Science.gov

Sample records for dr agostinho neto

  1. Publications for Chiara Neto Lee, T., Hendy, S., Neto, C. (2015). Control of nanoparticle

    E-print Network

    Müller, Dietmar

    2015-01-01

    Publications for Chiara Neto 2015 Lee, T., Hendy, S., Neto, C. (2015). Control of nanoparticle] Ghezzi, M., Thickett, S., Telford, A., Easton, C., Meagher, L., Neto, C. (2014). Protein Micropatterns of proteins by thin polymer film dewetting. Soft Matter, 9(9), 2598- 2602.

  2. Nome Inscrio ABRAO MERIJ NETO 395

    E-print Network

    1 / 14 Nome Inscrição ABRAO MERIJ NETO 395 ADAIANA FRANCISCA GOMES DA SILVA 325 ADENILSON JOSÉ ADRIANA REIS 1505 ADRIANO BITTAR 471 ADRIANO CAVALCA ALVES 90 ADRIANO DE MOURA 253 ADRIANO GONÇALVES DOS REIS 619 ADRIANO SENE GONÇALVES 1466 AFONSO KOUJI SAKAMOTO 492 AGNALDO VIEIRA DIAS 970 AILTON PEREIRA

  3. Jeronimo Gomes Da Silva Neto Curriculum Vitae

    E-print Network

    Hopkins, William A.

    , U.S. Fish and Wildlife Service Back Bay National Wildlife Refuge, VA. May 2013 ­ September 2013 LeadJeronimo Gomes Da Silva Neto Curriculum Vitae Hellbender Field Technician Wildlife Ecotoxicology and Physiology Ecology Program Department of Fish and Wildlife Conservation, Virginia Tech, VA EDUCATION Virginia

  4. Neto-Mediated Intracellular Interactions Shape Postsynaptic Composition at the Drosophila Neuromuscular Junction

    PubMed Central

    Ramos, Cathy I.; Igiesuorobo, Oghomwen; Wang, Qi; Serpe, Mihaela

    2015-01-01

    The molecular mechanisms controlling the subunit composition of glutamate receptors are crucial for the formation of neural circuits and for the long-term plasticity underlying learning and memory. Here we use the Drosophila neuromuscular junction (NMJ) to examine how specific receptor subtypes are recruited and stabilized at synaptic locations. In flies, clustering of ionotropic glutamate receptors (iGluRs) requires Neto (Neuropillin and Tolloid-like), a highly conserved auxiliary subunit that is essential for NMJ assembly and development. Drosophila neto encodes two isoforms, Neto-? and Neto-?, with common extracellular parts and distinct cytoplasmic domains. Mutations that specifically eliminate Neto-? or its intracellular domain were generated. When Neto-? is missing or is truncated, the larval NMJs show profound changes in the subtype composition of iGluRs due to reduced synaptic accumulation of the GluRIIA subunit. Furthermore, neto-? mutant NMJs fail to accumulate p21-activated kinase (PAK), a critical postsynaptic component implicated in the synaptic stabilization of GluRIIA. Muscle expression of either Neto-? or Neto-? rescued the synaptic transmission at neto null NMJs, indicating that Neto conserved domains mediate iGluRs clustering. However, only Neto-? restored PAK synaptic accumulation at neto null NMJs. Thus, Neto engages in intracellular interactions that regulate the iGluR subtype composition by preferentially recruiting and/or stabilizing selective receptor subtypes. PMID:25905467

  5. The auxiliary subunits Neto1 and Neto2 have distinct, subunit-dependent effects at recombinant GluK1- and GluK2-containing kainate receptors.

    PubMed

    Fisher, Janet L

    2015-12-01

    The kainate-type of ionotropic glutamate receptors are assembled from a combination of five different pore-forming subunits (GluK1-5), which confer distinct functional and pharmacological properties. These receptors are also modulated by co-assembly with the auxiliary subunits Neto1 and Neto2. To determine the impact of variation in subunit composition on the functional interaction between kainate receptors and Neto subunits, the Neto subunits were combined with either GluK1 or GluK2 in HEK-293T cells and responses to glutamate examined through patch-clamp recordings. Co-expression of GluK1 with either Neto1 or Neto2 caused a substantial increase in glutamate sensitivity and a slowing of the onset of desensitization at low agonist concentrations. However, at higher glutamate concentrations the primary effect of Neto2 was to slow the onset of desensitization, while that of Neto1 was to increase recovery from desensitization. In contrast, co-expression of Neto2 with GluK2 homomeric receptors had only modest effects on glutamate sensitivity, but increased the rate of recovery from desensitization as well as slowing its onset at all agonist concentrations. The properties of chimeric Neto1/Neto2 subunits suggested that the extracellular N-terminal region including the two CUB domains was largely responsible for the distinct regulatory effects of Neto1 and Neto2 on the desensitization properties of GluK1 homomeric receptors. These results further demonstrate that the functional effects of Neto subunits depend upon the subunit identity of both the auxiliary and the pore-forming subunits. PMID:26277340

  6. Prodomain Removal Enables Neto to Stabilize Glutamate Receptors at the Drosophila Neuromuscular Junction

    PubMed Central

    Kim, Young-Jun; Igiesuorobo, Oghomwen; Ramos, Cathy I.; Bao, Hong; Zhang, Bing; Serpe, Mihaela

    2015-01-01

    Stabilization of neurotransmitter receptors at postsynaptic specializations is a key step in the assembly of functional synapses. Drosophila Neto (Neuropillin and Tolloid-like protein) is an essential auxiliary subunit of ionotropic glutamate receptor (iGluR) complexes required for the iGluRs clustering at the neuromuscular junction (NMJ). Here we show that optimal levels of Neto are crucial for stabilization of iGluRs at synaptic sites and proper NMJ development. Genetic manipulations of Neto levels shifted iGluRs distribution to extrajunctional locations. Perturbations in Neto levels also produced small NMJs with reduced synaptic transmission, but only Neto-depleted NMJs showed diminished postsynaptic components. Drosophila Neto contains an inhibitory prodomain that is processed by Furin1-mediated limited proteolysis. neto null mutants rescued with a Neto variant that cannot be processed have severely impaired NMJs and reduced iGluRs synaptic clusters. Unprocessed Neto retains the ability to engage iGluRs in vivo and to form complexes with normal synaptic transmission. However, Neto prodomain must be removed to enable iGluRs synaptic stabilization and proper postsynaptic differentiation. PMID:25723514

  7. Neto2-null mice have impaired GABAergic inhibition and are susceptible to seizures

    PubMed Central

    Mahadevan, Vivek; Dargaei, Zahra; Ivakine, Evgueni A.; Hartmann, Anna-Maria; Ng, David; Chevrier, Jonah; Ormond, Jake; Nothwang, Hans Gerd; McInnes, Roderick R.; Woodin, Melanie A.

    2015-01-01

    Neto2 is a transmembrane protein that interacts with the neuron-specific K+-Cl? cotransporter (KCC2) in the central nervous system (CNS). Efficient KCC2 transport is essential for setting the neuronal Cl? gradient, which is required for fast GABAergic inhibition. Neto2 is required to maintain the normal abundance of KCC2 in neurons, and increases KCC2 function by binding to the active oligomeric form of this cotransporter. In the present study, we characterized GABAergic inhibition and KCC2-mediated neuronal chloride homeostasis in pyramidal neurons from adult hippocampal slices. Using gramicidin perforated patch clamp recordings we found that the reversal potential for GABA (EGABA) was significantly depolarized. We also observed that surface levels of KCC2 and phosphorylation of KCC2 serine 940 (Ser940) were reduced in Neto2?/? neurons compared to wild-type controls. To examine GABAergic inhibition we recorded spontaneous inhibitory postsynaptic currents (sIPSCs) and found that Neto2?/? neurons had significant reductions in both their amplitude and frequency. Based on the critical role of Neto2 in regulating GABAergic inhibition we rationalized that Neto2-null mice would be prone to seizure activity. We found that Neto2-null mice demonstrated a decrease in the latency to pentylenetetrazole (PTZ)-induced seizures and an increase in seizure severity. PMID:26441539

  8. JOINT STATE AND PARAMETER ESTIMATION FOR BOOLEAN DYNAMICAL SYSTEMS Ulisses Braga-Neto

    E-print Network

    Braga-Neto, Ulisses

    JOINT STATE AND PARAMETER ESTIMATION FOR BOOLEAN DYNAMICAL SYSTEMS Ulisses Braga-Neto Department the application of the BKF in the context of the well-known paradigm of joint estimation of state and pa- rameters in the context of joint state and parameter estimation [2, 3], by introducing a parameter pro- cess and auxiliary

  9. Trajectories of Spectral Clusters of HRV Related to Myocardial Ischemic J. Souza Neto1

    E-print Network

    Carvalho, João Luiz

    Trajectories of Spectral Clusters of HRV Related to Myocardial Ischemic Episodes J. Souza Neto1 freqüência cardíaca (HRV) antes, durante e após episódios isquêmicos miocárdicos transitórios e prolongados episódio. Palavras-chave: Escalogramas, Wavelets, CWT, Tempo-escala, Tempo-freqüência, HRV, Isquemia

  10. Neto1 Is a Novel CUB-Domain NMDA Receptor–Interacting Protein Required for Synaptic Plasticity and Learning

    PubMed Central

    Szilard, Rachel K; Sertié, Andréa; Kanisek, Marijana; Clapcote, Steven J; Lipina, Tatiana; Kalia, Lorraine V; Joo, Daisy; McKerlie, Colin; Cortez, Miguel; Roder, John C; Salter, Michael W; McInnes, Roderick R

    2009-01-01

    The N-methyl-D-aspartate receptor (NMDAR), a major excitatory ligand-gated ion channel in the central nervous system (CNS), is a principal mediator of synaptic plasticity. Here we report that neuropilin tolloid-like 1 (Neto1), a complement C1r/C1s, Uegf, Bmp1 (CUB) domain-containing transmembrane protein, is a novel component of the NMDAR complex critical for maintaining the abundance of NR2A-containing NMDARs in the postsynaptic density. Neto1-null mice have depressed long-term potentiation (LTP) at Schaffer collateral-CA1 synapses, with the subunit dependency of LTP induction switching from the normal predominance of NR2A- to NR2B-NMDARs. NMDAR-dependent spatial learning and memory is depressed in Neto1-null mice, indicating that Neto1 regulates NMDA receptor-dependent synaptic plasticity and cognition. Remarkably, we also found that the deficits in LTP, learning, and memory in Neto1-null mice were rescued by the ampakine CX546 at doses without effect in wild-type. Together, our results establish the principle that auxiliary proteins are required for the normal abundance of NMDAR subunits at synapses, and demonstrate that an inherited learning defect can be rescued pharmacologically, a finding with therapeutic implications for humans. PMID:19243221

  11. Dr. Dean W. Ahrenholz Dr. M. James Allen

    E-print Network

    . Fogarty Dr. Malcolm P. Francis Dr. R.I.C.C. Francis Dr. Ken Gerow Dr. Carter Gilbert Dr. V. Guillory Dr. William G. Pearcy Dr. Jerome J. Pella Dr. Michael A. Perez Dr. Randall M. Peterman Dr. Bruce F. Phillips Regner Dr. R. Anne Richards Dr. William J. Richards 884 #12;dr. Linda R. Richardson Dr. T.A. Rien Dr

  12. Dr. David A. Ambrose Dr. Allen H. Andrews

    E-print Network

    . Bodkin Dr. Richard W. Brill Dr. Jon K.T. Brodziak Dr. Nancy Brown-Peterson Dr. John K. Carlson Dr737 Dr. David A. Ambrose Dr. Allen H. Andrews Dr. John Arnould Dr. Richard J. Beamish Dr. James L L. Domeier Dr. Miriam J. Doyle Mr. Nick K. Dulvy Dr. Anne-Marie Eklund Dr. Alan R. Everson Mr. John

  13. Dr. G.R. Abbe Dr. Pere Abello

    E-print Network

    . Robert J. Allman Mr. Michael D. Arendt Dr. Alexander I. Arkhipkin Dr. David A. Armstrong Dr. Colin. Michael Burton Dr. Morgan S. Busby Dr. Michael Canino Dr. John K. Carlson Dr. Milani Y. Chaloupka Dr. David M. Checkley Jr. Dr. Susan J. Chivers Dr. Phillip J. Clapham Dr. William Coles Mr. L. Alan Collins

  14. Sankalya Ambaaspitilya Dr. Randall Jeter

    E-print Network

    Rock, Chris

    -Bravo Tiffany Hopper Dr. Sandra Diamond Eric Howell Dr. Brenda Rodgers Nardana Esmaeili Dr. Hong Zhang Chun Dr. Chris Rock Narayan Kandel Dr. Jorge Salazar-Bravo Doug Knabe Dr. Gene Wilde Neha Kumari Dr. John Jaehyung Lee Dr. Lauren Gollahon Kyungwoo Lee Dr. Lauren Gollahon Sayani Mallick Dr. Chris Rock Raquel

  15. Dr. Wernher Von Braun with Dr. Christian Barnard.

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. Christian Barnard Tours Marshall Space Flight Center. Shown in Dr. Von Braun's office are (left to right): Dr. Ernst Sthulinger, a representative from General Electric, Dr. Wernher Von Braun, Dr. Christian Barnard, and Dr. Eberhard Rees.

  16. GEORGE BUSH DR HARVEYMITCHELLPWS

    E-print Network

    BUSH DR NAGLEST HARVEYMITCHELLPWS RAYMOND STOTZER PW STEXASAVTEXASAV BIZZELLST OLSENBL TURKRD BOYETTST DR TEXASAVS MAYWOODDR MILITARYMALL FARMSERVICERD NATALIE ST SIPPELRD WOODSON DR HOUSTONST GEORGE BUSH DR GEORGE BUSH DR COKEST CROSS ST BIZZELLST TEXASAVS On-Campus Game Day Routes Para Shuttle - 4 hrs

  17. HospitalDrDr To NC 54 West,

    E-print Network

    Damania, Blossom

    WestDr WILLIAM BLYTHE DR Vance St WestDr Medical DanielsDr NewEastDr EmergencyRoomDr BRANSON ST University Dr HospitalDr Bernard St Dauer Dr PharmacyLn Jackson Cir Dental Cir 11 13 3 3 10 5 7 17 9 6 12 8 Cardinal Parking Deck 11 Dogwood Parking Deck Structure 12 Jackson Circle Parking Deck 13 Ambulatory

  18. Large Customers (DR Sellers)

    SciTech Connect

    Kiliccot, Sila

    2011-10-25

    State of the large customers for demand response integration of solar and wind into electric grid; openADR; CAISO; DR as a pseudo generation; commercial and industrial DR strategies; California regulations

  19. Dr. Robert Atlas Director

    E-print Network

    Dr. Robert Atlas Director NOAA's Atlantic Oceanographic and Meteorological #12;AOML Internal Organization OAR's most diverse laboratory Director Dr. Robert (vacant) Computer Network Services Robert Kohler Communications Erica Rule AOML

  20. Herbert Ave BrooklaneDr

    E-print Network

    Jenny, Bernhard

    Dr NeabeackHillDr Fairhaven Dr Gar ryann a Dr OwlPl KingsBlvd 28th 33rd Pl Honeysuckle Princess Fern w o od 13th Pl Yukon WithamDr Hilltop 55th Gerold Bell Ave Mayberry Ave Lar k Pl DairyCenter Morris Ave

  1. Foucault and Dr. Ruth.

    ERIC Educational Resources Information Center

    LaFountain, Marc J.

    1989-01-01

    Expands Foucault's genealogy of the modern subject and morals, particularly as found in "The History of Sexuality." Focuses on the contemporary sex therapist Dr. Ruth, locating the phenomenon of Dr. Ruth within the matrix of power/knowledge and the political technology of the body. (SR)

  2. Dr. Daniel Carter

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Dr. Daniel Carter, president of New Century Pharmaceuticals in Huntsville, Al, is one of three principal investigators in NASA's microgravity protein crystal growth program. Dr. Carter's experties is in albumins. Albumins are proteins in the bloodstream that transport materials, drugs, nutrients, and wastes. Photo credit: NASA/Marshall Space Flight Center

  3. Dr. Wernher Von Braun

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Shown viewing the Apollo telescope mockup are, from left to right, Charles Donlan, deputy associate administrator for manned space flight; Dr. Wernher Von Braun, Marshall Space Flight Center director; William Horton, astrionics lab; Dr. Thomas Paine, NASA deputy administrator; Warner Kuers, director of the ME lab.

  4. Dr. Jaume Bacardit Curriculum Vitae

    E-print Network

    Bacardit, Jaume

    inflammation" Dr. J. Bacardit (Main supervisor), Dr. A. Mobasheri, Dr. D. Allaway BBSRC/W altham Centre for Pet Nutrition £74410 from BBSRC, £20000 from Waltham 2010 Principled Application of Learning Classifier Systems

  5. GEORGEBUSHDR. UNIVERSITY DR.

    E-print Network

    Pump COKE GEORGEBUSHDR. UNIVERSITY DR. SOUTHCOLLEGEAVE. BIZZELL BIZZELL NAGLE MILAM CROSS DOGWOOD) GEORGEBUSHDR. LEWIS LUBBOCK ELAMAR MOSHER CENTRALLAMAR NAGLE COKE THROCKMORTON COKE THROCKMORTON HOUSTON JONES EDUCATION CENTER DUNCAN HALL REED ARENA TTI COMMISSARY YMCA COKE WERC RICHARDSON DOHERTY CYCLOTRON REED

  6. Dr. Wernher Von Braun

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. Wernher Von Braun (right), Deputy Associate Administrator for Planning, National Aeronautics and Space Administration, inspects the mockup of the Saturn Workshop during a visit marking the 10th anniversary of the Marshall Center. Shown with Dr. Von Braun, from left to right, are Karl Heimburg, Director of the Astronautics Lab; Herman K. Weidner, Director of Science and Engineering, and George Hardy of the Astronautics Lab.

  7. Dr. Wernher Von Braun

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. Wernher Von Braun (right), Deputy Associate Administrator for planning, National Aeronautics and Space Administration, inspects the mockup of the Saturn Workshop during a visit marking the 10th anniversary of the Marshall Center. Shown with Dr. Von Braun, from left to right, are Karl Heimburg, Director of the astronautics lab; Herman K. Weidner, Director of Science and Engineering, and George Hardy of the Astronautics lab.

  8. Dr. von Braun Helicopter Tour

    NASA Technical Reports Server (NTRS)

    1968-01-01

    This photograph was published by the Marshall Space Flight Center (MSFC) on May 1, 1968. Dr. von Braun and Dr. Pain visited both the Michoud Assembly Facility (MAF) and the Mississippi Test Facility (MTF) via helicopter during their tour. This photograph shows Dr. von Braun, second from left, and Dr. Pain, far right, arriving at the MAF heliport.

  9. 1. View of three detection radar (DR) antennas. DR 1 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. View of three detection radar (DR) antennas. DR 1 (structure no. 735) on left, DR 2 (structure no. 736) in center, and DR 3 (structure no. 737) looking north 30 degrees west, with tracking radar (large radome) and satcom (satellite communication) system in small radome in view between DR 2 and DR 3 antennae. - Clear Air Force Station, Ballistic Missile Early Warning System Site II, One mile west of mile marker 293.5 on Parks Highway, 5 miles southwest of Anderson, Anderson, Denali Borough, AK

  10. Dr. Wernher von Braun

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Dr. von Braun is looking out from a 10th floor window of building 4200 at the Marshall Space Flight Center (MSFC). He was the first Center Director and served as the Director from July 1960 through February 1970. Following World War II, Dr. von Braun and his German colleagues arrived in the United States under the Project Paperclip (American acquisition of German rocket experts) to continue their rocket development work. In 1950, von Braun and his German Rocket Team (also called the Peenemuende Team) were transferred from Ft. Bliss, Texas to Huntsville, Alabama to work for the Army's rocket program at Redstone Arsenal and later, NASA's Marshall Space Flight Center (MSFC). Under Dr. von Braun's leadership, MSFC developed the Saturn V launch vehicle, which placed the first men, two American astronauts, on the Moon. Wernher von Braun's life was dedicated to expanding man's knowledge through the exploration of space.

  11. Dr. Harold Varmus: Closing Remarks

    Cancer.gov

    Dr. Harold Varmus delivers closing remarks at Cancer Epidemiology: From Pedigrees to Populations, a scientific symposium honoring 50 years of visionary leadership by Dr. Joseph F. Fraumeni, Jr., hosted by NCI’s Division of Cancer Epidemiology and Genetics (DCEG).

  12. Dr. Michael Thun: Closing Remarks

    Cancer.gov

    Dr. Michael Thun delivered closing remarks at Cancer Epidemiology: From Pedigrees to Populations, a scientific symposium honoring 50 years of visionary leadership by Dr. Joseph F. Fraumeni, Jr., hosted by NCI’s Division of Cancer Epidemiology and Genetics (DCEG).

  13. Dr. Stella 3. Necrosis

    E-print Network

    Wang, Edith

    permeability: Trypan blue (manual counting), LDH release Cell morphology: Swelling (recovery?), pearling Floyd Skloot #12;NBIO 404 Dr. Stella 3. Cell Death Page 4 3.4 Ca++-dependent effector mechanisms, irreversible damage occur in 2-3 minutes. Therapeutic: Different mechanism/anatomies between species? 2] Slower

  14. Dr. Goddard Transports Rocket

    NASA Technical Reports Server (NTRS)

    1974-01-01

    Dr. Robert H. Goddard tows his rocket to the launching tower behind a Model A Ford truck, 15 miles northwest of Roswell, New Mexico. 1930- 1932. Dr. Goddard has been recognized as the 'Father of American Rocketry' and as one of three pioneers in the theoretical exploration of space. Robert Hutchings Goddard was born in Worcester, Massachusetts, on October 15, 1882. He was a theoretical scientist as well as a practical engineer. His dream was the conquest of the upper atmosphere and ultimately space through the use of rocket propulsion. Dr. Goddard, who died in 1945, was probably as responsible for the dawning of the Space Age as the Wright Brothers were for the begining of the Air Age. Yet his work attracted little serious attention during his lifetime. When the United States began to prepare for the conquest of space in the 1950's, American rocket scientists began to recognize the debt owed to the New England professor. They discovered that it was virtually impossible to construct a rocket or launch a satellite without acknowledging the work of Dr. Goddard. This great legacy was covered by more than 200 patents, many of which were issued after his death.

  15. AUTORIDADES Dr. Rubn HALLU

    E-print Network

    Cortiñas, Guillermo

    Abg. Carlos E. MAS VELEZ SECRETARIA DE ASUNTOS ACADÉMICOS Lic. María Catalina NOSIGLIA SECRETARIO DE CIENCIA Y TÉCNICA Dr. Hugo SIRKIN SECRETARIO DE HACIENDA Y ADMINISTRACIÓN Lic. José Luis GIUSTI SECRETARIO DE EXTENSIÓN UNIVERSITARIA Y BIENESTAR ESTUDIANTIL Lic. Oscar GARCÍA SECRETARIO DE RELACIONES

  16. Dr. Wernher Von Braun

    NASA Technical Reports Server (NTRS)

    1999-01-01

    A camerman catches Dr. Wernher Von Braun, Director of the Marshall Space Flight Center, his son, Peter, and daughter, Martgrit, as they arrive at the employee picnic held to celebrate man's first landing on the moon 6 days earlier. In the foreground is David R. Newby, Director of Administration and Technical Services at the Marshall Space Flight Center.

  17. Schizophrenia lectures Dr. Bajjalieh

    E-print Network

    Wang, Edith

    NeuBio 404 Schizophrenia lectures Dr. Bajjalieh D429 HSB bajjalie@u.washington.edu Lecture 1 What are psychosis and schizophrenia? What is the clinical profile of schizophrenia? Distinguish between positive and negative symptoms in schizophrenia and discuss hypothesized differences in their etiologies. What evidence

  18. Barbara Fh, Prof. Dr. Geschftsstelle

    E-print Network

    Steiner, Daniel

    Fremdsprachen Ruth Keller-Bolliger, Dr. A-S1-FRE Bildung und Erziehung Flurin Senn-Albrecht Naas, Marcel, Dr. A Barbara Fäh, Prof. Dr. A-AA Stundenplanung Bernhard Keller, Prof. A-RE-STU Kanzlei Therese Graf A-RE-KAN Aufnahmeverfahren Fabian Camenzind A-RE-AUF Eignung Ernst Huber / Iris Rüfenacht / Helen Buss A

  19. Dr. Joseph Fraumeni: Closing Remarks

    Cancer.gov

    Dr. Joseph Fraumeni and Dr. Stephen Chanock deliver closing remarks at Cancer Epidemiology: From Pedigrees to Populations, a scientific symposium honoring 50 years of visionary leadership by Dr. Joseph F. Fraumeni, Jr., hosted by NCI’s Division of Cancer Epidemiology and Genetics (DCEG).

  20. MATH 231 Scientific Calculus I Instructor: Dr. Lester Caudill Dr. James Davis Dr. Michael Kerckhove

    E-print Network

    Caudill Jr., Lester F.

    ://www.mathcs.richmond.edu/~caudill/localhome_links/f07node2.html Text: Calculus Concepts and Contexts, Third Edition, by James Stewart. In additionMATH 231 ­ Scientific Calculus I Fall, 2007 Instructor: Dr. Lester Caudill Dr. James Davis Dr Reasoning Field-of-Study Statement: MATH 231 is an introduction to calculus, the mathematical language

  1. Three MSFC Directors; Dr. Petrone, Dr. Rees, and Dr. von Braun

    NASA Technical Reports Server (NTRS)

    1973-01-01

    Three Marshall Space Flight Center (MSFC) Directors: at left, Dr. Rocco A. Petrone (1973-1974), who had been named to succeed Dr. Rees, then-present director (Center); Dr. Eberhard Rees (1970-1973); and past director (right), Dr. Wernher von Braun (1960-1970). This photo was taken at the Redstone Arsenal Officers Club where over three hundred people had gathered to honor the career of Dr. Rees which sparned more than thirty years in rocketry and space exploration and wish him well upon his pending retirement on January 26, 1973.

  2. SpringerReference Dr. Jonathan Winawer and Dr. Nathan Witthoft

    E-print Network

    Grill-Spector, Kalanit

    performance on tasks which strictly depend on color appearance, is determined entirely by the visual system to distinguishstraddle shades that fall within a single color category. No color scientist t1 SpringerReference Dr. Jonathan Winawer and Dr. Nathan Witthoft Effect of Color Terms on Color

  3. MEMORIAL DR. OLIVER "CECIL" COMPTON

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dr. Oliver "Cecil" Compton of Corvallis, Oregon, died Wednesday 10 August 2005, at Samaritan Heart of the Valley Care Center. He was 102. Dr. Compton was an Emeritus Professor of Oregon State University. This brief article gives a brief summary of his life and some of his academic activities in pomo...

  4. Dr. Fumin Zhang Assistant Professor,

    E-print Network

    Zhang, Fumin

    Dr. Fumin Zhang Assistant Professor, School of Electrical and Computer Engineering, Georgia 30th, 2009, PI, amount $15,000, total $30,000. CURRICULUM VITAE: Dr. Fumin Zhang, fumin-PI, amount $50,441, total, $100,000. P U B L I C AT I O N S Journal Publications: [1] F. Zhang and P. S

  5. Dr. Michael Gottesman: Closing Remarks

    Cancer.gov

    Dr. Michael Gottesman of the National Cancer Institute delivers closing remarks at Cancer Epidemiology: From Pedigrees to Populations, a scientific symposium honoring 50 years of visionary leadership by Dr. Joseph F. Fraumeni, Jr., hosted by NCI’s Division of Cancer Epidemiology and Genetics (DCEG).

  6. JOINT WELCOME LECTURE PROF. DR. SEBASTIAN BSER

    E-print Network

    Kaus, Boris

    JOINT WELCOME LECTURE PROF. DR. SEBASTIAN BÖSER PROF. DR. JOACHIM KOPP PROF. DR. MICHAEL WURM:15: Laudatio, followed by joint lecture The Invisibles: Neutrinos on Earth and in the Sky #12;Dear colleagues

  7. Dr. Beverly Adams ZCDH (Zone Clinical Department

    E-print Network

    Calgary, University of

    Health Community Clinic Dr. J. Taggart ACH Psychiatry Ambulatory Clinic Dr. K. Tomm Family Therapy Vacant Rural Mental Health Clinics Vacant SMCHC Urgent Mental Health Special Services Division Dr. D and Adolescent Psychiatry #12;

  8. Dr. Christian Helmrich Lehrstuhl Prof. Alexander Graser

    E-print Network

    Schubart, Christoph

    Dr. Christian Helmrich Lehrstuhl Prof. Alexander Graser FAKULTÄT FÜR RECHTSWISSENSCHAFT Dr. Max Mustermann Referat Kommunikation & Marketing Verwaltung Dr. Christian Helmrich Lehrstuhl für öff. Recht und. Christian Helmrich Lehrstuhl Prof. Alexander Graser FAKULTÄT FÜR RECHTSWISSENSCHAFT Flüchtlingssituation

  9. Doctors and Dr. Seuss.

    PubMed

    Carlin, Nathan

    2015-01-01

    In 2012, Dartmouth College renamed its medical school, founded in 1797, the Audrey and Theodor Geisel School of Medicine. Using the renaming of the medical school of Dartmouth College as a foil, I offer in this article a vision of what it might mean to align Theodor Geisel, better known as Dr. Seuss, with doctors by examining Geisel's You're Only Old Once! A Book for Obsolete Children. In this article, I derive four critiques of modern medicine from the book and offer four strategies as to how these critiques could be explored in medical education. If You're Only Old Once! is read as a pathography, I argue that it can be used as a resource for medical education. PMID:25473864

  10. INTERCOMMITTEE MEMORANDUM TO: DR. CHARLES MAULE

    E-print Network

    Saskatchewan, University of

    INTERCOMMITTEE MEMORANDUM TO: DR. CHARLES MAULE CHAIR, FACULTY COUNCIL, COLLEGE OF ENGINEERING FROM ACADEMIC, COLLEGE OF ENGINEERING Dr. Charles Maule: At the recommendation of the Undergraduate Academic

  11. 5. View of middle DR 2 antenna with DR 1 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. View of middle DR 2 antenna with DR 1 antenna in background. Photograph shows on left side at bottom foundation berm and along right side bottom stanchion concrete foundations at bottom structural steel assembly. - Clear Air Force Station, Ballistic Missile Early Warning System Site II, One mile west of mile marker 293.5 on Parks Highway, 5 miles southwest of Anderson, Anderson, Denali Borough, AK

  12. Prof. Dr. Stefan Brass 07. Juni 2011 Dr. Henning Thielemann

    E-print Network

    Brass, Stefan

    Prof. Dr. Stefan Brass 07. Juni 2011 Dr. Henning Thielemann Institut f¨ur Informatik Universit Homeverzeichnis und f¨ur dieses Verzeichnis m¨ussen Sie aller Welt das Recht geben, dadurch zu wechseln (d.h. auf sein: cd public_html chmod a+r h3.html · Wenn Ihr Benutzername "xyz" ist, w¨are diese Datei unter

  13. Dr. Barnett's dream

    SciTech Connect

    Wilson, A.

    1990-04-01

    In 1986, AstroPower was a tiny R D company located at the University of Delaware. Like many other entrepreneurs in the field at that time, the company's president, Dr. Allen Barnett, had a good idea, a good research staff, and the dream of becoming a successful manufacturer of photovoltaic (PV) cells. If the Newark, Del. company's projections remain on track, Barnett plans to become the third largest PV manufacturer in the United States by the end of next year. Were it not for the company's performance to date, such a claim might well be dismissed as idle dreaming. AstroPower Inc. is pursuing a two-pronged strategy: to rapidly bring a new thin-crystal silicon PV cell to commercialization; and, in the meantime, to gain experience in manufacturing and distributing conventional single-crystal and polycrystal silicon cells. The company sold approximately 200 kilowatts (kWp) of cells last year (about half single-crystal and half polycrystal). Its current production capacity is 360 kWp. The company and its products are described.

  14. Introductions Dr. John M. Butler &

    E-print Network

    ) #12;Dr. John M. Butler Experience · University of Virginia/FBI Laboratory (1992-1995) ­ Work performed Airport BWI Airport NIST FBI Lab Baltimore, MD Richmond, VA Capitol Beltway (I-495) I-270 I-95 I-95 I-66

  15. BOISBOISE STATE Dr. Julia Oxford

    E-print Network

    Barrash, Warren

    valuable experiences. 18 NO WRONG DOOR Solutions for industry ranging from high-tech 3D printing the spotlight on the university's sculpture program. 34 IN PRINT Dr. Heidi Reeder's book "Commit to Win" offers

  16. GRAPE-DR 512 1 512Gflops 256Gflops 2Pflops GRAPE-DR

    E-print Network

    Makino, Jun

    2007 11 28 2007 2 GRAPE-DR GRAPE-DR 512 1 512Gflops 256Gflops GRAPE SIMD 2008 2Pflops GRAPE-DR HPC : GRAPE 1 GRAPE-DR 1 1 ( ) 2 1 512 500MHz 512 Gflops 1 2 1 0.5 256 Gflops 256 Gflops 2007 11 GRAPE-DR GRAPE GRAPE-DR FPGA GPGPU 2 -- 1940 ENIAC 60 10 100 2 1969 1 CDC 7600 2 1950 60 CMOS 2 #12;· · 1 · · 2 1

  17. Principal Investigators Prof. Dr. Jutta Geldermann

    E-print Network

    Wardetzky, Max

    . Anita Schöbel Research Group Optimization Institute of Numerical and Applied Mathematics schoebel@math.unigoettingen.de Prof. Dr. Waldemar Toporowski Chair of Marketing and Retailing wtoporo@unigoettingen.de Prof. Dr

  18. Dr. Francis Collins Is New NIH Director

    MedlinePLUS

    ... Current Issue Past Issues Dr. Francis Collins Is New NIH Director Past Issues / Summer 2009 Table of ... of this page please turn Javascript on. The new NIH Director, Dr. Francis Collins, served as Director ...

  19. Dr. Glenn Froning Professor Emeritus

    E-print Network

    Powers, Robert

    Dr. Glenn Froning Professor Emeritus Education: B.S. Agricultural Poultry Science, University of Missouri M.S. Poultry Products, University of Missouri Ph.D. Food Technology, University of Minnesota research emphasis included mechanical deboning of poultry meat; emulsification properties of poultry meat

  20. CYBERINFRASTRUCTURE Dr. Phil Moore Director

    E-print Network

    Valtorta, Marco

    #12;RESEARCH CYBERINFRASTRUCTURE Dr. Phil Moore Director Paul Sagona HPC Systems Architect Ben Torkian Senior Applications Scientist Nathan Elger HPC Systems Analyst Tower Building, Suite 750 1301 take them too long. Richard Gerber, NERSC, https://www.nersc.gov/assets/Uploads/Gerber-HPC-2.pdf #12

  1. Frontotemporal dementia Dr Christopher Butler

    E-print Network

    's disease Vascular dementia Lewy Body dementiaFrontotemporal dementia #12;Frontotemporal dementiaFrontotemporal dementia Dr Christopher Butler Senior Clinical Research Fellow and Honorary Consultant Neurologist chris.butler@ndcn.ox.ac.uk #12;Dementia has different causes DEMENTIA Alzheimer

  2. KEYNOTE SPEAKER Dr. Don Sparks

    E-print Network

    Sparks, Donald L.

    Sciences Director, Center for Critical Zone Research University of Delaware Title of Presentation: Shining Light on Biogeochemical Processes in the Earth's Critical Zone! Dr. Sparks is internationally recognized) to determine the forms (species) of the metals and nutrients in the soil at the molecular scale

  3. AWARDS & ANNOUNCEMENTS Dr. Lee Dicker

    E-print Network

    Chen, Kuang-Yu

    AWARDS & ANNOUNCEMENTS Dr. Lee Dicker Maximum likelihood and nonparametric empirical Bayes methods and empirical Bayes methods in high-dimensional data analysis. This work is fundamentally related to the analysis of nonparametric mixture models. Empirical Bayes methods have a long and rich history

  4. Statement of Dr. Edmund Synakowski

    E-print Network

    1 Statement of Dr. Edmund Synakowski Associate Director for Fusion Energy Sciences Office of Science U.S. Department of Energy Before the Subcommittee on Energy and Environment Committee on Science Energy Sciences program in the Department of Energy's (DOE's) Office of Science (SC). I have been

  5. Prof. Dr. Henning Luter Publikationen

    E-print Network

    Baer, Christian

    Prof. Dr. Henning Läuter Publikationen Refereed papers Läuter, H. et al. (2008). Estimation. Vonta et al.: p. 187-198, Birkhäuser. Läuter, H. (2008). Approximate likelihood in survival models. In. Mesbah, M. Nikulin, 121-130, ISTE&J.Wiley, London. Läuter, H. and Liero, H. (2006). Nonparametric

  6. Dr. Heike Tauerschmidt, IO 1 Hochschule Bremen

    E-print Network

    Diekmann, Martin

    Dr. Heike Tauerschmidt, IO 1 Hochschule Bremen ---- an International University in Europe InternationalOffice #12;Dr. Heike Tauerschmidt, IO 2 Mission Strong in.... ... Applied Studies & ResearchOffice #12;Dr. Heike Tauerschmidt, IO 3 1799 Navigation School Bremen later: College of Nautical Science 1894

  7. Dr. Jeffrey Doering, Professor/Chairperson

    E-print Network

    Kelly, John J.

