Science.gov

Sample records for early gene expression

  1. Biased gene expression in early honeybee larval development

    PubMed Central

    2013-01-01

    Background Female larvae of the honeybee (Apis mellifera) develop into either queens or workers depending on nutrition. This nutritional stimulus triggers different developmental trajectories, resulting in adults that differ from each other in physiology, behaviour and life span. Results To understand how these trajectories are established we have generated a comprehensive atlas of gene expression throughout larval development. We found substantial differences in gene expression between worker and queen-destined larvae at 6 hours after hatching. Some of these early changes in gene expression are maintained throughout larval development, indicating that caste-specific developmental trajectories are established much earlier than previously thought. Within our gene expression data we identified processes that potentially underlie caste differentiation. Queen-destined larvae have higher expression of genes involved in transcription, translation and protein folding early in development with a later switch to genes involved in energy generation. Using RNA interference, we were able to demonstrate that one of these genes, hexamerin 70b, has a role in caste differentiation. Both queen and worker developmental trajectories are associated with the expression of genes that have alternative splice variants, although only a single variant of a gene tends to be differentially expressed in a given caste. Conclusions Our data, based on the biases in gene expression early in development together with published data, supports the idea that caste development in the honeybee consists of two phases; an initial biased phase of development, where larvae can still switch to the other caste by differential feeding, followed by commitment to a particular developmental trajectory. PMID:24350621

  2. Expression of developmental genes during early embryogenesis of Hydra.

    PubMed

    Fröbius, Andreas C; Genikhovich, Gregory; Kürn, Ulrich; Anton-Erxleben, Friederike; Bosch, Thomas C G

    2003-09-01

    Hydra is a classical model to study key features of embryogenesis such as axial patterning and stem cell differentiation. In contrast to other organisms where these mechanisms are active only during embryonic development, in Hydra they can be studied in adults. The underlying assumption is that the machinery governing adult patterning mimics regulatory mechanisms which are also active during early embryogenesis. Whether, however, Hydra embryogenesis is governed by the same mechanisms which are controlling adult patterning, remains to be shown. In this paper, in precisely staged Hydra embryos, we examined the expression pattern of 15 regulatory genes shown previously to play a role in adult patterning and cell differentiation. RT-PCR revealed that most of the genes examined were expressed in rather late embryonic stages. In situ hybridization, nuclear run-on experiments, and staining of nucleolar organizer region-associated proteins indicated that genes expressed in early embryos are transcribed in the engulfed "nurse cells" (endocytes). This is the first direct evidence that endocytes in Hydra not only provide nutrients to the developing oocyte but also produce maternal factors critical for embryogenesis. Our findings are an initial step towards understanding the molecular machinery controlling embryogenesis of a key group of basal metazoans and raise the possibility that in Hydra there are differences in the mechanisms controlling embryogenesis and adult patterning. PMID:12883882

  3. A gene expression atlas of early craniofacial development.

    PubMed

    Brunskill, Eric W; Potter, Andrew S; Distasio, Andrew; Dexheimer, Phillip; Plassard, Andrew; Aronow, Bruce J; Potter, S Steven

    2014-07-15

    We present a gene expression atlas of early mouse craniofacial development. Laser capture microdissection (LCM) was used to isolate cells from the principal critical microregions, whose development, differentiation and signaling interactions are responsible for the construction of the mammalian face. At E8.5, as migrating neural crest cells begin to exit the neural fold/epidermal ectoderm boundary, we examined the cranial mesenchyme, composed of mixed neural crest and paraxial mesoderm cells, as well as cells from adjacent neuroepithelium. At E9.5 cells from the cranial mesenchyme, overlying olfactory placode/epidermal ectoderm, and underlying neuroepithelium, as well as the emerging mandibular and maxillary arches were sampled. At E10.5, as the facial prominences form, cells from the medial and lateral prominences, the olfactory pit, multiple discrete regions of underlying neuroepithelium, the mandibular and maxillary arches, including both their mesenchymal and ectodermal components, as well as Rathke's pouch, were similarly sampled and profiled using both microarray and RNA-seq technologies. Further, we performed single cell studies to better define the gene expression states of the early E8.5 pioneer neural crest cells and paraxial mesoderm. Taken together, and analyzable by a variety of biological network approaches, these data provide a complementing and cross validating resource capable of fueling discovery of novel compartment specific markers and signatures whose combinatorial interactions of transcription factors and growth factors/receptors are responsible for providing the master genetic blueprint for craniofacial development. PMID:24780627

  4. A Gene Expression Atlas of Early Craniofacial Development

    PubMed Central

    Brunskill, Eric W.; Potter, Andrew S.; Distasio, Andrew; Dexheimer, Phillip; Plassard, Andrew; Aronow, Bruce J.; Potter, S. Steven

    2014-01-01

    We present a gene expression atlas of early mouse craniofacial development. Laser capture microdissection (LCM) was used to isolate cells from the principal critical micro-regions, whose development, differentiation and signaling interactions are responsible for the construction of the mammalian face. At E8.5, as migrating neural crest cells begin to exit the neural fold/epidermal ectoderm boundary, we examined the cranial mesenchyme, composed of mixed neural crest and paraxial mesoderm cells, as well as cells from adjacent neuroepithelium. At E9.5 cells from the cranial mesenchyme, overlying olfactory placode/epidermal ectoderm, and underlying neuroepithelium, as well as the emerging mandibular and maxillary arches were sampled. At E10.5, as the facial prominences form, cells from the medial and lateral prominences, the olfactory pit, multiple discrete regions of underlying neuroepithelium, the mandibular and maxillary arches, including both their mesenchymal and ectodermal components, as well as Rathke’s pouch, were similarly sampled and profiled using both microarray and RNA-seq technologies. Further, we performed single cell studies to better define the gene expression states of the early E8.5 pioneer neural crest cells and paraxial mesoderm. Taken together, and analyzable by a variety of biological network approaches, these data provide a complementing and cross-validating resource capable of fueling discovery of novel compartment specific markers and signatures whose combinatorial interactions of transcription factors and growth factors/receptors are responsible for providing the master genetic blueprint for craniofacial development. PMID:24780627

  5. Identification of Bacillus subtilis genes expressed early during sporulation.

    PubMed

    Mathiopoulos, C; Sonenshein, A L

    1989-08-01

    Labelled cDNA transcribed in vitro from early-sporulation RNA was enriched for sporulation-specific sequences by subtractive hybridization to an excess of vegetative RNA and used to probe libraries of Bacillus subtilis chromosomal DNA. From the initial collection of clones that coded for RNAs transcribed preferentially during sporulation, several were subcloned and studied in more detail. It was found that two clones contained sequences (dciA and dciB) that had an undetectable level of transcription during vegetative growth but had transcripts that started to appear no later than eight minutes after induction of sporulation. A third DNA segment (dciC) was expressed at a low level in vegetative cells and increased within four minutes after induction of sporulation. The effects of spoO mutations, i.e. mutations that prevent cells from reaching stage I of the sporulation process, were tested. Induction of the dciA and dciB transcripts was significantly reduced in strains carrying mutations in the spoOA and spoOH genes but not in a spoOB mutant strain. In addition, a product of the abrB locus, a locus in which mutations are known to partially overcome the pleiotropic effect of spoOA and spoOB mutations, seemed to be required for dciA and dciB expression. PMID:2481799

  6. Influence of Isoflurane on Immediate-Early Gene Expression

    PubMed Central

    Bunting, Kristopher M.; Nalloor, Rebecca I.; Vazdarjanova, Almira

    2016-01-01

    Background: Anterograde amnesia is a hallmark effect of volatile anesthetics. Isoflurane is known to affect both the translation and transcription of plasticity-associated genes required for normal memory formation in many brain regions. What is not known is whether isoflurane anesthesia prevents the initiation of transcription or whether it halts transcription already in progress. We tested the hypothesis that general anesthesia with isoflurane prevents learning-induced initiation of transcription of several memory-associated immediate-early genes (IEGs) correlated with amnesia; we also assessed whether it stops transcription initiated prior to anesthetic administration. Methods: Using a Tone Fear Conditioning paradigm, rats were trained to associate a tone with foot-shock. Animals received either no anesthesia, anesthesia immediately after training, or anesthesia before, during, and after training. Animals were either sacrificed after training or tested 24 h later for long-term memory. Using Cellular Compartment Analysis of Temporal Activity by Fluorescence in situ Hybridization (catFISH), we examined the percentage of neurons expressing the IEGs Arc/Arg3.1 and Zif268/Egr1/Ngfi-A/Krox-24 in the dorsal hippocampus, primary somatosensory cortex, and primary auditory cortex. Results: On a cellular level, isoflurane administered at high doses (general anesthesia) prevented initiation of transcription, but did not stop transcription of Arc and Zif268 mRNA initiated prior to anesthesia. On a behavioral level, the same level of isoflurane anesthesia produced anterograde amnesia for fear conditioning when administered before and during training, but did not produce retrograde amnesia when administered immediately after training. Conclusion: General anesthesia with isoflurane prevents initiation of learning-related transcription but does not stop ongoing transcription of two plasticity-related IEGs, Arc and Zif268, a pattern of disruption that parallels the effects of

  7. Early pregnancy peripheral blood gene expression and risk of preterm delivery: a nested case control study

    PubMed Central

    2009-01-01

    Background Preterm delivery (PTD) is a significant public health problem associated with greater risk of mortality and morbidity in infants and mothers. Pathophysiologic processes that may lead to PTD start early in pregnancy. We investigated early pregnancy peripheral blood global gene expression and PTD risk. Methods As part of a prospective study, ribonucleic acid was extracted from blood samples (collected at 16 weeks gestational age) from 14 women who had PTD (cases) and 16 women who delivered at term (controls). Gene expressions were measured using the GeneChip® Human Genome U133 Plus 2.0 Array. Student's T-test and fold change analysis were used to identify differentially expressed genes. We used hierarchical clustering and principle components analysis to characterize signature gene expression patterns among cases and controls. Pathway and promoter sequence analyses were used to investigate functions and functional relationships as well as regulatory regions of differentially expressed genes. Results A total of 209 genes, including potential candidate genes (e.g. PTGDS, prostaglandin D2 synthase 21 kDa), were differentially expressed. A set of these genes achieved accurate pre-diagnostic separation of cases and controls. These genes participate in functions related to immune system and inflammation, organ development, metabolism (lipid, carbohydrate and amino acid) and cell signaling. Binding sites of putative transcription factors such as EGR1 (early growth response 1), TFAP2A (transcription factor AP2A), Sp1 (specificity protein 1) and Sp3 (specificity protein 3) were over represented in promoter regions of differentially expressed genes. Real-time PCR confirmed microarray expression measurements of selected genes. Conclusions PTD is associated with maternal early pregnancy peripheral blood gene expression changes. Maternal early pregnancy peripheral blood gene expression patterns may be useful for better understanding of PTD pathophysiology and PTD risk

  8. Gene expression profiling in spleens of deoxynivalenol-exposed mice: immediate early genes as primary targets.

    PubMed

    Kinser, Shawn; Jia, Qunshan; Li, Maioxing; Laughter, Ashley; Cornwell, Paul; Corton, J Christopher; Pestka, James

    2004-09-24

    signaling, were increased, while Jun kinase 2 (JNK2) was decreased. Taken together, data suggest that DON upregulated the expression of multiple immediate early genes, many of which are likely to contribute to the complex immunological effects reported for this and other trichothecenes. PMID:15371230

  9. Early Experiences Can Alter Gene Expression and Affect Long-Term Development. Working Paper #10

    ERIC Educational Resources Information Center

    National Scientific Council on the Developing Child, 2010

    2010-01-01

    New scientific research shows that environmental influences can actually affect whether and how genes are expressed. Thus, the old ideas that genes are "set in stone" or that they alone determine development have been disproven. In fact, scientists have discovered that early experiences can determine how genes are turned on and off and even…

  10. Control of adenovirus early gene expression: Posttranscriptional control mediated by both viral and cellular gene products

    SciTech Connect

    Katze, M.G.; Persson, H.; Philipson, L.

    1981-09-01

    An adenovirus type 5 host range mutant (hr-1) located in region E1A and phenotypically defective in expressing viral messenger ribonucleic acid (RNA) from other early regions was analyzed for accumulation of viral RNA in the presence of protein synthesis inhibitors. Nuclear RNA was transcribed from all early regions at the same rate, regardless of whether the drug was present or absent. As expected, low or undetectable levels of RNA were found in the cytoplasm of hr-1-infected cells compared with the wild-type adenovirus type 5 in the absence of drug. When anisomycin was added 30 min before hr-1 infection, cytoplasmic RNA was abundant from early regions E3 and E4 when assayed by filter hybridization. In accordance, early regions E3 and E4 viral messenger RNA species were detected by the S1 endonuclease mapping technique only in hr-1-infected cells that were treated with the drug. Similar results were obtained by in vitro translation studies. Together, these results suggest that this adenovirus type 5 mutant lacks a viral gene product necessary for accumulation of viral messenger RNA, but not for transcription. It is proposed that a cellular gene product serves as a negative regulator of viral messenger RNA accumulation at the posttranscriptional level.

  11. Genome-wide analysis of spatiotemporal gene expression patterns during early embryogenesis in rice.

    PubMed

    Itoh, Jun-Ichi; Sato, Yutaka; Sato, Yutaka; Hibara, Ken-Ichiro; Shimizu-Sato, Sae; Kobayashi, Hiromi; Takehisa, Hinako; Sanguinet, Karen A; Namiki, Nobukazu; Nagamura, Yoshiaki

    2016-04-01

    Embryogenesis in rice is different from that of most dicotolydonous plants in that it shows a non-stereotypic cell division pattern, formation of dorsal-ventral polarity, and endogenous initiation of the radicle. To reveal the transcriptional features associated with developmental events during rice early embryogenesis, we used microarray analysis coupled with laser microdissection to obtain both spatial and temporal transcription profiles. Our results allowed us to determine spatial expression foci for each expressed gene in the globular embryo, which revealed the importance of phytohormone-related genes and a suite of transcription factors to early embryogenesis. Our analysis showed the polarized expression of a small number of genes along the apical-basal and dorsal-ventral axes in the globular embryo, which tended to fluctuate in later developmental stages. We also analyzed gene expression patterns in the early globular embryo and how this relates to expression in embryonic organs at later stages. We confirmed the accuracy of the expression patterns found by microarray analysis of embryo subdomains usingin situhybridization. Our study identified homologous genes fromArabidopsis thalianawith known functions in embryogenesis in addition to unique and uncharacterized genes that show polarized expression patterns during embryogenesis. The results of this study are presented in a database to provide a framework for spatiotemporal gene expression during rice embryogenesis, to serve as a resource for future functional analysis of genes, and as a basis for comparative studies of plant embryogenesis. PMID:26903508

  12. Gene Expression Analysis for the Identification of Genes Involved in Early Tumour Development

    NASA Astrophysics Data System (ADS)

    Forte, Stefano; Scarpulla, Salvatore; Lagana, Alessandro; Memeo, Lorenzo; Gulisano, Massimo

    Prostatic tissues can undergo to cancer insurgence and prostate cancer is one of the most common types of malignancies affecting adult men in the United States. Primary adenocarcinoma of the seminal vesi-cles (SVCA) is a very rare neoplasm with only 48 histologically confirmed cases reported in the European and United States literature. Prostatic tissues, seminal vesicles and epididymis belongs all to the same microenvironment, shows a very close morphology and share the same embryological origin. Despite these common features the rate of cancer occurrence is very different. The understanding of molecular differences between non neoplastic prostatic tissues and non neoplastic epididymis or seminal vesicles may suggest potential mechanisms of resistance to tumour occurrence. The comparison of expression patterns of non neoplastic prostatic and seminal vesicles tissues to identify differentially expressed genes can help researchers in the identification of biological actors involved in the early stages of the tumour development.

  13. Variability of Gene Expression Identifies Transcriptional Regulators of Early Human Embryonic Development

    PubMed Central

    Hasegawa, Yu; Taylor, Deanne; Ovchinnikov, Dmitry A.; Wolvetang, Ernst J.; de Torrenté, Laurence; Mar, Jessica C.

    2015-01-01

    An analysis of gene expression variability can provide an insightful window into how regulatory control is distributed across the transcriptome. In a single cell analysis, the inter-cellular variability of gene expression measures the consistency of transcript copy numbers observed between cells in the same population. Application of these ideas to the study of early human embryonic development may reveal important insights into the transcriptional programs controlling this process, based on which components are most tightly regulated. Using a published single cell RNA-seq data set of human embryos collected at four-cell, eight-cell, morula and blastocyst stages, we identified genes with the most stable, invariant expression across all four developmental stages. Stably-expressed genes were found to be enriched for those sharing indispensable features, including essentiality, haploinsufficiency, and ubiquitous expression. The stable genes were less likely to be associated with loss-of-function variant genes or human recessive disease genes affected by a DNA copy number variant deletion, suggesting that stable genes have a functional impact on the regulation of some of the basic cellular processes. Genes with low expression variability at early stages of development are involved in regulation of DNA methylation, responses to hypoxia and telomerase activity, whereas by the blastocyst stage, low-variability genes are enriched for metabolic processes as well as telomerase signaling. Based on changes in expression variability, we identified a putative set of gene expression markers of morulae and blastocyst stages. Experimental validation of a blastocyst-expressed variability marker demonstrated that HDDC2 plays a role in the maintenance of pluripotency in human ES and iPS cells. Collectively our analyses identified new regulators involved in human embryonic development that would have otherwise been missed using methods that focus on assessment of the average expression

  14. Gene Expression Analyses of Subchondral Bone in Early Experimental Osteoarthritis by Microarray

    PubMed Central

    Chen, YuXian; Shen, Jun; Lu, HuaDing; Zeng, Chun; Ren, JianHua; Zeng, Hua; Li, ZhiFu; Chen, ShaoMing; Cai, DaoZhang; Zhao, Qing

    2012-01-01

    Osteoarthritis (OA) is a degenerative joint disease that affects both cartilage and bone. A better understanding of the early molecular changes in subchondral bone may help elucidate the pathogenesis of OA. We used microarray technology to investigate the time course of molecular changes in the subchondral bone in the early stages of experimental osteoarthritis in a rat model. We identified 2,234 differentially expressed (DE) genes at 1 week, 1,944 at 2 weeks and 1,517 at 4 weeks post-surgery. Further analyses of the dysregulated genes indicated that the events underlying subchondral bone remodeling occurred sequentially and in a time-dependent manner at the gene expression level. Some of the identified dysregulated genes that were identified have suspected roles in bone development or remodeling; these genes include Alp, Igf1, Tgf β1, Postn, Mmp3, Tnfsf11, Acp5, Bmp5, Aspn and Ihh. The differences in the expression of these genes were confirmed by real-time PCR, and the results indicated that our microarray data accurately reflected gene expression patterns characteristic of early OA. To validate the results of our microarray analysis at the protein level, immunohistochemistry staining was used to investigate the expression of Mmp3 and Aspn protein in tissue sections. These analyses indicate that Mmp3 protein expression completely matched the results of both the microarray and real-time PCR analyses; however, Aspn protein expression was not observed to differ at any time. In summary, our study demonstrated a simple method of separation of subchondral bone sample from the knee joint of rat, which can effectively avoid bone RNA degradation. These findings also revealed the gene expression profiles of subchondral bone in the rat OA model at multiple time points post-surgery and identified important DE genes with known or suspected roles in bone development or remodeling. These genes may be novel diagnostic markers or therapeutic targets for OA. PMID:22384228

  15. Characterization and embryonic expression of four amphioxus Frizzled genes with important functions during early embryogenesis.

    PubMed

    Qian, Guanghui; Li, Guang; Chen, Xiaoying; Wang, Yiquan

    2013-12-01

    The Wnt signaling pathway plays crucial roles in the embryonic patterning of all metazoans. Recent studies on Wnt genes in amphioxus have shed important insights into the evolution of the vertebrate Wnt gene family and their functions. Nevertheless, the potential roles of Wnt family receptors encoded by Frizzled (Fz) genes in amphioxus embryonic development remain to be investigated. In the present study, we identified four amphioxus Fz genes-AmphiFz1/2/7, AmphiFz4, AmphiFz5/8, and AmphiFz9/10-and analyzed their expression patterns during amphioxus embryogenesis. We found that these four Fz genes were maternally expressed and might be involved in early animal-vegetal axis establishment. The AmphiFz1/2/7 transcripts were detected in the central dorsal neural plate, mesoderm, the Hatschek's pit, and rim of the mouth, whereas those of AmphiFz4 were detected in the mesoderm, pharyngeal endoderm, and entire gut region. AmphiFz5/8 was exclusively expressed in the anterior-most region, whereas AmphiFz9/10 was expressed in the neural plate, somites, and tail bud. The dynamic and diverse expression patterns of amphioxus Fz genes suggest that these genes are not only associated with early embryonic axis establishment but also are involved in the development of several organs in amphioxus. PMID:24012522

  16. Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies

    PubMed Central

    Kosinová, Lucie; Cahová, Monika; Fábryová, Eva; Týcová, Irena; Koblas, Tomáš; Leontovyč, Ivan; Saudek, František; Kříž, Jan

    2016-01-01

    The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3) in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0–120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48–120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information from 48 hrs

  17. Gene Expression of Rat Alveolar Type II Cells during Hyperoxia Exposure and Early Recovery

    PubMed Central

    Chen, Zhongming; Chintagari, Narendranath Reddy; Guo, Yujie; Bhaskaran, Manoj; Chen, Jiwang; Gao, Li; Jin, Nili; Weng, Tingting; Liu, Lin

    2007-01-01

    Alveolar epithelial cell (AEC) injury and repair during hyperoxia exposure and recovery have been investigated for decades, but the molecular mechanisms of these processes are not clear. To identify potentially important genes involved in lung injury and repair, we studied the gene expression profiles of isolated AEC II from control, 48-hour hyperoxia-exposed (>95% O2) and 1-7 day recovering rats using a DNA microarray containing 10,000 genes. Fifty genes showed significant differential expression between two or more time points (p<0.05, fold change >2). These genes can be classified into 8 unique gene expression patterns. Real-time PCR verified 14 selected genes in three patterns related to hyperoxia exposure and early recovery. The change in the protein level for two of the selected genes, bmp-4 and retnla, paralleled that of the mRNA level. Many of these genes were found to be involved in cell proliferation and differentiation. In an in vitro AEC trans-differentiation culture model using AEC II isolated from control and 48 hrs hyperoxia-exposed rats, the expression of the cell proliferation and differentiation genes identified above were consistent with their predicted roles in the trans-differentiation of AEC. These data indicate that a coordinated mechanism may control AEC differentiation during in vivo hyperoxia exposure and recovery as well as during in vitro AEC culture. PMID:17640573

  18. Analysis on Gene Expression Profile in Oncospheres and Early Stage Metacestodes from Echinococcus multilocularis

    PubMed Central

    Dang, Zhisheng; Suzuki, Yutaka; Horiuchi, Terumi; Yagi, Kinpei; Kouguchi, Hirokazu; Irie, Takao; Kim, Kyeongsoon; Oku, Yuzaburo

    2016-01-01

    Alveolar echinococcosis is a worldwide zoonosis of great public health concern. Analysis of genome data for Echinococcus multilocularis has identified antigen families that can be used in diagnostic assays and vaccine development. However, little gene expression data is available for antigens of the egg and early larval stages. To address this information gap, we used a Next-Generation Sequencing approach to investigate three different stages (non-activated and activated oncospheres, and early stage metacestodes) of E. multilocularis (Nemuro strain). Transcriptome data analysis revealed that some diagnostic antigen gp50 isoforms and the antigen Eg95 family dominated in activated oncospheres, and the antigen B family dominated in early stage metacestodes. Furthermore, heat shock proteins and antigen II/3 are constantly expressed in the three stages. The expression pattern of various known antigens in E. multilocularis may give fundamental information for choosing candidate genes used in diagnosis and vaccine development. PMID:27092774

  19. Analysis on Gene Expression Profile in Oncospheres and Early Stage Metacestodes from Echinococcus multilocularis.

    PubMed

    Huang, Fuqiang; Dang, Zhisheng; Suzuki, Yutaka; Horiuchi, Terumi; Yagi, Kinpei; Kouguchi, Hirokazu; Irie, Takao; Kim, Kyeongsoon; Oku, Yuzaburo

    2016-04-01

    Alveolar echinococcosis is a worldwide zoonosis of great public health concern. Analysis of genome data for Echinococcus multilocularis has identified antigen families that can be used in diagnostic assays and vaccine development. However, little gene expression data is available for antigens of the egg and early larval stages. To address this information gap, we used a Next-Generation Sequencing approach to investigate three different stages (non-activated and activated oncospheres, and early stage metacestodes) of E. multilocularis (Nemuro strain). Transcriptome data analysis revealed that some diagnostic antigen gp50 isoforms and the antigen Eg95 family dominated in activated oncospheres, and the antigen B family dominated in early stage metacestodes. Furthermore, heat shock proteins and antigen II/3 are constantly expressed in the three stages. The expression pattern of various known antigens in E. multilocularis may give fundamental information for choosing candidate genes used in diagnosis and vaccine development. PMID:27092774

  20. EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHLOROACETIC ACID

    EPA Science Inventory

    EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHLOROACETIC ACID

    Dichloroacetic acid (DCA) is a major by-product of water disinfection by chlorination. Several studies have shown that DCA induces liver tumors in rodents when administered in drinking wate...

  1. EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHOLORACETC ACID

    EPA Science Inventory

    EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHLOROACETIC ACID

    Dichloroacetic acid COCA) is a major by-product ofwater disinfection by cWorination. Several
    studies have shown that DCA induces liver tumors in rodents when administered in drinkmg wate...

  2. Functional mapping of a trans-activating gene required for expression of a baculovirus delayed-early gene.

    PubMed Central

    Guarino, L A; Summers, M D

    1986-01-01

    The temporal regulation of an early gene of the baculovirus Autographa californica nuclear polyhedrosis virus was examined. We constructed a plasmid (plasmid 39CAT) in which the bacterial gene for chloramphenicol acetyltransferase was placed under the control of the promoter for the gene for a A. californica nuclear polyhedrosis virus 39,000-dalton protein (39K). A transient expression assay of plasmid 39CAT revealed that the 39K gene was expressed in infected cells but not in uninfected cells, indicating that the 39K gene should be classified as a delayed-early gene. The 39K promoter also efficiently directed the synthesis of chloramphenicol acetyltransferase when the plasmid was cotransfected with viral DNA which had been restricted with several restriction enzymes. To map the location of the gene(s) required for the synthesis of 39K, plasmid 39CAT was cotransfected with purified restriction fragments of A. californica nuclear polyhedrosis virus DNA. Fragments which mapped between 90.7 and 100.8 map units induced plasmid 39CAT. Plasmid pEcoRI-B, containing EcoRI fragment B (90 to 100 map units), activated plasmid 39CAT. Functional mapping of plasmid pEcoRI-B indicated that the essential region was located between 95.0 and 97.5 map units. The 5' end of this gene was mapped, and the chloramphenicol acetyltransferase gene was inserted under the control of its promoter. Transient assay experiments indicated that the trans-acting regulatory gene was expressed in uninfected cells and is therefore an immediate-early gene. This gene was named IE-1. Images PMID:3944847

  3. Differential expression of CaMK-II genes during early zebrafish embryogenesis.

    PubMed

    Rothschild, Sarah C; Lister, James A; Tombes, Robert M

    2007-01-01

    CaMK-II is a highly conserved Ca(2+)/calmodulin-dependent protein kinase expressed throughout the lifespan of all vertebrates. During early development, CaMK-II regulates cell cycle progression and "non-canonical" Wnt-dependent convergent extension. In the zebrafish, Danio rerio, CaMK-II activity rises within 2 hr after fertilization. At the time of somite formation, zygotic expression from six genes (camk2a1, camk2b1, camk2g1, camk2g2, camk2d1, camk2d2) results in a second phase of increased activity. Zebrafish CaMK-II genes are 92-95% identical to their human counterparts in the non-variable regions. During the first three days of development, alternative splicing yields at least 20 splice variants, many of which are unique. Whole-mount in situ hybridization reveals that camk2g1 comprises the majority of maternal expression. All six genes are expressed strongly in ventral regions at the 18-somite stage. Later, camk2a1 is expressed in anterior somites, heart, and then forebrain. Camk2b1 is expressed in somites, mid- and forebrain, gut, retina, and pectoral fins. Camk2g1 appears strongly along the midline and then in brain, gut, and pectoral fins. Camk2g2 is expressed early in the midbrain and trunk and exhibits the earliest retinal expression. Camk2d1 is elevated early at somite boundaries, then epidermal tissue, while camk2d2 is expressed in discrete anterior locations, steadily increasing along either side of the dorsal midline and then throughout the brain, including the retina. These findings reveal a complex pattern of CaMK-II gene expression consistent with pleiotropic roles during development. PMID:17103413

  4. Gene expression profiles during early differentiation of mouse embryonic stem cells

    PubMed Central

    Mansergh, Fiona C; Daly, Carl S; Hurley, Anna L; Wride, Michael A; Hunter, Susan M; Evans, Martin J

    2009-01-01

    Background Understanding the mechanisms controlling stem cell differentiation is the key to future advances in tissue and organ regeneration. Embryonic stem (ES) cell differentiation can be triggered by embryoid body (EB) formation, which involves ES cell aggregation in suspension. EB growth in the absence of leukaemia inhibitory factor (LIF) leads EBs to mimic early embryonic development, giving rise to markers representative of endoderm, mesoderm and ectoderm. Here, we have used microarrays to investigate differences in gene expression between 3 undifferentiated ES cell lines, and also between undifferentiated ES cells and Day 1–4 EBs Results An initial array study identified 4 gene expression changes between 3 undifferentiated ES cell lines. Tissue culture conditions for ES differentiation were then optimized to give the maximum range of gene expression and growth. -Undifferentiated ES cells and EBs cultured with and without LIF at each day for 4 days were subjected to microarray analysis. -Differential expression of 23 genes was identified. 13 of these were also differentially regulated in a separate array comparison between undifferentiated ES cells and compartments of very early embryos. A high degree of inter-replicate variability was noted when confirming array results. Using a panel of marker genes, RNA amplification and RT-PCR, we examined expression pattern variation between individual -D4-Lif EBs. We found that individual EBs selected from the same dish were highly variable in gene expression profile. Conclusion ES cell lines derived from different mouse strains and carrying different genetic modifications are almost invariant in gene expression profile under conditions used to maintain pluripotency. Tissue culture conditions that give the widest range of gene expression and maximise EB growth involve the use of 20% serum and starting cell numbers of 1000 per EB. 23 genes of importance to early development have been identified; more than half of these

  5. Gene Expression Profiling during Early Acute Febrile Stage of Dengue Infection Can Predict the Disease Outcome

    PubMed Central

    Calzavara-Silva, Carlos E.; Gomes, Ana L. V.; Brito, Carlos A. A.; Cordeiro, Marli T.; Silva, Ana M.; Magalhães, Cecilia; Andrade, Raoni; Gil, Laura H. V. G.; Marques, Ernesto T. A.

    2009-01-01

    Background We report the detailed development of biomarkers to predict the clinical outcome under dengue infection. Transcriptional signatures from purified peripheral blood mononuclear cells were derived from whole-genome gene-expression microarray data, validated by quantitative PCR and tested in independent samples. Methodology/Principal Findings The study was performed on patients of a well-characterized dengue cohort from Recife, Brazil. The samples analyzed were collected prospectively from acute febrile dengue patients who evolved with different degrees of disease severity: classic dengue fever or dengue hemorrhagic fever (DHF) samples were compared with similar samples from other non-dengue febrile illnesses. The DHF samples were collected 2–3 days before the presentation of the plasma leakage symptoms. Differentially-expressed genes were selected by univariate statistical tests as well as multivariate classification techniques. The results showed that at early stages of dengue infection, the genes involved in effector mechanisms of innate immune response presented a weaker activation on patients who later developed hemorrhagic fever, whereas the genes involved in apoptosis were expressed in higher levels. Conclusions/Significance Some of the gene expression signatures displayed estimated accuracy rates of more than 95%, indicating that expression profiling with these signatures may provide a useful means of DHF prognosis at early stages of infection. PMID:19936257

  6. Pyrosequencing of Haliotis diversicolor Transcriptomes: Insights into Early Developmental Molluscan Gene Expression

    PubMed Central

    Huang, Zi-Xia; Chen, Zhi-Sen; Ke, Cai-Huan; Zhao, Jing; You, Wei-Wei; Zhang, Jie; Dong, Wei-Ting; Chen, Jun

    2012-01-01

    Background The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. Methodology/Principal Findings In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the ‘lock system’ in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM) structures within the earliest postlarvae. Conclusion This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level. PMID:23236463

  7. Polymorphic core promoter GA-repeats alter gene expression of the early embryonic developmental genes.

    PubMed

    Valipour, E; Kowsari, A; Bayat, H; Banan, M; Kazeminasab, S; Mohammadparast, S; Ohadi, M

    2013-12-01

    Protein complexes that bind to 'GAGA' DNA elements are necessary to replace nucleosomes to create a local chromatin environment that facilitates a variety of site-specific regulatory responses. Three to four elements are required for the disruption of a preassembled nucleosome. We have previously identified human protein-coding gene core promoters that are composed of exceptionally long GA-repeats. The functional implication of those GA-repeats is beginning to emerge in the core promoter of the human SOX5 gene, which is involved in multiple developmental processes. In the current study, we analyze the functional implication of GA-repeats in the core promoter of two additional genes, MECOM and GABRA3, whose expression is largely limited to embryogenesis. We report a significant difference in gene expression as a result of different alleles across those core promoters in the HEK-293 cell line. Across-species homology check for the GABRA3 GA-repeats revealed that those repeats are evolutionary conserved in mouse and primates (p<1 × 10(-8)). The MECOM core promoter GA-repeats are also conserved in numerous species, of which human has the longest repeat and complexity. We propose a novel role for GA-repeat core promoters to regulate gene expression in the genes involved in development and evolution. PMID:24055488

  8. In vitro gene expression profile of bovine peripheral blood mononuclear cells in early Mycobacterium bovis infection

    PubMed Central

    CHENG, YAFEN; CHOU, CHUNG-HSI; TSAI, HSIANG-JUNG

    2015-01-01

    The intracellular parasite Mycobacterium bovis (M. bovis) causes tuberculosis in cattle and humans. Understanding the interactions between M. bovis and host cells is essential in developing tools for the prevention, detection, and treatment of M. bovis infection. Gene expression profiles provide a large amount of information regarding the molecular mechanisms underlying these interactions. The present study analyzed changes in gene expression in bovine peripheral blood mononuclear cells (PBMCs) at 0, 4 and 24 h following exposure to M. bovis. Using bovine whole-genome microarrays, a total of 420 genes were identified that exhibited significant alterations in expression (≥2-fold). Significantly enriched genes were identified using the Kyoto Encyclopedia of Genes and Genomes database, of which the highest differentially expressed genes were associated with the immune system, signal transduction, endocytosis, cellular transport, inflammation, and apoptosis. Of the genes associated with the immune system, 84.85% displayed downregulation. These findings support the view that M. bovis inhibits signaling pathways of antimycobacterial host defense in bovine PBMCs. These in vitro data demonstrated that molecular alterations underlying the pathogenesis of tuberculosis begin early, during the initial 24 h following M. bovis infection. PMID:26668602

  9. Early changes in lung gene expression due to high tidal volume.

    PubMed

    Copland, Ian B; Kavanagh, Brian P; Engelberts, Doreen; McKerlie, Colin; Belik, Jaques; Post, Martin

    2003-11-01

    The purpose of this study was to use gene expression profiling to understand how adult rat lung responds to high tidal volume (HV) ventilation in vivo. HV ventilation for 30 minutes did not cause discernable lung injury (in terms of altered mechanics or histology) but caused obvious injury when continued for 90 minutes. However, at 30-minute ventilation, HV caused significant upregulation of 10 genes and suppression of 12 genes. Among the upregulated genes were transcription factors, stress proteins, and inflammatory mediators; the downregulated genes were exemplified by metabolic regulatory genes. On the basis of cluster analysis, we studied Egr-1, c-Jun, heat shock protein 70, and interleukin (IL)-1beta in further detail. Temporal studies demonstrated that Egr-1 and c-Jun were increased early and before heat shock protein 70 and IL-1beta. Spatial studies using in situ hybridization and laser capture microscopy revealed that all four genes were upregulated primarily in the bronchiolar airway epithelium. Furthermore, at 90 minutes of HV ventilation, a significant increase in intracellular IL-1beta protein was observed. Although there are limitations to gene array methodology, the current data suggest a global hypothesis that (1). the effects of HV are cumulative; (2). specific patterns of gene activation and suppression precede lung injury; and (3). alteration of gene expression after mechanical stretch is pathogenic. PMID:12816737

  10. Analysis of early hepatic stage schistosomula gene expression by subtractive expressed sequence tags library.

    PubMed

    Wang, Xinzhi; Gobert, Geoffrey N; Feng, XinGang; Fu, Zhiqiang; Jin, Yamei; Peng, Jinbiao; Lin, Jiaojiao

    2009-07-01

    Schistosome parasites require a complex lifecycle requiring two hosts and aquatic phases of development. The schistosomula is a key phase of parasite development within the mammalian host, however relatively little is understood about the molecular processes underlying this stage. In this study 5723 subtractive expressed sequence tags (ESTs) were randomly selected from a 7 day hepatic schistosomula enriched library constructed using suppression subtractive hybridization method. Sequence analysis of these ESTs identified 1762 unique genes (contigs). Among them, 989 contigs were annotated with known genes, 311 contigs were homologous to established genes, 101 contigs were similar to established genes, 72 contigs were weakly similar to established genes and 289 sequences did not match any published sequences. Genes identified related to metabolism, cellular development, immune evasion and host-parasite interactions were identified as enriched in the hepatic schistosomula stage. The future identification of poorly annotated but stage-specific genes may potentially represent new drugs or vaccine targets, applicable for the future controlling of schistosomiasis. PMID:19428674

  11. Tightly Regulated Expression of Autographa californica Multicapsid Nucleopolyhedrovirus Immediate Early Genes Emerges from Their Interactions and Possible Collective Behaviors

    PubMed Central

    Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

    2015-01-01

    To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network. PMID:25816136

  12. Expression of Putative Immune Response Genes during Early Ontogeny in the Coral Acropora millepora

    PubMed Central

    Puill-Stephan, Eneour; Seneca, François O.; Miller, David J.; van Oppen, Madeleine J. H.; Willis, Bette L.

    2012-01-01

    Background Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Methodology/Principal Findings Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A.millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Conclusions/Significance Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of

  13. Early embryonic failure: Expression and imprinted status of candidate genes on human chromosome 21

    SciTech Connect

    Sherman, L.S.; Bennett, P.R.; Moore, G.E.

    1994-09-01

    Two cases of maternal uniparental (hetero)disomy for human chromosome 21 (mUPD21) have been identified in a systematic search for UPD in 23 cases of early embryonic failure (EEF). Bi-parental origin of the other chromosome pairs was confirmed using specific VNTR probes or dinucleotide repeat analysis. Both maternally and paternally derived isochromosomes 21q have previously been identified in two individuals with normal phenotypes. Full UPD21 has a different mechanism of origin than uniparental isochromosome 21q and its effect on imprinted genes and phenotypic outcome will therefore not necessarily be the same. EEF associated with mUPD21 suggests that developmentally important genes on HSA 21 may be imprinted such that they are only expressed from either the maternally or paternally derived alleles. We have searched for monoallelic expression of candidate genes on HSA 21 in human pregnancy (CBS, IFNAR, COL6A1) using intragenic DNA polymorphisms. These genes were chosen either because their murine homologues lie in imprinted regions or because they are potentially important in embryogenesis. Once imprinted candidate genes have been identified, their methylation status and expression in normal, early embryonic failure and uniparental disomy 21 pregnancies will be studied. At the same time, a larger number of cases of EEF are being examined to further investigate the incidence of UPD21 in this group.

  14. Expression of immediate early genes after treatment of human astrocytoma cells with radiation and taxol

    SciTech Connect

    Gubits, R.M.; Geard, C.R.; Schiff, P.B.

    1993-10-20

    The promising chemotherapeutic agent, taxol, has been shown to sensitize the G18 line of human astrocytoma cells to ionizing radiation. The present studies were performed to identify specific changes in gene expression associated with this altered sensitivity. The products of immediate early genes, which are induced transiently in cells in response to a variety of treatments, including growth factors, neurotransmitters, and irradiation with UV light or X rays, are thought to initiate a cascade of genetic responses to alterations in cellular environment. The present results demonstrate a dramatic attenuation in one immediate early gene response in association with a treatment that enhances radiosensitivity in a refractory human brain tumor line. 22 refs., 5 figs., 1 tab.

  15. Global gene expression analysis of early response to chemotherapy treatment in ovarian cancer spheroids

    PubMed Central

    L'Espérance, Sylvain; Bachvarova, Magdalena; Tetu, Bernard; Mes-Masson, Anne-Marie; Bachvarov, Dimcho

    2008-01-01

    Background Chemotherapy (CT) resistance in ovarian cancer (OC) is broad and encompasses diverse unrelated drugs, suggesting more than one mechanism of resistance. To better understand the molecular mechanisms controlling the immediate response of OC cells to CT exposure, we have performed gene expression profiling in spheroid cultures derived from six OC cell lines (OVCAR3, SKOV3, TOV-112, TOV-21, OV-90 and TOV-155), following treatment with 10,0 μM cisplatin, 2,5 μM paclitaxel or 5,0 μM topotecan for 72 hours. Results Exposure of OC spheroids to these CT drugs resulted in differential expression of genes associated with cell growth and proliferation, cellular assembly and organization, cell death, cell cycle control and cell signaling. Genes, functionally involved in DNA repair, DNA replication and cell cycle arrest were mostly overexpressed, while genes implicated in metabolism (especially lipid metabolism), signal transduction, immune and inflammatory response, transport, transcription regulation and protein biosynthesis, were commonly suppressed following all treatments. Cisplatin and topotecan treatments triggered similar alterations in gene and pathway expression patterns, while paclitaxel action was mainly associated with induction of genes and pathways linked to cellular assembly and organization (including numerous tubulin genes), cell death and protein synthesis. The microarray data were further confirmed by pathway and network analyses. Conclusion Most alterations in gene expression were directly related to mechanisms of the cytotoxics actions in OC spheroids. However, the induction of genes linked to mechanisms of DNA replication and repair in cisplatin- and topotecan-treated OC spheroids could be associated with immediate adaptive response to treatment. Similarly, overexpression of different tubulin genes upon exposure to paclitaxel could represent an early compensatory effect to this drug action. Finally, multicellular growth conditions that are

  16. Role of the Bacillus subtilis gsiA gene in regulation of early sporulation gene expression.

    PubMed Central

    Mueller, J P; Sonenshein, A L

    1992-01-01

    The Bacillus subtilis gsiA operon was induced rapidly, but transiently, as cells entered the stationary phase in nutrient broth medium. A mutation at the gsiC locus caused sporulation to be defective and expression of gsiA to be elevated and prolonged. The sporulation defect in this strain was apparently due to persistent expression of gsiA, since a gsiA null mutation restored sporulation to wild-type levels. Detailed mapping experiments revealed that the gsiC82 mutation lies within the kinA gene, which encodes the histidine protein kinase member of a two-component regulatory system. Since mutations in this gene caused a substantial blockage in expression of spoIIA, spoIIG, and spoIID genes, it seems that accumulation of a product of the gsiA operon interferes with sporulation by blocking the completion of stage II. It apparently does so by inhibiting or counteracting the activity of KinA. PMID:1624431

  17. Early Evolution of Vertebrate Mybs: An Integrative Perspective Combining Synteny, Phylogenetic, and Gene Expression Analyses.

    PubMed

    Campanini, Emeline B; Vandewege, Michael W; Pillai, Nisha E; Tay, Boon-Hui; Jones, Justin L; Venkatesh, Byrappa; Hoffmann, Federico G

    2015-11-01

    The genes in the Myb superfamily encode for three related transcription factors in most vertebrates, A-, B-, and c-Myb, with functionally distinct roles, whereas most invertebrates have a single Myb. B-Myb plays an essential role in cell division and cell cycle progression, c-Myb is involved in hematopoiesis, and A-Myb is involved in spermatogenesis and regulating expression of pachytene PIWI interacting RNAs, a class of small RNAs involved in posttranscriptional gene regulation and the maintenance of reproductive tissues. Comparisons between teleost fish and tetrapods suggest that the emergence and functional divergence of the Myb genes were linked to the two rounds of whole-genome duplication early in vertebrate evolution. We combined phylogenetic, synteny, structural, and gene expression analyses of the Myb paralogs from elephant shark and lampreys with data from 12 bony vertebrates to reconstruct the early evolution of vertebrate Mybs. Phylogenetic and synteny analyses suggest that the elephant shark and Japanese lamprey have copies of the A-, B-, and c-Myb genes, implying their origin could be traced back to the common ancestor of lampreys and gnathostomes. However, structural and gene expression analyses suggest that their functional roles diverged between gnathostomes and cyclostomes. In particular, we did not detect A-Myb expression in testis suggesting that the involvement of A-Myb in the pachytene PIWI interacting RNA pathway is probably a gnathostome-specific innovation. We speculate that the secondary loss of a central domain in lamprey A-Myb underlies the functional differences between the cyclostome and gnathostome A-Myb proteins. PMID:26475318

  18. Expression of cyr61, a growth factor-inducible immediate-early gene.

    PubMed Central

    O'Brien, T P; Yang, G P; Sanders, L; Lau, L F

    1990-01-01

    A set of immediate-early genes that are rapidly activated by serum or purified platelet-derived growth factor in mouse 3T3 fibroblasts has been previously identified. Among these genes, several are related to known or putative transcription factors and growth factors, supporting the notion that some of these genes encode regulatory molecules important to cell growth. We show here that a member of this set of genes, cyr61 (originally identified by its cDNA 3CH61), encodes a 379-amino-acid polypeptide rich in cysteine residues. cyr61 can be induced through protein kinase C-dependent and -independent pathways. Unlike many immediate-early genes that are transiently expressed, the cyr61 mRNA is accumulated from the G0/G1 transition through mid-G1. This expression pattern is due to persistent transcription, while the mRNA is rapidly turned over during the G0/G1 transition and in mid-G1 at the same rate. In logarithmically growing cells, the cyr61 mRNA level is constant throughout the cell cycle. Cyr61 contains an N-terminal secretory signal sequence; however, it is not detected in the culture medium by immunoprecipitation. Cyr61 is synthesized maximally at 1 to 2 h after serum stimulation and has a short half-life within the cell. Images PMID:2355916

  19. BEST: a novel computational approach for comparing gene expression patterns from early stages of Drosophila melanogaster development.

    PubMed Central

    Kumar, Sudhir; Jayaraman, Karthik; Panchanathan, Sethuraman; Gurunathan, Rajalakshmi; Marti-Subirana, Ana; Newfeld, Stuart J

    2002-01-01

    Embryonic gene expression patterns are an indispensable part of modern developmental biology. Currently, investigators must visually inspect numerous images containing embryonic expression patterns to identify spatially similar patterns for inferring potential genetic interactions. The lack of a computational approach to identify pattern similarities is an impediment to advancement in developmental biology research because of the rapidly increasing amount of available embryonic gene expression data. Therefore, we have developed computational approaches to automate the comparison of gene expression patterns contained in images of early stage Drosophila melanogaster embryos (prior to the beginning of germ-band elongation); similarities and differences in gene expression patterns in these early stages have extensive developmental effects. Here we describe a basic expression search tool (BEST) to retrieve best matching expression patterns for a given query expression pattern and a computational device for gene interaction inference using gene expression pattern images and information on the associated genotypes and probes. Analysis of a prototype collection of Drosophila gene expression pattern images is presented to demonstrate the utility of these methods in identifying biologically meaningful matches and inferring gene interactions by direct image content analysis. In particular, the use of BEST searches for gene expression patterns is akin to that of BLAST searches for finding similar sequences. These computational developmental biology methodologies are likely to make the great wealth of embryonic gene expression pattern data easily accessible and to accelerate the discovery of developmental networks. PMID:12524369

  20. Lhx9 gene expression during early limb development in mice requires the FGF signalling pathway.

    PubMed

    Yang, Yisheng; Wilson, Megan J

    2015-01-01

    Lhx9 is a member of the LIM-homeodomain gene family necessary for the correct development of many organs including gonads, limbs, heart and the nervous system. In the context of limb development, Lhx9 has been implicated as an integrator for Fibroblast growth factor (FGF) and Sonic hedgehog (Shh) signalling required for proximal-distal (PD) and anterior-posterior (AP) development of the limb. Three splice variants of the Lhx9 transcript are expressed during development, two of which are predicted to act in a dominant negative fashion, competing with the DNA binding version of Lhx9 for binding to cofactors via the LIM-domain. We examined the expression pattern for the three alternative splice forms of Lhx9; Lhx9α, Lhx9β and Lhx9c during early limb development. We have found that of the three Lhx9 isoforms, only Lhx9α and Lhx9c (intact homeodomain) are expressed during early limb development, each with their own distinct expression pattern. Additionally we determined that Lhx9 expression overlaps with FGF10 expression in the developing limb bud mesenchyme. Limb bud explant cultures, in the presence of signalling pathway inhibitors, also indicated that Lhx9 mRNA expression in the limb bud was dependent on FGF signalling. PMID:26220830

  1. Fibrotic gene expression coexists with alveolar proteinosis in early indium lung.

    PubMed

    Noguchi, Shuhei; Eitoku, Masamitsu; Kiyosawa, Hidenori; Suganuma, Narufumi

    2016-08-01

    Occupational inhalation of indium compounds can cause the so-called "indium lung disease". Most affected individuals show pulmonary alveolar proteinosis (PAP) and fibrotic interstitial lung disease. In animal experiments, inhalation of indium tin oxide or indium oxide has been shown to cause lung damage. However, the mechanisms by which indium compounds lead to indium lung disease remain unknown. In this study, we constructed a mouse model of indium lung disease and analyzed gene expression in response to indium exposure. Indium oxide (In2O3, 10 mg/kg, primary particle size <100 nm) was administered intratracheally to C57BL/6 mice (male, 8 weeks of age) twice a week for 8 weeks. Four weeks after the final instillation, histopathological analysis exhibited periodic acid-Schiff positive material in the alveoli, characteristic of PAP. Comprehensive gene expression analysis by RNA-Seq, however, revealed expression of fibrosis-related genes, such as surfactant associated protein D, surfactant associated protein A1, mucin 1, and collagen type I and III, was significantly increased, indicating that fibrotic gene expression progresses in early phase of indium lung. These data supported the latest hypothesis that PAP occurs as an acute phase response and is replaced by fibrosis after long-term latency. PMID:27308969

  2. Gene expression profile and synovial microcirculation at early stages of collagen-induced arthritis

    PubMed Central

    Gierer, Philip; Ibrahim, Saleh; Mittlmeier, Thomas; Koczan, Dirk; Moeller, Steffen; Landes, Jürgen; Gradl, Georg; Vollmar, Brigitte

    2005-01-01

    A better understanding of the initial mechanisms that lead to arthritic disease could facilitate development of improved therapeutic strategies. We characterized the synovial microcirculation of knee joints in susceptible mouse strains undergoing intradermal immunization with bovine collagen II in complete Freund's adjuvant to induce arthritis (i.e. collagen-induced arthritis [CIA]). Susceptible DBA1/J and collagen II T-cell receptor transgenic mice were compared with CIA-resistant FVB/NJ mice. Before onset of clinical symptoms of arthritis, in vivo fluorescence microscopy of knee joints revealed marked leucocyte activation and interaction with the endothelial lining of synovial microvessels. This initial inflammatory cell response correlated with the gene expression profile at this disease stage. The majority of the 655 differentially expressed genes belonged to classes of genes that are involved in cell movement and structure, cell cycle and signal transduction, as well as transcription, protein synthesis and metabolism. However, 24 adhesion molecules and chemokine/cytokine genes were identified, some of which are known to contribute to arthritis (e.g. CD44 and neutrophil cytosolic factor 1) and some of which are novel in this respect (e.g. CC chemokine ligand-27 and IL-13 receptor α1). Online in vivo data on synovial tissue microcirculation, together with gene expression profiling, emphasize the potential role played by early inflammatory events in the development of arthritis. PMID:15987489

  3. Gene expression profiling of peripheral blood cells for early detection of breast cancer

    PubMed Central

    2010-01-01

    Introduction Early detection of breast cancer is key to successful treatment and patient survival. We have previously reported the potential use of gene expression profiling of peripheral blood cells for early detection of breast cancer. The aim of the present study was to refine these findings using a larger sample size and a commercially available microarray platform. Methods Blood samples were collected from 121 females referred for diagnostic mammography following an initial suspicious screening mammogram. Diagnostic work-up revealed that 67 of these women had breast cancer while 54 had no malignant disease. Additionally, nine samples from six healthy female controls were included. Gene expression analyses were conducted using high density oligonucleotide microarrays. Partial Least Squares Regression (PLSR) was used for model building while a leave-one-out (LOO) double cross validation approach was used to identify predictors and estimate their prediction efficiency. Results A set of 738 probes that discriminated breast cancer and non-breast cancer samples was identified. By cross validation we achieved an estimated prediction accuracy of 79.5% with a sensitivity of 80.6% and a specificity of 78.3%. The genes deregulated in blood of breast cancer patients are related to functional processes such as defense response, translation, and various metabolic processes, such as lipid- and steroid metabolism. Conclusions We have identified a gene signature in whole blood that classifies breast cancer patients and healthy women with good accuracy supporting our previous findings. PMID:20078854

  4. Modeling the Kinetics of a Memory-Associated Immediate Early Gene's Compartmental Expression After Sensory Experience

    NASA Astrophysics Data System (ADS)

    Willats, Adam; Ivanova, Tamara; Prinz, Astrid; Liu, Robert

    2015-03-01

    Immediate Early Genes (IEGs) are rapidly and transiently transcribed in neurons after a sensory experience. Some of these genes act as effector IEGs, which mediate specific effects on cellular function. Arc is one such effector IEG that is essential for synaptic plasticity and memory consolidation in hippocampus and cortex. The expression of Arc in neurons has previously been examined using an imaging method known as Compartmental Analysis of Temporal Fluorescent In-Situ Hybridization. Previous work found that the time course of Arc expression within the nuclear and perinuclear cytoplasmic compartments of a neuron is altered by prior sensory experience. We explore a simple model of the kinetics of IEG transcription and nuclear export, with the aim of eventually uncovering possible mechanisms for how experience alters expression kinetics. Thus far, we characterize our compartmental model using phase-plane analysis and validate it against several IEG expression data sets, including one where prior experience with vocalizing mice alters the time course of call-induced Arc expression in the auditory cortex of a listening mouse. Our model provides a framework to explore why Arc expression may change depending on a receiver's past sound experience and internal state. Adam Willats was supported by NIH Training Grant 5T90DA032466. This research was also supported by NIDCD R01 DC8343.

  5. Dynamics of gene expression patterns during early development of the European seabass (Dicentrarchus labrax).

    PubMed

    Kaitetzidou, E; Xiang, J; Antonopoulou, E; Tsigenopoulos, C S; Sarropoulou, E

    2015-05-01

    Larval and embryonic stages are the most critical period in the life cycle of marine fish. Key developmental events occur early in development and are influenced by external parameters like stress, temperature, salinity, and photoperiodism. Any failure may cause malformations, developmental delays, poor growth, and massive mortalities. Advanced understanding of molecular processes underlying marine larval development may lead to superior larval rearing conditions. Today, the new sequencing and bioinformatic methods allow transcriptome screens comprising messenger (mRNA) and microRNA (miRNA) with the scope of detecting differential expression for any species of interest. In the present study, we applied Illumina technology to investigate the transcriptome of early developmental stages of the European seabass (Dicentrarchus labrax). The European seabass, in its natural environment, is a euryhaline species and has shown high adaptation processes in early life phases. During its embryonic and larval phases the European seabass lives in a marine environment and as a juvenile it migrates to coastal zones, estuaries, and lagoons. Investigating the dynamics of gene expression in its early development may shed light on factors promoting phenotypic plasticity and may also contribute to the improvement and advancement of rearing methods of the European seabass, a species of high economic importance in European and Mediterranean aquaculture. We present the identification, characterization, and expression of mRNA and miRNA, comprising paralogous genes and differentially spliced transcripts from early developmental stages of the European seabass. We further investigated the detection of possible interactions of miRNA with mRNA. PMID:25736025

  6. A developmental characterization of mesolimbocortical serotonergic gene expression changes following early immune challenge.

    PubMed

    Sidor, M M; Amath, A; MacQueen, G; Foster, J A

    2010-12-15

    An immunogenic challenge during early postnatal development leads to long-term changes in behavioural and physiological measures reflecting enhanced emotionality and anxiety. Altered CNS serotonin (5-HT) signalling during the third postnatal week is thought to modify the developing neurocircuitry governing anxiety-like behaviour. Changes in 5-HT signalling during this time window may underlie increased emotionality reported in early immune challenge rodents. Here we examine both the spatial and temporal profile of 5-HT related gene expression, including 5HT1A, 2A, 2C receptors, the 5-HT transporter (5HTT), and tryptophan hydroxylase 2 (TPH2) during early development (postnatal day [P]14, P17, P21, P28) in mice challenged with lipopolysaccharide (LPS) during the first postnatal week. Expression levels were measured using in situ hybridization in regions associated with mediating emotive behaviours: the dorsal raphe (DR), hippocampus, amygdala, and prefrontal cortex (PFC). Increased TPH2 and 5HTT expression in the ventrolateral region of the DR of LPS-mice accompanied decreased expression of ventral DR 5HT1A and dorsal DR 5HTT. In the forebrain, 5HT1A and 2A receptors were increased, whereas 5HT2C receptors were decreased in the hippocampus. Decreased mRNA expression of 5HT2C was detected in the amygdala and PFC of LPS-treated pups; 5HT1A was increased in the PFC. The majority of these changes were restricted to P14-21. These transient changes in 5-HT expression coincide with the critical time window in which 5-HT disturbance leads to permanent modification of anxiety-related behaviours. This suggests that alterations in CNS 5-HT during development may underlie the enhanced emotionality associated with an early immune challenge. PMID:20816924

  7. Comparative gene expression analysis of Dtg, a novel target gene of Dpp signaling pathway in the early Drosophila melanogaster embryo.

    PubMed

    Hodar, Christian; Zuñiga, Alejandro; Pulgar, Rodrigo; Travisany, Dante; Chacon, Carlos; Pino, Michael; Maass, Alejandro; Cambiazo, Verónica

    2014-02-10

    In the early Drosophila melanogaster embryo, Dpp, a secreted molecule that belongs to the TGF-β superfamily of growth factors, activates a set of downstream genes to subdivide the dorsal region into amnioserosa and dorsal epidermis. Here, we examined the expression pattern and transcriptional regulation of Dtg, a new target gene of Dpp signaling pathway that is required for proper amnioserosa differentiation. We showed that the expression of Dtg was controlled by Dpp and characterized a 524-bp enhancer that mediated expression in the dorsal midline, as well as, in the differentiated amnioserosa in transgenic reporter embryos. This enhancer contained a highly conserved region of 48-bp in which bioinformatic predictions and in vitro assays identified three Mad binding motifs. Mutational analysis revealed that these three motifs were necessary for proper expression of a reporter gene in transgenic embryos, suggesting that short and highly conserved genomic sequences may be indicative of functional regulatory regions in D. melanogaster genes. Dtg orthologs were not detected in basal lineages of Dipterans, which unlike D. melanogaster develop two extra-embryonic membranes, amnion and serosa, nevertheless Dtg orthologs were identified in the transcriptome of Musca domestica, in which dorsal ectoderm patterning leads to the formation of a single extra-embryonic membrane. These results suggest that Dtg was recruited as a new component of the network that controls dorsal ectoderm patterning in the lineage leading to higher Cyclorrhaphan flies, such as D. melanogaster and M. domestica. PMID:24321690

  8. Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution.

    PubMed

    Gómez-Sagasti, María T; Becerril, José M; Epelde, Lur; Alkorta, Itziar; Garbisu, Carlos

    2015-02-01

    The molecular response of Pseudomonas fluorescens cells exposed to a mixture of heavy metals remains largely unknown. Here, we studied the temporal changes in the early gene expression of P. fluorescens cells exposed to three doses of a polymetallic solution over two exposure times, through the application of a customized cDNA microarray. At the lowest metal dose (MD/4), we observed a repression of the Hsp70 chaperone system, MATE and MFS transporters, TonB membrane transporter and histidine kinases, together with an overexpression of metal transport (ChaC, CopC), chemotaxis and glutamine synthetase genes. At the intermediate metal dose (MD), several amino acid transporters, a response regulator (CheY), a TonB-dependent receptor and the mutT DNA repair gene were repressed; by contrast, an overexpression of genes associated with the antioxidative stress system and the transport of chelates and sulfur was observed. Finally, at the highest metal dose (4MD), a repression of genes encoding metal ion transporters, drug resistance and alginate biosynthesis was found, together with an overexpression of genes encoding antioxidative proteins, membrane transporters, ribosomal proteins, chaperones and proteases. It was concluded that P. fluorescens cells showed, over exposure time, a highly complex molecular response when exposed to a polymetallic solution, involving mechanisms related with chemotaxis, signal transmission, membrane transport, cellular redox state, and the regulation of transcription and ribosomal activity. PMID:25754557

  9. Activation of GATA4 gene expression at the early stage of cardiac specification

    NASA Astrophysics Data System (ADS)

    Yilbas, Ayse; Hamilton, Alison; Wang, Yingjian; Mach, Hymn; Lacroix, Natascha; Davis, Darryl; Chen, Jihong; LI, Qiao

    2014-03-01

    Currently, there are no effective treatments to directly repair damaged heart tissue after cardiac injury since existing therapies focus on rescuing or preserving reversibly damaged tissue. Cell-based therapies using cardiomyocytes generated from stem cells present a promising therapeutic approach to directly replace damaged myocardium with new healthy tissue. However, the molecular mechanisms underlying the commitment of stem cells into cardiomyocytes are not fully understood and will be critical to guide this new technology into the clinic. Since GATA4 is a critical regulator of cardiac differentiation, we examined the molecular basis underlying the early activation of GATA4 gene expression during cardiac differentiation of pluripotent stem cells. Our studies demonstrate the direct involvement of histone acetylation and transcriptional coactivator p300 in the regulation of GATA4 gene expression. More importantly, we show that histone acetyltransferase (HAT) activity is important for GATA4 gene expression with the use of curcumin, a HAT inhibitor. In addition, the widely used histone deacetylase inhibitor valproic acid enhances both histone acetylation and cardiac specification.

  10. Expression of Potential Regulatory Genes in Abdominal Adipose Tissue of Broiler Chickens during Early Development.

    PubMed

    Bohannon-Stewart, Ann; Kelley, Gary; Kimathi, Boniface; Subramanya, Sri Harsha K V; Donkor, Joseph; Darris, Carl; Tyus, James; Payne, Ashley; Byers, Shannon; Hui, Dafeng; Nahashon, Samuel; Chen, Fur-Chi; Ivy, Michael; Wang, Xiaofei

    2014-01-01

    The identities of genes that underlie population variation in adipose tissue development in farm animals are poorly understood. Previous studies in our laboratory have suggested that increased fat tissue involves the expression modulation of an array of genes in broiler chickens. Of special interest are eight genes, FGFR3, EPHB2, IGFBP2, GREM1, TNC, COL3A1, ACBD7, and SCD. To understand their expression regulation and response to dietary manipulation, we investigated their mRNA levels after dietary manipulation during early development. Chickens were fed either a recommended standard or a high caloric diet from hatch to eight weeks of age (WOA). The high caloric diet markedly affected bodyweight of the broiler birds. mRNA levels of the eight genes in the abdominal adipose tissue were assayed at 2, 4, 6, and 8 WOA using RT-qPCR. Results indicate that (1) FGFR3 mRNA level was affected significantly by diet, age, and diet:age interaction; (2) COL3A mRNA level was repressed by high caloric diet; (3) mRNA levels of EPHB2, ACBD7, and SCD were affected by age; (4) mRNA level of TNC was modulated by age:diet interaction; (5) changes in GREM1 and IGFBP2 mRNA levels were not statistically different. PMID:24551454

  11. Expression of Potential Regulatory Genes in Abdominal Adipose Tissue of Broiler Chickens during Early Development

    PubMed Central

    Bohannon-Stewart, Ann; Subramanya, Sri Harsha K. V.; Donkor, Joseph; Tyus, James; Hui, Dafeng; Ivy, Michael

    2014-01-01

    The identities of genes that underlie population variation in adipose tissue development in farm animals are poorly understood. Previous studies in our laboratory have suggested that increased fat tissue involves the expression modulation of an array of genes in broiler chickens. Of special interest are eight genes, FGFR3, EPHB2, IGFBP2, GREM1, TNC, COL3A1, ACBD7, and SCD. To understand their expression regulation and response to dietary manipulation, we investigated their mRNA levels after dietary manipulation during early development. Chickens were fed either a recommended standard or a high caloric diet from hatch to eight weeks of age (WOA). The high caloric diet markedly affected bodyweight of the broiler birds. mRNA levels of the eight genes in the abdominal adipose tissue were assayed at 2, 4, 6, and 8 WOA using RT-qPCR. Results indicate that (1) FGFR3 mRNA level was affected significantly by diet, age, and diet:age interaction; (2) COL3A mRNA level was repressed by high caloric diet; (3) mRNA levels of EPHB2, ACBD7, and SCD were affected by age; (4) mRNA level of TNC was modulated by age:diet interaction; (5) changes in GREM1 and IGFBP2 mRNA levels were not statistically different. PMID:24551454

  12. Gene expression analysis of early and late maturation stage rat enamel organ

    PubMed Central

    LACRUZ, RODRIGO S.; SMITH, CHARLES E.; CHEN, YI-BU; HUBBARD, MICHAEL J.; HACIA, JOSEPH G.; PAINE, MICHAEL L.

    2011-01-01

    Enamel maturation is a dynamic process that involves high rates of mineral acquisition, associated fluctuations in extracellular pH and resorption of extracellular enamel proteins. During maturation, ameloblasts change from a tall, thin and highly polarized organization characteristic of the secretory stage, to a low columnar and widened morphology in the maturation stage. To identify potential differences in gene expression throughout maturation, we obtained enamel organ epithelial cells derived from the early and late maturation stages from rat incisor and analyzed global gene expression profiles at each stage. Sixty three candidate genes were identified with potential roles in the maturation process. qPCR was used to confirm results from this genome-wide analysis in a subset of genes. Enriched transcripts in late maturation (n= 38) included those associated with lysosomal activity, solute carrier transport and calcium signaling. Cellular responses to oxidative stress, proton transport, cell death and immune system-related transcripts were also up-regulated. Transcripts down-regulated in the late maturation stage (n= 25) included those with functions related to cell adhesion, cell signaling, and T-cell activation. These results indicate that ameloblasts undergo widespread molecular changes during the maturation stage of amelogenesis and so provide the bases for future functional investigations into the mechanistic basis of enamel mineralization. PMID:22243241

  13. Autoregulation of Adenovirus Type 5 Early Gene Expression II. Effect of Temperature-Sensitive Early Mutations on Virus RNA Accumulation

    PubMed Central

    Carter, T. H.; Blanton, R. A.

    1978-01-01

    The kinetics of accumulation of early virus RNA in the cytoplasm of KB cells infected at 40.5°C by wild-type (WT) adenovirus type 5 and a temperature-sensitive “early” mutant, H5ts125 (ts125), were compared by hybridization of unlabeled RNA in solution to the 3H-labeled l strand of Ad5 DNA HindIII restriction endonuclease fragment A. In the presence of 1-β-d-arabinofuranosylcytosine, Al RNA accumulated in WT-infected cells for 9 h and then decreased in concentration to 6% of the 9-h concentration by 18 h. In ts125-infected cells, Al RNA accumulated for 12 h and then remained at the same concentration for at least 6 h thereafter. The concentrations of virus RNA from the four early transcription regions of the genome were measured at 15 h in cells infected at 40.5°C in the presence of 1-β-d-arabinofuranosylcytosine by: (i) ts125 and WT; (ii) two other ts early mutants, ts107 and ts149; and (iii) a revertant of ts125. The revertant and ts149, a mutant from a different complementation group than ts125, both accumulated all early virus cytoplasmic RNA species in amounts similar to, or less than, WT. However, both ts125 and ts107, independently isolated mutations in the 72,000-molecular-weight (72K) DNA-binding protein gene, accumulated cytoplasmic early RNA in excess of that found in WT infection. This pattern of RNA accumulation with the mutants and WT virus was the same in the nuclei as in the cytoplasm at 40.5°C. At 32°C, however, the abundance of nuclear virus RNA from all four early regions was the same in cells infected by either ts125 or WT. Differences in the relative abundance of nuclear RNA from the four early regions were observed in cells infected at 40.5 and 32°C, but were not dependent upon the infecting virus genotype. These results are consistent with autoregulation of early gene expression by the 72K protein and support the hypothesis that the 72K protein either decreases the rate of early virus transcription or increases the rate of virus

  14. Novel Implant Coating Agent Promotes Gene Expression of Osteogenic Markers in Rats during Early Osseointegration

    PubMed Central

    Bougas, Kostas; Jimbo, Ryo; Xue, Ying; Mustafa, Kamal; Wennerberg, Ann

    2012-01-01

    The aim of this study was to evaluate the early bone response around laminin-1-coated titanium implants. Forty-five rats distributed in three equally sized groups were provided with one control (turned) and one test (laminin-1-coated) implant and were sacrificed after 3, 7, and 21 days. Real-time reverse-transcriptase polymerase chain reaction was performed for osteoblast markers (alkaline phosphatase, runt-related transcription factor 2, osteocalcin, type I collagen, and bone morphogenic protein 2), osteoclast markers (cathepsin K and tartrate-resistant acid phosphatase), inflammation markers (tumor necrosis factor α, interleukin 1β and interleukin 10), and integrin β1. Bone implant contact (BIC) and bone area (BA) were assessed and compared to the gene expression. After 3 days, the expression of bone markers was higher for the control group. After 7 days, the expression of integrin β1 and osteogenic markers was enhanced for the test group, while cathepsin K and inflammation markers were down-regulated. No significant differences in BIC or BA were detected between test and control at any time point. As a conclusion, implant coating with laminin-1 altered gene expression in the bone-implant interface. However, traditional evaluation methods, as histomorphometry, were not adequately sensitive to detect such changes due to the short follow-up time. PMID:23193408

  15. Effect of Hyperglycemia on Gene Expression during Early Organogenesis in Mice

    PubMed Central

    Zhao, Jing; Hakvoort, Theodorus B. M.; Willemsen, A. Marcel; Jongejan, Aldo; Sokolovic, Milka; Bradley, Edward J.; de Boer, Vincent C. J.; Baas, Frank; van Kampen, Antoine H. C.; Lamers, Wouter H.

    2016-01-01

    Background Cardiovascular and neural malformations are common sequels of diabetic pregnancies, but the underlying molecular mechanisms remain unknown. We hypothesized that maternal hyperglycemia would affect the embryos most shortly after the glucose-sensitive time window at embryonic day (ED) 7.5 in mice. Methods Mice were made diabetic with streptozotocin, treated with slow-release insulin implants and mated. Pregnancy aggravated hyperglycemia. Gene expression profiles were determined in ED8.5 and ED9.5 embryos from diabetic and control mice using Serial Analysis of Gene Expression and deep sequencing. Results Maternal hyperglycemia induced differential regulation of 1,024 and 2,148 unique functional genes on ED8.5 and ED9.5, respectively, mostly in downward direction. Pathway analysis showed that ED8.5 embryos suffered mainly from impaired cell proliferation, and ED9.5 embryos from impaired cytoskeletal remodeling and oxidative phosphorylation (all P ≤ E-5). A query of the Mouse Genome Database showed that 20–25% of the differentially expressed genes were caused by cardiovascular and/or neural malformations, if deficient. Despite high glucose levels in embryos with maternal hyperglycemia and a ~150-fold higher rate of ATP production from glycolysis than from oxidative phosphorylation on ED9.5, ATP production from both glycolysis and oxidative phosphorylation was reduced to ~70% of controls, implying a shortage of energy production in hyperglycemic embryos. Conclusion Maternal hyperglycemia suppressed cell proliferation during gastrulation and cytoskeletal remodeling during early organogenesis. 20–25% of the genes that were differentially regulated by hyperglycemia were associated with relevant congenital malformations. Unexpectedly, maternal hyperglycemia also endangered the energy supply of the embryo by suppressing its glycolytic capacity. PMID:27433804

  16. Structural organization, expression, and functional characterization of the murine cytomegalovirus immediate-early gene 3.

