presence of various divalent metals, focusing particularly on the Mg(2+) - dependent reaction. Results: We generated a population of greater than 10(exp 13) DNAs containing 40 random nucleotides and carried out repeated rounds of selective amplification, enriching for molecules that cleave a target RNA phosphoester in the presence of 1 mM Mg(2+), Mn(2+), Zn(2+) or Pb(2+). Examination of individual clones from the Mg(2+) lineage after the sixth round revealed a catalytic motif comprised of a three-stem junction.This motif was partially randomized and subjected to seven additional rounds of selective amplification, yielding catalysts with a rate of 0.01/ min. The optimized DNA catalyst was divided into separate substrate and enzyme domains and shown to have a similar level of activity under multiple turnover conditions. Conclusions: We have generated a Mg(2+) - dependent DNA enzyme that cleaves a target RNA phosphoester with a catalytic rate approx. 10(exp 5) - fold greater than that of the uncatalyzed reaction. This activity is compatible with intracellular conditions, raising the possibility that DNA enzymes might be made to operate in vivo.

  11. The Production of Complement Clauses in Children with Language Impairment

    ERIC Educational Resources Information Center

    Steel, Gillian; Rose, Miranda; Eadie, Patricia

    2016-01-01

    Purpose: The purpose of this research was to provide a comprehensive description of complement-clause production in children with language impairment. Complement clauses were examined with respect to types of complement structure produced, verb use, and both semantic and syntactic accuracy. Method: A group of 17 children with language impairment…

  12. Myasthenia gravis: the role of complement at the neuromuscular junction.

    PubMed

    Howard, James F

    2018-01-01

    Generalized myasthenia gravis (gMG) is a rare autoimmune disorder characterized by skeletal muscle weakness caused by disrupted neurotransmission at the neuromuscular junction (NMJ). Approximately 74-88% of patients with gMG have acetylcholine receptor (AChR) autoantibodies. Complement plays an important role in innate and antibody-mediated immunity, and activation and amplification of complement results in the formation of membrane attack complexes (MACs), lipophilic proteins that damage cell membranes. The role of complement in gMG has been demonstrated in animal models and patients. Studies in animals lacking specific complement proteins have confirmed that MAC formation is required to induce experimental autoimmune MG (EAMG) and NMJ damage. Complement inhibition in EAMG models can prevent disease induction and reverse its progression. Patients with anti-AChR + MG have autoantibodies and MACs present at NMJs. Damaged NMJs are associated with more severe disease, fewer AChRs, and MACs in synaptic debris. Current MG therapies do not target complement directly. Eculizumab is a humanized monoclonal antibody that inhibits cleavage of complement protein C5, preventing MAC formation. Eculizumab treatment improved symptoms compared with placebo in a phase II study in patients with refractory gMG. Direct complement inhibition could preserve NMJ physiology and muscle function in patients with anti-AChR + gMG. © 2017 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals Inc. on behalf of The New York Academy of Sciences.

  13. Generalized look-ahead number conversion from signed digit to complement representation with optical logic operations

    NASA Astrophysics Data System (ADS)

    Qian, Feng; Li, Guoqiang

    2001-12-01

    In this paper a generalized look-ahead logic algorithm for number conversion from signed-digit to its complement representation is developed. By properly encoding the signed digits, all the operations are performed by binary logic, and unified logical expressions can be obtained for conversion from modified-signed-digit (MSD) to 2's complement, trinary signed-digit (TSD) to 3's complement, and quaternary signed-digit (QSD) to 4's complement. For optical implementation, a parallel logical array module using electron-trapping device is employed, which is suitable for realizing complex logic functions in the form of sum-of-product. The proposed algorithm and architecture are compatible with a general-purpose optoelectronic computing system.

  14. A local complement response by RPE causes early-stage macular degeneration

    PubMed Central

    Fernandez-Godino, Rosario; Garland, Donita L.; Pierce, Eric A.

    2015-01-01

    Inherited and age-related macular degenerations (AMDs) are important causes of vision loss. An early hallmark of these disorders is the formation of sub-retinal pigment epithelium (RPE) basal deposits. A role for the complement system in MDs was suggested by genetic association studies, but direct functional connections between alterations in the complement system and the pathogenesis of MD remain to be defined. We used primary RPE cells from a mouse model of inherited MD due to a p.R345W mutation in EGF-containing fibulin-like extracellular matrix protein 1 (EFEMP1) to investigate the role of the RPE in early MD pathogenesis. Efemp1R345W RPE cells recapitulate the basal deposit formation observed in vivo by producing sub-RPE deposits in vitro. The deposits share features with basal deposits, and their formation was mediated by EFEMP1R345W or complement component 3a (C3a), but not by complement component 5a (C5a). Increased activation of complement appears to occur in response to an abnormal extracellular matrix (ECM), generated by the mutant EFEMP1R345W protein and reduced ECM turnover due to inhibition of matrix metalloproteinase 2 by EFEMP1R345W and C3a. Increased production of C3a also stimulated the release of cytokines such as interleukin (IL)-6 and IL-1B, which appear to have a role in deposit formation, albeit downstream of C3a. These studies provide the first direct indication that complement components produced locally by the RPE are involved in the formation of basal deposits. Furthermore, these results suggest that C3a generated by RPE is a potential therapeutic target for the treatment of EFEMP1-associated MD as well as AMD. PMID:26199322

  15. Systemic Lupus Erythematosus and Deficiencies of Early Components of the Complement Classical Pathway

    PubMed Central

    Macedo, Ana Catarina Lunz; Isaac, Lourdes

    2016-01-01

    The complement system plays an important role in the innate and acquired immune response against pathogens. It consists of more than 30 proteins found in soluble form or attached to cell membranes. Most complement proteins circulate in inactive forms and can be sequentially activated by the classical, alternative, or lectin pathways. Biological functions, such as opsonization, removal of apoptotic cells, adjuvant function, activation of B lymphocytes, degranulation of mast cells and basophils, and solubilization and clearance of immune complex and cell lysis, are dependent on complement activation. Although the activation of the complement system is important to avoid infections, it also can contribute to the inflammatory response triggered by immune complex deposition in tissues in autoimmune diseases. Paradoxically, the deficiency of early complement proteins from the classical pathway (CP) is strongly associated with development of systemic lupus erythematous (SLE) – mainly C1q deficiency (93%) and C4 deficiency (75%). The aim of this review is to focus on the deficiencies of early components of the CP (C1q, C1r, C1s, C4, and C2) proteins in SLE patients. PMID:26941740

  16. Evolution and diversity of the complement system of poikilothermic vertebrates.

    PubMed

    Sunyer, J O; Lambris, J D

    1998-12-01

    In mammals the complement system plays an important role in innate and acquired host defense mechanisms against infection and in various immunoregulatory processes. The complement system is an ancient defense mechanism that is already present in the invertebrate deuterostomes. In these species as well as in agnathans (the most primitive vertebrate species), both the alternative and lectin pathway of complement activation are already present, and the complement system appears to be involved mainly in opsonization of foreign material. With the emergence of immunoglobulins in cartilaginous fish, the classical and lytic pathways first appear. The rest of the poikilothermic species, from teleosts to reptilians, appear to contain a well-developed complement system resembling that of homeothermic vertebrates. However, important differences remain. Unlike homeotherms, several species of poikilotherms have recently been shown to possess multiple forms of complement components (C3 and factor B) that are structurally and functionally more diverse than those of higher vertebrates. It is noteworthy that the multiple forms of C3 that have been characterized in several teleost fish are able to bind with varying efficiencies to various complement-activating surfaces. We hypothesize that this diversity has allowed these animals to expand their innate capacity for immune recognition.

  17. Complement and the control of HIV infection: an evolving story.

    PubMed

    Frank, Michael M; Hester, Christopher; Jiang, Haixiang

    2014-05-01

    Thirty years ago, investigators isolated and later determined the structure of HIV-1 and its envelope proteins. Using techniques that were effective with other viruses, they prepared vaccines designed to generate antibody or T-cell responses, but they were ineffective in clinical trials. In this article, we consider the role of complement in host defense against enveloped viruses, the role it might play in the antibody response and why complement has not controlled HIV-1 infection. Complement consists of a large group of cell-bound and plasma proteins that are an integral part of the innate immune system. They provide a first line of defense against microbes and also play a role in the immune response. Here we review the studies of complement-mediated HIV destruction and the role of complement in the HIV antibody response. HIV-1 has evolved a complex defense to prevent complement-mediated killing reviewed here. As part of these studies, we have discovered that HIV-1 envelope, on administration into animals, is rapidly broken down into small peptides that may prove to be very inefficient at provident the type of antigenic stimulation that leads to an effective immune response. Improving complement binding and stabilizing envelope may improve the vaccine response.

  18. More than just immune evasion: Hijacking complement by Plasmodium falciparum.

    PubMed

    Schmidt, Christoph Q; Kennedy, Alexander T; Tham, Wai-Hong

    2015-09-01

    Malaria remains one of the world's deadliest diseases. Plasmodium falciparum is responsible for the most severe and lethal form of human malaria. P. falciparum's life cycle involves two obligate hosts: human and mosquito. From initial entry into these hosts, malaria parasites face the onslaught of the first line of host defence, the complement system. In this review, we discuss the complex interaction between complement and malaria infection in terms of hosts immune responses, parasite survival and pathogenesis of severe forms of malaria. We will focus on the role of complement receptor 1 and its associated polymorphisms in malaria immune complex clearance, as a mediator of parasite rosetting and as an entry receptor for P. falciparum invasion. Complement evasion strategies of P. falciparum parasites will also be highlighted. The sexual forms of the malaria parasites recruit the soluble human complement regulator Factor H to evade complement-mediated killing within the mosquito host. A novel evasion strategy is the deployment of parasite organelles to divert complement attack from infective blood stage parasites. Finally we outline the future challenge to understand the implications of these exploitation mechanisms in the interplay between successful infection of the host and pathogenesis observed in severe malaria. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Neurodegeneration as the presenting symptom in 2 adults with xeroderma pigmentosum complementation group F

    PubMed Central

    Shanbhag, Niraj M.; Geschwind, Michael D.; DiGiovanna, John J.; Groden, Catherine; Godfrey, Rena; Yousefzadeh, Matthew J.; Wade, Erin A.; Niedernhofer, Laura J.; Malicdan, May Christine V.; Kraemer, Kenneth H.; Gahl, William A.

    2018-01-01

    Objective To describe the features of 2 unrelated adults with xeroderma pigmentosum complementation group F (XP-F) ascertained in a neurology care setting. Methods We report the clinical, imaging, molecular, and nucleotide excision repair (NER) capacity of 2 middle-aged women with progressive neurodegeneration ultimately diagnosed with XP-F. Results Both patients presented with adult-onset progressive neurologic deterioration involving chorea, ataxia, hearing loss, cognitive deficits, profound brain atrophy, and a history of skin photosensitivity, skin freckling, and/or skin neoplasms. We identified compound heterozygous pathogenic mutations in ERCC4 and confirmed deficient NER capacity in skin fibroblasts from both patients. Conclusions These cases illustrate the role of NER dysfunction in neurodegeneration and how adult-onset neurodegeneration could be the major symptom bringing XP-F patients to clinical attention. XP-F should be considered by neurologists in the differential diagnosis of patients with adult-onset progressive neurodegeneration accompanied by global brain atrophy and a history of heightened sun sensitivity, excessive freckling, and skin malignancies. PMID:29892709

  20. Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.

    PubMed

    Ataci, Nese; Ozcelik, Elif; Arsu, Nergis

    2018-06-02

    Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3  L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3  L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. The role of RNase H2 in processing ribonucleotides incorporated during DNA replication.

    PubMed

    Williams, Jessica S; Gehle, Daniel B; Kunkel, Thomas A

    2017-05-01

    Saccharomyces cerevisiae RNase H2 resolves RNA-DNA hybrids formed during transcription and it incises DNA at single ribonucleotides incorporated during nuclear DNA replication. To distinguish between the roles of these two activities in maintenance of genome stability, here we investigate the phenotypes of a mutant of yeast RNase H2 (rnh201-RED; ribonucleotide excision defective) that retains activity on RNA-DNA hybrids but is unable to cleave single ribonucleotides that are stably incorporated into the genome. The rnh201-RED mutant was expressed in wild type yeast or in a strain that also encodes a mutant allele of DNA polymerase ε (pol2-M644G) that enhances ribonucleotide incorporation during DNA replication. Similar to a strain that completely lacks RNase H2 (rnh201Δ), the pol2-M644G rnh201-RED strain exhibits replication stress and checkpoint activation. Moreover, like its null mutant counterpart, the double mutant pol2-M644G rnh201-RED strain and the single mutant rnh201-RED strain delete 2-5 base pairs in repetitive sequences at a high rate that is topoisomerase 1-dependent. The results highlight an important role for RNase H2 in maintaining genome integrity by removing single ribonucleotides incorporated during DNA replication. Published by Elsevier B.V.

  2. Increased levels of the acetaldehyde-derived DNA adduct N 2-ethyldeoxyguanosine in oral mucosa DNA from Rhesus monkeys exposed to alcohol

    PubMed Central

    Balbo, Silvia; Juanes, Rita Cervera; Khariwala, Samir; Baker, Erich J.; Daunais, James B.; Grant, Kathleen A.