    NEWSLETTER Dr. Jeffrey Doering, Professor/Chairperson On April 29, the Biology department hosted and Undergraduate Biology students (see page 6 for a complete list) leading up to the keynote ad- dress, "What Makes Us Humans: A Genomics View" by Dr. Yoav Gilad. Dr. Gilad works in the Department of Human Genetics

  8. Dr. David Kortenkamp NASA Johnson Space Center

    E-print Network

    Kortenkamp, David

    Dr. David Kortenkamp NASA Johnson Space Center Dr. David Kortenkamp NASA Johnson Space Center Intelligent Robots for Space Applications Intelligent Robots for Space Applications Dr. David Kortenkamp NASA Johnson Space Center/Metrica Inc. Houston TX 77058 kortenkamp@jsc.nasa.gov http

  9. Dr. Stella 1. Introduction to Pharmacology

    E-print Network

    Wang, Edith

    NBIO 404 Dr. Stella 1. Introduction to Pharmacology Page 6 8 C: Synthetic compounds: medicinal of targeted protein 1.2 TARGETS AND DRUGS #12;NBIO 404 Dr. Stella 1. Introduction to Pharmacology Page 7 9 #12;NBIO 404 Dr. Stella 1. Introduction to Pharmacology Page 8 C2: Rational design: = Compound

  10. Dr. Stella 1. Introduction to Pharmacology

    E-print Network

    Wang, Edith

    NBIO 404 Dr. Stella 1. Introduction to Pharmacology Page 13 Intro 16 Intro 17 1.3 PHARMACODYNAMICS is bored by knowledge" Matt Ridley Genome #12;NBIO 404 Dr. Stella 1. Introduction to Pharmacology Page 14 of a Scientific Dynasty #12;NBIO 404 Dr. Stella 1. Introduction to Pharmacology Page 15 One protein can bind a set

  11. School of Dental Medicine Dr. R. Lamont MacNeil

    E-print Network

    Oliver, Douglas L.

    Craniofacial Sciences Dr. R. Nanda Dept. Head Oral Health & Diagnostic Sciences Dr. A. Dongari- Bagtzoglou Dept Admissions Dr. D. Paolella Assistant Dean Student Affairs Dr. M. Goupil Associate Dean Health Career of Oral & Maxillofacial Surgery Dr. D. Shafer, Chair Division of General Dentistry Dr. S. Lepowsky, Chair

  12. 93Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center ConclusionsConclusions

    E-print Network

    Kortenkamp, David

    93Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center and practical. #12;94Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space with respect to a change in autonomy? #12;95Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David

  13. Hernandez Made Chairman Of Tech Faculty SenateDr. David E. Hernandez, Associate Professor of Education,

    E-print Network

    Wu, Shin-Tson

    Brennan, Dr. William Smith, Dr. Donald Wall and Dr. Harvey Rexroad were Dr. David E. Hernandez elected two. William K. Esler, Dr. David E. Hernandez, and Dr. Robert A. Rothberg were selected as two-year term. Allen, Dr. George R. Prof. S. E. Omans Hertel, Dr. Frank E. Juge, Dr. Ernest J. Lytle, and Dr. William W

  14. Dr. Hugh L. Dryden - portrait

    NASA Technical Reports Server (NTRS)

    1959-01-01

    Dr. Hugh Latimer Dryden, had many titles after his name in his lifetime. In 1949 he became the director of the National Advisory Committee for Aeronautics (NACA). Dr. Dryden received many accolades and awards both during his life and after his death, but the greatest and most appropriate honor came on March 26, 1976, when NASA renamed the NASA Flight Research Center as the NASA Hugh L. Dryden Flight Research Center. At the dedication ceremony NASA Administrator James C. Fletcher stated: 'in 1924, when the fastest racing planes did well to fly at 280 m.p.h., Dryden was already probing the transonic range of . . . flight. Later in the 1920s, he sought to develop methods of accurately measuring . . . turbulence in wind tunnels. In 1938 he was the first American to deliver the Wright Brothers lecture. His 'Turbulence and the Boundary Layer' became a classic summary on the subject. It is most fitting that this Flight Research Center, with its unique and highly specialized capability for solving aerospace problems, should memorialize the genius of Hugh Dryden.' Dr. Dryden was initially an aerodynamicist with the National Bureau of Standards. He did important early work in high-speed aerodynamics. In 1947 he became the director of aeronautical research for the NACA (a predecessor of the National Aeronautics and Space Administration). Two years later, he became NACA's director, a position he held until 1958 when he became deputy administrator of NASA.

  15. Name Instructor Dr. William A. Withers 1895-1925

    E-print Network

    Velev, Orlin D.

    1935-1936 Dr. Byron E. Lauer 1935-1937 1937-1941 1941-1946 Dr. Albert H. Cooper 1935-1936 1936-1937 Dr. Samuel T. Goforth 1960-1961 Mr. William M. Cooper 1960-1961 Mr. Leandros P. Lenas 1960-1961 Dr. David B-1974 1974-1977 1983-2001 2003- Dr. James R. Fair 1974-1975 Dr. James E. Helt 1975-1979 Dr. Peter V

  16. To: Dr. Duane Nellis, Texas Tech University President From: Dr. Michael Farmer, Faculty Senate President

    E-print Network

    Rock, Chris

    To: Dr. Duane Nellis, Texas Tech University President From: Dr Regarding Funding Introduced to, and passed by, the Texas Tech Faculty Senate by the State of Texas for higher education is not keeping pace with the needs

  17. To: Dr. Duane Nellis, Texas Tech University President From: Dr. Michael Farmer, Faculty Senate President

    E-print Network

    Rock, Chris

    To: Dr. Duane Nellis, Texas Tech University President From: Dr Regarding Funding Introduced to, and passed by, the Texas Tech Faculty Senate to the classroom and to our university; WHEREAS, the Texas legislature passed

  18. Petroleum Geosciences Program Dr. Aldo Vesnaver

    E-print Network

    Ali, Mohammed

    1 Petroleum Geosciences Program Faculty Dr. Aldo Vesnaver KADOC Chaired Professor Ruwais Building). Experience: 2014 ­ present: KADOC Chair Professor of Petroleum Geoscience at the Petroleum Institute (Abu

  19. 100-DR-1 radiological surveys

    SciTech Connect

    Naiknimbalkar, N.M.

    1994-01-28

    This report summarizes and documents the results of the radiological surveys conducted over the surface of the 100-DR-1 Operable Unit, Hanford Site, Richland, Washington. In addition, this report explains the survey methodology using the Ultrasonic Ranging and Data System (USRADS). The 100-DR-1 radiological survey field task consisted of two activities: characterization of the operable unit-specific background conditions and the radiological survey of the operable unit surface area. The survey methodology was based on utilization of USRADS for automated recording of the gross gamma radiation levels at or near 6 in. and at 3 ft from the surface soil. The purpose of the survey is to identify the location of unidentified subsurface radioactive material areas and any surface contamination associated with these areas. The radiological surveys were conducted using both a digital count rate meter with a NaI detector reporting in counts per minute (CPM) and a dose rate meter reporting micro-Roentgen per hour (uR) connected to a CHEMRAD Tennessee Corp. Series 2000 USRADS. The count rate meter was set for gross counting, i.e., Window ``out``. The window setting allows detection of low, intermediate, and high energy photons. The USRADS equipment is used to record the detector readings verses the location of the readings, generate a map of the survey area, and save the data on computer storage media.

  20. Interview with Dr. Charley Zeanah

    PubMed Central

    2013-01-01

    Dr. Charles Zeanah is the Mary K. Sellars-Polchow Chair in Psychiatry, Professor of Clinical Pediatrics and Vice Chair for Child and Adolescent Psychiatry in the Department of Psychiatry and Behavioral Sciences at Tulane University School of Medicine in New Orleans. He is also Executive Director of the Institute for Infant and Early Childhood Mental Health at Tulane. He is the recipient of multiple awards including the Irving Phillips Award for Prevention, (AACAP), the Presidential Citation for Distinguished Research and Leadership in Infant Mental Health (American Orthopsychiatric Association), the Sarah Haley Memorial Award for Clinical Excellence (International Society for Traumatic Stress Studies), the Blanche F. Ittelson Award for Research in Child Psychiatry (APA), and the Serge Lebovici Award for International Contributions in Infant Mental Health (World Association for Infant Mental Health). Dr. Zeanah is a Distinguished Fellow of AACAP, a Distinguished Fellow of the APA and a Board Member of Zero to Three. He is the Editor of Handbook of Infant Mental Health (3rd edition) considered as the state of the art textbook and standard reference in the field of Infant Mental Health. PMID:23667354

  1. A Fuzzy Sets approach to New Product Portfolio Management Dr. N. Bilalis D. Lolos Dr. A. Antoniadis Dr. D. Emiris

    E-print Network

    Aristomenis, Antoniadis

    A Fuzzy Sets approach to New Product Portfolio Management Dr. N. Bilalis D. Lolos Dr. A. Antoniadis: Selecting R&D projects, qualitative criteria, fuzzy sets, portfolio management, new product development. I within the firm. In addition, it is quite often to form alliances and to partner with others in the new

  2. Dr. von Braun Tries Out the NBS

    NASA Technical Reports Server (NTRS)

    1967-01-01

    Marshall Space Flight Center (MSFC) Director, Dr. von Braun, is shown fitted with suit and diving equipment as he prepares for a tryout in the MSFC Neutral Buoyancy Simulator (NBS). Weighted to a neutrally buoyant condition, Dr. von Braun was able to perform tasks underwater which simulated weightless conditions found in space.

  3. Tuesday, March 5, 2002 Dr. Steven Miller

    E-print Network

    Mallin, Michael

    Tuesday, March 5, 2002 Dr. Steven Miller SeaLab, Tektite, Hydrolab, and UNCW's Aquarius: The Story is not at work or underwater you might find him at the tennis court. SeaLab, Tektite, Hydrolab, and UNCW-2002 series: SeaLab, Tektite, Hydrolab, and UNCW's Aquarius: The Story of the U.S. Underwater Space Program Dr

  4. March 5, 2003 Dr. Ray Orbach

    E-print Network

    rather than import fusion energy systems." #12;Yours truly, Richard Hazeltine Chair, Fusion EnergyMarch 5, 2003 Dr. Ray Orbach Director, Office of Science U.S. Department of Energy 1000 Independence Avenue, S.W. Washington, D.C. 20585 Dear Dr. Orbach: The Fusion Energy Sciences Advisory Committee

  5. Dr. Stella 1. Introduction to Pharmacology

    E-print Network

    Wang, Edith

    NBIO 404 Dr. Stella 1. Introduction to Pharmacology Page 1 1 "For the most dismal event to become ingredients 1.1 DEFINITIONS #12;NBIO 404 Dr. Stella 1. Introduction to Pharmacology Page 2 4 3 2 Life is hard to Pharmacology Page 3 "Much of what accounts for scientific good fortune is looking at the right problem

  6. Dr. von Braun Discusses 'Bottle Suit' Concept

    NASA Technical Reports Server (NTRS)

    1954-01-01

    Dr. Wernher von Braun (center), then Chief of the Guided Missile Development Division at Redstone Arsenal, Alabama, discusses a 'bottle suit' model with Dr. Heinz Haber (left), an expert on aviation medicine, and Willey Ley, a science writer on rocketry and space exploration. The three men were at the Disney studios appearing in the motion picture, entitled 'Man in Space.'

  7. Dr. Pete's useful stuff College Physics I*

    E-print Network

    Nelson, Peter Hugo

    Dr. Pete's useful stuff College Physics I* ·v.4.3 © Dr. Pete Nelson 2002-05 http://www.circle4.com= = = = - r F rF = = neti = Moduli stress / / / Young's Shear Bulk strain / / / / F A F A F A P Y S B L L x L

  8. February 28, 1994 Dr. Martha Krebs

    E-print Network

    February 28, 1994 Dr. Martha Krebs Director, Office of Energy Research Dr. N. Anne Davies Associate Director for Fusion Energy U.S. Department of Energy Office of Energy Research Washington, DC. 20585 Dear quality scientific research must continue to play a central role if our gods are to be achieved. Yet

  9. PCB 3063, Dr. Hoffman Summer 2014

    E-print Network

    PCB 3063, Dr. Hoffman Summer 2014 PCB 3063 Genetics, Summer Semester A, 2014 Course Objectives. _______________________________________________________________________ TIME AND PLACE: Lecture: 12:30 -2:20 Monday, Tuesday, Wednesday and Thursday in CB1 104. CREDIT: PCB-823-4007 E-mail: eric.hoffman@ucf.edu Web Site: https://webcourses.ucf.edu For PCB 3063 OFFICE HOURS: Dr

  10. Dr. Wernher Von Braun at a picnic.

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. Wernher Von Braun, director of the Marshall Space Flight Center, stakes claim to a table for the picnic celebrating man's first lunar landing. With Dr. Von Braun are his wife, Maria (seated, right), and son, Peter (back to camera). His daughter, Margrit, was also present, but is hidden from view by friends in this view.

  11. Dr. Wernher Von Braun greeting dignitaries.

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. Wernher Von Braun, left, greets vice president Spiro T. Agnew in the Launch Control Center for the Apollo 14 mission. Between Dr. Von Braun and Mr. Agnew are their Royal Highnesses, The Prince and Princess of Spain. The royal visitors greeted the launch control team in th enter after the launch of Apollo 14.

  12. Tobias K. Kohoutek Dr. Andreas Donaubauer

    E-print Network

    ) - Support of any geodetic reference system -> coupling of indoor and outdoor positioning methods GeographicTobias K. Kohoutek Dr. Andreas Donaubauer Dr. Rainer Mautz Real-time Indoor Positioning Using Range Institute of Geodesy and Photogrammetry Today's positioning systems in dependence to accuracy and coverage

  13. Dr. Paul J. Solomon Office Address

    E-print Network

    Jank, Wolfgang

    Advertising: A converging Comparison of Rational and Emotional Appeals," Proceedings of the Academy on Salesperson's Role Stress, Job Attitudes, and Behavioral Intentions, Journal of Personal Selling and Sales Management, Summer 2006, pp 271- 282, Co-authors Dr. Jaramillo and Dr. Mulki "Relationship Advertising

  14. Guest Artist Recital Dr. Jennifer Cooper, flute

    E-print Network

    Wang, Xiaorui "Ray"

    PR EVIEW presents a Guest Artist Recital Cooper Duo Dr. Jennifer Cooper, flute Dr. Zachary Cooper become/decay Tyler Kline World Premiere (b. 1991) Trio for Flute, Horn and Piano Hugo Kauder (1888-1972) Hochzeits-Ständchen, Henri Kling Trio for Flute, Horn and Piano (1842-1918) Nocturne Rudolf Tillmetz Trio

  15. Vice Presidents Prof. Dr. Angela Friederici (GSHS) 1303

    E-print Network

    Data Protection Officer Heidi Schuster 1554 Berlin Archives Dr. Kristina Starkloff 030 8413 and Evaluation Dr. Helene Schruff 1430 Officer for the Environment and Safety Dr. Peter Neurieder 1652 Unit VIII

  16. Computer Science Faculty Dr. Stephen Beale, Research Assistant Professor

    E-print Network

    Adali, Tulay

    Computer Science Faculty Dr. Stephen Beale, Research Assistant Professor Syntactic and semantic, multi-engine NLP applications Dr. Richard Chang, Associate Professor Computational complexity theory, natural language processing, intelligent agents Dr. Milton Halem, Research Professor Scientific computing

  17. Prsentationstechnik -SS 2004 -Prof. Dr. Stefan Bttcher 1

    E-print Network

    Kindler, Ekkart

    Präsentationstechnik - SS 2004 - Prof. Dr. Stefan Böttcher 1 Präsentationstechnik - SS 2004 - Prof Markus Toschläger, AG Suhl) Präsentationstechnik - SS 2004 - Prof. Dr. Stefan Böttcher - 2 / 41 Inhalt Vortragende Logische Struktur Visualisierung Präsentationstechnik - SS 2004 - Prof. Dr. Stefan Böttcher - 3

  18. Klinik fr Psychosomatik und Psychotherapie PD Dr. Peter Angerer

    E-print Network

    Manstein, Dietmar J.

    Klinik für Psychosomatik und Psychotherapie 6.11.2008 PD Dr. Peter Angerer Dr. Mechthild Heinmüller. Harald Gündel Medizinische Hochschule Hannover Klinik für Psychosomatik und Psychotherapie Dr. Heribert, Psychotherapie und Medizinische Psychologie Betriebliche Gesundheitsförderung am Beispiel der Studie: Prävention

  19. Introduction Java Bootcamp -Villanova University Dr. Papalaskari 1

    E-print Network

    Papalaskari, Mary-Angela

    Introduction Java Bootcamp - Villanova University Dr. Papalaskari 1 CSC 2014 ­ Java Bootcamp Dr in this presentation are adapted from the slides accompanying Java Software Solutions by Lewis & Loftus Java Bootcamp Dr. Papalaskari Villanova University Introduction to Java Course website www

  20. MSE Department Organization Structure, 2013 Dr. Robert Hendricks

    E-print Network

    Zallen, Richard

    MSE Department Organization Structure, 2013 Dr. Robert Hendricks Academic Programs Special Projects-Cook Academic Program Support Dr. Robert Hendricks Associate Department Head Instructional Faculty Department

  1. 2. Historic American Buildings Survey Dr. Jackson Building (Summerfield College) ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. Historic American Buildings Survey Dr. Jackson Building (Summerfield College) FIREPLACE AND MANTEL (LIVING ROOM) - Summerfield College, Dr. Jackson Building, Main & College Streets, Summerfield, Dallas County, AL

  2. Dr. Robert H. Goddard and His Rockets

    NASA Technical Reports Server (NTRS)

    1926-01-01

    Dr. Robert H. Goddard and liquid oxygen-gasoline rocket in the frame from which it was fired on March 16, 1926, at Auburn, Mass. It flew for only 2.5 seconds, climbed 41 feet, and landed 184 feet away in a cabbage patch. From 1930 to 1941, Dr. Goddard made substantial progress in the development of progressively larger rockets, which attained altitudes of 2400 meters, and refined his equipment for guidance and control, his techniques of welding, and his insulation, pumps, and other associated equipment. In many respects, Dr. Goddard laid the essential foundations of practical rocket technology

  3. SEE6999 Dissertation Dr. Wen ZHOU

    E-print Network

    Po, Lai-Man

    , rainwater harvesting and wastewater reclamation) in Hong Kong 9. Zero-Food waste Town Development 10-cleaning materials and surfaces via nanotechnology Dr. Wey Yang TEOH 17. Solar conversion of carbon dioxide

  4. August 9, 2011 Dr. Robert C. Froh

    E-print Network

    Chandy, John A.

    August 9, 2011 Dr. Robert C. Froh Associate Director of the Commission NEASC CIHE 209 Burlington & Information Resources Steve Parks Institute for Teaching and Learning 8 Physical & Tech. Resources Cameron

  5. 28 November 2007 Dear Dr Pearson,

    E-print Network

    Crowther, Paul

    28 November 2007 Dear Dr Pearson, I am writing to appeal for your help in ameliorating the STFC funding crisis, which I fear will have serious implications for science in the UK. I have previously been

  6. The Science of Science Dr. Katy Brner

    E-print Network

    Menczer, Filippo

    1 The Science of Science Dr. Katy Börner Cyberinfrastructure for Network Science Center, Director Information Visualization Laboratory, Director School of Library and Information Science Indiana University February 20th, 2008 Computational Scientometrics: Studying Science by Scientific Means Börner, Katy, Chen

  7. Science Maps in Action Dr. Katy Brner

    E-print Network

    Menczer, Filippo

    Science Maps in Action Dr. Katy Börner Cyberinfrastructure for Network Science Center, Director Information Visualization Laboratory, Director School of Library and Information Science Indiana University Computational Scientometrics: Studying Science by Scientific Means Börner, Katy, Chen, Chaomei, and Boyack

  8. CURRICULUM VITAE Dr. Edward (Ted) Van Vleet

    E-print Network

    Meyers, Steven D.

    Biogeochemistry American Chemical Society Hydrocarbon Pollution European Assoc. Organic Geochemists Biochemical, Chemosphere). Hosted Visiting Scholar (Wenqing Zheng) from People's Republic of China for one year (1986 - 1987). Research: Hydrocarbon Pollution in the Dry Tortugas. Hosted Visiting Scholar (Dr. Wilhelm Hagen

  9. Dr. Jeffrey Doering, Professor/Chairperson

    E-print Network

    Kelly, John J.

    Bon voyage, Drs. New & Rosi-Marshall! 2 Babies! Babies! Babies! 3 2009 Fellows Poster Presen- tation 4 Rosi- Marshall, and John New. At a going away party in late August, Dr. New expressed his appreciation

  10. Dr. Carlo Fezzi Valuing production: the agricultural

    E-print Network

    Bateman, Ian J.

    Dr. Carlo Fezzi Valuing production: the agricultural landscape today and tomorrow #12;Agriculture Climate change impacts Climate change #12;Agriculture Climate change impacts Climate change Environment #12;Main questions How climate change will impact agriculture? How adaptation in agriculture

  11. Dr. David N. Rosenthal Professor of Pediatrics

    E-print Network

    Bejerano, Gill

    Dr. David N. Rosenthal Professor of Pediatrics Division of Cardiology (some achievements since last appointment in Pediatrics) Pediatric cardiology ­ chronic heart failure Founded the largest and most successful pediatric heart failure program in the west (Pediatric Advanced Therapies Program

  12. Video Interviews by Dr. Lowy (Video Playlist)

    Cancer.gov

    Acting Director of the National Cancer Institute, Dr. Douglas Lowy, discusses his role in developing the first vaccine to protect against certain strains of the sexually transmitted infection known as the human papillomavirus (HPV) and its underutilization

  13. Curriculum Vitae Prof. Dr. Thomas Baumert

    E-print Network

    Kassel, Universität

    of Prof. Dr. Ahmed Zewail, California Institute of Technology 1993 - 1997 Habilitation in Experimental of more than 4500 citations; h-index: 36 (see Researcher ID: : D-3962-2009); 4 Patents; more than 150

  14. Dr. Robert H. Goddard and His Rocket

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Goddard rocket with four rocket motors. This rocket attained an altitude of 200 feet in a flight, November 1936, at Roswell, New Mexico. From 1930 to 1941, Dr. Goddard made substantial progress in the development of progressively larger rockets which attained altitudes of 2400 meters, and refined his equipment for guidance and control, his techniques of welding, and his insulation, pumps, and other associated equipment. In many respects, Dr. Goddard laid the essential foundations of practical rocket technology

  15. Colises de galxias Gasto B. Lima Neto

    E-print Network

    Neto, Gastão Bierrenbach Lima

    , Galileu descobre que a Via Láctea é feita de "uma multitude de estrelas fracas". #12;"Estrelas Nebulosas" · Depois da luneta de Galileu, descoberta de nebulosas. · Dezenas conhecidas no início do séc. XVIII. · 1781: Catálogo de ~100 nebulosas de Charles Messier. #12;Universos-ilhas menos estrelas mais estrelas

  16. Letter to Dr. Felix Bronner

    NASA Technical Reports Server (NTRS)

    Greenleaf, John E.; Dalton, Bonnie (Technical Monitor)

    2002-01-01

    Dear Dr. Bronner: I have been reading in The Physiologist the letters from senior physiologists for many years with great interest. It is impressive that many of the respondents are still pursuing scientific endeavours in their 70's and some even in their 80's. The interesting task is to ponder the relative causative proportions of heredity and environment responsible. One wonders whether knowing something about physiology engenders longer and more productive lives? I suspect so because of the accompanying self-discipline. But another factor would seem to be the pervasive joy of working in this profession. I have been fortunate to be able to acquire the joy of physiology during my graduate studies at Illinois, and to have been able to carry it over here at NASA, Ames Research Center for the past 40 years. A truly academic style research environment at a federal research center is rare. The trick to a joyous research career is to overcome those ever-present slings and arrows of outrageous fortune with dignity whenever possible. To that end I have found solace and guidance in reading the history of warfare and its leaders, especially Sun Tsu's The Art of War and Clauswitz's On War. I became eligible for retirement in 1993, but to insure domestic tranquility and also the joy of pursuing my research hobby have continued working in the laboratory on human research. It is troubling to see that funding for individual scientists conducting human research is declining rapidly, along with their new ideas; perhaps the old ones are more comfortable. Hopefully I can provide a similar response when I'm 80! Thanks for your interest. Sincerely, John Greenleaf

  17. 9Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center Human-Centered

    E-print Network

    Kortenkamp, David

    9Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center-based Reasoning Related WorkRelated Work #12;10Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center Autonomous Control SystemsAutonomous Control Systems l Brings to table

  18. WHY WORRY ABOUT PERFORMANCE IN E-COMMERCE SOLUTIONS? Dr. Ed Upchurch & Dr. John Murphy

    E-print Network

    Murphy, John

    WHY WORRY ABOUT PERFORMANCE IN E-COMMERCE SOLUTIONS? Dr. Ed Upchurch & Dr. John Murphy Abstract engineer is the explosion of e-Commerce systems where the users are increasingly impatient and the design: so-called e-Commerce systems that allow millions of users to connect to other users and servers

  19. MODEL UNCERTAINTY AND THE ROBUSTNESS OF HEDGING MODELS DR TILL C. SCHROTER AND DR MICHAEL MONOYIOS

    E-print Network

    Monoyios, Michael

    MODEL UNCERTAINTY AND THE ROBUSTNESS OF HEDGING MODELS DR TILL C. SCHR¨OTER AND DR MICHAEL MONOYIOS of popular hedging models (the Black-Scholes, the Heston, and the SABR model) to model uncertainty in an exotic, non-exchange-traded option. One way to avoid model risk is to use completely model-free, static

  20. Geophysical survey of 105-DR Pluto Crib, 116-DR-4, 100-D Area

    SciTech Connect

    Bergstrom, K.A.

    1993-10-01

    The objective of this Geophysical Survey was to verify the location of the 105-DR Pluto Crib, 116-DR-4. A surface monument currently marks its location. The crib is 10 feet by 10 feet and 15 feet deep. Ground-Penetrating Radar was the geophysical method selected to conduct the investigation.

  1. Research Group "Migration and Society", Prof. Dr. Helen Schwenken, Lisa-Marie Heimeshoff , Dr. Johanna Neuhauser

    E-print Network

    Steinhoff, Heinz-Jürgen

    Organizers Research Group "Migration and Society", Prof. Dr. Helen Schwenken, Lisa-Marie Heimeshoff-imis@uni-osnabrueck.de Program 14.0014.15 Begrüßung und Einführung in das Thema LisaMarie Heimeshoff, Dr. Johanna Neuhauser workers in Malaysia Kommentar: LisaMarie Heimeshoff (IMIS) 17:1517.45 Samia Dinkelaker (Berlin): Making

  2. August 2001 Engineer 17 By Dr. Alan Davison, Dr. Jim Staszewski, and Mr. Glenn Boxley

    E-print Network

    Creswell, J. David

    a 1-hour refresher course by NCOs on standardArmy techniques and were then tested using thoseAugust 2001 Engineer 17 By Dr. Alan Davison, Dr. Jim Staszewski, and Mr. Glenn Boxley Improving that are now being included in the MOS 12B10 One-Station Unit Training Course at Fort Leonard Wood, Missouri. F

  3. Programme Coordination Professor Dr.-Ing. habil. Dr. h. c. Karl J. Thom-Kozmiensky

    E-print Network

    Columbia University

    of Mineral and Waste Processing, Waste Disposal and Geomechanics, Germany Professor Dr.-Ing. Daniel Goldmann Technical University Clausthal, Head of the Institute of Mineral and Waste Processing, Waste Disposal) Professor Dr. Helmut Flachberger University of Leoben, Chair of Mineral Resources and Petroleum Engineering

  4. The Next Generation Autonomous Lawn Mower Rand C. Chandler, Dr. A. Antonio Arroyo, Dr. Michael Nechyba,

    E-print Network

    Schwartz, Eric M.

    The Next Generation Autonomous Lawn Mower Rand C. Chandler, Dr. A. Antonio Arroyo, Dr. Michael and intelligently mow grass in an environment typical of a person's lawn. Unlike its predecessors, this mower, the mower becomes a "lawn maintainer" instead of just a lawnmower. Several sensors will be used as well

  5. The 3XMM-DR4 Catalogue

    NASA Astrophysics Data System (ADS)

    Rosen, S.; Watson, M.; Pye, J.; Webb, N.; Schwope, A.; Freyberg, M.; Motch, C.; Ballet, J.; Carrera, F.; Page, M.; Page, C.

    2015-09-01

    The 3XMM-DR4 catalogue is the third generation catalogue of serendipitous X-ray sources from the European Space Agency's (ESA) XMM-Newton observatory, and has been created by the XMM-Newton Survey Science Centre (SSC) on behalf of ESA. Released in July 2013, 3XMM-DR4 contains 531261 detections from 372728 unique sources observed in 7427 XMM-Newton observations, about 50% more than in the preceding 2XMMi-DR3 catalogue, made public in April 2010. We review some of the key science-driven algorithmic and calibration changes to the processing pipeline adopted to enhance the scientific quality of the catalogue, such as the optimised filtering of background flares, improvements to the astrometric analysis and upgrades to the catalogue construction process. Examples of the gains obtained are illustrated.

  6. Red. prof. dr. Emil Tokarz – sedemdesetletnik

    E-print Network

    Jesenšek, Marko; B?dkowska-Kopczyk, Agnieszka

    2014-11-01

    Bielsku Bia?ej od 01.10.2006. 5. Studia z j?zyków i literatur narodów s?owia?skich: tendencje rozwojowe – Red. B. Czapik, E. Tokarz. Wyd. U?. Katowice 1991. 6. Kryzys toz?samo?ci. Slavica. Red. B. Czapik, E. Tokarz. Wyd. U?. Katowice 1992. 7. Pu?apki... Józefa i Stefanii z domu Buczy?skiej obywatelstwo polskie 2. studia wy?sze – filologia s?owia?ska, Wydzia? Filologiczny, Uniwersytet Jagiello?ski (1963–1968) rok uko?czenia: 30.05.1968 r. promotor: prof. dr hab. S. Urba?czyk, rec. prof. dr hab. F...

  7. Dr. Wernher Von Braun examines a ruby crystal.

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. Wernher Von Braun (right), director of the Marshall Space Flight Center, and Dr. Eberhard Rees (left), deputy director, technical, examine a ruby crystal used in laser experiments in the Marshall Center's Space Sciences Laboratory.

  8. Physics 3610: Thermodynamics Instructor: Dr. William Robertson

    E-print Network

    Robertson, William

    Physics 3610: Thermodynamics Instructor: Dr. William Robertson Office: WPS 207 E-mail: William Objective: To provide an introduction to thermodynamics. The course divides into an initial section that covers the essentials of thermodynamics from the applied engineering perspective and a second section

  9. Junior Year in Munich Dr. Marianne Riegler

    E-print Network

    Cinabro, David

    and patents. EMPLOYER MATCHING GIFT PROGRAMS Many companies have a matching gift program which will double insurance, in the form of an old policy no longer needed by the original beneficiary or a newly created insurance as a benefit, and JYM can be named for a portion of the proceeds. #12;Junior Year in Munich Dr

  10. Statement of Dr. John P. Holdren

    E-print Network

    Statement of Dr. John P. Holdren Director-designate Office of Science and Technology Policy Executive Office of the President for the Committee on Commerce, Science, and Transportation United States this Committee as President Obama's nominee for Director of the Office of Science and Technology Policy (OSTP

  11. HawthorneDr City of Wilmington

    E-print Network

    Olszewski Jr., Edward A.

    Post Office Cape Fear Memorial Hospital Forden Station SCollegeRd rtDr Holly Tree Rd Wilshire Blvd Cove Applebee's Miller Motte College Hoggard St Randall Pkwy Landmark Hospital Transit Station © 2014, Wave Transit Design by Smartmaps, Knoxville, TN. Legend Bus Route1 US Highway17 City of Wilmington

  12. ISE 418: Integer Programming Dr. Ted Ralphs

    E-print Network

    Ralphs, Ted

    to use common methodology for the solution of integer programs. 4. Understand the basic conceptsISE 418: Integer Programming Syllabus Dr. Ted Ralphs Fall 2014 1 Miscellaneous Course Information page: http://coral.ie.lehigh.edu/~ted Course web page: http://coral.ie.lehigh.edu/~ted/teaching/ie418

  13. Dr. Hugh L. Dryden - artist's sketch

    NASA Technical Reports Server (NTRS)

    1980-01-01

    Artist's depiction of Dr. Hugh Latimer Dryden. Dr. Dryden saw his first airplane, the Antoinette, on November 7, 1910. Years later he was fond of remarking. 'The airplane and I grew up together.' In addition to his professional work, Dr. Dryden was a licensed preacher for 45 years. One of his later sermons perhaps best describes his legacy: 'None of us knows what the final destiny of man may be, or if there is any end to his capacity for growth and adaptation. Wherever this venture leads us, I am convinced that the power to leave the Earth -- to travel where we will in space and to return at will -- marks the opening of a brilliant new stage in man's evolution.' The honors, offices and awards bestowed on Hugh Dryden were great both in significance and in number. His honorary degrees numbered 16. In 1962 the Methodist Union named him the Methodist Layman of the Year. Dr. Dryden was initially an aerodynamicist with the National Bureau of Standards. He did important early work in high-speed aerodynamics. In 1947 he became the director of aeronautical research for the National Advisory Committee for Aeronautics (NACA -- predecessor of the National Aeronautics and Space Administration). Two years later, he became NACA's director, a position he held until 1958 when he became deputy administrator of NASA.

  14. Dr. F. Amar Chy 475 Spring 2009

    E-print Network

    Amar, François G.

    Dr. F. Amar Chy 475 Spring 2009 Hermitian operators Physical observables are represented: ! f " (x #$ +$ % ) ^Ag(x)dx ! g(x "# +# $ ) ^A% f % (x)dx, (4) is a Hermitian operator. So we've shown, will the eigenvalues of ! ^A be real? Proof: Suppose that we apply eqn 4 in the situation where f and g are the same

  15. Dr. F. Amar Chy 475 Spring 2013

    E-print Network

    Amar, François G.

    Dr. F. Amar Chy 475 Spring 2013 Hermitian operators Physical observables are represented which leads to: = (3) An operator, ^A , that satisfies eqn. 3, or more generally, eqn. 4: f (x - + ) ^Ag(x)dx g(x - + ) ^A f (x)dx, (4) is a Hermitian operator. So we've shown that real eigenvalues

  16. Dr. Stella 1. Introduction to Pharmacology

    E-print Network

    Wang, Edith

    NBIO 404 Dr. Stella 1. Introduction to Pharmacology Page 16 Intro 21 Intro 22 1.4 PHARMACOKINETICS to Pharmacology Page 17 Intro 23 ·Hydrophobic: lipid-soluble = readily cross cell membranes. ·Hydrophobic drugs. Introduction to Pharmacology Page 18 Intro 24 - Form: ·liquid ·tablet or capsule (= slower release) ·patch

  17. FOTO:DR.ROGERS NEUE SENSORTECHNOLOGIE

    E-print Network

    Rogers, John A.

    FOTO:©DR.ROGERS NEUE SENSORTECHNOLOGIE Wissenschaftler in den USA haben es geschafft, halbkugelförmige Sensoren herzustellen, die weniger Verzeichnung und Aberration versprechen. fotoMAGAZIN hat mit Foto- dioden nicht zu denken ist. Ein halbku- gelförmiger Sensor erfordert deshalb, dass die

  18. Infection Research Colloquium Dr. Sina Bartfeld

    E-print Network

    Gugat, Martin

    Infection Research Colloquium Dr. Sina Bartfeld Research Centre for Infectious Diseases (ZINF) University of Würzburg ,,Infection, innate immune signaling and cancer in the stomach - stem cell derived, seminar room 01.178 Erlangen Center for Infection Research Contributing Research Consortia: Collaborative

  19. Dr. Jeffrey Doering, Professor/Chairperson

    E-print Network

    Kelly, John J.

    again the field class in the tropical rain forest of Costa Rica was a great experience for the students Rica Dr. Robert Hamilton has taken another Natural Resource Conserva- tion class to the rain forest Cruces is a 300 hectare pre-montane rain forest near the town of San Vito in southwestern Costa Rica

  20. Dr. Caleb Williams Saleeby: The Complete Eugenicist.

    ERIC Educational Resources Information Center

    Rodwell, Grant

    1997-01-01

    Profiles the work of Dr. Caleb Williams Saleeby, a late 19th-century propagandist for eugenics. Eugenics is a science that deals with the transmission of hereditary racial traits, coupled with a desire to use this for the elimination of social ills. Discusses Saleeby's work with the Eugenics Education Society. (MJP)

  1. 9-THC 8-THC Cannabinoid Dr. Stella

    E-print Network

    Wang, Edith

    O 1 2 3 4 5 6 6a 7 8 9 10 10a O OH O OH 9-THC 8-THC Cannabinoid NBIO 404 Dr. Stella 2 identified the chemical structure of the major psychoactive ingredient = 9-THC = hydrophobic (Fig 2A). ·8-THC and monkey = self-administer CP55940 (high affinity full agonist), rarely with THC (partial agonist). B

  2. Publications Dr. Barbara Frisken / Professor / Physics

    E-print Network

    Frisken, Barbara

    .J. Frisken, "The Interaction of a Charged Polymer with Zwitterionic Lipid Vesicles", Langmuir 26, 4095.J. Frisken, A.E. Bailey, J.R. deBruyn, "Microrheology and structure of a yield-stress polymer gel", Phys. Rev vesicles using an inverted emulsion", Langmuir 19, pp. 2870-2879 (2003). #12;Publications Dr. Barbara

  3. MICROBIAL PHYSIOLOGY AND BIOCHEMISTRY Dr. Aditya Mittal

    E-print Network

    Mittal, Aditya

    H Effect of temperature Ribozymes Applications of Enzymes Keywords Enzyme activity, enzyme kinetics, it is observed that by lowering the activation energy for the reaction, an enzyme makes it possible for reactantMICROBIAL PHYSIOLOGY AND BIOCHEMISTRY Enzymes Dr. Aditya Mittal Dept. of Biochemical Engineering

  4. Introduction to Animation Programming Dr. Susan Rodger

    E-print Network

    Rodger, Susan H.

    . The color of the text is blue, and ``Your Name'' is the text that is written. Delaying so the animation to slow the animation down so you can see what is happening. Rectangle objects rectangle 200 16.0 8.0 40Introduction to Animation Programming Dr. Susan Rodger PipeLINK Activity Day Introduction First we

  5. Interview [with Dr. Gerald W. Bracey

    ERIC Educational Resources Information Center

    Journal of Educational Research, 2007

    2007-01-01

    This article presents an interview with Dr. Gerald W. Bracey, author of "Reading Educational Research: How to Avoid Getting Statistically Snookered." During the interview, Bracey explains why he considers the No Child Left Behind Act (NCLB) as a "weapon of mass destruction" and that he sees nothing to suggest that NCLB has improved schools.…

  6. Walt Disney and Dr. Wernher von Braun

    NASA Technical Reports Server (NTRS)

    1954-01-01

    Dr. Werhner von Braun, then Chief, Guided Missile Development Operation Division at Army Ballistic Missile Agency (ABMA) in Redstone Arsenal, Alabama, was visited by Walt Disney in 1954. In the 1950's, von Braun worked with Disney Studio as a technical director, making three films about space exploration for television. A model of the V-2 rocket is in background.

