Sample records for early replication events

  1. Different rates of DNA replication at early versus late S-phase sections: multiscale modeling of stochastic events related to DNA content/EdU (5-ethynyl-2'deoxyuridine) incorporation distributions.

    PubMed

    Li, Biao; Zhao, Hong; Rybak, Paulina; Dobrucki, Jurek W; Darzynkiewicz, Zbigniew; Kimmel, Marek

    2014-09-01

    Mathematical modeling allows relating molecular events to single-cell characteristics assessed by multiparameter cytometry. In the present study we labeled newly synthesized DNA in A549 human lung carcinoma cells with 15-120 min pulses of EdU. All DNA was stained with DAPI and cellular fluorescence was measured by laser scanning cytometry. The frequency of cells in the ascending (left) side of the "horseshoe"-shaped EdU/DAPI bivariate distributions reports the rate of DNA replication at the time of entrance to S phase while their frequency in the descending (right) side is a marker of DNA replication rate at the time of transition from S to G2 phase. To understand the connection between molecular-scale events and scatterplot asymmetry, we developed a multiscale stochastic model, which simulates DNA replication and cell cycle progression of individual cells and produces in silico EdU/DAPI scatterplots. For each S-phase cell the time points at which replication origins are fired are modeled by a non-homogeneous Poisson Process (NHPP). Shifted gamma distributions are assumed for durations of cell cycle phases (G1, S and G2 M), Depending on the rate of DNA synthesis being an increasing or decreasing function, simulated EdU/DAPI bivariate graphs show predominance of cells in left (early-S) or right (late-S) side of the horseshoe distribution. Assuming NHPP rate estimated from independent experiments, simulated EdU/DAPI graphs are nearly indistinguishable from those experimentally observed. This finding proves consistency between the S-phase DNA-replication rate based on molecular-scale analyses, and cell population kinetics ascertained from EdU/DAPI scatterplots and demonstrates that DNA replication rate at entrance to S is relatively slow compared with its rather abrupt termination during S to G2 transition. Our approach opens a possibility of similar modeling to study the effect of anticancer drugs on DNA replication/cell cycle progression and also to quantify other kinetic events that can be measured during S-phase. PMID:24894899

  2. Early steps of retrovirus replicative cycle.

    PubMed

    Nisole, Sébastien; Saïb, Ali

    2004-01-01

    During the last two decades, the profusion of HIV research due to the urge to identify new therapeutic targets has led to a wealth of information on the retroviral replication cycle. However, while the late stages of the retrovirus life cycle, consisting of virus replication and egress, have been partly unraveled, the early steps remain largely enigmatic. These early steps consist of a long and perilous journey from the cell surface to the nucleus where the proviral DNA integrates into the host genome. Retroviral particles must bind specifically to their target cells, cross the plasma membrane, reverse-transcribe their RNA genome, while uncoating the cores, find their way to the nuclear membrane and penetrate into the nucleus to finally dock and integrate into the cellular genome. Along this journey, retroviruses hijack the cellular machinery, while at the same time counteracting cellular defenses. Elucidating these mechanisms and identifying which cellular factors are exploited by the retroviruses and which hinder their life cycle, will certainly lead to the discovery of new ways to inhibit viral replication and to improve retroviral vectors for gene transfer. Finally, as proven by many examples in the past, progresses in retrovirology will undoubtedly also provide some priceless insights into cell biology. PMID:15169567

  3. Early replication fragile sites: where replication–transcription collisions cause genetic instability

    PubMed Central

    Mortusewicz, Oliver; Herr, Patrick; Helleday, Thomas

    2013-01-01

    Cell (2013) 152: 620–632 doi:10.1016/j.cell.2013.01.006; published online 01312013 Although it is known that replication stress causes genetic instability, the underlying mechanisms are not yet fully understood. A new study by Barlow et al (2013) used an elegant genome-wide chromatin immunoprecipitation approach to reveal that DNA lesions induced by replication stress occur predominantly in early replicating and actively transcribed gene clusters. These ‘early replication fragile sites' (ERFS) can be the source for rearrangements commonly found in cancer, and represent a new type of fragile site, distinct from common fragile sites (CFS). PMID:23376922

  4. Loss of heterozygosity preferentially occurs in early replicating regions in cancer genomes

    PubMed Central

    Pedersen, Brent S.; De, Subhajyoti

    2013-01-01

    Erroneous repair of DNA double-strand breaks by homologous recombination (HR) leads to loss of heterozygosity (LOH). Analysing 22 392 and 74 415 LOH events in 363 glioblastoma and 513 ovarian cancer samples, respectively, and using three different metrics, we report that LOH selectively occurs in early replicating regions; this pattern differs from the trends for point mutations and somatic deletions, which are biased toward late replicating regions. Our results are independent of BRCA1 and BRCA2 mutation status. The LOH events are significantly clustered near RNA polII-bound transcription start sites, consistent with the reports that slow replication near paused RNA polII might initiate HR-mediated repair. The frequency of LOH events is higher in the chromosomes with shorter inter-homolog distance inside the nucleus. We propose that during early replication, HR-mediated rescue of replication near paused RNA polII using homologous chromosomes as template leads to LOH. The difference in the preference for replication timing between different classes of genomic alterations in cancer genomes also provokes a testable hypothesis that replicating cells show changing preference between various DNA repair pathways, which have different levels of efficiency and fidelity, as the replication progresses. PMID:23793816

  5. USF Binding Sequences from the HS4 Insulator Element Impose Early Replication Timing on a Vertebrate Replicator

    PubMed Central

    Cadoret, Jean-Charles; Ma, Meiji Kit-Wan; Boggetto, Nicole; West, Adam G.; Prioleau, Marie-Noëlle

    2012-01-01

    The nuclear genomes of vertebrates show a highly organized program of DNA replication where GC-rich isochores are replicated early in S-phase, while AT-rich isochores are late replicating. GC-rich regions are gene dense and are enriched for active transcription, suggesting a connection between gene regulation and replication timing. Insulator elements can organize independent domains of gene transcription and are suitable candidates for being key regulators of replication timing. We have tested the impact of inserting a strong replication origin flanked by the ?-globin HS4 insulator on the replication timing of naturally late replicating regions in two different avian cell types, DT40 (lymphoid) and 6C2 (erythroid). We find that the HS4 insulator has the capacity to impose a shift to earlier replication. This shift requires the presence of HS4 on both sides of the replication origin and results in an advance of replication timing of the target locus from the second half of S-phase to the first half when a transcribed gene is positioned nearby. Moreover, we find that the USF transcription factor binding site is the key cis-element inside the HS4 insulator that controls replication timing. Taken together, our data identify a combination of cis-elements that might constitute the basic unit of multi-replicon megabase-sized early domains of DNA replication. PMID:22412349

  6. Mode of action of SDZ NIM 811, a nonimmunosuppressive cyclosporin A analog with activity against human immunodeficiency virus type 1 (HIV-1): interference with early and late events in HIV-1 replication.

    PubMed Central

    Steinkasserer, A; Harrison, R; Billich, A; Hammerschmid, F; Werner, G; Wolff, B; Peichl, P; Palfi, G; Schnitzel, W; Mlynar, E

    1995-01-01

    SDZ NIM 811 is a cyclosporin A analog that is completely devoid of immunosuppressive capacity but exhibits potent and selective anti-human immunodeficiency virus type 1 (HIV-1) activity. The mechanism of action of SDZ NIM 811 is clearly different from those of all other anti-HIV agents described so far. In cell-free assays, it is not an inhibitor of reverse transcriptase, protease, integrase, and it does not interfere with Rev or Tat function. SDZ NIM 811 does not down-regulate CD4 or inhibit fusion between infected and uninfected, CD4-expressing cells. p24 production from chronically HIV-infected cells is not impaired either. To elucidate the mode of action of SDZ NIM 811, we performed DNA PCR analysis in HIV-1 IIIB-infected MT4 cells in one cycle of virus replication. The effects of SDZ NIM 811 on the kinetics of viral DNA synthesis, appearance of two-long terminal repeat circles (2-LTR circles), and integration of DNA were studied. SDZ NIM 811 inhibited 2-LTR circle formation in a concentration-dependent manner, which is indicative of nuclear localization of preintegration complexes. Half-maximal inhibition was achieved at 0.17 microgram/ml; this concentration is close to the 50% inhibitory concentrations (0.01 to 0.2 microgram/ml) for viral growth inhibition. As expected, integration of proviral DNA into cellular DNA was also inhibited by SDZ NIM 811. Analysis of the viral particles produced by SDZ NIM 811-treated, chronically infected cells revealed amounts of capsid proteins, reverse transcriptase activity, and viral RNA comparable to those of the untreated control. However, these particles showed a dose-dependent reduction in infectivity (50% inhibitory concentration of 0.028 microgram/ml) which indicates that the assembly process is also impaired by SDZ NIM 811. Gag proteins are postulated to play a role not only in assembly but also in early steps of viral replication, e.g., nuclear localization of the preintegration complex. Recently, it was reported that HIV-1 Gag protein binds to cyclophilin A, the intracellular receptor for cyclosporin A. Interference with Gag-cyclophilin interaction may be the molecular basis for the antiviral activity of cyclosporin A and its analogs. PMID:7815548

  7. Early events of DNA photodamage.

    PubMed

    Schreier, Wolfgang J; Gilch, Peter; Zinth, Wolfgang

    2015-04-01

    Ultraviolet (UV) radiation is a leading external hazard to the integrity of DNA. Exposure to UV radiation triggers a cascade of chemical reactions, and many molecular products (photolesions) have been isolated that are potentially dangerous for the cellular system. The early steps that take place after UV absorption by DNA have been studied by ultrafast spectroscopy. The review focuses on the evolution of excited electronic states, the formation of photolesions, and processes suppressing their formation. Emphasis is placed on lesions involving two thymine bases, such as the cyclobutane pyrimidine dimer, the (6-4) lesion, and its Dewar valence isomer. PMID:25664840

  8. Unraveling the early steps of prokaryotic replication Erin L Cunningham and James M Berger

    E-print Network

    Berger, James M.

    Unraveling the early steps of prokaryotic replication Erin L Cunningham and James M Berger In prokaryotes, many of the physical mechanisms governing the process of initiating DNA replication are now studies have shown that prokaryotic initiator structures are both modular and conserved, and have begun

  9. Detection and early identification in bioterrorism events.

    PubMed

    Persell, Deborah J; Robinson, Carolyn H

    2008-01-01

    Syndromic surveillance, collecting and analyzing symptoms before diagnosis, has the potential to identify bioterrorist attacks in a timely, flexible, and specific manner. Nurses are important resources in collecting and interpreting surveillance data. Clinical skills in early diagnosis may identify a bioterrorist attack before surveillance systems and independently trigger investigations. Computerized syndromic surveillance systems are difficult to sustain and are not in use nationwide. Traditional public health surveillance is not replaced by syndromic surveillance. Weaknesses remain in surveillance related to bioterrorism preparedness. Bioterrorist events must be recognized in a timely manner, but this is dependent on sufficient funding for training, equipment, and personnel. PMID:18091080

  10. The Chemistry of Early Self-Replicating Systems

    NASA Technical Reports Server (NTRS)

    Bada, Jeffrey L.

    2004-01-01

    On June 10, 2003, a symposium 'Celebrating 50 Years of Prebiotic Chemistry' honoring the 50th Anniversary of the 1953 publication of the Miller Experiment in SCIENCE was held at the University of California, San Diego. This event was organized and hosted by the NASA Specialized Center of Research and Training in Exobiology. It was sponsored by NASA, the Dean of Physical Sciences and the Department of Chemistry and Biochemistry at the University of California, San Diego (UCSD). The following events were held: 1) For the symposium, public lectures and a reception were held at UCSD on June 10, 2003 in honor of the 50th Anniversary of the Miller Experiment. The speakers were the NSCORT/Exobiology Principal Investigators Dr. Jeffrey L. Bada and Dr. Gerald F. Joyce and the moderator, Dr. Leslie Orgel; 2) A evening discussion seminar and dinner was held at UCSD with invited scientists, NSCORT investigators, NASA Headquarters Officials and the Chancellor and Officials of the University of California, San Diego. Stanley Miller has had a long history of support from the NASA Exobiology Section. This event commemorated the anniversary of his classic experiment and was a small recognition of his contributions to the field.

  11. Ubc9- and mms21-mediated sumoylation counteracts recombinogenic events at damaged replication forks.

    PubMed

    Branzei, Dana; Sollier, Julie; Liberi, Giordano; Zhao, Xiaolan; Maeda, Daisuke; Seki, Masayuki; Enomoto, Takemi; Ohta, Kunihiro; Foiani, Marco

    2006-11-01

    The Ubc9 SUMO-conjugating enzyme and the Siz1 SUMO ligase sumoylate several repair and recombination proteins, including PCNA. Sumoylated PCNA binds Srs2, a helicase counteracting certain recombination events. Here we show that ubc9 mutants depend on checkpoint, recombination, and replication genes for growth. ubc9 cells maintain stalled-fork stability but exhibit a Rad51-dependent accumulation of cruciform structures during replication of damaged templates. Mutations in the Mms21 SUMO ligase resemble the ubc9 mutations. However, siz1, srs2, or pcna mutants altered in sumoylation do not exhibit the ubc9/mms21 phenotype. Like ubc9/mms21 mutants, sgs1 and top3 mutants also accumulate X molecules at damaged forks, and Sgs1/BLM is sumoylated. We propose that Ubc9 and Mms21 act in concert with Sgs1 to resolve the X structures formed during replication. Our results indicate that Ubc9- and Mms21-mediated sumoylation functions as a regulatory mechanism, different from that of replication checkpoints, to prevent pathological accumulation of cruciform structures at damaged forks. PMID:17081974

  12. The intracellular sites of early replication and budding of SARS-coronavirus.

    PubMed

    Stertz, Silke; Reichelt, Mike; Spiegel, Martin; Kuri, Thomas; Martínez-Sobrido, Luis; García-Sastre, Adolfo; Weber, Friedemann; Kochs, Georg

    2007-05-10

    In this study, we analyzed the replication and budding sites of severe acute respiratory syndrome coronavirus (SARS-CoV) at early time points of infection. We detected cytoplasmic accumulations containing the viral nucleocapsid protein, viral RNA and the non-structural protein nsp3. Using EM techniques, we found that these putative viral replication sites were associated with characteristic membrane tubules and double membrane vesicles that most probably originated from ER cisternae. In addition to its presence at the replication sites, N also accumulated in the Golgi region and colocalized with the viral spike protein. Immuno-EM revealed that budding occurred at membranes of the ERGIC (ER-Golgi intermediate compartment) and the Golgi region as early as 3 h post infection, demonstrating that SARS-CoV replicates surprisingly fast. Our data suggest that SARS-CoV establishes replication complexes at ER-derived membranes. Later on, viral nucleocapsids have to be transported to the budding sites in the Golgi region where the viral glycoproteins accumulate and particle formation occurs. PMID:17210170

  13. A noise-induced mechanism for biological homochirality of early life self-replicators

    E-print Network

    Jafarpour, Farshid; Goldenfeld, Nigel

    2015-01-01

    The observed single-handedness of biological amino acids and sugars has long been attributed to autocatalysis. However, the stability of homochiral states in deterministic autocatalytic systems relies on cross inhibition of the two chiral states, an unlikely scenario for early life self-replicators. Here, we present a theory for a stochastic individual-level model of autocatalysis due to early life self-replicators. Without chiral inhibition, the racemic state is the global attractor of the deterministic dynamics, but intrinsic multiplicative noise stabilizes the homochiral states, in both well-mixed and spatially-extended systems. We conclude that autocatalysis is a viable mechanism for homochirality, without imposing additional nonlinearities such as chiral inhibition.

  14. DNA replication origin interference increases the spacing between initiation events in human cells.

    PubMed

    Lebofsky, Ronald; Heilig, Roland; Sonnleitner, Max; Weissenbach, Jean; Bensimon, Aaron

    2006-12-01

    Mammalian DNA replication origins localize to sites that range from base pairs to tens of kilobases. A regular distribution of initiations in individual cell cycles suggests that only a limited number of these numerous potential start sites are converted into activated origins. Origin interference can silence redundant origins; however, it is currently unknown whether interference participates in spacing functional human initiation events. By using a novel hybridization strategy, genomic Morse code, on single combed DNA molecules from primary keratinocytes, we report the initiation sites present on 1.5 Mb of human chromosome 14q11.2. We confirm that initiation zones are widespread in human cells, map to intergenic regions, and contain sequence motifs found at other mammalian initiation zones. Origins used per cell cycle are less abundant than the potential sites of initiation, and their limited use increases the spacing between initiation events. Between-zone interference decreases in proportion to the distance from the active origin, whereas within-zone interference is 100% efficient. These results identify a hierarchical organization of origin activity in human cells. Functional origins govern the probability that nearby origins will fire in the context of multiple potential start sites of DNA replication, and this is mediated by origin interference. PMID:17005913

  15. Nigericin is a potent inhibitor of the early stage of vaccinia virus replication.

    PubMed

    Myskiw, Chad; Piper, Jessica; Huzarewich, Rhiannon; Booth, Tim F; Cao, Jingxin; He, Runtao

    2010-12-01

    Poxviruses remain a significant public health concern due to their potential use as bioterrorist agents and the spread of animal borne poxviruses, such as monkeypox virus, to humans. Thus, the identification of small molecule inhibitors of poxvirus replication is warranted. Vaccinia virus is the prototypic member of the Orthopoxvirus genus, which also includes variola and monkeypox virus. In this study, we demonstrate that the carboxylic ionophore nigericin is a potent inhibitor of vaccinia virus replication in several human cell lines. In HeLa cells, we found that the 50% inhibitory concentration of nigericin against vaccinia virus was 7.9 nM, with a selectivity index of 1038. We present data demonstrating that nigericin targets vaccinia virus replication at a post-entry stage. While nigericin moderately inhibits both early vaccinia gene transcription and translation, viral DNA replication and intermediate and late gene expression are severely compromised in the presence of nigericin. Our results demonstrate that nigericin has the potential to be further developed into an effective antiviral to treat poxvirus infections. PMID:20951746

  16. DNA Replication

    NSDL National Science Digital Library

    American Society For Microbiology

    2002-01-01

    This animation, which shows DNA replication and the interactions of the various enzymes, can be used to illustrate to students the order of events in DNA replication, as well as emphasize which enzymes are involved in the process.

  17. Chasing the Origin of Viruses: Capsid-Forming Genes as a Life-Saving Preadaptation within a Community of Early Replicators.

    PubMed

    Jalasvuori, Matti; Mattila, Sari; Hoikkala, Ville

    2015-01-01

    Virus capsids mediate the transfer of viral genetic information from one cell to another, thus the origin of the first viruses arguably coincides with the origin of the viral capsid. Capsid genes are evolutionarily ancient and their emergence potentially predated even the origin of first free-living cells. But does the origin of the capsid coincide with the origin of viruses, or is it possible that capsid-like functionalities emerged before the appearance of true viral entities? We set to investigate this question by using a computational simulator comprising primitive replicators and replication parasites within a compartment matrix. We observe that systems with no horizontal gene transfer between compartments collapse due to the rapidly emerging replication parasites. However, introduction of capsid-like genes that induce the movement of randomly selected genes from one compartment to another rescues life by providing the non-parasitic replicators a mean to escape their current compartments before the emergence of replication parasites. Capsid-forming genes can mediate the establishment of a stable meta-population where parasites cause only local tragedies but cannot overtake the whole community. The long-term survival of replicators is dependent on the frequency of horizontal transfer events, as systems with either too much or too little genetic exchange are doomed to succumb to replication-parasites. This study provides a possible scenario for explaining the origin of viral capsids before the emergence of genuine viruses: in the absence of other means of horizontal gene transfer between compartments, evolution of capsid-like functionalities may have been necessary for early life to prevail. PMID:25955384

  18. Operational early warning platform for extreme meteorological events

    NASA Astrophysics Data System (ADS)

    Mühr, Bernhard; Kunz, Michael

    2015-04-01

    Operational early warning platform for extreme meteorological events Most natural disasters are related to extreme weather events (e.g. typhoons); weather conditions, however, are also highly relevant for humanitarian and disaster relief operations during and after other natural disaster like earthquakes. The internet service "Wettergefahren-Frühwarnung" (WF) provides various information on extreme weather events, especially when these events are associated with a high potential for large damage. The main focus of the platform is on Central Europe, but major events are also monitored worldwide on a daily routine. WF provides high-resolution forecast maps for many weather parameters which allow detailed and reliable predictions about weather conditions during the next days in the affected areas. The WF service became operational in February 2004 and is part of the Center for Disaster Management and Risk Reduction Technology (CEDIM) since 2007. At the end of 2011, CEDIM embarked a new type of interdisciplinary disaster research termed as forensic disaster analysis (FDA) in near real time. In case of an imminent extreme weather event WF plays an important role in CEDIM's FDA group. It provides early and precise information which are always available and updated several times during a day and gives advice and assists with articles and reports on extreme events.

  19. Early Events in Protein Folding Explored by Rapid Mixing Methods

    E-print Network

    Roder, Heinrich

    15 Early Events in Protein Folding Explored by Rapid Mixing Methods Heinrich Roder, Kosuke Maki for Understanding Protein Folding As with any complex reaction, time-resolved data are essential for elucidating the mechanism of protein folding. Even in cases where the whole process of folding occurs in a single step

  20. Early events leading to fate decisions during leech embryogenesis

    E-print Network

    Weisblat, David A.

    Early events leading to fate decisions during leech embryogenesis Marc Pilon and David A. Weisblat This paper reviews leech development up to the 12-cell embryo. Oogenesis proceeds by a system of nurse cells-nos, a leech homolog to the Drosophila gene nanos, suggests that it may be a determinant associated

  1. Transient increases in p53-responsible gene expression at early stages of Epstein-Barr virus productive replication.

    PubMed

    Sato, Yoshitaka; Shirata, Noriko; Murata, Takayuki; Nakasu, Sho; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Chiba, Shigeki; Isomura, Hiroki; Kanda, Teru; Tsurumi, Tatsuya

    2010-02-15

    Expression of Epstein-Barr Virus BZLF1, a key protein initiating the switch from latent to lytic infection, is known to cause cell growth arrest by accumulating p53 and p21(WAF1/CIP1) in epithelial cells, but its molecular mechanism remains elusive. We found here that the BZLF1 protein stimulates p53 binding to its recognition sequence. The BZLF1 accelerated the rate of p53-DNA complex formation through the interaction with p53 protein and also enhanced p53-specific transcription in vitro. Furthermore, p53 protein was found to bind to its target promoter regions specifically in the early stages of lytic replication. Overexpression of p53 at the early stages of lytic replication enhanced viral genome replication, supporting the idea that p53 plays an important role in the initiation steps of EBV replication. Taking the independent role of BZLF1 on p53 degradation into consideration, we propose that the BZLF1 protein regulates p53 and its target gene products in two distinctive manners; transient induction of p53 at the early stages for the initiation of viral productive replication and p53 degradation at the later stages for S-phase like environment preferable for viral replication. PMID:20139729

  2. Replisome stall events have shaped the distribution of replication origins in the genomes of yeasts

    PubMed Central

    Newman, Timothy J.; Mamun, Mohammed A.; Nieduszynski, Conrad A.; Blow, J. Julian

    2013-01-01

    During S phase, the entire genome must be precisely duplicated, with no sections of DNA left unreplicated. Here, we develop a simple mathematical model to describe the probability of replication failing due to the irreversible stalling of replication forks. We show that the probability of complete genome replication is maximized if replication origins are evenly spaced, the largest inter-origin distances are minimized, and the end-most origins are positioned close to chromosome ends. We show that origin positions in the yeast Saccharomyces cerevisiae genome conform to all three predictions thereby maximizing the probability of complete replication if replication forks stall. Origin positions in four other yeasts—Kluyveromyces lactis, Lachancea kluyveri, Lachancea waltii and Schizosaccharomyces pombe—also conform to these predictions. Equating failure rates at chromosome ends with those in chromosome interiors gives a mean per nucleotide fork stall rate of ?5 × 10?8, which is consistent with experimental estimates. Using this value in our theoretical predictions gives replication failure rates that are consistent with data from replication origin knockout experiments. Our theory also predicts that significantly larger genomes, such as those of mammals, will experience a much greater probability of replication failure genome-wide, and therefore will likely require additional compensatory mechanisms. PMID:23963700

  3. Early microbial translocation blockade reduces SIV-mediated inflammation and viral replication

    PubMed Central

    Kristoff, Jan; Haret-Richter, George; Ma, Dongzhu; Ribeiro, Ruy M.; Xu, Cuiling; Cornell, Elaine; Stock, Jennifer L.; He, Tianyu; Mobley, Adam D.; Ross, Samantha; Trichel, Anita; Wilson, Cara; Tracy, Russell; Landay, Alan; Apetrei, Cristian; Pandrea, Ivona

    2014-01-01

    Damage to the intestinal mucosa results in the translocation of microbes from the intestinal lumen into the circulation. Microbial translocation has been proposed to trigger immune activation, inflammation, and coagulopathy, all of which are key factors that drive HIV disease progression and non-HIV comorbidities; however, direct proof of a causal link is still lacking. Here, we have demonstrated that treatment of acutely SIV-infected pigtailed macaques with the drug sevelamer, which binds microbial lipopolysaccharide in the gut, dramatically reduces immune activation and inflammation and slightly reduces viral replication. Furthermore, sevelamer administration reduced coagulation biomarkers, confirming the contribution of microbial translocation in the development of cardiovascular comorbidities in SIV-infected nonhuman primates. Together, our data suggest that early control of microbial translocation may improve the outcome of HIV infection and limit noninfectious comorbidities associated with AIDS. PMID:24837437

  4. Early microbial translocation blockade reduces SIV-mediated inflammation and viral replication.

    PubMed

    Kristoff, Jan; Haret-Richter, George; Ma, Dongzhu; Ribeiro, Ruy M; Xu, Cuiling; Cornell, Elaine; Stock, Jennifer L; He, Tianyu; Mobley, Adam D; Ross, Samantha; Trichel, Anita; Wilson, Cara; Tracy, Russell; Landay, Alan; Apetrei, Cristian; Pandrea, Ivona

    2014-06-01

    Damage to the intestinal mucosa results in the translocation of microbes from the intestinal lumen into the circulation. Microbial translocation has been proposed to trigger immune activation, inflammation, and coagulopathy, all of which are key factors that drive HIV disease progression and non-HIV comorbidities; however, direct proof of a causal link is still lacking. Here, we have demonstrated that treatment of acutely SIV-infected pigtailed macaques with the drug sevelamer, which binds microbial lipopolysaccharide in the gut, dramatically reduces immune activation and inflammation and slightly reduces viral replication. Furthermore, sevelamer administration reduced coagulation biomarkers, confirming the contribution of microbial translocation in the development of cardiovascular comorbidities in SIV-infected nonhuman primates. Together, our data suggest that early control of microbial translocation may improve the outcome of HIV infection and limit noninfectious comorbidities associated with AIDS. PMID:24837437

  5. Human cytomegalovirus replicates abortively in polymorphonuclear leukocytes after transfer from infected endothelial cells via transient microfusion events.

    PubMed

    Gerna, G; Percivalle, E; Baldanti, F; Sozzani, S; Lanzarini, P; Genini, E; Lilleri, D; Revello, M G

    2000-06-01

    Using a recently developed model for in vitro generation of pp65-positive polymorphonuclear leukocytes (PMNLs), we demonstrated that PMNLs from immunocompetent subjects may harbor both infectious human cytomegalovirus (HCMV) and viral products (pp65, p72, DNA, and immediate-early [IE] and pp67 late mRNAs) as early as 60 min after coculture with human umbilical vein endothelial cells (HUVEC) or human embryonic lung fibroblasts (HELF) infected with a clinical HCMV isolate (VR6110) or other wild-type strains. The number of PMNLs positive for each viral parameter increased with coculture time. Using HELF infected with laboratory-adapted HCMV strains, only very small amounts of viral DNA and IE and late mRNAs were detected in PMNLs. A cellular mRNA, the vascular cell adhesion molecule-1 mRNA, which is abundantly present in both infected and uninfected HUVEC, was detected in much larger amounts in PMNLs cocultured with VR6110-infected cells than in controls. Coculture of PMNLs with VR6110-infected permissive cells in the presence or absence of RNA, protein, and viral DNA synthesis inhibitors showed that only IE genes were transcribed in PMNLs during coculture. Synthesis of IE transcripts in PMNLs was also supported by the finding that only the copy number of IE mRNA (and not the DNA or the pp67 mRNA) per infected PMNL increased markedly with time, and the pp67 to IE mRNA copy number ratio changed from greater than 10 in infected HUVEC to less than 1 in cocultured PMNLs. Fluorescent probe transfer experiments and electron microscopy studies indicated that transfer of infectious virus and viral products from infected cells to PMNLs is likely to be mediated by microfusion events induced by wild-type strains only. In addition, HCMV pp65 and p72 were both shown to localize in the nucleus of the same PMNLs by double immunostaining. Two different mechanisms may explain the virus presence in PMNLs: (i) one major mechanism consists of transitory microfusion events (induced by wild-type strains only) of HUVEC or HELF and PMNLs with transfer of viable virus and biologically active viral material to PMNLs; and (ii) one minor mechanism, i.e., endocytosis, occurs with both wild-type and laboratory strains and leads to the acquisition of very small amounts of viral nucleic acids. In conclusion, HCMV replicates abortively in PMNLs, and wild-type strains and their products (as well as cellular metabolites and fluorescent dyes) are transferred to PMNLs, thus providing evidence for a potential mechanism of HCMV dissemination in vivo. PMID:10823870

  6. Human Cytomegalovirus Replicates Abortively in Polymorphonuclear Leukocytes after Transfer from Infected Endothelial Cells via Transient Microfusion Events

    PubMed Central

    Gerna, Giuseppe; Percivalle, Elena; Baldanti, Fausto; Sozzani, Silvano; Lanzarini, Paolo; Genini, Emilia; Lilleri, Daniele; Revello, Maria Grazia

    2000-01-01

    Using a recently developed model for in vitro generation of pp65-positive polymorphonuclear leukocytes (PMNLs), we demonstrated that PMNLs from immunocompetent subjects may harbor both infectious human cytomegalovirus (HCMV) and viral products (pp65, p72, DNA, and immediate-early [IE] and pp67 late mRNAs) as early as 60 min after coculture with human umbilical vein endothelial cells (HUVEC) or human embryonic lung fibroblasts (HELF) infected with a clinical HCMV isolate (VR6110) or other wild-type strains. The number of PMNLs positive for each viral parameter increased with coculture time. Using HELF infected with laboratory-adapted HCMV strains, only very small amounts of viral DNA and IE and late mRNAs were detected in PMNLs. A cellular mRNA, the vascular cell adhesion molecule-1 mRNA, which is abundantly present in both infected and uninfected HUVEC, was detected in much larger amounts in PMNLs cocultured with VR6110-infected cells than in controls. Coculture of PMNLs with VR6110-infected permissive cells in the presence or absence of RNA, protein, and viral DNA synthesis inhibitors showed that only IE genes were transcribed in PMNLs during coculture. Synthesis of IE transcripts in PMNLs was also supported by the finding that only the copy number of IE mRNA (and not the DNA or the pp67 mRNA) per infected PMNL increased markedly with time, and the pp67 to IE mRNA copy number ratio changed from greater than 10 in infected HUVEC to less than 1 in cocultured PMNLs. Fluorescent probe transfer experiments and electron microscopy studies indicated that transfer of infectious virus and viral products from infected cells to PMNLs is likely to be mediated by microfusion events induced by wild-type strains only. In addition, HCMV pp65 and p72 were both shown to localize in the nucleus of the same PMNLs by double immunostaining. Two different mechanisms may explain the virus presence in PMNLs: (i) one major mechanism consists of transitory microfusion events (induced by wild-type strains only) of HUVEC or HELF and PMNLs with transfer of viable virus and biologically active viral material to PMNLs; and (ii) one minor mechanism, i.e., endocytosis, occurs with both wild-type and laboratory strains and leads to the acquisition of very small amounts of viral nucleic acids. In conclusion, HCMV replicates abortively in PMNLs, and wild-type strains and their products (as well as cellular metabolites and fluorescent dyes) are transferred to PMNLs, thus providing evidence for a potential mechanism of HCMV dissemination in vivo. PMID:10823870

  7. Early Immunologic Events at the Tick-Host Interface

    PubMed Central

    Heinze, Dar M.; Carmical, J. Russ; Aronson, Judith F.; Thangamani, Saravanan

    2012-01-01

    Ixodes species ticks are competent vectors of tick-borne viruses including tick-borne encephalitis and Powassan encephalitis. Tick saliva has been shown to facilitate and enhance viral infection. This likely occurs by saliva-mediated modulation of host responses into patterns favorable for viral infection and dissemination. Because of the rapid kinetics of tick-borne viral transmission, this modulation must occur as early as tick attachment and initiation of feeding. In this study, cutaneous bite-site lesions were analyzed using Affymetrix mouse genome 430A 2.0 arrays and histopathology at 1, 3, 6, and 12 hours after uninfected Ixodes scapularis nymphal tick attachment. At 1 and 3 hrs after attachment, the gene expression profile is markedly different than at later time points. Upregulated gene ontology term clusters enriched at 1 and 3 hrs were related to post-translational modification. At 6 and 12 hrs, cytoskeletal rearrangements, DNA replication/cell division, inflammation, and chemotaxis were prominent clusters. At 6 and 12 hrs, extracellular matrix, signaling, and DNA binding clusters were downregulated. Histopathological analysis shows minimal inflammation at 1 and 3 hrs but an appreciable neutrophil infiltrate at 6 and 12 hrs. In addition, putative hyperemia, localized necrosis, and increased ECM deposition were identified. Putting the gene expression and histopathology analysis together suggests early tick feeding is characterized by modulation of host responses in resident cells that merges into a nascent, neutrophil-driven immune response by 12 hrs post-attachment. PMID:23077588

  8. Early immunologic events at the tick-host interface.

    PubMed

    Heinze, Dar M; Carmical, J Russ; Aronson, Judith F; Thangamani, Saravanan

    2012-01-01

    Ixodes species ticks are competent vectors of tick-borne viruses including tick-borne encephalitis and Powassan encephalitis. Tick saliva has been shown to facilitate and enhance viral infection. This likely occurs by saliva-mediated modulation of host responses into patterns favorable for viral infection and dissemination. Because of the rapid kinetics of tick-borne viral transmission, this modulation must occur as early as tick attachment and initiation of feeding. In this study, cutaneous bite-site lesions were analyzed using Affymetrix mouse genome 430A 2.0 arrays and histopathology at 1, 3, 6, and 12 hours after uninfected Ixodes scapularis nymphal tick attachment. At 1 and 3 hrs after attachment, the gene expression profile is markedly different than at later time points. Upregulated gene ontology term clusters enriched at 1 and 3 hrs were related to post-translational modification. At 6 and 12 hrs, cytoskeletal rearrangements, DNA replication/cell division, inflammation, and chemotaxis were prominent clusters. At 6 and 12 hrs, extracellular matrix, signaling, and DNA binding clusters were downregulated. Histopathological analysis shows minimal inflammation at 1 and 3 hrs but an appreciable neutrophil infiltrate at 6 and 12 hrs. In addition, putative hyperemia, localized necrosis, and increased ECM deposition were identified. Putting the gene expression and histopathology analysis together suggests early tick feeding is characterized by modulation of host responses in resident cells that merges into a nascent, neutrophil-driven immune response by 12 hrs post-attachment. PMID:23077588

  9. Continental temperature change during Early Eocene hyperthermal events

    NASA Astrophysics Data System (ADS)

    Ziegler, Martin; Abels, Hemmo; de Winter, Nils; Gingerich, Philip; Bernasconi, Stefano

    2015-04-01

    Carbonate clumped isotope thermometry has great potential for solving long-standing questions in paleoclimatology as it provides temperature estimates that are independent from assumptions regarding the isotopic or elemental composition of water from which the carbonate precipitated. The clumped isotope group at ETH has worked towards decreasing the sample size requirements and derived new calibrations for the Kiel method based on synthetic and natural calcites. Here we present results of clumped isotope based continental temperatures across the Paleocene-Eocene Thermal Maximum (PETM). The Bighorn Basin of northwestern Wyoming provides hundreds of meters of excellently exposed river floodplain strata of Paleocene and early Eocene age. Records of the the largest greenhouse-warming episode in this interval of time, were recovered soon after their discovery in deep marine sediments. This has allowed intensive study of the major impact this greenhouse warming event had on continental interior climate. Recently, records of four successive, smaller, transient greenhouse warming events in the early Eocene - ETM2/H1/Elmo, H2, I1, and I2 - were located in the fluvial rock record of the basin. We show that the (summer) temperature excursions during hyperthermal events in continental mid-latitudes were amplified compared to marine temperatures and proportional to the size of associated carbon isotope excursions.

  10. Pentacyclic triterpenes in birch bark extract inhibit early step of herpes simplex virus type 1 replication.

    PubMed

    Heidary Navid, M; Laszczyk-Lauer, M N; Reichling, J; Schnitzler, P

    2014-09-25

    Antiviral agents frequently applied for treatment of herpesvirus infections include acyclovir and its derivatives. The antiviral effect of a triterpene extract of birch bark and its major pentacyclic triterpenes, i.e. betulin, lupeol and betulinic acid against acyclovir-sensitive and acyclovir-resistant HSV type 1 strains was examined. The cytotoxic effect of a phytochemically defined birch bark triterpene extract (TE) as well as different pentacyclic triterpenes was analyzed in cell culture, and revealed a moderate cytotoxicity on RC-37 cells. TE, betulin, lupeol and betulinic acid exhibited high levels of antiviral activity against HSV-1 in viral suspension tests with IC50 values ranging between 0.2 and 0.5 ?g/ml. Infectivity of acyclovir-sensitive and clinical isolates of acyclovir-resistant HSV-1 strains was significantly reduced by all tested compounds and a direct concentration- and time-dependent antiherpetic activity could be demonstrated. In order to determine the mode of antiviral action, TE and the compounds were added at different times during the viral infection cycle. Addition of these drugs to uninfected cells prior to infection or to herpesvirus-infected cells during intracellular replication had low effect on virus multiplication. Minor virucidal activity of triterpenes was observed, however both TE and tested compounds exhibited high anti-herpetic activity when viruses were pretreated with these drugs prior to infection. Pentacyclic triterpenes inhibit acyclovir-sensitive and acyclovir-resistant clinical isolates of HSV-1 in the early phase of infection. PMID:25172789

  11. Rubella virus-like replicon particles: analysis of encapsidation determinants and non-structural roles of capsid protein in early post-entry replication.

    PubMed

    Claus, Claudia; Tzeng, Wen-Pin; Liebert, U G; Frey, Teryl K

    2012-03-01

    Rubella virus (RUBV) contains a plus-strand RNA genome with two ORFs, one encoding the non-structural replicase proteins (NS-ORF) and the second encoding the virion structural proteins (SP-ORF). This study describes development and use of a trans-encapsidation system for the assembly of infectious RUBV-like replicon particles (VRPs) containing RUBV replicons (self replicating genomes with the SP-ORF replaced with a reporter gene). First, this system was used to map signals within the RUBV genome that mediate packaging of viral RNA. Mutations within a proposed packaging signal did not significantly affect relative packaging efficiency. The insertion of various fragments derived from the RUBV genome into Sindbis virus replicons revealed that there are several regions within the RUBV genome capable of enhancing encapsidation of heterologous replicon RNAs. Secondly, the trans-encapsidation system was used to analyse the effect of alterations within the capsid protein (CP) on release of VRPs and subsequent initiation of replication in newly infected cells. Deletion of the N-terminal eight amino acids of the CP reduced VRP titre significantly, which could be partially complemented by native CP provided in trans, indicating that this mutation affected an entry or post-entry event in the replication cycle. To test this hypothesis, the trans-encapsidation system was used to demonstrate the rescue of a lethal deletion within P150, one of the virus replicase proteins, by CP contained within the virus particle. This novel finding substantiated the functional role of CP in early post-entry replication. PMID:22113006

  12. Examining the Structure of the Schedule of Sexist Events: Replication and Extension

    ERIC Educational Resources Information Center

    Matteson, Alicia V.; Moradi, Bonnie

    2005-01-01

    The current study reexamined the factor structure of the Lifetime and Recent scales of the Schedule of Sexist Events (SSE; Klonoff & Landrine, 1995) and conducted the first factor analysis of the SSE-Appraisal scale ( Landrine & Klonoff, 1997). Factor analyses conducted with data from 245 women yielded, for SSE-Lifetime and SSE-Appraisal scales,…

  13. Baculovirus resistance in codling moth (Cydia pomonella L.) caused by early block of virus replication.

    PubMed

    Asser-Kaiser, Sabine; Radtke, Pit; El-Salamouny, Said; Winstanley, Doreen; Jehle, Johannes A

    2011-02-20

    An up to 10,000-fold resistance against the biocontrol agent Cydia pomonella granulovirus (CpGV) was observed in field populations of codling moth, C. pomonella, in Europe. Following different experimental approaches, a modified peritrophic membrane, a modified midgut receptor, or a change of the innate immune response could be excluded as possible resistance mechanisms. When CpGV replication was traced by quantitative PCR in different tissues of susceptible and resistant insects after oral and intra-hemocoelic infection, no virus replication could be detected in any of the tissues of resistant insects, suggesting a systemic block prior to viral DNA replication. This conclusion was corroborated by fluorescence microscopy using a modified CpGV (bacCpGV(hsp-eGFP)) carrying enhanced green fluorescent gene (eGFP), which showed that infection in resistant insects did not spread. In conclusion, the different lines of evidence indicate that CpGV can enter but not replicate in the cells of resistant codling moth larvae. PMID:21190707

  14. Understanding the link between early sexual initiation and later sexually transmitted infection: Test and replication in two longitudinal studies

    PubMed Central

    Epstein, Marina; Manhart, Lisa E.; Hill, Karl G.; Bailey, Jennifer A.; Hawkins, J. David; Haggerty, Kevin P.; Catalano, Richard F.

    2013-01-01

    Purpose Age at sexual initiation is strongly associated with sexually transmitted infections (STI), yet prevention programs aiming to delay sexual initiation have shown mixed results in reducing STI. This study tested three explanatory mechanisms for the relationship between early sexual debut and STI: number of sexual partners, individual characteristics, and environmental antecedents. Methods A test-and-replicate strategy was employed using two longitudinal studies: the Seattle Social Development Project (SSDP) and Raising Healthy Children (RHC). Childhood measures included pubertal age, behavioral disinhibition, family, school, and peer influences. Alcohol use and age of sexual debut were measured during adolescence. Lifetime number of sexual partners and having sex under the influence were measured during young adulthood. STI diagnosis was self-reported at age 24. Early sex was defined as debut at <15 years. Path models were developed in SSDP evaluating relationships between measures and were then tested in RHC. Results The relationship between early sex and STI was fully mediated by lifetime sex partners in SSDP, but only partially in RHC, after accounting for co-occurring factors. Behavioral disinhibition predicted early sex, early alcohol use, number of sexual partners, and sex under the influence, but had no direct effect on STI. Family management protected against early sex and early alcohol use, while antisocial peers exacerbated the risk. Conclusions Early sexual initiation, a key mediator of STI, is driven by antecedents that influence multiple risk behaviors. Targeting co-occurring individual and environmental factors may be more effective than discouraging early sexual debut and concomitantly improve other risk behaviors. PMID:24280303

  15. Tetraploidy and chromosomal instability are early events during cervical carcinogenesis.

    PubMed

    Olaharski, Andrew J; Sotelo, Rita; Solorza-Luna, Gilberto; Gonsebatt, Maria E; Guzman, Patricia; Mohar, Alejandro; Eastmond, David A

    2006-02-01

    Chromosomal instability as manifested by increases in aneuploidy and structural chromosome aberrations is believed to play a critical role in the intermediate to late stages in the development of cervical malignancies. The current study was designed to determine the role of tetraploidy in the formation of aneuploidy and ascertain the occurrence of these alterations during the earlier stages of cervical carcinogenesis. Cervical cell samples, with diagnoses ranging from Normal to high-grade lesions, (HSIL) were obtained from 143 women and were evaluated for chromosomal alterations using dual-probe fluorescence in situ hybridization. Cervical cells from a subset of the group were also evaluated for chromosomal instability in the form of micronuclei. The frequencies of cells exhibiting either tetrasomy or aneusomy for Chromosomes 3 and 17 increased significantly with disease progression and displayed distinctive patterns where aneusomy was rarely present in the absence of tetrasomy. The frequencies of micronuclei that formed through either chromosomal loss or breakage increased significantly in both the low-grade and high-grade diagnostic categories and were highly correlated with both the number of tetrasomic and aneusomic cervical cells. In addition, a unique chromosomal alteration involving a significant non-random loss of Chromosome 17 specific to near-tetraploid aneusomic cells (trisomy 17 and tetrasomy 3) was observed. We conclude that tetraploidy and chromosomal instability are related events occurring during the early stages of cervical carcinogenesis that predispose cervical cells to the formation of aneuploidy frequently involving the loss of Chromosome 17. PMID:16123119

  16. Defining the roles of the baculovirus regulatory proteins IE0 and IE1 in genome replication and early gene transactivation.

    PubMed

    Sokal, Nadia; Nie, Yingchao; Willis, Leslie G; Yamagishi, Junya; Blissard, Gary W; Rheault, Mark R; Theilmann, David A

    2014-11-01

    IE0 and IE1 of the baculovirus Autographa californica multiple nucleopolyhedrovirus are essential transregulatory proteins required for both viral DNA replication and transcriptional transactivation. IE0 is identical to IE1 except for 54 amino acids at the N-terminus but the functional differences between these two proteins remain unclear. The purpose of this study was to determine the separate roles of these critical proteins in the virus life cycle. Unlike prior studies, IE0 and IE1 were analyzed using viruses that expressed ie0 and ie1 from an identical promoter so that the timing and levels of expression were comparable. IE0 and IE1 were found to equally support viral DNA replication and budded virus (BV) production. However, specific viral promoters were selectively transactivated by IE0 relative to IE1 but only when expressed at low levels. These results indicate that IE0 preferentially transactivates specific viral genes at very early times post-infection enabling accelerated replication and BV production. PMID:25173193

  17. Onset of the DNA Replication Checkpoint in the Early Drosophila Embryo

    PubMed Central

    Crest, Justin; Oxnard, Nathan; Ji, Jun-Yuan; Schubiger, Gerold

    2007-01-01

    The Drosophila embryo is a promising model for isolating gene products that coordinate S phase and mitosis. We have reported before that increasing maternal Cyclin B dosage to up to six copies (six cycB) increases Cdk1–Cyclin B (CycB) levels and activity in the embryo, delays nuclear migration at cycle 10, and produces abnormal nuclei at cycle 14. Here we show that the level of CycB in the embryo inversely correlates with the ability to lengthen interphase as the embryo transits from preblastoderm to blastoderm stages and defines the onset of a checkpoint that regulates mitosis when DNA replication is blocked with aphidicolin. A screen for modifiers of the six cycB phenotypes identified 10 new suppressor deficiencies. In addition, heterozygote dRPA2 (a DNA replication gene) mutants suppressed only the abnormal nuclear phenotype at cycle 14. Reduction of dRPA2 also restored interphase duration and checkpoint efficacy to control levels. We propose that lowered dRPA2 levels activate Grp/Chk1 to counteract excess Cdk1–CycB activity and restore interphase duration and the ability to block mitosis in response to aphidicolin. Our results suggest an antagonistic interaction between DNA replication checkpoint activation and Cdk1–CycB activity during the transition from preblastoderm to blastoderm cycles. PMID:17151243

  18. Sequence of Events in Measles Virus Replication: Role of Phosphoprotein-Nucleocapsid Interactions

    PubMed Central

    Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia

    2014-01-01

    ABSTRACT The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, PXD and NTAIL is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the PXD F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in PXD-to-NTAIL binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the PXD-NTAIL interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. IMPORTANCE Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ?6,700-nucleotide messenger RNAs from six to ten consecutive genes is unknown. Using a quantitative protein complementation assay and a biGene-biSilencing system allowing conditional expression of two P genes copies, the role of the P-to-N interaction in polymerase function was further characterized. We report here a dynamic protein anchoring mechanism that differs from all other known polymerases that rely only onto a sustained and direct binding to their nucleic acid template. PMID:25008930

  19. The Gammaretroviral p12 protein has multiple domains that function during the early stages of replication

    PubMed Central

    2012-01-01

    Background The Moloney murine leukaemia virus (Mo-MLV) gag gene encodes three main structural proteins, matrix, capsid and nucleocapsid and a protein called p12. In addition to its role during the late stages of infection, p12 has an essential, but undefined, function during early post-entry events. As these stages of retroviral infection remain poorly understood, we set out to investigate the function of p12. Results Examination of the infectivity of Mo-MLV virus-like particles containing a mixture of wild type and mutant p12 revealed that the N- and C-terminal regions of p12 are sequentially acting domains, both required for p12 function, and that the N-terminal activity precedes the C-terminal activity in the viral life cycle. By creating a panel of p12 mutants in other gammaretroviruses, we showed that these domains are conserved in this retroviral genus. We also undertook a detailed mutational analysis of each domain, identifying residues essential for function. These data show that different regions of the N-terminal domain are necessary for infectivity in different gammaretroviruses, in stark contrast to the C-terminal domain where the same region is essential for all viruses. Moreover, chimeras between the p12 proteins of Mo-MLV and gibbon ape leukaemia virus revealed that the C-terminal domains are interchangeable whereas the N-terminal domains are not. Finally, we identified potential functions for each domain. We observed that particles with defects in the N-terminus of p12 were unable to abrogate restriction factors, implying that their cores were impaired. We further showed that defects in the C-terminal domain of p12 could be overcome by introducing a chromatin binding motif into the protein. Conclusions Based on these data, we propose a model for p12 function where the N-terminus of p12 interacts with, and stabilizes, the viral core, allowing the C-terminus of p12 to tether the preintegration complex to host chromatin during mitosis, facilitating integration. PMID:23035841

  20. Early Events of B Cell Activation by Antigen

    NSDL National Science Digital Library

    David Depoil (Cancer Research UK London Research Institute; Lymphocyte Interaction Laboratory REV)

    2009-03-24

    The activation of B cells confers long-lasting protection from a plethora of infectious diseases through the generation of plasma cells that produce high-affinity antibodies and memory cells. Engagement of the B cell receptor (BCR) with cognate antigen initiates intracellular signaling and subsequent internalization of antigen. Membrane-bound antigens are now considered the predominant forms that initiate B cell activation in vivo. We have shown that upon recognition of antigen on the surface of a presenting cell, the B cell undergoes a dramatic change in morphology characterized by rapid spreading followed by more prolonged contraction along the presenting surface. This two-phase response increases the amount of antigen that the B cell accumulates, internalizes, and subsequently presents to T cells. Thus, the spreading and contraction response shapes the outcome of B cell activation. We used a combination of planar lipid bilayers and total internal reflection fluorescence microscopy to investigate the early events that occur after engagement of the BCR and before B cell spreading. We observed the rapid formation of BCR-antigen microclusters, which we redefine as “microsignalosomes” because they mediate the coordinated recruitment of intracellular effectors, such as the kinases Lyn and Syk, the adaptor Vav, and phospholipase C–?2 (PLC-?2). We identified an essential role for the co-receptor CD19 in mediating spreading, and thus B cell activation, in response to membrane-bound antigen. Preliminary evidence suggests that the cellular morphology changes described in vitro are likely to occur upon recognition of antigen presented on the surface of macrophages in lymph nodes in vivo.

  1. Replication forks and replication checkpoints in repair

    Microsoft Academic Search

    Dana Branzei; Marco Foiani

    Eukaryotic cells replicate their DNA and coordinate their response to DNA damage and replication\\u000a blocks by activating appropriate repair processes, regulating recombination, chromatin assembly and\\u000a chromosome partitioning. Replication forks stall at specific problematic genomic regions, and forks\\u000a collapse unless protected by replication checkpoint proteins. These events have been associated with\\u000a recombination and chromosomal rearrangements that lead to genomic instability and

  2. Replicating vaccines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Early work on fish immunology and disease resistance demonstrated fish (like animals and humans) that survived infection were typically resistant to re-infection with the same pathogen. The concepts of resistance upon reinfection lead to the research and development of replicating (live) vaccines in...

  3. Early Jurassic mass extinction: A global long-term event Crispin T. S. Little

    E-print Network

    Benton, Michael

    Early Jurassic mass extinction: A global long-term event Crispin T. S. Little Department of Geology-Pliensbachian extinction event (187 Ma) has been in- terpreted either as one of 10 global periodically recurring mass extinctions of the past 250 m.y. or as a minor localized European event. Elevated levels of family extinction

  4. Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication.

    PubMed

    Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

    2013-01-01

    odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner. PMID:23825525

  5. Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication

    PubMed Central

    Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

    2013-01-01

    odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner. PMID:23825525

  6. Prolidase Is Required for Early Trafficking Events during Influenza A Virus Entry

    PubMed Central

    Pohl, Marie O.; Edinger, Thomas O.

    2014-01-01

    ABSTRACT Influenza A virus (IAV) entry is a multistep process that requires the interaction of the virus with numerous host factors. In this study, we demonstrate that prolidase (PEPD) is a cellular factor required by IAV for successful entry into target cells. PEPD was selected as a candidate during an entry screen performed on nonvalidated primary hits from previously published genome-wide small interfering RNA (siRNA) screens. siRNA-mediated depletion of PEPD resulted in the decreased growth of IAV during mono- and multicycle growth. This growth defect was independent of cell type or virus strain. Furthermore, IAV restriction was apparent as early as 3 h postinfection, and experiments in the absence of protein biosynthesis revealed that the nuclear import of viral ribonucleoprotein complexes (vRNPs) was already blocked in the absence of PEPD. These results led us to investigate which step during entry was affected. Receptor expression, IAV attachment, or IAV internalization was not dependent on the presence of PEPD. However, when looking at the distribution of incoming IAV particles in PEPD-knockdown cells, we found a localization pattern that differed from that in control cells: IAV mostly localized to the cell periphery, and consequently, viral particles displayed reduced colocalization with early and late endosome markers and fusion between viral and endosomal membranes was strongly reduced. Finally, experiments using a competitive inhibitor of PEPD catalytic activity suggested that the enzymatic function of the dipeptidase is required for its proviral effect on IAV entry. In sum, this study establishes PEPD as a novel entry factor required for early endosomal trafficking of IAV. IMPORTANCE Influenza A virus (IAV) continues to be a constant threat to public health. As IAV relies on its host cell for replication, the identification of host factors required by the virus is of importance. First, such studies often reveal novel functions of cellular factors and can extend our knowledge of cellular processes. Second, we can further our understanding of processes that are required for the entry of IAV into target cells. Third, the identification of host factors that contribute to IAV entry will increase the number of potential targets for the development of novel antiviral drugs that are of urgent need. Our study identifies prolidase (PEPD) to be a novel entry factor required by IAV for correct routing within the endosomal compartment following virus internalization. Thereby, we link PEPD, which has been shown to play a role during collagen recycling and growth factor signaling, to early events of viral infection. PMID:25031340

  7. EARLY DETECTION OF RARE EVENTS FOR SUPPLY CHAIN SECURITY

    Microsoft Academic Search

    Douglas H. Jones; Francis A. Méndez Mediavilla

    This study proposes a method to estimate the posterior distribution of multivariate categorical data pertaining to supply chain management. This methodology enables Bayesian analysis of rare events by borrowing strength from a large database. Once the posterior distributions are profiled, further analysis can be performed and\\/or decisions made about the importance of the occurrence of particular rare event. For example,

  8. Eclipse period during replication of plasmid R1: contributions from structural events and from the copy-number control system.

    PubMed

    Olsson, Jan A; Berg, Otto G; Dasgupta, Santanu; Nordström, Kurt

    2003-10-01

    The eclipse period (the time period during which a newly replicated plasmid copy is not available for a new replication) of plasmid R1 in Escherichia coli was determined with the classic Meselson-Stahl density-shift experiment. A mini-plasmid with the wild-type R1 replicon and a mutant with a thermo-inducible runaway-replication phenotype were used in this work. The eclipses of the chromosome and of the wild-type plasmid were 0.6 and 0.2 generation times, respectively, at temperatures ranging from 30 degrees C to 42 degrees C. The mutant plasmid had a similar eclipse at temperatures up to 38 degrees C. At 42 degrees C, the plasmid copy number increased rapidly because of the absence of replication control and replication reached a rate of 350-400 plasmid replications per cell and cell generation. During uncontrolled replication, the eclipse was about 3 min compared with 10 min at controlled replication (the wild-type plasmid at 42 degrees C). Hence, the copy-number control system contributed significantly to the eclipse. The eclipse in the absence of copy-number control (3 min) presumably is caused by structural requirements: the covalently closed circular plasmid DNA has to regain the right degree of superhelicity needed for initiation of replication and it takes time to assemble the initiation factors. PMID:14507381

  9. The structure of the extended psychosis phenotype in early adolescence--a cross-sample replication.

    PubMed

    Wigman, Johanna T W; Vollebergh, Wilma A M; Raaijmakers, Quinten A W; Iedema, Jurjen; van Dorsselaer, Saskia; Ormel, Johan; Verhulst, Frank C; van Os, Jim

    2011-07-01

    The extended psychosis phenotype, or the expression of nonclinical positive psychotic experiences, is already prevalent in adolescence and has a dose-response risk relationship with later psychotic disorder. In 2 large adolescent general population samples (n = 5422 and n = 2230), prevalence and structure of the extended psychosis phenotype was investigated. Positive psychotic experiences, broadly defined, were reported by the majority of adolescents. Exploratory analysis with Structural Equation Modelling (Exploratory Factor Analysis followed by Confirmatory Factor Analysis [CFA]) in sample 1 suggested that psychotic experiences were best represented by 5 underlying dimensions; CFA in sample 2 provided a replication of this model. Dimensions were labeled Hallucinations, Delusions, Paranoia, Grandiosity, and Paranormal beliefs. Prevalences differed strongly, Hallucinations having the lowest and Paranoia having the highest rates. Girls reported more experiences on all dimensions, except Grandiosity, and from age 12 to 16 years rates increased. Hallucinations, Delusions, and Paranoia, but not Grandiosity and Paranormal beliefs, were associated with distress and general measures of psychopathology. Thus, only some of the dimensions of the extended psychosis phenotype in young people may represent a continuum with more severe psychopathology and predict later psychiatric disorder. PMID:20044595

  10. Replication Evidence in Support of the Psychometric Properties of the Devereux Early Childhood Assessment

    Microsoft Academic Search

    Peter E. Jaberg; David J. Dixon; Glenna M. Weis

    2009-01-01

    The Devereux Early Childhood Assessment (DECA) was developed to assess the social-emotional functioning of preschool children. The developers of the DECA report initial validity and reliability evidence in support of the use of the instrument with 2- to 5-year-old children across the United States. There is further need to collect independent validity and reliability evidence in support of the use

  11. Aneuploidy as an Early Mechanistic Event in Metal Carcinogenesis

    PubMed Central

    Wise, Sandra S.; Wise, John Pierce

    2014-01-01

    Aneuploidy has recently been proposed as an initiating event for carcinogenesis. There is significant evidence that carcinogenic metals induce aneuploidy. Here we review the mechanisms for how carcinogenic metals may induce aneuploidy and the evidence that carcinogenic metals induce an aneugenic effect which can destabilize the genome leading to genomic instability and cancer. PMID:21118142

  12. Compartmentalized Replication of R5 T Cell-Tropic HIV-1 in the Central Nervous System Early in the Course of Infection

    PubMed Central

    Sturdevant, Christa Buckheit; Joseph, Sarah B.; Schnell, Gretja; Price, Richard W.; Swanstrom, Ronald; Spudich, Serena

    2015-01-01

    Compartmentalized HIV-1 replication within the central nervous system (CNS) likely provides a foundation for neurocognitive impairment and a potentially important tissue reservoir. The timing of emergence and character of this local CNS replication has not been defined in a population of subjects. We examined the frequency of elevated cerebrospinal fluid (CSF) HIV-1 RNA concentration, the nature of CSF viral populations compared to the blood, and the presence of a cellular inflammatory response (with the potential to bring infected cells into the CNS) using paired CSF and blood samples obtained over the first two years of infection from 72 ART-naïve subjects. Using single genome amplification (SGA) and phylodynamics analysis of full-length env sequences, we compared CSF and blood viral populations in 33 of the 72 subjects. Independent HIV-1 replication in the CNS (compartmentalization) was detected in 20% of sample pairs analyzed by SGA, or 7% of all sample pairs, and was exclusively observed after four months of infection. In subjects with longitudinal sampling, 30% showed evidence of CNS viral replication or pleocytosis/inflammation in at least one time point, and in approximately 16% of subjects we observed evolving CSF/CNS compartmentalized viral replication and/or a marked CSF inflammatory response at multiple time points suggesting an ongoing or recurrent impact of the infection in the CNS. Two subjects had one of two transmitted lineages (or their recombinant) largely sequestered within the CNS shortly after transmission, indicating an additional mechanism for establishing early CNS replication. Transmitted variants were R5 T cell-tropic. Overall, examination of the relationships between CSF viral populations, blood and CSF HIV-1 RNA concentrations, and inflammatory responses suggested four distinct states of viral population dynamics, with associated mechanisms of local viral replication and the early influx of virus into the CNS. This study considerably enhances the generalizability of our results and greatly expands our knowledge of the early interactions of HIV-1 in the CNS. PMID:25811757

  13. Prenatal or early postnatal events predict infectious deaths in young adulthood in rural Africa

    Microsoft Academic Search

    Sophie E Moore; Timothy J Cole; Andrew C Collinson; Ian A McGregord; Andrew M Prenticea

    1999-01-01

    Background Research over the past decade has suggested that prenatal and early postnatal nutrition influence the risk of developing chronic degenerative diseases up to 60 years later. We now present evidence that risk of death from infectious diseases in young adulthood is similarly programmed by early life events. Methods In three rural Gambian villages, affected by a marked annual seasonality

  14. Weekly Digest Guide The Weekly Digest is YSM's weekly events newsletter, distributed early

    E-print Network

    Lee, Daeyeol

    Weekly Digest Guide The Weekly Digest is YSM's weekly events newsletter, distributed early each Friday morning to 9,000+ email recipients on the Yale campus. The Weekly Digest includes approximately. Timeline The Weekly Digest is published on Fridays for events taking place the following week. Lead time

  15. Correlating environmental changes during early Albian oceanic anoxic event 1B using benthic foraminiferal paleoecology

    Microsoft Academic Search

    Jochen Erbacher; Christoph Hemleben; Brian T. Huber; Molly Markey

    1999-01-01

    The nature and consequences of mid-Cretaceous oceanic anoxic events (OAEs) are the subject of ongoing debate, and recent studies have shown that different scenarios are needed to explain each of these events. Nevertheless, similarities between the different OAEs can be observed. Here, we have reconstructed paleoenvironmental changes during the early Albian OAE 1b using benthic foraminiferal distributions and lithologies in

  16. Phosphoproteome Dynamics Upon Changes in Plant Water Status Reveal Early Events Associated With Rapid Growth Adjustment in Maize Leaves*

    PubMed Central

    Bonhomme, Ludovic; Valot, Benoît; Tardieu, François; Zivy, Michel

    2012-01-01

    Plant growth adjustment during water deficit is a crucial adaptive response. The rapid fine-tuned control achieved at the post-translational level is believed to be of considerable importance for regulating early changes in plant growth reprogramming. Aiming at a better understanding of early responses to contrasting plant water statuses, we carried out a survey of the protein phosphorylation events in the growing zone of maize leaves upon a range of water regimes. In this study, the impact of mild and severe water deficits were evaluated in comparison with constant optimal watering and with recovery periods lasting 5, 10, 20, 30, 45, and 60 min. Using four biological replicates per treatment and a robust quantitative phosphoproteomic methodology based on stable-isotope labeling, we identified 3664 unique phosphorylation sites on 2496 proteins. The abundance of nearly 1250 phosphorylated peptides was reproducibly quantified and profiled with high confidence among treatments. A total of 138 phosphopeptides displayed highly significant changes according to water regimes and enabled to identify specific patterns of response to changing plant water statuses. Further quantification of protein amounts emphasized that most phosphorylation changes did not reflect protein abundance variation. During water deficit and recovery, extensive changes in phosphorylation status occurred in critical regulators directly or indirectly involved in plant growth and development. These included proteins influencing epigenetic control, gene expression, cell cycle-dependent processes and phytohormone-mediated responses. Some of the changes depended on stress intensity whereas others depended on rehydration duration, including rapid recoveries that occurred as early as 5 or 10 mins after rewatering. By combining a physiological approach and a quantitative phosphoproteomic analysis, this work provides new insights into the in vivo early phosphorylation events triggered by rapid changes in plant water status, and their possible involvement in plant growth-related processes. PMID:22787273

  17. Characterization of Moloney Murine Leukemia Virus p12 Mutants Blocked during Early Events of Infection

    Microsoft Academic Search

    Bing Yuan; Ariberto Fassati; Andrew Yueh; Stephen P. Goff

    2002-01-01

    Mutations affecting either the N- or C-terminal regions of the Gag protein p12 block replication of Moloney murine leukemia virus (M-MuLV). Viruses carrying mutations in this portion of gag can mediate the assembly and release of virions but are unable to successfully carry out the early phase of the M-MuLV life cycle. Wild-type and mutant viruses were found to synthesize

  18. HIV-protease inhibitors block the replication of both vesicular stomatitis and influenza viruses at an early post-entry replication step

    SciTech Connect

    Federico, Maurizio, E-mail: maurizio.federico@iss.it

    2011-08-15

    The inhibitors of HIV-1 protease (PIs) have been designed to block the activity of the viral aspartyl-protease. However, it is now accepted that this family of inhibitors can also affect the activity of cell proteases. Since the replication of many virus species requires the activity of host cell proteases, investigating the effects of PIs on the life cycle of viruses other than HIV would be of interest. Here, the potent inhibition induced by saquinavir and nelfinavir on the replication of both vesicular stomatitis and influenza viruses is described. These are unrelated enveloped RNA viruses infecting target cells upon endocytosis and intracellular fusion. The PI-induced inhibition was apparently a consequence of a block at the level of the fusion between viral envelope and endosomal membranes. These findings would open the way towards the therapeutic use of PIs against enveloped RNA viruses other than HIV.