    PubMed Central

    Messerle, M; Bühler, B; Keil, G M; Koszinowski, U H

    1992-01-01

    We have previously defined ie3 as a coding region located downstream of the ie1 gene which gives rise to a 2.75-kb immediate-early (IE) transcript. Here we describe the structural organization of the ie3 gene, the amino acid sequence of the gene product, and some of the functional properties of the protein. The 2.75-kb ie3 mRNA is generated by splicing and is composed of four exons. The first three exons, of 300, 111, and 191 nucleotides (nt), are shared with the ie1 mRNA and are spliced to exon 5, which is located downstream of the fourth exon used by the ie1 mRNA. Exon 5 starts 28 nt downstream of the 3' end of the ie1 mRNA and has a length of 1,701 nt. The IE3 protein contains 611 amino acids, the first 99 of which are shared with the ie1 product pp89. The IE3 protein expressed at IE times has a relative mobility of 88 kDa in gels, and a mobility shift to 90 kDa during the early phase is indicative of posttranslational modification. Sequence comparison reveals significant homology of the exon 5-encoded amino acid sequence with the respective sequence of UL 122, a component of the IE1-IE2 complex of human cytomegalovirus (HCMV). This homology is also apparent at the functional level. The IE3 protein is a strong transcriptional activator of the murine cytomegalovirus (MCMV) e1 promoter and shows an autoregulatory function by repression of the MCMV ie1/ie3 promoter. The high degree of conservation between the MCMV ie3 and HCMV IE2 genes and their products with regard to gene structure, amino acid sequence, and protein functions suggests that these genes play a comparable role in the transcriptional control of the two cytomegaloviruses. Images PMID:1309246

  17. Gene Expression Associated with Early and Late Chronotypes in Drosophila melanogaster

    PubMed Central

    Pegoraro, Mirko; Picot, Emma; Hansen, Celia N.; Kyriacou, Charalambos P.; Rosato, Ezio; Tauber, Eran

    2015-01-01

    The circadian clock provides the temporal framework for rhythmic behavioral and metabolic functions. In the modern era of industrialization, work, and social pressures, clock function is jeopardized, and can result in adverse and chronic effects on health. Understanding circadian clock function, particularly individual variation in diurnal phase preference (chronotype), and the molecular mechanisms underlying such chronotypes may lead to interventions that could abrogate clock dysfunction and improve human (and animal) health and welfare. Our preliminary studies suggested that fruit-flies, like humans, can be classified as early rising “larks” or late rising “owls,” providing a convenient model system for these types of studies. We have identified strains of flies showing increased preference for morning emergence (Early or E) from the pupal case, or more pronounced preference for evening emergence (Late or L). We have sampled pupae the day before eclosion (fourth day after pupariation) at 4 h intervals in the E and L strains, and examined differences in gene expression by RNA-seq. We have identified differentially expressed transcripts between the E and L strains, which provide candidate genes for subsequent studies of Drosophila chronotypes and their human orthologs. PMID:26097463

  18. Central Renin Injections: Effects on Drinking and Expression of Immediate Early Genes

    NASA Technical Reports Server (NTRS)

    Xu, Zhice; Johnson, Alan Kim

    1998-01-01

    This study investigated the drinking response and the expression of Fos- and Egr-1-immunoreactivity (Fos-ir, Egr-1-ir) in the brain induced by endogenous angiotensin generated by intracerebroventricular (i.c.v.) injection of renin. Renin induced Fos-ir in the subformical organ (SFO), median preoptic (MnPO), supraoptic and paraventricular nuclei (SON and PVN), area postrema (AP), nuclei of the solitary tract (NTS) and lateral parabrachial nuclei (LPBN). Renin-induced Egr-1-ir exhibited a similar pattern of distribution as that observed for Fos-ir. The dose of i.c.v. renin that induced expression of immediate early gene (IEG) product immunoreactivity also produced vigorous drinking. When renin-injected rats were pretreated with captopril, an angiotensin converting enzyme inhibitor, drinking was blocked. With the same captopril pretreatment, both Fos- and Egr-1-ir in the SFO, MnPO, SON, PVN, AP and LPBN were also significantly reduced.

  19. Functional characterization of calliphorid cell death genes and cellularization gene promoters for controlling gene expression and cell viability in early embryos.

    PubMed

    Edman, R M; Linger, R J; Belikoff, E J; Li, F; Sze, S-H; Tarone, A M; Scott, M J

    2015-02-01

    The New World screwworm fly, Cochliomyia hominivorax, and the Australian sheep blow fly, Lucilia cuprina, are major pests of livestock. The sterile insect technique was used to eradicate C. hominivorax from North and Central America. This involved area-wide releases of male and female flies that had been sterilized by radiation. Genetic systems have been developed for making 'male-only' strains that would improve the efficiency of genetic control of insect pests. One system involves induction of female lethality in embryos through activation of a pro-apoptotic gene by the tetracycline-dependent transactivator. Sex-specific expression is achieved using an intron from the transformer gene, which we previously isolated from several calliphorids. In the present study, we report the isolation of the promoters from the C. hominivorax slam and Lucilia sericata bnk cellularization genes and show that these promoters can drive expression of a GFP reporter gene in early embryos of transgenic L. cuprina. Additionally, we report the isolation of the L. sericata pro-apoptotic hid and rpr genes, identify conserved motifs in the encoded proteins and determine the relative expression of these genes at different stages of development. We show that widespread expression of the L. sericata pro-apoptotic genes was lethal in Drosophila melanogaster. The isolated gene promoters and pro-apoptotic genes could potentially be used to build transgenic embryonic sexing strains of calliphorid livestock pests. PMID:25225046

  20. Gene expression profiling of reproductive meristem types in early rice inflorescences by laser microdissection.

    PubMed

    Harrop, Thomas W R; Ud Din, Israr; Gregis, Veronica; Osnato, Michela; Jouannic, Stefan; Adam, Hélène; Kater, Martin M

    2016-04-01

    In rice, inflorescence architecture is established at early stages of reproductive development and contributes directly to grain yield potential. After induction of flowering, the complexity of branching, and therefore the number of seeds on the panicle, is determined by the activity of different meristem types and the timing of transitions between them. Although some of the genes involved in these transitions have been identified, an understanding of the network of transcriptional regulators controlling this process is lacking. To address this we used a precise laser microdissection and RNA-sequencing approach in Oryza sativa ssp. japonica cv. Nipponbare to produce quantitative data that describe the landscape of gene expression in four different meristem types: the rachis meristem, the primary branch meristem, the elongating primary branch meristem (including axillary meristems), and the spikelet meristem. A switch in expression profile between apical and axillary meristem types followed by more gradual changes during transitions in axillary meristem identity was observed, and several genes potentially involved in branching were identified. This resource will be vital for a mechanistic understanding of the link between inflorescence development and grain yield. PMID:26932536

  1. Altered gene expression in dry age-related macular degeneration suggests early loss of choroidal endothelial cells

    PubMed Central

    Whitmore, S. Scott; Braun, Terry A.; Skeie, Jessica M.; Haas, Christine M.; Sohn, Elliott H.; Stone, Edwin M.; Scheetz, Todd E.

    2013-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in developed countries. The molecular pathogenesis of early events in AMD is poorly understood. We investigated differential gene expression in samples of human retinal pigment epithelium (RPE) and choroid from early AMD and control maculas with exon-based arrays. Methods Gene expression levels in nine human donor eyes with early AMD and nine control human donor eyes were assessed using Affymetrix Human Exon ST 1.0 arrays. Two controls did not pass quality control and were removed. Differentially expressed genes were annotated using the Database for Annotation, Visualization and Integrated Discovery (DAVID), and gene set enrichment analysis (GSEA) was performed on RPE-specific and endothelium-associated gene sets. The complement factor H (CFH) genotype was also assessed, and differential expression was analyzed regarding high AMD risk (YH/HH) and low AMD risk (YY) genotypes. Results Seventy-five genes were identified as differentially expressed (raw p value <0.01; ≥50% fold change, mean log2 expression level in AMD or control ≥ median of all average gene expression values); however, no genes were significant (adj. p value <0.01) after correction for multiple hypothesis testing. Of 52 genes with decreased expression in AMD (fold change <0.5; raw p value <0.01), 18 genes were identified by DAVID analysis as associated with vision or neurologic processes. The GSEA of the RPE-associated and endothelium-associated genes revealed a significant decrease in genes typically expressed by endothelial cells in the early AMD group compared to controls, consistent with previous histologic and proteomic studies. Analysis of the CFH genotype indicated decreased expression of ADAMTS9 in eyes with high-risk genotypes (fold change = –2.61; raw p value=0.0008). Conclusions GSEA results suggest that RPE transcripts are preserved or elevated in early AMD, concomitant with loss of endothelial cell marker

  2. Transcriptome profiling and digital gene expression by deep sequencing in early somatic embryogenesis of endangered medicinal Eleutherococcus senticosus Maxim.

    PubMed

    Tao, Lei; Zhao, Yue; Wu, Ying; Wang, Qiuyu; Yuan, Hongmei; Zhao, Lijuan; Guo, Wendong; You, Xiangling

    2016-03-01

    Somatic embryogenesis (SE) has been studied as a model system to understand molecular events in physiology, biochemistry, and cytology during plant embryo development. In particular, it is exceedingly difficult to access the morphological and early regulatory events in zygotic embryos. To understand the molecular mechanisms regulating early SE in Eleutherococcus senticosus Maxim., we used high-throughput RNA-Seq technology to investigate its transcriptome. We obtained 58,327,688 reads, which were assembled into 75,803 unique unigenes. To better understand their functions, the unigenes were annotated using the Clusters of Orthologous Groups, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes databases. Digital gene expression libraries revealed differences in gene expression profiles at different developmental stages (embryogenic callus, yellow embryogenic callus, global embryo). We obtained a sequencing depth of >5.6 million tags per sample and identified many differentially expressed genes at various stages of SE. The initiation of SE affected gene expression in many KEGG pathways, but predominantly that in metabolic pathways, biosynthesis of secondary metabolites, and plant hormone signal transduction. This information on the changes in the multiple pathways related to SE induction in E. senticosus Maxim. embryogenic tissue will contribute to a more comprehensive understanding of the mechanisms involved in early SE. Additionally, the differentially expressed genes may act as molecular markers and could play very important roles in the early stage of SE. The results are a comprehensive molecular biology resource for investigating SE of E. senticosus Maxim. PMID:26657036

  3. Maturation of coordinated immediate early gene expression by cocaine during adolescence.

    PubMed

    Caster, J M; Kuhn, C M

    2009-04-21

    Adolescence may be a critical period for drug addiction. Young adolescent male rats have greater locomotor responses than adults after acute low dose cocaine administration. Further, repeated cocaine administration produces as much or more conditioned place preference but reduced locomotor sensitization in adolescents compared to adults. Acute activation of neurons by cocaine induces long-term changes in behavior by activating transcriptional complexes. The purpose of the present study was to correlate cocaine-induced locomotor activity with neuronal activation in subregions of the striatum and cortex by acute cocaine in young adolescent (postnatal (PN) 28) and adult (PN 65) male rats by measuring the induction of the plasticity-associated immediate early genes (IEGs) c-fos and zif268 using in situ hybridization. Animals were treated with saline, low (10 mg/kg), or high (40 mg/kg) dose cocaine in locomotor activity chambers and killed 30 min later. Low dose cocaine induced more locomotor activity and striatal c-fos expression in adolescents than adults whereas high dose cocaine induced more locomotor activity, striatal c-fos, and striatal zif268 expression in adults. Locomotor activity correlated with the expression of both genes in adults but correlated with striatal c-fos only in adolescents. Finally, there was a significant correlation between the expression of c-fos and zif268 in the adult striatum but not in adolescents. Our results suggest that the coordinated expression of transcription factors by cocaine continues to develop during adolescence. The immature regulation of transcription factors by cocaine could explain why adolescents show unique sensitivity to specific long-term behavioral alterations following cocaine treatment. PMID:19245875

  4. Genome-wide identification and analysis of rice genes preferentially expressed in pollen at an early developmental stage.

    PubMed

    Nguyen, Tien Dung; Moon, Sunok; Nguyen, Van Ngoc Tuyet; Gho, Yunsil; Chandran, Anil Kumar Nalini; Soh, Moon-Soo; Song, Jong Tae; An, Gynheung; Oh, Sung Aeong; Park, Soon Ki; Jung, Ki-Hong

    2016-09-01

    Microspore production using endogenous developmental programs has not been well studied. The main limitation is the difficulty in identifying genes preferentially expressed in pollen grains at early stages. To overcome this limitation, we collected transcriptome data from anthers and microspore/pollen and performed meta-expression analysis. Subsequently, we identified 410 genes showing preferential expression patterns in early developing pollen samples of both japonica and indica cultivars. The expression patterns of these genes are distinguishable from genes showing pollen mother cell or tapetum-preferred expression patterns. Gene Ontology enrichment and MapMan analyses indicated that microspores in rice are closely linked with protein degradation, nucleotide metabolism, and DNA biosynthesis and regulation, while the pollen mother cell or tapetum are strongly associated with cell wall metabolism, lipid metabolism, secondary metabolism, and RNA biosynthesis and regulation. We also generated transgenic lines under the control of the promoters of eight microspore-preferred genes and confirmed the preferred expression patterns in plants using the GUS reporting system. Furthermore, cis-regulatory element analysis revealed that pollen specific elements such as POLLEN1LELAT52, and 5659BOXLELAT5659 were commonly identified in the promoter regions of eight rice genes with more frequency than estimation. Our study will provide new sights on early pollen development in rice, a model crop plant. PMID:27356912

  5. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    ERIC Educational Resources Information Center

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  6. Time-Series Interactions of Gene Expression, Vascular Growth and Hemodynamics during Early Embryonic Arterial Development.

    PubMed

    Goktas, Selda; Uslu, Fazil E; Kowalski, William J; Ermek, Erhan; Keller, Bradley B; Pekkan, Kerem

    2016-01-01

    The role of hemodynamic forces within the embryo as biomechanical regulators for cardiovascular morphogenesis, growth, and remodeling is well supported through the experimental studies. Furthermore, clinical experience suggests that perturbed flow disrupts the normal vascular growth process as one etiology for congenital heart diseases (CHD) and for fetal adaptation to CHD. However, the relationships between hemodynamics, gene expression and embryonic vascular growth are poorly defined due to the lack of concurrent, sequential in vivo data. In this study, a long-term, time-lapse optical coherence tomography (OCT) imaging campaign was conducted to acquire simultaneous blood velocity, pulsatile micro-pressure and morphometric data for 3 consecutive early embryonic stages in the chick embryo. In conjunction with the in vivo growth and hemodynamics data, in vitro reverse transcription polymerase chain reaction (RT-PCR) analysis was performed to track changes in transcript expression relevant to histogenesis and remodeling of the embryonic arterial wall. Our non-invasive extended OCT imaging technique for the microstructural data showed continuous vessel growth. OCT data coupled with the PIV technique revealed significant but intermitted increases in wall shear stress (WSS) between first and second assigned stages and a noticeable decrease afterwards. Growth rate, however, did not vary significantly throughout the embryonic period. Among all the genes studied, only the MMP-2 and CASP-3 expression levels remained unchanged during the time course. Concurrent relationships were obtained among the transcriptional modulation of the genes, vascular growth and hemodynamics-related changes. Further studies are indicated to determine cause and effect relationships and reversibility between mechanical and molecular regulation of vasculogenesis. PMID:27552150

  7. Time-Series Interactions of Gene Expression, Vascular Growth and Hemodynamics during Early Embryonic Arterial Development

    PubMed Central

    Goktas, Selda; Uslu, Fazil E.; Kowalski, William J.; Ermek, Erhan; Keller, Bradley B.

    2016-01-01

    The role of hemodynamic forces within the embryo as biomechanical regulators for cardiovascular morphogenesis, growth, and remodeling is well supported through the experimental studies. Furthermore, clinical experience suggests that perturbed flow disrupts the normal vascular growth process as one etiology for congenital heart diseases (CHD) and for fetal adaptation to CHD. However, the relationships between hemodynamics, gene expression and embryonic vascular growth are poorly defined due to the lack of concurrent, sequential in vivo data. In this study, a long-term, time-lapse optical coherence tomography (OCT) imaging campaign was conducted to acquire simultaneous blood velocity, pulsatile micro-pressure and morphometric data for 3 consecutive early embryonic stages in the chick embryo. In conjunction with the in vivo growth and hemodynamics data, in vitro reverse transcription polymerase chain reaction (RT-PCR) analysis was performed to track changes in transcript expression relevant to histogenesis and remodeling of the embryonic arterial wall. Our non-invasive extended OCT imaging technique for the microstructural data showed continuous vessel growth. OCT data coupled with the PIV technique revealed significant but intermitted increases in wall shear stress (WSS) between first and second assigned stages and a noticeable decrease afterwards. Growth rate, however, did not vary significantly throughout the embryonic period. Among all the genes studied, only the MMP-2 and CASP-3 expression levels remained unchanged during the time course. Concurrent relationships were obtained among the transcriptional modulation of the genes, vascular growth and hemodynamics-related changes. Further studies are indicated to determine cause and effect relationships and reversibility between mechanical and molecular regulation of vasculogenesis. PMID:27552150

  8. Early responses of silkworm midgut to microsporidium infection--A Digital Gene Expression analysis.

    PubMed

    Yue, Ya-Jie; Tang, Xu-Dong; Xu, Li; Yan, Wei; Li, Qian-Long; Xiao, Sheng-Yan; Fu, Xu-Liang; Wang, Wei; Li, Nan; Shen, Zhong-Yuan

    2015-01-01

    Host-pathogen interactions are complex processes, which have been studied extensively in recent years. In insects, the midgut is a vital organ of digestion and nutrient absorption, and also serves as the first physiological and immune barrier against invading pathogenic microorganisms. Our focus is on Nosema bombycis, which is a pathogen of silkworm pebrine and causes great economic losses to the silk industry. A complete understanding of the host response to infection by N. bombycis and the interaction between them is necessary to prevent this disease. Silkworm midgut infected with N. bombycis is a good model to investigate the early host responses to microsporidia infection and the interaction between the silkworm and the microsporidium. Using Digital Gene Expression analysis, we investigated the midgut transcriptome profile of P50 silkworm larvae orally inoculated with N. bombycis. At 6, 12, 18, 24, 48, 72, and 96 h post-infection (hpi), 247, 95, 168, 450, 89, 80, and 773 DEGs were identified, respectively. KEGG pathway analysis showed the influence of N. bombycis infection on many biological processes including folate biosynthesis, spliceosome, nicotinate and nicotinamide metabolism, protein export, protein processing in endoplasmic reticulum, lysosome, biosynthesis of amino acids, ribosome, and RNA degradation. In addition, a number of differentially expressed genes involved in the immune response were identified. Overall, the results of this study provide an understanding of the strategy used by silkworm as a defense against the invasion by N. bombycis. Similar interactions between hosts and pathogens infection may exist in other species. PMID:25315610

  9. Hox and ParaHox gene expression in early body plan patterning of polyplacophoran mollusks

    PubMed Central

    Fritsch, Martin; Wollesen, Tim

    2016-01-01

    ABSTRACT Molecular developmental studies of various bilaterians have shown that the identity of the anteroposterior body axis is controlled by Hox and ParaHox genes. Detailed Hox and ParaHox gene expression data are available for conchiferan mollusks, such as gastropods (snails and slugs) and cephalopods (squids and octopuses), whereas information on the putative conchiferan sister group, Aculifera, is still scarce (but see Fritsch et al., 2015 on Hox gene expression in the polyplacophoran Acanthochitona crinita). In contrast to gastropods and cephalopods, the Hox genes in polyplacophorans are expressed in an anteroposterior sequence similar to the condition in annelids and other bilaterians. Here, we present the expression patterns of the Hox genes Lox5, Lox4, and Lox2, together with the ParaHox gene caudal (Cdx) in the polyplacophoran A. crinita. To localize Hox and ParaHox gene transcription products, we also investigated the expression patterns of the genes FMRF and Elav, and the development of the nervous system. Similar to the other Hox genes, all three Acr‐Lox genes are expressed in an anteroposterior sequence. Transcripts of Acr‐Cdx are seemingly present in the forming hindgut at the posterior end. The expression patterns of both the central class Acr‐Lox genes and the Acr‐Cdx gene are strikingly similar to those in annelids and nemerteans. In Polyplacophora, the expression patterns of the Hox and ParaHox genes seem to be evolutionarily highly conserved, while in conchiferan mollusks these genes are co‐opted into novel functions that might have led to evolutionary novelties, at least in gastropods and cephalopods. PMID:27098677

  10. Hox and ParaHox gene expression in early body plan patterning of polyplacophoran mollusks.

    PubMed

    Fritsch, Martin; Wollesen, Tim; Wanninger, Andreas

    2016-03-01

    Molecular developmental studies of various bilaterians have shown that the identity of the anteroposterior body axis is controlled by Hox and ParaHox genes. Detailed Hox and ParaHox gene expression data are available for conchiferan mollusks, such as gastropods (snails and slugs) and cephalopods (squids and octopuses), whereas information on the putative conchiferan sister group, Aculifera, is still scarce (but see Fritsch et al., 2015 on Hox gene expression in the polyplacophoran Acanthochitona crinita). In contrast to gastropods and cephalopods, the Hox genes in polyplacophorans are expressed in an anteroposterior sequence similar to the condition in annelids and other bilaterians. Here, we present the expression patterns of the Hox genes Lox5, Lox4, and Lox2, together with the ParaHox gene caudal (Cdx) in the polyplacophoran A. crinita. To localize Hox and ParaHox gene transcription products, we also investigated the expression patterns of the genes FMRF and Elav, and the development of the nervous system. Similar to the other Hox genes, all three Acr-Lox genes are expressed in an anteroposterior sequence. Transcripts of Acr-Cdx are seemingly present in the forming hindgut at the posterior end. The expression patterns of both the central class Acr-Lox genes and the Acr-Cdx gene are strikingly similar to those in annelids and nemerteans. In Polyplacophora, the expression patterns of the Hox and ParaHox genes seem to be evolutionarily highly conserved, while in conchiferan mollusks these genes are co-opted into novel functions that might have led to evolutionary novelties, at least in gastropods and cephalopods. PMID:27098677

  11. Loss of extra-striatal phosphodiesterase 10A expression in early premanifest Huntington's disease gene carriers.

    PubMed

    Wilson, Heather; Niccolini, Flavia; Haider, Salman; Marques, Tiago Reis; Pagano, Gennaro; Coello, Christopher; Natesan, Sridhar; Kapur, Shitij; Rabiner, Eugenii A; Gunn, Roger N; Tabrizi, Sarah J; Politis, Marios

    2016-09-15

    Huntington's disease (HD) is a monogenic neurodegenerative disorder with an underlying pathology involving the toxic effect of mutant huntingtin protein primarily in striatal and cortical neurons. Phosphodiesterase 10A (PDE10A) regulates intracellular signalling cascades, thus having a key role in promoting neuronal survival. Using positron emission tomography (PET) with [(11)C]IMA107, we investigated the in vivo extra-striatal expression of PDE10A in 12 early premanifest HD gene carriers. Image processing and kinetic modelling was performed using MIAKAT™. Parametric images of [(11)C]IMA107 non-displaceable binding potential (BPND) were generated from the dynamic [(11)C]IMA107 scans using the simplified reference tissue model with the cerebellum as the reference tissue for nonspecific binding. We set a threshold criterion for meaningful quantification of [(11)C]IMA107 BPND at 0.30 in healthy control data; regions meeting this criterion were designated as regions of interest (ROIs). MRI-based volumetric analysis showed no atrophy in ROIs. We found significant differences in mean ROIs [(11)C]IMA107 BPND between HD gene carriers and healthy controls. HD gene carriers had significant loss of PDE10A within the insular cortex and occipital fusiform gyrus compared to healthy controls. Insula and occipital fusiform gyrus are important brain areas for the regulation of cognitive and limbic function that is impaired in HD. Our findings suggest that dysregulation of PDE10A-mediated intracellular signalling could be an early phenomenon in the course of HD with relevance also for extra-striatal brain areas. PMID:27538642

  12. Exposure to Early Life Stress Results in Epigenetic Changes in Neurotrophic Factor Gene Expression in a Parkinsonian Rat Model

    PubMed Central

    Mpofana, Thabisile; Daniels, Willie M. U.; Mabandla, Musa V.

    2016-01-01

    Early life adversity increases the risk of mental disorders later in life. Chronic early life stress may alter neurotrophic factor gene expression including those for brain derived neurotrophic factor (BDNF) and glial cell derived neurotrophic factor (GDNF) that are important in neuronal growth, survival, and maintenance. Maternal separation was used in this study to model early life stress. Following unilateral injection of a mild dose of 6-hydroxydopamine (6-OHDA), we measured corticosterone (CORT) in the blood and striatum of stressed and nonstressed rats; we also measured DNA methylation and BDNF and GDNF gene expression in the striatum using real time PCR. In the presence of stress, we found that there was increased corticosterone concentration in both blood and striatal tissue. Further to this, we found higher DNA methylation and decreased neurotrophic factor gene expression. 6-OHDA lesion increased neurotrophic factor gene expression in both stressed and nonstressed rats but this increase was higher in the nonstressed rats. Our results suggest that exposure to early postnatal stress increases corticosterone concentration which leads to increased DNA methylation. This effect results in decreased BDNF and GDNF gene expression in the striatum leading to decreased protection against subsequent insults later in life. PMID:26881180

  13. Specifically expressed genes of the nematode Bursaphelenchus xylophilus involved with early interactions with pine trees.

    PubMed

    Qiu, Xiuwen; Wu, Xiaoqin; Huang, Lin; Tian, Minqi; Ye, Jianren

    2013-01-01

    As the causal agent of pine wilt disease (PWD), the pine wood nematode (PWN), Bursaphelenchus xylophilus, causes huge economic losses by devastating pine forests worldwide. However, the pathogenesis-related genes of B. xylophilus are not well characterized. Thus, DNA microarrays were used to investigate differential gene expression in PWN where Pinus thunbergii was inoculated with nematodes, compared with those cultured on Botrytis cinerea. The microarrays comprised 31121 probes, 1310 (4.2%) of which were differentially regulated (changes of >2-fold, P < 0.01) in the two growth conditions. Of these 1310 genes, 633 genes were upregulated, whereas 677 genes were downregulated. Gene Ontology (GO) categories were assigned to the classes Cellular Component, Molecular Function, and Biological Process. The comparative gene expression analysis showed that a large number of the pathogenesis-related genes of B. xylophilus, such as pectate lyase genes, cytochrome P450s, UGTs, and ABC transporter genes, were highly expressed when B. xylophilus infected P. thunbergii. Annotation analysis indicated that these genes contributed to cell wall degradation, detoxification, and the reproduction process. The microarray results were validated using quantitative RT-PCR (qRT-PCR). The microarray data confirmed the specific expression of B. xylophilus genes during infection of P. thunbergii, which provides basic information that facilitates a better understanding of the molecular mechanism of PWD. PMID:24155981

  14. Specifically Expressed Genes of the Nematode Bursaphelenchus Xylophilus Involved with Early Interactions with Pine Trees

    PubMed Central

    Qiu, Xiuwen; Wu, Xiaoqin; Huang, Lin; Tian, Minqi; Ye, Jianren

    2013-01-01

    As the causal agent of pine wilt disease (PWD), the pine wood nematode (PWN), Bursaphelenchus xylophilus, causes huge economic losses by devastating pine forests worldwide. However, the pathogenesis-related genes of B. xylophilus are not well characterized. Thus, DNA microarrays were used to investigate differential gene expression in PWN where Pinus thunbergii was inoculated with nematodes, compared with those cultured on Botrytis cinerea. The microarrays comprised 31121 probes, 1310 (4.2%) of which were differentially regulated (changes of >2-fold, P < 0.01) in the two growth conditions. Of these 1310 genes, 633 genes were upregulated, whereas 677 genes were downregulated. Gene Ontology (GO) categories were assigned to the classes Cellular Component, Molecular Function, and Biological Process. The comparative gene expression analysis showed that a large number of the pathogenesis-related genes of B. xylophilus, such as pectate lyase genes, cytochrome P450s, UGTs, and ABC transporter genes, were highly expressed when B. xylophilus infected P. thunbergii. Annotation analysis indicated that these genes contributed to cell wall degradation, detoxification, and the reproduction process. The microarray results were validated using quantitative RT-PCR (qRT-PCR). The microarray data confirmed the specific expression of B. xylophilus genes during infection of P. thunbergii, which provides basic information that facilitates a better understanding of the molecular mechanism of PWD. PMID:24155981

  15. Sexual polymorphisms of vomeronasal 1 receptor family gene expression in bulls, steers, and estrous and early luteal-phase heifers

    PubMed Central

    KUBO, Haruna; OTSUKA, Midori; KADOKAWA, Hiroya

    2015-01-01

    Vomeronasal 1 receptors (V1R) are a family of receptors for intraspecies chemosignals, including pheromones, and are expressed in the olfactory epithelium (OE) and vomeronasal organ (VO). Even in the well-studied rodents, it is unclear which members of the V1R family cause sexual polymorphisms, as there are numerous genes and it is difficult to quantify their expressions individually. Bovine species carry only 34 V1R homologs, and the OE and VOs are large enough to sample. Here, V1R expression was quantified in the OE and VOs of individual bovines. Based on the 34 gene sequences, we obtained a molecular dendrogram consisting of four clusters and six independent branches. Semi-quantitative RT-PCR was used to obtain gene expression profiles in the VOs and OE of 5 Japanese Black bulls, 5 steers, 7 estrous heifers and 6 early luteal-phase heifers. Ten genes showed significant between-group differences, and 22 showed high expression in VOs than in OE. The bulls showed higher expression of one gene more in OE and another in VOs (both P<0.05) than did steers; both genes belonged to the first cluster. No genes were expressed more abundantly in steers than in bulls. The estrous heifers showed higher expression of a gene of the second cluster in OE, and a gene of the third cluster in VOs (both P<0.05) than did early luteal-phase heifers. These results suggest V1R expression exhibits sexual polymorphisms in cattle. PMID:26477467

  16. Sexual polymorphisms of vomeronasal 1 receptor family gene expression in bulls, steers, and estrous and early luteal-phase heifers.

    PubMed

    Kubo, Haruna; Otsuka, Midori; Kadokawa, Hiroya

    2016-02-01

    Vomeronasal 1 receptors (V1R) are a family of receptors for intraspecies chemosignals, including pheromones, and are expressed in the olfactory epithelium (OE) and vomeronasal organ (VO). Even in the well-studied rodents, it is unclear which members of the V1R family cause sexual polymorphisms, as there are numerous genes and it is difficult to quantify their expressions individually. Bovine species carry only 34 V1R homologs, and the OE and VOs are large enough to sample. Here, V1R expression was quantified in the OE and VOs of individual bovines. Based on the 34 gene sequences, we obtained a molecular dendrogram consisting of four clusters and six independent branches. Semi-quantitative RT-PCR was used to obtain gene expression profiles in the VOs and OE of 5 Japanese Black bulls, 5 steers, 7 estrous heifers and 6 early luteal-phase heifers. Ten genes showed significant between-group differences, and 22 showed high expression in VOs than in OE. The bulls showed higher expression of one gene more in OE and another in VOs (both P<0.05) than did steers; both genes belonged to the first cluster. No genes were expressed more abundantly in steers than in bulls. The estrous heifers showed higher expression of a gene of the second cluster in OE, and a gene of the third cluster in VOs (both P<0.05) than did early luteal-phase heifers. These results suggest V1R expression exhibits sexual polymorphisms in cattle. PMID:26477467

  17. Enhanced jun gene expression is an early genomic response to transforming growth factor beta stimulation.

    PubMed Central

    Pertovaara, L; Sistonen, L; Bos, T J; Vogt, P K; Keski-Oja, J; Alitalo, K

    1989-01-01

    Transforming growth factor beta (TGF beta) is a multifunctional polypeptide that regulates proliferation, differentiation, and other functions of many cell types. The pathway of TGF beta signal transduction in cells is unknown. We report here that an early effect of TGF beta is an enhancement of the expression of two genes encoding serum- and phorbol ester tumor promoter-regulated transcription factors: the junB gene and the c-jun proto-oncogene, respectively. This stimulation was observed in human lung adenocarcinoma A549 cells which were growth inhibited by TGF beta, AKR-2B mouse embryo fibroblasts which were growth stimulated by TGF beta, and K562 human erythroleukemia cells, which were not appreciably affected in their growth by TGF beta. The increase in jun mRNA occurred with picomolar TGF beta concentrations within 1 h of TGF beta stimulation, reached a peak between 1 and 5 h in different cells, and declined gradually to base-line levels. This mRNA response was followed by a large increase in the biosynthesis of the c-jun protein (AP-1), as shown by metabolic labeling and immunoprecipitation analysis. However, differential and cell type-specific regulation appeared to determine the timing and magnitude of the response of each jun gene in a given cell. In AKR-2B and NIH 3T3 cells, only junB was induced by TGF beta, evidently in a protein synthesis-independent fashion. The junB response to TGF beta was maintained in c-Ha-ras and neu oncogene-transformed cells. Thus, one of the earliest genomic responses to TGF beta may involve nuclear signal transduction and amplification by the junB and c-jun transcription factors in concert with c-fos, which is also induced. The differential activation of the jun genes may explain some of the pleiotropic effects of TGF beta. Images PMID:2725496

  18. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  19. Alterations of Gene Expression in the Development of Early Hyperplastic Precursors of Breast Cancer

    PubMed Central

    Lee, Sangjun; Medina, Dan; Tsimelzon, Anna; Mohsin, Syed K.; Mao, Sufeng; Wu, Yun; Allred, D. Craig

    2007-01-01

    Enlargement of normal terminal duct lobular units (TDLUs) by hyperplastic columnar epithelial cells is one of the most common abnormalities of growth in the adult female human breast. These hyperplastic enlarged lobular units (HELUs) are important clinically as the earliest histologically identifiable potential precursor of breast cancer. The causes of the hyperplasia are unknown but may include estrogen-simulated growth mediated by estrogen receptor-α, which is highly elevated in HELUs and may be fundamental to their development. The present study used DNA microarray technology and RNA from microdissected pure epithelial cells to examine changes in gene expression and molecular pathways associated with the development of HELUs from TDLUs. The results suggest that HELUs evolve from TDLUs primarily by reactivation of pathways involved in embryonic development and suppression of terminal differentiation. Changes in ERBB genes were particularly prominent, including a uniform switch in ligands for the ERBB1 receptor (14-fold decrease in epidermal growth factor and 10-fold increase in amphiregulin, respectively) in HELUs compared with TDLUs. Epidermal growth factor regulates terminal differentiation in adult breast and amphiregulin is critical to normal embryonic breast development. Because HELUs are such early potential precursors of breast cancer, targeting some of these alterations may be especially promising strategies for breast cancer prevention. PMID:17591970

  20. Characterization and developmental expression of genes encoding the early carotenoid biosynthetic enzymes in Citrus paradisi Macf.

    PubMed

    Costa, Marcio G C; Moreira, Cristina D; Melton, John R; Otoni, Wagner C; Moore, Gloria A

    2012-02-01

    In the present study, the full-length cDNA sequences of PSY, PDS, and ZDS, encoding the early carotenoid biosynthetic enzymes in the carotenoid pathway of grapefruit (Citrus paradisi), were isolated and characterized for the first time. CpPSY contained a 1311-bp open reading frame (ORF) encoding a polypeptide of 436 amino acids, CpPDS contained a 1659-bp ORF encoding a polypeptide of 552 amino acids, and CpZDS contained a 1713-bp ORF encoding a polypeptide of 570 amino acids. Phylogenetic analysis indicated that CpPSY shares homology with PSYs from Citrus, tomato, pepper, Arabidopsis, and the monocot PSY1 group, while CpPDS and CpZDS are most closely related to orthologs from Citrus and tomato. Expression analysis revealed fluctuations in CpPSY, CpPDS, and CpZDS transcript abundance and a non-coordinated regulation between the former and the two latter genes during fruit development in albedo and juice vesicles of white ('Duncan') and red ('Flame') grapefruits. A 3× higher upregulation of CpPSY expression in juice vesicles of red-fleshed 'Flame' as compared to white-fruited 'Duncan' was observed in the middle stages of fruit development, which correlates with the well documented accumulation pattern of lycopene in red grapefruit. Together with previous data, our results suggest that the primary mechanism controlling lycopene accumulation in red grapefruit involves the transcriptional upregulation of CpPSY, which controls the flux into the carotenoid pathway, and the downregulated expression of CpLCYB2, which controls the step of cyclization of lycopene in chromoplasts during fruit ripening. A correlation between CpPSY expression and fruit color evolution in red grapefruit is demonstrated. PMID:21594623

  1. Monocyte Gene Expression Signature of Patients with Early Onset Coronary Artery Disease

    PubMed Central

    Sivapalaratnam, Suthesh; Basart, Hanneke; Watkins, Nicholas A.; Maiwald, Stepanie; Rendon, Augusto; Krishnan, Unni; Sondermeijer, Brigitte M.; Creemers, Esther E.; Pinto-Sietsma, Sara J.; Hovingh, Kees; Ouwehand, Willem H.; Kastelein, John J. P.; Goodall, Alison H.; Trip, Mieke D.

    2012-01-01

    The burden of cardiovascular disease (CVD) cannot be fully addressed by therapy targeting known pathophysiological pathways. Even with stringent control of all risk factors CVD events are only diminished by half. A number of additional pathways probably play a role in the development of CVD and might serve as novel therapeutic targets. Genome wide expression studies represent a powerful tool to identify such novel pathways. We compared the expression profiles in monocytes from twenty two young male patients with premature familial CAD with those from controls matched for age, sex and smoking status, without a family history of CVD. Since all patients were on statins and aspirin treatment, potentially affecting the expression of genes in monocytes, twelve controls were subsequently treated with simvastatin and aspirin for 6 and 2 weeks, respectively. By whole genome expression arrays six genes were identified to have differential expression in the monocytes of patients versus controls; ABCA1, ABCG1 and RGS1 were downregulated in patients, whereas ADRB2, FOLR3 and GSTM1 were upregulated. Differential expression of all genes, apart from GSTM1, was confirmed by qPCR. Aspirin and statins altered gene expression of ABCG1 and ADBR2. All finding were validated in a second group of twenty four patients and controls. Differential expression of ABCA1, RSG1 and ADBR2 was replicated. In conclusion, we identified these 3 genes to be expressed differently in CAD cases which might play a role in the pathogenesis of atherosclerotic vascular disease. PMID:22363809

  2. A Digital Framework to Build, Visualize and Analyze a Gene Expression Atlas with Cellular Resolution in Zebrafish Early Embryogenesis

    PubMed Central

    Castro-González, Carlos; Luengo-Oroz, Miguel A.; Duloquin, Louise; Savy, Thierry; Rizzi, Barbara; Desnoulez, Sophie; Doursat, René; Kergosien, Yannick L.; Ledesma-Carbayo, María J.; Bourgine, Paul

    2014-01-01

    A gene expression atlas is an essential resource to quantify and understand the multiscale processes of embryogenesis in time and space. The automated reconstruction of a prototypic 4D atlas for vertebrate early embryos, using multicolor fluorescence in situ hybridization with nuclear counterstain, requires dedicated computational strategies. To this goal, we designed an original methodological framework implemented in a software tool called Match-IT. With only minimal human supervision, our system is able to gather gene expression patterns observed in different analyzed embryos with phenotypic variability and map them onto a series of common 3D templates over time, creating a 4D atlas. This framework was used to construct an atlas composed of 6 gene expression templates from a cohort of zebrafish early embryos spanning 6 developmental stages from 4 to 6.3 hpf (hours post fertilization). They included 53 specimens, 181,415 detected cell nuclei and the segmentation of 98 gene expression patterns observed in 3D for 9 different genes. In addition, an interactive visualization software, Atlas-IT, was developed to inspect, supervise and analyze the atlas. Match-IT and Atlas-IT, including user manuals, representative datasets and video tutorials, are publicly and freely available online. We also propose computational methods and tools for the quantitative assessment of the gene expression templates at the cellular scale, with the identification, visualization and analysis of coexpression patterns, synexpression groups and their dynamics through developmental stages. PMID:24945246

  3. Resistance of wheat to Mycosphaerella graminicola involves early and late peaks of gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Expression of 14 genes associated with the resistance response of wheat to the Septoria tritici blotch fungus, Mycosphaerella graminicola, was measured from 0 to 27 days after inoculation (DAI) in two resistant and two susceptible cultivars by real-time quantitative PCR. The four genes chitinase, ph...

  4. Identification of miRNAs and differentially expressed genes in early phase non-small cell lung cancer.

    PubMed

    Tian, Wen; Liu, Jie; Pei, Baojing; Wang, Xiaobo; Guo, Yu; Yuan, Lin

    2016-04-01

    To explore the potential therapeutic targets of early‑stage non-small cell lung cancer (NSCLC), gene microarray analysis was conducted. The microarray data of NSCLC in stage IA, IB, IIA, and IIB (GSE50081), were downloaded from the Gene Expression Omnibus (GEO) database. The differentially expressed genes (DEGs) in IB vs. IA, IIA vs. IB, IIB vs. IIA were screened out via R. ToppGene Suite was used to get the enriched Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways of the DEGs. The GeneCoDis3 database and Cytoscape software were used to construct the transcriptional regulatory network. In total, 25, 17 and 14 DEGs were identified in IB vs. IA, IIA vs. IB, IIB vs. IIA of NSCLC, respectively. Some GO terms and pathways (e.g., extracellular space, alveolar lamellar body, bioactivation via cytochrome P450 pathway) were found significantly enriched in DEGs. Genes S100P, ALOX15B, CCL11, NLRP2, SERPINA3, FoxO4 and hsa-miR-491 may play important roles in the development of early-stage NSCLC. Thus, by bioinformatics analysis the key genes and biological processes involving in the development of early-stage NSCLC could be established, providing more potential references for the therapeutic targets. PMID:26781349

  5. Enhanced jun gene expression is an early genomic response to transforming growth factor. beta. stimulation

    SciTech Connect

    Pertovaara, L.; Sistonen, L.; Keski-Oja, J.; Alitalo, K. ); Bos, T.J.; Vogt, P.K. . Dept. of Microbiology)

    1989-03-01

    Transforming growth factor {beta} (TGF{beta}) is a multifunctional polypeptide4 that regulates proliferation, differentiation, and other functions of many cell types. The pathway of TGF{beta} signal transduction in cells is unknown. The authors report here that an early effect of TGF{beta} is an enhancement of the expression of two genes encoding serum- and phorbol ester tumor promoter-regulated transcription factors: the junB gene and the c-jun proto-oncogene, respectively. This stimulation was observed in human lung adenocarcinoma A549 cells which were growth inhibited by TGF{beta}, AKR-2B mouse embryo fibroblasts which were growth stimulated by TGF{beta}, and K562 human erythroleukemia cells, which were not appreciably affected in their growth by TFG{beta}. The increase in jun mRNA occurred with picomolar TGF{beta} concentrations within 1 h of TGF{beta} stimulation, reached a peak between 1 and 5 h in different cells, and declined gradually to base-fine levels. This mRNA response was followed by a large increase in the biosynthesis of the c-jun protein (AP-1), as shown by metabolic labeling and immunoprecipitation analysis. However, differential and cell type-specific regulation appeared to determine the timing and magnitude of the response of each jun gene in a given cell. In AKR-2B and NIH 3T3 cells, only junB was induced by TGF{beta}, evidently in a protein synthesis-independent fashion. The junB response to TGF{beta} was maintained in c-Ha-ras and neu oncogene-transformed cells. Thus, one of the earliest genomic responses to TGF{beta} may involve nuclear signal transduction and amplification by the junB and c-jun transcription factors in concert with c-fos, which is also induced. The differential activation of the jun genes may explain some of the pleiotropic effects of TGF{beta}.

  6. The GATA transcription factor GtaC regulates early developmental gene expression dynamics in Dictyostelium.

    PubMed

    Santhanam, Balaji; Cai, Huaqing; Devreotes, Peter N; Shaulsky, Gad; Katoh-Kurasawa, Mariko

    2015-01-01

    In many systems, including the social amoeba Dictyostelium discoideum, development is often marked by dynamic morphological and transcriptional changes orchestrated by key transcription factors. However, efforts to examine sequential genome-wide changes of gene regulation in developmental processes have been fairly limited. Here we report the developmental regulatory dynamics of GtaC, a GATA-type zinc-finger transcription factor, through the analyses of serial ChIP- and RNA-sequencing data. GtaC is essential for developmental progression, decoding extracellular cAMP pulses during early development and may play a role in mediating cell-type differentiation at later stages. We find that GtaC exhibits temporally distinctive DNA-binding patterns concordant with each developmental stage. We identify direct GtaC targets and observe cotemporaneous GtaC-binding and developmental expression regulation. Our results suggest that GtaC regulates multiple physiological processes as Dictyostelium transitions from a group of unicellular amoebae to an integrated multicellular organism. PMID:26144553

  7. The GATA transcription factor GtaC regulates early developmental gene expression dynamics in Dictyostelium

    PubMed Central

    Santhanam, Balaji; Cai, Huaqing; Devreotes, Peter N.; Shaulsky, Gad; Katoh-Kurasawa, Mariko

    2015-01-01

    In many systems, including the social amoeba Dictyostelium discoideum, development is often marked by dynamic morphological and transcriptional changes orchestrated by key transcription factors. However, efforts to examine sequential genome-wide changes of gene regulation in developmental processes have been fairly limited. Here we report the developmental regulatory dynamics of GtaC, a GATA-type zinc-finger transcription factor, through the analyses of serial ChIP- and RNA-sequencing data. GtaC is essential for developmental progression, decoding extracellular cAMP pulses during early development and may play a role in mediating cell-type differentiation at later stages. We find that GtaC exhibits temporally distinctive DNA-binding patterns concordant with each developmental stage. We identify direct GtaC targets and observe cotemporaneous GtaC-binding and developmental expression regulation. Our results suggest that GtaC regulates multiple physiological processes as Dictyostelium transitions from a group of unicellular amoebae to an integrated multicellular organism. PMID:26144553

  8. Early IL-4 gene expression in abomasum is associated with resistance to Haemonchus contortus in hair and wool sheep breeds.

    PubMed

    Jacobs, J R; Sommers, K N; Zajac, A M; Notter, D R; Bowdridge, S A

    2016-06-01

    Early immune events associated with reduced larval burden remain unclear in parasite-resistant breeds of sheep. Therefore, our objective was to determine breed differences in immune-related gene expression following infection with H. contortus. Gene expression in abomasal tissue and mucosa and in abomasal lymph nodes (ALN) was measured in 24 St. Croix (hair) lambs and 24 Dorset x (Finn-Rambouillet) (wool) lambs at 0 (uninfected), 3, 5 and 7 days after infection with 10 000 L3 H. contortus larvae. Expression of IL-4 in abomasal mucosa was detected on day 3 and increased to day 7 in hair lambs, but was not detectable in wool lambs. Genes that recruit neutrophils (CXCL1) and macrophages (MCP1) were upregulated in abomasal mucosa of hair lambs. Genes associated with alternative macrophage activation (ARG-1) and eosinophil activation (Gal-14) were also upregulated in the abomasal mucosa of hair lambs. Tissue remodeling genes (MMP13, PDGF) and tumour necrosis factor alpha (TNF-α) and MCP1 were upregulated in abomasal tissue of wool lambs; these lambs also had greater expression of forkhead box P3 in ALN. These data indicate a role for early IL-4 expression locally and demonstrate potential downregulation of immunity in wool sheep that could facilitate establishment of H. contortus. PMID:27059919

  9. Early Embryonic Gene Expression Profiling of Zebrafish Prion Protein (Prp2) Morphants

    PubMed Central

    Nourizadeh-Lillabadi, Rasoul; Seilø Torgersen, Jacob; Vestrheim, Olav; König, Melanie; Aleström, Peter; Syed, Mohasina

    2010-01-01

    Background The Prion protein (PRNP/Prp) plays a crucial role in transmissible spongiform encephalopathies (TSEs) like Creutzfeldt-Jakob disease (CJD), scrapie and mad cow disease. Notwithstanding the importance in human and animal disease, fundamental aspects of PRNP/Prp function and transmission remains unaccounted for. Methodology/Principal Findings The zebrafish (Danio rerio) genome contains three Prp encoding genes assigned prp1, prp2 and prp3. Currently, the second paralogue is believed to be the most similar to the mammalian PRNP gene in structure and function. Functional studies of the PRNP gene ortholog was addressed by prp2 morpholino (MO) knockdown experiments. Investigation of Prp2 depleted embryos revealed high mortality and apoptosis at 24 hours post fertilization (hpf) as well as impaired brain and neuronal development. In order to elucidate the underlying mechanisms, a genome-wide transcriptome analysis was carried out in viable 24 hpf morphants. The resulting changes in gene expression profiles revealed 249 differently expressed genes linked to biological processes like cell death, neurogenesis and embryonic development. Conclusions/Significance The current study contributes to the understanding of basic Prp functions and demonstrates that the zebrafish is an excellent model to address the role of Prp in vertebrates. The gene knockdown of prp2 indicates an essential biological function for the zebrafish ortholog with a morphant phenotype that suggests a neurodegenerative action and gene expression effects which are apoptosis related and effects gene networks controlling neurogenesis and embryo development. PMID:21042590

  10. Temporal expression of hypoxia-regulated genes is associated with early changes in redox status in irradiated lung

    PubMed Central

    Jackson, Isabel L.; Zhang, Xiuwu; Hadley, Caroline; Rabbani, Zahid N.; Zhang, Yu; Marks, Sam; Vujaskovic, Zeljko

    2013-01-01

    The development of normal lung tissue toxicity after radiation exposure results from multiple changes in cell signaling and communication initiated at the time of the ionizing event. The onset of gross pulmonary injury is preceded by tissue hypoxia and chronic oxidative stress. We have previously shown development of debilitating lung injury can be mitigated or prevented by administration of AEOL10150, a potent catalytic antioxidant, 24 hours after radiation. This suggests that hypoxia-mediated signaling pathways may play a role in late radiation injury, but the exact mechanism remains unclear. The purpose of this study was to evaluate changes in the temporal expression of hypoxia-associated genes in irradiated mouse lung and determine whether AEOL10150 alters expression of these genes. A focused oligo array was used to establish a hypoxia-associated gene expression signature for lung tissue from sham-irradiated or irradiated mice treated with or without AEOL10150. Results were further verified by RT-PCR. 44 genes associated with metabolism, cell growth, apoptosis, inflammation, oxidative stress and extracellular matrix synthesis were upregulated after radiation. Elevated expression of 31 of these genes was attenuated in animals treated with AEOL10150, suggesting that expression of a number of hypoxia-associated genes are regulated by early development of oxidative stress after radiation. Genes identified herein could provide insight into the role of hypoxic signaling in radiation lung injury, suggesting novel therapeutic targets, as well as clues to the mechanism by which AEOL10150 confers pulmonary radioprotection. PMID:22588005

  11. Early diffusion of gene expression profiling in breast cancer patients associated with areas of high income inequality.

    PubMed

    Ponce, Ninez A; Ko, Michelle; Liang, Su-Ying; Armstrong, Joanne; Toscano, Michele; Chanfreau-Coffinier, Catherine; Haas, Jennifer S

    2015-04-01

    With the Affordable Care Act reducing coverage disparities, social factors could prominently determine where and for whom innovations first diffuse in health care markets. Gene expression profiling is a potentially cost-effective innovation that guides chemotherapy decisions in early-stage breast cancer, but adoption has been uneven across the United States. Using a sample of commercially insured women, we evaluated whether income inequality in metropolitan areas was associated with receipt of gene expression profiling during its initial diffusion in 2006-07. In areas with high income inequality, gene expression profiling receipt was higher than elsewhere, but it was associated with a 10.6-percentage-point gap between high- and low-income women. In areas with low rates of income inequality, gene expression profiling receipt was lower, with no significant differences by income. Even among insured women, income inequality may indirectly shape diffusion of gene expression profiling, with benefits accruing to the highest-income patients in the most unequal places. Policies reducing gene expression profiling disparities should address low-inequality areas and, in unequal places, practice settings serving low-income patients. PMID:25847643

  12. Impact of birth weight and gender on early postnatal hypothalamic energy balance regulatory gene expression in the young lamb.

    PubMed

    Adam, C L; Bake, T; Findlay, P A; Milne, J S; Aitken, R P; Wallace, J M

    2013-11-01

    Intra-uterine growth restriction (IUGR) is involved in developmental metabolic programming and here we test the hypothesis that IUGR affects the developing hypothalamic energy balance regulatory pathways in a sex-specific manner. This experiment investigated early postnatal hypothalamic gene expression for six primary leptin- and insulin-sensitive neuropeptides and receptors in male and female IUGR (n = 8 and 9, respectively) and normal (N) birth weight lambs (n = 8 per gender) gestated and suckled by overnourished mothers. IUGR lambs were smaller at birth, had increased fractional growth rates (FGR), lower final body weight (11 weeks) and similar body fat content compared with N lambs, while males had higher final body weight and insulinemia but lower body fat and leptinemia than females. In situ hybridization revealed greater gene expression in the hypothalamic arcuate nucleus at 11 weeks for anorexigenic genes in females and orexigenic genes in males, with no effect of IUGR. Leptinemia correlated with gene expression for neuropeptide Y (NPY, negatively) in both sexes and pro-opiomelanocortin (POMC, positively) in females but with leptin receptor (negatively) only in males. Current FGR for girth correlated negatively with gene expression for NPY in males and POMC in females. Neither IUGR nor gender affected suckling activity (proxy for appetite) assessed at 3 weeks, but final NPY gene expression correlated with suckling weight gain in males. This study has revealed no effect of IUGR on early postnatal hypothalamic energy balance gene expression but a major effect of gender associated with major sex differences in adiposity and leptinemia. PMID:23932904

  13. Comparison of the effects of early pregnancy with human interferon, alpha 2 (IFNA2), on gene expression in bovine endometrium.

    PubMed

    Bauersachs, Stefan; Ulbrich, Susanne E; Reichenbach, Horst-Dieter; Reichenbach, Myriam; Büttner, Mathias; Meyer, Heinrich H D; Spencer, Thomas E; Minten, Megan; Sax, Gerhard; Winter, Gerhard; Wolf, Eckhard

    2012-02-01

    Interferon tau (IFNT), a type I IFN similar to alpha IFNs (IFNA), is the pregnancy recognition signal produced by the ruminant conceptus. To elucidate specific effects of bovine IFNT and of other conceptus-derived factors, endometrial gene expression changes during early pregnancy were compared to gene expression changes after intrauterine application of human IFNA2. In experiment 1, endometrial tissue samples were obtained on Day (D) 12, D15, and D18 postmating from nonpregnant or pregnant heifers. In experiment 2, heifers were treated from D14 to D16 of the estrous cycle with an intrauterine device releasing IFNA2 or, as controls, placebo lipid extrudates or PBS only. Endometrial biopsies were performed after flushing the uterus. All samples from both experiments were analyzed with an Affymetrix Bovine Genome Array. Experiment 1 revealed differential gene expression between pregnant and nonpregnant endometria on D15 and D18. In experiment 2, IFNA2 treatment resulted in differential gene expression in the bovine endometrium. Comparison of the data sets from both studies identified genes that were differentially expressed in response to IFNA2 but not in response to pregnancy on D15 or D18. In addition, genes were found that were differentially expressed during pregnancy but not after IFNA2 treatment. In experiment 3, spatiotemporal alterations in expression of selected genes were determined in uteri from nonpregnant and early pregnant heifers using in situ hybridization. The overall findings of this study suggest differential effects of bovine IFNT compared to human IFNA2 and that some pregnancy-specific changes in the endometrium are elicited by conceptus-derived factors other than IFNT. PMID:22034527

  14. An organ culture system to model early degenerative changes of the intervertebral disc II: profiling global gene expression changes

    PubMed Central

    2013-01-01

    Introduction Despite many advances in our understanding of the molecular basis of disc degeneration, there remains a paucity of preclinical models which can be used to study the biochemical and molecular events that drive disc degeneration, and the effects of potential therapeutic interventions. The goal of this study is to characterize global gene expression changes in a disc organ culture system that mimics early nontraumatic disc degeneration. Methods To mimic a degenerative insult, rat intervertebral discs were cultured in the presence of TNF-α, IL-1β and serum-limiting conditions. Gene expression analysis was performed using a microarray to identify differential gene expression between experimental and control groups. Differential pattern of gene expression was confirmed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) or Western blot. Results Treatment resulted in significant changes in expression of more than 1,000 genes affecting many aspects of cell function including cellular movement, the cell cycle, cellular development, and cell death and proliferation. Many of the most highly upregulated and downregulated genes have known functions in disc degeneration and extracellular matrix hemostasis. Construction of gene networks based on known cellular pathways and expression data from our analysis demonstrated that the network associated with cell death, cell cycle regulation and DNA replication and repair was most heavily affected in this model of disc degeneration. Conclusions This rat organ culture model uses cytokine exposure to induce wide gene expression changes with the most affected genes having known reported functions in disc degeneration. We propose that this model is a valuable tool to study the etiology of disc degeneration and evaluate potential therapeutic treatments. PMID:24171898

  15. Progression of Gene Expression Changes following a Mechanical Injury to Articular Cartilage as a Model of Early Stage Osteoarthritis

    PubMed Central

    McCulloch, R. S.; Ashwell, M. S.; Maltecca, C.; O'Nan, A. T.; Mente, P. L.

    2014-01-01

    An impact injury model of early stage osteoarthritis (OA) progression was developed using a mechanical insult to an articular cartilage surface to evaluate differential gene expression changes over time and treatment. Porcine patellae with intact cartilage surfaces were randomized to one of three treatments: nonimpacted control, axial impaction (2000 N), or a shear impaction (500 N axial, with tangential displacement to induce shear forces). After impact, the patellae were returned to culture for 0, 3, 7, or 14 days. At the appropriate time point, RNA was extracted from full-thickness cartilage slices at the impact site. Quantitative real-time PCR was used to evaluate differential gene expression for 18 OA related genes from four categories: cartilage matrix, degradative enzymes and inhibitors, inflammatory response and signaling, and cell apoptosis. The shear impacted specimens were compared to the axial impacted specimens and showed that shear specimens more highly expressed type I collagen (Col1a1) at the early time points. In addition, there was generally elevated expression of degradative enzymes, inflammatory response genes, and apoptosis markers at the early time points. These changes suggest that the more physiologically relevant shear loading may initially be more damaging to the cartilage and induces more repair efforts after loading. PMID:25478225

  16. Expression of an early gene in the flagellar regulatory hierarchy is sensitive to an interruption in DNA replication.

    PubMed Central

    Dingwall, A; Zhuang, W Y; Quon, K; Shapiro, L

    1992-01-01

    Genes involved in the biogenesis of the flagellum in Caulobacter crescentus are expressed in a temporal order and are controlled by a trans-acting regulatory hierarchy. Strains with mutations in one of these genes, flaS, cannot transcribe flagellar structural genes and divide abnormally. This gene was cloned, and it was found that its transcription is initiated early in the cell cycle. Subclones that restored motility to FlaS mutants also restored normal cell division. Although transcription of flaS was not dependent on any other known gene in the flagellar hierarchy, it was autoregulated and subject to mild negative control by other genes at the same level of the hierarchy. An additional level of control was revealed when it was found that an interruption of DNA replication caused the inhibition of flaS transcription. The flaS transcript initiation site was identified, and an apparently unique promoter sequence was found to be highly conserved among the genes at the same level of the hierarchy. The flagellar genes with this conserved 5' region all initiate transcription early in the cell cycle and are all sensitive to a disruption in DNA replication. Mutations in these genes also cause an aberrant cell division phenotype. Therefore, flagellar genes at or near the top of the hierarchy may be controlled, in part, by a unique transcription factor and may be responsive to the same DNA replication cues that mediate other cell cycle events, such as cell division. Images PMID:1372311

  17. Characterization and target genes of nine human PRD-like homeobox domain genes expressed exclusively in early embryos

    PubMed Central

    Madissoon, Elo; Jouhilahti, Eeva-Mari; Vesterlund, Liselotte; Töhönen, Virpi; Krjutškov, Kaarel; Petropoulous, Sophie; Einarsdottir, Elisabet; Linnarsson, Sten; Lanner, Fredrik; Månsson, Robert; Hovatta, Outi; Bürglin, Thomas R.; Katayama, Shintaro; Kere, Juha

    2016-01-01

    PAIRED (PRD)-like homeobox genes belong to a class of predicted transcription factor genes. Several of these PRD-like homeobox genes have been predicted in silico from genomic sequence but until recently had no evidence of transcript expression. We found recently that nine PRD-like homeobox genes, ARGFX, CPHX1, CPHX2, DPRX, DUXA, DUXB, NOBOX, TPRX1 and TPRX2, were expressed in human preimplantation embryos. In the current study we characterized these PRD-like homeobox genes in depth and studied their functions as transcription factors. We cloned multiple transcript variants from human embryos and showed that the expression of these genes is specific to embryos and pluripotent stem cells. Overexpression of the genes in human embryonic stem cells confirmed their roles as transcription factors as either activators (CPHX1, CPHX2, ARGFX) or repressors (DPRX, DUXA, TPRX2) with distinct targets that could be explained by the amino acid sequence in homeodomain. Some PRD-like homeodomain transcription factors had high concordance of target genes and showed enrichment for both developmentally important gene sets and a 36 bp DNA recognition motif implicated in Embryo Genome Activation (EGA). Our data implicate a role for these previously uncharacterized PRD-like homeodomain proteins in the regulation of human embryo genome activation and preimplantation embryo development. PMID:27412763

  18. Microarray Expression Data Identify DCC as a Candidate Gene for Early Meningioma Progression

    PubMed Central

    Schulten, Hans-Juergen; Hussein, Deema; Al-Adwani, Fatima; Karim, Sajjad; Al-Maghrabi, Jaudah; Al-Sharif, Mona; Jamal, Awatif; Al-Ghamdi, Fahad; Baeesa, Saleh S.; Bangash, Mohammed; Chaudhary, Adeel; Al-Qahtani, Mohammed

    2016-01-01

    Meningiomas are the most common primary brain tumors bearing in a minority of cases an aggressive phenotype. Although meningiomas are stratified according to their histology and clinical behavior, the underlying molecular genetics predicting aggressiveness are not thoroughly understood. We performed whole transcript expression profiling in 10 grade I and four grade II meningiomas, three of which invaded the brain. Microarray expression analysis identified deleted in colorectal cancer (DCC) as a differentially expressed gene (DEG) enabling us to cluster meningiomas into DCC low expression (3 grade I and 3 grade II tumors), DCC medium expression (2 grade I and 1 grade II tumors), and DCC high expression (5 grade I tumors) groups. Comparison between the DCC low expression and DCC high expression groups resulted in 416 DEGs (p-value < 0.05; fold change > 2). The most significantly downregulated genes in the DCC low expression group comprised DCC, phosphodiesterase 1C (PDE1C), calmodulin-dependent 70kDa olfactomedin 2 (OLFM2), glutathione S-transferase mu 5 (GSTM5), phosphotyrosine interaction domain containing 1 (PID1), sema domain, transmembrane domain (TM) and cytoplasmic domain, (semaphorin) 6D (SEMA6D), and indolethylamine N-methyltransferase (INMT). The most significantly upregulated genes comprised chromosome 5 open reading frame 63 (C5orf63), homeodomain interacting protein kinase 2 (HIPK2), and basic helix-loop-helix family, member e40 (BHLHE40). Biofunctional analysis identified as predicted top upstream regulators beta-estradiol, TGFB1, Tgf beta complex, LY294002, and dexamethasone and as predicted top regulator effectors NFkB, PIK3R1, and CREBBP. The microarray expression data served also for a comparison between meningiomas from female and male patients and for a comparison between brain invasive and non-invasive meningiomas resulting in a number of significant DEGs and related biofunctions. In conclusion, based on its expression levels, DCC may constitute

  19. Satb1 Ablation Alters Temporal Expression of Immediate Early Genes and Reduces Dendritic Spine Density during Postnatal Brain Development

    PubMed Central

    Balamotis, Michael A.; Tamberg, Nele; Woo, Young Jae; Li, Jingchuan; Davy, Brian

    2012-01-01

    Complex behaviors, such as learning and memory, are associated with rapid changes in gene expression of neurons and subsequent formation of new synaptic connections. However, how external signals are processed to drive specific changes in gene expression is largely unknown. We found that the genome organizer protein Satb1 is highly expressed in mature neurons, primarily in the cerebral cortex, dentate hilus, and amygdala. In Satb1-null mice, cortical layer morphology was normal. However, in postnatal Satb1-null cortical pyramidal neurons, we found a substantial decrease in the density of dendritic spines, which play critical roles in synaptic transmission and plasticity. Further, we found that in the cerebral cortex, Satb1 binds to genomic loci of multiple immediate early genes (IEGs) (Fos, Fosb, Egr1, Egr2, Arc, and Bdnf) and other key neuronal genes, many of which have been implicated in synaptic plasticity. Loss of Satb1 resulted in greatly alters timing and expression levels of these IEGs during early postnatal cerebral cortical development and also upon stimulation in cortical organotypic cultures. These data indicate that Satb1 is required for proper temporal dynamics of IEG expression. Based on these findings, we propose that Satb1 plays a critical role in cortical neurons to facilitate neuronal plasticity. PMID:22064485

  20. Dietary tomato and lycopene impact androgen signaling- and carcinogenesis-related gene expression during early TRAMP prostate carcinogenesis.

    PubMed

    Wan, Lei; Tan, Hsueh-Li; Thomas-Ahner, Jennifer M; Pearl, Dennis K; Erdman, John W; Moran, Nancy E; Clinton, Steven K

    2014-12-01

    Consumption of tomato products containing the carotenoid lycopene is associated with a reduced risk of prostate cancer. To identify gene expression patterns associated with early testosterone-driven prostate carcinogenesis, which are impacted by dietary tomato and lycopene, wild-type (WT) and transgenic adenocarcinoma of the mouse prostate (TRAMP) mice were fed control or tomato- or lycopene-containing diets from 4 to 10 weeks of age. Eight-week-old mice underwent sham surgery, castration, or castration followed by testosterone repletion (2.5 mg/kg/d initiated 1 week after castration). Ten-week-old intact TRAMP mice exhibit early multifocal prostatic intraepithelial neoplasia. Of the 200 prostate cancer-related genes measured by quantitative NanoString, 189 are detectable, 164 significantly differ by genotype, 179 by testosterone status, and 30 by diet type (P < 0.05). In TRAMP, expression of Birc5, Mki67, Aurkb, Ccnb2, Foxm1, and Ccne2 is greater compared with WT and is decreased by castration. In parallel, castration reduces Ki67-positive staining (P < 0.0001) compared with intact and testosterone-repleted TRAMP mice. Expression of genes involved in androgen metabolism/signaling pathways is reduced by lycopene feeding (Srd5a1) and by tomato feeding (Srd5a2, Pxn, and Srebf1). In addition, tomato feeding significantly reduced expression of genes associated with stem cell features, Aldh1a and Ly6a, whereas lycopene feeding significantly reduced expression of neuroendocrine differentiation-related genes, Ngfr and Syp. Collectively, these studies demonstrate a profile of testosterone-regulated genes associated with early prostate carcinogenesis that are potential mechanistic targets of dietary tomato components. Future studies on androgen signaling/metabolism, stem cell features, and neuroendocrine differentiation pathways may elucidate the mechanisms by which dietary tomato and lycopene impact prostate cancer risk. PMID:25315431

  1. Dietary tomato and lycopene impact androgen signaling- and carcinogenesis-related gene expression during early TRAMP prostate carcinogenesis

    PubMed Central

    Wan, Lei; Tan, Hsueh-Li; Thomas-Ahner, Jennifer M.; Pearl, Dennis K.; Erdman, John W.; Moran, Nancy E.; Clinton, Steven K.

    2014-01-01

    Consumption of tomato products containing the carotenoid lycopene is associated with a reduced risk of prostate cancer. To identify gene expression patterns associated with early testosterone-driven prostate carcinogenesis, which are impacted by dietary tomato and lycopene, wild type (WT) and transgenic adenocarcinoma of the mouse prostate (TRAMP) mice were fed control or tomato- or lycopene-containing diets from 4-10 wk-of-age. Eight-week-old mice underwent sham surgery, castration, or castration followed by testosterone-repletion (2.5 mg/kg/d initiated 1 wk after castration). Ten-wk-old intact TRAMP mice exhibit early multifocal prostatic intraepithelial neoplasia (PIN). Of the 200 prostate cancer-related genes measured by quantitative NanoString®, 189 are detectable, 164 significantly differ by genotype, 179 by testosterone status, and 30 by diet type (P<0.05). In TRAMP, expression of Birc5, Mki67, Aurkb, Ccnb2, Foxm1, and Ccne2 is greater compared to WT and is decreased by castration. In parallel, castration reduces Ki67-positive staining (P<0.0001) compared to intact and testosterone-repleted TRAMP mice. Expression of genes involved in androgen metabolism/signaling pathways are reduced by lycopene feeding (Srd5a1) and by tomato-feeding (Srd5a2, Pxn, and Srebf1). Additionally, tomato-feeding significantly reduced expression of genes associated with stem cell features, Aldh1a and Ly6a, while lycopene-feeding significantly reduced expression of neuroendocrine differentiation-related genes, Ngfr and Syp. Collectively, these studies demonstrate a profile of testosterone-regulated genes associated with early stages of prostate carcinogenesis that are potential mechanistic targets of dietary tomato components. Future studies on androgen signaling/metabolism, stem cell features, and neuroendocrine differentiation pathways may elucidate the mechanisms by which dietary tomato and lycopene impact prostate cancer risk. PMID:25315431

  2. Use of heat stress responsive gene expression levels for early selection of heat tolerant cabbage (Brassica oleracea L.).

    PubMed

    Park, Hyun Ji; Jung, Won Yong; Lee, Sang Sook; Song, Jun Ho; Kwon, Suk-Yoon; Kim, Hyeran; Kim, Chulwook; Ahn, Jun Cheul; Cho, Hye Sun

    2013-01-01

    Cabbage is a relatively robust vegetable at low temperatures. However, at high temperatures, cabbage has disadvantages, such as reduced disease tolerance and lower yields. Thus, selection of heat-tolerant cabbage is an important goal in cabbage breeding. Easier or faster selection of superior varieties of cabbage, which are tolerant to heat and disease and have improved taste and quality, can be achieved with molecular and biological methods. We compared heat-responsive gene expression between a heat-tolerant cabbage line (HTCL), "HO", and a heat-sensitive cabbage line (HSCL), "JK", by Genechip assay. Expression levels of specific heat stress-related genes were increased in response to high-temperature stress, according to Genechip assays. We performed quantitative RT-PCR (qRT-PCR) to compare expression levels of these heat stress-related genes in four HTCLs and four HSCLs. Transcript levels for heat shock protein BoHsp70 and transcription factor BoGRAS (SCL13) were more strongly expressed only in all HTCLs compared to all HSCLs, showing much lower level expressions at the young plant stage under heat stress (HS). Thus, we suggest that expression levels of these genes may be early selection markers for HTCLs in cabbage breeding. In addition, several genes that are involved in the secondary metabolite pathway were differentially regulated in HTCL and HSCL exposed to heat stress. PMID:23736694

  3. HPV-16 E2 contributes to induction of HPV-16 late gene expression by inhibiting early polyadenylation

    PubMed Central

    Johansson, Cecilia; Somberg, Monika; Li, Xiaoze; Backström Winquist, Ellenor; Fay, Joanna; Ryan, Fergus; Pim, David; Banks, Lawrence; Schwartz, Stefan

    2012-01-01

    We provide evidence that the human papillomavirus (HPV) E2 protein regulates HPV late gene expression. High levels of E2 caused a read-through at the early polyadenylation signal pAE into the late region of the HPV genome, thereby inducing expression of L1 and L2 mRNAs. This is a conserved property of E2 of both mucosal and cutaneous HPV types. Induction could be reversed by high levels of HPV-16 E1 protein, or by the polyadenylation factor CPSF30. HPV-16 E2 inhibited polyadenylation in vitro by preventing the assembly of the CPSF complex. Both the N-terminal and hinge domains of E2 were required for induction of HPV late gene expression in transfected cells as well as for inhibition of polyadenylation in vitro. Finally, overexpression of HPV-16 E2 induced late gene expression from a full-length genomic clone of HPV-16. We speculate that the accumulation of high levels of E2 during the viral life cycle, not only turns off the expression of the pro-mitotic viral E6 and E7 genes, but also induces the expression of the late HPV genes L1 and L2. PMID:22617423

  4. Gene expression analysis of Six3, Pax6, and Otx in the early development of the stalked crinoid Metacrinus rotundus.

    PubMed

    Omori, Akihito; Akasaka, Koji; Kurokawa, Daisuke; Amemiya, Shonan

    2011-01-01

    The stalked crinoid, Metacrinus rotundus, is one of the most basal extant echinoderms. Here, we show the expression patterns of Six3, Pax6, and Otx in the early development of M. rotundus. All three genes are highly expressed in stages from the gastrula to the auricularia larval stage. Ectodermal expression of MrOtx appears to be correlated with development of the ciliary band. These three genes are expressed sequentially along the embryonic body axis in the anterior and middle walls of the archenteron in the order of MrPax6, MrSix3, and MrOtx. The anterior, middle, and posterior parts of the archenteron in the late gastrula differentiate into the axo-hydrocoel, the enteric sac, and somatocoels at later stages, respectively. The three genes are expressed sequentially from the tip of the axo-hydrocoel to the bottom of enteric sac in the order of MrSix3, MrPax6, and MrOtx at the later stages. This suggests that these genes are involved in patterning of the larval endo-mesoderm in stalked crinoids. The present results suggest that radical alterations have occurred in the expression and function of homeobox genes in basal echinoderms. PMID:20837165

  5. Properties of a novel gene isolated from a Hodgkin's disease cell line that is expressed early during lymphoid cell activation

    SciTech Connect

    Bennett, J.S.; Tredway, T.L.; Dizikes, G.J.; Nawrocki, J.F. Hines Veterans Administration Hospital, IL )

    1994-03-01

    The authors have isolated a novel 667-bp cDNA clone, designated epag, from a Hodgkin's-disease cell line-derived library that is expressed in association with T cell activation and which is not related to any known gene family. By using reverse transcription/PCR, the authors have demonstrated that epag mRNA is expressed as early as 1 h after stimulation of normal PBMCs with anti-CD3. The levels of mRNA peaked by 4 h, and no expression was detectable by 12 h postactivation or in resting cells incubated in culture without activation. Expression of epag was also detected in PMA- and PHA-stimulated, but not in nonstimulated Jurkat cells, and overall its expression in transformed cell lines of hemopoietic origin is highly restricted. Sequence analysis of multiple independent cDNA clones showed that epag expressed in the Hodgkin's-disease cell line L428 is identical to the gene expressed in normal activated PBMC. Epag expression was detected by reverse transcription/PCR in RNA preparations made from various normal nonlymphoid tissues. Computer analysis of the sequence identified an open reading frame encoding a putative protein of 13.2 kDa initiating at a CUG translational codon. In vitro translation and Western blot analysis with anti-peptide serum supported this analysis. The authors hypothesize that epag functions as an early signal that helps mediate the activation of T cells. 63 refs., 11 figs.