  7. Online marketing & privacy law Dr. Frederik Borgesius

    E-print Network

    Hoepman, Jaap-Henk

    Optimization Agency Trading Desks Ad Networks Media Planning and Attribution Verification / Privacy Ad Servers Retargeting Media Mgmt Systems and Operations Sharing Data / Social Tools SSPs DISPLAY(LUMAscape M A R K E T EOnline marketing & privacy law Dr. Frederik Borgesius Nijmegen 28 Feb 2015 #12;1. Behavioural

  8. Dr. David Innes Outline of topics

    E-print Network

    Innes, David J.

    1 Dr. David Innes Fall 2009 Outline of topics: 1. Introduction/History of Interest in Genetic and Introgression 9. Topics in Evolutionary Genetics - Human evolutionary genetics - Conservation genetics Chapter Phylogeography and Limited Genetic Connectivity in the Endangered Boring Giant Clam across the Coral Triangle

  9. Build A Comet! Dr. Henry Throop

    E-print Network

    Throop, Henry

    Build A Comet! Dr. Henry Throop Planetary Science Institute Tucson,Arizona, USA SciFest Africa, March 2013 #12;Comet Basics Comets are icy snowballs.They are made of the same things the rest of the planets are made of: rock and ice, mixed with a small amount of junk and goo (organic molecules) #12;Comet

  10. Math 112, Spring 2013 Dr. Sarah Raynor

    E-print Network

    Raynor, Sarah G.

    Math 112, Spring 2013 Dr. Sarah Raynor Textbook: Single Variable Calculus, 7th Edition, James Stewart, ISBN 0-538-49781-5. You do not need to have this exact textbook edition for this course. Office is intended for students with a background in differential calculus, either via Math 111 at Wake or the AB

  11. Dr. Lakshmi Goyal Cell Editorial Office

    E-print Network

    . Wolf, M.D. July 11, 2003 Dear Dr. Goyal, We are submitting the enclosed manuscript entitled "BTB as a Short Article in Molecular Cell. In this study, we show that all three BTB/POZ domain containing. Importantly, these interactions depend on the integrity of the BTB/POZ domains as well as conserved residues

  12. HIS EXCELLENCY DR. IBRAHIM BADRAN I. Achievements

    E-print Network

    , and writing 1970 - till present - Engineering and Post-graduate studies 1970 - 1980 Dr. Badran has contributed Reform and education economics. - Concept of Social Economics. - Industrialization of National Economy of Engineering in Philadelphia University to the forefront among engineering faculties in Jordan. - Creating

  13. Alcohol And drUg Policies

    E-print Network

    Massachusetts at Amherst, University of

    University Alcohol And drUg Policies 404-185 Rev 8/13 #12;#12;High-risk drinking and other drug use and consumption of alcoholic beverages and other drugs. These standards conform to state and federal laws hall community standards d.10 Alcohol Policy for Residence Halls and University-approved Housing

  14. Dr. von Braun Visits Huntsville Boys Club

    NASA Technical Reports Server (NTRS)

    1961-01-01

    Dr. von Braun, Director of Marshall Space Flight Center (MSFC) and chairman of this year's United Givers Fund (UGF) drive at MSFC, takes time out from the problems of sending a man to the Moon to talk baseball with 11-year-old Randy Smith at the Huntsville Boys Club.

  15. Dr. Peter M. Vallone NIST NSF Workshop

    E-print Network

    GGTGGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA GATAGATAGATAGATATCATTGAAAGACAAAACAGAGATGGATGATAGATACA An accordion-like DNA sequence that occurs be run in all DNA tests in order to provide a common currency with DNA profiles #12;Dr. Peter M. Vallone AMEL Sex-typing CoreST Forensic DNA Testing Probe subsets of genetic variation in order

  16. ORAC-DR: Astronomy data reduction pipeline

    NASA Astrophysics Data System (ADS)

    Jenness, Tim; Economou, Frossie; Cavanagh, Brad; Currie, Malcolm J.; Gibb, Andy

    2013-10-01

    ORAC-DR is a generic data reduction pipeline infrastructure; it includes specific data processing recipes for a number of instruments. It is used at the James Clerk Maxwell Telescope, United Kingdom Infrared Telescope, AAT, and LCOGT. This pipeline runs at the JCMT Science Archive hosted by CADC to generate near-publication quality data products; the code has been in use since 1998.

  17. Dr. Wernher Von Braun presents a certificate

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. Wernher Von Braun (left), director of the Marshall Space Flight Center, presents a humorous certificate to Major General Charles W. Eifler, commanding general of Redstone Arsenal, at the close of a farewell luncheon for the general prior to General Eifler moving to a new European duty station.

  18. Dr. Israel Cuellar (1946-2008)

    ERIC Educational Resources Information Center

    Zamarripa, Manuel X.

    2009-01-01

    On September 7th, 2008, the mental health field lost a trailblazing researcher and clinician as he lost his battle with amyotrophic lateral sclerosis (ALS), commonly referred to as Lou Gehrig's disease. Dr. Israel Cuellar made significant contributions to the study of acculturation including its importance in delivering appropriate mental health…

  19. URBAN ECOLOGY SYLLABUS Dr. Myla Aronson

    E-print Network

    Chen, Kuang-Yu

    1 URBAN ECOLOGY ­ SYLLABUS Dr. Myla Aronson Email: Myla.Aronson@rutgers.edu Required Text and Readings · Gaston, K.J. 2010. Urban Ecology. Cambridge University Press, New York. ISBN: 978-0-521-743479-5 · Various papers throughout the semester. TBA Course Description Urban landscapes are rapidly expanding

  20. In Their Own Words: Dr. Sholom Wacholder

    Cancer.gov

    Dr. Sholom Wacholder, a biostatistician in the NCI Division of Cancer Epidemiology and Genetics, discusses his role on a human papillomavirus vaccine clinical trial. You will need Adobe Flash Player 8 or later and JavaScript enabled to view this video. You

  1. On Dr. Loebner's Lessons Stuart M. Shieber

    E-print Network

    Shieber, Stuart

    believes that it will advance the state of 1 Recently, former chair of the Loebner Prize committee Daniel Dennett has stated that ``Unless serious competition can be attracted, continuing the contests of genuine depth of model, genuine progress, in AI.'' (personal communication) According to Dr. Dennett, he

  2. Curriculum Vitae Oliver C. Schultheiss, Dr. phil.

    E-print Network

    Schultheiss, Oliver C.

    Psychology, Motivation, and Affective Neuroscience Department of Psychology and Sport Sciences FriedrichCurriculum Vitae Oliver C. Schultheiss, Dr. phil. Professor of Psychology Chair for Experimental-Alexander University, Erlangen, Germany Last update: March 3, 2015 Work address: Institute of Psychology, Friedrich

  3. A TRIBUTE TO DR. WILLIAM PENN WATKINSON

    EPA Science Inventory

    Dr. William Penn Watkinson (known to colleagues as "Penn") of EPA¿s health research lab (National Health and Environmental Research Laboratory) of Research Triangle Park, North Carolina, died Wednesday, December 13 after a battle with lung cancer. He was a member of the Pulmonar...

  4. Fluid Mechanics IB Lecturer: Dr Natalia Berloff

    E-print Network

    Fluid Mechanics IB Lecturer: Dr Natalia Berloff Office: CMS G1.02 E-mail: N · Lighthill: An Informal Introduction to Theoretical Fluid Mechanics · van Dyke: Album of Fluid Motion 1.G.Berloff@damtp.cam.ac.uk Class web page: www.damtp.cam.ac.uk/user/ngb23/FD/ 0. INTRODUCTION What is a fluid? By definition

  5. Sweet Corn Cultivar Trial Dr. Richard Hassell

    E-print Network

    Stuart, Steven J.

    Sweet Corn Cultivar Trial 2014 Dr. Richard Hassell Clemson Coastal Research and Education Center 2700 Savannah Highway Charleston SC 29414 #12;Family: Poaceae or True Grasses Sweet Corn #12;The Iroquois gave the first recorded sweet corn (called 'Papoon') to European settlers in 1779. #12;Types: SU

  6. Silicon Wafer Processing Dr. Seth P. Bates

    E-print Network

    Colton, Jonathan S.

    Silicon Wafer Processing Dr. Seth P. Bates Applied Materials Summer, 2000 Objective To provide from blank silicon wafers. Goals The Transfer Plan provides a curriculum covering the process of manufacturing integrated circuits from the silicon wafer blanks, using the equipment manufactured by Applied

  7. Sensor Design II Dr. C. Alex Simpkins

    E-print Network

    Simpkins, Alex

    des but with greater sensitivity ­ light-dependent resistors (LDRs) are slow, but respond like the hu man eye A light-dependent resistor (LDR) #12;Sound Sensors · Microphones ­ a number of forms a presentation by Dr. Kee Moon #12;Sensors · Temperature Sensors · Light Sensors · Force Sensors · Displacement

  8. Dr Eugenio Carminati Associate Professor (Structural Geology)

    E-print Network

    Dr Eugenio Carminati Associate Professor (Structural Geology) room 216 ph: +39 0649914950 fax a degree in Geological Sciences at the University of Milano with a thesis in Structural Geology. I achieved. I'm fellow of the Geological Society of Italy and of the American Geophysical union. Between 2004

  9. 25 Year Medallion Dr Avery Andrews

    E-print Network

    Professor Desmond Ball Mrs Barbara Bankovsky Dr Richard Barz Professor Peter Bellwood Professor Michael Professor George Clark- Walker Ms Marjorie Coggan Mr Peter Conroy Mrs Jennie Colman Mrs Nelida Contreras Mrs Jeanette Coombes Mr Alan Cooper Mr Robert Cooper Mr Derek Corrigan Mr Selwyn Cornish Mr Michael Craft Mr

  10. Dr. Wernher von Braun and Associates With Saturn 1

    NASA Technical Reports Server (NTRS)

    1961-01-01

    Pictured in front of the Saturn 1 launch vehicle are (L to R): Dr. Rocco Petrone, Director of Launch Operations at Kennedy Space Center; Dr. Werher von Braun, Director of Marshall Space Flight Center; Dr. Oswald Lange, Director of the Saturn Systems Office; Mr. Hans. H. Maus, Director of Fabrication and Assembly Engineering Division; and Dr. Hans Gruene, Deputy Director of Launch Operations Directorate. Maus and Gruene were original members of von Braun's rocket team.

  11. Dr. von Braun and Dr. Stuhlinger With a Model of the Nuclear-Electric Vehicles

    NASA Technical Reports Server (NTRS)

    2004-01-01

    In this photo, taken at the Walt Disney Studios in California, Dr. Wernher von Braun and Dr. Ernst Stuhlinger are shown discussing the concepts of nuclear-electric spaceships designed to undertake the mission to the planet Mars. As a part of the Disney 'Tomorrowland' series on the exploration of space, the nuclear-electric vehicles were shown in the last three television films, entitled 'Mars and Beyond,' which first aired in December 1957.

  12. Rev. February 4, 2010 DR. PAT FEINSTEIN CHILD DEVELOPMENT CENTER

    E-print Network

    Rhode Island, University of

    Rev. February 4, 2010 DR. PAT FEINSTEIN CHILD DEVELOPMENT CENTER ADMISSIONS APPLICATION Return application and non-refundable $20.00 application fee to: Dr. Pat Feinstein Child Development Center 80 child in your family attended Dr. Pat Feinstein Child Development Center in the past? Yes No Do you

  13. Guidelines for completing a Masters Thesis in Dr. Mason's lab

    E-print Network

    Mason, Andrew

    Guidelines for completing a Masters Thesis in Dr. Mason's lab Thesis Requirements This document defines the requirements for completing a Thesis Option Masters degree with Dr. Mason as a thesis advisor degree, Dr. Mason requires several documents and presentation to be during the thesis research effort

  14. Dr. Wernher Von Braun talkes with George Hardy.

    NASA Technical Reports Server (NTRS)

    1999-01-01

    George Hardy of the Marshall Space Flight center's Astronautics Laboratory, talks with Dr. Wernher Von Braun (right), deputy associate administrator for planning. Dr. Von Braun was inspecting the mockup of the Saturn workshop during a visit to the Marshall Center. The visit coincided with the 10th anniversary celebration of the center of which Dr. Von Braun was director until March 1, 1970.

  15. Prof. Dr. Frank Maschmann -Bibliographie Stand: Dezember 2014

    E-print Network

    Schubart, Christoph

    . Der Tarifwechsel (zusammen mit Prof. Dr. Wolfgang Hromadka), Verlag C. H. Beck, München 1996. Dr. Wolfgang Hromadka), Springer-Verlag, Heidelberg 1. Aufl. 1998 / 2. Aufl. 2001 / 3. Aufl. 2005 / 4 (zusammen mit Prof. Dr. Wolfgang Hromadka), Springer-Verlag, Heidelberg 1. Aufl. 1999 / 2. Aufl. 2001 / 3

  16. The Java API Java Bootcamp -Villanova University Dr. Papalaskari 1

    E-print Network

    Papalaskari, Mary-Angela

    The Java API Java Bootcamp - Villanova University Dr. Papalaskari 1 CSC 2014 ­ Java Bootcamp Dr in this presentation are adapted from the slides accompanying Java Software Solutions by Lewis & Loftus Java Bootcamp Dr. Papalaskari Villanova University Using Classes and Objects The Java class library or Java API

  17. DR JOHN ADAMCZYK AND DR LONNIE REID EXAMINE SOFTWARE FOR THE NEW START-UP SOFTWARE - ELECTRONICS - A

    NASA Technical Reports Server (NTRS)

    1999-01-01

    DR JOHN ADAMCZYK AND DR LONNIE REID EXAMINE SOFTWARE FOR THE NEW START-UP SOFTWARE - ELECTRONICS - AND COMMUNICATIONS - SEC - INCUBATOR OPENED MAY 1 1999 AS PART OF THE LEWIS INCUBATOR FOR TECHNOLOGY - LIFT

  18. Surname Forename Programme Personal Tutor Abbey Sam PHYU16 Dr CN Booth

    E-print Network

    Crowther, Paul

    Dr M Grell Archer Isabelle PHYU11 Dr M Mears Armitage Josie PHYU11 Dr AR Buckley Armstrong Emma PHYU Mears Bradshaw Jacob PHYU01 Professor LF Thompson Broad Thomas PHYU11 Professor DM Whittaker Brookes JW Cockburn Collins Jared PHYU06 Dr M Mears Cook Alex PHYU25 Dr SL Cartwright Cooper Derry PHYU02 Dr

  19. 21Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center Design of AA systemsDesign of AA systems

    E-print Network

    Kortenkamp, David

    21Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center in autonomy #12;22Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center Generic control system

  20. Dr. John J. Stephens, Jr., metallurgist extraordinaire.

    SciTech Connect

    Hosking, Floyd Michael

    2010-10-01

    The organizers of the Dr. John J. Stephens, Jr. Memorial Symposium: Deformation and Interfacial Phenomena in Advanced High-Temperature Materials are honoring the memory of Dr. Stephens and his many technical contributions that were accomplished over a relatively brief twenty year career. His research spanned the areas of creep and deformation of metals, dispersion-strengthened alloys and their properties, metal matrix composite materials, processing and properties of refractory metals, joining of ceramic-ceramic and metal-ceramic systems, active braze alloy development, and mechanical modeling of soldered and brazed assemblies. The purpose of this presentation is to highlight his research and engineering accomplishments, particularly during his professional career at Sandia National Laboratories in Albuquerque, NM.

  1. Dr.L: Distributed Recursive (Graph) Layout

    Energy Science and Technology Software Center (ESTSC)

    2007-11-19

    Dr. L provides two-dimensional visualizations of very large abstract graph structures. it can be used for data mining applications including biology, scientific literature, and social network analysis. Dr. L is a graph layout program that uses a multilevel force-directed algorithm. A graph is input and drawn using a force-directed algorithm based on simulated annealing. The resulting layout is clustered using a single link algorithm. This clustering is used to produce a coarsened graph (fewer nodes)more »which is then re-drawn. this process is repeated until a sufficiently small graph is produced. The smallest graph is drawn and then used as a basis for drawing the original graph by refining the series of coarsened graphs that were produced. The layout engine can be run in serial or in parallel.« less

  2. Dr. Norman Bethune as a surgeon

    PubMed Central

    Rosen, Irving B.

    1996-01-01

    Dr. Norman Bethune’s recognition as a Canadian of renown resulted from his devoted work in China during the late 1930s. He had received a general surgical training, but his personal illness with tuberculosis led him to specialize in thoracic surgery. A surgical program at McGill University under Dr. Edward Archibald, a pioneer thoracic surgeon, was initially successful, but by the mid-1930s Bethune was rejected by McGill and Dr. Archibald. He became chief of thoracic surgery at the Hôpital du Sacré-Coeur outside Montreal. He developed thoracic surgical instruments and wrote numerous scientific papers. The outbreak of civil war in Spain in 1937 attracted Bethune to oppose what he viewed as fascist aggression. He went to Spain, where he established the value of mobile blood banking. On his return to Canada in 1937 he became aware of the escalating war between China and Japan. He joined the Chinese communist forces in northern China and spent 18 months doing Herculean mobile war surgery, while improving the state of medical services in primitive, depressing conditions. He died in 1939 at the age of 49 years of septicemia as a result of accidental laceration of his finger during surgery. The Chinese have venerated Norman Bethune and stimulated his memorialization in Canada. His surgical record can be viewed as mixed in quality, but overall his performance remains impressive for its achievement. PMID:8599799

  3. Dual Agonist Surrobody Simultaneously Activates Death Receptors DR4 and DR5 to Induce Cancer Cell Death.

    PubMed

    Milutinovic, Snezana; Kashyap, Arun K; Yanagi, Teruki; Wimer, Carina; Zhou, Sihong; O'Neil, Ryann; Kurtzman, Aaron L; Faynboym, Alexsandr; Xu, Li; Hannum, Charles H; Diaz, Paul W; Matsuzawa, Shu-Ichi; Horowitz, Michael; Horowitz, Lawrence; Bhatt, Ramesh R; Reed, John C

    2016-01-01

    Death receptors of the TNF family are found on the surface of most cancer cells and their activation typically kills cancer cells through the stimulation of the extrinsic apoptotic pathway. The endogenous ligand for death receptors 4 and 5 (DR4 and DR5) is TNF-related apoptosis-inducing ligand, TRAIL (Apo2L). As most untransformed cells are not susceptible to TRAIL-induced apoptosis, death receptor activators have emerged as promising cancer therapeutic agents. One strategy to stimulate death receptors in cancer patients is to use soluble human recombinant TRAIL protein, but this agent has limitations of a short half-life and decoy receptor sequestration. Another strategy that attempted to evade decoy receptor sequestration and to provide improved pharmacokinetic properties was to generate DR4 or DR5 agonist antibodies. The resulting monoclonal agonist antibodies overcame the limitations of short half-life and avoided decoy receptor sequestration, but are limited by activating only one of the two death receptors. Here, we describe a DR4 and DR5 dual agonist produced using Surrobody technology that activates both DR4 and DR5 to induce apoptotic death of cancer cells in vitro and in vivo and also avoids decoy receptor sequestration. This fully human anti-DR4/DR5 Surrobody displays superior potency to DR4- and DR5-specific antibodies, even when combined with TRAIL-sensitizing proapoptotic agents. Moreover, cancer cells were less likely to acquire resistance to Surrobody than either anti-DR4 or anti-DR5 monospecific antibodies. Taken together, Surrobody shows promising preclinical proapoptotic activity against cancer cells, meriting further exploration of its potential as a novel cancer therapeutic agent. Mol Cancer Ther; 15(1); 114-24. ©2015 AACR. PMID:26516157

  4. Multiwavelength observations of two B-star nurseries - DR 15 and DR 20

    SciTech Connect

    Odenwald, S.F.; Campbell, M.F.; Shivanandan, K.; Schwartz, P.; Fazio, G.G.; Moseley, H. Colby College, Waterville, ME Naval Research Laboratory, Washington, DC Harvard-Smithsonian Center for Astrophysics, Cambridge, MA NASA, Goddard Space Flight Center, Greenbelt, MD )

    1990-01-01

    New observations of DR 15 and 20 are reported as part of a study of compact H II regions in the Cyg X region. The radio and FIR data for these objects, when combined with (C-12)O maps, IRAS imagery, and optical photographs, provide new insights into the structure of this complex region and the nature of the star-formation process there. The observations show that DR 15 may consist of one or two B0 ZAMS stars whose H I regions have formed a low-density cavity within a molecular cloud. DR 20 appears to be a young OB cluster. The cluster is dominated by an O5.5 ZAMS star and also contains an approximately 3500-yr-old B0 star appearing as a compact H II region, along with weak FIR sources that may be B0-star candidates. 36 refs.

  5. Enrico Fermi Awards Ceremony for Dr. Mildred S. Dresselhaus and Dr. Burton Richter, May 2012 (Presentations, including remarks by Energy Secretary, Dr. Steven Chu)

    SciTech Connect

    Chu, Steven

    2012-05-07

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On May 7, 2012 it was conferred upon two exceptional scientists: Dr. Mildred Dresselhaus, 'for her scientific leadership, her major contributions to science and energy policy, her selfless work in science education and the advancement of diversity in the scientific workplace, and her highly original and impactful research,' and Dr. Burton Richter, 'for the breadth of his influence in the multiple disciplines of accelerator physics and particle physics, his profound scientific discoveries, his visionary leadership as SLAC Director, his leadership of science, and his notable contributions in energy and public policy.' Dr. John Holder, Director of the White House Office of Science and Technology Policy, opened the ceremony, and Dr. Bill Brinkman, Director of DOE's Office of Science introduced the main speaker, Dr. Steven Chu, U.S. Energy Secretary.

  6. Enrico Fermi Awards Ceremony for Dr. Mildred S. Dresselhaus and Dr. Burton Richter, May 2012 (Presentations, including remarks by Energy Secretary, Dr. Steven Chu)

    ScienceCinema

    Chu, Steven (U.S. Energy Secretary)

    2012-06-28

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On May 7, 2012 it was conferred upon two exceptional scientists: Dr. Mildred Dresselhaus, 'for her scientific leadership, her major contributions to science and energy policy, her selfless work in science education and the advancement of diversity in the scientific workplace, and her highly original and impactful research,' and Dr. Burton Richter, 'for the breadth of his influence in the multiple disciplines of accelerator physics and particle physics, his profound scientific discoveries, his visionary leadership as SLAC Director, his leadership of science, and his notable contributions in energy and public policy.' Dr. John Holder, Director of the White House Office of Science and Technology Policy, opened the ceremony, and Dr. Bill Brinkman, Director of DOE's Office of Science introduced the main speaker, Dr. Steven Chu, U.S. Energy Secretary.

  7. Dr. Goddard and a 1918 version of 'Bazooka'

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Dr. Robert H. Goddard loading a 1918 version of the Bazooka of World War II. From 1930 to 1941, Dr. Goddard made substantial progress in the development of progressively larger rockets, which attained altitudes of 2400 meters, and refined his equipment for guidance and control, his techniques of welding, and his insulation, pumps, and other associated equipment. In many respects, Dr. Goddard laid the essential foundations of practical rocket technology

  8. Dr. Jan Rogers with Electrostatic Levitator

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Dr. Jan Rogers, project scientist for the Electrostatic Levitator (ESL) at NASA's Marshall Space Flight Center(MSFC). The ESL uses static electricity to suspend an obejct (about 2-3 mm in diameter) inside a vacuum chamber while a laser heats the sample until it melts. This lets scientists record a wide range of physical properties without the sample contacting the container or any instruments, conditions that would alter the readings. The Electrostatic Levitator is one of several tools used in NASA's microgravity materials sciences program.

  9. On the trail of Dr. Fifer.

    PubMed Central

    Asche, G

    1996-01-01

    A gift from a patient drew Hope, BC, family physician Gerd Asche irrevocably into the local medical history of the 1858 Fraser River Gold Rush. Because of his interest in Dr. Max William Fifer, Asche undertook research missions in British Columbia, England and the US, converted his computer room to a research and writing centre, and wrote a biography of his predecessor and colleague. He recounts his experience and the growing satisfaction provided by his interest in medical history. Images p1398-a PMID:8616743

  10. CAD BASED DRILLING USING CONVENTIONAL TWIST DRILLS PANAGIOTIS KYRATSIS*, Dr. Ing. NIKOLAOS BILALIS**, Dr. VASILIS

    E-print Network

    Aristomenis, Antoniadis

    CAD BASED DRILLING USING CONVENTIONAL TWIST DRILLS PANAGIOTIS KYRATSIS*, Dr. Ing. NIKOLAOS BILALIS use of modern CAD systems, provide an excellent platform for the development of CAD-based tools Programming Interface) of a general purpose CAD system. The model is parameterized in order to achieve

  11. GWU Personnel: Dr. J. Rene van Dorp VCU Personnel: Dr. Jason R. W. Merrick

    E-print Network

    van Dorp, Johan René

    Barges BASE CASE 2010 TRAFFIC WITH FOLLOWING WHAT-IF FOCUS VESSELS 348 Delta Port Bulk Carriers about 24.7% of Focus Vessel Traffic to the 2010 ­ Base Case. D raft #12;GWU Personnel: Dr. J. Rene van 2010 TRAFFIC DENSITIES BY CARGO ­ FV and TANK- FV Presentation by: J. Rene van Dorp PRELIMINARY CASE T

  12. Dr. Keller Frey Named Distinguished Congratulations to Dr. Demarious Keller Frey on

    E-print Network

    for his contributions to lasers and photonics in veterinary medicine. SPIE is House Officer Seminar Dr and see a special screening of the film "Nature vs. Nature: The Animal Victims of the May 2013 Oklahoma://www.ostate.tv/. Science Cafe The Science Cafe at OSU will feature the film "Nature vs. Nature: The Animal Victims

  13. White dwarfs identified in LAMOST DR 2

    NASA Astrophysics Data System (ADS)

    Guo, Jincheng; Zhao, Jingkun; Tziamtzis, Anestis; Liu, Jifeng; Li, Lifang; Zhang, Yong; Hou, Yonghui; Wang, Yuefei

    2015-12-01

    Here we present a catalogue of 1056 spectroscopically identified hydrogen-dominated white dwarfs (DAWDs), 34 helium-dominated white dwarfs (DBWDs) and 276 white dwarf main sequence (WDMS) binaries from the Large sky Area Multi-Object Fiber Spectroscopic Telescope (LAMOST) survey data release 2 (DR2). 383 DAWDs, 4 DBWDs and 138 WDMSs are new identifications after cross-match with literature. There are ˜4100 k spectra in total from DR 2. The low ratio of white dwarfs found in LAMOST is attributed to biased selection of LAMOST input catalogue and much brighter targets relative to stars observed in Sloan Digital Sky Survey. In this paper, a new DAWD selection method is adopted as a new attempt and supplement to the traditional methods. The effective temperature, surface gravity, mass, cooling age and distance of high signal-to-noise DAWDs are estimated. The peak of the mass distribution is found to be ˜0.6 M?, which is consistent with previous work. The parameters of WDMS binaries are also provided in this paper. As the foundation of our future work, which is to identify more WDs with debris disc, WDs found in LAMOST showed a lot of potential. Interesting infrared-excess WDs will be reported in our forthcoming paper.

  14. Entrevue avec le Dr Charley Zeanah

    PubMed Central

    2013-01-01

    Le Dr Charles Zeanah est titulaire de la chaire de psychiatrie Mary K. Sellars-Polchow, professeur de pédiatrie clinique et vice-président de la pédopsychiatrie au département de psychiatrie et des sciences du comportement de la faculté de médecine de l’Université Tulane, à la Nouvelle-Orléans. Il est également directeur général de l’institut de la santé mentale des nourrissons et des jeunes enfants de Tulane. Il est récipiendaire de nombreux prix, notamment le prix de prévention Irving Phillips (AACAP), la mention élogieuse présidentielle pour sa recherche et son leadership exceptionnels en santé mentale des nourrissons (American Orthopsychiatric Association), le prix d’excellence clinique Sarah Haley Memorial (International Society for Traumatic Stress Studies), le prix de recherche en pédopsychiatrie Blanche F. Ittelson (APA), et le prix Serge Lebovici Award soulignant les contributions internationales à la santé mentale des nourrissons (World Association for Infant Mental Health). Le Dr Zeanah est fellow distingué de l’AACAP, fellow distingué de l’APA et membre du conseil d’administration de Zero to Three. Il est l’éditeur scientifique de Handbook of Infant Mental Health (3e édition) qui est considéré comme étant le manuel de pointe et la référence de base du domaine de la santé mentale des nourrissons.

  15. Summer school HEALTHY AGEING: from cell to society, 6 July 10 July 2015 Programme committee: Prof. dr. Monicque Lorist, Prof. dr. Uli Eisel, Dr. Andrea de Winter, Dr. Eva Kibele, Prof. dr. Judith Rosmalen (chair)

    E-print Network

    Zaroubi, Saleem

    Summer school HEALTHY AGEING: from cell to society, 6 July ­ 10 July 2015 Programme committee: Prof RUG) Healthy ageing and cognition 10.00-11.00 Model organisms for healthy ageing research: an introduction. Dr. Michael Chang (ERIBA) Tour ERIBA 11.00-12.00 The LifeLines cohort study and healthy ageing

  16. 81Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center Deep Space One Remote AgentDeep Space One Remote Agent

    E-print Network

    Kortenkamp, David

    81Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center of the NASA 1999 Software of the Year Award #12;82Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center Deep Space One (DS1)Deep Space One (DS1) l Launched 10/98 l Remote

  17. 60Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center NASA HCA Applications OutlineNASA HCA Applications Outline

    E-print Network

    Kortenkamp, David

    60Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center NASA HCA Applications OutlineNASA HCA Applications Outline l 3T Control Architecture ­ architecture Satellite Assistant (under development) #12;61Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David

  18. 39Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center Requirements OutlineRequirements Outline

    E-print Network

    Kortenkamp, David

    39Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center responsibility: both accept and request #12;40Dr. Gregory A. Dorais, NASA Ames Research Center Dr. David Kortenkamp, NASA Johnson Space Center MotivationsMotivations l Adjustable autonomy places severe requirements

  19. D&R visualization tool http://tessera.io

    E-print Network

    Knight, Keith

    D&R visualization tool http://tessera.io Barret Schloerke Purdue University Bill Cleveland & Ryan · Trelliscope! #12;Trelliscope · http://tessera.io/docs-trelliscope/ · Divide & Recombine (D&R) visualization, flexible, detailed visualization of data #12;http://tessera.io Stack · Divide and Recombine #12;http://tessera.io

  20. Dr. von Braun Tries Out the Neutral Buoyancy Simulator (NBS)

    NASA Technical Reports Server (NTRS)

    1967-01-01

    Marshall Space Flight Center (MSFC) Director, Dr. von Braun, is shown leaving the suiting-up van wearing a pressure suit prepared for a tryout in the MSFC Neutral Buoyancy Simulator (NBS). Weighted to a neutrally buoyant condition, Dr. von Braun was able to perform tasks underwater which simulated weightless conditions found in space.

  1. Dr. von Braun Tries Out the Neutral Buoyancy Simulator (NBS)

    NASA Technical Reports Server (NTRS)

    1967-01-01

    Astronaut L. Gordon Cooper checks the neck ring of a space suit worn by Marshall Space Flight Center (MSFC) Director, Dr. von Braun before he submerges into the water of the MSFC Neutral Buoyancy Simulator (NBS). Wearing a pressurized suit and weighted to a neutrally buoyant condition, Dr. von Braun was able to perform tasks underwater which simulated weightless conditions found in space.

  2. Dr. von Braun Tries Out the Neutral Buoyancy Simulator (NBS)

    NASA Technical Reports Server (NTRS)

    1967-01-01

    Marshall Space Flight Center (MSFC) Director, Dr. von Braun, submerges after spending some time under water in the MSFC Neutral Buoyancy Simulator (NBS). Weighted to a neutrally buoyant condition, Dr. von Braun was able to perform tasks underwater which simulated weightless conditions found in space.

  3. College of Science & Engineering Dr. Sheldon Axler, Dean

    E-print Network

    Dr. Susan Lea, Chair, Department of Physics & Astronomy Dr. Toby Garfield, Director, Romberg Tiburon and equipment possible. In addition to our active research faculty, we have many state-of-the-art facilities chemistry and visualization laboratory, a molecular biology core facility, and the Nuclear Magnetic

  4. Biotechnology Symposium - In Memoriam, the Late Dr. Allan Zipf

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A one-day biotechnology symposium was held at Alabama A&M University (AAMU), Normal, AL on June 4, 2004 in memory of the late Dr. Allan Zipf (Sept 1953-Jan 2004). Dr. Zipf was a Research Associate Professor at the Department of Plant and Soil Sciences, AAMU, who collaborated extensively with ARS/MS...

  5. EMICO3DR.DOC (last update Feb 10, 1997)

    E-print Network

    Baker, Timothy S.

    EMICO3DR.DOC (last update Feb 10, 1997) CONTENTS A. INTRODUCTION B. PROGRAM INPUT C. PROGRAM [TSB.DOC]EMICO_SYS.DOC). EMICO3DR replaces either of two previously used program combinations: 1 of individual images stored in a single file (PURDUE BYTE- PACKED FORMAT). Read BABE3:[TSB.DOC]EMPROGS.DOC

  6. Infection Research Colloquium Univ.-Prof. Dr. Silja Wessler

    E-print Network

    Gugat, Martin

    -Lodron University of Salzburg "Targeting E-cadherin: Functional role of HtrA in Helicobacter pylori pathogenesis. Schuler Research Training Group 1071 Spokesman: Prof. Dr. B. Fleckenstein Graduate School Molecular Research Training Group 1660 Spokesman: Prof. Dr. H.-M. Jäck Research Training Group CRC 643 Spokesman

  7. Dr.-Ing. Norbert Frhleke PIBRAC -Piezoelectrical Brake Actuator

    E-print Network

    Noé, Reinhold

    -mass ultrasonic Power supply and control development Dr.-Ing. Norbert Fröhleke, Department of Power Electronics Böcker, Dr.-Ing. Norbert Fröhleke Current Aircraft Brake Actuator #12;Power Electronics and Electrical" aircraft: · Reduction in volume and weight · Increase in reliability and operating safety · Reduction costs

  8. hello, poindexter! THE (UN)REMARKABLE DR. CHARLES LIU

    E-print Network

    Liu, Charles

    hello, poindexter! THE (UN)REMARKABLE DR. CHARLES LIU October 8, 2008 at 12:35 pm · Filed under people in this world. He is my astronomy teacher, mentor, overall life coach-in-general: Dr. Charles Liu of curiosity--which happened to be (thankfully) the only passport that Charles accepts. When I enrolled in his

  9. Center for Computational Engineering Science Prof. Dr. Martin Frank

    E-print Network

    Ábrahám, Erika

    then transfers the resulting heat to a fluid (i.e. molten salt or air) Solar power plant PS10 in Andalusia, Spain is a corporation of the Theory of Hybrid Systems (i2) research group headed by Prof. Dr. Erika ´Abrah http://www.mathcces.rwth-aachen.de/5people/frank/ Theory of Hybrid Systems Prof. Dr. Erika ´Abrah

  10. Celebrating the Life and Legacy of Dr. John Hope Franklin

    ERIC Educational Resources Information Center

    Harris, Robert L., Jr.; Levering-Lewis, David; French, John D.; Wharton, Clifton R., Jr.

    2009-01-01

    Dr. John Hope Franklin chronicled the experiences of African-Americans like no one before him, forcing America to recognize Black history as American history. His contributions were innumerable and his impact was abiding. In celebration of his life and legacy, the authors profile the celebrated scholar and activist, Dr. John Hope Franklin.

  11. Dr. Jeremy Martin Senior Scientist, Clean Vehicles Program

    E-print Network

    Firestone, Jeremy

    Dr. Jeremy Martin Senior Scientist, Clean Vehicles Program Union of Concerned Scientists Jeremy Martin, Senior Scientist in the Union of Concerned Scientists' Clean Vehicles Program, evaluates the impact of biofuels and fuel policy. Dr. Martin is the author of more than 15 technical publications

  12. Name Address Alumnae Hall 91 Alumnae Dr. EG

    E-print Network

    Arnold, Elizabeth A.

    Jr., Way AUX McGraw-Long Hall 421 Martin Luther King Jr., Way AUX Phillips Hall 261 Warren Serv. Dr 1251 Carrier Dr. EG Montpelier Hall 235 Martin Luther King, Jr. Way EG Madison Hall 100 E. Grace EG The Annex North Campus 725 S. Mason EG Cantrell Parking Deck (3-level) 275 Martin Luther King, Jr. Way AUX

  13. Address Lot Description 981 MADISON DR A PARKING LOT

    E-print Network

    Arnold, Elizabeth A.

    ST C2 PARKING LOT 761 DUKE DRIVE C3 PARKING LOT 441 MARTIN LUTHER KING JR WAY C4 PARKING LOT 650 DUKE DR CISAT HP/SERVICE REP. 275 MARTIN LUTHER KING JR WAY CANTRELL AVENUE PARKING DECK 851 UNIVERSITY M PARKING LOT 1000 NEWMAN DR N PARKING LOT 714 S MASON ST N2 PARKING LOT 231 MARTIN LUTHER KING JR

  14. Department of Biochemistry Supervisor: Dr. Andrew MacMillan

    E-print Network

    MacMillan, Andrew

    Dr. Tao Wu Department of Biochemistry Supervisor: Dr. Andrew MacMillan Originally from Penglai. At PKU I gained research experience in tissue culture and virus vaccine studies. I was then admitted to the Department of Biochemistry at University of Alberta to pursue my graduate studies. After finishing my

  15. Dr. Shawn Mehlenbacher 2012 Wilder Silver Medal Recipient

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dr. Shawn Mehlenbacher, Oregon State University, was awarded the 2012 Wilder Medal by the American Pomological Society for his contributions to hazelnut genetics and cultivar development. Dr. Mehlenbacher took over the leadership of the Oregon State University hazelnut breeding program in 1986 aft...