  19. Sambucus nigra extracts inhibit infectious bronchitis virus at an early point during replication

    PubMed Central

    2014-01-01

    Background Infectious bronchitis virus (IBV) is a pathogenic chicken coronavirus. Currently, vaccination against IBV is only partially protective; therefore, better preventions and treatments are needed. Plants produce antimicrobial secondary compounds, which may be a source for novel anti-viral drugs. Non-cytotoxic, crude ethanol extracts of Rhodiola rosea roots, Nigella sativa seeds, and Sambucus nigra fruit were tested for anti-IBV activity, since these safe, widely used plant tissues contain polyphenol derivatives that inhibit other viruses. Results Dose–response cytotoxicity curves on Vero cells using trypan blue staining determined the highest non-cytotoxic concentrations of each plant extract. To screen for IBV inhibition, cells and virus were pretreated with extracts, followed by infection in the presence of extract. Viral cytopathic effect was assessed visually following an additional 24 h incubation with extract. Cells and supernatants were harvested separately and virus titers were quantified by plaque assay. Variations of this screening protocol determined the effects of a number of shortened S. nigra extract treatments. Finally, S. nigra extract-treated virions were visualized by transmission electron microscopy with negative staining. Virus titers from infected cells treated with R. rosea and N. sativa extracts were not substantially different from infected cells treated with solvent alone. However, treatment with S. nigra extracts reduced virus titers by four orders of magnitude at a multiplicity of infection (MOI) of 1 in a dose-responsive manner. Infection at a low MOI reduced viral titers by six orders of magnitude and pretreatment of virus was necessary, but not sufficient, for full virus inhibition. Electron microscopy of virions treated with S. nigra extract showed compromised envelopes and the presence of membrane vesicles, which suggested a mechanism of action. Conclusions These results demonstrate that S. nigra extract can inhibit IBV at an early point in infection, probably by rendering the virus non-infectious. They also suggest that future studies using S. nigra extract to treat or prevent IBV or other coronaviruses are warranted. PMID:24433341

  20. Early events in polyoma virus infection: attachment, penetration, and nuclear entry.

    PubMed Central

    Mackay, R L; Consigli, R A

    1976-01-01

    The plaque-assay technique was used as a tool to determine the optimal conditions for adsorption of polyoma virions to host cells. Using these optimal conditions of adsorption, an electron microscopy study of the early events of infection was performed. By electron microscopy and autoradiography, it was demonstrated that both the viral coat proteins and DNA arrive simultaneously in the nucleus as early as 15 min postinfection. When horseradish peroxidase-labeled virions, pseudovirions, and capsids were used to infect cells, only the particles with nucleic acid or a factor(s) associated with the nucleic acid, i.e., histones, appeared to enter the nucleus. Moreover, when virions were used to infect either permissive or nonpermissive cells, identical early events of viral infection, i.e., adsorption, penetration, and nuclear transport, were observed, suggesting that these early events of infection are a property of the virion and not the host cell. Images PMID:183018

  1. Knowledge | Replication Knowledg owledge | Replication Knowledge | R

    E-print Network

    Shull, Kenneth R.

    Knowledge | Replication Knowledg owledge | Replication Knowledge | R wledge | ReplicationKnowledge | Re dge | ReplicationKnowledge | Repl e | ReplicationKnowledge | Replica | ReplicationKnowledge | Replicatio Replication Knowledge | Replication ication Knowledge | Replication ationKnowledge | Replication

  2. The future is now: early life events preset adult behaviour.

    PubMed

    Patchev, A V; Rodrigues, A J; Sousa, N; Spengler, D; Almeida, O F X

    2014-01-01

    To consider the evidence that human and animal behaviours are epigenetically programmed by lifetime experiences. Extensive PubMed searches were carried out to gain a broad view of the topic, in particular from the perspective of human psychopathologies such as mood and anxiety disorders. The selected literature cited is complemented by previously unpublished data from the authors' laboratories. Evidence that physiological and behavioural functions are particularly sensitive to the programming effects of environmental factors such as stress and nutrition during early life, and perhaps at later stages of life, is reviewed and extended. Definition of stimulus- and function-specific critical periods of programmability together with deeper understanding of the molecular basis of epigenetic regulation will deliver greater appreciation of the full potential of the brain's plasticity while providing evidence-based social, psychological and pharmacological interventions to promote lifetime well-being. PMID:23790203

  3. Early events in the disulfide-coupled folding of BPTI.

    PubMed Central

    Bulaj, G.; Goldenberg, D. P.

    1999-01-01

    Recent studies of the refolding of reduced bovine pancreatic trypsin inhibitor (BPTI) have shown that a previously unidentified intermediate with a single disulfide is formed much more rapidly than any other one-disulfide species. This intermediate contains a disulfide that is present in the native protein (between Cys14 and 38), but it is thermodynamically less stable than the other two intermediates with single native disulfides. To characterize the role of the [14-38] intermediate and the factors that favor its formation, detailed kinetic and mutational analyses of the early disulfide-formation steps were carried out. The results of these studies indicate that the formation of [14-38] from the fully reduced protein is favored by both local electrostatic effects, which enhance the reactivities of the Cys14 and 38 thiols, and conformational tendencies that are diminished by the addition of urea and are enhanced at lower temperatures. At 25 degrees C and pH 7.3, approximately 35% of the reduced molecules were found to initially form the 14-38 disulfide, but the majority of these molecules then undergo intramolecular rearrangements to generate non-native disulfides, and subsequently the more stable intermediates with native disulfides. Amino acid replacements, other than those involving Cys residues, were generally found to have only small effects on either the rate of forming [14-38] or its thermodynamic stability, even though many of the same substitutions greatly destabilized the native protein and other disulfide-bonded intermediates. In addition, those replacements that did decrease the steady-state concentration of [14-38] did not adversely affect further folding and disulfide formation. These results suggest that the weak and transient interactions that are often detected in unfolded proteins and early folding intermediates may, in some cases, not persist or promote subsequent folding steps. PMID:10493584

  4. Live Cell Imaging of Early Autophagy Events: Omegasomes and Beyond

    PubMed Central

    Karanasios, Eleftherios; Stapleton, Eloise; Walker, Simon A.; Manifava, Maria; Ktistakis, Nicholas T.

    2013-01-01

    Autophagy is a cellular response triggered by the lack of nutrients, especially the absence of amino acids. Autophagy is defined by the formation of double membrane structures, called autophagosomes, that sequester cytoplasm, long-lived proteins and protein aggregates, defective organelles, and even viruses or bacteria. Autophagosomes eventually fuse with lysosomes leading to bulk degradation of their content, with the produced nutrients being recycled back to the cytoplasm. Therefore, autophagy is crucial for cell homeostasis, and dysregulation of autophagy can lead to disease, most notably neurodegeneration, ageing and cancer. Autophagosome formation is a very elaborate process, for which cells have allocated a specific group of proteins, called the core autophagy machinery. The core autophagy machinery is functionally complemented by additional proteins involved in diverse cellular processes, e.g. in membrane trafficking, in mitochondrial and lysosomal biology. Coordination of these proteins for the formation and degradation of autophagosomes constitutes the highly dynamic and sophisticated response of autophagy. Live cell imaging allows one to follow the molecular contribution of each autophagy-related protein down to the level of a single autophagosome formation event and in real time, therefore this technique offers a high temporal and spatial resolution. Here we use a cell line stably expressing GFP-DFCP1, to establish a spatial and temporal context for our analysis. DFCP1 marks omegasomes, which are precursor structures leading to autophagosomes formation. A protein of interest (POI) can be marked with either a red or cyan fluorescent tag. Different organelles, like the ER, mitochondria and lysosomes, are all involved in different steps of autophagosome formation, and can be marked using a specific tracker dye. Time-lapse microscopy of autophagy in this experimental set up, allows information to be extracted about the fourth dimension, i.e. time. Hence we can follow the contribution of the POI to autophagy in space and time. PMID:23929131

  5. Evidence for an early pliocene cold event in the southern oceans

    SciTech Connect

    Burckle, L.H.; Mortlock, R.A. (Columbia Univ., Palisades, NY (United States)); Rudolph, S. (State Univ. of New York, Oswego, NY (United States))

    1993-01-01

    Although it is generally agreed that the early Pliocene witnessed the last great climate warming before the onset of Northern Hemisphere glaciation, it is generally not recognized that this time interval also witnessed what appear to be major glaciations in both northern and southern Hemispheres. This describes a study of brief, intense warm events in the early Pliocene as well as evidence for at least one major glaciation during this time interval. 13 refs.

  6. Chromatin signatures of the Drosophila replication program.

    PubMed

    Eaton, Matthew L; Prinz, Joseph A; MacAlpine, Heather K; Tretyakov, George; Kharchenko, Peter V; MacAlpine, David M

    2011-02-01

    DNA replication initiates from thousands of start sites throughout the Drosophila genome and must be coordinated with other ongoing nuclear processes such as transcription to ensure genetic and epigenetic inheritance. Considerable progress has been made toward understanding how chromatin modifications regulate the transcription program; in contrast, we know relatively little about the role of the chromatin landscape in defining how start sites of DNA replication are selected and regulated. Here, we describe the Drosophila replication program in the context of the chromatin and transcription landscape for multiple cell lines using data generated by the modENCODE consortium. We find that while the cell lines exhibit similar replication programs, there are numerous cell line-specific differences that correlate with changes in the chromatin architecture. We identify chromatin features that are associated with replication timing, early origin usage, and ORC binding. Primary sequence, activating chromatin marks, and DNA-binding proteins (including chromatin remodelers) contribute in an additive manner to specify ORC-binding sites. We also generate accurate and predictive models from the chromatin data to describe origin usage and strength between cell lines. Multiple activating chromatin modifications contribute to the function and relative strength of replication origins, suggesting that the chromatin environment does not regulate origins of replication as a simple binary switch, but rather acts as a tunable rheostat to regulate replication initiation events. PMID:21177973

  7. High STOP-BANG questionnaire scores predict intraoperative and early postoperative adverse events

    PubMed Central

    Seet, Edwin; Chua, Maureen; Liaw, Chen Mei

    2015-01-01

    INTRODUCTION Obstructive sleep apnoea (OSA) is the most common sleep-related breathing disorder associated with multisystemic organ involvement. The STOP-BANG questionnaire is a concise, validated questionnaire that is used to screen for OSA. This study aimed to establish the use of the STOP-BANG questionnaire for perioperative patient risk stratification. METHODS In this retrospective cohort study, we extracted the demographic, medical and perioperative outcome data of all patients who underwent elective surgery, excluding ophthalmic surgeries, from January to December 2011. Multivariate regression analysis was used to predict independent risk factors for intraoperative and early postoperative adverse events. RESULTS Of the 5,432 patients analysed, 7.4% had unexpected intraoperative and early postoperative adverse events. We found that the risk of unexpected intraoperative and early postoperative adverse events was greater in patients with STOP-BANG scores ? 3 compared to those with a STOP-BANG score of 0 (score 3: odds ratio [OR] 3.6, 95% confidence interval [CI] 2.1–6.3, p < 0.001; score 4: OR 3.4, 95% CI 1.8–6.5, p < 0.001; score 5: OR 6.4, 95% CI 2.7–15.0, p < 0.001; score ? 6: OR 5.6, 95% CI 2.1–15.4, p < 0.001). Patients with STOP-BANG scores ? 5 had a fivefold increased risk of unexpected intraoperative and early postoperative adverse events, while patients with STOP-BANG scores ? 3 had a ‘one in four’ chance of having an adverse event. Other independent predictors included older age (p < 0.001), American Society of Anesthesiologists class ? 2 (p < 0.003) and uncontrolled hypertension (p = 0.028). CONCLUSION STOP-BANG score may be used as a preoperative risk stratification tool to predict the risk of intraoperative and early postoperative adverse events. PMID:25917473

  8. Early event of protein folding studied by time-resolved photoacoustic calorimetry

    Microsoft Academic Search

    Wunshain Fann; Hsin-Liang Chen; Jen-Tse Huang; Pei-Yeh R. Chen; Chung Tien Lee; Sunney I. Chan

    2003-01-01

    Recently, various methods including temperature jump and hydro-dynamics focusing have been used to study early event of protein folding. In this paper, we propose to use time-resolved photoacoustic (PAC) to study protein folding from nanoseconds to microseconds. The experiment use photolabile linkers to \\

  9. Evidence for kill-butchery events of early Upper Paleolithic age at Kostenki, Russia

    E-print Network

    Holliday, Vance T.

    are found at Kostenki on the west bank of the Don River in Russia. During the 1950s, A.N. Rogachev excavatedEvidence for kill-butchery events of early Upper Paleolithic age at Kostenki, Russia John F, Universitetskaya nab., 1, 199034 St. Petersburg, Russia c Institute of the History of Material Culture, Russian

  10. How Early Events Affect Growing Brains. An Interview with Neuroscientist Pat Levitt

    ERIC Educational Resources Information Center

    National Scientific Council on the Developing Child, 2006

    2006-01-01

    Recent advances in neuroscience show clearly how experience can change brain neurochemicals, and how this in turn affects the way the brain functions. As a result, early negative events actually get built into the growing brain's neurochemistry, altering the brain's architecture. Research is continuing to investigate how children with genetic…

  11. Let's Party! How To Plan Special Events and Raise Money in Early Childhood Programs.

    ERIC Educational Resources Information Center

    Rice, Judith Anne

    This guide for early childhood program administrators provides guidelines and makes suggestions for planning special events to facilitate opportunities for parents, children, teachers, and organizations to connect in ways that strengthen individuals and communities and raise money for the organization. Part 1, "Planning," focuses on organization,…

  12. Emerging and re-emerging rickettsioses: endothelial cell infection and early disease events

    Microsoft Academic Search

    Nahed Ismail; David H. Walker

    2008-01-01

    Rickettsiae cause some of the most severe human infections, including epidemic typhus and Rocky Mountain spotted fever. Substantial progress has been made in research into the genomics, vector relationships, pathogenesis and immunity of these obligate, intracellular, arthropod-transmitted bacteria. This Review summarizes our understanding of the early and late events in pathogenesis and immunity, modulation of the host response to rickettsial

  13. Polyomavirus JC in the context of immunosuppression: a series of adaptive, DNA replication-driven recombination events in the development of progressive multifocal leukoencephalopathy.

    PubMed

    Johnson, Edward M; Wortman, Margaret J; Dagdanova, Ayuna V; Lundberg, Patric S; Daniel, Dianne C

    2013-01-01

    Polyomavirus JC (JCV) is the etiological agent of progressive multifocal leukoencephalopathy (PML), a demyelinating infection of oligodendrocytes in the brain. PML, a frequently fatal opportunistic infection in AIDS, has also emerged as a consequence of treatment with several new immunosuppressive therapeutic agents. Although nearly 80% of adults are seropositive, JCV attains an ability to infect glial cells in only a minority of people. Data suggest that JCV undergoes sequence alterations that accompany this ability, and these changes can be derived from an archetype strain by mutation, deletion, and duplication. While the introductory source and primary tissue reservoir of JCV remain unknown, lymphoid cells have been identified as potential intermediaries in progression of JCV to the brain. This review is focused on sequence changes in the noncoding control region (NCCR) of the virus. We propose an adaptive mechanism that involves a sequential series of DNA replication-driven NCCR recombination events involving stalled DNA replication forks at NCCR palindromic secondary structures. We shall describe how the NCCR sequence changes point to a model in which viral DNA replication drives NCCR recombination, allowing JCV adaptation to different cell types in its progression to neurovirulence. PMID:23690820

  14. The p92 Polymerase Coding Region Contains an Internal RNA Element Required at an Early Step in Tombusvirus Genome Replication

    Microsoft Academic Search

    Sandra Monkewich; Han-Xin Lin; Marc R. Fabian; Wei Xu; Hong Na; Debashish Ray; Olena A. Chernysheva; Peter D. Nagy; K. Andrew White

    2005-01-01

    The replication of positive-strand RNA viral genomes involves various cis-acting RNA sequences. Generally, regulatory RNA sequences are present at or near genomic termini; however, internal replication elements (IREs) also exist. Here we report the structural and functional characterization of an IRE present in the readthrough portion of the p92 polymerase gene of Tomato bushy stunt virus. Analysis of this element

  15. Clinical predictors of early second event in patients with clinically isolated syndrome.

    PubMed

    Mowry, Ellen M; Pesic, Mila; Grimes, Barbara; Deen, Serina R; Bacchetti, Peter; Waubant, Emmanuelle

    2009-07-01

    This study aimed to determine the predictors of increased risk of a second demyelinating event within the first year of an initial demyelinating event (IDE) suggestive of early multiple sclerosis (MS). Patients with MS or clinically isolated syndrome (CIS) seen at the UCSF MS Center within one year of the IDE were studied. Univariate and multivariate Cox models were used to analyze predictors of having a second event within 1 year of the IDE. Of 330 patients with MS/CIS, 111 had a second event within 1 year. Non-white race/ethnicity (HR = 2.39, 95% CI [1.58, 3.60], p < 0.0001) and younger age (HR for each 10-year decrease in age = 1.51, 95% CI [1.28, 1.80], p < 0.0001) were strongly associated with an increased risk of having a second event within one year of onset. Having a lower number of functional systems affected by the IDE was also associated with an increased risk of early second event (HR for every one less FS involved = 1.31, 95% CI [1.06, 1.61], p = 0.011). These results were similar after adjusting for treatment of the IDE with steroids and disease-modifying therapy. Non-white race/ethnicity, younger age, and a lower number of FS affected by the IDE are associated with a substantially increased hazard ratio for a second demyelinating event within 1 year. Since early relapse is predictive of worse long-term outcome, identifying and treating such patients after the IDE may be of benefit to them. PMID:19252775

  16. Identifying Early Events of Gene Expression in Breast Cancer with Systems Biology Phylogenetics

    PubMed Central

    Abu-Asab, M.S.; Abu-Asab, N.; Loffredo, C.A.; Clarke, R.; Amri, H.

    2013-01-01

    Advanced omics technologies such as deep sequencing and spectral karyotyping are revealing more of cancer heterogeneity at the genetic, genomic, gene expression, epigenetic, proteomic, and metabolomic levels. With this increasing body of emerging data, the task of data analysis becomes critical for mining and modeling to better understand the relevant underlying biological processes. However, the multiple levels of heterogeneity evident within and among populations, healthy and diseased, complicate the mining and interpretation of biological data, especially when dealing with hundreds to tens of thousands of variables. Heterogeneity occurs in many diseases, such as cancers, autism, macular degeneration, and others. In cancer, heterogeneity has hampered the search for validated biomarkers for early detection, and it has complicated the task of finding clonal (driver) and nonclonal (nonexpanded or passenger) aberrations. We show that subtyping of cancer (classification of specimens) should be an a priori step to the identification of early events of cancers. Studying early events in oncogenesis can be done on histologically normal tissues from diseased individuals (HNTDI), since they most likely have been exposed to the same mutagenic insults that caused the cancer in their neighboring tissues. Polarity assessment of HNTDI data variables by using healthy specimens as outgroup(s), followed by the application of parsimony phylogenetic analysis, produces a hierarchical classification of specimens that reveals the early events of the disease ontogeny within its subtypes as shared derived changes (abnormal changes) or synapomorphies in phylogenetic terminology. PMID:23548567

  17. Marine signature of early Holocene glacial events of the eastern margin of the Laurentide Ice Sheet

    NASA Astrophysics Data System (ADS)

    Pearce, Christof; Seidenkrantz, Marit-Solveig

    2015-04-01

    The gradual demise of the Laurentide Ice Sheet during the last deglaciation was characterized by large-scale and abrupt glacial events along its eastern margin. During the early Holocene, several episodes of iceberg and meltwater release originated from glacial advances and retreats mostly from the Hudson Strait region. Evidence for these events can be found in marine sediment cores from large areas of the Labrador Sea as increased input of ice-rafted debris and detrital carbonate. These events are especially clear from sites proximal to Hudson Strait and downstream the Labrador Current on the Labrador Shelf. In this study we present signals for several of such early Holocene ice sheet instabilities from more distal study sites. Sedimentological analyses of marine sediment cores from different bays in eastern Newfoundland revealed long distance transport of detrital carbonate during short-lived intervals of the early Holocene. The layers were investigated using a multi-proxy approach consisting of high resolution X-ray fluorescence (XRF) core scans, grain size analysis, quantitative X-ray diffraction (XRD), and biomarker analysis. The presence of detrital carbonate was most clearly found from elevated calcium - strontium ratios based on XRF core scanning results and further confirmed by increased content of calcite and dolomite and an ancient biomarker composition. Based on radiocarbon dating, the detrital carbonate layers can be linked to glacial events Heinrich 0, the Gold Cove event and possibly the Noble Inlet advance. The wide spread signature of these glacial events can be used for correlation of climate archives over a large geographic area. We propose that by detailed fingerprinting of the composition of these layers, they can be used as time-synchronous correlation tools, which may be used to infer past leads and lags in climatic and oceanographic variability as well as help to unravel unknown past marine radiocarbon reservoir ages in the Labrador Sea.

  18. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression. PMID:24741094

  19. Early Events in the Pathogenesis of Foot-and-Mouth Disease in Cattle After Controlled Aerosol Exposure

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The goal of this study was to identify the primary sites of replication of foot-and-mouth disease virus (FMDV) in cattle subsequent to aerogenous inoculation. A novel aerosol inoculation method was developed to simulate natural, airborne transmission and thereby allow the identification of early rep...

  20. Early Reading Success and Its Relationship to Reading Achievement and Reading Volume: Replication of "10 Years Later"

    ERIC Educational Resources Information Center

    Sparks, Richard L.; Patton, Jon; Murdoch, Amy

    2014-01-01

    Cunningham and Stanovich reported a longitudinal investigation over 10 years that examined the unique influence of exposure to print in explaining individual differences on various measures of reading achievement and declarative (general) knowledge. The present study replicated their investigation with a larger number of participants and…

  1. Murine Gammaherpesvirus 68 Open Reading Frame 45 Plays an Essential Role during the Immediate-Early Phase of Viral Replication

    PubMed Central

    Jia, Qingmei; Chernishof, Vasili; Bortz, Eric; Mchardy, Ian; Wu, Ting-Ting; Liao, Hsiang-I; Sun, Ren

    2005-01-01

    Murine gammaherpesvirus 68 (MHV-68) has been developed as a model for the human gammaherpesviruses Epstein-Barr virus and human herpesvirus 8/Kaposi's sarcoma-associated herpesvirus (HHV-8/KSHV), which are associated with several types of human diseases. Open reading frame 45 (ORF45) is conserved among the members of the Gammaherpesvirinae subfamily and has been suggested to be a virion tegument protein. The repression of ORF45 expression by small interfering RNAs inhibits MHV-68 viral replication. However, the gene product of MHV-68 ORF45 and its function have not yet been well characterized. In this report, we show that MHV-68 ORF45 is a phosphorylated nuclear protein. We constructed an ORF45-null MHV-68 mutant virus (45STOP) by the insertion of translation termination codons into the portion of the gene encoding the N terminus of ORF45. We demonstrated that the ORF45 protein is essential for viral gene expression immediately after the viral genome enters the nucleus. These defects in viral replication were rescued by providing ORF45 in trans or in an ORF45-null revertant (45STOP.R) virus. Using a transcomplementation assay, we showed that the function of ORF45 in viral replication is conserved with that of its KSHV homologue. Finally, we found that the C-terminal 23 amino acids that are highly conserved among the Gammaherpesvirinae subfamily are critical for the function of ORF45 in viral replication. PMID:15795297

  2. Dissemination of a highly virulent pathogen: tracking the early events that define infection.

    PubMed

    Gonzalez, Rodrigo J; Lane, M Chelsea; Wagner, Nikki J; Weening, Eric H; Miller, Virginia L

    2015-01-01

    The series of events that occurs immediately after pathogen entrance into the body is largely speculative. Key aspects of these events are pathogen dissemination and pathogen interactions with the immune response as the invader moves into deeper tissues. We sought to define major events that occur early during infection of a highly virulent pathogen. To this end, we tracked early dissemination of Yersinia pestis, a highly pathogenic bacterium that causes bubonic plague in mammals. Specifically, we addressed two fundamental questions: (1) do the bacteria encounter barriers in disseminating to draining lymph nodes (LN), and (2) what mechanism does this nonmotile bacterium use to reach the LN compartment, as the prevailing model predicts trafficking in association with host cells. Infection was followed through microscopy imaging in addition to assessing bacterial population dynamics during dissemination from the skin. We found and characterized an unexpected bottleneck that severely restricts bacterial dissemination to LNs. The bacteria that do not pass through this bottleneck are confined to the skin, where large numbers of neutrophils arrive and efficiently control bacterial proliferation. Notably, bottleneck formation is route dependent, as it is abrogated after subcutaneous inoculation. Using a combination of approaches, including microscopy imaging, we tested the prevailing model of bacterial dissemination from the skin into LNs and found no evidence of involvement of migrating phagocytes in dissemination. Thus, early stages of infection are defined by a bottleneck that restricts bacterial dissemination and by neutrophil-dependent control of bacterial proliferation in the skin. Furthermore, and as opposed to current models, our data indicate an intracellular stage is not required by Y. pestis to disseminate from the skin to draining LNs. Because our findings address events that occur during early encounters of pathogen with the immune response, this work can inform efforts to prevent or control infection. PMID:25611317

  3. Modulation of in vitro transformation and the early and late modes of DNA replication of uv-irradiation Syrian hamster cells by caffeine

    SciTech Connect

    Doniger, J.; DiPaolo, J.A.

    1981-09-01

    The effect of caffeine on post-uv DNA replication was studied to determine its relevance to carcinogenesis. The level of uv-induced transformed colonies of Syrian hamster embryo cells (HEC) was increased up to fivefold when caffeine was added to cells between 0 and 6 h post-uv. The greatest increase was observed when the interval between uv irradiation and caffeine addition was 4 h. Two modes of DNA replication occurred after uv irradiation. During the early mode (0 to 3 h post-uv) the size of nascent strands, as measured by alkaline sucrose sedimentation, was smaller than those in nonirradiated cells, whereas during the late mode they recovered to normal size. Caffeine inhibited the rate of elongation of nascent strands during the early mode. When caffeine was added immediately after uv irradiation, the conversion of the early mode to the late mode was inhibited. Studies on the effects of caffeine have now been extended to the late mode. While caffeine has little effect with the fd elements beginning from the 10th day after irradiation is connected with their proliferation but not with the migration out from lymphoid organs.

  4. The glutathione transferase of Nicotiana benthamiana NbGSTU4 plays a role in regulating the early replication of Bamboo mosaic virus

    PubMed Central

    Chen, I-Hsuan; Chiu, Meng-Hsuen; Cheng, Shun-Fang; Hsu, Yau-Heiu; Tsai, Ching-Hsiu

    2013-01-01

    Bamboo mosaic virus (BaMV) is a single-stranded positive-sense RNA virus. One of the plant glutathione S-transferase (GST) genes, NbGSTU4, responds as an upregulated gene in Nicotiana benthamiana post BaMV infection. In order to identify the role of NbGSTU4 in BaMV infection, the expression of NbGSTU4 was knocked down using a virus-induced gene silencing technique or was transiently expressed in N. benthamiana in BaMV inoculation. The results show a significant decrease in BaMV RNA accumulation when the expression level of NbGSTU4 is reduced; whereas the viral RNA accumulation increases when NbGSTU4 is transiently expressed. Furthermore, this study identified that the involvement of NbGSTU4 in viral RNA accumulation occurs by its participation in the viral early replication step. The findings show that the NbGSTU4 protein expressed from Escherichia coli can interact with the 3? untranslated region (UTR) of the BaMV RNA in vitro in the presence of glutathione (GSH). The addition of GSH in the in vitro replication assay shows an enhancement of minus-strand but not plus-strand RNA synthesis. The results suggest that the plant GST protein plays a role in binding viral RNA and delivering GSH to the replication complex to create a reduced condition for BaMV minus-strand RNA synthesis. PMID:23701112

  5. The glutathione transferase of Nicotiana benthamiana NbGSTU4 plays a role in regulating the early replication of Bamboo mosaic virus.

    PubMed

    Chen, I-Hsuan; Chiu, Meng-Hsuen; Cheng, Shun-Fang; Hsu, Yau-Heiu; Tsai, Ching-Hsiu

    2013-08-01

    Bamboo mosaic virus (BaMV) is a single-stranded positive-sense RNA virus. One of the plant glutathione S-transferase (GST) genes, NbGSTU4, responds as an upregulated gene in Nicotiana benthamiana post BaMV infection. In order to identify the role of NbGSTU4 in BaMV infection, the expression of NbGSTU4 was knocked down using a virus-induced gene silencing technique or was transiently expressed in N. benthamiana in BaMV inoculation. The results show a significant decrease in BaMV RNA accumulation when the expression level of NbGSTU4 is reduced; whereas the viral RNA accumulation increases when NbGSTU4 is transiently expressed. Furthermore, this study identified that the involvement of NbGSTU4 in viral RNA accumulation occurs by its participation in the viral early replication step. The findings show that the NbGSTU4 protein expressed from Escherichia coli can interact with the 3' untranslated region (UTR) of the BaMV RNA in vitro in the presence of glutathione (GSH). The addition of GSH in the in vitro replication assay shows an enhancement of minus-strand but not plus-strand RNA synthesis. The results suggest that the plant GST protein plays a role in binding viral RNA and delivering GSH to the replication complex to create a reduced condition for BaMV minus-strand RNA synthesis. PMID:23701112

  6. Protein-mediated Selective Enclosure of Early Replicators Inside of Membranous Vesicles: First Step Towards Cell Membranes

    Microsoft Academic Search

    Tiina Laiterä; Kirsi Lehto

    2009-01-01

    Containment in cell membranes is essential for all contemporary life, and apparently even the earliest life forms had to be\\u000a somehow contained. It has been postulated that random enclosure of replicating molecules inside of spontaneously assembled\\u000a vesicles would have formed the initial cellular ancestors. However, completely random re-formation or division of such primitive\\u000a vesicles would have abolished the heritability of

  7. ``Early/slow'' events: A new category of VLF perturbations observed in relation with sprites

    NASA Astrophysics Data System (ADS)

    Haldoupis, C.; Steiner, R. J.; Mika, Á.; Shalimov, S.; Marshall, R. A.; Inan, U. S.; BöSinger, T.; Neubert, T.

    2006-11-01

    Analysis of subionospheric VLF transmissions, observed in relation with sprites, has led to the identification of a new category of VLF perturbations caused by the direct effects of tropospheric lightning on the overlying lower ionosphere. They constitute a large subset of the so-called "early/fast" events where now the term "fast," which implies rapid onset durations less than ˜20 ms, does not apply. In contrast with early/fast, the perturbations have a gradual growth and thus "slow" onset durations ranging from about 0.5 to 2.5 s; thus these events are labeled herein as "early/slow." They are indicative of a new physical process at work which, following a sprite-causative cloud-to-ground discharge, leads to a gradual buildup of conductivity changes in the lower ionosphere which must be responsible for the long onset durations of the observed perturbations. Analysis of broadband VLF sferic recordings, made with a two-channel receiver near the sprite producing storms, shows that the growth phase of an early/slow event coincides with the occurrence of complex and dynamic lightning action. This is composed of a few sequential cloud-to-ground lightning strokes and clusters (bursts) of sferics which are attributable to intracloud lightning. We postulate that the long onset durations are due to secondary ionization buildup in the upper D region below the nighttime VLF reflection heights, caused mainly by the impact on sprite-produced electrons of sequential electromagnetic pulses radiated upward from horizontal in-cloud discharges.

  8. Effects of 60 Hz electromagnetic fields on early growth in three plant species and a replication of previous results

    SciTech Connect

    Davis, M.S. [Univ. of Sunderland (United Kingdom). Ecology Centre] [Univ. of Sunderland (United Kingdom). Ecology Centre

    1996-05-01

    In an attempt to replicate the findings of Smith et al., seeds of Raphanus sativus L. (radish), Sinapsis alba L. (mustard), and Hordeum vulgare L. (barley) were grown for between 9 and 21 days in continuous electromagnetic fields (EMFs) at ion-cyclotron resonance conditions for stimulation of Ca{sup 2+} (B{sub H} = 78.3 {micro}T, B{sub HAC} = 40 {micro}T peak-peak at 60 Hz, B{sub v} = 0). On harvesting, radish showed results similar to those of Smith et al. Dry stem weight and plant height were both significantly greater (Mann-Whitney tests, Ps < 0.05) in EMF-exposed plants than in control plants in each EMF experiment. Wet root weight was significantly greater in EMF-exposed plants in two out of three experiments, as were dry leaf weight, dry whole weight, and stem diameter. Dry root weight, wet leaf weight, and wet whole weight were significantly greater in EMF-exposed plants in one of three experiments. All significant differences indicated an increase in weight or size in the EMF-exposed plants. In each of the sham experiments, no differences between exposed and control plants were evident. Mustard plants failed to respond to the EMFs in any of the plant parameters measured. In one experiment, barley similarly failed to respond; but in another showed significantly greater wet root weight and significantly smaller stem diameter and dry seed weight at the end of the experiment in exposed plants compared to control plants. Although these results give no clue about the underlying bioelectromagnetic mechanism, they demonstrate that, at least for one EMF-sensitive biosystem, results can be independently replicated in another laboratory. Such replication is crucial in establishing the validity of bioelectromagnetic science.

  9. An early Miocene age for a high-temperature event in gneisses from Zabargad Island (Red Sea, Egypt): mantle diapirism?

    E-print Network

    Demouchy, Sylvie

    An early Miocene age for a high-temperature event in gneisses from Zabargad Island (Red Sea, Egypt outcropping on Zabargad Island (Red Sea, Egypt). This island, though of limited size (& 4 km2 ), has an almost

  10. Early events following experimental infection with Peste-Des-Petits ruminants virus suggest immune cell targeting.

    PubMed

    Pope, Robert A; Parida, Satya; Bailey, Dalan; Brownlie, Joe; Barrett, Thomas; Banyard, Ashley C

    2013-01-01

    Peste-des-petits ruminants virus (PPRV) is a viral pathogen that causes a devastating plague of small ruminants. PPRV is an economically significant disease that continues to be a major obstacle to the development of sustainable agriculture across the developing world. The current understanding of PPRV pathogenesis has been heavily assumed from the closely related rinderpest virus (RPV) and other morbillivirus infections alongside data derived from field outbreaks. There have been few studies reported that have focused on the pathogenesis of PPRV and very little is known about the processes underlying the early stages of infection. In the present study, 15 goats were challenged by the intranasal route with a virulent PPRV isolate, Côte d'Ivoire '89 (CI/89) and sacrificed at strategically defined time-points post infection to enable pre- and post-mortem sampling. This approach enabled precise monitoring of the progress and distribution of virus throughout the infection from the time of challenge, through peak viraemia and into a period of convalescence. Observations were then related to findings of previous field studies and experimental models of PPRV to develop a clinical scoring system for PPRV. Importantly, histopathological investigations demonstrated that the initial site for virus replication is not within the epithelial cells of the respiratory mucosa, as has been previously reported, but is within the tonsillar tissue and lymph nodes draining the site of inoculation. We propose that virus is taken up by immune cells within the respiratory mucosa which then transport virus to lymphoid tissues where primary virus replication occurs, and from where virus enters circulation. Based on these findings we propose a novel clinical scoring methodology for PPRV pathogenesis and suggest a fundamental shift away from the conventional model of PPRV pathogenesis. PMID:23418464

  11. Early Events following Experimental Infection with Peste-Des-Petits Ruminants Virus Suggest Immune Cell Targeting

    PubMed Central

    Pope, Robert A.; Parida, Satya; Bailey, Dalan; Brownlie, Joe; Barrett, Thomas; Banyard, Ashley C.

    2013-01-01

    Peste-des-petits ruminants virus (PPRV) is a viral pathogen that causes a devastating plague of small ruminants. PPRV is an economically significant disease that continues to be a major obstacle to the development of sustainable agriculture across the developing world. The current understanding of PPRV pathogenesis has been heavily assumed from the closely related rinderpest virus (RPV) and other morbillivirus infections alongside data derived from field outbreaks. There have been few studies reported that have focused on the pathogenesis of PPRV and very little is known about the processes underlying the early stages of infection. In the present study, 15 goats were challenged by the intranasal route with a virulent PPRV isolate, Côte d’Ivoire ’89 (CI/89) and sacrificed at strategically defined time-points post infection to enable pre- and post-mortem sampling. This approach enabled precise monitoring of the progress and distribution of virus throughout the infection from the time of challenge, through peak viraemia and into a period of convalescence. Observations were then related to findings of previous field studies and experimental models of PPRV to develop a clinical scoring system for PPRV. Importantly, histopathological investigations demonstrated that the initial site for virus replication is not within the epithelial cells of the respiratory mucosa, as has been previously reported, but is within the tonsillar tissue and lymph nodes draining the site of inoculation. We propose that virus is taken up by immune cells within the respiratory mucosa which then transport virus to lymphoid tissues where primary virus replication occurs, and from where virus enters circulation. Based on these findings we propose a novel clinical scoring methodology for PPRV pathogenesis and suggest a fundamental shift away from the conventional model of PPRV pathogenesis. PMID:23418464

  12. Approximate entropy analysis of event-related potentials in patients with early vascular dementia.

    PubMed

    Xu, Jin; Sheng, Hengsong; Lou, Wutao; Zhao, Songzhen

    2012-06-01

    This study investigated differences in event-related potential (ERP) parameters among early vascular dementia (VD) patients, healthy elder controls (ECs), and young controls (YCs). A visual "oddball" color identification task was performed while individuals' electroencephalograms (EEGs) were recorded. Approximate entropy (ApEn), a nonlinear measure, along with P300 latencies and amplitudes were used to analyze ERP data and compare these three groups. The patients with VD showed more complex ERP waveforms and higher ApEn values than did ECs while performing the visual task. It was further found that patients with VD showed reduced P300 amplitudes and increased latencies. The results indicate that patients with VD have fewer attention resources to devote to processing stimuli, lower speed of stimulus classification, and lower synchrony in their cortical activity during the response period. We suggest that ApEn, as a measure of ERP complexity, is a promising marker for early diagnosis of VD. PMID:22659716

  13. Multi-events earthquake early warning algorithm using a Bayesian approach

    NASA Astrophysics Data System (ADS)

    Wu, S.; Yamada, M.; Tamaribuchi, K.; Beck, J. L.

    2015-02-01

    Current earthquake early warning (EEW) systems lack the ability to appropriately handle multiple concurrent earthquakes, which led to many false alarms during the 2011 Tohoku earthquake sequence in Japan. This paper uses a Bayesian probabilistic approach to handle multiple concurrent events for EEW. We implement the theory using a two-step algorithm. First, an efficient approximate Bayesian model class selection scheme is used to estimate the number of concurrent events. Then, the Rao-Blackwellized Importance Sampling method with a sequential proposal probability density function is used to estimate the earthquake parameters, that is hypocentre location, origin time, magnitude and local seismic intensity. A real data example based on 2 months data (2011 March 9-April 30) around the time of the 2011 M9 Tohoku earthquake is studied to verify the proposed algorithm. Our algorithm results in over 90 per cent reduction in the number of incorrect warnings compared to the existing EEW system operating in Japan.

  14. Rapid Eye Movement Sleep Behavioral Events: A New Marker for Neurodegeneration in Early Parkinson Disease?

    PubMed Central

    Sixel-Döring, Friederike; Trautmann, Ellen; Mollenhauer, Brit; Trenkwalder, Claudia

    2014-01-01

    Objective: To analyze potential markers in sleep for early recognition of neurodegenerative disease in newly diagnosed, unmedicated patients with Parkinson disease (PD) compared to controls. Methods: Videopolysomnography (vPSG) was available in 158 newly diagnosed, unmedicated patients with PD and 110 age-, sex-, and education-matched healthy controls (HC). Rapid eye movement (REM) sleep was analyzed for REM without atonia (RWA) and studied by review of time-synchronized video. Motor behaviors and/or vocalizations in REM sleep with a purposeful component other than comfort moves were identified as REM sleep behavioral events (RBE). Two or more events had to be present to be classified as “RBE positive.” RBE subjects included rapid eye movement sleep behavior disorder (RBD) and non-RBD subjects based on the presence or absence of RWA > 18.2%. Results: RBE were detected in 81 of 158 patients with de novo PD (51%) and 17 of 110 HC (15%) (P < 0.001). RBD was identified in 40/81 RBE-positive patients with PD (25% of all PD patients) and 2 of 17 RBE-positive HC (2% of all controls). RBE-positive patients showed no specific motor or neuropsychological features compared to RBE-negative patients. Patients with PD and HC with RBE had more REM sleep (P = 0.002) and a higher periodic leg movements in sleep index (P = 0.022) compared to subjects without RBE. Conclusion: This first description of REM sleep behavioral events (RBE) shows it occurs more frequently in patients with de novo Parkinson disease (PD) than in healthy controls and may be an early sign of neurodegeneration and precede rapid eye movement sleep behavior disorder (RBD). There is no specific phenotype of PD associated with newly defined RBE or RBD at this early stage. Citation: Sixel-Döring F; Trautmann E; Mollenhauer B; Trenkwalder C. Rapid eye movement sleep behavioral events: a new marker for neurodegeneration in early Parkinson disease? SLEEP 2014;37(3):431-438. PMID:24587564

  15. Not Just the 8.2 event: Dynamic Early Holocene Climate in Arctic Canada

    NASA Astrophysics Data System (ADS)

    Axford, Y.; Briner, J. P.; Miller, G. H.; Francis, D. R.

    2006-12-01

    Temperature reconstructions from a lake in the eastern Canadian Arctic indicate that peak warmth in the early Holocene was interrupted by two abrupt, short-lived temperature reversals at ~9.l and ~8.5 ka. Summer temperatures at Lake CF8, Baffin Island (~500 km west of Greenland) are inferred from subfossil midge (Chironomidae) assemblages. Our results indicate that the site, like others on Baffin Island, experienced exceptionally warm summers (almost 5°C warmer than present) through much of the early Holocene, presumably in response to enhanced summer insolation. After 1000 years of very warm, stable climate, warmth was interrupted by two discrete cold reversals at ~9.1 and ~8.5 ka, during which multiple cold-stenothermous midge taxa appeared in the lake and summer temperatures dropped more than 3°C. These two clearly-defined reversals, well beyond the range of background variability, were of similar amplitude and duration, and were separated by several centuries of near-peak warmth. The only Holocene events of comparable amplitude at this site are the rapid onset of Holocene warmth, and the more gradual Neoglacial cooling after 8 ka. Abrupt cooling events over the Baffin region are consistent with model simulations of the impacts of freshwater outbursts into the Labrador Sea, such as the Lake Agassiz outburst flood that occurred ~8.4 ka. That there are two discrete events recorded at this site indicates that the "8.2 event" was not uniquely significant in this region; rather, the period between approximately ~9.2 and 8 ka was characterized by repeated climate fluctuations forced by multiple outburst floods or other mechanisms. Thus global correlations among paleoclimate records need not assume that climate perturbations during this time period necessarily correlate with the draining of Lake Agassiz or the 8.2 ka cooling in central Greenland.

  16. Exposure to potentially traumatic events in early childhood: differential links to emergent psychopathology

    PubMed Central

    Briggs-Gowan, Margaret J.; Carter, Alice S.; Clark, Roseanne; Augustyn, Marilyn; McCarthy, Kimberly J.; Ford, Julian D.

    2011-01-01

    Objective To examine associations between exposure to potentially traumatic events (PTEs) and clinical patterns of symptoms and disorders in preschool children. Method Two hundred and thirteen referred and non-referred children, ages 24 to 48 months (MN = 34.9, SD = 6.7 months) were studied. Lifetime exposure to PTEs (family violence and non-interpersonal events) and recent stressful life events were assessed with the Preschool Age Psychiatric Assessment (PAPA) and Child Life Events Scale. Child psychiatric symptoms and disorders were assessed with parent-reports in the PAPA, a comprehensive, developmentally sensitive interview. Sociodemographic risk, parental anxiety and depressive symptoms (Center for Epidemiologic Studies Depression, Beck Anxiety Inventory), and child developmental level (Mullen Scales of Early Learning) also were assessed. Results Violence exposure was broadly associated with psychiatric status in the areas of depression, separation anxiety, posttraumatic stress, and conduct problems, whereas potentially traumatic non-interpersonal exposure was associated with phobic anxiety. The majority of the associations between violence exposure and preschoolers’ symptoms were significant even when other key factors, including economic disadvantage and parental mood and anxiety symptoms, were controlled statistically. However, parental depressive/anxious symptoms may have partially or fully mediated the relationships between violence exposure and depressive and conduct symptoms. Conclusions Evidence of robust associations between violence exposure and early childhood internalizing and externalizing disorders and symptoms highlights the need for longitudinal prospective research concerning neurodevelopmental mechanisms and pathways. Findings underscore the relevance of assessing trauma exposure, particularly interpersonal violence, to identify young children at risk. PMID:20840502

  17. Early Cretaceous High Arctic Magmatism and the Oceanic Anoxic Event 1a

    NASA Astrophysics Data System (ADS)

    Planke, Sverre; Polteau, Stephane; Faleide, Jan Inge; Svensen, Henrik; Myklebust, Reidun; Midtkandal, Ivar; Corfu, Fernando

    2014-05-01

    The High Arctic Large Igneous Province (HALIP) comprises Early and Late Cretaceous igneous deposits extending from the Canadian Arctic Archipelago in the west to the east Siberian Island in the east. It also includes anomalously thick igneous crust in the Canada Basin. We have mapped out the distribution of HALIP volcanic extrusive and intrusive rocks in the Barents Sea based on field work and borehole data in Svalbard and extensive geophysical data in the offshore areas. The volcanic extrusive and intrusive rocks in the Barents Sea Large Igneous Province (BLIP) are present in a 700 000 km2 large region extending across the northern and eastern Barents Sea. The igneous complex is dominated by a large sill complex intruded into organic-rich Jurassic to Permian age sequences in the East Barents Basin, on Svalbard and on Franz Josef Land. Geochemical data suggest that the tholeiitic igneous rocks were likely formed during a short-lived melting event. New geochronology data (U/Pb on zircons) suggest that the igneous event occurred in the Early Aptian or Barremian. Marine and terrestrial Cretaceous shales and sandstones of the Carolinefjellet, Helvetiafjellet, and Rurikfjellet formations have recently been cored in four boreholes on Svalbard (the Longyearbyen CO2 Laboratory). We have completed a comprehensive analytical program of samples from the boreholes, including geochronology (Ar/Ar and zircon U/Pb), biostratigraphy (palynology), and geochemistry (ICP-MS, RockEval, TOC). In the boreholes, the Barremian-early Aptian Helvetiafjellet Formation is overlaid by early Aptian sapropel-rich shales of the Carolinefjellet Formation. Carbon isotope data reveal a negative excursion in this anoxic interval, most likely representing the Oceanic Anoxic Event 1a (OAE1a). The geochronology data suggest that the intrusive BLIP volcanism occurred at the tim e of the early Aptian OAE1a. We propose that the link between the BLIP and the OAE1a is a massive release of thermogenic methane from contact aureoles of thermally altered sediments surrounding the hot sill intrusions in the BLIP. We estimate that about 9000 Gt of carbon was potentially degassed from the contact aureoles in the East Barents Basin. A rapid release of isotopically light metamorphic greenhouse gases to the atmosphere is therefore a possible trigger for the OAE1a and the associated negative carbon isotope excursion. Subsequent lava degassing from the HALIP or the Ontong Java Plateau may have caused the subsequent increase in isotopically heavy carbon.

  18. Does Silent Reading Speed in Normal Adult Readers Depend on Early Visual Processes? Evidence from Event-Related Brain Potentials

    ERIC Educational Resources Information Center

    Korinth, Sebastian Peter; Sommer, Werner; Breznitz, Zvia

    2012-01-01

    Little is known about the relationship of reading speed and early visual processes in normal readers. Here we examined the association of the early P1, N170 and late N1 component in visual event-related potentials (ERPs) with silent reading speed and a number of additional cognitive skills in a sample of 52 adult German readers utilizing a Lexical…

  19. On the earliest record of Cretaceous tyrannosauroids in western North America: implications for an Early Cretaceous Laurasian interchange event

    Microsoft Academic Search

    Lindsay E. Zanno; Peter J. Makovicky

    2011-01-01

    The sudden appearance of Asian dinosaur clades within Lower Cretaceous strata of western North America has long been recognised as a biotic dispersion event related to initial establishment of a Beringian land bridge. To date, uncertainty exists regarding the timing of the Early Cretaceous Laurasian interchange event (EKLInE) and the pattern of associated biotic dispersal. Here, we report a tyrannosauroid

  20. Environmental controls on marine ecosystems during the early Toarcian extinction event

    NASA Astrophysics Data System (ADS)

    Danise, Silvia; Twitchett, Richard J.

    2015-04-01

    The fossil record has the potential to provide valuable insights into species response to past climate change if paleontological data are combined with appropriate proxies of environmental change. In the early Toarcian (Early Jurassic, ˜183Ma ago) rapid warming coincided with a main perturbation in the carbon cycle, seal level rise, widespread deposition of organic-rich, black shales under anoxic conditions, increased weathering rates and a biotic crisis in the marine realm, with the extinction of approximately 5% of families and 26% of genera. Because of this complex suite of inter-linked environmental and oceanographic changes, a key challenge is to determine which of these were most influential in controlling specific aspects of extinction and ecological collapse. In this study we combine high resolution palaeontological and palaeoenvironmental data from the coastal sections of the Whitby Mudstone Formation in North Yorkshire, UK, to reconstruct how climate changes controlled the structure of benthic and nektonic communities through the event, over a time period of ˜1.7 Ma. We show that benthic and nektonic ecosystems became decoupled and were driven by different environmental variables. Although rapid warming has been invoked as the main trigger of this event, the palaeotemperature proxy was a poor predictor of marine community dynamics, and abiotic factors indirectly linked to temperature, such as change in seawater dissolved oxygen concentration and nutrient inputs, were more important.

  1. Reliability of demographic and socioeconomic variables in predicting early initiation of breastfeeding: a replication analysis using the Kenya Demographic and Health Survey data

    PubMed Central

    Matanda, Dennis J; Mittelmark, Maurice B; Urke, Helga B; Amugsi, Dickson A

    2014-01-01

    Objectives Examine the reliability of sociodemographic variables in predicting initiation of breastfeeding within an hour of birth (EarlyBF), using data from 1998, 2003 and 2008–2009. Study design A replication analysis using the Kenya Demographic and Health Survey (KDHS) data collected in 1998, 2003 and 2008–2009. The candidate predictor variables were child's gender, home or health facility place of birth, vaginal or caesarean mode of birth, urban or rural setting, province of residence, Wealth Index and maternal education, occupation, literacy and media exposure. Setting Kenya. Participants 6375 dyads of mothers aged 15–49 and their children aged 0–23?months (2125 dyads in each of the survey years). Results Mode of birth and province were statistically significant predictors of EarlyBF in 1998, 2003 and 2008–2009. Children delivered through caesarean section were non-EarlyBF in 1998 (OR 2.63, 95% CI 1.72 to 4.04), 2003 (OR 3.36, 95% CI 1.83 to 6.16) and 2008 (OR 3.51, 95% CI 2.17 to 5.69). The same was true of those living in the Western province in 1998 (OR 2.67, 95% CI 1.61 to 4.43), 2003 (OR 4.92, 95% CI 3.01 to 8.04) and 2008 (OR 6.07, 95% CI 3.54 to 10.39). Conclusions The 1998 KDHS data do not provide the basis for reliable prediction of EarlyBF, with reliability conceptualised as replicability of findings using highly similar data sets from 2003 and 2008–2009. Most of the demographic and socioeconomic variables were unreliable predictors of EarlyBF. We speculate that activities in parts or all of Kenya changed the analysis context in the period between 1998 and 2008–2009, and these changes were of a sufficient magnitude to affect the relationships under investigation. The degree to which this is a general problem in child health research is not known, calling for further research to investigate this methodological issue with other health end points and other data. PMID:24939811

  2. Heterologous microarray experiments allow the identification of the early events associated with potato tuber cold sweetening

    PubMed Central

    Bagnaresi, Paolo; Moschella, Anna; Beretta, Ottavio; Vitulli, Federico; Ranalli, Paolo; Perata, Pierdomenico

    2008-01-01

    Background Since its discovery more than 100 years ago, potato (Solanum tuberosum) tuber cold-induced sweetening (CIS) has been extensively investigated. Several carbohydrate-associated genes would seem to be involved in the process. However, many uncertainties still exist, as the relative contribution of each gene to the process is often unclear, possibly as the consequence of the heterogeneity of experimental systems. Some enzymes associated with CIS, such as ?-amylases and invertases, have still to be identified at a sequence level. In addition, little is known about the early events that trigger CIS and on the involvement/association with CIS of genes different from carbohydrate-associated genes. Many of these uncertainties could be resolved by profiling experiments, but no GeneChip is available for the potato, and the production of the potato cDNA spotted array (TIGR) has recently been discontinued. In order to obtain an overall picture of early transcriptional events associated with CIS, we investigated whether the commercially-available tomato Affymetrix GeneChip could be used to identify which potato cold-responsive gene family members should be further studied in detail by Real-Time (RT)-PCR (qPCR). Results A tomato-potato Global Match File was generated for the interpretation of various aspects of the heterologous dataset, including the retrieval of best matching potato counterparts and annotation, and the establishment of a core set of highly homologous genes. Several cold-responsive genes were identified, and their expression pattern was studied in detail by qPCR over 26 days. We detected biphasic behaviour of mRNA accumulation for carbohydrate-associated genes and our combined GeneChip-qPCR data identified, at a sequence level, enzymatic activities such as ?-amylases and invertases previously reported as being involved in CIS. The GeneChip data also unveiled important processes accompanying CIS, such as the induction of redox- and ethylene-associated genes. Conclusion Our Global Match File strategy proved critical for accurately interpretating heterologous datasets, and suggests that similar approaches may be fruitful for other species. Transcript profiling of early events associated with CIS revealed a complex network of events involving sugars, redox and hormone signalling which may be either linked serially or act in parallel. The identification, at a sequence level, of various enzymes long known as having a role in CIS provides molecular tools for further understanding the phenomenon. PMID:18416834

  3. Age-related differences in event-related potentials for early visual processing of emotional faces.

    PubMed

    Hilimire, Matthew R; Mienaltowski, Andrew; Blanchard-Fields, Fredda; Corballis, Paul M

    2014-07-01

    With advancing age, processing resources are shifted away from negative emotional stimuli and toward positive ones. Here, we explored this 'positivity effect' using event-related potentials (ERPs). Participants identified the presence or absence of a visual probe that appeared over photographs of emotional faces. The ERPs elicited by the onsets of angry, sad, happy and neutral faces were recorded. We examined the frontocentral emotional positivity (FcEP), which is defined as a positive deflection in the waveforms elicited by emotional expressions relative to neutral faces early on in the time course of the ERP. The FcEP is thought to reflect enhanced early processing of emotional expressions. The results show that within the first 130 ms young adults show an FcEP to negative emotional expressions, whereas older adults show an FcEP to positive emotional expressions. These findings provide additional evidence that the age-related positivity effect in emotion processing can be traced to automatic processes that are evident very early in the processing of emotional facial expressions. PMID:23677489

  4. Characteristics of long recovery early VLF events observed by the North African AWESOME Network

    NASA Astrophysics Data System (ADS)

    Naitamor, S.; Cohen, M. B.; Cotts, B. R. T.; Ghalila, H.; Alabdoadaim, M. A.; Graf, K.

    2013-08-01

    Lightning strokes are capable of initiating disturbances in the lower ionosphere, whose recoveries persist for many minutes. These events are remotely sensed via monitoring subionospherically propagating very low frequency (VLF) transmitter signals, which are perturbed as they pass through the region above the lightning stroke. In this paper we describe the properties and characteristics of the early VLF signal perturbations, which exhibit long recovery times using subionospheric VLF transmitter data from three identical receivers located at Algiers (Algeria), Tunis (Tunisia), and Sebha (Libya). The results indicate that the observation of long recovery events depends strongly on the modal structure of the signal electromagnetic field and the distance from the disturbed region and the receiver or transmitter locations. Comparison of simultaneously collected data at the three sites indicates that the role of the causative lightning stroke properties (e.g., peak current and polarity), or that of transient luminous events may be much less important. The dominant parameter which determines the duration of the recovery time and amplitude appears to be the modal structure of the subionospheric VLF probe signal at the ionospheric disturbance, where scattering occurs, and the subsequent modal structure that propagates to the receiver location.