  6. Protein Kinase Cδ Blocks Immediate-Early Gene Expression in Senescent Cells by Inactivating Serum Response Factor

    PubMed Central

    Wheaton, Keith; Riabowol, Karl

    2004-01-01

    Fibroblasts lose the ability to replicate in response to growth factors and become unable to express growth-associated immediate-early genes, including c-fos and egr-1, as they become senescent. The serum response factor (SRF), a major transcriptional activator of immediate-early gene promoters, loses the ability to bind to the serum response element (SRE) and becomes hyperphosphorylated in senescent cells. We identify protein kinase C delta (PKCδ) as the kinase responsible for inactivation of SRF both in vitro and endogenously in senescent cells. This is due to a higher level of PKCδ activity as cells age, production of the PKCδ catalytic fragment, and its nuclear localization in senescent but not in low-passage-number cells. The phosphorylation of T160 of SRF by PKCδ in vitro and in vivo led to loss of SRF DNA binding activity. Both the PKCδ inhibitor rottlerin and ectopic expression of a dominant negative form of PKCδ independently restored SRE-dependent transcription and immediate-early gene expression in senescent cells. Modulation of PKCδ activity in vivo with rottlerin or bistratene A altered senescent- and young-cell morphology, respectively. These observations support the idea that the coordinate transcriptional inhibition of several growth-associated genes by PKCδ contributes to the senescent phenotype. PMID:15282327

  7. Economic Impact of Gene Expression Profiling in Patients with Early-Stage Breast Cancer in France

    PubMed Central

    Katz, Gregory; Romano, Olivier; Foa, Cyril; Vataire, Anne-Lise; Chantelard, Jean-Victor; Hervé, Robert; Barletta, Hugues; Durieux, Axel; Martin, Jean-Pierre; Salmon, Rémy

    2015-01-01

    Background and Aims The heterogeneous nature of breast cancer can make decisions on adjuvant chemotherapy following surgical resection challenging. Oncotype DX is a validated gene expression profiling test that predicts the likelihood of adjuvant chemotherapy benefit in early-stage breast cancer. The aim of this study is to determine the costs of chemotherapy in private hospitals in France, and evaluate the cost-effectiveness of Oncotype DX from national insurance and societal perspectives. Methods A multicenter study was conducted in seven French private hospitals, capturing retrospective data from 106 patient files. Cost estimates were used in conjunction with a published Markov model to assess the cost-effectiveness of using Oncotype DX to inform chemotherapy decision making versus standard care. Sensitivity analyses were performed. Results The cost of adjuvant chemotherapy in private hospitals was estimated at EUR 8,218 per patient from a national insurance perspective and EUR 10,305 from a societal perspective. Cost-effectiveness analysis indicated that introducing Oncotype DX improved life expectancy (+0.18 years) and quality-adjusted life expectancy (+0.17 QALYs) versus standard care. Oncotype DX was found cost-effective from a national insurance perspective (EUR 2,134 per QALY gained) and cost saving from a societal perspective versus standard care. Inclusion of lost productivity costs in the modeling analysis meant that costs for eligible patients undergoing Oncotype DX testing were on average EUR 602 lower than costs for those receiving standard care. Conclusions As Oncotype DX was found both cost and life-saving from a societal perspective, the test was considered to be dominant to standard care. However, the delay in coverage has the potential to erode the quality of the French healthcare system, thus depriving patients of technologies that could improve clinical outcomes and allow healthcare professionals to better allocate hospital resources to

  8. Early gene expression in bacteriophage T7. I. In vivo synthesis, inactivation, and translational utilization of early mRNA's.

    PubMed

    Hercules, K; Jovanovich, S; Sauerbrier, W

    1976-02-01

    In vivo decay rates for the individual T7 early mRNA species were determined. The physical half-lives, measured at 37 C, range from 1.1 min for gene 0.7 RNA to 4.5 min for gene 0.3 RNA. Physical half-lives, as observed after rifampin inhibition of RNA synthesis and polyacylamide electrophoresis of RNAs, are approximately 30% longer than functional half-lives, as observed by 14C-labeled amino acid uptake into individual T7 early proteins. The different RNA species are synthesized at grossly different rates, 0.3 RNA at four times the rate of 1.0 RNA, 0.7 RNA at twice the rate, and 1.1 and 1.3 RNAs at about the same or a slightly lower rate than 1.0 RNA. Rho-factor-mediated termination of transcription behind genes 0.3, 0.7, and perhaps behind 1.0 is inferred from these data. The in vivo translational utilization of the individual T7 early-message species was found to vary by not more than a factor of 2. PMID:1255850

  9. A Low Phytic Acid Barley Mutation Alters Gene Expression in Early Seed Development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Barley (Hordeum vulgare L.) low phytic acid (lpa) mutants have reduced levels of seed phytate, the most abundant form of phosphorus in seeds, and increases in seed inorganic phosphorus. To understand how lpa mutations affect metabolic and developmental processes during seed growth, gene expression ...

  10. Shaped Singular Spectrum Analysis for Quantifying Gene Expression, with Application to the Early Drosophila Embryo

    PubMed Central

    Holloway, David

    2015-01-01

    In recent years, with the development of automated microscopy technologies, the volume and complexity of image data on gene expression have increased tremendously. The only way to analyze quantitatively and comprehensively such biological data is by developing and applying new sophisticated mathematical approaches. Here, we present extensions of 2D singular spectrum analysis (2D-SSA) for application to 2D and 3D datasets of embryo images. These extensions, circular and shaped 2D-SSA, are applied to gene expression in the nuclear layer just under the surface of the Drosophila (fruit fly) embryo. We consider the commonly used cylindrical projection of the ellipsoidal Drosophila embryo. We demonstrate how circular and shaped versions of 2D-SSA help to decompose expression data into identifiable components (such as trend and noise), as well as separating signals from different genes. Detection and improvement of under- and overcorrection in multichannel imaging is addressed, as well as the extraction and analysis of 3D features in 3D gene expression patterns. PMID:25945341

  11. A comparative study of RNA and DNA as internal gene expression controls early in the developmental cycle of Chlamydia pneumoniae.

    PubMed

    Engström, Patrik; Bailey, Leslie; Onskog, Thomas; Bergström, Sven; Johansson, Jörgen

    2010-03-01

    Many microbial pathogens invade and proliferate within host cells and the molecular mechanism underlying this behavior is currently being revealed for several bacterial species. Testing clinically relevant antibacterial compounds and elucidating their effects on gene expression requires adequate controls, especially when studying genetically intractable organisms such as Chlamydia spp., for which various gene fusions cannot be constructed. Until now, relative mRNA levels in Chlamydia have been measured using different internal gene expression controls, including 16S rRNA, mRNAs, and DNA. Here, we compared the advantages and disadvantages of various internal expression controls during the early phase of Chlamydia pneumoniae development. The relative abundance of target mRNAs varied using the different internal control RNAs. This was partly due to variation in the transcript stability of the RNA species. Also, seven out of nine of the analyzed RNAs increased fivefold or more between 2 and 14 h postinfection, while the amount of DNA and number of cells remained essentially unaltered. Our results suggest that RNA should not be used as a gene expression control during the early phase of Chlamydia development, and that intrinsic bacterial DNA is preferable for that purpose because it is stable, abundant, and its relative amount is generally correlated with bacterial numbers. PMID:20002746

  12. Early Differential Gene Expression in Haemocytes from Resistant and Susceptible Biomphalaria glabrata Strains in Response to Schistosoma mansoni

    PubMed Central

    Lockyer, Anne E.; Emery, Aidan M.; Kane, Richard A.; Walker, Anthony J.; Mayer, Claus D.; Mitta, Guillaume; Coustau, Christine; Adema, Coen M.; Hanelt, Ben; Rollinson, David; Noble, Leslie R.; Jones, Catherine S.

    2012-01-01

    The outcome of infection in the host snail Biomphalaria glabrata with the digenean parasite Schistosoma mansoni is determined by the initial molecular interplay occurring between them. The mechanisms by which schistosomes evade snail immune recognition to ensure survival are not fully understood, but one possibility is that the snail internal defence system is manipulated by the schistosome enabling the parasite to establish infection. This study provides novel insights into the nature of schistosome resistance and susceptibility in B. glabrata at the transcriptomic level by simultaneously comparing gene expression in haemocytes from parasite-exposed and control groups of both schistosome-resistant and schistosome-susceptible strains, 2 h post exposure to S. mansoni miracidia, using an novel 5K cDNA microarray. Differences in gene expression, including those for immune/stress response, signal transduction and matrix/adhesion genes were identified between the two snail strains and tests for asymmetric distributions of gene function also identified immune-related gene expression in resistant snails, but not in susceptible. Gene set enrichment analysis revealed that genes involved in mitochondrial electron transport, ubiquinone biosynthesis and electron carrier activity were consistently up-regulated in resistant snails but down-regulated in susceptible. This supports the hypothesis that schistosome-resistant snails recognize schistosomes and mount an appropriate defence response, while in schistosome-susceptible snails the parasite suppresses this defence response, early in infection. PMID:23300533

  13. Prenylation differentially inhibits insulin-dependent immediate early gene mRNA expression.

    PubMed

    Franklin, J Lee; Amsler, Maggie O; Messina, Joseph L

    2016-06-01

    Increased activity of prenyl transferases is observed in pathological states of insulin resistance, diabetes, and obesity. Thus, functional inhibitors of farnesyl transferase (FTase) and geranylgeranyl transferase (GGTase) may be promising therapeutic treatments. We previously identified insulin responsive genes from a rat H4IIE hepatoma cell cDNA library, including β-actin, EGR1, Pip92, c-fos, and Hsp60. In the present study, we investigated whether acute treatment with FTase and GGTase inhibitors would alter insulin responsive gene initiation and/or elongation rates. We observed differential regulation of insulin responsive gene expression, suggesting a differential sensitivity of these genes to one or both of the specific protein prenylation inhibitors. PMID:27086854

  14. A requirement for the immediate early gene Zif268 in the expression of late LTP and long-term memories.

    PubMed

    Jones, M W; Errington, M L; French, P J; Fine, A; Bliss, T V; Garel, S; Charnay, P; Bozon, B; Laroche, S; Davis, S

    2001-03-01

    The induction of long-term potentiation (LTP) in the dentate gyrus of the hippocampus is associated with a rapid and robust transcription of the immediate early gene Zif268. We used a mutant mouse with a targeted disruption of Zif268 to ask whether this gene, which encodes a zinc finger transcription factor, is required for the maintenance of late LTP and for the expression of long-term memory. We show that whereas mutant mice exhibit early LTP in the dentate gyrus, late LTP is absent when measured 24 and 48 hours after tetanus in the freely moving animal. In both spatial and non-spatial learning tasks, short-term memory remained intact, whereas performance was impaired in tests requiring long-term memory. Thus, Zif268 is essential for the transition from short- to long-term synaptic plasticity and for the expression of long-term memories. PMID:11224546

  15. Small-molecule inhibitors of ERK-mediated immediate early gene expression and proliferation of melanoma cells expressing mutated BRaf

    PubMed Central

    Samadani, Ramin; Zhang, Jun; Brophy, Amanda; Oashi, Taiji; Priyakumar, U. Deva; Raman, E. Prabhu; St John, Franz J.; Jung, Kwan-Young; Fletcher, Steven; Pozharski, Edwin; MacKerell, Alexander D.; Shapiro, Paul

    2015-01-01

    Constitutive activation of the extracellular-signal-regulated kinases 1 and 2 (ERK1/2) are central to regulating the proliferation and survival of many cancer cells. The current inhibitors of ERK1/2 target ATP binding or the catalytic site and are therefore limited in their utility for elucidating the complex biological roles of ERK1/2 through its phosphorylation and regulation of over 100 substrate proteins. To overcome this limitation, a combination of computational and experimental methods was used to identify low-molecular-mass inhibitors that are intended to target ERK1/2 substrate-docking domains and selectively interfere with ERK1/2 regulation of substrate proteins. In the present study, we report the identification and characterization of compounds with a thienyl benzenesulfonate scaffold that were designed to inhibit ERK1/2 substrates containing an F-site or DEF (docking site for ERK, FXF) motif. Experimental evidence shows the compounds inhibit the expression of F-site containing immediate early genes (IEGs) of the Fos family, including c-Fos and Fra1, and transcriptional regulation of the activator protein-1 (AP-1) complex. Moreover, this class of compounds selectively induces apoptosis in melanoma cells containing mutated BRaf and constitutively active ERK1/2 signalling, including melanoma cells that are inherently resistant to clinically relevant kinase inhibitors. These findings represent the identification and initial characterization of a novel class of compounds that inhibit ERK1/2 signalling functions and their potential utility for elucidating ERK1/2 and other signalling events that control the growth and survival of cancer cells containing elevated ERK1/2 activity. PMID:25695333

  16. Small-molecule inhibitors of ERK-mediated immediate early gene expression and proliferation of melanoma cells expressing mutated BRaf.

    PubMed

    Samadani, Ramin; Zhang, Jun; Brophy, Amanda; Oashi, Taiji; Priyakumar, U Deva; Raman, E Prabhu; St John, Franz J; Jung, Kwan-Young; Fletcher, Steven; Pozharski, Edwin; MacKerell, Alexander D; Shapiro, Paul

    2015-05-01

    Constitutive activation of the extracellular-signal-regulated kinases 1 and 2 (ERK1/2) are central to regulating the proliferation and survival of many cancer cells. The current inhibitors of ERK1/2 target ATP binding or the catalytic site and are therefore limited in their utility for elucidating the complex biological roles of ERK1/2 through its phosphorylation and regulation of over 100 substrate proteins. To overcome this limitation, a combination of computational and experimental methods was used to identify low-molecular-mass inhibitors that are intended to target ERK1/2 substrate-docking domains and selectively interfere with ERK1/2 regulation of substrate proteins. In the present study, we report the identification and characterization of compounds with a thienyl benzenesulfonate scaffold that were designed to inhibit ERK1/2 substrates containing an F-site or DEF (docking site for ERK, FXF) motif. Experimental evidence shows the compounds inhibit the expression of F-site containing immediate early genes (IEGs) of the Fos family, including c-Fos and Fra1, and transcriptional regulation of the activator protein-1 (AP-1) complex. Moreover, this class of compounds selectively induces apoptosis in melanoma cells containing mutated BRaf and constitutively active ERK1/2 signalling, including melanoma cells that are inherently resistant to clinically relevant kinase inhibitors. These findings represent the identification and initial characterization of a novel class of compounds that inhibit ERK1/2 signalling functions and their potential utility for elucidating ERK1/2 and other signalling events that control the growth and survival of cancer cells containing elevated ERK1/2 activity. PMID:25695333

  17. Entamoeba histolytica: differential gene expression during programmed cell death and identification of early pro- and anti-apoptotic signals.

    PubMed

    Monroy, Virginia Sánchez; Flores, Ma Olivia Medel; Villalba-Magdaleno, José D'Artagnan; Garcia, Consuelo Gómez; Ishiwara, David Guillermo Pérez

    2010-12-01

    We have demonstrated that programmed cell death (PCD) in Entamoeba histolytica is induced in vitro by G418 aminoglycoside antibiotic. To ascertain if biochemical and morphological changes previously observed are paired to molecular changes that reflect a genetic program, we looked here for early differential gene expression during the induction of PCD. Using cDNA-amplified fragment length polymorphisms (AFLPs) and in silico derived analysis we showed in E. histolytica a differential gene expression during PCD induced by G418. The genes identified encoded for proteins homologous to Glutaminyl-tRNA synthase, Ribosomal Subunit Proteins 40S and 18S, Saposin-like, Silent Information Regulator-2 (Sir-2), and Grainins 1 and 2. Using real-time quantitative PCR (RT Q-PCR), we found that glutaminyl-tRNA synthetase, sir-2, grainins and saposin-like genes were strongly overexpressed after 30min of PCD induction, while its expression dramatically decreased up to 60min. On the other hand, overexpression of ribosomal genes increased only 7-fold of basal expression, showing a progressive down-regulation up to 90min. glutaminyl-tRNA synthetase, sir-2 and grainins could act as negative regulators of PCD, trying to control the biochemical changes related to PCD activation. Overexpression of saposin-like gene could act as up-regulator of some cell death pathways. Our results give evidence of the first genes identified during the early stage of PCD in E. histolytica that could be implicated in regulation of apoptotic pathways. PMID:20515683

  18. Spatio-Temporal Gene Expression Profiling during In Vivo Early Ovarian Folliculogenesis: Integrated Transcriptomic Study and Molecular Signature of Early Follicular Growth

    PubMed Central

    Bonnet, Agnes; Servin, Bertrand; Mulsant, Philippe; Mandon-Pepin, Beatrice

    2015-01-01

    Background The successful achievement of early ovarian folliculogenesis is important for fertility and reproductive life span. This complex biological process requires the appropriate expression of numerous genes at each developmental stage, in each follicular compartment. Relatively little is known at present about the molecular mechanisms that drive this process, and most gene expression studies have been performed in rodents and without considering the different follicular compartments. Results We used RNA-seq technology to explore the sheep transcriptome during early ovarian follicular development in the two main compartments: oocytes and granulosa cells. We documented the differential expression of 3,015 genes during this phase and described the gene expression dynamic specific to these compartments. We showed that important steps occurred during primary/secondary transition in sheep. We also described the in vivo molecular course of a number of pathways. In oocytes, these pathways documented the chronology of the acquisition of meiotic competence, migration and cellular organization, while in granulosa cells they concerned adhesion, the formation of cytoplasmic projections and steroid synthesis. This study proposes the involvement in this process of several members of the integrin and BMP families. The expression of genes such as Kruppel-like factor 9 (KLF9) and BMP binding endothelial regulator (BMPER) was highlighted for the first time during early follicular development, and their proteins were also predicted to be involved in gene regulation. Finally, we selected a data set of 24 biomarkers that enabled the discrimination of early follicular stages and thus offer a molecular signature of early follicular growth. This set of biomarkers includes known genes such as SPO11 meiotic protein covalently bound to DSB (SPO11), bone morphogenetic protein 15 (BMP15) and WEE1 homolog 2 (S. pombe)(WEE2) which play critical roles in follicular development but other

  19. Gene expression profiling reveals underlying molecular mechanisms of the early stages of tamoxifen-induced rat hepatocarcinogenesis

    SciTech Connect

    Pogribny, Igor P. Bagnyukova, Tetyana V.; Tryndyak, Volodymyr P.; Muskhelishvili, Levan; Rodriguez-Juarez, Rocio; Kovalchuk, Olga; Han Tao; Fuscoe, James C.; Ross, Sharon A.; Beland, Frederick A.

    2007-11-15

    Tamoxifen is a widely used anti-estrogenic drug for chemotherapy and, more recently, for the chemoprevention of breast cancer. Despite the indisputable benefits of tamoxifen in preventing the occurrence and re-occurrence of breast cancer, the use of tamoxifen has been shown to induce non-alcoholic steatohepatitis, which is a life-threatening fatty liver disease with a risk of progression to cirrhosis and hepatocellular carcinoma. In recent years, the high-throughput microarray technology for large-scale analysis of gene expression has become a powerful tool for increasing the understanding of the molecular mechanisms of carcinogenesis and for identifying new biomarkers with diagnostic and predictive values. In the present study, we used the high-throughput microarray technology to determine the gene expression profiles in the liver during early stages of tamoxifen-induced rat hepatocarcinogenesis. Female Fisher 344 rats were fed a 420 ppm tamoxifen containing diet for 12 or 24 weeks, and gene expression profiles were determined in liver of control and tamoxifen-exposed rats. The results indicate that early stages of tamoxifen-induced liver carcinogenesis are characterized by alterations in several major cellular pathways, specifically those involved in the tamoxifen metabolism, lipid metabolism, cell cycle signaling, and apoptosis/cell proliferation control. One of the most prominent changes during early stages of tamoxifen-induced hepatocarcinogenesis is dysregulation of signaling pathways in cell cycle progression from the G{sub 1} to S phase, evidenced by the progressive and sustained increase in expression of the Pdgfc, Calb3, Ets1, and Ccnd1 genes accompanied by the elevated level of the PI3K, p-PI3K, Akt1/2, Akt3, and cyclin B, D1, and D3 proteins. The early appearance of these alterations suggests their importance in the mechanism of neoplastic cell transformation induced by tamoxifen.

  20. Measuring gene expression noise in early Drosophila embryos: nucleus-to-nucleus variability.

    PubMed

    Golyandina, Nina E; Holloway, David M; Lopes, Francisco J P; Spirov, Alexander V; Spirova, Ekaterina N; Usevich, Konstantin D

    2012-01-01

    In recent years the analysis of noise in gene expression has widely attracted the attention of experimentalists and theoreticians. Experimentally, the approaches based on in vivo fluorescent reporters in single cells appear to be straightforward and effective tools for bacteria and yeast. However, transferring these approaches to multicellular organisms presents many methodological problems. Here we describe our approach to measure between-nucleus variability (noise) in the primary morphogenetic gradient of Bicoid (Bcd) in the precellular blastoderm stage of fruit fly (Drosophila) embryos. The approach is based on the comparison of results for fixed immunostained embryos with observations of live embryos carrying fluorescent Bcd (Bcd-GFP). We measure the noise using two-dimensional Singular Spectrum Analysis (2D SSA). We have found that the nucleus-to-nucleus noise in Bcd intensity, both for live (Bcd-GFP) and for fixed immunstained embryos, tends to be signal-independent. In addition, the character of the noise is sensitive to the nuclear masking technique used to extract quantitative intensities. Further, the method of decomposing the raw quantitative expression data into a signal (expression surface) and residual noise affects the character of the residual noise. We find that careful masking of confocal images and use of appropriate computational tools to decompose raw expression data into trend and noise makes it possible to extract and study the biological noise of gene expression. PMID:22723811

  1. Measuring gene expression noise in early Drosophila embryos: nucleus-to-nucleus variability

    PubMed Central

    Golyandina, Nina E.; Holloway, David M.; Lopes, Francisco J.P.; Spirov, Alexander V.; Spirova, Ekaterina N.; Usevich, Konstantin D.

    2012-01-01

    In recent years the analysis of noise in gene expression has widely attracted the attention of experimentalists and theoreticians. Experimentally, the approaches based on in vivo fluorescent reporters in single cells appear to be straightforward and effective tools for bacteria and yeast. However, transferring these approaches to multicellular organisms presents many methodological problems. Here we describe our approach to measure between-nucleus variability (noise) in the primary morphogenetic gradient of Bicoid (Bcd) in the precellular blastoderm stage of fruit fly (Drosophila) embryos. The approach is based on the comparison of results for fixed immunostained embryos with observations of live embryos carrying fluorescent Bcd (Bcd-GFP). We measure the noise using two-dimensional Singular Spectrum Analysis (2D SSA). We have found that the nucleus-to-nucleus noise in Bcd intensity, both for live (Bcd-GFP) and for fixed immunstained embryos, tends to be signal-independent. In addition, the character of the noise is sensitive to the nuclear masking technique used to extract quantitative intensities. Further, the method of decomposing the raw quantitative expression data into a signal (expression surface) and residual noise affects the character of the residual noise. We find that careful masking of confocal images and use of appropriate computational tools to decompose raw expression data into trend and noise makes it possible to extract and study the biological noise of gene expression. PMID:22723811

  2. RNA sequencing analysis of gene expression regulated by the transcription factor SlZFP2 during early fruit development.

    PubMed

    Weng, Lin; Zhao, Fangfang; Li, Rong; Xiao, Han

    2016-06-01

    The transcription factor SlZFP2 (Solanum lycopersicum Zinc Finger Protein 2) regulates ABA biosynthesis during fruit development. To reveal the regulatory network of this transcription factor, we conducted a high-throughput RNA-seq to identify differentially expressed genes in 2 dpa (days post anthesis) fruits from a representative RNAi line in Solanum pimpinellifolium LA1589 background and the wild type. The transcriptome analysis revealed that expression of 2722 genes was regulated by SlZFP2 during early fruit development and further helped to narrow down its direct targets to 193 genes. Here, we provide a detailed description of the experimental procedure associated with our transcriptome sequencing data deposited in the National Center for Biotechnology Information (accession no. GSE63838). PMID:27114906

  3. Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat

    SciTech Connect

    Kenney, S.; Kamine, J.; Markovitz, D.; Fenrick, R.; Pagano, J.

    1988-03-01

    Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses.

  4. Transcriptome Sequencing, De Novo Assembly and Differential Gene Expression Analysis of the Early Development of Acipenser baeri

    PubMed Central

    Song, Wei; Jiang, Keji; Zhang, Fengying; Lin, Yu; Ma, Lingbo

    2015-01-01

    The molecular mechanisms that drive the development of the endangered fossil fish species Acipenser baeri are difficult to study due to the lack of genomic data. Recent advances in sequencing technologies and the reducing cost of sequencing offer exclusive opportunities for exploring important molecular mechanisms underlying specific biological processes. This manuscript describes the large scale sequencing and analyses of mRNA from Acipenser baeri collected at five development time points using the Illumina Hiseq2000 platform. The sequencing reads were de novo assembled and clustered into 278167 unigenes, of which 57346 (20.62%) had 45837 known homologues proteins in Uniprot protein databases while 11509 proteins matched with at least one sequence of assembled unigenes. The remaining 79.38% of unigenes could stand for non-coding unigenes or unigenes specific to A. baeri. A number of 43062 unigenes were annotated into functional categories via Gene Ontology (GO) annotation whereas 29526 unigenes were associated with 329 pathways by mapping to KEGG database. Subsequently, 3479 differentially expressed genes were scanned within developmental stages and clustered into 50 gene expression profiles. Genes preferentially expressed at each stage were also identified. Through GO and KEGG pathway enrichment analysis, relevant physiological variations during the early development of A. baeri could be better cognized. Accordingly, the present study gives insights into the transcriptome profile of the early development of A. baeri, and the information contained in this large scale transcriptome will provide substantial references for A. baeri developmental biology and promote its aquaculture research. PMID:26359664

  5. Sulphur limitation and early sulphur deficiency responses in poplar: significance of gene expression, metabolites, and plant hormones

    PubMed Central

    Honsel, Anne; Kojima, Mikiko; Haas, Richard; Frank, Wolfgang; Sakakibara, Hitoshi; Herschbach, Cornelia; Rennenberg, Heinz

    2012-01-01

    The influence of sulphur (S) depletion on the expression of genes related to S metabolism, and on metabolite and plant hormone contents was analysed in young and mature leaves, fine roots, xylem sap, and phloem exudates of poplar (Populus tremula×Populus alba) with special focus on early consequences. S depletion was applied by a gradual decrease of sulphate availability. The observed changes were correlated with sulphate contents. Based on the decrease in sulphate contents, two phases of S depletion could be distinguished that were denominated as ‘S limitation’ and ‘early S deficiency’. S limitation was characterized by improved sulphate uptake (enhanced root-specific sulphate transporter PtaSULTR1;2 expression) and reduction capacities (enhanced adenosine 5′-phosphosulphate (APS) reductase expression) and by enhanced remobilization of sulphate from the vacuole (enhanced putative vacuolar sulphate transporter PtaSULTR4;2 expression). During early S deficiency, whole plant distribution of S was impacted, as indicated by increasing expression of the phloem-localized sulphate transporter PtaSULTR1;1 and by decreasing glutathione contents in fine roots, young leaves, mature leaves, and phloem exudates. Furthermore, at ‘early S deficiency’, expression of microRNA395 (miR395), which targets transcripts of PtaATPS3/4 (ATP sulphurylase) for cleavage, increased. Changes in plant hormone contents were observed at ‘early S deficiency’ only. Thus, S depletion affects S and plant hormone metabolism of poplar during ‘S limitation’ and ‘early S deficiency’ in a time series of events. Despite these consequences, the impact of S depletion on growth of poplar plants appears to be less severe than in Brassicaceae such as Arabidopsis thaliana or Brassica sp. PMID:22162873

  6. Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells.

    PubMed Central

    Chapman, B S; Thayer, R M; Vincent, K A; Haigwood, N L

    1991-01-01

    A 2.4 kb fragment of hCMV (Towne strain), containing the 5' end of the major immediate-early gene, has been cloned, sequenced, and used to construct a series of mammalian cell expression plasmids. The effects of regulatory regions present on this fragment were assessed using human glycoproteins as reporter molecules. We compared secreted levels of Factor VIII, t-PA, and HIV-1 envelope glycoproteins in cells transfected with plasmids in which intron A of the immediate-early gene was present or absent. Secretion of several glycoproteins was significantly higher when cells were transfected with intron A-containing plasmids. Mutation of three basepairs in the strong nuclear factor 1 (NF1) binding site in intron A led to reduced transient expression levels, but not to the level observed in the absence of intron A. Reduced expression from NF1 mutant plasmids was roughly correlated with reduced binding in vitro of NF1 proteins to a synthetic oligonucleotide containing the mutation. The evidence indicates that sequences in intron A positively regulate expression from the hCMV immediate-early enhancer/promoter in transformed monkey kidney cells. Images PMID:1650459

  7. Thalidomide induced early gene expression perturbations indicative of human embryopathy in mouse embryonic stem cells

    SciTech Connect

    Gao, Xiugong Sprando, Robert L.; Yourick, Jeffrey J.

    2015-08-15

    Developmental toxicity testing has traditionally relied on animal models which are costly, time consuming, and require the sacrifice of large numbers of animals. In addition, there are significant disparities between human beings and animals in their responses to chemicals. Thalidomide is a species-specific developmental toxicant that causes severe limb malformations in humans but not in mice. Here, we used microarrays to study transcriptomic changes induced by thalidomide in an in vitro model based on differentiation of mouse embryonic stem cells (mESCs). C57BL/6 mESCs were allowed to differentiate spontaneously and RNA was collected at 24, 48, and 72 h after exposure to 0.25 mM thalidomide. Global gene expression analysis using microarrays revealed hundreds of differentially expressed genes upon thalidomide exposure that were enriched in gene ontology (GO) terms and canonical pathways associated with embryonic development and differentiation. In addition, many genes were found to be involved in small GTPases-mediated signal transduction, heart development, and inflammatory responses, which coincide with clinical evidences and may represent critical embryotoxicities of thalidomide. These results demonstrate that transcriptomics in combination with mouse embryonic stem cell differentiation is a promising alternative model for developmental toxicity assessment. - Highlights: • Studied genomic changes in mouse embryonic stem cells upon thalidomide exposure • Identified gene expression changes that may represent thalidomide embryotoxicity • The toxicogenomic changes coincide well with known thalidomide clinical outcomes. • The mouse embryonic stem cell model is suitable for developmental toxicity testing. • The model has the potential for high-throughput screening of a multitude of compounds.

  8. Expression dynamics of bovine MX genes in the endometrium and placenta during early to mid pregnancy

    PubMed Central

    SHIROZU, Takahiro; SASAKI, Keisuke; KAWAHARA, Manabu; YANAGAWA, Yojiro; NAGANO, Masashi; YAMAUCHI, Nobuhiko; TAKAHASHI, Masashi

    2015-01-01

    MX belongs to a family of type I interferon (IFN)-stimulated genes, and the MX protein has antiviral activity. MX has at least two isoforms, known as MX1 and MX2, in mammals. Moreover, bovine MX1 has been found to have alternative splice variants—namely, MX1-a and MX1B. In ruminants, IFN-τ—a type I IFN—is temporarily produced from the conceptus before implantation and induces MX expression in the endometrium. However, the expression dynamics of MX after implantation are not clear. In the present study, we investigated the expression of MX1-a, MX1B and MX2 in the endometrium and placenta before and after implantation along with the expression of IFN-α, type I receptors (IFNAR1 and IFNAR2) and interferon regulatory factors (IRF3 and IRF9). Pregnant uterine samples were divided into five groups according to pregnancy days 14–18, 25–40, 50–70, 80–100, and 130–150. Tissue samples were collected from the intercaruncular endometrium (IC), caruncular endometrium (C) and fetal placenta (P). Although all the MX expressions were significantly higher in the IC and C at days 14–18, presumably caused by embryo-secreted IFN-τ stimulation, their expressions were also detectable in the IC, C and P after implantation. Furthermore, IFN-α expression was significantly higher in the IC. RT-PCR indicated IFNAR1, IFNAR2, IRF3 and IRF9 mRNA in all the tissues during pregnancy. These results suggest that all the MX genes are affected by the type I IFN pathway during pregnancy and are involved in an immune response to protect the mother and fetus. PMID:26498202

  9. Dynamic shifts in corticostriatal expression patterns of the immediate early genes Homer 1a and Zif268 during early and late phases of instrumental training.

    PubMed

    Hernandez, Pepe J; Schiltz, Craig A; Kelley, Ann E

    2006-01-01

    Adaptive motor actions require prior knowledge of instrumental contingencies. With practice, these actions can become highly automatic in nature. However, the molecular and anatomical substrates mediating these related forms of learning are not understood. In the present study, we used in situ hybridization to measure the mRNA levels of two immediate early genes (IEGs) in an instrumental paradigm where rats learned to lever-press for food. We report that after three training sessions, Homer 1a and Zif268 (an effector and regulatory IEG, respectively) were significantly induced within an extensive corticostriatal network relative to untrained controls. With extended training (23 sessions), however, a shift in the expression patterns of the two genes was evident. Expression of Homer 1a (official symbol Homer1) decreased significantly in frontal and cingulate cortices, whereas striatal expression was generally maintained. Interestingly, Homer 1a expression markedly increased with extensive training in the ventrolateral region of the striatum (VLS) relative to early learners, suggesting that plasticity in the VLS is required for the efficient production of the learned behavior or in habit formation. Zif268 (official symbol Egr1) expression generally decreased with extensive training; however, these changes were not significant. These results demonstrate for the first time, on a molecular level, a dynamic shift in the contribution of corticostriatal systems mediating the early acquisition and consolidation of goal-directed responses to those engaged after extensive training. PMID:17015857

  10. Thalidomide induced early gene expression perturbations indicative of human embryopathy in mouse embryonic stem cells.

    PubMed

    Gao, Xiugong; Sprando, Robert L; Yourick, Jeffrey J

    2015-08-15

    Developmental toxicity testing has traditionally relied on animal models which are costly, time consuming, and require the sacrifice of large numbers of animals. In addition, there are significant disparities between human beings and animals in their responses to chemicals. Thalidomide is a species-specific developmental toxicant that causes severe limb malformations in humans but not in mice. Here, we used microarrays to study transcriptomic changes induced by thalidomide in an in vitro model based on differentiation of mouse embryonic stem cells (mESCs). C57BL/6 mESCs were allowed to differentiate spontaneously and RNA was collected at 24, 48, and 72h after exposure to 0.25mM thalidomide. Global gene expression analysis using microarrays revealed hundreds of differentially expressed genes upon thalidomide exposure that were enriched in gene ontology (GO) terms and canonical pathways associated with embryonic development and differentiation. In addition, many genes were found to be involved in small GTPases-mediated signal transduction, heart development, and inflammatory responses, which coincide with clinical evidences and may represent critical embryotoxicities of thalidomide. These results demonstrate that transcriptomics in combination with mouse embryonic stem cell differentiation is a promising alternative model for developmental toxicity assessment. PMID:26006729

  11. Expression of a cellular gene cloned in herpes simplex virus: rabbit beta-globin is regulated as an early viral gene in infected fibroblasts.

    PubMed Central

    Smiley, J R; Smibert, C; Everett, R D

    1987-01-01

    We constructed nondefective herpes simplex virus type 1 recombinants bearing the intact rabbit beta-globin gene inserted into the viral gene for thymidine kinase to study the expression of a cellular gene when it is present in the viral genome during lytic viral infections. The globin promoter was activated to high levels during productive infection of Vero cells, giving rise to properly spliced and processed cytoplasmic globin transcripts. Expression of globin RNA occurred with early kinetics, was not affected by blocking viral DNA replication, and was strongly inhibited by preventing viral immediate-early protein synthesis with cycloheximide. These results support the hypothesis that temporal control of herpes simplex virus early gene expression is accomplished by mechanisms that are not restricted to viral promoters. In addition, these data show that a cellular transcript can be correctly processed and can accumulate to high levels during viral infection; this indicates that the mechanisms of virally induced shutoff of host RNA accumulation and degradation of host mRNAs do not depend on sequence-specific differentiation between host and viral RNAs. These findings also suggest that herpesviruses have considerable potential as high-capacity gene transfer vectors for a variety of applications. Images PMID:3037101

  12. Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups.

    PubMed

    Bel-Vialar, Sophie; Itasaki, Nobue; Krumlauf, Robb

    2002-11-01

    Initiation of Hox genes requires interactions between numerous factors and signaling pathways in order to establish their precise domain boundaries in the developing nervous system. There are distinct differences in the expression and regulation of members of Hox genes within a complex suggesting that multiple competing mechanisms are used to initiate their expression domains in early embryogenesis. In this study, by analyzing the response of HoxB genes to both RA and FGF signaling in neural tissue during early chick embryogenesis (HH stages 7-15), we have defined two distinct groups of Hox genes based on their reciprocal sensitivity to RA or FGF during this developmental period. We found that the expression domain of 5' members from the HoxB complex (Hoxb6-Hoxb9) can be expanded anteriorly in the chick neural tube up to the level of the otic vesicle following FGF treatment and that these same genes are refractory to RA treatment at these stages. Furthermore, we showed that the chick caudal-related genes, cdxA and cdxB, are also responsive to FGF signaling in neural tissue and that their anterior expansion is also limited to the level of the otic vesicle. Using a dominant negative form of a Xenopus Cdx gene (XcadEnR) we found that the effect of FGF treatment on 5' HoxB genes is mediated in part through the activation and function of CDX activity. Conversely, the 3' HoxB genes (Hoxb1 and Hoxb3-Hoxb5) are sensitive to RA but not FGF treatments at these stages. We demonstrated by in ovo electroporation of a dominant negative retinoid receptor construct (dnRAR) that retinoid signaling is required to initiate expression. Elevating CDX activity by ectopic expression of an activated form of a Xenopus Cdx gene (XcadVP16) in the hindbrain ectopically activates and anteriorly expands Hoxb4 expression. In a similar manner, when ectopic expression of XcadVP16 is combined with FGF treatment, we found that Hoxb9 expression expands anteriorly into the hindbrain region. Our

  13. An amphioxus nodal gene (AmphiNodal) with early symmetrical expression in the organizer and mesoderm and later asymmetrical expression associated with left-right axis formation

    NASA Technical Reports Server (NTRS)

    Yu, Jr-Kai; Holland, Linda Z.; Holland, Nicholas D.

    2002-01-01

    The full-length sequence and zygotic expression of an amphioxus nodal gene are described. Expression is first detected in the early gastrula just within the dorsal lip of the blastopore in a region of hypoblast that is probably comparable with the vertebrate Spemann's organizer. In the late gastrula and early neurula, expression remains bilaterally symmetrical, limited to paraxial mesoderm and immediately overlying regions of the neural plate. Later in the neurula stage, all neural expression disappears, and mesodermal expression disappears from the right side. All along the left side of the neurula, mesodermal expression spreads into the left side of the gut endoderm. Soon thereafter, all expression is down-regulated except near the anterior and posterior ends of the animal, where transcripts are still found in the mesoderm and endoderm on the left side. At this time, expression also begins in the ectoderm on the left side of the head, in the region where the mouth later forms. These results suggest that amphioxus and vertebrate nodal genes play evolutionarily conserved roles in establishing Spemann's organizer, patterning the mesoderm rostrocaudally and setting up the asymmetrical left-right axis of the body.

  14. A novel naturally occurring tandem promoter in modified vaccinia virus ankara drives very early gene expression and potent immune responses.

    PubMed

    Wennier, Sonia T; Brinkmann, Kay; Steinhäußer, Charlotte; Mayländer, Nicole; Mnich, Claudia; Wielert, Ursula; Dirmeier, Ulrike; Hausmann, Jürgen; Chaplin, Paul; Steigerwald, Robin

    2013-01-01

    Modified vaccinia virus Ankara (MVA) has been shown to be suitable for the generation of experimental vaccines against cancer and infectious diseases, eliciting strong humoral and cellular immune responses. In viral vectored vaccines, strong recombinant antigen expression and timing of expression influence the quantity and quality of the immune response. Screening of synthetic and native poxvirus promoters for strong protein expression in vitro and potent immune responses in vivo led to the identification of the MVA13.5L promoter, a unique and novel naturally occurring tandem promoter in MVA composed of two 44 nucleotide long repeated motifs, each containing an early promoter element. The MVA13.5L gene is highly conserved across orthopoxviruses, yet its function is unknown. The unique structure of its promoter is not found for any other gene in the MVA genome and is also conserved in other orthopoxviruses. Comparison of the MVA13.5L promoter activity with synthetic poxviral promoters revealed that the MVA13.5L promoter produced higher levels of protein early during infection in HeLa cells and particularly in MDBK cells, a cell line in which MVA replication stops at an early stage before the expression of late genes. Finally, a recombinant antigen expressed under the control of this novel promoter induced high antibody titers and increased CD8 T cell responses in homologous prime-boost immunization compared to commonly used promoters. In particular, the recombinant antigen specific CD8 T cell responses dominated over the immunodominant B8R vector-specific responses after three vaccinations and even more during the memory phase. These results have identified the native MVA13.5L promoter as a new potent promoter for use in MVA vectored preventive and therapeutic vaccines. PMID:23951355

  15. A Novel Naturally Occurring Tandem Promoter in Modified Vaccinia Virus Ankara Drives Very Early Gene Expression and Potent Immune Responses

    PubMed Central

    Wennier, Sonia T.; Brinkmann, Kay; Steinhäußer, Charlotte; Mayländer, Nicole; Mnich, Claudia; Wielert, Ursula; Dirmeier, Ulrike; Hausmann, Jürgen; Chaplin, Paul; Steigerwald, Robin

    2013-01-01

    Modified vaccinia virus Ankara (MVA) has been shown to be suitable for the generation of experimental vaccines against cancer and infectious diseases, eliciting strong humoral and cellular immune responses. In viral vectored vaccines, strong recombinant antigen expression and timing of expression influence the quantity and quality of the immune response. Screening of synthetic and native poxvirus promoters for strong protein expression in vitro and potent immune responses in vivo led to the identification of the MVA13.5L promoter, a unique and novel naturally occurring tandem promoter in MVA composed of two 44 nucleotide long repeated motifs, each containing an early promoter element. The MVA13.5L gene is highly conserved across orthopoxviruses, yet its function is unknown. The unique structure of its promoter is not found for any other gene in the MVA genome and is also conserved in other orthopoxviruses. Comparison of the MVA13.5L promoter activity with synthetic poxviral promoters revealed that the MVA13.5L promoter produced higher levels of protein early during infection in HeLa cells and particularly in MDBK cells, a cell line in which MVA replication stops at an early stage before the expression of late genes. Finally, a recombinant antigen expressed under the control of this novel promoter induced high antibody titers and increased CD8 T cell responses in homologous prime-boost immunization compared to commonly used promoters. In particular, the recombinant antigen specific CD8 T cell responses dominated over the immunodominant B8R vector-specific responses after three vaccinations and even more during the memory phase. These results have identified the native MVA13.5L promoter as a new potent promoter for use in MVA vectored preventive and therapeutic vaccines. PMID:23951355

  16. SuperFly: a comparative database for quantified spatio-temporal gene expression patterns in early dipteran embryos.

    PubMed

    Cicin-Sain, Damjan; Pulido, Antonio Hermoso; Crombach, Anton; Wotton, Karl R; Jiménez-Guri, Eva; Taly, Jean-François; Roma, Guglielmo; Jaeger, Johannes

    2015-01-01

    We present SuperFly (http://superfly.crg.eu), a relational database for quantified spatio-temporal expression data of segmentation genes during early development in different species of dipteran insects (flies, midges and mosquitoes). SuperFly has a special focus on emerging non-drosophilid model systems. The database currently includes data of high spatio-temporal resolution for three species: the vinegar fly Drosophila melanogaster, the scuttle fly Megaselia abdita and the moth midge Clogmia albipunctata. At this point, SuperFly covers up to 9 genes and 16 time points per species, with a total of 1823 individual embryos. It provides an intuitive web interface, enabling the user to query and access original embryo images, quantified expression profiles, extracted positions of expression boundaries and integrated datasets, plus metadata and intermediate processing steps. SuperFly is a valuable new resource for the quantitative comparative study of gene expression patterns across dipteran species. Moreover, it provides an interesting test set for systems biologists interested in fitting mathematical gene network models to data. Both of these aspects are essential ingredients for progress toward a more quantitative and mechanistic understanding of developmental evolution. PMID:25404137

  17. SuperFly: a comparative database for quantified spatio-temporal gene expression patterns in early dipteran embryos

    PubMed Central

    Cicin-Sain, Damjan; Pulido, Antonio Hermoso; Crombach, Anton; Wotton, Karl R.; Jiménez-Guri, Eva; Taly, Jean-François; Roma, Guglielmo; Jaeger, Johannes

    2015-01-01

    We present SuperFly (http://superfly.crg.eu), a relational database for quantified spatio-temporal expression data of segmentation genes during early development in different species of dipteran insects (flies, midges and mosquitoes). SuperFly has a special focus on emerging non-drosophilid model systems. The database currently includes data of high spatio-temporal resolution for three species: the vinegar fly Drosophila melanogaster, the scuttle fly Megaselia abdita and the moth midge Clogmia albipunctata. At this point, SuperFly covers up to 9 genes and 16 time points per species, with a total of 1823 individual embryos. It provides an intuitive web interface, enabling the user to query and access original embryo images, quantified expression profiles, extracted positions of expression boundaries and integrated datasets, plus metadata and intermediate processing steps. SuperFly is a valuable new resource for the quantitative comparative study of gene expression patterns across dipteran species. Moreover, it provides an interesting test set for systems biologists interested in fitting mathematical gene network models to data. Both of these aspects are essential ingredients for progress toward a more quantitative and mechanistic understanding of developmental evolution. PMID:25404137

  18. Pheromone-induced expression of immediate early genes in the mouse vomeronasal sensory system.

    PubMed

    Haga-Yamanaka, Sachiko; Touhara, Kazushige

    2013-01-01

    Immediate early genes (IEGs) are powerful tools for visualizing activated neurons and extended circuits that are stimulated by sensory input. Several kinds of IEGs (e.g., c-fos, egr-1) have been utilized for detecting activated receptor neurons in the pheromone sensory organ called the vomeronasal organ (VNO), as well as for mapping the neurons within the central nervous system (CNS) excited by pheromones.In this chapter, we describe the procedure for the detection of pheromone-induced neural activation in the VNO and CNS using the c-Fos immunostaining technique. PMID:24014367

  19. The effect of enterotoxigenic Escherichia coli F4ab,ac on early-weaned piglets: a gene expression study.

    PubMed

    Schroyen, M; Goddeeris, B M; Stinckens, A; Verhelst, R; Janssens, S; Cox, E; Georges, M; Niewold, T; Buys, N

    2013-03-15

    Diarrhoea in neonatal and early-weaned piglets due to enterotoxigenic Escherichia coli-F4 (ETEC-F4) is an important problem in the pig farming industry. There is substantial evidence for a genetic basis for susceptibility to ETEC-F4 since not all pigs suffer from diarrhoea after an ETEC-F4 infection. A region on SSC13 has been found to be in close linkage to the susceptibility of piglets for ETEC-F4ab,ac. Potential candidate genes on SSC13 have been examined and although some polymorphisms were found to be in linkage disequilibrium with the phenotype, the causative mutation has not yet been found. In this study we are looking at the expression of porcine genes in relation to ETEC-F4ab,ac. With the aid of the Affymetrix GeneChip Porcine Genome Array we were able to find differentially expressed genes between ETEC-F4ab,ac receptor positive (Fab,acR(+)) piglets without diarrhoea and F4ab,acR(+) piglets with diarrhoea or F4ab,acR(-) animals. Since the susceptibility to ETEC-F4ab,ac was described as a Mendelian trait, it is not so surprisingly that only two differentially expressed genes, transferrin receptor (TFRC) and trefoil factor 1 (TFF1), came out of the analysis. Although both genes could pass for functional candidate genes only TFRC also mapped to the region on SSC13 associated with susceptibility for ETEC-F4, which makes TFRC a positional functional candidate gene. Validation by qRT-PCR confirmed the differential expression of TFRC and TFF1. In piglets without diarrhoea, the expression of both genes was higher in F4ab,acR(+) than in F4ab,acR(-) piglets. Similarly, TFRC and TFF1 expression in F4ab,acR(+) piglets without diarrhoea was also higher than in F4ab,acR(+) piglets with diarrhoea. Consequently, although both genes might not play a role as receptor for F4 fimbriae, they could be of great importance during an ETEC-F4 outbreak. An upregulation of TFRC can be a consequence of the piglets ability to raise an effective immune response. An elevation of TFF1, a

  20. Expression of leptin and its receptor genes in the ovarian follicles of cycling and early pregnant pigs.

    PubMed

    Smolinska, N; Kaminski, T; Siawrys, G; Przala, J

    2013-01-01

    Leptin is a polypeptide hormone produced primarily by adipocytes. It has been implicated in the regulation of satiety and energy homeostasis. Leptin has been suggested to play a role in reproduction based on its involvement in the regulation of the hypothalamic-pituitary-gonadal axis via endocrine, paracrine and/or autocrine pathways. The aim of the present study was to localize the cellular distribution of leptin and the long isoform of leptin receptor (OB-Rb) genes in porcine ovarian antral follicles and to compare the expression levels of leptin and OB-Rb mRNAs in porcine granulosa cells (GC), theca interna (TIC) and theca externa (TEC) cells during the luteal phase of the estrous cycle and in early pregnancy. The expression of leptin and OB-Rb genes was detected in GC, TIC and TEC. Significantly higher levels of leptin gene expression in GC were observed during the mid- and late-luteal phases of the cycle than on days 30 to 32 of pregnancy. On days 14 to 16 of pregnancy, leptin mRNA expression was higher than that on days 14 to 16 of the cycle. The expression of the OB-Rb gene in GC and TEC increased during pregnancy in comparison with the analyzed luteal phases of the cycle. Our results validate the hypothesis that locally produced leptin plays a role in the regulation of porcine reproduction at the ovarian level and exerts a direct effect on porcine follicles. The differences in OB-Rb gene expression in porcine GC and theca cells also suggest that their sensitivity to leptin varies in the ovaries of pregnant and cyclic pigs. PMID:23031202

  1. Three LIF-dependent signatures and gene clusters with atypical expression profiles, identified by transcriptome studies in mouse ES cells and early derivatives

    PubMed Central

    Trouillas, Marina; Saucourt, Claire; Guillotin, Bertrand; Gauthereau, Xavier; Ding, Li; Buchholz, Frank; Doss, Michael Xavier; Sachinidis, Agapios; Hescheler, Jurgen; Hummel, Oliver; Huebner, Norbert; Kolde, Raivo; Vilo, Jaak; Schulz, Herbert; Bœuf, Hélène

    2009-01-01

    Background Mouse embryonic stem (ES) cells remain pluripotent in vitro when grown in the presence of the cytokine Leukaemia Inhibitory Factor (LIF). Identification of LIF targets and of genes regulating the transition between pluripotent and early differentiated cells is a critical step for understanding the control of ES cell pluripotency. Results By gene profiling studies carried out with mRNAs from ES cells and their early derivatives treated or not with LIF, we have identified i) LIF-dependent genes, highly expressed in pluripotent cells, whose expression level decreases sharply upon LIF withdrawal [Pluri genes], ii) LIF induced genes [Lifind genes] whose expression is differentially regulated depending upon cell context and iii) genes specific to the reversible or irreversible committed states. In addition, by hierarchical gene clustering, we have identified, among eight independent gene clusters, two atypical groups of genes, whose expression level was highly modulated in committed cells only. Computer based analyses led to the characterization of different sub-types of Pluri and Lifind genes, and revealed their differential modulation by Oct4 or Nanog master genes. Individual knock down of a selection of Pluri and Lifind genes leads to weak changes in the expression of early differentiation markers, in cell growth conditions in which these master genes are still expressed. Conclusion We have identified different sets of LIF-regulated genes depending upon the cell state (reversible or irreversible commitment), which allowed us to present a novel global view of LIF responses. We are also reporting on the identification of genes whose expression is strictly regulated during the commitment step. Furthermore, our studies identify sub-networks of genes with a restricted expression in pluripotent ES cells, whose down regulation occurs while the master knot (composed of OCT4, SOX2 and NANOG) is still expressed and which might be down-regulated together for driving

  2. Rodent cell transformation and immediate early gene expression following 60-Hz magnetic field exposure.

    PubMed Central

    Balcer-Kubiczek, E K; Zhang, X F; Harrison, G H; McCready, W A; Shi, Z M; Han, L H; Abraham, J M; Ampey, L L; Meltzer, S J; Jacobs, M C; Davis, C C

    1996-01-01

    Some epidemiological studies suggest that exposure to power frequency magnetic fields (MFs) may be associated with an elevated risk of human cancer, but the experimental database remains limited and controversial. We investigated the hypothesis that 60-Hz MF action at the cellular level produces changes in gene expression that can result in neoplastic transformation. Twenty-four hour 200 microT continuous MF exposure produced negative results in two standard transformation systems (Syrian hamster embryo cells and C3H/10T1/2 murine fibroblasts) with or without postexposure to a chemical promoter. This prompted a reexamination of previously reported MF-induced changes in gene expression in human HL60 cells. Extensive testing using both coded and uncoded analyses was negative for an MF effect. Using the same exposure conditions as in the transformation studies, no MF-induced changes in ornithine decarboxylase expression were observed in C3H/10T1/2 cells, casting doubt on a promotional role of MF for the tested cells and experimental conditions. Images Figure 1. Figure 2. A Figure 2. B Figure 2. C Figure 2. D Figure 3. A Figure 3. B Figure 4. Figure 5. A Figure 5. B Figure 5. C Figure 5. D Figure 5. E Figure 6. A Figure 6. B Figure 6. C Figure 6. D Figure 6. E Figure 7. Figure 8. A Figure 8. B Figure 8. C Figure 9. Figure 10. A Figure 10. B PMID:8959408

  3. Gene expression profiling of early intervertebral disc degeneration reveals a down-regulation of canonical Wnt signaling and caveolin-1 expression: implications for development of regenerative strategies

    PubMed Central

    2013-01-01

    Introduction Early degeneration of the intervertebral disc (IVD) involves a change in cellular differentiation from notochordal cells (NCs) in the nucleus pulposus (NP) to chondrocyte-like cells (CLCs). The purpose of this study was to investigate the gene expression profiles involved in this process using NP tissue from non-chondrodystrophic and chondrodystrophic dogs, a species with naturally occurring IVD degeneration. Methods Dual channel DNA microarrays were used to compare 1) healthy NP tissue containing only NCs (NC-rich), 2) NP tissue with a mixed population of NCs and CLCs (Mixed), and 3) NP tissue containing solely CLCs (CLC-rich) in both non-chondrodystrophic and chondrodystrophic dogs. Based on previous reports and the findings of the microarray analyses, canonical Wnt signaling was further evaluated using qPCR of relevant Wnt target genes. We hypothesized that caveolin-1, a regulator of Wnt signaling that showed significant changes in gene expression in the microarray analyses, played a significant role in early IVD degeneration. Caveolin-1 expression was investigated in IVD tissue sections and in cultured NCs. To investigate the significance of Caveolin-1 in IVD health and degeneration, the NP of 3-month-old Caveolin-1 knock-out mice was histopathologically evaluated and compared with the NP of wild-type mice of the same age. Results Early IVD degeneration involved significant changes in numerous pathways, including Wnt/β-catenin signaling. With regard to Wnt/β-catenin signaling, axin2 gene expression was significantly higher in chondrodystrophic dogs compared with non-chondrodystrophic dogs. IVD degeneration involved significant down-regulation of axin2 gene expression. IVD degeneration involved significant down-regulation in Caveolin-1 gene and protein expression. NCs showed abundant caveolin-1 expression in vivo and in vitro, whereas CLCs did not. The NP of wild-type mice was rich in viable NCs, whereas the NP of Caveolin-1 knock-out mice

  4. Herpes simplex virus type 1 ICP0 regulates expression of immediate-early, early, and late genes in productively infected cells.

    PubMed Central

    Cai, W; Schaffer, P A

    1992-01-01

    The herpes simplex virus type 1 protein, ICP0, can activate expression of all kinetic classes of viral promoters in transient expression assays. To examine the role of ICP0 in the regulation of viral gene expression during productive infection, we characterized the wild-type virus, an ICP0 null mutant (7134), and several ICP0 nonsense mutant viruses with regard to virus replication and protein synthesis in Vero cells. Relative to wild-type virus, 7134 was severely deficient in viral growth and protein synthesis at low multiplicities of infection but exhibited a nearly wild-type phenotype at high multiplicities. The phenotypes of the ICP0 nonsense mutants were intermediate between those of the wild-type virus and 7134 in that the more ICP0-coding sequence expressed by a given nonsense mutant, the more wild type-like was its phenotype. The location of the ICP0 domain responsible for transactivation during productive infection was confirmed to be within the N-terminal portion of the protein, as previously shown in transient expression assays. Immunoprecipitation and immunofluorescence tests were used to detect low-level expression of selected immediate-early (IE), early (E), and late (L) proteins by mutant and wild-type viruses following low-multiplicity infection. The 7134 deletion mutant and several nonsense mutants expressed markedly reduced levels of E and L proteins but wild-type levels of the IE protein, ICP4. Because the latency-associated transcripts (LATs) are specified by the strand opposite that which encodes ICP0, the ICP0 deletion and nonsense mutants are by definition ICP0-LAT double mutants. The ability of a LAT- ICP0+ mutant to replicate as efficiently as wild-type virus at low multiplicities and the ability of ICP0-expressing 0-28 cells to complement the defects of the mutants in E and L protein synthesis indicates that the phenotypes of the mutants are caused by mutations in ICP0 and not the LATs. Thus, we conclude that ICP0 up-regulates E and L but

  5. Maternal expression and early zygotic regulation of the Hox3/zen gene in the grasshopper Schistocerca gregaria.

    PubMed

    Dearden, P; Grbic, M; Falciani, F; Akam, M

    2000-01-01

    In insects, a key step in the early patterning of the egg is to distinguish the primordium of the embryo proper from those regions that will form extra-embryonic membranes. In Drosophila, where these processes are well understood, the structure of the extra-embryonic membranes is highly derived. The distinct amnion and serosa typical of lower insects is replaced by a single, fused, and much reduced membrane, the amnioserosa, which never secretes an embryonic cuticle. We have used the Zen gene as a marker to study the formation of the extra-embryonic membranes, and other aspects of early embryonic patterning, in the grasshopper Schistocerca gregaria (African Plague Locust). Zen genes are derived from Hox genes, but in Drosophila they appear to have lost any role in patterning the A/P axis of the embryo; instead, they are involved in D/V patterning and the specification of the extra-embryonic membranes. We show that the Schistocerca zen gene is expressed during embryogenesis in three distinct phases. The first of these is during cleavage, when Sgzen is transiently expressed in all energids that reach the cell surface. The second phase of expression initiates in a ring of "necklace cells" that surround the forming embryo, and demarcate the boundary between the amnion and serosa. This leads to expression throughout the serosa. The final phase of expression is in the amnion, after this has separated from the serosa. This complex pattern implies that the role of Sgzen in Schistocerca is not limited solely to the specification of cell identity in the extra-embryonic membranes. We also report that the Schistocerca zen gene is expressed maternally, unlike its Drosophila and Tribolium counterparts. A distinct maternal transcript, and maternal Zen protein, accumulate in the developing oocyte from early post-meiotic stages. They remain uniformly distributed in the oocyte cytoplasm until late vitellogenic stages, when the protein and RNA become somewhat concentrated at the egg

  6. Gene-metabolite expression in blood can discriminate allergen-induced isolated early from dual asthmatic responses.

    PubMed

    Singh, Amrit; Yamamoto, Masatsugu; Kam, Sarah H Y; Ruan, Jian; Gauvreau, Gail M; O'Byrne, Paul M; FitzGerald, J Mark; Schellenberg, Robert; Boulet, Louis-Philippe; Wojewodka, Gabriella; Kanagaratham, Cynthia; De Sanctis, Juan B; Radzioch, Danuta; Tebbutt, Scott J

    2013-01-01

    Some asthmatic individuals undergoing allergen inhalation challenge develop an isolated early response whereas others develop a dual response (early plus late response). In the present study we have used transcriptomics (microarrays) and metabolomics (mass spectrometry) of peripheral blood to identify molecular patterns that can discriminate allergen-induced isolated early from dual asthmatic responses. Peripheral blood was obtained prior to (pre-) and 2 hours post allergen inhalation challenge from 33 study participants. In an initial cohort of 14 participants, complete blood counts indicated significant differences in neutrophil and lymphocyte counts at pre-challenge between early and dual responders. At post-challenge, significant genes (ALOX15, FADS2 and LPCAT2) and metabolites (lysolipids) were enriched in lipid metabolism pathways. Enzymes encoding for these genes are involved in membrane biogenesis and metabolism of fatty acids into pro-inflammatory and anti-inflammatory mediators. Correlation analysis indicated a strong negative correlation between ALOX15, FADS2, and IL5RA expression with 2-arachidonoylglycerophosphocholine levels in dual responders. However, measuring arachidonic acid and docosahexaenoic acid levels in a validation cohort of 19 participants indicated that the free form of DHA (nmoles/µg of protein) was significantly (p = 0.03) different between early and dual responders after allergen challenge. Collectively these results may suggest an imbalance in lipid metabolism which dictates pro- (anti-) inflammatory and pro-resolving mechanisms. Future studies with larger sample sizes may reveal novel mechanisms and therapeutic targets of the late phase asthmatic response. PMID:23844124

  7. Spaceflight and simulated microgravity cause a significant reduction of key gene expression in early T-cell activation.

    PubMed

    Martinez, Emily M; Yoshida, Miya C; Candelario, Tara Lynne T; Hughes-Fulford, Millie

    2015-03-15

    Healthy immune function depends on precise regulation of lymphocyte activation. During the National Aeronautics and Space Administration (NASA) Apollo and Shuttle eras, multiple spaceflight studies showed depressed lymphocyte activity under microgravity (μg) conditions. Scientists on the ground use two models of simulated μg (sμg): 1) the rotating wall vessel (RWV) and 2) the random positioning machine (RPM), to study the effects of altered gravity on cell function before advancing research to the true μg when spaceflight opportunities become available on the International Space Station (ISS). The objective of this study is to compare the effects of true μg and sμg on the expression of key early T-cell activation genes in mouse splenocytes from spaceflight and ground animals. For the first time, we compared all three conditions of microgravity spaceflight, RPM, and RWV during immune gene activation of Il2, Il2rα, Ifnγ, and Tagap; moreover, we confirm two new early T-cell activation genes, Iigp1 and Slamf1. Gene expression for all samples was analyzed using quantitative real-time PCR (qRT-PCR). Our results demonstrate significantly increased gene expression in activated ground samples with suppression of mouse immune function in spaceflight, RPM, and RWV samples. These findings indicate that sμg models provide an excellent test bed for scientists to develop baseline studies and augment true μg in spaceflight experiments. Ultimately, sμg and spaceflight studies in lymphocytes may provide insight into novel regulatory pathways, benefiting both future astronauts and those here on earth suffering from immune disorders. PMID:25568077

  8. Spaceflight and simulated microgravity cause a significant reduction of key gene expression in early T-cell activation

    PubMed Central

    Martinez, Emily M.; Yoshida, Miya C.; Candelario, Tara Lynne T.

    2015-01-01

    Healthy immune function depends on precise regulation of lymphocyte activation. During the National Aeronautics and Space Administration (NASA) Apollo and Shuttle eras, multiple spaceflight studies showed depressed lymphocyte activity under microgravity (μg) conditions. Scientists on the ground use two models of simulated μg (sμg): 1) the rotating wall vessel (RWV) and 2) the random positioning machine (RPM), to study the effects of altered gravity on cell function before advancing research to the true μg when spaceflight opportunities become available on the International Space Station (ISS). The objective of this study is to compare the effects of true μg and sμg on the expression of key early T-cell activation genes in mouse splenocytes from spaceflight and ground animals. For the first time, we compared all three conditions of microgravity spaceflight, RPM, and RWV during immune gene activation of Il2, Il2rα, Ifnγ, and Tagap; moreover, we confirm two new early T-cell activation genes, Iigp1 and Slamf1. Gene expression for all samples was analyzed using quantitative real-time PCR (qRT-PCR). Our results demonstrate significantly increased gene expression in activated ground samples with suppression of mouse immune function in spaceflight, RPM, and RWV samples. These findings indicate that sμg models provide an excellent test bed for scientists to develop baseline studies and augment true μg in spaceflight experiments. Ultimately, sμg and spaceflight studies in lymphocytes may provide insight into novel regulatory pathways, benefiting both future astronauts and those here on earth suffering from immune disorders. PMID:25568077

  9. Co-ordinate regulation of herpes simplex virus gene expression is mediated by the functional interaction of two immediate early gene products.

    PubMed

    Gelman, I H; Silverstein, S

    1986-10-01

    At early times after infection with herpes simplex virus, transcription from beta-promoters is initiated only in the presence of a functional 174,000 Mr phosphoprotein (ICP4), encoded by an immediate early (alpha) gene (IE4). A transient expression assay was used to analyze the requirement for two (ICP4 and ICP0) of the five alpha-gene products in the transcriptional regulation of model alpha and beta-gene promoters. These studies reveal that cells cotransfected with plasmids containing the alpha-gene sequences for infected cell proteins (ICPs) 4 and 0 and a thymidine kinase (TK, a beta-gene) gene or the thymidine kinase promoter fused to a chloramphenicol acetyltransferase (CAT) cassette accumulate 10 to 20-fold more RNA or exhibit 10 to 20-fold more CAT activity than cells cotransfected with a plasmid encoding either alpha-gene protein and a thymidine kinase indicator gene. Functional ICP4 is required for enhanced transcriptional activation in the transient expression assay system. It is also required for the uniform dispersal of ICP0 throughout the nucleus as shown by immunofluorescence staining analysis of transfected cells. Two alpha-promoter-CAT fusions were used as targets to study what effects ICP4, ICP0 and Vmw65 (the virion-associated alpha-gene transactivator) have on expression from alpha-promoters that contain all of the sequences that confer alpha-gene regulation, or only the core sequence governing basal level expression. We conclude that ICP4 can activate alpha-gene expression from the core sequence and, depending on its abundance, activate or repress expression from a promoter containing the sequences required for alpha-gene regulation. Independent of these alpha-regulatory sequences cotransfection with low levels of sequences encoding both ICP0 and ICP4 activate expression. At higher ratios of effector (both ICP4 and ICP0) the target accumulation of CAT activity decreases. Although a ts allele of IE4 (cloned from the mutant virus tsK) does not

  10. Analysis of the early adaptive response of endothelial cells to hypoxia via a long serial analysis of gene expression

    SciTech Connect

    Liang, Guang-Ping; Su, Yong-Yue; Chen, Jian; Yang, Zong-Cheng; Liu, You-Sheng; Luo, Xiang-Dong

    2009-07-10

    Activation of endothelial cells in humans is an early event in the response to hypoxia that may contribute to the endothelium's endogenous capacity to reduce tissue injury. To better understand the mechanism underlying this process, we utilized Long Serial Analysis of Gene Expression to study the transcriptome of human vein umbilical endothelial cells (EA.hy926) shortly after the induction of hypoxia. Of over 13,000 genes detected in each pool, 112 showed obvious differences in expression. Metabolic processes such as protein biosynthesis and proteolysis, aminoglycan metabolism, ribonucleotide biosynthesis, adenosine salvage, and lipid metabolism were reinforced. Pro-proliferation and pro-apoptotic states suggest the co-existence of pro- and anti-injury forces in endothelium shortly after the induction of hypoxia. Other adaptive responses include reinforced angiogenesis and vasodilation. Additionally, gene transcription in the endothelium shortly after the induction of hypoxia was regulated independently of HIF-1{alpha}. Our efforts to elucidate the adaptive response at an early post-hypoxia stage should contribute to further investigation of the protective processes that occur in the endothelium and has potential clinical implications.

  11. Early Changes in Gene Expression Induced by Tobacco Smoke: Evidence for the Importance of Estrogen within Lung Tissue

    PubMed Central

    Meireles, Sibele I.; Esteves, Gustavo H.; Hirata, Roberto; Peri, Suraj; Devarajan, Karthik; Slifker, Michael; Mosier, Stacy L.; Peng, Jing; Vadhanam, Manicka V.; Hurst, Harrell E.; Neves, E. Jordao; Reis, Luiz F.; Gairola, C. Gary; Gupta, Ramesh C.; Clapper, Margie L.