  16. MAS275 Probability Modelling Example 21: Dr Jonathan Jordan

    E-print Network

    Jordan, Jonathan

    MAS275 Probability Modelling Example 21: Monopoly Dr Jonathan Jordan School of Mathematics;Monopoly simplified Board game with 40 "squares", which we will number 0 to 39 (or 1 to 40). Most are labelled with a street or other location. Dr Jonathan Jordan MAS275 Probability Modelling #12;Monopoly

  17. Dr. Truthlove, How I Learned to Stop Worrying and Love

    E-print Network

    Fitelson, Branden

    Dr. Truthlove, or How I Learned to Stop Worrying and Love Bayesian Probabilities Kenny Easwaran September 1, 2014 1 Setup 1.1 The Preface Paradox Dr. Truthlove loves believing things that are true loves -- believing a true claim. But none of this answers the overall question. Is she doing what she

  18. Dr. Truthlove, How I Learned to Stop Worrying and Love

    E-print Network

    Fitelson, Branden

    Dr. Truthlove, or How I Learned to Stop Worrying and Love Bayesian Probabilities Kenny Easwaran March 1, 2013 1 Setup 1.1 The Preface Paradox Dr. Truthlove loves believing things that are true loves -- believing a true claim. But none of this answers the overall question. Is she doing what she

  19. Dr. Wernher Von Braun near the mobile launcher.

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. George Mueller, NASA associate administrator for manned space flight, and Dr. Wernher Von Braun (right), director of the Marshall Space Flight Center, are seen near the mobile launcher carrying a 363 foot tall Saturn V space launch vehicle as the rocket is rolled from the vehicle assembly building at KSC for its three mile trip to the launch pad.

  20. College of Science & Engineering Dr. Sheldon Axler, Dean

    E-print Network

    Goldman, Chair, Department of Biology Dr. Jane DeWitt, Chair, Department of Chemistry & Biochemistry Dr- boratory, a molecular biology core facility, and the Nuclear Magnetic Resonance Center. A Setting That environment. Our students learn through research opportunities, internships, cooperative education, and other

  1. CSC 2014 Java Bootcamp Dr. Mary-Angela Papalaskari

    E-print Network

    Papalaskari, Mary-Angela

    CSC 2014 ­ Java Bootcamp Dr. Mary-Angela Papalaskari Department of Computing Sciences Villanova University Some slides in this presentation are adapted from the slides accompanying Java Software Solutions by Lewis & Loftus Java Bootcamp Dr. Papalaskari Villanova University Introduction to Java #12;Course

  2. Enrico Fermi Awards Ceremony for Dr. Allen J. Bard and Dr. Andrew Sessler, February 2014 (Presentations, including remarks by Energy Secretary, Dr. Ernest Moniz)

    ScienceCinema

    Moniz, Ernest [U.S. Energy Secretary

    2014-08-22

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On February 3, 2014 it was conferred upon two exceptional scientists. The first to be recognized is Dr. Allen J. Bard, 'for international leadership in electrochemical science and technology, for advances in photoelectrochemistry and photocatalytic materials, processes, and devices, and for discovery and development of electrochemical methods including electrogenerated chemiluminescence and scanning electrochemical microscopy.' The other honoree is Dr. Andrew Sessler, 'for advancing accelerators as powerful tools of scientific discovery, for visionary direction of the research enterprise focused on challenges in energy and the environment, and for championing outreach and freedom of scientific inquiry worldwide.' Dr. Patricia Dehmer opened the ceremony, and Dr. Ernest Moniz presented the awards.

  3. Enrico Fermi Awards Ceremony for Dr. Allen J. Bard and Dr. Andrew Sessler, February 2014 (Presentations, including remarks by Energy Secretary, Dr. Ernest Moniz)

    SciTech Connect

    Moniz, Ernest

    2014-02-03

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On February 3, 2014 it was conferred upon two exceptional scientists. The first to be recognized is Dr. Allen J. Bard, 'for international leadership in electrochemical science and technology, for advances in photoelectrochemistry and photocatalytic materials, processes, and devices, and for discovery and development of electrochemical methods including electrogenerated chemiluminescence and scanning electrochemical microscopy.' The other honoree is Dr. Andrew Sessler, 'for advancing accelerators as powerful tools of scientific discovery, for visionary direction of the research enterprise focused on challenges in energy and the environment, and for championing outreach and freedom of scientific inquiry worldwide.' Dr. Patricia Dehmer opened the ceremony, and Dr. Ernest Moniz presented the awards.

  4. Anlsslich der bevorstehenden Emeritierung von o.Univ.-Prof.Dipl.-Ing. Dr.mont. Horst Cerjak

    E-print Network

    Cambridge, University of

    :30 Uhr Vortrag Prof. Dr. Bruno Buchmayr, Montanuniversität Leoben 14:00 Uhr Vortrag Prof. Dr. Ernst Ausflug auch unter oben stehendem Link anzumelden. IWS Dr. Peter Mayr, Kopernikusgasse 24/1, 8010 Graz

  5. Dr. Cheryl Nickerson studies Salmonella Typhimurium

    NASA Technical Reports Server (NTRS)

    2003-01-01

    Dr. Cheryl Nickerson of Tulane University is studying the effects of simulated low-g on a well-known pathogen, Salmonella typhimurium, a bacterium that causes two to four million cases of gastrointestinal illness in the United States each year. While most healthy people recover readily, S. typhimurium can kill people with weakened immune systems. Thus, a simple case of food poisoning could disrupt a space mission. Using the NASA rotating-wall bioreactor, Nickerson cultured S. typhimurium in modeled microgravity. Mice infected with the bacterium died an average of three days faster than the control mice, indicating that S. typhimurium's virulence was enhanced by the bioreactor. Earlier research showed that 3 percent of the genes were altered by exposure to the bioreactor. Nickerson's work earned her a 2001 Presidential Early Career Award for Scientists and Engineers.

  6. 78 FR 29781 - Before Administrative Judges: Ronald M. Spritzer, Chairman, Dr. Anthony J. Baratta, Dr. Randall J...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-21

    ... From the Federal Register Online via the Government Printing Office NUCLEAR REGULATORY COMMISSION Atomic Safety and Licensing Board Before Administrative Judges: Ronald M. Spritzer, Chairman, Dr. Anthony J. Baratta, Dr. Randall J. Charbeneau; In the Matter of Detroit Edison Company (Fermi Nuclear Power Plant, Unit 3); Notice of Hearing (Notice...

  7. LinuxIntro.doc p.1 Introduction to Linux at Loyola (by Dr. Sabin hastily edited by Dr. Binkley)

    E-print Network

    Lawrie, Dawn J.

    LinuxIntro.doc p.1 Introduction to Linux at Loyola (by Dr. Sabin hastily edited by Dr. Binkley) UNIX is an operating system (OS) that allows simultaneous multiple users and multiple tasks. Linux is a Unix-like OS that runs on PCs. We have a Linux workstation network composed of Dell PCs located

  8. Chronic Pain and the Modulation of Self in Immersive Virtual Reality Dr. Diane Gromala, Dr. Chris Shaw, Meehae Song

    E-print Network

    Shaw, Chris

    Chronic Pain and the Modulation of Self in Immersive Virtual Reality Dr. Diane Gromala, Dr. Chris 102 Avenue, Surrey, BC V3T 0A3 CANADA dgromala | shaw | meehaes@sfu.ca Abstract In contrast to "pain of agency over their experience of chronic pain. Meditating in Virtual Environments Many specialists who

  9. Nr. 344 / 2010 // 15. Dezember 2010 Jan Hacker (Mitte) und Professor Dr. Dr. h. c. Peter Oberender

    E-print Network

    Dettweiler, Michael

    S. 1 / 2 Nr. 344 / 2010 // 15. Dezember 2010 Jan Hacker (Mitte) und Professor Dr. Dr. h. c. Peter wollen damit unsere enge Verbindung zur Universität Bayreuth unterstreichen", erklärte Jan Hacker, neben / 2 Nr. 344 / 2010 // 15. Dezember 2010 Universitätsbibliothek Ralf Brugbauer im Gespräch mit Hacker

  10. SDSS DR7 WHITE DWARF CATALOG

    SciTech Connect

    Kleinman, S. J.; Nitta, A.; Kepler, S. O.; Pelisoli, Ingrid; Pecanha, Viviane; Costa, J. E. S.; Koester, D.; Krzesinski, J.; Dufour, P.; Lachapelle, F.-R.; Bergeron, P.; Yip, Ching-Wa; Harris, Hugh C.; Eisenstein, Daniel J.; Althaus, L.; Corsico, A.

    2013-01-15

    We present a new catalog of spectroscopically confirmed white dwarf stars from the Sloan Digital Sky Survey (SDSS) Data Release 7 spectroscopic catalog. We find 20,407 white dwarf spectra, representing 19,712 stars, and provide atmospheric model fits to 14,120 DA and 1011 DB white dwarf spectra from 12,843 and 923 stars, respectively. These numbers represent more than a factor of two increase in the total number of white dwarf stars from the previous SDSS white dwarf catalogs based on DR4 data. Our distribution of subtypes varies from previous catalogs due to our more conservative, manual classifications of each star in our catalog, supplementing our automatic fits. In particular, we find a large number of magnetic white dwarf stars whose small Zeeman splittings mimic increased Stark broadening that would otherwise result in an overestimated log g if fit as a non-magnetic white dwarf. We calculate mean DA and DB masses for our clean, non-magnetic sample and find the DB mean mass is statistically larger than that for the DAs.

  11. Portrait of Dr Michael G. Hanna, Jr

    PubMed Central

    Hanna Jr, Michael

    2014-01-01

    While a PhD candidate, doing my thesis at the Oak Ridge National Laboratory, Biology Division under Dr. Charles Congdon, my introduction to the immune response was studying graft vs. host (GVH) disease as a consequence of bone marrow transplantation in mice. The sequalae of GVH was impressive, and demonstrated the potential of negative clinical consequences of the immune system. The idea of harnessing this immunological phenomena in cancer therapy was appealing even in the late 1960s. The problem was that at the time T-cells as a component of the immune system were identified but not defined. We moved to soluble antigen stimulation in mice and recognized and described the post antigen stimulation changes in lymphatic tissue germinal centers during the first 48 h after the induction of the humoral immune response. We described the extracellular localization of soluble antigens on the surface of dendritic reticular cells of the stroma, directing a response of B-cells to produce antibody against non-self. The ensuing reaction was the rapid proliferation of B-cells toward antibody secreting plasma cells. PMID:25424782

  12. Curriculum Vitae -Dr. Paul B. Demorest Contact Information

    E-print Network

    Groppi, Christopher

    Scientist, National Radio Astronomy Observatory, Charlottesville, VA. 2010­2011 Senior Research Associate, National Radio Astronomy Observatory, Charlottesville, VA. 2007­2010 Jansky Fellow, National RadioCurriculum Vitae - Dr. Paul B. Demorest Contact Information Address National Radio Astronomy

  13. Software User Guide Prepared by: Dr Rainer Mautz

    E-print Network

    Cricket Software User Guide Prepared by: Dr Rainer Mautz DOCUMENT NUMBER: RELEASE/REVISION: RELEASE ..........................................................................................................4 1.1 Hardware and Software Requirements ...........................................4 1.2 Purpose of the Software ..................................................................4 1.3 High level architecture

  14. Congratulations, Dr. Hauser! The American Animal Hospital Association (AAHA)

    E-print Network

    keep our food supply healthy: http://goo.gl/Aa18bD. Veterinary Voices Seminar If you missed Dr. Lindsay a Diplomate of the American College of Veterinary Internal Medicine-Large Animal. Reppert completed a Food

  15. Journal of the Waterbird Society Dr. Keith A. Hobson

    E-print Network

    you will consider submission of additional manuscripts in the months to come. Sincerely, Dr. Keith A in marking proofs and they are readily understood by the printer. However, in the event of any possibility

  16. UNIVERSIDAD DE BUENOS AIRES Prof. Dr. Alberto Edgardo Barbieri

    E-print Network

    Cortiñas, Guillermo

    1 UNIVERSIDAD DE BUENOS AIRES RECTOR: Prof. Dr. Alberto Edgardo Barbieri SECRETARIO DE EXTENSIÓN Buenos Aires............. Pág. 9 Programas de Salud Aires ......................Pág. 65 Casas de las Provincias en la CABA

  17. Dr Jenifer BRALEY Assistant Professor Department of Chemistry &

    E-print Network

    , Member Professional Services: Reviewer for: Journal of Physical Chemistry, Inorganic Chemistry1 Dr Jenifer BRALEY Assistant Professor Department of Chemistry & Phone: (303) 273, CO 80401 Professional Preparation Colorado State University Chemistry (ACS Certified) BS 2005

  18. 74. Historic American Buildings Survey, Photocopy of a photograph, Dr. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    74. Historic American Buildings Survey, Photocopy of a photograph, Dr. A. Bertram Gilliland, Photographer, ca. 1922 NORTH CORNER OF PARADE, SHOWING OFFICERS' QUARTERS AND SOLDIERS' BARRACKS. - Fort Mifflin, Mud Island, Marine & Penrose Ferry Roads, Philadelphia, Philadelphia County, PA

  19. Z25 Adaptive and Mobile Systems Dr. Cecilia Mascolo

    E-print Network

    Karp, Brad

    1 Z25 Adaptive and Mobile Systems Dr. Cecilia Mascolo Reality Mining: Sensing Complex Social (cellular) to augment location and activity info · Cell and encounters can be logged · Apps on Bluetooth encounters ­ Transport traces · Analysis of these traces of connectiv

  20. 1. Photocopy of engraved flyer (from the collection of Dr. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Photocopy of engraved flyer (from the collection of Dr. Margaret Ballard, Union, West Virginia) H. Bartsch, engraver late 19th century AERIAL VIEW OF TOWN AND ADVERTISING SLOGANS - Red Sulphur Springs, Route 12, Salt Sulphur Springs, Monroe County, WV

  1. 2. Photocopy of advertisement (from the collection of Dr. Margaret ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. Photocopy of advertisement (from the collection of Dr. Margaret Ballard, Union, West Virginia) late 19th century AERIAL VIEW OF TOWN - Red Sulphur Springs, Route 12, Salt Sulphur Springs, Monroe County, WV

  2. Lehrgebiet Parallelitt & VLSI Univ.Prof. Dr. Jrg Keller

    E-print Network

    Keller, Jörg

    Studiengang Abgabe Betreuer Eric Lahr Algorithmische Analyse der S-Boxen des Data Encryption Standard im Systems am Beispiel der AIRBUS Deutschland GmbH B. Sc. Inf. 02/2005 Prof. Dr. J. Keller Daniel Meyer

  3. CERT AVP CURRICULUM MANAGERS LIST Course Director Dr Jill Maddison

    E-print Network

    Daley, Monica A.

    B-PAP.2 Production Animal Practice ­ in the context of poultry Dr Mandy Nevel B-PAP.2 Production Poultry Species, Hatcheries and Incubation, Poultry Processing and Legislation Programme Co-Ordinator Ms

  4. Dr. Peter M. Vallone Vermont Green Mountain Conference

    E-print Network

    Dr. Peter M. Vallone Vermont Green Mountain Conference August 6th, 2008 http Butler Human Identification Project National Institute of Standards and Technology 1st Green Mountain DNA. Vallone Vermont Green Mountain Conference August 6th, 2008 http

  5. Honorary Doctor of Social Science Dr CHAN Sui-kau

    E-print Network

    Po, Lai-Man

    situations in doing business. 33 #12;Dr Chan is management-conscious and has divided the operations of his philosophy. He believes that to train his mind, one must not overlook seemingly trivial matters and lessons

  6. (some achievements since last appointment in Pediatrics) Dr. Jeffrey Feinstein

    E-print Network

    Bejerano, Gill

    of Pediatrics Division of Cardiology Scholarship Related to pulmonary hypertension and computational simulation 12 invited lectures at national conferences Education · Director of Pediatric Cardiology Fellowship(some achievements since last appointment in Pediatrics) Dr. Jeffrey Feinstein Professor

  7. Dr. Michelle C. Zebrack Clinical Associate Professor of Pediatrics

    E-print Network

    Bejerano, Gill

    Dr. Michelle C. Zebrack Clinical Associate Professor of Pediatrics Division of Cardiology (some achievements since last appointment in Pediatrics) Pediatric Cardiology Attending cardiologist in CVICU at LPCH · Stanford Pediatric Cardiology Information Technology Lead Scholarship · 3 publications, 2 book chapter

  8. Additive Manufacturing Challenges and Opportunities Prof. Dr. Gideon Levy

    E-print Network

    New South Wales, University of

    Additive Manufacturing ­ Challenges and Opportunities Prof. Dr. Gideon Levy Institute for Rapid Product Development, Swiss Federal Institute of Technology (ETH) Zurich ABSTRACT Additive Manufacturing scientific and technical publications, over the half are dealing with AM (Additive Manufacturing

  9. Plug-In Electric Vehicles' Charging Dr. Alireza Khaligh

    E-print Network

    Zeng, Ning

    ! TRANSPORTATION ELECTRIFICATION § ELECTRIFICATION § Hybrid Electric Vehicles (HEVs) § Plug-In Hybrid ElectricPlug-In Electric Vehicles' Charging Dr. Alireza Khaligh Electrical and Computer Engineering Vehicles (PHEVs) § Electric Vehicles (EVs) ICE Vehicle HEVs PHEVs EVs Transportation 2.0: Electrified

  10. Research Program Summary Dr. Donald L. Rockwood (.70 Research FTE)

    E-print Network

    Hill, Jeffrey E.

    by developing short-rotation woody crop (SRWC) systems through tree improvement, silvicultural, and biometric rotation woody crop, mined land reclamation, and dendroremediatiResearch Program Summary Dr. Donald L. Rockwood (.70 Research FTE) Professor Short Rotation Woody

  11. 10. Copy by Historic American Buildings Survey of Dr. Collins ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Copy by Historic American Buildings Survey of Dr. Collins Marchall photo Unknown photographer (App. 1880-1890) VIEW FROM NORTHWEST (front) - General John Mason House, Analostan Island or Theodore Roosevelt Island, Washington, District of Columbia, DC

  12. Dr. von Braun at 'Wernher von Braun Day' Celebration

    NASA Technical Reports Server (NTRS)

    1970-01-01

    In 1970 Marshall Space Flight Center (MSFC) Director Dr. Wernher von Braun (right) was reassigned to NASA Headquarters to serve as Deputy Associate Administrator for Plarning. Prior to his transfer, Dr. von Braun was honored for his career in Huntsville, Alabama, with the celebration of 'Wernher von Braun Day.' Among those participating were Alabama Governor Albert Brewer (left) and Alabama Senator John Sparkman (center). (Courtesy of Huntsville/Madison County Public library)

  13. Dr. Wernher Von Braun at the launch of Apollo 11.

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Mission officials relax, all smiles, a few moments after the successful launch of the Apollo 11 spacecraft by Saturn V vehicle AS-506. Relieved of the tension of waiting through the countdown are (left to right) Charles W. Matthews, NASA deputy associate administrator for manned space flight; Dr. Wernher Von Braun, Director of the Marshall Space Flight Center; Dr. George E. Meuller, NASA associate administrator for manned spaceflight, and Lt. General Samuel C. Phillips, director of the Apollo program.

  14. Physio Progress Alumni Newsletter | 2014 Dr. John F. MacDonald Memorial Fund

    E-print Network

    Toronto, University of

    that Dr. MacDonald's legacy continues to inspire future leaders in Neuroscience. We welcome anyDonald Memorial Fund 1 Interim Chair - Dr. Steffen-Sebastian Bolz 2 Celebration for the Outgoing Chair, Dr ........................................................................................ #12;Physio Progress 2014 | 3 Celebration for the Outgoing Chair, Dr. Stephen Matthews On September 23

  15. SE3SS13 Frequency Response Part A Dr Richard Mitchell, 2014 1

    E-print Network

    Mitchell, Richard

    SE3SS13 ­ Frequency Response ­ Part A © Dr Richard Mitchell, 2014 1 p1 RJM 12/09/14 SE3SS13 ­ Frequency Response ­ Part A © Dr Richard Mitchell 2014 1. SE3SS13 Frequency Response 2014/14 - Dr Richard 12/09/14 SE3SS13 ­ Frequency Response ­ Part A © Dr Richard Mitchell 2014 Assessment Examination

  16. Remaining Sites Verification Package for 132-DR-1, 1608-DR Effluent Pumping Station, Waste Site Reclassification Form 2005-035

    SciTech Connect

    R. A. Carlson

    2005-09-22

    Radiological characterization, decommissioning and demolition of the 132-DR-1 site, 1608-DR Effluent Pumping Station was performed in 1987. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. Residual concentrations support future land uses that can be represented by a rural-residential scenario and pose no threat to groundwater or the Columbia River based on RESRAD modeling.

  17. Relationship between autoimmune hepatitis and HLA-DR4 and DR? allelic sequences in the third hypervariable region in Chinese

    PubMed Central

    Ma, Xiong; Qiu, De-Kai

    2001-01-01

    AIM: To analyze the association of HLA-DRB1 with autoimmune hepatitis (AIH) in patients from China. METHODS: In 32 patients and 48 healthy controls, polymerase chain reaction amplification with sequence-specific primers (PCR-SSP) was performed to examine the association of certain alleles or polymorphic sequences of HLA-DRB1 with AIH. RESULTS: HLA-DRB1 typing by PCR-SSP showed that DR4 had a significantly increased frequency among patients with AIH versus healthy control (46.9% versus 20.8%; relative risk = 3.35, P = 0.014). In subtypes of DR4, there was a trend of increase in the gene frequency of DRB1 *0405 in patients with AIH versus healthy controls (21.9% vs 6.3%, P = 0.04, but Pc = 0.08). In addition, a significant increase was found in the alleles frequency encoding QRRAA from the third hyperpolymorphic region of DR4 in the patients with AIH (86.7% of DR4 positive patients vs 40.0% in DR4 positive controls, P = 0.016, Pc = 0.028, RR = 9.75). CONCLUSION: AIH in Chinese is associated with HLA-DR4. There is a relationship between QRRAA sequence within the third hyperpolymorphic region of the DRB allele and AIH in Chinese. PMID:11819862

  18. CONTAGIOUS DISEASE MODULE FOR THE JOINT EFFECTS MODEL Mr. Jason Rodriguez, Ms. Karen E. Cheng, Dr. Gene E. McClellan, Dr. David J. Crary, and Dr.

    E-print Network

    Ray, Jaideep

    CONTAGIOUS DISEASE MODULE FOR THE JOINT EFFECTS MODEL Mr. Jason Rodriguez, Ms. Karen E. Cheng, Dr to modeling the spread of contagious diseases across a population-at-risk represented by the LandScan database used by the Joint Effects Model (JEM). We are implementing two models of disease transmission

  19. A new approach to RIS/DR interconnection.

    PubMed

    Hayes, B

    1999-01-01

    The article focuses on a new, standards-based approach for linking modalities to a radiology information system (RIS) in the radiology department. Computers have been used in radiology for quite some time-for the complex processing of algorithms used by CT and MR, for example. The advent of computed radiography (CR) and direct radiography (DR) has helped bring x-ray film into the world of computers. DR uses a technology similar to that in digital cameras to convert the intensity and location of the diagnostic image into digital form. Many radiology departments now store images on disks and read from computer monitors in a reading room. With its high-volume radiology department, the Cleveland Clinic Foundation (CCF) has been a long-time user of one particular RIS system. As the department moved to DR implementation, it required a means to automatically include patient demographic information with the image at the time of study acquisition, so this information would be associated with the image throughout its history. Using an approach developed by several companies in connection with CCF, technologists now use only two interfaces on one computer screen. Further, a technologist can close the study from the DR unit, allowing more time for patient care. The collaborative effort between CCF and the companies involved has resulted in an exciting standards-based approach to linking its RIS and DR systems. PMID:10351742

  20. Study of photoluminescence properties of thin films DR1

    NASA Astrophysics Data System (ADS)

    Herman, Ulya, Naily

    2015-09-01

    Fabrication of thin films DR1 have been carried out by the EFA-PDF (Electric Field-Assisted Physical Vapor Deposition) method to obtain films with parallel dipole arrangement. Molecular deposition process is performed by applying an electric field that is placed between the substrate ITO (Indium Tin Oxide) and copper mesh. The resulting films were characterized by using a spectrofluorometer. Analysis of the emission spectrum, indicate that DR1 molecules in the film oriented perpendicular to the substrate and arranged in parallel order (H-aggregate). As an effect, the peak of the emission spectrum appears stronger along with the increase of electric field strength.

  1. DrML: Probabilistic Modeling of Gene Duplications

    PubMed Central

    Eulenstein, Oliver

    2014-01-01

    Abstract DrML is a software program for inferring evolutionary scenarios from a gene tree and a species tree with speciation time estimates that is based on a general maximum likelihood model. The program implements novel algorithms that efficiently infer most likely scenarios of gene duplication and loss events. Our comparative studies suggest that the general maximum likelihood model provides more credible estimates than standard parsimony reconciliation, especially when speciation times differ significantly. DrML is an open source project written in Python, and along with an on-line manual and sample data sets publicly available. PMID:24073895

  2. The Improvement of Photosystem I Deposition Using a Spin-Coating Method Karla M. Dumeng1,3 , Gabriel LeBlanc2, Darlene Gunther1, Dr. David Cliffel2, and Dr. Kane Jennings1

    E-print Network

    ,3 , Gabriel LeBlanc2, Darlene Gunther1, Dr. David Cliffel2, and Dr. Kane Jennings1 1Department of Chemical not have been achieved without the continuous advising of Darlene Gunther and Dr. Kane Jennings. Also

  3. Dr. David Sawyer, Mickey Mouse and Dr. David Brown attend a ceremony at Ronald McNair Middle School

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. David Sawyer (left), Superintendent of the Brevard County School District, Mickey Mouse, and Dr. David Brown, a NASA astronaut, attend a tribute to NASA astronaut Ronald McNair held in the gymnasium of Ronald McNair Magnet School in Cocoa, Fla. During the tribute, Walt Disney World presented a portrait of McNair to the school, which had previously been renamed for the fallen astronaut. McNair was one of a crew of seven who lost their lives during an accident following launch of the Space Shuttle Challenger in January 1986.

  4. Coelho Neto: Introduction of African Culture into Brazilian Drama

    E-print Network

    Pierson, Colin M.

    1976-04-01

    Pai Ambrósio. A cena é dividida em duas partes: sala à direita, cubículo à esquerda. No cubículo, ao fundo, sob a janela, uma cómoda, com uma salva para dinheiro e várias bugigangas; à esquerda, grosseiro altar do orixá, ídolo disforme, entre flores...

  5. Bolstered Error Estimation Ulisses Braga-Neto a,c

    E-print Network

    Braga-Neto, Ulisses

    the bolstered error estimators proposed in this paper, as part of a larger library for classification and error of the data. It has a direct geometric interpretation and can be easily applied to any classification rule as smoothed error estimation. In some important cases, such as a linear classification rule with a Gaussian

  6. The electronic properties of graphene A. H. Castro Neto

    E-print Network

    Wu, Zhigang

    2009 This article reviews the basic theoretical aspects of graphene, a one-atom-thick allotrope of states 114 B. Dirac fermions 114 1. Chiral tunneling and Klein paradox 115 2. Confinement, the result of the dimensionality of these structures. Among systems with only carbon atoms, graphene--a two

  7. 75 FR 68603 - Proposed Information Collection; Comment Request; Office of Education Dr. Nancy Foster...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-08

    ...Office of Education Dr. Nancy Foster Scholarship Program AGENCY: National Oceanic and...the purpose of selecting successful scholarship candidates, generating internal NOAA...its program. The Dr. Nancy Foster Scholarship Program is available to graduate...

  8. SAIC/NCI-Frederick’s Nanotechnology Characterization Lab (NCL) is pleased to announce that Dr

    Cancer.gov

    Dr. Martin Fritts, Senior Principal Scientist and Co-Founder of the NCL, Receives the 2010 ASTM International President’s Leadership Award SAIC/NCI-Frederick’s Nanotechnology Characterization Lab (NCL) is pleased to announce that Dr. Martin Fritts

  9. Dr. Wernher Von Braun leads a tour of the S-IC checkout area.

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. Eberhard Rees, Charles Schultze, James Webb, Elmer Staats, Comptroller General of the United States, and Dr. Wernher Von Braun tour the S-IC checkout area in the Marshall Space Flight Center quality lab.

  10. JOB ANNOUNCEMENT The Developmental Neurophysiology Lab (PI: Dr. Shafali Jeste) at the UCLA Center for Autism

    E-print Network

    Guo, Ming

    : Dr. Jeste) from the National Institutes of Mental Health, Autism Speaks-density electrophysiology (EEG) with genetics and behavior to characterize infants and children of Excellence (PI: Dr. Susan Bookheimer) and is also funded by individual grants (PI

  11. Design and construction techniques of an American vernacular architect : the work of Dr. Henry Chapman Mercer

    E-print Network

    Eichenberger, Kurt Frederick

    1982-01-01

    The design and building process of Dr. Henry Chapman Mercer is explored for its relationship to vernacular design. The vehicle for this exploration is 'Fonthill,' the home of Dr. Mercer constructed by him in 1908. Complete ...

  12. Dr. Susan James (center) with Hunt Lambert, Vice Provost of Continuing Education (left) and Carl

    E-print Network

    Anderson, Charles W.

    Melle (Program Director, Continuing Education) Dr. Susan James Receives Prestigious eLearning Award In April, Dr. Susan James received the eLearning Educator of the Year award from the eLearning Consortium

  13. 2014 Navigant Consulting, Inc. Assessing Demand Response (DR)

    E-print Network

    © 2014 Navigant Consulting, Inc. Assessing Demand Response (DR) Program Potential for the Seventh Power Plan UPDATED FINAL REPORT Prepared for: Northwest Power and Conservation Council Navigant Consulting, Inc. One Market Street, Spear Street Tower Suite 1200 San Francisco, CA 94105 415-399-2109 www.navigant

  14. NASA ACTS SATELLITE: A DISASTER RECOVERY TEST Dr. Hans Kruse

    E-print Network

    Kruse, Hans

    NASA ACTS SATELLITE: A DISASTER RECOVERY TEST Dr. Hans Kruse School of Communications Systems In September 1993, NASA launched its long- awaited Advanced Communication Technology (ACTS) satellite. ACTS and opening of the Ka frequency band. Among the earliest of the tests on the new satellite was a NASA

  15. Program Contact: Dr. Cian O'Kelly, Program Director

    E-print Network

    MacMillan, Andrew

    Program Contact: Dr. Cian O'Kelly, Program Director Kirsten Bauer, Program Administrator Plastic Surgery Residency Program 2D2.02 WMC, 8440 ­ 112 Street Edmonton, AB T6G 2B7 Phone: (780) 407-1591, Fax blocks of General Surgery · 1 28-day block of Anesthesia · 4 28-day blocks of Neurosurgery · 1 28-day

  16. Practical Memory Checking with Dr. Memory Derek Bruening

    E-print Network

    Cortes, Corinna

    instruction, further decreasing performance. Accuracy is also an issue for leak checking. To detect leaks is that it depends on low-level operating system and architectural details, making it difficult to port to other platforms and difficult to target proprietary systems like Windows. This paper presents Dr. Memory, a memory

  17. Dr. Robert M. Ramirez rramirez@sfsu.edu

    E-print Network

    Dr. Robert M. Ramirez rramirez@sfsu.edu Associate Dean, College of Science & Engineering Copyright: Robert Ramirez, SFSU S'14 1 #12;To communicate/publicize your information to others Research & Effective Presenter must be Knowledgeable Enthusiastic Copyright: Robert Ramirez, SFSU S'14 2 #12

  18. ISE 172: Algorithms in Systems Engineering Dr. Ted Ralphs

    E-print Network

    Ralphs, Ted

    ISE 172: Algorithms in Systems Engineering Syllabus Dr. Ted Ralphs Spring 2015 1 Miscellaneous, analyzing, and imple- menting basic algorithms common in systems engineering applications. The course's lectures to solve a given systems engineering problem. This will be accomplished mainly through

  19. Exhaust Waste Heat Dr. HoSung Lee

    E-print Network

    Lee, Ho Sung

    exchanger modeling and design · Dana, Inc.- heat exchanger design and fabrication · Eberspaecher - exhaust system design & fabrication · JPL ­ Modeling of TEG system, heat exchangers & modules; TE module testingExhaust Waste Heat Recovery Dr. HoSung Lee February 18, 2015 #12;Cost-Competitive Advanced

  20. Dr. Dimitris C. Lagoudas Texas A&M University

    E-print Network

    and controlled deployment. · Lightweight, simple, and low coefficient of thermal expansion. #12;Texas InstituteBrent Volk Dr. Dimitris C. Lagoudas Texas A&M University College Station, TX 6th International · Deployable Space Structures · Flexible Biodegradable Applications (i.e. sutures) #12;Texas Institute

  1. SCIENCE, TECHNOLOGY AND DEVELOPMENT DR. F. K. A. ALLOTEY*

    E-print Network

    McLeod, Jillian E.

    SCIENCE, TECHNOLOGY AND DEVELOPMENT BY DR. F. K. A. ALLOTEY* KING/CHAVEZ/PARKS VISITING PROFESSOR #12;· Importance of science and Technology for socio-economic development · Comparison of the newly developed countries and Africa · Science and technology as necessary but not sufficient factors

  2. Project/Paper Ideas for COE449 Dr. Ahmad Almulhem

    E-print Network

    Almulhem, Ahmad

    Project/Paper Ideas for COE449 Dr. Ahmad Almulhem spring 2008 - 072 1 Design Projects · Hospital Network Design a network for a hypothetical general hospital. The design has to enumerate dif- ferent such as patients' records, employees' records, etc. Identify potential threats and perform risk analysis. Design

  3. Dr. S. Cruz-Pol, INEL 4151-Electromagnetics I

    E-print Network

    Cruz-Pol, Sandra L.

    ://micro.magnet.fsu.edu/electromag/java/generator/dc.html BlIF BuQF ×= ×= Encarta® Who was NikolaTesla? ØFind out what inventions he made ØHis relation = magnetic field density, [Teslas] mH mF HB ED o o /104 36 10 /1085.8 7 9 12 - - - ×= =×= = = µ µ #12;Dr

  4. Syllabus EEE598 "Advanced Biosensor Concepts" Instructor: Dr. Michael Goryll

    E-print Network

    Zhang, Junshan

    Syllabus ­ EEE598 "Advanced Biosensor Concepts" Instructor: Dr. Michael Goryll Assistant Professor development in the field of biosensors is driven by creating robust and reliable devices for a vast variety of analytes while constantly improving the detection speed and the specificity. Biosensors use a bio

  5. 73. Historic American Buildings Survey, Photocopy of a photograph, Dr. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    73. Historic American Buildings Survey, Photocopy of a photograph, Dr. A. Bertram Gilliland, Photographer, ca. 1922 NORTHEAST END OF PARADE, SHOWING SOLDIERS' BARRACKS AND STOREHOUSE, RAILROAD TRACKS IN FOREGROUND. - Fort Mifflin, Mud Island, Marine & Penrose Ferry Roads, Philadelphia, Philadelphia County, PA

  6. Solar Thermoelectric Generators (STEG) Dr. HoSung Lee

    E-print Network

    Lee, Ho Sung

    Solar Thermoelectric Generators (STEG) Dr. HoSung Lee Western Michigan University Mechanical;#12;· Kraemer et al. (2011) · 1 sun · t = 0.94, a = 0.95, e = 0.05 · q" = 1000 W/m^2, Cth = 299 · Thermoelectric;Baranowski, Snyder, Tober (2012) #12;Baranowski, Snyder, Tober (2012) Reduced current density Thermoelectric

  7. NOAA 2015 Atlantic Hurricane Season Outlook Dr. Gerry Bell

    E-print Network

    Chen, Tsuhan

    NOAA 2015 Atlantic Hurricane Season Outlook Dr. Gerry Bell Lead Seasonal Forecaster Climate Prediction Center NOAA/ NWS/ NCEP Collaboration With National Hurricane Center/ NOAA/ NWS/ NCEP Hurricane Research Division/ NOAA/ OAR/ AOML/ HRD www.cpc.ncep.noaa.gov/products/hurricane #12;Outline 1. Features

  8. 99129-5/2002-DR/SC Universitrio

    E-print Network

    Floeter, Sergio Ricardo

    Impresso 99129-5/2002-DR/SC UFSC CORREIOS Jornal Universitário Doença negligenciada Foto. p. 12 Foto: James Tavares #12;UFSC - Jornal Universitário - Nº 389 - Abril de 2008 - PÁG 2 Do Editor A comunicação cuida da saúde da instituição Foto: Arquivo Agecom Fotos:JamesTavares A Administração da

  9. Plagiarism in Linguistic Editing Dr. Ismael Al-Qayam

    E-print Network

    Plagiarism in Linguistic Editing Abstract Dr. Ismael Al-Qayam Philadelphia University This paper deals with the phenomena of plagiarism in linguistic editing in modern times. The paper does not limit Lughawiyya is plagiarized from a number of former linguists, especially Mohammed Al Adnani and Mohammed Dhari

  10. Structured Custom Design of MEMS Devices Dr. Debjyoti Banerjee

    E-print Network

    Banerjee, Debjyoti

    on the complexity and sophistication of the design process for MEMS applications as it evolved from its inception;MEMS applications and are used for exploring "macro-scale" physical phenomena. Hence, the toolsStructured Custom Design of MEMS Devices Dr. Debjyoti Banerjee Senior Consulting Engineer COVENTOR

  11. 2010-2011 Campus Map North Campus Dr.