    2016-01-01

    Alcohol is a human carcinogen. A causal link has been established between alcohol drinking and cancers of the upper aerodigestive tract, colon, liver and breast. Despite this established association, the underlying mechanisms of alcohol-induced carcinogenesis remain unclear. Various mechanisms may come into play depending on the type of cancer; however, convincing evidence supports the concept that ethanol’s major metabolite acetaldehyde may play a major role. Acetaldehyde can react with DNA forming adducts which can serve as biomarkers of carcinogen exposure and potentially of cancer risk. The major DNA adduct formed from this reaction is N 2-ethylidenedeoxyguanosine, which can be quantified as its reduced form N 2-ethyl-dG by LC-ESI-MS/MS. To investigate the potential use of N 2-ethyl-dG as a biomarker of alcohol-induced DNA damage, we quantified this adduct in DNA from the oral, oesophageal and mammary gland tissues from rhesus monkeys exposed to alcohol drinking over their lifetimes and compared it to controls. N 2-Ethyl-dG levels were significantly higher in the oral mucosa DNA of the exposed animals. Levels of the DNA adduct measured in the oesophageal mucosa of exposed animals were not significantly different from controls. A correlation between the levels measured in the oral and oesophageal DNA, however, was observed, suggesting a common source of formation of the DNA adducts. N 2-Ethyl-dG was measured in mammary gland DNA from a small cohort of female animals, but no difference was observed between exposed animals and controls. These results support the hypothesis that acetaldehyde induces DNA damage in the oral mucosa of alcohol-exposed animals and that it may play role in the alcohol-induced carcinogenic process. The decrease of N 2-ethyl-dG levels in exposed tissues further removed from the mouth also suggests a role of alcohol metabolism in the oral cavity, which may be considered separately from ethanol liver metabolism in the investigation of

  3. Children's understanding of the addition/subtraction complement principle.

    PubMed

    Torbeyns, Joke; Peters, Greet; De Smedt, Bert; Ghesquière, Pol; Verschaffel, Lieven

    2016-09-01

    In the last decades, children's understanding of mathematical principles has become an important research topic. Different from the commutativity and inversion principles, only few studies have focused on children's understanding of the addition/subtraction complement principle (if a - b = c, then c + b = a), mainly relying on verbal techniques. This contribution aimed at deepening our understanding of children's knowledge of the addition/subtraction complement principle, combining verbal and non-verbal techniques. Participants were 67 third and fourth graders (9- to 10-year-olds). Children solved two tasks in which verbal reports as well as accuracy and speed data were collected. These two tasks differed only in the order of the problems and the instructions. In the looking-back task, children were told that sometimes the preceding problem might help to answer the next problem. In the baseline task, no helpful preceding items were offered. The looking-back task included 10 trigger-target problem pairs on the complement relation. Children verbally reported looking back on about 40% of all target problems in the looking-back task; the target problems were also solved faster and more accurately than in the baseline task. These results suggest that children used their understanding of the complement principle. The verbal and non-verbal data were highly correlated. This study complements previous work on children's understanding of mathematical principles by highlighting interindividual differences in 9- to 10-year-olds' understanding of the complement principle and indicating the potential of combining verbal and non-verbal techniques to investigate (the acquisition of) this understanding. © 2016 The British Psychological Society.

  4. Temperature-sensitive Mutants of Sindbis Virus: Biochemical Correlates of Complementation

    PubMed Central

    Burge, Boyce W.; Pfefferkorn, E. R.

    1967-01-01

    Temperature-sensitive mutants of Sindbis virus fail to grow at a temperature that permits growth of the wild type, but when certain pairs of these mutants, mixed together, infect cells at that temperature, viral growth (i.e., complementation) occurs. The yield from this complementation, however, is of the same order of magnitude as the infectivity in the inoculum. Since in animal virus infections the protein components of the virion probably enter the cell with the viral nucleic acid, it was necessary to demonstrate that the observed complementation required synthesis of new viral protein and nucleic acid rather than some sort of rearrangement of the structural components of the inoculum. To demonstrate that complementation does require new biosynthesis, three biochemical events of normal virus growth have been observed during complementation and correlated with the efficiency of viral growth seen in complementation. These events include: (i) entrance of parental viral ribonucleic acid (RNA) into a double-stranded form; (ii) subsequent synthesis of viral RNA; and (iii) synthesis and subsequent incorporation of viral protein(s) into cell membranes where they were detected by hemadsorption. Although the infecting single-stranded RNA genome of the wild type was converted to a ribonuclease-resistant form, the genome of a mutant (ts-11) incapable of RNA synthesis at a nonpermissive temperature was not so converted. However, during complementation with another mutant also defective in viral RNA synthesis, some of the RNA of mutant ts-11 was converted to a ribonuclease-resistant form, and total synthesis of virus-specific RNA was markedly enhanced. The virus-specific alteration of the cell surface, detected by hemadsorption, was also extensively increased during complementation. These observations support the view that complementation between temperature-sensitive mutants and replication of wild-type virus are similar processes. PMID:5630228

  5. Complement factor H in host defense and immune evasion.

    PubMed

    Parente, Raffaella; Clark, Simon J; Inforzato, Antonio; Day, Anthony J

    2017-05-01

    Complement is the major humoral component of the innate immune system. It recognizes pathogen- and damage-associated molecular patterns, and initiates the immune response in coordination with innate and adaptive immunity. When activated, the complement system unleashes powerful cytotoxic and inflammatory mechanisms, and thus its tight control is crucial to prevent damage to host tissues and allow restoration of immune homeostasis. Factor H is the major soluble inhibitor of complement, where its binding to self markers (i.e., particular glycan structures) prevents complement activation and amplification on host surfaces. Not surprisingly, mutations and polymorphisms that affect recognition of self by factor H are associated with diseases of complement dysregulation, such as age-related macular degeneration and atypical haemolytic uremic syndrome. In addition, pathogens (i.e., non-self) and cancer cells (i.e., altered-self) can hijack factor H to evade the immune response. Here we review recent (and not so recent) literature on the structure and function of factor H, including the emerging roles of this protein in the pathophysiology of infectious diseases and cancer.

  6. Auditory analysis of xeroderma pigmentosum 1971–2012: hearing function, sun sensitivity and DNA repair predict neurological degeneration

    PubMed Central

    Totonchy, Mariam B.; Tamura, Deborah; Pantell, Matthew S.; Zalewski, Christopher; Bradford, Porcia T.; Merchant, Saumil N.; Nadol, Joseph; Khan, Sikandar G.; Schiffmann, Raphael; Pierson, Tyler Mark; Wiggs, Edythe; Griffith, Andrew J.; DiGiovanna, John J.; Brewer, Carmen C.

    2013-01-01

    To assess the role of DNA repair in maintenance of hearing function and neurological integrity, we examined hearing status, neurological function, DNA repair complementation group and history of acute burning on minimal sun exposure in all patients with xeroderma pigmentosum, who had at least one complete audiogram, examined at the National Institutes of Health from 1971 to 2012. Seventy-nine patients, aged 1–61 years, were diagnosed with xeroderma pigmentosum (n = 77) or xeroderma pigmentosum/Cockayne syndrome (n = 2). A total of 178 audiograms were included. Clinically significant hearing loss (>20 dB) was present in 23 (29%) of 79 patients. Of the 17 patients with xeroderma pigmentosum-type neurological degeneration, 13 (76%) developed hearing loss, and all 17 were in complementation groups xeroderma pigmentosum type A or type D and reported acute burning on minimal sun exposure. Acute burning on minimal sun exposure without xeroderma pigmentosum-type neurological degeneration was present in 18% of the patients (10/55). Temporal bone histology in a patient with severe xeroderma pigmentosum-type neurological degeneration revealed marked atrophy of the cochlear sensory epithelium and neurons. The 19-year mean age of detection of clinically significant hearing loss in the patients with xeroderma pigmentosum with xeroderma pigmentosum-type neurological degeneration was 54 years younger than that predicted by international norms. The four frequency (0.5/1/2/4 kHz) pure-tone average correlated with degree of neurodegeneration (P < 0.001). In patients with xeroderma pigmentosum, aged 4–30 years, a four-frequency pure-tone average ≥10 dB hearing loss was associated with a 39-fold increased risk (P = 0.002) of having xeroderma pigmentosum-type neurological degeneration. Severity of hearing loss parallels neurological decline in patients with xeroderma pigmentosum-type neurological degeneration. Audiometric findings, complementation group, acute burning on minimal

  7. Quiescent complement in nonhuman primates during E coli Shiga toxin-induced hemolytic uremic syndrome and thrombotic microangiopathy.

    PubMed

    Lee, Benjamin C; Mayer, Chad L; Leibowitz, Caitlin S; Stearns-Kurosawa, D J; Kurosawa, Shinichiro

    2013-08-01

    Enterohemorrhagic Escherichia coli (EHEC) produce ribosome-inactivating Shiga toxins (Stx1, Stx2) responsible for development of hemolytic uremic syndrome (HUS) and acute kidney injury (AKI). Some patients show complement activation during EHEC infection, raising the possibility of therapeutic targeting of complement for relief. Our juvenile nonhuman primate (Papio baboons) models of endotoxin-free Stx challenge exhibit full spectrum HUS, including thrombocytopenia, hemolytic anemia, and AKI with glomerular thrombotic microangiopathy. There were no significant increases in soluble terminal complement complex (C5b-9) levels after challenge with lethal Stx1 (n = 6) or Stx2 (n = 5) in plasma samples from T0 to euthanasia at 49.5 to 128 hours post-challenge. d-dimer and cell injury markers (HMGB1, histones) confirmed coagulopathy and cell injury. Thus, complement activation is not required for the development of thrombotic microangiopathy and HUS induced by EHEC Shiga toxins in these preclinical models, and benefits or risks of complement inhibition should be studied further for this infection.

  8. Validation of a multi-analyte panel with cell-bound complement activation products for systemic lupus erythematosus.

    PubMed

    Dervieux, Thierry; Conklin, John; Ligayon, Jo-Anne; Wolover, Leilani; O'Malley, Tyler; Alexander, Roberta Vezza; Weinstein, Arthur; Ibarra, Claudia A

    2017-07-01

    We describe the analytical validation of an assay panel intended to assist clinicians with the diagnosis of systemic lupus erythematosus (SLE). The multi-analyte panel includes quantitative assessment of complement activation and measurement of autoantibodies. The levels of the complement split product C4d bound to erythrocytes (EC4d) and B-lymphocytes (BC4d) (expressed as mean fluorescence intensity [MFI]) are measured by quantitative flow cytometry, while autoantibodies (inclusive of antinuclear and anti-double stranded DNA antibodies) are determined by immunoassays. Results of the multi-analyte panel are reported as positive or negative based on a 2-tiered index score. Post-phlebotomy stability of EC4d and BC4d in EDTA-anticoagulated blood is determined using specimens collected from patients with SLE and normal donors. Three-level C4 coated positive beads are run daily as controls. Analytical validity is reported using intra-day and inter-day coefficient of variation (CV). EC4d and BC4d are stable for 2days at ambient temperature and for 4days at 4°C post-phlebotomy. Median intra-day and inter-day CV range from 2.9% to 7.8% (n=30) and 7.3% to 12.4% (n=66), respectively. The 2-tiered index score is reproducible over 4 consecutive daysupon storage of blood at 4°C. A total of 2,888 three-level quality control data were collected from 6 flow cytometers with an overall failure rate below 3%. Median EC4d level is 6 net MFI (Interquartile [IQ] range 4-9 net MFI) and median BC4d is 18 net MFI (IQ range 13-27 net MFI) among 86,852 specimens submitted for testing. The incidence of 2-tiered positive test results is 13.4%. We have established the analytical validity of a multi-analyte assay panel for SLE. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. The Human Ligase IIIα-XRCC1 Protein Complex Performs DNA Nick Repair after Transient Unwrapping of Nucleosomal DNA*

    PubMed Central

    Rashid, Ishtiaque; Tomkinson, Alan E.; Pederson, David S.

    2017-01-01

    Reactive oxygen species generate potentially cytotoxic and mutagenic lesions in DNA, both between and within the nucleosomes that package DNA in chromatin. The vast majority of these lesions are subject to base excision repair (BER). Enzymes that catalyze the first three steps in BER can act at many sites in nucleosomes without the aid of chromatin-remodeling agents and without irreversibly disrupting the host nucleosome. Here we show that the same is true for a protein complex comprising DNA ligase IIIα and the scaffolding protein X-ray repair cross-complementing protein 1 (XRCC1), which completes the fourth and final step in (short-patch) BER. Using in vitro assembled nucleosomes containing discretely positioned DNA nicks, our evidence indicates that the ligase IIIα-XRCC1 complex binds to DNA nicks in nucleosomes only when they are exposed by periodic, spontaneous partial unwrapping of DNA from the histone octamer; that the scaffolding protein XRCC1 enhances the ligation; that the ligation occurs within a complex that ligase IIIα-XRCC1 forms with the host nucleosome; and that the ligase IIIα-XRCC1-nucleosome complex decays when ligation is complete, allowing the host nucleosome to return to its native configuration. Taken together, our results illustrate ways in which dynamic properties intrinsic to nucleosomes may contribute to the discovery and efficient repair of base damage in chromatin. PMID:28184006

  10. Lead inhibition of DNA-binding mechanism of Cys(2)His(2) zinc finger proteins.

    PubMed

    Hanas, J S; Rodgers, J S; Bantle, J A; Cheng, Y G

    1999-11-01

    The association of lead with chromatin in cells suggests that deleterious metal effects may in part be mediated through alterations in gene function. To elucidate if and how lead may alter DNA binding of cysteine-rich zinc finger proteins, lead ions were analyzed for their ability to alter the DNA binding mechanism of the Cys(2)His(2) zinc finger protein transcription factor IIIA (TFIIIA). As assayed by DNase I protection, the interaction of TFIIIA with the 50-bp internal control region of the 5S ribosomal gene was partially inhibited by 5 microM lead ions and completely inhibited by 10 to 20 microM lead ions. Preincubation of free TFIIIA with lead resulted in DNA-binding inhibition, whereas preincubation of a TFIIIA/5S RNA complex with lead did not result in DNA-binding inhibition. Because 5S RNA binds TFIIIA zinc fingers, this result is consistent with an inhibition mechanism via lead binding to zinc fingers. The complete loss of DNase I protection on the 5S gene indicates the mechanism of inhibition minimally involves the N-terminal fingers of TFIIIA. Inhibition was not readily reversible and occurred in the presence of an excess of beta-mercaptoethanol. Inhibition kinetics were fast, progressing to completion in approximately 5 min. Millimolar concentrations of sulfhydryl-specific arsenic ions were not inhibitory for TFIIIA binding. Micromolar concentrations of lead inhibited DNA binding by Sp1, another Cys(2)His(2) finger protein, but not by the nonfinger protein AP2. Inhibition of Cys(2)His(2) zinc finger transcription factors by lead ions at concentrations near those known to have deleterious physiological effects points to new molecular mechanisms for lead toxicity in promoting disease.

  11. Structure of the E2 DNA-binding domain from human papillomavirus serotype 31 at 2.4 A.

    PubMed

    Bussiere, D E; Kong, X; Egan, D A; Walter, K; Holzman, T F; Lindh, F; Robins, T; Giranda, V L

    1998-11-01

    The papillomaviruses are a family of small double-stranded DNA viruses which exclusively infect epithelial cells and stimulate the proliferation of those cells. A key protein within the papillomavirus life-cycle is known as the E2 (Early 2) protein and is responsible for regulating viral transcription from all viral promoters as well as for replication of the papillomavirus genome in tandem with another protein known as E1. The E2 protein itself consists of three functional domains: an N-terminal trans-activation domain, a proline-rich linker, and a C-terminal DNA-binding domain. The first crystal structure of the human papillomavirus, serotype 31 (HPV-31), E2 DNA-binding domain has been determined at 2.4 A resolution. The HPV DNA-binding domain monomer consists of two beta-alpha-beta repeats of approximately equal length and is arranged as to have an anti-parallel beta-sheet flanked by the two alpha-helices. The monomers form the functional in vivo dimer by association of the beta-sheets of each monomer so as to form an eight-stranded anti-parallel beta-barrel at the center of the dimer, with the alpha-helices lining the outside of the barrel. The overall structure of HVP-31 E2 DNA-binding domain is similar to both the bovine papillomavirus E2-binding domain and the Epstein-Barr nuclear antigen-1 DNA-binding domain.