    2010-01-01

    Lung cancer is the leading cause of cancer deaths in the U.S., surpassing breast cancer as the primary cause of cancer-related mortality in women. The goal of the present study was to identify early molecular changes in the lung induced by exposure to tobacco smoke and thus identify potential targets for chemoprevention. Female A/J mice were exposed to either tobacco smoke or HEPA-filtered air via a whole-body exposure chamber (6 h/day; 5 days/wk for 3, 8 and 20 wk). Gene expression profiles of lung tissue from control and smoke-exposed animals were established using a 15 K cDNA microarray. Cytochrome P450 1b1 (Cyp1b1), a Phase I enzyme involved in both the metabolism of xenobiotics and the 4-hydroxylation of 17β-estradiol, was modulated to the greatest extent following smoke exposure. A panel of 10 genes was found to be differentially expressed in control and smoke-exposed lung tissue at 3, 8 and 20 wk (P < 0.001). The interaction network of these differentially expressed genes revealed new pathways modulated by short-term smoke exposure including estrogen metabolism. In addition, 17β-estradiol was detected within murine lung tissue by gas chromatography coupled mass spectrometry and immunohistochemistry. Identification of the early molecular events that contribute to lung tumor formation is anticipated to lead to the development of promising targeted chemopreventive therapies. In conclusion, the presence of 17β-estradiol within lung tissue when combined with the modulation of Cyp1b1 and other estrogen metabolism genes by tobacco smoke provides novel insight into a possible role for estrogens in lung cancer. PMID:20515954

  12. Early gene expression changes in skeletal muscle from SOD1(G93A) amyotrophic lateral sclerosis animal model.

    PubMed

    de Oliveira, Gabriela P; Maximino, Jessica R; Maschietto, Mariana; Zanoteli, Edmar; Puga, Renato D; Lima, Leandro; Carraro, Dirce M; Chadi, Gerson

    2014-04-01

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease characterized by loss of motor neurons. Familial ALS is strongly associated to dominant mutations in the gene for Cu/Zn superoxide dismutase (SOD1). Recent evidences point to skeletal muscle as a primary target in the ALS mouse model. Wnt/PI3 K signaling pathways and epithelial-mesenchymal transition (EMT) have important roles in maintenance and repair of skeletal muscle. Wnt/PI3 K pathways and EMT gene expression profile were investigated in gastrocnemius muscle from SOD1(G93A) mouse model and age-paired wild-type control in the presymptomatic ages of 40 and 80 days aiming the early neuromuscular abnormalities that precede motor neuron death in ALS. A customized cDNA microarray platform containing 326 genes of Wnt/PI3 K and EMT was used and results revealed eight up-regulated (Loxl2, Pik4ca, Fzd9, Cul1, Ctnnd1, Snf1lk, Prkx, Dner) and nine down-regulated (Pik3c2a, Ripk4, Id2, C1qdc1, Eif2ak2, Rac3, Cds1, Inppl1, Tbl1x) genes at 40 days, and also one up-regulated (Pik3ca) and five down-regulated (Cd44, Eef2 k, Fzd2, Crebbp, Piki3r1) genes at 80 days. Also, protein-protein interaction networks grown from the differentially expressed genes of 40 and 80 days old mice have identified Grb2 and Src genes in both presymptomatic ages, thus playing a potential central role in the disease mechanisms. mRNA and protein levels for Grb2 and Src were found to be increased in 80 days old ALS mice. Gene expression changes in the skeletal muscle of transgenic ALS mice at presymptomatic periods of disease gave further evidence of early neuromuscular abnormalities that precede motor neuron death. The results were discussed in terms of initial triggering for neuronal degeneration and muscle adaptation to keep function before the onset of symptoms. PMID:24442855

  13. Ebola virion attachment and entry into human macrophages profoundly effects early cellular gene expression.

    PubMed

    Wahl-Jensen, Victoria; Kurz, Sabine; Feldmann, Friedericke; Buehler, Lukas K; Kindrachuk, Jason; DeFilippis, Victor; da Silva Correia, Jean; Früh, Klaus; Kuhn, Jens H; Burton, Dennis R; Feldmann, Heinz

    2011-10-01

    Zaire ebolavirus (ZEBOV) infections are associated with high lethality in primates. ZEBOV primarily targets mononuclear phagocytes, which are activated upon infection and secrete mediators believed to trigger initial stages of pathogenesis. The characterization of the responses of target cells to ZEBOV infection may therefore not only further understanding of pathogenesis but also suggest possible points of therapeutic intervention. Gene expression profiles of primary human macrophages exposed to ZEBOV were determined using DNA microarrays and quantitative PCR to gain insight into the cellular response immediately after cell entry. Significant changes in mRNA concentrations encoding for 88 cellular proteins were observed. Most of these proteins have not yet been implicated in ZEBOV infection. Some, however, are inflammatory mediators known to be elevated during the acute phase of disease in the blood of ZEBOV-infected humans. Interestingly, the cellular response occurred within the first hour of Ebola virion exposure, i.e. prior to virus gene expression. This observation supports the hypothesis that virion binding or entry mediated by the spike glycoprotein (GP(1,2)) is the primary stimulus for an initial response. Indeed, ZEBOV virions, LPS, and virus-like particles consisting of only the ZEBOV matrix protein VP40 and GP(1,2) (VLP(VP40-GP)) triggered comparable responses in macrophages, including pro-inflammatory and pro-apoptotic signals. In contrast, VLP(VP40) (particles lacking GP(1,2)) caused an aberrant response. This suggests that GP(1,2) binding to macrophages plays an important role in the immediate cellular response. PMID:22028943

  14. Six homeoproteins directly activate Myod expression in the gene regulatory networks that control early myogenesis.

    PubMed

    Relaix, Frédéric; Demignon, Josiane; Laclef, Christine; Pujol, Julien; Santolini, Marc; Niro, Claire; Lagha, Mounia; Rocancourt, Didier; Buckingham, Margaret; Maire, Pascal

    2013-04-01

    In mammals, several genetic pathways have been characterized that govern engagement of multipotent embryonic progenitors into the myogenic program through the control of the key myogenic regulatory gene Myod. Here we demonstrate the involvement of Six homeoproteins. We first targeted into a Pax3 allele a sequence encoding a negative form of Six4 that binds DNA but cannot interact with essential Eya co-factors. The resulting embryos present hypoplasic skeletal muscles and impaired Myod activation in the trunk in the absence of Myf5/Mrf4. At the axial level, we further show that Myod is still expressed in compound Six1/Six4:Pax3 but not in Six1/Six4:Myf5 triple mutant embryos, demonstrating that Six1/4 participates in the Pax3-Myod genetic pathway. Myod expression and head myogenesis is preserved in Six1/Six4:Myf5 triple mutant embryos, illustrating that upstream regulators of Myod in different embryonic territories are distinct. We show that Myod regulatory regions are directly controlled by Six proteins and that, in the absence of Six1 and Six4, Six2 can compensate. PMID:23637613

  15. The Early-Onset Myocardial Infarction Associated PHACTR1 Gene Regulates Skeletal and Cardiac Alpha-Actin Gene Expression

    PubMed Central

    Kelloniemi, Annina; Szabo, Zoltan; Serpi, Raisa; Näpänkangas, Juha; Ohukainen, Pauli; Tenhunen, Olli; Kaikkonen, Leena; Koivisto, Elina; Bagyura, Zsolt; Kerkelä, Risto; Leosdottir, Margret; Hedner, Thomas; Melander, Olle

    2015-01-01

    The phosphatase and actin regulator 1 (PHACTR1) locus is a very commonly identified hit in genome-wide association studies investigating coronary artery disease and myocardial infarction (MI). However, the function of PHACTR1 in the heart is still unknown. We characterized the mechanisms regulating Phactr1 expression in the heart, used adenoviral gene delivery to investigate the effects of Phactr1 on cardiac function, and analyzed the relationship between MI associated PHACTR1 allele and cardiac function in human subjects. Phactr1 mRNA and protein levels were markedly reduced (60%, P<0.01 and 90%, P<0.001, respectively) at 1 day after MI in rats. When the direct myocardial effects of Phactr1 were studied, the skeletal α-actin to cardiac α-actin isoform ratio was significantly higher (1.5-fold, P<0.05) at 3 days but 40% lower (P<0.05) at 2 weeks after adenovirus-mediated Phactr1 gene delivery into the anterior wall of the left ventricle. Similarly, the skeletal α-actin to cardiac α-actin ratio was lower at 2 weeks in infarcted hearts overexpressing Phactr1. In cultured neonatal cardiac myocytes, adenovirus-mediated Phactr1 overexpression for 48 hours markedly increased the skeletal α-actin to cardiac α-actin ratio, this being associated with an enhanced DNA binding activity of serum response factor. Phactr1 overexpression exerted no major effects on the expression of other cardiac genes or LV structure and function in normal and infarcted hearts during 2 weeks’ follow-up period. In human subjects, MI associated PHACTR1 allele was not associated significantly with cardiac function (n = 1550). Phactr1 seems to regulate the skeletal to cardiac α-actin isoform ratio. PMID:26098115

  16. Broad Shifts in Gene Expression during Early Postnatal Life Are Associated with Shifts in Histone Methylation Patterns

    PubMed Central

    Lui, Julian C.; Chen, Weiping; Cheung, Crystal S. F.; Baron, Jeffrey

    2014-01-01

    During early postnatal life, extensive changes in gene expression occur concomitantly in multiple major organs, indicating the existence of a common core developmental genetic program. This program includes hundreds of growth-promoting genes that are downregulated with age in liver, kidney, lung, and heart, and there is evidence that this component of the program drives the widespread decline in cell proliferation that occurs in juvenile life, as organs approach adult sizes. To investigate epigenetic changes that might orchestrate this program, we performed chromatin immunoprecipitation-promoter tiling array to assess temporal changes in histone H3K4 and H3K27 trimethylation (me3) at promoter regions throughout the genome in kidney and lung, comparing 1- to 4-wk-old mice. We found extensive genome-wide shifts in H3K4me3 and H3K27me3 occurring with age in both kidney and lung. The number of genes with concordant changes in the two organs was far greater than expected by chance. Temporal changes in H3K4me3 showed a strong, positive association with changes in gene expression, assessed by microarray, whereas changes in H3K27me3 showed a negative association. Gene ontology analysis indicated that shifts in specific histone methylation marks were associated with specific developmental functions. Of particular interest, genes with decreases in H3K4me3 with age in both organs were strongly implicated in cell cycle and cell proliferation functions. Taken together, the findings suggest that the common core developmental program of gene expression which occurs in multiple organs during juvenile life is associated with a common core developmental program of histone methylation. In particular, declining H3K4me3 is strongly associated with gene downregulation and occurs in the promoter regions of many growth-regulating genes, suggesting that this change in histone methylation may contribute to the component of the genetic program that drives juvenile body growth deceleration

  17. Expression of genes involved in the embryo-maternal interaction in the early-pregnant canine uterus.

    PubMed

    Kautz, E; Gram, A; Aslan, S; Ay, S S; Selçuk, M; Kanca, H; Koldaş, E; Akal, E; Karakaş, K; Findik, M; Boos, A; Kowalewski, M P

    2014-05-01

    Although there is no acute luteolytic mechanism in the absence of pregnancy in the bitch, a precise and well-timed embryo-maternal interaction seems to be required for the initiation and maintenance of gestation. As only limited information is available about these processes in dogs, in this study, the uterine expression of possible decidualization markers was investigated during the pre-implantation stage (days 10-12) of pregnancy and in the corresponding nonpregnant controls. In addition, the expression of selected genes associated with blastocyst development and/or implantation was investigated in embryos flushed from the uteri of bitches used for this study (unhatched and hatched blastocysts). There was an upregulated expression of prolactin receptor (PRLR) and IGF2 observed pre-implantation. The expression of PRL and of IGF1 was unaffected, and neither was the expression of progesterone- or estrogen receptor β (ESR2). In contrast, (ESR1) levels were elevated during early pregnancy. Prostaglandin (PG)-system revealed upregulated expression of PGE2-synthase and its receptors, PTGER2 and PTGER4, and of the PG-transporter. Elevated levels of AKR1C3 mRNA, but not the protein itself, were noted. Expression of prostaglandin-endoperoxide synthase 2 (PTGS2) remained unaffected. Most of the transcripts were predominantly localized to the uterine epithelial cells, myometrium and, to a lesser extent, to the uterine stroma. PGES (PTGES) mRNA was abundantly expressed in both groups of embryos and appeared higher in the hatched ones. The expression level of IGF2 mRNA appeared higher than that of IGF1 mRNA in hatched embryos. In unhatched embryos IGF1, IGF2, and PTGS2 mRNA levels were below the detection limit. PMID:24481956

  18. Pattern of cerebrospinal immediate early gene c-fos expression in an ovine model of non-accidental head injury.

    PubMed

    Finnie, J W; Blumbergs, P C; Manavis, J; Vink, R

    2013-12-01

    Expression of the immediate early gene, c-fos, was examined in a large animal model of non-accidental head injury ("shaken baby syndrome"). Lambs were used because they have a relatively large gyrencephalic brain and weak neck muscles resembling a human infant. Neonatal lambs were manually shaken in a manner similar to that believed to occur with most abused human infants, but there was no head impact. The most striking c-fos expression was in meningothelial cells of the cranial cervical spinal cord and, to a lesser degree, in hemispheric, cerebellar, and brainstem meninges. Vascular endothelial cells also frequently showed c-fos immunopositivity in the meninges and hemispheric white matter. It was hypothesised that this c-fos immunoreactivity was due to mechanical stress induced by shaking, with differential movement of different craniospinal components. PMID:24035422

  19. Knockout of ERK1 enhances cocaine-evoked immediate early gene expression and behavioral plasticity.

    PubMed

    Ferguson, Susan M; Fasano, Stefania; Yang, Pengwei; Brambilla, Riccardo; Robinson, Terry E

    2006-12-01

    The ability of cocaine to produce lasting neural adaptations in mesocorticolimbic brain regions is thought to promote drug seeking and facilitate addiction in humans. The Ras-controlled Raf-MEK-ERK protein kinase signaling cascade has been implicated in the behavioral and neurobiological actions of cocaine in animals. However, these pharmacological studies have not been able to determine the specific role of the two predominant isoforms of ERK (ERK1 and ERK2) in these processes. We report here that deletion of the ERK1 isoform, which leads to increased ERK2 stimulus-dependent signaling, facilitates the development of cocaine-induced psychomotor sensitization and the acquisition of a cocaine conditioned place preference. Conversely, pharmacological blockade of ERK signaling attenuates the development of psychomotor sensitization to cocaine. Finally, cocaine-evoked gene expression in mesocorticolimbic brain regions is potentiated in ERK1-deficient mice. Thus, alterations in ERK signaling influence both the neurobiological impact of cocaine and its ability to produce enduring forms of drug experience-dependent behavioral plasticity. Our results suggest that enhanced ERK2 signaling following repeated drug exposure may facilitate the development of forms of cocaine-induced plasticity that contribute to addiction. PMID:16407894

  20. TGFβ2 regulates hypothalamic Trh expression through the TGFβ inducible early gene-1 (TIEG1) during fetal development

    PubMed Central

    Martínez-Armenta, Miriam; de León-Guerrero, Sol Díaz; Catalán, Ana; Alvarez-Arellano, Lourdes; Uribe, Rosa Maria; Subramaniam, Malayannan; Charli, Jean-Louis; Pérez-Martínez, Leonor

    2015-01-01

    The hypothalamus regulates the homeostasis of the organism by controlling hormone secretion from the pituitary. The molecular mechanisms that regulate the differentiation of the hypothalamic thyrotropin-releasing hormone (TRH) phenotype are poorly understood. We have previously shown that Klf10 or TGFβ inducible early gene-1 (TIEG1) is enriched in fetal hypothalamic TRH neurons. Here, we show that expression of TGFβ isoforms (1–3) and both TGFβ receptors (TβRI and II) occurs in the hypothalamus concomitantly with the establishment of TRH neurons during late embryonic development. TGFβ2 induces Trh expression via a TIEG1 dependent mechanism. TIEG1 regulates Trh expression through an evolutionary conserved GC rich sequence on the Trh promoter. Finally, in mice deficient in TIEG1, Trh expression is lower than in wild type animals at embryonic day 17. These results indicate that TGFβ signaling, through the upregulation of TIEG1, plays an important role in the establishment of Trh expression in the embryonic hypothalamus. PMID:25448845

  1. Initial receptor-ligand interactions modulate gene expression and phagosomal properties during both early and late stages of phagocytosis.

    PubMed

    Hoffmann, Eik; Marion, Sabrina; Mishra, Bibhuti Bhusan; John, Mathias; Kratzke, Ramona; Ahmad, Syed Furquan; Holzer, Daniela; Anand, Paras Kumar; Weiss, Dieter G; Griffiths, Gareth; Kuznetsov, Sergei A

    2010-09-01

    The receptors engaged during recognition and phagocytic uptake of microorganisms and particles influence signaling events and diverse subcellular responses that occur during phagosome formation and maturation. However, pathogens generally have multiple ligands on their surface, making it difficult to dissect the roles of individual receptors during phagocytosis. Moreover, it remains elusive to which extent receptor-ligand interactions and early binding events define the subsequent intracellular fate of phagosomes. Here, we used latex beads coupled to single ligands, focusing on immunoglobulin G, mannan, bacterial lipopolysaccharides and avidin, and monitored: (1) phagocytic uptake rates, (2) fusion of phagosomes with lysosomal compartments, (3) the gene expression profile during phagocytosis, (4) the protein composition of mature phagosomes and (5) time-dependent dynamics of protein association with phagosomes in J774.A1 mouse macrophages. The differently coated latex beads were internalized at different rates and exhibited different kinetics of phagolysosomal fusion events dependent on their specific ligand. Furthermore, less than 60% of identified phagosomal proteins and only 10-15% of changes in gene expression were common to all investigated ligands. These findings demonstrate that each single ligand induced a distinct pattern of genes and a different protein composition of phagosomes. Taken together, our data argue that phagocytic receptor-specific programs of signaling events direct phagosomes to different physiological states and support the existence of a specific receptor-ligand 'signature' during the whole process of phagocytosis. PMID:20579766

  2. Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs

    PubMed Central

    Stoker, Aaron M; Cook, James L; Kuroki, Keiichi; Fox, Derek B

    2006-01-01

    Background Osteoarthritis (OA) is a progressive and debilitating disease that often develops from a focal lesion and may take years to clinically manifest to a complete loss of joint structure and function. Currently, there is not a cure for OA, but early diagnosis and initiation of treatment may dramatically improve the prognosis and quality of life for affected individuals. This study was designed to determine the feasibility of analyzing changes in gene expression of articular cartilage using the Pond-Nuki model two weeks after ACL-transection in dogs, and to characterize the changes observed at this time point. Methods The ACL of four dogs was completely transected arthroscopically, and the contralateral limb was used as the non-operated control. After two weeks the dogs were euthanatized and tissues harvested from the tibial plateau and femoral condyles of both limbs. Two dogs were used for histologic analysis and Mankin scoring. From the other two dogs the surface of the femoral condyle and tibial plateau were divided into four regions each, and tissues were harvested from each region for biochemical (GAG and HP) and gene expression analysis. Significant changes in gene expression were determined using REST-XL, and Mann-Whitney rank sum test was used to analyze biochemical data. Significance was set at (p < 0.05). Results Significant differences were not observed between ACL-X and control limbs for Mankin scores or GAG and HP tissue content. Further, damage to the tissue was not observed grossly by India ink staining. However, significant changes in gene expression were observed between ACL-X and control tissues from each region analyzed, and indicate that a unique regional gene expression profile for impending ACL-X induced joint pathology may be identified in future studies. Conclusion The data obtained from this study lend credence to the research approach and model for the characterization of OA, and the identification and validation of future diagnostic

  3. Sp1 Sites in the Noncoding Control Region of BK Polyomavirus Are Key Regulators of Bidirectional Viral Early and Late Gene Expression

    PubMed Central

    Bethge, Tobias; Hachemi, Helen A.; Manzetti, Julia; Gosert, Rainer; Schaffner, Walter

    2015-01-01

    ABSTRACT In kidney transplant patients with BK polyomavirus (BKPyV) nephropathy, viral variants arise bearing rearranged noncoding control regions (rr-NCCRs) that increase viral early gene expression, replicative fitness, and cytopathology. rr-NCCRs result from various deletions and duplications of archetype NCCR (ww-NCCR) sequences, which alter transcription factor binding sites (TFBS). However, the role of specific TFBS is unclear. We inactivated 28 TFBS in the archetype NCCR by selective point mutations and examined viral gene expression in bidirectional reporter constructs. Compared to the archetype, group 1 mutations increased viral early gene expression similar to rr-NCCR and resulted from inactivating one Sp1 or one Ets1 TFBS near the late transcription start site (TSS). Group 2 mutations conferred intermediate early gene activation and affected NF1, YY1, and p53 sites between early and late TSS. Group 3 mutations decreased early and late gene expression and included two other Sp1 sites near the early TSS. Recombinant viruses bearing group 1 NCCRs showed increased replication in human renal epithelial cells similar to clinical rr-NCCR variants. Group 2 and 3 viruses showed intermediate or no replication, respectively. A literature search revealed unnoticed group 1 mutations in BKPyV nephropathy, hemorrhagic cystitis, and disseminated disease. IMPORTANCE The NCCRs of polyomaviruses mediate silent persistence of the viral genome as well as the appropriately timed (re)activation of the viral life cycle. This study indicates that the basal BKPyV NCCR is critically controlled by a hierarchy of single TFBS in the archetype NCCR that direct, modulate, and execute the bidirectional early and late viral gene expression. The results provide new insights into how BKPyV NCCR functions as a viral sensor of host cell signals and shed new light on how transcription factors like Sp1 control bidirectional viral gene expression and contribute to replication and pathology

  4. Gene expression profiling in a mouse model of infantile neuronal ceroid lipofuscinosis reveals upregulation of immediate early genes and mediators of the inflammatory response

    PubMed Central

    Qiao, Xingwen; Lu, Jui-Yun; Hofmann, Sandra L

    2007-01-01

    Background The infantile form of neuronal ceroid lipofuscinosis (also known as infantile Batten disease) is caused by hereditary deficiency of a lysosomal enzyme, palmitoyl-protein thioesterase-1 (PPT1), and is characterized by severe cortical degeneration with blindness and cognitive and motor dysfunction. The PPT1-deficient knockout mouse recapitulates the key features of the disorder, including seizures and death by 7–9 months of age. In the current study, we compared gene expression profiles of whole brain from PPT1 knockout and normal mice at 3, 5 and 8 months of age to identify temporal changes in molecular pathways implicated in disease pathogenesis. Results A total of 267 genes were significantly (approximately 2-fold) up- or downregulated over the course of the disease. Immediate early genes (Arc, Cyr61, c-fos, jun-b, btg2, NR4A1) were among the first genes upregulated during the presymptomatic period whereas immune response genes dominated at later time points. Chemokine ligands and protease inhibitors were among the most transcriptionally responsive genes. Neuronal survival factors (IGF-1 and CNTF) and a negative regulator of neuronal apoptosis (DAP kinase-1) were upregulated late in the course of the disease. Few genes were downregulated; these included the α2 subunit of the GABA-A receptor, a component of cortical and hippocampal neurons, and Hes5, a transcription factor important in neuronal differentiation. Conclusion A molecular description of gene expression changes occurring in the brain throughout the course of neuronal ceroid lipofuscinosis suggests distinct phases of disease progression, provides clues to potential markers of disease activity, and points to new targets for therapy. PMID:18021406

  5. Immediate early gene expression reveals interactions between social and nicotine rewards on brain activity in adolescent male rats.

    PubMed

    Bastle, Ryan M; Peartree, Natalie A; Goenaga, Julianna; Hatch, Kayla N; Henricks, Angela; Scott, Samantha; Hood, Lauren E; Neisewander, Janet L

    2016-10-15

    Smoking initiation predominantly occurs during adolescence, often in the presence of peers. Therefore, understanding the neural mechanisms underlying the rewarding effects of nicotine and social stimuli is vital. Using the conditioned place preference (CPP) procedure, we measured immediate early gene (IEG) expression in animals following exposure either to a reward-conditioned environment or to the unconditioned stimuli (US). Adolescent, male rats were assigned to the following CPP US conditions: (1) Saline+Isolated, (2) Nicotine+Isolated, (3) Saline+Social, or (4) Nicotine+Social. For Experiment 1, brain tissue was collected 90min following the CPP expression test and processed for Fos immunohistochemistry. We found that rats conditioned with nicotine with or without a social partner exhibited CPP; however, we found no group differences in Fos expression in any brain region analyzed, with the exception of the nucleus accumbens core that exhibited a social-induced attenuation in Fos expression. For Experiment 2, brain tissue was collected 90min following US exposure during the last conditioning session. We found social reward-induced increases in IEG expression in striatal and amydalar subregions. In contrast, nicotine reduced IEG expression in prefrontal and striatal subregions. Reward interactions were also found in the dorsolateral striatum, basolateral amygdala, and ventral tegmental area where nicotine alone attenuated IEG expression and social reward reversed this effect. These results suggest that in general social rewards enhance, whereas nicotine attenuates, activation of mesocorticolimbic regions; however, the rewards given together interact to enhance activation in some regions. The findings contribute to knowledge of how a social environment influences nicotine effects. PMID:27435419

  6. Brain region-specific gene expression changes after chronic intermittent ethanol exposure and early withdrawal in C57BL/6J mice.

    PubMed

    Melendez, Roberto I; McGinty, Jacqueline F; Kalivas, Peter W; Becker, Howard C

    2012-03-01

    Neuroadaptations that participate in the ontogeny of alcohol dependence are likely a result of altered gene expression in various brain regions. The present study investigated brain region-specific changes in the pattern and magnitude of gene expression immediately following chronic intermittent ethanol (CIE) exposure and 8 hours following final ethanol exposure [i.e. early withdrawal (EWD)]. High-density oligonucleotide microarrays (Affymetrix 430A 2.0, Affymetrix, Santa Clara, CA, USA) and bioinformatics analysis were used to characterize gene expression and function in the prefrontal cortex (PFC), hippocampus (HPC) and nucleus accumbens (NAc) of C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME, USA). Gene expression levels were determined using gene chip robust multi-array average followed by statistical analysis of microarrays and validated by quantitative real-time reverse transcription polymerase chain reaction and Western blot analysis. Results indicated that immediately following CIE exposure, changes in gene expression were strikingly greater in the PFC (284 genes) compared with the HPC (16 genes) and NAc (32 genes). Bioinformatics analysis revealed that most of the transcriptionally responsive genes in the PFC were involved in Ras/MAPK signaling, notch signaling or ubiquitination. In contrast, during EWD, changes in gene expression were greatest in the HPC (139 genes) compared with the PFC (four genes) and NAc (eight genes). The most transcriptionally responsive genes in the HPC were involved in mRNA processing or actin dynamics. Of the few genes detected in the NAc, the most representatives were involved in circadian rhythms. Overall, these findings indicate that brain region-specific and time-dependent neuroadaptive alterations in gene expression play an integral role in the development of alcohol dependence and withdrawal. PMID:21812870

  7. Brain region-specific gene expression changes after chronic intermittent ethanol exposure and early withdrawal in C57BL/6J mice

    PubMed Central

    Melendez, Roberto I.; McGinty, Jacqueline F.; Kalivas, Peter W.; Becker, Howard C.

    2014-01-01

    Neuroadaptations that participate in the ontogeny of alcohol dependence are likely a result of altered gene expression in various brain regions. The present study investigated brain region-specific changes in the pattern and magnitude of gene expression immediately following chronic intermittent ethanol (CIE) exposure and 8 hours following final ethanol exposure [i.e. early withdrawal (EWD)]. High-density oligonucleotide microarrays (Affymetrix 430A 2.0, Affymetrix, Santa Clara, CA, USA) and bioinformatics analysis were used to characterize gene expression and function in the prefrontal cortex (PFC), hippocampus (HPC) and nucleus accumbens (NAc) of C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME, USA). Gene expression levels were determined using gene chip robust multi-array average followed by statistical analysis of microarrays and validated by quantitative real-time reverse transcription polymerase chain reaction and Western blot analysis. Results indicated that immediately following CIE exposure, changes in gene expression were strikingly greater in the PFC (284 genes) compared with the HPC (16 genes) and NAc (32 genes). Bioinformatics analysis revealed that most of the transcriptionally responsive genes in the PFC were involved in Ras/MAPK signaling, notch signaling or ubiquitination. In contrast, during EWD, changes in gene expression were greatest in the HPC (139 genes) compared with the PFC (four genes) and NAc (eight genes). The most transcriptionally responsive genes in the HPC were involved in mRNA processing or actin dynamics. Of the few genes detected in the NAc, the most representatives were involved in circadian rhythms. Overall, these findings indicate that brain region-specific and time-dependent neuroadaptive alterations in gene expression play an integral role in the development of alcohol dependence and withdrawal. PMID:21812870

  8. Profiles of mRNA expression for genes involved in implantation, early and middle phases of secretion stage in human endometrium.

    PubMed

    Maslova, M A; Smol'nikova, V Yu; Savilova, A M; Burmenskaya, O V; Bystritskii, A A; Tabolova, V K; Korneeva, I E; Demura, T A; Donnikov, A E

    2015-04-01

    The expression of mRNA of 36 genes involved in implantation was studied by reverse transcription and real-time PCR. Significant differences in mRNA expression during the early and middle stages of the secretion phase were detected for genes mmp7, vegf, il2m, il1β, il8, il18, tnfα, il10, tgfβ, igfbp2, etc. PMID:25894777

  9. Time Course of Immediate Early Gene Protein Expression in the Spinal Cord following Conditioning Stimulation of the Sciatic Nerve in Rats

    PubMed Central

    Bojovic, Ognjen; Panja, Debabrata; Bittins, Margarethe; Bramham, Clive R.; Tjølsen, Arne

    2015-01-01

    Long-term potentiation induced by conditioning electrical stimulation of afferent fibers is a widely studied form of synaptic plasticity in the brain and the spinal cord. In the spinal cord dorsal horn, long-term potentiation is induced by a series of high-frequency trains applied to primary afferent fibers. Conditioning stimulation (CS) of sciatic nerve primary afferent fibers also induces expression of immediate early gene proteins in the lumbar spinal cord. However, the time course of immediate early gene expression and the rostral-caudal distribution of expression in the spinal cord have not been systematically studied. Here, we examined the effects of sciatic nerve conditioning stimulation (10 stimulus trains, 0.5 ms stimuli, 7.2 mA, 100 Hz, train duration 2 s, 8 s intervals between trains) on cellular expression of immediate early genes, Arc, c-Fos and Zif268, in anesthetized rats. Immunohistochemical analysis was performed on sagittal sections obtained from Th13- L5 segments of the spinal cord at 1, 2, 3, 6 and 12 h post-CS. Strikingly, all immediate early genes exhibited a monophasic increase in expression with peak increases detected in dorsal horn neurons at 2 hours post-CS. Regional analysis showed peak increases at the location between the L3 and L4 spinal segments. Both Arc, c-Fos and Zif268 remained significantly elevated at 2 hours, followed by a sharp decrease in immediate early gene expression between 2 and 3 hours post-CS. Colocalization analysis performed at 2 hours post-CS showed that all c-Fos and Zif268 neurons were positive for Arc, while 30% and 43% of Arc positive neurons were positive for c-Fos and Zif268, respectively. The present study identifies the spinal cord level and time course of immediate early gene (IEGP) expression of relevance for analysis of IEGPs function in neuronal plasticity and nociception. PMID:25860146

  10. XSIP1 is essential for early neural gene expression and neural differentiation by suppression of BMP signaling.

    PubMed

    Nitta, Kazuhiro R; Tanegashima, Kousuke; Takahashi, Shuji; Asashima, Makoto

    2004-11-01

    Neural differentiation is induced by inhibition of BMP signaling. Secreted inhibitors of BMP such as Chordin from the Spemann organizer contribute to the initial step of neural induction. Xenopus Smad-interacting protein-1 gene (XSIP1) is expressed in neuroectoderm from the early gastrula stage through to the neurula stage. XSIP1 is able to inhibit BMP signaling and overexpression of XSIP1 induces neural differentiation. To clarify the function of XSIP1 in neural differentiation, we performed a loss-of-function study of XSIP1. Knockdown of XSIP1 inhibited SoxD expression and neural differentiation. These results indicate that XSIP1 is essential for neural induction. Furthermore, loss-of-function experiments showed that SoxD is essential for XSIP1 transcription and for neural differentiation. However, inhibition of XSIP1 translation prevented neural differentiation induced by SoxD; thus, SoxD was not sufficient to mediate neural differentiation. Expression of XSIP1 was also required for inhibition of BMP signaling. Together, these results suggest that XSIP1 and SoxD interdependently function to maintain neural differentiation. PMID:15464588

  11. Diethylstilbestrol at environmental levels affects the development of early life stage and target gene expression in Japanese Medaka (Oryzias latipes).

    PubMed

    Lei, Bingli; Peng, Wei; Li, Wei; Yu, Yingxin; Xu, Jie; Wang, Yipei

    2016-04-01

    In this study, the biologic effects of DES on the early life and adult life stages of Japanese medaka (Oryzias latipes) were evaluated. At the early life stage, the fertilized eggs were exposed to 1-1000 ng/L diethylstilbestrol (DES) for 15 days and the hatched larvae were continually exposed to the same concentrations for an additional 25 days. Significant adverse effects on hatchability, time to hatching and mortality rate occurred at DES concentrations of 100 and 1000 ng/L, while the abnormality (scoliosis and abdominal swelling) rate was significantly increased at 10 ng/L and above. After exposure, the fish were maintained in charcoal-dechlorinated tap water for a further 30 days. Only the male gonadosomatic index (GSI) at 1000 ng/L was significantly increased. At concentrations greater than 1 ng/L, estrogen receptor α (ERα) mRNA in both sexes and vitellogenin-I (Vtg-I) mRNA in males were significantly down-regulated; while Vtg-I mRNA in females was significantly up-regulated. When sexually mature medaka were exposed to 10 and 1000 ng/L DES for 21 days, only the GSI in females was significantly decreased at 1000 ng/L. At 10 and 1000 ng/L, ERα mRNA in both sexes was significantly down-regulated, while Vtg-I mRNA in males was significantly up-regulated. These findings showed that DES at the environmental concentration of 10 ng/L can affect the early life stage development of medaka and alter liver ERα and Vtg-I gene expression. Therefore, if we only focused on these sensitive toxicity endpoints such as ERα and Vtg-I mRNA expression, DES has a strong estrogenic effect on Japanese medaka. PMID:26908245

  12. Dynamic gene expression patterns in animal models of early and late heart failure reveal biphasic-bidirectional transcriptional activation of signaling pathways.

    PubMed

    Rowell, Janelle; Koitabashi, Norimichi; Kass, David A; Barth, Andreas S

    2014-10-15

    Altered cardiac gene expression in heart failure (HF) has mostly been identified by single-point analysis of end-stage disease. This may miss earlier changes in gene expression that are transient and/or directionally opposite to those observed later. Myocardial datasets from the largest microarray data repository (Gene Expression Omnibus) yielded six HF studies with time-course data. Differentially expressed transcripts between nonfailing controls, early HF (<3 days after cardiac insult) and late HF (usually >2 wk) were determined, and analysis of KEGG pathways and predicted regulatory control elements performed. We found that gene expression followed varying patterns: Downregulation of metabolic pathways occurred early and was sustained into late-stage HF. In contrast, most signaling pathways undergo a complex biphasic pattern: Calcium signaling, p53, apoptosis, and MAPK pathways displayed a bidirectional response, declining early but rising late. These profiles were compatible with specific microRNA (miRNA) and transcription regulators: Estrogen-related receptor-α and myocyte-enhancer factor-2 binding sites were overrepresented in the promoter regions of downregulated transcripts. Concurrently, there were overrepresented binding sites for E2f and ETS family members (E-Twenty Six, including Gabp, Elf1, and Ets2), serum response and interferon regulated factor in biphasic-bidirectional and late-upregulated transcripts. Binding sites for miRNAs downregulated by HF were more common in upregulated transcripts (e.g., miRNA-22,-133a/b, and -150 in early HF and miRNA-1,-9,-499 in late HF). During the development of HF, gene expression is characterized by dynamic overlapping sets of transcripts controlled by specific interrelated regulatory mechanisms. While metabolic gene classes show early and sustained downregulation in HF, signaling pathways undergo a complex biphasic pattern with early down- and more pronounced late upregulation. PMID:25159852

  13. Early Expression of the Calmodulin Gene, Which Precedes Appressorium Formation in Magnaporthe grisea, Is Inhibited by Self-Inhibitors and Requires Surface Attachment

    PubMed Central

    Liu, Zhi-Mei; Kolattukudy, Pappachan E.

    1999-01-01

    Fungal conidia contain chemicals that inhibit germination and appressorium formation until they are well dispersed in a favorable environment. Recently, such self-inhibitors were found to be present on the conidia of Magnaporthe grisea, and plant surface waxes were found to relieve this self-inhibition. To determine whether the self-inhibitors suppress the expression of early genes involved in the germination and differentiation of conidia, the calmodulin gene was chosen as a representative early gene, because it was found to be expressed early in Colletotrichum gloeosporioides and Colletotrichum trifolii differentiation. After calmodulin cDNA and genomic DNA from M. grisea were cloned, the promoter of the calmodulin gene was fused to a reporter gene, that for green fluorescent protein (GFP), and transformed into the M. grisea genome. Confocal microscopic examination and quantitation of expression of GFP green fluorescence showed (i) that the expression of the calmodulin gene decreased significantly when self-inhibition of M. grisea appressorium formation occurred because of high conidial density or addition of exogenous self-inhibitors and (ii) that the expression level of this gene was restored when self-inhibition was relieved by the addition of plant surface waxes. The increase in fluorescence correlated with the percentage of conidia that formed appressoria. The induction of calmodulin was also confirmed by RNA blotting. Concanavalin A inhibited surface attachment of conidia, GFP expression, and appressorium formation without affecting germination. The high correlation between GFP expression and appressorium formation strongly suggests that calmodulin gene expression and appressorium formation require surface attachment. PMID:10348871

  14. Genes of the adaptive immune system are expressed early in zebrafish larval development following lipopolysaccharide stimulation

    NASA Astrophysics Data System (ADS)

    Li, Fengling; Zhang, Shicui; Wang, Zhiping; Li, Hongyan

    2011-03-01

    Information regarding immunocompetence of the adaptive immune system (AIS) in zebrafish Danio rerio remains limited. Here, we stimulated an immune response in fish embryos, larvae and adults using lipopolysaccharide (LPS) and measured the upregulation of a number of AIS-related genes ( Rag2, AID, TCRAC, IgLC-1, mIg, sIg, IgZ and DAB) 3 and 18 h later. We found that all of the genes evaluated were strongly induced following LPS stimulation, with most of them responding at 8 d post fertilization. This confirms that a functional adaptive immune response is present in D. rerio larvae, and provides a window for further functional analyses.

  15. Experience affects immediate early gene expression in response to conspecific call notes in black-capped chickadees (Poecile atricapillus).

    PubMed

    Hahn, Allison H; Guillette, Lauren M; Lee, Daniel; McMillan, Neil; Hoang, John; Sturdy, Christopher B

    2015-01-01

    Black-capped chickadees (Poecile atricapillus) produce numerous vocalizations, including the acoustically complex chick-a-dee call that is composed of A, B, C, and D notes. D notes are longer in duration and lower in frequency than the other note types and contain information regarding flock and species identification. Adult wild-caught black-capped chickadees have been shown to have similar amounts of immediate early gene (IEG) expression following playback of vocalizations with harmonic-like acoustic structure, similar to D notes. Here we examined how different environmental experiences affect IEG response to conspecific D notes. We hand-reared black-capped chickadees under three conditions: (1) with adult conspecifics, (2) with adult heterospecific mountain chickadees, and (3) without adults. We presented all hand-reared birds and a control group of field-reared black-capped chickadees, with conspecific D notes and quantified IEG expression in the caudomedial mesopallium (CMM) and caudomedial nidopallium (NCM). We found that field-reared birds that heard normal D notes had a similar neural response as a group of field-reared birds that heard playback of reversed D notes. Field-reared birds that heard normal D notes also had a similar neural response as birds reared with adult conspecifics. Birds reared without adults had a significantly reduced IEG response, whereas the IEG expression in birds reared with heterospecifics was at intermediate levels between birds reared with conspecifics and birds reared without adults. Although acoustic characteristics have been shown to drive IEG expression, our results demonstrate that experience with adults or normal adult vocalizations is also an important factor. PMID:25813748

  16. Changes in neurotransmitter levels and expression of immediate early genes in brain of mice infected with Neospora caninum

    PubMed Central

    Ihara, Fumiaki; Nishimura, Maki; Muroi, Yoshikage; Furuoka, Hidefumi; Yokoyama, Naoaki; Nishikawa, Yoshifumi

    2016-01-01

    Neospora caninum is an obligate intracellular parasite that causes neurological disorders in dogs and cattle. The majority of host animals are asymptomatic at the chronic stage of infection. However, it remains unclear whether cerebral function is normal in asymptomatic animals. In this study, mice were infected with N. caninum (strain Nc-1) and their brains were examined to understand changes in cerebral function at the chronic stage of infection. Mice infected with N. caninum showed impaired locomotor activity, but no differences in clinical symptoms were observed. In the brains of infected mice, parasites were distributed throughout the brain and histological lesions were observed everywhere except for the cerebellum. Expression levels of proinflammatory cytokines, interferon-gamma and tumour necrosis factor-alpha, were highly upregulated in several brain regions of infected mice. Additionally, the level of neurotransmitters glutamate, glycine, gamma-aminobutyric acid, dopamine and 5-hydroxytryptamine, were altered in infected mice compared with those of uninfected mice. Interestingly, the expression levels of immediately early genes, c-Fos and Arc, in the brain of infected mice were lower than those of in uninfected mice. Our findings may provide insight into neurological disorders associated with N. caninum infection. PMID:26971577

  17. mTORC1 Is Essential for Early Steps during Schwann Cell Differentiation of Amniotic Fluid Stem Cells and Regulates Lipogenic Gene Expression

    PubMed Central

    Schörghofer, David; Kinslechner, Katharina; Schütz, Birgit; Thi Thanh Pham, Ha; Rosner, Margit; Joo, Gabor Jozsef; Röhrl, Clemens; Weichhart, Thomas; Stangl, Herbert; Lubec, Gert; Hengstschläger, Markus; Mikula, Mario

    2014-01-01

    Schwann cell development is hallmarked by the induction of a lipogenic profile. Here we used amniotic fluid stem (AFS) cells and focused on the mechanisms occurring during early steps of differentiation along the Schwann cell lineage. Therefore, we initiated Schwann cell differentiation in AFS cells and monitored as well as modulated the activity of the mechanistic target of rapamycin (mTOR) pathway, the major regulator of anabolic processes. Our results show that mTOR complex 1 (mTORC1) activity is essential for glial marker expression and expression of Sterol Regulatory Element-Binding Protein (SREBP) target genes. Moreover, SREBP target gene activation by statin treatment promoted lipogenic gene expression, induced mTORC1 activation and stimulated Schwann cell differentiation. To investigate mTORC1 downstream signaling we expressed a mutant S6K1, which subsequently induced the expression of the Schwann cell marker S100b, but did not affect lipogenic gene expression. This suggests that S6K1 dependent and independent pathways downstream of mTORC1 drive AFS cells to early Schwann cell differentiation and lipogenic gene expression. In conclusion our results propose that future strategies for peripheral nervous system regeneration will depend on ways to efficiently induce the mTORC1 pathway. PMID:25221943

  18. Shaped 3D Singular Spectrum Analysis for Quantifying Gene Expression, with Application to the Early Zebrafish Embryo

    PubMed Central

    Shlemov, Alex; Golyandina, Nina; Holloway, David; Spirov, Alexander

    2015-01-01

    Recent progress in microscopy technologies, biological markers, and automated processing methods is making possible the development of gene expression atlases at cellular-level resolution over whole embryos. Raw data on gene expression is usually very noisy. This noise comes from both experimental (technical/methodological) and true biological sources (from stochastic biochemical processes). In addition, the cells or nuclei being imaged are irregularly arranged in 3D space. This makes the processing, extraction, and study of expression signals and intrinsic biological noise a serious challenge for 3D data, requiring new computational approaches. Here, we present a new approach for studying gene expression in nuclei located in a thick layer around a spherical surface. The method includes depth equalization on the sphere, flattening, interpolation to a regular grid, pattern extraction by Shaped 3D singular spectrum analysis (SSA), and interpolation back to original nuclear positions. The approach is demonstrated on several examples of gene expression in the zebrafish egg (a model system in vertebrate development). The method is tested on several different data geometries (e.g., nuclear positions) and different forms of gene expression patterns. Fully 3D datasets for developmental gene expression are becoming increasingly available; we discuss the prospects of applying 3D-SSA to data processing and analysis in this growing field. PMID:26495320

  19. Quantitative perturbation-based analysis of gene expression predicts enhancer activity in early Drosophila embryo.

    PubMed

    Sayal, Rupinder; Dresch, Jacqueline M; Pushel, Irina; Taylor, Benjamin R; Arnosti, David N

    2016-01-01

    Enhancers constitute one of the major components of regulatory machinery of metazoans. Although several genome-wide studies have focused on finding and locating enhancers in the genomes, the fundamental principles governing their internal architecture and cis-regulatory grammar remain elusive. Here, we describe an extensive, quantitative perturbation analysis targeting the dorsal-ventral patterning gene regulatory network (GRN) controlled by Drosophila NF-κB homolog Dorsal. To understand transcription factor interactions on enhancers, we employed an ensemble of mathematical models, testing effects of cooperativity, repression, and factor potency. Models trained on the dataset correctly predict activity of evolutionarily divergent regulatory regions, providing insights into spatial relationships between repressor and activator binding sites. Importantly, the collective predictions of sets of models were effective at novel enhancer identification and characterization. Our study demonstrates how experimental dataset and modeling can be effectively combined to provide quantitative insights into cis-regulatory information on a genome-wide scale. PMID:27152947

  20. Quantitative perturbation-based analysis of gene expression predicts enhancer activity in early Drosophila embryo

    PubMed Central

    Sayal, Rupinder; Dresch, Jacqueline M; Pushel, Irina; Taylor, Benjamin R; Arnosti, David N

    2016-01-01

    Enhancers constitute one of the major components of regulatory machinery of metazoans. Although several genome-wide studies have focused on finding and locating enhancers in the genomes, the fundamental principles governing their internal architecture and cis-regulatory grammar remain elusive. Here, we describe an extensive, quantitative perturbation analysis targeting the dorsal-ventral patterning gene regulatory network (GRN) controlled by Drosophila NF-κB homolog Dorsal. To understand transcription factor interactions on enhancers, we employed an ensemble of mathematical models, testing effects of cooperativity, repression, and factor potency. Models trained on the dataset correctly predict activity of evolutionarily divergent regulatory regions, providing insights into spatial relationships between repressor and activator binding sites. Importantly, the collective predictions of sets of models were effective at novel enhancer identification and characterization. Our study demonstrates how experimental dataset and modeling can be effectively combined to provide quantitative insights into cis-regulatory information on a genome-wide scale. DOI: http://dx.doi.org/10.7554/eLife.08445.001 PMID:27152947

  1. Early and sustained expression of latent and host modulating genes in coordinated transcriptional program of KSHV productive primary infection of human primary endothelial cells

    PubMed Central

    Yoo, Seung Min; Zhou, Fu-Chun; Ye, Feng-Chun; Pan, Hong-Yi; Gao, Shou-Jiang

    2009-01-01

    Coordinated expression of viral genes in primary infection is essential for successful infection of host cells. We examined the expression profiles of Kaposi’s sarcoma-associated herpesvirus (KSHV) transcripts in productive primary infection of primary human umbilical vein endothelial cells by whole-genome reverse-transcription real-time quantitative PCR. The latent transcripts were expressed early and sustained at high levels throughout the infection while the lytic transcripts were expressed in the order of immediate early, early, and lytic transcripts, all of which culminated before the production of infectious virions. Significantly, transcripts encoding genes with host modulating functions, including mitogenic and cell cycle-regulatory, immune-modulating, and anti-apoptotic genes, were expressed before those encoding viral structure and replication genes, and sustained at high levels throughout the infection, suggesting KSHV manipulation of host environment to facilitate infection. The KSHV transcriptional program in a primary infection defined in this study should provide a basis for further investigation of virus–cell interactions. PMID:16154170

  2. Αlpha 2a-Adrenoceptor Gene Expression and Early Life Stress-Mediated Propensity to Alcohol Drinking in Outbred Rats

    PubMed Central

    Comasco, Erika; Todkar, Aniruddha; Granholm, Linnea; Nilsson, Kent W.; Nylander, Ingrid

    2015-01-01

    Stressful events early in life, later high alcohol consumption and vulnerability to alcohol use disorder (AUD) are tightly linked. Norepinephrine is highly involved in the stress response and the α2A-adrenoceptor, which is an important regulator of norepinephrine signalling, is a putative target in pharmacotherapy of AUD. The aim of the present study was to investigate the effects of early-life stress and adult voluntary alcohol drinking on the α2A-adrenoceptor. The relative expression and promoter DNA methylation of the Adra2a gene were measured in the hypothalamus, a key brain region in stress regulation. A well-characterized animal model of early-life stress was used in combination with an episodic voluntary drinking in adulthood. Alcohol drinking rats with a history of early-life stress had lower Adra2a expression than drinking rats not exposed to stress. Alcohol intake and Adra2a gene expression were negatively correlated in high-drinking animals, which were predominantly rats subjected to early-life stress. The results provide support for a link between early-life stress, susceptibility for high alcohol consumption, and low Adra2a expression in the hypothalamus. These findings can increase our understanding of the neurobiological basis for vulnerability to initiate risk alcohol consumption and individual differences in the response to α2A-adrenoceptor agonists. PMID:26121187

  3. Expression of dmrt1 and vtg genes during gonad formation, differentiation and early maturation in cultured Russian sturgeon Acipenser gueldenstaedtii.

    PubMed

    Fajkowska, M; Rzepkowska, M; Adamek, D; Ostaszewska, T; Szczepkowski, M

    2016-08-01

    Expression of the dmrt1 and vtg genes was described using the real-time PCR (rt-PCR) method from 25 to 1600 days post-hatch (dph) in cultured Russian sturgeon Acipenser gueldenstaedtii. The level of dmrt1 transcription in gonads in subsequent studied periods increased exponentially while vtg expression increased in gonads and livers of A. gueldenstaedtii examined, but in later stages of development. Both dmrt1 and vtg genes showed elevated expression in intersex individuals probably caused by dietary exposure to phyto-oestrogens. PMID:27239004

  4. A gene expression atlas of a bicoid-depleted Drosophila embryo reveals early canalization of cell fate

    PubMed Central

    Staller, Max V.; Fowlkes, Charless C.; Bragdon, Meghan D. J.; Wunderlich, Zeba; Estrada, Javier; DePace, Angela H.

    2015-01-01

    In developing embryos, gene regulatory networks drive cells towards discrete terminal fates, a process called canalization. We studied the behavior of the anterior-posterior segmentation network in Drosophila melanogaster embryos by depleting a key maternal input, bicoid (bcd), and measuring gene expression patterns of the network at cellular resolution. This method results in a gene expression atlas containing the levels of mRNA or protein expression of 13 core patterning genes over six time points for every cell of the blastoderm embryo. This is the first cellular resolution dataset of a genetically perturbed Drosophila embryo that captures all cells in 3D. We describe the technical developments required to build this atlas and how the method can be employed and extended by others. We also analyze this novel dataset to characterize the degree and timing of cell fate canalization in the segmentation network. We find that in two layers of this gene regulatory network, following depletion of bcd, individual cells rapidly canalize towards normal cell fates. This result supports the hypothesis that the segmentation network directly canalizes cell fate, rather than an alternative hypothesis whereby cells are initially mis-specified and later eliminated by apoptosis. Our gene expression atlas provides a high resolution picture of a classic perturbation and will enable further computational modeling of canalization and gene regulation in this transcriptional network. PMID:25605785

  5. Decreased approach behavior and nucleus accumbens immediate early gene expression in response to Parkinsonian ultrasonic vocalizations in rats.

    PubMed

    Pultorak, Joshua D; Kelm-Nelson, Cynthia A; Holt, Lauren R; Blue, Katherine V; Ciucci, Michelle R; Johnson, Aaron M

    2016-08-01

    Many individuals with Parkinson disease (PD) have difficulty producing normal speech and voice, resulting in problems with interpersonal communication and reduced quality of life. Translational animal models of communicative dysfunction have been developed to assess disease pathology. However, it is unknown whether acoustic feature changes associated with vocal production deficits in these animal models lead to compromised communication. In rodents, male ultrasonic vocalizations (USVs) have a well-established role in functional inter-sexual communication. To test whether acoustic deficits in USVs observed in a PTEN-induced putative kinase 1 (PINK1) knockout (KO) PD rat model compromise communication, we presented recordings of male PINK1 KO USVs and normal wild-type (WT) USVs to female rat listeners. We measured approached behavior and immediate early gene expression (c-Fos) in brain regions implicated in auditory processing and sexual motivation. Our results suggest that females show reduced approach in response to PINK1 KO USVs compared with WT. Moreover, females exposed to PINK1 KO USVs had lower c-Fos immunolabeling in the nucleus accumbens, a region implicated in sexual motivation. These results are the first to demonstrate that vocalization deficits in a rat PD model result in compromised communication. Thus, the PINK1 KO PD model may be valuable for assessing treatments aimed at restoring vocal communicative function. PMID:26313334

  6. INDUCTION OF EARLY GROWTH RESPONSE GENE 2 EXPRESSION IN THE FOREBRAIN OF MICE PERFORMING AN ATTENTION-SET-SHIFTING TASK

    PubMed Central

    DeSteno, Deirdre A.; Schmauss, Claudia

    2008-01-01

    Early growth response (egr) genes encode transcription factors that are induced by stimuli that cause synaptic plasticity. Here we show that the expression of one member of this family, egr-2, is induced in the orbital frontal cortex (OFC) and medial prefrontal cortex (mPFC) of mice performing an attention-set-shifting task (ASST). The ASST is a series of two-choice perceptual discriminations between different odors and textures. Within the OFC and mPFC, different subregions exhibited egr-2 induction in response to different test-related features. In the medial OFC and the anterior cingulate subregion of the mPFC, egr-2 induction occurred in response to exposure to the novel odor stimulus. In the ventrolateral OFC and the pre- and infralimbic mPFC, additional egr-2 induction occurred during the associative learning phase of the ASST. In the infralimbic mPFC, further egr-2 induction occurred when mice performed set-shifting and reversal learning phases of the ASST. Mice with enhanced set-shifting performance exhibited decreased egr-2 induction in the mPFC indicating that the magnitude of egr-2 induction correlates with the magnitude of attentional demand. This decrease was largest in the infralimbic mPFC suggesting further that egr-2 induction in this region plays a role in the attentional control during set-shifting. In contrast to egr-2, neither egr-1 nor egr-3 expression was altered in ASST-tested mice, and no egr-2 induction occurred in mice that performed a spatial working memory task. These findings suggest a specific role of egr-2-mediated transcriptional activation in cognitive functions associated with attention. PMID:18280047

  7. Immediate early gene expression in the vestibular nuclei and related vegetative areas in rats during space flight.

    PubMed

    Pompeiano, O; d'Ascanio, P; Centini, C; Pompeiano, M; Cirelli, C; Tononi, G

    2001-01-01

    Changes in neuronal activity resulting in somatic and vegetative deficits occur during different space flight conditions. Immediate early genes (IEGs: c-fos and Fos-related antigen [FRA]) are useful indicators of changes in neuronal activity and plasticity. They are induced within minutes of several extracellular stimulations, while the corresponding proteins persist for hours (Fos) or days (FRAs). Changes in IEG expression are likely to contribute to adaptation to microgravity and readaptation to the terrestrial environment. During the NASA Neurolab Mission (STS-90), changes in IEG expression were studied in adult male albino rats (Fisher 344) sacrificed at flight day (FD) 2 (24 h after launch), FD14 and at similar time points after re-entry (R + 1, 24 h after re-entry, and R + 13). These time points were chosen to maximize the probability of detecting changes in IEG expression related to changes in gravitational fields occurring during the mission, e.g. (i) increase in gravitational force from 1 to 3 g during the launch, before reaching about 0 g at FD2; (ii) adaptation to 0 g at FD14; (iii) increase in gravity from 0 to approximately 1.5-1.8 g before reaching 1 g at R + 1; and (iv) readaptation to 1 g at R + 13. Fos- and FRA-positive cells were identified in the brainstem of flight rats and ground-based controls using immunocytochemistry. With respect to control rats, the number of labeled cells increased in flight animals in the medial and spinal vestibular nuclei (but not in the lateral vestibular nucleus) at FD2, decreased at FD14, greatly increased at R + 1 and returned to baseline levels at R + 13. Similar changes in IEG expression were also observed in the nucleus of the solitary tract, the area postrema and the central nucleus of the amygdala. In particular, in these vegetative areas the number of Fos-positive cells decreased in flight rats with respect to controls at FD14, i.e. after exposure to 0 g, but significantly increased at R + 1, i.e. after

  8. 17α-Ethinylestradiol (EE2) treatment of wild roach (Rutilus rutilus) during early life development disrupts expression of genes directly involved in the feedback cycle of estrogen.

    PubMed

    Nikoleris, Lina; Hultin, Cecilia L; Hallgren, Per; Hansson, Maria C

    2016-02-01

    Fish are more sensitive to introduced disturbances from synthetic endocrine disrupting compounds during early life phases compared with mature stages. 17α-Ethinylestradiol (EE2), which is the active compound in human oral contraceptives and hormone replacement therapies, is today ever present in the effluents from sewage treatment plants. EE2 targets and interacts with the endogenous biological systems of exposed vertebrates resulting in to large extents unknown short- and long-term effects. We investigated how EE2 exposure affects expression profiles of a large number of target genes during early life of roach (Rutilus rutilus). We exposed fertilized roach eggs collected from a lake in Southern Sweden to EE2 for 12weeks together with 1+-year-old roach in aquaria. We measured the gene expression of the estrogen receptor (esr)1/2a/2b, androgen receptor (ar), vitellogenin, cytochrome P450 (cyp)19a1a/1b in fertilized eggs; newly hatched larvae; 12-week-old fry; and juvenile wild roach (1+-year-old). Results shows that an EE2 concentration as low as 0.5ng/L significantly affects gene expression during early development. Gene expression responses vary both among life stages and molecular receptors. We also show that the gene profile of the estrogen feedback cycle to a large extent depends on the relationship between the three esr genes and the two cyp19a1 genes, which are all up-regulated with age. Results indicate that a disruption of the natural activity of the dominant esr gene could lead to detrimental biological effects if EE2 exposure occurs during development, even if this exposure occurred for only a short period. PMID:26689641

  9. Early and sustained altered expression of aging-related genes in young 3xTg-AD mice

    PubMed Central

    Gatta, V; D'Aurora, M; Granzotto, A; Stuppia, L; Sensi, S L

    2014-01-01

    Alzheimer's disease (AD) is a multifactorial neurological condition associated with a genetic profile that is still not completely understood. In this study, using a whole gene microarray approach, we investigated age-dependent gene expression profile changes occurring in the hippocampus of young and old transgenic AD (3xTg-AD) and wild-type (WT) mice. The aim of the study was to assess similarities between aging- and AD-related modifications of gene expression and investigate possible interactions between the two processes. Global gene expression profiles of hippocampal tissue obtained from 3xTg-AD and WT mice at 3 and 12 months of age (m.o.a.) were analyzed by hierarchical clustering. Interaction among transcripts was then studied with the Ingenuity Pathway Analysis (IPA) software, a tool that discloses functional networks and/or pathways associated with sets of specific genes of interest. Cluster analysis revealed the selective presence of hundreds of upregulated and downregulated transcripts. Functional analysis showed transcript involvement mainly in neuronal death and autophagy, mitochondrial functioning, intracellular calcium homeostasis, inflammatory response, dendritic spine formation, modulation of synaptic functioning, and cognitive decline. Thus, overexpression of AD-related genes (such as mutant APP, PS1, and hyperphosphorylated tau, the three genes that characterize our model) appears to favor modifications of additional genes that are involved in AD development and progression. The study also showed overlapping changes in 3xTg-AD at 3 m.o.a. and WT mice at 12 m.o.a., thereby suggesting altered expression of aging-related genes that occurs earlier in 3xTg-AD mice. PMID:24525730

  10. Type I Interferon Released by Myeloid Dendritic Cells Reversibly Impairs Cytomegalovirus Replication by Inhibiting Immediate Early Gene Expression

    PubMed Central

    Holzki, Julia Katharina; Dağ, Franziska; Dekhtiarenko, Iryna; Rand, Ulfert; Casalegno-Garduño, Rosaely; Trittel, Stephanie; May, Tobias; Riese, Peggy

    2015-01-01

    ABSTRACT Cytomegalovirus (CMV) is a ubiquitous beta-herpesvirus whose reactivation from latency is a major cause of morbidity and mortality in immunocompromised hosts. Mouse CMV (MCMV) is a well-established model virus to study virus-host interactions. We showed in this study that the CD8-independent antiviral function of myeloid dendritic cells (mDC) is biologically relevant for the inhibition of MCMV replication in vivo and in vitro. In vivo ablation of CD11c+ DC resulted in higher viral titers and increased susceptibility to MCMV infection in the first 3 days postinfection. We developed in vitro coculture systems in which we cocultivated MCMV-infected endothelial cells or fibroblasts with T cell subsets and/or dendritic cells. While CD8 T cells failed to control MCMV replication, bone marrow-derived mDC reduced viral titers by a factor of up to 10,000. Contact of mDC with the infected endothelial cells was crucial for their antiviral activity. Soluble factors secreted by the mDC blocked MCMV replication at the level of immediate early (IE) gene expression, yet the viral lytic cycle reinitiated once the mDC were removed from the cells. On the other hand, the mDC did not impair MCMV replication in cells deficient for the interferon (IFN) alpha/beta receptor (IFNAR), arguing that type I interferons were critical for viral control by mDC. In light of our recent observation that type I IFN is sufficient for the induction of latency immediately upon infection, our results imply that IFN secreted by mDC may play an important role in the establishment of CMV latency. IMPORTANCE Numerous studies have focused on the infection of DC with cytomegaloviruses and on the establishment of latency within them. However, almost all of these studies have relied on the infection of DC monocultures in vitro, whereas DC are just one among many cell types present in an infection site in vivo. To mimic this aspect of the in vivo situation, we cocultured DC with infected endothelial cells

  11. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  12. Expression of p53 Target Genes in the Early Phase of Long-Term Potentiation in the Rat Hippocampal CA1 Area

    PubMed Central

    Pustylnyak, Vladimir O.; Lisachev, Pavel D.; Shtark, Mark B.

    2015-01-01

    Gene expression plays an important role in the mechanisms of long-term potentiation (LTP), which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC) tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity. PMID:25767724

  13. Nodule parenchyma-specific expression of the sesbania rostrata early nodulin gene SrEnod2 is mediated by its 3' untranslated region

    PubMed Central

    Chen, R; Silver, DL; de Bruijn FJ

    1998-01-01

    The early nodulin Enod2 gene encodes a putative hydroxyproline-rich cell wall protein and is expressed exclusively in the nodule parenchyma cell layer. The latter finding suggests that the Enod2 protein may contribute to the special morphological features of the nodule parenchyma and to the creation of an oxygen diffusion barrier. The Enod2 gene of the stem-nodulating legume Sesbania rostrata (SrEnod2) is induced specifically in roots by the plant hormone cytokinin, and this induction occurs at a post-transcriptional level. Here, we characterize the cis determinant(s) in the SrEnod2 locus responsible for nodule parenchyma-specific expression and show that the 3' untranslated region (UTR) of the SrEnod2 gene is both required and sufficient for directing chimeric reporter gene expression in the nodule parenchyma of transgenic Lotus corniculatus plants. Moreover, we show that the SrEnod2 3' UTR does not act as a tissue-specific enhancer element. By conducting a detailed deletion analysis of the 5' and 3' SrEnod2 regions, we delimited the minimal promoter of the SrEnod2 gene, and it appears that the 5' flanking sequences are not essential for nodule parenchyma-specific expression. This finding is in contrast with the report that the 5' upstream region of the soybean Enod2 gene directs nodule parenchyma-specific expression, indicating that different mechanisms may be involved in regulating the expression of these two genes. We definitively demonstrate that the cis element(s) for tissue-specific expression is located within the 3' UTR of a plant nuclear gene. PMID:9761788

  14. Molecular cloning and expression of a novel CYP26 gene (cyp26d1) during zebrafish early development.

    PubMed

    Gu, Xingxing; Xu, Fang; Wang, Xiaolin; Gao, Xiang; Zhao, Qingshun

    2005-08-01

    Proper restriction of retinoid signaling by Cyp26s is essential for development of vertebrate embryos while inappropriate retinoid signaling can cause teratogenesis. Here, we report cloning and expression analysis of a novel cyp26 gene (cyp26d1) isolated from zebrafish. The predicted protein encoded by cyp26d1 consists of 554 amino acids. It exhibits 54% amino acid identity with human Cyp26C1, 50% with zebrafish Cyp26B1 and 38% with zebrafish Cyp26A1. Whole-mount in situ hybridization shows that cyp26d1 is first expressed in sphere stage, then disappears at 50% epiboly and resumes its expression at 75% epiboly. During segmentation period, cyp26d1 message is found at presumptive hindbrain. Double in situ hybridization with krox20 and cyp26d1 reveals that cyp26d1 is expressed in presumptive rhombomere 2-4 (r2-r4) at 2-somite stage. At 3-somite stage, cyp26d1 gene is expressed in r6 and pharyngeal arch (pa) one in addition to its expression at r2 and r4. At 6-somite stage, cyp26d1 message is present in continuous bands at r2-r6 and in pa1. This expression pattern is maintained from 10-somite stage through 21-somite stage except that the expression level is greatly reduced at r2 and r4. At 21-somite stage, cyp26d1 is also found in a group of cells in telencephalon and diencephalons. At 25-31h post-fertilization (hpf), the zebrafish cyp26d1 expression domain is extended to eyes, otic vesicles and midbrain in addition to its expression in hindbrain, telencephalon, diencephalons, and pharyngeal arches. At 35-48hpf, the expression of cyp26d1 is mainly restricted to otic vesicles, pharyngeal arches and pectoral fins and the expression level is greatly reduced. PMID:15979416

  15. Cord blood gene expression supports that prenatal exposure to perfluoroalkyl substances causes depressed immune functionality in early childhood.

    PubMed

    Pennings, Jeroen L A; Jennen, Danyel G J; Nygaard, Unni C; Namork, Ellen; Haug, Line S; van Loveren, Henk; Granum, Berit

    2016-01-01

    Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are a class of synthetic compounds that have widespread use in consumer and industrial applications. PFAS are considered environmental pollutants that have various toxic properties, including effects on the immune system. Recent human studies indicate that prenatal exposure to PFAS leads to suppressed immune responses in early childhood. In this study, data from the Norwegian BraMat cohort was used to investigate transcriptomics profiles in neonatal cord blood and their association with maternal PFAS exposure, anti-rubella antibody levels at 3 years of age and the number of common cold episodes until 3 years. Genes associated with PFAS exposure showed enrichment for immunological and developmental functions. The analyses identified a toxicogenomics profile of 52 PFAS exposure-associated genes that were in common with genes associated with rubella titers and/or common cold episodes. This gene set contains several immunomodulatory genes (CYTL1, IL27) as well as other immune-associated genes (e.g. EMR4P, SHC4, ADORA2A). In addition, this study identified PPARD as a PFAS toxicogenomics marker. These markers can serve as the basis for further mechanistic or epidemiological studies. This study provides a transcriptomics connection between prenatal PFAS exposure and impaired immune function in early childhood and supports current views on PPAR- and NF-κB-mediated modes of action. The findings add to the available evidence that PFAS exposure is immunotoxic in humans and support regulatory policies to phase out these substances. PMID:25812627

  16. First Generation Gene Expression Signature for Early Prediction of Late Occurring Hematological Acute Radiation Syndrome in Baboons.

    PubMed

    Port, M; Herodin, F; Valente, M; Drouet, M; Lamkowski, A; Majewski, M; Abend, M

    2016-07-01

    We implemented a two-stage study to predict late occurring hematologic acute radiation syndrome (HARS) in a baboon model based on gene expression changes measured in peripheral blood within the first two days after irradiation. Eighteen baboons were irradiated to simulate different patterns of partial-body and total-body exposure, which corresponded to an equivalent dose of 2.5 or 5 Gy. According to changes in blood cell counts the surviving baboons (n = 17) exhibited mild (H1-2, n = 4) or more severe (H2-3, n = 13) HARS. Blood samples taken before irradiation served as unexposed control (H0, n = 17). For stage I of this study, a whole genome screen (mRNA microarrays) was performed using a portion of the samples (H0, n = 5; H1-2, n = 4; H2-3, n = 5). For stage II, using the remaining samples and the more sensitive methodology, qRT-PCR, validation was performed on candidate genes that were differentially up- or down-regulated during the first two days after irradiation. Differential gene expression was defined as significant (P < 0.05) and greater than or equal to a twofold difference above a H0 classification. From approximately 20,000 genes, on average 46% appeared to be expressed. On day 1 postirradiation for H2-3, approximately 2-3 times more genes appeared up-regulated (1,418 vs. 550) or down-regulated (1,603 vs. 735) compared to H1-2. This pattern became more pronounced at day 2 while the number of differentially expressed genes decreased. The specific genes showed an enrichment of biological processes coding for immune system processes, natural killer cell activation and immune response (P = 1 × E-06 up to 9 × E-14). Based on the P values, magnitude and sustained differential gene expression over time, we selected 89 candidate genes for validation using qRT-PCR. Ultimately, 22 genes were confirmed for identification of H1-3 classifications and seven genes for identification of H2-3 classifications using qRT-PCR. For H1-3 classifications, most genes were

  17. Expression analysis of mitotic spindle checkpoint genes in breast carcinoma: role of NDC80/HEC1 in early breast tumorigenicity, and a two-gene signature for aneuploidy

    PubMed Central

    2011-01-01

    Background Aneuploidy and chromosomal instability (CIN) are common abnormalities in human cancer. Alterations of the mitotic spindle checkpoint are likely to contribute to these phenotypes, but little is known about somatic alterations of mitotic spindle checkpoint genes in breast cancer. Methods To obtain further insight into the molecular mechanisms underlying aneuploidy in breast cancer, we used real-time quantitative RT-PCR to quantify the mRNA expression of 76 selected mitotic spindle checkpoint genes in a large panel of breast tumor samples. Results The expression of 49 (64.5%) of the 76 genes was significantly dysregulated in breast tumors compared to normal breast tissues: 40 genes were upregulated and 9 were downregulated. Most of these changes in gene expression during malignant transformation were observed in epithelial cells. Alterations of nine of these genes, and particularly NDC80, were also detected in benign breast tumors, indicating that they may be involved in pre-neoplastic processes. We also identified a two-gene expression signature (PLK1 + AURKA) which discriminated between DNA aneuploid and DNA diploid breast tumor samples. Interestingly, some DNA tetraploid tumor samples failed to cluster with DNA aneuploid breast tumors. Conclusion This study confirms the importance of previously characterized genes and identifies novel candidate genes that could be activated for aneuploidy to occur. Further functional analyses are required to clearly confirm the role of these new identified genes in the molecular mechanisms involved in breast cancer aneuploidy. The novel genes identified here, and/or the two-gene expression signature, might serve as diagnostic or prognostic markers and form the basis for novel therapeutic strategies. PMID:21352579

  18. Meta-analysis of Gene Expression in the Mouse Liver Reveals Biomarkers Associated with Inflammation Increased Early During Aging

    EPA Science Inventory

    Aging is associated with a predictable loss of cellular homeostasis, a decline in physiological function and an increase in various diseases. We hypothesized that similar age-related gene expression profiles would be observed in mice across independent studies. Employing a metaan...

  19. Whole-Genome Analysis of Temporal Gene Expression during Early Transdifferentiation of Human Lung Alveolar Epithelial Type 2 Cells In Vitro

    PubMed Central

    Johansson, Helena Morales; Newman, Donna R.; Sannes, Philip L.

    2014-01-01

    It is generally accepted that the surfactant-producing pulmonary alveolar epithelial type II (AT2) cell acts as the progenitor of the type I (AT1) cell, but the regulatory mechanisms involved in this relationship remain the subject of active investigation. While previous studies have established a number of specific markers that are expressed during transdifferentiation from AT2 to AT1 cells, we hypothesized that additional, previously unrecognized, signaling pathways and relevant cellular functions are transcriptionally regulated at early stages of AT2 transition. In this study, a discovery-based gene expression profile analysis was undertaken of freshly isolated human AT2 (hAT2) cells grown on extracellular matrix (ECM) substrata known to either support (type I collagen) or retard (Matrigel) the early transdifferentiation process into hAT1-like cells over the first three days. Cell type-specific expression patterns analyzed by Illumina Human HT-12 BeadChip yielded over 300 genes that were up- or down-regulated. Candidate genes significantly induced or down-regulated during hAT2 transition to hAT1-like cells compared to non-transitioning hAT2 cells were identified. Major functional groups were also recognized, including those of signaling and cytoskeletal proteins as well as genes of unknown function. Expression of established signatures of hAT2 and hAT1 cells, such as surfactant proteins, caveolin-1, and channels and transporters, was confirmed. Selected novel genes further validated by qRT-PCR, protein expression analysis, and/or cellular localization included SPOCK2, PLEKHO1, SPRED1, RAB11FIP1, PTRF/CAVIN-1 and RAP1GAP. These results further demonstrate the utility of genome-wide analysis to identify relevant, novel cell type-specific signatures of early ECM-regulated alveolar epithelial transdifferentiation processes in vitro. PMID:24690998

  20. The uterine expression of SEC63 gene is up-regulated at implantation sites in association with the decidualization during the early pregnancy in mice

    PubMed Central

    Su, Ren-wei; Sun, Zhao-gui; Zhao, Yue-chao; Chen, Qiu-ju; Yang, Zeng-ming; Li, Run-sheng; Wang, Jian

    2009-01-01

    Background Sec63 is a key component of the protein translocation machinery in the mammalian endoplasmic reticulum (ER), and involved in the post-translation processing of secretory proteins. The aim of this study was to determine the expression pattern of SEC63 gene in mouse uterus during the early pregnancy. Methods Real-time quantitative PCR and Western blot analyses were used to evaluate the alteration in levels of uterine SEC63 gene expression during the peri-implantation period in mice. Further, both in situ hybridization and immunohistochemical analyses were performed to examine the spatial localization of SEC63 gene expression in mouse uterine tissues. The presence of Sec63 protein in human uterine tissue was also detected by immunohistochemical analysis. Statistical analysis was carried out using Tukey test. Results Uterine SEC63 gene expression was up-regulated and predominantly localized in mouse decidual cells during days 5–8 of pregnancy. More interestingly, Sec63 protein was also detected in human decidua of 10-week pregnancy, whereas was not observed in human endometrial tissues both at proliferative and secretory phases of menstrual cycle. Conclusion The pattern of SEC63 gene expression is consistent with a possible role for SEC63 in decidualization. PMID:19208265

  1. ZBTB32 is an early repressor of the class II transactivator and MHC class II gene expression during B cell differentiation to plasma cells1

    PubMed Central

    Yoon, Hyesuk; Scharer, Christopher D.; Majumder, Parimal; Davis, Carl W.; Butler, Royce; Zinzow-Kramer, Wendy; Skountzou, Ioanna; Koutsonanos, Dimitrios G.; Ahmed, Rafi; Boss, Jeremy M.