  5. Evidence of systematic bias in sexual over- and underperception of naturally occurring events: a direct replication of Haselton (2003) in a more gender-equal culture.

    PubMed

    Bendixen, Mons

    2014-01-01

    Error Management Theory (Haselton and Buss, 2000; Haselton and Nettle, 2006) maintains that natural selection has engineered adaptations for judgment under uncertainty to minimize the overall cost of making errors, leading to universal biases in judgments of sexual interest in men and women. This study, using a sample of het erosexual Norwegian students (n = 308), was carried out as a direct replication of Haselton's (2003) original study of naturally occurring events of sexual misperception. The results strongly supported the main hypotheses in the original study, showing that women reported being subject to opposite-sex sexual overperception far more often relative to underperception, and that this difference was small for men. In support of Error Management Theory, and in contrast to Social Role / Structure Theory expectations, the pattern of misperception for women and men was largely invariant across studies and across demographic groups within a culture. The findings suggest that cross-national differences in the level of gender inequality do not influence reports of sexual over- and underperception in women and men. Beyond sex, factors associated with more sexual overperception relative to underperception were being single, young, and having attitudes condoning casual sex. PMID:25402231

  6. An Early Warning System for Hypoglycemic/Hyperglycemic Events Based on Fusion of Adaptive Prediction Models

    PubMed Central

    Daskalaki, Elena; Nørgaard, Kirsten; Züger, Thomas; Prountzou, Aikaterini; Diem, Peter; Mougiakakou, Stavroula

    2013-01-01

    Introduction Early warning of future hypoglycemic and hyperglycemic events can improve the safety of type 1 diabetes mellitus (T1DM) patients. The aim of this study is to design and evaluate a hypoglycemia/hyperglycemia early warning system (EWS) for T1DM patients under sensor-augmented pump (SAP) therapy. Methods The EWS is based on the combination of data-driven online adaptive prediction models and a warning algorithm. Three modeling approaches have been investigated: (i) autoregressive (ARX) models, (ii) auto-regressive with an output correction module (cARX) models, and (iii) recurrent neural network (RNN) models. The warning algorithm performs postprocessing of the models? outputs and issues alerts if upcoming hypoglycemic/hyperglycemic events are detected. Fusion of the cARX and RNN models, due to their complementary prediction performances, resulted in the hybrid autoregressive with an output correction module/recurrent neural network (cARN)-based EWS. Results The EWS was evaluated on 23 T1DM patients under SAP therapy. The ARX-based system achieved hypoglycemic (hyperglycemic) event prediction with median values of accuracy of 100.0% (100.0%), detection time of 10.0 (8.0) min, and daily false alarms of 0.7 (0.5). The respective values for the cARX-based system were 100.0% (100.0%), 17.5 (14.8) min, and 1.5 (1.3) and, for the RNN-based system, were 100.0% (92.0%), 8.4 (7.0) min, and 0.1 (0.2). The hybrid cARN-based EWS presented outperforming results with 100.0% (100.0%) prediction accuracy, detection 16.7 (14.7) min in advance, and 0.8 (0.8) daily false alarms. Conclusion Combined use of cARX and RNN models for the development of an EWS outperformed the single use of each model, achieving accurate and prompt event prediction with few false alarms, thus providing increased safety and comfort. PMID:23759402

  7. Late Palaeozoic and Early Mesozoic Circum-Pacific Events and their Global Correlation

    NASA Astrophysics Data System (ADS)

    Dickins, J. M.; Zunyi, Yang; Hongfu, Yin; Lucas, S. G.; Acharyya, S. K.

    1997-07-01

    The interval between the Carboniferous and Jurassic eras is marked by major changes in the structure and character of the Earth and is associated with massive earthquakes, volcanic activity, and large-scale changes of life at the Permian-Triassic and the Triassic-Jurassic boundaries. In this volume, an international assemblage of geologists reveals a wide range of information about these events in the circum-Pacific region, as a conclusion to International Geological Correlation Programme Project 272. They explore the nature of the changes in the Late Paleozoic and Early Mesozoic, and suggest issues for future investigation through the study of paleontology, biostratigraphy, tectonics, magmatic and volcanic development, ore deposition, paleography and climate. As the circum-Pacific region becomes increasingly important for hydrocarbon and mineral exploration, this book will be an invaluable resource for researchers and students in stratigraphy and paleontology.

  8. Airway PI3K pathway activation is an early and reversible event in lung cancer development.

    PubMed

    Gustafson, Adam M; Soldi, Raffaella; Anderlind, Christina; Scholand, Mary Beth; Qian, Jun; Zhang, Xiaohui; Cooper, Kendal; Walker, Darren; McWilliams, Annette; Liu, Gang; Szabo, Eva; Brody, Jerome; Massion, Pierre P; Lenburg, Marc E; Lam, Stephen; Bild, Andrea H; Spira, Avrum

    2010-04-01

    Although only a subset of smokers develop lung cancer, we cannot determine which smokers are at highest risk for cancer development, nor do we know the signaling pathways altered early in the process of tumorigenesis in these individuals. On the basis of the concept that cigarette smoke creates a molecular field of injury throughout the respiratory tract, this study explores oncogenic pathway deregulation in cytologically normal proximal airway epithelial cells of smokers at risk for lung cancer. We observed a significant increase in a genomic signature of phosphatidylinositol 3-kinase (PI3K) pathway activation in the cytologically normal bronchial airway of smokers with lung cancer and smokers with dysplastic lesions, suggesting that PI3K is activated in the proximal airway before tumorigenesis. Further, PI3K activity is decreased in the airway of high-risk smokers who had significant regression of dysplasia after treatment with the chemopreventive agent myo-inositol, and myo-inositol inhibits the PI3K pathway in vitro. These results suggest that deregulation of the PI3K pathway in the bronchial airway epithelium of smokers is an early, measurable, and reversible event in the development of lung cancer and that genomic profiling of these relatively accessible airway cells may enable personalized approaches to chemoprevention and therapy. Our work further suggests that additional lung cancer chemoprevention trials either targeting the PI3K pathway or measuring airway PI3K activation as an intermediate endpoint are warranted. PMID:20375364

  9. Airway PI3K Pathway Activation Is an Early and Reversible Event in Lung Cancer Development

    PubMed Central

    Gustafson, Adam M.; Soldi, Raffaella; Anderlind, Christina; Scholand, Mary Beth; Qian, Jun; Zhang, Xiaohui; Cooper, Kendal; Walker, Darren; McWilliams, Annette; Liu, Gang; Szabo, Eva; Brody, Jerome; Massion, Pierre P.; Lenburg, Marc E.; Lam, Stephen; Bild, Andrea H.; Spira, Avrum

    2013-01-01

    Although only a subset of smokers develop lung cancer, we cannot determine which smokers are at highest risk for cancer development, nor do we know the signaling pathways altered early in the process of tumorigenesis in these individuals. On the basis of the concept that cigarette smoke creates a molecular field of injury throughout the respiratory tract, this study explores oncogenic pathway deregulation in cytologically normal proximal airway epithelial cells of smokers at risk for lung cancer. We observed a significant increase in a genomic signature of phosphatidylinositol 3-kinase (PI3K) pathway activation in the cytologically normal bronchial airway of smokers with lung cancer and smokers with dysplastic lesions, suggesting that PI3K is activated in the proximal airway before tumorigenesis. Further, PI3K activity is decreased in the airway of high-risk smokers who had significant regression of dysplasia after treatment with the chemopreventive agent myo-inositol, and myo-inositol inhibits the PI3K pathway in vitro. These results suggest that deregulation of the PI3K pathway in the bronchial airway epithelium of smokers is an early, measurable, and reversible event in the development of lung cancer and that genomic profiling of these relatively accessible airway cells may enable personalized approaches to chemoprevention and therapy. Our work further suggests that additional lung cancer chemoprevention trials either targeting the PI3K pathway or measuring airway PI3K activation as an intermediate endpoint are warranted. PMID:20375364

  10. Membrane remodeling, an early event in benzo[alpha]pyrene-induced apoptosis

    SciTech Connect

    Tekpli, Xavier; Rissel, Mary; Huc, Laurence [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France); Catheline, Daniel [Laboratoire de Biochimie, INRA-Agrocampus Rennes, 35042 Rennes (France); Sergent, Odile [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France); Rioux, Vincent; Legrand, Philippe [Laboratoire de Biochimie, INRA-Agrocampus Rennes, 35042 Rennes (France); Holme, Jorn A. [Division of Environmental Medicine, Norwegian Institute of Public Health, P.O. Box 404 Torshov, N-4303 Oslo (Norway); Dimanche-Boitrel, Marie-Therese [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France); Lagadic-Gossmann, Dominique, E-mail: dominique.lagadic@univ-rennes1.f [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France)

    2010-02-15

    Benzo[alpha]pyrene (B[alpha]P) often serves as a model for mutagenic and carcinogenic polycyclic aromatic hydrocarbons (PAHs). Our previous work suggested a role of membrane fluidity in B[alpha]P-induced apoptotic process. In this study, we report that B[alpha]P modifies the composition of cholesterol-rich microdomains (lipid rafts) in rat liver F258 epithelial cells. The cellular distribution of the ganglioside-GM1 was markedly changed following B[alpha]P exposure. B[alpha]P also modified fatty acid composition and decreased the cholesterol content of cholesterol-rich microdomains. B[alpha]P-induced depletion of cholesterol in lipid rafts was linked to a reduced expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase). Aryl hydrocarbon receptor (AhR) and B[alpha]P-related H{sub 2}O{sub 2} formation were involved in the reduced expression of HMG-CoA reductase and in the remodeling of membrane microdomains. The B[alpha]P-induced membrane remodeling resulted in an intracellular alkalinization observed during the early phase of apoptosis. In conclusion, B[alpha]P altered the composition of plasma membrane microstructures through AhR and H{sub 2}O{sub 2} dependent-regulation of lipid biosynthesis. In F258 cells, the B[alpha]P-induced membrane remodeling was identified as an early apoptotic event leading to an intracellular alkalinization.

  11. Insights into the early dissolution events of amlodipine using UV imaging and Raman spectroscopy.

    PubMed

    Boetker, Johan P; Savolainen, Marja; Koradia, Vishal; Tian, Fang; Rades, Thomas; Müllertz, Anette; Cornett, Claus; Rantanen, Jukka; Østergaard, Jesper

    2011-08-01

    Traditional dissolution testing determines drug release to the bulk, but does not enable an understanding of the events happening close to the surface of a solid or a tablet. UV imaging is a new imaging approach that can be used to study the dissolution behavior of chemical compounds. The UV imaging instrumentation offers recording of absorbance maps with a high spatial and temporal resolution which facilitates the abundant collection of information regarding the evolving solution concentrations. In this study, UV imaging was used to visualize the dissolution behavior of amlodipine besylate (amorphous and dihydrate forms) and amlodipine free base. The dissolution of amlodipine besylate was faster from the amorphous form than from the crystalline forms. The UV imaging investigations suggested that a solvent mediated phase transformation occurred for the amorphous amlodipine besylate and the amlodipine free base samples. Raman spectroscopy was used to confirm and probe the changes at the solid surface occurring upon contact with the dissolution media and verified the recrystallization of the amorphous form to the monohydrate. The combination of UV imaging and Raman spectroscopy is an efficient tool to obtain a deeper insight into the early events of the dissolution process. PMID:21634435

  12. New Early Jurassic Tetrapod Assemblages Constrain Triassic-Jurassic Tetrapod Extinction Event

    NASA Astrophysics Data System (ADS)

    Olsen, P. E.; Shubin, N. H.; Anders, M. H.

    1987-08-01

    The discovery of the first definitively correlated earliest Jurassic (200 million years before present) tetrapod assemblage (Fundy basin, Newark Supergroup, Nova Scotia) allows reevaluation of the duration of the Triassic-Jurassic tetrapod extinction event. Present are tritheledont and mammal-like reptiles, prosauropod, theropod, and ornithischian dinosaurs, protosuchian and sphenosuchian crocodylomorphs, sphenodontids, and hybodont, semionotid, and palaeonisciform fishes. All of the families are known from Late Triassic and Jurassic strata from elsewhere; however, pollen and spore, radiometric, and geochemical correlation indicate an early Hettangian age for these assemblages. Because all ``typical Triassic'' forms are absent from these assemblages, most Triassic-Jurassic tetrapod extinctions occurred before this time and without the introduction of new families. As was previously suggested by studies of marine invertebrates, this pattern is consistent with a global extinction event at the Triassic-Jurassic boundary. The Manicouagan impact structure of Quebec provides dates broadly compatible with the Triassic-Jurassic boundary and, following the impact theory of mass extinctions, may be implicated in the cause.

  13. Subclinical alexithymia modulates early audio-visual perceptive and attentional event-related potentials

    PubMed Central

    Delle-Vigne, Dyna; Kornreich, Charles; Verbanck, Paul; Campanella, Salvatore

    2014-01-01

    Introduction: Previous studies have highlighted the advantage of using audio–visual oddball tasks (instead of unimodal ones) in order to electrophysiologically index subclinical behavioral differences. Since alexithymia is highly prevalent in the general population, we investigated whether the use of various bimodal tasks could elicit emotional effects in low- vs. high-alexithymic scorers. Methods: Fifty students (33 females and 17 males) were split into groups based on low and high scores on the Toronto Alexithymia Scale (TAS-20). During event-related potential (ERP) recordings, they were exposed to three kinds of audio–visual oddball tasks: neutral-AVN—(geometrical forms and bips), animal-AVA—(dog and cock with their respective shouts), or emotional-AVE—(faces and voices) stimuli. In each condition, participants were asked to quickly detect deviant events occurring amongst a train of repeated and frequent matching stimuli (e.g., push a button when a sad face–voice pair appeared amongst a train of neutral face–voice pairs). P100, N100, and P300 components were analyzed: P100 refers to visual perceptive and attentional processing, N100 to auditory ones, and the P300 relates to response-related stages, involving memory processes. Results: High-alexithymic scorers presented a particular pattern of results when processing the emotional stimulations, reflected in early ERP components by increased P100 and N100 amplitudes in the emotional oddball tasks [P100: F(2, 48) = 20,319, p < 0.001; N100: F(2, 96) = 8,807, p = 0.001] as compared to the animal or neutral ones. Indeed, regarding the P100, subjects exhibited a higher amplitude in the AVE condition (8.717 ?V), which was significantly different from that observed during the AVN condition (4.382 ?V, p < 0.001). For the N100, the highest amplitude was found in the AVE condition (?4.035 ?V) and the lowest was observed in the AVN condition (?2.687 ?V, p = 0.003). However, no effect was found on the later P300 component. Conclusions: Our findings suggest that high-alexithymic scorers require heightened early attentional resources in comparison to low scorers, particularly when confronted with emotional bimodal stimuli. PMID:24624070

  14. Reflections on some early events related to behavior analysis of child development

    PubMed Central

    Bijou, Sidney W.

    1996-01-01

    A series of events related to the early application of behavioral principles to child behavior and development is described. The events began in the 1930s at Columbia University with a solicited letter from John B. Watson suggesting a master's degree thesis problem, and continued through the 1950s and 1960s at the University of Washington. Specifically, these happenings resulted in (a) research demonstrating that Skinner's laboratory method for studying nonhuman organisms could be profitably applied to the laboratory study of young normal children; (b) a demonstration that by successive approximations, a normal child can be operantly conditioned to respond to an arbitrary situation; (c) research showing that the effects of simple schedules of reinforcement obtained with nonhuman organisms could be duplicated in young normal and retarded children; (d) the demonstration that Skinner's operant laboratory method could be adapted to study young children in field situations; (e) research showing that operant principles can be successfully applied to the treatment of a young autistic boy with a serious visual handicap; (f) laboratory studies showing that mothers can be trained to treat their own young children who have behavior problems; (g) an in-home study demonstrating that a mother can treat her own child who has behavior problems; (h) a demonstration that operant principles can be applied effectively to teaching reading, writing, and arithmetic to children with retardation; and (i) publication of a book, Child Development: A Systematic and Empirical Theory, in collaboration with Donald M. Baer, by Prentice Hall in their Century Psychological Series. PMID:22478239

  15. The strontium isotope seawater curve during the early Middle Miocene and its relation to paleoceanographic events

    SciTech Connect

    Hodell, D.A. (Univ. of Florida, Gainesville, FL (United States). Dept. of Geology); Woodruff, F. (Univ. of Southern California, Los Angeles, CA (United States). Dept. Geological Sciences)

    1992-01-01

    Breaks in slope of the strontium isotope seawater curve signal fundamental changes in either rates of continental weathering, seafloor spreading (i.e., tectonic reorganizations), or submarine dissolution of marine carbonates. The authors conducted a detailed study of the change in slope of the strontium isotopic seawater curve that occurred during the early middle Miocene in three Pacific DSDP sites (289, 574, and 588). The change in slope from the rapid rise in Sr-87/Sr-86 of the early Miocene (60 ppm/Ma) to the less rapid increase of the mid- and late Miocene (22 ppm/Ma) occurred between two periods of maximum [delta]C-13 values dated between 15.5 and 15.2 Ma. This internal was followed by relatively constant Sr-87/Sr-86 values (averaging 0.70878) between 15.2 and 14.2 Ma. Sr-87/Sr-86 ratios began to increase again after 14.2 Ma, but at a reduced rate compared to the early Miocene. The break in slope in Sr-87/Sr-86 preceded the mid-Miocene increase in [delta]O-18 that represents ice growth on Antarctica, which began at 14.9 Ma and increased rapidly after 14.2 Ma. In 2 out of 3 of the sites, the break in Sr-slope between 15.5 and 15.2 Ma is accompanied by a small, but significant, decrease in Sr-87/Sr-86 values. They speculate, that this decrease in Sr-87/Sr-86 may have been related to massive dissolution of older carbonate on the sea floor associated with NH2B (Neogene Hiatus 2 of Keller and Barron, 1983). This event may have important implications for changes in carbonate chemistry of the oceans. Numerical modeling of the strontium isotope budget will be used to test the feasibility of this mechanism and to estimate the volume and age of dissolved carbonate needed to produce the observed decrease in Sr-87/Sr-86.

  16. Early Eocene changes in the frequency and spatial distribution of extreme precipitation events

    NASA Astrophysics Data System (ADS)

    Carmichael, Matthew; Lunt, Daniel; Pancost, Richard

    2015-04-01

    Global warming over the next 100 years is likely to result not only in changes to the spatial distribution of mean annual precipitation, but also to the seasonality of precipitation and the frequency of hydrological extremes, with far-reaching socio-economic and ecological impacts. The study of the sensitivity of the hydrological cycle to episodes of global warmth in the geologic past is receiving increased attention from the paleoclimate community, but our understanding of the occurrence of hydrological extremes remains limited. The warming associated with the Paleocene-Eocene Thermal Maximum (PETM) hyperthermal (~56 Ma) has received widespread attention given its global nature, rapid onset and transient nature. A range of geomorphological, microfossil and biomarker proxies suggest significant hydrological changes occurred at the PETM which have traditionally been interpreted in terms of changes in mean annual precipitation; recently changes in the frequency of hydrological extremes at the PETM have also been suggested. In this work, we seek to better understand whether numerical climate models run with boundary conditions appropriate for the early Eocene (56 - 49 Ma) are capable of simulating changes in the frequency of intense precipitation ('storm') events by analysing GCM-simulated precipitation rates at an hourly frequency. Our Eocene simulations are performed at x2 and x4 preindustrial CO2 using a coupled atmosphere-ocean GCM, HadCM3L. Differences in climatology between high and low CO2 may be considered analogous to the changes which occurred at the PETM. Our results indicate significant changes occur in the precipitation intensity-frequency relationships at locations which correspond to sites from which PETM proxies exist. The percentage of time during which precipitation occurs and the overall number of events lasting longer than an hour declines in the high-CO2 model. These changes tend to occur with an associated increase in mean storm precipitation rate, such that hydrological extremes occur with a reduced return-period. We explore how these relationships vary spatially and show relative changes vary between sites in close geographic proximity. Our results suggest that the interpretation of existing paleoclimatic proxies for hydrological change must consider both changes in mean annual precipitation rate, but also changes in the frequency of intense, high impact events.

  17. Disruption of early events in thalamocortical tract formation in mice lacking the transcription factors Pax6 or Foxg1

    Microsoft Academic Search

    Thomas Pratt; Jane C. Quinn; T. Ian Simpson; John D. West; John O. Mason; David J. Price

    2002-01-01

    Early events in the formation of the thalamocortical tract remain poorly understood. Recent work has suggested that thalamocortical axons follow a path pioneered by transient thalamic afferents originating from the medial part of the ventral telencephalon. We studied the development of these transient afferents and the thalamocortical tract in mutant mice lacking transcription factors normally expressed in the dorsal thalamus

  18. Early Events in the Fusarium verticillioides-Maize Interaction Characterized by Using a Green Fluorescent Protein-Expressing Transgenic Isolate

    Microsoft Academic Search

    Liat Oren; Smadar Ezrati; David Cohen; Amir Sharon

    2003-01-01

    The infection of maize by Fusarium verticillioides can result in highly variable disease symptoms ranging from asymptomatic plants to severe rotting and wilting. We produced F. verticillioides green fluorescent protein- expressing transgenic isolates and used them to characterize early events in the F. verticillioides-maize inter- action that may affect later symptom appearance. Plants grown in F. verticillioides-infested soil were smaller

  19. Early Life Events Carry Over to Influence Pre-Migratory Condition in a Free-Living Songbird

    Microsoft Academic Search

    Greg W. Mitchell; Christopher G. Guglielmo; Nathaniel T. Wheelwright; Corey R. Freeman-Gallant; D. Ryan Norris

    2011-01-01

    Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1st year survival and

  20. Emergence of infectious simian virus 40 whose AT tract in the replication origin/early promoter region is substituted by cellular or viral DNAs.

    PubMed

    Keiser, Simon; Schmidt, Katharina; Bethge, Tobias; Steiger, Julia; Hirsch, Hans H; Schaffner, Walter; Georgiev, Oleg

    2015-03-01

    In simian virus 40 (SV40) and several other polyomaviruses, the TATA box of the early promoter is embedded in an AT tract that is also an essential part of the replication origin. We generated an 'AT trap', an SV40 genome lacking the AT tract and unable to grow in CV-1 monkey cells. Co-transfection of the AT trap with oligonucleotides containing AT tracts of human polyomaviruses, a poly(A : T) tract or variants of the SV40 WT sequence all restored infectious virus. In a transfection of the AT trap without a suitable oligonucleotide, an AT-rich segment was incorporated, stemming either from bovine (calf serum) or monkey (host cell) DNA. Similarly, when cells were grown with human serum, a human DNA segment was captured by SV40 to substitute for the missing AT stretch. We conclude that the virus is quite opportunistic in accepting heterologous substitutes, and that even low-abundance DNA from serum can be incorporated into the viral genome. PMID:25385869

  1. Impact of early and late winter icing events on sub-arctic dwarf shrubs.

    PubMed

    Preece, C; Phoenix, G K

    2013-04-10

    Polar regions are predicted to undergo large increases in winter temperature and an increased frequency of freeze-thaw cycles, which can cause ice layers in the snow pack and ice encasement of vegetation. Early or late winter timing of ice encasement could, however, modify the extent of damage caused to plants. To determine impacts of the date of ice encasement, a novel field experiment was established in sub-arctic Sweden, with icing events simulated in January and March 2008 and 2009. In the subsequent summers, reproduction, phenology, growth and mortality, as well as physiological indicators of leaf damage were measured in the three dominant dwarf shrubs: Vaccinium uliginosum, Vaccinium vitis-idaea and Empetrum nigrum. It was hypothesised that January icing would be more damaging compared to March icing due to the longer duration of ice encasement. Following 2 years of icing, E. nigrum berry production was 83% lower in January-iced plots compared to controls, and V. vitis-idaea electrolyte leakage was increased by 69%. Conversely, electrolyte leakage of E. nigrum was 25% lower and leaf emergence of V. vitis-idaea commenced 11 days earlier in March-iced plots compared to control plots in 2009. There was no effect of icing on any of the other parameters measured, indicating that overall these study species have moderate to high tolerance to ice encasement. Even much longer exposure under the January icing treatment does not clearly increase damage. PMID:23574610

  2. Visualization of Early Events in Acetic Acid Denaturation of HIV-1 Protease: A Molecular Dynamics Study

    PubMed Central

    Borkar, Aditi Narendra; Rout, Manoj Kumar; Hosur, Ramakrishna V.

    2011-01-01

    Protein denaturation plays a crucial role in cellular processes. In this study, denaturation of HIV-1 Protease (PR) was investigated by all-atom MD simulations in explicit solvent. The PR dimer and monomer were simulated separately in 9 M acetic acid (9 M AcOH) solution and water to study the denaturation process of PR in acetic acid environment. Direct visualization of the denaturation dynamics that is readily available from such simulations has been presented. Our simulations in 9 M AcOH reveal that the PR denaturation begins by separation of dimer into intact monomers and it is only after this separation that the monomer units start denaturing. The denaturation of the monomers is flagged off by the loss of crucial interactions between the ?-helix at C-terminal and surrounding ?-strands. This causes the structure to transit from the equilibrium dynamics to random non-equilibrating dynamics. Residence time calculations indicate that denaturation occurs via direct interaction of the acetic acid molecules with certain regions of the protein in 9 M AcOH. All these observations have helped to decipher a picture of the early events in acetic acid denaturation of PR and have illustrated that the ?-helix and the ?-sheet at the C-terminus of a native and functional PR dimer should maintain both the stability and the function of the enzyme and thus present newer targets for blocking PR function. PMID:21738569

  3. Early events in the mammalian response to DNA double-strand breaks.

    PubMed

    Riches, Lucy C; Lynch, Anthony M; Gooderham, Nigel J

    2008-09-01

    Physical and chemical agents that induce DNA double-strand breaks (DSBs) are among the most potent mutagens. The mammalian cell response to DSB comprises a highly co-ordinated, yet complex network of proteins that have been categorized as sensors, signal transducers, mediators and effectors of damage and repair. While this provides an accessible classification system, review of the literature indicates that many proteins satisfy the criteria of more than one category, pointing towards a series of highly co-operative pathways with overlapping function. In summary, the MRE11-NBS1-RAD50 complex is necessary for achieving optimal activation of ataxia-telangiectasia-mutated (ATM) kinase, which catalyses a phosphorylation-mediated signal transduction cascade. Among the subset of proteins phosphorylated by ATM are histone H2AX (H2AX), mediator of damage checkpoint protein 1, nibrin (NBS1), P53-binding protein 1 and breast cancer protein 1, all of which subsequently redistribute into DSB-containing sub-nuclear compartments. Post-translational modification of DSB responding proteins achieves a rapid and reversible change in protein behaviour and mediates damage-specific interactions, hence imparting a high degree of vigilance to the cell. This review highlights events fundamental in maintaining genetic integrity with emphasis on early stages of the DSB response. PMID:18644834

  4. Early events of rotavirus infection: the search for the receptor(s).

    PubMed

    Arias, C F; Guerrero, C A; Méndez, E; Zárate, S; Isa, P; Espinosa, R; Romero, P; López, S

    2001-01-01

    The entry of rotaviruses into epithelial cells seems to be a multistep process. Infection competition experiments have suggested that at least three different interactions between the virus and cell surface molecules take place during the early events of infection, and glycolipids as well as glycoproteins have been suggested to be primary attachment receptors for rotaviruses. The infectivity of some rotavirus strains depends on the presence of sialic acid on the cell surface, however, it has been shown that this interaction is not essential, and it has been suggested that there exists a neuraminidase-resistant cell surface molecule with which most rotaviruses interact. The comparative characterization of the sialic acid-dependent rotavirus strain RRV (G3P5[3]), its neuraminidase-resistant variant nar3, and the human rotavirus strain Wa (G1P1A[8]) has allowed us to show that alpha 2 beta 1 integrin is used by nar3 as its primary cell attachment site, and by RRV in a second interaction, subsequent to its initial contact with a sialic acid-containing cell receptor. We have also shown that integrin alpha V beta 3 is used by all three rotavirus strains as a co-receptor, subsequent to their initial attachment to the cell. We propose that the functional rotavirus receptor is a complex of several cell molecules most likely immersed in glycosphingolipid-enriched plasma membrane microdomains. PMID:11444034

  5. A Time Scale for Major Events in Early Mars Crustal Evolution

    NASA Technical Reports Server (NTRS)

    Frey, Herbert V.

    2004-01-01

    The population of visible and buried impact basins > 200 km diameter revealed by high resolution gridded MOLA data and the cumulative frequency curves derived for these pvide a basis for a chronology of major events in early martian history. The relative chronology can be given in terms of N(200) crater retention ages; 'absolute ages' can be assigued using the Hartmann-Neukum (H&N) model chronology. In terms of billions of H&N years, the crustal dichotomy formed by large impact basins at 4.12 +/- 0.08 BYA (N(200) = 3.0-3.2) and the global magnetic field died at about or slightly before the same time (4.15 +/- 0.08 BYA (N(200) = 3.5). In this chronology, the buried lowlands are approx. 120 my younger than the buried highlands, approx. 160 my younger than the highlands overall and approx. 340 my younger than the oldest crater retention surface we see, defined by the largest impact basins.

  6. The E8?E2 Gene Product of Human Papillomavirus Type 16 Represses Early Transcription and Replication but Is Dispensable for Viral Plasmid Persistence in Keratinocytes?

    PubMed Central

    Lace, Michael J.; Anson, James R.; Thomas, Gregory S.; Turek, Lubomir P.; Haugen, Thomas H.

    2008-01-01

    A conserved E8?E2 spliced mRNA is detected in keratinocytes transfected with human papillomavirus type 16 (HPV-16) plasmid DNA. Expression of HPV-16 E8?E2 (16-E8?E2) is independent of the major early promoter, P97, and is modulated by both specific splicing events and conserved cis elements in the upstream regulatory region in a manner that differs from transcriptional regulation of other early viral genes. Mutations that disrupt the predicted 16-E8?E2 message also increase initial HPV-16 plasmid amplification 8- to 15-fold and major early gene (P97) transcription 4- to 5-fold over those of the wild type (wt). Expressing the 16-E8?E2 gene product from the cytomegalovirus (CMV) promoter represses HPV-16 early gene transcription from P97 in a dose-dependent manner, as detected by RNase protection assays. When expressed from the CMV promoter, 16-E8?E2 also inhibits the amplification of an HPV-16 plasmid and a heterologous simian virus 40 (SV40) ori plasmid that contains E2 binding sites in cis. In contrast, cotransfections with HPV-16 wt genomes that express physiologic levels of 16-E8?E2 are sufficient to repress HPV-16 plasmid amplification but are limiting and insufficient for the repression of SV40 amplification. 16-E8?E2-dependent repression of HPV-16 E1 expression is sufficient to account for this observed inhibition of initial HPV-16 plasmid amplification. Unlike with other papillomaviruses, primary human keratinocytes immortalized by the HPV-16 E8 mutant genome contain more than eightfold-higher levels of unintegrated plasmid than the wt, demonstrating that 16-E8?E2 limits the viral copy number but is not required for plasmid persistence and maintenance. PMID:18753207

  7. Caffeine-Induced Uncoupling of Mitosis from the Completion of DNA Replication in Mammalian Cells

    Microsoft Academic Search

    Robert Schlegel; Arthur B. Pardee

    1986-01-01

    Caffeine was shown to induce mitotic events in mammalian cells before DNA replication (S phase) was completed. Synchronized BHK cells that were arrested in early S phase underwent premature chromosome condensation, nuclear envelope breakdown, morphological ``rounding up,'' and mitosis-specific phosphoprotein synthesis when they were exposed to caffeine. These mitotic responses occurred only after the cells had entered S phase and

  8. Paleomagnetic study of French Guyana Early Jurassic dolerites: hypothesis of a multistage magmatic event

    NASA Astrophysics Data System (ADS)

    Nomade, S.; Théveniaut, H.; Chen, Y.; Pouclet, A.; Rigollet, C.

    2000-12-01

    A detailed paleomagnetic and anisotropy of magnetic susceptibility (AMS) study was carried out on 34 sites of Early Jurassic dolerite dykes from French Guyana, which formed during the initial opening of the Central Atlantic Ocean. Four types of AMS fabrics are recognized: (i) 'Normal' fabric (21 dykes) defined by clustering of K1- K2 axes on the dyke plane whereas the K 3 axis is nearly perpendicular to it. This fabric is interpreted as due to magma flow. The sub-horizontal inclination of the K1 axis permitted to suggest that the French Guyana dykes could be fed by horizontal magma fluxes from a distant magma source. (ii) 'Reversal' fabric (8 dykes) is characterized by the K2- K3 plane close to the dyke plane and the K1 perpendicular to dyke orientation. Such fabric was attributed to the local shearing stress. (iii) 'Intermediate' fabric (1 dyke) is defined by K1- K3 axes close to the dyke plane and K2 axis is perpendicular to this plane. It was interpreted as due to vertical compaction of a static magma column. (iiii) 'Other' fabric (4 dykes) does not show any preferential orientation. Scanning electronic microscope and susceptibility versus temperature experiments show that minerals of the titanomagnetite family are main magnetic remanence carriers. Two magnetic components were isolated. Ages of magnetic remanences are estimated at 198.3±2.0 Ma to 192.3±1.5 Ma. Their virtual geomagnetic poles are calculated, Pole A: ?=73.2°N, ?=15.3°E, k=288.8, A95=3.4°, n=8, and Pole B: ?=81.6°N, ?=89.1°E, k=69.8, A95=4.2°, n=18. These two groups probably correspond to two distinct magmatic events which occurred in a short period. This hypothesis is consistent with published 40Ar- 39Ar radiometric ages though with 'mini plateau' spectra. These paleomagnetic results suggest the presence of magmatic pulses led to the construction of the Central Atlantic Magmatic Province in French Guyana during the Early Jurassic.

  9. How the timing of weather events influences early development in a large mammal.

    PubMed

    Hendrichsen, D K; Tyler, N J C

    2014-07-01

    Capturing components of the weather that drive environment-animal interactions is a perennial problem in ecology. Identifying biologically significant elements of weather conditions in sensible statistics suitable for analysis of life history variation and population dynamics is central. Meteorological variables such as temperature, precipitation, and wind modulate rates of heat loss in animals, but analysis of their effects on endothermic species is complicated by the fact that their influence on energy balance is not invariably linear, even across the thermoneutral range. Rather, the thermal load imposed by a given set of weather conditions is a function of organisms' metabolic requirement, which, crucially, may vary spontaneously both seasonally and across different life phases. We propose that the endogenous component of variation in metabolic demand introduces a temporal dimension and that, as a consequence, the specific effect of meteorological variables on energy balance and attendant life history parameters is a function of the timing of weather events with respect to the organism's metabolic rhythm(s). To test this, we examined how a spontaneous increase in metabolic demand influenced the effect of weather on early development in a large mammal. Specifically, we examined interaction between the exponential rise in the energy requirements of pregnancy and depth of snow, which restricts dams' access to forage, on the body mass of reindeer calves (Rangifer tarandus) at weaning. As expected, we detected a significant temporal component: the specific negative effect of snow on weaning mass was not constant, but increased across pregnancy. The life history response was therefore better predicted by interaction between the magnitude and the timing of weather events than by their magnitude alone. To our knowledge, this is the first demonstration of the influence of an endogenous metabolic dynamic on the impact of weather on a life history trait in a free-living mammal. Evaluating weather variables with respect to endogenous variation in metabolic demand adds biological realism and is likely to improve understanding of the influence of environmental variation on life history traits in many ecological contexts. PMID:25163108

  10. Shorter Exposures to Harder X-Rays Trigger Early Apoptotic Events in Xenopus laevis Embryos

    PubMed Central

    Dong, JiaJia; Mury, Sean P.; Drahos, Karen E.; Moscovitch, Marko

    2010-01-01

    Background A long-standing conventional view of radiation-induced apoptosis is that increased exposure results in augmented apoptosis in a biological system, with a threshold below which radiation doses do not cause any significant increase in cell death. The consequences of this belief impact the extent to which malignant diseases and non-malignant conditions are therapeutically treated and how radiation is used in combination with other therapies. Our research challenges the current dogma of dose-dependent induction of apoptosis and establishes a new parallel paradigm to the photoelectric effect in biological systems. Methodology/Principal Findings We explored how the energy of individual X-ray photons and exposure time, both factors that determine the total dose, influence the occurrence of cell death in early Xenopus embryo. Three different experimental scenarios were analyzed and morphological and biochemical hallmarks of apoptosis were evaluated. Initially, we examined cell death events in embryos exposed to increasing incident energies when the exposure time was preset. Then, we evaluated the embryo's response when the exposure time was augmented while the energy value remained constant. Lastly, we studied the incidence of apoptosis in embryos exposed to an equal total dose of radiation that resulted from increasing the incoming energy while lowering the exposure time. Conclusions/Significance Overall, our data establish that the energy of the incident photon is a major contributor to the outcome of the biological system. In particular, for embryos exposed under identical conditions and delivered the same absorbed dose of radiation, the response is significantly increased when shorter bursts of more energetic photons are used. These results suggest that biological organisms display properties similar to the photoelectric effect in physical systems and provide new insights into how radiation-mediated apoptosis should be understood and utilized for therapeutic purposes. PMID:20126466

  11. Phase noise reveals early category-specific modulation of the event-related potentials

    PubMed Central

    Németh, Kornél; Kovács, Petra; Vakli, Pál; Kovács, Gyula; Zimmer, Márta

    2014-01-01

    Previous studies have found that the amplitude of the early event-related potential (ERP) components evoked by faces, such as N170 and P2, changes systematically as a function of noise added to the stimuli. This change has been linked to an increased perceptual processing demand and to enhanced difficulty in perceptual decision making about faces. However, to date it has not yet been tested whether noise manipulation affects the neural correlates of decisions about face and non-face stimuli similarly. To this end, we measured the ERPs for faces and cars at three different phase noise levels. Subjects performed the same two-alternative age-discrimination task on stimuli chosen from young–old morphing continua that were created from faces as well as cars and were calibrated to lead to similar performances at each noise-level. Adding phase noise to the stimuli reduced performance and enhanced response latency for the two categories to the same extent. Parallel to that, phase noise reduced the amplitude and prolonged the latency of the face-specific N170 component. The amplitude of the P1 showed category-specific noise dependence: it was enhanced over the right hemisphere for cars and over the left hemisphere for faces as a result of adding phase noise to the stimuli, but remained stable across noise levels for cars over the left and for faces over the right hemisphere. Moreover, noise modulation altered the category-selectivity of the N170, while the P2 ERP component, typically associated with task decision difficulty, was larger for the more noisy stimuli regardless of stimulus category. Our results suggest that the category-specificity of noise-induced modulations of ERP responses starts at around 100 ms post-stimulus. PMID:24795689

  12. Temporal Events in Skin Injury and the Early Adaptive Responses in Ultraviolet-Irradiated Mouse Skin

    PubMed Central

    Ouhtit, Allal; Muller, H. Konrad; Davis, Darren W.; Ullrich, Stephen E.; McConkey, David; Ananthaswamy, Honnavara N.

    2000-01-01

    We examined the effects of ultraviolet (UV) radiation on the time course for induction of sunburn (apoptotic) cells and expression of proteins known to be associated with growth arrest and apoptosis in SKH-hr1 mouse skin. Mice were irradiated with a single dose (2.5 kJ/m2) of UV from Kodacel-filtered (290–400 nm) FS40 sunlamps and the skin tissues were analyzed at various times after irradiation for the presence of apoptotic cells and expression of p53, p21Waf-1/Cip1, bcl-2, bax, and proliferating cell nuclear antigen. The results indicated that p53 expression was induced early in the epidermis, reaching maximum levels 12 hours after irradiaton, and p21Waf-1/Cip1 expression in the epidermis peaked at 24 hours after irradiation. In contrast, UV radiation induced high levels of bax at 24 to 72 hours after irradiation with a concomitant decrease in bcl-2 expression. Coinciding with these changes, apoptotic cells began to appear 6 hours after irradiation and reached a maximum at 24 hours after irradiation. Interestingly, proliferating cell nuclear antigen expression, which was initially confined to the basal layer, became dispersed throughout the basal and suprabasal layers of the skin at 48 hours and paralleled marked hyperplasia. These results suggest that UV irradiation of mouse skin induces apoptosis mediated by the p53/p21/bax/bcl-2 pathway and that the dead cells are replaced by hyperproliferative cells, leading to epidermal hyperplasia. This implies that UV-induced apoptosis and hyperplasia are closely linked and tightly regulated and that dysregulation of these two events may lead to skin cancer development. PMID:10623668

  13. The Early Toarcian Oceanic Anoxic Event and its sedimentary record in Switzerland

    NASA Astrophysics Data System (ADS)

    Fantasia, Alicia; Föllmi, Karl B.; Adatte, Thierry; Spangenberg, Jorge E.; Montero-Serrano, Jean-Carlos

    2015-04-01

    In the Jurassic period, the Early Toarcian Oceanic Anoxic Event (T-OAE), about 183 Ma ago, was a global perturbation of paleoclimatic and paleoenvironmental conditions. This episode was associated with a crisis in marine carbonate accumulation, climate warming, an increase in sea level, ocean acidification, enhanced continental weathering, whereas organic-rich sediments are noticeable for example in the Atlantic and in the Tethys. This episode is associated with a negative carbon excursion, which is recorded both in marine and terrestrial environments. The cause(s) of this environmental crisis remain(s) still controversial. Nevertheless, the development of negative ?13C excursions is commonly interpreted as due to the injection of isotopically-light carbon associated with gas hydrate dissociation, the thermal metamorphism of carbon-rich sediments and input of thermogenic and volcanogenic carbon related to the formation of the Karoo-Ferrar basaltic province in southern Gondwana (Hesselbo et al., 2000, 2007; Beerling et al., 2002; Cohen et al., 2004, 2007; McElwain et al., 2005, Beerling and Brentnall, 2007; Svensen et al., 2007; Hermoso et al., 2009, 2012; Mazzini et al., 2010). Several studies of the T-OAE have been conducted on sediments in central and northwest Europe, but only few data are available concerning the Swiss sedimentary records. Therefore, we focused on two sections in the Jura Plateau (canton Aargau): the Rietheim section (Montero-Serrano et al., submitted) and the Gipf section (current study). A multidisciplinary approach has been chosen and the tools to be used are based on sedimentological observations (sedimentary condensation, etc.), biostratigraphy, mineralogy (bulk-rock composition), facies and microfacies analysis (presence or absence of benthos), clay-mineralogy composition (climatic conditions), major and trace-element analyses (productivity, redox conditions, etc.), phosphorus (trophic levels, anoxia), carbon isotopes and organic-matter content (source of organic matter and preservation). The Posidonia Shales in northern Switzerland accumulated in a relatively slowly subsiding transition zone between the southwestern part of the Swabian basin and the eastern part of the Paris basin under fully marine conditions (Reisdorf et al., 2011). The negative carbon isotopic excursion characteristic of the Early Toarcian is well developed in the Gipf section although the bituminous sequence is considerably reduced in thickness relative to the Rietheim section. Indeed, the Plienbachian-Toarcian transition in the Gipf section probably lacks most of the tenuicostatum Zone and the Gipf Bed, which is a peculiar limestone bed showing an erosive base, correlates with the erosion horizons of the Variabilis Zone, Late Toarcian (Rieber, 1973; Reisdorf, 2011). The Gipf Bed is overlain by an alternation of condensed, fossil-rich marl and nodular limestone. The analysis of Swiss sections will assist us in the identification of the mechanisms implied in the condensation and/or erosion of parts of the Lower Toarcian Posidonia Shale. Therefore, it will improve our understanding of the general paleoceanographic conditions leading to the development of widespread oceanic anoxia during the early Toarcian.

  14. PKR and RNase L Contribute to Protection against Lethal West Nile Virus Infection by Controlling Early Viral Spread in the Periphery and Replication in Neurons

    PubMed Central

    Samuel, Melanie A.; Whitby, Kevin; Keller, Brian C.; Marri, Anantha; Barchet, Winfried; Williams, Bryan R. G.; Silverman, Robert H.; Gale, Michael; Diamond, Michael S.

    2006-01-01

    West Nile virus (WNV) is a neurotropic, mosquito-borne flavivirus that can cause lethal meningoencephalitis. Type I interferon (IFN) plays a critical role in controlling WNV replication, spread, and tropism. In this study, we begin to examine the effector mechanisms by which type I IFN inhibits WNV infection. Mice lacking both the interferon-induced, double-stranded-RNA-activated protein kinase (PKR) and the endoribonuclease of the 2?,5?-oligoadenylate synthetase-RNase L system (PKR?/? × RL?/?) were highly susceptible to subcutaneous WNV infection, with a 90% mortality rate compared to the 30% mortality rate observed in congenic wild-type mice. PKR?/? × RL?/? mice had increased viral loads in their draining lymph nodes, sera, and spleens, which led to early viral entry into the central nervous system (CNS) and higher viral burden in neuronal tissues. Although mice lacking RNase L showed a higher CNS viral burden and an increased mortality, they were less susceptible than the PKR?/? × RL?/? mice; thus, we also infer an antiviral role for PKR in the control of WNV infection. Notably, a deficiency in both PKR and RNase L resulted in a decreased ability of type I IFN to inhibit WNV in primary macrophages and cortical neurons. In contrast, the peripheral neurons of the superior cervical ganglia of PKR?/? × RL?/? mice showed no deficiency in the IFN-mediated inhibition of WNV. Our data suggest that PKR and RNase L contribute to IFN-mediated protection in a cell-restricted manner and control WNV infection in peripheral tissues and some neuronal subtypes. PMID:16809306

  15. PKR and RNase L contribute to protection against lethal West Nile Virus infection by controlling early viral spread in the periphery and replication in neurons.

    PubMed

    Samuel, Melanie A; Whitby, Kevin; Keller, Brian C; Marri, Anantha; Barchet, Winfried; Williams, Bryan R G; Silverman, Robert H; Gale, Michael; Diamond, Michael S

    2006-07-01

    West Nile virus (WNV) is a neurotropic, mosquito-borne flavivirus that can cause lethal meningoencephalitis. Type I interferon (IFN) plays a critical role in controlling WNV replication, spread, and tropism. In this study, we begin to examine the effector mechanisms by which type I IFN inhibits WNV infection. Mice lacking both the interferon-induced, double-stranded-RNA-activated protein kinase (PKR) and the endoribonuclease of the 2',5'-oligoadenylate synthetase-RNase L system (PKR(-/-) x RL(-/-)) were highly susceptible to subcutaneous WNV infection, with a 90% mortality rate compared to the 30% mortality rate observed in congenic wild-type mice. PKR(-/-) x RL(-/-) mice had increased viral loads in their draining lymph nodes, sera, and spleens, which led to early viral entry into the central nervous system (CNS) and higher viral burden in neuronal tissues. Although mice lacking RNase L showed a higher CNS viral burden and an increased mortality, they were less susceptible than the PKR(-/-) x RL(-/-) mice; thus, we also infer an antiviral role for PKR in the control of WNV infection. Notably, a deficiency in both PKR and RNase L resulted in a decreased ability of type I IFN to inhibit WNV in primary macrophages and cortical neurons. In contrast, the peripheral neurons of the superior cervical ganglia of PKR(-/-) x RL(-/-) mice showed no deficiency in the IFN-mediated inhibition of WNV. Our data suggest that PKR and RNase L contribute to IFN-mediated protection in a cell-restricted manner and control WNV infection in peripheral tissues and some neuronal subtypes. PMID:16809306

  16. Early events in tissues during infection with pathogenic (SIVmac239) and nonpathogenic (SIVmac1A11) molecular clones of simian immunodeficiency virus.

    PubMed Central

    Lackner, A. A.; Vogel, P.; Ramos, R. A.; Kluge, J. D.; Marthas, M.

    1994-01-01

    The extent of virus replication, tissue distribution, localization of virus within tissues, and the presence of pathological lesions was examined early after experimental infection of rhesus monkeys with simian immunodeficiency virus (SIV). Three strains of SIV were used: molecularly cloned pathogenic SIVmac239; molecularly cloned nonpathogenic SIVmac1A11; and uncloned pathogenic SIVmac. The major targets of infection in all animals at 2 weeks postinoculation were the thymus and spleen. The distribution of virus within lymphoid organs varied with the viral inoculum: nonpathogenic SIVmac1A11 was present primarily within lymphoid follicles and in the thymic cortex; SIVmac239 was present primarily within periarteriolar lymphoid sheaths in the spleen, the paracortex of lymph nodes, and the medulla of the thymus; uncloned SIVmac was present in all these areas but tended to parallel the distribution of SIVmac239. Animals inoculated with nonpathogenic SIVmac1A11 had fewer SIV-positive cells by in situ hybridization and after 13 weeks postinoculation, virus was undetectable in any tissue from these animals. No significant pathological abnormalities were recognized in animals inoculated with this nonpathogenic virus. In contrast, nearly half of the animals inoculated with either SIVmac or SIVmac239 developed significant pathological lesions, including opportunistic infections by 13 weeks postinoculation, highlighting the virulence of these viruses. Our results indicate marked differences in tissue distribution between pathogenic and nonpathogenic molecular clones of SIV during the acute phase of infection. The most striking differences were the absence of SIVmac1A11 from the central nervous system and thymic medulla. The prominent early involvement of the thymus suggests that infection of this organ is a key event in the induction of immune suppression by SIV. Images Figure 1 Figure 2 Figure 3 PMID:8053500

  17. RUNX3 inactivation by frequent promoter hypermethylation and protein mislocalization constitute an early event in breast cancer progression

    Microsoft Academic Search

    Manish Mani Subramaniam; Jason Yongsheng Chan; Richie Soong; Kosei Ito; Yoshiaki Ito; Khay Guan Yeoh; Manuel Salto-Tellez; Thomas Choudary Putti

    2009-01-01

    Background We had previously established that inactivation of RUNX3 occurs by frequent promoter hypermethylation and protein mislocalization\\u000a in invasive ductal carcinomas (IDC) of breast. Here, we hypothesize that inactivation of RUNX3 occurring in ductal carcinoma\\u000a in situ (DCIS) represent early event in breast carcinogenesis. \\u000a Methods The study cohort of 40 patients included 17 pure DCIS cases and 23 cases of DCIS

  18. Microgravity Effects on the Early Events of Biological Nitrogen Fixation in Medicago Truncatula: Results from the SyNRGE Experiment

    NASA Technical Reports Server (NTRS)

    Stutte, Gary W.; Roberts, Michael

    2012-01-01

    SyNRGE (Symbiotic Nodulation in a Reduced Gravity Environment) was a sortie mission on STS-135 in the Biological Research in Canisters (BRIC) hardware to study the effect of microgravity on a plant-microbe symbiosis resulting in biological nitrogen fixation. Medicago truncatula, a model species for th legume family, was inoculated with its bacterial symbiont, Sinorhizobium meliloti, to observe early biomolecular events associated with infection and nodulation in Petri Dish Fixation Units (PDFU's).

  19. Interrelationships between Yeast Ribosomal Protein Assembly Events and Transient Ribosome Biogenesis Factors Interactions in Early Pre-Ribosomes

    PubMed Central

    Jakob, Steffen; Ohmayer, Uli; Neueder, Andreas; Hierlmeier, Thomas; Perez-Fernandez, Jorge; Hochmuth, Eduard; Deutzmann, Rainer; Griesenbeck, Joachim; Tschochner, Herbert; Milkereit, Philipp

    2012-01-01

    Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA). Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins) and ribosome precursors (pre-ribosomes) are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU) processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains. PMID:22431976

  20. The Cenozoic Diversity of Agglutinated Foraminifera - Evidence for a late Oligocene to early Miocene diversification event

    NASA Astrophysics Data System (ADS)

    Kaminski, Michael; Setoyama, Eiichi; Kender, Sev; Cetean, Claudia

    2014-05-01

    The agglutinated foraminifera are among the most abundant micro-organisms in the deep marine environment and have a diversity record extending back to the late Precambrian. We present an updated diversity curve for agglutinated foraminiferal genera based on the stratigraphic ranges of all the agglutinated genera recognized as valid in the classification of Kaminski (2014). The data set for this analysis is based on the stratigraphic ranges of agglutinated genera published in Foraminiferal Genera and their Classification, which has been subsequently updated based on published studies and our new observations. The mean standing diversity of agglutinated foraminiferal genera was compiled by counting the number of boundary crossers rather than the number of genera in each stage. In this study, we report the stratigraphic and geographical occurrence of a benthic foraminiferal diversification event that has previously received little attention. In the latest Oligocene to earliest Miocene a number of trochospiral agglutinated genera with alveolar or canaliculate walls first appeared in the fossil record. Our studies of late Oligocene of the Congo fan, offshore Angola (Kender et al., 2008; Cetean and Kaminski, 2011) have revealed a diverse assemblage that includes new taxa of deep-water agglutinated foraminifera. In a biostratigraphic study of the Miocene foraminiferal assemblages Kender et al. (2008) noted steadily increasing diversity and proportions of infaunal agglutinated foraminiferal morphotypes over the lower Miocene interval. The proportion of infaunal agglutinated foraminifera assigned to the order Textularida increased dramatically in the lower mid-Miocene, suggesting expansion of the oxygen minimum zone into deeper waters. In addition to the trochospiral alveolar genera, several species of Reticulophragmium and Cyclammina display rapid diversification into numerous separate lineages that are at present not reflected in our generic diversity record owing to their poorly established taxonomy. Genera such as Alveovalvulina, Guppyella, Goesella, and Alveovalvulinella, are typical of assemblages found in subtropical oxygen minimum zones, especially in West Africa and the Caribbean. These agglutinated genera are not found in coeval assemblages from the northern high latitudes (Kaminski et al. 2005), suggesting they are restricted to the low-latitude OMZ. It is likely that the global warming of the latest Oligocene to Early Miocene contributed to intensification of dysoxic conditions in low-latitude upwelling regions, possibly from enhanced productivity and reduced deep-sea ventilation, creating an expanded niche for these organisms that flourished in low-oxygen conditions with high particulate organic matter input. We believe a more detailed phylogenetic approach to these agglutinated genera would result in the description of new genera for individual lineages and refinement of the foraminiferal diversity record.

  1. Modeling Temporal Processes in Early Spacecraft Design: Application of Discrete-Event Simulations for Darpa's F6 Program

    NASA Technical Reports Server (NTRS)

    Dubos, Gregory F.; Cornford, Steven

    2012-01-01

    While the ability to model the state of a space system over time is essential during spacecraft operations, the use of time-based simulations remains rare in preliminary design. The absence of the time dimension in most traditional early design tools can however become a hurdle when designing complex systems whose development and operations can be disrupted by various events, such as delays or failures. As the value delivered by a space system is highly affected by such events, exploring the trade space for designs that yield the maximum value calls for the explicit modeling of time.This paper discusses the use of discrete-event models to simulate spacecraft development schedule as well as operational scenarios and on-orbit resources in the presence of uncertainty. It illustrates how such simulations can be utilized to support trade studies, through the example of a tool developed for DARPA's F6 program to assist the design of "fractionated spacecraft".

  2. Early terrestrial impact events: Archean spherule layers in the Barberton Greenstone Belt, South Africa

    NASA Astrophysics Data System (ADS)

    Ozdemir, Seda; Koeberl, Christian; Schulz, Toni; Reimold, W. Uwe; Hofmann, Axel

    2015-04-01

    In addition to the oldest known impact structure on Earth, the 2.02-billion-year-old Vredefort Structure in South Africa, the evidence of Early Earth impact events are Archean spherule beds in South Africa and Australia. These spherules have been interpreted as condensation products from impact plumes and molten impact ejecta or/and impact ejecta that were melted during atmospheric re-entry [e.g., 1,2]. The 3.2-3.5 Ga spherule layers in the Barberton Greenstone Belt in South Africa currently represent the oldest known remnants of impact deposits on Earth. Aiming at identification of extraterrestrial components and to determine the diagenetic and metamorphic history of spherule layer intersections recently recovered in the CT3 drill core from the northeastern part of the Barberton Greenstone Belt, we have studied samples from these layers in terms of petrography and geochemistry. All samples, including spherule layer intersections and intercalating country rocks, were studied for mineral identification by optical and electron microscopy, as well as electron microprobe analysis (EPMA) at Natural History Museum Vienna and Museum für Naturkunde Berlin (MfN). Major and trace element compositions were determined via X-ray fluorescence spectrometry at MfN and instrumental neutron activation analysis (INAA) at University of Vienna. Os isotopes were measured by thermal ionization mass spectrometry (N-TIMS) at University of Vienna. Eighteen spherule beds are distributed over 150 meter drill core in CT3. Spherules are variably, deformed or undeformed. The high number of these layers may have been caused by tectonic duplication. Spherule beds are intercalated with shale, chert, carbonate, and/or sulfide deposits (country rocks). The size range of spherules is 0.5 to 2 mm, and some layers exhibit gradation. Shapes of spherules differ from spherical to ovoid, as well as teardrops, and spherules commonly show off-center vesicles, which have been interpreted as a primary characteristic pointing toward an impact origin [3]. Mineralogical and petrographic studies indicate that most of the mineralogy of the spherule layers is secondary due to secondary overprint by alteration and metamorphism. The mineral assemblages comprise quartz, K-feldspar, various muscovite types, phyllosilicates, Mg-siderite, Ti/Fe-Ti oxides, sulfides such as pyrite, pyrrhotite, chalkopyrite, sphalerite, and galena. INAA data show that some spherule layer intersections have extremely high siderophile element contents, with up to 1.60 wt% Ni, 0.69 wt% Cr, 0.05 wt% Co, 2.06 ppm Ir and 0.02 ppm Au, which is considered extraterrestrial component. This is further supported by their chondritic to slightly supercondritic 187Os/188Os ratios (ranging from 0.11 to 0.19), contrasting more radiogenic values of the spherule layer intercalations in comparison to country rocks, and Os concentrations up to ~4312 ppb. References: [1] Artemieva, N.A., and Simonson, B.M., 2012, LPSC 43, abstract #1372. [2] Johnson, B.C., and Melosh, H.J., 2014, Icarus, 228, 347-363. [3] Glass, B.P. and Simonson, B.M., 2012, Elements 8, 15-60.

  3. Event-related potentials — neurophysiological tools for predicting emergence and early outcome from traumatic coma

    Microsoft Academic Search

    N. M. Kane; S. H. Curry; C. A. Rowlands; A. R. Manara; T. Lewis; T. Moss; B. H. Cummins; S. R. Butler

    1996-01-01

    Objective: To determine the prognostic value of multimodal evoked potentials (EPs) and event- related (ERPs) potentials in coma (Glasgow Coma Score < 8), after severe traumatic brain injury (TBI). Design: Prospective, longitudinal study of neurophysiological re- sponses recorded during traumatic coma.

  4. Early Maastrichtian carbon cycle perturbation and cooling event: Implications from the South Atlantic Ocean

    Microsoft Academic Search

    Oliver Friedrich; Jens O. Herrle; Paul A. Wilson; Matthew J. Cooper; Jochen Erbacher; Christoph Hemleben

    2009-01-01

    Published stable isotope records in marine carbonate are characterized by a positive ?18O excursion associated with a negative ?13C shift during the early Maastrichtian. However, the cause and even the precise timing of these excursions remain uncertain. We have generated high-resolution foraminiferal stable isotope and gray-scale records for the latest Campanian to early Maastrichtian (?73–68 Ma) at two Ocean Drilling

  5. Early healing events around titanium implant devices with different surface microtopography: a pilot study in an in vivo rabbit model.

    PubMed

    Orsini, Ester; Salgarello, Stefano; Martini, Désirée; Bacchelli, Beatrice; Quaranta, Marilisa; Pisoni, Luciano; Bellei, Emma; Joechler, Monika; Ottani, Vittoria

    2012-01-01

    In the present pilot study, the authors morphologically investigated sandblasted, acid-etched surfaces (SLA) at very early experimental times. The tested devices were titanium plate-like implants with flattened wide lateral sides and jagged narrow sides. Because of these implant shape and placement site, the device gained a firm mechanical stability but the largest portion of the implant surface lacked direct contact with host bone and faced a wide peri-implant space rich in marrow tissue, intentionally created in order to study the interfacial interaction between metal surface and biological microenvironment. The insertion of titanium devices into the proximal tibia elicited a sequence of healing events. Newly formed bone proceeded through an early distance osteogenesis, common to both surfaces, and a delayed contact osteogenesis which seemed to follow different patterns at the two surfaces. In fact, SLA devices showed a more osteoconductive behavior retaining a less dense blood clot, which might be earlier and more easily replaced, and leading to a surface-conditioning layer which promotes osteogenic cell differentiation and appositional new bone deposition at the titanium surface. This model system is expected to provide a starting point for further investigations which clarify the early cellular and biomolecular events occurring at the metal surface. PMID:22545015

  6. End-Binding Protein 1 (EB1) Up-regulation is an Early Event in Colorectal Carcinogenesis

    PubMed Central

    Stypula-Cyrus, Yolanda; Mutyal, Nikhil N.; Cruz, Mart Angelo Dela; Kunte, Dhananjay P.; Radosevich, Andrew J.; Wali, Ramesh; Roy, Hemant K.; Backman, Vadim

    2014-01-01

    End-binding protein (EB1) is a microtubule protein that binds to the tumor suppressor adenomatous polyposis coli (APC). While EB1 is implicated as a potential oncogene, its role in cancer progression is unknown. Therefore, we analyzed EB1/APC expression at the earliest stages of colorectal carcinogenesis and in the uninvolved mucosa ("field effect") of human and animal tissue. We also performed siRNA-knockdown in colon cancer cell lines. EB1 is up-regulated in early and field carcinogenesis in the colon, and the cellular/nano-architectural effect of EB1 knockdown depended on the genetic context. Thus, dysregulation of EB1 is an important early event in colon carcinogenesis. PMID:24492008

  7. CENTRIOLE REPLICATION

    PubMed Central

    Gall, Joseph G.