  12. Targeted Transgenic Overexpression of Mitochondrial Thymidine Kinase (TK2) Alters Mitochondrial DNA (mtDNA) and Mitochondrial Polypeptide Abundance

    PubMed Central

    Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William

    2007-01-01

    Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK1) were used to study NRTI mitochondrial toxicity. Echocardiography and nuclear magnetic resonance imaging defined cardiac performance and structure. TK gene copy and enzyme activity, mitochondrial (mt) DNA and polypeptide abundance, succinate dehydrogenase and cytochrome oxidase histochemistry, and electron microscopy correlated with transgenesis, mitochondrial structure, and biogenesis. Antiretroviral combinations simulated therapy. Untreated hTK1 or TK2 TGs exhibited normal left ventricle mass. In TK2 TGs, cardiac TK2 gene copy doubled, activity increased 300-fold, and mtDNA abundance doubled. Abundance of the 17-kd subunit of complex I, succinate dehydrogenase histochemical activity, and cristae density increased. NRTIs increased left ventricle mass 20% in TK2 TGs. TK activity increased 3 logs in hTK1 TGs, but no cardiac phenotype resulted. NRTIs abrogated functional effects of transgenically increased TK2 activity but had no effect on TK2 mtDNA abundance. Thus, NRTI mitochondrial phosphorylation by TK2 is integral to clinical NRTI mitochondrial toxicity. PMID:17322372

  13. Modeling the interactions of the nucleotide excision repair UvrA(2) dimer with DNA.

    PubMed

    Gantchev, Tsvetan G; Hunting, Darel J

    2010-12-28

    The UvrA protein initiates the DNA damage recognition process by the bacterial nucleotide excision repair (NER) system. Recently, crystallographic structures of holo-UvrA(2) dimers from two different microorganisms have been released (Protein Data Bank entries 2r6f , 2vf7 , and 2vf8 ). However, the details of the DNA binding by UvrA(2) and other peculiarities involved in the damage recognition process remain unknown. We have undertaken a molecular modeling approach to appraise the possible modes of DNA-UvrA(2) interaction using molecular docking and short-scale guided molecular dynamics [continuum field, constrained, and/or unrestricted simulated annealing (SA)], taking into account the three-dimensional location of a series of mutation-identified UvrA residues implicated in DNA binding. The molecular docking was based on the assumptions that the UvrA(2) dimer is preformed prior to DNA binding and that no major protein conformational rearrangements, except moderate domain reorientations, are required for binding of undamaged DNA. As a first approximation, DNA was treated as a rigid ligand. From the electrostatic relief of the ventral surface of UvrA(2), we initially identified three, noncollinear DNA binding paths. Each of the three resulting nucleoprotein complexes (C1, C2, and C3) was analyzed separately, including calculation of binding energies, the number and type of interaction residues (including mutated ones), and the predominant mode of translational and rotational motion of specific protein domains after SA to ensure improved DNA binding. The UvrA(2) dimer can accommodate DNA in all three orientations, albeit with different binding strengths. One of the UvrA(2)-DNA complexes (C1) fulfilled most of the requirements (high interaction energy, proximity of DNA to mutated residues, etc.) expected for a natural, high-affinity DNA binding site. This nucleoprotein presents a structural organization that is designed to clamp and bend double-stranded DNA. We

  14. Domain Requirements for DNA Unwinding by Mycobacterial UvrD2, an Essential DNA Helicase†

    PubMed Central

    Sinha, Krishna Murari; Stephanou, Nicolas C.; Unciuleac, Mihaela-Carmen; Glickman, Michael S.; Shuman, Stewart

    2008-01-01

    Mycobacterial UvrD2 is a DNA-dependent ATPase with 3′ to 5′ helicase activity. UvrD2 is an atypical helicase, insofar as its N-terminal ATPase domain resembles the superfamily I helicases UvrD/PcrA, yet it has a C-terminal HRDC domain, which is a feature of RecQ-type superfamily II helicases. The ATPase and HRDC domains are connected by a CxxC-(14)-CxxC tetracysteine module that defines a new clade of UvrD2-like bacterial helicases found only in Actinomycetales. By characterizing truncated versions of Mycobacterium smegmatis UvrD2, we show that whereas the HRDC domain is not required for ATPase or helicase activities in vitro, deletion of the tetracysteine module abolishes duplex unwinding while preserving ATP hydrolysis. Replacing each of the CxxC motifs with a double-alanine variant AxxA had no effect on duplex unwinding, signifying that the domain module, not the cysteines, is crucial for function. The helicase activity of a truncated UvrD2 lacking the tetracysteine and HRDC domains was restored by the DNA-binding protein Ku, a component of the mycobacterial NHEJ system and a cofactor for DNA unwinding by the paralogous mycobacterial helicase UvrD1. Our findings indicate that coupling of ATP hydrolysis to duplex unwinding can be achieved by protein domains acting in cis or trans. Attempts to disrupt the M. smegmatis uvrD2 gene were unsuccessful unless a second copy of uvrD2 was present elsewhere in the chromosome, indicating that UvrD2 is essential for growth of M. smegmatis. PMID:18702526

  15. Inhibition of DNA2 nuclease as a therapeutic strategy targeting replication stress in cancer cells.

    PubMed

    Kumar, S; Peng, X; Daley, J; Yang, L; Shen, J; Nguyen, N; Bae, G; Niu, H; Peng, Y; Hsieh, H-J; Wang, L; Rao, C; Stephan, C C; Sung, P; Ira, G; Peng, G

    2017-04-17

    Replication stress is a characteristic feature of cancer cells, which is resulted from sustained proliferative signaling induced by activation of oncogenes or loss of tumor suppressors. In cancer cells, oncogene-induced replication stress manifests as replication-associated lesions, predominantly double-strand DNA breaks (DSBs). An essential mechanism utilized by cells to repair replication-associated DSBs is homologous recombination (HR). In order to overcome replication stress and survive, cancer cells often require enhanced HR repair capacity. Therefore, the key link between HR repair and cellular tolerance to replication-associated DSBs provides us with a mechanistic rationale for exploiting synthetic lethality between HR repair inhibition and replication stress. DNA2 nuclease is an evolutionarily conserved essential enzyme in replication and HR repair. Here we demonstrate that DNA2 is overexpressed in pancreatic cancers, one of the deadliest and more aggressive forms of human cancers, where mutations in the KRAS are present in 90-95% of cases. In addition, depletion of DNA2 significantly reduces pancreatic cancer cell survival and xenograft tumor growth, suggesting the therapeutic potential of DNA2 inhibition. Finally, we develop a robust high-throughput biochemistry assay to screen for inhibitors of the DNA2 nuclease activity. The top inhibitors were shown to be efficacious against both yeast Dna2 and human DNA2. Treatment of cancer cells with DNA2 inhibitors recapitulates phenotypes observed upon DNA2 depletion, including decreased DNA double strand break end resection and attenuation of HR repair. Similar to genetic ablation of DNA2, chemical inhibition of DNA2 selectively attenuates the growth of various cancer cells with oncogene-induced replication stress. Taken together, our findings open a new avenue to develop a new class of anticancer drugs by targeting druggable nuclease DNA2. We propose DNA2 inhibition as new strategy in cancer therapy by targeting

  16. Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways.

    PubMed Central

    Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M

    1993-01-01

    Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454

  17. Verbal Complementizers in Arabic

    ERIC Educational Resources Information Center

    Ahmed, Hossam Eldin Ibrahim

    2015-01-01

    A class of Modern Standard Arabic complementizers known as "'?inna' and its sisters" demonstrate unique case and word order restrictions. While CPs in Arabic allow both Subject-Verb (SV) and Verb-Subject (VS) word order and their subjects show nominative morphology, CPs introduced by "?inna" ban a verb from directly following…

  18. Keep your fingers off my DNA: protein-protein interactions mediated by C2H2 zinc finger domains.

    PubMed

    Brayer, Kathryn J; Segal, David J

    2008-01-01

    Cys2-His2 (C2H2) zinc finger domains (ZFs) were originally identified as DNA-binding domains, and uncharacterized domains are typically assumed to function in DNA binding. However, a growing body of evidence suggests an important and widespread role for these domains in protein binding. There are even examples of zinc fingers that support both DNA and protein interactions, which can be found in well-known DNA-binding proteins such as Sp1, Zif268, and Ying Yang 1 (YY1). C2H2 protein-protein interactions (PPIs) are proving to be more abundant than previously appreciated, more plastic than their DNA-binding counterparts, and more variable and complex in their interactions surfaces. Here we review the current knowledge of over 100 C2H2 zinc finger-mediated PPIs, focusing on what is known about the binding surface, contributions of individual fingers to the interaction, and function. An accurate understanding of zinc finger biology will likely require greater insights into the potential protein interaction capabilities of C2H2 ZFs.

  19. Molecular and Bioenergetic Differences between Cells with African versus European Inherited Mitochondrial DNA Haplogroups: Implications for Population Susceptibility to Diseases

    PubMed Central

    Kenney, M. Cristina; Chwa, Marilyn; Atilano, Shari R.; Falatoonzadeh, Payam; Ramirez, Claudio; Malik, Deepika; Tarek, Mohamed; Cáceres del Carpio, Javier; Nesburn, Anthony B.; Boyer, David S.; Kuppermann, Baruch D.; Vawter, Marquis P.; Jazwinski, S. Michal; Miceli, Michael V.; Wallace, Douglas C.; Udar, Nitin

    2015-01-01

    The geographic origins of populations can be identified by their maternally inherited mitochondrial DNA (mtDNA) haplogroups. This study compared human cybrids (cytoplasmic hybrids), which are cell lines with identical nuclei but mitochondria from different individuals with mtDNA from either the H haplogroup or L haplogroup backgrounds. The most common European haplogroup is H while individuals of maternal African origin are of the L haplogroup. Despite lower mtDNA copy numbers, L cybrids had higher expression levels for nine mtDNA-encoded respiratory complex genes, decreased ATP turnover rates and lower levels of ROS production, parameters which are consistent with more efficient oxidative phosphorylation. Surprisingly, GeneChip arrays showed that the L and H cybrids had major differences in expression of genes of the canonical complement system (5 genes), dermatan/chondroitin sulfate biosynthesis (5 genes) and CCR3 signaling (9 genes). Quantitative nuclear gene expression studies confirmed that L cybrids had (a) lower expression levels of complement pathway and innate immunity genes and (b) increased levels of inflammation-related signaling genes, which are critical in human diseases. Our data support the hypothesis that mtDNA haplogroups representing populations from different geographic origins may play a role in differential susceptibilities to diseases. PMID:24200652

  20. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  1. Precerebellin is a cerebellum-specific protein with similarity to the globular domain of complement C1q B chain.

    PubMed Central

    Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I

    1991-01-01

    The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between

  2. Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

    2010-11-05

    Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

  3. Code conversion from signed-digit to complement representation based on look-ahead optical logic operations

    NASA Astrophysics Data System (ADS)

    Li, Guoqiang; Qian, Feng

    2001-11-01

    We present, for the first time to our knowledge, a generalized lookahead logic algorithm for number conversion from signed-digit to complement representation. By properly encoding the signed-digits, all the operations are performed by binary logic, and unified logical expressions can be obtained for conversion from modified-signed- digit (MSD) to 2's complement, trinary signed-digit (TSD) to 3's complement, and quarternary signed-digit (QSD) to 4's complement. For optical implementation, a parallel logical array module using an electron-trapping device is employed and experimental results are shown. This optical module is suitable for implementing complex logic functions in the form of the sum of the product. The algorithm and architecture are compatible with a general-purpose optoelectronic computing system.

  4. Coupling complement regulators to immunoglobulin domains generates effective anti-complement reagents with extended half-life in vivo

    PubMed Central

    HARRIS, C L; WILLIAMS, A S; LINTON, S M; MORGAN, B P

    2002-01-01

    Complement activation and subsequent generation of inflammatory molecules and membrane attack complex contributes to the pathology of a number of inflammatory and degenerative diseases, including arthritis, glomerulonephritis and demyelination. Agents that specifically inhibit complement activation might prove beneficial in the treatment of these diseases. Soluble recombinant forms of the naturally occurring membrane complement regulatory proteins (CRP) have been exploited for this purpose. We have undertaken to design better therapeutics based on CRP. Here we describe the generation of soluble, recombinant CRP comprising rat decay accelerating factor (DAF) or rat CD59 expressed as Fc fusion proteins, antibody-like molecules comprising two CRP moieties in place of the antibody Fab arms (CRP-Ig). Reagents bearing DAF on each arm (DAF-Ig), CD59 on each arm (CD59-Ig) and a hybrid reagent containing both DAF and CD59 were generated. All three reagents inhibited C activation in vitro. Compared with soluble CRP lacking Fc domains, activity was reduced, but was fully restored by enzymatic release of the regulator from the Ig moiety, implicating steric constraints in reducing functional activity. In vivo studies showed that DAF-Ig, when compared to soluble DAF, had a much extended half-life in the circulation in rats and concomitantly caused a sustained reduction in plasma complement activity. When given intra-articularly to rats in a model of arthritis, DAF-Ig significantly reduced severity of disease. The data demonstrate the potential of CRP-Ig as reagents for sustained therapy of inflammatory disorders, including arthritis, but emphasize the need for careful design of fusion proteins to retain function. PMID:12165074

  5. Dynamic monitoring of p53 translocation to mitochondria for the analysis of specific inhibitors using luciferase-fragment complementation.