    2012-01-01

    The MHC class II transactivator (CIITA) and MHC class II expression is silenced during the differentiation of B cells to plasma cells. When B cell differentiation is carried out ex vivo, CIITA silencing occurs rapidly but the factors contributing to this event are not known. ZBTB32, also known as repressor of GATA3, was identified as an early repressor of CIITA in an ex vivo plasma cell differentiation model. ZBTB32 activity occurred at a time when Blimp-1, the regulator of plasma cell fate and suppressor of CIITA, was minimally induced. Ectopic expression of ZBTB32 suppressed CIITA and I-A gene expression in B cells. ShRNA depletion of ZBTB32 in a plasma cell line resulted in reexpression of CIITA and I-A. Compared to conditional Blimp-1 knock out and wild-type B cells, B cells from ZBTB32/ROG-knock out mice displayed delayed kinetics in silencing CIITA during ex vivo plasma cell differentiation. ZBTB32 was found to bind to the CIITA gene, suggesting that ZBTB32 directly regulates CIITA. Lastly, ZBTB32 and Blimp-1 coimmunoprecipitated, suggesting that the two repressors may ultimately function together to silence CIITA expression. These results introduce ZBTB32 as a novel regulator of MHC-II gene expression and a potential regulatory partner of Blimp-1 in repressing gene expression. PMID:22851713

  2. GENE EXPRESSION NETWORKS

    EPA Science Inventory

    "Gene expression network" is the term used to describe the interplay, simple or complex, between two or more gene products in performing a specific cellular function. Although the delineation of such networks is complicated by the existence of multiple and subtle types of intera...

  3. Expression of proteolipid protein gene in spinal cord stem cells and early oligodendrocyte progenitor cells is dispensable for normal cell migration and myelination.

    PubMed

    Harlow, Danielle E; Saul, Katherine E; Culp, Cecilia M; Vesely, Elisa M; Macklin, Wendy B

    2014-01-22

    Plp1 gene expression occurs very early in development, well before the onset of myelination, creating a conundrum with regard to the function of myelin proteolipid protein (PLP), one of the major proteins in compact myelin. Using PLP-EGFP mice to investigate Plp1 promoter activity, we found that, at very early time points, PLP-EGFP was expressed in Sox2+ undifferentiated precursors in the spinal cord ventricular zone (VZ), as well as in the progenitors of both neuronal and glial lineages. As development progressed, most PLP-EGFP-expressing cells gave rise to oligodendrocyte progenitor cells (OPCs). The expression of PLP-EGFP in the spinal cord was quite dynamic during development. PLP-EGFP was highly expressed as cells delaminated from the VZ. Expression was downregulated as cells moved laterally through the cord, and then robustly upregulated as OPCs differentiated into mature myelinating oligodendrocytes. The presence of PLP-EGFP expression in OPCs raises the question of its role in this migratory population. We crossed PLP-EGFP reporter mice into a Plp1-null background to investigate the role of PLP in early OPC development. In the absence of PLP, normal numbers of OPCs were generated and their distribution throughout the spinal cord was unaffected. However, the orientation and length of OPC processes during migration was abnormal in Plp1-null mice, suggesting that PLP plays a role either in the structural integrity of OPC processes or in their response to extracellular cues that orient process outgrowth. PMID:24453324

  4. Nuclear Neighborhoods and Gene Expression

    PubMed Central

    Zhao, Rui; Bodnar, Megan S.; Spector, David L.

    2009-01-01

    Summary The eukaryotic nucleus is a highly compartmentalized and dynamic environment. Chromosome territories are arranged non-randomly within the nucleus and numerous studies have indicated that a gene’s position in the nucleus can impact its transcriptional activity. Here, we focus on recent advances in our understanding of the influence of specific nuclear neighborhoods on gene expression or repression. Nuclear neighborhoods associated with transcriptional repression include the inner nuclear membrane/nuclear lamina and peri-nucleolar chromatin, whereas neighborhoods surrounding the nuclear pore complex, PML nuclear bodies, and nuclear speckles seem to be transcriptionally permissive. While nuclear position appears to play an important role in gene expression, it is likely to be only one piece of a flexible puzzle that incorporates numerous parameters. We are still at a very early, yet exciting stage in our journey toward deciphering the mechanism(s) that govern the permissiveness of gene expression/repression within different nuclear neighborhoods. PMID:19339170

  5. Milk yield responses to changes in milking frequency during early lactation are associated with coordinated and persistent changes in mammary gene expression

    PubMed Central

    2013-01-01

    Background The lactating mammary gland responds to changes in milking frequency by modulating milk production. This response is locally regulated and, in dairy cows, the udder is particularly sensitive during early lactation. Relative to cows milked twice-daily throughout lactation, those milked four-times-daily for just the first 3 weeks of lactation produce more milk throughout that lactation. We hypothesized that the milk yield response would be associated with increased mammary cell turnover and changes in gene expression during frequent milking and persisting thereafter. Cows were assigned to unilateral frequent milking (UFM; left udder halves milked twice-daily; right udder halves milked four-times daily) on days 1 to 21 of lactation, followed by twice-daily milking for the remainder of lactation. Relative to udder halves milked twice-daily, those milked four-times produced more milk during UFM; the difference in milk yield declined acutely upon cessation of UFM after day 21, but remained significantly elevated thereafter. We obtained mammary biopsies from both udder halves on days 21, 23, and 40 of lactation. Results Mammary cell proliferation and apoptosis were not affected by milking frequency. We identified 75 genes that were differentially expressed between paired udder halves on day 21 but exhibited a reversal of differential expression on day 23. Among those genes, we identified four clusters characterized by similar temporal patterns of differential expression. Two clusters (11 genes) were positively correlated with changes in milk yield and were differentially expressed on day 21 of lactation only, indicating involvement in the initial milk yield response. Two other clusters (64 genes) were negatively correlated with changes in milk yield. Twenty-nine of the 75 genes were also differentially expressed on day 40 of lactation. Conclusions Changes in milking frequency during early lactation did not alter mammary cell population dynamics, but were

  6. Early changes in gene expression induced by blue light irradiation of A2E-laden retinal pigment epithelial cells

    PubMed Central

    van der Burght, Barbro W.; Hansen, Morten; Olsen, Jørgen; Zhou, Jilin; Wu, Yalin; Nissen, Mogens H.; Sparrow, Janet R.

    2016-01-01

    Purpose Accumulation of bisretinoids as lipofuscin in retinal pigment epithelial (RPE) cells is implicated in the pathogenesis of some blinding diseases including age-related macular degeneration (AMD). To identify genes whose expression may change under conditions of bisretinoid accumulation, we investigated the differential gene expression in RPE cells that had accumulated the lipofuscin fluorophore A2E and were exposed to blue light (430 nm). Methods A2E-laden RPE cells were exposed to blue light (A2E/430 nm) at various time intervals. Cell death was quantified using Dead Red staining, and RNA levels for the entire genome was determined using DNA microarrays (Affymetrix GeneChip Human Genome 2.0 Plus). Array results for selected genes were confirmed by real-time reverse-transcriptase polymerase chain reaction. Results Principal component analysis revealed that the A2E-laden RPE cells irradiated with blue light were clearly distinguishable from the control samples. We found differential regulation of genes belonging to the following functional groups: transcription factors, stress response, apoptosis and immune response. Among the last mentioned were downregulation of four genes that coded for proteins that have an inhibitory effect on the complement cascade: (complement factor H, complement factor H-related 1, complement factor I and vitronectin) and of two belonging to the classical pathway (complement component 1, s subcomponent and complement component 1, r subcomponent). Conclusion This study demonstrates that blue light irradiation of A2E-laden RPE cells can alter the transcription of genes belonging to different functional pathways including stress response, apoptosis and the immune response. We suggest that these molecules may be associated to the pathogenesis of AMD and can potentially serve as future therapeutic targets. PMID:23742627

  7. Changes of thyroid hormone levels and related gene expression in zebrafish on early life stage exposure to triadimefon.

    PubMed

    Liu, Shaoying; Chang, Juhua; Zhao, Ying; Zhu, Guonian

    2011-11-01

    In this study, zebrafish was exposed to triadimefon. Thyroid hormones levels and the expression of related genes in the hypothalamic-pituitary-thyroid (HPT) axis, including thyroid-stimulating hormone (TSH-beta), deiodinases (dio1 and dio2) and the thyroid hormone receptor (thraa and thrb) were evaluated. After triadimefon exposure, increased T4 can be explained by increased thyroid-stimulating hormone (TSH-beta). The conversion of T4 to T3 (deiodinase type I-dio1) was decreased, which reduced the T3 level. Thyroid hormone receptor beta (thrb) mRNA levels were significantly down-regulated, possibly as a response to the decreased T3 levels. The overall results indicated that triadimefon exposure could alter gene expression in the HPT axis and that mechanisms of disruption of thyroid status by triadimefon could occur at several steps in the synthesis, regulation, and action of thyroid hormones. PMID:22004968

  8. Assessing early therapeutic response to bevacizumab in primary breast cancer using magnetic resonance imaging and gene expression profiles.

    PubMed

    Mehta, Shaveta; Hughes, Nicholas P; Buffa, Francesca M; Li, Sonia P; Adams, Rosemary F; Adwani, Asha; Taylor, N Jane; Levitt, Nicola C; Padhani, Anwar R; Makris, Andreas; Harris, Adrian L

    2011-01-01

    Antiangiogenic therapy is a promising approach for the treatment of breast cancer. In practice, however, only a subset of patients who receive antiangiogenic drugs demonstrate a significant response. A key challenge, therefore, is to discover biomarkers that are predictive of response to antiangiogenic therapy. To address this issue, we have designed a window-of-opportunity study in which bevacizumab is administered as a short-term first-line treatment to primary breast cancer patients. Central to our approach is the use of a detailed pharmacodynamic assessment, consisting of pre- and post-bevacizumab multi-parametric magnetic resonance imaging scans and core biopsies for exon array gene expression analysis. Here, we illustrate three intrinsic patterns of response to bevacizumab and discuss the molecular mechanisms that may underpin each. Our results illustrate how the combination of dynamic imaging data and gene expression profiles can guide the development of biomarkers for predicting response to antiangiogenic therapy. PMID:22043045

  9. The thyroid hormone receptor gene (c-erbA alpha) is expressed in advance of thyroid gland maturation during the early embryonic development of Xenopus laevis.

    PubMed Central

    Banker, D E; Bigler, J; Eisenman, R N

    1991-01-01

    The c-erbA proto-oncogene encodes the thyroid hormone receptor, a ligand-dependent transcription factor which plays an important role in vertebrate growth and development. To define the role of the thyroid hormone receptor in developmental processes, we have begun studying c-erbA gene expression during the ontogeny of Xenopus laevis, an organism in which thyroid hormone has well-documented effects on morphogenesis. Using polymerase chain reactions (PCR) as a sensitive assay of specific gene expression, we found that polyadenylated erbA alpha RNA is present in Xenopus cells at early developmental stages, including the fertilized egg, blastula, gastrula, and neurula. By performing erbA alpha-specific PCR on reverse-transcribed RNAs from high-density sucrose gradient fractions prepared from early-stage embryos, we have demonstrated that these erbA transcripts are recruited to polysomes. Therefore, erbA is expressed in Xenopus development prior to the appearance of the thyroid gland anlage in tailbud-stage embryos. This implies that erbA alpha/thyroid hormone receptors may play ligand-independent roles during the early development of X. laevis. Quantitative PCR revealed a greater than 25-fold range in the steady-state levels of polyadenylated erbA alpha RNA across early stages of development, as expressed relative to equimolar amounts of total embryonic RNA. Substantial increases in the levels of erbA alpha RNA were noted at stages well after the onset of zygotic transcription at the mid-blastula transition, with accumulation of erbA alpha transcripts reaching a relative maximum in advance of metamorphosis. We also show that erbA alpha RNAs are expressed unequally across Xenopus neural tube embryos. This differential expression continues through later stages of development, including metamorphosis. This finding suggests that erbA alpha/thyroid hormone receptors may play roles in tissue-specific processes across all of Xenopus development. Images PMID:1656222

  10. Clinical utility of gene-expression profiling in women with early breast cancer: an overview of systematic reviews

    PubMed Central

    Marrone, Michael; Stewart, Alison; Dotson, W. David

    2015-01-01

    Purpose This overview systematically evaluates the clinical utility of using Oncotype DX and MammaPrint gene-expression profiling tests to direct treatment decisions in women with breast cancer. The findings are intended to inform an updated recommendation from the Evaluation of Genomic Applications in Practice and Prevention Working Group. Methods Evidence reported in systematic reviews evaluating the clinical utility of Oncotype DX and MammaPrint, as well as the ability to predict treatment outcomes, change in treatment decisions, and cost-effectiveness, was qualitatively synthesized. Results Five systematic reviews found no direct evidence of clinical utility for either test. Indirect evidence showed Oncotype DX was able to predict treatment effects of adjuvant chemotherapy, whereas no evidence of predictive value was found for MammaPrint. Both tests influenced a change in treatment recommendations in 21 to 74% of participants. The cost-effectiveness of Oncotype DX varied with the alternative compared. For MammaPrint, lack of evidence of the predictive value led to uncertainty in the cost-effectiveness. Conclusion No studies were identified that provided direct evidence that using gene-expression profiling tests to direct treatment decisions improved outcomes in women with breast cancer. Three ongoing studies may provide direct evidence for determining the clinical utility of gene-expression profiling testing. PMID:25474343

  11. Unraveling low-level gamma radiation--responsive changes in expression of early and late genes in leaves of rice seedlings at Iitate Village, Fukushima.

    PubMed

    Hayashi, Gohei; Shibato, Junko; Imanaka, Tetsuji; Cho, Kyoungwon; Kubo, Akihiro; Kikuchi, Shoshi; Satoh, Kouji; Kimura, Shinzo; Ozawa, Shoji; Fukutani, Satoshi; Endo, Satoru; Ichikawa, Katsuki; Agrawal, Ganesh Kumar; Shioda, Seiji; Fukumoto, Manabu; Rakwal, Randeep

    2014-01-01

    In the summer of 2012, 1 year after the nuclear accident in March 2011 at the Fukushima Daiichi nuclear power plant, we examined the effects of gamma radiation on rice at a highly contaminated field of Iitate village in Fukushima, Japan. We investigated the morphological and molecular changes on healthy rice seedlings exposed to continuous low-dose gamma radiation up to 4 µSv h(-1), about 80 times higher than natural background level. After exposure to gamma rays, expression profiles of selected genes involved in DNA replication/repair, oxidative stress, photosynthesis, and defense/stress functions were examined by RT-PCR, which revealed their differential expression in leaves in a time-dependent manner over 3 days (6, 12, 24, 48, and 72 h). For example, OsPCNA mRNA rapidly increased at 6, 12, and 24 h, suggesting that rice cells responded to radiation stress by activating a gene involved in DNA repair mechanisms. At 72 h, genes related to the phenylpropanoid pathway (OsPAL2) and cell death (OsPR1oa) were strongly induced, indicating activation of defense/stress responses. We next profiled the transcriptome using a customized rice whole-genome 4×44K DNA microarray at early (6h) and late (72 h) time periods. Low-level gamma radiation differentially regulated rice leaf gene expression (induced 4481 and suppressed 3740 at 6 h and induced 2291 and suppressed 1474 genes at 72 h) by at least 2-fold. Using the highly upregulated and downregulated gene list, MapMan bioinformatics tool generated diagrams of early and late pathways operating in cells responding to gamma ray exposure. An inventory of a large number of gamma radiation-responsive genes provides new information on novel regulatory processes in rice. PMID:25124817

  12. Gene expression technology

    SciTech Connect

    Goeddel, D.V. )

    1990-01-01

    The articles in this volume were assemble to enable the reader to design effective strategies for the expression of cloned genes and cDNAs. More than a compilation of papers describing the multitude of techniques now available for expressing cloned genes, this volume provides a manual that should prove useful for solving the majority of expression problems one likely to encounter. The four major expression systems commonly available to most investigators are stressed: Escherichia coli, Bacillus subtilis, yeast, and mammalian cells. Each of these system has its advantages and disadvantages, details of which are found in Chapter 1 and the strategic overviews for the four major sections of the volume. The papers in each of these sections provide many suggestions on how to proceed if initial expression levels are not sufficient.

  13. Okadaic acid mimics multiple changes in early protein phosphorylation and gene expression induced by tumor necrosis factor or interleukin-1.

    PubMed

    Guy, G R; Cao, X; Chua, S P; Tan, Y H

    1992-01-25

    Okadaic acid, a phosphatase inhibitor from a marine organism, mimics tumor necrosis factor/interleukin-1 (TNF/IL-1) in inducing changes in early cellular protein phosphorylation. A total of approximately 116 proteins exhibit significant and concordant changes in phosphorylation or dephosphorylation within 15 min in human fibroblasts activated by either okadaic acid, TNF, or IL-1. The fidelity of this mimicry by okadaic acid extends to the phosphorylation of the 27 hsp complex, stathmin, eIF-4E, myosin light chain, nucleolin, epidermal growth factor receptor, and other cdc2-kinase substrates (c-abl, RB, and p53). The okadaic acid-induced pattern of protein phosphorylation is distinct from that observed in cells treated with phorbol 12-myristate 13-acetate or with ligands like epidermal growth factor, cyclic AMP agonists, bradykinin, or interferons. Like TNF, okadaic acid also induces the transcription of immediate early response genes like c-jun and Egr-1 as well as the interleukin-6 genes. The overall early effects of okadaic acid uniquely parallel those of TNF/IL-1 and not those of other cytokines or ligands. Regulation of protein phosphatase inhibition is discussed as a mechanism for TNF/IL-1 signal transduction. PMID:1370482

  14. Expressed sequence-tag analysis of ovaries of Brachiaria brizantha reveals genes associated with the early steps of embryo sac differentiation of apomictic plants.

    PubMed

    Silveira, Erica Duarte; Guimarães, Larissa Arrais; de Alencar Dusi, Diva Maria; da Silva, Felipe Rodrigues; Martins, Natália Florencio; do Carmo Costa, Marcos Mota; Alves-Ferreira, Márcio; de Campos Carneiro, Vera Tavares

    2012-02-01

    In apomixis, asexual mode of plant reproduction through seeds, an unreduced megagametophyte is formed due to circumvented or altered meiosis. The embryo develops autonomously from the unreduced egg cell, independently of fertilization. Brachiaria is a genus of tropical forage grasses that reproduces sexually or by apomixis. A limited number of studies have reported the sequencing of apomixis-related genes and a few Brachiaria sequences have been deposited at genebank databases. This work shows sequencing and expression analyses of expressed sequence-tags (ESTs) of Brachiaria genus and points to transcripts from ovaries with preferential expression at megasporogenesis in apomictic plants. From the 11 differentially expressed sequences from immature ovaries of sexual and apomictic Brachiaria brizantha obtained from macroarray analysis, 9 were preferentially detected in ovaries of apomicts, as confirmed by RT-qPCR. A putative involvement in early steps of Panicum-type embryo sac differentiation of four sequences from B. brizantha ovaries: BbrizHelic, BbrizRan, BbrizSec13 and BbrizSti1 is suggested. Two of these, BbrizSti1 and BbrizHelic, with similarity to a gene coding to stress induced protein and a helicase, respectively, are preferentially expressed in the early stages of apomictic ovaries development, especially in the nucellus, in a stage previous to the differentiation of aposporous initials, as verified by in situ hybridization. PMID:22068439

  15. Gene expression networks.

    PubMed

    Thomas, Reuben; Portier, Christopher J

    2013-01-01

    With the advent of microarrays and next-generation biotechnologies, the use of gene expression data has become ubiquitous in biological research. One potential drawback of these data is that they are very rich in features or genes though cost considerations allow for the use of only relatively small sample sizes. A useful way of getting at biologically meaningful interpretations of the environmental or toxicological condition of interest would be to make inferences at the level of a priori defined biochemical pathways or networks of interacting genes or proteins that are known to perform certain biological functions. This chapter describes approaches taken in the literature to make such inferences at the biochemical pathway level. In addition this chapter describes approaches to create hypotheses on genes playing important roles in response to a treatment, using organism level gene coexpression or protein-protein interaction networks. Also, approaches to reverse engineer gene networks or methods that seek to identify novel interactions between genes are described. Given the relatively small sample numbers typically available, these reverse engineering approaches are generally useful in inferring interactions only among a relatively small or an order 10 number of genes. Finally, given the vast amounts of publicly available gene expression data from different sources, this chapter summarizes the important sources of these data and characteristics of these sources or databases. In line with the overall aims of this book of providing practical knowledge to a researcher interested in analyzing gene expression data from a network perspective, the chapter provides convenient publicly accessible tools for performing analyses described, and in addition describe three motivating examples taken from the published literature that illustrate some of the relevant analyses. PMID:23086841

  16. Early Parental Deprivation in the Marmoset Monkey Produces Long-term Changes in Hippocampal Expression of Genes Involved in Synaptic Plasticity and Implicated in Mood Disorder

    PubMed Central

    Law, Amanda J.; Pei, Qi; Walker, Mary; Gordon-Andrews, Helen; Weickert, Cyndi Shannon; Feldon, Joram; Pryce, Christopher R.; Harrison, Paul J.

    2008-01-01

    In mood disorder, early stressors including parental separation are vulnerability factors, and hippocampal involvement is prominent. In common marmoset monkeys, daily parental deprivation during infancy produces a pro-depressive state of increased basal activity and reactivity in stress systems and mild anhedonia that persists at least to adolescence. Here we examined the expression of eight genes, each implicated in neural plasticity and in the pathophysiology of mood disorder, in the hippocampus of these same adolescent marmosets, relative to their normally-reared sibling controls. We also measured hippocampal volume. Early deprivation led to decreases in hippocampal GAP-43 mRNA, 5-HT1A receptor mRNA and 5-HT1AR binding ([3H]WAY100,635), and to increased VGAT mRNA. BDNF, synaptophysin, VGluT1, MAP2, and spinophilin transcripts were unchanged. There were some correlations with in vivo biochemical and behavioural indices, including VGluT1 mRNA with reward-seeking behaviour, and 5-HT1AR mRNA with CSF cortisol. Early deprivation did not affect hippocampal volume. We conclude that early deprivation in a non-human primate, in the absence of subsequent stressors, has a long-term effect on the hippocampal expression of genes implicated in synaptic function and plasticity. The reductions in GAP-43 and 5-HT1AR expression are comparable with findings in mood disorder, supporting the possibility that the latter reflect an early developmental contribution to disease vulnerability. Equally, the negative results suggest that other features of mood disorder, such as decreased hippocampal volume and BDNF expression, are related to different aspects of the pathophysiological process. PMID:18615010

  17. Gene Expression Signatures Predictive of Early Response and Outcome in High-Risk Childhood Acute Lymphoblastic Leukemia: A Children's Oncology Group Study

    PubMed Central

    Bhojwani, Deepa; Kang, Huining; Menezes, Renee X.; Yang, Wenjian; Sather, Harland; Moskowitz, Naomi P.; Min, Dong-Joon; Potter, Jeffrey W.; Harvey, Richard; Hunger, Stephen P.; Seibel, Nita; Raetz, Elizabeth A.; Pieters, Rob; Horstmann, Martin A.; Relling, Mary V.; den Boer, Monique L.; Willman, Cheryl L.; Carroll, William L.

    2008-01-01

    Purpose To identify children with acute lymphoblastic leukemia (ALL) at initial diagnosis who are at risk for inferior response to therapy by using molecular signatures. Patients and Methods Gene expression profiles were generated from bone marrow blasts at initial diagnosis from a cohort of 99 children with National Cancer Institute–defined high-risk ALL who were treated uniformly on the Children's Oncology Group (COG) 1961 study. For prediction of early response, genes that correlated to marrow status on day 7 were identified on a training set and were validated on a test set. An additional signature was correlated with long-term outcome, and the predictive models were validated on three large, independent patient cohorts. Results We identified a 24–probe set signature that was highly predictive of day 7 marrow status on the test set (P = .0061). Pathways were identified that may play a role in early blast regression. We have also identified a 47–probe set signature (which represents 41 unique genes) that was predictive of long-term outcome in our data set as well as three large independent data sets of patients with childhood ALL who were treated on different protocols. However, we did not find sufficient evidence for the added significance of these genes and the derived predictive models when other known prognostic features, such as age, WBC, and karyotype, were included in a multivariate analysis. Conclusion Genes and pathways that play a role in early blast regression may identify patients who may be at risk for inferior responses to treatment. A fully validated predictive gene expression signature was defined for high-risk ALL that provided insight into the biologic mechanisms of treatment failure. PMID:18802149

  18. A single early postnatal estradiol injection affects morphology and gene expression of the ovary and parametrial adipose tissue in adult female rats.

    PubMed

    Alexanderson, Camilla; Stener-Victorin, Elisabet; Kullberg, Joel; Nilsson, Staffan; Levin, Max; Cajander, Stefan; Lönn, Lars; Lönn, Malin; Holmäng, Agneta

    2010-10-01

    Events during early life can affect reproductive and metabolic functions in adulthood. We evaluated the programming effects of a single early postnatal estradiol injection (within 3h after birth) in female rats. We assessed ovarian and parametrial adipose tissue morphology, evaluated gene expression related to follicular development and adipose tissue metabolism, and developed a non-invasive volumetric estimation of parametrial adipose tissue by magnetic resonance imaging. Estradiol reduced ovarian weight, increased antral follicle size and number of atretic antral follicles, and decreased theca interna thickness in atretic antral follicles. Adult estradiol-injected rats also had malformed vaginal openings and lacked corpora lutea, confirming anovulation. Estradiol markedly reduced parametrial adipose tissue mass. Adipocyte size was unchanged, suggesting reduced adipocyte number. Parametrial adipose tissue lipoprotein lipase activity was increased. In ovaries, estradiol increased mRNA expression of adiponectin, complement component 3, estrogen receptor α, and glucose transporter 3 and 4; in parametrial adipose tissue, expression of complement component 3 was increased, expression of estrogen receptor α was decreased, and expression of leptin, lipoprotein lipase, and hormone-sensitive lipase was unaffected. These findings suggest that early postnatal estradiol exposure of female rats result in long-lasting effects on the ovary and parametrial adipose tissue at adult age. PMID:19857573

  19. A new reporter mouse cytomegalovirus reveals maintained immediate-early gene expression but poor virus replication in cycling liver sinusoidal endothelial cells

    PubMed Central

    2013-01-01

    Background The MCMV major immediate early promoter/enhancer (MIEP) is a bidirectional promoter that drives the expression of the three immediate early viral genes, namely ie1, ie2 and ie3. The regulation of their expression is intensively studied, but still incompletely understood. Methods We constructed a reporter MCMV, (MCMV-MIEPr) expressing YFP and tdTomato under the control of the MIEP as proxies of ie1 and ie2, respectively. Moreover, we generated a liver sinusoidal endothelial cell line (LSEC-uniLT) where cycling is dependent on doxycycline. We used these novel tools to study the kinetics of MIEP-driven gene expression in the context of infection and at the single cell level by flow cytometry and by live imaging of proliferating and G0-arrested cells. Results MCMV replicated to higher titers in G0-arrested LSEC, and cycling cells showed less cytopathic effect or YFP and tdTomato expression at 5 days post infection. In the first 24 h post infection, however, there was no difference in MIEP activity in cycling or G0-arrested cells, although we could observe different profiles of MIEP gene expression in different cell types, like LSECs, fibroblasts or macrophages. We monitored infected LSEC-uniLT in G0 by time lapse microscopy over five days and noticed that most cells survived infection for at least 96 h, arguing that quick lysis of infected cells could not account for the spread of the virus. Interestingly, we noticed a strong correlation between the ratio of median YFP and tdTomato expression and length of survival of infected cells. Conclusion By means of our newly developed genetic tools, we showed that the expression pattern of MCMV IE1 and IE2 genes differs between macrophages, endothelial cells and fibroblasts. Substantial and cell-cycle independent differences in the ie1 and ie2 transcription could also be observed within individual cells of the same population, and marked ie2 gene expression was associated with longer survival of the infected cells

  20. A Porcine Animal Model for Early Meniscal Degeneration – Analysis of Histology, Gene Expression and Magnetic Resonance Imaging Six Months after Resection of the Anterior Cruciate Ligament

    PubMed Central

    Kreinest, Michael; Reisig, Gregor; Ströbel, Philipp; Dinter, Dietmar; Attenberger, Ulrike; Lipp, Peter; Schwarz, Markus

    2016-01-01

    Background/Objective The menisci of the mammalian knee joint balance the incongruence between femoral condyle and tibial plateau and thus menisci absorb and distribute high loads. Degeneration processes of the menisci lead to pain syndromes in the knee joint. The origin of such degenerative processes on meniscal tissue is rarely understood and may be described best as an imbalance of anabolic and catabolic metabolism. A standardized animal model of meniscal degeneration is needed for further studies. The aim of the current study was to develop a porcine animal model with early meniscal degeneration. Material and Methods Resection of the anterior cruciate ligament (ACLR) was performed on the left knee joints of eight Göttingen minipigs. A sham operation was carried out on the right knee joint. The grade of degeneration was determined 26 weeks after the operation using histology and magnetic resonance imaging (MRI). Furthermore, the expression of 14 genes which code for extracellular matrix proteins, catabolic matrix metalloproteinases and inflammation mediators were analyzed. Results Degenerative changes were detected by a histological analysis of the medial meniscus after ACLR. These changes were not detected by MRI. In terms of their gene expression profile, these degenerated medial menisci showed a significantly increased expression of COL1A1. Conclusion This paper describes a new animal model for early secondary meniscal degeneration in the Göttingen minipig. Histopathological evidence of the degenerative changes could be described. This early degenerative changes could not be seen by NMR imaging. PMID:27434644

  1. 3,19-isopropylideneandrographolide suppresses early gene expression of drug-resistant and wild type herpes simplex viruses.

    PubMed

    Kongyingyoes, Bunkerd; Priengprom, Thongkoon; Pientong, Chamsai; Aromdee, Chantana; Suebsasana, Supawadee; Ekalaksananan, Tipaya

    2016-08-01

    A diterpenoid lactone, 3,19-isopropylideneandrographolide (IPAD) compound isolated from Andrographis paniculata (Burm. f.) Nees, has been reported to inhibit herpes simplex virus type 1 (HSV-1) infection at the post-entry step. To identify the molecular target of IPAD, this study characterized the inhibitory effect of IPAD on infection of Vero cells by HSV-1, HSV-2 and a drug-resistant (DR) HSV-1 strain ACGr4 (acyclovir-resistant and thymidine kinase (TK)-deficient). Viral production, gene and protein expression were determined using plaque assays, quantitative RT-PCR and western blotting, respectively. The results showed that IPAD inhibited HSV-1, HSV-2 and DR-HSV-1 infections at 6-12 h post-infection, a time that corresponded with E gene expression. IPAD completely suppressed ICP8 transcription and translation as well as DNA replication and gD expression in the three strains tested, while acyclovir suppressed transcription and translation of UL30 and gD of HSV-2, HSV-1, but had no effect on DR-HSV-1. These results showed that IPAD has a different molecular target from acyclovir and might therefore be an alternative drug for HSV-1 and HSV-2 wild types and DR-HSV-1 strains. PMID:27424493

  2. A joint modeling approach for uncovering associations between gene expression, bioactivity and chemical structure in early drug discovery to guide lead selection and genomic biomarker development.

    PubMed

    Perualila-Tan, Nolen; Kasim, Adetayo; Talloen, Willem; Verbist, Bie; Göhlmann, Hinrich W H; Shkedy, Ziv

    2016-08-01

    The modern drug discovery process involves multiple sources of high-dimensional data. This imposes the challenge of data integration. A typical example is the integration of chemical structure (fingerprint features), phenotypic bioactivity (bioassay read-outs) data for targets of interest, and transcriptomic (gene expression) data in early drug discovery to better understand the chemical and biological mechanisms of candidate drugs, and to facilitate early detection of safety issues prior to later and expensive phases of drug development cycles. In this paper, we discuss a joint model for the transcriptomic and the phenotypic variables conditioned on the chemical structure. This modeling approach can be used to uncover, for a given set of compounds, the association between gene expression and biological activity taking into account the influence of the chemical structure of the compound on both variables. The model allows to detect genes that are associated with the bioactivity data facilitating the identification of potential genomic biomarkers for compounds efficacy. In addition, the effect of every structural feature on both genes and pIC50 and their associations can be simultaneously investigated. Two oncology projects are used to illustrate the applicability and usefulness of the joint model to integrate multi-source high-dimensional information to aid drug discovery. PMID:27269248

  3. Early changes in gene expression induced by acute UV exposure in leaves of Psychotria brachyceras, a bioactive alkaloid accumulating plant.

    PubMed

    do Nascimento, Naíla Cannes; Menguer, Paloma Koprovski; Sperotto, Raul Antonio; de Almeida, Márcia Rodrigues; Fett-Neto, Arthur Germano

    2013-05-01

    UV-B radiation can damage biomolecules, such as DNA, RNA, and proteins, halting essential cellular processes; this damage is partly due to ROS generation. Plant secondary metabolites may protect against UV-B. Psychotria brachyceras Müll. Arg. (Rubiaceae), a subtropical shrub, produces brachycerine, a monoterpene indole alkaloid mainly accumulated in leaf tissues, which displays antioxidant and antimutagenic activities. Exposure of P. brachyceras cuttings to UV-B radiation significantly increases leaf brachycerine concentration. It has been suggested that this alkaloid might contribute to protection against UV-B damage both through its quenching activity on ROS and as UV shield. To identify differentially expressed genes of P. brachyceras in response to UV-B and investigate a possible influence of this stimulus on putative brachycerine-related genes, suppressive subtractive hybridization was applied. Complementary DNA from UV-B-treated leaves for 24 h was used as tester, and cDNA from untreated leaves, as driver. After BLASTX alignments, 134 sequences matched plant genes. Using quantitative RT-PCR, selected genes potentially related to brachycerine showed significant increases in transcription after UV-B exposure: tryptophan decarboxylase, ACC oxidase, UDP-glucose glucosyltransferase, lipase, and serine/threonine kinase. Results suggest a possible involvement of brachycerine in acute UV-B responses and show that alkaloid accumulation seems at least partly regulated at transcriptional level. PMID:22562190

  4. Reduced cortical expression of a newly identified splicing variant of the DLG1 gene in patients with early-onset schizophrenia

    PubMed Central

    Uezato, A; Yamamoto, N; Iwayama, Y; Hiraoka, S; Hiraaki, E; Umino, A; Haramo, E; Umino, M; Yoshikawa, T; Nishikawa, T

    2015-01-01

    The human discs, large homolog 1 gene (DLG1) is mapped to the schizophrenia-susceptibility locus 3q29, and it encodes a scaffold protein that interacts with the N-methyl-D-aspartate receptor presumably dysregulated in schizophrenia. In the current study, we have newly identified a splicing variant of DLG1, which is transcribed from an unreported 95-base-pair exon (exon 3b) and is labeled 3b(+). We investigated the mRNA expression of 3b(+) in the post-mortem dorsolateral prefrontal cortices of patients with psychiatric disorders, obtained from The Stanley Medical Research Institute, and examined the potential association of the expression with the genotype of the single-nucleotide polymorphism (SNP) rs3915512 located within exon 3b. A real-time quantitative reverse transcriptase-polymerase chain reaction revealed that the mRNA levels of 3b(+) were significantly reduced in patients with early-onset schizophrenia (onset at <18 years old, P=0.0003) but not in those with non-early-onset schizophrenia, early-onset or non-early-onset bipolar disorder or in the controls. Furthermore, the genotype at the rs3915512 SNP was closely associated with the levels of 3b(+) mRNA expression. It is inferred that the T allele fails to meet the exonic splicing enhancer consensus, thus resulting in skipping of exon 3b, leading to the expression of 3b(−) (the previously known DLG1 variant) but not 3b(+). Because all the subjects with early-onset schizophrenia in the current study possess the T/T genotype, the reduced level of the DLG1 3b(+) transcript may be involved in the susceptibility and/or pathophysiology of early-onset schizophrenia. PMID:26440542

  5. Gene expression of Lactobacillus plantarum and the commensal microbiota in the ileum of healthy and early SIV-infected rhesus macaques.

    PubMed

    Golomb, Benjamin L; Hirao, Lauren A; Dandekar, Satya; Marco, Maria L

    2016-01-01

    Chronic HIV infection results in impairment of gut-associated lymphoid tissue leading to systemic immune activation. We previously showed that in early SIV-infected rhesus macaques intestinal dysfunction is initiated with the induction of the IL-1β pathway in the small intestine and reversed by treatment with an exogenous Lactobacillus plantarum strain. Here, we provide evidence that the transcriptomes of L. plantarum and ileal microbiota are not altered shortly after SIV infection. L. plantarum adapts to the small intestine by expressing genes required for tolerating oxidative stress, modifying cell surface composition, and consumption of host glycans. The ileal microbiota of L. plantarum-containing healthy and SIV+ rhesus macaques also transcribed genes for host glycan metabolism as well as for cobalamin biosynthesis. Expression of these pathways by bacteria were proposed but not previously demonstrated in the mammalian small intestine. PMID:27102350

  6. Gene expression of Lactobacillus plantarum and the commensal microbiota in the ileum of healthy and early SIV-infected rhesus macaques

    PubMed Central

    Golomb, Benjamin L.; Hirao, Lauren A.; Dandekar, Satya; Marco, Maria L.

    2016-01-01

    Chronic HIV infection results in impairment of gut-associated lymphoid tissue leading to systemic immune activation. We previously showed that in early SIV-infected rhesus macaques intestinal dysfunction is initiated with the induction of the IL-1β pathway in the small intestine and reversed by treatment with an exogenous Lactobacillus plantarum strain. Here, we provide evidence that the transcriptomes of L. plantarum and ileal microbiota are not altered shortly after SIV infection. L. plantarum adapts to the small intestine by expressing genes required for tolerating oxidative stress, modifying cell surface composition, and consumption of host glycans. The ileal microbiota of L. plantarum-containing healthy and SIV+ rhesus macaques also transcribed genes for host glycan metabolism as well as for cobalamin biosynthesis. Expression of these pathways by bacteria were proposed but not previously demonstrated in the mammalian small intestine. PMID:27102350

  7. Utilization of a novel deuterostome model for the study of regeneration genetics: molecular cloning of genes that are differentially expressed during early stages of larval sea star regeneration.

    PubMed

    Vickery, M C; Vickery, M S; McClintock, J B; Amsler, C D

    2001-01-10

    Sea stars share many characteristics with vertebrates, including deuterostome type development. We previously reported that sea star larvae are capable of complete regeneration (with organogenesis) of missing body parts. Here we report the first application of whole-body cDNA subtractive hybridization for the identification of regeneration-specific gene expression in a deuterostome. We identified nine novel cDNAs from genes differentially expressed during early larval sea star regeneration, including a serine protease which may have a function similar to that of trypsin/plasmin-like proteases during vertebrate wound repair and regeneration. This study demonstrates that sea star larvae can provide a valuable new deuterostome model for the study of regeneration genetics, with potential applications in vertebrate regeneration. PMID:11179669

  8. Expression of Rice Chitinase Gene in Genetically Engineered Tomato Confers Enhanced Resistance to Fusarium Wilt and Early Blight

    PubMed Central

    Jabeen, Nyla; Chaudhary, Zubeda; Gulfraz, Muhammad; Rashid, Hamid; Mirza, Bushra

    2015-01-01

    This is the first study reporting the evaluation of transgenic lines of tomato harboring rice chitinase (RCG3) gene for resistance to two important fungal pathogens Fusarium oxysporum f. sp. lycopersici (Fol) causing fusarium wilt and Alternaria solani causing early blight (EB). In this study, three transgenic lines TL1, TL2 and TL3 of tomato Solanum lycopersicum Mill. cv. Riogrande genetically engineered with rice chitinase (RCG 3) gene and their R1 progeny was tested for resistance to Fol by root dip method and A. solani by detached leaf assay. All the R0 transgenic lines were highly resistant to these fungal pathogens compared to non-transgenic control plants. The pattern of segregation of three independent transformant for Fol and A. solani was also studied. Mendelian segregation was observed in transgenic lines 2 and 3 while it was not observed in transgenic line 1. It was concluded that introduction of chitinase gene in susceptible cultivar of tomato not only enhanced the resistance but was stably inherited in transgenic lines 2 and 3. PMID:26361473

  9. Cocaine reverses the naltrexone-induced reduction in operant ethanol self-administration: the effects on immediate-early gene expression in the rat prefrontal cortex.

    PubMed

    Echeverry-Alzate, Víctor; Tuda-Arízcun, María; Bühler, Kora-Mareen; Santos, Ángel; Giné, Elena; Olmos, Pedro; Gorriti, Miguel Ángel; Huertas, Evelio; Rodríguez de Fonseca, Fernando; López-Moreno, Jose Antonio

    2012-11-01

    Naltrexone is a clinically approved medication for alcoholism. We aimed to investigate the effectiveness of naltrexone co-administered with cocaine and the association of these substances with immediate-early gene expression in the rat prefrontal cortex. We used chronic operant ethanol self-administration and oral treatments prescribed for alcoholism and available in pharmacies to maximise the predictive validity in humans. We performed real-time PCR analysis to determine gene expression levels in the prefrontal cortex. Only the highest dose of naltrexone (1, 3, and 10 mg/kg, p.o.) reduced the response to ethanol. Cocaine increased ethanol self-administration in a dose-dependent manner (2.5, 10, 20 mg/kg, i.p.) and reversed the naltrexone-induced reduction. Naltrexone failed to prevent the cocaine-induced increase in locomotor activity observed in these animals. Chronic self-administration of ethanol reduced the expression of the C-fos gene 4- to 12-fold and increased expression of the COX-2 (up to 4-fold) and Homer1a genes in the rat prefrontal cortex. Chronic ethanol self-administration is prevented by naltrexone, but cocaine fully reverses this effect. This result suggests that cocaine may overcome naltrexone's effectiveness as a treatment for alcoholism. The ethanol-induced reduction in C-fos gene expression in the prefrontal cortex reveals an abnormal activity of these neurons, which may be relevant in the compulsive consumption of ethanol, the control of reward-related areas and the behavioural phenotype of ethanol addiction. PMID:22749946

  10. Early cytokine and chemokine gene expression in lymph nodes of macaques infected with simian immunodeficiency virus is predictive of disease outcome and vaccine efficacy.

    PubMed Central

    Zou, W; Lackner, A A; Simon, M; Durand-Gasselin, I; Galanaud, P; Desrosiers, R C; Emilie, D

    1997-01-01

    Competitive PCR was used to evaluate the expression of cytokine, granzyme B, and chemokine genes in lymph nodes of macaques recently infected with the simian immunodeficiency virus (SIV) pathogenic molecular clone SIVmac239 (n = 16), the nonpathogenic vaccine strain SIVmac239 delta nef (n = 8), and the nonpathogenic molecular clone SIVmac1A11 (n = 8). For both SIVmac239 and its nef-deleted derivative, strong expression was observed as early as 7 days postinfection for interleukin 1beta (IL-1beta), IL-6, tumor necrosis factor alpha, gamma interferon, and IL-13. The levels of gene induction were equally intense for both viruses despite a lower viral load for SIVmac239 deltanef compared with that for SIVmac239. However, the nature of the cytokine network activation varied with the viral inocula. Primary infection with SIVmac239 was characterized by a higher level of IL-4, IL-10, MIP-1alpha, MIP-1beta, MCP-1, and RANTES gene expression and a lower level of IL-12 and granzyme B gene expression compared with infection with SIVmac239 delta nef. Thus, infection with nef-deleted SIV was associated with a preferential Th1 versus Th2 pattern of cytokine production. Infection with SIVmac1A11 was characterized by a delayed immune response for all markers tested. The unique patterns of cytokine and chemokine gene expression in lymph nodes correlated nicely with the pathogenic potential of the SIV strains used as well as with differences in their ability to serve as protective vaccines. PMID:8995646

  11. HPA Axis Gene Expression and DNA Methylation Profiles in Rats Exposed to Early Life Stress, Adult Voluntary Ethanol Drinking and Single Housing

    PubMed Central

    Todkar, Aniruddha; Granholm, Linnea; Aljumah, Mujtaba; Nilsson, Kent W.; Comasco, Erika; Nylander, Ingrid

    2016-01-01

    The neurobiological basis of early life stress (ELS) impact on vulnerability to alcohol use disorder is not fully understood. The effect of ELS, adult ethanol consumption and single housing, on expression of stress and DNA methylation regulatory genes as well as blood corticosterone levels was investigated in the hypothalamus and pituitary of adult out-bred Wistar rats subjected to different rearing conditions. A prolonged maternal separation (MS) of 360 min (MS360) was used to study the effect of ELS, and a short MS of 15 min (MS15) was used as a control. Voluntary ethanol drinking was assessed using a two-bottle free choice paradigm to simulate human episodic drinking. The effects of single housing and ethanol were assessed in conventional animal facility rearing (AFR) conditions. Single housing in adulthood was associated with lower Crhr1 and higher Pomc expression in the pituitary, whereas ethanol drinking was associated with higher expression of Crh in the hypothalamus and Crhr1 in the pituitary, accompanied by lower corticosterone levels. As compared to controls with similar early life handling, rats exposed to ELS displayed lower expression of Pomc in the hypothalamus, and higher Dnmt1 expression in the pituitary. Voluntary ethanol drinking resulted in lower Fkbp5 expression in the pituitary and higher Crh expression in the hypothalamus, independently of rearing conditions. In rats exposed to ELS, water and ethanol drinking was associated with higher and lower corticosterone levels, respectively. The use of conventionally reared rats as control group yielded more significant results than the use of rats exposed to short MS. Positive correlations, restricted to the hypothalamus and ELS group, were observed between the expression of the hypothalamus-pituitary-adrenal receptor and the methylation-related genes. Promoter DNA methylation and expression of respective genes did not correlate suggesting that other loci are involved in transcriptional regulation

  12. De Novo Analysis of Wolfiporia cocos Transcriptome to Reveal the Differentially Expressed Carbohydrate-Active Enzymes (CAZymes) Genes During the Early Stage of Sclerotial Growth

    PubMed Central

    Zhang, Shaopeng; Hu, Bingxiong; Wei, Wei; Xiong, Ying; Zhu, Wenjun; Peng, Fang; Yu, Yang; Zheng, Yonglian; Chen, Ping

    2016-01-01

    The sclerotium of Wolfiporia cocos has been used as an edible mushroom and/or a traditional herbal medicine for centuries. W. cocos sclerotial formation is dependent on parasitism of the wood of Pinus species. Currently, the sclerotial development mechanisms of W. cocos remain largely unknown and the lack of pine resources limit the commercial production. The CAZymes (carbohydrate-active enzymes) play important roles in degradation of the plant cell wall to provide carbohydrates for fungal growth, development, and reproduction. In this study, the transcript profiles from W. cocos mycelium and 2-months-old sclerotium, the early stage of sclerotial growth, were specially analyzed using de novo sequencing technology. A total of 142,428,180 high-quality reads of mycelium and 70,594,319 high-quality reads of 2-months-old sclerotium were obtained. Additionally, differentially expressed genes from the W. cocos mycelium and 2-months-old sclerotium stages were analyzed, resulting in identification of 69 CAZymes genes which were significantly up-regulated during the early stage of sclerotial growth compared to that of in mycelium stage, and more than half of them belonged to glycosyl hydrolases (GHs) family, indicating the importance of W. cocos GHs family for degrading the pine woods. And qRT-PCR was further used to confirm the expression pattern of these up-regulated CAZymes genes. Our results will provide comprehensive CAZymes genes expression information during W. cocos sclerotial growth at the transcriptional level and will lay a foundation for functional genes studies in this fungus. In addition, our study will also facilitate the efficient use of limited pine resources, which is significant for promoting steady development of Chinese W. cocos industry. PMID:26870032

  13. Long-term alterations in vulnerability to addiction to drugs of abuse and in brain gene expression after early life ethanol exposure.

    PubMed

    Barbier, Estelle; Pierrefiche, Olivier; Vaudry, David; Vaudry, Hubert; Daoust, Martine; Naassila, Mickaël

    2008-12-01

    Exposure to ethanol early in life can have long-lasting implications on brain function and drug of abuse response later in life. The present study investigated in rats, the long-term consequences of pre- and postnatal (early life) ethanol exposure on drug consumption/reward and the molecular targets potentially associated with these behavioral alterations. Since a relationship has been demonstrated between heightened drugs intake and susceptibility to drugs-induced locomotor activity/sensitization, anxiolysis, we tested these behavioral responses, depending on the drug, in control and early life ethanol-exposed animals. Our results show that progeny exposed to early life ethanol displayed increased consumption of ethanol solutions and increased sensitivity to cocaine rewarding effects assessed in the conditioned place preference test. Offspring exposed to ethanol were more sensitive to the anxiolytic effect of ethanol and the increased sensitivity could, at least in part, explain the alteration in the consumption of ethanol for its anxiolytic effects. In addition, the sensitivity to hypothermic effects of ethanol and ethanol metabolism were not altered by early life ethanol exposure. The sensitization to cocaine (20 mg/kg) and to amphetamine (1.2 mg/kg) was increased after early life ethanol exposure and, could partly explain, an increase in the rewarding properties of psychostimulants. Gene expression analysis revealed that expression of a large number of genes was altered in brain regions involved in the reinforcing effects of drugs of abuse. Dopaminergic receptors and transporter binding sites were also down-regulated in the striatum of ethanol-exposed offspring. Such long-term neurochemical alterations in transmitter systems and in the behavioral responses to ethanol and other drugs of abuse may confer an increased liability for addiction in exposed offspring. PMID:18713641

  14. Regulation of early T-lineage gene expression and developmental progression by the progenitor cell transcription factor PU.1

    PubMed Central

    Champhekar, Ameya; Damle, Sagar S.; Freedman, George; Carotta, Sebastian; Nutt, Stephen L.

    2015-01-01

    The ETS family transcription factor PU.1 is essential for the development of several blood lineages, including T cells, but its function in intrathymic T-cell precursors has been poorly defined. In the thymus, high PU.1 expression persists through multiple cell divisions in early stages but then falls sharply during T-cell lineage commitment. PU.1 silencing is critical for T-cell commitment, but it has remained unknown how PU.1 activities could contribute positively to T-cell development. Here we employed conditional knockout and modified antagonist PU.1 constructs to perturb PU.1 function stage-specifically in early T cells. We show that PU.1 is needed for full proliferation, restricting access to some non-T fates, and controlling the timing of T-cell developmental progression such that removal or antagonism of endogenous PU.1 allows precocious access to T-cell differentiation. Dominant-negative effects reveal that this repression by PU.1 is mediated indirectly. Genome-wide transcriptome analysis identifies novel targets of PU.1 positive and negative regulation affecting progenitor cell signaling and cell biology and indicating distinct regulatory effects on different subsets of progenitor cell transcription factors. Thus, in addition to supporting early T-cell proliferation, PU.1 regulates the timing of activation of the core T-lineage developmental program. PMID:25846797

  15. Early alterations in extracellular matrix and transforming growth factor [beta] gene expression in mouse lung indicative of late radiation fibrosis

    SciTech Connect

    Finkelstein, J.N.; Johnston, C.J.; Baggs, R.; Rubin, P. )

    1994-02-01

    Fibrosis, characterized by the accumulation of collagen, is a late result of thoracic irradiation. The expression of late radiation injury can be found immediately after irradiation by measuring messenger RNA (mRNA) abundance. To determine if extracellular matrix mRNA and transforming growth factor beta abundance was affected acutely after irradiation, the authors measured mRNA levels of collagen I (CI), collagen III (CIII), collagen IV (CIV), fibronectin (FN), and transforming growth factor [beta] (TGF[beta][sub 1,2 3]) in mouse lungs on day 1 and day 14 after graded doses of radiation. C57BL/6 female mice were irradiated with a single dose to the thorax of 5 or 12.5 Gy. Total lung RNA was prepared and immobilized by Northern and slot blotting and hybridized with radiolabelled cDNA probes for CI, CIII, CIV, FN, TGF[beta][sub 1,2 3] and a control probe encoding for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Autoradiographic data were quantified by video densitometry and results normalized to GAPDH. Changes in the expression of CI, CIII, CIV, FN and TGF[beta][sub 1,2 3] were observed as early as 1 day after exposure. Through 14 days, changes in mRNA up to 5-fold were seen for any one dose. Dose related changes as high as 10-fold were also evident. The CI:CIII ratio increased gradually for the 5 Gy dose at 14 days postirradiation while the CI:CII ratio for the 12.5 Gy dose decreased by approximately 4-fold as compared to the control. These studies suggest that alterations in expression of extracellular matrix and TGF[beta] mRNA occur very early after radiation injury even at low doses and may play a role in the development of chronic fibrosis. 37 refs., 6 figs.

  16. Possible role of the 72,000 dalton DNA-binding protein in regulation of adenovirus type 5 early gene expression.

    PubMed Central

    Carter, T H; Blanton, R A

    1978-01-01

    Relative abundances of early virus RNA species in the cytoplasm of cells infected with wild-type adenovirus type 5 (WT Ad5) and a temperature-sensitive "early" mutant, H5ts125 (ts125), were compared by hybridization kinetics using separated strands of HindIII restriction endonuclease fragments of Ad5 DNA. 1-beta-D-Arabinofuranosylcytosine (ara-C) was used to limit transcription to early virus genes in cells infected by WT virus. At 40.5 degrees C, a restrictive temperature for ts125, three to seven times as much virus RNA from all four early regions of the genome accumulated in the cytoplasm of cells infected by the mutant as accumulated in cells infected by WT. At 32 degrees C, no such difference in the relative abundances of cytoplasmic virus RNA was observed. The capacity to synthesize a 72,000-dalton (72K) virus polypeptide, presumably the single-stranded DNA-binding protein that is defective in ts125 at restrictive temperatures, was compared in cells infected at 40.5 degrees C in the presence of ara-C with the mutant or WT Ad5. The rate of 72K polypeptide synthesis, measured by sodium dodecyl sulfate-polyacrylamide gradient gel electrophoresis of [35S]methionine-labeled polypeptides and autoradiography, was greater at 15 h after infection in ts125-infected cells than in cells infected by WT. A time course experiment showed that the rate of synthesis of the 72K polypeptide increased continuously in ts125-infected cells during the first 15 h of infection, relative to the rate in WT-infected cells. These data are consistent with the hypothesis that Ad5 early gene expression is modulated by the product of an early gene, the 72K DNA-binding protein. Images PMID:203722

  17. Transient gene expression control: effects of transfected DNA stability and trans-activation by viral early proteins.

    PubMed

    Alwine, J C

    1985-05-01

    The effects of trans-acting factors and transfected DNA stability on promoter activity were examined with chloramphenicol acetyl transferase (CAT) transient expression analysis. With cotransfection into CV-1P and HeLa cells, simian virus 40 T antigen, adenovirus E1a, and herpes-virus IE proteins were compared for their ability to trans-activate a variety of eucaryotic promoters constructed into CAT plasmids. T antigen and the IE protein were promiscuous activators of all the promoters tested [the simian virus 40 late promoter, the adenovirus E3 promoter, the alpha 2(I) collagen promoter, and the promoter of the Rous sarcoma virus long terminal repeat]. Conversely the E1a protein was specific, activating only the adenovirus E3 promoter and suppressing the basal activity of the other promoters. This specificity of activation by E1a contrasted with the high activity generated by all of the promoter-CAT plasmids when transfected into 293 cells, which endogenously produce E1a protein. Examination of transfected 293 cells determined that they stabilized much greater amounts of plasmid DNA than any other cells tested (CV-1P, COS, NIH-3T3, KB). Thus the high activity of nonadenovirus promoter-CAT plasmids in 293 cells results from the cumulative effect of basal promoter activity from a very large number of gene copies, not from E1a activation. This conclusion was supported by similar transfection analysis of KB cell lines which endogenously produce E1a protein. These cells stabilize plasmid DNA at a level comparable to that of CV-1P cells and, in agreement with the CV-1P cotransfection results, did not activate a nonadenovirus promoter-CAT plasmid. These results indicate that the stability of plasmid DNA must be considered when transient gene expression is being compared between cell lines. The use of relative plasmid copy numbers for the standardization of transient expression results is discussed. PMID:2987671

  18. Transient gene expression control: effects of transfected DNA stability and trans-activation by viral early proteins.

    PubMed Central

    Alwine, J C

    1985-01-01

    The effects of trans-acting factors and transfected DNA stability on promoter activity were examined with chloramphenicol acetyl transferase (CAT) transient expression analysis. With cotransfection into CV-1P and HeLa cells, simian virus 40 T antigen, adenovirus E1a, and herpes-virus IE proteins were compared for their ability to trans-activate a variety of eucaryotic promoters constructed into CAT plasmids. T antigen and the IE protein were promiscuous activators of all the promoters tested [the simian virus 40 late promoter, the adenovirus E3 promoter, the alpha 2(I) collagen promoter, and the promoter of the Rous sarcoma virus long terminal repeat]. Conversely the E1a protein was specific, activating only the adenovirus E3 promoter and suppressing the basal activity of the other promoters. This specificity of activation by E1a contrasted with the high activity generated by all of the promoter-CAT plasmids when transfected into 293 cells, which endogenously produce E1a protein. Examination of transfected 293 cells determined that they stabilized much greater amounts of plasmid DNA than any other cells tested (CV-1P, COS, NIH-3T3, KB). Thus the high activity of nonadenovirus promoter-CAT plasmids in 293 cells results from the cumulative effect of basal promoter activity from a very large number of gene copies, not from E1a activation. This conclusion was supported by similar transfection analysis of KB cell lines which endogenously produce E1a protein. These cells stabilize plasmid DNA at a level comparable to that of CV-1P cells and, in agreement with the CV-1P cotransfection results, did not activate a nonadenovirus promoter-CAT plasmid. These results indicate that the stability of plasmid DNA must be considered when transient gene expression is being compared between cell lines. The use of relative plasmid copy numbers for the standardization of transient expression results is discussed. Images PMID:2987671

  19. Expression of Early Growth Response Gene-2 and Regulated Cytokines Correlates with Recovery from Guillain-Barré Syndrome.

    PubMed

    Doncel-Pérez, Ernesto; Mateos-Hernández, Lourdes; Pareja, Eduardo; García-Forcada, Ángel; Villar, Margarita; Tobes, Raquel; Romero Ganuza, Francisco; Vila Del Sol, Virginia; Ramos, Ricardo; Fernández de Mera, Isabel G; de la Fuente, José

    2016-02-01

    Guillain-Barré syndrome (GBS) is an immune-mediated peripheral neuropathy. The goal of this research was the identification of biomarkers associated with recovery from GBS. In this study, we compared the transcriptome of PBMCs from a GBS patient and her healthy twin to discover possible correlates of disease progression and recovery. The study was then extended using GBS and spinal cord injury unrelated patients with similar medications and healthy individuals. The early growth response gene-2 (EGR2) was upregulated in GBS patients during disease recovery. The results provided evidence for the implication of EGR2 in GBS and suggested a role for EGR2 in the regulation of IL-17, IL-22, IL-28A, and TNF-β cytokines in GBS patients. These results identified biomarkers associated with GBS recovery and suggested that EGR2 overexpression has a pivotal role in the downregulation of cytokines implicated in the pathophysiology of this acute neuropathy. PMID:26718337

  20. A Pectate Lyase-Coding Gene Abundantly Expressed during Early Stages of Infection Is Required for Full Virulence in Alternaria brassicicola

    PubMed Central

    Cho, Yangrae; Jang, Mina; Srivastava, Akhil; Jang, Jae-Hyuk; Soung, Nak-Kyun; Ko, Sung-Kyun; Kang, Dae-Ook; Ahn, Jong Seog; Kim, Bo Yeon

    2015-01-01

    Alternaria brassicicola causes black spot disease of Brassica species. The functional importance of pectin digestion enzymes and unidentified phytotoxins in fungal pathogenesis has been suspected but not verified in A. brassicicola. The fungal transcription factor AbPf2 is essential for pathogenicity and induces 106 genes during early pathogenesis, including the pectate lyase-coding gene, PL1332. The aim of this study was to test the importance and roles of PL1332 in pathogenesis. We generated deletion strains of the PL1332 gene, produced heterologous PL1332 proteins, and evaluated their association with virulence. Deletion strains of the PL1332 gene were approximately 30% less virulent than wild-type A. brassicicola, without showing differences in colony expansion on solid media and mycelial growth in nutrient-rich liquid media or minimal media with pectins as a major carbon source. Heterologous PL1332 expressed as fusion proteins digested polygalacturons in vitro. When the fusion proteins were injected into the apoplast between leaf veins of host plants the tissues turned dark brown and soft, resembling necrotic leaf tissue. The PL1332 gene was the first example identified as a general toxin-coding gene and virulence factor among the 106 genes regulated by the transcription factor, AbPf2. It was also the first gene to have its functions investigated among the 19 pectate lyase genes and several hundred putative cell-wall degrading enzymes in A. brassicicola. These results further support the importance of the AbPf2 gene as a key pathogenesis regulator and possible target for agrochemical development. PMID:25996954

  1. Molecular characterization of two ferritins of the scallop Argopecten purpuratus and gene expressions in association with early development, immune response and growth rate.

    PubMed

    Coba de la Peña, Teodoro; Cárcamo, Claudia B; Díaz, María I; Brokordt, Katherina B; Winkler, Federico M

    2016-08-01

    Ferritin is involved in several iron homoeostasis processes in molluscs. We characterized two ferritin homologues and their expression patterns in association with early development, growth rate and immune response in the scallop Argopecten purpuratus, a species of economic importance for Chile and Peru. Two ferritin subunits (Apfer1 and Apfer2) were cloned. Apfer1 cDNA is a 792bp clone containing a 516bp open reading frame (ORF) that corresponds to a novel ferritin subunit in A. purpuratus. Apfer2 cDNA is a 681bp clone containing a 522bp ORF that corresponds to a previously sequenced EST. A putative iron responsive element (IRE) was identified in the 5'-untranslated region of both genes. The deduced protein sequences of both cDNAs possessed the motifs and domains characteristic of functional ferritin subunits. Both genes showed differential expression patterns at tissue-specific and early development stage levels. Apfer1 expression level increased 40-fold along larval developmental stages, decreasing markedly after larval settlement. Apfer1 expression in mantle tissue was 2.8-fold higher in fast-growing than in slow-growing scallops. Apfer1 increased 8-fold in haemocytes 24h post-challenge with the bacterium Vibrio splendidus. Apfer2 expression did not differ between fast- and slow-growing scallops or in response to bacterial challenge. These results suggest that Apfer1 and Apfer2 may be involved in iron storage, larval development and shell formation. Apfer1 expression may additionally be involved in immune response against bacterial infections and also in growth; and thus would be a potential marker for immune capacity and for fast growth in A. purpuratus. PMID:27040527

  2. Gene Expression Studies on Human Trisomy 21 iPSCs and Neurons: Towards Mechanisms Underlying Down's Syndrome and Early Alzheimer's Disease-Like Pathologies.

    PubMed

    Weick, Jason P; Kang, Huining; Bonadurer, George F; Bhattacharyya, Anita

    2016-01-01

    The cause of Alzheimer disease (AD) is not well understood and there is no cure. Our ability to understand the early events in the course of AD is severely limited by the difficulty of identifying individuals who are in the early, preclinical stage of this disease. Most individuals with Down's syndrome (DS, trisomy 21) will predictably develop AD and that they will do so at a young age makes them an ideal population in which to study the early stages of AD. Several recent studies have exploited induced pluripotent stem cells (iPSCs) generated from individuals with familial AD, spontaneous AD and DS to attempt to identify early events and discover novel biomarkers of disease progression in AD. Here, we summarize the progress and limitations of these iPSC studies with a focus on iPSC-derived neurons. Further, we outline the methodology and results for comparing gene expression between AD and DS iPSC-derived neurons. We highlight differences and commonalities in these data that may implicate underlying genes and pathways that are causative for AD. PMID:26235072

  3. Effect of mitotic inducers and retinoic acid blocker on expression of pluripotent genes in ES cells derived from early stage in vitro-produced embryos in buffalo.

    PubMed

    Kumar, Ashok; Kumar, Kuldeep; Singh, Renu; Puri, Gopal; Ranjan, R; Yasotha, T; Singh, R K; Sarkar, M; Bag, Sadhan

    2012-12-01

    So far, it has been difficult to generate embryonic stem (ES) cell from early stage preimplantation embryos of buffalo. These ES cells will be more helpful for efficient embryo cloning and generation of body cells as they are more primitive than inner cell mass (ICM)-derived ES cells. The present study was conducted to find the effect of lipopolysaccharide (LPS), melatonin (N-acetyl-5-methoxytryptamine, a pineal gland product), and citral (3,7-dimethyl-2,6-octadienal and a retinoic acid synthesis blocker) on establishment of primary ES cell colonies, the comparative size of the ES cell colonies, and expression of pluripotent genes during extended period of culture in buffalo. Zona-free eight-cell stage in vitro fertilization (IVF) embryos were cultured in ES cell medium supplemented with none (media I as control), LPS (media II), citral melatonin (media III), or melatonin (media IV). The multiplication of blastomere leading to ES cell colony formation and expression of pluripotent genes were assessed up to day 20 of culture. The primary colony formation, the comparative size of the ES cell colonies, and expression of pluripotent genes in these colonies were better in the medium supplemented with melatonin in all days of culture. Within melatonin supplementation, the colony size was comparatively larger on day 8 and day 12 of culture. Further, with this supplementation, the Oct-4 and Nanog expression was comparatively higher on all days of culture. The results indicated that supplementation of melatonin helped in the formation of better primary ES cell colony as well as in the maintenance of pluripotency. The results also indicated that primary colonies developed on day 8 to day 12 of culture may be better for passaging them for establishment of ES cell line from early stage preimplantation IVF embryos of in buffalo. PMID:23093464

  4. Gene expression analysis of early stage endometrial cancers reveals unique transcripts associated with grade and histology but not depth of invasion.

    PubMed

    Risinger, John I; Allard, Jay; Chandran, Uma; Day, Roger; Chandramouli, Gadisetti V R; Miller, Caela; Zahn, Christopher; Oliver, Julie; Litzi, Tracy; Marcus, Charlotte; Dubil, Elizabeth; Byrd, Kevin; Cassablanca, Yovanni; Becich, Michael; Berchuck, Andrew; Darcy, Kathleen M; Hamilton, Chad A; Conrads, Thomas P; Maxwell, G Larry

    2013-01-01

    Endometrial cancer is the most common gynecologic malignancy in the United States but it remains poorly understood at the molecular level. This investigation was conducted to specifically assess whether gene expression changes underlie the clinical and pathologic factors traditionally used for determining treatment regimens in women with stage I endometrial cancer. These include the effect of tumor grade, depth of myometrial invasion and histotype. We utilized oligonucleotide microarrays to assess the transcript expression profile in epithelial glandular cells laser microdissected from 79 endometrioid and 12 serous stage I endometrial cancers with a heterogeneous distribution of grade and depth of myometrial invasion, along with 12 normal post-menopausal endometrial samples. Unsupervised multidimensional scaling analyses revealed that serous and endometrioid stage I cancers have similar transcript expression patterns when compared to normal controls where 900 transcripts were identified to be differentially expressed by at least fourfold (univariate t-test, p < 0.001) between the cancers and normal endometrium. This analysis also identified transcript expression differences between serous and endometrioid cancers and tumor grade, but no apparent differences were identified as a function of depth of myometrial invasion. Four genes were validated by quantitative PCR on an independent set of cancer and normal endometrium samples. These findings indicate that unique gene expression profiles are associated with histologic type and grade, but not myometrial invasion among early stage endometrial cancers. These data provide a comprehensive perspective on the molecular alterations associated with stage I endometrial cancer, particularly those subtypes that have the worst prognosis. PMID:23785665

  5. Gene expression during memory formation.

    PubMed

    Igaz, Lionel Muller; Bekinschtein, Pedro; Vianna, Monica M R; Izquierdo, Ivan; Medina, Jorge H

    2004-01-01

    For several decades, neuroscientists have provided many clues that point out the involvement of de novo gene expression during the formation of long-lasting forms of memory. However, information regarding the transcriptional response networks involved in memory formation has been scarce and fragmented. With the advent of genome-based technologies, combined with more classical approaches (i.e., pharmacology and biochemistry), it is now feasible to address those relevant questions--which gene products are modulated, and when that processes are necessary for the proper storage of memories--with unprecedented resolution and scale. Using one-trial inhibitory (passive) avoidance training of rats, one of the most studied tasks so far, we found two time windows of sensitivity to transcriptional and translational inhibitors infused into the hippocampus: around the time of training and 3-6 h after training. Remarkably, these periods perfectly overlap with the involvement of hippocampal cAMP/PKA (protein kinase A) signaling pathways in memory consolidation. Given the complexity of transcriptional responses in the brain, particularly those related to processing of behavioral information, it was clearly necessary to address this issue with a multi-variable, parallel-oriented approach. We used cDNA arrays to screen for candidate inhibitory avoidance learning-related genes and analyze the dynamic pattern of gene expression that emerges during memory consolidation. These include genes involved in intracellular kinase networks, synaptic function, DNA-binding and chromatin modification, transcriptional activation and repression, translation, membrane receptors, and oncogenes, among others. Our findings suggest that differential and orchestrated hippocampal gene expression is necessary in both early and late periods of long-term memory consolidation. Additionally, this kind of studies may lead to the identification and characterization of genes that are relevant for the pathogenesis

  6. Lack of increased immediate early gene expression in rats reinstating cocaine-seeking behavior to discrete sensory cues.

    PubMed

    Riedy, Matthew D; Keefe, Kristen A

    2013-01-01

    Drug-seeking behavior elicited by drug-associated cues contributes to relapse in addiction; however, whether relapse elicited by drug-associated conditioned reinforcers (CR) versus discriminative stimuli (DS) involves distinct or overlapping neuronal populations is unknown. To address this question, we developed a novel cocaine self-administration and cue-induced reinstatement paradigm that exposed the same rats to distinct cocaine-associated CR and DS. Rats were trained to self-administer cocaine in separate sessions. In one, a DS signaled cocaine availability; in the other, cocaine delivery was paired with a different CR. After extinction training and reinstatement testing, where both cues were presented in separate sessions, rats were sacrificed and processed for cellular analysis of temporal activity by fluorescent in situ hybridization (CatFISH) for activity regulated cytoskeleton-associated protein (Arc) mRNA and for radioactive in situ hybridization for Arc and zif268 mRNAs. CatFISH did not reveal significant changes in Arc mRNA expression. Similar results were obtained with radioactive in situ hybridization. We have shown that while rats reinstate drug seeking in response to temporally discrete presentations of distinct drug-associated cues, such reinstatement is not associated with increased transcriptional activation of Arc or zif268 mRNAs, suggesting that expression of these genes may not be necessary for cue-induced reinstatement of drug-seeking behavior. PMID:24069163

  7. Expression pattern of immediate early genes in the cerebellum of D1R KO, D2R KO, and wild type mice under vestibular-controlled activity.