    1961-01-01

    This paper describes the replication of centrioles during spermatogenesis in the Prosobranch snail, Viviparus malleatus Reeve. Sections for electron microscopy were cut from pieces of testis fixed in OsO4 and embedded in the polyester resin Vestopal W. Two kinds of spermatocytes are present. These give rise to typical uniflagellate sperm carrying the haploid number of 9 chromosomes, and atypical multiflagellate sperm with only one chromosome. Two centrioles are present in the youngest typical spermatocyte. Each is a hollow cylinder about 160 mµ in diameter and 330 mµ long. The wall consists of 9 sets of triplet fibers arranged in a characteristic pattern. Sometime before pachytene an immature centriole, or procentriole as it will be called, appears next to each of the mature centrioles. The procentriole resembles a mature centriole in most respects except length: it is more annular than tubular. The daughter procentriole lies with its axis perpendicular to that of its parent. It presumably grows to full size during the late prophase, although the maturation stages have not been observed with the electron microscope. It is suggested that centrioles possess a constant polarization. The distal end forms the flagellum or other centriole products, while the proximal end represents the procentriole and is concerned with replication. The four centrioles of prophase (two parents and two daughters) are distributed by the two meiotic divisions to the four typical spermatids, in which they function as the basal bodies of the flagella. Atypical spermatocytes at first contain two normal centrioles. Each of these becomes surrounded by a cluster of procentrioles, which progressively elongate during the late prophase. After two aberrant meiotic divisions the centriole clusters give rise to the basal bodies of the multiflagellate sperm. These facts are discussed in the light of the theory, first proposed by Pollister, that the supernumerary centrioles in the atypical cells are derived from the centromeres of degenerating chromosomes. PMID:13703108

  8. Impaired Early Attentional Processes in Parkinson’s Disease: A High-Resolution Event-Related Potentials Study

    PubMed Central

    Bocquillon, Perrine; Bourriez, Jean-Louis; Palmero-Soler, Ernesto; Defebvre, Luc; Derambure, Philippe; Dujardin, Kathy

    2015-01-01

    Introduction The selection of task-relevant information requires both the focalization of attention on the task and resistance to interference from irrelevant stimuli. A previous study using the P3 component of the event-related potentials suggested that a reduced ability to resist interference could be responsible for attention disorders at early stages of Parkinson’s disease (PD), with a possible role of the dorsolateral prefrontal cortex (DLPFC). Methods Our objective was to better determine the origin of this impairment, by studying an earlier ERP component, the N2, and its subcomponents, as they reflect early inhibition processes and as they are known to have sources in the anterior cingulate cortex (ACC), which is involved together with the DLPFC in inhibition processes. Fifteen early-stage PD patients and 15 healthy controls (HCs) performed a three-stimulus visual oddball paradigm, consisting in detecting target inputs amongst standard stimuli, while resisting interference from distracter ones. A 128-channel electroencephalogram was recorded during this task and the generators of the N2 subcomponents were identified using standardized weighted low-resolution electromagnetic tomography (swLORETA). Results PD patients displayed fewer N2 generators than HCs in both the DLPFC and the ACC, for all types of stimuli. In contrast to controls, PD patients did not show any differences between their generators for different N2 subcomponents. Conclusion Our data suggest that impaired inhibition in PD results from dysfunction of the DLPFC and the ACC during the early stages of attentional processes. PMID:26135906

  9. The "terminal Triassic catastrophic extinction event" in perspective: a review of carboniferous through Early Jurassic terrestrial vertebrate extinction patterns

    USGS Publications Warehouse

    Weems, R.E.

    1992-01-01

    A catastrophic terminal Triassic extinction event among terrestrial vertebrates is not supported by available evidence. The current model for such an extinction is based on at least eight weak or untenable assumptions: (1) a terminal Triassic extinction-inducing asteroid impact occurred, (2) a terminal Triassic synchronous mass extinction of terrestrial vertebrates occurred, (3) a concurrent terminal Triassic marine extinction occurred, (4) all terrestrial vertebrate families have similar diversities and ecologies, (5) changes in familial diversity can be gauged accurately from the known fossil record, (6) extinction of families can be compared through time without normalizing for changes in familial diversity through time, (7) extinction rates can be compared without normalizing for differing lengths of geologic stages, and (8) catastrophic mass extinctions do not select for small size. These assumptions have resulted in unsupportable and (or) erroneous conclusions. Carboniferous through Early Jurassic terrestrial vertebrate families mostly have evolution and extinction patterns unlike the vertebrate evolution and extinction patterns during the terminal Cretaceous event. Only the Serpukhovian (mid Carboniferous) extinction event shows strong analogy to the terminal Cretaceous event. Available data suggest no terminal Triassic extinction anomaly, but rather a prolonged and nearly steady decline in the global terrestrial vertebrate extinction rate throughout the Triassic and earliest Jurassic. ?? 1992.

  10. Strontium isotope profile of the early Toarcian (Jurassic) oceanic anoxic event, the duration of ammonite biozones, and belemnite palaeotemperatures

    NASA Astrophysics Data System (ADS)

    McArthur, J. M.; Donovan, D. T.; Thirlwall, M. F.; Fouke, B. W.; Mattey, D.

    2000-06-01

    We profile 87Sr/ 86Sr, ? 13C, ? 18O, Sr/Ca, Mg/Ca, and Na/Ca in belemnites through Pliensbachian and Toarcian strata on the Yorkshire coast, UK, which include the early Jurassic oceanic anoxic event. The 87Sr/ 86Sr profile shows that the relative duration of ammonite subzones differ by a factor of up to 30: the Lower Jurassic exaratum subzone is 30 times longer than the clevelandicum subzone because the exaratum subzone in Yorkshire, which contains the anoxic event, is condensed by a factor of between 6.5 and 12.2 times, relative to adjacent strata. Using our 87Sr/ 86Sr profile, the resolution in correlation and dating attainable in the interval is between ±1.5 m and ±15 m of section, and better than 0.25 Myr. In parts of the sequence, this stratigraphic resolution equals that attainable with ammonites. A new age model is provided for late Pliensbachian and early Toarcian time that is based on the 87Sr/ 86Sr profile. Through the sequence, the Sr/Ca, Mg/Ca, Na/Ca and ? 18O of belemnite carbonate covary, suggesting that elemental ratios may be useful for palaeotemperature measurement. Our ? 13C belemnite data splits into three the previously reported positive isotope excursion (to +6.5‰) in the early Toarcian. We speculate that the excursion(s) resulted from addition to surface waters of isotopically heavy CO 2 via ebullition of methanogenic CO 2 from the sediment during early burial of organic rich (>10% TOC) sediments

  11. SeismoGeodesy: Combination of High Rate, Real-time GNSS and Accelerometer Observations and Rapid Seismic Event Notification for Earth Quake Early Warning and Volcano Monitoring

    NASA Astrophysics Data System (ADS)

    Jackson, Michael; Zimakov, Leonid; Moessmer, Matthias

    2015-04-01

    Scientific GNSS networks are moving towards a model of real-time data acquisition, epoch-by-epoch storage integrity, and on-board real-time position and displacement calculations. This new paradigm allows the integration of real-time, high-rate GNSS displacement information with acceleration and velocity data to create very high-rate displacement records. The mating of these two instruments allows the creation of a new, very high-rate (200 Hz) displacement observable that has the full-scale displacement characteristics of GNSS and high-precision dynamic motions of seismic technologies. It is envisioned that these new observables can be used for earthquake early warning studies, volcano monitoring, and critical infrastructure monitoring applications. Our presentation will focus on the characteristics of GNSS, seismic, and strong motion sensors in high dynamic environments, including historic earthquakes replicated on a shake table over a range of displacements and frequencies. We will explore the optimum integration of these sensors from a filtering perspective including simple harmonic impulses over varying frequencies and amplitudes and under the dynamic conditions of various earthquake scenarios. We will also explore the tradeoffs between various GNSS processing schemes including real-time precise point positioning (PPP) and real-time kinematic (RTK) as applied to seismogeodesy. In addition we will discuss implementation of a Rapid Seismic Event Notification System that provides quick delivery of digital data from seismic stations to the acquisition and processing center and a full data integrity model for real-time earthquake notification that provides warning prior to significant ground shaking.

  12. Estimating the Climatic Impact of an Early Holocene Meltwater Event Around the Gulf of St. Lawrence

    Microsoft Academic Search

    E. Levac

    2004-01-01

    An early Holocene episode of meltwater drainage from the Great Lake region through the St. Lawrence River (sometimes referred to as the Middle Stanley) was previously shown to cause important changes in sea surface temperature (SST) in Bay of Islands (west coast of Newfoundland) and a reversal in the postglacial vegetation succession along the shores of the St. Lawrence River

  13. Introduction: Cortical event-related potentials and early language development: Variations with age and nutrition

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There is increasing evidence in the form of language-relevant sensory processing and discrimination that the foundations for speech perception are present at birth and are subject to significant modification during the first year of life. However, charting the course of early language development is...

  14. Is Epigenetics an Important Link between Early Life Events and Adult Disease?

    Microsoft Academic Search

    Robert A. Waterland

    2009-01-01

    Background: Epigenetic mechanisms provide one potential explanation for how environmental influences in early life cause long-term changes in chronic disease susceptibility. Whereas epigenetic dysregulation is increasingly implicated in various rare developmental syndromes and cancer, the role of epigenetics in complex chronic diseases, such as cardiovascular disease, type 2 diabetes and obesity, remains largely uncharacterized. Extensive work in animal models is

  15. Riding the Wave to Reach the Masses: Natural Events in Early Twentieth Century Portuguese Daily Press

    ERIC Educational Resources Information Center

    Simoes, Ana; Carneiro, Ana; Diogo, Maria Paula

    2012-01-01

    This paper brings together science communicated in newspapers in Portugal by looking at how news on natural events were communicated in two different newspapers--the capital newspaper "Diario de Noticias" ("Daily News") and the "Diario dos Acores" ("Azores Daily"). In particular, we look at how the 1900 solar eclipse, a hot topic throughout…

  16. Maternal Sensitivity during Infancy and Subsequent Life Events Relate to Attachment Representation at Early Adulthood.

    ERIC Educational Resources Information Center

    Beckwith, Leila; Cohen, Sarale E.; Hamilton, Claire E.

    1999-01-01

    Prospective longitudinal study examined continuity in infants' experience to attachment representations at 18 years. Found that adults with dismissing representations had received less sensitive maternal care than adults with secure or preoccupied representations. Adverse life events through age 12, especially parental divorce, reduced likelihood…

  17. Exposure to Potentially Traumatic Events in Early Childhood: Differential Links to Emergent Psychopathology

    ERIC Educational Resources Information Center

    Briggs-Gowan, Margaret J.; Carter, Alice S.; Clark, Roseanne; Augustyn, Marilyn; McCarthy, Kimberly J.; Ford, Julian D.

    2010-01-01

    Research NeedsObjective: To examine associations between exposure to potentially traumatic events (PTEs) and clinical patterns of symptoms and disorders in preschool children. Method: Two hundred and thirteen referred and non-referred children, ages 24 to 48 months (MN = 34.9, SD = 6.7 months) were studied. Lifetime exposure to PTEs (family…

  18. Stalagmite evidence for the precise timing of North Atlantic cold events during the early last glacial

    NASA Astrophysics Data System (ADS)

    Drysdale, Russell N.; Zanchetta, Giovanni; Hellstrom, John C.; Fallick, Anthony E.; McDonald, Janece; Cartwright, Ian

    2007-01-01

    Evidence of millennial-scale cold events following the last interglacial are well preserved in North Atlantic marine cores, Greenland ice, and pollen records from Europe. However, their timing was previously undetermined by radiometric dating. We report the first precise radiometric ages for two such events, C23 (105.1 ± 0.9 ka to 102.6 ± 0.8 ka) and C24 (112.0 ± 0.8 ka and 108.8 ± 1.0 ka), based on stable carbon and oxygen isotope measurements on a stalagmite from Italy (CC28). In addition to providing new information on the duration of these events in southern Europe, the age data provide invaluable tuning points for the Mélisey I (C24) and Montaigu (C23) pollen zones identified in western Europe. The former event is of particular significance because it represents the end of the Eemian interglacial forest phase in western Europe. The new age data will also allow fine tuning of the timing and duration of Greenland stadial 24 (equivalent to C23) in the North Greenland Ice Core Project ice core and, via a common gasage chronology, tuning of the Vostok and EPICA (European Project for Ice Coring in Antarctica) ice cores.

  19. [Stressful life events, health symptoms, social support and coping in early adolescents].

    PubMed

    Oh, K; Han, J S

    1990-12-01

    Numerous research reports have substantiated the role of stressful life events in relation to the onset of health changes. The relationship tends to hold across different age groups. Theoretically, adolescence has been considered a developmental crisis period of great stress, impoverished coping skills and high vulnerability to biological, social and psychological demands. The research problem addressed by this study was to examine the relationships between stressful life events and health symptom patterns, and the effect of two variables, coping and social support, theoretically considered to mediate the relationship between stress and health symptoms in adolescents. The following five hypotheses were tested in this research: 1. Health symptoms are positively related to stressful life events in adolescents, 2. Health symptoms are negatively related to coping in adolescents, 3. Health symptoms are negatively related to social support in adolescents, 4. When coping is controlled, the relationship between health symptoms and stressful life events will decrease, and 5. When social support is controlled, the relationship between health symptoms and stressful life events will increase. The study subjects consisted of 1090 high school students of the metropolitan city of Seoul. The following sampling procedure was used: 1. Of the 169 high schools in nine school administrative districts in the city, a proportional sample of ten schools was selected. 2. One class from each of the freshman and sophomore was randomly selected and all the students who were in the sampled class were used as the study sample. The study was limited to freshman and sophomore adolescents, aged 15 to 18 (mean = 16.6). Of the 1090 subjects 688 (63%) were boys and 402 (37%) were girls. An Adolescent Inventory of Stressful Life Events, a Health Symptom Questionnaire and an Adolescent Coping Inventory were adapted for this study. The Norbeck Social Support Questionnaire was utilized to collect the data on perceived social support. Five high school teachers in the areas of school health and counselling reviewed the items of each questionnaire for content validity. A pilot study was undertaken to ascertain reliability. Fifty three high school students responded to the questionnaires and gave their opinions on the items. For stressful life events, health symptoms, coping, and social support, the Cronbach's alpha's on the study were .70, .94, .77, and .76, respectively. Research assistants attended all the sampled classes with the school proctor to explain the purpose and procedures of the study to the students. The questionnaires along with a ballpoint pen were distributed to the students who were asked to complete each item.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:2290252

  20. Production of Lipid-Derived Free Radicals in L1210 Murine Leukemia Cells Is an Early Oxidative Event in the Photodynamic Action of Photofrin

    Microsoft Academic Search

    Eric E. Kelleyl; Garry R. Buettner; C. Patrick Burns

    1997-01-01

    the photodynamic therapy (PDT)? of cancer (l-3). Photody- namic action relies on the absorption of visible light by the Photofrine photosensitization initiates a sequence of oxi- dative events that begins with singlet oxygen formation and ultimately leads to cell death. We hypothesize that membrane lipid-derived free radical formation is an early event in this process. In the presence of iron

  1. Early folding events protect aggregation-prone regions of a ?-rich protein

    PubMed Central

    Budyak, Ivan L.; Krishnan, Beena; Marcelino-Cruz, Anna M.; Ferrolino, Mylene C.; Zhuravleva, Anastasia; Gierasch, Lila M.

    2013-01-01

    Summary Protein folding and aggregation inevitably compete with one another. This competition is even keener for proteins with frustrated landscapes, such as those rich in ?-structure. Interestingly, despite their rugged energy landscapes and high ?-sheet content, intracellular lipid-binding proteins (iLBPs) appear to successfully avoid aggregation, as they are not implicated in aggregation diseases. In this study, we used a canonical iLBP, cellular retinoic acid-binding protein 1 (CRABP1), to better understand how folding is favored over aggregation. Analysis of folding kinetics of point mutants reveals that the folding pathway of CRABP1 involves early barrel closure. This folding mechanism protects sequences in CRABP1 that comprise cores of aggregates as identified by NMR. The amino acid conservation pattern in other iLBPs suggests that early barrel closure may be a general strategy for successful folding and minimization of aggregation. We suggest that folding mechanisms more broadly may incorporate steps that disfavor aggregation. PMID:23454187

  2. Early events in rabies virus infection of the central nervous system in skunks ( Mephitis mephitis )

    Microsoft Academic Search

    K. M. Charlton; G. A. Casey; A. I. Wandeler; S. Nadin-Davis

    1995-01-01

    Twenty-four striped skunks were inoculated intramuscularly (long digital extensor muscle of right pelvic limb) with street\\u000a rabies virus. Groups of two clinically normal skunks were killed at various times after inoculation; skunks that developed\\u000a rabies were killed in early stages of the clinical signs. Four clinically normal skunks (numbered 1–4) had slight infection\\u000a in lumbar spinal ganglia, spinal cord and

  3. Age Dating Merger Events in Early Type Galaxies via the Detection of AGB Light

    NASA Technical Reports Server (NTRS)

    Bothun, G.

    2005-01-01

    A thorough statistical analysis of the J-H vs. H-K color plane of all detected early type galaxies in the 2MASS catalog with velocities less than 5000 km/s has been performed. This all sky survey is not sensitive to one particular galactic environment and therefore a representative range of early type galaxy environments have been sampled. Virtually all N-body simulation so major mergers produces a central starburst due to rapid collection of gas. This central starburst is of sufficient amplitude to change the stellar population in the central regions of the galaxy. Intermediate age populations are given away by the presence of AGB stars which will drive the central colors redder in H-K relative to the J- H baseline. This color anomaly has a lifetime of 2-5 billion years depending on the amplitude of the initial starburst Employing this technique on the entire 2MASS sample (several hundred galaxies) reveals that the AGB signature occurs less than 1% of the time. This is a straightforward indication that virtually all nearby early type galaxies have not had a major merger occur within the last few billion years.

  4. An early warning indicator for atmospheric blocking events using transfer operators

    E-print Network

    Alexis Tantet; Fiona R. van der Burgt; Henk A. Dijkstra

    2015-03-14

    The existence of persistent midlatitude atmospheric flow regimes with time-scales larger than 5-10 days and indications of preferred transitions between them motivates to develop early warning indicators for such regime transitions. In this paper, we use a hemispheric barotropic model together with estimates of transfer operators on a reduced phase space to develop an early warning indicator of the zonal to blocked flow transition in this model. It is shown that, the spectrum of the transfer operators can be used to study the slow dynamics of the flow as well as the non-Markovian character of the reduction. The slowest motions are thereby found to have time scales of three to six weeks and to be associated with meta-stable regimes (and their transitions) which can be detected as almost-invariant sets of the transfer operator. From the energy budget of the model, we are able to explain the meta-stability of the regimes and the existence of preferred transition paths. Even though the model is highly simplified, the skill of the early warning indicator is promising, suggesting that the transfer operator approach can be used in parallel to an operational deterministic model for stochastic prediction or to assess forecast uncertainty.

  5. Impact of Prior Traumatic Life Events on Parental Early Stage Reactions following a Child's Cancer

    PubMed Central

    Boman, Krister K.; Kjällander, Ylva; Eksborg, Staffan; Becker, Jeremy

    2013-01-01

    Background In pediatric oncology, effective clinic–based management of acute and long–term distress in families calls for investigation of determinants of parents' psychological response to the child's cancer. We examined the relationship between parents' prior exposure to traumatic life events (TLE) and the occurrence of posttraumatic stress symptoms (PTSS) following their child's cancer diagnosis. Factors mediating the TLE–PTSS relationship were analyzed. Methodology The study comprised 169 parents (97 mothers, 72 fathers) of 103 cancer diagnosed children (median age: 5,9 years; range 0.1–19.7 years). Thirty five parents were of immigrant origin (20.7%). Prior TLE were collated using a standardized questionnaire, PTSS was assessed using the Impact of Events–Revised (IES–R) questionnaire covering intrusion, avoidance and hyperarousal symptoms. The predictive significance of prior TLE on PTSS was tested in adjusted regression models. Results Mothers demonstrated more severe PTSS across all symptom dimensions. TLE were associated with significantly increased hyperarousal symptoms. Parents' gender, age and immigrant status did not significantly influence the TLE–PTSS relationship. Conclusions Prior traumatic life–events aggravate posttraumatic hyperarousal symptoms. In clinic–based psychological care of parents of high–risk pediatric patients, attention needs to be paid to life history, and to heightened vulnerability to PTSS associated with female gender. PMID:23516408

  6. The Roles of Chromatin Remodelling Factors in Replication

    Microsoft Academic Search

    Ana Neves-Costa; Patrick Varga-Weisz

    Dynamic changes of chromatin structure control DNA-dependent events, including DNA replication.\\u000a Along with DNA, chromatin organization must be replicated to maintain genetic and epigenetic information\\u000a through cell generations. Chromatin remodelling is important for several steps in replication: determination\\u000a and activation of origins of replication, replication machinery progression, chromatin assembly and\\u000a DNA repair. Histone chaperones such as the FACT complex assist

  7. Early Oligocene geomagnetic field behavior from ODP Site 1128: Complex records of short-period polarity events

    NASA Astrophysics Data System (ADS)

    Molina-Garza, R. S.; Fuller, M. D.

    2001-12-01

    At Site 1128, in the Great Australian Bight, Leg 182 of the Ocean Drilling Program recovered a thick (~350 m) section of Upper Eocene and Lower Oligocene marine calcareous clays. Shipboard measurements established a magnetostratigraphy that can unambiguously be correlated to chrons C13n to C10n of the global polarity time scale (GPTS), and a less complete record of chrons C17n to C15r (due to poor core recovery). Correlation to the GPTS is further supported by available biostratigraphic data. For the Lower Oligocene sequence, average sedimentation rate is estimated at ~4 cm/kyr. The sediments recovered thus allow to test for the completeness and reliability of the geomagnetic field polarity during the Early Oligocene. The original shipboard long-core measurements suggested the presence of additional short polarity events or geomagnetic field excursions during chrons C13n, C12r, C11r, and C11n. In order to examine the reliability of the record and the nature of possible short-polarity events, we obtained discrete samples from the entire sequence at ~1 m intervals, with a closer sample spacing in critical intervals (~10 cm). The natural remanence of these sediments is normally simple. After removing a small soft overprint, the magnetization decays towards the origin with distributed coercivities and distributed unblocking temperatures. Demagnetization behavior and other rock magnetic data indicate that the remanence resides primarily in a cubic phase such as magnetite or maghemite, with a small contribution from hematite. Discrete samples from chron C12r did not reproduce the long-core record for two of the supposed events, single samples suggest the presence of short events or cryptochrons near the base of both C13n and C12r, and multiple samples suggest the existence of short-period normal polarity events during C11r and near the top of C12r. The records of these events are, however, complex. Demagnetization results indicate that the magnetization consists of an intermediate- (10-40 mT) and a high-coercivity (40-80 mT) component. Only the intermediate coercivity magnetization records normal polarities, although transitional directions are observed in both components. Hysteresis data suggest the presence of PSD particles, and show no discernable difference between sediments recording short-period polarity events and those with uniform near univectorial behavior and single polarity, suggesting uniformity of remanence carriers. The two components of the NRM can be attributed to the presence of two carriers with different lock-in time mechanisms.

  8. Helicase Loading at Chromosomal Origins of Replication

    PubMed Central

    Bell, Stephen P.; Kaguni, Jon M.

    2013-01-01

    Loading of the replicative DNA helicase at origins of replication is of central importance in DNA replication. As the first of the replication fork proteins assemble at chromosomal origins of replication, the loaded helicase is required for the recruitment of the rest of the replication machinery. In this work, we review the current knowledge of helicase loading at Escherichia coli and eukaryotic origins of replication. In each case, this process requires both an origin recognition protein as well as one or more additional proteins. Comparison of these events shows intriguing similarities that suggest a similar underlying mechanism, as well as critical differences that likely reflect the distinct processes that regulate helicase loading in bacterial and eukaryotic cells. PMID:23613349

  9. Lung Transplant Acceptance is Facilitated by Early Events in the Graft and is Associated with Lymphoid Neogenesis

    PubMed Central

    Li, Wenjun; Bribriesco, Alejandro C.; Nava, Ruben G.; Brescia, Alexander A.; Ibricevic, Aida; Spahn, Jessica H.; Brody, Steven L.; Ritter, Jon H.; Gelman, Andrew E.; Krupnick, Alexander S.; Miller, Mark J.; Kreisel, Daniel

    2012-01-01

    Early immune responses are important in shaping long-term outcomes of human lung transplants. To examine the role of early immune responses in lung rejection and acceptance we developed a method to retransplant mouse lungs. Retransplantation into T cell-deficient hosts showed that for lungs and hearts alloimmune responses occurring within 72 hours of transplantation are reversible. In contrast to hearts, a 72-hour period of immunosuppression with costimulation blockade in primary allogeneic recipients suffices to prevent rejection of lungs upon retransplantation into untreated allogeneic hosts. Long-term lung acceptance is associated with induction of bronchus-associated lymphoid tissue, where Foxp3+ cells accumulate and recipient T cells interact with CD11c+ dendritic cells. Acceptance of retransplanted lung allografts is abrogated by treatment of immunosuppressed primary recipients with anti-CD25 antibodies. Thus, events contributing to lung transplant acceptance are established early in the graft and induction of bronchus-associated lymphoid tissue can be associated with an immune quiescent state. PMID:22549742

  10. Climate forcing due to the 8200 cal yr BP event observed at Early Neolithic sites in the eastern Mediterranean

    NASA Astrophysics Data System (ADS)

    Weninger, Bernhard; Alram-Stern, Eva; Bauer, Eva; Clare, Lee; Danzeglocke, Uwe; Jöris, Olaf; Kubatzki, Claudia; Rollefson, Gary; Todorova, Henrieta; van Andel, Tjeerd

    2006-11-01

    We explore the hypothesis that the abrupt drainage of Laurentide lakes and associated rapid switch of the North Atlantic thermohaline circulation 8200 yr ago had a catastrophic influence on Neolithic civilisation in large parts of southeastern Europe, Anatolia, Cyprus, and the Near East. The event at 8200 cal yr BP is observed in a large number of high-resolution climate proxies in the Northern Hemisphere, and in many cases corresponds to markedly cold and arid conditions. We identify the relevant archaeological levels of major Neolithic settlements in Central Anatolia, Cyprus, Greece and Bulgaria, and examine published stratigraphic, architectural, cultural and geoarchaeological studies for these sites. The specific archaeological events and processes we observe at a number of these sites during the study interval 8400-8000 cal yr BP lead us to refine some previously established Neolithisation models. The introduction of farming to South-East Europe occurs in all study regions (Thrace, Macedonia, Thessaly, Bulgaria) near 8200 cal yr BP. We observe major disruptions of Neolithic cultures in the Levant, North Syria, South-East Anatolia, Central Anatolia and Cyprus, at the same time. We conclude that the 8200 cal yr BP aridity event triggered the spread of early farmers, by different routes, out of West Asia and the Near East into Greece and Bulgaria.

  11. Early Paleozoic magmatic events in the eastern Klamath Mountains, northern California

    SciTech Connect

    Wallin, E.T.; Mattinson, J.M.; Potter, A.W.

    1988-02-01

    New U-Pb zircon ages for nine samples of tonalite and pegmatitic trondhjemite from the Trinity ophiolite and associated melange reveal a complex history of magmatic activity extending back into the earliest Cambrian, much older than previously believed. Earlier investigations, based on limited data, recognized lower Paleozoic crustal elements in the eastern Klamath terrane (EKT) ranging in age from Middle Ordovician to Early to Middle Devonian. The new work in the Yreka-Callahan area of the EKT confirms the Ordovician (440-475 Ma) and younger ages, but reveals for the first time the presence of tonalitic rocks that crystallized during a narrow time interval at about 565-570 Ma. The authors also recognize younger, Late Silurian magmatism at 412 Ma. In the context of available mapping, these ages indicate that the Trinity ophiolite is broadly polygenetic because parts of it yield crystallization ages that span approximately 150 m.y. Superjacent dismembered units of probable early Paleozoic age may be tectonostratigraphically equivalent to the Sierra City melange in the northern Sierra Nevada.

  12. An In Vitro Tissue Culture Bilayer Model To Examine Early Events in Mycobacterium tuberculosis Infection

    PubMed Central

    Birkness, K. A.; Deslauriers, M.; Bartlett, J. H.; White, E. H.; King, C. H.; Quinn, F. D.

    1999-01-01

    A tissue culture bilayer system that mimics some aspects of early alveolar infection by Mycobacterium tuberculosis was developed. This model incorporates human lung epithelial type II pneumocyte (A549) (upper chamber) and endothelial cell (lower chamber) layers separated by a microporous membrane. This construction makes it possible to observe and quantify the passage of bacteria through the two layers, to observe the interaction of the bacteria with the various cell types, and to examine the basic mechanisms of immune cell recruitment to the site of infection. After 107 organisms were added to the upper chamber we microscopically observed large numbers of bacteria attached to and within the pneumocytes and we determined by viable-cell counting that a small percentage of the inoculum (0.02 to 0.43%) passed through the bilayer into the lower chamber. When peripheral blood mononuclear cells were added to the lower chamber, microscopic examination indicated a migration of the mononuclear cells through the bilayer to the apical surface, where they were seen associated with the mycobacteria on the pneumocytes. The added complexity of the bilayer system offers an opportunity to define more precisely the roles of the various lung cell types in the pathogenesis of early tuberculosis. PMID:9916072

  13. Autophagy, and BiP level decrease are early key events in retrograde degeneration of motoneurons

    PubMed Central

    Penas, C; Font-Nieves, M; Forés, J; Petegnief, V; Planas, A; Navarro, X; Casas, C

    2011-01-01

    Disconnection of the axon from the soma of spinal motoneurons (MNs) leads either to a retrograde degenerative process or to a regenerative reaction, depending on the severity and the proximity to the soma of the axonal lesion. The endoplasmic reticulum (ER) is a continuous membranous network that extends from the nucleus to the entire cytoplasm of the neuronal soma, axon and dendrites. We investigated whether axonal injury is sensed by the ER and triggers the activation of protective mechanisms, such as the unfolded protein response (UPR) and autophagy. We found early (at 3 days) accumulation of beclin1, LC3II and Lamp-1, hallmarks of autophagy, in both degenerating MNs after spinal root avulsion and in non-degenerating MNs after distal nerve section, although Lamp-1 disappeared by 5 days only in the former. In contrast, only degenerating MNs presented early activation of IRE1?, revealed by an increase of the spliced isoform of Xbp1 and accumulation of ATF4 in their nucleus, two branches of the UPR, and late BiP downregulation in association with cytoskeletal and organelle disorganization. We conclude that BiP decrease is a signature of the degenerating process, as its overexpression led to an increase in MN survival after root avulsion. Besides, Bcl2 is strongly implicated in the survival pathway activated by BiP overexpression. PMID:21436843

  14. Knockin' on pollen's door: live cell imaging of early polarization events in germinating Arabidopsis pollen

    PubMed Central

    Vogler, Frank; Konrad, Sebastian S. A.; Sprunck, Stefanie

    2015-01-01

    Pollen tubes are an excellent system for studying the cellular dynamics and complex signaling pathways that coordinate polarized tip growth. Although several signaling mechanisms acting in the tip-growing pollen tube have been described, our knowledge on the subcellular and molecular events during pollen germination and growth site selection at the pollen plasma membrane is rather scarce. To simultaneously track germinating pollen from up to 12 genetically different plants we developed an inexpensive and easy mounting technique, suitable for every standard microscope setup. We performed high magnification live-cell imaging during Arabidopsis pollen activation, germination, and the establishment of pollen tube tip growth by using fluorescent marker lines labeling either the pollen cytoplasm, vesicles, the actin cytoskeleton or the sperm cell nuclei and membranes. Our studies revealed distinctive vesicle and F-actin polarization during pollen activation and characteristic growth kinetics during pollen germination and pollen tube formation. Initially, the germinating Arabidopsis pollen tube grows slowly and forms a uniform roundish bulge, followed by a transition phase with vesicles heavily accumulating at the growth site before switching to rapid tip growth. Furthermore, we found the two sperm cells to be transported into the pollen tube after the phase of rapid tip growth has been initiated. The method presented here is suitable to quantitatively study subcellular events during Arabidopsis pollen germination and growth, and for the detailed analysis of pollen mutants with respect to pollen polarization, bulging, or growth site selection at the pollen plasma membrane. PMID:25954283

  15. Paleoceanographic Implications of the Terrestrial Carbon-Isotope Record of the Early Toarcian (Jurassic) Oceanic Anoxic Event

    NASA Astrophysics Data System (ADS)

    Hesselbo, S.; Jenkyns, H. C.; Duarte, L. V.

    2005-12-01

    Macrofossil wood in two European sections representing the Toarcian (Early Jurassic) Oceanic Anoxic Event (OAE) have previously been shown to exhibit a large (~ -6 to -7 %) shift in d13C values which has been interpreted as a massive and geologically short-lived perturbation to the global carbon cycle. This interpretation has recently been challenged on the basis of a compilation of carbon-isotope data from belemnites collected from sections in northern Europe that exhibit carbon isotope values that are heavier than expected at the peak of the OAE. Here we present new carbon isotope measurements from wood collected from a marine record of the early Toarcian at Peniche, Portugal, a section currently under consideration as a GSSP for the base of the Toarcian. A large negative excursion (~ -7%) is confirmed for the OAE in these samples. These cannot have been severely impregnated by hydrocarbons of marine origin and the ages are well defined by ammonite biostratigraphy and by Sr-isotope stratigraphy. Carbon-isotope data is also presented for an early diagenetic silica nodule that formed within jet from the Toarcian of the Yorkshire coast, northeast England; values are indistinguishable from those of stratigraphically equivalent jet samples from which solvent extractable hydrocarbons had been removed. Thus, the early Toarcian negative carbon-isotope excursion is confirmed as a phenomenon of the global shallow-ocean, biosphere and atmosphere. It is likely that the anomalously heavy values obtained from belemnites from the OAE interval derive their isotopic signature from localized and possibly seasonal water masses characterized by dissolved inorganic carbon strongly enriched in heavy carbon by very high organic productivity.

  16. Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-?B and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling

    PubMed Central

    Scherbik, S. V.; Pulit-Penaloza, J. A.; Basu, M.; Courtney, S. C.

    2013-01-01

    Although infections with “natural” West Nile virus (WNV) and the chimeric W956IC WNV infectious clone virus produce comparable peak virus yields in type I interferon (IFN) response-deficient BHK cells, W956IC infection produces higher levels of “unprotected” viral RNA at early times after infection. Analysis of infections with these two viruses in IFN-competent cells showed that W956IC activated NF-?B, induced higher levels of IFN-?, and produced lower virus yields than WNV strain Eg101. IPS-1 was required for both increased induction of IFN-? and decreased yields of W956IC. In Eg101-infected cells, phospho-STAT1/STAT2 nuclear translocation was blocked at all times analyzed, while some phospho-STAT1/STAT2 nuclear translocation was still detected at 8 h after infection in W956IC-infected mouse embryonic fibroblasts (MEFs), and early viral protein levels were lower in these cells. A set of additional chimeras was made by replacing various W956IC gene regions with the Eg101 equivalents. As reported previously, for three of these chimeras, the low early RNA phenotype of Eg101 was restored in BHK cells. Analysis of infections with two of these chimeric viruses in MEFs detected lower early viral RNA levels, higher early viral protein levels, lower early IFN-? levels, and higher virus yields similar to those seen after Eg101 infection. The data suggest that replicase protein interactions directly or indirectly regulate genome switching between replication and translation at early times in favor of translation to minimize NF-?B activation and IFN induction by decreasing the amount of unprotected viral RNA, to produce sufficient viral protein to block canonical type I IFN signaling, and to efficiently remodel cell membranes for exponential genome amplification. PMID:23678179

  17. Long-term impact of early life events on physiology and behaviour.

    PubMed

    Boersma, G J; Bale, T L; Casanello, P; Lara, H E; Lucion, A B; Suchecki, D; Tamashiro, K L

    2014-09-01

    This review discusses the effects of stress and nutrition throughout development and summarises studies investigating how exposure to stress or alterations in nutrition during the pre-conception, prenatal and early postnatal periods can affect the long-term health of an individual. In general, the data presented here suggest that that anything signalling potential adverse conditions later in life, such as high levels of stress or low levels of food availability, will lead to alterations in the offspring, possibly of an epigenetic nature, preparing the offspring for these conditions later in life. However, when similar environmental conditions are not met in adulthood, these alterations may have maladaptive consequences, resulting in obesity and heightened stress sensitivity. The data also suggest that the mechanism underlying these adult phenotypes might be dependent on the type and the timing of exposure. PMID:24690036

  18. Phosphoproteomic Analyses Reveal Early Signaling Events in the Osmotic Stress Response1[W][OPEN

    PubMed Central

    E. Stecker, Kelly; Minkoff, Benjamin B.; Sussman, Michael R.

    2014-01-01

    Elucidating how plants sense and respond to water loss is important for identifying genetic and chemical interventions that may help sustain crop yields in water-limiting environments. Currently, the molecular mechanisms involved in the initial perception and response to dehydration are not well understood. Modern mass spectrometric methods for quantifying changes in the phosphoproteome provide an opportunity to identify key phosphorylation events involved in this process. Here, we have used both untargeted and targeted isotope-assisted mass spectrometric methods of phosphopeptide quantitation to characterize proteins in Arabidopsis (Arabidopsis thaliana) whose degree of phosphorylation is rapidly altered by hyperosmotic treatment. Thus, protein phosphorylation events responsive to 5 min of 0.3 m mannitol treatment were first identified using 15N metabolic labeling and untargeted mass spectrometry with a high-resolution ion-trap instrument. The results from these discovery experiments were then validated using targeted Selected Reaction Monitoring mass spectrometry with a triple quadrupole. Targeted Selected Reaction Monitoring experiments were conducted with plants treated under nine different environmental perturbations to determine whether the phosphorylation changes were specific for osmosignaling or involved cross talk with other signaling pathways. The results indicate that regulatory proteins such as members of the mitogen-activated protein kinase family are specifically phosphorylated in response to osmotic stress. Proteins involved in 5? messenger RNA decapping and phosphatidylinositol 3,5-bisphosphate synthesis were also identified as targets of dehydration-induced phosphoregulation. The results of these experiments demonstrate the utility of targeted phosphoproteomic analysis in understanding protein regulation networks and provide new insight into cellular processes involved in the osmotic stress response. PMID:24808101

  19. The PRESSCA operational early warning system for landslide forecasting: the 11-12 November 2013 rainfall event in Central Italy.

    NASA Astrophysics Data System (ADS)

    Ciabatta, Luca; Brocca, Luca; Ponziani, Francesco; Berni, Nicola; Stelluti, Marco; Moramarco, Tommaso

    2014-05-01

    The Umbria Region, located in Central Italy, is one of the most landslide risk prone area in Italy, almost yearly affected by landslides events at different spatial scales. For early warning procedures aimed at the assessment of the hydrogeological risk, the rainfall thresholds represent the main tool for the Italian Civil Protection System. As shown in previous studies, soil moisture plays a key-role in landslides triggering. In fact, acting on the pore water pressure, soil moisture influences the rainfall amount needed for activating a landslide. In this work, an operational physically-based early warning system, named PRESSCA, that takes into account soil moisture for the definition of rainfall thresholds is presented. Specifically, the soil moisture conditions are evaluated in PRESSCA by using a distributed soil water balance model that is recently coupled with near real-time satellite soil moisture product obtained from ASCAT (Advanced SCATterometer) and from in-situ monitoring data. The integration of three different sources of soil moisture information allows to estimate the most accurate possible soil moisture condition. Then, both observed and forecasted rainfall data are compared with the soil moisture-based thresholds in order to obtain risk indicators over a grid of ~ 5 km. These indicators are then used for the daily hydrogeological risk evaluation and management by the Civil Protection regional service, through the sharing/delivering of near real-time landslide risk scenarios (also through an open source web platform: www.cfumbria.it). On the 11th-12th November, 2013, Umbria Region was hit by an exceptional rainfall event with up to 430mm/72hours that resulted in significant economic damages, but fortunately no casualties among the population. In this study, the results during the rainfall event of PRESSCA system are described, by underlining the model capability to reproduce, two days in advance, landslide risk scenarios in good spatial and temporal agreement with the occurred actual conditions. High-resolution risk scenarios (100mx100m), obtained by coupling PRESSCA forecasts with susceptibility and vulnerability layers, are also produced. The results show good relationship between the PRESSCA forecast and the reported landslides to the Civil Protection Service during the rainfall event, confirming the system robustness. The good forecasts of PRESSCA system have surely contributed to start well in advance the Civil Protection operations (alerting local authorities and population).

  20. Petrography and carbonate isotope stratigraphy from MIS AND-1B core, Antarctica: Evidence of the early Pliocene warming event

    NASA Astrophysics Data System (ADS)

    Scopelliti, G.; Bellanca, A.; Neri, R.

    2011-03-01

    A large portion of ANDRILL (ANtarctic geological DRILLing) core AND-1B recovered in the Western Ross Sea and spanning the early Pliocene has been investigated in order to obtain a detailed carbonate isotope record from Antarctic margin sediments through the early Pliocene warming event. Petrographic observations and mineralogical analyses reveal the authigenic nature of the carbonate and small proportions of Fe and Mg incorporated within the calcite lattice. High productivity conditions testified by ~ 80 m-thick diatomite interval (383 to 460 mbsf) well fit with the composite nature of the authigenic carbonate generally characterizing organic matter-rich sediments. As is known, sediments from the Polar Region are generally poor in carbonate. Although in the investigated portion of AND-1B core the carbonate seldom exceeds 5% in content, an automated Carbonate Preparation Device was used to obtain a high-resolution stable isotope dataset. Paleoenvironmental conditions characterized by high organic matter flux are supported by negative ? 13C values suggesting a contribution of isotopically light biogenic CO 2 during the carbonate precipitation. As to ? 18O, even if melting glaciers are thought to be responsible for depletion in 18O composition, the isotope record exhibits long- and short-term trends. Analysis of the long-term trend constrains the Pliocene warming climax in an interval between 400-450 mbsf highlighting that most of the event is not documented because of a 800 kyr hiatus. The short-term trend documents the influence of obliquity controlling the annual insolation, but also that of precession-linked cyclicity seldom documented at high latitude.

  1. Hypoinnervation is an early event in experimental myocardial remodelling induced by pressure overload

    PubMed Central

    Mühlfeld, Christian; Schipke, Julia; Schmidt, Albrecht; Post, Heiner; Pieske, Burkert; Sedej, Simon

    2013-01-01

    Structural and functional remodelling of cardiomyocytes, capillaries and cardiac innervation occurs in left ventricular hypertrophy (LVH) and heart failure (HF) in response to pressure-induced overload. However, the onset, time course and the extent of these morphological alterations remain controversial. In the present study, we tested the hypothesis that the progression from hypertrophy to HF is accompanied by changes in the innervation (hyper- or hypoinnervation). Left ventricles of wild-type murine hearts subjected to pressure overload-induced hypertrophy by transverse aortic constriction (TAC) were investigated by morphometric and design-based stereological methods at 1 and 4?weeks after TAC and compared with sham-operated mice. Mice developed compensated LVH at 1 week and typical signs of HF, such as left ventricular dilation, reduced ejection fraction and increased relative lung weight at 4?weeks post-TAC. At the (sub-)cellular level, cardiomyocyte myofibrillar and mitochondrial volume increased progressively in response to mechanical overload. The total length of capillaries was not significantly increased after TAC, indicating a misrelationship between the cardiomyocyte and the capillary compartment. The myocardial innervation decreased already during the development of LVH and did not significantly decrease further during the progression to HF. In conclusion, our study suggests that early loss of myocardial innervation density and increased heterogeneity occur during pressure overload-induced hypertrophy, and that these changes appear to be independent of cardiomyocyte and capillary remodelling. PMID:23565587

  2. FOXO3a loss is a frequent early event in high-grade pelvic serous carcinogenesis

    PubMed Central

    Levanon, Keren; Sapoznik, Stav; Bahar-Shany, Keren; Brand, Hadar; Shapira-Frommer, Ronnie; Korach, Jacob; Hirsch, Michelle S.; Roh, Michael H.; Miron, Alexander; Liu, Joyce F.; Vena, Natalie; Ligon, Azra H.; Fotheringham, Susan; Bailey, Dyane; Flavin, Richard J.; Birrer, Michael J.; Drapkin, Ronny I.

    2014-01-01

    Serous ovarian carcinoma is the most lethal gynecological malignancy in Western countries. The molecular events that underlie the development of the disease have been elusive for many years. The recent identification of the fallopian tube secretory epithelial cells (FTSECs) as the cell-of-origin for most cases of this disease has led to studies aimed at elucidating new candidate therapeutic pathways through profiling of normal FTSECs and serous carcinomas. Here, we describe the results of transcriptional profiles that identify the loss of the tumor suppressive transcription factor FOXO3a in a vast majority of high grade serous ovarian carcinomas (HGSOCs). We show that FOXO3a loss is a hallmark of the earliest stages of serous carcinogenesis and occurs both at the DNA, RNA and protein levels. We describe several mechanisms responsible for FOXO3a inactivity, including chromosomal deletion (chromosome 6q21), upregulation of miRNA-182 and destabilization by activated PI3K and MEK. The identification of pathways involved in the pathogenesis of ovarian cancer can advance the management of this disease from being dependant on surgery and cytotoxic chemotherapy alone to the era of targeted therapy. Our data strongly suggest FOXO3a as a possible target for clinical intervention. PMID:24077281

  3. FOXO3a loss is a frequent early event in high-grade pelvic serous carcinogenesis.

    PubMed

    Levanon, K; Sapoznik, S; Bahar-Shany, K; Brand, H; Shapira-Frommer, R; Korach, J; Hirsch, M S; Roh, M H; Miron, A; Liu, J F; Vena, N; Ligon, A H; Fotheringham, S; Bailey, D; Flavin, R J; Birrer, M J; Drapkin, R I

    2014-08-28

    Serous ovarian carcinoma is the most lethal gynecological malignancy in Western countries. The molecular events that underlie the development of the disease have been elusive for many years. The recent identification of the fallopian tube secretory epithelial cells (FTSECs) as the cell-of-origin for most cases of this disease has led to studies aimed at elucidating new candidate therapeutic pathways through profiling of normal FTSECs and serous carcinomas. Here we describe the results of transcriptional profiles that identify the loss of the tumor suppressive transcription factor FOXO3a in a vast majority of high-grade serous ovarian carcinomas. We show that FOXO3a loss is a hallmark of the earliest stages of serous carcinogenesis and occurs both at the DNA, RNA and protein levels. We describe several mechanisms responsible for FOXO3a inactivity, including chromosomal deletion (chromosome 6q21), upregulation of miRNA-182 and destabilization by activated PI3K and MEK. The identification of pathways involved in the pathogenesis of ovarian cancer can advance the management of this disease from being dependant on surgery and cytotoxic chemotherapy alone to the era of targeted therapy. Our data strongly suggest FOXO3a as a possible target for clinical intervention. PMID:24077281

  4. Timing of the Toarcian Ocean Anoxic Event (Early Jurassic) from correlation of astronomically forced global stratigraphic sections

    NASA Astrophysics Data System (ADS)

    Huang, C.; Hinnov, L. A.; Hesselbo, S. P.

    2012-12-01

    The Early Toarcian Oceanic Anoxic Event (OAE) in the Early Jurassic Period is associated with a major negative carbon isotope excursion (CIE), mass extinction, marine transgression and global warming. The Toarcian OAE is thought to have been caused by flood basalt magmatism, and may have been a trigger for mass extinction. However, these proposed causes of the Toarcian OAE and associated biotic crisis are not adequately resolved by a precise chronology. The duration of the Toarcian OAE has been estimated to be anywhere from ~0.12 to ~0.9 Myr, most recently 0.74 to 3.26 Myr from U-Pb dating. The CIE associated with the Toarcian OAE has a similar pattern at numerous localities, and there is evidence for astronomical forcing of marine carbon isotopes. Here we estimate a duration of ~625 kyr for the main negative CIE, ~860 kyr for the polymorphum zone and >1.58 Myr for the levisoni zone based on 405-kyr astronomical eccentricity tuning of the marine section at Peniche (Portugal). This 405-kyr tuned series provides a ~2.5 Myr continuous high-resolution chronology through the Early Toarcian. There are 6, or possibly 7 short eccentricity cycles in the main CIE interval at Peniche. To confirm this astronomically based estimate, we analyzed five other sections at Yorkshire (UK), Dotternhausen (Germany), Valdorbia (Italy), Mechowo (Poland) and Serrucho, Neuquén (Argentina), from marine and terrestrial carbon isotopic series. These six stratigraphic sections from Early Jurassic western Tethys and eastern Panthalassa record the Toarcian OAE with ~6 prominent carbon isotope cycles in the CIE that provide us a 600 ± 100 kyr duration. The Peniche 405 kyr-tuned series indicates that the pre- and post-CIE intervals experienced strong precession-eccentricity-forced climate change, whereas the CIE interval is marked by dominant obliquity forcing. These dramatic and abrupt changes in astronomical response in the carbon isotopes point to fundamental shifting in the Early Toarcian paleoclimate system that is directly linked to the global carbon cycle.

  5. Differential Network Analyses of Alzheimer’s Disease Identify Early Events in Alzheimer’s Disease Pathology

    DOE PAGESBeta

    Xia, Jing; Rocke, David M.; Perry, George; Ray, Monika

    2014-01-01

    In late-onset Alzheimer’s disease (AD), multiple brain regions are not affected simultaneously. Comparing the gene expression of the affected regions to identify the differences in the biological processes perturbed can lead to greater insight into AD pathogenesis and early characteristics. We identified differentially expressed (DE) genes from single cell microarray data of four AD affected brain regions: entorhinal cortex (EC), hippocampus (HIP), posterior cingulate cortex (PCC), and middle temporal gyrus (MTG). We organized the DE genes in the four brain regions into region-specific gene coexpression networks. Differential neighborhood analyses in the coexpression networks were performed to identify genes with lowmore »topological overlap (TO) of their direct neighbors. The low TO genes were used to characterize the biological differences between two regions. Our analyses show that increased oxidative stress, along with alterations in lipid metabolism in neurons, may be some of the very early events occurring in AD pathology. Cellular defense mechanisms try to intervene but fail, finally resulting in AD pathology as the disease progresses. Furthermore, disease annotation of the low TO genes in two independent protein interaction networks has resulted in association between cancer, diabetes, renal diseases, and cardiovascular diseases.« less

  6. Green tea (-)-epigallocatechin-gallate modulates early events in huntingtin misfolding and reduces toxicity in Huntington's disease models.

    PubMed

    Ehrnhoefer, Dagmar E; Duennwald, Martin; Markovic, Phoebe; Wacker, Jennifer L; Engemann, Sabine; Roark, Margaret; Legleiter, Justin; Marsh, J Lawrence; Thompson, Leslie M; Lindquist, Susan; Muchowski, Paul J; Wanker, Erich E

    2006-09-15

    Huntington's disease (HD) is a progressive neurodegenerative disorder for which only symptomatic treatments of limited effectiveness are available. Preventing early misfolding steps and thereby aggregation of the polyglutamine (polyQ)-containing protein huntingtin (htt) in neurons of patients may represent an attractive therapeutic strategy to postpone the onset and progression of HD. Here, we demonstrate that the green tea polyphenol (-)-epigallocatechin-3-gallate (EGCG) potently inhibits the aggregation of mutant htt exon 1 protein in a dose-dependent manner. Dot-blot assays and atomic force microscopy studies revealed that EGCG modulates misfolding and oligomerization of mutant htt exon 1 protein in vitro, indicating that it interferes with very early events in the aggregation process. Also, EGCG significantly reduced polyQ-mediated htt protein aggregation and cytotoxicity in an yeast model of HD. When EGCG was fed to transgenic HD flies overexpressing a pathogenic htt exon 1 protein, photoreceptor degeneration and motor function improved. These results indicate that modulators of htt exon 1 misfolding and oligomerization like EGCG are likely to reduce polyQ-mediated toxicity in vivo. Our studies may provide the basis for the development of a novel pharmacotherapy for HD and related polyQ disorders. PMID:16893904

  7. Altering second-order configurations reduces the adaptation effects on early face-sensitive event-related potential components.

    PubMed

    Vakli, Pál; Németh, Kornél; Zimmer, Márta; Schweinberger, Stefan R; Kovács, Gyula

    2014-01-01

    The spatial distances among the features of a face are commonly referred to as second-order relations, and the coding of these properties is often regarded as a cornerstone in face recognition. Previous studies have provided mixed results regarding whether the N170, a face-sensitive component of the event-related potential, is sensitive to second-order relations. Here we investigated this issue in a gender discrimination paradigm following long-term (5 s) adaptation to normal or vertically stretched male and female faces, considering that the latter manipulation substantially alters the position of the inner facial features. Gender-ambiguous faces were more likely judged to be female following adaptation to a male face and vice versa. This aftereffect was smaller but statistically significant after being adapted to vertically stretched when compared to unstretched adapters. Event-related potential recordings revealed that adaptation effects measured on the amplitude of the N170 show strong modulations by the second-order relations of the adapter: reduced N170 amplitude was observed, however, this reduction was smaller in magnitude after being adapted to stretched when compared to unstretched faces. These findings suggest early face-processing, as reflected in the N170 component, proceeds by extracting the spatial relations of inner facial features. PMID:24971058

  8. Altering second-order configurations reduces the adaptation effects on early face-sensitive event-related potential components

    PubMed Central

    Vakli, Pál; Németh, Kornél; Zimmer, Márta; Schweinberger, Stefan R.; Kovács, Gyula

    2014-01-01

    The spatial distances among the features of a face are commonly referred to as second-order relations, and the coding of these properties is often regarded as a cornerstone in face recognition. Previous studies have provided mixed results regarding whether the N170, a face-sensitive component of the event-related potential, is sensitive to second-order relations. Here we investigated this issue in a gender discrimination paradigm following long-term (5 s) adaptation to normal or vertically stretched male and female faces, considering that the latter manipulation substantially alters the position of the inner facial features. Gender-ambiguous faces were more likely judged to be female following adaptation to a male face and vice versa. This aftereffect was smaller but statistically significant after being adapted to vertically stretched when compared to unstretched adapters. Event-related potential recordings revealed that adaptation effects measured on the amplitude of the N170 show strong modulations by the second-order relations of the adapter: reduced N170 amplitude was observed, however, this reduction was smaller in magnitude after being adapted to stretched when compared to unstretched faces. These findings suggest early face-processing, as reflected in the N170 component, proceeds by extracting the spatial relations of inner facial features. PMID:24971058

  9. Traumatic and Stressful Events in Early Childhood: Can Treatment Help Those at Highest Risk?

    PubMed Central

    Ippen, Chandra Ghosh; Harris, William W.; Van Horn, Patricia; Lieberman, Alicia F.

    2011-01-01

    Objective This study involves a reanalysis of data from a randomized controlled trial to examine whether child-parent psychotherapy (CPP), an empirically based treatment focusing on the mother-child relationship as the vehicle for child improvement, is efficacious for children who experienced multiple traumatic and stressful life events (TSEs). Methods Participants comprised 75 preschool-aged children and their mothers referred to treatment following the child’s exposure to domestic violence. Dyads were randomly assigned to CPP or to a comparison group that received monthly case management plus referrals to community services and were assessed at intake, posttest, and 6-month follow-up. Treatment effectiveness was examined by level of child TSE risk exposure (<4 risks versus 4+ TSEs). Results For children in the 4+ risk group, those who received CPP showed significantly greater improvements in PTSD and depression symptoms, PTSD diagnosis, number of co-occurring diagnoses, and behavior problems compared to those in the comparison group. CPP children with <4 risks showed greater improvements in symptoms of PTSD than those in the comparison group. Mothers of children with 4+ TSEs in the CPP group showed greater reductions in symptoms of PTSD and depression than those randomized to the comparison condition. Analyses of 6-month follow-up data suggest improvements were maintained for the high risk group. Conclusions The data provide evidence that CPP is effective in improving outcomes for children who experienced four or more TSEs and had positive effects for their mothers as well. Practice Implications Numerous studies show that exposure to childhood trauma and adversity has negative consequences for later physical and mental health, but few interventions have been specifically evaluated to determine their effectiveness for children who experienced multiple TSEs. The findings suggest that including the mother as an integral participant in the child’s treatment may be particularly effective in the treatment of young children exposed to multiple risks. PMID:21816474

  10. N-sulfation of heparan sulfate regulates early branching events in the developing mammary gland.

    PubMed

    Bush, Kevin T; Crawford, Brett E; Garner, Omai B; Nigam, Kabir B; Esko, Jeffrey D; Nigam, Sanjay K

    2012-12-01

    Branching morphogenesis, a fundamental process in the development of epithelial organs (e.g. breast, kidney, lung, salivary gland, prostate, pancreas), is in part dependent on sulfation of heparan sulfate proteoglycans. Proper sulfation is mediated by biosynthetic enzymes, including exostosin-2 (Ext2), N-deacetylase/N-sulfotransferases and heparan sulfate O-sulfotransferases. Recent conditional knockouts indicate that whereas primary branching is dependent on heparan sulfate, other stages are dependent upon selective addition of N-sulfate and/or 2-O sulfation (Crawford, B .E., Garner, O. B., Bishop, J. R., Zhang, D. Y., Bush, K. T., Nigam, S. K., and Esko, J. D. (2010) PLoS One 5, e10691; Garner, O .B., Bush, K. T., Nigam, S .K., Yamaguchi, Y., Xu, D., Esko, J. D., and Nigam, S. K. (2011) Dev. Biol. 355, 394-403). Here, we analyzed the effect of deleting both Ndst2 and Ndst1. Whereas deletion of Ndst1 has no major effect on primary or secondary branching, deletion of Ndst2 appears to result in a mild increase in branching. When both genes were deleted, ductal growth was variably diminished (likely due to variable Cre-recombinase activity), but an overabundance of branched structures was evident irrespective of the extent of gland growth or postnatal age. "Hyperbranching" is an unusual phenotype. The effects on N-sulfation and growth factor binding were confirmed biochemically. The results indicate that N-sulfation or a factor requiring N-sulfation regulates primary and secondary branching events in the developing mammary gland. Together with previous work, the data indicate that different stages of ductal branching and lobuloalveolar formation are regulated by distinct sets of heparan sulfate biosynthetic enzymes in an appropriate growth factor context. PMID:23060443

  11. Perturbation of bile acid homeostasis is an early pathogenesis event of drug induced liver injury in rats

    SciTech Connect

    Yamazaki, Makoto; Miyake, Manami; Sato, Hiroko; Masutomi, Naoya; Tsutsui, Naohisa [Mitsubishi Tanabe Pharma Corporation, Kisarazu, Chiba 292-0818 (Japan); Adam, Klaus-Peter; Alexander, Danny C.; Lawton, Kay A.; Milburn, Michael V.; Ryals, John A.; Wulff, Jacob E. [Metabolon Inc., 617 Davis Drive, Suite 400, Durham, NC 27713 (United States); Guo, Lining, E-mail: lguo@metabolon.com [Metabolon Inc., 617 Davis Drive, Suite 400, Durham, NC 27713 (United States)

    2013-04-01

    Drug-induced liver injury (DILI) is a significant consideration for drug development. Current preclinical DILI assessment relying on histopathology and clinical chemistry has limitations in sensitivity and discordance with human. To gain insights on DILI pathogenesis and identify potential biomarkers for improved DILI detection, we performed untargeted metabolomic analyses on rats treated with thirteen known hepatotoxins causing various types of DILI: necrosis (acetaminophen, bendazac, cyclosporine A, carbon tetrachloride, ethionine), cholestasis (methapyrilene and naphthylisothiocyanate), steatosis (tetracycline and ticlopidine), and idiosyncratic (carbamazepine, chlorzoxasone, flutamide, and nimesulide) at two doses and two time points. Statistical analysis and pathway mapping of the nearly 1900 metabolites profiled in the plasma, urine, and liver revealed diverse time and dose dependent metabolic cascades leading to DILI by the hepatotoxins. The most consistent change induced by the hepatotoxins, detectable even at the early time point/low dose, was the significant elevations of a panel of bile acids in the plasma and urine, suggesting that DILI impaired hepatic bile acid uptake from the circulation. Furthermore, bile acid amidation in the hepatocytes was altered depending on the severity of the hepatotoxin-induced oxidative stress. The alteration of the bile acids was most evident by the necrosis and cholestasis hepatotoxins, with more subtle effects by the steatosis and idiosyncratic hepatotoxins. Taking together, our data suggest that the perturbation of bile acid homeostasis is an early event of DILI. Upon further validation, selected bile acids in the circulation could be potentially used as sensitive and early DILI preclinical biomarkers. - Highlights: ? We used metabolomics to gain insights on drug induced liver injury (DILI) in rats. ? We profiled rats treated with thirteen hepatotoxins at two doses and two time points. ? The toxins decreased the liver's ability to uptake bile acid from the circulation. ? Oxidative stress induced by the toxins altered bile acid biosynthesis in the liver. ? Selected bile acids in the plasma and urine could be sensitive DILI biomarkers.