    E-print Network

    2010-2011 Campus Map P1/V1 P23 P20 North Campus Dr. P2 P30/V30 revised 6-10 P26/ V26 Amy Harrison Extension Center Highlander Hall International Village Housing Chemical Sciences Falkirk Apts Child Development Center North Child Development Center South Health Center Career Center Vietch Student Center

  12. Optical MEMS Laboratory OML Prof. Dr. Hakan rey

    E-print Network

    Örmeci, E. Lerzan

    Optical MEMS Laboratory OML Prof. Dr. Hakan Ürey Koç University, Electrical Engineering #12;Koç) Rankings 31st in THE Top 100-under-50 & Among top 300 in THE World Rank #12;Research Focus: MEMS. Assistant mems.ku.edu.tr #12;Optical Microsystems Laboratory (OML) Koç University Patent Success Story >25

  13. Strings and Printing CSC 1051 Villanova University Dr Papalaskari 1

    E-print Network

    Papalaskari, Mary-Angela

    output · print is similar to the println except that it does not advance to the next line System.out.printStrings and Printing CSC 1051 Villanova University Dr Papalaskari 1 CSC 1051 ­ Algorithms and Data of Java Programming - Strings and Printing Lab 1: · Learn about jGrasp - the programming environment

  14. Dr. S. Cruz-Pol, INEL 4152-Electromagnetics

    E-print Network

    Cruz-Pol, Sandra L.

    JdlH Cruz-Pol, Electromagnetics UPRM Would magnetism would produce electricity? Ø Eleven years later Electromagnetics was born! Ø This is the principle of motors, hydro-electric generators and transformers operationDr. S. Cruz-Pol, INEL 4152- Electromagnetics Electrical Engineering, UPRM 1 Electromagnetic

  15. Electron Cyclotron Emission Radiometer Cristina Morales, Advisor: Dr. John Rodgers,

    E-print Network

    Anlage, Steven

    Electron Cyclotron Emission Radiometer Cristina Morales, Advisor: Dr. John Rodgers, Abstract ·The-Maxwellian bursts in plasma temperature. ·The receiver measures electron cyclotron emission (ECE) from magnetized around the magnetic field lines and radiate at the electron cyclotron frequency given by ·Magnetic Field

  16. Natural Forests and Woodlands Symposium Prepared by Dr Brett Hurley

    E-print Network

    Natural Forests and Woodlands Symposium Prepared by Dr Brett Hurley Five members of the CTHB middle) and Johan van der Linde (picture right), attended the Fifth Natural Forests and Woodlands time the symposium also included a section on natural forests and woodlands protection. Staff

  17. Dr Skateboard's Action Science: Teaching Physics in Context

    ERIC Educational Resources Information Center

    Robertson, William H.

    2009-01-01

    In order to create student interest and promote new connections to the understanding of fundamental physics concepts, there is a need for new approaches and methods that are both contemporary and relevant. Dr Skateboard's Action Science, a curriculum supplement comprising video instruction and classroom activities, is an example that focuses on…

  18. CAMERA RESPONSE SIMULATION FOR PLANETARY EXPLORATION Dr. Richard Madison(1)

    E-print Network

    camera response and synthesize images for onboard vision-based control algorithms. ROAMS image synthesisCAMERA RESPONSE SIMULATION FOR PLANETARY EXPLORATION Dr. Richard Madison(1) , Marc Pomerantz(2-209, 4800 Oak Grove Drive, Pasadena CA 91109, USA, Madison@robotics.jpl.nasa.gov (2) Jet Propulsion

  19. The Generic Graph Component Library Dr. Dobb's Journal September 2000

    E-print Network

    Lumsdaine, Andrew

    The Generic Graph Component Library Dr. Dobb's Journal September 2000 Generic programming for graph.nd.edu, and lumsg@lsc.nd.edu, respectively. The Standard Template Library has established a solid foundation in such diverse application areas as design automation, transportation, optimization, and databases. Our own

  20. Dr. Eric Harmsen Professor, Dept. of Agricultural and Biosystems Eng.,

    E-print Network

    Gilbes, Fernando

    of agricultural production is being promoted, which will result in more competition for water resources. #12;WhatDr. Eric Harmsen Professor, Dept. of Agricultural and Biosystems Eng., Univ. of Puerto Rico of water and temperature in Puerto Rico Water Insufficient water supply for Agriculture Insufficient

  1. The life and legacy of Dr. Lee Baldwin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper outlines the life and legacy of the late Dr. Ransom L. Baldwin, V. The purpose was to highlight the impact his teaching and research had on the international energy and protein metabolism communities at their fourth international conference. The paper will be presented at the outset of ...

  2. By Dr. Charles F, Brooks of Clark University.

    E-print Network

    No. e14 April 30 By Dr. Charles F, Brooks of Clark University. HOVi MUCH-DID IT RAIN? Tho. be eliminated, Tho rain ,qa,i~;e: should catch a l l and only the mater that, without. eddying action around the gauge, would fall onto a piece of ground tho same size, The gauge has t o be above the ground splash

  3. Land Transformation Model (LTM) Dr. Bryan C. Pijanowski

    E-print Network

    Clarke, Keith

    Land Transformation Model (LTM) Dr. Bryan C. Pijanowski College of Natural Science Michigan State University · Early LTM (Pijanowski, 1997) ­ Conceptual framework ­ Spatial framework ­ GIS integration · LTM external learning ­ Local versus regional learning #12;#12;LTM Spatial Object Class Hierarchy #12;GIS

  4. 28. View of data test area for DR data take ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    28. View of data test area for DR data take off set operators panel and cabinet at second floor of transmitter building no. 102 in MIP area. - Clear Air Force Station, Ballistic Missile Early Warning System Site II, One mile west of mile marker 293.5 on Parks Highway, 5 miles southwest of Anderson, Anderson, Denali Borough, AK

  5. Dr. Crampton Aquatic Ecology Spring 2014 AQUATIC ECOLOGY (PCB-3442)

    E-print Network

    Dr. Crampton Aquatic Ecology Spring 2014 1 AQUATIC ECOLOGY (PCB-3442) SYLLABUS - SPRING SEMESTER 2014 COURSE DESCRIPTION: Aquatic Ecology PCB-3442 is a general introduction to freshwater ecology WEBSITE: crampton.cos.ucf.edu/pcb3442 USERNAME: student PASSWORD: aquatic13 You will see two folders

  6. BIOL 3420 Animal Behavior, Fall 2015 Dr. Troy Murphy

    E-print Network

    Murphy, Troy G.

    BIOL 3420 Animal Behavior, Fall 2015 Syllabus Dr. Troy Murphy Email: tmurphy@trinity.edu Office will be updated regularly, so check often for updates). Required texts --Animal Behavior, 10th Edition by John Alcock --Exploring Animal Behavior: Readings from American Scientist, Paul W Sherman (Editor), John

  7. A Dr. Martin Luther King, Jr. Curriculum: Playing the Dream.

    ERIC Educational Resources Information Center

    Clemens, Sydney Gurewitz

    1988-01-01

    Discusses curriculum for young children centered around the beliefs and teachings of Dr. Martin Luther King, Jr. His works are interpreted in a human rights context in which children find their voice in the peaceable resolution of everyday conflicts. Describes the Child of the Day program. (Author/RWB)

  8. Curriculum Vitae (2014) Dr. rer. nat. Stefan Hild

    E-print Network

    Greenaway, Alan

    2014-01-01

    . Outside his core area, Stefan also carries out research on renewable energy sources, energy storageCurriculum Vitae (2014) Dr. rer. nat. Stefan Hild Date of Birth: 1st of April 1978, Celle, Germany 2013 to date 2009 ­ 2013 Reader, School of Physics and Astronomy, University of Glasgow, UK Lecturer

  9. By Dr David Whitehouse BBC News Online science editor

    E-print Network

    By Dr David Whitehouse BBC News Online science editor Decision day for fusion project ITER - NUCLEAR FUSION PROJECT The project is estimated to cost $5bn over the next 10 years It will produce The International Thermonuclear Experimental Reactor (Iter) is the boldest nuclear initiative since the Manhattan

  10. C++ Concept Checking Dr. Dobb's Journal June 2001

    E-print Network

    Lumsdaine, Andrew

    C++ Concept Checking Dr. Dobb's Journal June 2001 A better practice for template programming by the use of template parameters to represent abstract data types, that is, "concepts" as the term is used parameters. We use the term "concept" to mean a set of requirements and, therefore, call our resulting

  11. md Science Service Featuro By Dr. Charles F. Brooks

    E-print Network

    No. 745 Sept. 30 md Science Service Featuro By Dr. Charles F. Brooks of Clark University. RAIN SKADOWS Mountains cast rain shadoms; often there is the greatest difference in rain- is fall between in me trade wind, laden with water vapor, blows persistently from one direction. is forced to rise

  12. Cognitive Radio and Smart Grid Dr. Robert C. Qiu

    E-print Network

    Qiu, Robert Caiming

    Cognitive Radio and Smart Grid Dr. Robert C. Qiu Professor Wireless Networking Systems Laboratory RadioCognitive Radio 2 2/23/2010 #12;Outline Cognitive Radio Cognitive Radio @ Tennessee Tech University Spectrum Sensing and Wideband Spectrum Sensing Cognitive Radio Networks and Testbeds Cognitive

  13. Dr, Chs.sles 3'. Broola Of Clark University

    E-print Network

    , tala t o grow instead of new ones forming, and even for large crystals t o grow at the expense. appear around these growing crystals. Soon the pane is covered with fine crystals, The tendency iDr, Chs.sles 3'. Broola Of Clark University Discusses FORMS OF FROST CRYSTALS___.-- VJh@nf r o

  14. Dr. Ernst Stuhlinger Speaks at Educator Honor Reception

    NASA Technical Reports Server (NTRS)

    2003-01-01

    Dr. Ernst Stuhlinger, a member of von Braun's original German rocket team who directed the Research Projects Office, spoke about the importance of teachers in his life during a reception honoring educators attending the NASA Student Launch Initiative Rocketry Workshop at the Marshall Space Flight Center in July, 2003.

  15. Honorary Doctor of Social Science Dr CHUNG Chi-yung

    E-print Network

    Po, Lai-Man

    27 Honorary Doctor of Social Science Dr CHUNG Chi-yung Citation written and delivered by Professor subsequently became the first female judge in China's history. In 1945, after her marriage to Mr Hu Hung, she translated into Chinese Le Petit Chose, a fiction by Alphonse Daudet, which reflects on issues

  16. Colin O'Reilly 1810 Aspen Dr. #303

    E-print Network

    Wu, Mingshen

    and Investment in Post-Civil War Recovery" Comparative Economic Studies. Vol. 56(1): 1-24. 2014. "Firm Investment.colinworeilly.com 774-402-0122 U.S. Citizen EDUCATION PhD Economics (May 2014) Suffolk University (Boston, MA and Consumption" "War and the Growth of Government" (with Dr. Benjamin Powell) "Rwandan Firms and Judicial

  17. Dr. Chad E. Finn, 2013 Wilder Medal Recipient

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dr. Chad Finn took over the leadership of the USDA-ARS small fruit breeding program in Corvallis, Oregon in 1993 after three years working as an extension horticulturist in the Department of Horticulture at the University of Missouri, Columbia. Since taking over this program he has developed what is...

  18. Dr. Christopher D. Snow Department of Chemical & Biological Engineering

    E-print Network

    Snow, Christopher

    Dr. Christopher D. Snow Department of Chemical & Biological Engineering Department of Biochemistry., Fort Collins, CO 80524; 650.387.2219 Online: christopher.snow@colostate.edu http://www.engr.colostate.edu/~cdasnow/ #12;Publications [2001-2006] Christopher D. Snow 1. Absolute comparison of simulated and experimental

  19. Mathematical Modelling of Sap Flow Graham Moore, Dr. John Stockie

    E-print Network

    Stockie, John

    Mathematical Modelling of Sap Flow Graham Moore, Dr. John Stockie Department of Mathematics, Simon of mathematical models to describe the sap flow through trees: an RC model based on Ohm's law, a hydraulic model to its linear portion and obtain equation (9). A Porous Media Model In Holtta et al. (2006), a sap flow

  20. Mathematiker bei SAP Dr. Stefan Breulmann, Consulting Director

    E-print Network

    Ferrari, Patrik L.

    Mathematiker bei SAP Dr. Stefan Breulmann, Consulting Director 20.04.2011 #12;© 2011 SAP AG. All Münster Promotion 1996 Heidelberg Wiss. Assistent Mannheim / Heidelberg 1995 ­ 1999 Seit 1999: SAP SAP AG. All rights reserved. 3Confidential ... verarbeiten 2,5 Mrd. Stromrechnungen pro Jahr

  1. Aluminum Removal from Photographic Waste Submitted to Dr. Tony Bi

    E-print Network

    Aluminum Removal from Photographic Waste Submitted to Dr. Tony Bi By: Kristen Favel, Tiffany Jung, and Kenny Tam CHBE 484 University of British Columbia April 15, 2009 #12;ii "Aluminum Removal from photographic waste has shown elevated levels of aluminum in the fixer, which exceed sewer discharge standards

  2. Weld Surfacing Edited by Dr I.A. Bucklow

    E-print Network

    Cambridge, University of

    V01.II Weld Surfacing Edited by Dr I.A. Bucklow ConferenceTechnicalDirector Organised by The Welding Institute in associationwith The Surface Engineering Society THE WELDING INSTITUTE #12;L becomesconfigurationally frozen at a temperature of about 1150°Cduring deposition by the manual-metal-arc welding technique

  3. Dr. Wernher Von Braun with Congressman Gerald R. fod

    NASA Technical Reports Server (NTRS)

    1999-01-01

    On a visit to the Marshall Space Flight Center in April, 1964, Congressman Gerald R. Ford, Jr. Republican of Michigan, was warmly greeted by Dr. Wernher Von Braun, Marshall Space Flight Center director. Ford, along with two other congressmen, visited the center for a briefing on the Saturn program and for a tour of the facilities.

  4. Retaining Best and Brightest Dr. D. E. (Steve) Stevenson

    E-print Network

    Stevenson, D. E. "Steve"

    Retaining Best and Brightest IT Talent Dr. D. E. (Steve) Stevenson Director Institute for Modeling;Misconceptions: Opportunities Web Job Search Engines #12;Shear Numbers: Companies 10,88713,1104,119High Tech $3Consultant 76843Management 88144Design 167565Engineering 4496328IT CASCCategory: Jobs #12;Data Points

  5. 14C in Leaf Litter Fractions Dr. Laura J. Hainsworth

    E-print Network

    Post, Wilfred M.

    14C in Leaf Litter Fractions Dr. Laura J. Hainsworth Emory & Henry College/CAMS #12;Preliminary that the 14C label is not uniformly distributed in the leaf litter. This can influence how and when the label shows up in the soil fractions. #12;Methods for isolating leaf litter fractions. Literature sources

  6. DR. LEE K. FEINE SCHOLARSHIP For Undergraduate and Graduate Students

    E-print Network

    Paulsen, Vern

    for women, children and families and strives to ensure individual rights and freedom for all. The Dr. Lee K of Jewish Women, Greater Houston Section GENERAL REQUIREMENTS for Undergraduate and Graduate Students of Jewish Women (NCJW) is the oldest national Jewish women's volunteer organization in America. Founded

  7. 39. View of checkout indicator computer console for DR beams, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    39. View of checkout indicator computer console for DR beams, TR chains, and special checkout target control located in CSMR in transmitter building no. 102. - Clear Air Force Station, Ballistic Missile Early Warning System Site II, One mile west of mile marker 293.5 on Parks Highway, 5 miles southwest of Anderson, Anderson, Denali Borough, AK

  8. College of Science & Engineering Dr. Sheldon Axler, Dean

    E-print Network

    . Michael Goldman, Chair, Department of Biology Dr. Jane DeWitt, Chair, Department of Chemistry, a molecular biology core facility, and a nuclear magnetic resonance center. A Setting That's Ideal Few places environment. Our students learn through research opportunities, internships, cooperative education, and other

  9. College of Science & Engineering Dr. Sheldon Axler, Dean

    E-print Network

    . Michael Goldman, Chair, Department of Biology Dr. Jane DeWitt, Chair, Department of Chemistry biology core facility, and the Nuclear Magnetic Resonance Center. A Setting That's Ideal Few places environment. Our students learn through research opportunities, internships, cooperative education, and other

  10. Dr. T.P. Clement CE 3010 class notes

    E-print Network

    Clement, Prabhakar

    , true error, ET = 53.28214 54.95878 = 1.67666 Absolute error is Eabs = 1.67666 Relative percent error · Trapezoidal formula (single segment): I = [f(a) + f(b)]/2 * (b ­ a) (average height * width) Dr. T unequal segments of width h1, h2, h3.. hn then the formula is: 0 1 11 2 1 2 ( ) ( ) ( ) ( )( ) ( ) ... 2

  11. 50 Florida League of Cities WWhen Dr. John Scott

    E-print Network

    Fernandez, Eduardo

    50 Florida League of Cities WWhen Dr. John Scott Dailey departed this world on May 21, 2003, he had succeeded. Scott ­ as he was called by those close to him ­ wore so many hats and touched so many lives and hundreds of municipal offi- cials, Scott was a visionary problem-solver and innova- tive leader who

  12. ASSURING PERFORMANCE IN E-COMMERCE SYSTEMS Dr. John Murphy

    E-print Network

    Murphy, John

    ASSURING PERFORMANCE IN E-COMMERCE SYSTEMS Dr. John Murphy Abstract Performance Assurance these might manifest themselves. A definition and the reasoning behind a performance assurance methodology is given, and the performance assurance methodology that is proposed is outlined. 1. Introduction

  13. Ecosystem Valuation and Management (EVM) Course organiser: Dr Janet Fisher

    E-print Network

    1 Ecosystem Valuation and Management (EVM) Course organiser: Dr Janet Fisher School theoretical and practical applications of ecosystem valuation are explored through case studies of policies around monetary valuation and consider some of the premises and critiques of this approach. A1

  14. DR-OSGi: Hardening Distributed Components with Network Volatility Resiliency

    E-print Network

    Ryder, Barbara G.

    DR-OSGi: Hardening Distributed Components with Network Volatility Resiliency Young-Woo Kwon1 , Eli applications. To address these challenges, this paper presents a systematic approach to hardening distributed of network volatility. To accommodate the diverse hardening needs of various combinations of networks

  15. -A Science Service Feature By Dr. Charles F. Brooks

    E-print Network

    No. 491 Dec. 6 -A Science Service Feature By Dr. Charles F. Brooks of Clark University, T E GULF STREAh S O E E OF iViOISm Since our tflomsffand tthighs", the storms and fair weather areas, almost all l rights reserved by Science Service SCIENCE SERVICE, Washington, D.C. B a d 21st StS,, #12;

  16. A Science Servico Foature By Dr, Chnrles F. Brooks

    E-print Network

    . rrindy veathor. (Tonorrow: Indications of Fair and `Jarmer) All. rights ressrvod by Science Service SGIPiNo 549 Jme 10 A Science Servico Foature By Dr, Chnrles F. Brooks of Cln.rk University doesn`t t c l of moderate, fair and quiet d,ays. Tho coast of Cnlifornia is preeminenfly the place f o r inoderate fair and

  17. A Science Service Feature-Dr-Charles F. Brooks,

    E-print Network

    No. 210 Jan. 14 A Science Service Feature- Dr- Charles F. Brooks, of Clark URivcrsity, describes It \\ arrives, heralding fair -eather, -c may say that the polar front has come- simply means that the blast-.7: The ',;inter Thunderstorn) A l l rights reserved by Science Sarvice Scieme Service, 1115 Conn. Ave., Vashington

  18. A Science Service Feature By Dr, Charles F. Brooks

    E-print Network

    No* 579 Paarch 19 A Science Service Feature By Dr, Charles F. Brooks of Clark University. -HOW Fihen they a r e moving from the north, that means Wannerto be stormy hhe next day. and fair. likely t o weather that constitutes the threat, (Tomorrow: The Coming of Spring) A l l Fights reserved by Science

  19. FALL 2014 -ECE 658 -DR. D. MISRA Course Outline

    E-print Network

    Haimovich, Alexander

    FALL 2014 - ECE 658 - DR. D. MISRA Course Outline VLSI Design - I TEXT: Weste and Harris; CMOS VLSI Design, 4th Ed., Addison-Wesley Publishing Co. 2011. More Resourses on the Text REF: Weste and Harris; CMOS VLSI Design, 3rd Ed., Addison-Wesley Publishing Co. 2005. REF: Weste & Eshraghian, Principle

  20. Dr. Cindy Briggs Advocacy & Public Policy DRAFT Syllabus

    E-print Network

    Vonessen, Nikolaus

    / and Evaluation 1. Students will understand common terms used within advocacy and public policy Unit 1, 2Dr. Cindy Briggs Advocacy & Public Policy DRAFT Syllabus 2014 Page 1 Important Communication Tips for help... it is why I am here!! PSCI 405 Nonprofit Administration: Advocacy and Public Policy Syllabus

  1. PRESENTATION TO NRC BURNING PLASMA PANEL DR. STEPHEN O. DEAN

    E-print Network

    1 PRESENTATION TO NRC BURNING PLASMA PANEL DR. STEPHEN O. DEAN PRESIDENT FUSION POWER ASSOCIATES is some sense of what the applications community, such as potential industry, see for the future of fusion" #12;2 BOTTOM LINES FUSION IS NOT ON THE RADAR SCREEN OF THE U. S. ELECTRIC UTILITIES ! To get

  2. IS740 -Fundamentals of Software Testing Dr. Sreedevi Sampath

    E-print Network

    Sampath, Sreedevi

    IS740 - Fundamentals of Software Testing Dr. Sreedevi Sampath Fall 2012 Course Description Software is becoming increasingly complex and there is a growing need for systematic strate- gies for testing software testing infrastructure is up to 60 billion dollars (about 0.6% of the US Gross Domestic Product

  3. Augmenting Reality Using Affine Object Representations Dr. James Vallino

    E-print Network

    Vallino, James R

    1 Augmenting Reality Using Affine Object Representations Dr. James Vallino Department of Computer of Computer Science University of Rochester {kyros@cs.rochester.edu} 1. Introduction An augmented reality the virtual objects appear as if they actually exist in the scene. One motivation for augmenting reality

  4. MATH2390: Dynamical Systems Dr A.M. Rucklidge

    E-print Network

    Rucklidge, Alastair

    MATH2390: Dynamical Systems Dr A.M. Rucklidge 8.18g, Department of Applied Mathematics A familiarity with ordinary dif- ferential equations, at the level of (for example) MATH1932, MATH1400 or MATH2450. MATH2360 or MATH2420 would be helpful but are not essential, as would some famil- iarity

  5. MATH3395: Dynamical Systems Dr A.M. Rucklidge

    E-print Network

    Rucklidge, Alastair

    MATH3395: Dynamical Systems Dr A.M. Rucklidge 8.18g, Department of Applied Mathematics A.M.Rucklidge at leeds.ac.uk This course continues the study of nonlinear dynamics begun in MATH2390/2391, but for maps example) MATH2390/2391. Basic linear algebra is required, and there will be some use of the notion

  6. A HUMAN ACHIEVEMENT: MATHEMATICS WITHOUT BOUNDARIES Prof. Dr. Tosun TERZIOLU

    E-print Network

    Yanikoglu, Berrin

    A HUMAN ACHIEVEMENT: MATHEMATICS WITHOUT BOUNDARIES Prof. Dr. Tosun TERZIOLU Sabanci University and humanities in their first years before specializing in their degree areas. This was the third fundamental minded intellectuals who would not automatically hate the designated enemy of the state. At the beginning

  7. D.R. Woolf Curriculum Vitae Revised May 10 2015

    E-print Network

    Fletcher, Robin

    Daniel Robert Woolf Email address for academic correspondence only: woolfd@queensu.ca Twitter: @queensprincipal Mailing Address Office of the Principal and Vice-Chancellor Richardson Hall 351 Queen's University. Thesis title: "Change and Continuity in English Historical Thought, c. 1590-1640", supervised by Dr. G

  8. PHYS 8202: Advanced Electromagnetic Theory II Instructor: Dr. M. Bachmann

    E-print Network

    Geller, Michael R.

    PHYS 8202: Advanced Electromagnetic Theory II Instructor: Dr. M. Bachmann Room: Physics Bldg. 309 with electromagnetic waves. Field quantization concepts, such as the canonical oper- ator approach and symmetry; dielectrics II. Magnetostatics · Magnetic induction; Biot-Savart Law; Maxwell equations · Vector potential

  9. GEOL 455 Marine Geophysics Dr. Wen-lu Zhu

    E-print Network

    Zeng, Ning

    geophysics. Topics include: Plate tectonics, earthquake and faulting, isostasy and gravity, heat and mantle1 GEOL 455 Marine Geophysics Syllabus Instructor Dr. Wen-lu Zhu Department of Geology Office: CHEM@geol.umd.edu). I will response ASAP. Office hours Location: CHEM 1210A Time: Wednesday, 3:00-4:00 PM Lectures

  10. Focus on Fitness: Q&A with Dr. Greene

    ERIC Educational Resources Information Center

    Greene, Alan

    2005-01-01

    Dr. Greene answers the following question in this brief article focusing on fitness: Everyone knows that children need plenty of exercise to stay healthy--But what does "fitness" really involve for young children? Following this discussion, the topics presented include: snack of the month; nutrition fact; and activities, "Move to the Music" and…

  11. A-Science Service Feature By Dr. Charles F. Brooks

    E-print Network

    No, 504 Dec, 22 A- Science Service Feature By Dr. Charles F. Brooks of Clark Univernify. RAIN occur with the same pressure distribution as snowI Sleet starts t u f a l l as slush drops o r rain, formed i n a warm, moist, southerly nind a l o f t , and freezes as it falls through a lower stratum

  12. ContaCt InformatIon Dr. Art Gowan

    E-print Network

    Arnold, Elizabeth A.

    Application Developer n Business Intelligence Specialist n Chief Information Officer n Computer ForensicsContaCt InformatIon Dr. Art Gowan CIS & Business Analytics Dpt Head College of Business ZSH 234 Computer Information Systems Bachelor of Business Administration (B.B.A.) Career Possibilities What

  13. Dr. Edward de Bono's Six Thinking Hats and Numeracy

    ERIC Educational Resources Information Center

    Paterson, Anne

    2006-01-01

    In education, the term "metacognition" describes thinking about thinking. Within mathematics, the term "metacomputation" describes thinking about computational methods and tools. This article shows how Dr. Edward de Bono's Six Thinking Hats can be used to demonstrate metacognition and metacomputation in the primary classroom. The article suggests…

  14. Berufliches Curriculum Vitae PD Dr. phil. Andreas Walter Aste

    E-print Network

    Aste, Andreas

    .aste@unibas.ch 1976-1980 Primarschule in Basel. 1980-1988 Besuch des Mathematisch-Naturwissenschaftlichen Gymnasium Vikariate am Mathematisch-Naturwissenschaftlichen Gymnasium in Basel. 1992-1993 Diplomarbeit bei Prof. Dr-Alsace. Teilpensum als Physiklehrer am Gymnasium am M¨unsterplatz in Basel. Okt. 2010 ­ Hauptamlicher Dozent f

  15. Curriculum Vitae PD Dr. phil. Andreas Walter Aste

    E-print Network

    Aste, Andreas

    in Basel. 1980-1988 Besuch des Mathematisch-Naturwissenschaftlichen Gymnasium in Basel. M¨arz 1988 Matura-Naturwissenschaftlichen Gymnasium in Basel. 1992-1993 Diplomarbeit bei Prof. Dr. Dirk Trautmann mit dem Titel "Elektron-Alsace. Teilpensum als Physiklehrer am Gymnasium am M¨unsterplatz in Basel. Okt. 2010 ­ Hauptamlicher Dozent f

  16. Dynamic Star Formation in the Massive DR21 Filament

    SciTech Connect

    Schneider, N.; Csengeri, T.; Bontemps, S.; Motte, F.; Simon, R.; Hennebelle, P.; Federrath, C.; Klessen, R.; /ZAH, Heidelberg /KIPAC, Menlo Park

    2010-08-25

    The formation of massive stars is a highly complex process in which it is unclear whether the star-forming gas is in global gravitational collapse or an equilibrium state supported by turbulence and/or magnetic fields. By studying one of the most massive and dense star-forming regions in the Galaxy at a distance of less than 3 kpc, i.e. the filament containing the well-known sources DR21 and DR21(OH), we attempt to obtain observational evidence to help us to discriminate between these two views. We use molecular line data from our {sup 13}CO 1 {yields} 0, CS 2 {yields} 1, and N{sub 2}H{sup +} 1 {yields} 0 survey of the Cygnus X region obtained with the FCRAO and CO, CS, HCO{sup +}, N{sub 2}H{sup +}, and H{sub 2}CO data obtained with the IRAM 30m telescope. We observe a complex velocity field and velocity dispersion in the DR21 filament in which regions of the highest column-density, i.e., dense cores, have a lower velocity dispersion than the surrounding gas and velocity gradients that are not (only) due to rotation. Infall signatures in optically thick line profiles of HCO{sup +} and {sup 12}CO are observed along and across the whole DR21 filament. By modelling the observed spectra, we obtain a typical infall speed of {approx}0.6 km s{sup -1} and mass accretion rates of the order of a few 10{sup -3} M{sub {circle_dot}} yr{sup -1} for the two main clumps constituting the filament. These massive clumps (4900 and 3300 M{sub {circle_dot}} at densities of around 10{sup 5} cm{sup -3} within 1 pc diameter) are both gravitationally contracting. The more massive of the clumps, DR21(OH), is connected to a sub-filament, apparently 'falling' onto the clump. This filament runs parallel to the magnetic field. Conclusions. All observed kinematic features in the DR21 filament (velocity field, velocity dispersion, and infall), its filamentary morphology, and the existence of (a) sub-filament(s) can be explained if the DR21 filament was formed by the convergence of flows on large scales and is now in a state of global gravitational collapse. Whether this convergence of flows originated from self-gravity on larger scales or from other processes cannot be determined by the present study. The observed velocity field and velocity dispersion are consistent with results from (magneto)-hydrodynamic simulations where the cores lie at the stagnation points of convergent turbulent flows.

  17. Enhancing Price Response Programs through Auto-DR: California's 2007 Implementation Experience

    SciTech Connect

    Kiliccote, Sila; Wikler, Greg; Chiu, Albert; Piette, Mary Ann; Kiliccote, Sila; Hennage, Dan; Thomas, Chuck

    2007-12-18

    This paper describes automated demand response (Auto-DR) activities, an innovative effort in California to ensure that DR programs produce effective and sustainable impacts. Through the application of automation and communication technologies coupled with well-designed incentives and DR programs such as Critical Peak Pricing (CPP) and Demand Bidding (DBP), Auto-DR is opening up the opportunity for many different types of buildings to effectively participate in DR programs. We present the results of Auto-DR implementation efforts by the three California investor-owned utilities for the Summer of 2007. The presentation emphasizes Pacific Gas and Electric Company's (PG&E) Auto-DR efforts, which represents the largest in the state. PG&E's goal was to recruit, install, test and operate 15 megawatts of Auto-DR system capability. We describe the unique delivery approaches, including optimizing the utility incentive structures designed to foster an Auto-DR service provider community. We also show how PG&E's Critical Peak Pricing (CPP) and Demand Bidding (DBP) options were called and executed under the automation platform. Finally, we show the results of the Auto-DR systems installed and operational during 2007, which surpassed PG&E's Auto-DR goals. Auto-DR is being implemented by a multi-disciplinary team including the California Investor Owned Utilities (IOUs), energy consultants, energy management control system vendors, the Lawrence Berkeley National Laboratory (LBNL), and the California Energy Commission (CEC).

  18. G Year/D101 CURRICLUM MANAGERS LIST Course Director Dr Stephen Frean

    E-print Network

    Daley, Monica A.

    . Endocrine Systems Prof Mark Fox Infections and Responses Unit 4:Parasitology Term1,2&3 Dr Raymond Macharia & Function Unit 3. Urinary System Dr Robert Abayasekara Principles of Animal Form & Function Unit 4 Principles of Animal Form & Function Unit 5. Principles of the Nervous System Dr Liam Good Infections

  19. Dr. Matt Burleigh 3677: Life in the Universe DEPARTMENT OF PHYSICS AND ASTRONOMY

    E-print Network

    Burleigh, Matt

    #12;Dr. Matt Burleigh 3677: Life in the Universe Kepler results Petigura et al. 2013: · 11±4% of sun light years #12;Dr. Matt Burleigh 3677: Life in the Universe Kepler's limitations · Kepler observes · (See Kepler mission) Ptransit = R* a #12;Dr. Matt Burleigh 3677: Life in the Universe Transits

  20. SE1CC11 Feedback Part A Dr Richard Mitchell, 2014 1

    E-print Network

    Mitchell, Richard

    SE1CC11 ­ Feedback ­ Part A © Dr Richard Mitchell, 2014 1 SE1CC11 Cybernetics and Circuits Feedback ­ Part A Dr Richard Mitchell p1 RJM 17/09/14 SE1CC11 ­ Feedback ­ Part A © Dr Richard Mitchell 2014 SE1CC11 and SE1CA11 introduce fundamental concepts and applications of Cybernetics ­ Feedback theory

  1. Dr. Wernher Von Braun greeting dignitaries at the Redstone Arsenal airfield.

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Dr. George E. Mueller, center, associate administrator for manned space flight, is flanked by Dr. Wernher Von Braun, left, and Dr. Eberhard Rees at the Redstone Arsenal airstrip. the associate adminstrator was making his annual staff visit to the Marshall Space Flight Center.

  2. Einstein/MMC CFAR Awarded Pilot Projects for 2006 Dr. Matthew Anderson, Department of

    E-print Network

    Emmons, Scott

    Einstein/MMC CFAR Awarded Pilot Projects for 2006 PI Title Dr. Matthew Anderson, Department retention of gp160 Einstein/MMC CFAR Awarded Pilot Projects for 2005 PI Title Dr. Carol Harris, Department Einstein/MMC CFAR Awarded Pilot Projects for 2004 PI Title Dr. Laura Santambrogio, Department of Pathology

  3. LIGHT AND PHOTOSYNTHESIS IN THE SEA, SPRING 2010 Instructor: Dr. Michael Durako BIO 495 009

    E-print Network

    Durako, Michael J.

    LIGHT AND PHOTOSYNTHESIS IN THE SEA, SPRING 2010 Instructor: Dr. Michael Durako BIO 495 009 Class/14 Photosynthesis vs Light Dr. Durako 3 1/21 Utilization of Light in Aquatic Systems Dr. Durako 4 1/28* Carbon of Light Attenuation in Aquatic Systems - TSS, CDOM, Water Photosynthesis versus Irradiance Measurement

  4. HIT am 01.07.2011 Dr. Ute Vogel 1 Informatik oder

    E-print Network

    Damm, Werner

    HIT am 01.07.2011 Dr. Ute Vogel 1 Informatik oder Wirtschaftsinformatik? Studium an der Universität. Jürgen Sauer Hochschulinformationstag am 01.07.2011 #12;HIT am 01.07.2011 Dr. Ute Vogel 2 Überblick/HilfenWeitere Informationen/HilfenWeitere Informationen/Hilfen #12;HIT am 01.07.2011 Dr. Ute Vogel 4 Was ist Informatik

  5. ICHHAPORIA, PRATIK KISHORE. Composite from Natural Fibers. (Under the direction of Dr. William Oxenham and Dr. Behnam Pourdeyhimi.)

    E-print Network

    ABSTRACT ICHHAPORIA, PRATIK KISHORE. Composite from Natural Fibers. (Under the direction of Dr to achieve the goal of recyclable composites, natural fibers surfaced as the fiber of choice for reinforcing composites. The overhead for using natural fibers is their cleaning and processing needs. The current project

  6. Alpha-tocopheryl succinate induces DR4 and DR5 expression by a p53-dependent route: implication for sensitisation of resistant cancer cells to TRAIL apoptosis.

    PubMed

    Tomasetti, Marco; Andera, Ladislav; Alleva, Renata; Borghi, Battista; Neuzil, Jiri; Procopio, Antonio

    2006-04-01

    We evaluated the ability of alpha-tocopheryl succinate (alpha-TOS) to sensitise TRAIL-resistant malignant mesothelioma (MM) cells to TRAIL-induced apoptosis. We show that alpha-TOS activates expression of DR4/DR5 in a p53-dependent manner and re-establishes sensitivity of resistant MM cells to TRAIL-mediated apoptosis, as documented in p53wt MM cells but not in their p53null counterparts. MM cells selected for TRAIL resistance expressed low cell surface levels of DR4 and DR5. Treatment with sub-lethal doses of alpha-TOS restored expression of DR4 and DR5. The ability of alpha-TOS to modulate expression of pro-apoptotic genes may play a role in sensitisation of tumour cells to immunological stimuli. PMID:16529749

  7. Knowledge, attitude and behaviour regarding dietary salt intake among medical students in Angola

    PubMed Central

    Magalhães, Pedro; Sanhangala, Edgar JR; Dombele, Isildro M; Ulundo, Henrique SN; Capingana, Daniel P; Silva, Amílcar BT

    2015-01-01

    Summary Background Levels of salt consumption and its awareness among medical students in Angola remain insufficiently studied. This study determined salt intake and assessed medical students’ knowledge, attitude and behaviour regarding salt consumption. Methods Were collected 24-hour urine samples from a random sample of 123 undergraduate medical students aged 17–43 years who were studying at the University of Agostinho Neto in Luanda. Their knowledge, attitude and behaviour regarding dietary salt were surveyed. Socio-demographic, clinical and anthropometric data were collected. Results Average salt intake was 14.2 ± 5.1 g/day, without significant difference between genders (p = 0.221). In total, 96.7% consumed over 5 g/day, but only 6.5% of participants were aware of their excessive salt intake. The majority knew about salt-related health consequences and 45.5% reported they controlled their salt intake. Conclusions This study indicated a high salt intake and inadequate behaviour regarding dietary salt consumption among medical students studying at the University of Agostinho Neto. This highlights the need for nutritional education to improve their dietary habits and future role in counselling. PMID:25940118

  8. STATISTICAL STUDY OF 2XMMi-DR3/SDSS-DR8 CROSS-CORRELATION SAMPLE

    SciTech Connect

    Zhang Yanxia; Zhou Xinlin; Zhao Yongheng; Wu Xuebing

    2013-02-01

    Cross-correlating the XMM-Newton 2XMMi-DR3 catalog with the Sloan Digital Sky Survey (SDSS) Data Release 8, we obtain one of the largest X-ray/optical catalogs and explore the distribution of various classes of X-ray emitters in the multidimensional photometric parameter space. Quasars and galaxies occupy different zones while stars scatter in them. However, X-ray active stars have a certain distributing rule according to spectral types. The earlier the type of stars, the stronger its X-ray emitting. X-ray active stars have a similar distribution to most stars in the g - r versus r - i diagram. Based on the identified samples with SDSS spectral classification, a random forest algorithm for automatic classification is performed. The result shows that the classification accuracy of quasars and galaxies adds up to more than 93.0% while that of X-ray emitting stars only amounts to 45.3%. In other words, it is easy to separate quasars and galaxies, but it is difficult to discriminate X-ray active stars from quasars and galaxies. If we want to improve the accuracy of automatic classification, it is necessary to increase the number of X-ray emitting stars, since the majority of X-ray emitting sources are quasars and galaxies. The results obtained here will be used for the optical spectral survey performed by the Large sky Area Multi-Object fiber Spectroscopic Telescope (LAMOST, also named the Guo Shou Jing Telescope), which is a Chinese national scientific research facility operated by the National Astronomical Observatories, Chinese Academy of Sciences.