    PubMed

    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Sasaoka, Toshikuni; Yamamori, Tetsuo

    2015-01-01

    We previously reported the different motor abilities of D1R knockout (KO), D2R KO and wild-type (WT) mice. To understand the interaction between the cerebellum and the striatal direct and indirect pathways, we examined the expression patterns of immediate early genes (IEG) in the cerebellum of these three genotypes of mice. In the WT naive mice, there was little IEG expression. However, we observed a robust expression of c-fos mRNA in the vermis and hemisphere after running rota-rod tasks. In the vermis, c-fos was expressed throughout the lobules except lobule 7, and also in crus 1 of the ansiform lobule (Crus1), copula of the pyramis (Cop) and most significantly in the flocculus in the hemisphere. jun-B was much less expressed but more preferentially expressed in Purkinje cells. In addition, we observed significant levels of c-fos and jun-B expressions after handling mice, and after the stationary rota-rod task in naive mice. Surprisingly, we observed significant expression of c-fos and jun-B even 30 min after single weighing. Nonetheless, certain additional c-fos and jun-B expressions were observed in three genotypes of the mice that experienced several sessions of motor tasks 24 h after stationary rota-rod task and on days 1 and 5 after rota-rod tasks, but no significant differences in expressions after the running rota-rod tasks were observed among the three genotypes. In addition, there may be some differences 24 h after the stationary rota-rod task between the naive mice and the mice that experienced several sessions of motor tasks. PMID:26137459

  8. Precocious anaphase and expression of Securin and p53 genes as candidate biomarkers for the early detection in areca nut-induced carcinogenesis.

    PubMed

    Kurkalang, Sillarine; Banerjee, Atanu; Dkhar, Hughbert; Nongrum, Henry B; Ganguly, Buddha; Islam, Mohammad; Rangad, Gordon M; Chatterjee, Anupam

    2015-05-01

    Research over the years has generated enough evidence to implicate areca nut, as a carcinogen in humans. Besides oral, significant rise in the incidence of cancers of the oesophagus, liver and stomach was seen among areca nut chewers. Early diagnosis seems key to understand the initial processes of carcinogenesis which is highly curable. In North-East India, betel quid contains raw areca nut (RAN), lime and small portion of betel leaf without any other constituents. This study was not intended to isolate any active ingredients from the RAN and to look its action. The present objective is to validate the screening of precocious anaphase and analysis of expression of Securin and p53 in non-target cells like human peripheral blood lymphocytes (PBLs) and mouse bone marrow cells (BMCs) as early indicative parameters of RAN + lime-induced cancers. A total of 35 mice were examined at different time points for following ad libitum administration of RAN extract in drinking water with lime. Peripheral blood was collected from 32 human donors of which, 24 were RAN + lime heavy chewers. Expression of genes was assessed by immunoblotting and/or by immunohistochemistry. Histological preparation of stomach tissue of mice revealed that RAN + lime induced stomach cancer. A gradual increase in the frequency of precocious anaphases and aneuploid cells was observed in both RAN + lime-treated mouse BMC and human PBL of RAN heavy chewers. Levels of p53 and Securin were increased in these cells during early days of RAN + lime exposure. The level of Securin was significantly higher in human tumour samples than their adjacent normal counterpart. The expression of Securin was increased significantly in RAN + lime-administered mice as well as in stomach tumour. Present study revealed that precocious anaphase and expression of p53 and Securin in non-target cells are significantly associated with an increased risk of RAN-induced cancer and thus these parameters can be of early diagnostic value

  9. The HOXC13-controlled expression of early hair keratin genes in the human hair follicle does not involve TALE proteins MEIS and PREP as cofactors.

    PubMed

    Jave-Suárez, Luis Felipe; Schweizer, Jürgen

    2006-02-01

    We previously showed that the homeodomain protein HOXC13 is involved in the expression control of the early human hair keratin genes hHa5 and hHa2, which contain specific HOXC13 binding sites in their proximal promoters. Hox specificity is generally thought to be enhanced by the interaction with members of the TALE superclass of homeodomain proteins Pbx, Meis, and Prep. Using reverse transcription PCR with total human hair follicle RNA, we demonstrated transcripts of the major TALE proteins PBX1-4, MEIS1, 2 and PREP1, 2 in the human hair follicle. In view of the presence of MEIS/PREP responsive elements in close vicinity to the HOXC13 binding sites of the hHa5 and hHa2 promoters, we determined the expression sites of these TALE proteins in the human hair follicle. We found that MEIS1, MEIS2, PREP1 and PREP2 were differentially expressed in the three layers of the inner root sheath. In addition, MEIS2 and PREP1 exhibited expression in the mid-to upper hair cortex, with PREP1 being also expressed in the dermal papilla and the connective tissue sheath of the hair follicle. In virtually all cases, the expression of these TALE proteins was exclusively cytoplasmic. Considering that in contrast, HOXC13 is expressed in the nuclei of matrix, precortex and lower cuticle cells of the hair follicle, our data suggest that despite the presence of MEIS/PREP binding sites in the hHa5 and hHa2 promoters, the HOXC13-controlled activation of these genes in the hair follicle does not seem to involve these TALE proteins as cofactors. PMID:16292560

  10. BRAFV600E-Associated Gene Expression Profile: Early Changes in the Transcriptome, Based on a Transgenic Mouse Model of Papillary Thyroid Carcinoma

    PubMed Central

    Rusinek, Dagmara; Swierniak, Michal; Chmielik, Ewa; Kowal, Monika; Kowalska, Malgorzata; Cyplinska, Renata; Czarniecka, Agnieszka; Piglowski, Wojciech; Korfanty, Joanna; Chekan, Mykola; Krajewska, Jolanta; Szpak-Ulczok, Sylwia; Jarzab, Michal; Widlak, Wieslawa; Jarzab, Barbara

    2015-01-01

    Background The molecular mechanisms driving the papillary thyroid carcinoma (PTC) are still poorly understood. The most frequent genetic alteration in PTC is the BRAFV600E mutation–its impact may extend even beyond PTC genomic profile and influence the tumor characteristics and even clinical behavior. Methods In order to identify BRAF-dependent signature of early carcinogenesis in PTC, a transgenic mouse model with BRAFV600E-induced PTC was developed. Mice thyroid samples were used in microarray analysis and the data were referred to a human thyroid dataset. Results Most of BRAF(+) mice developed malignant lesions. Nevertheless, 16% of BRAF(+) mice displayed only benign hyperplastic lesions or apparently asymptomatic thyroids. After comparison of non-malignant BRAF(+) thyroids to BRAF(−) ones, we selected 862 significantly deregulated genes. When the mouse BRAF-dependent signature was transposed to the human HG-U133A microarray, we identified 532 genes, potentially indicating the BRAF signature (representing early changes, not related to developed malignant tumor). Comparing BRAF(+) PTCs to healthy human thyroids, PTCs without BRAF and RET alterations and RET(+), RAS(+) PTCs, 18 of these 532 genes displayed significantly deregulated expression in all subgroups. All 18 genes, among them 7 novel and previously not reported, were validated as BRAFV600E-specific in the dataset of independent PTC samples, made available by The Cancer Genome Atlas Project. Conclusion The study identified 7 BRAF-induced genes that are specific for BRAF V600E-driven PTC and not previously reported as related to BRAF mutation or thyroid carcinoma: MMD, ITPR3, AACS, LAD1, PVRL3, ALDH3B1, and RASA1. The full signature of BRAF-related 532 genes may encompass other BRAF-related important transcripts and require further study. PMID:26625260

  11. Early gene expression changes by Epstein-Barr virus infection of B-cells indicate CDKs and survivin as therapeutic targets for post-transplant lymphoproliferative diseases.

    PubMed

    Bernasconi, Michele; Ueda, Seigo; Krukowski, Patricia; Bornhauser, Beat C; Ladell, Kristin; Dorner, Marcus; Sigrist, Juerg A; Campidelli, Cristina; Aslandogmus, Roberta; Alessi, Davide; Berger, Christoph; Pileri, Stefano A; Speck, Roberto F; Nadal, David

    2013-11-15

    Lymphoproliferative diseases (LPDs) associated with Epstein-Barr virus (EBV) infection cause significant morbidity and mortality in bone marrow and solid organ transplant recipients. To gain insight into LPD pathogenesis and to identify potential effective therapeutic approaches, we investigated early molecular events leading to B-cell transformation by gene expression profiling of EBV-infected B-cells from tonsils by Affymetrix microarray 72 hr postinfection when the B-cells hyperproliferation phase starts. Cell cycle and apoptosis were the most significantly affected pathways and enriched gene sets. In particular, we found significantly increased expression of cyclin-dependent kinase (CDK)1 and CCNB1 (cyclin B1) and of one of their downstream targets BIRC5 (survivin). Importantly, the strong upregulation of the antiapoptotic protein survivin was confirmed in lymphoblastoid cell lines (LCLs) and 71% of EBV-positive post-transplant EBV-LPD lesions scored positive for survivin. The validity of early transforming events for the identification of therapeutic targets for EBV-LPD was confirmed by the marked antiproliferative effect of the CDK inhibitor flavopiridol on LCLs and by the strong induction of apoptosis by survivin inhibition with YM155 or terameprocol. Our results suggest that targeting of CDKs and/or survivin in post-transplant EBV-LPD by specific inhibitors might be an important approach to control and eliminate EBV-transformed B-cells that should be further considered. PMID:23640782

  12. Intragraft Expression of the IL-10 Gene Is Up-Regulated in Renal Protocol Biopsies with Early Interstitial Fibrosis, Tubular Atrophy, and Subclinical Rejection

    PubMed Central

    Hueso, Miguel; Navarro, Estanis; Moreso, Francesc; O'Valle, Francisco; Pérez-Riba, Mercè; del Moral, Raimundo García; Grinyó, Josep M.; Serón, Daniel

    2010-01-01

    Grafts with subclinical rejection associated with interstitial fibrosis and tubular atrophy (SCR+IF/TA) show poorer survival than grafts with subclinical rejection without IF/TA (SCR). Aiming to detect differences among SCR+IF/TA and SCR, we immunophenotyped the inflammatory infiltrate (CD45, CD3, CD20, CD68) and used a low-density array to determine levels of TH1 (interleukin IL-2, IL-3, γ-interferon, tumor necrosis factor-α, lymphotoxin-α, lymphotoxin-β, granulocyte-macrophage colony-stimulating factor) and TH2 (IL-4, IL-5, IL-6, IL-10, and IL-13) transcripts as well as of IL-2R (as marker for T-cell activation) in 31 protocol biopsies of renal allografts. Here we show that grafts with early IF/TA and SCR can be distinguished from grafts with SCR on the basis of the activation of IL-10 gene expression and of an increased infiltration by B-lymphocytes in a cellular context in which the degree of T-cell activation is similar in both groups of biopsies, as demonstrated by equivalent levels of IL-2R mRNA. These results suggest that the up-regulation of the IL-10 gene expression, as well as an increased proportion of B-lymphocytes in the inflammatory infiltrates, might be useful as markers of early chronic lesions in grafts with SCR. PMID:20150436

  13. Expression kinetics of key genes in the early innate immune response to Great Lakes viral hemorrhagic septicemia virus IVb infection in yellow perch (Perca flavescens)

    USGS Publications Warehouse

    Olson, Wendy; Emmenegger, Eveline; Glenn, Jolene; Simchick, Crystal; Winton, Jim; Goetz, Frederick

    2013-01-01

    The recently discovered strain of viral hemorrhagic septicemia virus, VHSV-IVb, represents an example of the introduction of an extremely pathogenic rhabdovirus capable of infecting a wide variety of new fish species in a new host-environment. The goal of the present study was to delineate the expression kinetics of key genes in the innate immune response relative to the very early stages of VHSV-IVb infection using the yellow perch (Perca flavescens) as a model. Administration of VHSV-IVb by IP-injection into juvenile yellow perch resulted in 84% cumulative mortality, indicating their high susceptibility to this disease. In fish sampled in the very early stages of infection, a significant up-regulation of Mx gene expression in the liver, as well as IL-1β and SAA activation in the head kidney, spleen, and liver was directly correlated to viral load. The potential down-regulation of Mx in the hematopoietic tissues, head kidney and spleen, may represent a strategy utilized by the virus to increase replication.

  14. Egg storage duration and hatch window affect gene expression of nutrient transporters and intestine morphological parameters of early hatched broiler chicks.

    PubMed

    Yalcin, S; Gursel, I; Bilgen, G; Izzetoglu, G T; Horuluoglu, B H; Gucluer, G

    2016-05-01

    In recent years, researchers have given emphasis on the differences in physiological parameters between early and late hatched chicks within a hatch window. Considering the importance of intestine development in newly hatched chicks, however, changes in gene expression of nutrient transporters in the jejunum of early hatched chicks within a hatch window have not been studied yet. This study was conducted to determine the effects of egg storage duration before incubation and hatch window on intestinal development and expression of PepT1 (H+-dependent peptide transporter) and SGLT1 (sodium-glucose co-transporter) genes in the jejunum of early hatched broiler chicks within a 30 h of hatch window. A total of 1218 eggs obtained from 38-week-old Ross 308 broiler breeder flocks were stored for 3 (ES3) or 14 days (ES14) and incubated at the same conditions. Eggs were checked between 475 and 480 h of incubation and 40 chicks from each egg storage duration were weighed; chick length and rectal temperature were measured. The chicks were sampled to evaluate morphological parameters and PepT1 and SGLT1 expression. The remaining chicks that hatched between 475 and 480 h were placed back in the incubator and the same measurements were conducted with those chicks at the end of hatch window at 510 h of incubation. Chick length, chick dry matter content, rectal temperature and weight of small intestine segments increased, whereas chick weight decreased during the hatch window. The increase in the jejunum length and villus width and area during the hatch window were higher for ES3 than ES14 chicks. PepT1 expression was higher for ES3 chicks compared with ES14. There was a 10.2 and 17.6-fold increase in PepT1 and SGLT1 expression of ES3 chicks at the end of hatch window, whereas it was only 2.3 and 3.3-fold, respectively, for ES14 chicks. These results suggested that egg storage duration affected development of early hatched chicks during 30 h of hatch window. It can be concluded that

  15. Successful In Vitro Expansion and Differentiation of Cord Blood Derived CD34+ Cells into Early Endothelial Progenitor Cells Reveals Highly Differential Gene Expression

    PubMed Central

    Topcic, Denijal; Haviv, Izhak; Merivirta, Ruusu-Maaria; Agrotis, Alexander; Leitner, Ephraem; Jowett, Jeremy B.; Bode, Christoph; Lappas, Martha; Peter, Karlheinz

    2011-01-01

    Endothelial progenitor cells (EPCs) can be purified from peripheral blood, bone marrow or cord blood and are typically defined by a limited number of cell surface markers and a few functional tests. A detailed in vitro characterization is often restricted by the low cell numbers of circulating EPCs. Therefore in vitro culturing and expansion methods are applied, which allow at least distinguishing two different types of EPCs, early and late EPCs. Herein, we describe an in vitro culture technique with the aim to generate high numbers of phenotypically, functionally and genetically defined early EPCs from human cord blood. Characterization of EPCs was done by flow cytometry, immunofluorescence microscopy, colony forming unit (CFU) assay and endothelial tube formation assay. There was an average 48-fold increase in EPC numbers. EPCs expressed VEGFR-2, CD144, CD18, and CD61, and were positive for acetylated LDL uptake and ulex lectin binding. The cells stimulated endothelial tube formation only in co-cultures with mature endothelial cells and formed CFUs. Microarray analysis revealed highly up-regulated genes, including LL-37 (CAMP), PDK4, and alpha-2-macroglobulin. In addition, genes known to be associated with cardioprotective (GDF15) or pro-angiogenic (galectin-3) properties were also significantly up-regulated after a 72 h differentiation period on fibronectin. We present a novel method that allows to generate high numbers of phenotypically, functionally and genetically characterized early EPCs. Furthermore, we identified several genes newly linked to EPC differentiation, among them LL-37 (CAMP) was the most up-regulated gene. PMID:21858032

  16. Isolation rearing attenuates social interaction-induced expression of immediate early gene protein products in the medial prefrontal cortex of male and female rats

    PubMed Central

    Wall, Vanessa L.; Fischer, Eva K.; Bland, Sondra T.

    2013-01-01

    Early life adversity and stress in humans has been related to a number of psychological disorders including anxiety, depression, and addiction. The present study used isolation rearing, a well-characterized animal model of early life adversity, to examine its effects on social behavior and immediate early gene (IEG) expression produced by exposure to a novel social experience. Male and female rats were housed in same-sex groups or in isolation for 4 weeks beginning at weaning and were tested during late adolescence. The protein products of the IEGs c-fos and Arc, as well as the neurotrophic factor BDNF were assessed in medial prefrontal cortex (mPFC) subregions (anterior cingulate, prelimbic and infralimbic) using immunohistochemistry. Aggressive and non-aggressive behaviors during novel social exposure were also assessed. Exposure to a novel conspecific produced increases in Arc and c-fos activation in the mPFC of group reared animals in a sex- and subregion-dependent fashion compared to no social exposure controls, but this increase was blunted or absent in isolated animals. Isolates engaged in more social interactions and more aggressive behavior than group reared rats. Sex differences in some behaviors as well as in Arc and BDNF expression were observed. These results indicate that isolation rearing alters IEG activation in the mPFC produced by exposure to a novel conspecific, in addition to changing social behavior, and that these effects depend in part on sex. PMID:22982514

  17. Quantitative mRNA expression analysis of selected genes in patients with early-stage hypothyroidism induced by treatment with iodine-131.

    PubMed

    Guo, Kun; Gao, Rui; Yu, Yan; Zhang, Weixiao; Yang, Yuxuan; Yang, Aimin

    2015-11-01

    The present study aimed to investigate the molecular markers indicative of early-stage hypothyroidism induced by treatment with iodine-131, in order to assist in further investigations of radio iodine‑induced hypothyroidism. A total of 59 patients diagnosed with hyperthyroidism (male/female, 16/43; median age, 46.4 years) and 27 healthy subjects (male/female, 7/21; median age, 44.6 years) were included in the present study. All patients were treated with appropriate doses of iodine‑131 and, three months following treatment, the patients were subdivided into two groups: A group with early‑stage hypothyroidism symptoms, and a group with non‑early‑stage hypothyroidism, including euthyroid patients and patients remaining with hyperthyroidism. Tissue samples from the patients and healthy subjects were collected by fine needle biopsies, and the mRNA expression levels of B-cell lymphoma 2 (Bcl‑2), nuclear factor (NF)‑κB, Ku70, epidermal growth factor receptor (EGFR), early growth response 1 (Egr‑1), TP53 and ataxia telangiectasia mutated were analyzed using reverse transcription‑quantitative polymerase chain reaction prior to iodine‑131 treatment. The association of the variation of target genes with susceptibility to early‑stage hypothyroidism was analyzed. Compared with normal subjects, the mRNA expression levels of Ku70 (0.768, vs. 3.304, respectively; P<0.001) and EGFR (0.859, vs. 1.752, respectively; P<0.05) were significantly higher, whereas those of NF‑κB (0.884, vs. 0.578, respectively; P<0.05) and Bcl‑2 (1.235, vs. 0.834, respectively; P<0.05) were lower in the hyperthyroid patients. Following treatment with iodine‑131, 30 of the 59 (50.8%) patients with hyperthyroidism were diagnosed with early‑stage hypothyroidism, and in the early‑stage hypothyroidism group, the mRNA expression levels of Bcl‑2 were significantly decreased (P<0.05), whereas those of Egr‑1 (P<0.05) were significantly increased, compared with the non

  18. Tissue Inhibitor of Metalloproteinase 1 Expression Associated with Gene Demethylation Confers Anoikis Resistance in Early Phases of Melanocyte Malignant Transformation1

    PubMed Central

    Ricca, Tatiana I; Liang, Gangning; Suenaga, Ana Paula M; Han, Sang W; Jones, Peter A; Jasiulionis, Miriam G

    2009-01-01

    Although anoikis resistance has been considered a hallmark of malignant phenotype, the causal relation between neoplastic transformation and anchorage-independent growth remains undefined. We developed an experimental model of murine melanocyte malignant transformation, where a melanocyte lineage (melan-a) was submitted to sequential cycles of anchorage blockade, resulting in progressive morphologic alterations, and malignant transformation. Throughout this process, cells corresponding to premalignant melanocytes and melanoma cell lines were established and show progressive anoikis resistance and increased expression of Timp1. In melan-a melanocytes, Timp1 expression is suppressed by DNA methylation as indicated by its reexpression after 5-aza-2′-deoxycytidine treatment. Methylation-sensitive single-nucleotide primer extension analysis showed increased demethylation in Timp1 in parallel with its expression along malignant transformation. Interestingly, TIMP1 expression has already been related with negative prognosis in some human cancers. Although described as a MMP inhibitor, this protein has been associated with apoptosis resistance in different cell types. Melan-a cells overexpressing Timp1 showed increased survival in suspension but were unable to form tumors in vivo, whereas Timp1-overexpressing melanoma cells showed reduced latency time for tumor appearance and increased metastatic potential. Here, we demonstrated for the first time an increment in Timp1 expression since the early phases of melanocyte malignant transformation, associated to a progressive gene demethylation, which confers anoikis resistance. In this way, Timp1 might be considered as a valued marker for melanocyte malignant transformation. PMID:19956395

  19. Effect of hypergravity on expression of the immediate early gene, c-fos, in central nervous system of medaka (Oryzias latipes)

    NASA Astrophysics Data System (ADS)

    Sayaka, Shimomura-Umemura; Ijiri, Kenichi

    2006-01-01

    Immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brains. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3 g hypergravity by centrifugation. Investigation of c-fos mRNA expression indicated that c-fos mRNA significantly increased 30 min after a start of 3 g exposure. The distribution of its transcripts within the brains was analyzed by an in situ hybridization method. The 3-g treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, nucleus tangentialis, posterior octavu nucleus, and inferior olive. Our results established a method to follow the effect of gravity stimulation, which can be used to investigate gravity perception.

  20. Induction of bovine papillomavirus E2 gene expression and early region transcription by cell growth arrest: correlation with viral DNA amplification and evidence for differential promoter induction.

    PubMed Central

    Burnett, S; Ström, A C; Jareborg, N; Alderborn, A; Dillner, J; Moreno-Lopez, J; Pettersson, U; Kiessling, U

    1990-01-01

    The bovine papillomavirus type 1 (BPV-1) genome replicates as a latent plasmid in mouse C127 cells transformed in vitro by the virus. However, we have recently shown that BPV-1 DNA amplification can be induced in a subpopulation of cells under culture conditions which suppress cell proliferation, a finding which led us to hypothesize that expression of a viral replication factor was regulated by cell growth stage. In this report, we describe the detection in these cells of abundant BPV-1 nuclear E2 antigen by immunofluorescence analysis. Expression of E2 antigen in fibropapilloma tissue was similarly localized to nonproliferating epidermal cells of the lower spinous layers--the natural site of induction of vegetative viral DNA replication. Immunoprecipitation analysis showed that the previously characterized 48-kilodalton (transactivator) and 31-kilodalton (repressor) E2 proteins were both induced in growth-arrested cell cultures. In parallel with E2 antigen synthesis under conditions of serum-deprivation in vitro, we observed a significant increase in levels of BPV-1 early region mRNAs. Furthermore, we present evidence for preferential induction of the P2443 promoter, in addition to specific induction of the P7940 promoter in response to serum deprivation. These observations indicate a central role for E2 transcription factors in the induction of viral DNA amplification in division-arrested cells in vitro and in vivo and suggest that this process is associated with a qualitative switch in the expression of viral early region genes. Images PMID:2170685

  1. Early Stress Causes Sex-Specific, Life-Long Changes in Behaviour, Levels of Gonadal Hormones, and Gene Expression in Chickens

    PubMed Central

    Elfwing, Magnus; Nätt, Daniel; Goerlich-Jansson, Vivian C.; Persson, Mia; Hjelm, Jonas; Jensen, Per

    2015-01-01

    Early stress can have long-lasting phenotypic effects. Previous research shows that male and female chickens differ in many behavioural aspects, and respond differently to chronic stress. The present experiment aimed to broadly characterize long-term sex differences in responses to brief events of stress experienced during the first weeks of life. Chicks from a commercial egg-laying hybrid were exposed to stress by inducing periods of social isolation during their first three weeks of life, followed by a broad behavioural, physiological and genomic characterization throughout life. Early stressed males, but not females, where more anxious in an open field-test, stayed shorter in tonic immobility and tended to have delayed sexual maturity, as shown by a tendency for lower levels of testosterone compared to controls. While early stressed females did not differ from non-stressed in fear and sexual maturation, they were more socially dominant than controls. The differential gene expression profile in hypothalamus was significantly correlated from 28 to 213 days of age in males, but not in females. In conclusion, early stress had a more pronounced long-term effect on male than on female chickens, as evidenced by behavioral, endocrine and genomic responses. This may either be attributed to inherent sex differences due to evolutionary causes, or possibly to different stress related selection pressures on the two sexes during commercial chicken breeding. PMID:25978318

  2. Differential placental gene expression in severe preeclampsia.

    PubMed

    Sitras, V; Paulssen, R H; Grønaas, H; Leirvik, J; Hanssen, T A; Vårtun, A; Acharya, G

    2009-05-01

    We investigated the global placental gene expression profile in severe preeclampsia. Twenty-one women were randomly selected from 50 participants with uncomplicated pregnancies to match 21 patients with severe preeclampsia. A 30K Human Genome Survey Microarray v.2.0 (Applied Biosystems) was used to evaluate the gene expression profile. After RNA isolation, five preeclamptic placentas were excluded due to poor RNA quality. The series composed of 37 hybridizations in a one-channel detection system of chemiluminescence emitted by the microarrays. An empirical Bayes analysis was applied to find differentially expressed genes. In preeclamptic placentas 213 genes were significantly (fold-change>or=2 and pexpressed genes were associated with Alzheimer disease, angiogenesis, Notch-, TGFbeta- and VEGF-signalling pathways. Sixteen genes best discriminated preeclamptic from normal placentas. Comparison between early- (<34 weeks) and late-onset preeclampsia showed 168 differentially expressed genes with oxidative stress, inflammation, and endothelin signalling pathways mainly involved in early-onset disease. Validation of the microarray results was performed by RT-PCR, quantitative urine hCG measurement and placental histopathologic examination. In summary, placental gene expression is altered in preeclampsia and we provide a comprehensive list of the differentially expressed genes. Placental gene expression is different between early- and late-onset preeclampsia, suggesting differences in pathophysiology. PMID:19249095

  3. Effects of dry period length and dietary energy source on metabolic status and hepatic gene expression of dairy cows in early lactation.

    PubMed

    Chen, J; Gross, J J; van Dorland, H A; Remmelink, G J; Bruckmaier, R M; Kemp, B; van Knegsel, A T M

    2015-02-01

    In a prior study, we observed that cows with a 0-d dry period had greater energy balance and lower milk production compared with cows with a 30- or 60-d dry period in early lactation. The objective of the current study was to evaluate the influence of dry period length on metabolic status and hepatic gene expression in cows fed a lipogenic or glucogenic diet in early lactation. Holstein-Friesian dairy cows (n=167) were assigned randomly to 3×2 factorial design with 3 dry period lengths (n=56, 55, and 56 for 0-, 30-, and 60-d dry, respectively) and 2 early lactation diets (n=84 and 83 for glucogenic and lipogenic diet, respectively). Cows were fed a glucogenic or lipogenic diet from 10d before the expected calving date and onward. The main ingredient for a glucogenic concentrate was corn, and the main ingredients for a lipogenic concentrate were sugar beet pulp, palm kernel, and rumen-protected palm oil. Blood was sampled weekly from 95 cows from wk 3 precalving to wk 8 postcalving. Liver samples were collected from 76 cows in wk -2, 2, and 4 relative to calving. Liver samples were analyzed for triacylglycerol concentrations and mRNA expression of 12 candidate genes. Precalving, cows with a 0-d dry period had greater plasma β-hydroxybutyrate, urea, and insulin concentrations compared with cows with a 30- or 60-d dry period. Postcalving, cows with a 0-d dry period had lower liver triacylglycerol and plasma nonesterified fatty acids concentrations (0.20, 0.32, and 0.36mmol/L for 0-, 30-, and 60-d dry period, respectively), greater plasma glucose, insulin-like growth factor-I, and insulin (24.38, 14.02, and 11.08µIU/mL for 0-, 30-, and 60-d dry period, respectively) concentrations, and lower hepatic mRNA expression of pyruvate carboxylase, compared with cows with a 30- or 60-d dry period. Plasma urea and β-hydroxybutyrate concentrations were greater in cows fed a lipogenic diet compared with cows fed a glucogenic diet. In conclusion, cows with a 0-d dry period had

  4. Regulation of Early Light-Inducible Protein Gene Expression by Blue and Red Light in Etiolated Seedlings Involves Nuclear and Plastid Factors.

    PubMed Central

    Adamska, I.

    1995-01-01

    Early light-inducible proteins (ELIPs) are nuclear-encoded chloroplast proteins whose genes are transiently transcribed during the greening process of etiolated plants. In the present work the regulation of ELIP gene expression by blue and red light has been investigated in plumulas of etiolated pea plants (Pisum sativum). The results show that the steady-state level of ELIP transcripts is controlled by a combined action of phytochrome and blue light receptor systems and, in addition, depends on the age of the seedlings. Both a low-light fluence system of blue and a very-low-fluence system of red light are involved in ELIP induction. The threshold for accumulation of ELIP transcripts was as low as 10-5 [mu]E m-2 s-1 for both light qualities but a different pattern of accumulation was obtained in blue and in red light. Blue light not only acts at the level of transcription but also regulates the stability of the ELIP transcripts in a light intensity-dependent manner. Moreover, it is shown that product(s) of nuclear gene(s) negatively regulate the steady-state level of ELIP transcripts during the 1st h of illumination with red light. Preillumination of seedlings with white light abolishes this repression. Accumulation of ELIP transcripts requires "plastid factors" in both blue and red light qualities. PMID:12228423

  5. Intranasal application of vasopressin fails to elicit changes in brain immediate early gene expression, neural activity and behavioral performance of rats

    PubMed Central

    Ludwig, Mike; Tobin, Vicky A.; Callahan, Michael F.; Papadaki, Eirini; Becker, Axel; Engelmann, Mario; Leng, Gareth

    2013-01-01

    Intranasal administration has been widely used to investigate effects of the neuropeptides vasopressin and oxytocin on human behaviors and neurological disorders, but exactly what happens when these neuropeptides are administered intranasally is far from clear. In particular, it is not clear whether a physiological significant amount of peptide enters the brain to account for the observed effects. Here, we investigated whether intranasal administration of vasopressin and oxytocin to rats induces expression of the immediate-early gene product Fos in brain areas that are sensitive to centrally administered peptide, whether it alters neuronal activity in the way that centrally administered peptide does, and whether it affects behavior in ways expected from studies of centrally administered peptide. We found that, whereas intracerebroventricular (icv) injection of very low doses of vasopressin or oxytocin increased Fos expression in several distinct brain regions, intranasal administration of large doses of the peptides had no significant effect. In contrast to the effects of vasopressin applied topically to the main olfactory bulb, we saw no changes in the electrical activity of olfactory bulb mitral cells after intranasal vasopressin administration. In addition, vasopressin given intranasally had no significant effects on social recognition or short-term recognition memory. Finally, intranasal infusions of vasopressin had no significant effects on the parameters monitored on the elevated plus maze, a rodent model of anxiety. Our data in rats suggest that, after intranasal administration, significant amounts of vasopressin and oxytocin do not reach areas in the brain at levels sufficient to change immediate early gene expression, neural activity or behavior in the ways described for central administration of the peptides. PMID:23656518

  6. Activity-dependent expression of miR-132 regulates immediate-early gene induction during olfactory learning in the greater short-nosed fruit bat, Cynopterus sphinx.

    PubMed

    Mukilan, Murugan; Ragu Varman, Durairaj; Sudhakar, Sivasubramaniam; Rajan, Koilmani Emmanuvel

    2015-04-01

    The activity-dependent expression of immediate-early genes (IEGs) and microRNA (miR)-132 has been implicated in synaptic plasticity and the formation of long-term memory (LTM). In the present study, we show that olfactory training induces the expression of IEGs (EGR-1, C-fos, C-jun) and miR-132 at similar time scale in olfactory bulb (OB) of Cynopterus sphinx. We examined the role of miR-132 in the OB using antisense oligodeoxynucleotide (AS-ODN) and demonstrated that a local infusion of AS-ODN in the OB 2h prior to training impaired olfactory memory formation in C. sphinx. However, the infusion of AS-ODN post-training did not cause a deficit in memory formation. Furthermore, the inhibition of miR-132 reduced the olfactory training-induced expression of IEGs and post synaptic density protein-95 (PSD-95) in the OB. Additionally, we show that miR-132 regulates the activation of calcium/calmodulin-dependent protein kinase-II (CaMKII) and cAMP response element binding protein (CREB), possibly through miR-148a. These data suggest that olfactory training induces the expression of miR-132 and IEGs, which in turn activates post-synaptic proteins that regulate olfactory memory formation. PMID:25725166

  7. Oral administration recombinant porcine epidermal growth factor enhances the jejunal digestive enzyme genes expression and activity of early-weaned piglets.

    PubMed

    Lee, D N; Chuang, Y S; Chiou, H Y; Wu, F Y; Yen, H T; Weng, C F

    2008-08-01

    This study attempted to determine ingested porcine epidermal growth factor (pEGF) on the gastrointestinal tract development of early-weaned piglets. Thirty-two piglets (14-day weaned) were randomly allotted to supplemented with 0 (control), 0.5, 1.0, or 1.5 mg pEGF/kg diet. Each treatment consisted of four replicates with two pigs per pen for a 14 days experimental period. Piglets were sacrificed and gastrointestinal tract samples were collected to measure mucosa morphology, mRNA expression and activities of digestive enzymes in the gastrointestinal tract of piglets at the end of the experiment. Diets supplemented with pEGF failed to influence growth performance but tended to increase jejunal mucosa weight (p < 0.09) and protein content (p < 0.07). Piglets supplemental pEGF induced incrementally the gastric pepsin activity (p < 0.05) and stimulated jejunal alkaline phosphatase (ALP) and lactase activities accompanied with the increase of jejunal ALP and maltase mRNA expression. No effect of pEGF on the activities of all enzymes in ileum except the stimulation of ileal aminopeptide N mRNA expression. These results reveal that dietary pEGF supplementation might enhance gene expression and activities of digestive enzymes in the stomach and jejunum of piglets. PMID:18662356

  8. Gene Express Inc.

    PubMed

    Saccomanno, Colette F

    2006-07-01

    Gene Express, Inc. is a technology-licensing company and provider of Standardized Reverse Transcription Polymerase Chain Reaction (StaRT-PCR) services. Designed by and for clinical researchers involved in pharmaceutical, biomarker and molecular diagnostic product development, StaRT-PCR is a unique quantitative and standardized multigene expression measurement platform. StaRT-PCR meets all of the performance characteristics defined by the US FDA as required to support regulatory submissions [101,102] , and by the Clinical Laboratory Improvement Act of 1988 (CLIA) as necessary to support diagnostic testing [1] . A standardized mixture of internal standards (SMIS), manufactured in bulk, provides integrated quality control wherein each native template target gene is measured relative to a competitive template internal standard. Bulk production enables the compilation of a comprehensive standardized database from across multiple experiments, across collaborating laboratories and across the entire clinical development lifecycle of a given compound or diagnostic product. For the first time, all these data are able to be directly compared. Access to such a database can dramatically shorten the time from investigational new drug (IND) to new drug application (NDA), or save time and money by hastening a substantiated 'no-go' decision. High-throughput StaRT-PCR is conducted at the company's automated Standardized Expression Measurement (SEM) Center. Currently optimized for detection on a microcapillary electrophoretic platform, StaRT-PCR products also may be analyzed on microarray, high-performance liquid chromatography (HPLC), or matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) platforms. SEM Center services deliver standardized genomic data--data that will accelerate the application of pharmacogenomic technology to new drug and diagnostic test development and facilitate personalized medicine. PMID:16886903

  9. Prolonged gene expression and cell survival after infection by a herpes simplex virus mutant defective in the immediate-early genes encoding ICP4, ICP27, and ICP22.

    PubMed Central

    Wu, N; Watkins, S C; Schaffer, P A; DeLuca, N A

    1996-01-01

    Very early in infection, herpes simplex virus (HSV) expresses four immediate-early (IE) regulatory proteins, ICP4, ICP0, ICP22, and ICP27. The systematic inactivation of sets of the IE proteins in cis, and the subsequent phenotypic analysis of the resulting mutants, should provide insights into how these proteins function in the HSV life cycle and also into the specific macromolecular events that are altered or perturbed in cells infected with virus strains blocked very early in infection. This approach may also provide a rational basis to assess the efficacy and safety of HSV mutants for use in gene transfer experiments. In this study, we generated and examined the phenotype of an HSV mutant simultaneously mutated in the ICP4, ICP27, and ICP22 genes of HSV. Unlike mutants deficient in ICP4 (d120), ICP4 and ICP27 (d92), and ICP4 and ICP22 (d96), mutants defective in ICP4, ICP27, and ICP22 (d95) were visually much less toxic to Vero and human embryonic lung cells. Cells infected with d95 at a multiplicity of infection of 10 PFU per cell retained a relatively normal morphology and expressed genes from the viral and cellular genomes for at least 3 days postinfection. The other mutant backgrounds were too toxic to allow examination of gene expression past 1 day postinfection. However, when cell survival was measured by the capacity of the infected cells to form colonies, d95 inhibited colony formation similarly to d92. This apparent paradox was reconciled by the observation that host cell DNA synthesis was inhibited in cells infected with d120, d92, d96, and d95. In addition, all of the mutants exhibited pronounced and distinctive alterations in nuclear morphology, as determined by electron microscopy. The appearance of d95-infected cells deviated from that of uninfected cells in that large circular structures formed in the nucleus. d95-infected cells abundantly expressed ICP0, which accumulated in fine punctate structures in the nucleus at early times postinfection

  10. The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein

    SciTech Connect

    Ahn, Byung Chul; Breitenbach, Jonathan E.; Kim, Seong K.; O'Callaghan, Dennis J. . E-mail: docall@lsuhsc.edu

    2007-06-20

    The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5'untranslated region (UTR), a 285 base pair open reading frame (ORF), and a poly adenylation (A) signal [Holden, V.R., Harty, R.N., Yalamanchili, R.R., O'Callaghan, D.J., 1992. The IR3 gene of equine herpesvirus type 1: a unique gene regulated by sequences within the intron of the immediate-early gene. DNA Seq. 3, 143-152]. Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed.

  11. Transcriptional activation and repression by Fos are independent functions: the C terminus represses immediate-early gene expression via CArG elements.

    PubMed

    Gius, D; Cao, X M; Rauscher, F J; Cohen, D R; Curran, T; Sukhatme, V P

    1990-08-01

    The Fos-Jun complex has been shown to activate transcription through the regulatory element known as the AP-1 binding site. We show that Fos down regulates several immediate-early genes (c-fos, Egr-1, and Egr-2) after mitogenic stimulation. Specifically, we demonstrate that the target for this repression is a sequence of the form CC(A/T)6GG, also known as a CArG box. Whereas Fos bound to the AP-1 site through a domain rich in basic amino acids and associated with Jun via a leucine zipper interaction, mutant Fos proteins lacking these structures were still capable of causing repression. Furthermore, Jun neither enhanced nor inhibited down regulation by Fos. Critical residues required for repression are located within the C-terminal 27 amino acids of c-Fos, since v-Fos and C-terminal truncations of c-Fos did not down regulate. In addition, transfer of 180 c-Fos C-terminal amino acids to Jun conferred upon it the ability to repress. Finally, Fra-1, a Fos-related protein which has striking similarity to Fos in its C-terminal 40 amino acids, also down regulated Egr-1 expression. Thus, Fos is a transcriptional regulator that can activate or repress gene expression by way of two separate functional domains that act on distinct regulatory elements. PMID:2115122

  12. Regulation of immunoglobulin gene rearrangement and expression.

    PubMed

    Taussig, M J; Sims, M J; Krawinkel, U

    1989-05-01

    The molecular genetic events leading to Ig expression and their control formed the topic of a recent EMBO workshop. This report by Michael Taussig, Martin Sims and Ulrich Krawinkel discusses contributions dealing with genes expressed in early pre-B cells, the mechanism of rearrangement, aberrant rearrangements seen in B cells of SCID mice, the feedback control of rearrangement as studied in transgenic mice, the control of Ig expression at the transcriptional and post-transcriptional levels, and class switching. PMID:2787158

  13. Lactoferrin up-regulates intestinal gene expression of brain-derived neurotrophic factors BDNF, UCHL1 and alkaline phosphatase activity to alleviate early weaning diarrhea in postnatal piglets.

    PubMed

    Yang, Changwei; Zhu, Xi; Liu, Ni; Chen, Yue; Gan, Hexia; Troy, Frederic A; Wang, Bing

    2014-08-01

    The molecular mechanisms underlying how dietary lactoferrin (Lf) impacts gut development and maturation and protects against early weaning diarrhea are not well understood. In this study, we supplemented postnatal piglets with an Lf at a dose level of 155 and 285 mg/kg/day from 3 to 38 days following birth. Our findings show that the high dose of Lf up-regulated messenger RNA expression levels of genes encoding brain-derived neurotrophic factor (BDNF) and ubiquitin carboxy-terminal hydrolase L1 (ubiquitin thiolesterase (UCHL1) and, to a lesser extent, glial cell line-derived neurotrophic factor, in the duodenum (P<.05). Piglets in the high and low Lf group had 30% and 7% larger jejunal crypts compared with the control group (P<.05). Escherichia coli 16S rRNA copy number per gram of ascending colon contents was significantly reduced (P=.001), while the copy number of Bifidobacteria and Lactobacillus spp. was not affected. In addition, Lf increased intestinal alkaline phosphatase activity (P<.05) and delayed the onset of food transitional diarrhea, reducing its frequency and duration (P<.05). The incidence of diarrhea in the high and low Lf groups was decreased 54% and 15%, respectively, compared with the control group (P=.035). In summary, these findings provide new evidence that dietary Lf supplementation up-regulated gene expression of BDNF and UCHL1, decreased the colon microbiota of E. coli, improved gut maturation and reduced early weaning diarrhea in piglets. The molecular basis underlying these findings suggests that Lf may enhance gut development and immune function by providing new insight into the gut-brain-microbe axis that has not been previously reported. PMID:24824862

  14. Stress induced hippocampal mineralocorticoid and estrogen receptor β gene expression and long-term potentiation in male adult rats is sensitive to early-life stress experience.

    PubMed

    Wang, Han; Meyer, Katrin; Korz, Volker

    2013-02-01

    Glucocorticoid hormones and their receptors have been identified to be involved in emotional and cognitive disorders in early stressed subjects during adulthood. However, the impact of other steroid hormones and receptors has been considered less. Especially, functional roles of estrogen and estrogen receptors in male subjects are largely unknown. Therefore, we measured hippocampal concentrations of 17β-estradiol, corticosterone and testosterone, as well as the gene expression of estrogen receptor α and β (ERα, β), androgen receptor (AR), glucocorticoid (GR) and mineralocorticoid (MR) receptors after stress in adulthood in maternally separated (MS+; at postnatal days 14-16 for 6h each day) and control (MS-) male rats. In vivo hippocampal long-term potentiation (LTP) serves as a cellular model of learning and memory formation. Population spike- (PSA) and the fEPSP-LTP within the dentate gyrus (DG) were reinforced by elevated-platform-stress (EP-stress) in MS- but not in MS+ rats. MR- and ERβ-mRNA were upregulated 1h after EP-stress in MS- but not in MS+ rats as compared to non-stressed littermates. Infusion of an MR antagonist before LTP induction blocked early- and late-PSA- and -fEPSP-LTP, whereas blockade of ERβ impaired only the late PSA-LTP. Application of a DNA methyltransferase (DNMT) inhibitor partly restored the LTP-reinforcement in MS+ rats, accompanied by a retrieval of ERβ- but not MR-mRNA upregulation. Basal ERβ gene promoter methylation was similar between groups, whereas MS+ and MS- rats showed different methylation patterns across CpG sites after EP-stress. These findings indicate a key role of ERβ in early-stress mediated emotionality and emotion-induced late-LTP in adult male rats via DNA methylation mechanisms. PMID:22776422

  15. Evolution of gene expression after gene amplification.

    PubMed

    Garcia, Nelson; Zhang, Wei; Wu, Yongrui; Messing, Joachim

    2015-05-01

    We took a rather unique approach to investigate the conservation of gene expression of prolamin storage protein genes across two different subfamilies of the Poaceae. We took advantage of oat plants carrying single maize chromosomes in different cultivars, called oat-maize addition (OMA) lines, which permitted us to determine whether regulation of gene expression was conserved between the two species. We found that γ-zeins are expressed in OMA7.06, which carries maize chromosome 7 even in the absence of the trans-acting maize prolamin-box-binding factor (PBF), which regulates their expression. This is likely because oat PBF can substitute for the function of maize PBF as shown in our transient expression data, using a γ-zein promoter fused to green fluorescent protein (GFP). Despite this conservation, the younger, recently amplified prolamin genes in maize, absent in oat, are not expressed in the corresponding OMAs. However, maize can express the oldest prolamin gene, the wheat high-molecular weight glutenin Dx5 gene, even when maize Pbf is knocked down (through PbfRNAi), and/or another maize transcription factor, Opaque-2 (O2) is knocked out (in maize o2 mutant). Therefore, older genes are conserved in their regulation, whereas younger ones diverged during evolution and eventually acquired a new repertoire of suitable transcriptional activators. PMID:25912045

  16. Evolution of Gene Expression after Gene Amplification

    PubMed Central

    Garcia, Nelson; Zhang, Wei; Wu, Yongrui; Messing, Joachim

    2015-01-01

    We took a rather unique approach to investigate the conservation of gene expression of prolamin storage protein genes across two different subfamilies of the Poaceae. We took advantage of oat plants carrying single maize chromosomes in different cultivars, called oat–maize addition (OMA) lines, which permitted us to determine whether regulation of gene expression was conserved between the two species. We found that γ-zeins are expressed in OMA7.06, which carries maize chromosome 7 even in the absence of the trans-acting maize prolamin-box-binding factor (PBF), which regulates their expression. This is likely because oat PBF can substitute for the function of maize PBF as shown in our transient expression data, using a γ-zein promoter fused to green fluorescent protein (GFP). Despite this conservation, the younger, recently amplified prolamin genes in maize, absent in oat, are not expressed in the corresponding OMAs. However, maize can express the oldest prolamin gene, the wheat high-molecular weight glutenin Dx5 gene, even when maize Pbf is knocked down (through PbfRNAi), and/or another maize transcription factor, Opaque-2 (O2) is knocked out (in maize o2 mutant). Therefore, older genes are conserved in their regulation, whereas younger ones diverged during evolution and eventually acquired a new repertoire of suitable transcriptional activators. PMID:25912045

  17. Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.

    PubMed

    Takemura, Yoshihiro; Kuroki, Katsuou; Katou, Masahiro; Kishimoto, Masayuki; Tsuji, Wataru; Nishihara, Eiji; Tamura, Fumio

    2015-01-01

    To better understand the molecular mechanisms related to growth promotion in the early developmental stages of Eustoma grandiflorum (Raf.) Shinn. under end-of-day far-red light (EOD-FR) treatment, we analyzed the leaf transcriptome of treated (EOD) and untreated plants (Cont) by using RNA-seq technology. EOD-FR treatment for only about 2 weeks in regions with limited sunshine during winter resulted in significantly higher internode length between the 3rd and 4th nodes on the main stem in EOD than in Cont. Among the differentially expressed genes (DEGs) related to synthesis or transport of auxin, higher levels of YUCCA (CL6581) and PIN4 (CL6181) were noted after treatment in EOD than in Cont in the leaf. In addition, high expression levels of GA20ox (Unigene11862) related to gibberellin (GA) synthesis and transcription factor bHLH 135 (CL7761) were observed in the stem of EOD, 3 h after treatment. A vertical section of the stem showed that the pith length of cells at the 4th node was longer in EOD than in Cont. Collectively, these results suggested that EOD-FR treatment increased the expression of DEGs related to GA and auxin biosynthesis, bHLH transcription factor, and internodal cell elongation along the longitudinal axis of Eustoma plants. PMID:26642764

  18. Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.

    PubMed Central

    Takemura, Yoshihiro; Kuroki, Katsuou; Katou, Masahiro; Kishimoto, Masayuki; Tsuji, Wataru; Nishihara, Eiji; Tamura, Fumio

    2015-01-01

    To better understand the molecular mechanisms related to growth promotion in the early developmental stages of Eustoma grandiflorum (Raf.) Shinn. under end-of-day far-red light (EOD-FR) treatment, we analyzed the leaf transcriptome of treated (EOD) and untreated plants (Cont) by using RNA-seq technology. EOD-FR treatment for only about 2 weeks in regions with limited sunshine during winter resulted in significantly higher internode length between the 3rd and 4th nodes on the main stem in EOD than in Cont. Among the differentially expressed genes (DEGs) related to synthesis or transport of auxin, higher levels of YUCCA (CL6581) and PIN4 (CL6181) were noted after treatment in EOD than in Cont in the leaf. In addition, high expression levels of GA20ox (Unigene11862) related to gibberellin (GA) synthesis and transcription factor bHLH 135 (CL7761) were observed in the stem of EOD, 3 h after treatment. A vertical section of the stem showed that the pith length of cells at the 4th node was longer in EOD than in Cont. Collectively, these results suggested that EOD-FR treatment increased the expression of DEGs related to GA and auxin biosynthesis, bHLH transcription factor, and internodal cell elongation along the longitudinal axis of Eustoma plants. PMID:26642764

  19. The Zebrafish Homologue of the Human DYT1 Dystonia Gene Is Widely Expressed in CNS Neurons but Non-Essential for Early Motor System Development

    PubMed Central

    Sager, Jonathan J.; Torres, Gonzalo E.; Burton, Edward A.

    2012-01-01

    DYT1 dystonia is caused by mutation of the TOR1A gene, resulting in the loss of a single glutamic acid residue near the carboxyl terminal of TorsinA. The neuronal functions perturbed by TorsinA[ΔE] are a major unresolved issue in understanding the pathophysiology of dystonia, presenting a critical roadblock to developing effective treatments. We identified and characterized the zebrafish homologue of TOR1A, as a first step towards elucidating the functions of TorsinA in neurons, in vivo, using the genetically-manipulable zebrafish model. The zebrafish genome was found to contain a single alternatively-spliced tor1 gene, derived from a common ancestral locus shared with the dual TOR1A and TOR1B paralogues found in tertrapods. tor1 was expressed ubiquitously during early embryonic development and in multiple adult tissues, including the CNS. The 2.1 kb tor1 mRNA encodes Torsin1, which is 59% identical and 78% homologous to human TorsinA. Torsin1 was expressed as major 45 kDa and minor 47 kDa glycoproteins, within the cytoplasm of neurons and neuropil throughout the CNS. Similar to previous findings relating to human TorsinA, mutations of the ATP hydrolysis domain of Torsin1 resulted in relocalization of the protein in cultured cells from the endoplasmic reticulum to the nuclear envelope. Zebrafish embryos lacking tor1 during early development did not show impaired viability, overt morphological abnormalities, alterations in motor behavior, or developmental defects in the dopaminergic system. Torsin1 is thus non-essential for early development of the motor system, suggesting that important CNS functions may occur later in development, consistent with the critical time window in late childhood when dystonia symptoms usually emerge in DYT1 patients. The similarities between Torsin1 and human TorsinA in domain organization, expression pattern, and cellular localization suggest that the zebrafish will provide a useful model to understand the neuronal functions of Torsins

  20. Expression and sequences of T cell antigen receptor beta-chain genes in the thymus at an early stage after sublethal irradiation

    SciTech Connect

    Yuuki, H.; Yoshikai, Y.; Kishihara, K.; Matsuzaki, G.; Ayukawa, K.; Nomoto, K.

    1989-05-15

    The sequential appearance of the thymocyte subpopulations and TCR gene messages occurred in the thymus of AKR mice (H-2k, Mlsa) from 7 to 14 days after sublethal irradiation. The thymocytes on day 7 after irradiation were composed of a large number of CD4+CD8+ blast-like cells and a relatively high proportion of CD4-CD8- cells (15 to 25%) but few CD3highCD4+CD8-/CD4-CD8+ cells. Approximately 22% of the CD4-CD8- cells were CD3high and -27% of the CD3highCD4-CD8- cells (-6% of whole CD4-CD8- cells) were F23.1+. The thymocytes on day 7 expressed a large amount of gamma- and delta-chain gene transcripts but reduced levels of alpha- and beta-chain gene transcripts. The V gene repertoire of 18 functional beta-chain cDNA derived from the thymocytes on day 7 was compared with those of 20 functional beta-chain cDNA derived from the thymocytes on day 14 which were composed of a large number of CD3lowCD4+CD8+ small-sized cells and a small number of CD3highCD4+CD8- cells. It is noteworthy that the distribution of V beta genes expressed in the thymocytes on day 7 was much the same as that in the thymocytes on day 14 but significantly different from that in normal BALB/c thymocytes as previously described. Interestingly, neither V beta 8.1 nor V beta 6 genes, which are important for recognition of the product of the Mlsa locus, was detected in these two cDNA libraries. These results suggest that clonal selection of TCR V beta repertoire, irrespective of positive or negative selection, appears to occur at the early stage of T cell differentiation, i.e., on the blast-like CD4+CD8+ thymocytes.

  1. Shortening and intracellular Ca2+ in ventricular myocytes and expression of genes encoding cardiac muscle proteins in early onset type 2 diabetic Goto-Kakizaki rats.

    PubMed

    Salem, K A; Adrian, T E; Qureshi, M A; Parekh, K; Oz, M; Howarth, F C

    2012-12-01

    There has been a spectacular rise in the global prevalence of type 2 diabetes mellitus. Cardiovascular complications are the major cause of morbidity and mortality in diabetic patients. Contractile dysfunction, associated with disturbances in excitation-contraction coupling, has been widely demonstrated in the diabetic heart. The aim of this study was to investigate the pattern of cardiac muscle genes that are involved in the process of excitation-contraction coupling in the hearts of early onset (8-10 weeks of age) type 2 diabetic Goto-Kakizaki (GK) rats. Gene expression was assessed in ventricular muscle with real-time RT-PCR; shortening and intracellular Ca(2+) were measured in ventricular myocytes with video edge detection and fluorescence photometry, respectively. The general characteristics of the GK rats included elevated fasting and non-fasting blood glucose and blood glucose at 120 min following a glucose challenge. Expression of genes encoding cardiac muscle proteins (Myh6/7, Mybpc3, Myl1/3, Actc1, Tnni3, Tnn2, Tpm1/2/4 and Dbi) and intercellular proteins (Gja1/4/5/7, Dsp and Cav1/3) were unaltered in GK ventricle compared with control ventricle. The expression of genes encoding some membrane pumps and exchange proteins was unaltered (Atp1a1/2, Atp1b1 and Slc8a1), whilst others were either upregulated (Atp1a3, relative expression 2.61 ± 0.69 versus 0.84 ± 0.23) or downregulated (Slc9a1, 0.62 ± 0.07 versus 1.08 ± 0.08) in GK ventricle compared with control ventricle. The expression of genes encoding some calcium (Cacna1c/1g, Cacna2d1/2d2 and Cacnb1/b2), sodium (Scn5a) and potassium channels (Kcna3/5, Kcnj3/5/8/11/12, Kchip2, Kcnab1, Kcnb1, Kcnd1/2/3, Kcne1/4, Kcnq1, Kcng2, Kcnh2, Kcnk3 and Kcnn2) were unaltered, whilst others were either upregulated (Cacna1h, 0.95 ± 0.16 versus 0.47 ± 0.09; Scn1b, 1.84 ± 0.16 versus 1.11 ± 0.11; and Hcn2, 1.55 ± 0.15 versus 1.03 ± 0.08) or downregulated (Hcn4, 0.16 ± 0.03 versus 0.37 ± 0.08; Kcna2, 0.35 ± 0

  2. Serial analysis of gene expression.

    PubMed

    Velculescu, V E; Zhang, L; Vogelstein, B; Kinzler, K W

    1995-10-20

    The characteristics of an organism are determined by the genes expressed within it. A method was developed, called serial analysis of gene expression (SAGE), that allows the quantitative and simultaneous analysis of a large number of transcripts. To demonstrate this strategy, short diagnostic sequence tags were isolated from pancreas, concatenated, and cloned. Manual sequencing of 1000 tags revealed a gene expression pattern characteristic of pancreatic function. New pancreatic transcripts corresponding to novel tags were identified. SAGE should provide a broadly applicable means for the quantitative cataloging and comparison of expressed genes in a variety of normal, developmental, and disease states. PMID:7570003

  3. Retinoid receptor-specific agonists regulate bovine in vitro early embryonic development, differentiation and expression of genes related to cell cycle arrest and apoptosis.

    PubMed

    Rodríguez, A; Díez, C; Caamaño, J N; de Frutos, C; Royo, L J; Muñoz, M; Ikeda, S; Facal, N; Alvarez-Viejo, M; Gómez, E

    2007-11-01

    A major goal in reproductive biotechnology is the identification of pathways that regulate early embryonic development and the allocation of cells to the inner cell mass (ICM) and trophectoderm (TE). Retinoids regulate the development and differentiation of the bovine blastocyst in vitro, although the involvement of the retinoid X receptors (RXRs) remains to be clarified. This paper compares the effect of a synthetic RXR agonist (LG100268; LG) with that of the retinoic acid receptor (RAR) agonist all-trans retinoic acid (ATRA) on blastulation. In vitro-produced morulae were treated for 48 h with LG (0.1 microM, 1 microM and 10 microM), ATRA 0.7 microM, or no additives. Treatment with ATRA did not increase the rate of development; however, the LG 0.1 microM treatment increased both the blastocyst development and hatching rate. Cell numbers increased in the ICM with LG 10 microM, while a dose-dependent reduction was observed in the TE in the presence of LG. Gene expression levels of p53 and p66 did not vary with LG but increased with ATRA. Both LG and ATRA activated bax, a pro-apoptotic gene and H2A.Z, a cell cycle-related gene. The above effects suggest the existence of active p53-dependent and -independent apoptotic pathways for ATRA and LG, respectively, in the bovine embryo. The expression of p53 and H2A.Z showed a strong, positive correlation (r=0.93; p<0.0001) in all experimental groups; both proteins are linked through the cell cycle. Agonists of RXR could be used to control blastocyst development and differentiation. PMID:17869331

  4. A Common Variant of PROK1 (V67I) Acts as a Genetic Modifier in Early Human Pregnancy through Down-Regulation of Gene Expression

    PubMed Central

    Su, Mei-Tsz; Huang, Jyun-Yuan; Tsai, Hui-Ling; Chen, Yi-Chi; Kuo, Pao-Lin

    2016-01-01

    PROK1-V67I has been shown to play a role as a modifier gene in the PROK1-PROKR system of human early pregnancy. To explore the related modifier mechanism of PROK1-V67I, we carried out a comparison study at the gene expression level and the cell function alternation of V67I, and its wild-type (WT), in transiently-transfected cells. We, respectively, performed quantitative RT-PCR and ELISA assays to evaluate the protein and/or transcript level of V67I and WT in HTR-8/SV neo, JAR, Ishikawa, and HEK293 cells. Transiently V67I- or WT-transfected HTR-8/SV neo and HEK293 cells were used to investigate cell function alternations. The transcript and protein expressions were down-regulated in all cell lines, ranging from 20% to 70%, compared with WT. There were no significant differences in the ligand activities of V67I and WT with regard to cell proliferation, cell invasion, calcium influx, and tubal formation. Both PROK1 alleles promoted cell invasion and intracellular calcium mobilization, whereas they had no significant effects on cell proliferation and tubal formation. In conclusion, the biological effects of PROK1-V67I on cell functions are similar to those of WT, and the common variant of V67I may act as a modifier in the PROK1-PROKR system through down-regulation of PROK1 expression. This study may provide a general mechanism that the common variant of V67I, modifying the disease severity of PROK1-related pathophysiologies. PMID:26828479

  5. Gene Expression Profiling Soybean Stem Tissue Early Response to Sclerotinia sclerotiorum and in Silico Mapping in Relation to Resistance Markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White mold, caused by Sclerotinia sclerotiorum (Lib) de Bary, can be a serious disease of crops grown under cool moist environments. In many plants, like soybean [Glycine max (L.) Merr.], complete genetic resistance does not exist. To identify possible genes involved in defense against this pathogen...

  6. Involvement of EARLY BUD-BREAK, an AP2/ERF Transcription Factor Gene, in Bud Break in Japanese Pear (Pyrus pyrifolia Nakai) Lateral Flower Buds: Expression, Histone Modifications and Possible Target Genes.

    PubMed

    Anh Tuan, Pham; Bai, Songling; Saito, Takanori; Imai, Tsuyoshi; Ito, Akiko; Moriguchi, Takaya

    2016-05-01

    In the Japanese pear (Pyrus pyrifolia Nakai) 'Kosui', three developmental stages of lateral flower buds have been proposed to occur during ecodormancy to the flowering phase, i.e. rapid enlargement, sprouting and flowering. Here, we report an APETALA2/ethylene-responsive factor (AP2/ERF) transcription factor gene, named pear EARLY BUD-BREAK (PpEBB), which was highly expressed during the rapid enlargement stage occurring prior to the onset of bud break in flower buds. Gene expression analysis revealed that PpEBB expression was dramatically increased during the rapid enlargement stage in three successive growing seasons. PpEBB transcript levels peaked 1 week prior to onset of bud break in 'Kosui' potted plants treated with hydrogen cyanamide or water under forcing conditions. Chromatin immunoprecipitation-quantitative PCR showed that higher levels of active histone modifications (trimethylation of the histone H3 tail at Lys4) in the 5'-upstream and start codon regions of the PpEBB gene were associated with the induced expression level of PpEBB during the rapid enlargement stage. In addition, we provide evidence that PpEBB may interact with and regulate pear four D-type cyclin (PpCYCD3) genes during bud break in 'Kosui' lateral flower buds. PpEBB significantly increased the promoter activities of four PpCYCD3 genes in a dual-luciferase assay using tobacco leaves. Taken together, our findings uncovered aspects of the bud break regulatory mechanism in the Japanese pear and provided further evidence that the EBB family plays an important role in bud break in perennial plants. PMID:26940832

  7. Aberrant Gene Expression in Humans

    PubMed Central

    Yang, Ence; Ji, Guoli; Brinkmeyer-Langford, Candice L.; Cai, James J.

    2015-01-01

    Gene expression as an intermediate molecular phenotype has been a focus of research interest. In particular, studies of expression quantitative trait loci (eQTL) have offered promise for understanding gene regulation through the discovery of genetic variants that explain variation in gene expression levels. Existing eQTL methods are designed for assessing the effects of common variants, but not rare variants. Here, we address the problem by establishing a novel analytical framework for evaluating the effects of rare or private variants on gene expression. Our method starts from the identification of outlier individuals that show markedly different gene expression from the majority of a population, and then reveals the contributions of private SNPs to the aberrant gene expression in these outliers. Using population-scale mRNA sequencing data, we identify outlier individuals using a multivariate approach. We find that outlier individuals are more readily detected with respect to gene sets that include genes involved in cellular regulation and signal transduction, and less likely to be detected with respect to the gene sets with genes involved in metabolic pathways and other fundamental molecular functions. Analysis of polymorphic data suggests that private SNPs of outlier individuals are enriched in the enhancer and promoter regions of corresponding aberrantly-expressed genes, suggesting a specific regulatory role of private SNPs, while the commonly-occurring regulatory genetic variants (i.e., eQTL SNPs) show little evidence of involvement. Additional data suggest that non-genetic factors may also underlie aberrant gene expression. Taken together, our findings advance a novel viewpoint relevant to situations wherein common eQTLs fail to predict gene expression when heritable, rare inter-individual variation exists. The analytical framework we describe, taking into consideration the reality of differential phenotypic robustness, may be valuable for investigating

  8. The effects of dexamethasone treatment in early gestation on hypothalamic-pituitary-adrenal responses and gene expression at 7 months of postnatal age in sheep.

    PubMed

    Li, Shaofu; Nitsos, Ilias; Polglase, Graeme R; Braun, Thorsten; Moss, Timothy J M; Newnham, John P; Challis, John R G

    2012-03-01

    We determined the effects of prenatal dexamethasone administration in early gestation on development of the hypothalamic-pituitary-adrenal (HPA) axis up to 7 months of postnatal age with measurements of hormone levels and gene expression. Plasma adrenocorticotropic hormone and cortisol levels after corticotropin-releasing hormone (CRH)/arginine vasopressin challenge were lower in treatment females than in control females and treatment males. Calculation of cortisol to adrenocorticotropic hormone ratios indicated however that the adrenals of treatment females were more responsive to adrenocorticotropic hormone than control females or treatment males. Effects of treatment and sex dependence at 7 months of age were observed in levels of hypothalamic CRH messenger RNA (mRNA), hypothalamic arginine vasopressin mRNA, pituitary proopiomelanocortin mRNA, pituitary prohormone convertase 1 and prohormone convertase 2, glucocorticoid receptor and mineralocorticoid receptor in the hypothalamus and hippocampus, adrenal adrenocorticotropic hormone receptor, steroidogenic acute regulatory, 3β hydroxysteroid dehydrogenase, and 11β hydroxysteroid dehydrogenase type 2 mRNA. The results indicate that exposure to glucocorticoids in early pregnancy produces persisting and sex-dependent effects on the hypothalamic-pituitary-adrenal axis at 7 months of age. PMID:22101239

  9. The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

    PubMed Central

    Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

    2010-01-01

    The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

  10. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis.

    PubMed

    Kubík, Stěpán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena - Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated

  11. Method of controlling gene expression

    DOEpatents

    Peters, Norman K.; Frost, John W.; Long, Sharon R.

    1991-12-03

    A method of controlling expression of a DNA segment under the control of a nod gene promoter which comprises administering to a host containing a nod gene promoter an amount sufficient to control expression of the DNA segment of a compound of the formula: ##STR1## in which each R is independently H or OH, is described.

  12. Over-expression of the PaAP1 gene from sweet cherry (Prunus avium L.) causes early flowering in Arabidopsis thaliana.

    PubMed

    Wang, Jing; Zhang, Xiaoming; Yan, Guohua; Zhou, Yu; Zhang, Kaichun

    2013-02-15

    A homologue of SQUAMOSA/APETALA1, designated PaAP1, was isolated from Prunus avium by reverse transcription-PCR (RT-PCR). The full length of PaAP1 cDNA is 753 bp, and it codes for a polypeptide of 250 amino acid residues. Sequence comparison revealed that PaAP1 belongs to the MADS-box gene family. Phylogenetic analysis indicated that PaAP1 shared the highest identity with SQUA/AP1 homologues from Prunus serrulata. Real-time fluorescence quantitative PCR analysis showed that PaAP1 was expressed at high levels in petal, sepal, style, and flower buds, which was slightly different from the expression pattern of AP1 of Arabidopsis thaliana. To characterize the functions of PaAP1, we assessed Arabidopsis transformed with 35S::PaAP1. A total of 8 transgenic T(1) lines with an early flowering phenotype were obtained, and a 3:1 segregation ratio of flowering time was observed in the T(2) generation of 4 lines. This study provides the first functional analysis of an SQUA/AP1 homolog from P. avium and suggests that PaAP1 is potentially useful for shortening the juvenile period in sweet cherry. PMID:23206932

  13. Bone-specific gene expression patterns and whole bone tissue of female mice are programmed by early life exposure to soy isoflavones and folic acid.

    PubMed

    Kaludjerovic, Jovana; Ward, Wendy E

    2015-10-01

    Female mice exposed to soy isoflavones (ISO) during early postnatal life have improved bone outcomes at adulthood. Since long-lasting effects may be mediated by DNA methylation, we hypothesized that providing supplemental folic acid (FA), a methyl donor, during early life, would enhance the positive effect of ISO to bone health. Bone-specific gene expression patterns were studied to understand potential mechanisms. CD-1 dams (n=36) were randomized to adequate or supplemental levels of FA (2 or 8 mg/kg diet) during pregnancy and lactation, and offspring received corn oil or ISO (7 mg/kg body weight/d) from postnatal day 1 to 10. From weaning, pups were fed an adequate FA diet and were studied to 4 months of age. Female offspring exposed to supplemental FA+ISO had higher bone mineral density (BMD), trabecular connectivity and peak load at the lumbar spine compared to females exposed to adequate FA. Female offspring exposed to adequate FA+ISO or supplemental FA had higher (P<.05) BMD and greater resistance to fracture at the lumbar spine and the femur; higher trabecular connectivity at the lumbar spine; and lower expression of DNA methyltransferase 3a (Dnmt3a) and neuropeptide Y (NPY) in the femur compared to mice exposed to adequate FA. In addition, only mice exposed to adequate FA+ISO had microstructural improvements at the femur neck and higher serum osteoprotegrin (OPG) and insulin growth factor-I (IGF-I). In summary, exposure to supplemental FA did not enhance the positive effect of ISO in bone. However, exposure to adequate FA+ISO or supplemental FA improved bone at least in part by suppressing Dnmt3a and NPY. PMID:26089235

  14. Gene Expression in Oligodendroglial Tumors

    PubMed Central

    Shaw, Elisabeth J.; Haylock, Brian; Husband, David; du Plessis, Daniel; Sibson, D. Ross; Warnke, Peter C.; Walker, Carol

    2010-01-01

    Background: Oligodendroglial tumors with 1p/19q loss are more likely to be chemosensitive and have longer survival than those with intact 1p/19q, but not all respond to chemotherapy, warranting investigation of the biological basis of chemosensitivity. Methods: Gene expression profiling was performed using amplified antisense RNA from 28 oligodendroglial tumors treated with chemotherapy (26 serial stereotactic biopsy, 2 resection). Expression of differentially expressed genes was validated by real-time PCR. Results: Unsupervised hierarchical clustering showed clustering of multiple samples from the same case in 14/17 cases and identified subgroups associated with tumor grade and 1p/19q status. 176 genes were differentially expressed, 164 being associated with 1p/19q loss (86% not on 1p or 19q). 94 genes differed between responders and non-responders to chemotherapy; 12 were not associated with 1p/19q loss. Significant differential expression was confirmed in 11/13 selected genes. Novel genes associated with response to therapy included SSBP2, GFRA1, FAP and RASD1. IQGAP1, INA, TGIF1, NR2F2 and MYCBP were differentially expressed in oligodendroglial tumors with 1p/19q loss. Conclusion: Gene expression profiling using serial stereotactic biopsies indicated greater homogeneity within tumors than between tumors. Genes associated with 1p/19q status or response were identified warranting further elucidation of their role in oligodendroglial tumors. PMID:20966545

  15. Involvement of the major capsid protein and two early-expressed phage genes in the activity of the lactococcal abortive infection mechanism AbiT.

    PubMed

    Labrie, Simon J; Tremblay, Denise M; Moisan, Maxim; Villion, Manuela; Magadán, Alfonso H; Campanacci, Valérie; Cambillau, Christian; Moineau, Sylvain

    2012-10-01

    The dairy industry uses the mesophilic, Gram-positive, lactic acid bacterium (LAB) Lactococcus lactis to produce an array of fermented milk products. Milk fermentation processes are susceptible to contamination by virulent phages, but a plethora of phage control strategies are available. One of the most efficient is to use LAB strains carrying phage resistance systems such as abortive infection (Abi) mechanisms. Yet, the mode of action of most Abi systems remains poorly documented. Here, we shed further light on the antiviral activity of the lactococcal AbiT system. Twenty-eight AbiT-resistant phage mutants derived from the wild-type AbiT-sensitive lactococcal phages p2, bIL170, and P008 were isolated and characterized. Comparative genomic analyses identified three different genes that were mutated in these virulent AbiT-insensitive phage derivatives: e14 (bIL170 [e14(bIL170)]), orf41 (P008 [orf41(P008)]), and orf6 (p2 [orf6(p2)] and P008 [orf6(P008)]). The genes e14(bIL170) and orf41(P008) are part of the early-expressed genomic region, but bioinformatic analyses did not identify their putative function. orf6 is found in the phage morphogenesis module. Antibodies were raised against purified recombinant ORF6, and immunoelectron microscopy revealed that it is the major capsid protein (MCP). Coexpression in L. lactis of ORF6(p2) and ORF5(p2), a protease, led to the formation of procapsids. To our knowledge, AbiT is the first Abi system involving distinct phage genes. PMID:22820334

  16. Differential expression of transcriptional regulatory units in the prefrontal cortex of patients with bipolar disorder: potential role of early growth response gene 3.