  12. It's early: event-related potential evidence for initial interaction of syntax and prosody in speech comprehension.

    PubMed

    Eckstein, Korinna; Friederici, Angela D

    2006-10-01

    Psycholinguistic theories assume an interaction between prosody and syntax during language processing. Based on studies using mostly off-line methods, it is unclear whether an interaction occurs at later or initial processing stages. Using event-related potentials, the present study provides neurophysiological evidence for a prosody and syntax interaction in initial processing. The sentence material contained mere prosodic and syntactic as well as combined prosodic-syntactic violations. For the syntax violation, the critical word appeared after a preposition. The suffix of the critical word either indicated a noun fulfilling the syntactic requirements of the preceding preposition or a verb causing a word category violation. For the prosodic manipulation, congruent critical words were normally intonated (signaling sentence continuation) while prosodically incongruent critical words signaled sentence end. For the mere prosodic incongruity, a broadly distributed negativity was observed at the critical word-stem (300-500 msec aligned to word onset). In response to a mere syntactic error, a left temporal negativity was elicited in an early time window (200-400 msec aligned to suffix onset), taken to reflect initial phrase structure building processes. In contrast, in response to the combined prosodic-syntactic violation, an early temporal negativity showed up bilaterally at the suffix in the same time window. Our interpretation is that the process of initial structure building as reflected in the early left anterior negativity recruits additional right hemispheric neural resources when the critical word contains both syntactic and prosodic violations. This suggests the immediate influence of phrasal prosody during the initial parsing stage in speech processing. PMID:17014374

  13. Early impact event and fluid activity on H chondrite parent body registered in the Pu?tusk meteorite

    NASA Astrophysics Data System (ADS)

    Krzesinska, Agata

    2015-04-01

    Impact is one of the most important processes affecting asteroids, but it is neglected as a source for heat of these bodies. Recent modeling work show, however, that impact into warm planetesimals is able to cause global-scale temperature increase to the point of melting of silicates [1]. An obvious consequence of this fact is that the impact activity in early evolution of asteroids may promote formation of melt and its differentiation. H chondrites provide some lines of evidence for an early, 4.4 Ga impact event on their parent body. The event resulted in formation of heavily shocked and melted H chondrites with old gas retention ages [2, 3], including Portales Valley, an unique metal-rich breccia [e.g. 4]. The impact led also, very likely, to unmixing of silicate and metal-sulfide melts and to formation of silicate-iron non-magmatic IIE meteorites [5]. Additional evidence for this event, and for melting it caused, may come from highly equilibrated and recrystallized fragments of the Pu?tusk meteorite containing vein-like metal accumulations [6]. In the Pu?tusk, vein-like metal accumulations are kamacite-rich, and basically depleted in sulfides. They form many tendrils into the equilibrated, well recrystallized chondritic rock. Marked feature of the chondritic rock at the contact with accumulations is presence of unusually large phosphate and feldspar grains. The minerals bear record of crystallization from melt. Both vein-like metal accumulations and chondritic rock record, however, slow cooling rate. Phopshates are in the meteorite represented by merrillite and apatite, predominantly intergrown with each other. Merrillite poikilitically encloses silicate grains. It is probably of magmatic origin, since it contains detectable amount of potassium and high content of sodium. Apatite contains varying concentrations of chlorine, fluorine and missing structural component. Content of Cl and F are negatively correlated and both elements are heterogeneously distributed in the mineral, forming complex, patchy compositional zoning. Formation of vein-like metal accumulations in the Pu?tusk requires impact activity, since under static conditions metal would have formed isolated patches or globules, rather than veins. The impact event must have affected warm parent body in its early evolution, what resulted in slow cooling. Association of phosphate minerals with metal accumulations suggests that they were also formed in response to impact activity. The most likely source of phosphorous to form merrillite was oxidation of P from metal alloys. Merrillite was magmatic rather than metamorphic in origin, whereas apatite overgrowing it was probably formed by interaction between merrillite and a halogen-rich residual fluid or vapor derived from an impact melt. References: [1] Ciesla F.J. et al., 2013. MaPS 48: 2559-2576. [2] Swindle T.D. et al., 2009. MaPS 44: 747-762. [3] Wittmann A. et al., 2010. JGR 115: E07009. [4] Ruzicka A. et al., 2005. MaPS 40: 261-295. [5] Ruzicka A., 2014. Chem der Erde 74: 3-48. [6] Krzesi?ska A., 2011. Meteorites 1: 3-12.

  14. Quantifying the differential effects of DHA and DPA on the early events in visual signal transduction.

    PubMed

    Mitchell, Drake C; Niu, Shui-Lin; Litman, Burton J

    2012-05-01

    A range of evidence from animal, clinical and epidemiological studies indicates that highly polyunsaturated acyl chains play important roles in development, cognition, vision and other aspects of neurological function. In a number of these studies n3 polyunsaturated fatty acids (PUFAs) appear to be more efficacious than n6 PUFAs. In a previous study of retinal rod outer segments obtained from rats raised on either an n3 adequate or deficient diet, we demonstrated that the replacement of 22:6n3 by 22:5n6 in the n3 deficient rats led to functional deficits in each step in the visual signaling process (Niu et al., 2004). In this study, we examined rhodopsin and phosphodiesterase function and acyl chain packing properties in membranes consisting of phosphatidylcholines with sn-1=18:0, and sn-2=22:6n3, 22:5n6, or 22:5n3 in order to determine if differences in function are due to the loss of one double bond or due to differences in double bond location. At 37 °C the n6 lipid shifted the equilibrium between the active metarhodopsin II (MII) state and inactive metarhodopsin I (MI) state towards MI. In addition, 22:5n6 reduced the rates of MII formation and MII-transducin complex formation by 2- and 6-fold, respectively. At a physiologically relevant level of rhodopsin light stimulation, the activity of phosphodiesterase was reduced by 50% in the 22:5n6 membrane, relative to either of the n3 membranes. Activity levels in the two n3 membranes were essentially identical. Ensemble acyl chain order was assessed with time-resolved fluorescence measurements of the membrane probe diphenylhexatriene (DPH). Analysis in terms of the orientational distribution of DPH showed that acyl chain packing in the two n3 membranes is quite similar, while in the 22:5n6 membrane there was considerably less packing disorder in the bilayer midplane. These results demonstrate that the n3 bond configuration uniquely optimizes the early steps in signaling via a mechanism which may involve acyl chain packing deep in the bilayer. PMID:22405878

  15. Defects of mitochondrial DNA replication.

    PubMed

    Copeland, William C

    2014-09-01

    Mitochondrial DNA is replicated by DNA polymerase ? in concert with accessory proteins such as the mitochondrial DNA helicase, single-stranded DNA binding protein, topoisomerase, and initiating factors. Defects in mitochondrial DNA replication or nucleotide metabolism can cause mitochondrial genetic diseases due to mitochondrial DNA deletions, point mutations, or depletion, which ultimately cause loss of oxidative phosphorylation. These genetic diseases include mitochondrial DNA depletion syndromes such as Alpers or early infantile hepatocerebral syndromes, and mitochondrial DNA deletion disorders, such as progressive external ophthalmoplegia, ataxia-neuropathy, or mitochondrial neurogastrointestinal encephalomyopathy. This review focuses on our current knowledge of genetic defects of mitochondrial DNA replication (POLG, POLG2, C10orf2, and MGME1) that cause instability of mitochondrial DNA and mitochondrial disease. PMID:24985751

  16. Early events in the life of apple roots: variation in root growth rate is linked to mycorrhizal and nonmycorrhizal fungal colonization

    Microsoft Academic Search

    Maryann L. Resendes; David R. Bryla; David M. Eissenstat

    2008-01-01

    Early events of mycorrhizal and nonmycorrhizal fungal colonization in newly-emerging roots of mature apple (Malus domestica Borkh) trees were characterized to determine the relationship of these events to fine root growth rate and development. New\\u000a roots were traced on root windows to measure growth and then collected and stained to quantify microscopically the presence\\u000a of mycorrhizal and nonmycorrhizal fungal structures.

  17. Induction of DNA Damage Signaling by Oxidative Stress in Relation to DNA Replication as Detected Using “Click Chemistry”

    PubMed Central

    Zhao, Hong; Dobrucki, Jurek; Rybak, Paulina; Traganos, Frank; Halicka, H. Dorota; Darzynkiewicz, Zbigniew

    2011-01-01

    Induction of DNA damage by oxidants such as H2O2 activates the complex network of DNA damage response (DDR) pathways present in cells to initiate DNA repair, halt cell cycle progression, and prepare an apoptotic reaction. We have previously reported that activation of Ataxia Telangiectasia Mutated protein kinase (ATM) and induction of ?H2AX are among the early events of the DDR induced by exposure of cells to H2O2, and in human pulmonary carcinoma A549 cells, both events were expressed predominantly during S-phase. This study was designed to further explore a correlation between these events and DNA replication. Toward this end, we utilized 5-ethynyl-2?deoxyuridine (EdU) and the “click chemistry” approach to label DNA during replication, followed by exposure of A549 cells to H2O2. Multiparameter laser scanning cytometric analysis of these cells made it possible to identify DNA replicating cells and directly correlate H2O2-induced ATM activation and induction of ?H2AX with DNA replication on a cell by cell basis. After pulse-labeling with EdU and exposure to H2O2, confocal microscopy was also used to examine the localization of DNA replication sites (“replication factories”) versus the H2AX phosphorylation sites (?H2AX foci) in nuclear chromatin in an attempt to observe the absence or presence of colocalization. The data indicate a close association between DNA replication and H2AX phosphorylation in A549 cells, suggesting that these DNA damage response events may be triggered by stalled replication forks and perhaps also by induction of DNA double-strand breaks at the primary DNA lesions induced by H2O2 PMID:21905210

  18. Replication of kinetoplast minicircle DNA

    SciTech Connect

    Sheline, C.T.

    1989-01-01

    These studies describe the isolation and characterization of early minicircle replication intermediates from Crithidia fasciculata, and Leishmania tarentolae, the mitochondrial localization of a type II topoisomerase (TIImt) in C. fasciculata, and the implication of the aforementioned TIImt in minicircle replication in L. tarentolae. Early minicircle replication intermediates from C. fasciculata were identified and characterized using isolated kinetoplasts to incorporate radiolabeled nucleotides into its DNA. The pulse-label in an apparent theta-type intermediate chase into two daughter molecules. A uniquely gapped, ribonucleotide primed, knotted molecule represents the leading strand in the model proposed, and a highly gapped molecule represents the lagging strand. This theta intermediate is repaired in vitro to a doubly nicked catenated dimer which was shown to result from the replication of a single parental molecule. Very similar intermediates were found in the heterogeneous population of minicircles of L. tarentolae. The sites of the Leishmania specific discontinuities were mapped and shown to lie within the universally conserved sequence blocks in identical positions as compared to C. fasciculata and Trypanosoma equiperdum.

  19. Prognostic Value of Tissue Doppler-derived E/e? on Early Morbid Events after Cardiac Surgery

    PubMed Central

    Groban, Leanne; Sanders, David M.; Houle, Timothy T.; Antonio, Benjamin L.; Ntuen, Edi C.; Zvara, David A.; Kon, Neal D.; Kincaid, Edward H.

    2015-01-01

    Background The tissue Doppler-derived surrogate for left ventricular diastolic pressure, E/e?, has been used to prognosticate outcome in a variety of cardiovascular conditions. In this study we determined the relationship of intraoperative E/e? to the use of inotropic support, duration of mechanical ventilation (MV), length of intensive care unit stay (ICU-LOS) and total hospital stay (H-LOS) in patients requiring cardiac surgery. The records of 245 consecutive patients were retrospectively reviewed to obtain 205 patients who had intraoperative transesophageal echocardiography (TEE) examinations prior to coronary artery bypass grafting (CABG) and/or valvular surgery. Cox proportional hazards and logistic regression models were used to analyze the relation between intraoperative E/e? or LVEF and early postoperative morbidity (H-LOS, ICU-LOS, and MV) and the probability that a patient would require inotropic support. With adjustments for other predictors (female gender, hypertension, diabetes, history of myocardial infarction, emergency surgery, renal failure, procedure type, length of aortic cross-clamp time), an elevated E/e? ratio (? 8) was significantly associated with an increased ICU-LOS (49 versus 41 median h, P = 0.037) and need for inotropic support (P = 0.002) while baseline LVEF associated with inotropic support alone (P < 0.0001). These data suggest that the tissue Doppler derived-index of left ventricular diastolic filling pressure may be a useful indicator for predicting early morbid events after cardiac surgery, and may even provide additional information from that of baseline LVEF. Further, patients with elevated preoperative E/e? may need more careful peri- and postoperative management than those patients with E/e? <8. PMID:20380676

  20. Postweaning Exposure to Dietary Zearalenone, a Mycotoxin, Promotes Premature Onset of Puberty and Disrupts Early Pregnancy Events in Female Mice

    PubMed Central

    Ye, Xiaoqin

    2013-01-01

    Zearalenone (ZEA) is a mycotoxin commonly found in contaminated livestock feed and human food with levels in the range of ppb and low ppm. It was hypothesized that ZEA, an endocrine disruptor, could affect puberty and early pregnancy. To test this hypothesis, newly weaned (3 weeks old) C57BL/6J female mice were exposed to 0, 0.002, 4, 10, and 40 ppm ZEA and 0.05 ppm diethylstilbestrol (positive control) in phytoestrogen-free AIN-93G diet. Females exposed to 10 and 40 ppm ZEA diets showed earlier onset of vaginal opening. Those treated with 40 ppm ZEA diet also had earlier first copulation plug and irregular estrous cyclicity. At 8 weeks old, all females were mated with untreated stud males on AIN-93G diet during mating. Treatment resumed upon identification of a vaginal plug on gestation day 0.5 (D0.5). Embryo implantation was assessed on D4.5. Exposure to 40 ppm ZEA diet resulted in reduced percentage of plugged mice with implantation sites, distended uterine appearance, and retained expression of progesterone receptor in D4.5 uterine epithelium. To determine the exposure timing and mechanisms of disrupted embryo implantation, four groups of females were fed with 0 or 40 ppm ZEA diets during premating (weaning to mating) and postmating (D0.5–D4.5), respectively. Premating exposure to 40 ppm ZEA diet reduced fertilization rate, whereas postmating exposure to 40 ppm ZEA diet delayed embryo transport and preimplantation embryo development, which subsequently affected embryo implantation. These data demonstrate that postweaning exposure to dietary ZEA can promote premature onset of puberty and disrupt early pregnancy events. PMID:23291560

  1. Event-related synchronization of alpha activity in early Alzheimer's disease and mild cognitive impairment: An MEG study combining beamformer and group comparison

    Microsoft Academic Search

    Ryu Kurimoto; Ryouhei Ishii; Leonides Canuet; Koji Ikezawa; Michiyo Azechi; Masao Iwase; Tetsuhiko Yoshida; Hiromitsu Kazui; Toshiki Yoshimine; Masatoshi Takeda

    2008-01-01

    In patients with Alzheimer's disease (AD), it is sometimes challenging to identify typical findings in electroencephalography (EEG) or magnetoencephalography (MEG) such as a slowing of the posterior dominant activity or an increase in slow activity. In this MEG study, we evaluated the event-related synchronization (ERS) of alpha activity after eye closing in patients with early AD and mild cognitive impairment

  2. Effects of Early High-Dose Levothyroxine Treatment on Auditory Brain Event-Related Potentials at School Entry in Children with Congenital Hypothyroidism

    Microsoft Academic Search

    S. Marti; M. Alvarez; J. Simoneau-Roy; S. Leroux; G. Van Vliet; P. Robaey

    2006-01-01

    Aims: We tested whether brain event-related potentials (ERPs) are normal in children with congenital hypothyroidism (CH) after early high-dose levothyroxine treatment. Methods: Auditory ERPs were recorded in 33 normal controls and in 15 children with CH at 5 years 9\\/12. Based on bone maturation at diagnosis, the CH group was divided into severe (n = 8) and moderate (n =

  3. Genetic and Functional Analysis of DD44, a Sex-Linked Gene From the Dioecious Plant Silene latifolia, Provides Clues to Early Events in Sex Chromosome Evolution

    Microsoft Academic Search

    Richard C. Moore; Olga Kozyreva; Sabine Lebel-Hardenack; Jiri Siroky; Roman Hobza; Boris Vyskot; Sarah R. Grant

    Silene latifolia is a dioecious plant with heteromorphic sex chromosomes. The sex chromosomes of S. latifolia provide an opportunity to study the early events in sex chromosome evolution because of their relatively recent emergence. In this article, we present the genetic and physical mapping, expression analysis, and molecular evolutionary analysis of a sex-linked gene from S. latifolia, DD44 (Differential Display

  4. Early Events in the Life of Apple Roots: Variation in Root Growth Rate is Linked to Mycorrhizal and Nonmycorrhizal Fungal Colonization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A study was conducted to characterize early events of mycorrhizal and nonmycorrhizal fungal colonization in newly-emerging roots of mature apple (Malus domestica) trees and to determine the relationship to fine root growth rate and development. New roots were traced on root windows to measure growt...

  5. Cognitive and behavioral development of at risk infants and toddlers exposed to stressful life events: The effects of trauma in early childhood

    Microsoft Academic Search

    Zachary E. Warren

    2005-01-01

    The present study examined the relations between traumatic life events and cognitive, behavioral, and relational competence in an at-risk sample of children between the ages of 11 and 41 months. As part of a larger, ongoing investigation, participants for the current study were 53 children enrolled in Early Head Start programs and their primary caregivers. The children participated in a

  6. The response of marine phytoplankton and sedimentary organic matter to the early Toarcian (Lower Jurassic) oceanic anoxic event in northern England

    Microsoft Academic Search

    Raffaella Bucefalo Palliani; Emanuela Mattioli; James B. Riding

    2002-01-01

    Early Toarcian organic-rich sediments, reflecting the Lower Jurassic oceanic anoxic event, were investigated in the Brown Moor Borehole, North Yorkshire (northern England). Integrated micropalaeontological (calcareous nannofossils and dinoflagellate cysts) and geochemical (rock-eval pyrolysis) analyses reveal a sequence of changes mainly driven by palaeoecological shifts. These changes mainly involve the composition, source and preservation rate of sedimentary organic matter as well

  7. High-Resolution Replication Profiles Define the Stochastic Nature of Genome Replication Initiation and Termination

    PubMed Central

    Hawkins, Michelle; Retkute, Renata; Müller, Carolin A.; Saner, Nazan; Tanaka, Tomoyuki U.; de Moura, Alessandro P.S.; Nieduszynski, Conrad A.

    2013-01-01

    Summary Eukaryotic genome replication is stochastic, and each cell uses a different cohort of replication origins. We demonstrate that interpreting high-resolution Saccharomyces cerevisiae genome replication data with a mathematical model allows quantification of the stochastic nature of genome replication, including the efficiency of each origin and the distribution of termination events. Single-cell measurements support the inferred values for stochastic origin activation time. A strain, in which three origins were inactivated, confirmed that the distribution of termination events is primarily dictated by the stochastic activation time of origins. Cell-to-cell variability in origin activity ensures that termination events are widely distributed across virtually the whole genome. We propose that the heterogeneity in origin usage contributes to genome stability by limiting potentially deleterious events from accumulating at particular loci. PMID:24210825

  8. Subsurface North Atlantic warming as a trigger of rapid cooling events: evidence from the early Pleistocene (MIS 31-19)

    NASA Astrophysics Data System (ADS)

    Hernández-Almeida, I.; Sierro, F.-J.; Cacho, I.; Flores, J.-A.

    2015-04-01

    Subsurface water column dynamics in the subpolar North Atlantic were reconstructed in order to improve the understanding of the cause of abrupt ice-rafted detritus (IRD) events during cold periods of the early Pleistocene. We used paired Mg / Ca and ?18O measurements of Neogloboquadrina pachyderma (sinistral - sin.), deep-dwelling planktonic foraminifera, to estimate the subsurface temperatures and seawater ?18O from a sediment core from Gardar Drift, in the subpolar North Atlantic. Carbon isotopes of benthic and planktonic foraminifera from the same site provide information about the ventilation and water column nutrient gradient. Mg / Ca-based temperatures and seawater ?18O suggest increased subsurface temperatures and salinities during ice-rafting, likely due to northward subsurface transport of subtropical waters during periods of weaker Atlantic Meridional Overturning Circulation (AMOC). Planktonic carbon isotopes support this suggestion, showing coincident increased subsurface ventilation during deposition of IRD. Subsurface accumulation of warm waters would have resulted in basal warming and break-up of ice-shelves, leading to massive iceberg discharges in the North Atlantic. The release of heat stored at the subsurface to the atmosphere would have helped to restart the AMOC. This mechanism is in agreement with modelling and proxy studies that observe a subsurface warming in the North Atlantic in response to AMOC slowdown during Marine Isotope Stage (MIS) 3.

  9. A computational model for early events in B cell antigen receptor signaling: analysis of the roles of Lyn and Fyn

    PubMed Central

    Barua, Dipak; Hlavacek, William S.; Lipniacki, Tomasz

    2012-01-01

    B cell antigen receptor (BCR) signaling regulates the activities and fates of B cells. BCR signaling encompasses two feedback loops emanating from Lyn and Fyn, which are Src-family protein tyrosine kinases (SFKs). Positive feedback arises from SFK-mediated trans phosphorylation of BCR and receptor-bound Lyn and Fyn, which increases the kinase activities of Lyn and Fyn. Negative feedback arises from SFK-mediated cis phosphorylation of the transmembrane adapter protein PAG1, which recruits the cytosolic protein tyrosine kinase Csk to the plasma membrane, where it acts to decrease the kinase activities of Lyn and Fyn. To study the effects of the positive and negative feedback loops on the dynamical stability of BCR signaling and the relative contributions of Lyn and Fyn to BCR signaling, we consider here a rule-based model for early events in BCR signaling that encompasses membrane-proximal interactions of six proteins: BCR, Lyn, Fyn, Csk, PAG1 and Syk, a cytosolic protein tyrosine kinase that is activated as a result of SFK-mediated phosphorylation of BCR. The model is consistent with known effects of Lyn and Fyn deletions. We find that BCR signaling can generate a single pulse or oscillations of Syk activation depending on the strength of antigen signal and the relative levels of Lyn and Fyn. We also show that bistability can arise in Lyn or Csk deficient cells. PMID:22711887

  10. MGMT promoter hypermethylation is a frequent, early, and consistent event in astrocytoma progression, and not correlated with TP53 mutation.

    PubMed

    Groenendijk, Floris H; Taal, Walter; Dubbink, Hendrikus J; Haarloo, Cathleen R; Kouwenhoven, Mathilde C; van den Bent, Martin J; Kros, Johan M; Dinjens, Winand N M

    2011-02-01

    Hypermethylation of the MGMT gene promoter and mutation of the TP53 tumor-suppressor gene are frequently present in diffuse astrocytomas. However, there is only anecdotal information about MGMT methylation status and TP53 mutations during progression of low-grade diffuse astrocytoma (AII) to anaplastic astrocytoma (AIII) and secondary glioblastoma (sGB). In this study biopsy specimens from 51 patients with astrocytic tumors with radiologically proved progression from low to high-grade malignancy were investigated for the presence and consistency of MGMT promoter hypermethylation and TP53 mutations. For 27 patients biopsy samples both of primary tumors and their recurrences were available. For the other 24 patients histology of either the low-grade lesion or the high-grade recurrence was available. It was found that MGMT promoter hypermethylation and TP53 mutations are both frequent and early events in the progression of astrocytomas and that their status is consistent over time. No correlation was found between MGMT methylation status and the presence of TP53 mutations. In addition, no correlation was found between MGMT promoter hypermethylation and the type of TP53 mutations. These results argue against the putative TP53 G:C>A:T transition mutations suggested to occur preferentially in MGMT hypermethylated tumors. PMID:20593220

  11. MGMT promoter hypermethylation is a frequent, early, and consistent event in astrocytoma progression, and not correlated with TP53 mutation

    PubMed Central

    Groenendijk, Floris H.; Taal, Walter; Dubbink, Hendrikus J.; Haarloo, Cathleen R.; Kouwenhoven, Mathilde C.; van den Bent, Martin J.; Kros, Johan M.

    2010-01-01

    Hypermethylation of the MGMT gene promoter and mutation of the TP53 tumor-suppressor gene are frequently present in diffuse astrocytomas. However, there is only anecdotal information about MGMT methylation status and TP53 mutations during progression of low-grade diffuse astrocytoma (AII) to anaplastic astrocytoma (AIII) and secondary glioblastoma (sGB). In this study biopsy specimens from 51 patients with astrocytic tumors with radiologically proved progression from low to high-grade malignancy were investigated for the presence and consistency of MGMT promoter hypermethylation and TP53 mutations. For 27 patients biopsy samples both of primary tumors and their recurrences were available. For the other 24 patients histology of either the low-grade lesion or the high-grade recurrence was available. It was found that MGMT promoter hypermethylation and TP53 mutations are both frequent and early events in the progression of astrocytomas and that their status is consistent over time. No correlation was found between MGMT methylation status and the presence of TP53 mutations. In addition, no correlation was found between MGMT promoter hypermethylation and the type of TP53 mutations. These results argue against the putative TP53 G:C>A:T transition mutations suggested to occur preferentially in MGMT hypermethylated tumors. PMID:20593220

  12. Early life events carry over to influence pre-migratory condition in a free-living songbird.

    PubMed

    Mitchell, Greg W; Guglielmo, Christopher G; Wheelwright, Nathaniel T; Freeman-Gallant, Corey R; Norris, D Ryan

    2011-01-01

    Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1(st) year survival and nestling mass in migratory Savannah sparrows (Passerculus sandwichensis). We also use a brood manipulation experiment to show that nestlings from smaller broods have higher mass in the nest relative to individuals from larger broods. Having established these relationships, we then use three years of field data involving multiple captures of individuals throughout the pre-migratory period and a multi-level path model to examine the hypothesis that conditions during development limit survival during migration by affecting an individual's ability to accumulate sufficient lean tissue and fat mass prior to migration. We found a positive relationship between fat mass during the pre-migratory period (Sept-Oct) and nestling mass and a negative indirect relationship between pre-migratory fat mass and fledging date. Our results provide the first evidence that conditions during development limit survival during migration through their effect on fat stores. These results are particularly important given recent evidence showing that body condition of songbirds at fledging is affected by climate change and anthropogenic changes to landscape structure. PMID:22194925

  13. Event-related potentials suggest early interaction between syntax and semantics during on-line sentence comprehension.

    PubMed

    Palolahti, Maria; Leino, Sakari; Jokela, Markus; Kopra, Kreetta; Paavilainen, Petri

    2005-08-26

    Event-related potentials (ERPs) were used to investigate interaction between syntactic parsing and semantic integration processes during a visual sentence comprehension task. The linguistic stimuli were Finnish five-word sentences containing morphosyntactic and/or semantic violations. Single morphosyntactic violations evoked left anterior negativity (LAN) and P600 components. Single semantic violations elicited a robust N400 effect over the left hemisphere. A later and weaker N400-like response was also observed in the right hemisphere, left-right hemispheric latency difference being 40 ms. Combined morphosyntactic and semantic violations elicited a P600 component and a negative ERP component within the latency range of the LAN and N400 components. Further analysis of these ERP effects provided evidence for early processual interaction between syntax and semantics during on-line sentence comprehension. The hemispheric distribution of the LAN and N400 components was taken to suggest lateralization of initial morphosyntactic parsing and semantic integration processes to the left hemisphere. In contrast, the later syntax-related P600 component was observed as being more pronounced over the posterior areas of the right hemisphere. PMID:15894426

  14. HARP: A Hierarchical Asynchronous Replication Protocol for Massively Replicated Systems

    E-print Network

    Haddadi, Hamed

    HARP: A Hierarchical Asynchronous Replication Protocol for Massively Replicated Systems Noha Adly a Hierarchical Asynchronous Replication Protocol (HARP) that scales well for thousands of replicas while ensuring

  15. Prenatal and Early Life Exposure to Stressful Life Events and Risk of Autism Spectrum Disorders: Population-Based Studies in Sweden and England

    PubMed Central

    Rai, Dheeraj; Golding, Jean; Magnusson, Cecilia; Steer, Colin; Lewis, Glyn; Dalman, Christina

    2012-01-01

    Background and Aim Exposure to stressful life events during pregnancy has been suggested as a potential risk factor for offspring Autism Spectrum Disorders (ASD), but the literature is limited and inconsistent. We tested the hypothesis that maternal exposure to stressful life events would be associated with increased risks of offspring ASD, and that these risks would be highest for exposures during the prenatal period. Methods and Results We used prospectively collected data from two large population based studies in Sweden and England. In the Swedish study of 4429 ASD cases and 43277 controls, our exposure comprised the occurrence of any severe life event before and during pregnancy and the child's early life. In the English study (maximum n?=?11554, ASD n?=?72), we studied the risk of offspring ASD in relation to a combined maternal exposure to multiple (up to 42) common and rare life events, as well as their perceived impact upon the mother during pregnancy and early life. In crude and adjusted regression analyses in both studies, we found no evidence of an association between prenatal life events, or their number and perceived impact and the risk of offspring ASD. Sub-group analysis of ASD with and without intellectual disability in the Swedish study yielded similar results. Conclusion We found no evidence to support the hypotheses that exposure to stressful life events during the prenatal period is associated with an increased risk of offspring ASD. PMID:22719977

  16. The Neuronal Replicator Hypothesis

    Microsoft Academic Search

    Chrisantha Fernando; Richard Goldstein; Eörs Szathmáry

    2010-01-01

    We propose that replication (with mutation) of patterns of neuronal activity can occur within the brain using known neurophysiological processes. Thereby evolutionary algorithms implemented by neuro- nal circuits can play a role in cognition. Replication of structured neuronal representations is assumed in several cognitive architectures. Replicators overcome some limitations of selectionist models of neuronal search. Hebbian learning is combined with

  17. Single-Cell and Single-Cycle Analysis of HIV-1 Replication

    PubMed Central

    Holmes, Mowgli; Zhang, Fengwen; Bieniasz, Paul D.

    2015-01-01

    The dynamics of the late stages of the HIV-1 life cycle are poorly documented. Viral replication dynamics are typically measured in populations of infected cells, but asynchrony that is introduced during the early steps of HIV-1 replication complicates the measurement of the progression of subsequent steps and can mask replication dynamics and their variation in individual infected cells. We established microscopy-based methods to dynamically measure HIV-1-encoded reporter gene and antiviral gene expression in individual infected cells. We coupled these measurements with conventional analyses to quantify delays in the HIV-1 replication cycle imposed by the biphasic nature of HIV-1 gene expression and by the assembly-inhibiting property of the matrix domain of Gag. We further related the dynamics of restriction factor (APOBEC3G) removal to the dynamics of HIV-1 replication in individual cells. These studies provide a timeline for key events in the HIV-1 replication cycle, and reveal that the interval between the onset of early and late HIV-1 gene expression is only ~3h, but matrix causes a ~6–12h delay in the generation of extracellular virions. Interestingly, matrix delays particle assembly to a time at which APOBEC3G has largely been removed from the cell. Thus, a need to prepare infected cells to be efficient producers of infectious HIV-1 may provide an impetus for programmed delays in HIV-1 virion genesis. Our findings also emphasize the significant heterogeneity in the length of the HIV-1 replication cycle in homogenous cell populations and suggest that a typical infected cell generates new virions for only a few hours at the end of a 48h lifespan. Therefore, small changes in the lifespan of infected cells might have a large effect on viral yield in a single cycle and the overall clinical course in infected individuals. PMID:26086614

  18. Replication timing, chromosomal bands, and isochores

    Microsoft Academic Search

    Maria Costantini; Giorgio Bernardi

    2008-01-01

    Chromosome replication timing is biphasic (early-late) in the cell cycle of vertebrates and of most (possibly all) eukaryotes. In the present work we have compared the extended, detailed replication timing maps that are available, namely those of human chromosomes 6, 11q, and 21q, with chromosomal bands as visualized at low (400 bands), high (850 bands), and highest (3,200 isochores) resolution.

  19. Strong alkalinization of Chara cell surface in the area of cell wall incision as an early event in mechanoperception.

    PubMed

    Bulychev, Alexander A; Alova, Anna V; Bibikova, Tatiana N

    2013-11-01

    Mechanical wounding of cell walls occurring in plants under the impact of pathogens or herbivores can be mimicked by cell wall incision with a glass micropipette. Measurements of pH at the surface of Chara corallina internodes following microperforation of cell wall revealed a rapid (10-30s) localized alkalinization of the apoplast after a lag period of 10-20s. The pH increase induced by incision could be as large as 3 pH units and relaxed slowly, with a halftime up to 20min. The axial pH profile around the incision zone was bell-shaped and localized to a small area, extending over a distance of about 100?m. The pH response was suppressed by lowering cell turgor upon the replacement of artificial pond water (APW) with APW containing 50mM sorbitol. Stretching of the plasma membrane during its impression into the cell wall defect is likely to activate the Ca(2+) channels, as evidenced from sensitivity of the incision-induced alkalinization to the external calcium concentration and to the addition of Ca(2+)-channel blockers, such as La(3+), Gd(3+), and Zn(2+). The maximal pH values attained at the incision site (~10.0) were close to pH in light-dependent alkaline zones of Chara cells. The involvement of cytoskeleton in the origin of alkaline patch was documented by observations that the incision-induced pH transients were suppressed by the inhibitors of microtubules (oryzalin and taxol) and, to a lesser extent, by the actin inhibitor (cytochalasin B). The results indicate that the localized increase in apoplastic pH is an early event in mechanoperception and depends on light, cytoskeleton, and intracellular calcium. PMID:23850637

  20. Combination of High Rate, Real-Time GNSS and Accelerometer Observations and Rapid Seismic Event Notification for Earthquake Early Warning and Volcano Monitoring with a Focus on the Pacific Rim.

    NASA Astrophysics Data System (ADS)

    Zimakov, L. G.; Passmore, P.; Raczka, J.; Alvarez, M.; Jackson, M.

    2014-12-01

    Scientific GNSS networks are moving towards a model of real-time data acquisition, epoch-by-epoch storage integrity, and on-board real-time position and displacement calculations. This new paradigm allows the integration of real-time, high-rate GNSS displacement information with acceleration and velocity data to create very high-rate displacement records. The mating of these two instruments allows the creation of a new, very high-rate (200 sps) displacement observable that has the full-scale displacement characteristics of GNSS and high-precision dynamic motions of seismic technologies. It is envisioned that these new observables can be used for earthquake early warning studies, volcano monitoring, and critical infrastructure monitoring applications. Our presentation will focus on the characteristics of GNSS, seismic, and strong motion sensors in high dynamic environments, including historic earthquakes in Southern California and the Pacific Rim, replicated on a shake table, over a range of displacements and frequencies. We will explore the optimum integration of these sensors from a filtering perspective including simple harmonic impulses over varying frequencies and amplitudes and under the dynamic conditions of various earthquake scenarios. In addition we will discuss implementation of a Rapid Seismic Event Notification System that provides quick delivery of digital data from seismic stations to the acquisition and processing center and a full data integrity model for real-time earthquake notification that provides warning prior to significant ground shaking.

  1. Global organization of replication time zones of the mouse genome

    PubMed Central

    Farkash-Amar, Shlomit; Lipson, Doron; Polten, Andreas; Goren, Alon; Helmstetter, Charles; Yakhini, Zohar; Simon, Itamar

    2008-01-01

    The division of genomes into distinct replication time zones has long been established. However, an in-depth understanding of their organization and their relationship to transcription is incomplete. Taking advantage of a novel synchronization method (“baby machine”) and of genomic DNA microarrays, we have, for the first time, mapped replication times of the entire mouse genome at a high temporal resolution. Our data revealed that although most of the genome has a distinct time of replication either early, middle, or late S phase, a significant portion of the genome is replicated asynchronously. Analysis of the replication map revealed the genomic scale organization of the replication time zones. We found that the genomic regions between early and late replication time zones often consist of extremely large replicons. Analysis of the relationship between replication and transcription revealed that early replication is frequently correlated with the transcription potential of a gene and not necessarily with its actual transcriptional activity. These findings, along with the strong conservation found between replication timing in human and mouse genomes, emphasize the importance of replication timing in transcription regulation. PMID:18669478

  2. Activation of Human Herpesvirus Replication by Apoptosis

    PubMed Central

    Prasad, Alka; Remick, Jill

    2013-01-01

    A central feature of herpesvirus biology is the ability of herpesviruses to remain latent within host cells. Classically, exposure to inducing agents, like activating cytokines or phorbol esters that stimulate host cell signal transduction events, and epigenetic agents (e.g., butyrate) was thought to end latency. We recently showed that Kaposi's sarcoma-associated herpesvirus (KSHV, or human herpesvirus-8 [HHV-8]) has another, alternative emergency escape replication pathway that is triggered when KSHV's host cell undergoes apoptosis, characterized by the lack of a requirement for the replication and transcription activator (RTA) protein, accelerated late gene kinetics, and production of virus with decreased infectivity. Caspase-3 is necessary and sufficient to initiate the alternative replication program. HSV-1 was also recently shown to initiate replication in response to host cell apoptosis. These observations suggested that an alternative apoptosis-triggered replication program might be a general feature of herpesvirus biology and that apoptosis-initiated herpesvirus replication may have clinical implications, particularly for herpesviruses that almost universally infect humans. To explore whether an alternative apoptosis-initiated replication program is a common feature of herpesvirus biology, we studied cell lines latently infected with Epstein-Barr virus/HHV-4, HHV-6A, HHV-6B, HHV-7, and KSHV. We found that apoptosis triggers replication for each HHV studied, with caspase-3 being necessary and sufficient for HHV replication. An alternative apoptosis-initiated replication program appears to be a common feature of HHV biology. We also found that commonly used cytotoxic chemotherapeutic agents activate HHV replication, which suggests that treatments that promote apoptosis may lead to activation of latent herpesviruses, with potential clinical significance. PMID:23885073

  3. H3K4me3 demethylation by the histone demethylase KDM5C/JARID1C promotes DNA replication origin firing.

    PubMed

    Rondinelli, Beatrice; Schwerer, Hélène; Antonini, Elena; Gaviraghi, Marco; Lupi, Alessio; Frenquelli, Michela; Cittaro, Davide; Segalla, Simona; Lemaitre, Jean-Marc; Tonon, Giovanni

    2015-03-11

    DNA replication is a tightly regulated process that initiates from multiple replication origins and leads to the faithful transmission of the genetic material. For proper DNA replication, the chromatin surrounding origins needs to be remodeled. However, remarkably little is known on which epigenetic changes are required to allow the firing of replication origins. Here, we show that the histone demethylase KDM5C/JARID1C is required for proper DNA replication at early origins. JARID1C dictates the assembly of the pre-initiation complex, driving the binding to chromatin of the pre-initiation proteins CDC45 and PCNA, through the demethylation of the histone mark H3K4me3. Fork activation and histone H4 acetylation, additional early events involved in DNA replication, are not affected by JARID1C downregulation. All together, these data point to a prominent role for JARID1C in a specific phase of DNA replication in mammalian cells, through its demethylase activity on H3K4me3. PMID:25712104

  4. The evolution of replicators.

    PubMed Central

    Szathmáry, E

    2000-01-01

    Replicators of interest in chemistry, biology and culture are briefly surveyed from a conceptual point of view. Systems with limited heredity have only a limited evolutionary potential because the number of available types is too low. Chemical cycles, such as the formose reaction, are holistic replicators since replication is not based on the successive addition of modules. Replicator networks consisting of catalytic molecules (such as reflexively autocatalytic sets of proteins, or reproducing lipid vesicles) are hypothetical ensemble replicators, and their functioning rests on attractors of their dynamics. Ensemble replicators suffer from the paradox of specificity: while their abstract feasibility seems to require a high number of molecular types, the harmful effect of side reactions calls for a small system size. No satisfactory solution to this problem is known. Phenotypic replicators do not pass on their genotypes, only some aspects of the phenotype are transmitted. Phenotypic replicators with limited heredity include genetic membranes, prions and simple memetic systems. Memes in human culture are unlimited hereditary, phenotypic replicators, based on language. The typical path of evolution goes from limited to unlimited heredity, and from attractor-based to modular (digital) replicators. PMID:11127914

  5. Defining the replication program through the chromatin landscape

    PubMed Central

    Ding, Queying; MacAlpine, David M.

    2011-01-01

    DNA replication is an essential cell cycle event required for the accurate and timely duplication of the chromosomes. It is essential that the genome is replicated accurately and completely within the confines of S-phase. Failure to completely copy the genome has the potential to result in catastrophic genomic instability. Replication initiates in a coordinated manner from multiple locations, termed origins of replication, distributed across each of the chromosomes. The selection of these origins of replication is a dynamic process responding to both developmental and tissue specific signals. In this review, we explore the role of the local chromatin environment in regulating the DNA replication program at the level of origin selection and activation. Finally, there is increasing molecular evidence that the DNA replication program itself affects the chromatin landscape, suggesting that DNA replication is critical for both genetic and epigenetic inheritance. PMID:21417598

  6. The Temporal Program of Chromosome Replication: Genomewide Replication in clb5? Saccharomyces cerevisiae

    PubMed Central

    McCune, Heather J.; Danielson, Laura S.; Alvino, Gina M.; Collingwood, David; Delrow, Jeffrey J.; Fangman, Walton L.; Brewer, Bonita J.; Raghuraman, M. K.

    2008-01-01

    Temporal regulation of origin activation is widely thought to explain the pattern of early- and late-replicating domains in the Saccharomyces cerevisiae genome. Recently, single-molecule analysis of replication suggested that stochastic processes acting on origins with different probabilities of activation could generate the observed kinetics of replication without requiring an underlying temporal order. To distinguish between these possibilities, we examined a clb5? strain, where origin firing is largely limited to the first half of S phase, to ask whether all origins nonspecifically show decreased firing (as expected for disordered firing) or if only some origins (“late” origins) are affected. Approximately half the origins in the mutant genome show delayed replication while the remainder replicate largely on time. The delayed regions can encompass hundreds of kilobases and generally correspond to regions that replicate late in wild-type cells. Kinetic analysis of replication in wild-type cells reveals broad windows of origin firing for both early and late origins. Our results are consistent with a temporal model in which origins can show some heterogeneity in both time and probability of origin firing, but clustering of temporally like origins nevertheless yields a genome that is organized into blocks showing different replication times. PMID:18832352

  7. ATP Depletion Via Mitochondrial F1F0 Complex by Lethal Factor is an Early Event in B. Anthracis-Induced Sudden Cell Death

    PubMed Central

    Woodberry, Mitchell W.; Aguilera-Aguirre, Leopoldo; Bacsi, Attila; Chopra, Ashok K.; Kurosky, Alexander; Peterson, Johnny W.; Boldogh, Istvan

    2009-01-01

    Bacillus anthracis’ primary virulence factor is a tripartite anthrax toxin consisting of edema factor (EF), lethal factor (LF) and protective antigen (PA). In complex with PA, EF and LF are internalized via receptor-mediated endocytosis. EF is a calmodulin-dependent adenylate cyclase that induces tissue edema. LF is a zinc-metalloprotease that cleaves members of mitogen-activated protein kinase kinases. Lethal toxin (LT: PA plus LF)-induced death of macrophages is primarily attributed to expression of the sensitive Nalp1b allele, inflammasome formation and activation of caspase-1, but early events that initiate these processes are unknown. Here we provide evidence that an early essential event in pyroptosis of alveolar macrophages is LF-mediated depletion of cellular ATP. The underlying mechanism involves interaction of LF with F1F0-complex gamma and beta subunits leading to increased ATPase activity in mitochondria. In support, mitochondrial DNA-depleted MH-S cells have decreased F1F0 ATPase activity due to the lack of F06 and F08 polypeptides and show increased resistance to LT. We conclude that ATP depletion is an important early event in LT-induced sudden cell death and its prevention increases survival of toxin-sensitive cells.

  8. Infection of Brachypodium distachyon by formae speciales of Puccinia graminis: early infection events and host-pathogen incompatibility.

    PubMed

    Figueroa, Melania; Alderman, Stephen; Garvin, David F; Pfender, William F

    2013-01-01

    Puccinia graminis causes stem rust, a serious disease of cereals and forage grasses. Important formae speciales of P. graminis and their typical hosts are P. graminis f. sp. tritici (Pg-tr) in wheat and barley, P. graminis f. sp. lolii (Pg-lo) in perennial ryegrass and tall fescue, and P. graminis f. sp. phlei-pratensis (Pg-pp) in timothy grass. Brachypodium distachyon is an emerging genetic model to study fungal disease resistance in cereals and temperate grasses. We characterized the P. graminis-Brachypodium pathosystem to evaluate its potential for investigating incompatibility and non-host resistance to P. graminis. Inoculation of eight Brachypodium inbred lines with Pg-tr, Pg-lo or Pg-pp resulted in sporulating lesions later accompanied by necrosis. Histological analysis of early infection events in one Brachypodium inbred line (Bd1-1) indicated that Pg-lo and Pg-pp were markedly more efficient than Pg-tr at establishing a biotrophic interaction. Formation of appressoria was completed (60-70% of germinated spores) by 12 h post-inoculation (hpi) under dark and wet conditions, and after 4 h of subsequent light exposure fungal penetration structures (penetration peg, substomatal vesicle and primary infection hyphae) had developed. Brachypodium Bd1-1 exhibited pre-haustorial resistance to Pg-tr, i.e. infection usually stopped at appressorial formation. By 68 hpi, only 0.3% and 0.7% of the Pg-tr urediniospores developed haustoria and colonies, respectively. In contrast, development of advanced infection structures by Pg-lo and Pg-pp was significantly more common; however, Brachypodium displayed post-haustorial resistance to these isolates. By 68 hpi the percentage of urediniospores that only develop a haustorium mother cell or haustorium in Pg-lo and Pg-pp reached 8% and 5%, respectively. The formation of colonies reached 14% and 13%, respectively. We conclude that Brachypodium is an apt grass model to study the molecular and genetic components of incompatiblity and non-host resistance to P. graminis. PMID:23441218

  9. Inhibition of Influenza Virus Replication by Targeting Broad Host Cell Pathways

    PubMed Central

    Marois, Isabelle; Cloutier, Alexandre; Meunier, Isabelle; Weingartl, Hana M.; Cantin, André M.; Richter, Martin V.

    2014-01-01

    Antivirals that are currently used to treat influenza virus infections target components of the virus which can mutate rapidly. Consequently, there has been an increase in the number of resistant strains to one or many antivirals in recent years. Here we compared the antiviral effects of lysosomotropic alkalinizing agents (LAAs) and calcium modulators (CMs), which interfere with crucial events in the influenza virus replication cycle, against avian, swine, and human viruses of different subtypes in MDCK cells. We observed that treatment with LAAs, CMs, or a combination of both, significantly inhibited viral replication. Moreover, the drugs were effective even when they were administered 8 h after infection. Finally, analysis of the expression of viral acidic polymerase (PA) revealed that both drugs classes interfered with early events in the viral replication cycle. This study demonstrates that targeting broad host cellular pathways can be an efficient strategy to inhibit influenza replication. Furthermore, it provides an interesting avenue for drug development where resistance by the virus might be reduced since the virus is not targeted directly. PMID:25333287

  10. The spectral absorption coefficient at 254nm as a real-time early warning proxy for detecting faecal pollution events at alpine karst water resources

    PubMed Central

    Stadler, H.; Klock, E.; Skritek, P.; Mach, R.L.; Zerobin, W.; Farnleitner, A.H.

    2011-01-01

    Because spring water quality from alpine karst aquifers can change very rapidly during event situations, water abstraction management has to be performed in near real-time. Four summer events (2005-2008) at alpine karst springs were investigated in detail in order to evaluate the spectral absorption coefficient at 254nm (SAC254) as a real-time early warning proxy for faecal pollution. For the investigation Low-Earth-Orbit (LEO) Satellite-based data communication between portable hydrometeorological measuring stations and an automated microbiological sampling device was used. The method for event triggered microbial sampling and analyzing was already established and described in a previous paper (Stadler et al., Wat. Sci. Technol. 58(4): 899-909, 2008). Data analysis including on-line event characterisation (i.e. precipitation, discharge, turbidity, SAC254) and comprehensive E. coli determination (n > 800) indicated that SAC254 is a useful early warning proxy. Irrespective of the studied event situations SAC254 always increased 3 to 6 hours earlier than the onset of faecal pollution, featuring different correlation phases. Furthermore, it seems also possible to use SAC254 as a real-time proxy parameter for estimating the extent of faecal pollution after establishing specific spring and event-type calibrations that take into consideration the variability of the occurrence and the transferability of faecal material It should be highlighted that diffuse faecal pollution from wildlife and live stock sources was responsible for spring water contamination at the investigated catchments. In this respect, the SAC254 can also provide useful information to support microbial source tracking efforts where different situations of infiltration have to be investigated. PMID:20962406

  11. The spectral absorption coefficient at 254?nm as a real-time early warning proxy for detecting faecal pollution events at alpine karst water resources.

    PubMed

    Stadler, H; Klock, E; Skritek, P; Mach, R L; Zerobin, W; Farnleitner, A H

    2010-01-01

    Because spring water quality from alpine karst aquifers can change very rapidly during event situations, water abstraction management has to be performed in near real-time. Four summer events (2005-2008) at alpine karst springs were investigated in detail in order to evaluate the spectral absorption coefficient at 254?nm (SAC254) as a real-time early warning proxy for faecal pollution. For the investigation Low-Earth-Orbit (LEO) Satellite-based data communication between portable hydrometeorological measuring stations and an automated microbiological sampling device was used. The method for event triggered microbial sampling and analyzing was already established and described in a previous paper. Data analysis including on-line event characterisation (i.e. precipitation, discharge, turbidity, SAC254) and comprehensive E. coli determination (n>800) indicated that SAC254 is a useful early warning proxy. Irrespective of the studied event situations SAC254 always increased 3 to 6 hours earlier than the onset of faecal pollution, featuring different correlation phases. Furthermore, it seems also possible to use SAC254 as a real-time proxy parameter for estimating the extent of faecal pollution after establishing specific spring and event-type calibrations that take into consideration the variability of the occurrence and the transferability of faecal material It should be highlighted that diffuse faecal pollution from wildlife and live stock sources was responsible for spring water contamination at the investigated catchments. In this respect, the SAC254 can also provide useful information to support microbial source tracking efforts where different situations of infiltration have to be investigated. PMID:20962406

  12. A replication-enhancing element with transcriptional silencer activity in autonomously replicating human chromosomal fragments.

    PubMed Central

    Obuse, C; Okuno, Y; Okazaki, T; Masukata, H

    1996-01-01

    We have identified specific nucleotide sequences involved in autonomous replication of human chromosomal fragments in human cells. Nested deletion analysis of a 10.2-kb long human chromosomal fragment showed that replication efficiency of the fragment was reduced to about 50% by loss of a short specific segment. Deletions outside the segment reduced the replication efficiency depending on their lengths. By introducing linker substitutions, we found that the distinct segment required for the efficient replication consisted of an 18-bp sequence, named REE1 (Replication Enhancing Element 1). Single or tandem copies of REE1 alone had no significant replication activity, but they stimulated replication of human chromosomal DNA fragments. We found, in addition, that the REE1 sequence inserted at a site 2.7 kb upstream of the SV40 early promoter caused repression of transcription from the promoter, suggesting that REE1 had a transcriptional silencer activity. Introduction of linker substitutions into the REE1 indicated that the nucleotide sequences required for the repression of transcription were the same as those for enhancement of replication. Thus, REE1 is responsible for both enhancement of replication and repression of transcription. Images PMID:8741838

  13. Replication of hepatitis C virus.

    PubMed

    Moradpour, Darius; Penin, François; Rice, Charles M

    2007-06-01

    Exciting progress has recently been made in understanding the replication of hepatitis C virus, a major cause of chronic hepatitis, liver cirrhosis and hepatocellular carcinoma worldwide. The development of complete cell-culture systems should now enable the systematic dissection of the entire viral lifecycle, providing insights into the hitherto difficult-to-study early and late steps. These efforts have already translated into the identification of novel antiviral targets and the development of new therapeutic strategies, some of which are currently undergoing clinical evaluation. PMID:17487147

  14. Reanalyses of Anomalous Gravitational Microlensing Events in the OGLE-III Early Warning System Database with Combined Data

    E-print Network

    Jeong, J; Han, C; Gould, A; Udalski, A; Szyma?ski, M K; Pietrzy?ski, G; Soszy?ski, I; Poleski, R; Ulaczyk, K; Wyrzykowski, ?; Abe, F; Bennett, D P; Bond, I A; Botzler, C S; Freeman, M; Fukui, A; Fukunaga, D; Itow, Y; Koshimoto, N; Masuda, K; Matsubara, Y; Muraki, Y; Namba, S; Ohnishi, K; Rattenbury, N J; Saito, To; Sullivan, D J; Sweatman, W L; Sumi, T; Suzuki, D; Tristram, P J; Tsurumi, N; Wada, K; Yamai, N; Yock, P C M; Yonehara, A; Albrow, M D; Batista, V; Beaulieu, J -P; Caldwell, J A R; Cassan, A; Cole, A; Coutures, C; Dieters, S; Dominik, M; Prester, D Dominis; Donatowicz, J; Fouqué, P; Greenhill, J; Hoffman, M; Huber, M; Jørgensen, U G; Kane, S R; Kubas, D; Martin, R; Marquette, J -B; Menzies, J; Pitrou, C; Pollard, K; Sahu, K C; Vinter, C; Wambsganss, J; Williams, A; Allen, W; Bolt, G; Choi, J -Y; Christie, G W; DePoy, D L; Drummond, J; Gaudi, B S; Hwang, K -H; Jung, Y K; Lee, C -U; Mallia, F; Maoz, D; Maury, A; McCormick, J; Monard, L A G; Moorhouse, D; Natusch, T; Ofek, E O; Park, B -G; Pogge, R W; Santallo, R; Shin, I -G; Thornley, G; Yee, J C; Bramich, D M; Horne, K; Hundertmark, M; Kains, N; Snodgrass, C; Steele, I; Street, R; Tsapras, Y

    2015-01-01

    We reanalyze microlensing events in the published list of anomalous events that were observed from the OGLE lensing survey conducted during 2004-2008 period. In order to check the existence of possible degenerate solutions and extract extra information, we conduct analyses based on combined data from other survey and follow-up observation and consider higher-order effects. Among the analyzed events, we present analyses of 8 events for which either new solutions are identified or additional information is obtained. We find that the previous binary-source interpretations of 5 events are better interpreted by binary-lens models. These events include OGLE-2006-BLG-238, OGLE-2007-BLG-159, OGLE-2007-BLG-491, OGLE-2008-BLG-143, and OGLE-2008-BLG-210. With additional data covering caustic crossings, we detect finite-source effects for 6 events including OGLE-2006-BLG-215, OGLE-2006-BLG-238, OGLE-2006-BLG-450, OGLE-2008-BLG-143, OGLE-2008-BLG-210, and OGLE-2008-BLG-513. Among them, we are able to measure the Einstein ...

  15. Project New Pride: Replication.

    ERIC Educational Resources Information Center

    National Inst. for Juvenile Justice and Delinquency Prevention (Dept. of Justice/LEAA), Washington, DC.

    The Office of Juvenile Justice and Delinquency Prevention, Law Enforcement Assistance Administration, is establishing a new discretionary grant program entitled Replication of Project New Pride: A Serious Offender Youth Treatment Program. Project New Pride was chosen for replication because of its demonstrated effectiveness in Denver, Colorado,…

  16. Thermal Replication Trap

    NASA Astrophysics Data System (ADS)

    Braun, Dieter

    2011-03-01

    The hallmark of living matter is the replication of genetic molecules and their active storage against diffusion. We have argued in the past that thermal convection can host the million-fold accumulation even of single nucleotides and at the same time trigger exponential replication. Accumulation is driven by thermophoresis and convection in elongated chambers, replication by the inherent temperature cycling in convection. Optothermal pumping [2,3] allows to implement the thermal trap efficiently in a toroidal or linear geometry. Based on this method, we were in a position to combine accumulation and replication of DNA in the same chamber. As we are missing a solid chemistry of prebiotic replication, we used as a proxy reaction for to replication the polymerase chain reaction. Convective flow both drives the DNA replicating polymerase chain reaction (PCR) while concurrent thermophoresis accumulates the replicated 143 base pair DNA in bulk solution. The time constant for accumulation is 92 s while DNA is doubled every 50 s. The length of the amplified DNA is checked with thermophoresis. Finite element simulations confirm the findings. The experiments explore conditions in pores of hydrothermal rock which can serve as a model environment for the origin of life and has prospects towards the first autonomous evolution, hosting the Darwin process by molecular selection using the thermophoretic trap. On the other side, the implemented continuous evolution will be able to breed well specified DNA or RNA molecules in the future.

  17. Paleoceanographic changes and population dynamics in two left-coiling events of Pulleniatina during early Pleistocene, ODP 1115B, western equatorial Pacific

    NASA Astrophysics Data System (ADS)

    Chiang, M.; Wei, K.; Chuang, C.; Lo, L.

    2013-12-01

    The alternately left-coiling (LC) and right-coiling (RC) dominance in the populations of planktonic foraminifera Pulleniatina genus defined a series L events during the past 4 Ma. These L events have been used as useful biostratigraphic markers for the Indo-Pacific region, especially the L5 event, which marks the top of Gelasian stage in Early Pleistocene. However, previous studies emphasized on the stratigraphic application of the L events and have little attention on the L events itself. This study focuses on the population dynamics of Pu. during L events and tries to examine the mechanism triggering the L events by studying Core ODP 1115 B (9°11' S, 151°34' E, water depth 1149 m) in Solomon Sea, western equatorial Pacific. Owing to the variance in morphology, we lumped all species of Pu. genus into a 'Pulleniatina complex' rather than subdividing them into different species. Specimens larger than 250 ?m in each sample were sieved into six size-fractions. The Pu. complex as well as their coiling direction were identified under a stereomicroscope. To avoid biased sampling, we examined all Pu. complex specimens larger than 250 ?m. LC and RC relative percentages as well as absolute abundances of Pu. complex in each size-fraction were counted, respectively. In setting LC relative percentage >50% as a threshold, we recognized a distinctive L6 event (~ 2.202 - 2.175 Ma, began between MIS 85 - 84 and ended between MIS 83 - 82), a prominent L5 event (~ 2.147 - 1.875 Ma, began between MIS 82 - 81 and ended between MIS 71 - 70), and could not find a clear L4 event as reported by Saito (1976). The onset of the L5 event was marked by a dramatic reduction of absolute abundance of RC forms that give observers an impression of LC forms dominance. During the L5 event, the LC relative percentages fluctuated by 20 to 40%. The ending of the L5event was characterized by a slow recovery of RC forms in absolute abundance. L6 event was the result of two sudden significant changes in absolute abundance of LC forms that led to pronounced relative percentage changes in coiling direction. For the biostragtigraphic application, these characteristics make the L6 event a better biostratigraphic marker than the L5 event where Pu. is less abundant. The onsets of the L5 and L6 event were corresponding to opposite global climatic changing trends. In addition, linear regression between population parameters and environmental proxies, including those of salinity, ice volume, primary productivity and water temperature from both sea surface and thermocline show week correlations, indicating the causal relationship between the environmental changes and the population dynamics of Pu. is not as strong as expected.

  18. Ostracods and facies of the Early and Middle Frasnian at Devils Gate in Nevada: Relationship to the Alamo Event

    USGS Publications Warehouse

    Casier, J.-G.; Berra, I.; Olempska, Ewa; Sandberg, C.; Preat, A.

    2006-01-01

    In order to document the Alamo Event and to investigate its influence on shallow-marine environments, we undertook a study of ostracods, conodonts, and analysis of the sedimentology of the lower member of the type Devils Gate Limestone, Six major carbonate microfacies (MF1-MF6) ranging from open-marine environments below storm wave base to pre-evaporitic supratidal lagoons were recognized. The sedimentological study detected no important sedimentological changes during the Alamo Event; only an influx of detrital material and lithoclasts indicate that an unusual event had occurred. Ostracods are generally rare or absent in the lower member of the Devils Gate Limestone, and only 2,000 carapaces, valves and fragments were extracted; from these some 26 taxa were identified. Two new species, Voronina? eureka and Serenida dorsoplicata are proposed. The ostracods belong to the Eifelian Mega-Assemblage and their distribution was influenced by strong salinity variations. Because of the rarity and low diversity of ostracods and conodonts in samples collected from the lower part of the lower member of the Devils Gate Limestone it is not adequate to demonstrate conclusively an extinction event close to the Alamo Event Bed. Nevertheless the greater abundance and diversity of ostracods above this bed seems to indicate that the Alamo Event did not result in significant extinction of ostracod taxa in this shallow water setting. The ostracod fauna present in the lower member of the Devils Gate Limestone suggests faunal exchanges between Nevada and the Russian Platform via the Western Canadian platform.

  19. Combined oxygen- and carbon-isotope records through the Early Jurassic: multiple global events and two modes of carbon-cycle/temperature coupling

    NASA Astrophysics Data System (ADS)

    Hesselbo, S. P.; Korte, C.