    PubMed

    Noda, Natsumi; Awais, Raheela; Sutton, Robert; Awais, Muhammad; Ozawa, Takeaki

    2017-12-01

    Intracellular protein translocation plays a pivotal role in regulating complex biological processes, including cell death. The tumor suppressor p53 is a transcription factor activated by DNA damage and oxidative stress that also translocates from the cytosol into the mitochondrial matrix to facilitate necrotic cell death. However, specific inhibitors of p53 mitochondrial translocation are largely unknown. To explore the inhibitors of p53, we developed a bioluminescent probe to monitor p53 translocation from cytosol to mitochondria using luciferase fragment complementation assays. The probe is composed of a novel pair of luciferase fragments, the N-terminus of green click beetle luciferase CBG68 (CBGN) and multiple-complement luciferase fragment (McLuc1). The combination of luciferase fragments showed significant luminescence intensity and high signal-to-background ratio. When the p53 connected with McLuc1 translocates from cytosol into mitochondrial matrix, CBGN in mitochondrial matrix enables to complement with McLuc1, resulting in the restoration of the luminescence. The luminescence intensity was significantly increased under hydrogen peroxide-induced oxidative stress following the complementation of CBGN and McLuc1. Pifithrin-μ, a selective inhibitor of p53 mitochondrial translocation, prevented the mitochondrial translocation of the p53 probe in a concentration-dependent manner. Furthermore, the high luminescence intensity made it easier to visualize the p53 translocation at a single cell level under a bioluminescence microscope. This p53 mitochondrial translocation assay is a new tool for high-throughput screening to identify novel p53 inhibitors, which could be developed as drugs to treat diseases in which necrotic cell death is a major contributor. © 2017 Wiley Periodicals, Inc.

  6. Effects of freezer storage time on levels of complement biomarkers.

    PubMed

    Morgan, Angharad R; O'Hagan, Caroline; Touchard, Samuel; Lovestone, Simon; Morgan, B Paul

    2017-11-06

    There is uncertainty regarding how stable complement analytes are during long-term storage at - 80 °C. As part of our work program we have measured 17 complement biomarkers (C1q, C1 inhibitor, C3, C3a, iC3b, C4, C5, C9, FB, FD, FH, FI, TCC, Bb, sCR1, sCR2, Clusterin) and the benchmark inflammatory marker C-reactive protein (CRP) in a large set of plasma samples (n = 720) that had been collected, processed and subsequently stored at - 80 °C over a period of 6.6-10.6 years, prior to laboratory analysis. The biomarkers were measured using solid-phase enzyme immunoassays with a combination of multiplex assays using the MesoScale Discovery Platform and single-plex enzyme-linked immunosorbent assays (ELISAs). As part of a post hoc analysis of extrinsic factors (co-variables) affecting the analyses we investigated the impact of freezer storage time on the values obtained for each complement analyte. With the exception of five analytes (C4, C9, sCR2, clusterin and CRP), storage time was significantly correlated with measured plasma concentrations. For ten analytes: C3, FI, FB, FD, C5, sCR1, C3a, iC3b, Bb and TCC, storage time was positively correlated with concentration and for three analytes: FH, C1q, and C1 inhibitor, storage time was negatively correlated with concentration. The results suggest that information on storage time should be regarded as an important co-variable and taken into consideration when analysing data to look for associations of complement biomarker levels and disease or other outcomes.

  7. Genetics Home Reference: TK2-related mitochondrial DNA depletion syndrome, myopathic form

    MedlinePlus

    ... mtDNA. Specifically, this enzyme plays a role in recycling mtDNA building blocks (nucleotides) so that errors in ... kinase 2. A decrease in enzyme activity impairs recycling of mtDNA nucleotides, causing a shortage of nucleotides ...

  8. Homologous recombination mediates S-phase-dependent radioresistance in cells deficient in DNA polymerase eta.

    PubMed

    Nicolay, Nils H; Carter, Rebecca; Hatch, Stephanie B; Schultz, Niklas; Prevo, Remko; McKenna, W Gillies; Helleday, Thomas; Sharma, Ricky A

    2012-11-01

    DNA polymerase eta (pol η) is the only DNA polymerase causally linked to carcinogenesis in humans. Inherited deficiency of pol η in the variant form of xeroderma pigmentosum (XPV) predisposes to UV-light-induced skin cancer. Pol η-deficient cells demonstrate increased sensitivity to cisplatin and oxaliplatin chemotherapy. We have found that XP30R0 fibroblasts derived from a patient with XPV are more resistant to cell kill by ionising radiation (IR) than the same cells complemented with wild-type pol η. This phenomenon has been confirmed in Burkitt's lymphoma cells, which either expressed wild-type pol η or harboured a pol η deletion. Pol η deficiency was associated with accumulation of cells in S-phase, which persisted after IR. Cells deficient in pol η demonstrated increased homologous recombination (HR)-directed repair of double strand breaks created by IR. Depletion of the HR protein, X-ray repair cross-complementing protein 3 (XRCC3), abrogated the radioresistance observed in pol η-deficient cells as compared with pol η-complemented cells. These findings suggest that HR mediates S-phase-dependent radioresistance associated with pol η deficiency. We propose that pol η protein levels in tumours may potentially be used to identify patients who require treatment with chemo-radiotherapy rather than radiotherapy alone for adequate tumour control.

  9. ATM-Dependent Phosphorylation of MEF2D Promotes Neuronal Survival after DNA Damage

    PubMed Central

    Chan, Shing Fai; Sances, Sam; Brill, Laurence M.; Okamoto, Shu-ichi; Zaidi, Rameez; McKercher, Scott R.; Akhtar, Mohd W.; Nakanishi, Nobuki

    2014-01-01

    Mutations in the ataxia telangiectasia mutated (ATM) gene, which encodes a kinase critical for the normal DNA damage response, cause the neurodegenerative disorder ataxia-telangiectasia (AT). The substrates of ATM in the brain are poorly understood. Here we demonstrate that ATM phosphorylates and activates the transcription factor myocyte enhancer factor 2D (MEF2D), which plays a critical role in promoting survival of cerebellar granule cells. ATM associates with MEF2D after DNA damage and phosphorylates the transcription factor at four ATM consensus sites. Knockdown of endogenous MEF2D with a short-hairpin RNA (shRNA) increases sensitivity to etoposide-induced DNA damage and neuronal cell death. Interestingly, substitution of endogenous MEF2D with an shRNA-resistant phosphomimetic MEF2D mutant protects cerebellar granule cells from cell death after DNA damage, whereas an shRNA-resistant nonphosphorylatable MEF2D mutant does not. In vivo, cerebella in Mef2d knock-out mice manifest increased susceptibility to DNA damage. Together, our results show that MEF2D is a substrate for phosphorylation by ATM, thus promoting survival in response to DNA damage. Moreover, dysregulation of the ATM–MEF2D pathway may contribute to neurodegeneration in AT. PMID:24672010

  10. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  11. An Anti-C1s Monoclonal, TNT003, Inhibits Complement Activation Induced by Antibodies Against HLA.

    PubMed

    Thomas, K A; Valenzuela, N M; Gjertson, D; Mulder, A; Fishbein, M C; Parry, G C; Panicker, S; Reed, E F

    2015-08-01

    Antibody-mediated rejection (AMR) of solid organ transplants (SOT) is characterized by damage triggered by donor-specific antibodies (DSA) binding donor Class I and II HLA (HLA-I and HLA-II) expressed on endothelial cells. While F(ab')2 portions of DSA cause cellular activation and proliferation, Fc regions activate the classical complement cascade, resulting in complement deposition and leukocyte recruitment, both hallmark features of AMR. We characterized the ability of an anti-C1s monoclonal antibody, TNT003, to inhibit HLA antibody (HLA-Ab)-induced complement activation. Complement deposition induced by HLA-Ab was evaluated using novel cell- and bead-based assays. Human aortic endothelial cells (HAEC) were cultured with HLA-Ab and human complement; production of activated complement proteins was measured by flow cytometry. Additionally, C3d deposition was measured on single antigen beads (SAB) mixed with HLA-Ab and human complement. TNT003 inhibited HLA-Ab mediated complement deposition on HAEC in a concentration-dependent manner; C3a, C4a and C5a anaphylatoxin production was also diminished by TNT003. Finally, TNT003 blocked C3d deposition induced by Class I (HLAI-Ab)- and Class II (HLAII-Ab)-specific antibodies on SAB. These data suggest TNT003 may be useful for modulating the effects of DSA, as TNT003 inhibits complement deposition and split product formation generated by HLA-I/II-Ab in vitro. © 2015 The Authors. American Journal of Transplantation Published by Wiley Periodicals, Inc.

  12. An Anti-C1s Monoclonal, TNT003, Inhibits Complement Activation Induced by Antibodies Against HLA

    PubMed Central

    Thomas, K A; Valenzuela, N M; Gjertson, D; Mulder, A; Fishbein, M C; Parry, G C; Panicker, S; Reed, E F

    2015-01-01

    Antibody-mediated rejection (AMR) of solid organ transplants (SOT) is characterized by damage triggered by donor-specific antibodies (DSA) binding donor Class I and II HLA (HLA-I and HLA-II) expressed on endothelial cells. While F(ab′)2 portions of DSA cause cellular activation and proliferation, Fc regions activate the classical complement cascade, resulting in complement deposition and leukocyte recruitment, both hallmark features of AMR. We characterized the ability of an anti-C1s monoclonal antibody, TNT003, to inhibit HLA antibody (HLA-Ab)-induced complement activation. Complement deposition induced by HLA-Ab was evaluated using novel cell- and bead-based assays. Human aortic endothelial cells (HAEC) were cultured with HLA-Ab and human complement; production of activated complement proteins was measured by flow cytometry. Additionally, C3d deposition was measured on single antigen beads (SAB) mixed with HLA-Ab and human complement. TNT003 inhibited HLA-Ab mediated complement deposition on HAEC in a concentration-dependent manner; C3a, C4a and C5a anaphylatoxin production was also diminished by TNT003. Finally, TNT003 blocked C3d deposition induced by Class I (HLAI-Ab)- and Class II (HLAII-Ab)-specific antibodies on SAB. These data suggest TNT003 may be useful for modulating the effects of DSA, as TNT003 inhibits complement deposition and split product formation generated by HLA-I/II-Ab in vitro. PMID:25904443

  13. Protective responses to sublytic complement in the retinal pigment epithelium

    PubMed Central

    Tan, Li Xuan; Toops, Kimberly A.; Lakkaraju, Aparna

    2016-01-01

    The retinal pigment epithelium (RPE) is a key site of injury in inherited and age-related macular degenerations. Abnormal activation of the complement system is a feature of these blinding diseases, yet how the RPE combats complement attack is poorly understood. The complement cascade terminates in the cell-surface assembly of membrane attack complexes (MACs), which promote inflammation by causing aberrant signal transduction. Here, we investigated mechanisms crucial for limiting MAC assembly and preserving cellular integrity in the RPE and asked how these are compromised in models of macular degeneration. Using polarized primary RPE and the pigmented Abca4−/− Stargardt disease mouse model, we provide evidence for two protective responses occurring within minutes of complement attack, which are essential for maintaining mitochondrial health in the RPE. First, accelerated recycling of the membrane-bound complement regulator CD59 to the RPE cell surface inhibits MAC formation. Second, fusion of lysosomes with the RPE plasma membrane immediately after complement attack limits sustained elevations in intracellular calcium and prevents mitochondrial injury. Cholesterol accumulation in the RPE, induced by vitamin A dimers or oxidized LDL, inhibits these defense mechanisms by activating acid sphingomyelinase (ASMase), which increases tubulin acetylation and derails organelle traffic. Defective CD59 recycling and lysosome exocytosis after complement attack lead to mitochondrial fragmentation and oxidative stress in the RPE. Drugs that stimulate cholesterol efflux or inhibit ASMase restore both these critical safeguards in the RPE and avert complement-induced mitochondrial injury in vitro and in Abca4−/− mice, indicating that they could be effective therapeutic approaches for macular degenerations. PMID:27432952

  14. Polyanion-Induced Self Association of Complement Factor H1

    PubMed Central

    Pangburn, Michael K.; Rawal, Nenoo; Cortes, Claudio; Alam, M. Nurul; Ferreira, Viviana P.; Atkinson, Mark A. L.

    2008-01-01

    Factor H is the primary soluble regulator of activation of the alternative pathway of complement. It prevents activation of complement on host cells and tissues upon association with C3b and surface polyanions such as sialic acids, heparin and other glycosaminoglycans. Here we show that interaction with polyanions causes self-association forming tetramers of the 155,000 Da glycosylated protein. Monomeric human factor H is an extended flexible protein that exhibits an apparent size of 330,000 Da, relative to globular standards, during gel filtration chromatography in the absence of polyanions. In the presence of dextran sulfate (5,000 Da) or heparin an intermediate species of apparent m.w. 700,000 and a limit species of m.w. 1,400,000 were observed by gel filtration. Sedimentation equilibrium analysis by analytical ultracentrifugation indicated a monomer Mr of 163,000 in the absence of polyanions and a Mr of 607,000, corresponding to a tetramer, in the presence of less than a 2-fold molar excess of dextran sulfate. Increasing concentrations of dextran sulfate increased binding of factor H to zymosan-C3b 4.5-fold. This was accompanied by an increase in both the decay accelerating and cofactor activity of factor H on these cells. An expressed fragment encompassing the C-terminal polyanion binding site (complement control protein domains 18–20) also exhibited polyanion-induced self association, suggesting that the C-terminal ends of factor H mediate self-association. The results suggest that recognition of polyanionic markers on host cells and tissues by factor H, and the resulting regulation of complement activation, may involve formation of dimers and tetramers of factor H. PMID:19124749

  15. Defining the Complement Biomarker Profile of C3 Glomerulopathy

    PubMed Central

    Zhang, Yuzhou; Nester, Carla M.; Martin, Bertha; Skjoedt, Mikkel-Ole; Meyer, Nicole C.; Shao, Dingwu; Borsa, Nicolò; Palarasah, Yaseelan

    2014-01-01

    Background and objectives C3 glomerulopathy (C3G) applies to a group of renal diseases defined by a specific renal biopsy finding: a dominant pattern of C3 fragment deposition on immunofluorescence. The primary pathogenic mechanism involves abnormal control of the alternative complement pathway, although a full description of the disease spectrum remains to be determined. This study sought to validate and define the association of complement dysregulation with C3G and to determine whether specific complement pathway abnormalities could inform disease definition. Design, setting, participants, & measurements This study included 34 patients with C3G (17 with C3 glomerulonephritis [C3GN] and 17 with dense deposit disease [DDD]) diagnosed between 2008 and 2013 selected from the C3G Registry. Control samples (n=100) were recruited from regional blood drives. Nineteen complement biomarkers were assayed on all samples. Results were compared between C3G disease categories and with normal controls. Results Assessment of the alternative complement pathway showed that compared with controls, patients with C3G had lower levels of serum C3 (P<0.001 for both DDD and C3GN) and factor B (P<0.001 for both DDD and C3GN) as well as higher levels of complement breakdown products including C3d (P<0.001 for both DDD and C3GN) and Bb (P<0.001 for both DDD and C3GN). A comparison of terminal complement pathway proteins showed that although C5 levels were significantly suppressed (P<0.001 for both DDD and C3GN) its breakdown product C5a was significantly higher only in patients with C3GN (P<0.05). Of the other terminal pathway components (C6–C9), the only significant difference was in C7 levels between patients with C3GN and controls (P<0.01). Soluble C5b-9 was elevated in both diseases but only the difference between patients with C3GN and controls reached statistical significance (P<0.001). Levels of C3 nephritic factor activity were qualitatively higher in patients with DDD compared

  16. Assessing reprogramming by chimera formation and tetraploid complementation.

    PubMed

    Li, Xin; Xia, Bao-long; Li, Wei; Zhou, Qi

    2015-01-01

    Pluripotent stem cells can be evaluated by pluripotent markers expression, embryoid body aggregation, teratoma formation, chimera contribution and even more, tetraploid complementation. Whether iPS cells in general are functionally equivalent to normal ESCs is difficult to establish. Here, we present the detailed procedure for chimera formation and tetraploid complementation, the most stringent criterion, to assessing pluripotency.