    PubMed

    Pfaffenseller, B; da Silva Magalhães, P V; De Bastiani, M A; Castro, M A A; Gallitano, A L; Kapczinski, F; Klamt, F

    2016-01-01

    Bipolar disorder (BD) is a severe mental illness with a strong genetic component. Despite its high degree of heritability, current genetic studies have failed to reveal individual loci of large effect size. In lieu of focusing on individual genes, we investigated regulatory units (regulons) in BD to identify candidate transcription factors (TFs) that regulate large groups of differentially expressed genes. Network-based approaches should elucidate the molecular pathways governing the pathophysiology of BD and reveal targets for potential therapeutic intervention. The data from a large-scale microarray study was used to reconstruct the transcriptional associations in the human prefrontal cortex, and results from two independent microarray data sets to obtain BD gene signatures. The regulatory network was derived by mapping the significant interactions between known TFs and all potential targets. Five regulons were identified in both transcriptional network models: early growth response 3 (EGR3), TSC22 domain family, member 4 (TSC22D4), interleukin enhancer-binding factor 2 (ILF2), Y-box binding protein 1 (YBX1) and MAP-kinase-activating death domain (MADD). With a high stringency threshold, the consensus across tests was achieved only for the EGR3 regulon. We identified EGR3 in the prefrontal cortex as a potential key target, robustly repressed in both BD signatures. Considering that EGR3 translates environmental stimuli into long-term changes in the brain, disruption in biological pathways involving EGR3 may induce an impaired response to stress and influence on risk for psychiatric disorders, particularly BD. PMID:27163206

  17. Changes over time in the impact of gene-expression profiles on the administration of adjuvant chemotherapy in estrogen receptor positive early stage breast cancer patients: A nationwide study.

    PubMed

    Kuijer, A; Drukker, C A; Elias, S G; Smorenburg, C H; Th Rutgers, E J; Siesling, S; van Dalen, Th

    2016-08-15

    Ten years ago gene-expression profiles were introduced to aid adjuvant chemotherapy decision making in breast cancer. Since then subsequent national guidelines gradually expanded the indication area for adjuvant chemotherapy. In this nation-wide study the evolution of the proportion of patients with estrogen-receptor positive (ER+) tumors receiving adjuvant chemotherapy in relation to gene-expression profile use in patient groups that became newly eligible for chemotherapy according to national guideline changes over time is assessed. Data on all surgically treated early breast cancer patients diagnosed between 2004-2006 and 2012-2014 were obtained from the Netherlands Cancer Registry. ER+/Her2- patients with tumor-characteristics making them eligible for gene-expression testing in both cohorts and a discordant chemotherapy recommendation over time (2004 guideline not recommending and 2012 guideline recommending chemotherapy) were identified. We identified 3,864 patients eligible for gene-expression profile use during both periods. Gene-expression profiles were deployed in 5% and 35% of the patients in the respective periods. In both periods the majority of patients was assigned to a low genomic risk-profile (67% and 69%, respectively) and high adherence rates to the test result were observed (86% and 91%, respectively). Without deploying a gene-expression profile 8% and 52% (p <0.001) of the respective cohorts received chemotherapy while 21% and 28% of these patients received chemotherapy when a gene-expression profile was used (p 0.191). In conclusion, in ER+/Her2- early stage breast cancer patients gene-expression profile use was associated with a consistent proportion of patients receiving chemotherapy despite an adjusted guideline-based recommendation to administer chemotherapy. PMID:27062369

  18. Epigenetic Mechanisms for the Early Environmental Regulation of Hippocampal Glucocorticoid Receptor Gene Expression in Rodents and Humans

    PubMed Central

    Zhang, Tie Yuan; Labonté, Benoit; Wen, Xiang Lan; Turecki, Gustavo; Meaney, Michael J

    2013-01-01

    Parental care influences development across mammals. In humans such influences include effects on phenotypes, such as stress reactivity, which determine individual differences in the vulnerability for affective disorders. Thus, the adult offspring of rat mothers that show an increased frequency of pup licking/grooming (ie, high LG mothers) show increased hippocampal glucocorticoid receptor (GR) expression and more modest hypothalamic–pituitary–adrenal responses to stress compared with the offspring of low LG mothers. In humans, childhood maltreatment associates decreased hippocampal GR expression and increased stress responses in adulthood. We review the evidence suggesting that such effects are mediated by epigenetic mechanisms, including DNA methylation and hydroxymethylation across GR promoter regions. We also present new findings revealing associated histone post-translational modifications of a critical GR promoter in rat hippocampus. Taken together these existing evidences are consistent with the idea that parental influences establish stable phenotypic variation in the offspring through effects on intracellular signaling pathways that regulate the epigenetic state and function of specific regions of the genome. PMID:22968814

  19. Prenatal exposure to moderate levels of ethanol alters social behavior in adult rats: Relationship to structural plasticity and immediate early gene expression in frontal cortex

    PubMed Central

    Hamilton, Derek A.; Akers, Katherine G.; Rice, James P.; Johnson, Travis E.; Candelaria-Cook, Felicha T.; Maes, Levi I.; Rosenberg, Martina; Valenzuela, C. Fernando; Savage, Daniel D.

    2009-01-01

    The goals of the present study were to characterize the effects of prenatal exposure to moderate levels of ethanol on adult social behavior, and to evaluate fetal-ethanol-related effects on dendritic morphology, structural plasticity and activity-related immediate early gene (IEG) expression in the agranular insular (AID) and prelimbic (Cg3) regions of frontal cortex. Baseline fetal-ethanol-related alterations in social behavior were limited to reductions in social investigation in males. Repeated experience with novel cage-mates resulted in comparable increases in wrestling and social investigation among saccharin- and ethanol-exposed females, whereas social behavioral effects among males were more evident in ethanol-exposed animals. Male ethanol-exposed rats also displayed profound increases in wrestling when social interaction was motivated by 24 hours of isolation. Baseline decreases in dendritic length and spine density in AID were observed in ethanol-exposed rats that were always housed with the same cage-mate. Modest experience-related decreases in dendritic length and spine density in AID were observed in saccharin-exposed rats housed with various cage-mates. In contrast, fetal-ethanol-exposed rats displayed experience-related increases in dendritic length in AID, and no experience-related changes in spine density. The only effect observed in Cg3 was a baseline increase in basilar dendritic length among male ethanol-exposed rats. Robust increases in activity-related IEG expression in AID (c-fos and Arc) and Cg3 (c-fos) were observed following social interaction in saccharin-exposed rats, however, activity-related increases in IEG expression were not observed in fetal-ethanol-exposed rats in either region. The results indicate that deficits in social behavior are among the long-lasting behavioral consequences of moderate ethanol exposure during brain development, and implicate AID, and to a lesser degree Cg3, in fetal-ethanol-related social behavior

  20. The dopamine uptake inhibitor 3 alpha-[bis(4'-fluorophenyl)metoxy]-tropane reduces cocaine-induced early-gene expression, locomotor activity, and conditioned reward.

    PubMed

    Velázquez-Sánchez, Clara; Ferragud, Antonio; Hernández-Rabaza, Vicente; Nácher, Amparo; Merino, Virginia; Cardá, Miguel; Murga, Juan; Canales, Juan J

    2009-11-01

    Benztropine (BZT) analogs, a family of high-affinity dopamine transporter ligands, are molecules that exhibit pharmacological and behavioral characteristics predictive of significant therapeutic potential in cocaine addiction. Here, we examined in mice the effects of 3 alpha-[bis(4'-fluorophenyl)metoxy]-tropane (AHN-1055) on motor activity, conditioned place preference (CPP) and c-Fos expression in the striatum. AHN-1055 produced mild attenuation of spontaneous locomotor activity at a low dose (1 mg/kg) and weak stimulation at a higher dose (10 mg/kg). In parallel, the BZT analog significantly increased c-Fos expression in the dorsolateral caudoputamen at the high dose, whereas producing marginal decreases at low and moderate doses (1, 3 mg/kg) in both dorsal and ventral striatum. Interaction assays showed that cocaine's ability to stimulate locomotor activity was decreased by AHN-1055 treatment, but not by treatment with D-amphetamine. Such reduced ability did not result from an increase in stereotyped behavior. Another dopamine uptake inhibitor, nomifensine, decreased cocaine-induced locomotor activity but evoked by itself intense motor stereotypies. Remarkably, the BZT analog dose-dependently blocked cocaine-induced CPP without producing CPP when given alone, and blocked in conditioned mice cocaine-stimulated early-gene activation in the nucleus accumbens and dorsomedial striatum. These observations provide evidence that AHN-1055 does not behave as a classical psychomotor stimulant and that some of its properties, including attenuation of cocaine-induced striatal c-Fos expression, locomotor stimulation, and CPP, support its candidacy, and that of structurally related molecules, as possible pharmacotherapies in cocaine addiction. PMID:19606084

  1. Heat-induced expression of the immediate-early gene IER5 and its involvement in the proliferation of heat-shocked cells.

    PubMed

    Ishikawa, Yukio; Sakurai, Hiroshi

    2015-01-01

    The serum-inducible and growth factor-inducible gene IER5 encodes a protein that acts as a regulator of cell proliferation. Expression of IER5 is also induced by treatment of cells with ionizing radiation and anticancer agents. In this study, we demonstrate the expression and function of IER5 in heat-shocked cells. Heat treatment causes robust expression of IER5 in a heat shock factor (HSF)1-dependent manner. HSF1 is the master transcriptional regulator of chaperone genes, and the IER5 promoter contains the binding sequence for HSF1 and is bound by heat-activated HSF1. Proteotoxic stressors, such as celastrol and MG132, are known to activate HSF1, and are potent inducers of HSF1 binding and IER5 expression. Overexpression of IER5 leads to upregulation of chaperone gene expression and to an increase in refolding of heat-denatured proteins. Cells expressing IER5 efficiently recover viability after heat challenge. These observations suggest that HSF1-mediated IER5 expression is involved in the expression of chaperone genes and in recovery from thermal stress. PMID:25355627

  2. Efficient ectopic gene expression targeting chick mesoderm.

    PubMed

    Oberg, Kerby C; Pira, Charmaine U; Revelli, Jean-Pierre; Ratz, Beate; Aguilar-Cordova, Estuardo; Eichele, Gregor

    2002-07-01

    The chick model has been instrumental in illuminating genes that regulate early vertebrate development and pattern formation. Targeted ectopic gene expression is critical to dissect further the complicated gene interactions that are involved. In an effort to develop a consistent method to ectopically introduce and focally express genes in chick mesoderm, we evaluated and optimized several gene delivery methods, including implantation of 293 cells laden with viral vectors, direct adenoviral injection, and electroporation (EP). We targeted the mesoderm of chick wing buds between stages 19 and 21 (Hamburger and Hamilton stages) and used beta-galactosidase and green fluorescent protein (GFP) to document gene transfer. Expression constructs using the cytomegalovirus (CMV) promoter, the beta-actin promoter, and vectors with an internal ribosomal entry sequence linked to GFP (IRES-GFP) were also compared. After gene transfer, we monitored expression for up to 3 days. The functionality of ectopic expression was demonstrated with constructs containing the coding sequences for Shh, a secreted signaling protein, or Hoxb-8, a transcription factor, both of which can induce digit duplication when ectopically expressed in anterior limb mesoderm. We identified several factors that enhance mesodermal gene transfer. First, the use of a vector with the beta-actin promoter coupled to the 69% fragment of the bovine papilloma virus yielded superior mesodermal expression both by markers and functional results when compared with several CMV-driven vectors. Second, we found the use of mineral oil to be an important adjuvant for EP and direct viral injection to localize and contain vector within the mesoderm at the injection site. Lastly, although ectopic expression could be achieved with all three methods, we favored EP confined to the mesoderm with insulated microelectrodes (confined microelectroporation- CMEP), because vector construction is rapid, the method is efficient, and results

  3. How do women trade-off benefits and risks in chemotherapy treatment decisions based on gene expression profiling for early-stage breast cancer? A discrete choice experiment

    PubMed Central

    Marshall, Deborah A; Deal, Ken; Bombard, Yvonne; Leighl, Natasha; MacDonald, Karen V; Trudeau, Maureen

    2016-01-01

    Objectives Gene expression profiling (GEP) of tumours informs baseline risk prediction, potentially affecting adjuvant chemotherapy decisions for women with early-stage breast cancer. Since only 15% will experience a recurrence, concerns have been raised about potential harms from overtreatment and high GEP costs in publicly funded healthcare systems. We aimed to estimate preferences and personal utility of GEP testing information and benefit–risk trade-offs in chemotherapy treatment decisions. Design, setting and intervention Based on literature review and findings from our qualitative research (focus groups, interviews with patients with breast cancer and medical oncologists), we developed a discrete choice experiment (DCE) survey and administered it via an internet panel. The DCE included 12 choice tasks with 5 attributes and 3 alternatives considering orthogonality, D-efficiency and level balance. Participants The DCE survey was administered to 1004 Canadian women from the general population. Main outcome measures Preferences were analysed using conditional logit and hierarchical Bayes and evaluated for goodness of fit. We conducted simulation analyses for alternative scenarios. Results GEP test score indicating likely benefit from chemotherapy was the most important attribute. Doctor's clinical estimate of the risk of cancer returning, trust in your cancer doctor and side effects of chemotherapy (temporary and permanent) were relatively less important but showed significant differences among levels. In the scenario analyses, 78% were likely to choose chemotherapy in a high-risk scenario, 55% in a moderate-risk scenario and 33% in a low-risk scenario, with the other attributes held constant. A high GEP score was more important in influencing the choice of chemotherapy for those at intermediate clinical risk. Conclusions GEP testing information influences chemotherapy treatment decisions in early-stage breast cancer and varies depending on clinical risk

  4. Early post mortem expression of genes related to tenderization in two Italian Simmental young bulls' skeletal muscles differing in contractile type.

    PubMed

    Saccà, Elena; Corazzin, Mirco; Pizzutti, Nicoletta; Lippe, Giovanna; Piasentier, Edi

    2015-12-01

    The early post mortem expression of eight genes potentially involved in meat ageing process and the tenderness of two Italian Simmental young bulls' (Bos taurus) skeletal muscles differing in their contractile type were evaluated. Samples of Longissimus lumborum (LL) and Infraspinatus (IS) muscles were collected from 17 bulls. The messenger RNA (mRNA) abundances of calpain-1, calpain-2, calpastatin, caspase 3, caspase 9, heat shock protein 27 (Hsp27), Hsp40 and Hsp70 were detected by quantitative PCR. The myosin heavy chain-slow and -fast isoform content, the pH48h and the lipid content of the muscles were in line with the contractile and metabolic type. In comparison with the fast LL, the slow IS showed a lower calpain-1/calpastatin mRNA content ratio after slaughtering and a higher Warner-Bratzler Initial Yield value after 7 days of ageing. Hsp27 and Hsp70 mRNA abundances were significantly lower in LL than IS, highlighting their potential role in the ageing process of bovine muscles. PMID:26152790

  5. Analyses of expressed sequence tags in Neurospora reveal rapid evolution of genes associated with the early stages of sexual reproduction in fungi

    PubMed Central

    2012-01-01

    Background The broadly accepted pattern of rapid evolution of reproductive genes is primarily based on studies of animal systems, although several examples of rapidly evolving genes involved in reproduction are found in diverse additional taxa. In fungi, genes involved in mate recognition have been found to evolve rapidly. However, the examples are too few to draw conclusions on a genome scale. Results In this study, we performed microarray hybridizations between RNA from sexual and vegetative tissues of two strains of the heterothallic (self-sterile) filamentous ascomycete Neurospora intermedia, to identify a set of sex-associated genes in this species. We aligned Expressed Sequence Tags (ESTs) from sexual and vegetative tissue of N. intermedia to orthologs from three closely related species: N. crassa, N. discreta and N. tetrasperma. The resulting four-species alignments provided a dataset for molecular evolutionary analyses. Our results confirm a general pattern of rapid evolution of fungal sex-associated genes, compared to control genes with constitutive expression or a high relative expression during vegetative growth. Among the rapidly evolving sex-associated genes, we identified candidates that could be of importance for mating or fruiting-body development. Analyses of five of these candidate genes from additional species of heterothallic Neurospora revealed that three of them evolve under positive selection. Conclusions Taken together, our study represents a novel finding of a genome-wide pattern of rapid evolution of sex-associated genes in the fungal kingdom, and provides a list of candidate genes important for reproductive isolation in Neurospora. PMID:23186325

  6. Early Detection of Baculovirus Expression and Infection in Lepidopteran Larvae Fed Occlusion Bodies of an AcMNPV Recombinant Carrying a Red Fluorescent Protein Gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A method has been devised utilizing a baculovirus recombinant (AcMNPV hsp70Red) carrying a red fluorescent protein (RFP) gene under the early heat shock promoter (hsp70) to assess potential infectivity of larvae fed occlusion bodies. A time study was employed whereby first and third instars of Trich...

  7. Temporal and anatomic patterns of immediate-early gene expression in the forebrain of C57BL/6 and DBA/2 mice after morphine administration.

    PubMed

    Ziółkowska, B; Gieryk, A; Solecki, W; Przewłocki, R

    2015-01-22

    Although morphine was previously reported to produce an instant induction of c-fos in the striatum, our recent studies have demonstrated that the expression of numerous immediate early genes (IEGs) is significantly elevated at delayed time-points (several hours) after morphine administration. To better dissect the time-course of opioid-produced IEG induction, we used in situ hybridization to examine the expression of the IEGs c-fos, zif268 and arc in the mouse forebrain at several time-points after acute morphine injection. To link drug-produced behavioral changes with the activity of specific neuronal complexes, this study was performed comparatively in the C57BL/6 and DBA/2 mouse strains, which differ markedly in their locomotor responses to opioids and opioid reward. Our study demonstrates that morphine produces two episodes of IEG induction, which are separate in time (30 min vs. 4-6 h) and which have different neuroanatomic distribution. At 30 min, one or more IEGs were induced in circumscribed subregions of the dorsal striatum (dStr) and of the nucleus accumbens (NAc) shell, as well as in the lateral septum. The observed inter-strain differences in IEG expression at 30 min support earlier proposals that activation of the dorsomedial striatum may mediate morphine-elicited locomotor stimulation (both effects were present only in the C57BL/6 strain). In contrast, NAc shell activation does not appear to be linked to morphine-elicited changes in locomotor behavior. The second IEG induction (of arc and of zif268) was more widespread, involving most of the dStr and the cortex. The second IEG induction peaked earlier in the DBA/2 mice than in the C57BL/6 mice (4 h compared with 6 h) and displayed no apparent relation to locomotor behavior. This delayed episode of IEG activation, which has largely been overlooked thus far, may contribute to the development of long-term effects of opioids such as tolerance, dependence and/or addiction. PMID:25290009

  8. Survey of Transcript Expression in Rainbow Trout Leukocytes Reveals a Major Contribution of Interferon-Responsive Genes in the Early Response to a Rhabdovirus Infection

    PubMed Central

    O'Farrell, Caroline; Vaghefi, Nikta; Cantonnet, Monique; Buteau, Bénédicte; Boudinot, Pierre; Benmansour, Abdenour

    2002-01-01

    Virus infections induce changes in the expression of host cell genes. A global knowledge of these modifications should help to better understand the virus/host cell interactions. To obtain a more comprehensive view of the rainbow trout response to a viral infection, we used the subtractive suppressive hybridization methodology in the viral hemorrhagic septicemia model of infection. We infected rainbow trout leukocytes with viral hemorrhagic septicemia virus (VHSV), and total RNA from infected and mock-infected cells was compared at 40 h postinfection. Twenty-four virus-induced genes were ultimately retrieved from the subtracted cDNA library, and their differential expression was further confirmed by semiquantitative reverse transcription-PCR and Northern blot analysis. Among these sequences, three were already described as VHSV-induced genes. Eight sequences with known homologs were extended to full-length cDNA using 5′ and 3′ rapid amplification of cDNA ends, and they were subsequently divided into three functional subsets. Four genes were homologous to mammalian interferon responsive genes, three were similar to chemo-attractant molecules (CXC chemokine, galectin), and two had nucleic acid binding domains. All of the virus-induced genes were also induced by rainbow trout interferon, indicating that the interferon pathway is the predominant component of the anti-VHSV response. They were also expressed in vivo in experimentally infected fish, indicating their biological relevance in natural infection. PMID:12134009

  9. HSI2 Repressor Recruits MED13 and HDA6 to Down-Regulate Seed Maturation Gene Expression Directly During Arabidopsis Early Seedling Growth.

    PubMed

    Chhun, Tory; Chong, Suet Yen; Park, Bong Soo; Wong, Eriko Chi Cheng; Yin, Jun-Lin; Kim, Mijung; Chua, Nam-Hai

    2016-08-01

    Arabidopsis HSI2 (HIGH-LEVEL EXPRESSION OF SUGAR-INDUCIBLE GENE 2) which carries a EAR (ERF-associated amphiphilic repression) motif acts as a repressor of seed maturation genes and lipid biosynthesis, whereas MEDIATOR (MED) is a conserved multiprotein complex linking DNA-bound transcription factors to RNA polymerase II transcription machinery. How HSI2 executes its repressive function through MED is hitherto unknown. Here, we show that HSI2 and its homolog, HSI2-lik (HSL1), are able to form homo- and heterocomplexes. Both factors bind to the TRAP240 domain of MED13, a subunit of the MED CDK8 module. Mutant alleles of the med13 mutant show elevated seed maturation gene expression and increased lipid accumulation in cotyledons; in contrast, HSI2- or MED13-overexpressing plants display the opposite phenotypes. The overexpression phenotypes of HSI2 and MED13 are abolished in med13 and hsi2 hsl1, respectively, indicating that HSI2 and MED13 together are required for these functions. The HSI2 C-terminal region interacts with HDA6, whose overexpression also reduces seed maturation gene expression and lipid accumulation. Moreover, HSI2, MED13 and HDA6 bind to the proximal promoter and 5'-coding regions of seed maturation genes. Taken together, our results suggest that HSI2 recruits MED13 and HDA6 to suppress directly a subset of seed maturation genes post-germination. PMID:27335347

  10. Morphological and Gene Expression Changes in Cattle Embryos from Hatched Blastocyst to Early Gastrulation Stages after Transfer of In Vitro Produced Embryos

    PubMed Central

    van Leeuwen, Jessica; Berg, Debra K.; Pfeffer, Peter L.

    2015-01-01

    A detailed morphological staging system for cattle embryos at stages following blastocyst hatching and preceding gastrulation is presented here together with spatiotemporal mapping of gene expression for BMP4, BRACHYURY, CERBERUS1 (CER1), CRIPTO, EOMESODERMIN, FURIN and NODAL. Five stages are defined based on distinct developmental events. The first of these is the differentiation of the visceral hypoblast underlying the epiblast, from the parietal hypoblast underlying the mural trophoblast. The second concerns the formation of an asymmetrically positioned, morphologically recognisable region within the visceral hypoblast that is marked by the presence of CER1 and absence of BMP4 expression. We have termed this the anterior visceral hypoblast or AVH. Intra-epiblast cavity formation and the disappearance of the polar trophoblast overlying the epiblast (Rauber’s layer) have been mapped in relation to AVH formation. The third chronological event involves the transition of the epiblast into the embryonic ectoderm with concomitant onset of posterior NODAL, EOMES and BRACHYURY expression. Lastly, gastrulation commences as the posterior medial embryonic ectoderm layer thickens to form the primitive streak and cells ingress between the embryonic ectoderm and hypoblast. At this stage a novel domain of CER1 expression is seen whereas the AVH disappears. Comparison with the mouse reveals that while gene expression patterns at the onset of gastrulation are well conserved, asymmetry establishment, which relies on extraembryonic tissues such as the hypoblast and trophoblast, has diverged in terms of both gene expression and morphology. PMID:26076128

  11. Early expansion and expression of the lipopolysaccharide (LPS)-induced TNF-α factor (LITAF) gene family in the LPS-exposed monogonont rotifer Brachionus koreanus.

    PubMed

    Jeong, Chang-Bum; Lee, Jeong-Hyeon; Lee, Jae-Seong; Rhee, Jae-Sung

    2015-10-01

    To date, a single lipopolysaccharide-induced TNF-α factor (LITAF) homologue, mediating the expression of inflammatory cytokines including TNF-α in terms of host defense was identified in vertebrates and most invertebrates such as insects, mollusks, and crustaceans. However, LITAF gene family members have recently been characterized in only two mollusks, Crassostrea gigas and Mytilus galloprovincialis. Although a large gene family expansion of LITAF homologues was observed in the nematode Caenorhabditis elegans, the amino acid sequences encoded by the C. elegans LITAF homologue have low similarities to other LITAF gene family members. In this study, three LITAF genes were identified in the monogonont rotifer Brachionus koreanus. In silico analyses of B. koreanus LITAF genes of conserved domains and phylogenetic relationships supported gene annotations that indicated that LITAF is involved in innate immunity in primitive rotifers. To examine transcriptional sensitivity of B. koreanus LITAF genes, the rotifers were exposed to different concentrations of lipopolysaccharide (LPS). Transcriptional levels of LITAF1 and LITAF2 gene were significantly upregulated dose- and time-dependently in response to LPS exposure for 24 h. LPS exposure induced glutathione (GSH) depletion and antioxidant enzyme activity levels for 24 h in B. koreanus. These results suggested that the B. koreanus LITAF gene family has potential sensitivities directly and/or indirectly to immune stimulator-triggered oxidative stress. PMID:26056818

  12. Molecular imaging of in vivo gene expression

    PubMed Central

    Harney, Allison S.; Meade, Thomas J.

    2015-01-01

    Background Advances in imaging technologies have taken a prominent role in experimental and translational research and provide essential information on how changes in gene expression are related to downstream developmental and disease states. Discussion Magnetic resonance imaging contrast agents and optical probes developed to enhance signal intensity in the presence of a specific enzyme, genetic marker, second messenger or metabolite can prove a facile method of advancing the understanding of molecular events in disease progression. Conclusion The ability to detect changes in gene expression at the early stages of disease will lead to a greater understanding of disease progression, the use of early therapeutic intervention to increase patient survival, and tailored therapies to the detected genetic alterations in individual patients. PMID:21426178

  13. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  14. Hahb-10, a sunflower homeobox-leucine zipper gene, is regulated by light quality and quantity, and promotes early flowering when expressed in Arabidopsis.

    PubMed

    Rueda, Eva C; Dezar, Carlos A; Gonzalez, Daniel H; Chan, Raquel L

    2005-12-01

    Homeodomain-leucine zipper proteins constitute a family of transcription factors found only in plants. Expression patterns of the sunflower homeobox-leucine zipper gene Hahb-10 (Helianthus annuus homeobox-10), that belongs to the HD-Zip II subfamily, were analysed. Northern blots showed that Hahb-10 is expressed primarily in mature leaves, although expression is clearly detectable in younger leaves and also in stems. Considerably higher expression levels were detected in etiolated seedlings compared with light-grown seedlings. Induction of Hahb-10 expression was observed when seedlings were subjected to treatment with gibberellins. Transgenic Arabidopsis thaliana plants that express Hahb-10 under the 35S cauliflower mosaic virus promoter show special phenotypic characteristics such as darker cotyledons and planar leaves. A reduction in the life cycle of about 25% allowing earlier seed collection was also observed, and this phenomenon is clearly related to a shortened flowering time. When the number of plants per pot increased, the difference in developmental rate between transgenic and non-transformed individuals became larger. After gibberellin treatment, the relative difference in life cycle duration was considerably reduced. Several light-regulated genes have been tested as possible target genes of Hahb-10. One of them, PsbS, shows a different response to illumination conditions in transgenic plants compared with the response in wild-type plants while the other genes behave similarly in both genotypes. We propose that Hahb-10 functions in a signalling cascade(s) that control(s) plant responses to light quality and quantity, and may also be involved in gibberellin transduction pathways. PMID:16215272

  15. Keratin gene expression profiles after digit amputation in C57BL/6 vs. regenerative MRL mice imply an early regenerative keratinocyte activated-like state

    PubMed Central

    Cheng, Chia-Ho; Leferovich, John; Zhang, Xiang-Ming; Bedelbaeva, Khamilia; Gourevitch, Dmitri; Hatcher, Cathy J.; Basson, Craig T.; Heber-Katz, Ellen

    2013-01-01

    Mouse strains C57BL/6 (B6) and MRL were studied by whole mouse genome chip microarray analyses of RNA isolated from amputation sites at different times pre- and postamputation at the midsecond phalange of the middle digit. Many keratin genes were highly differentially expressed. All keratin genes were placed into three temporal response classes determined by injury/preinjury ratios. One class, containing only Krt6 and Krt16, were uniquely expressed relative to the other two classes and exhibited different temporal responses in MRL vs. B6. Immunohistochemical staining for Krt6 and Krt16 in tissue sections, including normal digit, flank skin, and small intestine, and from normal and injured ear pinna tissue exhibited staining differences in B6 (low) and MRL (high) that were consistent with the microarray results. Krt10 staining showed no injury-induced differences, consistent with microarray expression. We analyzed Krt6 and Krt16 gene association networks and observed in uninjured tissue several genes with higher expression levels in MRL, but not B6, that were associated with the keratinocyte activated state: Krt6, Krt16, S100a8, S100a9, and Il1b; these data suggest that keratinocytes in the MRL strain, but not in B6, are in an activated state prior to wounding. These expression levels decreased in MRL at all times postwounding but rose in the B6, peaking at day 3. Other keratins significantly expressed in the normal basal keratinocyte state showed no significant strain differences. These data suggest that normal MRL skin is in a keratinocyte activated state, which may provide it with superior responses to wounding. PMID:23512742

  16. Transgenic Arabidopsis Gene Expression System

    NASA Technical Reports Server (NTRS)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  17. Evaluation of Selected Borrelia burgdorferi lp54 Plasmid-Encoded Gene Products Expressed during Mammalian Infection as Antigens To Improve Serodiagnostic Testing for Early Lyme Disease

    PubMed Central

    Weiner, Zachary P.; Crew, Rebecca M.; Brandt, Kevin S.; Ullmann, Amy J.; Schriefer, Martin E.; Molins, Claudia R.

    2015-01-01

    Laboratory testing for the diagnosis of Lyme disease is performed primarily by serologic assays and is accurate for detection beyond the acute stage of the infection. Serodiagnostic assays to detect the early stages of infection, however, are limited in their sensitivity, and improvement is warranted. We analyzed a series of Borrelia burgdorferi proteins known to be induced within feeding ticks and/or during mammalian infection for their utility as serodiagnostic markers against a comprehensive panel of Lyme disease patient serum samples. The antigens were assayed for IgM and IgG reactivity in line immunoblots and separately by enzyme-linked immunosorbent assay (ELISA), with a focus on reactivity against early Lyme disease with erythema migrans (EM), early disseminated Lyme neuroborreliosis, and early Lyme carditis patient serum samples. By IgM immunoblotting, we found that recombinant proteins BBA65, BBA70, and BBA73 reacted with early Lyme EM samples at levels comparable to those of the OspC antigen used in the current IgM blotting criteria. Additionally, these proteins reacted with serum samples from patients with early neuroborreliosis and early carditis, suggesting value in detecting early stages of this disease progression. We also found serological reactivity against recombinant proteins BBA69 and BBA73 with early-Lyme-disease samples using IgG immunoblotting and ELISA. Significantly, some samples that had been scored negative by the Centers for Disease Control and Prevention-recommended 2-tiered testing algorithm demonstrated positive reactivity to one or more of the antigens by IgM/IgG immunoblot and ELISA. These results suggest that incorporating additional in vivo-expressed antigens into the current IgM/IgG immunoblotting tier in a recombinant protein platform assay may improve the performance of early-Lyme-disease serologic testing. PMID:26376927

  18. Gene Expression Patterns in Bone Following Mechanical Loading

    PubMed Central

    Mantila Roosa, Sara M; Liu, Yunlong; Turner, Charles H

    2011-01-01

    The advent of high-throughput measurements of gene expression and bioinformatics analysis methods offers new ways to study gene expression patterns. The primary goal of this study was to determine the time sequence for gene expression in a bone subjected to mechanical loading during key periods of the bone-formation process, including expression of matrix-related genes, the appearance of active osteoblasts, and bone desensitization. A standard model for bone loading was employed in which the right forelimb was loaded axially for 3 minutes per day, whereas the left forearm served as a nonloaded contralateral control. We evaluated loading-induced gene expression over a time course of 4 hours to 32 days after the first loading session. Six distinct time-dependent patterns of gene expression were identified over the time course and were categorized into three primary clusters: genes upregulated early in the time course, genes upregulated during matrix formation, and genes downregulated during matrix formation. Genes then were grouped based on function and/or signaling pathways. Many gene groups known to be important in loading-induced bone formation were identified within the clusters, including AP-1-related genes in the early-response cluster, matrix-related genes in the upregulated gene clusters, and Wnt/β-catenin signaling pathway inhibitors in the downregulated gene clusters. Several novel gene groups were identified as well, including chemokine-related genes, which were upregulated early but downregulated later in the time course; solute carrier genes, which were both upregulated and downregulated; and muscle-related genes, which were primarily downregulated. © 2011 American Society for Bone and Mineral Research. PMID:20658561

  19. Dietary Lipid During Late-Pregnancy and Early-Lactation to Manipulate Metabolic and Inflammatory Gene Network Expression in Dairy Cattle Liver with a Focus on PPARs

    PubMed Central

    Akbar, Haji; Schmitt, Eduardo; Ballou, Michael A.; Corrêa, Marcio N.; DePeters, Edward J.; Loor, Juan J.

    2013-01-01

    Polyunsaturated (PUFA) long-chain fatty acids (LCFAs) are more potent in eliciting molecular and tissue functional changes in monogastrics than saturated LCFA. From −21 through 10 days relative to parturition dairy cows were fed no supplemental LCFA (control), saturated LCFA (SFAT; mainly 16:0 and 18:0), or fish oil (FISH; high-PUFA). Twenty-seven genes were measured via quantitative RT-PCR in liver tissue on day −14 and day 10. Expression of nuclear receptor co-activators (CARM1, MED1), LCFA metabolism (ACSL1, SCD, ACOX1), and inflammation (IL6, TBK1, IKBKE) genes was lower with SFAT than control on day −14. Expression of SCD, however, was markedly lower with FISH than control or SFAT on both −14 and 10 days. FISH led to further decreases in expression on day 10 of LCFA metabolism (CD36, PLIN2, ACSL1, ACOX1), intracellular energy (UCP2, STK11, PRKAA1), de novo cholesterol synthesis (SREBF2), inflammation (IL6, TBK1, IKBKE), and nuclear receptor signaling genes (PPARD, MED1, NRIP1). No change in expression was observed for PPARA and RXRA. The increase of DGAT2, PLIN2, ACSL1, and ACOX1 on day 10 versus −14 in cows fed SFAT suggested upregulation of both beta-oxidation and lipid droplet (LD) formation. However, liver triacylglycerol concentration was similar among treatments. The hepatokine FGF21 and the gluconeogenic genes PC and PCK1 increased markedly on day 10 versus −14 only in controls. At the levels supplemented, the change in the profile of metabolic genes after parturition in cows fed saturated fat suggested a greater capacity for uptake of fatty acids and intracellular handling without excessive storage of LD. PMID:23825924

  20. Barley plants over-expressing the NAC transcription factor gene HvNAC005 show stunting and delay in development combined with early senescence

    PubMed Central

    Christiansen, Michael W.; Matthewman, Colette; Podzimska-Sroka, Dagmara; O’Shea, Charlotte; Lindemose, Søren; Møllegaard, Niels Erik; Holme, Inger B.; Hebelstrup, Kim; Skriver, Karen; Gregersen, Per L.

    2016-01-01

    The plant-specific NAC transcription factors have attracted particular attention because of their involvement in stress responses, senescence, and nutrient remobilization. The HvNAC005 gene of barley encodes a protein belonging to subgroup NAC-a6 of the NAC family. This study shows that HvNAC005 is associated with developmental senescence. It was significantly up-regulated following ABA treatment, supported by ABA-responsive elements in its promoter, but it was not up-regulated during dark-induced senescence. The C-termini of proteins closely related to HvNAC005 showed overall high divergence but also contained conserved short motifs. A serine- and leucine-containing central motif was essential for transcriptional activity of the HvNAC005 C-terminus in yeast. Over-expression of HvNAC005 in barley resulted in a strong phenotype with delayed development combined with precocious senescence. The over-expressing plants showed up-regulation of genes involved with secondary metabolism, hormone metabolism, stress, signalling, development, and transport. Up-regulation of senescence markers and hormone metabolism and signalling genes supports a role of HvNAC005 in the cross field of different hormone and signalling pathways. Binding of HvNAC005 to promoter sequences of putative target genes containing the T[G/A]CGT core motif was shown by direct protein–DNA interactions of HvNAC005 with promoters for two of the up-regulated genes. In conclusion, HvNAC005 was shown to be a strong positive regulator of senescence and so is an obvious target for the fine-tuning of gene expression in future attempts to improve nutrient remobilization related to the senescence process in barley. PMID:27436280

  1. Neighboring Genes Show Correlated Evolution in Gene Expression

    PubMed Central

    Ghanbarian, Avazeh T.; Hurst, Laurence D.

    2015-01-01

    When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

  2. Early embryonic expression of a LIM-homeobox gene Cs-lhx3 is downstream of beta-catenin and responsible for the endoderm differentiation in Ciona savignyi embryos.

    PubMed

    Satou, Y; Imai, K S; Satoh, N

    2001-09-01

    In early Ciona embryos, nuclear accumulation of beta-catenin is most probably the first step of endodermal cell specification. If beta-catenin is mis- and/or overexpressed, presumptive notochord cells and epidermal cells change their fates into endodermal cells, whereas if beta-catenin nuclear localization is downregulated by the overexpression of cadherin, the endoderm differentiation is suppressed, accompanied with the differentiation of extra epidermal cells ( Imai, K., Takada, N., Satoh, N. and Satou, Y. (2000) Development 127, 3009-3020). Subtractive hybridization screens of mRNAs between beta-catenin overexpressed embryos and cadherin overexpressed embryos were conducted to identify potential beta-catenin target genes that are responsible for endoderm differentiation in Ciona savignyi embryos. We found that a LIM-homeobox gene (Cs-lhx3), an otx homolog (Cs-otx) and an NK-2 class gene (Cs-ttf1) were among beta-catenin downstream genes. In situ hybridization signals for early zygotic expression of Cs-lhx3 were evident only in the presumptive endodermal cells as early as the 32-cell stage, those of Cs-otx in the mesoendodermal cells at the 32-cell stage and those of Cs-ttf1 in the endodermal cells at the 64-cell stage. Later, Cs-lhx3 was expressed again in a set of neuronal cells in the tailbud embryo, while Cs-otx was expressed in the anterior nervous system of the embryo. Expression of all three genes was upregulated in beta-catenin overexpressed embryos and downregulated in cadherin overexpressed embryos. Injection of morpholino oligonucleotides against Cs-otx did not affect the embryonic endoderm differentiation, although the formation of the central nervous system was suppressed. Injection of Cs-ttf1 morpholino oligonucleotides also failed to suppress the endoderm differentiation, although injection of its synthetic mRNAs resulted in ectopic development of endoderm differentiation marker alkaline phosphatase. By contrast, injection of Cs-lhx3 morpholino

  3. Current Gene Expression Studies in Esophageal Carcinoma

    PubMed Central

    Guo, Wei; Jiang, Yao-Guang

    2009-01-01

    Esophageal carcinoma is one of the deadliest cancers with highly aggressive potency, ranking as the sixth most common cancer among males and ninth most common cancer among females globally. Due to metastasis and invasion of surrounding tissues in early stage, the 5-year overall survival rate (14%) of esophageal cancer remains poor, even in comparison with the dismal survival rates (4%) from the 1970s. Numerous genes and proteins with abnormal expression and function involve in the pathogenesis of esophageal cancer, but the concrete process remains unclear. Microarray technique has been applied to investigating esophageal cancer. Many gene expression studies have been undertaken to look at the specific patterns of gene transcript levels in esophageal cancer. Human tissues and cell lines were used in these geneprofiling studies and a very valuable and interesting set of data has resulted from various microarray experiments. These expression studies have provided increased understanding of the complex pathological mechanisms involved in esophageal cancer. The eventual goal of microarray is to discover new markers for therapy and to customize therapy based on an individual tumor genetic composition. This review summarized the current state of gene expression profile studies in esophageal cancer. PMID:20514215

  4. Improved cell survival by the reduction of immediate-early gene expression in replication-defective mutants of herpes simplex virus type 1 but not by mutation of the virion host shutoff function.

    PubMed Central

    Johnson, P A; Wang, M J; Friedmann, T

    1994-01-01

    Derivatives of herpes simplex virus type 1 (HSV-1) have elicited considerable interest as gene transfer vectors because of their ability to infect a wide range of cell types efficiently, including fully differentiated neurons. However, it has been found that infection of many types of cell with vectors derived from replication-defective mutants of HSV-1 is associated with cytopathic effects (CPE). We have previously shown that viral gene expression played an important role in the induction of CPE caused by an HSV-1 mutant deleted for the essential immediate-early gene 3 (IE 3) (P.A. Johnson, A. Miyanohara, F. Levine, T. Cahill, and T. Friedmann, J. Virol. 66:2952-2965, 1992). We have investigated which viral genes might be responsible for CPE by comparing the ability of each of the individual genes expressed by an IE 3 deletion mutant during a nonproductive infection to inhibit biochemical transformation after cotransfection of BHK or CV-1 cells with a selectable marker gene. Transfection of IE genes 1,2, and 4 individually all caused a marked inhibition of colony formation, while transfection of IE 5 and the large subunit of ribonucleotide reductase had little effect. These results suggested that it would be necessary to mutate or reduce the expression of nearly all HSV-1 IE genes to reduce virus-induced CPE. Therefore, we have used VP16 mutants, which are unable to transinduce IE gene expression (C. I. Ace, T. A. McKee, J. M. Ryan, J. M. Cameron, and C. M. Preston, J. Virol. 63:2260-2269, 1989), to derive two replication-defective strains: 14H delta 3, which is deleted for both copies of IE 3, and in 1850 delta 42, which has a deletion in the essential early gene UL42. The IE 3-VP16 double mutant, 14H delta 3, is significantly less toxic than a single IE 3 deletion mutant over a range of multiplicities of infection, as measured in a cell-killing assay, and has an enhanced ability to persist in infected cells in a biologically retrievable form. In contrast, the UL

  5. Gene expression profile of pulpitis.

    PubMed

    Galicia, J C; Henson, B R; Parker, J S; Khan, A A

    2016-06-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the significance analysis of microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (⩾30 mm on VAS) compared with those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology. PMID:27052691

  6. Differential effects of Th1, monocyte/macrophage and Th2 cytokine mixtures on early gene expression for glial and neural-related molecules in central nervous system mixed glial cell cultures: neurotrophins, growth factors and structural proteins

    PubMed Central

    Lisak, Robert P; Benjamins, Joyce A; Bealmear, Beverly; Nedelkoska, Liljana; Yao, Bin; Land, Susan; Studzinski, Diane

    2007-01-01

    Background In multiple sclerosis, inflammatory cells are found in both active and chronic lesions, and it is increasingly clear that cytokines are involved directly and indirectly in both formation and inhibition of lesions. We propose that cytokine mixtures typical of Th1 or Th2 lymphocytes, or monocyte/macrophages each induce unique molecular changes in glial cells. Methods To examine changes in gene expression that might occur in glial cells exposed to the secreted products of immune cells, we have used gene array analysis to assess the early effects of different cytokine mixtures on mixed CNS glia in culture. We compared the effects of cytokines typical of Th1 and Th2 lymphocytes and monocyte/macrophages (M/M) on CNS glia after 6 hours of treatment. Results In this paper we focus on changes with potential relevance for neuroprotection and axon/glial interactions. Each mixture of cytokines induced a unique pattern of changes in genes for neurotrophins, growth and maturation factors and related receptors; most notably an alternatively spliced form of trkC was markedly downregulated by Th1 and M/M cytokines, while Th2 cytokines upregulated BDNF. Genes for molecules of potential importance in axon/glial interactions, including cell adhesion molecules, connexins, and some molecules traditionally associated with neurons showed significant changes, while no genes for myelin-associated genes were regulated at this early time point. Unexpectedly, changes occurred in several genes for proteins initially associated with retina, cancer or bone development, and not previously reported in glial cells. Conclusion Each of the three cytokine mixtures induced specific changes in gene expression that could be altered by pharmacologic strategies to promote protection of the central nervous system. PMID:18088439

  7. Systems Biophysics of Gene Expression

    PubMed Central

    Vilar, Jose M.G.; Saiz, Leonor

    2013-01-01

    Gene expression is a process central to any form of life. It involves multiple temporal and functional scales that extend from specific protein-DNA interactions to the coordinated regulation of multiple genes in response to intracellular and extracellular changes. This diversity in scales poses fundamental challenges to the use of traditional approaches to fully understand even the simplest gene expression systems. Recent advances in computational systems biophysics have provided promising avenues to reliably integrate the molecular detail of biophysical process into the system behavior. Here, we review recent advances in the description of gene regulation as a system of biophysical processes that extend from specific protein-DNA interactions to the combinatorial assembly of nucleoprotein complexes. There is now basic mechanistic understanding on how promoters controlled by multiple, local and distal, DNA binding sites for transcription factors can actively control transcriptional noise, cell-to-cell variability, and other properties of gene regulation, including precision and flexibility of the transcriptional responses. PMID:23790365

  8. Control of Renin Gene Expression

    PubMed Central

    Glenn, Sean T.; Jones, Craig A.; Gross, Kenneth W.; Pan, Li

    2015-01-01

    Renin, as part of the renin-angiotensin system, plays a critical role in the regulation of blood pressure, electrolyte homeostasis, mammalian renal development and progression of fibrotic/hypertrophic diseases. Renin gene transcription is subject to complex developmental and tissue-specific regulation. Initial studies using the mouse As4.1 cell line, which has many characteristics of the renin-expressing juxtaglomerular cells of the kidney, have identified a proximal promoter region (−197 to −50 bp) and an enhancer (−2866 to −2625 bp) upstream of the Ren-1c gene, which are critical for renin gene expression. The proximal promoter region contains several transcription factor-binding sites including a binding site for the products of the developmental control genes Hox. The enhancer consists of at least 11 transcription factor-binding sites and is responsive to various signal transduction pathways including cAMP, retinoic acid, endothelin-1, and cytokines, all of which are known to alter renin mRNA levels. Furthermore, in vivo models have validated several of these key components found within the proximal promoter region and the enhancer as well as other key sites necessary for renin gene transcription. PMID:22576577

  9. Differential modulation of expression of nuclear receptor mediated genes by tris(2-butoxyethyl) phosphate (TBOEP) on early life stages of zebrafish (Danio rerio).

    PubMed

    Ma, Zhiyuan; Yu, Yijun; Tang, Song; Liu, Hongling; Su, Guanyong; Xie, Yuwei; Giesy, John P; Hecker, Markus; Yu, Hongxia

    2015-12-01

    As one substitute for phased-out brominated flame retardants (BFRs), tris(2-butoxyethyl) phosphate (TBOEP) is frequently detected in aquatic organisms. However, knowledge about endocrine disrupting mechanisms associated with nuclear receptors caused by TBOEP remained restricted to results from in vitro studies with mammalian cells. In the study, results of which are presented here, embryos/larvae of zebrafish (Danio rerio) were exposed to 0.02, 0.1 or 0.5μM TBOEP to investigate expression of genes under control of several nuclear hormone receptors (estrogen receptors (ERs), androgen receptor (AR), thyroid hormone receptor alpha (TRα), mineralocorticoid receptor (MR), glucocorticoid receptor (GR), aryl hydrocarbon (AhR), peroxisome proliferator-activated receptor alpha (PPARα), and pregnane×receptor (P×R)) pathways at 120hpf. Exposure to 0.5μM TBOEP significantly (p<0.05, one-way analysis of variance) up-regulated expression of estrogen receptors (ERs, er1, er2a, and er2b) genes and ER-associated genes (vtg4, vtg5, pgr, ncor, and ncoa3), indicating TBOEP modulates the ER pathway. In contrast, expression of most genes (mr, 11βhsd, ube2i,and adrb2b) associated with the mineralocorticoid receptor (MR) pathway were significantly down-regulated. Furthermore, in vitro mammalian cell-based (MDA-kb2 and H4IIE-luc) receptor transactivation assays, were also conducted to investigate possible agonistic or antagonistic effects on AR- and AhR-mediated pathways. In mammalian cells, none of these pathways were affected by TBOEP at the concentrations studied. Receptor-mediated responses (in vivo) and mammalian cell lines receptor binding assay (in vitro) combined with published information suggest that TBOEP can modulate receptor-mediated, endocrine process (in vivo/in vitro), particularly ER and MR. PMID:26562049

  10. Early Life Exposure to Fructose Alters Maternal, Fetal and Neonatal Hepatic Gene Expression and Leads to Sex-Dependent Changes in Lipid Metabolism in Rat Offspring

    PubMed Central

    Clayton, Zoe E.; Vickers, Mark H.; Bernal, Angelica; Yap, Cassandra; Sloboda, Deborah M.

    2015-01-01

    Aim Fructose consumption is associated with altered hepatic function and metabolic compromise and not surprisingly has become a focus for perinatal studies. We have previously shown that maternal fructose intake results in sex specific changes in fetal, placental and neonatal outcomes. In this follow-up study we investigated effects on maternal, fetal and neonatal hepatic fatty acid metabolism and immune modulation. Methods Pregnant rats were randomised to either control (CON) or high-fructose (FR) diets. Fructose was given in solution and comprised 20% of total caloric intake. Blood and liver samples were collected at embryonic day 21 (E21) and postnatal day (P)10. Maternal liver samples were also collected at E21 and P10. Liver triglyceride and glycogen content was measured with standard assays. Hepatic gene expression was measured with qPCR. Results Maternal fructose intake during pregnancy resulted in maternal hepatic ER stress, hepatocellular injury and increased levels of genes that favour lipogenesis. These changes were associated with a reduction in the NLRP3 inflammasome. Fetuses of mothers fed a high fructose diet displayed increased hepatic fructose transporter and reduced fructokinase mRNA levels and by 10 days of postnatal age, also have hepatic ER stress, and elevated IL1β mRNA levels. At P10, FR neonates demonstrated increased hepatic triglyceride content and particularly in males, associated changes in the expression of genes regulating beta oxidation and the NLRP3 inflammasome. Further, prenatal fructose results in sex-dependant changes in levels of key clock genes. Conclusions Maternal fructose intake results in age and sex-specific alterations in maternal fetal and neonatal free fatty acid metabolism, which may be associated in disruptions in core clock gene machinery. How these changes are associated with hepatic inflammatory processes is still unclear, although suppression of the hepatic inflammasome, as least in mothers and male neonates may

  11. Gene expression throughout a vertebrate's embryogenesis

    PubMed Central

    2011-01-01

    Background Describing the patterns of gene expression during embryonic development has broadened our understanding of the processes and patterns that define morphogenesis. Yet gene expression patterns have not been described throughout vertebrate embryogenesis. This study presents statistical analyses of gene expression during all 40 developmental stages in the teleost Fundulus heteroclitus using four biological replicates per stage. Results Patterns of gene expression for 7,000 genes appear to be important as they recapitulate developmental timing. Among the 45% of genes with significant expression differences between pairs of temporally adjacent stages, significant differences in gene expression vary from as few as five to more than 660. Five adjacent stages have disproportionately more significant changes in gene expression (> 200 genes) relative to other stages: four to eight and eight to sixteen cell stages, onset of circulation, pre and post-hatch, and during complete yolk absorption. The fewest differences among adjacent stages occur during gastrulation. Yet, at stage 16, (pre-mid-gastrulation) the largest number of genes has peak expression. This stage has an over representation of genes in oxidative respiration and protein expression (ribosomes, translational genes and proteases). Unexpectedly, among all ribosomal genes, both strong positive and negative correlations occur. Similar correlated patterns of expression occur among all significant genes. Conclusions These data provide statistical support for the temporal dynamics of developmental gene expression during all stages of vertebrate development. PMID:21356103

  12. Disease Severity Is Associated with Differential Gene Expression at the Early and Late Phases of Infection in Nonhuman Primates Infected with Different H5N1 Highly Pathogenic Avian Influenza Viruses

    PubMed Central

    Muramoto, Yukiko; Shoemaker, Jason E.; Le, Mai Quynh; Itoh, Yasushi; Tamura, Daisuke; Sakai-Tagawa, Yuko; Imai, Hirotaka; Uraki, Ryuta; Takano, Ryo; Kawakami, Eiryo; Ito, Mutsumi; Okamoto, Kiyoko; Ishigaki, Hirohito; Mimuro, Hitomi; Sasakawa, Chihiro; Matsuoka, Yukiko; Noda, Takeshi; Fukuyama, Satoshi; Ogasawara, Kazumasa; Kitano, Hiroaki

    2014-01-01

    ABSTRACT Occasional transmission of highly pathogenic avian H5N1 influenza viruses to humans causes severe pneumonia with high mortality. To better understand the mechanisms via which H5N1 viruses induce severe disease in humans, we infected cynomolgus macaques with six different H5N1 strains isolated from human patients and compared their pathogenicity and the global host responses to the virus infection. Although all H5N1 viruses replicated in the respiratory tract, there was substantial heterogeneity in their replicative ability and in the disease severity induced, which ranged from asymptomatic to fatal. A comparison of global gene expression between severe and mild disease cases indicated that interferon-induced upregulation of genes related to innate immunity, apoptosis, and antigen processing/presentation in the early phase of infection was limited in severe disease cases, although interferon expression was upregulated in both severe and mild cases. Furthermore, coexpression analysis of microarray data, which reveals the dynamics of host responses during the infection, demonstrated that the limited expression of these genes early in infection led to a failure to suppress virus replication and to the hyperinduction of genes related to immunity, inflammation, coagulation, and homeostasis in the late phase of infection, resulting in a more severe disease. Our data suggest that the attenuated interferon-induced activation of innate immunity, apoptosis, and antigen presentation in the early phase of H5N1 virus infection leads to subsequent severe disease outcome. IMPORTANCE Highly pathogenic avian H5N1 influenza viruses sometimes transmit to humans and cause severe pneumonia with ca. 60% lethality. The continued circulation of these viruses poses a pandemic threat; however, their pathogenesis in mammals is not fully understood. We, therefore, investigated the pathogenicity of six H5N1 viruses and compared the host responses of cynomolgus macaques to the virus

  13. Gene expression profiling in sinonasal adenocarcinoma

    PubMed Central

    2009-01-01

    Background Sinonasal adenocarcinomas are uncommon tumors which develop in the ethmoid sinus after exposure to wood dust. Although the etiology of these tumors is well defined, very little is known about their molecular basis and no diagnostic tool exists for their early detection in high-risk workers. Methods To identify genes involved in this disease, we performed gene expression profiling using cancer-dedicated microarrays, on nine matched samples of sinonasal adenocarcinomas and non-tumor sinusal tissue. Microarray results were validated by quantitative RT-PCR and immunohistochemistry on two additional sets of tumors. Results Among the genes with significant differential expression we selected LGALS4, ACS5, CLU, SRI and CCT5 for further exploration. The overexpression of LGALS4, ACS5, SRI, CCT5 and the downregulation of CLU were confirmed by quantitative RT-PCR. Immunohistochemistry was performed for LGALS4 (Galectin 4), ACS5 (Acyl-CoA synthetase) and CLU (Clusterin) proteins: LGALS4 was highly up-regulated, particularly in the most differentiated tumors, while CLU was lost in all tumors. The expression of ACS5, was more heterogeneous and no correlation was observed with the tumor type. Conclusion Within our microarray study in sinonasal adenocarcinoma we identified two proteins, LGALS4 and CLU, that were significantly differentially expressed in tumors compared to normal tissue. A further evaluation on a new set of tissues, including precancerous stages and low grade tumors, is necessary to evaluate the possibility of using them as diagnostic markers. PMID:19903339

  14. Gene Expression Studies in Mosquitoes

    PubMed Central

    Chen, Xlao-Guang; Mathur, Geetika; James, Anthony A.

    2009-01-01

    Research on gene expression in mosquitoes is motivated by both basic and applied interests. Studies of genes involved in hematophagy, reproduction, olfaction, and immune responses reveal an exquisite confluence of biological adaptations that result in these highly-successful life forms. The requirement of female mosquitoes for a bloodmeal for propagation has been exploited by a wide diversity of viral, protozoan and metazoan pathogens as part of their life cycles. Identifying genes involved in host-seeking, blood feeding and digestion, reproduction, insecticide resistance and susceptibility/refractoriness to pathogen development is expected to provide the bases for the development of novel methods to control mosquito-borne diseases. Advances in mosquito transgenesis technologies, the availability of whole genome sequence information, mass sequencing and analyses of transcriptomes and RNAi techniques will assist development of these tools as well as deepen the understanding of the underlying genetic components for biological phenomena characteristic of these insect species. PMID:19161831

  15. The Gene Expression Omnibus database

    PubMed Central

    Clough, Emily; Barrett, Tanya

    2016-01-01

    The Gene Expression Omnibus (GEO) database is an international public repository that archives and freely distributes high-throughput gene expression and other functional genomics data sets. Created in 2000 as a worldwide resource for gene expression studies, GEO has evolved with rapidly changing technologies and now accepts high-throughput data for many other data applications, including those that examine genome methylation, chromatin structure, and genome–protein interactions. GEO supports community-derived reporting standards that specify provision of several critical study elements including raw data, processed data, and descriptive metadata. The database not only provides access to data for tens of thousands of studies, but also offers various Web-based tools and strategies that enable users to locate data relevant to their specific interests, as well as to visualize and analyze the data. This chapter includes detailed descriptions of methods to query and download GEO data and use the analysis and visualization tools. The GEO homepage is at http://www.ncbi.nlm.nih.gov/geo/. PMID:27008011

  16. The Gene Expression Omnibus Database.

    PubMed

    Clough, Emily; Barrett, Tanya

    2016-01-01

    The Gene Expression Omnibus (GEO) database is an international public repository that archives and freely distributes high-throughput gene expression and other functional genomics data sets. Created in 2000 as a worldwide resource for gene expression studies, GEO has evolved with rapidly changing technologies and now accepts high-throughput data for many other data applications, including those that examine genome methylation, chromatin structure, and genome-protein interactions. GEO supports community-derived reporting standards that specify provision of several critical study elements including raw data, processed data, and descriptive metadata. The database not only provides access to data for tens of thousands of studies, but also offers various Web-based tools and strategies that enable users to locate data relevant to their specific interests, as well as to visualize and analyze the data. This chapter includes detailed descriptions of methods to query and download GEO data and use the analysis and visualization tools. The GEO homepage is at http://www.ncbi.nlm.nih.gov/geo/. PMID:27008011

  17. Alterations in gene expression levels provide early indicators of chemical stress during Xenopus laevis embryo development: A case study with perfluorooctane sulfonate (PFOS).

    PubMed

    San-Segundo, Laura; Guimarães, Laura; Fernández Torija, Carlos; Beltrán, Eulalia M; Guilhermino, Lúcia; Pablos, María Victoria

    2016-05-01

    In the present study, Xenopus laevis embryos were exposed to a range of perfluorooctane sulfonate (PFOS) concentrations (0, 0.5, 6, 12, 24, 48 and 96mg/L) for 96h in laboratorial conditions to establish toxicity along with possible gene expression changes. Mortality and deformities were monitored daily and head-tail length was measured at the end of the assay as an indicator of growth. At 24 and 96h post-exposure (hpe), the mRNA expression levels of the genetic markers involved in general stress responses (hsp70, hsp47, crh-a and ucn1), oxidative stress (cat.2 and sod), lipid metabolism (ppard) and apoptosis (tp53 and bax) were analyzed by RT-qPCR. Malformations were significantly higher in the embryos exposed to the highest PFOS concentration (41.8% to 56.4%) compared to controls (5.5%) at 48, 72 and 96hpe. Growth inhibition was observed in the embryos exposed to PFOS concentrations≥48mg/L. At 24 hpe, a statistically significant up-regulation of genes hsp70, hsp47, ppard, tp53 and bax in relation to controls was found. Similar responses were found for genes hsp70, hsp47, crh-a, ucn1, sod and ppard at 96 hpe. Alterations in the mRNA expression levels indicated both a stress response to PFOS exposure during X. laevis embryo development, and alterations in the regulation of oxidative stress, apoptosis, and differentiation. These molecular alterations were detected at an earlier exposure time or at lower concentrations than those producing developmental toxicity. Therefore, these sensitive warning signals could be used together with other biomarkers to supplement alternative methods (i.e. the frog embryo test) for developmental toxicity safety evaluations, and as tools in amphibian risk assessments for PFOS and its potential substitutes. PMID:26802562

  18. Global analysis of patterns of gene expression during Drosophila embryogenesis

    PubMed Central

    Tomancak, Pavel; Berman, Benjamin P; Beaton, Amy; Weiszmann, Richard; Kwan, Elaine; Hartenstein, Volker; Celniker, Susan E; Rubin, Gerald M

    2007-01-01

    Background Cell and tissue specific gene expression is a defining feature of embryonic development in multi-cellular organisms. However, the range of gene expression patterns, the extent of the correlation of expression with function, and the classes of genes whose spatial expression are tightly regulated have been unclear due to the lack of an unbiased, genome-wide survey of gene expression patterns. Results We determined and documented embryonic expression patterns for 6,003 (44%) of the 13,659 protein-coding genes identified in the Drosophila melanogaster genome with over 70,000 images and controlled vocabulary annotations. Individual expression patterns are extraordinarily diverse, but by supplementing qualitative in situ hybridization data with quantitative microarray time-course data using a hybrid clustering strategy, we identify groups of genes with similar expression. Of 4,496 genes with detectable expression in the embryo, 2,549 (57%) fall into 10 clusters representing broad expression patterns. The remaining 1,947 (43%) genes fall into 29 clusters representing restricted expression, 20% patterned as early as blastoderm, with the majority restricted to differentiated cell types, such as epithelia, nervous system, or muscle. We investigate the relationship between expression clusters and known molecular and cellular-physiological functions. Conclusion Nearly 60% of the genes with detectable expression exhibit broad patterns reflecting quantitative rather than qualitative differences between tissues. The other 40% show tissue-restricted expression; the expression patterns of over 1,500 of these genes are documented here for the first time. Within each of these categories, we identified clusters of genes associated with particular cellular and developmental functions. PMID:17645804

  19. Complete Mitochondrial Genome of Helicoverpa zea (Lepidoptera: Noctuidae) and Expression Profiles of Mitochondrial-Encoded Genes in Early and Late Embryos.

    PubMed

    Perera, Omaththage P; Walsh, Thomas K; Luttrell, Randall G

    2016-01-01

    The mitochondrial genome (mitogenome) of the bollworm, Helicoverpa zea (Boddie), was assembled using paired-end nucleotide sequence reads generated with a next-generation sequencing platform. Assembly resulted in a mitogenome of 15,348 bp with greater than 17,000-fold average coverage. Organization of the H. zea mitogenome (gene order and orientation) was identical to other known lepidopteran mitogenome sequences. Compared with Helicoverpa armigera (Hübner) mitogenome, there were a few differences in the lengths of gaps between genes, but the lengths of nucleotide overlaps were essentially conserved between the two species. Nucleotide composition of the H. zea mitochondrial genome was very similar to those of the related species H. armigera and Helicoverpa punctigera Wallengren. Mapping of RNA-Seq reads obtained from 2-h eggs and 48-h embryos to protein coding genes (PCG) revealed that all H. zea PCGs were processed as single mature gene transcripts except for the bicistronic atp8 + atp6 transcript. A tRNA-like sequence predicted to form a hammer-head-like secondary structure that may play a role in transcription start and mitogenome replication was identified within the control region of the H. zea mitogenome. Similar structures were also found within the control regions of several other lepidopteran species. Expression analysis revealed significant differences in levels of expression of PCGs within each developmental stage, but the pattern of variation was similar in both developmental stages analyzed in this study. Mapping of RNA-Seq reads to PCG transcripts also identified transcription termination and polyadenylation sites that differed from the sites described in other lepidopteran species. PMID:27126963

  20. Complete Mitochondrial Genome of Helicoverpa zea (Lepidoptera: Noctuidae) and Expression Profiles of Mitochondrial-Encoded Genes in Early and Late Embryos

    PubMed Central

    Perera, Omaththage P.; Walsh, Thomas K.; Luttrell, Randall G.

    2016-01-01

    The mitochondrial genome (mitogenome) of the bollworm, Helicoverpa zea (Boddie), was assembled using paired-end nucleotide sequence reads generated with a next-generation sequencing platform. Assembly resulted in a mitogenome of 15,348 bp with greater than 17,000-fold average coverage. Organization of the H. zea mitogenome (gene order and orientation) was identical to other known lepidopteran mitogenome sequences. Compared with Helicoverpa armigera (Hübner) mitogenome, there were a few differences in the lengths of gaps between genes, but the lengths of nucleotide overlaps were essentially conserved between the two species. Nucleotide composition of the H. zea mitochondrial genome was very similar to those of the related species H. armigera and Helicoverpa punctigera Wallengren. Mapping of RNA-Seq reads obtained from 2-h eggs and 48-h embryos to protein coding genes (PCG) revealed that all H. zea PCGs were processed as single mature gene transcripts except for the bicistronic atp8 + atp6 transcript. A tRNA-like sequence predicted to form a hammer-head-like secondary structure that may play a role in transcription start and mitogenome replication was identified within the control region of the H. zea mitogenome. Similar structures were also found within the control regions of several other lepidopteran species. Expression analysis revealed significant differences in levels of expression of PCGs within each developmental stage, but the pattern of variation was similar in both developmental stages analyzed in this study. Mapping of RNA-Seq reads to PCG transcripts also identified transcription termination and polyadenylation sites that differed from the sites described in other lepidopteran species. PMID:27126963

  1. Classification of genes based on gene expression analysis

    NASA Astrophysics Data System (ADS)

    Angelova, M.; Myers, C.; Faith, J.

    2008-05-01

    Systems biology and bioinformatics are now major fields for productive research. DNA microarrays and other array technologies and genome sequencing have advanced to the point that it is now possible to monitor gene expression on a genomic scale. Gene expression analysis is discussed and some important clustering techniques are considered. The patterns identified in the data suggest similarities in the gene behavior, which provides useful information for the gene functionalities. We discuss measures for investigating the homogeneity of gene expression data in order to optimize the clustering process. We contribute to the knowledge of functional roles and regulation of E. coli genes by proposing a classification of these genes based on consistently correlated genes in expression data and similarities of gene expression patterns. A new visualization tool for targeted projection pursuit and dimensionality reduction of gene expression data is demonstrated.

  2. Classification of genes based on gene expression analysis

    SciTech Connect

    Angelova, M. Myers, C. Faith, J.

    2008-05-15

    Systems biology and bioinformatics are now major fields for productive research. DNA microarrays and other array technologies and genome sequencing have advanced to the point that it is now possible to monitor gene expression on a genomic scale. Gene expression analysis is discussed and some important clustering techniques are considered. The patterns identified in the data suggest similarities in the gene behavior, which provides useful information for the gene functionalities. We discuss measures for investigating the homogeneity of gene expression data in order to optimize the clustering process. We contribute to the knowledge of functional roles and regulation of E. coli genes by proposing a classification of these genes based on consistently correlated genes in expression data and similarities of gene expression patterns. A new visualization tool for targeted projection pursuit and dimensionality reduction of gene expression data is demonstrated.

  3. Identification of four soybean reference genes for gene expression normalization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene expression analysis requires the use of reference genes stably expressed independently of specific tissues or environmental conditions. Housekeeping genes (e.g., actin, tubulin, ribosomal, polyubiquitin and elongation factor 1-alpha) are commonly used as reference genes with the assumption tha...

  4. Mitochondrial RNA granules: Compartmentalizing mitochondrial gene expression.

    PubMed

    Jourdain, Alexis A; Boehm, Erik; Maundrell, Kinsey; Martinou, Jean-Claude

    2016-03-14

    In mitochondria, DNA replication, gene expression, and RNA degradation machineries coexist within a common nondelimited space, raising the question of how functional compartmentalization of gene expression is achieved. Here, we discuss the recently characterized "mitochondrial RNA granules," mitochondrial subdomains with an emerging role in the regulation of gene expression. PMID:26953349

  5. Gene expression in the brain during reovirus encephalitis

    PubMed Central

    Tyler, Kenneth L; Leser, J Smith; Phang, Tzu L; Clarke, Penny

    2010-01-01

    Viral encephalitis remains a significant cause of morbidity and mortality throughout the world. We performed microarray analysis to identify genes and pathways that are differentially regulated during reovirus encephalitis and that may provide novel therapeutic targets for virus-induced diseases of the central nervous system (CNS). An increase in the expression of 130 cellular genes was found in the brains of reovirus-infected mice at early times post infection, compared to mock-infected controls. The up-regulation of these genes was consistent with activation of innate immune responses, particularly interferon signaling. At later times post infection, when significant CNS injury is present and mice exhibit signs of severe neurologic disease, many more (1374) genes were up-regulated, indicating that increased gene expression correlates with disease pathology. Virus-induced gene expression at late times post infection was again consistent with the activation of innate immune responses. However, additional significant pathways included those associated with cytokine signaling and apoptosis, both of which can contribute to CNS injury. This is the first report comparing virus-induced cellular gene and pathway regulation at early and late times following virus infection of the brain. The shift of virus-induced gene expression from innate immune responses at early times post infection to cytokine signaling and apoptosis at later times suggests a potential therapeutic strategy that preserves early protective responses whilst inhibiting later responses that contribute to pathogenesis. PMID:20158406

  6. Strong early seed-specific gene regulatory region

    DOEpatents

    Broun, Pierre; Somerville, Chris

    2002-01-01

    Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

  7. Strong early seed-specific gene regulatory region

    DOEpatents

    Broun, Pierre; Somerville, Chris

    1999-01-01

    Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

  8. Using Immediate-Early Genes to Map Hippocampal Subregional Functions

    ERIC Educational Resources Information Center

    Kubik, Stepan; Miyashita, Teiko; Guzowski, John F.

    2007-01-01

    Different functions have been suggested for the hippocampus and its subdivisions along both transversal and longitudinal axes. Expression of immediate-early genes (IEGs) has been used to map specific functions onto neuronal activity in different areas of the brain including the hippocampus (IEG imaging). Here we review IEG studies on hippocampal…

  9. Expression Pattern of Inflammatory Response Genes and Their Regulatory MicroRNAs in Bovine Oviductal Cells in Response to Lipopolysaccharide: Implication for Early Embryonic Development

    PubMed Central

    Ibrahim, Sally; Salilew-Wondim, Dessie; Rings, Franca; Hoelker, Michael; Neuhoff, Christiane; Tholen, Ernst; Looft, Christian; Schellander, Karl; Tesfaye, Dawit

    2015-01-01

    In the present study, we used an in vitro model to investigate the response of the oviduct with respect to inflammatory mediators and their regulatory microRNAs in case of bacterial infection and subsequent association with embryo survival. For this, we conducted two experiments. In the first experiment, cultured primary bovine oviductal cells (BOEC) were challenged with lipopolysaccharide (LPS) for 24h and the temporal expression pattern of inflammatory mediators and their regulatory microRNAs were measured at 0, 3, 6, 12, 24 and 48h after LPS treatment. Intriguingly, the temporal patterns of all miRNAs except miR-21 were significantly up-regulated at 6h after LPS treatment. Whereas, we observed significant overexpression of pro-inflammatory mediators as tumor necrosis factor alpha (TNFα) and interleukin-1 beta (IL1β) after LPS challenge for 24h. On the other hand, the expression level of essential elements like oviductal glycoprotein 1 (OVGP1) and insulin-like growth factor 2 (IGF2) was significantly decreased in challenged groups compared with control. Moreover, miR-155, miR-146a, miR-223, miR-21, miR-16 and miR-215 have shown a clear suppression in challenged group after LPS treatment. In the 2nd experiment there were four groups of blastocysts produced, namely embryo+LPS free media, embryo+LPS, BOEC+embryo and BOEC+embryo+LPS. The suboptimal oviduct environment due to LPS challenge is found to have a significant influence on the expression of inflammatory response genes (TNFα and CSF1), stress response genes (SOD and CAT), mitochondrial activity, reactive oxygen species (ROS) accumulation and apoptotic level either in cultured or co-cultured blastocysts. Collectively, LPS challenge led to aberrant changes in oviductal transcriptome profile, which could lead to a suboptimal environment for embryo development. PMID:25764515

  10. Expression pattern of inflammatory response genes and their regulatory micrornas in bovine oviductal cells in response to lipopolysaccharide: implication for early embryonic development.