    2010-12-01

    The Jurassic comprises some 55 million years of Earth history. However, within the Jurassic, only one major environmental change (hyperthermal) event is really well known - the Early Toarcian Oceanic Anoxic Event (OAE) at ~183 Ma - and until very recently the extent to which the accompanying environmental changes were global has been strongly debated. Nevertheless, partly as a result of the international effort to define Global Stratotype Sections and Points (GSSPs), much more is now being discovered about environmental changes taking place at and around the other Jurassic Age (Stage) boundaries, to the extent that meaningful comparisons between these events can begin to be made. Here we present new carbon and oxygen isotope data from mollusks (bivalves and belemnites) and brachiopods collected through the marine Early Jurassic succession of NE England, including the Sinemurian-Plienbachian boundary GSSP. All materials have been screened by chemical analysis and scanning electron microscopy to check for diagenetic alteration. Analysis of carbon isotopes from marine calcite is supplemented by analysis of carbon-isotope values from fossil wood collected through the same section. It is demonstrated that both long-term and short-term carbon-isotope shifts from the UK Early Jurassic represent global changes in carbon cycle balances. The Sinemurian-Pliensbachian boundary event is an event of global significance and shows several similarities to the Toarcian OAE (relative sea-level change, carbon-isotope signature), but also some significant contrasts (oxygen-isotope based paleotemperatures which provide no evidence for warming). Significant contrast in oxygen- and carbon-isotope co-variation also occurs on a long timescale. There appear to be two modes in the co-variation of carbon and oxygen isotopes through this time interval: mode 1 shows positive correlation and may be explained by conventional sources and sinks for carbon-dioxide; mode 2, representing negative correlation, is more difficult to explain but appears to dominate. Additionally, we show that estimates of carbon dioxide change through the Early Jurassic based on ??13C values from the stratigraphically extended Mochras Farm core are unlikely to be correct.

  20. Replication timing of pseudo-NORs

    Microsoft Academic Search

    Evgeny Smirnov; Dušan Cmarko; Lubomír Ková?ik; Guy M. Hagen; Alexey Popov; Otakar Raška; José-Luis Prieto; Boris Ryabchenko; Filipa Amim; Brian McStay; Ivan Raška

    2011-01-01

    In mammalian cells, transcriptionally active ribosomal genes are replicated in the early S phase, and the silent ribosomal genes in the late S phase, though mechanisms of this timing remain unknown. UBF (Upstream Binding Factor), a DNA binding protein and component of the pol I transcription machinery, is considered to be responsible for the loose chromatin structure of the active

  1. Impacts of a water stress followed by an early frost event on beech (Fagus sylvatica L.) susceptibility to Scolytine ambrosia beetles - Research strategy and first results

    NASA Astrophysics Data System (ADS)

    La Spina, Sylvie; de Cannière, Charles; Molenberg, Jean-Marc; Vincke, Caroline; Deman, Déborah; Grégoire, Jean-Claude

    2010-05-01

    Climate change tends to induce more frequent abiotic and biotic extreme events, having large impacts on tree vitality. Weakened trees are then more susceptible to secondary insect outbreaks, as it happened in Belgium in the early 2000s: after an early frost event, secondary Scolytine ambrosia beetles attacks were observed on beech trees. In this study, we test if a combination of stress, i.e. a soil water deficit preceding an early frost, could render trees more attractive to beetles. An experimental study was set in autumn 2008. Two parcels of a beech forest were covered with plastic tents to induce a water stress by rain interception. The parcels were surrounded by 2-meters depth trenches to avoid water supply by streaming. Soil water content and different indicators of tree water use (sap flow, predawn leaf water potential, tree radial growth) were followed. In autumn 2010, artificial frost injuries will be inflicted to trees using dry ice. Trees attractivity for Scolytine insects, and the success of insect colonization will then be studied. The poster will focus on experiment setting and first results (impacts of soil water deficit on trees).

  2. Stable DNA replication: interplay between DNA replication, homologous recombination, and transcription.

    PubMed Central

    Kogoma, T

    1997-01-01

    Chromosome replication in Escherichia coli is normally initiated at oriC, the origin of chromosome replication. E. coli cells possess at least three additional initiation systems for chromosome replication that are normally repressed but can be activated under certain specific conditions. These are termed the stable DNA replication systems. Inducible stable DNA replication (iSDR), which is activated by SOS induction, is proposed to be initiated from a D-loop, an early intermediate in homologous recombination. Thus, iSDR is a form of recombination-dependent DNA replication (RDR). Analysis of iSDR and RDR has led to the proposal that homologous recombination and double-strand break repair involve extensive semiconservative DNA replication. RDR is proposed to play crucial roles in homologous recombination, double-strand break repair, restoration of collapsed replication forks, and adaptive mutation. Constitutive stable DNA replication (cSDR) is activated in mhA mutants deficient in RNase HI or in recG mutants deficient in RecG helicase. cSDR is proposed to be initiated from an R-loop that can be formed by the invasion of duplex DNA by an RNA transcript, which most probably is catalyzed by RecA protein. The third form of SDR is nSDR, which can be transiently activated in wild-type cells when rapidly growing cells enter the stationary phase. This article describes the characteristics of these alternative DNA replication forms and reviews evidence that has led to the formulation of the proposed models for SDR initiation mechanisms. The possible interplay between DNA replication, homologous recombination, DNA repair, and transcription is explored. PMID:9184011

  3. The onset of the Early Eocene Climatic Optimum, including the K/X event, at Branch Stream, Clarence Valley, New Zealand

    NASA Astrophysics Data System (ADS)

    Slotnick, B. S.; Dickens, G. R.; Hollis, C. J.; Crampton, J. S.; Strong, P.; Dallanave, E.; Philips, A.

    2014-12-01

    The Early Eocene Climatic Optimum (EECO), lasting from ~53-50 Ma, has been characterized as the warmest sustained interval through the Cenozoic. It was comprised of a broad temperature maximum with elevated atmospheric pCO2, noticeable shifts in carbon cycling, and a variety of faunal and floral changes. This included one, and likely additional, brief (<200 kyr) intervals of extreme warming, the K/X event. At least for the most prominent events, the long-term drop in ?13C and short-term Carbon Isotope Excursions (CIEs) have been coupled to massive fluxes of 13C-depleted carbon into the exogenic system and global climate change. However, much about EECO remains unknown because of a lack of detailed and coupled proxy records; we are currently generating useful records to better characterize lithological and geochemical signatures of EECO. Here, we help rectify this problem by presenting a new lithologic and carbon isotopic record for a ~84-m-thick section of early Eocene upper slope calcareous-rich sediments, now lithified and exposed along Branch Stream, New Zealand. Comparison of new carbon isotopic and lithologic records of this greatly expanded section to nearby Mead Stream identifies multiple negative CIEs in short succession and generally more marl during lowermost EECO (~53.3-51.7 Ma), with the most prominent of these equating to the K/X event. The early Eocene lithologic and ?13C records at Branch and Mead Streams are remarkably similar to each other, with the following distinctions: sequences at Branch Stream are thicker and generally have a wider range of ?13C across CIEs. Both expanded sections are marked by terrigenous dilution, best explained by enhanced seasonal precipitation, elevated greenhouse-gas concentrations, and likely global warming. These data indicate lowermost EECO can be described as a time with a general ?13C low superimposed by a series of short-term climate perturbations.

  4. Clustering of transcriptional profiles identifies changes to insulin signaling as an early event in a mouse model of Alzheimer’s disease

    PubMed Central

    2013-01-01

    Background Alzheimer’s disease affects more than 35 million people worldwide but there is no known cure. Age is the strongest risk factor for Alzheimer’s disease but it is not clear how age-related changes impact the disease. Here, we used a mouse model of Alzheimer’s disease to identify age-specific changes that occur prior to and at the onset of traditional Alzheimer-related phenotypes including amyloid plaque formation. To identify these early events we used transcriptional profiling of mouse brains combined with computational approaches including singular value decomposition and hierarchical clustering. Results Our study identifies three key events in early stages of Alzheimer’s disease. First, the most important drivers of Alzheimer’s disease onset in these mice are age-specific changes. These include perturbations of the ribosome and oxidative phosphorylation pathways. Second, the earliest detectable disease-specific changes occur to genes commonly associated with the hypothalamic-adrenal-pituitary (HPA) axis. These include the down-regulation of genes relating to metabolism, depression and appetite. Finally, insulin signaling, in particular the down-regulation of the insulin receptor substrate 4 (Irs4) gene, may be an important event in the transition from age-related changes to Alzheimer’s disease specific-changes. Conclusion A combination of transcriptional profiling combined with computational analyses has uncovered novel features relevant to Alzheimer’s disease in a widely used mouse model and offers avenues for further exploration into early stages of AD. PMID:24274089

  5. The critical early proinflammatory events associated with idiopathic pneumonia syndrome in irradiated murine allogeneic recipients are due to donor T cell infusion and potentiated by cyclophosphamide.

    PubMed Central

    Panoskaltsis-Mortari, A; Taylor, P A; Yaeger, T M; Wangensteen, O D; Bitterman, P B; Ingbar, D H; Vallera, D A; Blazar, B R

    1997-01-01

    We have hypothesized that lung damage occurring in the peri-bone marrow transplant (BMT) period is critical for the subsequent generation of idiopathic pneumonia syndrome (IPS), a major complication following human BMT. The proinflammatory events induced by a common pre-BMT conditioning regimen, cyclophosphamide (Cytoxan(R)) (Cy) and total body irradiation, were analyzed in a murine BMT model. Electron microscopy indicated that Cy exacerbated irradiation-induced epithelial cell injury as early as day 3 after BMT. Allogenicity was an important contributing factor to lung injury as measured by lung wet and dry weights and decreased specific lung compliance. The most significant pulmonary dysfunction was seen in mice receiving both allogeneic T cells and Cy conditioning. IPS was associated with an influx of T cells, macrophages, and neutrophils early post-BMT. Hydroxyproline levels were not increased, indicating that the injury was not fibrotic early post-BMT. As early as 2 h after chemoradiation, host macrophages increased in number in the lung parenchyma. Continued increases in macrophages occurred if splenic T cells were administered with the donor graft. The expression of costimulatory B7 molecules correlated with macrophage numbers. Frequencies of cells expressing mRNA for the inflammatory proteins TNF-alpha, IL-1beta, and TGFbeta were increased. Cy accelerated the upregulation of TGFbeta and increase in host macrophages. The exacerbation of macrophage activation and severity of IPS was dependent on allogeneic T cells, implicating immune-mediated mechanisms as critical to the outcome of IPS. This demonstration of early injury after BMT indicates the need for very early therapeutic intervention before lung damage becomes profound and irreversible. PMID:9276718

  6. Correlating carbon and oxygen isotope events in early to middle Miocene shallow marine carbonates in the Mediterranean region using orbitally tuned chemostratigraphy and lithostratigraphy

    NASA Astrophysics Data System (ADS)

    Auer, Gerald; Piller, Werner E.; Reuter, Markus; Harzhauser, Mathias

    2015-04-01

    During the Miocene prominent oxygen isotope events (Mi-events) reflect major changes in glaciation, while carbonate isotope maxima (CM-events) reflect changes in organic carbon burial, particularly during the Monterey carbon isotope excursion. However, despite their importance to the global climate history they have never been recorded in shallow marine carbonate successions. The Decontra section on the Maiella Platform (central Apennines, Italy), however, allows to resolve them for the first time in such a setting during the early to middle Miocene. The present study improves the stratigraphic resolution of parts of the Decontra section via orbital tuning of high-resolution gamma ray (GR) and magnetic susceptibility data to the 405 kyr eccentricity metronome. The tuning allows, within the established biostratigraphic, sequence stratigraphic, and isotope stratigraphic frameworks, a precise correlation of the Decontra section with pelagic records of the Mediterranean region, as well as the global paleoclimatic record and the global sea level curve. Spectral series analyses of GR data further indicate that the 405 kyr orbital cycle is particularly well preserved during the Monterey Event. Since GR is a direct proxy for authigenic uranium precipitation during increased burial of organic carbon in the Decontra section, it follows the same long-term orbital pacing as observed in the carbon isotope records. The 405 kyr GR beat is thus correlated with the carbon isotope maxima observed during the Monterey Event. Finally, the Mi-events can now be recognized in the ?18O record and coincide with plankton-rich, siliceous, or phosphatic horizons in the lithology of the section.

  7. Rumination as a Mechanism Linking Stressful Life Events to Symptoms of Depression and Anxiety: Longitudinal Evidence in Early Adolescents and Adults

    PubMed Central

    Michl, Louisa C.; McLaughlin, Katie A.; Shepherd, Kathrine; Nolen-Hoeksema, Susan

    2014-01-01

    Rumination is a well-established risk factor for the onset of major depression and anxiety symptomatology in both adolescents and adults. Despite the robust associations between rumination and internalizing psychopathology, there is a dearth of research examining factors that might lead to a ruminative response style. In the current study, we examined whether social environmental experiences were associated with rumination. Specifically, we evaluated whether self-reported exposure to stressful life events predicted subsequent increases in rumination. We also investigated whether rumination served as a mechanism underlying the longitudinal association between self-reported stressful life events and internalizing symptoms. Self-reported stressful life events, rumination, and symptoms of depression and anxiety were assessed in 2 separate longitudinal samples. A sample of early adolescents (N = 1,065) was assessed at 3 time points spanning 7 months. A sample of adults (N = 1,132) was assessed at 2 time points spanning 12 months. In both samples, self-reported exposure to stressful life events was associated longitudinally with increased engagement in rumination. In addition, rumination mediated the longitudinal relationship between self-reported stressors and symptoms of anxiety in both samples and the relationship between self-reported life events and symptoms of depression in the adult sample. Identifying the psychological and neurobiological mechanisms that explain a greater propensity for rumination following stressors remains an important goal for future research. This study provides novel evidence for the role of stressful life events in shaping characteristic responses to distress, specifically engagement in rumination, highlighting potentially useful targets for interventions aimed at preventing the onset of depression and anxiety. PMID:23713497

  8. Early Events in Xenograft Development from the Human Embryonic Stem Cell Line HS181 - Resemblance with an Initial Multiple Epiblast Formation

    PubMed Central

    Jamil, Seema; Ali, Rouknuddin; Imreh, Marta P.; Gulyas, Miklos; Sandstedt, Bengt; Ährlund-Richter, Lars

    2011-01-01

    Xenografting is widely used for assessing in vivo pluripotency of human stem cell populations. Here, we report on early to late events in the development of mature experimental teratoma from a well-characterized human embryonic stem cell (HESC) line, HS181. The results show an embryonic process, increasingly chaotic. Active proliferation of the stem cell derived cellular progeny was detected already at day 5, and characterized by the appearance of multiple sites of engraftment, with structures of single or pseudostratified columnar epithelium surrounding small cavities. The striking histological resemblance to developing embryonic ectoderm, and the formation of epiblast-like structures was supported by the expression of the markers OCT4, NANOG, SSEA-4 and KLF4, but a lack of REX1. The early neural marker NESTIN was uniformly expressed, while markers linked to gastrulation, such as BMP-4, NODAL or BRACHYURY were not detected. Thus, observations on day 5 indicated differentiation comparable to the most early transient cell populations in human post implantation development. Confirming and expanding on previous findings from HS181 xenografts, these early events were followed by an increasingly chaotic development, incorporated in the formation of a benign teratoma with complex embryonic components. In the mature HS181 teratomas not all types of organs/tissues were detected, indicating a restricted differentiation, and a lack of adequate spatial developmental cues during the further teratoma formation. Uniquely, a kinetic alignment of rare complex structures was made to human embryos at diagnosed gestation stages, showing minor kinetic deviations between HS181 teratoma and the human counterpart. PMID:22140465

  9. Early events in xenograft development from the human embryonic stem cell line HS181--resemblance with an initial multiple epiblast formation.

    PubMed

    Gertow, Karin; Cedervall, Jessica; Jamil, Seema; Ali, Rouknuddin; Imreh, Marta P; Gulyas, Miklos; Sandstedt, Bengt; Ahrlund-Richter, Lars

    2011-01-01

    Xenografting is widely used for assessing in vivo pluripotency of human stem cell populations. Here, we report on early to late events in the development of mature experimental teratoma from a well-characterized human embryonic stem cell (HESC) line, HS181. The results show an embryonic process, increasingly chaotic. Active proliferation of the stem cell derived cellular progeny was detected already at day 5, and characterized by the appearance of multiple sites of engraftment, with structures of single or pseudostratified columnar epithelium surrounding small cavities. The striking histological resemblance to developing embryonic ectoderm, and the formation of epiblast-like structures was supported by the expression of the markers OCT4, NANOG, SSEA-4 and KLF4, but a lack of REX1. The early neural marker NESTIN was uniformly expressed, while markers linked to gastrulation, such as BMP-4, NODAL or BRACHYURY were not detected. Thus, observations on day 5 indicated differentiation comparable to the most early transient cell populations in human post implantation development. Confirming and expanding on previous findings from HS181 xenografts, these early events were followed by an increasingly chaotic development, incorporated in the formation of a benign teratoma with complex embryonic components. In the mature HS181 teratomas not all types of organs/tissues were detected, indicating a restricted differentiation, and a lack of adequate spatial developmental cues during the further teratoma formation. Uniquely, a kinetic alignment of rare complex structures was made to human embryos at diagnosed gestation stages, showing minor kinetic deviations between HS181 teratoma and the human counterpart. PMID:22140465

  10. High resolution chronology of late Cretaceous-early Tertiary events determined from 21,000 yr orbital-climatic cycles in marine sediments

    NASA Technical Reports Server (NTRS)

    Herbert, Timothy D.; Dhondt, Steven

    1988-01-01

    A number of South Atlantic sites cored by the Deep Sea Drilling Project (DSDP) recovered late Cretaceous and early Tertiary sediments with alternating light-dark, high-low carbonate content. The sedimentary oscillations were turned into time series by digitizing color photographs of core segments at a resolution of about 5 points/cm. Spectral analysis of these records indicates prominent periodicity at 25 to 35 cm in the Cretaceous intervals, and about 15 cm in the early Tertiary sediments. The absolute period of the cycles that is determined from paleomagnetic calibration at two sites is 20,000 to 25,000 yr, and almost certainly corresponds to the period of the earth's precessional cycle. These sequences therefore contain an internal chronometer to measure events across the K/T extinction boundary at this scale of resolution. The orbital metronome was used to address several related questions: the position of the K/T boundary within magnetic chron 29R, the fluxes of biogenic and detrital material to the deep sea immediately before and after the K/T event, the duration of the Sr anomaly, and the level of background climatic variability in the latest Cretaceous time. The carbonate/color cycles that were analyzed contain primary records of ocean carbonate productivity and chemistry, as evidenced by bioturbational mixing of adjacent beds and the weak lithification of the rhythmic sequences. It was concluded that sedimentary sequences that contain orbital cyclicity are capable of providing resolution of dramatic events in earth history with much greater precision than obtainable through radiometric methods. The data show no evidence for a gradual climatic deterioration prior to the K/T extinction event, and argue for a geologically rapid revolution at this horizon.

  11. Adenomatous polyposis coli is required for early events in the normal growth and differentiation of the developing cerebral cortex

    Microsoft Academic Search

    Uladzislau Ivaniutsin; Yijing Chen; John O Mason; David J Price; Thomas Pratt

    2009-01-01

    BACKGROUND: Adenomatous polyposis coli (Apc) is a large multifunctional protein known to be important for Wnt\\/?-catenin signalling, cytoskeletal dynamics, and cell polarity. In the developing cerebral cortex, Apc is expressed in proliferating cells and its expression increases as cells migrate to the cortical plate. We examined the consequences of loss of Apc function for the early development of the cerebral

  12. Green tea (-)-epigallocatechin-gallate modulates early events in huntingtin misfolding and reduces toxicity in Huntington's disease models

    Microsoft Academic Search

    Dagmar E. Ehrnhoefer; Martin Duennwald; Phoebe Markovic; Jennifer L. Wacker; Sabine Engemann; Margaret Roark; Justin Legleiter; J. Lawrence Marsh; Leslie M. Thompson; Susan Lindquist; Paul J. Muchowski; Erich E. Wanker

    2006-01-01

    Huntington's disease (HD) is a progressive neurodegenerative disorder for which only symptomatic treat- ments of limited effectiveness are available. Preventing early misfolding steps and thereby aggregation of the polyglutamine (polyQ)-containing protein huntingtin (htt) in neurons of patients may represent an attrac- tive therapeutic strategy to postpone the onset and progression of HD. Here, we demonstrate that the green tea polyphenol

  13. Glacioeustatic fluctuation: The mechanism linking stable isotope events and sequence stratigraphy from the early Oligocene to middle Miocene

    SciTech Connect

    Abreu, V. (Petrobras and Rice Univ., Houston, TX (United States)); Haddad, G. (Rice Univ., Houston, TX (United States))

    1996-01-01

    One of the most difficult challenges of sequence stratigraphy is the establishment of synchronism between events observed in widely-separated basins. Problems arise because the resolution of the best stratigraphic methods is not good enough to establish the synchronism of similar-aged events on a global scale. Unless a common mechanism affecting global eustasy is assumed, such as variations in the ice volume, there is no a priori reason to expect that sequences of similar age in widely-separated basins are indeed synchronous. The stable oxygen isotope composition of marine carbonates is a proxy for sea level which has been underutilized in sequence stratigraphy. Identification of isotope events is based on d[sup 18]O data from DSDP and ODP sites 522, 529, 563, 608, and 747 drilled in the Atlantic and Indian oceans. These records were used to define Oligocene and Miocene oxygen isotope zones. In addition, we present isotope data from PETROBRAS Well A drilled in the Campos Basin (Brazil). Ages of isotope events correspond well with the ages of sequence boundaries and maximum flooding surfaces. Because of the good correlation between the isotope and sequence stratigraphic records, we reconfirm that ice-volume change is the common mechanism driving sea-level fluctuations from the Oligocene to present.

  14. Glacioeustatic fluctuation: The mechanism linking stable isotope events and sequence stratigraphy from the early Oligocene to middle Miocene

    SciTech Connect

    Abreu, V. [Petrobras and Rice Univ., Houston, TX (United States); Haddad, G. [Rice Univ., Houston, TX (United States)

    1996-12-31

    One of the most difficult challenges of sequence stratigraphy is the establishment of synchronism between events observed in widely-separated basins. Problems arise because the resolution of the best stratigraphic methods is not good enough to establish the synchronism of similar-aged events on a global scale. Unless a common mechanism affecting global eustasy is assumed, such as variations in the ice volume, there is no a priori reason to expect that sequences of similar age in widely-separated basins are indeed synchronous. The stable oxygen isotope composition of marine carbonates is a proxy for sea level which has been underutilized in sequence stratigraphy. Identification of isotope events is based on d{sup 18}O data from DSDP and ODP sites 522, 529, 563, 608, and 747 drilled in the Atlantic and Indian oceans. These records were used to define Oligocene and Miocene oxygen isotope zones. In addition, we present isotope data from PETROBRAS Well A drilled in the Campos Basin (Brazil). Ages of isotope events correspond well with the ages of sequence boundaries and maximum flooding surfaces. Because of the good correlation between the isotope and sequence stratigraphic records, we reconfirm that ice-volume change is the common mechanism driving sea-level fluctuations from the Oligocene to present.

  15. The Relationships between Adverse Events, Early Antecedents, and Carbon Dioxide Reactivity as an Intermediate Phenotype of Panic Disorder

    Microsoft Academic Search

    Anna Ogliari; Kristian Tambs; Jennifer R. Harris; Simona Scaini; Cesare Maffei; Ted Reichborn-Kjennerud; Marco Battaglia

    2010-01-01

    Background: Although adverse events have been consistently described to precede and potentially precipitate the onset of panic disorder, there is no information about their ability to alter the individual reactivity to inhaled carbon dioxide, a putative intermediate phenotype of susceptibility to panic disorder. Method: Seven-hundred twelve subjects belonging to the general population-based Norwegian Institute of Public Health Twin Panel underwent

  16. BRCA1 promotes unloading of the CMG helicase from a stalled DNA replication fork.

    PubMed

    Long, David T; Joukov, Vladimir; Budzowska, Magda; Walter, Johannes C

    2014-10-01

    The tumor suppressor protein BRCA1 promotes homologous recombination (HR), a high-fidelity mechanism to repair DNA double-strand breaks (DSBs) that arise during normal replication and in response to DNA-damaging agents. Recent genetic experiments indicate that BRCA1 also performs an HR-independent function during the repair of DNA interstrand crosslinks (ICLs). Here we show that BRCA1 is required to unload the CMG helicase complex from chromatin after replication forks collide with an ICL. Eviction of the stalled helicase allows leading strands to be extended toward the ICL, followed by endonucleolytic processing of the crosslink, lesion bypass, and DSB repair. Our results identify BRCA1-dependent helicase unloading as a critical, early event in ICL repair. PMID:25219499

  17. Organization of DNA Replication

    PubMed Central

    Chagin, Vadim O.; Stear, Jeffrey H.; Cardoso, M. Cristina

    2010-01-01

    The discovery of the DNA double helix structure half a century ago immediately suggested a mechanism for its duplication by semi-conservative copying of the nucleotide sequence into two DNA daughter strands. Shortly after, a second fundamental step toward the elucidation of the mechanism of DNA replication was taken with the isolation of the first enzyme able to polymerize DNA from a template. In the subsequent years, the basic mechanism of DNA replication and its enzymatic machinery components were elucidated, mostly through genetic approaches and in vitro biochemistry. Most recently, the spatial and temporal organization of the DNA replication process in vivo within the context of chromatin and inside the intact cell are finally beginning to be elucidated. On the one hand, recent advances in genome-wide high throughput techniques are providing a new wave of information on the progression of genome replication at high spatial resolution. On the other hand, novel super-resolution microscopy techniques are just starting to give us the first glimpses of how DNA replication is organized within the context of single intact cells with high spatial resolution. The integration of these data with time lapse microscopy analysis will give us the ability to film and dissect the replication of the genome in situ and in real time. PMID:20452942

  18. DNA Replication Origins

    PubMed Central

    Leonard, Alan C.; Méchali, Marcel

    2015-01-01

    The onset of genomic DNA synthesis requires precise interactions of specialized initiator proteins with DNA at sites where the replication machinery can be loaded. These sites, defined as replication origins, are found at a few unique locations in all of the prokaryotic chromosomes examined so far. However, replication origins are dispersed among tens of thousands of loci in metazoan chromosomes, thereby raising questions regarding the role of specific nucleotide sequences and chromatin environment in origin selection and the mechanisms used by initiators to recognize replication origins. Close examination of bacterial and archaeal replication origins reveals an array of DNA sequence motifs that position individual initiator protein molecules and promote initiator oligomerization on origin DNA. Conversely, the need for specific recognition sequences in eukaryotic replication origins is relaxed. In fact, the primary rule for origin selection appears to be flexibility, a feature that is modulated either by structural elements or by epigenetic mechanisms at least partly linked to the organization of the genome for gene expression. PMID:23838439

  19. Recombination enhancement by replication (RER) in Rhizobium etli.

    PubMed Central

    Valencia-Morales, E; Romero, D

    2000-01-01

    Studies in several organisms show that recombination and replication interact closely. Recombinational repair usually requires associated replication at some stage; moreover, additional replication can induce recombination through either homologous or illegitimate events. In prokaryotes, stimulation of recombination by replication is more dramatic when rolling circle replication is employed. In contrast, theta-type replication induces only a modest increase in recombination frequency. In this article, we show that induction of theta-type replication from a supernumerary origin in the symbiotic plasmid (pSym) of Rhizobium etli leads to a 1000-fold increase in deletion formation on this plasmid. These deletions span 120 kb (the symbiotic region) and have as endpoints the reiterated nitrogenase operons. We have named this phenomenon RER, for recombination enhancement by replication. RER is not affected by the position of the replication origin in the pSym, the direction of advance of the replication fork, or the distance from the origin to the recombining repeats. On the other hand, RER is dependent on an active recA allele, indicating that it is due to homologous recombination. RER displays a strong regionality restricted to the symbiotic region. The similarities and differences of RER with the recombination process observed at the terminus of replication of the Escherichia coli chromosome are discussed. PMID:10757747

  20. Accumulation of cell wall hydroxyproline-rich glycoprotein mRNA is an early event in maize embryo cell differentiation.

    PubMed Central

    Ruiz-Avila, L; Burgess, S R; Stiefel, V; Ludevid, M D; Puigdomènech, P

    1992-01-01

    The accumulation of the mRNA coding for a hydroxyproline-rich glycoprotein (HRGP), an abundant component of the wall from the cells of vegetative tissues, has been observed in maize embryo by in situ hybridization. The HRGP mRNA accumulates in the embryo axis and not in the scutellum and preferentially in dividing and provascular cells. The histone H4 mRNA is distributed in similar tissues but is restricted to defined groups of cells, indicating that these two gene products have a different steady-state level of accumulation during the cell cycle. The HRGP mRNA appears to be a useful marker for early formation of the vascular systems. The mRNA accumulation correlates in space and time with cells having a low content of cellulose in their walls, suggesting that the mRNA is produced in the early stages of cell wall formation before complete deposition of cellulose. Images PMID:1549604

  1. Nanosecond laser temperature-jump optical rotatory dispersion: Application to early events in protein folding\\/unfolding

    Microsoft Academic Search

    Eefei Chen; Youxian Wen; James W. Lewis; Robert A. Goldbeck; David S. Kliger; Charlie E. M. Strauss

    2005-01-01

    Nanosecond time-resolved optical rotatory dispersion (TRORD) techniques are coupled with laser temperature-jump (T-jump) triggering in an instrument that measures ultrafast protein folding-unfolding dynamics with high specificity to secondary structure. Far-ultraviolet (UV) ORD can be measured with this instrument over a wide wavelength range at times as early as 35 ns after a 3 ns laser T-jump pulse. The fundamental of

  2. High-resolution late Maastrichtian early Danian oceanic 87Sr\\/86Sr record: Implications for Cretaceous-Tertiary boundary events

    Microsoft Academic Search

    H. B. Vonhof; J. Smit

    1997-01-01

    A high-resolution late Maastrichtian early Danian seawater 87Sr\\/86Sr reference curve is constructed from two Cretaceous-Tertiary boundary (K-T boundary) sections: Bidart (France) and El Kef (Tunisia). The 87Sr\\/86Sr curve shows maxima at 0.3 0.4 Ma before the K-T boundary and at the K-T boundary. The first maximum could mark the onset of a major outflow of the Deccan Traps. The second

  3. Holocene glacier and climate variations in western Norway: Evidence for early Holocene glacier demise and multiple Neoglacial events

    Microsoft Academic Search

    Atle Nesje; Mons Kvamme

    1991-01-01

    Lithostratigraphic and paleobotanical studies suggest that the Jostedalsbreen ice cap probably disappeared during the early Holocene Hypsithermal interval (ca. 8000-6000 B.P.) and re-formed about 5300 B.P. The equilibrium-line altitude was lower than the modern mean equilibrium-line altitude between 2595 ±85 and 2360 ±80 B.P., between 2250 ±65 and 2150 ±80 B.P., between 1740 ±75 and 1730 ±75 B.P., between 1430

  4. Prevalence and Predictors of Early Cardiovascular Events after Kidney Transplantation: Evaluation of Pre-Transplant Cardiovascular Work-Up

    PubMed Central

    Delville, Marianne; Sabbah, Laurent; Girard, Delphine; Elie, Caroline; Manceau, Sandra; Piketty, Marie; Martinez, Frank; Méjean, Arnaud; Legendre, Christophe; Sberro-Soussan, Rebecca

    2015-01-01

    Introduction Cardiovascular disease is the leading cause of mortality after renal transplantation. The purpose of this study was to analyze cardiovascular risk factors at transplantation, occurrence of cardiovascular events in the first year after transplantation and evaluate pre-transplant work-up. Material and Method In total, 244 renal transplant recipients older than 50 years were included. The results of pre-transplant work-up, including clinical evaluation, electrocardiogram, echocardiography, myocardial perfusion testing and coronary angiography were analyzed. Results Patients had multiple risk factors at inclusion on renal transplantation waiting list as high blood pressure (94.7%), dyslipidemia (81.1%), smoking (45.3%), diabetes (23.6%), past history of cardiovascular disease (21.3%) and obesity (12.7%). Following transplantation, 15.5% (n = 38) of patients experienced a cardiovascular event, including 2.8% (n = 7) acute coronary syndrome, 5.8% (n = 14) isolated increase in troponin level and 5.3% (n = 13) new onset atrial fibrillation. The pre-transplant parameters associated with a cardiovascular event were a past medical history of cardiovascular disease (HR = 2.06 [1.06–4.03], p = 0.03), echocardiographic left ventricular hypertrophy (HR = 2.04 [1.04–3.98], p = 0.037) and abnormal myocardial perfusion testing (HR = 2.25 [1.09 –5.96], p = 0.03). Pre-transplantation evaluation allowed the diagnosis of unknown coronary artery lesions in 8.9% of patients. PMID:26107641

  5. Limiting replication initiation factors execute the temporal programme of origin firing in budding yeast

    PubMed Central

    Mantiero, Davide; Mackenzie, Amanda; Donaldson, Anne; Zegerman, Philip

    2011-01-01

    Eukaryotic chromosomes are replicated from multiple origins that initiate throughout the S-phase of the cell cycle. Why all origins do not fire simultaneously at the beginning of S-phase is not known, but two kinase activities, cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK), are continually required throughout the S-phase for all replication initiation events. Here, we show that the two CDK substrates Sld3 and Sld2 and their binding partner Dpb11, together with the DDK subunit Dbf4 are in low abundance in the budding yeast, Saccharomyces cerevisiae. Over-expression of these factors is sufficient to allow late firing origins of replication to initiate early and together with deletion of the histone deacetylase RPD3, promotes the firing of heterochromatic, dormant origins. We demonstrate that the normal programme of origin firing prevents inappropriate checkpoint activation and controls S-phase length in budding yeast. These results explain how the competition for limiting DDK kinase and CDK targets at origins regulates replication initiation kinetics during S-phase and establishes a unique system with which to investigate the biological roles of the temporal programme of origin firing. PMID:22081107

  6. The replication fork trap and termination of chromosome replication.

    PubMed

    Duggin, Iain G; Wake, R Gerry; Bell, Stephen D; Hill, Thomas M

    2008-12-01

    Bacteria that have a circular chromosome with a bidirectional DNA replication origin are thought to utilize a 'replication fork trap' to control termination of replication. The fork trap is an arrangement of replication pause sites that ensures that the two replication forks fuse within the terminus region of the chromosome, approximately opposite the origin on the circular map. However, the biological significance of the replication fork trap has been mysterious, as its inactivation has no obvious consequence. Here we review the research that led to the replication fork trap theory, and we aim to integrate several recent findings that contribute towards an understanding of the physiological roles of the replication fork trap. Likely roles include the prevention of over-replication, and the optimization of post-replicative mechanisms of chromosome segregation, such as that involving FtsK in Escherichia coli. PMID:19019156

  7. Induction of survivin expression by taxol (paclitaxel) is an early event, which is independent of taxol-mediated G2/M arrest.

    PubMed

    Ling, Xiang; Bernacki, Ralph J; Brattain, Michael G; Li, Fengzhi

    2004-04-01

    Survivin is a novel anti-apoptotic protein that is highly expressed in cancer but is undetectable in most normal adult tissues. It was reported that taxol-mediated mitotic arrest of cancer cells is associated with survivin induction, which preserves a survival pathway and results in resistance to taxol. In this study, we provide new evidence that induction of survivin by taxol is an early event and is independent of taxol-mediated G(2)/M arrest. Taxol treatment of MCF-7 cells rapidly up-regulated survivin expression (3.5-15-fold) within 4 h without G(2)/M arrest. Lengthening the treatment of cells (48 h) with taxol resulted in decreased survivin expression in comparison with early times following taxol treatment, although G(2)/M cells were significantly increased at later times. Interestingly, 3 nm taxol induces survivin as effectively as 300 nm and more effectively than 3000 nm. As a result, 3 nm taxol is ineffective at inducing cell death. However, inhibition of taxol-mediated survivin induction by small interfering RNA significantly increased taxol-mediated cell death. Taxol rapidly activated the phosphatidylinositol 3-kinase/Akt and MAPK pathways. Inhibition of these pathways diminished survivin induction and sensitized cells to taxol-mediated cell death. A cis-acting DNA element upstream of -1430 in the survivin pLuc-2840 construct is at least partially responsible for taxol-mediated survivin induction. Together, these data show, for the first time, that taxol-mediated induction of survivin is an early event and independent of taxol-mediated G(2)/M arrest. This appears to be a new mechanism for cancer cells to evade taxol-induced apoptosis. Targeting this survival pathway may result in novel approaches for cancer therapeutics. PMID:14722122

  8. The Early Miocene "Bisciaro volcaniclastic event" (northern Apennines, Italy): a key study for the geodynamic evolution of the central-western Mediterranean

    NASA Astrophysics Data System (ADS)

    Guerrera, Francesco; Martín-Martín, Manuel; Raffaelli, Giuliana; Tramontana, Mario

    2015-01-01

    The Early Miocene Bisciaro Fm., a marly limestone succession cropping out widely in the Umbria-Romagna-Marche Apennines, is characterized by a high amount of volcaniclastic content, characterizing this unit as a peculiar event of the Adria Plate margin. Because of this volcaniclastic event, also recognizable in different sectors of the central-western Mediterranean chains, this formation is proposed as a "marker" for the geodynamic evolution of the area. In the Bisciaro Fm., the volcaniclastic supply starts with the "Raffaello" bed (Earliest Aquitanian) that marks the base of the formation and ends in the lower portion of the Schlier Fm. (Late Burdigalian-Langhian p.p.). Forty-one studied successions allowed the recognition of three main petrofacies: (1) Pyroclastic Deposits (volcanic materials more than 90 %) including the sub-petrofacies 1A, Vitroclastic/crystallo-vitroclastic tuffs; 1B, Bentonitic deposits; and 1C, Ocraceous and blackish layers; (2) Resedimented Syn-Eruptive Volcanogenic Deposits (volcanic material 30-90 %) including the sub-petrofacies 2A, High-density volcanogenic turbidites; 2B, Low-density volcanogenic turbidites; 2C, Crystal-rich volcanogenic deposits; and 2D, Glauconitic-rich volcaniclastites; (3) Mixing of Volcaniclastic Sediments with Marine Deposits (volcanic material 5-30 %, mixed with marine sediments: marls, calcareous marls, and marly limestones). Coeval volcaniclastic deposits recognizable in different tectonic units of the Apennines, Maghrebian, and Betic Chains show petrofacies and chemical-geochemical features related to a similar calc-alkaline magmatism. The characterization of this event led to the hypothesis of a co-genetic relationship between volcanic activity centres (primary volcanic systems) and depositional basins (depositional processes) in the Early Miocene palaeogeographic and palaeotectonic evolution of the central-western Mediterranean region. The results support the proposal of a geodynamic model of this area that considers previously proposed interpretations.

  9. Bio- and chemostratigraphy of the Early Aptian Oceanic Anoxic Event 1a within the mid-latitudes of northwest Europe (Germany, Lower Saxony Basin)

    NASA Astrophysics Data System (ADS)

    Heldt, Matthias; Mutterlose, Joerg; Berner, Uli; Erbacher, Jochen

    2013-04-01

    The Mid-Cretaceous period was characterised by a series of prominent anoxic events, one of these was the late Early Aptian Oceanic Anoxic Event 1a (OAE 1a). The Fischschiefer horizon is the regional sedimentary expression of this event in a small epicontinental sea in northwest Europe (Germany, Lower Saxony Basin). In the present study, two sediment cores of Lower to Upper Aptian age (Hoheneggelsen KB 9 and 40) from the Brunswick area, north Germany, have been investigated in detail with respect to their lithostratigraphy, geochemistry (CaCO3, TOC), biostratigraphy (coccoliths, nannoliths) and high-resolution chemostratigraphy (^13Ccarb and ^13Corg). Together with separately published new planktonic foraminifer data of the cores it was possible to establish a detailed time frame and to recognise the OAE 1a. The ^13C data enabled us to subdivide the deposits into isotope segments (C2-C7), which are commonly used as stratigraphic markers in coeval sediments around the world. The carbon isotope curves are compared to recently published Aptian curves from other parts of the Lower Saxony Basin, all of which record the prominent carbon isotope anomaly of the OAE 1a. A high-resolution correlation of the typical isotope trends of OAE 1a (segments C3-6) across the Lower Saxony Basin appears difficult due to an early diagenetic overprint of the primary isotope signal. These alterations can be explained by the temporary establishment of euxinic conditions the Lower Saxony Basin during OAE 1a as consequence of an interplay of different factors, such as global warming, restricted palaeogeography, increased fluvial input and intensified stable water stratification, which is supported by several lines of regional evidence.

  10. The Early Miocene "Bisciaro volcaniclastic event" (northern Apennines, Italy): a key study for the geodynamic evolution of the central-western Mediterranean

    NASA Astrophysics Data System (ADS)

    Guerrera, Francesco; Martín-Martín, Manuel; Raffaelli, Giuliana; Tramontana, Mario

    2015-06-01

    The Early Miocene Bisciaro Fm., a marly limestone succession cropping out widely in the Umbria-Romagna-Marche Apennines, is characterized by a high amount of volcaniclastic content, characterizing this unit as a peculiar event of the Adria Plate margin. Because of this volcaniclastic event, also recognizable in different sectors of the central-western Mediterranean chains, this formation is proposed as a "marker" for the geodynamic evolution of the area. In the Bisciaro Fm., the volcaniclastic supply starts with the "Raffaello" bed (Earliest Aquitanian) that marks the base of the formation and ends in the lower portion of the Schlier Fm. (Late Burdigalian-Langhian p.p.). Forty-one studied successions allowed the recognition of three main petrofacies: (1) Pyroclastic Deposits (volcanic materials more than 90 %) including the sub-petrofacies 1A, Vitroclastic/crystallo- vitroclastic tuffs; 1B, Bentonitic deposits; and 1C, Ocraceous and blackish layers; (2) Resedimented Syn-Eruptive Volcanogenic Deposits (volcanic material 30-90 %) including the sub-petrofacies 2A, High- density volcanogenic turbidites; 2B, Low- density volcanogenic turbidites; 2C, Crystal- rich volcanogenic deposits; and 2D, Glauconitic- rich volcaniclastites; (3) Mixing of Volcaniclastic Sediments with Marine Deposits (volcanic material 5-30 %, mixed with marine sediments: marls, calcareous marls, and marly limestones). Coeval volcaniclastic deposits recognizable in different tectonic units of the Apennines, Maghrebian, and Betic Chains show petrofacies and chemical-geochemical features related to a similar calc-alkaline magmatism. The characterization of this event led to the hypothesis of a co-genetic relationship between volcanic activity centres (primary volcanic systems) and depositional basins (depositional processes) in the Early Miocene palaeogeographic and palaeotectonic evolution of the central-western Mediterranean region. The results support the proposal of a geodynamic model of this area that considers previously proposed interpretations.

  11. Modeling DNA Replication Intermediates

    SciTech Connect

    Broyde, S.; Roy, D.; Shapiro, R.

    1997-06-01

    While there is now available a great deal of information on double stranded DNA from X-ray crystallography, high resolution NMR and computer modeling, very little is known about structures that are representative of the DNA core of replication intermediates. DNA replication occurs at a single strand/double strand junction and bulged out intermediates near the junction can lead to frameshift mutations. The single stranded domains are particularly challenging. Our interest is focused on strategies for modeling the DNA of these types of replication intermediates. Modeling such structures presents special problems in addressing the multiple minimum problem and in treating the electrostatic component of the force field. We are testing a number of search strategies for locating low energy structures of these types and we are also investigating two different distance dependent dielectric functions in the coulombic term of the force field. We are studying both unmodified DNA and DNA damaged by aromatic amines, carcinogens present in the environment in tobacco smoke, barbecued meats and automobile exhaust. The nature of the structure adopted by the carcinogen modified DNA at the replication fork plays a key role in determining whether the carcinogen will cause a mutation during replication that can initiate the carcinogenic process. In the present work results are presented for unmodified DNA.

  12. DNA Replication Timing

    PubMed Central

    Rhind, Nicholas; Gilbert, David M.

    2015-01-01

    Patterns of replication within eukaryotic genomes correlate with gene expression, chromatin structure, and genome evolution. Recent advances in genome-scale mapping of replication kinetics have allowed these correlations to be explored in many species, cell types, and growth conditions, and these large data sets have allowed quantitative and computational analyses. One striking new correlation to emerge from these analyses is between replication timing and the three-dimensional structure of chromosomes. This correlation, which is significantly stronger than with any single histone modification or chromosome-binding protein, suggests that replication timing is controlled at the level of chromosomal domains. This conclusion dovetails with parallel work on the heterogeneity of origin firing and the competition between origins for limiting activators to suggest a model in which the stochastic probability of individual origin firing is modulated by chromosomal domain structure to produce patterns of replication. Whether these patterns have inherent biological functions or simply reflect higher-order genome structure is an open question. PMID:23838440

  13. Ancient DNA from South-East Europe Reveals Different Events during Early and Middle Neolithic Influencing the European Genetic Heritage.

    PubMed

    Hervella, Montserrat; Rotea, Mihai; Izagirre, Neskuts; Constantinescu, Mihai; Alonso, Santos; Ioana, Mihai; Laz?r, C?t?lin; Ridiche, Florin; Soficaru, Andrei Dorian; Netea, Mihai G; de-la-Rua, Concepcion

    2015-01-01

    The importance of the process of Neolithization for the genetic make-up of European populations has been hotly debated, with shifting hypotheses from a demic diffusion (DD) to a cultural diffusion (CD) model. In this regard, ancient DNA data from the Balkan Peninsula, which is an important source of information to assess the process of Neolithization in Europe, is however missing. In the present study we show genetic information on ancient populations of the South-East of Europe. We assessed mtDNA from ten sites from the current territory of Romania, spanning a time-period from the Early Neolithic to the Late Bronze Age. mtDNA data from Early Neolithic farmers of the Star?evo Cri? culture in Romania (Cârcea, Gura Baciului and Negrile?ti sites), confirm their genetic relationship with those of the LBK culture (Linienbandkeramik Kultur) in Central Europe, and they show little genetic continuity with modern European populations. On the other hand, populations of the Middle-Late Neolithic (Boian, Zau and Gumelni?a cultures), supposedly a second wave of Neolithic migration from Anatolia, had a much stronger effect on the genetic heritage of the European populations. In contrast, we find a smaller contribution of Late Bronze Age migrations to the genetic composition of Europeans. Based on these findings, we propose that permeation of mtDNA lineages from a second wave of Middle-Late Neolithic migration from North-West Anatolia into the Balkan Peninsula and Central Europe represent an important contribution to the genetic shift between Early and Late Neolithic populations in Europe, and consequently to the genetic make-up of modern European populations. PMID:26053041

  14. Ancient DNA from South-East Europe Reveals Different Events during Early and Middle Neolithic Influencing the European Genetic Heritage

    PubMed Central

    Hervella, Montserrat; Rotea, Mihai; Izagirre, Neskuts; Constantinescu, Mihai; Alonso, Santos; Ioana, Mihai; Laz?r, C?t?lin; Ridiche, Florin; Soficaru, Andrei Dorian; Netea, Mihai G.; de-la-Rua, Concepcion

    2015-01-01

    The importance of the process of Neolithization for the genetic make-up of European populations has been hotly debated, with shifting hypotheses from a demic diffusion (DD) to a cultural diffusion (CD) model. In this regard, ancient DNA data from the Balkan Peninsula, which is an important source of information to assess the process of Neolithization in Europe, is however missing. In the present study we show genetic information on ancient populations of the South-East of Europe. We assessed mtDNA from ten sites from the current territory of Romania, spanning a time-period from the Early Neolithic to the Late Bronze Age. mtDNA data from Early Neolithic farmers of the Star?evo Cri? culture in Romania (Cârcea, Gura Baciului and Negrile?ti sites), confirm their genetic relationship with those of the LBK culture (Linienbandkeramik Kultur) in Central Europe, and they show little genetic continuity with modern European populations. On the other hand, populations of the Middle-Late Neolithic (Boian, Zau and Gumelni?a cultures), supposedly a second wave of Neolithic migration from Anatolia, had a much stronger effect on the genetic heritage of the European populations. In contrast, we find a smaller contribution of Late Bronze Age migrations to the genetic composition of Europeans. Based on these findings, we propose that permeation of mtDNA lineages from a second wave of Middle-Late Neolithic migration from North-West Anatolia into the Balkan Peninsula and Central Europe represent an important contribution to the genetic shift between Early and Late Neolithic populations in Europe, and consequently to the genetic make-up of modern European populations. PMID:26053041

  15. Physical activity, additional breast cancer events, and mortality among early-stage breast cancer survivors: findings from the WHEL Study

    Microsoft Academic Search

    Lisa A. Cadmus Bertram; Marcia L. Stefanick; Nazmus Saquib; Loki Natarajan; Ruth E. Patterson; Wayne Bardwell; Shirley W. Flatt; Vicky A. Newman; Cheryl L. Rock; Cynthia A. Thomson; John P. Pierce

    2011-01-01

    Objective  Research suggests that physical activity is associated with improved breast cancer survival, yet no studies have examined\\u000a the association between post-diagnosis changes in physical activity and breast cancer outcomes. The aim of this study was\\u000a to determine whether baseline activity and 1-year change in activity are associated with breast cancer events or mortality.\\u000a \\u000a \\u000a \\u000a \\u000a Methods  A total of 2,361 post-treatment breast cancer

  16. Modulation of HCV Replication After Combination Antiretroviral Therapy in HCV/HIV Coinfected Patients

    PubMed Central

    Sherman, Kenneth E.; Guedj, Jeremie; Shata, Mohamed Tarek; Blackard, Jason T.; Rouster, Susan D.; Castro, Mario; Feinberg, Judith; Sterling, Richard K.; Goodman, Zachary; Aronow, Bruce J.; Perelson, Alan S.

    2015-01-01

    The hepatitis C virus (HCV) is an important contributor to morbidity and mortality in patients coinfected with human immunodeficiency virus (HIV). Coinfection results in increased HCV replication and more rapid rates of liver disease progression. The effect of HIV combination antiretroviral therapy (cART) on HCV replication has not been studied in depth. To address this issue, we enrolled a small cohort of HCV/HIV coinfected patients into a cART initiation trial, and used dynamic modeling combined with evaluation of immune responses and microarray profiles to determine how effective treatment of HIV affects HCV. Treatment with cART resulted in HCV flare and alanine aminotransferase (ALT) increase (2× or more increase from baseline) in a subset of treated patients. Subjects with evidence of hepatic injury (increased ALT) were more likely to have HCV-specific immune responses directed against HCV epitopes. Over time, HCV viral loads declined. Reproducible and biologically important gene expression changes occurred in patients who underwent successful cART, particularly with respect to downregulation of genes with known antiviral roles. Our findings suggest that the effective suppression of HIV by cART initiates a cascade of early and late events in treated patients with HCV. Early events involving downregulation of interferon-stimulated genes may lead to transiently increased viral replication and hepatic injury. At later time points, HCV viral load declines to levels comparable to those seen in the setting of HCV monoinfection. These findings support early antiretroviral therapy in those with HCV/HIV coinfection. PMID:25101888

  17. Unraveling the Early Events of Amyloid-? Protein (A?) Aggregation: Techniques for the Determination of A? Aggregate Size

    PubMed Central

    Pryor, N. Elizabeth; Moss, Melissa A.; Hestekin, Christa N.

    2012-01-01

    The aggregation of proteins into insoluble amyloid fibrils coincides with the onset of numerous diseases. An array of techniques is available to study the different stages of the amyloid aggregation process. Recently, emphasis has been placed upon the analysis of oligomeric amyloid species, which have been hypothesized to play a key role in disease progression. This paper reviews techniques utilized to study aggregation of the amyloid-? protein (A?) associated with Alzheimer’s disease. In particular, the review focuses on techniques that provide information about the size or quantity of oligomeric A? species formed during the early stages of aggregation, including native-PAGE, SDS-PAGE, Western blotting, capillary electrophoresis, mass spectrometry, fluorescence correlation spectroscopy, light scattering, size exclusion chromatography, centrifugation, enzyme-linked immunosorbent assay, and dot blotting. PMID:22489141

  18. Helicase Loading at Chromosomal Origins of Replication

    E-print Network

    Bell, Stephen P.

    Loading of the replicative DNA helicase at origins of replication is of central importance in DNA replication. As the first of the replication fork proteins assemble at chromosomal origins of replication, the loaded helicase ...

  19. Evidence for Proterozoic and late Cretaceous-early Tertiary ore-forming events in the Coeur d'Alene district, Idaho and Montana

    USGS Publications Warehouse

    Leach, D.L.; Hofstra, A.H.; Church, S.E.; Snee, L.W.; Vaughn, R.B.; Zartman, R.E.

    1998-01-01

    New 40Ar/39Ar age spectra on sericite and lead isotope data on tetrahedrite, siderite, galena, bournonite, and stibnite, together with previously published isotopic, geochemical, and geologic studies provide evidence for two major vein-forming events in the Coeur d'Alene district and surrounding area of the Belt basin. The data suggest that the zinc- and lead-rich veins (e.g., Bunker Hill and Star-Morning mines) formed in the Proterozoic (1.0 Ga), whereas the silver-rich veins (e.g., Silver belt mines), antimony veins (e.g., US Antimony mine), and gold-bearing quartz veins (Murry subdistrict) formed in Late Cretaceous to early Tertiary time.

  20. Replicative DNA Polymerases

    PubMed Central

    Johansson, Erik; Dixon, Nicholas

    2013-01-01

    In 1959, Arthur Kornberg was awarded the Nobel Prize for his work on the principles by which DNA is duplicated by DNA polymerases. Since then, it has been confirmed in all branches of life that replicative DNA polymerases require a single-stranded template to build a complementary strand, but they cannot start a new DNA strand de novo. Thus, they also depend on a primase, which generally assembles a short RNA primer to provide a 3?-OH that can be extended by the replicative DNA polymerase. The general principles that (1) a helicase unwinds the double-stranded DNA, (2) single-stranded DNA-binding proteins stabilize the single-stranded DNA, (3) a primase builds a short RNA primer, and (4) a clamp loader loads a clamp to (5) facilitate the loading and processivity of the replicative polymerase, are well conserved among all species. Replication of the genome is remarkably robust and is performed with high fidelity even in extreme environments. Work over the last decade or so has confirmed (6) that a common two-metal ion-promoted mechanism exists for the nucleotidyltransferase reaction that builds DNA strands, and (7) that the replicative DNA polymerases always act as a key component of larger multiprotein assemblies, termed replisomes. Furthermore (8), the integrity of replisomes is maintained by multiple protein–protein and protein–DNA interactions, many of which are inherently weak. This enables large conformational changes to occur without dissociation of replisome components, and also means that in general replisomes cannot be isolated intact. PMID:23732474

  1. CCR4 Controls the Suppressive Effects of Regulatory T Cells on Early and Late Events during Severe Sepsis

    PubMed Central

    Molinaro, Raphael; Pecli, Cyntia; Guilherme, Rafael F.; Alves-Filho, José Carlos; Cunha, Fernando Q.; Canetti, Claudio; Kunkel, Steven L.; Bozza, Marcelo T.; Benjamim, Claudia F.

    2015-01-01

    Sepsis is a deadly disease characterized by an overwhelming release of inflammatory mediators and the activation of different types of cells. This altered state of cell activation, termed leukocyte reprogramming, contributes to patient outcome. However, the understanding of the process underlying sepsis and the role of regulatory T cells (Tregs) in sepsis remains to be elucidated. In this study, we investigated the role of CCR4, the CCL17/CCL22 chemokine receptor, in the innate and acquired immune responses during severe sepsis and the role of Tregs in effecting the outcome. In contrast with wild-type (WT) mice subjected to cecal ligation and puncture (CLP) sepsis, CCR4-deficient (CCR4-/-) septic mice presented an increased survival rate, significant neutrophil migration toward the infection site, a low bacterial count in the peritoneum, and reduced lung inflammation and serum cytokine levels. Thus, a better early host response may favor an adequate long-term response. Consequently, the CCR4-/- septic mice were not susceptible to secondary fungal infection, in contrast with the WT septic mice. Furthermore, Tregs cells from the CCR4-/- septic mice showed reduced suppressive effects on neutrophil migration (both in vivo and in vitro), lymphocyte proliferation and ROS production from activated neutrophils, in contrast with what was observed for Tregs from the WT septic mice. These data show that CCR4 is involved in immunosuppression after severe sepsis and suggest that CCR4+ Tregs negatively modulate the short and long-term immune responses. PMID:26197455

  2. Early signaling events that underlie fate decisions of naive CD4+ T cells towards distinct T-helper cell subsets

    PubMed Central

    Yamane, Hidehiro; Paul, William E.

    2012-01-01

    Summary CD4+ T-helper (Th) cells are a major cell population that plays an important role in governing acquired immune responses to a variety of foreign antigens as well as inducing some types of autoimmune diseases. There are at least four distinct Th cell subsets (Th1, Th2, Th17, and inducible T-regulatory cells), each of which has specialized functions to control immune responses. Each of these cell types emerge from naive CD4+ T cells after encounter with foreign antigens presented by dendritic cells (DCs). Each Th cell subset expresses a unique set of transcription factors and produce hallmark cytokines. Both T-cell receptor (TCR)-mediated stimulation and the cytokine environment created by activated CD4+ T cells themselves, by `partner' DCs and/or other cell types during the course of differentiation, play an important role in the fate decisions towards distinct Th subsets. Here, we review how TCR-mediated signals in collaboration with the cytokine environment influence the fate decisions of naive CD4+ T cells towards distinct Th subsets at the early stages of activation. We also discuss the roles of TCR-proximal signaling intermediates and of the Notch pathway in regulating the differentiation to distinct Th phenotypes. PMID:23405892

  3. A dihydro-pyrido-indole potently inhibits HSV-1 infection by interfering the viral immediate early transcriptional events.

    PubMed

    Bag, Paromita; Ojha, Durbadal; Mukherjee, Hemanta; Halder, Umesh C; Mondal, Supriya; Biswas, Aruna; Sharon, Ashoke; Van Kaer, Luc; Chakrabarty, Sekhar; Das, Gobardhan; Mitra, Debashis; Chattopadhyay, Debprasad

    2014-05-01

    In our continued quest for identifying novel molecules from ethnomedicinal source we have isolated an alkaloid 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole, also known as Harmaline (HM), from an ethnomedicinal herb Ophiorrhiza nicobarica. The compound exhibited a potent anti-HSV-1 activity against both wild type and clinical isolates of HSV-1. Further we demonstrated that HM did not interfere in viral entry but the recruitment of lysine-specific demethylase-1 (LSD1) and the binding of immediate-early (IE) complex on ICP0 promoter. This leads to the suppression of viral IE gene synthesis and thereby the reduced expression of ICP4 and ICP27. Moreover, HM at its virucidal concentration is nontoxic and reduced virus yields in cutaneously infected Balb/C mice. Thus, the interference in the binding of IE complex, a decisive factor for HSV lytic cycle or latency by HM reveals an interesting target for developing non-nucleotide antiherpetic agent with different mode of action than Acyclovir. PMID:24576908

  4. Mutations altering the gammaretrovirus endoproteolytic motif affect glycosylation of the envelope glycoprotein and early events of the virus life cycle.

    PubMed

    Argaw, Takele; Wilson, Carolyn A

    2015-01-15

    Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectors with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription. PMID:25462351

  5. Purinergic signaling in early inflammatory events of the foreign body response: modulating extracellular ATP as an enabling technology for engineered implants and tissues.

    PubMed

    Rhett, J Matthew; Fann, Stephen A; Yost, Michael J

    2014-10-01

    Purinergic signaling is a ubiquitous and vital aspect of mammalian biology in which purines--mainly adenosine triphosphate (ATP)--are released from cells through loss of membrane integrity (cell death), exocytosis, or transport/diffusion across membrane channels, and exert paracrine or autocrine signaling effects through three subclasses of well-characterized receptors: the P1 adenosine receptors, the P2X ionotropic nucleotide receptors, and the P2Y metabotropic receptors. ATP and its metabolites are released by damaged and stressed cells in injured tissues. The early events of wound healing, hemostasis, and inflammation are highly regulated by these signals through activation of purinergic receptors on platelets and neutrophils. Recent data have demonstrated that ATP signaling is of particular importance to targeting leukocytes to sites of injury. This is particularly relevant to the subject of implanted medical devices, engineered tissues, and grafts as all these technologies elicit a wound healing response with varying degrees of encapsulation, rejection, extrusion, or destruction of the tissue or device. Here, we review the biology of purinergic signaling and focus on ATP release and response mechanisms that pertain to the early inflammatory phase of wound healing. Finally, therapeutic options are explored, including a new class of peptidomimetic drugs based on the ATP-conductive channel connexin43. PMID:24279914

  6. Root Secreted Metabolites and Proteins Are Involved in the Early Events of Plant-Plant Recognition Prior to Competition

    PubMed Central

    Badri, Dayakar V.; De-la-Peña, Clelia; Lei, Zhentian; Manter, Daniel K.; Chaparro, Jacqueline M.; Guimarães, Rejane L.; Sumner, Lloyd W.; Vivanco, Jorge M.