  17. Function of Serum Complement in Drinking Water Arsenic Toxicity

    PubMed Central

    Islam, Laila N.; Zahid, M. Shamim Hasan; Nabi, A. H. M. Nurun; Hossain, Mahmud

    2012-01-01

    Serum complement function was evaluated in 125 affected subjects suffering from drinking water arsenic toxicity. Their mean duration of exposure was 7.4 ± 5.3 yrs, and the levels of arsenic in drinking water and urine samples were 216 ± 211 and 223 ± 302 μg/L, respectively. The mean bactericidal activity of complement from the arsenic patients was 92% and that in the unexposed controls was 99% (P < 0.01), but heat-inactivated serum showed slightly elevated activity than in controls. In patients, the mean complement C3 was 1.56 g/L, and C4 was 0.29 g/L compared to 1.68 g/L and 0.25 g/L, respectively, in the controls. The mean IgG in the arsenic patients was 24.3 g/L that was highly significantly elevated (P < 0.001). Arsenic patients showed a significant direct correlation between C3 and bactericidal activity (P = 0.014). Elevated levels of C4 indicated underutilization and possibly impaired activity of the classical complement pathway. We conclude reduced function of serum complement in drinking water arsenic toxicity. PMID:22545044

  18. Cell-derived microparticles and complement activation in preeclampsia versus normal pregnancy.

    PubMed

    Biró, E; Lok, C A R; Hack, C E; van der Post, J A M; Schaap, M C L; Sturk, A; Nieuwland, R

    2007-01-01

    Inflammation plays a major role in the vascular dysfunction seen in preeclampsia, and several studies suggest involvement of the complement system. To investigate whether complement activation on the surface of microparticles is increased in plasma of preeclamptic patients versus healthy pregnant controls. Microparticles from plasma of preeclamptic (n=10), healthy pregnant (n=10) and healthy nonpregnant (n=10) women were analyzed by flow cytometry for bound complement components (C1q, C4, C3) and complement activator molecules (C-reactive protein [CRP], serum amyloid P component [SAP], immunoglobulin [Ig]M, IgG). Fluid phase complement activation products and activator molecules were also determined. Levels of microparticles with bound complement components showed no increase in complement activation on the microparticle surface in preeclamptic women, in line with levels of fluid phase complement activation products. In healthy nonpregnant and pregnant women, bound CRP was associated with classical pathway activation on the microparticle surface, and in healthy pregnant women IgM and IgG molecules also contributed. In preeclamptic women, microparticles with bound SAP and those with IgG seemed to contribute to C1q binding without a clear association to further classical pathway activation. Furthermore, significantly increased levels of microparticles with bound CRP were present in preeclamptic compared with healthy pregnant women (median 178x10(6)/L versus 47x10(6)/L, P<0.01), but without concomitant increases in complement activation. We found no evidence of increased complement activation on the microparticle surface in preeclamptic women. Microparticles with bound CRP were significantly increased, but in contrast to healthy pregnant and nonpregnant women, this was not associated with increased classical pathway activation on the surface of the microparticles.

  19. Analysis of a FANCE Splice Isoform in Regard to DNA Repair.

    PubMed

    Bouffard, Frédérick; Plourde, Karine; Bélanger, Simon; Ouellette, Geneviève; Labrie, Yvan; Durocher, Francine

    2015-09-25

    The FANC-BRCA DNA repair pathway is activated in response to interstrand crosslinks formed in DNA. A homozygous mutation in 1 of the 17 Fanconi anemia (FA) genes results in malfunctions of this pathway and development of FA syndrome. The integrity of this protein network is essential for good maintenance of DNA repair process and genome stability. Following the identification of an alternatively splice isoform of FANCE (Fanconi anemia complementation group E) significantly expressed in breast cancer individuals from high-risk non-BRCA1/2 families, we studied the impact of this FANCE splice isoform (FANCEΔ4) on DNA repair processes. We have demonstrated that FANCEΔ4 mRNA was efficiently translated into a functional protein and expressed in normal and breast cancer cell lines. Following treatment with the crosslinking agent mitomycin C, EUFA130 (FANCE-deficient) cells infected with FANCEΔ4 were blocked into G2/M phase, while cell survival was significantly reduced compared with FANCE-infected EUFA130 cells. In addition, FANCEΔ4 did not allow FANCD2 and FANCI monoubiquitination, which represents a crucial step of the FANC-BRCA functional pathway. As observed for FANCE wild-type protein, localization of FANCEΔ4 protein was confined to the nucleus following mitomycin C treatment. Although FANCEΔ4 protein showed interaction with FANCE, FANCEΔ4 did not support normal function of FANCE protein in this pathway and could have deleterious effects on FANCE protein activity. We have demonstrated that FANCEΔ4 seems to act as a regulator of FANCD2 protein expression level by promoting its degradation. This study highlights the importance of an efficient regulation of alternative splicing expression of FA genes for proper DNA repair. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. DNA adducts and oxidative DNA damage induced by organic extracts from PM2.5 in an acellular assay.

    PubMed

    Topinka, Jan; Rossner, Pavel; Milcova, Alena; Schmuczerova, Jana; Svecova, Vlasta; Sram, Radim J

    2011-05-10

    The genotoxic activities of complex mixtures of organic extracts from the urban air particles collected in various localities of the Czech Republic, which differed in the extent and sources of air pollution, were compared. For this purpose, PM2.5 particles were collected by high volume samplers in the most polluted area of the Czech Republic--Ostrava region (localities Bartovice, Poruba and Karvina) and in the locality exhibiting a low level of air pollution--Trebon--a small town in the non-industrial region of Southern Bohemia. To prepare extractable organic matter (EOM), PM2.5 particles were extracted by dichloromethane and c-PAHs contents in the EOMs were determined. As markers of genotoxic potential, DNA adduct levels and oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine, 8-oxodG, levels) induced by EOMs in an acellular assay of calf thymus DNA coupled with ³²P-postlabeling (DNA adducts) and ELISA (8-oxodG) in the presence and absence of microsomal S9 fraction were employed. Twofold higher DNA adduct levels (17.20 adducts/10⁸ nucleotides/m³ vs. 8.49 adducts/10⁸ nucleotides/m³) were induced by EOM from Ostrava-Bartovice (immediate proximity of heavy industry) compared with that from Ostrava-Poruba (mostly traffic emissions). Oxidative DNA damage induced by EOM from Ostrava-Bartovice was more than fourfold higher than damage induced by EOM from Trebon (8-oxodG/10⁸ dG/m³: 0.131 vs. 0.030 for Ostrava-Bartovice vs. Trebon, respectively). Since PM2.5 particles collected in various localities differ with respect to their c-PAHs content, and c-PAHs significantly contribute to genotoxicity (DNA adduct levels), we suggest that monitoring of PM2.5 levels is not a sufficient basis to assess genotoxicity of respirable aerosols. It seems likely that the industrial emissions prevailing in Ostrava-Bartovice represent a substantially higher genotoxic risk than mostly traffic-related emissions in Ostrava-Poruba. B[a]P and c-PAH contents in EOMs are the most

  1. Complement factor B expression profile in a spontaneous uveitis model.

    PubMed

    Zipplies, Johanna K; Kirschfink, Michael; Amann, Barbara; Hauck, Stefanie M; Stangassinger, Manfred; Deeg, Cornelia A

    2010-12-01

    Equine recurrent uveitis serves as a spontaneous model for human autoimmune uveitis. Unpredictable relapses and ongoing inflammation in the eyes of diseased horses as well as in humans lead to destruction of the retina and finally result in blindness. However, the molecular mechanisms leading to inflammation and retinal degeneration are not well understood. An initial screening for differentially regulated proteins in sera of uveitic cases compared to healthy controls revealed an increase of the alternative pathway complement component factor B in ERU cases. To determine the activation status of the complement system, sera were subsequently examined for complement split products. We could demonstrate a significant higher concentration of the activation products B/Ba, B/Bb, Bb neoantigen, iC3b and C3d in uveitic condition compared to healthy controls, whereas for C5b-9 no differences were detected. Additionally, we investigated complement activation directly in the retina by immunohistochemistry, since it is the main target organ of this autoimmune disease. Interestingly, infiltrating cells co-expressed activated factor Bb neoantigen, complement split product C3d as well as CD68, a macrophage marker. In this study, we could demonstrate activation of the complement system both systemically as well as in the eye, the target organ of spontaneous recurrent uveitis. Based on these novel findings, we postulate a novel role for macrophages in connection with complement synthesis at the site of inflammation. Copyright © 2010 Elsevier GmbH. All rights reserved.

  2. Inactivating UBE2M impacts the DNA damage response and genome integrity involving multiple cullin ligases.

    PubMed

    Cukras, Scott; Morffy, Nicholas; Ohn, Takbum; Kee, Younghoon

    2014-01-01

    Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.

  3. Novel Scabies Mite Serpins Inhibit the Three Pathways of the Human Complement System

    PubMed Central

    Mika, Angela; Reynolds, Simone L.; Mohlin, Frida C.; Willis, Charlene; Swe, Pearl M.; Pickering, Darren A.; Halilovic, Vanja; Wijeyewickrema, Lakshmi C.; Pike, Robert N.; Blom, Anna M.; Kemp, David J.; Fischer, Katja

    2012-01-01

    Scabies is a parasitic infestation of the skin by the mite Sarcoptes scabiei that causes significant morbidity worldwide, in particular within socially disadvantaged populations. In order to identify mechanisms that enable the scabies mite to evade human immune defenses, we have studied molecules associated with proteolytic systems in the mite, including two novel scabies mite serine protease inhibitors (SMSs) of the serpin superfamily. Immunohistochemical studies revealed that within mite-infected human skin SMSB4 (54 kDa) and SMSB3 (47 kDa) were both localized in the mite gut and feces. Recombinant purified SMSB3 and SMSB4 did not inhibit mite serine and cysteine proteases, but did inhibit mammalian serine proteases, such as chymotrypsin, albeit inefficiently. Detailed functional analysis revealed that both serpins interfered with all three pathways of the human complement system at different stages of their activation. SMSB4 inhibited mostly the initial and progressing steps of the cascades, while SMSB3 showed the strongest effects at the C9 level in the terminal pathway. Additive effects of both serpins were shown at the C9 level in the lectin pathway. Both SMSs were able to interfere with complement factors without protease function. A range of binding assays showed direct binding between SMSB4 and seven complement proteins (C1, properdin, MBL, C4, C3, C6 and C8), while significant binding of SMSB3 occurred exclusively to complement factors without protease function (C4, C3, C8). Direct binding was observed between SMSB4 and the complement proteases C1s and C1r. However no complex formation was observed between either mite serpin and the complement serine proteases C1r, C1s, MASP-1, MASP-2 and MASP-3. No catalytic inhibition by either serpin was observed for any of these enzymes. In summary, the SMSs were acting at several levels mediating overall inhibition of the complement system and thus we propose that they may protect scabies mites from complement

  4. A mutation in the XPB/ERCC3 DNA repair transcription gene, associated with trichothiodystrophy.

    PubMed Central

    Weeda, G; Eveno, E; Donker, I; Vermeulen, W; Chevallier-Lagente, O; Taïeb, A; Stary, A; Hoeijmakers, J H; Mezzina, M; Sarasin, A

    1997-01-01

    Trichothiodystrophy (TTD) is a rare, autosomal recessive disorder characterized by sulfur-deficient brittle hair and nails, mental retardation, impaired sexual development, and ichthyosis. Photosensitivity has been reported in approximately 50% of the cases, but no skin cancer is associated with TTD. Virtually all photosensitive TTD patients have a deficiency in the nucleotide excision repair (NER) of UV-induced DNA damage that is indistinguishable from that of xeroderma pigmentosum (XP) complementation group D (XP-D) patients. DNA repair defects in XP-D are associated with two additional, quite different diseases; XP, a sun-sensitive and cancer-prone repair disorder, and Cockayne syndrome (CS), a photosensitive condition characterized by physical and mental retardation and wizened facial appearance. One photosensitive TTD case constitutes a new repair-deficient complementation group, TTD-A. Remarkably, both TTD-A and XP-D defects are associated with subunits of TFIIH, a basal transcription factor with a second function in DNA repair. Thus, mutations in TFIIH components may, on top of a repair defect, also cause transcriptional insufficiency, which may explain part of the non-XP clinical features of TTD. Besides XPD and TTDA, the XPB gene product is also part of TFIIH. To date, three patients with the remarkable conjunction of XP and CS but not TTD have been assigned to XP complementation group B (XP-B). Here we present the characterization of the NER defect in two mild TTD patients (TTD6VI and TTD4VI) and confirm the assignment to X-PB. The causative mutation was found to be a single base substitution resulting in a missense mutation (T119P) in a region of the XPB protein completely conserved in yeast, Drosophila, mouse, and man. These findings define a third TTD complementation group, extend the clinical heterogeneity associated with XP-B, stress the exclusive relationship between TTD and mutations in subunits of repair/transcription factor TFIIH, and strongly

  5. Ulex europaeus agglutinin II (UEA-II) is a novel, potent inhibitor of complement activation.

    PubMed

    Lekowski, R; Collard, C D; Reenstra, W R; Stahl, G L

    2001-02-01

    Complement is an important mediator of vascular injury following oxidative stress. We recently demonstrated that complement activation following endothelial oxidative stress is mediated by mannose-binding lectin (MBL) and activation of the lectin complement pathway. Here, we investigated whether nine plant lectins which have a binding profile similar to that of MBL competitively inhibit MBL deposition and subsequent complement activation following human umbilical vein endothelial cell (HUVEC) oxidative stress. HUVEC oxidative stress (1% O(2), 24 hr) significantly increased Ulex europaeus agglutinin II (UEA-II) binding by 72 +/- 9% compared to normoxic cells. UEA-II inhibited MBL binding to HUVEC in a concentration-dependent manner following oxidative stress. Further, MBL inhibited UEA-II binding to HUVEC in a concentration-dependent manner following oxidative stress, suggesting a common ligand. UEA-II (< or = 100 micromol/L) did not attenuate the hemolytic activity, nor did it inhibit C3a des Arg formation from alternative or classical complement pathway-specific hemolytic assays. C3 deposition (measured by ELISA) following HUVEC oxidative stress was inhibited by UEA-II in a concentration-dependent manner (IC(50) = 10 pmol/L). UEA-II inhibited C3 and MBL co-localization (confocal microscopy) in a concentration-dependent manner on HUVEC following oxidative stress (IC(50) approximately 1 pmol/L). Finally, UEA-II significantly inhibited complement-dependent neutrophil chemotaxis, but failed to inhibit fMLP-mediated chemotaxis, following endothelial oxidative stress. These data demonstrate that UEA-II is a novel, potent inhibitor of human MBL deposition and complement activation following human endothelial oxidative stress.