  9. Strong association between microsatellites and an HLA-B, DR haplotype (B18-DR3): Implication for microsatellite evolution

    SciTech Connect

    Crouau-Roy, B.; Bouzekri, N.; Clayton, J.

    1996-09-01

    The HLA haplotype B18-DR3 has a widespread geographical distribution, but has its greatest frequencies in Southern Europe, probably vestigial of the earliest populations of this region, particularly in the Pays Basque and Sardinia. This haplotype is of medical significance, being that most implicated as a factor of risk in insulin-dependent diabetes mellitus. In this study, the closely linked microsatellite markers (TNFa,b,c) in the region of the tumor necrosis factor (TNF) genes have been used in an attempt to subtype this haplotype in the two populations and/or in healthy and diabetic populations. A total of 79 HLA-B18-DR3 haplotypes were analyzed: 54 in Basques (12 from healthy individuals and 42 from diabetics or their first-degree relatives) and 25 in Sardinians (13 from healthy and 13 from diabetic individuals). The TNF haplotype a1-b5-c2 is completely associated with B18-DR3 in both populations. The homogeneity of the B18-DR3 haplotype in two ethnically pure populations implies stability in evolution, which suggest that the mutation rate of these microsatellite markers must be less than is usually assumed (i.e., {approximately} 5x10{sup {minus}6} per site per generation). Such markers should be powerful tools for studying genetic drift and admixture of populations, but it remains to be established whether this stability is a rule for all microsatellites in HLA haplotypes or whether or whether it is restricted to some microsatellites and/or some HLA haplotypes. The population genetics of those microsatellites associated with HLA B18-DR3 was also studied in a random sample of the Basque population. 44 refs., 3 tabs.

  10. First images of 6.7-GHz methanol masers in DR21(OH) and DR21(OH)N

    E-print Network

    L. Harvey-Smith; R. Soria-Ruiz; A. Duarte-Cabral; R. J. Cohen

    2007-11-18

    The first images of 6.7-GHz methanol masers in the massive star-forming regions DR21(OH) and DR21(OH)N are presented. By measuring the shapes, radial velocities and polarization properties of these masers it is possible to map out the structure, kinematics and magnetic fields in the molecular gas that surrounds newly-formed massive stars. The intrinsic angular resolution of the observations was 43 mas (~100 AU at the distance of DR21), but structures far smaller than this were revealed by employing a non-standard mapping technique. This technique was used in an attempt to identify the physical structure (e.g. disc, outflow, shock) associated with the methanol masers. Two distinct star-forming centres were identified. In DR21(OH) the masers had a linear morphology, and the individual maser spots each displayed an internal velocity gradient in the same direction as the large-scale structure. They were detected at the same position as the OH 1.7-GHz ground-state masers, close to the centre of an outflow traced by CO and class I methanol masers. The shape and velocity gradients of the masers suggests that they probably delineate a shock. In DR21(OH)N the methanol masers trace an arc with a double-peaked profile and a complex velocity gradient. This velocity gradient closely resembles that of a Keplerian disc. The masers in the arc are 4.5% linearly polarized, with a polarization angle that indicates that the magnetic field direction is roughly perpendicular to the large-scale magnetic field in the region (indicated by lower angular resolution measurements of the CO and dust polarization). The suitability of channel-by-channel centroid mapping is discussed as an improved and viable means to maximise the information gained from the data.

  11. Data and computing intensive applications in GENESI-DR

    NASA Astrophysics Data System (ADS)

    Cossu, Roberto; Pacini, Fabrizio; Gonçalves, Pedro; Fusco, Luigi

    2010-05-01

    GENESI-DR (Ground European Network for Earth Science Interoperations - Digital Repositories) is a European Commission (EC)-funded project, kicked-off early 2008 lead by ESA; partners include Space Agencies (DLR, ASI, CNES), both space and no-space data providers such as ENEA (I), Infoterra (UK), K-SAT (N), NILU (N), JRC (EU) and industry as Elsag Datamat (I), CS (F) and TERRADUE (I). GENESI-DR intends to meet the challenge of facilitating "time to science" from different Earth Science disciplines in discovery, access and use (combining, integrating, processing, …) of historical and recent Earth-related data from space, airborne and in-situ sensors, which are archived in large distributed repositories. GENESI-DR provides a framework where data repositories can be easily integrated and users are given a single access point for discovery and access to heterogeneous data and processing resources. Processing services can be easily integrated as well so supporting the users in the analysis of the data. Coupled with high-performance and sizeable computing resources managed by Grid technologies, GENESI-DR provides indeed the necessary flexibility for building a virtual environment that gives transparent, fast, and easy access to data (even heterogeneous and dispersed among different archives), processing services, computing resources, and results. These characteristics make GENESI-DR an ideal platform for processing large amounts of heterogeneous data (e.g., satellite and in-situ data), developing services which require fast production and delivery of results, comparing approaches and fully validating algorithms. Security solutions adopted in GENESI-DR guarantee that only authorized users can access data, processing services and processing resources. GENESI-DR is designed to support the need for an effective exploitation of the large archives. Among the different applications already integrated in GENESI-DR, in this presentation we will describe some results related to Differential SAR Interferometry (DInSAR). This is an effective technique to detect and monitor ground displacements with centimetre accuracy. The recent development of advanced DInSAR techniques, aimed at the generation of deformation time series, has led to the need of suitable environments and approaches for an effective exploitation of the large archive of SAR data acquired by the ERS, ENVISAT and RADARSAT satellites. Accordingly, we discuss, from a data access and processing point of view, some results obtained merging the robustness of an advanced DInSAR approach (namely the Small Baseline Subset (SBAS) algorithm proposed and developed by Italian CNR - IREA) with the high computing capability provided by the distributed infrastructure available through GENESI-DR. A similar analysis is currently performed using Cloud Computing resources. As final remark, it is evident the importance that the presented distributed processing solution may have in scenarios as for the Supersite initiative, which is aimed at stimulating "an international and intergovernmental effort to monitor and study selected reference sites by establishing open access to relevant datasets according to GEO principles to foster the collaboration between all various partners and end-users".

  12. Name: pDR-GFPuniv Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described

    E-print Network

    Monnat, Ray

    Name: pDR-GFPuniv Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP-functional copies of the eGFP gene: the 5' copy is interrupted by the target site of interest and stop codons; the 3' copy is truncated on both 5'- and 3'- end. pDR-GFP as is does not fulfill any other purpose than

  13. The extent of HLA-DR expression on HLA-DR(+) Tregs allows the identification of patients with clinically relevant borderline rejection.

    PubMed

    Schaier, Matthias; Seissler, Nicole; Becker, Luis Eduardo; Schaefer, Sebastian Markus; Schmitt, Edgar; Meuer, Stefan; Hug, Friederike; Sommerer, Claudia; Waldherr, Rüdiger; Zeier, Martin; Steinborn, Andrea

    2013-03-01

    Regulatory T cells (Tregs) were shown to be involved into the pathogenesis of acute rejection after transplantation. The suppressive activity of the total regulatory T cell pool depends on its percentage of highly suppressive HLA-DR(+) -Treg cells. Therefore, both the suppressive activity of the total Treg pool and the extent of HLA-DR expression of HLA-DR(+) -Tregs (MFI HLA-DR) were estimated in non transplanted volunteers, patients with end-stage renal failure (ESRF), healthy renal transplant patients with suspicion on rejection, due to sole histological Bord-R or sole acute renal failure (ARF), and patients with clinically relevant borderline rejection (Bord-R and ARF). Compared to patients with only Bord-R or only ARF, the suppressive activity of the total Treg cell pool was exclusively reduced in patients with clinically relevant Bord-R. In parallel, the HLA-DR MFI of the DR(+) -Treg subset was significantly decreased in these patients, due to a significantly lower proportion of DR(high+) -Tregs, which were shown to have the highest suppressive capacity within the total Treg pool. Our findings clearly demonstrate that the determination of the HLA-DR MFI of the HLA-DR(+) -Treg subset allows a highly sensitive, specific and non-invasive discrimination between patients with clinically relevant Bord-R (Bord and ARF) and patients with subclinical rejection or other causes of transplant failure. PMID:23279010

  14. DR Resources for Energy and Ancillary Services in the West (Presentation)

    SciTech Connect

    Hummon, M.; Kiliccote, S.

    2014-04-01

    Demand response (DR) resources present a potentially important source of grid flexibility however, DR in grid models is limited by data availability and modeling complexity. This presentation focuses on the co-optimization of DR resources to provide energy and ancillary services in a production cost model of the Colorado "test system". We assume each DR resource can provide energy services by either shedding load or shifting its use between different times, as well as operating reserves: frequency regulation, contingency reserve, and flexibility (or ramping) reserve. There are significant variations in the availabilities of different types of DR resources, which affect both the operational savings as well as the revenue for each DR resource. The results presented include the system-wide avoided fuel and generator start-up costs as well as the composite revenue for each DR resource by energy and operating reserves.

  15. Star Formation in the DR21 Region (B)

    NASA Technical Reports Server (NTRS)

    2004-01-01

    [figure removed for brevity, see original site] Annotated mosaic

    Hidden behind a shroud of dust in the constellation Cygnus is an exceptionally bright source of radio emission called DR21. Visible light images reveal no trace of what is happening in this region because of heavy dust obscuration. In fact, visible light is attenuated in DR21 by a factor of more than 10,000,000,000,000,000,000,000,000,000,000,000,000,000 (ten thousand trillion heptillion).

    New images from NASA's Spitzer Space Telescope allow us to peek behind the cosmic veil and pinpoint one of the most massive natal stars yet seen in our Milky Way galaxy. The never-before-seen star is 100,000 times as bright as the Sun. Also revealed for the first time is a powerful outflow of hot gas emanating from this star and bursting through a giant molecular cloud.

    The upper image is a large-scale mosaic assembled from individual photographs obtained with the InfraRed Array Camera (IRAC) aboard Spitzer. The image covers an area about two times that of a full moon. The mosaic is a composite of images obtained at mid-infrared wavelengths of 3.6 microns (blue), 4.5 microns (green), 5.8 microns (orange) and 8 microns (red). The brightest infrared cloud near the top center corresponds to DR21, which presumably contains a cluster of newly forming stars at a distance of 10,000 light-years.

    Protruding out from DR21 toward the bottom left of the image is a gaseous outflow (green), containing both carbon monoxide and molecular hydrogen. Data from the Spitzer spectrograph, which breaks light into its constituent individual wavelengths, indicate the presence of hot steam formed as the outflow heats the surrounding molecular gas. Outflows are physical signatures of processes that create supersonic beams, or jets, of gas. They are usually accompanied by discs of material around the new star, which likely contain the materials from which future planetary systems are formed. Additional newborn stars, depicted in green, can be seen surrounding the DR21 region.

    The red filaments stretching across this image denote the presence of polycyclic aromatic hydrocarbons. These organic molecules, comprised of carbon and hydrogen, are excited by surrounding interstellar radiation and become luminescent at wavelengths near 8.0 microns. The complex pattern of filaments is caused by an intricate combination of radiation pressure, gravity and magnetic fields. The result is a tapestry in which winds, outflows and turbulence move and shape the interstellar medium.

    To the lower left of the mosaic is a large bubble of gas and dust, which may represent the remnants of a past generation of stars.

    The lower panel shows a 24-micron image mosaic, obtained with the Multiband Imaging Photometer aboard Spitzer (MIPS). This image maps the cooler infrared emission from interstellar dust found throughout the interstellar medium. The DR21 complex is clearly seen near the center of the strip, which covers about twice the area of the IRAC image.

    Perhaps the most fascinating feature in this image is a long and shadowy linear filament extending towards the 10 o'clock position of DR21. This jet of cold and dense gas, nearly 50 light-years in extent, appears in silhouette against a warmer background. This filament is too long and massive to be a stellar jet and may have formed from a pre-existing molecular cloud core sculpted by DR21's strong winds. Regardless of its true nature, this jet and the numerous other arcs and wisps of cool dust signify the interstellar turbulence normally unseen by the human eye.

  16. From the editor: an interview with Dr. Scott Grundy.

    PubMed

    Grundy, Scott; Brown, W Virgil

    2014-01-01

    During the American Heart Association's Scientific Sessions in November 2014, this Editor had the opportunity to interview Dr. Scott Grundy regarding the new recommendations for guideline development that was issued by the International Atherosclerosis Society. (The full document is published in this issue of the journal). In developing this report, Dr. Grundy chaired a panel of international experts who spent 1 year in consideration of new evidence and regional concerns regarding the clinical management of lipoprotein disorders and vascular disease prevention. His experience in developing the Adult Treatment Panel Reports from the National Cholesterol Education Program in the United States and his extensive research in lipoprotein physiology and related disorders makes him unique in offering the expertise for worldwide leadership in this effort. PMID:24528682

  17. Dr. Irmfried Eberl (1910-1948): mass murdering MD.

    PubMed

    Strous, Rael D

    2009-04-01

    There are isolated cases of physicians who murdered their patients. However, never had a single physician personally supervised the mass murder of hundreds of thousands of individuals, until Dr. Irmfried Eberl. Commander of the Nazi death camp Treblinka, he killed both the ill and those he considered "a disease to his nation." At age 32 Dr. Eberl established Treblinka, where he was responsible for the killing of approximately 280,000 individuals within a few weeks. The position of camp commandant was earned following his success as head of two psychiatric hospitals in Germany where he coordinated the murder of thousands of mentally ill Jews and non-Jews within the context of the euthanasia program. However, few in medicine have heard of him or the harm he caused to the ethical practice of the profession and to human rights. PMID:19603594

  18. [Dr Erwin Treu--the first permanent ophthalmologist in Split].

    PubMed

    Ivanisevi?, Milan; Boji?, Lovro; Bu?an, Kajo; Kovaci?, Zeljko

    2009-01-01

    Dr. Erwin Treu (Kotor, 1875-Skopje, 1937) was the first permanent ophthalmologist in Split, Croatia. He finished his ophthalmological specialization at the Eye Clinic in Prague in 1900 at W.P. Czermak. He originates from Tirol. Dr. Treu led and organized ophthalmological service in Split and worked from 1902 to 1921 in the Split Hospital, and had a private practice until 1923. From 1904 to 1910 he temporarily worked outside Split, in Sibenik, Zadar, Dubrovnik, Kotor and Cetinje. During the First World War he was a military doctor in Split and Trogir. He performed ophthalmological operations, cataracts, glaucomas (iridectomy), strabismus (tenotomies), ocular adnexa, injuries, trachoma etc. In 1923 he left for Skopje where he at first worked as a medical major in Military Hospital, and after that as a primarius in Civil Hospital at the Department of Ophthalmology till the end of his life. PMID:19769288

  19. Dr. Harry Whelan With the Light Emitting Diode Probe

    NASA Technical Reports Server (NTRS)

    1999-01-01

    The red light from the Light Emitting Diode (LED) probe shines through the fingers of Dr. Harry Whelan, a pediatric neurologist at the Children's Hospital of Wisconsin in Milwaukee. Dr. Whelan uses the long waves of light from the LED surgical probe to activate special drugs that kill brain tumors. Laser light previously has been used for this type of surgery, but the LED light illuminates through all nearby tissues, reaching parts of tumors that shorter wavelengths of laser light carnot. The new probe is safer because the longer wavelengths of light are cooler than the shorter wavelengths of laser light, making the LED less likely to injure normal brain tissue near the tumor. Also, it can be used for hours at a time while still remaining cool to the touch. The probe was developed for photodynamic cancer therapy under a NASA Small Business Innovative Research Program grant. The program is part of NASA's Technology Transfer Department at the Marshall Space Flight Center.

  20. 21. Dr. Harrison E. Stroud poses in front of his ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    21. Dr. Harrison E. Stroud poses in front of his newly completed building at the northeast corner of Central Avenue and the alley north of Washington Street in about 1900 or 1901. In 1901, the building seen here was enlarged by the construction of an addition of similar design immediately to the north (left). Virtually the entire west elevation of the initial building is depicted in this view. Credit ADLAPR. - Stroud Building, 31-33 North Central Avenue, Phoenix, Maricopa County, AZ

  1. Prof. Dr. Claudia Linnhoff-Popien Michael Beck, Andr Ebert

    E-print Network

    applications · the Android SDK offers developer tools and API libraries · allows for simple application (app.9% Microsoft 2.6% BlackBerry 0.3% Others 0.4% Total 100.0% http://www.gartner.com/newsroom/id/2573415 http://developer.android://www.mobile.ifi.lmu.de Wintersemester 2015/16 Praktikum Mobile und Verteilte Systeme Programming with Android #12;Prof. Dr. C. Linnhoff

  2. ORAC-DR: A generic data reduction pipeline infrastructure

    NASA Astrophysics Data System (ADS)

    Jenness, Tim; Economou, Frossie

    2015-03-01

    ORAC-DR is a general purpose data reduction pipeline system designed to be instrument and observatory agnostic. The pipeline works with instruments as varied as infrared integral field units, imaging arrays and spectrographs, and sub-millimeter heterodyne arrays and continuum cameras. This paper describes the architecture of the pipeline system and the implementation of the core infrastructure. We finish by discussing the lessons learned since the initial deployment of the pipeline system in the late 1990s.

  3. -A Scionoo Service Foature By Dr. Charlos F. Brooks

    E-print Network

    -A Scionoo Service Foature By Dr. Charlos F. Brooks of Clark Univorsity. OIL VERSUS FOG Oiling m q fog, the o i l covor would be usoloss. in spring warm and mist air mqjr bo chillod by contact'umishing the fog moisturn, BO tho s q p l y of fog could not bo curtailed by Putting a l i d over tho wator

  4. Of Brain and Bone: The Unusual Case of Dr. A

    PubMed Central

    Narvid, J; Gorno-Tempini, ML; Slavotinek, A; DeArmond, SJ; Cha, YH; Miller, BL; Rankin, K.P

    2009-01-01

    Frontotemporal dementia (FTD) is a clinical syndrome characterized by progressive decline in social conduct and a focal pattern of frontal and temporal lobe damage. Its biological basis is still poorly understood but the focality of the brain degeneration provides a powerful model to study the cognitive and anatomical basis of social cognition. Here, we present Dr. A, a patient with a rare hereditary bone disease (hereditary multiple exostoses) and FTD (pathologically characterized as Pick’s disease), who presented with a profound behavioral disturbance characterized by acquired sociopathy. We conducted a detailed genetic, pathological, neuroimaging and cognitive study, including a battery of tests designed to investigate Dr. A’s abilities to understand emotional cues and to infer mental states and intentions to others (theory of mind). Dr. A’s genetic profile suggests the possibility that a mutation causing hereditary multiple exostoses, Ext2, may play a role in the pattern of neurodegeneration in frontotemporal dementia since knockout mice deficient in the Ext gene family member, Ext1, show severe CNS defects including loss of olfactory bulbs and abnormally small cerebral cortex. Dr. A showed significant impairment in emotion comprehension, second order theory of mind, attribution of intentions, and empathy despite preserved general cognitive abilities. Voxel-based morphometry on structural MRI images showed significant atrophy in the medial and right orbital frontal and anterior temporal regions with sparing of dorsolateral frontal cortex. This case demonstrates that social and emotional dysfunction in FTD can dissociate from preserved performance on classic executive functioning tasks. The specific pattern of anatomical damage shown by VBM emphasizes the importance of the network including the superior medial frontal gyrus as well as temporal polar areas, in regulation of social cognition and theory of mind. This case provides new evidence regarding the neural basis of social cognition and suggests a possible genetic link between bone disease and FTD. PMID:20183548

  5. Dr. John Stack and other NASA Langley Research Center Visitors

    NASA Technical Reports Server (NTRS)

    2008-01-01

    Front Row, left to right: Mrs. Elsa Hoare and Major Philip L. Teed - staff members, Vickers-Armstrongs, Ltd., Weybridge, England: Dr. Barnes Wallis - Chief of Aeronautical Research, Vicers-Armstrong, Ltd., Weybridge, England. Back Row, left to right: Norman W. Boorer and Cecil W. Hayes - Staff members, Vickers-Armstrongs, Ltd., Weybridge, England; John R. Christie - Ministry of Supply, London, England; Philip A. Hufton - Chief Supt., Royal Aircraft Establishment, Bedford, England; Lindsey I. Turner, Jr. - Langley Research Center. Photographed November 13, 1958.

  6. 4. View of northerly DR 3 antenna looking north 35 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. View of northerly DR 3 antenna looking north 35 degrees west and showing radar scanner building no. 106 east face through antenna and partial view of satcom communication dome (attached to radar transmitter building 102) in left side of photograph. - Clear Air Force Station, Ballistic Missile Early Warning System Site II, One mile west of mile marker 293.5 on Parks Highway, 5 miles southwest of Anderson, Anderson, Denali Borough, AK

  7. ? WHY THE POUTHER ? By Dr. Charles F, Brooks

    E-print Network

    ? WHY THE POUTHER ? By Dr. Charles F, Brooks of Clark University, _THE CLIMATES OF YdRS If one of us took a t r i p t o Mars to v i s i t ths Mtirtizns, ahom, Va are now Cold, do not exist, w, ars confortably varm, at l e a s t i n `sumTr,ar. tion from Mars indicate a tjmperature of 48 degrsss

  8. 4Science Service 'Fenture Dr. Charles F. Brooks,'

    E-print Network

    NO* 292 April 18 4Science Service 'Fenture Dr. Charles F. Brooks,' of Clark University, t e l l s of: INDICATIONS OF FAIR AND MUCH WARMER Just about a year ago a great warm mave swept over it is cold i n the east, the cirrus clouds.come shooting out of the north and f a i r l y shout "fair and hot

  9. 105-DR Large Sodium Fire Facility closure plan. Revision 1

    SciTech Connect

    Not Available

    1993-05-01

    The Hanford Site, located northwest of the city of Richland, Washington, houses reactors, chemical-separation systems, and related facilities used for the production of special nuclear materials, and activities associated with nuclear energy development. The 105-DR Large Sodium Fire Facility (LSFF), which was in operation from about 1972 to 1986, was a research laboratory that occupied the former ventilation supply room on the southwest side of the 105-DR Reactor facility. The LSFF was established to provide a means of investigating fire and safety aspects associated with large sodium or other metal alkali fires in the liquid metal fast breeder reactor (LMFBR) facilities. The 105-DR Reactor facility was designed and built in the 1950`s and is located in the 100-D Area of the Hanford Site. The building housed the 105-DR defense reactor, which was shut down in 1964. The LSFF was initially used only for engineering-scale alkali metal reaction studies. In addition, the Fusion Safety Support Studies program sponsored intermediate-size safety reaction tests in the LSFF with lithium and lithium lead compounds. The facility has also been used to store and treat alkali metal waste, therefore the LSFF is subject to the regulatory requirements for the storage and treatment of dangerous waste. Closure will be conducted pursuant to the requirements of the Washington Administrative Code (WAC) 173-303-610. This closure plan presents a description of the facility, the history of waste managed, and the procedures that will be followed to close the LSFF as an Alkali Metal Treatment Facility. No future use of the LSFF is expected.

  10. Dr. Lytle Adams' incendiary "bat bomb" of World War II.

    PubMed

    Christen, Arden G; Christen, Joan A

    2004-11-01

    On December 7, 1941, a 60-year old dentist from Irwin, Pennsylvania, Dr. Lytle S. Adams, was driving home from a vacation at Carlsbad Caverns in New Mexico. Hours earlier, he had been gripped with amazement as he witnessed millions of bats exiting the caves of Carlsbad. Listening to his car radio on his return trip, he was shocked to hear that Japan had just attacked Pearl Harbor. Dr. Adams, outraged over this travesty, began to mentally construct a plan for U.S. retaliation. As his thoughts returned to the countless bats that had awed him, he formed a tentative plan: millions of these small, flying mammals could be connected to tiny, time-fused incendiary bombs, and then released to land on the flimsily constructed structures which dotted the cities of Japan. Within a few minutes, the bombs would explode and enflame the entire urban areas. He postulated that these immeasurable numbers of fires, spreading their devastation over such vast areas within Japanese cities would result in the enemy's speedy surrender. This article documents the futile efforts of Dr. Adams, his team and the U.S. government to develop and employ an effective, incendiary bat bomb. The recently developed atom bomb, a far more deadly weapon was used in its place. PMID:15666497

  11. DBBS Alumni 1977 to 2011 Carl Parker, Ph.D. Molecular Biology Lab of Dr. Robert Roeder

    E-print Network

    Gereau, Robert W. IV

    Christie King, Ph.D. Molecular Biology Lab of Dr. William A. Frazier Gilbert Mintz, Ph.D. Molecular Biology of Dr. Thomas Hall William Curtis, Ph.D. Plant Biology Lab of Dr. George G. Johnson Susan Daniels. Valeriote Alfonso Gonzalez Noriega, Ph.D. Cellular, Developmental, & Systemic Biology Lab of Dr. William W

  12. MSc WILD ANIMAL HEALTH / BIOLOGY CURRICULUM MANAGERS LIST Course Directors Mr Michael Waters / Dr Tony Sainsbury (ZSL)

    E-print Network

    Daley, Monica A.

    MSc WILD ANIMAL HEALTH / BIOLOGY CURRICULUM MANAGERS LIST Course Directors Mr Michael Waters / Dr Waters Health and Welfare of Captive Wild Animals Dr Tony Sainsbury / Mr Michael Waters Interventions Dr Michael Waters Ecosystem Health Dr Tony Sainsbury / Mr Michael Waters Evaluation of the Health and Welfare

  13. Clinical and molecular studies in full trisomy 22: Further delineation of the phenotype and review of the literature. Reply to Dr. Robinson and Dr. Kalousek

    SciTech Connect

    Bacino, C.A.; Graham, J.M. Jr.

    1996-03-01

    This {open_quotes}Letter to the Editor{close_quotes} responds to the comments by Dr. Robinson and Dr. Kalousek regarding the implications of meiotic versus somatic chromosomal aberrations. The survival time of the patient may depend on the detection of mosicism; the discussion of the existence of full trisomy 22 remains controversial. 2 refs.

  14. Dr. Judy Flythe Teacher Leader Award Nomination Form The Dr. Judy Flythe Teacher Leader Award is an annual $500 scholarship that honors the memory and contributions

    E-print Network

    Hammack, Richard

    Dr. Judy Flythe Teacher Leader Award Nomination Form The Dr. Judy Flythe Teacher Leader Award promoted and supported teachers as leaders for positive change in schools. This award also honors teachers who have exhibited exemplary teacher leadership. An effective teacher leader can directly impact

  15. The Chicago Board of Education Desegregation Policies and Practices [1975-1985]: A Historical Examination of the Administrations of Superintendents Dr. Joseph P. Hannon and Dr. Ruth Love

    ERIC Educational Resources Information Center

    James, Michael

    2009-01-01

    The purpose of this study will be to examine the policies and practices of two distinguished superintendents of the Chicago Public Schools: Dr. Joseph P. Hannon and the first African American female Superintendent Dr. Ruth Love. Hannon's four year administration extended from 1975 through 1979. Love's administration encompassed the years 1980…

  16. Cesium Evaporation Rate on Tungsten Photocathodes Ameerah Jabr-Hamdan, Dr. Eric Montgomery, Dr. Patrick O' Shea, Blake Riddick, and Peter Zhigang Pan

    E-print Network

    Anlage, Steven

    Cesium Evaporation Rate on Tungsten Photocathodes Ameerah Jabr-Hamdan, Dr. Eric Montgomery, Dr into a vacuum chamber. Experimentally found the evaporation rate of Cesium on a Tungsten Photocathode Photocathode) More accurate model of Cesium evaporation. The Free Electron Laser and Needed Improvements

  17. Pathogenesis of Human Diffusely Adhering Escherichia coli Expressing Afa/Dr Adhesins (Afa/Dr DAEC): Current Insights and Future Challenges

    PubMed Central

    2014-01-01

    SUMMARY The pathogenicity and clinical pertinence of diffusely adhering Escherichia coli expressing the Afa/Dr adhesins (Afa/Dr DAEC) in urinary tract infections (UTIs) and pregnancy complications are well established. In contrast, the implication of intestinal Afa/Dr DAEC in diarrhea is still under debate. These strains are age dependently involved in diarrhea in children, are apparently not involved in diarrhea in adults, and can also be asymptomatic intestinal microbiota strains in children and adult. This comprehensive review analyzes the epidemiology and diagnosis and highlights recent progress which has improved the understanding of Afa/Dr DAEC pathogenesis. Here, I summarize the roles of Afa/Dr DAEC virulence factors, including Afa/Dr adhesins, flagella, Sat toxin, and pks island products, in the development of specific mechanisms of pathogenicity. In intestinal epithelial polarized cells, the Afa/Dr adhesins trigger cell membrane receptor clustering and activation of the linked cell signaling pathways, promote structural and functional cell lesions and injuries in intestinal barrier, induce proinflammatory responses, create angiogenesis, instigate epithelial-mesenchymal transition-like events, and lead to pks-dependent DNA damage. UTI-associated Afa/Dr DAEC strains, following adhesin-membrane receptor cell interactions and activation of associated lipid raft-dependent cell signaling pathways, internalize in a microtubule-dependent manner within urinary tract epithelial cells, develop a particular intracellular lifestyle, and trigger a toxin-dependent cell detachment. In response to Afa/Dr DAEC infection, the host epithelial cells generate antibacterial defense responses. Finally, I discuss a hypothetical role of intestinal Afa/Dr DAEC strains that can act as “silent pathogens” with the capacity to emerge as “pathobionts” for the development of inflammatory bowel disease and intestinal carcinogenesis. PMID:25278576

  18. Dr. Arvid Lindau and discovery of von Hippel-Lindau disease.

    PubMed

    Huntoon, Kristin; Oldfield, Edward H; Lonser, Russell R

    2015-10-01

    Arvid Lindau, MD, PhD, consolidated the disparate array of benign and malignant visceral and nervous system lesions into the neoplastic syndrome known as von Hippel-Lindau (VHL) disease. Based on this pioneering work, Dr. Lindau was awarded both a Rockefeller fellowship to work in Dr. Harvey Cushing's laboratory in Boston, Massachusetts, and the Lennmalm Prize. While working in Dr. Cushing's laboratory, Dr. Lindau continued his study of CNS hemangioblastomas. His work with Dr. Cushing led to their lifelong friendship and scientific collaboration. In this paper the authors describe Arvid Lindau's pioneering work in nervous system tumor pathology, his relationship to Dr. Cushing, and his role in advancing neurological surgery and research in Europe. PMID:25748307

  19. GENESI-DR Portal: a scientific gateway to distributed repositories

    NASA Astrophysics Data System (ADS)

    Goncalves, Pedro; Brito, Fabrice; D'Andria, Fabio; Cossu, Roberto; Fusco, Luigi

    2010-05-01

    GENESI-DR (Ground European Network for Earth Science Interoperations - Digital Repositories) is a European Commission (EC)-funded project, kicked-off early 2008 lead by ESA; partners include Space Agencies (DLR, ASI, CNES), both space and no-space data providers such as ENEA (I), Infoterra (UK), K-SAT (N), NILU (N), JRC (EU) and industry as Elsag Datamat (I), CS (F) and TERRADUE (I). GENESI-DR intends to meet the challenge of facilitating "time to science" from different Earth Science disciplines in discovery, access and use (combining, integrating, processing, …) of historical and recent Earth-related data from space, airborne and in-situ sensors, which are archived in large distributed repositories. "Discovering" which data are available on a "geospatial web" is one of the main challenges ES scientists have to face today. Some well- known data sets are referred to in many places, available from many sources. For core information with a common purpose many copies are distributed, e.g., VMap0, Landsat, and SRTM. Other data sets in low or local demand may only be found in a few places and niche communities. Relevant services, results of analysis, applications and tools are accessible in a very scattered and uncoordinated way, often through individual initiatives from Earth Observation mission operators, scientific institutes dealing with ground measurements, service companies or data catalogues. In the discourse of Spatial Data Infrastructures, there are "catalogue services" - directories containing information on where spatial data and services can be found. For metadata "records" describing spatial data and services, there are "registries". The Geospatial industry coins specifications for search interfaces, where it might do better to reach out to other information retrieval and Internet communities. These considerations are the basis for the GENESI-DR scientific portal, which adopts a simple model allowing the geo-spatial classification and discovery of information as a loosely connected federation of nodes. This network had however to be resilient to node failures and able to scale with the growing addition of new information about data and services. The GENESI-DR scientific portal is still evolving as the project deploys the different components amongst the different partners, but the aim is to provide the connection to information, establish rights, access it and in some cases apply algorithms using the computer power available on the infrastructure with simple interfaces. As information is discovered in the network, it can be further exploited, filtered or enhanced according to the user goals. To implement this vision two specialized graphical interfaces were designed on the portal. The first, concentrates on the text-based search of information, while the second is a command and control of submission and order status on a distributed processing environment. The text search uses natural language features that extract the spatial temporal components from the user query. This is then propagated to the nodes by mapping them to OpenSearch extensions, and then returned to the user as an aggregated list of the resources. These can either be access points to dataset series or services that can be further analysed and processed. At this stage, the user is presented with dedicated interfaces that correspond to context of the action that is performing. Be it a bulk data download, data processing or data mining, the different services offer specialized interfaces that are integrated on the portal. In the overall, the GENESI-DR project identifies best practices and supporting context for the use of a minimal abstract model to loosely connect a federation of Digital Repositories. Surpassing the apparent lack of cost effectiveness of the Spatial Data Infrastructures effort in developing "catalogue services" is achieved by trimming the use cases to the most common and relevant. The GENESI-DR scientific portal is, as such, the visible front-end of a dedicated

  20. SE1EM11 Differentiation and Integration Part A Dr Richard Mitchell, 2014 1

    E-print Network

    Mitchell, Richard

    SE1EM11 Differentiation and Integration­ Part A © Dr Richard Mitchell, 2014 1 p1 RJM 10/09/14 SE1EM11 Differentiation and Integration­ Part A © Dr Richard Mitchell 2014 SE1EM11 - Engineering Maths Dr will see maths applied in module SE1CC11, for instance p2 RJM 10/09/14 SE1EM11 Differentiation

  1. SE2NN11 Neural Networks Part B Dr Richard Mitchell, 2014 1

    E-print Network

    Mitchell, Richard

    SE2NN11 ­ Neural Networks ­ Part B © Dr Richard Mitchell, 2014 1 p1 RJM 16/09/14 SE2NN11 Neural Networks ­ Part B © Dr Richard Mitchell 2014 SE2NN11 Neural Networks : Part B In Part B of the course, I Networks Including Stochastic Diffusion Search p2 RJM 16/09/14 SE2NN11 Neural Networks ­ Part B © Dr

  2. 89. View of DR 2 antenna (structure no. 736) at ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    89. View of DR 2 antenna (structure no. 736) at 65 percent completion showing erection process. Antenna system designed and factory construction by D.S. Kennedy & Company., Comasset, MA, 1958. Note scanner radar building in background. Official photograph BMEWS Project by unknown photographer, 11 July, 1960, Photographic Services, Riverton, NJ, BMEWS, clear as negative no. A-824. - Clear Air Force Station, Ballistic Missile Early Warning System Site II, One mile west of mile marker 293.5 on Parks Highway, 5 miles southwest of Anderson, Anderson, Denali Borough, AK

  3. Genocide in Bosnia: the case of Dr. Radovan Karadzic.

    PubMed

    Dekleva, K B; Post, J M

    1997-01-01

    From 1992 to 1995 the Republic of Bosnia-Herzegovina experienced a war of genocidal proportions between the Bosnian Serbs, the Bosnian Croats, and the Bosnian Muslims. The international Criminal Tribunal for the Former Yugoslavia has indicted Dr. Radovan Karadzic--former President of the Bosnian Serb Republic, psychiatrist, and poet--as a suspected war criminal for his role in war crimes, crimes against humanity, and genocide. Karadzic remains enigmatic and poorly understood. Psychological profiling highlights in Karadzic's case the complex coalescence of the psychology of a genocide perpetrator with that of a charismatic narcissistic political leader. Such a profile may possess usefulness in forensic psychiatric investigations and legal proceedings. PMID:9460036

  4. Dr. von Braun and Army Ballistics Missile Agency (ABMA) Group

    NASA Technical Reports Server (NTRS)

    1959-01-01

    This photograph of Dr. von Braun, shown here to the left of General Bruce Medaris, was taken in the fall of 1959, immediately prior to Medaris' retirement from the Army. At the time, von Braun and his associates worked for the Army Ballistics Missile Agency in Huntsville, Alabama. Those in the photograph have been identified as Ernst Stuhlinger, Frederick von Saurma, Fritz Mueller, Hermarn Weidner, E.W. Neubert (partially hidden), W.A. Mrazek, Karl Heimburg, Arthur Rudolph, Otto Hoberg, von Braun, Oswald Lange, Medaris, Helmut Hoelzer, Hans Maus, E.D. Geissler, Hans Heuter, and George Constan.