    2012-01-01

    The mechanism whereby organisms interact and differentiate between others has been at the forefront of scientific inquiry, particularly in humans and certain animals. It is widely accepted that plants also interact, but the degree of this interaction has been constricted to competition for space, nutrients, water and light. Here, we analyzed the root secreted metabolites and proteins involved in early plant neighbor recognition by using Arabidopsis thaliana Col-0 ecotype (Col) as our focal plant co-cultured in vitro with different neighbors [A. thaliana Ler ecotype (Ler) or Capsella rubella (Cap)]. Principal component and cluster analyses revealed that both root secreted secondary metabolites and proteins clustered separately between the plants grown individually (Col-0, Ler and Cap grown alone) and the plants co-cultured with two homozygous individuals (Col-Col, Ler-Ler and Cap-Cap) or with different individuals (Col-Ler and Col-Cap). In particularly, we observed that a greater number of defense- and stress- related proteins were secreted when our control plant, Col, was grown alone as compared to when it was co-cultured with another homozygous individual (Col-Col) or with a different individual (Col-Ler and Col-Cap). However, the total amount of defense proteins in the exudates of the co-cultures was higher than in the plant alone. The opposite pattern of expression was identified for stress-related proteins. These data suggest that plants can sense and respond to the presence of different plant neighbors and that the level of relatedness is perceived upon initial interaction. Furthermore, the role of secondary metabolites and defense- and stress-related proteins widely involved in plant-microbe associations and abiotic responses warrants reassessment for plant-plant interactions. PMID:23056382

  7. Losses of Chromosomes 1p and 3q Are Early Genetic Events in the Development of Sporadic Pheochromocytomas

    PubMed Central

    Dannenberg, Hilde; Speel, Ernst J.M.; Zhao, Jianming; Saremaslani, Parvin; van der Harst, Erwin; Roth, Jürgen; Heitz, Philipp U.; Bonjer, H. Jaap; Dinjens, Winand N.M.; Mooi, Wolter J.; Komminoth, Paul; de Krijger, Ronald R.

    2000-01-01

    Despite several loss of heterozygosity studies, a comprehensive genomic survey of pheochromocytomas is still lacking. To identify DNA copy number changes which might be important in tumor development and progression and which may have diagnostic utility, we evaluated genetic aberrations in 29 sporadic adrenal and extra-adrenal pheochromocytomas (19 clinically benign tumors and 10 malignant lesions). Comparative genomic hybridization was performed using directly fluorochrome-conjugated DNA extracted from frozen (16) and paraffin-embedded (13) tumor tissues. The most frequently observed changes were losses of chromosomes 1p11–p32 (86%), 3q (52%), 6q (34%), 3p, 17p (31% each), 11q (28%), and gains of chromosomes 9q (38%) and 17q (31%). No amplification was identified and no difference between adrenal and extra-adrenal tumors was detected. Progression to malignant tumors was strongly associated with deletions of chromosome 6q (60% versus 21% in clinically benign lesions, P = 0.0368) and 17p (50% versus 21%). Fluorescence in situ hybridization confirmed the comparative genomic hybridization data of chromosomes 1p, 3q, and 6q, and revealed aneuploidy in some tumors. Our results suggest that the development of pheochromocytomas is associated with specific genomic aberrations, such as losses of 1p, 3q, and 6q and gains of 9q and 17q. In particular, tumor suppressor genes on chromosomes 1p and 3q may be involved in early tumorigenesis, and deletions of chromosomes 6q and 17p in progression to malignancy. PMID:10934139

  8. Late, not early mismatch responses to changes in frequency are reduced or deviant in children with dyslexia: an event-related potential study

    PubMed Central

    2014-01-01

    Background Developmental disorders of oral and written language have been linked to deficits in the processing of auditory information. However, findings have been inconsistent, both for behavioural and electrophysiological measures. Methods In this study, we examined event-related potentials (ERPs) in 20 6- to 14-year-old children with developmental dyslexia and 20 age-matched controls, divided into younger (6–11 years, n?=?10) and older (11–14 years, n?=?10) age bands. We focused on early (mismatch negativity; MMN) and late (late discriminative negativity; LDN) conventional mismatch responses and associated measures derived from time-frequency analysis (inter-trial coherence and event-related spectral perturbation). Responses were elicited using an auditory oddball task, whereby a stream of 1000-Hz standards was interspersed with rare large (1,200 Hz) and small (1,030 Hz) frequency deviants. Results Conventional analyses revealed no significant differences between groups in the size of the MMN to either large or small frequency deviants. However, the younger age band of children with dyslexia showed an enhanced inter-trial coherence in the theta frequency band over the time window corresponding to the MMN to small deviants. By contrast, these same children showed a reduced-amplitude LDN for the small deviants relative to their age-matched controls, whilst the older children with dyslexia showed a shorter and less intense period of event-related desynchronization over this time window. Conclusions Initial detection and discrimination of auditory frequency change appears normal or even enhanced in children with dyslexia. Rather, deficits in late-stage auditory processing appear to be a feature of this population. PMID:25110526

  9. The Combined Effect of Nursing Support and Adverse Event Mitigation on Adherence to Interferon Beta-1b Therapy in Early Multiple Sclerosis: The START Study.

    PubMed

    Dhib-Jalbut, Suhayl; Markowitz, Clyde; Patel, Payal; Boateng, Francis; Rametta, Mark

    2012-01-01

    There is limited clinical evidence on the impact of nurse support and adverse event (AE) mitigation techniques on adherence to interferon beta-1b (IFN?-1b) therapy in multiple sclerosis (MS) in a real-world setting. The aim of the Success of Titration, analgesics, and BETA nurse support on Acceptance Rates in MS Treatment (START) trial was to assess the combined effect of titration, analgesics, and BETA (Betaseron Education, Training, Assistance) nurse support on adherence to IFN?-1b therapy in patients with early-onset MS and to evaluate safety. Participants were instructed to titrate IFN?-1b and use analgesics to minimize flu-like symptoms. All received BETA nurse follow-up at frequent intervals: live training, two telephone calls during the first month of therapy, and monthly calls thereafter. Participants were considered adherent if they took at least 75% of the total prescribed doses over 12 months (?75% compliance). Safety was monitored via reported AEs and laboratory test results. Participants who took at least one IFN?-1b dose over 12 months were analyzed (N = 104); 73.8% of participants completed the study. The mean age of participants was 37.2 years; 72.1% were women and 78.8% were white. Ninety participants had relapsing-remitting MS and 14 had clinically isolated syndrome. The mean compliance rate, reported for 96 participants with complete dose interruption records, was 84.4%. At 12 months, 78.1% of participants were considered adherent. The serious adverse event rate was 9.6%; most events were unrelated to therapy. Thus in the START study, in which participants received nursing support combined with dose titration and use of analgesics, the majority of participants were adherent to therapy. PMID:24453752

  10. Aluminum-26 in H4 chondrites: Implications for its production and its usefulness as a fine-scale chronometer for early solar system events

    NASA Astrophysics Data System (ADS)

    Zinner, Ernst; Göpel, Christa

    2002-07-01

    In order to investigate whether or not 26Al can be used as a fine-scale chronometer for early-solar-system events we measured, with an ion microprobe, Mg isotopes and Al/Mg ratios in separated plagioclase, olivine, and pyroxene crystals from the H4 chondrites Ste. Marguerite, Forest Vale, Beaver Creek and Quenggouk and compared the results with the canonical 26Al/27Al ratio for Ca,Al-rich inclusions (CAIs). For Ste. Marguerite (SM) and Forest Vale (FV) Pb/Pb and Mn-Cr ages have previously been determined (Göpel et al., 1994; Polnau et al., 2000; Polnau and Lugmair, 2001). Plagioclase grains from these two meteorites show clear excesses of 26Mg. The 26Al/27Al ratios inferred from these excesses and from isotopically normal Mg in pyroxene and olivine are (2.87+/-0.64)x10-7 for SM and (1.52+/-0.52)x10-7 for FV. The differences between these ratios and the ratio of 5x10-5 in CAIs indicate time differences of 5.4+/-0.1 Ma and 6.1+/-0.2 Ma for SM and FV, respectively. These differences are in agreement with the absolute Pb/Pb ages for CAIs and SM and FV phosphates but there are large discrepancies between the U-Pb and Mn-Cr system for the relative ages for CAIs, SM and FV. For example, Mn-Cr ages of carbonates from Kaidun are older than the Pb/Pb age of CAIs. However, even if we require that CAIs are older than these carbonates, the time difference between this "adjusted" CAI age and the Mn-Cr ages of SM and FV require that 26Al was widely distributed in the early solar system at the time of CAI formation and was not mostly present in CAIs, a feature of the X-wind model proposed by Shu and collaborators (Gounelle et al., 2001; Shu et al., 2001). From this we conclude that there was enough 26Al to melt small planetary bodies as long as they formed within 2 Ma of CAIs, and that 26Al can serve as a fine-scale chronometer for early solar system events.

  11. DNA Replicating Itself

    NSDL National Science Digital Library

    Access Excellence

    2005-03-12

    A simplified representation of a DNA molecule separating to form two new molecules.   To reproduce, a cell must copy and transmit its genetic information (DNA) to all of its progeny. To do so, DNA replicates, following the process of semiconservative replication. Each strand of the original molecule acts as a template for the synthesis of a new complementary DNA molecule. The two strands of the double helix are first separated by enzymes. With the assistance of other enzymes, spare parts available inside the cell are bound to the individual strands following the rules of complementary base pairing: adenine (A) to thymine (T) and guanine (G) to cytosine (C). Two strands of DNA are obtained from one, having produced two daughter molecules which are identical to one another and to the parent molecule.

  12. Timing of Early Proterozoic Collisional and Extensional Events in the Granulite-Gneiss-Charnockite-Granite Complex, Lake Baikal, USSR: A UPb, Rb-Sr, and Sm-Nd Isotopic Study

    Microsoft Academic Search

    M. Aftalion; E. V. Bibikova; D. R. Bowes; A. M. Hopgood; L. L. Perchuk

    1991-01-01

    In the Sharyzhalgay Complex of the Lake Baikal region in eastern Siberia Early Proterozoic collisional and extensional events were separated by ca. 100 m.yr. The earlier collisional event, associated with the development of granulites and gneisses as the result of high-grade dynamothermal metamorphism, took place close to 1965 {plus minus} 4 Ma. A ²°⁷Pb\\/²°⁴Pb vs. ²°⁶Pb\\/²°⁴Pb isochron for zircon from

  13. Simple systems that exhibit self-directed replication

    NASA Technical Reports Server (NTRS)

    Reggia, James A.; Armentrout, Steven L.; Chou, Hui-Hsien; Peng, Yun

    1993-01-01

    Biological experience and intuition suggest that self-replication is an inherently complex phenomenon, and early cellular automata models support that conception. More recently, simpler computational models of self-directed replication called sheathed loops have been developed. It is shown here that 'unsheathing' these structures and altering certain assumptions about the symmetry of their components leads to a family of nontrivial self-replicating structures some substantially smaller and simpler than those previously reported. The dependence of replication time and transition function complexity on initial structure size, cell state symmetry, and neighborhood are examined. These results support the view that self-replication is not an inherently complex phenomenon but rather an emergent property arising from local interactions in systems that can be much simpler than is generally believed.

  14. Choreography of the Mycobacterium Replication Machinery during the Cell Cycle

    PubMed Central

    Trojanowski, Damian; Ginda, Katarzyna; Pióro, Monika; Ho?ówka, Joanna; Skut, Partycja; Jakimowicz, Dagmara

    2015-01-01

    ABSTRACT It has recently been demonstrated that bacterial chromosomes are highly organized, with specific positioning of the replication initiation region. Moreover, the positioning of the replication machinery (replisome) has been shown to be variable and dependent on species-specific cell cycle features. Here, we analyzed replisome positions in Mycobacterium smegmatis, a slow-growing bacterium that exhibits characteristic asymmetric polar cell extension. Time-lapse fluorescence microscopy analyses revealed that the replisome is slightly off-center in mycobacterial cells, a feature that is likely correlated with the asymmetric growth of Mycobacterium cell poles. Estimates of the timing of chromosome replication in relation to the cell cycle, as well as cell division and chromosome segregation events, revealed that chromosomal origin-of-replication (oriC) regions segregate soon after the start of replication. Moreover, our data demonstrate that organization of the chromosome by ParB determines the replisome choreography. PMID:25691599

  15. Expression of human E46K-mutated ?-synuclein in BAC-transgenic rats replicates early-stage Parkinson’s disease features and enhances vulnerability to mitochondrial impairment

    PubMed Central

    Cannon, Jason R.; Geghman, Kindiya D.; Tapias, Victor; Sew, Thomas; Dail, Michelle K.; Li, Chenjian; Greenamyre, J. Timothy

    2012-01-01

    Parkinson’s disease (PD), the second most common neurodegenerative disorder, is etiologically heterogeneous, with most cases thought to arise from a combination of environmental factors and genetic predisposition; about 10% of cases are caused by single gene mutations. While neurotoxin models replicate many of the key behavioral and neurological features, they often have limited relevance to human exposures. Genetic models replicate known disease-causing mutations, but are mostly unsuccessful in reproducing major features of PD. In this study, we created a BAC (bacterial artificial chromosome) transgenic rat model of PD expressing the E46K mutation of ?-synuclein, which is pathogenic in humans. The mutant protein was expressed at levels ~2–3-fold above endogenous ?-synuclein levels. At 12 months of age, there was no overt damage to the nigrostriatal dopamine system; however, (i) alterations in striatal neurotransmitter metabolism, (ii) accumulation and aggregation of ?-synuclein in nigral dopamine neurons, and (iii) evidence of oxidative stress suggest this model replicates several preclinical features of PD. Further, when these animals were exposed to rotenone, a mitochondrial toxin linked to PD, they showed heightened sensitivity, indicating that ?-synuclein expression modulates the vulnerability to mitochondrial impairment. We conclude that these animals are well-suited to examination of gene-environment interactions that are relevant to PD. PMID:23153578

  16. Late gene expression from the Epstein-Barr virus BcLF1 and BFRF3 promoters does not require DNA replication in cis.

    PubMed Central

    Serio, T R; Kolman, J L; Miller, G

    1997-01-01

    Late gene expression follows and is dependent upon lytic replication of the viral genome. Although experimental evidence is lacking, lytic viral DNA replication is believed to remove modifications or binding factors from the genome which serve to repress late gene expression during latency or the early lytic cycle. We have developed a reporter assay to begin characterizing the mechanisms that regulate late gene expression in Epstein-Barr virus (EBV). In this model system, the activities of late promoter-reporter fusions are measured following transient transfection into tissue culture cells expressing EBV during different stages of the lytic cycle. This system faithfully recapitulates late expression patterns from the endogenous virus, implicating specific cis-active sequences in the control of late gene expression. In addition, these promoters respond only indirectly to the viral immediate-early transactivator, ZEBRA. This indirect response is mediated by other viral or virally induced activities downstream of ZEBRA in the lytic cascade. In this system, late gene expression is sensitive to inhibitors of the viral DNA polymerase such as phosphonoacetic acid, although the reporters lack a eukaryotic origin of replication and are not replicated under the assay conditions. Thus, replication of the transcriptional template is not a prerequisite for expression with late kinetics, a finding inconsistent with the current models which posit a cis-active relationship between lytic EBV DNA replication and late gene expression. Rather, analysis of this system has revealed a trans relationship between late gene expression and viral DNA replication and highlights the indirect and complex link between these two events. PMID:9343231

  17. Effects of the Deletion of Early Region 4 (E4) Open Reading Frame 1 (orf1), orf1-2, orf1-3 and orf1-4 on Virus-Host Cell Interaction, Transgene Expression, and Immunogenicity of Replicating Adenovirus HIV Vaccine Vectors

    PubMed Central

    Thomas, Michael A.; Song, Rui; Demberg, Thorsten; Vargas-Inchaustegui, Diego A.; Venzon, David; Robert-Guroff, Marjorie

    2013-01-01

    The global health burden engendered by human immunodeficiency virus (HIV)-induced acquired immunodeficiency syndrome (AIDS) is a sobering reminder of the pressing need for a preventative vaccine. In non-human primate models replicating adenovirus (Ad)-HIV/SIV recombinant vaccine vectors have been shown to stimulate potent immune responses culminating in protection against challenge exposures. Nonetheless, an increase in the transgene carrying capacity of these Ad vectors, currently limited to approximately 3000 base pairs, would greatly enhance their utility. Using a replicating, E3-deleted Ad type 5 host range mutant (Ad5 hr) encoding full-length single-chain HIVBaLgp120 linked to the D1 and D2 domains of rhesus macaque CD4 (rhFLSC) we systematically deleted the genes encoding early region 4 open reading frame 1 (E4orf1) through E4orf4. All the Ad-rhFLSC vectors produced similar levels of viral progeny. Cell cycle analysis of infected human and monkey cells revealed no differences in virus-host interaction. The parental and E4-deleted viruses expressed comparable levels of the transgene with kinetics similar to Ad late proteins. Similar levels of cellular immune responses and transgene-specific antibodies were elicited in vaccinated mice. However, differences in recognition of Ad proteins and induced antibody subtypes were observed, suggesting that the E4 gene products might modulate antibody responses by as yet unknown mechanisms. In short, we have improved the transgene carrying capacity by one thousand base pairs while preserving the replicability, levels of transgene expression, and immunogenicity critical to these vaccine vectors. This additional space allows for flexibility in vaccine design that could not be obtained with the current vector and as such should facilitate the goal of improving vaccine efficacy. To the best of our knowledge, this is the first report describing the effects of these E4 deletions on transgene expression and immunogenicity in a replicating Ad vector. PMID:24143187

  18. Acceleration of large active earthflows triggered by massive snow accumulation events: evidences from monitoring the Corvara landslide in early 2014 (Dolomites, Italy)

    NASA Astrophysics Data System (ADS)

    Corsini, Alessandro; Mulas, Marco; Marcato, Gianluca; Chinellato, Giulia; Mair, Volkmar

    2015-04-01

    In the Dolomites of Italy, snowfall during winter 2013/2014 was exceptionally abundant. Major snowfall events occurred from late December 2013 to mid-March 2014. Snow accumulation in Badia Valley peaked in early February: from 2 to 4 meters with a positive gradient respect to altimetry and accordingly to wind accumulation zones. Below 2000 m asl, due to the mild temperatures recorded before the onset of snowfall, the relatively dry snow cover was mostly deposited on top of unfrozen soils. The Corvara landslide is a large active earthflow located close to Corvara in Badia, at an elevation from 2000 to 1600 m. It's displacement rate before, during and after the exceptional snowfall period was monitored at high temporal frequency. Surface displacement was measured bi-weekly by differential GPS in several benchmarks in the source, track and accumulation zone. Deep displacement was monitored semi-continuously by two in-place inclinometers at 48 m depth in the accumulation zone, across the main deep-seated sliding surface. Results show an acceleration of movements, both at surface and at depth, soon after the massive snow accumulation event of 31st January to 2nd February 2014, which suddenly increased snow thickness from 1 to more than 2 metres. Short time lags between the onset of the acceleration of movements in the source, the track and the accumulation zones were also recorded. The landslide then maintained a relatively constant velocity during the high snow cover period extended to earlyApril and underwent a progressive deceleration during the snowmelt period that lasted until mid-June. The fact that the acceleration of the Corvara earthflow was triggered by a massive and rapid snow accumulation event, provides a quite different perspective from the generally adopted one that considers the destabilizing effect of snow only in relation to the increase of groundwater level during rapid snowmelt. A full explanation of the processes associated to the dynamics observed in Corvara is undoubtedly still an open issue. However, it can be tentatively speculated that in the some sectors of the source and track zone, where sliding surfaces are relatively shallow -around 15 m deep -, the weight of the copiously fallen snow induced a distributed undrained loading in the already fully saturated and confined landslide mass. Or, alternatively, that snow accumulation over the unfrozen soil induced groundwater levels above the ground. To explain how acceleration of movements occurred as deep as 48 m in the accumulation zone, it might be argued that the mass and/or the pore pressure transfer from the track to the accumulation zone - evidenced by the time lag of velocity peaks- can have played a role in indirectly transferring to the accumulation zone the acceleration induced by massive snowfall in the track zone. To provide more robust answers, further monitoring data collection and analysis is needed. Thus, while waiting for other massive snowfall events, three continuous GPS receivers and a water pressure transducer in the soil have been added to the monitoring network during 2014.

  19. MKP-1 Signaling Events are Required for Early Osteoclastogenesis in Lineage Defined Progenitor Populations by Disrupting RANKL-Induced NFATc1 Nuclear Translocation

    PubMed Central

    Valerio, Michael S.; Herbert, Bethany A.; Griffin, Alfred C.; Wan, Zhuang; Hill, Elizabeth G.; Kirkwood, Keith L.

    2013-01-01

    Cytokine-directed osteoclastogenesis is initiated in response to macrophage colony stimulating factor (M-CSF) and receptor activator of NF-?B ligand (RANKL), to drive formation of osteoclasts (OC), large bone resorptive cells of hematopoietic origin. RANKL-induced signaling activates the MAPK pathways, which initiates nuclear translocation of the master regulator of osteoclast formation, transcription factor NFATc1. Proper control over these signaling events is essential to normal OC formation response to stimuli. MAPK phosphatase 1 (MKP-1), a serine and tyrosine phosphatase encoded by the gene Dusp1, functions to dephosphorylate and subsequently inactivate MAPK (p38 and JNK) signaling essential in osteoclastogenesis. Here, we explored the role of MKP-1 during RANKL-driven osteoclastogenesis from defined (B220/CD45? GR1?CD11blo/?CD115+) OC progenitor (dOCP) populations using WT and Dusp1?/? global knockout mice. Sorted cells were driven to OC by M-CSF pre-treatment followed by RANKL stimulation for 3 days. OC formation and qPCR products were analyzed for maturation. Results indicate that Dusp1?/? dOCP form less numerous, significantly smaller and less functional OC compared to WT controls. These data were corroborated by mRNA expression of the key OC genes, Nfatc1 and Tm7sf4 (DC-STAMP), which were significantly reduced in early osteoclastogenesis in OC progenitor from Dusp1?/? mice. Intriguingly, our data reveals that MKP-1 may positively control OC formation in response to RANKL by regulating NFATc1 nuclear translocation. Collectively, this report supports the idea that MKP-1 signaling is essential in early osteoclastogenesis in response to RANKL-induced signaling. PMID:24269279

  20. Crosstalk between intestinal microbiota, adipose tissue and skeletal muscle as an early event in systemic low-grade inflammation and the development of obesity and diabetes.

    PubMed

    Bleau, Christian; Karelis, Antony D; St-Pierre, David H; Lamontagne, Lucie

    2014-10-28

    Obesity is associated with a systemic chronic low-grade inflammation that contributes to the development of metabolic disorders such as cardiovascular diseases and type 2 diabetes. However, the etiology of this obesity-related pro-inflammatory process remains unclear. Most studies have focused on adipose tissue dysfunctions and/or insulin resistance in skeletal muscle cells as well as changes in adipokine profile and macrophage recruitment as potential sources of inflammation. However, low-grade systemic inflammation probably involves a complex network of signals interconnecting several organs. Recent evidences have suggested that disturbances in the composition of the gut microbial flora and alterations in levels of gut peptides following the ingestion of a high-fat diet may be a cause of low-grade systemic inflammation that may even precede and predispose to obesity, metabolic disorders or type 2 diabetes. This hypothesis is appealing because the gastrointestinal system is first exposed to nutrients and may thereby represent the first link in the chain of events leading to the development of obesity-associated systemic inflammation. Therefore, the present review will summarize the latest advances interconnecting intestinal mucosal bacteria-mediated inflammation, adipose tissue and skeletal muscle in a coordinated circuitry favouring the onset of a high-fat diet-related systemic low-grade inflammation preceding obesity and predisposing to metabolic disorders and/or type 2 diabetes. A particular emphasis will be given to high-fat diet-induced alterations of gut homeostasis as an early initiator event of mucosal inflammation and adverse consequences contributing to the promotion of extended systemic inflammation, especially in adipose and muscular tissues. Copyright © 2014 John Wiley & Sons, Ltd. PMID:25352002

  1. Chk1 promotes replication fork progression by controlling replication initiation.

    PubMed

    Petermann, Eva; Woodcock, Mick; Helleday, Thomas

    2010-09-14

    DNA replication starts at initiation sites termed replication origins. Metazoan cells contain many more potential origins than are activated (fired) during each S phase. Origin activation is controlled by the ATR checkpoint kinase and its downstream effector kinase Chk1, which suppresses origin firing in response to replication blocks and during normal S phase by inhibiting the cyclin-dependent kinase Cdk2. In addition to increased origin activation, cells deficient in Chk1 activity display reduced rates of replication fork progression. Here we investigate the causal relationship between increased origin firing and reduced replication fork progression. We use the Cdk inhibitor roscovitine or RNAi depletion of Cdc7 to inhibit origin firing in Chk1-inhibited or RNAi-depleted cells. We report that Cdk inhibition and depletion of Cdc7 can alleviate the slow replication fork speeds in Chk1-deficient cells. Our data suggest that increased replication initiation leads to slow replication fork progression and that Chk1 promotes replication fork progression during normal S phase by controlling replication origin activity. PMID:20805465

  2. Chk1 promotes replication fork progression by controlling replication initiation

    PubMed Central

    Petermann, Eva; Woodcock, Mick; Helleday, Thomas

    2010-01-01

    DNA replication starts at initiation sites termed replication origins. Metazoan cells contain many more potential origins than are activated (fired) during each S phase. Origin activation is controlled by the ATR checkpoint kinase and its downstream effector kinase Chk1, which suppresses origin firing in response to replication blocks and during normal S phase by inhibiting the cyclin-dependent kinase Cdk2. In addition to increased origin activation, cells deficient in Chk1 activity display reduced rates of replication fork progression. Here we investigate the causal relationship between increased origin firing and reduced replication fork progression. We use the Cdk inhibitor roscovitine or RNAi depletion of Cdc7 to inhibit origin firing in Chk1-inhibited or RNAi-depleted cells. We report that Cdk inhibition and depletion of Cdc7 can alleviate the slow replication fork speeds in Chk1-deficient cells. Our data suggest that increased replication initiation leads to slow replication fork progression and that Chk1 promotes replication fork progression during normal S phase by controlling replication origin activity. PMID:20805465

  3. Taxonomy by Carbon Replication

    PubMed Central

    Dietz, Alma; Mathews, John

    1962-01-01

    Pre-shadowed carbon replication of spore surfaces (carbon repligraphy) provides a new technique for the characterization of streptomycetes. Carbon repligraphs of five members of the Streptomyces hygroscopicus complex show two distinct types. Type I shows a nonsegmented spore structure with an extremely wrinkled surface. Type II has a segmented spore chain with detailed surface structure resembling a basket weave. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 FIG. 5 FIG. 6 FIG. 7 FIG. 8 FIG. 9 FIG. 10 FIG. 11 FIG. 12 FIG. 13 FIG. 14 FIG. 15 FIG. 16 FIG. 17 PMID:13886326

  4. Role of replication time in the control of tissue-specific gene expression.

    PubMed Central

    Holmquist, G P

    1987-01-01

    Late-replicating chromatin in vertebrates is repressed. Housekeeping (constitutively active) genes always replicate early and are in the early-replicating R-bands. Tissue-specific genes are usually in the late-replicating G-bands and therein almost always replicate late. Within the G-bands, however, a tissue-specific gene does replicate early in those cell types that express that particular gene. While the condition of late replication may simply be coincident with gene repression, we review evidence suggesting that late replication may actively determine repression. As mammals utilize a developmental program to Lyonize (facultatively heterochromatinize) whole X chromosomes to a late-replicating and somatically heritable repressed state, similarly another program seems to Lyonize individual replicons. In frogs, all genes begin embryogenesis by replicating during a very short interval. As the developmental potency of embryonic cells becomes restricted, late-replicating DNA gradually appears. This addition to the repertoire of gene control--i.e., repression via Lyonization of individual replicons--seems to have evolved in vertebrates with G-bands being a manifestation of the mechanism. PMID:3551593

  5. Developmental defects of enamel in primary teeth and association with early life course events: a study of 6–36 month old children in Manyara, Tanzania

    PubMed Central

    2013-01-01

    Background Children with low birth weight show an increased prevalence of developmental defects of enamel in the primary dentition that subsequently may predispose to early childhood caries (ECC). Focusing 6–36 months old, the purpose of this study was to assess the frequency of enamel defects in the primary dentition and identify influences of early life course factors; socio-demographics, birth weight, child’s early illness episodes and mothers’ perceived size of the child at birth, whilst controlling for more recent life course events in terms of current breastfeeding and oral hygiene. Methods A cross-sectional study was conducted in the high fluoride area of Manyara, northern Tanzania including 1221 child-mother pairs who attended Reproductive and Child Health (RCH) clinics for immunization and/or growth monitoring. After the primary caregivers had completed face to face interviews at the health care facility, children underwent oral clinical examination whereby ECC and developmental defects of enamel were recorded using field criteria. All erupted teeth were examined and the enamel defects were assessed on buccal surfaces according to the modified DDE Index. Results The prevalence of enamel defects was 33.3%. Diffuse opacities were the most common defects identified (23.1%), followed by hypoplasia (7.6%) and demarcated opacities (5.0%). The most frequently affected teeth were the upper central incisors (29.0% - 30.5%), whereas lower central incisors (4.3% to 4.5%) were least frequently affected. Multiple logistic regression analysis, adjusting for confounding the factors revealed that having normal birth weight (equal or more than 2500 g) associated with lower odds of having enamel hypoplasia [OR 0.2 (95% CI 0.1-0.7)]. No statistically significant association occurred between birth weight and diffuse opacities, demarcated opacities or combined DDE. Conclusion Children with the history of low birth weight were more likely than their normal birth weight counterparts to present with enamel hypoplasia. In view of the frequent occurrence of enamel defects and the fact that hypoplasia may constitute a risk factor for future ECC, enamel defects should be included as a dental health indicator in epidemiological studies of children in northern Tanzania. PMID:23672512

  6. Replication stress in Mammalian cells and its consequences for mitosis.

    PubMed

    Gelot, Camille; Magdalou, Indiana; Lopez, Bernard S

    2015-01-01

    The faithful transmission of genetic information to daughter cells is central to maintaining genomic stability and relies on the accurate and complete duplication of genetic material during each cell cycle. However, the genome is routinely exposed to endogenous and exogenous stresses that can impede the progression of replication. Such replication stress can be an early cause of cancer or initiate senescence. Replication stress, which primarily occurs during S phase, results in consequences during mitosis, jeopardizing chromosome segregation and, in turn, genomic stability. The traces of replication stress can be detected in the daughter cells during G1 phase. Alterations in mitosis occur in two types: 1) local alterations that correspond to breaks, rearrangements, intertwined DNA molecules or non-separated sister chromatids that are confined to the region of the replication dysfunction; 2) genome-wide chromosome segregation resulting from centrosome amplification (although centrosomes do not contain DNA), which amplifies the local replication stress to the entire genome. Here, we discuss the endogenous causes of replication perturbations, the mechanisms of replication fork restart and the consequences for mitosis, chromosome segregation and genomic stability. PMID:26010955

  7. Replication Stress in Mammalian Cells and Its Consequences for Mitosis

    PubMed Central

    Gelot, Camille; Magdalou, Indiana; Lopez, Bernard S.

    2015-01-01

    The faithful transmission of genetic information to daughter cells is central to maintaining genomic stability and relies on the accurate and complete duplication of genetic material during each cell cycle. However, the genome is routinely exposed to endogenous and exogenous stresses that can impede the progression of replication. Such replication stress can be an early cause of cancer or initiate senescence. Replication stress, which primarily occurs during S phase, results in consequences during mitosis, jeopardizing chromosome segregation and, in turn, genomic stability. The traces of replication stress can be detected in the daughter cells during G1 phase. Alterations in mitosis occur in two types: 1) local alterations that correspond to breaks, rearrangements, intertwined DNA molecules or non-separated sister chromatids that are confined to the region of the replication dysfunction; 2) genome-wide chromosome segregation resulting from centrosome amplification (although centrosomes do not contain DNA), which amplifies the local replication stress to the entire genome. Here, we discuss the endogenous causes of replication perturbations, the mechanisms of replication fork restart and the consequences for mitosis, chromosome segregation and genomic stability. PMID:26010955

  8. Re-replication of a Centromere Induces Chromosomal Instability and Aneuploidy

    PubMed Central

    Hanlon, Stacey L.; Li, Joachim J.

    2015-01-01

    The faithful inheritance of chromosomes during cell division requires their precise replication and segregation. Numerous mechanisms ensure that each of these fundamental cell cycle events is performed with a high degree of fidelity. The fidelity of chromosomal replication is maintained in part by re-replication controls that ensure there are no more than two copies of every genomic segment to distribute to the two daughter cells. This control is enforced by inhibiting replication initiation proteins from reinitiating replication origins within a single cell cycle. Here we show in Saccharomyces cerevisiae that re-replication control is important for the fidelity of chromosome segregation. In particular, we demonstrate that transient re-replication of centromeric DNA due to disruption of re-replication control greatly induces aneuploidy of the re-replicated chromosome. Some of this aneuploidy arises from missegregation of both sister chromatids to one daughter cell. Aneuploidy can also arise from the generation of an extra sister chromatid via homologous recombination, suggesting that centromeric re-replication can trigger breakage and repair events that expand chromosome number without causing chromosomal rearrangements. Thus, we have identified a potential new non-mitotic source of aneuploidy that can arise from a defect in re-replication control. Given the emerging connections between the deregulation of replication initiation proteins and oncogenesis, this finding may be relevant to the aneuploidy that is prevalent in cancer. PMID:25901968

  9. Genetic and functional analysis of DD44, a sex-linked gene from the dioecious plant Silene latifolia, provides clues to early events in sex chromosome evolution.

    PubMed Central

    Moore, Richard C; Kozyreva, Olga; Lebel-Hardenack, Sabine; Siroky, Jiri; Hobza, Roman; Vyskot, Boris; Grant, Sarah R

    2003-01-01

    Silene latifolia is a dioecious plant with heteromorphic sex chromosomes. The sex chromosomes of S. latifolia provide an opportunity to study the early events in sex chromosome evolution because of their relatively recent emergence. In this article, we present the genetic and physical mapping, expression analysis, and molecular evolutionary analysis of a sex-linked gene from S. latifolia, DD44 (Differential Display 44). DD44 is homologous to the oligomycin sensitivity-conferring protein, an essential component of the mitochondrial ATP synthase, and is ubiquitously expressed in both sexes. We have been able to genetically map DD44 to a region of the Y chromosome that is genetically linked to the carpel-suppressing locus. Although we have physically mapped DD44 to the distal end of the long arm of the X chromosome using fluorescence in situ hybridization (FISH), DD44 maps to the opposite arm of the Y chromosome as determined by our genetic map. These data suggest that chromosomal rearrangements have occurred on the Y chromosome, which may have contributed to the genetic isolation of the Y chromosome. We discuss the implications of these results with respect to the structural and functional evolution of the S. latifolia Y chromosome. PMID:12586719

  10. Regulation of desmocollin gene expression in the epidermis: CCAAT/enhancer-binding proteins modulate early and late events in keratinocyte differentiation.

    PubMed Central

    Smith, Conrad; Zhu, Kuichun; Merritt, Anita; Picton, Rhian; Youngs, Denise; Garrod, David; Chidgey, Martyn

    2004-01-01

    Desmocollins (Dscs) are desmosomal cadherins that exhibit differentiation-specific patterns of expression in the epidermis. Dsc3 expression is strongest in basal cell layers, whereas Dsc1 is largely confined to upper, terminally differentiating strata. To understand better the processes by which Dsc expression is regulated in the epidermis, we have isolated Dsc3 and Dsc1 5'-flanking DNAs and analysed their activity in primary keratinocytes. In the present study, we found that transcription factors of the CCAAT/enhancer-binding protein family play a role in the regulation of expression of both Dscs and, in so doing, implicate this class of transcription factors in both early and late events in keratinocyte differentiation. We show that Dscs are differentially regulated by C/EBP (CCAAT/enhancer-binding protein) family members, with Dsc3 expression being activated by C/EBPbeta but not C/EBPalpha, and the reverse being the case for Dsc1. Expression of both Dscs is activated by another family member, C/EBPdelta. These results show for the first time how desmosomal cadherin gene expression is regulated and provide a mechanism for the control of other differentiation-specific genes in the epidermis. PMID:15030314

  11. Configural and featural face processing are differently modulated by attentional resources at early stages: an event-related potential study with rapid serial visual presentation.

    PubMed

    Wang, Hailing; Sun, Pei; Ip, Chengteng; Zhao, Xin; Fu, Shimin

    2015-03-30

    It is widely reported that face recognition relies on two dissociable mechanisms, the featural and the configural processing. However, it is unclear whether these two processing types involve different neural mechanisms and are differently modulated by attentional resources. Using the attentional blink (AB) paradigm, we aimed to investigate the effect of attentional resources on configural and featural face processing by recording event-related potentials (ERPs). The amount of attentional resources was manipulated as deficient or sufficient by presenting the second target (T2) in or out of the AB period, respectively. We found that in addition to a traditional P3 attention effect, the amplitude of N170/VPP to the T2 stimuli was also sensitive to attentional resources, suggesting that attention affects face processing at an earlier perceptual processing stage. More importantly, configural face processing elicited a larger posterior P1 compared to featural face processing, but only when the attentional resources were sufficient. In contrast, the anterior N1 was larger for configural relative to featural face processing only when the attentional resources were deficient. These results suggest that early stages of configural and featural face processing are differently modulated by attentional resources, possibly with different underlying mechanisms. PMID:25601005

  12. Event-Related EEG Time-Frequency Analysis: An Overview of Measures and An Analysis of Early Gamma Band Phase Locking in Schizophrenia

    PubMed Central

    Roach, Brian J.; Mathalon, Daniel H.

    2008-01-01

    An increasing number of schizophrenia studies have been examining electroencephalography (EEG) data using time-frequency analysis, documenting illness-related abnormalities in neuronal oscillations and their synchronization, particularly in the gamma band. In this article, we review common methods of spectral decomposition of EEG, time-frequency analyses, types of measures that separately quantify magnitude and phase information from the EEG, and the influence of parameter choices on the analysis results. We then compare the degree of phase locking (ie, phase-locking factor) of the gamma band (36–50 Hz) response evoked about 50 milliseconds following the presentation of standard tones in 22 healthy controls and 21 medicated patients with schizophrenia. These tones were presented as part of an auditory oddball task performed by subjects while EEG was recorded from their scalps. The results showed prominent gamma band phase locking at frontal electrodes between 20 and 60 milliseconds following tone onset in healthy controls that was significantly reduced in patients with schizophrenia (P?=?.03). The finding suggests that the early-evoked gamma band response to auditory stimuli is deficiently synchronized in schizophrenia. We discuss the results in terms of pathophysiological mechanisms compromising event-related gamma phase synchrony in schizophrenia and further attempt to reconcile this finding with prior studies that failed to find this effect. PMID:18684772

  13. Capturing the biological impact of CDKN2A and MC1R genes as an early predisposing event in melanoma and non melanoma skin cancer

    PubMed Central

    Puig-Butille, Joan Anton; Escámez, María José; Garcia-Garcia, Francisco; Tell-Marti, Gemma; Fabra, Àngels; Martínez-Santamaría, Lucía; Badenas, Celia; Aguilera, Paula; Pevida, Marta; Dopazo, Joaquín; del Río, Marcela; Puig, Susana

    2014-01-01

    Germline mutations in CDKN2A and/or red hair color variants in MC1R genes are associated with an increased susceptibility to develop cutaneous melanoma or non melanoma skin cancer. We studied the impact of the CDKN2A germinal mutation p.G101W and MC1R variants on gene expression and transcription profiles associated with skin cancer. To this end we set-up primary skin cell co-cultures from siblings of melanoma prone-families that were later analyzed using the expression array approach. As a result, we found that 1535 transcripts were deregulated in CDKN2A mutated cells, with over-expression of immunity-related genes (HLA-DPB1, CLEC2B, IFI44, IFI44L, IFI27, IFIT1, IFIT2, SP110 and IFNK) and down-regulation of genes playing a role in the Notch signaling pathway. 3570 transcripts were deregulated in MC1R variant carriers. In particular, genes related to oxidative stress and DNA damage pathways were up-regulated as well as genes associated with neurodegenerative diseases such as Parkinson’s, Alzheimer and Huntington. Finally, we observed that the expression signatures indentified in phenotypically normal cells carrying CDKN2A mutations or MC1R variants are maintained in skin cancer tumors (melanoma and squamous cell carcinoma). These results indicate that transcriptome deregulation represents an early event critical for skin cancer development. PMID:24742402

  14. The Role Of Oceanic Plateau Volcanism On Climate Change: Warming And Cooling Episodes Across Early Aptian Oceanic Anoxic Event 1a

    NASA Astrophysics Data System (ADS)

    Bottini, C.; Erba, E.; Mutterlose, J.

    2011-12-01

    The early Aptian is marked by a global phenomenon of organic matter burial in oxygen-depleted oceans known as Oceanic Anoxic Event 1a (OAE 1a: ~120 Ma). Volcanism associated with the emplacement of the Ontong Java Plateau (OJP) is thought to be the main triggering mechanism for global anoxia, ocean acidification and greenhouse conditions. However, climate instability during OAE 1a is indicated by independent studies on TEX86, sporomorphs and oxygen-stable isotope but a direct connection between OJP volcanic phases and temperature variations has not been ascertained. A high-resolution integrated nannofossil-geochemical investigation of distant sections from the Tethys, the Pacific Ocean and the Boreal Realm has revealed systematic and synchronous changes. Specifically, the nannofossil Temperature Index and Os-isotope records allowed the reconstruction of a complex series of global warming and cooling events across OAE 1a and their relationships with OJP volcanism as well as weathering patterns. Two prominent volcanic phases are documented in the Os-isotope records: the first preceding OAE 1a and the second one, of major intensity, starting in the core of the negative C-isotopic anomaly. Both phases are paralleled by increased temperature, suggestive of a (super)greenhouse climate triggered by excess volcanogenic CO2. Indeed, our data indicate that the beginning of the prolonged volcanic phase during OAE 1a coincides with warmest temperatures. In the early part of OAE 1a, between the two major volcanic phases, there is a ~100 kyrs-long interval characterized by a radiogenic Os-isotope peak, suggestive of accelerated continental weathering rates, with or without volcanism cessation, following an interval of abrupt warming and preceding a cooling interlude. Arguably, warming at OAE 1a onset promoted methane hydrate dissociation (also suggested by C-isotope and biomarkers analyses), which was perhaps instrumental in triggering continental weathering. Subsequent CO2 draw down, possibly during OJP quiescence, might explain the brief cooling interlude annihilated by warmest temperatures coeval with the onset of OJP paroxysmal phase. In the second part of OAE 1a two more cooling events sandwich an interval of intermediate and fluctuating temperatures. The three cooling episodes correlate with high TOC content, suggesting that burial of organic matter acted as storage of excess CO2, thus temporarily mitigating greenhouse conditions, although under persisting OJP activity. The end of OAE 1a corresponds to the vanishing of OJP volcanism as recorded by Os-isotope. A major cooling episode decrees the conclusion of greenhouse conditions for the rest of the Aptian. Increasing data and improved chronology show that volcanism of gigantic plateaus such as OJP is qualified to cause severe global warming and also indirectly to impact temperature changes. In fact, positive and negative feedbacks vicariously governed by prolonged (and possibly pulsing) formation of oceanic plateaus may be likewise or even more influential in controlling climate variability.

  15. Early bioenergetic evolution

    PubMed Central

    Sousa, Filipa L.; Thiergart, Thorsten; Landan, Giddy; Nelson-Sathi, Shijulal; Pereira, Inês A. C.; Allen, John F.; Lane, Nick; Martin, William F.

    2013-01-01

    Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. This paper outlines an energetically feasible path from a particular inorganic setting for the origin of life to the first free-living cells. The sources of energy available to early organic synthesis, early evolving systems and early cells stand in the foreground, as do the possible mechanisms of their conversion into harnessable chemical energy for synthetic reactions. With regard to the possible temporal sequence of events, we focus on: (i) alkaline hydrothermal vents as the far-from-equilibrium setting, (ii) the Wood–Ljungdahl (acetyl-CoA) pathway as the route that could have underpinned carbon assimilation for these processes, (iii) biochemical divergence, within the naturally formed inorganic compartments at a hydrothermal mound, of geochemically confined replicating entities with a complexity below that of free-living prokaryotes, and (iv) acetogenesis and methanogenesis as the ancestral forms of carbon and energy metabolism in the first free-living ancestors of the eubacteria and archaebacteria, respectively. In terms of the main evolutionary transitions in early bioenergetic evolution, we focus on: (i) thioester-dependent substrate-level phosphorylations, (ii) harnessing of naturally existing proton gradients at the vent–ocean interface via the ATP synthase, (iii) harnessing of Na+ gradients generated by H+/Na+ antiporters, (iv) flavin-based bifurcation-dependent gradient generation, and finally (v) quinone-based (and Q-cycle-dependent) proton gradient generation. Of those five transitions, the first four are posited to have taken place at the vent. Ultimately, all of these bioenergetic processes depend, even today, upon CO2 reduction with low-potential ferredoxin (Fd), generated either chemosynthetically or photosynthetically, suggesting a reaction of the type ‘reduced iron ? reduced carbon’ at the beginning of bioenergetic evolution. PMID:23754820

  16. SUMO and KSHV Replication

    PubMed Central

    Chang, Pei-Ching; Kung, Hsing-Jien

    2014-01-01

    Small Ubiquitin-related MOdifier (SUMO) modification was initially identified as a reversible post-translational modification that affects the regulation of diverse cellular processes, including signal transduction, protein trafficking, chromosome segregation, and DNA repair. Increasing evidence suggests that the SUMO system also plays an important role in regulating chromatin organization and transcription. It is thus not surprising that double-stranded DNA viruses, such as Kaposi’s sarcoma-associated herpesvirus (KSHV), have exploited SUMO modification as a means of modulating viral chromatin remodeling during the latent-lytic switch. In addition, SUMO regulation allows the disassembly and assembly of promyelocytic leukemia protein-nuclear bodies (PML-NBs), an intrinsic antiviral host defense, during the viral replication cycle. Overcoming PML-NB-mediated cellular intrinsic immunity is essential to allow the initial transcription and replication of the herpesvirus genome after de novo infection. As a consequence, KSHV has evolved a way as to produce multiple SUMO regulatory viral proteins to modulate the cellular SUMO environment in a dynamic way during its life cycle. Remarkably, KSHV encodes one gene product (K-bZIP) with SUMO-ligase activities and one gene product (K-Rta) that exhibits SUMO-targeting ubiquitin ligase (STUbL) activity. In addition, at least two viral products are sumoylated that have functional importance. Furthermore, sumoylation can be modulated by other viral gene products, such as the viral protein kinase Orf36. Interference with the sumoylation of specific viral targets represents a potential therapeutic strategy when treating KSHV, as well as other oncogenic herpesviruses. Here, we summarize the different ways KSHV exploits and manipulates the cellular SUMO system and explore the multi-faceted functions of SUMO during KSHV’s life cycle and pathogenesis. PMID:25268162

  17. Tight Chk1 Levels Control Replication Cluster Activation in Xenopus.

    PubMed

    Platel, Marie; Goldar, Arach; Wiggins, Jennifer M; Barbosa, Pedro; Libeau, Pierre; Priam, Pierre; Narassimprakash, Hemalatha; Grodzenski, Xenia; Marheineke, Kathrin

    2015-01-01

    DNA replication in higher eukaryotes initiates at thousands of origins according to a spatio-temporal program. The ATR/Chk1 dependent replication checkpoint inhibits the activation of later firing origins. In the Xenopus in vitro system initiations are not sequence dependent and 2-5 origins are grouped in clusters that fire at different times despite a very short S phase. We have shown that the temporal program is stochastic at the level of single origins and replication clusters. It is unclear how the replication checkpoint inhibits late origins but permits origin activation in early clusters. Here, we analyze the role of Chk1 in the replication program in sperm nuclei replicating in Xenopus egg extracts by a combination of experimental and modelling approaches. After Chk1 inhibition or immunodepletion, we observed an increase of the replication extent and fork density in the presence or absence of external stress. However, overexpression of Chk1 in the absence of external replication stress inhibited DNA replication by decreasing fork densities due to lower Cdk2 kinase activity. Thus, Chk1 levels need to be tightly controlled in order to properly regulate the replication program even during normal S phase. DNA combing experiments showed that Chk1 inhibits origins outside, but not inside, already active clusters. Numerical simulations of initiation frequencies in the absence and presence of Chk1 activity are consistent with a global inhibition of origins by Chk1 at the level of clusters but need to be combined with a local repression of Chk1 action close to activated origins to fit our data. PMID:26046346

  18. Tight Chk1 Levels Control Replication Cluster Activation in Xenopus

    PubMed Central

    Wiggins, Jennifer M.; Barbosa, Pedro; Libeau, Pierre; Priam, Pierre; Narassimprakash, Hemalatha; Grodzenski, Xenia; Marheineke, Kathrin

    2015-01-01

    DNA replication in higher eukaryotes initiates at thousands of origins according to a spatio-temporal program. The ATR/Chk1 dependent replication checkpoint inhibits the activation of later firing origins. In the Xenopus in vitro system initiations are not sequence dependent and 2-5 origins are grouped in clusters that fire at different times despite a very short S phase. We have shown that the temporal program is stochastic at the level of single origins and replication clusters. It is unclear how the replication checkpoint inhibits late origins but permits origin activation in early clusters. Here, we analyze the role of Chk1 in the replication program in sperm nuclei replicating in Xenopus egg extracts by a combination of experimental and modelling approaches. After Chk1 inhibition or immunodepletion, we observed an increase of the replication extent and fork density in the presence or absence of external stress. However, overexpression of Chk1 in the absence of external replication stress inhibited DNA replication by decreasing fork densities due to lower Cdk2 kinase activity. Thus, Chk1 levels need to be tightly controlled in order to properly regulate the replication program even during normal S phase. DNA combing experiments showed that Chk1 inhibits origins outside, but not inside, already active clusters. Numerical simulations of initiation frequencies in the absence and presence of Chk1 activity are consistent with a global inhibition of origins by Chk1 at the level of clusters but need to be combined with a local repression of Chk1 action close to activated origins to fit our data. PMID:26046346

  19. Phosphorylation of the replicative helicase by the S-phase kinase, Dbf4-Cdc7, at origins of replication in Saccharomyces cerevisiae

    E-print Network

    Francis, Laura Ileana

    2008-01-01

    In eukaryotic cells, events such as DNA replication and mitosis must be carefully coordinated in the cell cycle to ensure that the entire genome is duplicated before cells undergo cell division. In particular, initiation ...

  20. Fungal Pathogens: Survival and Replication within Macrophages.

    PubMed

    Gilbert, Andrew S; Wheeler, Robert T; May, Robin C

    2014-11-10

    The innate immune system is a critical line of defense against pathogenic fungi. Macrophages act at an early stage of infection, detecting and phagocytizing infectious propagules. To avoid killing at this stage, fungal pathogens use diverse strategies ranging from evasion of uptake to intracellular parasitism. This article will discuss five of the most important human fungal pathogens (Candida albicans, Aspergillus fumigatus, Cryptococcus neoformans, Coccidiodes immitis, and Histoplasma capsulatum) and consider the strategies and virulence factors adopted by each to survive and replicate within macrophages. PMID:25384769

  1. Loss of ALDH1A1 expression is an early event in the pathogenesis of ovarian high-grade serous carcinoma.

    PubMed

    Chui, M Herman; Wang, Yihong; Wu, Ren-Chin; Seidman, Jeffrey; Kurman, Robert J; Wang, Tian-Li; Shih, Ie-Ming

    2015-03-01

    Tumor-initiating cells are thought to share features with normal somatic stem cells. In mice, stem cells at the ovarian hilum have been shown to express the stem cell marker, aldehyde dehydrogenase isoform 1A1 (ALDH1A1), and are prone to malignant transformation. The potential relevance of this finding to humans has not been established. In this study, we used immunohistochemistry to assess the distribution of ALDH1A1 staining in the epithelium of human fallopian tubes, with particular reference to the transition of tubal epithelium to mesothelium (ie, tubal-mesothelial junction), ovarian surface epithelium, as well as putative precursors of ovarian high-grade serous carcinoma, namely, serous tubal intraepithelial carcinoma and 'p53 signatures,' and overt serous carcinoma. Expression of ALDH1A1 was detected in both secretory and ciliated tubal epithelial cells, tubal-mesothelial junctions and ovarian surface epithelium, but was absent in serous tubal intraepithelial carcinoma and p53 signatures. Positive staining in high-grade serous carcinoma, when present, was typically limited to rare tumor cells. In silico analyses of the mRNA expression data set from The Cancer Genome Atlas revealed downregulation of ALDH1A1 transcripts in high-grade serous carcinoma relative to normal tubal epithelium, and no association between ALDH1A1 expression levels and overall survival. Our results do not support ALDH1A1 as a specific marker of stem cells in human fallopian tube and demonstrate that its loss of expression is an early event in the development of high-grade serous carcinoma. PMID:25216223

  2. A Solution NMR Investigation into the Early Events of Amelogenin Nanosphere Self-Assembly Initiated with Sodium Chloride or Calcium Chloride†

    PubMed Central

    Buchko, Garry W.; Tarasevich, Barbara J.; Bekhazi, Jacky; Snead, Malcolm L.; Shaw, Wendy J.

    2009-01-01

    Using solution-state NMR spectroscopy, new insights into the early events governing amelogenin supramolecular self-assembly have been identified using sodium chloride and calcium chloride to trigger the association. Two-dimensional 1H–15N HSQC spectra were recorded for 15N- and 13C-labeled murine amelogenin as a function of increasing NaCl and CaCl2 concentration beginning with solution conditions of 2% acetic acid at pH 3.0, where amelogenin was monomeric. Residue specific changes in molecular dynamics, manifested by the reduction in intensity and disappearance of 1H–15N HSQC cross-peaks, were observed with the addition of either salt to the protein. With increasing NaCl concentrations, residues between T21 and R31 near the N-terminus were affected first, suggesting that these residues may initiate amelogenin dimerization, the first step in nanosphere assembly. At higher NaCl concentrations, more residues near the N-terminus (Y12–I51) were affected, and with further additions of NaCl, residues near the C-terminus (L141–T171) began to show a similar change in molecular dynamics. With increasing CaCl2 concentrations, a similar stepwise change in molecular dynamics involving essentially the same set of amelogenin residues was observed. As the concentration of either salt was increased, a concomitant increase in the estimated overall rotational correlation time (?c) was observed, consistent with assembly. Self-assembly into a dimer or trimer was established with dynamic light scattering studies under similar conditions that showed an increase in diameter of the smallest species from 4.1 nm in the absence of salt to ~10 nm in the presence of salt. These results suggest a possible stepwise interaction mechanism, starting with the N-terminus and followed by the C-terminus, leading to amelogenin nanosphere assembly. PMID:19086270

  3. The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells?

    PubMed Central

    Caposio, Patrizia; Luganini, Anna; Bronzini, Matteo; Landolfo, Santo; Gribaudo, Giorgio

    2010-01-01

    The major immediate-early promoter (MIEP) region of human cytomegalovirus (HCMV) plays a critical role in the regulation of lytic and latent infections by integrating multiple signals supplied by the infecting virus, the type and physiological state of the host cell, and its extracellular surroundings. The interaction of cellular transcription factors with their cognate binding sites, which are present at high densities within the enhancer upstream from the MIEP core promoter, regulate the rate of IE gene transcription and thus affect the outcome of HCMV infection. We have shown previously that the NF-?B binding sites within the MIEP enhancer and cellular NF-?B activity induced by HCMV infection are required for efficient MIEP activity and viral replication in quiescent cells (P. Caposio, A. Luganini, G. Hahn, S. Landolfo, and G. Gribaudo, Cell. Microbiol. 9:2040-2054, 2007). We now show that the inactivation of either the Elk-1 or serum response factor (SRF) binding site within the enhancer also reduces MIEP activation and viral replication of recombinant HCMV viruses in quiescent fibroblasts. In these cells, we show that the expression of either Elk-1 or SRF is required for optimal IE gene expression, and that the HCMV-stimulated activation of the MEK1/2-ERK1/2 signaling axis leads to Elk-1 transcriptional competency. Furthermore, the replication kinetics of recombinant viruses in which NF-?B, Elk-1, and SRF binding sites all are inactivated demonstrate that the higher levels of Elk-1 and SRF binding to MIEP in proliferating cells can compensate even for a lack of HCMV-induced NF-?B-mediated MIEP transactivation. These observations highlight the importance of the combination of different MIEP binding sites to optimize IE gene expression in cells in different physiological states. PMID:20147408

  4. Inhibitors of Nucleotidyltransferase Superfamily Enzymes Suppress Herpes Simplex Virus Replication

    PubMed Central

    Wang, Hong; Tollefson, Ann E.; Ying, Baoling; Korom, Maria; Cheng, Xiaohong; Cao, Feng; Davis, Katie L.; Wold, William S. M.

    2014-01-01

    Herpesviruses are large double-stranded DNA viruses that cause serious human diseases. Herpesvirus DNA replication depends on multiple processes typically catalyzed by nucleotidyltransferase superfamily (NTS) enzymes. Therefore, we investigated whether inhibitors of NTS enzymes would suppress replication of herpes simplex virus 1 (HSV-1) and HSV-2. Eight of 42 NTS inhibitors suppressed HSV-1 and/or HSV-2 replication by >10-fold at 5 ?M, with suppression at 50 ?M reaching ?1 million-fold. Five compounds in two chemical families inhibited HSV replication in Vero and human foreskin fibroblast cells as well as the approved drug acyclovir did. The compounds had 50% effective concentration values as low as 0.22 ?M with negligible cytotoxicity in the assays employed. The inhibitors suppressed accumulation of viral genomes and infectious particles and blocked events in the viral replication cycle before and during viral DNA replication. Acyclovir-resistant mutants of HSV-1 and HSV-2 remained highly sensitive to the NTS inhibitors. Five of six NTS inhibitors of the HSVs also blocked replication of another herpesvirus pathogen, human cytomegalovirus. Therefore, NTS enzyme inhibitors are promising candidates for new herpesvirus treatments that may have broad efficacy against members of the herpesvirus family. PMID:25267681

  5. Dynamic organization of DNA replication in mammalian cell nuclei: spatially and temporally defined replication of chromosome-specific alpha-satellite DNA sequences

    PubMed Central

    1992-01-01

    Five distinct patterns of DNA replication have been identified during S- phase in asynchronous and synchronous cultures of mammalian cells by conventional fluorescence microscopy, confocal laser scanning microscopy, and immunoelectron microscopy. During early S-phase, replicating DNA (as identified by 5-bromodeoxyuridine incorporation) appears to be distributed at sites throughout the nucleoplasm, excluding the nucleolus. In CHO cells, this pattern of replication peaks at 30 min into S-phase and is consistent with the localization of euchromatin. As S-phase continues, replication of euchromatin decreases and the peripheral regions of heterochromatin begin to replicate. This pattern of replication peaks at 2 h into S-phase. At 5 h, perinucleolar chromatin as well as peripheral areas of heterochromatin peak in replication. 7 h into S-phase interconnecting patches of electron-dense chromatin replicate. At the end of S-phase (9 h), replication occurs at a few large regions of electron-dense chromatin. Similar or identical patterns have been identified in a variety of mammalian cell types. The replication of specific chromosomal regions within the context of the BrdU-labeling patterns has been examined on an hourly basis in synchronized HeLa cells. Double labeling of DNA replication sites and chromosome-specific alpha-satellite DNA sequences indicates that the alpha-satellite DNA replicates during mid S-phase (characterized by the third pattern of replication) in a variety of human cell types. Our data demonstrates that specific DNA sequences replicate at spatially and temporally defined points during the cell cycle and supports a spatially dynamic model of DNA replication. PMID:1740468

  6. Lipids and Membrane Microdomains in HIV-1 Replication

    PubMed Central

    Waheed, Abdul A.; Freed, Eric O.

    2009-01-01

    Several critical steps in the replication cycle of human immunodeficiency virus type 1 (HIV-1) – entry, assembly and budding – are complex processes that take place at the plasma membrane of the host cell. A growing body of data indicates that these early and late steps in HIV-1 replication take place in specialized plasma membrane microdomains, and that many of the viral and cellular components required for entry, assembly, and budding are concentrated in these microdomains. In particular, a number of studies have shown that cholesterol- and sphingolipid-enriched microdomains known as lipid rafts play important roles in multiple steps in the virus replication cycle. In this review, we provide an overview of what is currently known about the involvement of lipids and membrane microdomains in HIV-1 replication. PMID:19383519

  7. Survival Outcomes and Effect of Early vs. Deferred cART Among HIV-Infected Patients Diagnosed at the Time of an AIDS-Defining Event: A Cohort Analysis

    PubMed Central

    Mussini, Cristina; Johnson, Margaret; d'Arminio Monforte, Antonella; Antinori, Andrea; Gill, M. John; Sighinolfi, Laura; Uberti-Foppa, Caterina; Borghi, Vanni; Sabin, Caroline

    2011-01-01

    Objectives We analyzed clinical progression among persons diagnosed with HIV at the time of an AIDS-defining event, and assessed the impact on outcome of timing of combined antiretroviral treatment (cART). Methods Retrospective, European and Canadian multicohort study.. Patients were diagnosed with HIV from 1997–2004 and had clinical AIDS from 30 days before to 14 days after diagnosis. Clinical progression (new AIDS event, death) was described using Kaplan-Meier analysis stratifying by type of AIDS event. Factors associated with progression were identified with multivariable Cox regression. Progression rates were compared between those starting early (<30 days after AIDS event) or deferred (30–270 days after AIDS event) cART. Results The median (interquartile range) CD4 count and viral load (VL) at diagnosis of the 584 patients were 42 (16, 119) cells/µL and 5.2 (4.5, 5.7) log10 copies/mL. Clinical progression was observed in 165 (28.3%) patients. Older age, a higher VL at diagnosis, and a diagnosis of non-Hodgkin lymphoma (NHL) (vs. other AIDS events) were independently associated with disease progression. Of 366 patients with an opportunistic infection, 178 (48.6%) received early cART. There was no significant difference in clinical progression between those initiating cART early and those deferring treatment (adjusted hazard ratio 1.32 [95% confidence interval 0.87, 2.00], p?=?0.20). Conclusions Older patients and patients with high VL or NHL at diagnosis had a worse outcome. Our data suggest that earlier initiation of cART may be beneficial among HIV-infected patients diagnosed with clinical AIDS in our setting. PMID:22043301

  8. Prebiotic chemistry: Replicating towards complexity

    NASA Astrophysics Data System (ADS)

    Chen, Irene A.