  6. Ulex europaeus agglutinin II (UEA-II) is a novel, potent inhibitor of complement activation

    PubMed Central

    Lekowski, Robert; Collard, Charles D.; Reenstra, Wende R.; Stahl, Gregory L.

    2001-01-01

    Complement is an important mediator of vascular injury following oxidative stress. We recently demonstrated that complement activation following endothelial oxidative stress is mediated by mannose-binding lectin (MBL) and activation of the lectin complement pathway. Here, we investigated whether nine plant lectins which have a binding profile similar to that of MBL competitively inhibit MBL deposition and subsequent complement activation following human umbilical vein endothelial cell (HUVEC) oxidative stress. HUVEC oxidative stress (1% O2, 24 hr) significantly increased Ulex europaeus agglutinin II (UEA-II) binding by 72 ± 9% compared to normoxic cells. UEA-II inhibited MBL binding to HUVEC in a concentration-dependent manner following oxidative stress. Further, MBL inhibited UEA-II binding to HUVEC in a concentration-dependent manner following oxidative stress, suggesting a common ligand. UEA-II (≤ 100 μmol/L) did not attenuate the hemolytic activity, nor did it inhibit C3a des Arg formation from alternative or classical complement pathway-specific hemolytic assays. C3 deposition (measured by ELISA) following HUVEC oxidative stress was inhibited by UEA-II in a concentration-dependent manner (IC50 = 10 pmol/L). UEA-II inhibited C3 and MBL co-localization (confocal microscopy) in a concentration-dependent manner on HUVEC following oxidative stress (IC50 ≈ 1 pmol/L). Finally, UEA-II significantly inhibited complement-dependent neutrophil chemotaxis, but failed to inhibit fMLP-mediated chemotaxis, following endothelial oxidative stress. These data demonstrate that UEA-II is a novel, potent inhibitor of human MBL deposition and complement activation following human endothelial oxidative stress. PMID:11266613

  7. Low-level laser irradiation alters mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts

    NASA Astrophysics Data System (ADS)

    Trajano, L. A. S. N.; Sergio, L. P. S.; Silva, C. L.; Carvalho, L.; Mencalha, A. L.; Stumbo, A. C.; Fonseca, A. S.

    2016-07-01

    Low-level lasers are used for the treatment of diseases in soft and bone tissues, but few data are available regarding their effects on genomic stability. In this study, we investigated mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts exposed to low-level infrared laser. C2C12 myoblast cultures in different fetal bovine serum concentrations were exposed to low-level infrared laser (10, 35 and 70 J cm-2), and collected for the evaluation of DNA repair gene expression. Laser exposure increased gene expression related to base excision repair (8-oxoguanine DNA glycosylase and apurinic/apyrimidinic endonuclease 1), nucleotide excision repair (excision repair cross-complementation group 1 and xeroderma pigmentosum C protein) and genomic stabilization (ATM serine/threonine kinase and tumor protein p53) in normal and low fetal bovine serum concentrations. Results suggest that genomic stability could be part of a biostimulation effect of low-level laser therapy in injured muscles.

  8. Steroids and triterpenes from the fruit bodies of Ganoderma lucidum and their anti-complement activity.

    PubMed

    Seo, Hyo Won; Hung, Tran Manh; Na, MinKyun; Jung, Hyun Ju; Kim, Jin Cheol; Choi, Jae Sue; Kim, Jung Hee; Lee, Hyeong-Kyu; Lee, IkSoo; Bae, KiHwan; Hattori, Masao; Min, Byung Sun

    2009-11-01

    To determine the anti-complement activity of natural triterpenes, chromatographic separation of the EtOAc-soluble fraction from the fruiting body of Ganoderma lucidum led to the isolation of three steroids and five triterpenoids. They were identified as ergosterol peroxide (1), ergosterol (2), genoderic acid Sz (3), stella sterol (4), ganoderic aic C1 (5), ganoderic acid A (6), methyl ganoderate A (7), and lucidenic acid A (8) based on spectroscopic evidence and physicochemical properties. These compounds were examined for their anti-complement activity against the classical pathway of the complement system. Compounds 2 and 3 showed potent anti-complement activity with IC50 values of 52.0 and 44.6 microM, respectively. Compound 1 exhibited significant inhibitory activity with an IC50 value of 126.8 microM, whereas compounds 4-8 were inactive. Our findings suggested that in addition to the ketone group at C-3, the delta7(8), delta9(11)-lanostadiene type triterpene also plays an important role in inhibiting the hemolytic activity of human serum against erythrocytes.

  9. Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

    PubMed

    Zakian, V A; Brewer, B J; Fangman, W L

    1979-08-01

    Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA

  10. Complement system studies in systemic lupus erythematosus (SLE)

    PubMed

    Teisberg, P

    1975-01-01

    Complement system involvement has been studied in 16 patients with systemic lupus erythematosus (SLE). Circulating conversion products of C3 were observed in 4 cases. Low mean values of C4 and C3 were found, while C3 proactivator (properdin factor B) levels were low in only a few of the patients. The levels of C4, C3 and C3 proactivator were not lower in the 4 patients in whom C3 conversion products could be demonstrated than in the others. It is concluded that the low complement values found in SLE may be caused mainly by deficient synthesis. Signs of complement activation are in this patient material demonstrated early in the disease, and chiefly in patients not receiving immunosuppressive therapy.

  11. Use of ancient sedimentary DNA as a novel conservation tool for high-altitude tropical biodiversity.

    PubMed

    Boessenkool, Sanne; McGlynn, Gayle; Epp, Laura S; Taylor, David; Pimentel, Manuel; Gizaw, Abel; Nemomissa, Sileshi; Brochmann, Christian; Popp, Magnus

    2014-04-01

    Conservation of biodiversity may in the future increasingly depend upon the availability of scientific information to set suitable restoration targets. In traditional paleoecology, sediment-based pollen provides a means to define preanthropogenic impact conditions, but problems in establishing the exact provenance and ecologically meaningful levels of taxonomic resolution of the evidence are limiting. We explored the extent to which the use of sedimentary ancient DNA (sedaDNA) may complement pollen data in reconstructing past alpine environments in the tropics. We constructed a record of afro-alpine plants retrieved from DNA preserved in sediment cores from 2 volcanic crater sites in the Albertine Rift, eastern Africa. The record extended well beyond the onset of substantial anthropogenic effects on tropical mountains. To ensure high-quality taxonomic inference from the sedaDNA sequences, we built an extensive DNA reference library covering the majority of the afro-alpine flora, by sequencing DNA from taxonomically verified specimens. Comparisons with pollen records from the same sediment cores showed that plant diversity recovered with sedaDNA improved vegetation reconstructions based on pollen records by revealing both additional taxa and providing increased taxonomic resolution. Furthermore, combining the 2 measures assisted in distinguishing vegetation change at different geographic scales; sedaDNA almost exclusively reflects local vegetation, whereas pollen can potentially originate from a wide area that in highlands in particular can span several ecozones. Our results suggest that sedaDNA may provide information on restoration targets and the nature and magnitude of human-induced environmental changes, including in high conservation priority, biodiversity hotspots, where understanding of preanthropogenic impact (or reference) conditions is highly limited. © 2013 Society for Conservation Biology.

  12. Serum complement C3 strongly correlates with whole-body insulin sensitivity in rheumatoid arthritis.

    PubMed

    Ursini, Francesco; D'Angelo, Salvatore; Russo, Emilio; Arturi, Franco; D'Antona, Lucia; Bruno, Caterina; Naty, Saverio; De Sarro, Giovambattista; Olivieri, Ignazio; Grembiale, Rosa Daniela

    2017-01-01

    Rheumatoid arthritis (RA) is characterised by an excess of cardiovascular diseases (CVD) risk, attributable to a synergy between under-diagnosed traditional risk factors (i.e. insulin resistance) and inflammatory disease activity. The aim of the present study was to evaluate the correlation between inflammatory measures and insulin sensitivity in RA patients. Forty non-diabetic RA patients (19 males) were recruited. All patients underwent anthropometric measurements, laboratory evaluation and oral glucose tolerance test (OGTT). Insulin sensitivity index (ISI) was calculated with the equation proposed by Matsuda et al., from dynamic values of glucose and insulin obtained during OGTT. In the univariate analysis, lnISI correlated inversely with age, BMI, waist circumference, sBP, ESR, lnCRP and complement C3, but not with disease duration, dBP or complement C4. In non-obese patients (BMI <30 kg/m2, n=28), only age, BMI, lnCRP and C3 maintained their correlation with lnISI. In a stepwise multiple regression using lnISI as the dependent variable and BMI, age, lnCRP and complement C3 as predictors, only BMI and C3 entered the equation and accounted for 38.2% of the variance in lnISI. In non-obese patients, only C3 entered the regression equation, accounting for 32.2% of the variance in lnISI. Using a ROC curve, we identified the best cut-off for complement C3 of 1.22 g/L that yielded a sensitivity of 67% and a specificity of 79% for classification of insulin resistant patients. In RA patients, complement C3 correlates strongly with insulin sensitivity, in both obese and non-obese individuals.

  13. Complement Activation in Relation to Capillary Leakage in Children with Septic Shock and Purpura

    PubMed Central

    Hazelzet, Jan A.; de Groot, Ronald; van Mierlo, Gerard; Joosten, Koen F. M.; van der Voort, Edwin; Eerenberg, Anke; Suur, Marja H.; Hop, Wim C. J.; Hack, C. Erik

    1998-01-01

    To assess the relationship between capillary leakage and inflammatory mediators during sepsis, blood samples were taken on hospital admission, as well as 24 and 72 h later, from 52 children (median age, 3.3 years) with severe meningococcal sepsis, of whom 38 survived and 14 died. Parameters related to cytokines (interleukin 6 [IL-6] IL-8, plasma phospholipase A2, and C-reactive protein [CRP]), to neutrophil degranulation (elastase and lactoferrin), to complement activation (C3a, C3b/c, C4b/c, and C3- and C4-CRP complexes), and to complement regulation (functional and inactivated C1 inhibitor and C4BP) were determined. The degree of capillary leakage was derived from the amount of plasma infused and the severity of disease by assessing the pediatric risk of mortality (PRISM) score. Levels of IL-6, IL-8, C3b/c, C3-CRP complexes, and C4BP on admission, adjusted for the duration of skin lesions, were significantly different in survivors and nonsurvivors (C3b/c levels were on average 2.2 times higher in nonsurvivors, and C3-CRP levels were 1.9 times higher in survivors). Mortality was independently related to the levels of C3b/c and C3-CRP complexes. In agreement with this, levels of complement activation products correlated well with the PRISM score or capillary leakage. Thus, these data show that complement activation in patients with severe meningococcal sepsis is associated with a poor outcome and a more severe disease course. Further studies should reveal whether complement activation may be a target for therapeutical intervention in this disease. PMID:9784543

  14. Oxidative DNA Damage Bypass in Arabidopsis thaliana Requires DNA Polymerase λ and Proliferating Cell Nuclear Antigen 2[W

    PubMed Central

    Amoroso, Alessandra; Concia, Lorenzo; Maggio, Caterina; Raynaud, Cécile; Bergounioux, Catherine; Crespan, Emmanuele; Cella, Rino; Maga, Giovanni

    2011-01-01

    The oxidized base 7,8-oxoguanine (8-oxo-G) is the most common DNA lesion generated by reactive oxygen species. This lesion is highly mutagenic due to the frequent misincorporation of A opposite 8-oxo-G during DNA replication. In mammalian cells, the DNA polymerase (pol) family X enzyme DNA pol λ catalyzes the correct incorporation of C opposite 8-oxo-G, together with the auxiliary factor proliferating cell nuclear antigen (PCNA). Here, we show that Arabidopsis thaliana DNA pol λ, the only member of the X family in plants, is as efficient in performing error-free translesion synthesis past 8-oxo-G as its mammalian homolog. Arabidopsis, in contrast with animal cells, possesses two genes for PCNA. Using in vitro and in vivo approaches, we observed that PCNA2, but not PCNA1, physically interacts with DNA pol λ, enhancing its fidelity and efficiency in translesion synthesis. The levels of DNA pol λ in transgenic plantlets characterized by overexpression or silencing of Arabidopsis POLL correlate with the ability of cell extracts to perform error-free translesion synthesis. The important role of DNA pol λ is corroborated by the observation that the promoter of POLL is activated by UV and that both overexpressing and silenced plants show altered growth phenotypes. PMID:21325140

  15. Functional analysis of the putative peroxidase domain of FANCA, the Fanconi anemia complementation group A protein.

    PubMed

    Ren, J; Youssoufian, H

    2001-01-01

    Fanconi anemia (FA) is an autosomal recessive disorder manifested by chromosomal breakage, birth defects, and susceptibility to bone marrow failure and cancer. At least seven complementation groups have been identified, and the genes defective in four groups have been cloned. The most common subtype is complementation group A. Although the normal functions of the gene products defective in FA cells are not completely understood, a clue to the function of the FA group A gene product (FANCA) was provided by the detection of limited homology in the amino terminal region to a class of heme peroxidases. We evaluated this hypothesis by mutagenesis and functional complementation studies. We substituted alanine residues for the most conserved FANCA residues in the putative peroxidase domain and tested their effects on known biochemical and cellular functions of FANCA. While the substitution mutants were comparable to wild-type FANCA with regard to their stability, subcellular localization, and interaction with FANCG, only the Trp(183)-to-Ala substitution (W183A) abolished the ability of FANCA to complement the sensitivity of FA group A cells to mitomycin C. By contrast, TUNEL assays for apoptosis after exposure to H2O2 showed no differences between parental FA group A cells, cells complemented with wild-type FANCA, and cells complemented with the W183A of FANCA. Moreover, semiquantitative RT-PCR analysis for the expression of the peroxide-sensitive heme oxygenase gene showed appropriate induction after H2O2 exposure. Thus, W183A appears to be essential for the in vivo activity of FANCA in a manner independent of its interaction with FANCG. Moreover, neither wild-type FANCA nor the W183A mutation appears to alter the peroxide-induced apoptosisor peroxide-sensing ability of FA group A cells. Copyright 2001 Academic Press.