  5. Expression and Mutational Analysis of DinB-Like Protein DR0053 in Deinococcus radiodurans

    PubMed Central

    Appukuttan, Deepti; Seo, Ho Seong; Jeong, Sunwook; Im, Sunghun; Joe, Minho; Song, Dusup; Choi, Jungjoon; Lim, Sangyong

    2015-01-01

    In order to understand the mechanism governing radiation resistance in Deinococcus radiodurans, current efforts are aimed at identifying potential candidates from a large repertoire of unique Deinococcal genes and protein families. DR0053 belongs to the DinB/YfiT protein family, which is an over-represented protein family in D. radiodurans. We observed that dr0053 transcript levels were highly induced in response to gamma radiation (?-radiation) and mitomycin C (MMC) exposure depending on PprI, RecA and the DrtR/S two-component signal transduction system. Protein profiles demonstrated that DR0053 is a highly induced protein in cultures exposed to 10 kGy ?-radiation. We were able to determine the transcriptional start site of dr0053, which was induced upon irradiation, and to assign the 133-bp promoter region of dr0053 as essential for radiation responsiveness through primer extension and promoter deletion analyses. A dr0053 mutant strain displayed sensitivity to ?-radiation and MMC exposure, but not hydrogen peroxide, suggesting that DR0053 helps cells recover from DNA damage. Bioinformatic analyses revealed that DR0053 is similar to the Bacillus subtilis protein YjoA, which is a substrate of bacterial protein-tyrosine kinases. Taken together, the DNA damage-inducible (din) gene dr0053 may be regulated at the transcriptional and post-translational levels. PMID:25706748

  6. Characteristics of dr1790 disruptant and its functional analysis in Deinococcus radiodurans

    PubMed Central

    Cheng, Jianhui; Wang, Hu; Xu, Xin; Wang, Liangyan; Tian, Bing; Hua, Yuejin

    2015-01-01

    Deinococcus radiodurans (DR) is an extremophile that is well known for its resistance to radiation, oxidants and desiccation. The gene dr1790 of D. radiodurans was predicted to encode a yellow-related protein. The primary objective of the present study was to characterize the biological function of the DR1790 protein, which is a member of the ancient yellow/major royal jelly (MRJ) protein family, in prokaryotes. Fluorescence labeling demonstrated that the yellow-related protein encoded by dr1790 is a membrane protein. The deletion of the dr1790 gene decreased the cell growth rate and sensitivity to hydrogen peroxide and radiation and increased the membrane permeability of D. radiodurans. Transcript profiling by microarray and RT-PCR analyses of the dr1790 deletion mutant suggested that some genes that are involved in protein secretion and transport were strongly suppressed, while other genes that are involved in protein quality control, such as chaperones and proteases, were induced. In addition, the expression of genes with predicted functions that are involved in antioxidant systems, electron transport, and energy metabolism was significantly altered through the disruption of dr1790. Moreover, the results of proteomic analyses using 2-DE and MS also demonstrated that DR1790 contributed to D. radiodurans survival. Taken together, these results indicate that the DR1790 protein from the ancient yellow protein family plays a pleiotropic role in the survival of prokaryotic cells and contributes to the extraordinary resistance of D. radiodurans against oxidative and radiation stresses. PMID:26273280

  7. Safety evaluation for packaging for 1720-DR sodium-filled tank

    SciTech Connect

    Mercado, M.S.

    1996-03-09

    Preparations are under way to sell the sodium stored in the 1720-DR tank in the 1720-DR building. This will require that the tank, as well as the 1720-DR facility, be moved to the 300 Area, so that the sodium may be melted and transferred into a railroad tanker car. Because the sodium is a hazardous material and is being shipped in a nonspecification packaging, a safety evaluation for packaging (SEP) is required. This SEP approves the sodium-filled tank for a single shipment from the 105-DR area to the 300 Area.

  8. M-giant star candidates identified in LAMOST DR 1

    NASA Astrophysics Data System (ADS)

    Zhong, Jing; Lépine, Sébastien; Li, Jing; Chen, Li; Hou, Jin-Liang; Yang, Ming; Li, Guang-Wei; Zhang, Yong; Hou, Yong-Hui

    2015-08-01

    We perform a discrimination procedure with the spectral index diagram of TiO5 and CaH2+CaH3 to separate M giants from M dwarfs. Using the M giant spectra identified from LAMOST DR1 with high signal-to-noise ratio, we have successfully assembled a set of M giant templates, which show more reliable spectral features. Combining with the M dwarf/subdwarf templates in Zhong et al., we present an extended library of M-type templates which includes not only M dwarfs with a well-defined temperature and metallicity grid but also M giants with subtypes from M0 to M6. Then, the template-fitting algorithm is used to automatically identify and classify M giant stars from LAMOST DR1. The resulting catalog of M giant stars is cross-matched with 2MASS JHKs and WISE W1/W2 infrared photometry. In addition, we calculated the heliocentric radial velocity of all M giant stars by using the cross-correlation method with the template spectrum in a zero-velocity rest frame. Using the relationship between the absolute infrared magnitude MJ and our classified spectroscopic subtype, we derived the spectroscopic distance of M giants with uncertainties of about 40%. A catalog of 8639 M giants is provided. As an additional result of this analysis, we also present a catalog of 101 690 M dwarfs/subdwarfs which are processed by our classification pipeline.

  9. PREFACE: Eighth International Conference on Dissociative Recombination (DR2010)

    NASA Astrophysics Data System (ADS)

    Guberman, Steven L.; Orel, Ann E.

    2011-07-01

    In dissociative recombination (DR), a molecular ion captures an electron and falls apart. One might initially conclude that this process is relatively simple. However, a review of the DR literature over the past 60 years, since the pioneering papers of Sir David Bates [1], shows that the study of DR has proved to be highly challenging for both theorists and experimentalists. Both this challenge and the ubiquitous importance of the process have made its study rewarding, endlessly interesting, and full of surprises. DR is fundamentally the interaction of an electronic continuum with a vibrational continuum often connected by quasibound intermediate states. Autoionization in the first continuum competes with dissociation in the second. DR occurs at the total energy of an ion plus a free electron and is in the same region as vibrationally excited Rydberg states and other neutral superexcited states. All these states interact with each other prior to dissociation, forming a complex that controls the quantum yields of products. The complexity of the process has required both innovation and ingenuity on the part of both theorists and experimentalists. Over the years, it has become apparent that in order to compare theoretical and experimental results, the experiments must identify the electronic, vibrational and for low mass ions, the rotational state. The traditional disagreement between theoretical and experimental results has been due, in part, to the sensitivity of DR cross sections and rate constants to the state of the recombining ion. Great progress has been made in recent years in both flowing afterglow and storage ring experiments aimed at reducing this uncertainty. The latest advances and insights in theory and experiment were the topics of the Eighth International Conference on Dissociative Recombination held at the Granlibakken Lodge at Lake, Tahoe, California, 16-20 August 2010. The conference was part of a series of conferences on DR that started at Chateau Lake Louise, Alberta, Canada in May, 1988 [2] and was followed in May 1992 [3] at L'Abbaye de Saint Jacut de la Mer, Brittany, France, in May, 1995 [4] at Ein Gedi, Israel, in June 1999 [5] on the island of Nässlingen in the Stockholm archipelago, Sweden, in August, 2001 [6] at Chicago, USA, in July, 2004 [7] at the Alte Mälzerei, Mosbach, Germany and in July, 2007 [8] at the Resort d'Amelander Kaap on the island of Ameland, The Netherlands. All papers from the last two conferences and this conference are freely available at http://iopscience.iop.org/1742-6596. In keeping with the tradition of prior DR conferences, all papers in this volume have been refereed. Our thanks go to the referees for their efforts. Travel support for conference participants was provided by NSF grant ATM-0838061 and NASA grant NNX09AQ73G to SLG. We thank Priscilla Kujawski for proofreading the Dedication. Steven L GubermanAnn E OrelEditors Conference photograph Participants of the 8th International Conference on Dissociative Recombination: Theory, Experiments and Applications. 1. Stephen Pratt18. Randy Vane35. Robert Continetti 2. Chris Greene19. Claude Krantz36. Henrik Buhr 3. Bastiaan Braams20. Xavier Urbain37. Mats Larsson 4. Ed Grant21. Hidekazu Takagi38. Dirk Schwalm 5. Christian Nordhorn22. Brian Mitchell39. Evelyne Roueff 6. Steen Brønsted Nielsen23. Andreas Wolf40. Pascal Pernot 7. Dermot Madden24. Daren Stotler41. Stefan Rosén 8. Radek Plašil25. Slava Kokoouline42. Rainer Johnsen 9. Daniel Savin26. David Schultz43. Xiaohong Cai 10. Jonathan Tennyson27. Mourad Telmini44. Dan Haxton 11. Peet Hickman28. Ruth Malenda45. Åsa Larson 12. Michael Fogle29. Slim Chourou46. Dahbia Talbi 13. Waffeu Tamo Francois Oliver30. Petr Dohnal47. Ann Orel 14. Christian Jungen31. Julia Stützel48. Steven Guberman 15. Ilya Fabrikant32. Ioan Schneider49. Jane Fox 16. Wolf Geppert33. Nicholas Shuman50. Richard Thomas 17. Old?ich Novotný34. Holger Kreckel51. Fangfang Ruan

  10. CENSUS OF BLUE STARS IN SDSS DR8

    SciTech Connect

    Scibelli, Samantha; Newberg, Heidi Jo; Carlin, Jeffrey L.; Yanny, Brian

    2015-01-01

    We present a census of the 12,060 spectra of blue objects ((g – r){sub 0} < –0.25) in the Sloan Digital Sky Survey (SDSS) Data Release 8 (DR8). As part of the data release, all of the spectra were cross-correlated with 48 template spectra of stars, galaxies, and QSOs to determine the best match. We compared the blue spectra by eye to the templates assigned in SDSS DR8. 10,856 of the objects matched their assigned template, 170 could not be classified due to low signal-to-noise ratio, and 1034 were given new classifications. We identify 7458 DA white dwarfs, 1145 DB white dwarfs, 273 rarer white dwarfs (including carbon, DZ, DQ, and magnetic), 294 subdwarf O stars, 648 subdwarf B stars, 679 blue horizontal branch stars, 1026 blue stragglers, 13 cataclysmic variables, 129 white dwarf-M dwarf binaries, 36 objects with spectra similar to DO white dwarfs, 179, quasi-stellar objects (QSOs), and 10 galaxies. We provide two tables of these objects, sample spectra that match the templates, figures showing all of the spectra that were grouped by eye, and diagnostic plots that show the positions, colors, apparent magnitudes, proper motions, etc., for each classification. Future surveys will be able to use templates similar to stars in each of the classes we identify to automatically classify blue stars, including rare types.

  11. Census of Blue Stars in SDSS DR8

    NASA Astrophysics Data System (ADS)

    Scibelli, Samantha; Newberg, Heidi Jo; Carlin, Jeffrey L.; Yanny, Brian

    2014-12-01

    We present a census of the 12,060 spectra of blue objects ((g - r)0 < -0.25) in the Sloan Digital Sky Survey (SDSS) Data Release 8 (DR8). As part of the data release, all of the spectra were cross-correlated with 48 template spectra of stars, galaxies, and QSOs to determine the best match. We compared the blue spectra by eye to the templates assigned in SDSS DR8. 10,856 of the objects matched their assigned template, 170 could not be classified due to low signal-to-noise ratio, and 1034 were given new classifications. We identify 7458 DA white dwarfs, 1145 DB white dwarfs, 273 rarer white dwarfs (including carbon, DZ, DQ, and magnetic), 294 subdwarf O stars, 648 subdwarf B stars, 679 blue horizontal branch stars, 1026 blue stragglers, 13 cataclysmic variables, 129 white dwarf-M dwarf binaries, 36 objects with spectra similar to DO white dwarfs, 179, quasi-stellar objects (QSOs), and 10 galaxies. We provide two tables of these objects, sample spectra that match the templates, figures showing all of the spectra that were grouped by eye, and diagnostic plots that show the positions, colors, apparent magnitudes, proper motions, etc., for each classification. Future surveys will be able to use templates similar to stars in each of the classes we identify to automatically classify blue stars, including rare types.

  12. Human radiation studies: Remembering the early years. Oral history of Dr. Nadine Foreman, M.D., August 19, 1994

    SciTech Connect

    1995-07-01

    Dr. Nadine Foreman was interviewed by representatives of the US DOE Office of Human Radiation Experiments (OHRE). Dr. Foreman was selected for interview because of the position she held at the University of California, San Francisco. Following a brief biographical sketch, Dr. Foreman describes her work with Dr. Mayo Soley using I-131 in treatment of hyperthyroidism, selection criteria for patients in the radioiodine project, work with Dr. Earl Miller, work at Highland Hospital, radioiodine treatment of diffuse toxic goiter (myxedema), the radiophosphorus and radioiodine programs with Dr. Bert Low-Beer, and treatment of polycythemia vera.

  13. [Story of three SS dentists during World War II: Pr Hugo Blaschke, Dr Hermann Pook and Dr Willy Frank].

    PubMed

    Riaud, Xavier

    2006-12-01

    This story of three SS dentists shows very clearly that the medical code of ethics, under a totalitarian regime, ends where ideology begins. Professor Hugo Blaschke provided dental care to the most eminent Nazi leaders, but he also was the senior SS dentist. He was in charge of dental care in the Waffen-SS, and therefore, he had responsibility for the stocks of dental gold collected from the mouths of those who died in the concentration camps, in order to make dentures for his soldiers. Dr Hermann Pook was the dentist in charge of all the other dentists practising in the concentration camps. He was responsible for gathering statistics on the dental care provided for prisoners in the camps. His instructions were very clear: "No conservation or restorative treatment. Only extractions, and with no anaesthesia!" He was also in charge of gathering the gold that was collected in the camps, for the financial department of the SS. Dr Willy Frank, an Auschwitz dentist, took part in the selection of some of the convoys for the gas chambers. His participation in the collection of gold from the mouths of the dead was also established. These three men were sentenced to prison for War Crimes and Crimes against Humanity. PMID:17575817

  14. Egghead betegelt badkamer | Afscheidsrede dr. Peter van Emde Boas1 Egghead betegelt badkamer

    E-print Network

    Koolen, Marijn

    Egghead betegelt badkamer | Afscheidsrede dr. Peter van Emde Boas1 Egghead betegelt badkamer Rede Emde Boas DONDERDAG 25 MAART 2010 Faculteit der Natuurwetenschappen, Wiskunde en Informatica #12 van Amsterdam 25 maart 2010 Dr. Peter van Emde Boas ILLC, FNWI, Universiteit van Amsterdam, Bronstee

  15. MONITORING TIANJIN SUBSIDENCE WITH THE PERMANENT SCATTERERS Dr. Daniele Perissin(1)

    E-print Network

    Perissin, Daniele

    MONITORING TIANJIN SUBSIDENCE WITH THE PERMANENT SCATTERERS TECHNIQUE Dr. Daniele Perissin(1) , Dr 34/5, 20133 Milano, Italy 1. ABSTRACT Many urban areas in China are affected by land subsidence the area around Tianjin city in the Popular Republic of China, where a subsidence at the present time

  16. Dr. Moon Chen: The Insights of a Cancer Scientist Addressing Asian American Cancer Disparities

    Cancer.gov

    Throughout most of his career, Dr. Moon S. Chen, Jr. has sought to address Asian American cancer health disparities through research, outreach, and training. He has also helped NCI reach out to the Asian American community to educate this community about cancer. As part of the “Meet the Researchers” series, Dr. Chen shares his insights with Lifelines.

  17. Presentation to Dr. Anne Davies, 1/26/99 OVERVIEW OF ADVANCED FUSION SCIENCE AND

    E-print Network

    California at Los Angeles, University of

    · Fusion Rocket Propulsion · Structural Material Research #12;Presentation to Dr. Anne Davies, 1: Space Propulsion, Waste Transmutation Basic Science Research in the physical and engineering sciences scientists MTF Propelled Rocket MeSO-Jet Research Staff and Students #12;Presentation to Dr. Anne Davies, 1

  18. Vegetable&SMALL FRUIT PRODUCTION HANDBOOK of FLORIDA DR. JOSHUA H. FREEMAN

    E-print Network

    Ma, Lena

    of Horticulture, North Florida REC, IFAS, University of Florida DR. PETER J. DITTMAR Assistant Professor practices, and pest management. The information is a result of a cooperative effort among vegetable crop, University of Florida North Florida REC, IFAS, University of Florida Dr. Peter J. Dittmar Assistant Professor

  19. Summer Undergraduate Research Program Dr. Barry Stoddard: Research Ethics and Issues

    E-print Network

    Brent, Roger

    perception (Harvard) 8. Eric Poehlman and studies of post-menopausal physiology (Vermont) (two articles) 9;#12;#12;#12;#12;#12;#12;Summer Undergraduate Research Program Dr. Barry Stoddard: Research Ethics and Issues 8) Eric Poehlman #1 and Issues 8) Eric Poehlman #2 #12;#12;#12;#12;#12;Summer Undergraduate Research Program Dr. Barry Stoddard

  20. "Throw Follow-up: Part I: Cling" ILLUSTRATED PRINCIPLES David Alciatore, PhD ("Dr. Dave")

    E-print Network

    Alciatore, David G.

    "Throw Follow-up: Part I: Cling" ILLUSTRATED PRINCIPLES David Alciatore, PhD ("Dr. Dave at: dr-dave-billiards.com. This is the first article in a series dealing with throw, which is the change in object ball (OB) direction due to sideways forces between the cue ball (CB) and OB during

  1. Prof. Dr. Gran Andersson, Director of Studies 03/10/14MEST 1

    E-print Network

    Daraio, Chiara

    /10/14MEST 9 Energy Research at ETH Zurich Research Areas Renewable energies and hydropower Prof. Abhari Prof|| Prof. Dr. Göran Andersson, Director of Studies 03/10/14MEST 1 Master in Energy Science in the MEST? § Head of studies: Prof. Göran Andersson § Energy Science Center (ESC): Content Dr. Christian

  2. Local Urban Environments and the Wellbeing of Older Dr. Rosemary Day

    E-print Network

    Birmingham, University of

    Local Urban Environments and the Wellbeing of Older People Dr. Rosemary Day February 2008 #12;This research was funded by the Scottish Centre for Research on Social Justice, Department of Urban Studies: Department of Urban Studies Dr Rosie Day University of Glasgow School of Geography, Earth & Environmental 29

  3. Class Notes from Dr John Barclay’s lectures on Comparative Anatomy 

    E-print Network

    Macdonald, Alastair A.; Warwick, Colin M

    2013-01-01

    Class Notes from Dr John Barclay’s lectures on Comparative Anatomy set down between 8th May 1821 and 31st July 1821 at 10 Surgeons Square, Edinburgh by Dr Robert Edmund Grant (UCL MS ADD 28). Transcribed by Alastair A. Macdonald and Colin M. Warwick...

  4. E4.18 Radio Frequency Electronics Copyright 2006 Dr Stepan Lucyszyn Frequency Spectrum

    E-print Network

    Papavassiliou, Christos

    Applications Phased-array radar Electronic warfare (e.g. Electronic Surveillance Measures, ECM, ECCM, decoysE4.18 Radio Frequency Electronics Copyright © 2006 Dr Stepan Lucyszyn Frequency Spectrum and Applications #12;E4.18 Radio Frequency Electronics Copyright © 2006 Dr Stepan Lucyszyn #12;E4.18 Radio

  5. "Does the Brand of Chalk Really Matter?" ILLUSTRATED PRINCIPLES David Alciatore, PhD ("Dr. Dave")

    E-print Network

    Alciatore, David G.

    "Does the Brand of Chalk Really Matter?" ILLUSTRATED PRINCIPLES David Alciatore, PhD ("Dr. Dave at: dr-dave-billiards.com. Have you ever heard claims about chalk like the following: "Pre-flag Master chalk is much better than Flag Master chalk." or "Blue Diamond and Kamui chalk let you put a lot

  6. CSC 1300 Discrete Structures Chapter 12: Graph Traversals Dr Papalaskari 1

    E-print Network

    Papalaskari, Mary-Angela

    D Leonhard Euler (1707-1783) rephrased the quesWon in terms of the mul9graph Villanova CSC 1300 - Dr Papalaskari 1 Major Themes Graph traversals: · Euler - Dr Papalaskari 3 Euler's SoluWon to The Bridges of Königsberg A C B

  7. Dr. Se-Yeun Lee joins the CIG team The Climate Impacts Group is

    E-print Network

    Brown, Sally

    Dr. Se-Yeun Lee joins the CIG team The Climate Impacts Group is pleased to welcome Dr. Se-Yeun Lee to her new position as CIG Research Scientist specializing in hydrology. Se-Yeun has a long history with the Skagit Climate Science Consortium. Se-Yeun has also collaborated extensively with Josh Lawler, Alan

  8. Vikrant Sahasrabuddhe, MBBS, MPH, DrPH | Division of Cancer Prevention

    Cancer.gov

    Dr. Vikrant Sahasrabuddhe received his medical degree from the University of Pune in India, his master's and doctorate degrees in public health from the University of Alabama at Birmingham, and completed fellowship training in epidemiology at the Johns Hopkins University Bloomberg School of Public Health and at the National Cancer Institute. Before joining NCI in 2015, Dr.

  9. Nested Velocity Feedback Control -1 Presented at CS 2007 Dr Richard Mitchell 2007

    E-print Network

    Mitchell, Richard

    Nested Velocity Feedback Control - 1 Presented at CS 2007 © Dr Richard Mitchell 2007 Nested tolerant to changes in the plant under control #12;Nested Velocity Feedback Control - 2 Presented at CS path #12;Nested Velocity Feedback Control - 3 Presented at CS 2007 © Dr Richard Mitchell 2007 Cherry

  10. Dr. Christian Werge, Steffen Hintze WS 2014/2015 Grundwissen Schulmathematik

    E-print Network

    Leipzig, Universität

    Dr. Christian Werge, Steffen Hintze WS 2014/2015 Grundwissen Schulmathematik �bungsaufgaben Serie 4 wenden Universität Leipzig Fakultät für Mathematik und Informatik Seite 1 von 2 #12;Dr. Christian Werge

  11. 78 FR 7438 - Prospective Grant of Exclusive License: Development of Human Monoclonal Antibodies Against DR4

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-01

    ... Human Monoclonal Antibodies Against DR4 AGENCY: National Institutes of Health, Public Health Service... Monoclonal Antibodies Against DR4'' (HHS Ref. No. E-158-2010/0) to Customized Biosciences, Inc., which is... relates to the development of two human monoclonal antibodies (mAbs) that bind to death receptor 4...

  12. SE3SS13 Frequency Response Part B Dr Richard Mitchell, 2013 1

    E-print Network

    Mitchell, Richard

    SE3SS13 ­ Frequency Response ­ Part B © Dr Richard Mitchell, 2013 1 6 : Frequency Response Part B .. Starting at low frequency, deduce each CF ... This is System Identification p1 RJM 21/10/13 SE3SS13 ­ Frequency Response ­ Part B © Dr Richard Mitchell 2013 System Identification p2 RJM 21/10/13 SE3SS13

  13. Session H -BIOCHEMISTRY AND MICROBIOLOGY (239) Chair: Dr. David Moffett, Loyola Marymount University

    E-print Network

    Dahlquist, Kam D.

    14 Session H - BIOCHEMISTRY AND MICROBIOLOGY (239) Chair: Dr. David Moffett, Loyola Marymount & Biochemistry, UCB 215, Boulder, CO 80309-0215. S41 (2:15pm) QUANTUM CHEMICAL QUANTIFICATION OF WEAKLY POLAR. of Biochemistry and Molecular Biology, West Peltason Dr., Irvine, CA 92697. S43 (2:45pm) MEASURING INTERNAL MN

  14. TITLE: Religion and Sustainability: Perspectives from India in a Conversation with Dr. M. H. Mehta

    E-print Network

    Walter, M.Todd

    TITLE: Religion and Sustainability: Perspectives from India in a Conversation with Dr. M. H. Mehta regarding religion and sustainability. Dr. Mehta is a noted scholar in agriculture, and his vast experience a concrete perspective on how religion can interact, both positively and negatively, in projects affecting

  15. Grantee Spotlight: Dr. Meena Jaggi - Investigating Curcumin (Turmeric) as HPV Repressor for Native American Women

    Cancer.gov

    Often cancer health disparities are the result of complex factors, including environmental, nutrition, lifestyle, etc. According to Dr. Jaggi, there is a relationship between smoking (which is very high in the region) and cervical cancer. “Native American women in Northern Plains smoke four times more compared to Caucasian women. Some research suggests that smoking can influence HPV infection,” said Dr. Jaggi.

  16. Dr. Bernard Langer — inductee into the Canadian Medical Hall of Fame

    PubMed Central

    Greig, Paul D.; Rotstein, Ori D.

    2015-01-01

    Summary Dr. Bernard Langer’s induction into the Canadian Medical Hall of Fame acknowledges his profound effect on medicine and surgery in Canada and an impact that has been truly international. In this brief biography, we highlight the major accomplishments that have made Dr. Langer a pre-eminent leader, innovator, teacher and exemplary surgeon. PMID:25799243

  17. Datenstrukturen und Algorithmen Prof. Dr. Leif Kobbelt, Thomas Strder, Fabian Emmes, Sven Middelberg, Michael Kremer

    E-print Network

    Kobbelt, Leif

    Datenstrukturen und Algorithmen Prof. Dr. Leif Kobbelt, Thomas Ströder, Fabian Emmes, Sven Wrapping 2.7.2.2 Graham's Scan 2.7.2.3 Divide & Conquer 2.7.2.4 Optimaler Algorithmus 2.7.3 Nachbarschaften 2.7.4 Schnittprobleme 1 #12;Datenstrukturen und Algorithmen Prof. Dr. Leif Kobbelt, Thomas Ströder

  18. Fachbereich: GNSS/Satellite Geodesy Leiter/in: Dr. N. Houli

    E-print Network

    Giger, Christine

    Fachbereich: GNSS/Satellite Geodesy Leiter/in: Dr. N. Houlié Betreuer/in: Dr. N. Houlié Titel: Real-term ionosphere disturbance related to external causes such as earthquake activity or solar flares interaction the earthquake occurrence from space [Ducic et al., 2003]. It is considered that ionosphere can be studied

  19. Presented by Helen S.Presented by Helen S. DuDu, Supervised by Dr., Supervised by Dr. Xiaohua JiaXiaohua Jia Computer Science DepartmentComputer Science Department

    E-print Network

    Po, Lai-Man

    Presented by Helen S.Presented by Helen S. DuDu, Supervised by Dr., Supervised by Dr. Xiaohua JiaXiaohua Jia Computer Science DepartmentComputer Science Department An Integrated Framework for Heterogeneous

  20. [Dr Guillermo Contreras Da Silva, a relevant figure in the development of Chilean microbiology].

    PubMed

    Cabello, Felipe C

    2008-02-01

    The influence of the work of Dr. Guillermo Contreras Da Silva and his colaborators on the evolution of microbiology in Chile is briefly analyzed. Dr. Contreras was trained in modern virology at Yale University with Dr. J. Melnick under the sponsorhip of the Rockefeller Foundation. During this training, he used serological methods to classify Cocksakie viruses. After his return to Chile, he studied the epidemiology of enteroviruses, including poliovirus. His laboratory, the country's first in modern virology, took an active role in Chile's first Sabin polio vaccination in 1961. Dr. Contreras and his group transformed the teaching and the character of microbiology in Chile from a descriptive medically oriented discipline into an autonomous, quantitative and experimental science. They modernized microbiology with the introduction of molecular biology and microbial genetics and fostered collaborations with allied biological sciences. Dr. Contreras was a Guggenheim Fellow, and until his retirement, was the Chief of the Viral Products Division, Bureau of Biologies, Ottawa, Canada. PMID:18483682

  1. Searching for Classical Be Stars from the LAMOST DR1

    E-print Network

    Lin, C C; Chen, L; Shao, Z Y; Zhong, J; Yu, P C

    2015-01-01

    We report on searching for Classical B-type emission-line (CBe) stars from the first data release (DR1) of the Large Sky Area Multi-Object fiber Spectroscopic Telescope (LAMOST; also named the Guoshoujing Telescope). A total of 192 (12 known CBes) objects were identified as CBe candidates with prominent He~I~$\\lambda4387$, He~I~$\\lambda4471$, and Mg~II~$\\lambda4481$ absorption lines, as well as H$\\beta$~$\\lambda4861$ and H$\\alpha$~$\\lambda6563$ emission lines. These candidates significantly increases current CBe sample of about 8\\%. Most of the CBe candidates are distributed at the Galactic Anti-Center due to the LAMOST observing strategy. Only two of CBes are in the star clusters with ages of 15.8 and 398~Myr, respectively.

  2. In Memoriam: Prof. Dr Dragutin Djurovic (1937-2013)

    NASA Astrophysics Data System (ADS)

    2013-12-01

    Prof. dr Dragutin Djurovic was born in Guca, Serbia, on December 20, 1937. He completed his primary and secondary education in Guca and Cacak. In the period 1956-1958, he studied at the General Military Academy in Belgrade. He enrolled at the Faculty of Sciences and Mathematics - Astronomy Group in 1958 and graduated in 1963. After graduation he went to study visits to Paris (1966) and Bruxelles (1972 and 1975). He obtained his MSc degree in 1970 from the University of Belgrade with a thesis entitled "Application of different types of telescopes for astronomical determination of time". His supervisor for the master thesis was Prof. Zaharije Brkic. Dragutin Djurovic defended his PhD thesis "Contribution to determination of Earth-rotation variations and polar motion" at the University of Belgrade in 1974. Most of the thesis-related research was done in Bruxelles during 1972 under the supervision of Prof. Paul Melchior.

  3. A 10,000 YEAR OLD EXPLOSION IN DR21

    SciTech Connect

    Zapata, Luis A.; Perez-Goytia, Nadia; Rodriguez, Luis F.; Loinard, Laurent; Schmid-Burgk, Johannes; Ho, Paul T. P.; Cruz-Gonzalez, Irene

    2013-03-10

    Sensitive high angular resolution ({approx}2'') CO(2-1) line observations made with the Submillimeter Array of the flow emanating from the high-mass star-forming region DR21 located in the Cygnus X molecular cloud are presented. These new interferometric observations indicate that this well known enigmatic outflow appears to have been produced by an explosive event that took place about 10,000 years ago, and that might be related to the disintegration of a massive stellar system such as the one that occurred in Orion Becklin-Neugebauer/Kleinman-Low 500 years ago, but about 20 times more energetic. This result therefore argues in favor of the idea that the disintegration of young stellar systems perhaps is a frequent phenomenon present during the formation of massive stars. However, many more theoretical and observational studies are still needed to confirm our hypothesis.

  4. Dr. Richard Grugel examines an ampoule of a succinonitrile mixture

    NASA Technical Reports Server (NTRS)

    2003-01-01

    On Earth when scientists melt metals, bubbles that form in the molten material can rise to the surface, pop and disappear. In microgravity -- the near-weightless environment created as the International Space Station orbits Earth -- the lighter bubbles do not rise and disappear. Prior space experiments have shown that bubbles often become trapped in the final metal or crystal sample -similar to the bubbles trapped in this sample. In the solid, these bubbles, or porosity, are defects that diminish both the material's strength and usefulness. The Pore Formation and Mobility Investigation will melt samples of a transparent modeling material, succinonitrile and succinonitrile water mixtures, shown here in an ampoule being examined by Dr. Richard Grugel, the principal investigator for the experiment at NASA's Marshall Space Flight Center in Huntsville, Ala. As the samples are processed in space, Grugel will be able to observe how bubbles form in the samples and study their movements and interactions.

  5. GPS/DR Error Estimation for Autonomous Vehicle Localization

    PubMed Central

    Lee, Byung-Hyun; Song, Jong-Hwa; Im, Jun-Hyuck; Im, Sung-Hyuck; Heo, Moon-Beom; Jee, Gyu-In

    2015-01-01

    Autonomous vehicles require highly reliable navigation capabilities. For example, a lane-following method cannot be applied in an intersection without lanes, and since typical lane detection is performed using a straight-line model, errors can occur when the lateral distance is estimated in curved sections due to a model mismatch. Therefore, this paper proposes a localization method that uses GPS/DR error estimation based on a lane detection method with curved lane models, stop line detection, and curve matching in order to improve the performance during waypoint following procedures. The advantage of using the proposed method is that position information can be provided for autonomous driving through intersections, in sections with sharp curves, and in curved sections following a straight section. The proposed method was applied in autonomous vehicles at an experimental site to evaluate its performance, and the results indicate that the positioning achieved accuracy at the sub-meter level. PMID:26307997

  6. GPS/DR Error Estimation for Autonomous Vehicle Localization.

    PubMed

    Lee, Byung-Hyun; Song, Jong-Hwa; Im, Jun-Hyuck; Im, Sung-Hyuck; Heo, Moon-Beom; Jee, Gyu-In

    2015-01-01

    Autonomous vehicles require highly reliable navigation capabilities. For example, a lane-following method cannot be applied in an intersection without lanes, and since typical lane detection is performed using a straight-line model, errors can occur when the lateral distance is estimated in curved sections due to a model mismatch. Therefore, this paper proposes a localization method that uses GPS/DR error estimation based on a lane detection method with curved lane models, stop line detection, and curve matching in order to improve the performance during waypoint following procedures. The advantage of using the proposed method is that position information can be provided for autonomous driving through intersections, in sections with sharp curves, and in curved sections following a straight section. The proposed method was applied in autonomous vehicles at an experimental site to evaluate its performance, and the results indicate that the positioning achieved accuracy at the sub-meter level. PMID:26307997

  7. Dr. von Braun Standing by Five F-1 Engines

    NASA Technical Reports Server (NTRS)

    2004-01-01

    A pioneer of America's space program, Dr. von Braun stands by the five F-1 engines of the Saturn V launch vehicle. This Saturn V vehicle is an actual test vehicle which has been displayed at the U.S. Space Rocket Center in Huntsville, Alabama. Designed and developed by Rocketdyne under the direction of the Marshall Space Flight Center, a cluster of five F-1 engines was mounted on the Saturn V S-IC (first) stage. The engines measured 19-feet tall by 12.5-feet at the nozzle exit and burned 15 tons of liquid oxygen and kerosene each second to produce 7,500,000 pounds of thrust. The S-IC stage is the first stage, or booster, of a 364-foot long rocket that ultimately took astronauts to the Moon.

  8. Chemical Cartography with SDSS-III APOGEE: DR12 Results

    NASA Astrophysics Data System (ADS)

    Hayden, Michael R.; Holtzman, Jon A.; Bovy, Jo; Majewski, Steven R.; Nidever, David L.; Zasowski, Gail; Schiavon, Ricardo P.; Frinchaboy, Peter M.; Hearty, Fred; Allende-Prieto, Carlos; García Pérez, Ana; Robin, Annie; Cunha, Katia M. L.; Beers, Timothy C.; Apogee Team

    2015-01-01

    The SDSS-III Apache Point Observatory Galactic Evolution Experiment (APOGEE) spectrograph provides an unprecedented view of the Milky Way disk, due in part to its ability to observe in the infrared, where the effects of extinction are significantly reduced compared to optical surveys. We present updated results on mean metallicity and chemical abundance gradients using the full three years of APOGEE1 observations and new results of the metallicity distribution function (MDF) and the [?/Fe] vs. [Fe/H] plane at different locations in the Milky Way disk. Our sample comprises nearly high signal-to-noise observations of nearly 100,000 red giant stars taken from SDSS DR12. These observations span the entire Milky Way visible from the northern hemisphere, ranging from the bulge to the edge of the disk (0

  9. The 3D Clustering of BOSS DR9 Galaxies

    NASA Astrophysics Data System (ADS)

    Ross, Ashley Jacob; Percival, W. J.; Berlind, A. A.; Blanton, M.; Bolton, A.; Brinkmann, J.; da Costa, L. A.; Crittenden, R.; Cuesta, A. J.; Eisenstein, D.; Guo, H.; Hamilton, J.; Hernandez-Monteagudo, C.; Ho, S.; Kazin, E.; McBride, C.; Maia, M. A.; Mandelbaum, R.; Manera, M.; Maraston, C.; Masters, K. L.; Montesano, F.; Myers, A. D.; Nichol, R. C.; Padmanbhan, N.; Parejko, J.; Prada, F.; Ramos, B.; Ross, N. P.; Zehavi, I.; Samushia, L.; Sanchez, A.; Schlafly, E. F.; Schlegel, D. J.; Schneider, D. P.; Seo, H.; de Simoni, F.; Skibba, R.; Swanson, M.; Thomas, D.; Tinker, J.; Tojeiro, R.; Vargas, M.; Wake, D.; Weaver, B. A.; White, M.; Dawson, K.

    2012-01-01

    The Baryon Oscillation Spectroscopic Survey provides the largest 3D map of the Universe ever obtained. We present results from the DR9 data set, which includes 360,000 galaxies distributed over 3200 square degrees. At large physical scales, these data allow measurements of unprecedented precision in the 3D redshift-space correlation function and the spherically-averaged power-spectrum. In order to utilize this map to measure galaxy clustering, we need to fully understand potential sources of systematic fluctuations in galaxy density, caused by observational effects rather than cosmological fluctuations. I will present a careful analysis of these fluctuations, showing how we can robustly recover the cosmological clustering signal. The measurements and their cosmological interpretation will be presented.

  10. Dr. Cheryl Nickerson studies Salmonella in simulated low-g

    NASA Technical Reports Server (NTRS)

    2003-01-01

    Dr. Cheryl Nickerson of Tulane University is studying the effects of simulated low-g on a well-known pathogen, Salmonella typhimurium, a bacterium that causes two to four million cases of gastrointestinal illness in the United States each year. While most healthy people recover readily, S. typhimurium can kill people with weakened immune systems. Thus, a simple case of food poisoning could disrupt a space mission. Using the NASA rotating-wall bioreactor, Nickerson cultured S. typhimurium in modeled microgravity. Mice infected with the bacterium died an average of three days faster than the control mice, indicating that S. typhimurium's virulence was enhanced by the bioreactor. Earlier research showed that 3 percent of the genes were altered by exposure to the bioreactor. Nickerson's work earned her a 2001 Presidential Early Career Award for Scientists and Engineers.