    PubMed

    Ibrahim, Sally; Salilew-Wondim, Dessie; Rings, Franca; Hoelker, Michael; Neuhoff, Christiane; Tholen, Ernst; Looft, Christian; Schellander, Karl; Tesfaye, Dawit

    2015-01-01

    In the present study, we used an in vitro model to investigate the response of the oviduct with respect to inflammatory mediators and their regulatory microRNAs in case of bacterial infection and subsequent association with embryo survival. For this, we conducted two experiments. In the first experiment, cultured primary bovine oviductal cells (BOEC) were challenged with lipopolysaccharide (LPS) for 24h and the temporal expression pattern of inflammatory mediators and their regulatory microRNAs were measured at 0, 3, 6, 12, 24 and 48h after LPS treatment. Intriguingly, the temporal patterns of all miRNAs except miR-21 were significantly up-regulated at 6h after LPS treatment. Whereas, we observed significant overexpression of pro-inflammatory mediators as tumor necrosis factor alpha (TNFα) and interleukin-1 beta (IL1β) after LPS challenge for 24h. On the other hand, the expression level of essential elements like oviductal glycoprotein 1 (OVGP1) and insulin-like growth factor 2 (IGF2) was significantly decreased in challenged groups compared with control. Moreover, miR-155, miR-146a, miR-223, miR-21, miR-16 and miR-215 have shown a clear suppression in challenged group after LPS treatment. In the 2nd experiment there were four groups of blastocysts produced, namely embryo+LPS free media, embryo+LPS, BOEC+embryo and BOEC+embryo+LPS. The suboptimal oviduct environment due to LPS challenge is found to have a significant influence on the expression of inflammatory response genes (TNFα and CSF1), stress response genes (SOD and CAT), mitochondrial activity, reactive oxygen species (ROS) accumulation and apoptotic level either in cultured or co-cultured blastocysts. Collectively, LPS challenge led to aberrant changes in oviductal transcriptome profile, which could lead to a suboptimal environment for embryo development. PMID:25764515

  11. Expression analysis of five zebrafish RXFP3 homologues reveals evolutionary conservation of gene expression pattern.

    PubMed

    Donizetti, Aldo; Fiengo, Marcella; Iazzetti, Giovanni; del Gaudio, Rosanna; Di Giaimo, Rossella; Pariante, Paolo; Minucci, Sergio; Aniello, Francesco

    2015-01-01

    Relaxin peptides exert different functions in reproduction and neuroendocrine processes via interaction with two evolutionarily unrelated groups of receptors: RXFP1 and RXFP2 on one hand, RXFP3 and RXFP4 on the other hand. Evolution of receptor genes after splitting of tetrapods and teleost lineage led to a different retention rate between mammals and fish, with the latter having more gene copies compared to the former. In order to improve our knowledge on the evolution of the relaxin ligands/receptors system and have insights on their function in early stages of life, in the present paper we analyzed the expression pattern of five zebrafish RXFP3 homologue genes during embryonic development. In our analysis, we show that only two of the five genes are expressed during embryogenesis and that their transcripts are present in all the developmental stages. Spatial localization analysis of these transcripts revealed that the gene expression is restricted in specific territories starting from early pharyngula stage. Both genes are expressed in the brain but in different cell clusters and in extra-neural territories, one gene in the interrenal gland and the other in the pancreas. These two genes share expression territories with the homologue mammalian counterpart, highlighting a general conservation of gene expression regulatory processes and their putative function during evolution that are established early in vertebrate embryogenesis. PMID:25384467

  12. Does inbreeding affect gene expression in birds?

    PubMed Central

    Hansson, Bengt; Naurin, Sara; Hasselquist, Dennis

    2014-01-01

    Inbreeding increases homozygosity, exposes genome-wide recessive deleterious alleles and often reduces fitness. The physiological and reproductive consequences of inbreeding may be manifested already during gene regulation, but the degree to which inbreeding influences gene expression is unknown in most organisms, including in birds. To evaluate the pattern of inbreeding-affected gene expression over the genome and in relation to sex, we performed a transcriptome-wide gene expression (10 695 genes) study of brain tissue of 10-day-old inbred and outbred, male and female zebra finches. We found significantly lower gene expression in females compared with males at Z-linked genes, confirming that dosage compensation is incomplete in female birds. However, inbreeding did not affect gene expression at autosomal or sex-linked genes, neither in males nor in females. Analyses of single genes again found a clear sex-biased expression at Z-linked genes, whereas only a single gene was significantly affected by inbreeding. The weak effect of inbreeding on gene expression in zebra finches contrasts to the situation, for example, in Drosophila where inbreeding has been found to influence gene expression more generally and at stress-related genes in particular. PMID:25232028

  13. Seasonal Effects on Gene Expression

    PubMed Central

    Goldinger, Anita; Shakhbazov, Konstantin; Henders, Anjali K.; McRae, Allan F.; Montgomery, Grant W.; Powell, Joseph E.

    2015-01-01

    Many health conditions, ranging from psychiatric disorders to cardiovascular disease, display notable seasonal variation in severity and onset. In order to understand the molecular processes underlying this phenomenon, we have examined seasonal variation in the transcriptome of 606 healthy individuals. We show that 74 transcripts associated with a 12-month seasonal cycle were enriched for processes involved in DNA repair and binding. An additional 94 transcripts demonstrated significant seasonal variability that was largely influenced by blood cell count levels. These transcripts were enriched for immune function, protein production, and specific cellular markers for lymphocytes. Accordingly, cell counts for erythrocytes, platelets, neutrophils, monocytes, and CD19 cells demonstrated significant association with a 12-month seasonal cycle. These results demonstrate that seasonal variation is an important environmental regulator of gene expression and blood cell composition. Notable changes in leukocyte counts and genes involved in immune function indicate that immune cell physiology varies throughout the year in healthy individuals. PMID:26023781

  14. MRI of Transgene Expression: Correlation to Therapeutic Gene Expression

    PubMed Central

    Ichikawa, Tomotsugu; Högemanny, Dagmar; Saeki, Yoshinaga; Tyminski, Edyta; Terada, Kinya; Weissleder, Ralph; Chiocca, E Antonio; Basilion, James P

    2002-01-01

    Abstract Magnetic resonance imaging (MRI) can provide highresolution 3D maps of structural and functional information, yet its use of mapping in vivo gene expression has only recently been explored. A potential application for this technology is to noninvasively image transgene expression. The current study explores the latter using a nonregulatable internalizing engineered transferrin receptor (ETR) whose expression can be probed for with a superparamagnetic Tf-CLIO probe. Using an HSV-based amplicon vector system for transgene delivery, we demonstrate that: 1) ETR is a sensitive MR marker gene; 2) several transgenes can be efficiently expressed from a single amplicon; 3) expression of each transgene results in functional gene product; and 4) ETR gene expression correlates with expression of therapeutic genes when the latter are contained within the same amplicon. These data, taken together, suggest that MRI of ETR expression can serve as a surrogate for measuring therapeutic transgene expression. PMID:12407446

  15. Differential gene expression in the bovine corpus luteum during transition from early phase to midphase and its potential role in acquisition of luteolytic sensitivity to prostaglandin F2 alpha.

    PubMed

    Goravanahally, Madhusudan P; Salem, Mohamed; Yao, Jianbo; Inskeep, E Keith; Flores, Jorge A

    2009-05-01

    Prostaglandin F2 alpha (PGF(2alpha)) brings about regression of the bovine corpus luteum (CL). This luteolytic property of PGF(2alpha) is used in beef and dairy cattle to synchronize estrus. A limitation of this protocol is insensitivity of the early CL to luteolytic actions of PGF(2alpha). The mechanisms underlying this differential luteal sensitivity are poorly understood. The developing CL has a maximum number of PGF(2alpha) receptors; therefore, differences in signaling events may be responsible for luteal insensitivity. Hence, differential gene expression at two developmental stages of CL, Day 4 (D-4) and D-10 after estrus, might account for differences in signal transduction pathways associated with luteal sensitivity. This possibility was examined in these studies. Microarray analysis (n = 3 cows per stage) identified 167 genes that were differentially expressed (P < 0.05). These were categorized into genes involved in protein biosynthesis and modification (18.5%), transcription regulation and DNA biosynthesis (18.5%), miscellaneous (17.0%), cell signaling (12.0%), steroidogenesis and metabolism (10.2%), extracellular matrix and cytoskeletal proteins (9.5%), unknown functions (6.0%), protein degradation (5.3%), and antioxidant property (3.0%). Real-time PCR confirmed the differential expression of nine selected genes, including tyrosine 3-monooxygenase/tryptophan 5-monooxygense activation protein zeta polypeptide (YWHAZ) and regulator of G protein signaling 2 24-kDa (RGS2), observed in microarray. Furthermore, the in vivo effect of exogenous PGF(2alpha) (n = 3 cows per stage) on selected genes that were found to be differentially expressed during this developmental transition was examined. PGF(2alpha) increased the expression of a guanine nucleotide-binding protein (G protein) beta polypeptide 1 (GNB1) in D-4 CL and calcium/calmodulin-dependent kinase kinase 2 beta (CAMKK2) in D-10 CL. Therefore, GNB1, CAMKK2, YWHAZ, and RGS2 are candidate genes that may

  16. Early gene expression events in the laminar abscission zone of abscission-promoted citrus leaves after a cycle of water stress/rehydration: involvement of CitbHLH1

    PubMed Central

    Tadeo, Francisco R.

    2012-01-01

    Leaf abscission is a common response of plants to drought stress. Some species, such as citrus, have evolved a specific behaviour in this respect, keeping their leaves attached to the plant body during water stress until this is released by irrigation or rain. This study successfully reproduced this phenomenon under controlled conditions (24h of water stress followed by 24h of rehydration) and used it to construct a suppression subtractive hybridization cDNA library enriched in genes involved in the early stages of rehydration-promoted leaf abscission after water stress. Sequencing of the library yielded 314 unigenes, which were spotted onto nylon membranes. Membrane hybridization with petiole (Pet)- and laminar abscission zone (LAZ)-enriched RNA samples corresponding to early steps in leaf abscission revealed an almost exclusive preferential gene expression programme in the LAZ. The data identified major processes such as protein metabolism, cell-wall modification, signalling, control of transcription and vesicle production, and transport as the main biological processes activated in LAZs during the early steps of rehydration-promoted leaf abscission after water stress. Based on these findings, a model for the early steps of citrus leaf abscission is proposed. In addition, it is suggested that CitbHLH1, the putative citrus orthologue of Arabidopsis BIGPETAL, may play major roles in the control of abscission-related events in citrus abscission zones. PMID:23028022

  17. Arabidopsis AMY1 expressions and early flowering mutant phenotype.

    PubMed

    Jie, Wang; Dashi, Yu; XinHong, Guo; Xuanming, Liu

    2009-02-28

    The homozygous T-DNA mutant of the AMY1 gene in Arabidopsis was identified and importantly, shown to cause an early flowering phenotype. We found that the disruption of AMY1 enhanced expression of CO and FT. The expression analyses of genes related to starch metabolism revealed that expression of the AGPase small subunit APS1 in the wild type was higher than in the amy1 mutant. However, there were no significant differences in expression levels of the AGPase large subunit genes ApL1, AMY2, or AMY3 between wild type and the amy1 mutant. Expression profiling showed that AMY1 was highly expressed in leaves, stems, and flowers, and expressed less in leafstalks and roots. Furthermore, the level of AMY1 mRNA was highly elevated with age and in senescing leaves. RT-PCR analyses showed that the expression of AMY1 was induced by heat shock, GA, and ABA, while salt stress had no apparent effect on its expression. PMID:19250611

  18. Effect of adiponectin on the steroidogenic acute regulatory protein, P450 side chain cleavage enzyme and 3β-hydroxysteroid dehydrogenase gene expression, progesterone and androstenedione production by the porcine uterus during early pregnancy.

    PubMed

    Smolinska, N; Dobrzyn, K; Kiezun, M; Szeszko, K; Maleszka, A; Kaminski, T

    2016-06-01

    Adiponectin and its receptors are expressed in the human and porcine uterus and this endocrine system has important role in the regulation of reproductive processes. The expression of steroidogenic acute regulatory protein (StAR) and 3β-hydroxysteroid dehydrogenase (HSD3B1) were observed in the human and porcine uterus during the oestrous cycle and pregnancy. The de novo synthesis of steroids in the uterus might be a crucial factor for effective implantation and maintenance of pregnancy. We hypothesized that adiponectin modulates the expression of key enzymes in the synthesis of the steroids: StAR, P450 side chain cleavage enzyme (CYP11A1) and HSD3B1, as well as progesterone (P4) and androstenedione (A4) secretion by the porcine uterus. Endometrial and myometrial explants harvested from gilts (n = 5) on days 10 to 11, 12 to 13, 15 to 16 and 27 to 28 of pregnancy and on days 10 to 11 of the oestrous cycle were cultured in vitro in the presence of adiponectin (1, 10 μg/ml), adiponectin with insulin (10 ng/ml) and insulin alone (10 ng/ml). Gene expression was examined by real-time PCR, and the secretion of the steroids was determined by radioimmunoassay. The content of StAR, CYP11A1 and HSD3B1 mRNAs and the secretion of P4 and A4 was modulated by adiponectin in endometrial and myometrial tissue explants during early pregnancy and the oestrous cycle. In this action adiponectin interacted with insulin. Insulin itself also regulated the steroidogenic activity of the porcine uterus. ere we reported, for the first time, the expression of CYP11A1 genes in the porcine endometrium and myometrium. Our novel findings indicate that adiponectin affects basal and insulin-stimulated expression of key steroidogenic genes and production of steroid hormones by the porcine uterus during maternal recognition of pregnancy and implantation. PMID:27512005

  19. Prenatal stress and early-life exposure to fluoxetine have enduring effects on anxiety and hippocampal BDNF gene expression in adult male offspring.

    PubMed

    Boulle, Fabien; Pawluski, Jodi L; Homberg, Judith R; Machiels, Barbie; Kroeze, Yvet; Kumar, Neha; Steinbusch, Harry W M; Kenis, Gunter; Van den Hove, Daniel L A

    2016-05-01

    With the growing use of selective serotonin reuptake inhibitor medications (SSRIs) for the treatment of depression during the perinatal period, questions have been raised about the longterm impact of these medications on development. We aimed to investigate how developmental SSRI exposure may alter affect-related behaviors and associated molecular processes in offspring using a rodent model of maternal stress and depression. For this purpose, prenatally stressed or non-stressed male offspring were exposed to fluoxetine (5 mg/kg/day) or vehicle, via lactation, until weaning. Primary results show that postnatal fluoxetine exposure differentially altered anxiety-like behavior by increasing anxiety in non-stressed offspring and decreasing anxiety in prenatally stressed offspring. In the hippocampus, developmental fluoxetine exposure decreased BDNF IV and TrkB mRNA expression. Prenatal stress alone also decreased escape behaviors and decreased hippocampal BDNF IV mRNA expression. These data provide important evidence for the long-term programming effects of early-life exposure to SSRIs on brain and behavior. © 2015 Wiley Periodicals, Inc. Dev Psychobiol 58: 427-438, 2016. PMID:26608001

  20. Influence of BMP-2 on early follicular development and mRNA expression of oocyte specific genes in bovine preantral follicles cultured in vitro.

    PubMed

    Rossi, Rodrigo O D S; da Cunha, Ellen V; Portela, Antonia M L R; Passos, José R S; Costa, José J N; Silva, Anderson W B; Saraiva, Márcia V A; Peixoto, Christina A; Donato, Mariana A M; van den Hurk, Robert; Silva, José R V

    2016-03-01

    This study evaluates the effect of different concentrations (0, 10, 50 and 100ng/mL) of bone morphogenetic protein-2 (BMP-2) on primordial and secondary follicle development. It also investigates the effects of FSH and BMP-2 on the growth, morphology, ultrastructure and expression of mRNA for GDF9, NLRP5 and NPM2 genes in secondary follicles cultured for 18 days. The presence of BMP-2 at all tested concentrations increased the development of primordial follicles in vitro, but the highest concentration of BMP-2 (100 ng/mL) reduced the percentage of normal follicles when compared with tissues cultured with 10 ng/mL BMP-2. During culture of secondary follicles, in contrast to higher concentrations (50 or 100 ng/mL), 10 ng/mL BMP-2 kept the morphology of follicles during initial stages of in vitro culture. This concentration of BMP-2 also benefits maintenance of the ultrastructure of 18-day cultured follicles. The presence of both BMP-2 and FSH in culture medium resulted in a significant (P<0.05) increase in follicular diameter after 18 days of culture. However, both FSH and BMP-2 reduced follicular mRNA expression of GDF9 and NLRP5 when compared to follicles cultured in media containing only FSH. In combination with FSH, BMP-2 reduced the mRNA levels of NPM2, when compared to follicles cultured in control medium. It is concluded from these data that 10 ng/mL BMP-2 promotes the growth of primordial in vitro and it helps to maintain the ultrastructure of secondary follicles, while FSH is more important for better expression of follicular markers like GDF9 and NLRP5. PMID:26435174

  1. Comparison of Bacterial Burden and Cytokine Gene Expression in Golden Hamsters in Early Phase of Infection with Two Different Strains of Leptospira interrogans

    PubMed Central

    Fujita, Rie; Koizumi, Nobuo; Sugiyama, Hiromu; Tomizawa, Rina; Sato, Ryoichi; Ohnishi, Makoto

    2015-01-01

    Leptospirosis, a zoonotic infection with worldwide prevalence, is caused by pathogenic spirochaetes of Leptospira spp., and exhibits an extremely broad clinical spectrum in human patients. Although previous studies indicated that specific serovars or genotypes of Leptospira spp. were associated with severe leptospirosis or its outbreak, the mechanism underlying the difference in virulence of the various Leptospira serotypes or genotypes remains unclear. The present study addresses this question by measuring and comparing bacterial burden and cytokine gene expression in hamsters infected with strains of two L. interrogans serovars Manilae (highly virulent) and Hebdomadis (less virulent). The histopathology of kidney, liver, and lung tissues was also investigated in infected hamsters. A significantly higher bacterial burden was observed in liver tissues of hamsters infected with serovar Manilae than those infected with serovar Hebdomadis (p < 0.01). The average copy number of the leptospiral genome was 1,302 and 20,559 in blood and liver, respectively, of hamsters infected with serovar Manilae and 1,340 and 4,896, respectively, in hamsters infected with serovar Hebdomadis. The expression levels of mip1alpha in blood; tgfbeta, il1beta, mip1alpha, il10, tnfalpha and cox2 in liver; and tgfbeta, il6, tnfalpha and cox2 in lung tissue were significantly higher in hamsters infected with serovar Manilae than those infected with serovar Hebdomadis (p < 0.05). In addition, infection with serovar Manilae resulted in a significantly larger number of hamsters with tnfalpha upregulation (p = 0.04). Severe distortion of tubular cell arrangement and disruption of renal tubules in kidney tissues and hemorrhage in lung tissues were observed in Manilae-infected hamsters. These results demonstrate that serovar Manilae multiplied more efficiently in liver tissues and induced significantly higher expression of genes encoding pro- and anti-inflammatory cytokines than serovar Hebdomadis

  2. Comprehensive serial analysis of gene expression of the cervical transcriptome

    PubMed Central

    Shadeo, Ashleen; Chari, Raj; Vatcher, Greg; Campbell, Jennifer; Lonergan, Kim M; Matisic, Jasenka; van Niekerk, Dirk; Ehlen, Thomas; Miller, Dianne; Follen, Michele; Lam, Wan L; MacAulay, Calum

    2007-01-01

    Background More than half of the approximately 500,000 women diagnosed with cervical cancer worldwide each year will die from this disease. Investigation of genes expressed in precancer lesions compared to those expressed in normal cervical epithelium will yield insight into the early stages of disease. As such, establishing a baseline from which to compare to, is critical in elucidating the abnormal biology of disease. In this study we examine the normal cervical tissue transcriptome and investigate the similarities and differences in relation to CIN III by Long-SAGE (L-SAGE). Results We have sequenced 691,390 tags from four L-SAGE libraries increasing the existing gene expression data on cervical tissue by 20 fold. One-hundred and eighteen unique tags were highly expressed in normal cervical tissue and 107 of them mapped to unique genes, most belong to the ribosomal, calcium-binding and keratinizing gene families. We assessed these genes for aberrant expression in CIN III and five genes showed altered expression. In addition, we have identified twelve unique HPV 16 SAGE tags in the CIN III libraries absent in the normal libraries. Conclusion Establishing a baseline of gene expression in normal cervical tissue is key for identifying changes in cancer. We demonstrate the utility of this baseline data by identifying genes with aberrant expression in CIN III when compared to normal tissue. PMID:17543121

  3. Contrasting role of phospholipase C-{gamma}1 in the expression of immediate early genes induced by epidermal or platelet-derived growth factors

    SciTech Connect

    Liao Hongjun; Santos, Josue de los; Carpenter, Graham . E-mail: graham.carpenter@vanderbilt.edu

    2006-04-01

    While significant progress has been achieved in identifying the signal transduction elements that operate downstream of activated receptor tyrosine kinases, it remains unclear how different receptors utilize these signaling elements to achieve a common response. This study compares the capacity of epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) to elicit the induction of immediate early gene (IEG) mRNAs in the presence or absence of phospholipase C-{gamma}1 (PLC-{gamma}1). The results show that while PDGF induction of nearly all IEG mRNAs is abrogated in plcg1 null cells, EGF induction of the same genes is variable in the null cells and exhibits three distinct responses. Five IEG mRNAs (Nup475, Cyr61, TF, Gly, TS7) are completely inducible by EGF in the presence or absence of PLC-{gamma}1, while three others (JE, KC, FIC) exhibit a stringent requirement for the presence of PLC-{gamma}1. The third type of response is exhibited by c-fos and COX-2. While these mRNAs are completely induced by EGF in the absence of PLC-{gamma}1, the time course of their accumulation is significantly delayed. No IEG was identified as completely inducible by EGF and PDGF in the absence of PLC-{gamma}1. Electrophoretic mobility shift assays (EMSA) demonstrate that PLC-{gamma}1 is necessary for nuclear extracts from PDGF-treated cells, but not EGF-treated cells, to interact with probes for AP-1 or NF-{kappa}B.

  4. Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids.

    PubMed Central

    Wang, Jianlin; Tian, Lu; Madlung, Andreas; Lee, Hyeon-Se; Chen, Meng; Lee, Jinsuk J; Watson, Brian; Kagochi, Trevor; Comai, Luca; Chen, Z Jeffrey

    2004-01-01

    Polyploidization is an abrupt speciation mechanism for eukaryotes and is especially common in plants. However, little is known about patterns and mechanisms of gene regulation during early stages of polyploid formation. Here we analyzed differential expression patterns of the progenitors' genes among successive selfing generations and independent lineages. The synthetic Arabidopsis allotetraploid lines were produced by a genetic cross between A. thaliana and A. arenosa autotetraploids. We found that some progenitors' genes are differentially expressed in early generations, whereas other genes are silenced in late generations or among different siblings within a selfing generation, suggesting that the silencing of progenitors' genes is rapidly and/or stochastically established. Moreover, a subset of genes is affected in autotetraploid and multiple independent allotetraploid lines and in A. suecica, a natural allotetraploid derived from A. thaliana and A. arenosa, indicating locus-specific susceptibility to ploidy-dependent gene regulation. The role of DNA methylation in silencing progenitors' genes is tested in DNA-hypomethylation transgenic lines of A. suecica using RNA interference (RNAi). Two silenced genes are reactivated in both ddm1- and met1-RNAi lines, consistent with the demethylation of centromeric repeats and gene-specific regions in the genome. A rapid and stochastic process of differential gene expression is reinforced by epigenetic regulation during polyploid formation and evolution. PMID:15342533

  5. Acute nicotine enhances spontaneous recovery of contextual fear and changes c-fos early gene expression in infralimbic cortex, hippocampus, and amygdala.

    PubMed

    Kutlu, Munir G; Tumolo, Jessica M; Holliday, Erica; Garrett, Brendan; Gould, Thomas J

    2016-08-01

    Exposure therapy, which focuses on extinguishing fear-triggering cues and contexts, is widely used to treat post-traumatic stress disorder (PTSD). Yet, PTSD patients who received successful exposure therapy are vulnerable to relapse of fear response after a period of time, a phenomenon known as spontaneous recovery (SR). Increasing evidence suggests ventral hippocampus, basolateral amygdala, and infralimbic cortex may be involved in SR. PTSD patients also show high rates of comorbidity with nicotine dependence. While the comorbidity between smoking and PTSD might suggest nicotine may alter SR, the effects of nicotine on SR of contextual fear are unknown. In the present study, we tested the effects of acute nicotine administration on SR of extinguished contextual fear memories and c-fos immediate early gene immunohistochemistry in mice. Our results demonstrated that acute nicotine enhanced SR of extinguished fear whereas acute nicotine did not affect retrieval of unextinguished contextual memories. This suggests that the effect of acute nicotine on SR is specific for memories that have undergone extinction treatment. C-fos immunoreactive (IR) cells in the ventral hippocampus and basolateral amygdala were increased in the nicotine-treated mice following testing for SR, whereas the number of IR cells in the infralimbic cortex was decreased in the same group. Overall, this study suggests that nicotine may adversely affect context-specific relapse of fear memories and this effect is potentially mediated by the suppression of cortical regions and increased activity in the ventral hippocampus and amygdala. PMID:27421892

  6. Gene Expression: Sizing it all up

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genomic architecture appears to be a largely unexplored component of gene expression. Although surely not the end of the story, we are learning that when it comes to gene expression, size is important. We have been surprised to find that certain patterns of expression, tissue-specific versus constit...

  7. Gravity-Induced Gene Expression in Plants.

    NASA Astrophysics Data System (ADS)

    Sederoff, Heike; Heber, Steffen; Howard, Brian; Myburg-Nichols, Henrietta; Hammond, Rebecca; Salinas-Mondragon, Raul; Brown, Christopher S.

    Plants sense changes in their orientation towards the vector of gravity and respond with directional growth. Several metabolites in the signal transduction cascade have been identified. However, very little is known about the interaction between these sensing and signal transduction events and even less is known about their role in the differential growth response. Gravity induced changes in transcript abundance have been identified in Arabidopsis whole seedlings and root apices (Moseyko et al. 2002; Kimbrough et al. 2004). Gravity induced transcript abundance changes can be observed within less than 1 min after stimulation (Salinas-Mondragon et al. 2005). Gene expression however requires not only transcription but also translation of the mRNA. Translation can only occur when mRNA is associated with ribosomes, even though not all mRNA associated with ribosomes is actively translated. To approximate translational capacity we quantified whole genome transcript abundances in corn stem pulvini during the first hour after gravity stimulation in total and poly-ribosomal fractions. As in Arabidopsis root apices, transcript abundances of several clusters of genes responded to gravity stimulation. The vast majority of these transcripts were also found to associate with polyribosomes in the same temporal and quantitative pattern. These genes are transcriptionally regulated by gravity stimulation, but do not exhibit translational regulation. However, a small group of genes showed increased transcriptional regulation after gravity stimulation, but no association with polysomes. These transcripts likely are translationally repressed. The mechanism of translational repression for these transcripts is unknown. Based on the hypothesis that the genes essential for gravitropic responses should be expressed in most or all species, we compared the temporal gravity induced expression pattern of all orthologs identified between maize and Arabidopsis. A small group of genes showed high

  8. Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

    PubMed

    Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

    2014-11-01

    Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops. PMID:25214014

  9. Adenovirus-induced alterations in host cell gene expression prior to the onset of viral gene expression.

    PubMed

    Granberg, Fredrik; Svensson, Catharina; Pettersson, Ulf; Zhao, Hongxing

    2006-09-15

    In this report, we have studied gene expression profiles in human primary lung fibroblasts (IMR-90) during the very early phase of an adenovirus infection. Eight out of twelve genes with known functions encoded transcription factors linked to two major cellular processes; inhibition of cell growth (ATF3, ATF4, KLF4, KLF6 and ELK3) and immune response (NR4A1 and CEBPB), indicating that the earliest consequences of an adenovirus infection are growth arrest and induction of an immune response. A time course analysis showed that the induction of these immediate-early response genes was transient and suppressed after the onset of the adenovirus early gene expression. PMID:16860366

  10. T(lys), a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes.

    PubMed

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta; Contursi, Patrizia

    2013-05-01

    While studying the gene expression of the Sulfolobus spindle-shaped virus 1 (SSV1) in Sulfolobus solfataricus lysogenic cells, a novel viral transcript (T(lys)) was identified. Transcriptional analysis revealed that T(lys) is expressed only in the absence of UV irradiation and is downregulated during the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and T(ind)) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA-binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and T(ind) transcripts, as well as of its own promoter. Binding sites of F55 are included within a tandem-repeated sequence overlapping the transcription start sites and/or the B recognition element of the pertinent genes. The strongest binding was observed with the promoters of T5 and T6, and an apparent cooperativity in binding was observed with the T(ind) promoter. Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1. PMID:23514883

  11. Control of RANKL Gene Expression

    PubMed Central

    O'Brien, Charles A.

    2009-01-01

    Osteoclasts are highly specialized cells capable of degrading mineralized tissue and form at different regions of bone to meet different physiological needs, such as mobilization of calcium, modeling of bone structure, and remodeling of bone matrix. Osteoclast production is elevated in a number of pathological conditions, many of which lead to loss of bone mass. Whether normal or pathological, osteoclastogenesis strictly depends upon support from accessory cells which supply cytokines required for osteoclast differentiation. Only one of these cytokines, receptor activator of NFκB ligand (RANKL), is absolutely essential for osteoclast formation throughout life and is thus expressed by all cell types that support osteoclast differentiation. The central role of RANKL in bone resorption is highlighted by the fact that it is the basis for a new therapy to inhibit bone loss. This review will discuss mechanisms that control RANKL gene expression in different osteoclast-support cells and how the study of such mechanisms may lead to a better understanding of the cellular interactions that drive normal and pathological bone resorption. PMID:19716455

  12. Expression profiles for six zebrafish genes during gonadal sex differentiation

    PubMed Central

    Jørgensen, Anne; Morthorst, Jane E; Andersen, Ole; Rasmussen, Lene J; Bjerregaard, Poul

    2008-01-01

    Background The mechanism of sex determination in zebrafish is largely unknown and neither sex chromosomes nor a sex-determining gene have been identified. This indicates that sex determination in zebrafish is mediated by genetic signals from autosomal genes. The aim of this study was to determine the precise timing of expression of six genes previously suggested to be associated with sex differentiation in zebrafish. The current study investigates the expression of all six genes in the same individual fish with extensive sampling dates during sex determination and -differentiation. Results In the present study, we have used quantitative real-time PCR to investigate the expression of ar, sox9a, dmrt1, fig alpha, cyp19a1a and cyp19a1b during the expected sex determination and gonadal sex differentiation period. The expression of the genes expected to be high in males (ar, sox9a and dmrt1a) and high in females (fig alpha and cyp19a1a) was segregated in two groups with more than 10 times difference in expression levels. All of the investigated genes showed peaks in expression levels during the time of sex determination and gonadal sex differentiation. Expression of all genes was investigated on cDNA from the same fish allowing comparison of the high and low expressers of genes that are expected to be highest expressed in either males or females. There were 78% high or low expressers of all three "male" genes (ar, sox9a and dmrt1) in the investigated period and 81% were high or low expressers of both "female" genes (fig alpha and cyp19a1a). When comparing all five genes with expected sex related expression 56% show expression expected for either male or female. Furthermore, the expression of all genes was investigated in different tissue of adult male and female zebrafish. Conclusion In zebrafish, the first significant peak in gene expression during the investigated period (2–40 dph) was dmrt1 at 10 dph which indicates involvement of this gene in the early gonadal sex

  13. The Epstein-Barr Virus BDLF4 Gene Is Required for Efficient Expression of Viral Late Lytic Genes

    PubMed Central

    Watanabe, Takahiro; Narita, Yohei; Yoshida, Masahiro; Sato, Yoshitaka; Goshima, Fumi; Kimura, Hiroshi

    2015-01-01

    Epstein-Barr virus (EBV) is a gammaherpesvirus, associated with infectious mononucleosis and various types of malignancy. We focused here on the BDLF4 gene of EBV and identified it as a lytic gene, expressed with early kinetics. Viral late gene expression of the BDLF4 knockout strain was severely restricted; this could be restored by an exogenous supply of BDLF4. These results indicate that BDLF4 is important for the EBV lytic replication cycle, especially in late gene expression. PMID:26202235

  14. Methods for monitoring multiple gene expression

    DOEpatents

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2008-06-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  15. Methods for monitoring multiple gene expression

    DOEpatents

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2012-05-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  16. Methods for monitoring multiple gene expression

    DOEpatents

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2013-10-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  17. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197).

    PubMed

    Mansur, M; Suárez, T; González, A E

    1998-02-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  18. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  19. Transforming Growth Factor Beta 1 Stimulates Expression of the Epstein-Barr Virus BZLF1 Immediate-Early Gene Product ZEBRA by an Indirect Mechanism Which Requires the MAPK Kinase Pathway

    PubMed Central

    Fahmi, Hassan; Cochet, Chantal; Hmama, Zakariae; Opolon, Paule; Joab, Irene

    2000-01-01

    Disruption of Epstein-Barr virus (EBV) latency is mediated by ZEBRA, the protein product of the immediate-early EBV gene, BZLF1. In vitro, phorbol 12-myristate 13-acetate (PMA), a potent activator of protein kinase C (PKC), induces reactivation of EBV. However, the physiological stimuli responsible for the disruption of viral latency are not well characterized. Transforming growth factor beta 1 (TGF-β1) has also been shown to trigger the reactivation of EBV in Burkitt lymphoma cell lines; however, the effect of TGF-β1 on ZEBRA expression has not been reported. To further understand this phenomenon, we have investigated the effect of TGF-β1 on ZEBRA expression. Our results indicate that the treatment of different EBV-positive Burkitt's lymphoma cell lines with TGF-β1 induces a time-dependent activation of BZLF1 transcription with a corresponding increase in the production of the protein ZEBRA. TGF-β1 has been shown to exert its effects through a wide range of intracellular routes; in the present study, we have explored these pathways. Transient expression of Smad proteins on their own had no effect on ZEBRA expression. A specific inhibitor of p38 mitogen-activated protein kinase (MAPK), SB203580, did not affect TGF-β1-induced ZEBRA expression, whereas treatment with the MAPK/ERK kinase inhibitors, PD98059 and U0126, dramatically decreased this induction. This suggests that TGF-β1 effect on BZLF1 expression requires the MAPK pathway. However, in Raji and B95-8 cells additional routes can be used, as (i) the inhibition of ZEBRA induction by PD98059 or U0126 was incomplete, whereas these inhibitors completely abolished PMA-induced ZEBRA expression, (ii) TGF-β1 induction of ZEBRA expression occurs in PKC-depleted cells, (iii) in Raji and in B95-8 cells, the effect of TGF-β1 and PMA are additive. Transient transfection of the EBV-negative B-cell line DG75 with a BZLF1 promoter-fusion construct (Zp-CAT) showed that under conditions where the BZLF1 promoter is

  20. Gene expression in major depressive disorder.

    PubMed

    Jansen, R; Penninx, B W J H; Madar, V; Xia, K; Milaneschi, Y; Hottenga, J J; Hammerschlag, A R; Beekman, A; van der Wee, N; Smit, J H; Brooks, A I; Tischfield, J; Posthuma, D; Schoevers, R; van Grootheest, G; Willemsen, G; de Geus, E J; Boomsma, D I; Wright, F A; Zou, F; Sun, W; Sullivan, P F

    2016-03-01

    The search for genetic variants underlying major depressive disorder (MDD) has not yet provided firm leads to its underlying molecular biology. A complementary approach is to study gene expression in relation to MDD. We measured gene expression in peripheral blood from 1848 subjects from The Netherlands Study of Depression and Anxiety. Subjects were divided into current MDD (N=882), remitted MDD (N=635) and control (N=331) groups. MDD status and gene expression were measured again 2 years later in 414 subjects. The strongest gene expression differences were between the current MDD and control groups (129 genes at false-discovery rate, FDR<0.1). Gene expression differences across MDD status were largely unrelated to antidepressant use, inflammatory status and blood cell counts. Genes associated with MDD were enriched for interleukin-6 (IL-6)-signaling and natural killer (NK) cell pathways. We identified 13 gene expression clusters with specific clusters enriched for genes involved in NK cell activation (downregulated in current MDD, FDR=5.8 × 10(-5)) and IL-6 pathways (upregulated in current MDD, FDR=3.2 × 10(-3)). Longitudinal analyses largely confirmed results observed in the cross-sectional data. Comparisons of gene expression results to the Psychiatric Genomics Consortium (PGC) MDD genome-wide association study results revealed overlap with DVL3. In conclusion, multiple gene expression associations with MDD were identified and suggest a measurable impact of current MDD state on gene expression. Identified genes and gene clusters are enriched with immune pathways previously associated with the etiology of MDD, in line with the immune suppression and immune activation hypothesis of MDD. PMID:26008736

  1. Analysis of Gene Expression Patterns Using Biclustering.

    PubMed

    Roy, Swarup; Bhattacharyya, Dhruba K; Kalita, Jugal K

    2016-01-01

    Mining microarray data to unearth interesting expression profile patterns for discovery of in silico biological knowledge is an emerging area of research in computational biology. A group of functionally related genes may have similar expression patterns under a set of conditions or at some time points. Biclustering is an important data mining tool that has been successfully used to analyze gene expression data for biologically significant cluster discovery. The purpose of this chapter is to introduce interesting patterns that may be observed in expression data and discuss the role of biclustering techniques in detecting interesting functional gene groups with similar expression patterns. PMID:26350227

  2. Xenbase: gene expression and improved integration.

    PubMed

    Bowes, Jeff B; Snyder, Kevin A; Segerdell, Erik; Jarabek, Chris J; Azam, Kenan; Zorn, Aaron M; Vize, Peter D

    2010-01-01

    Xenbase (www.xenbase.org), the model organism database for Xenopus laevis and X. (Silurana) tropicalis, is the principal centralized resource of genomic, development data and community information for Xenopus research. Recent improvements include the addition of the literature and interaction tabs to gene catalog pages. New content has been added including a section on gene expression patterns that incorporates image data from the literature, large scale screens and community submissions. Gene expression data are integrated into the gene catalog via an expression tab and is also searchable by multiple criteria using an expression search interface. The gene catalog has grown to contain over 15,000 genes. Collaboration with the European Xenopus Research Center (EXRC) has resulted in a stock center section with data on frog lines supplied by the EXRC. Numerous improvements have also been made to search and navigation. Xenbase is also the source of the Xenopus Anatomical Ontology and the clearinghouse for Xenopus gene nomenclature. PMID:19884130

  3. Visually Relating Gene Expression and in vivo DNA Binding Data

    SciTech Connect

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd

    2011-09-20

    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  4. Gene Expression Profiling of Gastric Cancer

    PubMed Central

    Marimuthu, Arivusudar; Jacob, Harrys K.C.; Jakharia, Aniruddha; Subbannayya, Yashwanth; Keerthikumar, Shivakumar; Kashyap, Manoj Kumar; Goel, Renu; Balakrishnan, Lavanya; Dwivedi, Sutopa; Pathare, Swapnali; Dikshit, Jyoti Bajpai; Maharudraiah, Jagadeesha; Singh, Sujay; Sameer Kumar, Ghantasala S; Vijayakumar, M.; Veerendra Kumar, Kariyanakatte Veeraiah; Premalatha, Chennagiri Shrinivasamurthy; Tata, Pramila; Hariharan, Ramesh; Roa, Juan Carlos; Prasad, T.S.K; Chaerkady, Raghothama; Kumar, Rekha Vijay; Pandey, Akhilesh

    2015-01-01

    Gastric cancer is the second leading cause of cancer death worldwide, both in men and women. A genomewide gene expression analysis was carried out to identify differentially expressed genes in gastric adenocarcinoma tissues as compared to adjacent normal tissues. We used Agilent’s whole human genome oligonucleotide microarray platform representing ~41,000 genes to carry out gene expression analysis. Two-color microarray analysis was employed to directly compare the expression of genes between tumor and normal tissues. Through this approach, we identified several previously known candidate genes along with a number of novel candidate genes in gastric cancer. Testican-1 (SPOCK1) was one of the novel molecules that was 10-fold upregulated in tumors. Using tissue microarrays, we validated the expression of testican-1 by immunohistochemical staining. It was overexpressed in 56% (160/282) of the cases tested. Pathway analysis led to the identification of several networks in which SPOCK1 was among the topmost networks of interacting genes. By gene enrichment analysis, we identified several genes involved in cell adhesion and cell proliferation to be significantly upregulated while those corresponding to metabolic pathways were significantly downregulated. The differentially expressed genes identified in this study are candidate biomarkers for gastric adenoacarcinoma. PMID:27030788

  5. HOXB homeobox gene expression in cervical carcinoma.

    PubMed

    López, R; Garrido, E; Piña, P; Hidalgo, A; Lazos, M; Ochoa, R; Salcedo, M

    2006-01-01

    The homeobox (HOX) genes are a family of transcription factors that bind to specific DNA sequences in target genes regulating gene expression. Thirty-nine HOX genes have been mapped in four conserved clusters: A, B, C, and D; they act as master genes regulating the identity of body segments along the anteroposterior axis of the embryo. The role played by HOX genes in adult cell differentiation is unclear to date, but growing evidence suggests that they may play an important role in the development of cancer. To study the role played by HOX genes in cervical cancer, in the present work, we analyzed the expression of HOXB genes and the localization of their transcripts in human cervical tissues. Reverse transcription-polymerase chain reaction analysis and nonradioactive RNA in situ hybridization were used to detect HOXB expression in 11 normal cervical tissues and 17 cervical carcinomas. It was determined that HOXB1, B3, B5, B6, B7, B8, and B9 genes are expressed in normal adult cervical epithelium and squamous cervical carcinomas. Interestingly, HOXB2, HOXB4, and HOXB13 gene expression was found only in tumor tissues. Our findings suggest that the new expression of HOXB2, HOXB4, and B13 genes is involved in cervical cancer. PMID:16445654

  6. Gene expression profiling in developing human hippocampus.

    PubMed

    Zhang, Yan; Mei, Pinchao; Lou, Rong; Zhang, Michael Q; Wu, Guanyun; Qiang, Boqin; Zhang, Zhengguo; Shen, Yan

    2002-10-15

    The gene expression profile of developing human hippocampus is of particular interest and importance to neurobiologists devoted to development of the human brain and related diseases. To gain further molecular insight into the developmental and functional characteristics, we analyzed the expression profile of active genes in developing human hippocampus. Expressed sequence tags (ESTs) were selected by sequencing randomly selected clones from an original 3'-directed cDNA library of 150-day human fetal hippocampus, and a digital expression profile of 946 known genes that could be divided into 16 categories was generated. We also used for comparison 14 other expression profiles of related human neural cells/tissues, including human adult hippocampus. To yield more confidence regarding differential expression, a method was applied to attach normalized expression data to genes with a low false-positive rate (<0.05). Finally, hierarchical cluster analysis was used to exhibit related gene expression patterns. Our results are in accordance with anatomical and physiological observations made during the developmental process of the human hippocampus. Furthermore, some novel findings appeared to be unique to our results. The abundant expression of genes for cell surface components and disease-related genes drew our attention. Twenty-four genes are significantly different from adult, and 13 genes might be developing hippocampus-specific candidate genes, including wnt2b and some Alzheimer's disease-related genes. Our results could provide useful information on the ontogeny, development, and function of cells in the human hippocampus at the molecular level and underscore the utility of large-scale, parallel gene expression analyses in the study of complex biological phenomena. PMID:12271469

  7. Widespread ectopic expression of olfactory receptor genes

    PubMed Central

    Feldmesser, Ester; Olender, Tsviya; Khen, Miriam; Yanai, Itai; Ophir, Ron; Lancet, Doron

    2006-01-01

    Background Olfactory receptors (ORs) are the largest gene family in the human genome. Although they are expected to be expressed specifically in olfactory tissues, some ectopic expression has been reported, with special emphasis on sperm and testis. The present study systematically explores the expression patterns of OR genes in a large number of tissues and assesses the potential functional implication of such ectopic expression. Results We analyzed the expression of hundreds of human and mouse OR transcripts, via EST and microarray data, in several dozens of human and mouse tissues. Different tissues had specific, relatively small OR gene subsets which had particularly high expression levels. In testis, average expression was not particularly high, and very few highly expressed genes were found, none corresponding to ORs previously implicated in sperm chemotaxis. Higher expression levels were more common for genes with a non-OR genomic neighbor. Importantly, no correlation in expression levels was detected for human-mouse orthologous pairs. Also, no significant difference in expression levels was seen between intact and pseudogenized ORs, except for the pseudogenes of subfamily 7E which has undergone a human-specific expansion. Conclusion The OR superfamily as a whole, show widespread, locus-dependent and heterogeneous expression, in agreement with a neutral or near neutral evolutionary model for transcription control. These results cannot reject the possibility that small OR subsets might play functional roles in different tissues, however considerable care should be exerted when offering a functional interpretation for ectopic OR expression based only on transcription information. PMID:16716209

  8. Gene expression profiling reveals differentially expressed genes in ovarian cancer of the hen: support for oviductal origin?

    PubMed

    Treviño, Lindsey S; Giles, James R; Wang, Wei; Urick, Mary Ellen; Johnson, Patricia Ann

    2010-08-01

    Ovarian cancer has a high mortality rate due, in part, to the lack of early detection and incomplete understanding of the origin of the disease. The hen is the only spontaneous model of ovarian cancer and can therefore aid in the identification and testing of early detection strategies and therapeutics. Our aim was to combine the use of the hen animal model and microarray technology to identify differentially expressed genes in ovarian tissue from normal hens compared with hens with ovarian cancer. We found that the transcripts up-regulated in chicken ovarian tumors were enriched for oviduct-related genes. Quantitative real-time PCR and immunohistochemistry confirmed expression of oviduct-related genes in normal oviduct and in ovaries from hens with early- and late-stage ovarian tumors, but not in normal ovarian surface epithelium. In addition, one of the oviduct-related genes identified in our analysis, paired box 2 has been implicated in human ovarian cancer and may serve as a marker of the disease. Furthermore, estrogen receptor 1 mRNA is over-expressed in early-stage tumors, suggesting that expression of the oviduct-related genes may be regulated by estrogen. We have also identified oviduct-related genes that encode secreted proteins that could represent putative serum biomarkers. The expression of oviduct-related genes in early-stage tumors is similar to what is seen in human ovarian cancer, with tumors resembling normal Müllerian epithelium. These data suggest that chicken ovarian tumors may arise from alternative sites, including the oviduct. PMID:21761365

  9. [Gene expression profile of spinal ventral horn in ALS].

    PubMed

    Yamamoto, Masahiko; Tanaka, Fumiaki; Sobue, Gen

    2007-10-01

    The causative pathomechanism of sporadic amyotrophic lateral sclerosis (ALS) is not clearly understood. Using microarray technology combined with laser-captured microdissection, gene expression profiles of degenerating spinal motor neurons as well as spinal ventral horn from autopsied patients with sporadic ALS were examined. Spinal motor neurons showed a distinct gene expression profile from the whole spinal ventral horn. Three percent of genes examined were significantly downregulated, and 1% were upregulated in motor neurons. In contrast with motor neurons, the total spinal ventral horn homogenates demonstrated 0.7% and 0.2% significant upregulation and downregulation of gene expression, respectively. Downregulated genes in motor neurons included those associated with cytoskeleton/axonal transport, transcription and cell surface antigens/receptors, such as dynactin 1 (DCTN1) and early growth response 3 (EGR3). In particular, DCTN1 was markedly downregulated in most residual motor neurons prior to the accumulation of pNF-H and ubiquitylated protein. Promoters for cell death pathway, death receptor 5 (DR5), cyclins C (CCNC) and A1 (CCNA), and caspases were upregulated, whereas cell death inhibitors, acetyl-CoA transporter (ACATN) and NF-kappaB (NFKB) were also upregulated. In terms of spinal ventral horn, the expression of genes related to cell surface antigens/receptors, transcription and cell adhesion/ECM were increased. The gene expression resulting in neurodegenerative and neuroprotective changes were both present in spinal motor neurons and ventral horn. Moreover, Inflammation-related genes, such as belonging to the cytokine family were not, however, significantly upregulated in either motor neurons or ventral horn. The sequence of motor neuron-specific gene expression changes from early DCTN1 downregulation to late CCNC upregulation in sporadic ALS can provide direct information on the genes leading to neurodegeneration and neuronal death, and are helpful

  10. Serial analysis of gene expression (SAGE) in rat liver regeneration

    SciTech Connect

    Cimica, Velasco . E-mail: vcimica@aecom.yu.edu; Batusic, Danko; Haralanova-Ilieva, Borislava; Chen, Yonglong; Hollemann, Thomas; Pieler, Tomas; Ramadori, Giuliano

    2007-08-31

    We have applied serial analysis of gene expression for studying the molecular mechanism of the rat liver regeneration in the model of 70% partial hepatectomy. We generated three SAGE libraries from a normal control liver (NL library: 52,343 tags), from a sham control operated liver (Sham library: 51,028 tags), and from a regenerating liver (PH library: 53,061 tags). By SAGE bioinformatics analysis we identified 40 induced genes and 20 repressed genes during the liver regeneration. We verified temporal expression of such genes by real time PCR during the regeneration process and we characterized 13 induced genes and 3 repressed genes. We found connective tissue growth factor transcript and protein induced very early at 4 h after PH operation before hepatocytes proliferation is triggered. Our study suggests CTGF as a growth factor signaling mediator that could be involved directly in the mechanism of liver regeneration induction.

  11. Gene Expression Patterns in Ovarian Carcinomas

    PubMed Central

    Schaner, Marci E.; Ross, Douglas T.; Ciaravino, Giuseppe; Sørlie, Therese; Troyanskaya, Olga; Diehn, Maximilian; Wang, Yan C.; Duran, George E.; Sikic, Thomas L.; Caldeira, Sandra; Skomedal, Hanne; Tu, I-Ping; Hernandez-Boussard, Tina; Johnson, Steven W.; O'Dwyer, Peter J.; Fero, Michael J.; Kristensen, Gunnar B.; Børresen-Dale, Anne-Lise; Hastie, Trevor; Tibshirani, Robert; van de Rijn, Matt; Teng, Nelson N.; Longacre, Teri A.; Botstein, David; Brown, Patrick O.; Sikic, Branimir I.

    2003-01-01

    We used DNA microarrays to characterize the global gene expression patterns in surface epithelial cancers of the ovary. We identified groups of genes that distinguished the clear cell subtype from other ovarian carcinomas, grade I and II from grade III serous papillary carcinomas, and ovarian from breast carcinomas. Six clear cell carcinomas were distinguished from 36 other ovarian carcinomas (predominantly serous papillary) based on their gene expression patterns. The differences may yield insights into the worse prognosis and therapeutic resistance associated with clear cell carcinomas. A comparison of the gene expression patterns in the ovarian cancers to published data of gene expression in breast cancers revealed a large number of differentially expressed genes. We identified a group of 62 genes that correctly classified all 125 breast and ovarian cancer specimens. Among the best discriminators more highly expressed in the ovarian carcinomas were PAX8 (paired box gene 8), mesothelin, and ephrin-B1 (EFNB1). Although estrogen receptor was expressed in both the ovarian and breast cancers, genes that are coregulated with the estrogen receptor in breast cancers, including GATA-3, LIV-1, and X-box binding protein 1, did not show a similar pattern of coexpression in the ovarian cancers. PMID:12960427

  12. Gene Expression Studies in Lygus lineolaris

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes are expressed in insect cells, as in all living organisms, by transcription of DNA into RNA followed by translation of RNA into proteins. The intricate patterns of differential gene expression in time and space directly influence the development and function of every aspect of the organism. Wh...

  13. Arabidopsis gene expression patterns during spaceflight

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.

  14. Expression of oligodendrocyte lineage genes in oligodendroglial and astrocytic gliomas.

    PubMed

    Riemenschneider, Markus J; Koy, Timmo H; Reifenberger, Guido

    2004-03-01

    The oligodendrocyte lineage genes OLIG1 and OLIG2 have been reported as potential diagnostic markers for oligodendrogliomas [Lu et al. (2001) Proc Natl Acad Sci USA 98:10851-10856; Marie et al. (2001) Lancet 358:298-300]. We investigated the mRNA expression of OLIG1 and OLIG2, as well as four other genes involved in oligodendrocyte development ( E2A, HEB, NKX2.2, and PDGFRA) in a panel of 70 gliomas, including 9 oligodendrogliomas, 11 anaplastic oligodendrogliomas, 5 oligoastrocytomas, 10 anaplastic oligoastrocytomas, 10 diffuse astrocytomas, 10 anaplastic astrocytomas, and 15 glioblastomas. Most tumors demonstrated higher transcript levels of these genes as compared to non-neoplastic adult brain tissue. Four glioblastomas showed markedly increased PDGFRA mRNA expression due to PDGFRA gene amplification. Statistical analyses revealed no significant expression differences between oligodendroglial and astrocytic tumors. In oligodendroglial tumors, expression of the six genes was not significantly correlated to loss of heterozygosity on chromosome arms 1p and 19q. Thus, expression of the investigated oligodendrocyte lineage genes is up-regulated relative to non-neoplastic brain tissue in the majority of oligodendroglial and astrocytic tumors, suggesting that glioma cells are arrested in or recapitulate molecular phenotypes corresponding to early stages of glial development. However, the determination of mRNA expression of these genes by means of reverse transcription-PCR does not appear to be diagnostically useful as a marker for oligodendrogliomas. PMID:14730454

  15. Gearbox gene expression and growth rate.

    PubMed

    Aldea, M; Garrido, T; Tormo, A

    1993-07-01

    Regulation of gene expression in prokaryotic cells usually takes place at the level of transcription initiation. Different forms of RNA polymerase recognizing specific promoters are engaged in the control of many prokaryotic regulons. This also seems to be the case for some Escherichia coli genes that are induced at low growth rates and by nutrient starvation. Their gene products are synthesized at levels inversely proportional to growth rate, and this mode of regulation has been termed gearbox gene expression. This kind of growth-rate modulation is exerted by specific transcriptional initiation signals, the gearbox promoters, and some of them depend on a putative new σ factor (RpoS). Gearbox promoters drive expression of morphogenetic and cell division genes at constant levels per cell and cycle to meet the demands of cell division and septum formation. A mechanism is proposed that could sense the growth rate of the cell to alter gene expression by the action of specific σ factors. PMID:24420108

  16. Quality measures for gene expression biclusters.

    PubMed

    Pontes, Beatriz; Girldez, Ral; Aguilar-Ruiz, Jess S

    2015-01-01

    An noticeable number of biclustering approaches have been proposed proposed for the study of gene expression data, especially for discovering functionally related gene sets under different subsets of experimental conditions. In this context, recognizing groups of co-expressed or co-regulated genes, that is, genes which follow a similar expression pattern, is one of the main objectives. Due to the problem complexity, heuristic searches are usually used instead of exhaustive algorithms. Furthermore, most of biclustering approaches use a measure or cost function that determines the quality of biclusters. Having a suitable quality metric for bicluster is a critical aspect, not only for guiding the search, but also for establishing a comparison criteria among the results obtained by different biclustering techniques. In this paper, we analyse a large number of existing approaches to quality measures for gene expression biclusters, as well as we present a comparative study of them based on their capability to recognize different expression patterns in biclusters. PMID:25763839

  17. Quality Measures for Gene Expression Biclusters

    PubMed Central

    Pontes, Beatriz; Girldez, Ral; Aguilar-Ruiz, Jess S.

    2015-01-01

    An noticeable number of biclustering approaches have been proposed proposed for the study of gene expression data, especially for discovering functionally related gene sets under different subsets of experimental conditions. In this context, recognizing groups of co-expressed or co-regulated genes, that is, genes which follow a similar expression pattern, is one of the main objectives. Due to the problem complexity, heuristic searches are usually used instead of exhaustive algorithms. Furthermore, most of biclustering approaches use a measure or cost function that determines the quality of biclusters. Having a suitable quality metric for bicluster is a critical aspect, not only for guiding the search, but also for establishing a comparison criteria among the results obtained by different biclustering techniques. In this paper, we analyse a large number of existing approaches to quality measures for gene expression biclusters, as well as we present a comparative study of them based on their capability to recognize different expression patterns in biclusters. PMID:25763839

  18. Differential expression of immediate early genes Zif268 and c-Fos in the hippocampus and prefrontal cortex following spatial learning and glutamate receptor antagonism.

    PubMed

    Farina, Francesca R; Commins, Sean

    2016-07-01

    The objective of this study was to examine the effects of NMDAR and AMPAR antagonism on the expression of Zif268 and c-Fos in the hippocampus and medial prefrontal cortex during spatial memory encoding in rats trained in the Morris water maze. NMDAR inhibition impaired navigation and significantly attenuated expression of Zif268, but not c-Fos, in area CA1. AMPAR channel blockade had little effect on learning or IEG expression. Overall, Zif268 and c-Fos displayed markedly different patterns of hippocampal and prefrontal expression, with Zif268 being more closely linked to spatial learning. PMID:27071329

  19. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    PubMed Central

    2009-01-01

    second in basidiomata, confirming their distinctiveness. The number of transcripts of the gene for plerototolysin B increased in reddish-pink mycelium and indicated an activation of the initial basidiomata production even at this culturing stage. Expression of the glucose transporter gene increased in mycelium after the stress, coinciding with a decrease of adenylate cyclase gene transcription. This indicated that nutrient uptake can be an important signal to trigger fruiting in this fungus. Conclusion The identification of genes with increased expression in this phase of the life cycle of M. perniciosa opens up new possibilities of controlling fungus spread as well as of genetic studies of biological processes that lead to basidiomycete fruiting. This is the first comparative morphologic study of the early development both in vivo and in vitro of M. perniciosa basidiomata and the first description of genes expressed at this stage of the fungal life cycle. PMID:19653910

  20. Aplysia californica neurons express microinjected neuropeptide genes.

    PubMed Central

    DesGroseillers, L; Cowan, D; Miles, M; Sweet, A; Scheller, R H

    1987-01-01

    Neuropeptide genes are expressed in specific subsets of large polyploid neurons in Aplysia californica. We have defined the transcription initiation sites of three of these neuropeptide genes (the R14, L11, and ELH genes) and determined the nucleotide sequence of the promoter regions. The genes contain the usual eucaryotic promoter signals as well as other structures of potential regulatory importance, including inverted and direct repeats. The L11 and ELH genes, which are otherwise unrelated, have homology in the promoter regions, while the R14 promoter was distinct. When cloned plasmids were microinjected into Aplysia neurons in organ culture, transitions between supercoiled, relaxed circular, and linear DNAs occurred along with ligation into high-molecular-weight species. About 20% of the microinjected neurons expressed the genes. The promoter region of the R14 gene functioned in expression of the microinjected DNA in all cells studied. When both additional 5' and 3' sequences were included, the gene was specifically expressed only in R14, suggesting that the specificity of expression is generated by a multicomponent repression system. Finally, the R14 peptide could be expressed in L11, demonstrating that it is possible to alter the transmitter phenotype of these neurons by introduction of cloned genes. Images PMID:3670293

  1. Sex-specific gene expression in early life stage fathead minnows (Pimephales promelas) throughout development and after exposure to synthetic hormones

    EPA Science Inventory

    There is evidence that exposure to endocrine disrupting chemicals (EDCs) during early life stages can alter sex differentiation in fishes. Fathead minnows (Pimephales promelas) are commonly used as a model fish species in endocrine disruption studies. However, limited knowledge...

  2. Characterization of duplicated Dunaliella viridis SPT1 genes provides insights into early gene divergence after duplication.

    PubMed

    Guan, Zhenwei; Meng, Xiangzong; Sun, Zhenhua; Xu, Zhengkai; Song, Rentao

    2008-10-15

    The sodium-dependent phosphate transporter gene from unicellular green algae Dunaliella viridis, DvSPT1, shares similarity with members of Pi transporter family. Sequencing analysis of D. viridis BAC clone containing the DvSPT1 gene revealed two inverted duplicated copies of this gene (DvSPT1 and DvSPT1-2 respectively). The duplication covered most of both genes except for their 3' downstream region. The duplicated genomic sequences exhibited 97.9% identity with a synonymous divergence of Ks=0.0126 in the coding region. This data indicated very recent gene duplication in D. viridis genome, providing an excellent opportunity to investigate sequence and expression divergence of duplicated genes at an early stage. Scattered point mutations and length polymorphism of simple sequence repeats (SSRs) were predominant among the sequence divergence soon after gene duplication. Due to sequence divergence in the 5' regulatory regions and a swap of the entire 3' downstream regions (3'-UTR), DvSPT1 and DvSPT1-2 showed expression divergence in response to extra-cellular NaCl concentration changes. According to their expression patterns, the two diverged gene copies would provide better adaptation to a broader range of extra-cellular NaCl concentration. Furthermore, Southern blot analysis indicated that there might be a large phosphate transporter gene family in D. viridis. PMID:18662752

  3. Methodological Limitations in Determining Astrocytic Gene Expression

    PubMed Central

    Peng, Liang; Guo, Chuang; Wang, Tao; Li, Baoman; Gu, Li; Wang, Zhanyou

    2013-01-01

    Traditionally, astrocytic mRNA and protein expression are studied by in situ hybridization (ISH) and immunohistochemically. This led to the concept that astrocytes lack aralar, a component of the malate-aspartate-shuttle. At least similar aralar mRNA and protein expression in astrocytes and neurons isolated by fluorescence-assisted cell sorting (FACS) reversed this opinion. Demonstration of expression of other astrocytic genes may also be erroneous. Literature data based on morphological methods were therefore compared with mRNA expression in cells obtained by recently developed methods for determination of cell-specific gene expression. All Na,K-ATPase-α subunits were demonstrated by immunohistochemistry (IHC), but there are problems with the cotransporter NKCC1. Glutamate and GABA transporter gene expression was well determined immunohistochemically. The same applies to expression of many genes of glucose metabolism, whereas a single study based on findings in bacterial artificial chromosome (BAC) transgenic animals showed very low astrocytic expression of hexokinase. Gene expression of the equilibrative nucleoside transporters ENT1 and ENT2 was recognized by ISH, but ENT3 was not. The same applies to the concentrative transporters CNT2 and CNT3. All were clearly expressed in FACS-isolated cells, followed by biochemical analysis. ENT3 was enriched in astrocytes. Expression of many nucleoside transporter genes were shown by microarray analysis, whereas other important genes were not. Results in cultured astrocytes resembled those obtained by FACS. These findings call for reappraisal of cellular nucleoside transporter expression. FACS cell yield is small. Further development of cell separation methods to render methods more easily available and less animal and cost consuming and parallel studies of astrocytic mRNA and protein expression by ISH/IHC and other methods are necessary, but new methods also need to be thoroughly checked. PMID:24324456

  4. Gene Expression Noise, Fitness Landscapes, and Evolution

    NASA Astrophysics Data System (ADS)

    Charlebois, Daniel

    The stochastic (or noisy) process of gene expression can have fitness consequences for living organisms. For example, gene expression noise facilitates the development of drug resistance by increasing the time scale at which beneficial phenotypic states can be maintained. The present work investigates the relationship between gene expression noise and the fitness landscape. By incorporating the costs and benefits of gene expression, we track how the fluctuation magnitude and timescale of expression noise evolve in simulations of cell populations under stress. We find that properties of expression noise evolve to maximize fitness on the fitness landscape, and that low levels of expression noise emerge when the fitness benefits of gene expression exceed the fitness costs (and that high levels of noise emerge when the costs of expression exceed the benefits). The findings from our theoretical/computational work offer new hypotheses on the development of drug resistance, some of which are now being investigated in evolution experiments in our laboratory using well-characterized synthetic gene regulatory networks in budding yeast. Nserc Postdoctoral Fellowship (Grant No. PDF-453977-2014).

  5. Developmental expression profiles of Celsr (Flamingo) genes in the mouse.

    PubMed

    Tissir, F; De-Backer, O; Goffinet, A M; Lambert de Rouvroit, C

    2002-03-01

    Celsr, also called Flamingo (Fmi) genes encode proteins of the cadherin superfamily. Celsr cadherins are seven-pass transmembrane proteins with nine cadherin repeats in the extracellular domain, and an anonymous intracellular C-terminus. The Drosophila Fmi gene regulates epithelial planar cell polarity and dendritic field deployment. The three Flamingo gene orthologs in man and rodents are named, respectively, CELSR1-3 and Celsr1-3. Celsr1 and 2 are expressed during early development, in the brain and epithelia. In this report, we characterized further Celsr genes in the mouse, and examined their developmental pattern of expression. Each Celsr is expressed prominently in the developing brain following a specific pattern, suggesting that they serve distinct functions. PMID:11850187

  6. Early evolution of the LIM homeobox gene family

    SciTech Connect

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  7. A comparative gene expression database for invertebrates

    PubMed Central

    2011-01-01

    Background As whole genome and transcriptome sequencing gets cheaper and faster, a great number of 'exotic' animal models are emerging, rapidly adding valuable data to the ever-expanding Evo-Devo field. All these new organisms serve as a fantastic resource for the research community, but the sheer amount of data, some published, some not, makes detailed comparison of gene expression patterns very difficult to summarize - a problem sometimes even noticeable within a single lab. The need to merge existing data with new information in an organized manner that is publicly available to the research community is now more necessary than ever. Description In order to offer a homogenous way of storing and handling gene expression patterns from a variety of organisms, we have developed the first web-based comparative gene expression database for invertebrates that allows species-specific as well as cross-species gene expression comparisons. The database can be queried by gene name, developmental stage and/or expression domains. Conclusions This database provides a unique tool for the Evo-Devo research community that allows the retrieval, analysis and comparison of gene expression patterns within or among species. In addition, this database enables a quick identification of putative syn-expression groups that can be used to initiate, among other things, gene regulatory network (GRN) projects. PMID:21861937

  8. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling

    PubMed Central

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-01-01

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. PMID:27194808

  9. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

    PubMed

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-01-01

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. PMID:27194808

  10. Gene expression analysis of aberrant signaling pathways in meningiomas

    PubMed Central

    TORRES-MARTÍN, MIGUEL; MARTINEZ-GLEZ, VICTOR; PEÑA-GRANERO, CAROLINA; ISLA, ALBERTO; LASSALETTA, LUIS; DE CAMPOS, JOSE M.; PINTO, GIOVANNY R.; BURBANO, ROMMEL R.; MELÉNDEZ, BÁRBARA; CASTRESANA, JAVIER S.; REY, JUAN A.

    2013-01-01

    Examining aberrant pathway alterations is one method for understanding the abnormal signals that are involved in tumorigenesis and tumor progression. In the present study, expression arrays were performed on tumor-related genes in meningiomas. The GE Array Q Series HS-006 was used to determine the expression levels of 96 genes that corresponded to six primary biological regulatory pathways in a series of 42 meningiomas, including 32 grade I, four recurrent grade I and six grade II tumors, in addition to three normal tissue controls. Results showed that 25 genes that were primarily associated with apoptosis and angiogenesis functions were downregulated and 13 genes frequently involving DNA damage repair functions were upregulated. In addition to the inactivation of the neurofibromin gene, NF2, which is considered to be an early step in tumorigenesis, variations of other biological regulatory pathways may play a significant role in the development of meningioma. PMID:23946817

  11. Gene expression analysis of aberrant signaling pathways in meningiomas.

    PubMed

    Torres-Martín, Miguel; Martinez-Glez, Victor; Peña-Granero, Carolina; Isla, Alberto; Lassaletta, Luis; DE Campos, Jose M; Pinto, Giovanny R; Burbano, Rommel R; Meléndez, Bárbara; Castresana, Javier S; Rey, Juan A

    2013-07-01

    Examining aberrant pathway alterations is one method for understanding the abnormal signals that are involved in tumorigenesis and tumor progression. In the present study, expression arrays were performed on tumor-related genes in meningiomas. The GE Array Q Series HS-006 was used to determine the expression levels of 96 genes that corresponded to six primary biological regulatory pathways in a series of 42 meningiomas, including 32 grade I, four recurrent grade I and six grade II tumors, in addition to three normal tissue controls. Results showed that 25 genes that were primarily associated with apoptosis and angiogenesis functions were downregulated and 13 genes frequently involving DNA damage repair functions were upregulated. In addition to the inactivation of the neurofibromin gene, NF2, which is considered to be an early step in tumorigenesis, variations of other biological regulatory pathways may play a significant role in the development of meningioma. PMID:23946817

  12. Gene Expression Signature in Endemic Osteoarthritis by Microarray Analysis

    PubMed Central

    Wang, Xi; Ning, Yujie; Zhang, Feng; Yu, Fangfang; Tan, Wuhong; Lei, Yanxia; Wu, Cuiyan; Zheng, Jingjing; Wang, Sen; Yu, Hanjie; Li, Zheng; Lammi, Mikko J.; Guo, Xiong

    2015-01-01

    Kashin-Beck Disease (KBD) is an endemic osteochondropathy with an unknown pathogenesis. Diagnosis of KBD is effective only in advanced cases, which eliminates the possibility of early treatment and leads to an inevitable exacerbation of symptoms. Therefore, we aim to identify an accurate blood-based gene signature for the detection of KBD. Previously published gene expression profile data on cartilage and peripheral blood mononuclear cells (PBMCs) from adults with KBD were compared to select potential target genes. Microarray analysis was conducted to evaluate the expression of the target genes in a cohort of 100 KBD patients and 100 healthy controls. A gene expression signature was identified using a training set, which was subsequently validated using an independent test set with a minimum redundancy maximum relevance (mRMR) algorithm and support vector machine (SVM) algorithm. Fifty unique genes were differentially expressed between KBD patients and healthy controls. A 20-gene signature was identified that distinguished between KBD patients and controls with 90% accuracy, 85% sensitivity, and 95% specificity. This study identified a 20-gene signature that accurately distinguishes between patients with KBD and controls using peripheral blood samples. These results promote the further development of blood-based genetic biomarkers for detection of KBD. PMID:25997002

  13. Nucleosome repositioning underlies dynamic gene expression.

    PubMed

    Nocetti, Nicolas; Whitehouse, Iestyn

    2016-03-15

    Nucleosome repositioning at gene promoters is a fundamental aspect of the regulation of gene expression. However, the extent to which nucleosome repositioning is used within eukaryotic genomes is poorly understood. Here we report a comprehensive analysis of nucleosome positions as budding yeast transit through an ultradian cycle in which expression of >50% of all genes is highly synchronized. We present evidence of extensive nucleosome repositioning at thousands of gene promoters as genes are activated and repressed. During activation, nucleosomes are relocated to allow sites of general transcription factor binding and transcription initiation to become accessible. The extent of nucleosome shifting is closely related to the dynamic range of gene transcription and generally related to DNA sequence properties and use of the coactivators TFIID or SAGA. However, dynamic gene expression is not limited to SAGA-regulated promoters and is an inherent feature of most genes. While nucleosome repositioning occurs pervasively, we found that a class of genes required for growth experience acute nucleosome shifting as cells enter the cell cycle. Significantly, our data identify that the ATP-dependent chromatin-remodeling enzyme Snf2 plays a fundamental role in nucleosome repositioning and the expression of growth genes. We also reveal that nucleosome organization changes extensively in concert with phases of the cell cycle, with large, regularly spaced nucleosome arrays being established in mitosis. Collectively, our data and analysis provide a framework for understanding nucleosome dynamics in relation to fundamental DNA-dependent transactions. PMID:26966245

  14. Effect of nTiO2 and nCeO2 nanoparticles on gene expression, germination, and early development in plants

    EPA Science Inventory

    Ten agronomic plant species and Arabidopsis thaliana were exposed to different concentrations of the metal oxide nanoparticles (NPs) TiO2 or CeO2 (0 - 1000 mg L-1) and monitored to examine effects on germination rate and early seedling development. Endpoints measured included ge...

  15. microRNA-dependent Temporal Gene Expression in the Ureteric Bud Epithelium during Mammalian Kidney Development

    PubMed Central

    Nagalakshmi, Vidya K.; Lindner, Volkhard; Wessels, Andy; Yu, Jing

    2014-01-01

    Background Our previous study on mouse mutants with the ureteric bud (UB) epithelium-specific Dicer deletion (Dicer UB mutants) demonstrated the significance of UB epithelium-derived miRNAs in UB development. Results Our whole-genome transcriptional profiling showed that the Dicer mutant UB epithelium abnormally retained transcriptional features of the early UB epithelium and failed to express many genes associated with collecting duct differentiation. Further, we identified a temporal expression pattern of early UB genes during UB epithelium development in which gene expression was detected at early developmental stages and became undetectable by E14.5. In contrast, expression of early UB genes persisted at later stages in the Dicer mutant UB epithelium and increased at early stages. Our bioinformatics analysis of the abnormally persistently expressed early genes in the Dicer mutant UB epithelium showed significant enrichment of the let-7 family miRNA targets. We further identified a temporal expression pattern of let-7 miRNAs in the UB epithelium that is anti-parallel to that of some early UB genes during kidney development. Conclusions We propose a model in which the let-7 family miRNAs silence the expression of a subset of early genes in the UB epithelium at later developmental stages in order to promote collecting duct differentiation. PMID:25369991

  16. A commonly used rumen-protected conjugated linoleic acid supplement marginally affects fatty acid distribution of body tissues and gene expression of mammary gland in heifers during early lactation

    PubMed Central

    2013-01-01

    Background Conjugated linoleic acids (CLA) in general, and