  16. Long-circulating DNA lipid nanocapsules as new vector for passive tumor targeting.

    PubMed

    Morille, Marie; Montier, Tristan; Legras, Pierre; Carmoy, Nathalie; Brodin, Priscille; Pitard, Bruno; Benoît, Jean-Pierre; Passirani, Catherine

    2010-01-01

    Systemic gene delivery systems are needed for therapeutic application to organs that are inaccessible by percutaneous injection. Currently, the main objective is the development of a stable and non-toxic vector that can encapsulate and deliver foreign genetic material to target cells. To this end, DNA, complexed with cationic lipids i.e. DOTAP/DOPE, was encapsulated into lipid nanocapsules (LNCs) leading to the formation of stable nanocarriers (DNA LNCs) with a size inferior to 130 nm. Amphiphilic and flexible poly (ethylene glycol) (PEG) polymer coatings [PEG lipid derivative (DSPE-mPEG(2000)) or F108 poloxamer] at different concentrations were selected to make DNA LNCs stealthy. Some of these coated lipid nanocapsules were able to inhibit complement activation and were not phagocytized in vitro by macrophagic THP-1 cells whereas uncoated DNA LNCs accumulated in the vacuolar compartment of THP-1 cells. These results correlated with a significant increase of in vivo circulation time in mice especially for DSPE-mPEG(2000) 10 mm and an early half-life time (t(1/2) of distribution) 5-fold greater than for non-coated DNA LNCs (7.1 h vs 1.4 h). Finally, a tumor accumulation assessed by in vivo fluorescence imaging system was evidenced for these coated LNCs as a passive targeting without causing any hepatic damage.

  17. Poly(ADP-ribose) Polymerase 1, PARP1, modifies EZH2 and inhibits EZH2 histone methyltransferase activity after DNA damage

    PubMed Central

    Lauretti, Elisabetta; Hulse, Michael; Siciliano, Micheal; Lupey-Green, Lena N.; Abraham, Aaron; Skorski, Tomasz; Tempera, Italo

    2018-01-01

    The enzyme Poly(ADP-ribose) polymerase 1 (PARP1) plays a very important role in the DNA damage response, but its role in numerous aspects is not fully understood. We recently showed that in the absence of DNA damage, PARP1 regulates the expression of the chromatin-modifying enzyme EZH2. Work from other groups has shown that EZH2 participates in the DNA damage response. These combined data suggest that EZH2 could be a target of PARP1 in both untreated and genotoxic agent-treated conditions. In this work we tested the hypothesis that, in response to DNA damage, PARP1 regulates EZH2 activity. Here we report that PARP1 regulates EZH2 activity after DNA damage. In particular, we find that EZH2 is a direct target of PARP1 upon induction of alkylating and UV-induced DNA damage in cells and in vitro. PARylation of EZH2 inhibits EZH2 histone methyltransferase (H3K27me) enzymatic activity. We observed in cells that the induction of PARP1 activity by DNA alkylating agents decreases the association of EZH2 with chromatin, and PARylation of histone H3 reduces EZH2 affinity for its target histone H3. Our findings establish that PARP1 and PARylation are important regulators of EZH2 function and link EZH2-mediated heterochromatin formation, DNA damage and PARylation. These findings may also have clinical implications, as they suggest that inhibitors of EZH2 can improve anti-tumor effects of PARP1 inhibitors in BRCA1/2-deficient cancers. PMID:29535829

  18. Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

    NASA Astrophysics Data System (ADS)

    Moktan, Hem; Pezza, Roberto; Zhou, Donghua

    2015-03-01

    The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

  19. Smallpox Inhibitor of Complement Enzymes (SPICE): Dissecting Functional Sites and Abrogating Activity1

    PubMed Central

    Liszewski, M. Kathryn; Leung, Marilyn K.; Hauhart, Richard; Fang, Celia J.; Bertram, Paula; Atkinson, John P.

    2010-01-01

    Although smallpox was eradicated as a global illness more than 30 years ago, variola virus and other related pathogenic poxviruses, such as monkeypox, remain potential bioterrorist weapons or could re-emerge as natural infections. Poxviruses express virulence factors that down-modulate the host’s immune system. We previously compared functional profiles of the poxviral complement inhibitors of smallpox, vaccinia, and monkeypox known as SPICE, VCP (or VICE), and MOPICE, respectively. SPICE was the most potent regulator of human complement and attached to cells via glycosaminoglycans. The major goals of the present study were to further characterize the complement regulatory and heparin binding sites of SPICE and to evaluate a mAb that abrogates its function. Using substitution mutagenesis, we established that (1) elimination of the three heparin binding sites severely decreases but does not eliminate glycosaminoglycan binding, (2) there is a hierarchy of activity for heparin binding among the three sites, and (3) complement regulatory sites overlap with each of the three heparin binding motifs. By creating chimeras with interchanges of SPICE and VCP residues, a combination of two SPICE amino acids (H77 plus K120) enhances VCP activity ~200-fold. Also, SPICE residue L131 is critical for both complement regulatory function and accounts for the electrophoretic differences between SPICE and VCP. An evolutionary history for these structure-function adaptations of SPICE is proposed. Finally, we identified and characterized a mAb that inhibits the complement regulatory activity of SPICE, MOPICE, and VCP and thus could be used as a therapeutic agent. PMID:19667083

  20. Cytophotometric and biochemical analyses of DNA in pentaploid and diploid Agave species.

    PubMed

    Cavallini, A; Natali, L; Cionini, G; Castorena-Sanchez, I

    1996-04-01

    Nuclear DNA content, chromatin structure, and DNA composition were investigated in four Agave species: two diploid, Agave tequilana Weber and Agave angustifolia Haworth var. marginata Hort., and two pentaploid, Agave fourcroydes Lemaire and Agave sisalana Perrine. It was determined that the genome size of pentaploid species is nearly 2.5 times that of diploid ones. Cytophotometric analyses of chromatin structure were performed following Feulgen or DAPI staining to determine optical density profiles of interphase nuclei. Pentaploid species showed higher frequencies of condensed chromatin (heterochromatin) than diploid species. On the other hand, a lower frequency of A-T rich (DAPI stained) heterochromatin was found in pentaploid species than in diploid ones, indicating that heterochromatin in pentaploid species is made up of sequences with base compositions different from those of diploid species. Since thermal denaturation profiles of extracted DNA showed minor variations in the base composition of the genomes of the four species, it is supposed that, in pentaploid species, the large heterochromatin content is not due to an overrepresentation of G-C repetitive sequences but rather to the condensation of nonrepetitive sequences, such as, for example, redundant gene copies switched off in the polyploid complement. It is suggested that speciation in the genus Agave occurs through point mutations and minor DNA rearrangements, as is also indicated by the relative stability of the karyotype of this genus. Key words : Agave, DNA cytophotometry, DNA melting profiles, chromatin structure, genome size.

  1. Selective detection of Mg2+ ions via enhanced fluorescence emission using Au–DNA nanocomposites

    PubMed Central

    Basu, Tanushree; Rana, Khyati; Das, Niranjan

    2017-01-01

    The biophysical properties of DNA-modified Au nanoparticles (AuNPs) have attracted a great deal of research interest for various applications in biosensing. AuNPs have strong binding capability to the phosphate and sugar groups in DNA, rendering unique physicochemical properties for detection of metal ions. The formation of Au–DNA nanocomposites is evident from the observed changes in the optical absorption, plasmon band, zeta potential, DLS particle size distribution, as well as TEM and AFM surface morphology analysis. Circular dichroism studies also revealed that DNA-functionalized AuNP binding caused a conformational change in the DNA structure. Due to the size and shape dependent plasmonic interactions of AuNPs (33–78 nm) with DNA, the resultant Au–DNA nanocomposites (NCs) exhibit superior fluorescence emission due to chemical binding with Ca2+, Fe2+ and Mg2+ ions. A significant increase in fluorescence emission (λex = 260 nm) of Au–DNA NCs was observed after selectively binding with Mg2+ ions (20–800 ppm) in an aqueous solution where a minimum of 100 ppm Mg2+ ions was detected based on the linearity of concentration versus fluorescence intensity curve (λem = 400 nm). The effectiveness of Au–DNA nanocomposites was further verified by comparing the known concentration (50–120 ppm) of Mg2+ ions in synthetic tap water and a real life sample of Gelusil (300–360 ppm Mg2+), a widely used antacid medicine. Therefore, this method could be a sensitive tool for the estimation of water hardness after careful preparation of a suitably designed Au–DNA nanostructure. PMID:28487819

  2. High-Resolution Mapping of Changes in Histone-DNA Contacts of Nucleosomes Remodeled by ISW2

    PubMed Central

    Kassabov, Stefan R.; Henry, Nathalia M.; Zofall, Martin; Tsukiyama, Toshio; Bartholomew, Blaine

    2002-01-01

    The imitation switch (ISWI) complex from yeast containing the Isw2 and Itc1 proteins was shown to preferentially slide mononucleosomes with as little as 23 bp of linker DNA from the end to the center of DNA. The contacts of unique residues in the histone fold regions of H4, H2B, and H2A with DNA were determined with base pair resolution before and after chromatin remodeling by a site-specific photochemical cross-linking approach. The path of DNA and the conformation of the histone octamer in the nucleosome remodeled or slid by ISW2 were not altered, because after adjustment for the new translational position, the DNA contacts at specific sites in the histone octamer had not been changed. Maintenance of the canonical nucleosome structure after sliding was also demonstrated by DNA photoaffinity labeling of histone proteins at specific sites within the DNA template. In addition, nucleosomal DNA does not become more accessible during ISW2 remodeling, as assayed by restriction endonuclease cutting. ISW2 was also shown to have the novel capability of counteracting transcriptional activators by sliding nucleosomes through Gal4-VP16 bound initially to linker DNA and displacing the activator from DNA. PMID:12370299

  3. Inhibition of DNA binding of Sox2 by the SUMO conjugation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuruzoe, Shu; Ishihara, Ko; Uchimura, Yasuhiro

    2006-12-29

    Sox2 is a member of the high mobility group (HMG) domain DNA-binding proteins for transcriptional control and chromatin architecture. The HMG domain of Sox2 binds the DNA to facilitate transactivation by the cooperative transcription factors such as Oct3/4. We report that mouse Sox2 is modified by SUMO at lysine 247. Substitution of the target lysine to arginine lost the sumoylation but little affected transcriptional potential or nuclear localization of Sox2. By contrast with the unmodified form, Sox2 fused to SUMO-1 did not augment transcription via the Fgf4 enhancer in the presence of Oct3/4. Further, SUMO-1-conjugated Sox2 at the lysine 247more » or at the carboxyl terminus reduced the binding to the Fgf4 enhancer. These indicate that Sox2 sumoylation negatively regulates its transcriptional role through impairing the DNA binding.« less

  4. Mesophilic Aeromonas sp. serogroup O:11 resistance to complement-mediated killing.

    PubMed Central

    Merino, S; Rubires, X; Aguilar, A; Albertí, S; Hernandez-Allés, S; Benedí, V J; Tomas, J M

    1996-01-01

    The complement activation by and resistance to complement-mediated killing of Aeromonas sp. strains from serogroup O:11 were investigated by using different wild-type strains (with an S-layer characteristic of this serogroup) and their isogenic mutants characterized for their surface components (S-layer and lipopolysaccharide [LPS]). All of the Aeromonas sp. serogroup O:11 wild-type strains are unable to activate complement, which suggested that the S-layer completely covered the LPS molecules. We found that the classical complement pathway is involved in serum killing of susceptible Aeromonas sp. mutant strains of serogroup O11, while the alternative complement pathway seems not to be involved, and that the complement activation seems to be independent of antibody. The smooth mutant strains devoid of the S-layer (S-layer isogenic mutants) or isogenic LPS mutant strains with a complete or rather complete LPS core (also without the S-layer) are able to activate complement but are resistant to complement-mediated killing. The reasons for this resistance are that C3b is rapidly degraded, and therefore the lytic membrane attack complex (C5b-9) is not formed. Isogenic LPS rough mutants with an incomplete LPS core are serum sensitive because they bind more C3b than the resistant strains, the C3b is not completely degraded, and therefore the lytic complex (C5b-9) is formed. PMID:8945581

  5. Terminal Complement Blockade after Hematopoietic Stem Cell Transplantation Is Safe without Meningococcal Vaccination.

    PubMed

    Jodele, Sonata; Dandoy, Christopher E; Danziger-Isakov, Lara; Myers, Kasiani C; El-Bietar, Javier; Nelson, Adam; Wallace, Gregory; Teusink-Cross, Ashley; Davies, Stella M

    2016-07-01

    Eculizumab inhibits terminal complement-mediated intravascular hemolysis in patients with paroxysmal nocturnal hemoglobinuria and complement-mediated thrombotic microangiopathy (TMA) in patients with atypical hemolytic uremic syndrome and is now used as a first-line therapy in these diseases. Eculizumab is available only through a restricted program under a Risk Evaluation and Mitigation Strategy (REMS) because of an increased risk of meningococcal infections in persons without adequate functional complement. Administration of meningococcal vaccine is required at least 2 weeks before administering the first dose of eculizumab, and this advice is included in the product label. Eculizumab use for treatment of TMA in hematopoietic stem cell transplantation (HSCT) recipients brings a significant dilemma regarding REMS required meningococcal vaccination. TMA after HSCT usually occurs within the first 100 days after transplantation when patients are severely immunocompromised and are not able to mount a response to vaccines. We evaluated 30 HSCT recipients treated with eculizumab for high-risk TMA without meningococcal vaccine. All patients received antimicrobial prophylaxis adequate for Neisseria meningitides during eculizumab therapy and for 8 weeks after discontinuation of the drug. Median time to TMA diagnosis was 28 days after transplant (range, 13.8 to 48.5). Study subjects received a median of 14 eculizumab doses (range, 2 to 38 doses) for HSCT-associated TMA therapy. There were no incidences of meningococcal infections. The incidences of bacterial and fungal bloodstream infections were similar in patients treated with eculizumab (n = 30) as compared with those with HSCT-associated TMA who did not receive any complement blocking therapy (n = 39). Our data indicate that terminal complement blockade in the early post-transplant period can be performed without meningococcal vaccination while using appropriate antimicrobial prophylaxis until complement

  6. Complement in the Initiation and Evolution of Rheumatoid Arthritis

    PubMed Central

    Holers, V. Michael; Banda, Nirmal K.