  11. Dr. Cheryl Nickerson studying Salmonella at Tulane University

    NASA Technical Reports Server (NTRS)

    2003-01-01

    Dr. Cheryl Nickerson (right) of Tulane University is studying the effects of simulated low-g on a well-known pathogen, Salmonella typhimurium, a bacterium that causes two to four million cases of gastrointestinal illness in the United States each year. While most healthy people recover readily, S. typhimurium can kill people with weakened immune systems. Thus, a simple case of food poisoning could disrupt a space mission. Using the NASA rotating-wall bioreactor, Nickerson cultured S. typhimurium in modeled microgravity. Mice infected with the bacterium died an average of three days faster than the control mice, indicating that S. typhimurium's virulence was enhanced by the bioreactor. Earlier research showed that 3 percent of the genes were altered by exposure to the bioreactor. Nickerson's work earned her a 2001 Presidential Early Career Award for Scientists and Engineers.

  12. The Chymistry of "The Learned Dr Plot" (1640-96).

    PubMed

    Roos, Anna Marie

    2014-01-01

    In the seventeenth century, there were developing norms of openness in the presentation of scientific knowledge that were at odds with traditions of secrecy among chymists, particularly practitioners of chrysopoeia, or the transmutation of metals. This chapter analyzes how Dr. Robert Plot, the first professor of chymistry at Oxford, negotiated these boundaries within an institutional context. I first delineate his chymical and experimental practice, which incorporated procedures from medieval alchemical sources, particularly the Lullian corpus, as well as more novel practices from seventeenth-century chymistry. Then, I analyze how personal and institutional ambitions and economic considerations shaped to what extent Plot negotiated the boundaries between secrecy and the public dissemination of chymical knowledge. PMID:26103749

  13. March 2015 Newsletter for alumni, faculty, staff, students and friends of the college Dr. Charles "Charlie" Tichy

    E-print Network

    Rhoads, James

    March 2015 Newsletter for alumni, faculty, staff, students and friends of the college Dr. Charles "Charlie" Tichy BA German, 1963 MA German, 1967 Dr. Charles Tichy, a 1963 and 1967 alumnus with a BA and MA

  14. The M giant candidates identified in the LAMOST DR1

    NASA Astrophysics Data System (ADS)

    Zhong, Jing

    2015-08-01

    M giants are red-giant-branch (RGB) stars with low surface temperature and high luminosity in the late-phase of stellar evolution. Its luminous nature allows us to use these stars as good tracers to study the outer Galactic halo and distant substructures. A well classified M-giant stars sample has important scientific values for the statistic research. In order to fully utilize the spectral data of LAMOST spectroscopic survey, we perform a discrimination procedure with the spectral index diagram of TiO5 and CaH2+CaH3 to separate M giants from M dwarfs. Using the M giant spectra identified from the LAMOST DR1 with high signal-to-noise ratio, we have successfully assembled a set of M giant templates from M0 to M6. Then, the template-fit algorithm were used to automatically identify and classify M giants from the LAMOST DR1. In addition, we calculated the heliocentric radial velocity of all M giants by using the cross-correlation method with the template spectrum in a zero-velocity rest frame. Using the relationship between the absolute infrared magnitude MJ and our classified spectroscopic subtype, we derived the spectroscopic distance of M giants, with uncertainties of about 40%. Finally, we present a spectroscopic catalog of 8639 M giants including stellar parameters like photometry, proper motion, radial velocity, distance, spectral type and so on. In particular, the large sample of M giants is carried out for the first time. We will further use this sample to study the sub-structures and tidal stream in the Galactic Anti-Center.

  15. Skeletal remains of Dr. Eugenio Antonio Berríos Sagredo.

    PubMed

    Solla, H E; I?can, M Y

    2001-02-15

    It is often noted that even a well-designed osteological technique may not provide accurate results when applied to single forensic cases. Case studies are ideal to test if this concern is valid, and forensic anthropology is a testing ground for applying a population based standard to individual skeletal remains. Secondly, the increasing role anthropologists have played in forensic sciences has aided the medicolegal disciplines in a number of ways. For example, identification of skeletal remains is now more accurate than ever before. Many of these cases have brought perpetrators to court for justice. The purpose of this paper is to use osteological techniques to analyze skeletal remains and make a positive identification. The victim was found partially buried in the sand near El Pinar, Uruguay in 1995. The analysis indicated that the victim was a 45-year old, white, male who was about 170cm tall. Based on preliminary evidence that the victim might be Dr. Eugenio Antonio Berríos Sagredo, a digital superimposition was made using the victim's photograph and the unknown skull. This examination revealed that the skull corresponded consistently with the individual in the photograph. Results were supported by the fact that personal belongings, such as a medal and wrist watch, also pointed to the same individual. Dental records and radiographs when made available later also indicated the same identity. Dr. Berríos was accused of making nerve gas during the dictatorial regime of former Chilean President General Augusto Pinochet. It was also alleged that he made bombs that killed a Spanish diplomat in his laboratory and a Chilean diplomat in Washington, DC. Many complex techniques are often needed to make a positive identification and such was the case for this study. Because of the nature of anthropology as a holistic discipline, such complexity is an integral part of human biology and behavior and can be used successfully in the forensic sciences and medicolegal investigations. PMID:11182273

  16. List of participants at Strobl 1:Dr. P. Bastian Universit"at Stuttgart, Inst. f. Computeranwendungen ICA, *

    E-print Network

    @informatik.uni-kiel.de 21:Dr. B. Heise Johannes Kepler Universit"at, Institut f"ur Mathematik, Al* *tenbergerstr. 69, dr.michael.jung@mathemathik.tu-chemnitz.de 25:F. Kickinger Johannes Kepler Universit"at Linz* *gelerstr.6, D-5315Bonn, BRD, griebel@iam.uni-bonn.de 19:Dr. G. Haase Johannes

  17. ETH ZurichEngineering Geodesy -Prof. Dr. H. Ingensand Overview of Current Indoor PositioningOverview of Current Indoor Positioning

    E-print Network

    Overview of Current Indoor Positioning SystemsSystems Dr. Rainer Mautz ETH Zürich Institute of GeodesyETH ZurichEngineering Geodesy - Prof. Dr. H. Ingensand Overview of Current Indoor PositioningEngineering Geodesy - Prof. Dr. H. Ingensand Positioning RequirementsPositioning Requirements Overview of Systems GNSS

  18. UCLA Appoints Dr. Gary W. Mathern to the Endowed Chair for Epilepsy Research, Honoring A Legacy of Pioneering Neurosurgery

    E-print Network

    Tavassoli, Abtine

    UCLA Appoints Dr. Gary W. Mathern to the Endowed Chair for Epilepsy Research, Honoring A Legacy Endowed Chair in Honor of Paul Crandall, M.D. for Epilepsy Research. Dr. Mathern was selected for his research in pediatric epilepsy that reflects the early work of Dr. Crandall, who founded the epilepsy

  19. Pioneers of Study on Desorption Induced by Electronic Transitions; Achievements by Dr. Yoshioki Ishikawa and Dr. Yoshio Ohta

    NASA Astrophysics Data System (ADS)

    Mase, Kazuhiko; Nambu, Akira

    Dr. Yoshioki Ishikawa is a pioneer who carried out systematic electron stimulated desorption (ESD) investigations for hydrogen adsorbed on a clean platinum plate (H2/Pt) under ultrahigh vacuum (UHV) conditions in 1942. (His name is spelled as Yosioki Isikawa in the original papers.) Although his papers are referred in several papers on desorption induced by electronic transitions (DIET), these seem to be not as well-known as famous ones by Menzel, Gomer, and Redhead in 1964. We describe his pioneering work in this article. He developed an UHV apparatus made of glass with a Pt plate and an oxide cathode pumped by a small mercury pump via a liquid air trap. Clear ESD signals were observed for H2/Pt at excitation energies of 8, 12, 14, 33-46, and 46-51 eV. He assigned the desorbate to atomic hydrogen (H), because it was pumped by a glass wall baked above 350°C. Based on these results and the potential curves of H2 in the gas phase, he proposed a model for the ESD of H from H2/Pt that is, the first step is an electronic transition of adsorbed H2, and the second is the desorption of H along the repulsive potential surface of the excited state. This was the first introduction of the notion of DIET. He also carried out an ESD study of H2O/Pt in 1943. We also introduce achievements by Dr. Yoshio Ohta, who was another pioneer in the field of DIET. He measured electron-stimulated ion desorption from an oxidized Ni plate. He found that the threshold excitation energy for ion desorption is 22 eV, and that the kinetic energy of the desorbed ion is 1˜2 eV. To explain these results, he also proposed the concept of DIET.

  20. Specificity and promiscuity among naturally processed peptides bound to HLA-DR alleles

    PubMed Central

    1993-01-01

    Naturally processed peptides were acid extracted from immunoaffinity- purified HLA-DR2, DR3, DR4, DR7, and DR8. Using the complementary techniques of mass spectrometry and Edman microsequencing, > 200 unique peptide masses were identified from each allele, ranging from 1,200 to 4,000 daltons (10-34 residues in length), and a total of 201 peptide sequences were obtained. These peptides were derived from 66 different source proteins and represented sets nested at both the amino- and carboxy-terminal ends with an average length of 15-18 amino acids. Strikingly, most of the peptides (> 85%) were derived from endogenous proteins that intersect the endocytic/class II pathway, even though class II molecules are thought to function mainly in the presentation of exogenous foreign peptide antigens. The predominant endogenous peptides were derived from major histocompatibility complex-related molecules. A few peptides derived from exogenous bovine serum proteins were also bound to every allele. Four prominent promiscuous self- peptide sets (capable of binding to multiple HLA-DR alleles) as well as 84 allele-specific peptide sets were identified. Binding experiments confirmed that the promiscuous peptides have high affinity for the binding groove of all HLA-DR alleles examined. A potential physiologic role for these endogenous self-peptides as immunomodulators of the cellular immune response is discussed. PMID:8315383

  1. Star Formation in the DR21 Region (A)

    NASA Technical Reports Server (NTRS)

    2004-01-01

    [figure removed for brevity, see original site] Annotated mosaic

    Hidden behind a shroud of dust in the constellation Cygnus is a stellar nursery called DR21, which is giving birth to some of the most massive stars in our galaxy. Visible light images reveal no trace of this interstellar cauldron because of heavy dust obscuration. In fact, visible light is attenuated in DR21 by a factor of more than 10,000,000,000,000,000,000,000,000,000,000,000,000,000 (ten thousand trillion heptillion).

    New images from NASA's Spitzer Space Telescope allow us to peek behind the cosmic veil and pinpoint one of the most massive natal stars yet seen in our Milky Way galaxy. The never-before-seen star is 100,000 times as bright as the Sun. Also revealed for the first time is a powerful outflow of hot gas emanating from this star and bursting through a giant molecular cloud.

    The colorful image (top panel) is a large-scale composite mosaic assembled from data collected at a variety of different wavelengths. Views at visible wavelengths appear blue, near-infrared light is depicted as green, and mid-infrared data from the InfraRed Array Camera (IRAC) aboard NASA's Spitzer Space Telescope is portrayed as red. The result is a contrast between structures seen in visible light (blue) and those observed in the infrared (yellow and red). A quick glance shows that most of the action in this image is revealed to the unique eyes of Spitzer. The image covers an area about two times that of a full moon.

    Each of the constituent images is shown below the large mosaic. The Digital Sky Survey (DSS) image (lower left) provides a familiar view of deep space, with stars scattered around a dark field. The reddish hue is from gas heated by foreground stars in this region. This fluorescence fades away in the near-infrared Two-Micron All-Sky Survey (2MASS) image (lower center), but other features start to appear through the obscuring clouds of dust, now increasingly transparent. Many more stars are discerned in this image because near-infrared light pierces through some of the obscuration of the interstellar dust. Note that some stars seen as very bright in the visible image are muted in the near-infrared image, whereas other stars become more prominent. Embedded nebulae revealed in the Spitzer image are only hinted at in this picture.

    The Spitzer image (lower right) provides a vivid contrast to the other component images, revealing star-forming complexes and large-scale structures otherwise hidden from view. The Spitzer image is composed of photographs obtained at four wavelengths: 3.6 microns (blue), 4.5 microns (green), 5.8 microns (orange) and 8 microns (red). The brightest infrared cloud near the top center corresponds to DR21, which presumably contains a cluster of newly forming stars at a distance of nearly 10,000 light-years.

    The red filaments stretching across the Spitzer image denote the presence of polycyclic aromatic hydrocarbons. These organic molecules, comprised of carbon and hydrogen, are excited by surrounding interstellar radiation and become luminescent at wavelengths near 8 microns. The complex pattern of filaments is caused by an intricate combination of radiation pressure, gravity, and magnetic fields. The result is a tapestry in which winds, outflows, and turbulence move and shape the interstellar medium.

  2. Dr. Ray Gause examines student Skylab experiment ED-52 Web Formation

    NASA Technical Reports Server (NTRS)

    1973-01-01

    Dr. Ray Gause of the NASA-Marshall Space Flight Center (MSFC) places dinner, in the form of a housefly, in the web of Arabella - the prime spider for the ED-52 Web Formation Experiment. Arabella can be delineated near the end of the black pen in Dr. Gause's hand. The experiment is one of 25 student experiments accepted for the Skylab program and will be performed during the Skylab 3 mission. Judy Miles, a 17-year-old high school student from Lexington, Massachusetts, is the student experimenter and Dr. Gause is the NASA student advisor.

  3. [WHO AFFECTS THE PATIENT, DR. GOOGLE OR THE DOCTOR?].

    PubMed

    Mishali, Moshe; Avrech, Tova

    2015-09-01

    In the last decade the World Wide Web has become one of the prime sources for medical data searches. The abundance of information and emphasis on consumer communication, which are the main characteristics of the new generation of the web named "Web 2.0", enable users to engage and educate others by sharing and collaborating knowledge. It also enables them to receive medical information based on the experience of other patients, while the duration of the traditional physician's visit has shortened. However, using Web 2.0 for health collaboration has drawbacks as well: When alternative ways of "knowing" replace objective medical facts, there is danger of misinformation and truth "flattening". This article examines the distribution of medical misinformation online: Its characteristics, the nature of the messages presented online and the means that might help protect users and patients from it. The authors hold positions in the Israeli Dairy Board (IDB): Dr. Averch manages the health field on the IDB, and the findings in this article are based on research that she is leading as part of this position, and Dr. Mishali is a trained psychologist, and acts as a strategic consultant for IDB in the field of coping with the opposition to milk and its products. In this article it is initially shown how the characteristics of information distribution in general help spreading medical misinformation online: The decline of doctors' authority as sole providers of medical information, disillusionment and suspicion towards science and the notion of expertise, and the emergence of new ways to evaluate information, based on community ties. The nature of this pseudo-medical information will then be discussed, including the range of the phenomenon and the probability of users to be affected by it. Furthermore, we will raise specific tactics in which anti-establishment messages are portrayed; examples will be given of the use of emotion evoking content in the anti-establishment messages in order to arouse comment. It will be demonstrated in anti-dairy products and anti-vaccination campaigns. The impact of pseudo-medical language on consumers will be debated, although the content can easily be scientifically disproved. Finally, recommendations for a better medical dialogue with the patient, based on the online arena of medical knowledge described, will be provided. PMID:26665743

  4. The life-work of Prof. MUDr. Zdenek Lojda, Dr.Sc., Dr. Med. et Iur. h.c.

    PubMed

    Hach, P

    2008-01-01

    Professor Zdenek Lojda, MD., Dr.Sc., Dr. Med.h.c., Dr. Jur. h.c., vice-rector emeritus of the Charles University and director emeritus of the Institute of Histology and Embryology of the 1st Medical Faculty of the Charles University in Prague died on the 24th April 2004. Born in Trebíc (in a local maternal hospital on the 7th December 1927) he grew up in Moravské Budejovice where he graduated from a primary and secondary school (he passed out each class as well as the leaving exam at the local gymnasium in 1946 cum laude). He was growing up in an inspiring atmosphere of a family of a professor at gymnasium that helped him to form his fundamental moral attitude and to gain high knowledge of an almost Renaissance comprehension. He was a gifted linguist (he spoke fluently several languages including Latin) and musician (he did community singing among others) and he was interested in natural sciences. In 1946 he enrolled for the medical faculty and coincidentally he was grouped among students that completed histology and embryology at the Institute of Embryology headed by professor Zdenek Frankenberger, MD., who had recognised his interest in this field of study. The young student gave himself and his free time to the work of an unqualified lab-worker and only later he became assistant conducting practical tutorials. He took his degree cum laude in 1952 and he received certificate of competence because of his excellent results. He showed his preoccupation with histology (strongly influenced by the personality of professor Frankenberger) after the graduation when he entered the job of the assistant professor at the Institute of Embryology and he stayed there until 1961. When he was about to decide which problems he should target, professor Frankenberger drew his attention to a very interesting part of histology that was just in advance and that was the use of diazonic salts for formation of colour reaction product demonstrating enzyme activity in tissues. In 1962 professor Frankenberger retired and Lojda left the Institute of Embryology for the 4th internal clinic to work in the Laboratory of Angiology housed at the 1st (Hlava) Institute of Pathologic Anatomy. This step influenced Lojda's professional occupations: in the Laboratory of Angiology he studied enzymes of blood vessel wall; the problems in gastroenterology solved at the 4th internal clinic and teaching hospital brought him to issues connected with enzyme garniture of the intestinal mucosal epithelium; his engagement at the Hlava Institute where he worked as well as house officer and later as pathology teacher caused that he subordinated his interest in enzyme garniture of various tissues to study and explanation of pathological processes using functional morphology. In years 1966 to 1975 he earned his master degree in pathology, he habilitated in pathology and was promoted to a professorship in pathology. PMID:19548603

  5. Kinematics and activity of M dwarfs in LAMOST DR1

    NASA Astrophysics Data System (ADS)

    Yi, Zhen-Ping; Luo, A.-Li; Zhao, Jing-Kun; Song, Yi-Han; Pan, Jing-Chang; Zhao, Yong-Heng; Zhang, Yong

    2015-06-01

    We report on the first investigation into kinematics and chromospheric activity of M dwarfs from the Guo Shou Jing Telescope (also called the Large Sky Area Multi-Object Fiber Spectroscopic Telescope – LAMOST) data release one (DR1). The sample comprises 71 304 M dwarfs. Their fundamental parameters such as spectral types, radial velocities, important molecular band indices and magnetic activities are measured. Their distances are determined by a spectroscopic parallax relation. Space motion (U, V, W) and Galactocentric cylindrical coordinates (R, ?, Z) for the M dwarfs are also computed. We examine velocity dispersion as a function of height from the Galactic plane and find that all three components of velocity dispersion increase with height as measured with respect to the Galactic plane. The investigation into chromospheric activities along the height from the Galactic plane confirms that M dwarfs closer to the Galactic plane are more likely to be active. We take a pure kinematical approach to select thin disk stars and thick disk stars from our sample, then to investigate the differences in properties between these two populations. Our analysis is in excellent agreement with previous studies and leads to a better understanding of the structure of the Galactic disk. Supported by the National Natural Science Foundation of China.

  6. Identification of the HLA-DM/HLA-DR interface.

    PubMed

    Davies, Matthew N; Lamikanra, Abigail; Sansom, Clare E; Flower, Darren R; Moss, David S; Travers, Paul J

    2008-02-01

    Human leukocyte antigen (HLA)-DM is a critical participant in antigen presentation that catalyzes the dissociation of the Class II-associated Invariant chain-derived Peptide (CLIP) from the major histocompatibility complex (MHC) Class II molecules. There is competition amongst peptides for access to an MHC Class II groove and it has been hypothesised that DM functions as a 'peptide editor' that catalyzes the replacement of one peptide for another within the groove. It is established that the DM catalyst interacts directly with the MHC Class II but the precise location of the interface is unknown. Here, we combine previously described mutational data with molecular docking and energy minimisation simulations to identify a putative interaction site of >4000A2 which agrees with known point mutational data for both the DR and DM molecule. The docked structure is validated by comparison with experimental data and previously determined properties of protein-protein interfaces. A possible dissociation mechanism is suggested by the presence of an acidic cluster near the N terminus of the bound peptide. PMID:17870168

  7. Reflections of a soon-to-be former DR

    SciTech Connect

    Larson, N.I.

    1997-12-31

    SRP, formerly known as Salt River Project, is actually a combination of two organizations, The Salt River Valley Water Users` Association (the {open_quotes}Association{close_quotes}), and the Salt River Project Agricultural Improvement and Power District (the {open_quotes}District{close_quotes}). The Association was incorporated under the laws of the Territory of Arizona in 1903, and is one of the first projects authorized under the Federal Reclamation Act of 1902. The District was formed in 1937 as a political subdivision of the State of Arizona, and is responsible for the construction, operation and maintenance of the Electric System and the irrigation and water supply system. Generation and sale of electrical power and energy represent a significant portion of the District`s investment and revenues. SRP has a total capability of over 5000 MW from hydroelectric, thermal and purchased sources, Of this, almost 2400 MW is provided by Title IV, Phase II affected units. Phase II units must comply with the SO{sub 2} allowance program starting in the year 2000. SRP operates four facilities having Title IV units. The implementation of Title IV requires the selection of a Designated Representative (DR) to represent the utility and all utilities in the participation plants the utility may operate, to be responsible for reporting emissions of sulfur dioxide and oxides of nitrogen to the United States Environmental Protection Agency on a quarterly and annual basis and certify to the accuracy and completeness of the information.

  8. Three moving groups detected in the LAMOST DR1 archive

    SciTech Connect

    Zhao, J. K.; Zhao, G.; Chen, Y. Q.; Tan, K. F.; Oswalt, T. D.; Zhang, Y. E-mail: oswaltt1@erau.edu

    2014-05-20

    We analyze the kinematics of thick disk and halo stars observed by the Large Sky Area Multi-Object Fiber Spectroscopic Telescope. We have constructed a sample of 7993 F, G, and K nearby main-sequence stars (d < 2 kpc) with estimates of position (x, y, z) and space velocity (U, V, W) based on color and proper motion from the Sloan Digital Sky Survey DR9 catalog. Three 'phase-space overdensities' are identified in (V, ?(U{sup 2}+2V{sup 2})) with significance levels of ? > 3. Two of them (the Hyades-Pleiades stream and the Arcturus-AF06 stream) have been identified previously. We also find evidence for a new stream (centered at V ? –180 km s{sup –1}) in the halo. The formation mechanisms of these three streams are analyzed. Our results support the hypothesis that the Arcturus-AF06 stream and the new stream originated from the debris of a disrupted satellite, while the Hyades-Pleiades stream has a dynamical origin.

  9. Candidate members of star clusters from LAMOST DR2

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Chen, Xiao-Yan; Liu, Chao; Chen, Li; Deng, Li-Cai; Hou, Jin-Liang; Shao, Zheng-Yi; Yang, Fan; Wu, Yue; Yang, Ming; Zhang, Yong; Hou, Yong-Hui; Wang, Yue-Fei

    2015-08-01

    In this work, we provide 2189 photometrically- and kinematically-selected candidate members of 24 star clusters from the LAMOST DR2 catalog. We perform two-step membership identification: selection along the stellar track in the color-magnitude diagram, i.e., photometric identification, and selection from the distribution of radial velocities, i.e. the kinematic identification. We find that the radial velocities from the LAMOST data are very helpful in the membership identification. The mean probability of membership is 40% for the sample selected with radial velocity. With these 24 star clusters, we investigate the performance of the radial velocity and metallicity estimated with the LAMOST pipeline. We find that the systematic offsets in radial velocity and metallicity are 0.85 ± 1.26 km s?1 and ?0.08 ± 0.04 dex, with dispersions of 5.47+1.16?0.71 km s?1 and 0.13+0.04?0.02 dex, respectively. Finally, we propose that the photometrically-selected candidate members of the clusters covered by the LAMOST footprint should be assigned higher priority so that more candidate stars can be observed.

  10. Dr. Monaco Examines Lab-on a-Chip

    NASA Technical Reports Server (NTRS)

    2003-01-01

    Dr. Lisa Monaco, Marshall Space Flight Center's (MSFC's) project scientist for the Lab-on-a-Chip Applications Development (LOCAD) program, examines a lab on a chip. The small dots are actually ports where fluids and chemicals can be mixed or samples can be collected for testing. Tiny channels, only clearly visible under a microscope, form pathways between the ports. Many chemical and biological processes, previously conducted on large pieces of laboratory equipment, can now be performed on these small glass or plastic plates. Monaco and other researchers at MSFC in Huntsville, Alabama, are customizing the chips to be used for many space applications, such as monitoring microbes inside spacecraft and detecting life on other planets. The portable, handheld Lab-on-a Chip Application Development Portable Test System (LOCAD-PTS) made its debut flight aboard Discovery during the STS-116 mission launched December 9, 2006. The system allowed crew members to monitor their environment for problematic contaminants such as yeast, mold, and even E.coli, and salmonella. Once LOCAD-PTS reached the International Space Station (ISS), the Marshall team continued to manage the experiment, monitoring the study from a console in the Payload Operations Center at MSFC. The results of these studies will help NASA researchers refine the technology for future Moon and Mars missions. (NASA/MSFC/D.Stoffer)

  11. Asylum Doctor Extraordinaire: Dr. Thomas Drapes (1847-1919).

    PubMed

    Kelly, B D

    2015-09-01

    Dr. Thomas Drapes (1847-1919) was resident medical superintendent of Enniscorthy District Asylum in County Wexford, Ireland from 1883 to 1919, and one of the leading figures in Irish asylum medicine for several decades. Drapes' career was as complex as it was remarkable. Drapes was elected president of the Medico-Psychological Association for the term 1911-12 but had to decline on health grounds. In 1912, however, he was unanimously elected as co-editor of the Journal of Mental Science, to which he devoted his considerable energies and intellect. Drapes published widely, opposing Emil Kraepelin's proposed division of "functional" psychosis into manic-depressive illness and dementia praecox; openly examining the use of "punitive measures" in asylums (Enniscorthy had notably low rates of restraint and seclusion); and publicly bemoaning the folly of "psychophysical parallelism", or the spurious division between mental and physical symptoms in medicine. Although not immune to passing trends in medical thought (e.g. regarding sterilisation of the mentally ill to prevent further mental disorder), Drapes was generally independent-minded, insightful and incisive, and his legacy was to help shape Irish mental health care for many decades. PMID:25833354

  12. Environmental and Industrial Flows Dr A.J. Hogg Example Sheet 1 October 2006

    E-print Network

    Hogg, Andrew

    Environmental and Industrial Flows Dr A.J. Hogg Example Sheet 1 October 2006 Dimensional analysis air resistance through a cloud of water vapour. The rate of accretion is given by dm dt = va2 v, where

  13. Automated Methods for Interpreting Geospatial Natural Language Dr Kristin Stock, Nottingham Geospatial Institute, University of Nottingham

    E-print Network

    Stock, Kristin

    NaturalGeo Automated Methods for Interpreting Geospatial Natural Language Dr Kristin Stock, Nottingham Geospatial Institute, University of Nottingham 2012-2014 What is geospatial natural language diagrams best match 2000 geospatial natural language expressions. The results will populate our

  14. Imaging Hall of Fame Chester F. Carlson Center for Imaging Science, RIT Dr. Robert H. Rines

    E-print Network

    Salvaggio, Carl

    Imaging Hall of Fame Chester F. Carlson Center for Imaging Science, RIT Dr. Robert H. Rines 1922-2009 Robert H. Rines is an American inventor, patent lawyer, and educator. His contributions to the technology

  15. Die Folgen der Europischen Integration fr die Privatrechtsgesellschaft Dr. Carsten Herresthal, LL.M.

    E-print Network

    Schubart, Christoph

    Die Folgen der Europäischen Integration für die Privatrechtsgesellschaft Dr. Carsten Herresthal, LL..................................................................................................................................... 1107 II. Die Konzeption der Privatrechtsgesellschaft.............................................................................. 1108 1. Die dezentrale Verfolgung individueller Ziele durch freie und gleiche Bürger

  16. Biological Sciences Seminar Dr. Peter B. McIntyre, Assoc. Professor

    E-print Network

    Biological Sciences Seminar Dr. Peter B. McIntyre, Assoc. Professor Center for Limnology University. We find that sucker migrations generate substantial inputs of nitrogen and phosphorus to small loading. These subsidies enhance nutrient availability, primary productivity, and insect growth

  17. For more information, please contact Dr. Hin Lee, Hin.Lee@utoronto.ca Seminar Notice

    E-print Network

    Toronto, University of

    For more information, please contact Dr. Hin Lee, Hin.Lee@utoronto.ca Seminar Notice The Nature and Nurture of Economic Outcomes: Recent Findings from a GWAS of Educational Attainment Jonathan Beauchamp, Ph

  18. Eye-Eye with Dr. Rachel Bishop | NIH MedlinePlus the Magazine

    MedlinePLUS

    ... this page please turn JavaScript on. Feature: Glaucoma Eye-to-Eye with Dr. Rachel Bishop Past Issues / Spring 2015 ... new patient comes in because they scratched their eye while working in the yard, or they think ...

  19. Interview with ARPA-E Acting Director Dr. Cheryl Martin on Platts Energy Week

    SciTech Connect

    Martin, Cheryl; Loveless, Bill

    2014-03-18

    Bill Loveless from Platts Energy Week interviews ARPA-E Acting Director, Dr. Cheryl Martin, about the many transformational energy technologies on display at ARPA-E's 5th annual Energy Innovation Summit.

  20. Dr. Michael DeBakey "is a magician of the heart…"

    MedlinePLUS

    ... today for just this kind of research, an artificial heart, or the vital parts of one, could ... In 1963, he made history by installing an artificial pump to assist a patient's damaged heart. Dr. ...

  1. Ask Dr. Sue--Updates: Infectious Diseases, SIDS, HIV/AIDS.

    ERIC Educational Resources Information Center

    Aronson, Susan S.

    1995-01-01

    Describes new concerns about infectious diseases in childcare settings (tuberculosis, gastrointestinal infections, and lice); sleep position and SIDS; HIV/AIDS issues; and the use of sterilized sand in sand boxes. (DR)

  2. AO12: To m-infinity and beyond... Candidate number: 51265 Supervisor: Dr D. Peters

    E-print Network

    Oxford, University of

    AO12: To m-infinity and beyond... Candidate number: 51265 Supervisor: Dr D. Peters Word count: 5700 an absorption band of the material [6]. A team in the Earth Observation Data Group of Oxford University

  3. Die Leopold-Franzens-Universitt Innsbruck trauert um Ass.-Prof. Mag. Dr. Peter Mayrhofer

    E-print Network

    Nawratil, Georg

    Die Leopold-Franzens-Universität Innsbruck trauert um Ass.-Prof. Mag. Dr. Peter Mayrhofer Hilfsbereitschaft und nicht zuletzt auch seinen Humor schätzten. Die Leopold-Franzens-Universität betrauert den

  4. Testimony for Senate Committee on Energy and Natural Resources by Dr. G. Wayne Clough, President

    E-print Network

    Testimony for Senate Committee on Energy and Natural Resources by Dr. G. Wayne Clough, President on Energy and Natural Resources, Secretary Abraham, Director Orbach.... It is an honor to be here today

  5. Possible association between HLA-DR5 and superficial spreading melanoma (SSM).

    PubMed

    Mueller-Eckhardt, G; Schendel, D J; Hundeiker, M; Riedel, T; O'Neill, G J; Riethmüller, G; Mueller-Eckhardt, C

    1984-12-15

    Previous analyses of possible associations between MHC determinants and cutaneous malignant melanoma (MM) have been inconclusive. We have investigated 98 patients with special emphasis on histologically determined subtypes of MM, and 5 multiple-case families. In addition to HLA-ABC and DR typing, complement allotypes of C2, C4A, C4B, BF were determined. Among the unrelated patients HLA-DR5 and, secondarily, B49 were observed to be associated with superficial spreading (SSM) but not with nodular (NM) or lentigo maligna melanoma (LMM). In families with MM, no definite segregation of the disease according to HLA and complement haplotypes was discernible. Moreover, no coincidence of haplotypes occurred in patients of the different families. HLA region recombinations including B/DR and/or DR/GLO were found in all the families investigated. PMID:6334654

  6. Dr. George Koob: "Alcohol use disorders are a major problem " | NIH MedlinePlus the Magazine

    MedlinePLUS

    ... JavaScript on. Feature: Rethinking Drinking Dr. George Koob: "Alcohol use disorders are a major problem …" Past Issues / ... is Director of the NIH's National Institute on Alcohol Abuse and Alcoholism. A renowned expert on how ...

  7. ISS Update: Dr. Steve Squyres, NEEMO 16 Aquanaut and Cornell Professor - Duration: 13 minutes.

    NASA Video Gallery

    ISS Update Commentator Pat Ryan interviews Dr. Steve Squyres, NEEMO 16 Aquanaut and Cornell Professor, about simulating a mission to an asteroid underwater. The Aquarius habitat simulates the isola...

  8. NES Live Video Chat: Dr. John C. Mather - Duration: 42 minutes.

    NASA Video Gallery

    NES welcomed Nobel Prize winner Dr. John C. Mather for a video webchat on May 17, 2011. He spoke about the James Webb Space Telescope and how it gives us a look into the past to see how galaxies ha...

  9. Modeling of Influenza Using Fuzzy Logic Under the Direction of Dr. Jay Walton

    E-print Network

    Rowell, Eric C.

    Modeling of Influenza Using Fuzzy Logic Ananth Ram Under the Direction of Dr. Jay Walton Texas A of an influenza infection using fuzzy logic and computational methods. Computational models can be based off

  10. Dr. Grant Heikan examines lunar material in sieve from sample container

    NASA Technical Reports Server (NTRS)

    1969-01-01

    Dr. Grant Heikan, Manned Spacecraft Center and a Lunar Sample preliminary Examination Team member, examines lunar material in a sieve from the bulk sample container which was opened in the Biopreparation Laboratory of the Lunar Receiving Laboratory.

  11. Detection of HLA-D/DR-related DNA polymorphism in HLA-D homozygous typing cells.

    PubMed Central

    Owerbach, D; Lernmark, A; Rask, L; Peterson, P A; Platz, P; Svejgaard, A

    1983-01-01

    Sequences of different sizes are generated when DNA from homozygous HLA-Dw/DR typing cells are digested with restriction endonuclease and analyzed by hybridization with a HLA-D region class II antigen beta-chain cDNA probe. The patterns of hybridization were highly polymorphic but one endonuclease, BamHI, defined sequences unique to all HLA-Dw/DR specificities 1-8 except HLA-Dw/DR 2 and 6; however, these two specificities were resolved with the enzyme EcoRI. Digestion with other endonucleases such as Pst I results in patterns of restriction fragments that differ between homozygous typing cells of the same HLA-Dw/DR specificity. HLA-D region beta-chain probes permit HLA-D region genotyping at the DNA level and may allow detection of genes controlling the association of HLA specificities with a wide variety of diseases. Images PMID:6304735

  12. Math 142-10 Calculus II Winter 2006 Course Instructor: Dr. Paul Choboter

    E-print Network

    Choboter, Paul

    . Textbook: Calculus, 5th edition, James Stewart, 2003. The course will follow the text closely, coveringMath 142-10 · Calculus II · Winter 2006 Course Instructor: Dr. Paul Choboter Office: 25-313 Email

  13. VERY LARGE ARRAY DETECTION OF THE 36 GHz ZEEMAN EFFECT IN DR21W REVISITED

    E-print Network

    Momjian, Emmanuel

    We report on the observation of the 36 GHz methanol maser line in the star-forming region DR21W to accurately measure the Zeeman effect. The Zeeman signature reported by Fish et al. became suspicious after an instrumental ...

  14. EE 577 -Dr. Salam A. Zummo 1 EE 577 -Wireless and Personal

    E-print Network

    Zummo, Salam Adel

    . Zummo 14 Mobile Station Components Subscriber Identity Module (SIM): Implemented as a smart card): Uniquely identified by IMEI Operational only with SIM card, except for emergency calls #12;8 EE 577 - Dr

  15. Dr Mary Crosse, OBE, MD (1900–1972) and the premature baby

    PubMed Central

    Dunn, P M

    2007-01-01

    On behalf of Birmingham's Department of Public Health, Dr Crosse developed the Sorrento Premature Baby Unit in 1931 and pioneered the modern care of these small newborn infants in Britain. PMID:17337665

  16. 17.00 Begrssung von Prof. Dr. Walter Bircher Rektor der PHZH

    E-print Network

    Steiner, Daniel

    Programm 17.00 Begrüssung von Prof. Dr. Walter Bircher Rektor der PHZH Gedanken zur Internationalisierung von Bildung und Pädagogik Benedikt Hauser, Staatssekretariat für Bildung und Forschung Stiftung Pestalozzianum für beste Arbeiten von Studierenden Monika Weber, Präsidentin Stiftungsrat Stiftung

  17. New NIH Director Dr. Francis Collins on Medical Research That Benefits Everyone's Health

    MedlinePLUS

    ... version of this page please turn Javascript on. New NIH Director Dr. Francis Collins on Medical Research ... Our goal is to advance biomedical research in new, innovative ways that will benefit everyone's health." — NIH ...

  18. Grantee Spotlight: Dr. Kolawole Okuyemi - Improving Cervical Cancer Screening Attitudes of African Immigrants and Refugees

    Cancer.gov

    Dr. Kolawole Okuyumi is studying cervical cancer screening attitudes and behaviors of African immigrants and refugees (Ethiopians, Nigerians, and Somalis) in Minnesota, and introducing “cancer” and “cervix” to their everyday vocabulary.

  19. Dr. Scott Dearborn Colby--Center for East Asian Studies Interview

    E-print Network

    Colby, Scott; Greene, Megan

    2015-04-01

    Dr. Scott Colby, KU EALC (1966), talks about his experience studying East Asian Studies and Chinese language in the 1960s and early 1970s. This interview is a part of the University of Kansas Center for East Asian Studies ...

  20. For Immediate Release --Friday, April 10, 2015 University of Lethbridge's Dr. Claudia Gonzalez renewed

    E-print Network

    Morris, Joy

    on hemispheric lateralization for grasping and linking those findings to the development neuroscientist Dr. Robbin Gibb on several studies that showed that a more lateralized brain supports the development of EF ­ a blanket term that is considered