    2018-01-01

    The complement system is a major component of the immune system and plays a central role in many protective immune processes, including circulating immune complex processing and clearance, recognition of foreign antigens, modulation of humoral and cellular immunity, removal of apoptotic and dead cells, and engagement of injury resolving and tissue regeneration processes. In stark contrast to these beneficial roles, however, inadequately controlled complement activation underlies the pathogenesis of human inflammatory and autoimmune diseases, including rheumatoid arthritis (RA) where the cartilage, bone, and synovium are targeted. Recent studies of this disease have demonstrated that the autoimmune response evolves over time in an asymptomatic preclinical phase that is associated with mucosal inflammation. Notably, experimental models of this disease have demonstrated that each of the three major complement activation pathways plays an important role in recognition of injured joint tissue, although the lectin and amplification pathways exhibit particularly impactful roles in the initiation and amplification of damage. Herein, we review the complement system and focus on its multi-factorial role in human patients with RA and experimental murine models. This understanding will be important to the successful integration of the emerging complement therapeutics pipeline into clinical care for patients with RA. PMID:29892280

  7. Covalent trapping of human DNA polymerase beta by the oxidative DNA lesion 2-deoxyribonolactone.

    PubMed

    DeMott, Michael S; Beyret, Ergin; Wong, Donny; Bales, Brian C; Hwang, Jae-Taeg; Greenberg, Marc M; Demple, Bruce

    2002-03-08

    Oxidized abasic residues in DNA constitute a major class of radiation and oxidative damage. Free radical attack on the nucleotidyl C-1' carbon yields 2-deoxyribonolactone (dL) as a significant lesion. Although dL residues are efficiently incised by the main human abasic endonuclease enzyme Ape1, we show here that subsequent excision by human DNA polymerase beta is impaired at dL compared with unmodified abasic sites. This inhibition is accompanied by accumulation of a protein-DNA cross-link not observed in reactions of polymerase beta with unmodified abasic sites, although a similar form can be trapped by reduction with sodium borohydride. The formation of the stably cross-linked species with dL depends on the polymerase lysine 72 residue, which forms a Schiff base with the C-1 aldehyde during excision of an unmodified abasic site. In the case of a dL residue, attack on the lactone C-1 by lysine 72 proceeds more slowly and evidently produces an amide linkage, which resists further processing. Consequently dL residues may not be readily repaired by "short-patch" base excision repair but instead function as suicide substrates in the formation of protein-DNA cross-links that may require alternative modes of repair.

  8. Host DNA released by NETosis promotes rhinovirus-induced type 2 allergic asthma exacerbation

    PubMed Central

    Toussaint, Marie; Jackson, David J; Swieboda, Dawid; Guedán, Anabel; Tsourouktsoglou, Theodora-Dorita; Ching, Yee Man; Radermecker, Coraline; Makrinioti, Heidi; Aniscenko, Julia; Edwards, Michael R; Solari, Roberto; Farnir, Frédéric; Papayannopoulos, Venizelos; Bureau, Fabrice; Marichal, Thomas; Johnston, Sebastian L

    2018-01-01

    Respiratory viral infections represent the most common cause of allergic asthma exacerbations. Amplification of type 2 immune response is strongly implicated in asthma exacerbation, but how virus infection boosts type 2 responses is poorly understood. We report a significant correlation between release of host double stranded DNA (dsDNA) following rhinovirus infection and exacerbation of type 2 allergic inflammation in humans. In a mouse model of allergic airway hypersensitivity, we show that rhinovirus infection triggers dsDNA release associated with neutrophil extracellular traps (NETs) formation (NETosis). We further demonstrate that inhibiting NETosis by blocking neutrophil elastase, or degrading NETs with DNase protects mice from type 2 immunopathology. Furthermore, injection of mouse genomic DNA alone is sufficient to recapitulate many features of rhinovirus-induced type 2 immune responses and asthma pathology. Thus, NETosis and its associated extracellular dsDNA contribute to the pathogenesis and may represent potential therapeutic targets of rhinovirus-induced asthma exacerbations. PMID:28459437

  9. Clinical heterogeneity within xeroderma pigmentosum associated with mutations in the DNA repair and transcription gene ERCC3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vermeulen, W.; Kleijer, W.J.; Bootsma, D.

    1994-02-01

    The human DNA excision repair gene ERCC3 specifically corrects the nucleotide excision repair (NER) defect of xeroderma pigmentosum (XP) complementation group B. In addition to its function in NER, the ERCC3 DNA helicase was recently identified as one of the components of the human BTF2/TFIIH transcription factor complex, which is required for initiation of transcription of class II genes. To date, a single patient (XP11BE) has been assigned to this XP group B (XP-B), with the remarkable conjunction of two autosomal recessive DNA repair deficiency disorders: XP and Cockayne syndrome (CS). The intriguing involvement of the ERCC3 protein in themore » vital process of transcription may provide an explanation for the rarity, severity, and wide spectrum of clinical features in this complementation group. Here the authors report the identification of two new XP-B patients: XPCS1BA and XPCS2BA (siblings), by microneedle injection of the cloned ERCC3 repair gene as well as by cell hybridization. Molecular analysis of the ERCC3 gene in both patients revealed a single base substitution causing a missense mutation in a region that is completely conserved in yeast, Drosophila, mouse, and human ERCC3. As in patient XP11BE, the expression of only one allele (paternal) is detected. The mutation causes a virtually complete inactivation of the NER function of the protein. Despite this severe NER defect, both patients display a late onset of neurologic impairment, mild cutaneous symptoms, and a striking absence of skin tumors even at an age of >40 years. Analysis of the frequency of hprt[sup [minus

  10. Mechanism of degradation of 2'-deoxycytidine by formamide: implications for chemical DNA sequencing procedures.

    PubMed

    Saladino, R; Crestini, C; Mincione, E; Costanzo, G; Di Mauro, E; Negri, R

    1997-11-01

    We describe the reaction of formamide with 2'-deoxycytidine to give pyrimidine ring opening by nucleophilic addition on the electrophilic C(6) and C(4) positions. This information is confirmed by the analysis of the products of formamide attack on 2'-deoxycytidine, 5-methyl-2'-deoxycytidine, and 5-bromo-2'-deoxycytidine, residues when the latter are incorporated into oligonucleotides by DNA polymerase-driven polymerization and solid-phase phosphoramidite procedure. The increased sensitivity of 5-bromo-2'-deoxycytidine relative to that of 2'-deoxycytidine is pivotal for the improvement of the one-lane chemical DNA sequencing procedure based on the base-selective reaction of formamide with DNA. In many DNA sequencing cases it will in fact be possible to incorporate this base analogue into the DNA to be sequenced, thus providing a complete discrimination between its UV absorption signal and that of the thymidine residues. The wide spectrum of different sensitivities to formamide displayed by the 2'-deoxycytidine analogues solves, in the DNA single-lane chemical sequencing procedure, the possible source of errors due to low discrimination between C and T residues.

  11. (CAG)(n)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition.

    PubMed

    Owen, Barbara A L; Yang, Zungyoon; Lai, Maoyi; Gajec, Maciej; Gajek, Maciez; Badger, John D; Hayes, Jeffrey J; Edelmann, Winfried; Kucherlapati, Raju; Wilson, Teresa M; McMurray, Cynthia T

    2005-08-01

    Cells have evolved sophisticated DNA repair systems to correct damaged DNA. However, the human DNA mismatch repair protein Msh2-Msh3 is involved in the process of trinucleotide (CNG) DNA expansion rather than repair. Using purified protein and synthetic DNA substrates, we show that Msh2-Msh3 binds to CAG-hairpin DNA, a prime candidate for an expansion intermediate. CAG-hairpin binding inhibits the ATPase activity of Msh2-Msh3 and alters both nucleotide (ADP and ATP) affinity and binding interfaces between protein and DNA. These changes in Msh2-Msh3 function depend on the presence of A.A mispaired bases in the stem of the hairpin and on the hairpin DNA structure per se. These studies identify critical functional defects in the Msh2-Msh3-CAG hairpin complex that could misdirect the DNA repair process.

  12. Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

    PubMed

    Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Hernández-Laín, Aurelio; Coca-Robinot, David; Rivera, Henry; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, MiguelÁngel; Martínez-Azorín, Francisco

    2016-02-29

    Whole-exome sequencing (WES) was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase (CK), deficiency of mitochondrial complex III and depletion of mtDNA. With WES data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in Thymidine kinase 2 gene (TK2; NM_004614.4:c.323C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes (MDS). This patient presents an atypical TK2 related-myopathic form of MDS, because despite having a very low content of mtDNA (<20%), she presents a slower and less severe evolution of the disease. In conclusion, our data confirm the role of TK2 gene in MDS and expanded the phenotypic spectrum.

  13. Overexpression of the DNA mismatch repair factor, PMS2, confers hypermutability and DNA damage tolerance.

    PubMed

    Gibson, Shannon L; Narayanan, Latha; Hegan, Denise Campisi; Buermeyer, Andrew B; Liskay, R Michael; Glazer, Peter M

    2006-12-08

    Inherited defects in genes associated with DNA mismatch repair (MMR) have been linked to familial colorectal cancer. Cells deficient in MMR are genetically unstable and demonstrate a tolerance phenotype in response to certain classes of DNA damage. Some sporadic human cancers also show abnormalities in MMR gene function, typically due to diminished expression of one of the MutL homologs, MLH1. Here, we report that overexpression of the MutL homolog, human PMS2, can also cause a disruption of the MMR pathway in mammalian cells, resulting in hypermutability and DNA damage tolerance. A mouse fibroblast cell line carrying a recoverable lambda phage shuttle vector for mutation detection was transfected with either a vector designed to express hPMS2 or with an empty vector control. Cells overexpressing hPMS2 were found to have elevated spontaneous mutation frequencies at the cII reporter gene locus. They also showed an increase in the level of mutations induced by the alkylating agent, methynitrosourea (MNU). Clonogenic survival assays demonstrated increased survival of the PMS2-overexpressing cells following exposure to MNU, consistent with the induction of a damage tolerance phenotype. Similar results were seen in cells expressing a mutant PMS2 gene, containing a premature stop codon at position 134 and representing a variant found in an individual with familial colon cancer. These results show that dysregulation of PMS2 gene expression can disrupt MMR function in mammalian cells and establish an additional carcinogenic mechanism by which cells can develop genetic instability and acquire resistance to cytotoxic cancer therapies.

  14. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

    PubMed

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

    2003-10-01

    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  15. 21 CFR 866.5260 - Complement C3b inactivator immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... immunochemical techniques the complement C3b inactivator (a plasma protein) in serum. Complement is a group of serum proteins that destroy infectious agents. Measurement of complement C3b inactivator aids in the...

  16. 21 CFR 866.5260 - Complement C3b inactivator immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... immunochemical techniques the complement C3b inactivator (a plasma protein) in serum. Complement is a group of serum proteins that destroy infectious agents. Measurement of complement C3b inactivator aids in the...

  17. 21 CFR 866.5260 - Complement C3b inactivator immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... immunochemical techniques the complement C3b inactivator (a plasma protein) in serum. Complement is a group of serum proteins that destroy infectious agents. Measurement of complement C3b inactivator aids in the...

  18. 21 CFR 866.5260 - Complement C3b inactivator immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... immunochemical techniques the complement C3b inactivator (a plasma protein) in serum. Complement is a group of serum proteins that destroy infectious agents. Measurement of complement C3b inactivator aids in the...

  19. The effects of DNA supercoiling on G-quadruplex formation.

    PubMed

    Sekibo, Doreen A T; Fox, Keith R

    2017-12-01

    Guanine-rich DNAs can fold into four-stranded structures that contain stacks of G-quartets. Bioinformatics studies have revealed that G-rich sequences with the potential to adopt these structures are unevenly distributed throughout genomes, and are especially found in gene promoter regions. With the exception of the single-stranded telomeric DNA, all genomic G-rich sequences will always be present along with their C-rich complements, and quadruplex formation will be in competition with the corresponding Watson-Crick duplex. Quadruplex formation must therefore first require local dissociation (melting) of the duplex strands. Since negative supercoiling is known to facilitate the formation of alternative DNA structures, we have investigated G-quadruplex formation within negatively supercoiled DNA plasmids. Plasmids containing multiple copies of (G3T)n and (G3T4)n repeats, were probed with dimethylsulphate, potassium permanganate and S1 nuclease. While dimethylsulphate footprinting revealed some evidence for G-quadruplex formation in (G3T)n sequences, this was not affected by supercoiling, and permanganate failed to detect exposed thymines in the loop regions. (G3T4)n sequences were not protected from DMS and showed no reaction with permanganate. Similarly, both S1 nuclease and 2D gel electrophoresis of DNA topoisomers did not detect any supercoil-dependent structural transitions. These results suggest that negative supercoiling alone is not sufficient to drive G-quadruplex formation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. DNA-Targeted 2-Nitroimidazoles: Studies of the Influence of the Phenanthridine-Linked Nitroimidazoles, 2-NLP-3 and 2-NLP-4, on DNA Damage Induced by Ionizing Radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchko, Garry W.; Weinfeld, Michael

    The nitroimidazole-linked phenanthridines 2-NLP-3 (5-[3-(2-nitro-1-imidazoyl)-propyl]-phenanthridinium bromide) and 2-NLP-4 (5-[3-(2-nitro-1-imidazoyl)-butyl1]-phenanthridinium bromide) are composed of the radiosensitizer, 2-nitroimidazole, attached to the DNA intercalator phenanthridine via a 3- and 4-carbon linker, respectively. Previous in vitro assays show both compounds to be 10 - 100 times more efficient as hypoxic cell radiosensitizer, misonidazole[Cowan et al., Radiat. Res. 127, 81-89, 1991]. Here we have used a 32P postlabeling assay and 5'-end labeled oligonucleotide assay to compare the radiogenic DNA damage generated in the presence of 2-NLP-3, 2-NLP-4 compared to irradiation in the presence of misonidazole. This may account, at least in part, for the greatermore » cellular radiosensitization shown by the nitroimidazole-linked phenanthridines over misonidazole.« less