    2015-03-01

    Replication of long nucleic acid sequences was required for the evolution of biological complexity during the origin of life; however, short sequences are normally better replicators than long ones. A common physical environment now provides a simple mechanism to reverse this trend and enables long sequences to flourish.

  9. Weighted voting for replicated data

    Microsoft Academic Search

    David K. Gifford

    1979-01-01

    In a new algorithm for maintaining replicated data, every copy of a replicated file is assigned some number of votes. Every transaction collects a read quorum of rvotes to read a file, and a write quorum of wvotes to write a file, such that r+w is greater than the total number of votes assigned to the file. This ensures that

  10. LHCb experience with LFC replication

    NASA Astrophysics Data System (ADS)

    Bonifazi, F.; Carbone, A.; Perez, E. D.; D'Apice, A.; dell'Agnello, L.; Duellmann, D.; Girone, M.; Re, G. L.; Martelli, B.; Peco, G.; Ricci, P. P.; Sapunenko, V.; Vagnoni, V.; Vitlacil, D.

    2008-07-01

    Database replication is a key topic in the framework of the LHC Computing Grid to allow processing of data in a distributed environment. In particular, the LHCb computing model relies on the LHC File Catalog, i.e. a database which stores information about files spread across the GRID, their logical names and the physical locations of all the replicas. The LHCb computing model requires the LFC to be replicated at Tier-1s. The LCG 3D project deals with the database replication issue and provides a replication service based on Oracle Streams technology. This paper describes the deployment of the LHC File Catalog replication to the INFN National Center for Telematics and Informatics (CNAF) and to other LHCb Tier-1 sites. We performed stress tests designed to evaluate any delay in the propagation of the streams and the scalability of the system. The tests show the robustness of the replica implementation with performance going much beyond the LHCb requirements.

  11. Regulating DNA replication in plants.

    PubMed

    Sanchez, Maria de la Paz; Costas, Celina; Sequeira-Mendes, Joana; Gutierrez, Crisanto

    2012-12-01

    Chromosomal DNA replication in plants has requirements and constraints similar to those in other eukaryotes. However, some aspects are plant-specific. Studies of DNA replication control in plants, which have unique developmental strategies, can offer unparalleled opportunities of comparing regulatory processes with yeast and, particularly, metazoa to identify common trends and basic rules. In addition to the comparative molecular and biochemical studies, genomic studies in plants that started with Arabidopsis thaliana in the year 2000 have now expanded to several dozens of species. This, together with the applicability of genomic approaches and the availability of a large collection of mutants, underscores the enormous potential to study DNA replication control in a whole developing organism. Recent advances in this field with particular focus on the DNA replication proteins, the nature of replication origins and their epigenetic landscape, and the control of endoreplication will be reviewed. PMID:23209151

  12. The Fork in the Road: Histone Partitioning During DNA Replication

    PubMed Central

    Annunziato, Anthony T.

    2015-01-01

    In the following discussion the distribution of histones at the replication fork is examined, with specific attention paid to the question of H3/H4 tetramer "splitting." After a presentation of early experiments surrounding this topic, more recent contributions are detailed. The implications of these findings with respect to the transmission of histone modifications and epigenetic models are also addressed. PMID:26110314

  13. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast

    Microsoft Academic Search

    Patrick Dumont; Maggi Burton; Qin M Chen; Efstathios S Gonos; Christophe Frippiat; Jean-Baptiste Mazarati; François Eliaers; José Remacle; Olivier Toussaint

    2000-01-01

    We tested the long-term effects of sublethal oxidative stresses on replicative senescence. WI-38 human diploid fibroblasts (HDFs) at early cumulative population doublings (CPDs) were exposed to five stresses with 30 ?M tert-butylhydroperoxide (t-BHP). After at least 2 d of recovery, the cells developed biomarkers of replicative senescence: loss of replicative potential, increase in senescence-associated ?-galactosidase activity, overexpression of p21Waf-1\\/SDI-1\\/Cip1, and

  14. Self-assembly and Self-replication of Short Amphiphilic ?-sheet Peptides

    NASA Astrophysics Data System (ADS)

    Bourbo, Valery; Matmor, Maayan; Shtelman, Elina; Rubinov, Boris; Ashkenasy, Nurit; Ashkenasy, Gonen

    2011-12-01

    Most self-replicating peptide systems are made of ?-helix forming sequences. However, it has been postulated that shorter and simpler peptides may also serve as templates for replication when arranged into well-defined structures. We describe here the design and characterization of new peptides that form soluble ?-sheet aggregates that serve to significantly accelerate their ligation and self-replication. We then discuss the relevance of these phenomena to early molecular evolution, in light of additional functionality associated with ?-sheet assemblies.

  15. Replication timing: a fingerprint for cell identity and pluripotency.

    PubMed

    Ryba, Tyrone; Hiratani, Ichiro; Sasaki, Takayo; Battaglia, Dana; Kulik, Michael; Zhang, Jinfeng; Dalton, Stephen; Gilbert, David M

    2011-10-01

    Many types of epigenetic profiling have been used to classify stem cells, stages of cellular differentiation, and cancer subtypes. Existing methods focus on local chromatin features such as DNA methylation and histone modifications that require extensive analysis for genome-wide coverage. Replication timing has emerged as a highly stable cell type-specific epigenetic feature that is regulated at the megabase-level and is easily and comprehensively analyzed genome-wide. Here, we describe a cell classification method using 67 individual replication profiles from 34 mouse and human cell lines and stem cell-derived tissues, including new data for mesendoderm, definitive endoderm, mesoderm and smooth muscle. Using a Monte-Carlo approach for selecting features of replication profiles conserved in each cell type, we identify "replication timing fingerprints" unique to each cell type and apply a k nearest neighbor approach to predict known and unknown cell types. Our method correctly classifies 67/67 independent replication-timing profiles, including those derived from closely related intermediate stages. We also apply this method to derive fingerprints for pluripotency in human and mouse cells. Interestingly, the mouse pluripotency fingerprint overlaps almost completely with previously identified genomic segments that switch from early to late replication as pluripotency is lost. Thereafter, replication timing and transcription within these regions become difficult to reprogram back to pluripotency, suggesting these regions highlight an epigenetic barrier to reprogramming. In addition, the major histone cluster Hist1 consistently becomes later replicating in committed cell types, and several histone H1 genes in this cluster are downregulated during differentiation, suggesting a possible instrument for the chromatin compaction observed during differentiation. Finally, we demonstrate that unknown samples can be classified independently using site-specific PCR against fingerprint regions. In sum, replication fingerprints provide a comprehensive means for cell characterization and are a promising tool for identifying regions with cell type-specific organization. PMID:22028635

  16. Surveillance of vector populations and malaria transmission during the 2009\\/10 El Niño event in the western Kenya highlands: opportunities for early detection of malaria hyper-transmission

    Microsoft Academic Search

    Ednah N Ototo; Andrew K Githeko; Christine L Wanjala; Thomas W Scott

    2011-01-01

    Background  Vector control in the highlands of western Kenya has resulted in a significant reduction of malaria transmission and a change\\u000a in the vectorial system. Climate variability as a result of events such as El Niño increases the highlands suitability for\\u000a malaria transmission. Surveillance and monitoring is an important component of early transmission risk identification and\\u000a management. However, below certain disease

  17. Ultrastructural Characterization and Three-Dimensional Architecture of Replication Sites in Dengue Virus-Infected Mosquito Cells

    PubMed Central

    Junjhon, Jiraphan; Pennington, Janice G.; Edwards, Thomas J.; Perera, Rushika; Lanman, Jason

    2014-01-01

    ABSTRACT During dengue virus infection of host cells, intracellular membranes are rearranged into distinct subcellular structures such as double-membrane vesicles, convoluted membranes, and tubular structures. Recent electron tomographic studies have provided a detailed three-dimensional architecture of the double-membrane vesicles, representing the sites of dengue virus replication, but temporal and spatial evidence linking membrane morphogenesis with viral RNA synthesis is lacking. Integrating techniques in electron tomography and molecular virology, we defined an early period in virus-infected mosquito cells during which the formation of a virus-modified membrane structure, the double-membrane vesicle, is proportional to the rate of viral RNA synthesis. Convoluted membranes were absent in dengue virus-infected C6/36 cells. Electron tomographic reconstructions elucidated a high-resolution view of the replication complexes inside vesicles and allowed us to identify distinct pathways of particle formation. Hence, our findings extend the structural details of dengue virus replication within mosquito cells and highlight their differences from mammalian cells. IMPORTANCE Dengue virus induces several distinct intracellular membrane structures within the endoplasmic reticulum of mammalian cells. These structures, including double-membrane vesicles and convoluted membranes, are linked, respectively, with viral replication and viral protein processing. However, dengue virus cycles between two disparate animal groups with differing physiologies: mammals and mosquitoes. Using techniques in electron microscopy, we examined the differences between intracellular structures induced by dengue virus in mosquito cells. Additionally, we utilized techniques in molecular virology to temporally link events in virus replication to the formation of these dengue virus-induced membrane structures. PMID:24522909

  18. Carbon-isotope record of the Early Jurassic (Toarcian) Oceanic Anoxic Event from fossil wood and marine carbonate (Lusitanian Basin, Portugal)

    NASA Astrophysics Data System (ADS)

    Hesselbo, Stephen P.; Jenkyns, Hugh C.; Duarte, Luis V.; Oliveira, Luiz C. V.

    2007-01-01

    The Toarcian Oceanic Anoxic Event (OAE) in the Early Jurassic (˜ 183 Ma ago) was characterized by widespread near-synchronous deposition of organic-rich shales in marine settings, as well as perturbations to several isotopic systems. Characteristically, two positive carbon-isotope excursions in a range of materials are separated by an abrupt negative shift. Carbon-isotope profiles from Toarcian fossil wood collected in England and Denmark have previously been shown to exhibit this large drop (˜ - 7‰) in ?13C values, interpreted as due to an injection of isotopically light CO 2 into the ocean-atmosphere system. However, the global nature of this excursion has been challenged on the basis of carbon-isotope data from nektonic marine molluscs (belemnites), which exhibit heavier than expected carbon-isotope values. Here we present new data, principally from fossil wood and bulk carbonate collected at centimetre scale from a hemipelagic section at Peniche, coastal Portugal. This section is low in organic carbon (average TOC = ˜ 0.5%), and the samples should not have suffered significant diagenetic contamination by organic carbon of marine origin. The carbon-isotope profile based on wood shows two positive excursions separated by a large and abrupt negative excursion, which parallels exactly the profile based on bulk carbonate samples from the same section, albeit with approximately twice the amplitude (˜ - 8‰ in wood versus ˜ - 3.5‰ in carbonate). These data indicate that the negative carbon-isotope excursion affected the atmosphere and, by implication, the global ocean as well. The difference in amplitude between terrestrial organic and marine carbonate curves can be explained by greater water availability in the terrestrial environment during the negative excursion, for which there is independent evidence from marine osmium-isotope records and, plausibly, changes in atmospheric CO 2 content, for which independent evidence is also available. The Peniche succession is also notable for the occurrence of re-deposited sediments: their lowest occurrence coincides with the base of the negative excursion and their highest occurrence coincides with its top. Thus, slope instability and sediment supply could have been strongly linked to the global environmental perturbation, an association that may misleadingly simulate the effects of sea-level fall.

  19. Effect of Microgravity on Early Events of Biological Nitrogen Fixation in Medicago Truncatula: Initial Results from the SyNRGE Experiment

    NASA Technical Reports Server (NTRS)

    Stutte, Gary W.; Roberts, Michael S.

    2011-01-01

    SyNRGE (Symbiotic Nodulation in a Reduced Gravity Environment) was a sortie mission on STS-135 in the Biological Research in Canisters (BRIC) hardware to study the effect of microgravity on a plant-microbe symbiosis resulting in biological nitrogen fixation. Medicago truncatula, a model species of the legume family, was inoculated with its bacterial symbiont, Sinorhizobium meliloti, to observe early events associated with infection and nodulation in Petri Dish Fixation Units (PDFUs). Two sets of experiments were conducted in orbit and in 24-hour delayed ground controls. Experiment one was designed to determine if S. meliloti infect M. truncatula and initiate physiological changes associated with nodule formation. Roots of five-day-old M. truncatula cultivar Jemalong A17 (Enodll::gus) were inoculated 24 hr before launch with either S. meliloti strain 1021 or strain ABS7 and integrated into BRIC-PDFU hardware placed in a 4 C Cold Bag for launch on Atlantis. Inoculated plants and uninoculated controls were maintained in the dark at ambient temperature in the middeck of STS-135 for 11 days before fixation in RNAlater(tM) by crew activation of the PDFU. Experiment two was designed to determine if microgravity altered the process of bacterial infection and host plant nodule formation. Seeds of two M. truncatula cultivar Jemalong A17 lines, the Enodll::gus used in experiment 1, and SUNN, a super-nodulating mutant of A17, were germinated on orbit for 11 days in the middeck cabin and returned to Earth alive inside of BRIC-PDFU's at 4 C. S. meliloti strains 1021 and ABS7 were cultivated separately in broth culture on orbit and also returned to Earth alive. After landing, flight- and groundgrown plants and bacteria were transferred from BRIC-PDFU's into Nunc(tm) 4-well plates for reciprocity crosses. Rates of plant growth and nodule development on Buffered Nodulation Medium (lacking nitrogen) were measured for 14 days. Preliminary analysis' of Experiment 1 confirms that legumes and bacteria cultivated in space 'initiate the symbiotic interaction leading to nitrogen fixation and that bacteria retain the ability to form nodules on M. truncatula roots. Initial assessment of experiment 2 shows 100% seed germination and excellent bacterial growth in microgravity.

  20. Scrapie replication in lymphoid tissues depends on prion protein-expressing follicular dendritic cells

    Microsoft Academic Search

    K. L. Brown; K. Stewart; D. L. Ritchie; N. A. Mabbott; A. Williams; H. Fraser; W. I. Morrison; M. E. Bruce

    1999-01-01

    The immune system is central in the pathogenesis of scrapie and other transmissible spongiform encephalopathies (TSEs) or 'prion' diseases. After infecting by peripheral (intraperitoneal or oral) routes, most TSE agents replicate in spleen and lymph nodes before neuroinvasion. Characterization of the cells supporting replication in these tissues is essential to understanding early pathogenesis and may indicate potential targets for therapy,

  1. Carcinogen-induced early molecular events and its implication in the initiation of chemical hepatocarcinogenesis in rats: Chemopreventive role of vanadium on this process

    Microsoft Academic Search

    Tridib Chakraborty; Amrita Chatterjee; Ajay Rana; Duraisami Dhachinamoorthi; Ashok Kumar P; Malay Chatterjee

    2007-01-01

    Carcinogen-induced formation of DNA adducts and other types of DNA lesions are the critical molecular events in the initiation of chemical carcinogenesis and modulation of such events by chemopreventive agents could be an important step in limiting neoplastic transformation in vivo. Vanadium, a dietary micronutrient has been found to be effective in several types of cancers both in vivo and

  2. Segregation of Replicative DNA Polymerases during S Phase

    PubMed Central

    Vaara, Markku; Itkonen, Harri; Hillukkala, Tomi; Liu, Zhe; Nasheuer, Heinz-Peter; Schaarschmidt, Daniel; Pospiech, Helmut; Syväoja, Juhani E.

    2012-01-01

    DNA polymerases (Pol) ?, ?, and ? replicate the bulk of chromosomal DNA in eukaryotic cells, Pol ? being the main leading strand and Pol ? the lagging strand DNA polymerase. By applying chromatin immunoprecipitation (ChIP) and quantitative PCR we found that at G1/S arrest, all three DNA polymerases were enriched with DNA containing the early firing lamin B2 origin of replication and, 2 h after release from the block, with DNA containing the origin at the upstream promoter region of the MCM4 gene. Pol ?, ?, and ? were released from these origins upon firing. All three DNA polymerases, Mcm3 and Cdc45, but not Orc2, still formed complexes in late S phase. Reciprocal ChIP of the three DNA polymerases revealed that at G1/S arrest and early in S phase, Pol ?, ?, and ? were associated with the same nucleoprotein complexes, whereas in late S phase Pol ? and Pol ?/? were largely associated with distinct complexes. At G1/S arrest, the replicative DNA polymerases were associated with lamins, but in late S phase only Pol ?, not Pol ?/?, remained associated with lamins. Consistently, Pol ?, but not Pol ?, was found in nuclear matrix fraction throughout the cell cycle. Therefore, Pol ? and Pol ?/? seem to pursue their functions at least in part independently in late S phase, either by physical uncoupling of lagging strand maturation from the fork progression, or by recruitment of Pol ?, but not Pol ?, to post-replicative processes such as translesion synthesis or post-replicative repair. PMID:22887995

  3. Mathematical modeling of genome replication

    NASA Astrophysics Data System (ADS)

    Retkute, Renata; Nieduszynski, Conrad A.; de Moura, Alessandro

    2012-09-01

    Eukaryotic DNA replication is initiated from multiple sites on the chromosome, but little is known about the global and local regulation of replication. We present a mathematical model for the spatial dynamics of DNA replication, which offers insight into the kinetics of replication in different types of organisms. Most biological experiments involve average quantities over large cell populations (typically >107 cells) and therefore can mask the cell-to-cell variability present in the system. Although the model is formulated in terms of a population of cells, using mathematical analysis we show that one can obtain signatures of stochasticity in individual cells from averaged quantities. This work generalizes the result by Retkute [Phys. Rev. Lett.PRLTAO0031-900710.1103/PhysRevLett.107.068103 107, 068103 (2011)] to a broader set of parameter regimes.

  4. CVD Replication For Optics Applications

    NASA Astrophysics Data System (ADS)

    Goela, Jitendra S.; Taylor, Raymond L.

    1989-07-01

    A chemical vapor deposition process has been used to replicate shapes, patterns or highly reflective surfaces in infrared transmissive optical materials (ZnS, ZnSe) and mirror materials (Si, SiC) for a variety of applications, such as ZnS domes or meniscus lenses, ZnSe lens arrays for adaptive optics and low f-number Si/SiC mirrors for space optics. Conditions for achieving a high degree of replication are specified and replication results on several different substrate materials are presented. Techniques to obtain replication on those substrates which either are attacked in the CVD environment or whose thermal expansion coefficients are considerably different from that of the deposit are also discussed.

  5. Plasmid Rolling-Circle Replication.

    PubMed

    Ruiz-Masó, J A; MachóN, C; Bordanaba-Ruiseco, L; Espinosa, M; Coll, M; Del Solar, G

    2015-02-01

    Plasmids are DNA entities that undergo controlled replication independent of the chromosomal DNA, a crucial step that guarantees the prevalence of the plasmid in its host. DNA replication has to cope with the incapacity of the DNA polymerases to start de novo DNA synthesis, and different replication mechanisms offer diverse solutions to this problem. Rolling-circle replication (RCR) is a mechanism adopted by certain plasmids, among other genetic elements, that represents one of the simplest initiation strategies, that is, the nicking by a replication initiator protein on one parental strand to generate the primer for leading-strand initiation and a single priming site for lagging-strand synthesis. All RCR plasmid genomes consist of a number of basic elements: leading strand initiation and control, lagging strand origin, phenotypic determinants, and mobilization, generally in that order of frequency. RCR has been mainly characterized in Gram-positive bacterial plasmids, although it has also been described in Gram-negative bacterial or archaeal plasmids. Here we aim to provide an overview of the RCR plasmids' lifestyle, with emphasis on their characteristic traits, promiscuity, stability, utility as vectors, etc. While RCR is one of the best-characterized plasmid replication mechanisms, there are still many questions left unanswered, which will be pointed out along the way in this review. PMID:26104557

  6. Timing of Early Proterozoic collisional and extensional events in the granulite-gneiss-charnockite-granite complex, Lake Baikal, USSR: A U-Pb, Rb-Sr, and Sm-Nd isotopic study

    SciTech Connect

    Aftalion, M. (Scottish Univ. Research and Reactor Centre, Glasgow (United Kingdom)); Bibikova, E.V. (Vernadsky Inst. of Geochemistry and Analytical Chemistry, Moscow (USSR)); Bowes, D.R. (Univ. of Glasgow (United Kingdom)); Hopwood, A.M. (Univ. of St. Andrews, Fife (United Kingdom)); Perchuk, L.L. (Inst. of Experimental Mineralogy, Moscow (USSR))

    1991-11-01

    In the Sharyzhalgay Complex of the Lake Baikal region in eastern Siberia Early Proterozoic collisional and extensional events were separated by ca. 100 m.yr. The earlier collisional event, associated with the development of granulites and gneisses as the result of high-grade dynamothermal metamorphism, took place close to 1965 {plus minus} 4 Ma. A {sup 207}Pb/{sup 204}Pb vs. {sup 206}Pb/{sup 204}Pb isochron for zircon from five size fractions and a six point Rb-Sr whole-rock errorchron give generally corresponding ages of 1956 {plus minus} 8 and 1963 {plus minus} 163 Ma, respectively. The later extensional event, associated with charnockitization due to the uprise of fluids and heat in a regime corresponding to the middle to upper crustal levels of a Basin and Range-type province, was initiated in the 1880-1860 Ma period. The event was continued with magmatic emplacement of granitic masses into the deep levels of caldera-like structures, possibly during the upper time range of lower concordia intercept ages of 1817 +30/{minus}32 and 1797 +40/{minus}44 Ma for two distinctly different zircon populations in a pyroxene-bearing granodiorite interpreted as an evolved (and contaminated) product of the mantle-derived magma that was the source of CO{sub 2} involved in the charnockitization. Upper intercept ages of 2784 +48/{minus}45 and 2775 +61/{minus}55 Ma indicate late Archean crust at depth as the source region of the incorporated zircon. T{sub DM} ages from Sm-Nd isotopic data show that the protolith of the lithologically layered supracrustal assemblage, subsequently polyphase deformed and polymetamorphosed in Early Proterozoic times, was also formed in Early Proterozoic (not Archean) times.

  7. Cellular and molecular consequences of defective Fanconi anemia proteins in replication-coupled DNA repair: mechanistic insights.

    PubMed

    Thompson, Larry H; Hinz, John M

    2009-07-31

    The Fanconi anemia (FA) molecular network consists of 15 "FANC" proteins, of which 13 are associated with mutations in patients with this cancer-prone chromosome instability disorder. Whereas historically the common phenotype associated with FA mutations is marked sensitivity to DNA interstrand crosslinking agents, the literature supports a more global role for FANC proteins in coping with diverse stresses encountered by replicative polymerases. We have attempted to reconcile and integrate numerous observations into a model in which FANC proteins coordinate the following physiological events during DNA crosslink repair: (a) activating a FANCM-ATR-dependent S-phase checkpoint, (b) mediating enzymatic replication-fork breakage and crosslink unhooking, (c) filling the resulting gap by translesion synthesis (TLS) by error-prone polymerase(s), and (d) restoring the resulting one-ended double-strand break by homologous recombination repair (HRR). The FANC core subcomplex (FANCA, B, C, E, F, G, L, FAAP100) promotes TLS for both crosslink and non-crosslink damage such as spontaneous oxidative base damage, UV-C photoproducts, and alkylated bases. TLS likely helps prevent stalled replication forks from breaking, thereby maintaining chromosome continuity. Diverse DNA damages and replication inhibitors result in monoubiquitination of the FANCD2-FANCI complex by the FANCL ubiquitin ligase activity of the core subcomplex upon its recruitment to chromatin by the FANCM-FAAP24 heterodimeric translocase. We speculate that this translocase activity acts as the primary damage sensor and helps remodel blocked replication forks to facilitate checkpoint activation and repair. Monoubiquitination of FANCD2-FANCI is needed for promoting HRR, in which the FANCD1/BRCA2 and FANCN/PALB2 proteins act at an early step. We conclude that the core subcomplex is required for both TLS and HRR occurring separately for non-crosslink damages and for both events during crosslink repair. The FANCJ/BRIP1/BACH1 helicase functions in association with BRCA1 and may remove structural barriers to replication, such as guanine quadruplex structures, and/or assist in crosslink unhooking. PMID:19622404

  8. Restricted replication of simian immunodeficiency virus strain 239 in macrophages is determined by env but is not due to restricted entry.

    PubMed Central

    Mori, K; Ringler, D J; Desrosiers, R C

    1993-01-01

    Virus derived from the infectious, pathogenic, molecular clone of simian immunodeficiency virus (SIV) called SIVmac239 replicates poorly in primary rhesus monkey alveolar macrophage cultures. Variants with three to nine amino acid changes in the envelope replicate 100 to 1,000 times more efficiently in these macrophage cultures than parental SIVmac239. Early events, including virus entry into cells, were analyzed by measuring the amounts of newly synthesized viral DNA 14 to 16 h after infection of macrophages by using a quantitative polymerase chain reaction method. SIVmac239 ws found to enter macrophages with an efficiency similar to that of the macrophage-tropic derivatives. The assay indeed measured newly synthesized viral DNA since detection was inhibited by the reverse transcriptase inhibitors azidothymidine and foscarnet and by heat inactivation of the virus stock prior to infection. Furthermore, entry of SIVmac239 and macrophage-tropic variant into macrophages was inhibited by monoclonal antibody against CD4. Analysis of the time course of viral DNA accumulation showed that although initial entry of SIVmac239 into cells occurred normally, subsequent logarithmic increases in the amounts of viral DNA associated with spread of virus through the macrophage cultures was blocked. Increasing the amount of SIVmac239 incubated with macrophages increased the amount of virus entering the cell, but this could not overcome the block to replication. Thus, restricted replication of SIVmac239 in macrophages is determined by the envelope, but surprisingly it is not due to restricted virus entry. Images PMID:7682627

  9. Structural Insights into the Coupling of Virion Assembly and Rotavirus Replication

    PubMed Central

    Trask, Shane D.; McDonald, Sarah M.; Patton, John T.

    2013-01-01

    Preface Viral replication is rapid and robust, but it is far from a chaotic process. Instead, successful production of infectious progeny requires that events occur in the correct place and at the correct time. Rotavirus, a segmented double-stranded RNA virus of the Reoviridae family, seems to govern its replication through ordered disassembly and assembly of a triple-layered icosahedral capsid. In recent years, high-resolution structural data have provided unprecedented insight into these events. In this Review, we explore the current understanding of rotavirus replication and how it compares to other Reoviridae family members. PMID:22266782

  10. Mutations disrupting histone methylation have different effects on replication timing in S. pombe centromere.

    PubMed

    Li, Pao-Chen; Green, Marc D; Forsburg, Susan L

    2013-01-01

    The fission yeast pericentromere comprises repetitive sequence elements packaged into heterchromatin marked by histone H3K9 methylation and Swi6 binding. Transient disruption of Swi6 during S phase allows a period of RNA synthesis which programs the RNAi machinery to maintain histone methylation. However, Swi6 is also required for early replication timing. We show that not only Swi6 but also the chromodomain protein Chp1 are delocalized during S phase. Different from loss of swi6, mutations that disrupt histone methylation in the centromere, chp1? and clr4?, undergo early DNA replication. However, timing is modestly delayed in RNAi mutants dcr1? or rdp1?, while hrr1? mutants resemble swi6? in their replication delay. Finally, we show that recruitment of RNA polymerase II in the centromere occurs independently of replication. These different effects indicate that replication timing is not simply linked to histone methylation. PMID:23658693

  11. Glucocorticosteroids enhance replication of respiratory viruses: effect of adjuvant interferon.

    PubMed

    Thomas, Belinda J; Porritt, Rebecca A; Hertzog, Paul J; Bardin, Philip G; Tate, Michelle D

    2014-01-01

    Glucocorticosteroids (GCS) are used on a daily basis to reduce airway inflammation in asthma and chronic obstructive pulmonary disease (COPD). This treatment is usually escalated during acute disease exacerbations, events often associated with virus infections. We examined the impact of GCS on anti-viral defences and virus replication and assessed supplementary interferon (IFN) treatment. Here, we report that treatment of primary human airway cells in vitro with GCS prior to rhinovirus (RV) or influenza A virus (IAV) infection significantly reduces the expression of innate anti-viral genes and increases viral replication. Mice given intranasal treatment with GCS prior to IAV infection developed more severe disease associated with amplified virus replication and elevated inflammation in the airways. Adjuvant IFN treatment markedly reduced GCS-amplified infections in human airway cells and in mouse lung. This study demonstrates that GCS cause an extrinsic compromise in anti-viral defences, enhancing respiratory virus infections and provides a rationale for adjuvant IFN treatment. PMID:25417801

  12. Relationship of eukaryotic DNA replication to committed gene expression: general theory for gene control.

    PubMed Central

    Villarreal, L P

    1991-01-01

    The historic arguments for the participation of eukaryotic DNA replication in the control of gene expression are reconsidered along with more recent evidence. An earlier view in which gene commitment was achieved with stable chromatin structures which required DNA replication to reset expression potential (D. D. Brown, Cell 37:359-365, 1984) is further considered. The participation of nonspecific stable repressor of gene activity (histones and other chromatin proteins), as previously proposed, is reexamined. The possible function of positive trans-acting factors is now further developed by considering evidence from DNA virus models. It is proposed that these positive factors act to control the initiation of replicon-specific DNA synthesis in the S phase (early or late replication timing). Stable chromatin assembles during replication into potentially active (early S) or inactive (late S) states with prevailing trans-acting factors (early) or repressing factors (late) and may asymmetrically commit daughter templates. This suggests logical schemes for programming differentiation based on replicons and trans-acting initiators. This proposal requires that DNA replication precede major changes in gene commitment. Prior evidence against a role for DNA replication during terminal differentiation is reexamined along with other results from terminal differentiation of lower eukaryotes. This leads to a proposal that DNA replication may yet underlie terminal gene commitment, but that for it to do so there must exist two distinct modes of replication control. In one mode (mitotic replication) replicon initiation is tightly linked to the cell cycle, whereas the other mode (terminal replication) initiation is not cell cycle restricted, is replicon specific, and can lead to a terminally differentiated state. Aberrant control of mitotic and terminal modes of DNA replication may underlie the transformed state. Implications of a replicon basis for chromatin structure-function and the evolution of metazoan organisms are considered. Images PMID:1943999

  13. The Early America Review: A Journal of Fact and Opinion On the People, Issues and Events Of 18th Century America

    NSDL National Science Digital Library

    A site of interest to students of 18th Century America is the Early America Review. Early America Review is a new quarterly e-journal produced by DEV Communications, Inc., that is aimed toward both scholarly and lay readers. In that spirit, the first edition contains a long scholarly article on Benjamin Franklin and the Presbyterians by a Creighton University history professor, an introduction to the novel The Quintumviri by Circian, a letter from Jefferson to Madison ("...a little rebellion now and then is a good thing"), a poem, and a crossword puzzle (available only with Macromedia Shockwave). Early America Review is also enhanced with RealAudio clips. Both Shockwave and RealAudio are available from the site.

  14. Phosphoproteomic analyses reveal signaling pathways that facilitate lytic gammaherpesvirus replication.

    PubMed

    Stahl, James A; Chavan, Shweta S; Sifford, Jeffrey M; MacLeod, Veronica; Voth, Daniel E; Edmondson, Ricky D; Forrest, J Craig

    2013-09-01

    Lytic gammaherpesvirus (GHV) replication facilitates the establishment of lifelong latent infection, which places the infected host at risk for numerous cancers. As obligate intracellular parasites, GHVs must control and usurp cellular signaling pathways in order to successfully replicate, disseminate to stable latency reservoirs in the host, and prevent immune-mediated clearance. To facilitate a systems-level understanding of phosphorylation-dependent signaling events directed by GHVs during lytic replication, we utilized label-free quantitative mass spectrometry to interrogate the lytic replication cycle of murine gammaherpesvirus-68 (MHV68). Compared to controls, MHV68 infection regulated by 2-fold or greater ca. 86% of identified phosphopeptides - a regulatory scale not previously observed in phosphoproteomic evaluations of discrete signal-inducing stimuli. Network analyses demonstrated that the infection-associated induction or repression of specific cellular proteins globally altered the flow of information through the host phosphoprotein network, yielding major changes to functional protein clusters and ontologically associated proteins. A series of orthogonal bioinformatics analyses revealed that MAPK and CDK-related signaling events were overrepresented in the infection-associated phosphoproteome and identified 155 host proteins, such as the transcription factor c-Jun, as putative downstream targets. Importantly, functional tests of bioinformatics-based predictions confirmed ERK1/2 and CDK1/2 as kinases that facilitate MHV68 replication and also demonstrated the importance of c-Jun. Finally, a transposon-mutant virus screen identified the MHV68 cyclin D ortholog as a viral protein that contributes to the prominent MAPK/CDK signature of the infection-associated phosphoproteome. Together, these analyses enhance an understanding of how GHVs reorganize and usurp intracellular signaling networks to facilitate infection and replication. PMID:24068923

  15. Duration of Symptom and ABCD2 Score as Predictors of Risk of Early Recurrent Events after Transient Ischemic Attack: A Hospital-Based Case Series Study

    PubMed Central

    Li, Qiang; Zhu, Xiaolong; Feng, Chao; Fang, Min; Liu, Xueyuan

    2015-01-01

    Background The aim of this study was to refine clinical risk factor stratification and make an optimal intervention plan to prevent ischemic stroke. Material/Methods Clinical data, including diffusion-weighted imaging (DWI) findings, were collected in a cohort of hospitalized transient ischemic attack (TIA) patients from January 2010 to December 2011. Recurrent cerebrovascular events after TIA, including recurrent TIA, minor stroke, and major stroke, were identified by face-to-face follow-up. A multivariate, ordinal, logistic regression model was used to determine significant predictors of recurrent events. Results Of 106 TIA patients, 24 (22.6%) had recurrent TIA and 20 (18.9%) had a stroke within 7 days. Hypertension, dyslipidemia, a history of ischemic stroke or TIA, and ABCD2 score were significantly associated with the recurrent events after TIA (P<0.001, P=0.02, P<0.001, P=0.02). Hypertension (RR=9.21; 95% CI, 3.07–27.61, P<0.001) and duration of symptom (RR=1.10; 95% CI, 1.02–1.17, P=0.01) as an item of ABCD2 score were highly predictive of the severity of recurrent events, whereas ABCD2 score as a whole (P=0.18) proved to be less strongly predictive. Conclusions A history of hypertension and long duration of symptom independently and significantly predict severe recurrent events after TIA within 7 days, but a high ABCD2 score was less strongly predictive of severe recurrent events. PMID:25604068

  16. Uracil DNA Glycosylase BKRF3 Contributes to Epstein-Barr Virus DNA Replication through Physical Interactions with Proteins in Viral DNA Replication Complex

    PubMed Central

    Su, Mei-Tzu; Liu, I-Hua; Wu, Chia-Wei; Chang, Shu-Ming; Tsai, Ching-Hwa; Yang, Pei-Wen; Chuang, Yu-Chia; Lee, Chung-Pei

    2014-01-01

    ABSTRACT Epstein-Barr virus (EBV) BKRF3 shares sequence homology with members of the uracil-N-glycosylase (UNG) protein family and has DNA glycosylase activity. Here, we explored how BKRF3 participates in the DNA replication complex and contributes to viral DNA replication. Exogenously expressed Flag-BKRF3 was distributed mostly in the cytoplasm, whereas BKRF3 was translocated into the nucleus and colocalized with the EBV DNA polymerase BALF5 in the replication compartment during EBV lytic replication. The expression level of BKRF3 increased gradually during viral replication, coupled with a decrease of cellular UNG2, suggesting BKRF3 enzyme activity compensates for UNG2 and ensures the fidelity of viral DNA replication. In immunoprecipitation-Western blotting, BKRF3 was coimmunoprecipitated with BALF5, the polymerase processivity factor BMRF1, and the immediate-early transactivator Rta. Coexpression of BMRF1 appeared to facilitate the nuclear targeting of BKRF3 in immunofluorescence staining. Residues 164 to 255 of BKRF3 were required for interaction with Rta and BALF5, whereas residues 81 to 166 of BKRF3 were critical for BMRF1 interaction in glutathione S-transferase (GST) pulldown experiments. Viral DNA replication was defective in cells harboring BKRF3 knockout EBV bacmids. In complementation assays, the catalytic mutant BKRF3(Q90L,D91N) restored viral DNA replication, whereas the leucine loop mutant BKRF3(H213L) only partially rescued viral DNA replication, coupled with a reduced ability to interact with the viral DNA polymerase and Rta. Our data suggest that BKRF3 plays a critical role in viral DNA synthesis predominantly through its interactions with viral proteins in the DNA replication compartment, while its enzymatic activity may be supplementary for uracil DNA glycosylase (UDG) function during virus replication. IMPORTANCE Catalytic activities of both cellular UDG UNG2 and viral UDGs contribute to herpesviral DNA replication. To ensure that the enzyme activity executes at the right time and the right place in DNA replication forks, complex formation with other components in the DNA replication machinery provides an important regulation for UDG function. In this study, we provide the mechanism for EBV UDG BKRF3 nuclear targeting and the interacting domains of BKRF3 with viral DNA replication proteins. Through knockout and complementation approaches, we further demonstrate that in addition to UDG activity, the interaction of BKRF3 with viral proteins in the replication compartment is crucial for efficient viral DNA replication. PMID:24872582

  17. A Replication of Failure, Not a Failure to Replicate

    ERIC Educational Resources Information Center

    Holden, Gary; Barker, Kathleen; Kuppens, Sofie; Rosenberg, Gary; LeBreton, Jonathan

    2015-01-01

    Purpose: The increasing role of systematic reviews in knowledge production demands greater rigor in the literature search process. The performance of the Social Work Abstracts (SWA) database has been examined multiple times over the past three decades. The current study is a replication within this line of research. Method: Issue-level coverage…

  18. Exploiting replication in distributed systems

    NASA Technical Reports Server (NTRS)

    Birman, Kenneth P.; Joseph, T. A.

    1989-01-01

    Techniques are examined for replicating data and execution in directly distributed systems: systems in which multiple processes interact directly with one another while continuously respecting constraints on their joint behavior. Directly distributed systems are often required to solve difficult problems, ranging from management of replicated data to dynamic reconfiguration in response to failures. It is shown that these problems reduce to more primitive, order-based consistency problems, which can be solved using primitives such as the reliable broadcast protocols. Moreover, given a system that implements reliable broadcast primitives, a flexible set of high-level tools can be provided for building a wide variety of directly distributed application programs.

  19. Alternate pathways involving Sgs1/Top3, Mus81/ Mms4, and Srs2 prevent formation of toxic recombination intermediates from single-stranded gaps created by DNA replication.

    PubMed

    Fabre, Francis; Chan, Allan; Heyer, Wolf-Dietrich; Gangloff, Serge

    2002-12-24

    Toxic recombination events are detected in vegetative Saccharomyces cerevisiae cells through negative growth interactions between certain combinations of mutations. For example, mutations affecting both the Srs2 and Sgs1 helicases result in extremely poor growth, a phenotype suppressed by mutations in genes that govern early stages of recombination. Here, we identify a similar interaction involving double mutations affecting Sgs1 or Top3 and Mus81 or Mms4. We also find that the primary DNA structures that initiate these toxic recombination events cannot be double-strand breaks and thus are likely to be single-stranded DNA. We interpret our results in the context of the idea that replication stalling leaves single-stranded DNA, which can then be processed by two competing mechanisms: recombination and nonrecombination gap-filling. Functions involved in preventing toxic recombination would either avoid replicative defects or act on recombination intermediates. Our results suggest that Srs2 channels recombination intermediates back into the gap-filling route, whereas Sgs1Top3 and Mus81Mms4 are involved in recombination andor in replication to allow replication restart. PMID:12475932

  20. 3-Methyladenine blocks Toxoplasma gondii division prior to centrosome replication.

    PubMed

    Wang, Yubao; Karnataki, Anuradha; Parsons, Marilyn; Weiss, Louis M; Orlofsky, Amos

    2010-10-01

    The apicomplexan Toxoplasma gondii replicates by endodyogeny, in which replicated organelles assemble into nascent daughter buds within the maternal parasite. The mechanisms governing this complex sequence are not understood. We now report that the kinase inhibitor 3-methlyadenine (3-MA) efficiently blocks T. gondii replication. The inhibition could not be attributed to the effects of 3-MA on mammalian phosphatidylinositol 3-kinase and host cell autophagy. Furthermore, we show that accumulation of host lysosomes around the parasitophorous vacuoles was unaffected. Most 3-MA-treated parasites failed to form daughter buds or replicate DNA, indicating arrest in G1 or early S-phase. Some 3-MA-treated parasites displayed abortive cell division, in which nuclear segregation to malformed daughter buds was incomplete or asymmetrical. Electron microscopy revealed the presence of residual body-like structures in many vacuoles, even in the absence of daughter buds. Most treated parasites had otherwise normal morphology and were able to resume replication upon drug removal. 3-MA-treated and control parasites were similar with respect to the extent of Golgi body division and apicoplast elongation; however, treated parasites rarely possessed replicated centrosomes or apicoplasts. These data are suggestive of a generalized blockade of T. gondii cell cycle progression at stages preceding centrosome replication, rather than arrest at a specific checkpoint. We hypothesize that 3-MA treatment triggers a cell cycle pause program that may serve to protect parasites during periods, such as subsequent to egress, when cell cycle progression might be deleterious. Elucidation of the mechanism of 3-MA inhibition may provide insight into the control of parasite growth. PMID:20609430

  1. Coordinating DNA replication with cell division: lessons from outgrowing spores.

    PubMed

    Harry, E J

    2001-01-01

    Progress in solving the long-standing puzzle of how a cell coordinates chromosome replication with cell division is significantly aided by the use of synchronous cell populations. Currently three systems are employed for obtaining such populations: the Escherichia coli 'baby machine', the developmentally-controlled cell cycle of Caulobacter crescentus, and Bacillus subtilis germinated and outgrowing spores. This review examines our current understanding of the relationship between replication and division and how the use of B. subtilis outgrowing spores and, more recently its combination with immunofluorescence microscopy, has contributed significantly to this important area of biology. About 20 years ago, and also more recently, this system was used to show convincingly that termination of DNA replication is not essential for a central septum to form, raising the possibility that the early stages of division occur well before termination. It has also been demonstrated that there is no major synthesis of the division initiation proteins, FtsZ and DivIB, linked to initiation, progression or completion of the first round of chromosome replication accompanying spore outgrowth. This has led to the suggestion that the primary link between chromosome replication and cell division at midcell is not likely to occur through a control over the levels of these proteins. Very recent work has employed a combination of the use of B. subtilis outgrowing spores with immunofluorescence microscopy to investigate the relationship between midcell Z ring assembly and the round of chromosome replication linked to it. The results of this work suggest a role for initiation and progression into the round of replication in blocking midcell Z ring formation until the round is complete or almost complete, thereby ensuring that cell division occurs between two equally-partitioned chromosomes. PMID:11254978

  2. Modulation of the C1 Visual Event-related Component by Conditioned Stimuli: Evidence for Sensory Plasticity in Early Affective Perception

    Microsoft Academic Search

    Margarita Stolarova; Andreas Keil; Stephan Moratti

    2006-01-01

    Previous research has demonstrated optimized processing of motivationally significant stimuli early in perception. In the present study, the time course and underlying mechanisms for such fast differentiation are of interest. We investigated the involvement of the primary visual cortex in affective evaluation of conditioned stimuli (CSs). In order to elicit learning within the visual system we chose affective pictures as

  3. Development of a Systems Computational Model to Investigate Early Biological Events in Hepatic Activation of Constitutive Androstane Receptor (CAR) by Phenobarbital

    EPA Science Inventory

    Activation of the nuclear receptor CAR (constitutive active/androstane receptor) is implicated in the control several key biological events such as metabolic pathways. Here, we combined data from literature with information obtained from in vitro assays in the US EPA ToxCast dat...

  4. The Impact of Early Institutional Rearing on the Ability to Discriminate Facial Expressions of Emotion: An Event-Related Potential Study

    ERIC Educational Resources Information Center

    Parker, Susan W.; Nelson, Charles A.

    2005-01-01

    Event-related potentials (ERPs), in response to 4 facial expressions of fear, angry, happy, and sad, were collected from 72 institutionalized children (IG), ages 7 to 32 months, in Bucharest, Romania, and compared with ERPs from 33 children, ages 8 to 32 months, who had never been institutionalized (NIG). The NIG and IG exhibited different…

  5. Chameleon Chasing II: A Replication.

    ERIC Educational Resources Information Center

    Newsom, Doug A.; And Others

    1993-01-01

    Replicates a 1972 survey of students, educators, and Public Relations Society of America members regarding who the public relations counselor really serves. Finds that, in 1992, most respondents thought primary responsibility was to the client, then to the client's relevant publics, then to self, then to society, and finally to media. Compares…

  6. An algorithm, for replicated directories

    Microsoft Academic Search

    Dean S. Daniels; Alfred Z. Spector

    1983-01-01

    This paper describes a replication algorithm for directory objects based upon Gifford's weighted voting for files. The algorithm associates version number with each possible key on every replica and thereby resolves an ambiguity that arises when directory entries are not stored in every replica. The range of keys associated with a version number changes dynamically; but in all instances, a

  7. Chapter 7: Self-replication

    Microsoft Academic Search

    Johann Wolfgang von Goethe; Dario Dariol

    Note: The strange line above is called a 'Quine' (from the name of the logician Willard van Orman Quine, via Douglas Hofstadter). It is a C program that, when executed, will print out an exact copy of its own source code. This is a very small example of a self-replicating program. Can you figure out how it works?

  8. Contextual Replication for Mobile Users

    Microsoft Academic Search

    Murali Rangan; Edward Swierk; Douglas B. Terry

    2005-01-01

    The classic tension between designing systems around thin client applications to facilitate controlling and sharing an enterprise's information resources and thick client applications to avoid dependence on a centralized, potentially unreliable infrastructure has never been more prominent than in today's mobile computing environments. Contextual replication can mitigate this tension by providing mobile users with the benefits of shared information managed

  9. Epidemic Algorithms for Replicated Databases

    Microsoft Academic Search

    Joanne Holliday; Robert C. Steinke; Divyakant Agrawal; Amr El Abbadi

    2003-01-01

    We present a family of epidemic algorithms for maintaining replicated database systems. The algorithms are based on the causal delivery of log records where each record corresponds to one transaction instead of one operation. The first algorithm in this family is a pessimistic protocol that ensures serializability and guarantees strict executions. Since we expect the epidemic algorithms to be used

  10. Hyperthermia Stimulates HIV-1 Replication

    PubMed Central

    Roesch, Ferdinand; Meziane, Oussama; Kula, Anna; Nisole, Sébastien; Porrot, Françoise; Anderson, Ian; Mammano, Fabrizio; Fassati, Ariberto; Marcello, Alessandro; Benkirane, Monsef; Schwartz, Olivier

    2012-01-01

    HIV-infected individuals may experience fever episodes. Fever is an elevation of the body temperature accompanied by inflammation. It is usually beneficial for the host through enhancement of immunological defenses. In cultures, transient non-physiological heat shock (42–45°C) and Heat Shock Proteins (HSPs) modulate HIV-1 replication, through poorly defined mechanisms. The effect of physiological hyperthermia (38–40°C) on HIV-1 infection has not been extensively investigated. Here, we show that culturing primary CD4+ T lymphocytes and cell lines at a fever-like temperature (39.5°C) increased the efficiency of HIV-1 replication by 2 to 7 fold. Hyperthermia did not facilitate viral entry nor reverse transcription, but increased Tat transactivation of the LTR viral promoter. Hyperthermia also boosted HIV-1 reactivation in a model of latently-infected cells. By imaging HIV-1 transcription, we further show that Hsp90 co-localized with actively transcribing provirus, and this phenomenon was enhanced at 39.5°C. The Hsp90 inhibitor 17-AAG abrogated the increase of HIV-1 replication in hyperthermic cells. Altogether, our results indicate that fever may directly stimulate HIV-1 replication, in a process involving Hsp90 and facilitation of Tat-mediated LTR activity. PMID:22807676

  11. Crinivirus replication and host interactions

    PubMed Central

    Kiss, Zsofia A.; Medina, Vicente; Falk, Bryce W.

    2013-01-01

    Criniviruses comprise one of the genera within the family Closteroviridae. Members in this family are restricted to the phloem and rely on whitefly vectors of the genera Bemisia and/or Trialeurodes for plant-to-plant transmission. All criniviruses have bipartite, positive-sense single-stranded RNA genomes, although there is an unconfirmed report of one having a tripartite genome. Lettuce infectious yellows virus (LIYV) is the type species of the genus, the best studied so far of the criniviruses and the first for which a reverse genetics system was developed. LIYV RNA 1 encodes for proteins predicted to be involved in replication, and alone is competent for replication in protoplasts. Replication results in accumulation of cytoplasmic vesiculated membranous structures which are characteristic of most studied members of the Closteroviridae. These membranous structures, often referred to as Beet yellows virus (BYV)-type vesicles, are likely sites of RNA replication. LIYV RNA 2 is replicated in trans when co-infecting cells with RNA 1, but is temporally delayed relative to RNA 1. Efficient RNA 2 replication also is dependent on the RNA 1-encoded RNA-binding protein, P34. No LIYV RNA 2-encoded proteins have been shown to affect RNA replication, but at least four, CP (major coat protein), CPm (minor coat protein), Hsp70h, and P59 are virion structural components and CPm is a determinant of whitefly transmissibility. Roles of other LIYV RNA 2-encoded proteins are largely as yet unknown, but P26 is a non-virion protein that accumulates in cells as characteristic plasmalemma deposits which in plants are localized within phloem parenchyma and companion cells over plasmodesmata connections to sieve elements. The two remaining crinivirus-conserved RNA 2-encoded proteins are P5 and P9. P5 is 39 amino acid protein and is encoded at the 5? end of RNA 2 as ORF 1 and is part of the hallmark closterovirus gene array. The orthologous gene in BYV has been shown to play a role in cell-to-cell movement and indicated to be localized to the endoplasmic reticulum as a Type III integral membrane protein. The other small protein, P9, is encoded by ORF 4 overlaps with ORF 3 that encodes the structural protein, P59. P9 seems to be unique to viruses in the genus Crinivirus, as no similar protein has been detected in viruses of the other two genera of the Closteroviridae. PMID:23730299

  12. Replication domains are self-interacting structural chromatin units of human chromosomes

    NASA Astrophysics Data System (ADS)

    Arneodo, Alain

    2011-03-01

    In higher eukaryotes, the absence of specific sequence motifs marking the origins of replication has been a serious hindrance to the understanding of the mechanisms that regulate the initiation and the maintenance of the replication program in different cell types. In silico analysis of nucleotide compositional skew has predicted the existence, in the germline, of replication N-domains bordered by putative replication origins and where the skew decreases rather linearly as the signature of a progressive inversion of the average fork polarity. Here, from the demonstration that the average fork polarity can be directly extracted from the derivative of replication timing profiles, we develop a wavelet-based pattern recognition methodology to delineate replication U-domains where the replication timing profile is shaped as a U and its derivative as a N. Replication U-domains are robustly found in seven cell lines as covering a significant portion (40-50%) of the human genome where the replication timing data actually displays some plasticity between cell lines. The early replication initiation zones at U-domains borders are found to be hypersensitive to DNase I cleavage, to be associated with transcriptional activity and to present a significant enrichment in insular-binding proteins CTCF, the hallmark of an open chromatin structure. A comparative analysis of genome-wide chromatin interaction (HiC) data shows that replication-U domains correspond to self-interacting structural high order chromatin units of megabase characteristic size. Taken together, these findings provide evidence that the epigenetic compartmentalization of the human genome into autonomous replication U-domains comes along with an extensive remodelling of the threedimensional chromosome architecture during development or in specific diseases. The observed cell specific conservation of the replication timing between the human and mouse genomes strongly suggests that this chromosome organization into self-interacting structural and functional units is a general feature of mammalian organisms.

  13. Combination therapy with conditionally replicating adenovirus and replication defective adenovirus.

    PubMed

    Lee, Choon-Taek; Park, Kyung-Ho; Yanagisawa, Kiyoshi; Adachi, Yasushi; Ohm, Joyce E; Nadaf, Sorena; Dikov, Mikhail M; Curiel, David T; Carbone, David P

    2004-09-15

    Low gene transfer rate is the most substantial hurdle in the practical application of gene therapy. One strategy to improve transfer efficiency is the use of a conditionally replicating adenovirus (CRAD) that can selectively replicate in tumor cells. We hypothesized that conventional E1-deleted adenoviruses (ad) can become replication-competent when cotransduced with a CRAD to selectively supply E1 in trans in tumors. The resulting selective production of large numbers of the E1-deleted ad within the tumor mass will increase the transduction efficiency. We used a CRAD (Delta24RGD) that produces a mutant E1 without the ability to bind retinoblastoma but retaining viral replication competence in cancer cells with a defective pRb/p16. Ad-lacZ, adenovirus-luciferase (ad-luc), and adenovirus insulin-like growth factor-1R/dominant-negative (ad-IGF-1R/dn; 482, 950) are E1-deleted replication-defective adenoviruses. The combination of CRAD and ad-lacZ increased the transduction efficiency of lacZ to 100% from 15% observed with ad-lacZ alone. Transfer of media of CRAD and ad-lacZ cotransduced cells induced the transfer of lacZ (media transferable bystander effect). Combination of CRAD and ad-IGF-1R/dn increased the production of truncated IGF-1R or soluble IGF-1R > 10 times compared with transduction with ad-IGF-1R/dn alone. Combined intratumoral injection of CRAD and ad-luc increased the luciferase expression about 70 times compared with ad-luc alone without substantial systemic spread. Combined intratumoral injection of CRAD and ad-IGF-1R/482 induced stronger growth suppression of established lung cancer xenografts than single injections. The combination of CRAD and E1-deleted ad induced tumor-specific replication of CRAD and E1-deleted ad and increased the transduction rate and therapeutic efficacy of these viruses in model tumors. PMID:15374981

  14. Modulation of HIV1 replication by RNA interference

    Microsoft Academic Search

    Jean-Marc Jacque; Karine Triques; Mario Stevenson

    2002-01-01

    RNA interference (RNAi) is the process by which double-stranded RNA (dsRNA) directs sequence-specific degradation of messenger RNA in animal and plant cells. In mammalian cells, RNAi can be triggered by 21-nucleotide duplexes of small interfering RNA (siRNA). Here we describe inhibition of early and late steps of HIV-1 replication in human cell lines and primary lymphocytes by siRNAs targeted to

  15. Temporal organization of replication in DNA fibers of mammalian cells

    PubMed Central

    1979-01-01

    The extent of coordinate control over the multiple initiation events in DNA replication has been investigated in three mammalian cell lines by DNA fiber autoradiography. Quantitative estimates have been obtained of the degree of synchrony among initiations occurring on stretches of DNA. Synchrony decreases markedly with increasing distance between initiation sites in MDBK (bovine) and L929 (mouse) cells, but only slightly in muntjac cells. Possible control mechanisms for the initiation process are discussed. PMID:457781

  16. Eyewitness Suggestibility and Source Similarity: Intrusions of Details from One Event into Memory Reports of Another Event

    ERIC Educational Resources Information Center

    Lindsay, D. Stephen; Allen, Bem P.; Chan, Jason C. K.; Dahl, Leora C.

    2004-01-01

    We explored the effect of the degree of conceptual similarity between a witnessed event and an extra-event narrative on eyewitness suggestibility. Experiments 1A and 1B replicated Allen and Lindsay's (1998) finding that subjects sometimes intrude details from a narrative description of one event into their reports of a different visual event

  17. HIV-1 sexual transmission: early events of HIV-1 infection of human cervico-vaginal tissue in an optimized ex vivo model.

    PubMed

    Saba, E; Grivel, J-C; Vanpouille, C; Brichacek, B; Fitzgerald, W; Margolis, L; Lisco, A

    2010-05-01

    Infection and dissemination of human immunodeficiency virus (HIV)-1 through the female body after vaginal intercourse depends on the activation/differentiation status of mucosal CD4 T cells. In this study, we investigated this status and the susceptibility to HIV-1 infection of human cervico-vaginal tissue ex vivo. We found that virtually all T cells are of the effector memory phenotype with broad CC chemokine receptor 5 (CCR5) expression. As it does in vivo, human cervico-vaginal tissue ex vivo preferentially supports the productive infection of R5 HIV-1 rather than that of X4 HIV-1 in spite of the broad expression of CXC chemokine receptor 4 (CXCR4). X4 HIV-1 replicated only in the few tissues that were enriched in CD27(+)CD28(+) effector memory CD4 T cells. Productive infection of R5 HIV-1 occurred preferentially in activated CD38(+)CD4 T cells and was followed by a similar activation of HIV-1-uninfected (bystander) CD4 T cells that may amplify viral infection. These results provide new insights into the dependence of HIV-1 infection and dissemination on the activation/differentiation of cervico-vaginal lymphocytes. PMID:20147895

  18. The role of temporal abundance structure and habitat preferences in the survival of conodonts during the mid-early Silurian Ireviken mass extinction event.

    PubMed

    Spiridonov, Andrej; Brazauskas, Antanas; Radzevi?ius, Sigitas

    2015-01-01

    The Ireviken event was one of the most intense extinction episodes that occurred during the mid-Paleozoic era. It had a strong global effect on a range of clades, with conodonts, graptolites and chitinozoans affected most. Using geophysical proxies and conodont species parameters of their temporal abundance structure we investigate how they affected the selectivity of conodont species survival during this calamity. After performing bivariate logistic analyses on 34 species of conodonts, we find three variables that were statistically significantly associated with their odds of survival. These namely include spectral exponents that describe degrees of autocorrelation in a time series, the skewness of species abundance distribution, and average environmental preferences, which are mostly determined by ancient water depths at sampling sites. Model selection of multivariate logistic models found the best model includes species local abundance skewness and substrate preference. A similar pattern is revealed through the regression tree analysis. The apparent extinction selectivity points to a possible causes of environmental deterioration during the Ireviken event. The significant positive relationship between extinction risk and preferential existence in deeper environments suggests the open ocean causal mechanisms of biotic stress that occurred during the Ireviken event. Marine regressions, which were previously suggested as a causal factor in this extinction episode, on theoretical grounds should have had higher impact on species living in near-shore environments, through the processes of habitat loss which are associated with decreases of shelfal areas. In addition, the significant positive correlations found between skewness of abundance distributions and spectral exponent values and the probability of species survival suggest that community and ecosystem processes (which controlled species abundance fluctuation patterns) were significantly related to selectivity processes of this smaller mass extinction event. PMID:25859854

  19. Elevation of Mitochondrial Transmembrane Potential and Reactive Oxygen Intermediate Levels Are Early Events and Occur Independently from Activation of Caspases in Fas Signaling1

    Microsoft Academic Search

    Katalin Banki; Eliza Hutter; Nick J. Gonchoroff; Andras Perl

    Stimulation of the CD95\\/Fas\\/Apo-1 receptor leads to apoptosis through activation of the caspase family of cysteine proteases and disruption of the mitochondrial transmembrane potential (Dcm). We show that, in Jurkat human T cells and peripheral blood lymphocytes, Fas-induced apoptosis is preceded by 1) an increase in reactive oxygen intermediates (ROI) and 2) an elevation of Dcm. These events are followed

  20. Event-related brain potentials to Memory Workload and ‘Analytical-Specific Perception’ (Mangina-Test) in patients with early Alzheimer's Disease and in normal controls

    Microsoft Academic Search

    J. Helen Beuzeron-Mangina; Constantine A Mangina

    2000-01-01

    Our previous research with intra-cerebral event-related potentials in conjunction with an original Memory Workload Paradigm has shown that significant load effects for the N4 latency were found only for both amygdalae and the left posterior hippocampus as well as for both anterior neo-cortical regions of the temporal gyri. These same structures are also affected in Alzheimer’s Disease. Therefore, based on

  1. Regulation of DNA replication during development

    PubMed Central

    Nordman, Jared; Orr-Weaver, Terry L.

    2012-01-01

    As development unfolds, DNA replication is not only coordinated with cell proliferation, but is regulated uniquely in specific cell types and organs. This differential regulation of DNA synthesis requires crosstalk between DNA replication and differentiation. This dynamic aspect of DNA replication is highlighted by the finding that the distribution of replication origins varies between differentiated cell types and changes with differentiation. Moreover, differential DNA replication in some cell types can lead to increases or decreases in gene copy number along chromosomes. This review highlights the recent advances and technologies that have provided us with new insights into the developmental regulation of DNA replication. PMID:22223677

  2. Pathways of mammalian replication fork restart.

    PubMed

    Petermann, Eva; Helleday, Thomas

    2010-10-01

    Single-molecule analyses of DNA replication have greatly advanced our understanding of mammalian replication restart. Several proteins that are not part of the core replication machinery promote the efficient restart of replication forks that have been stalled by replication inhibitors, suggesting that bona fide fork restart pathways exist in mammalian cells. Different models of replication fork restart can be envisaged, based on the involvement of DNA helicases, nucleases, homologous recombination factors and the importance of DNA double-strand break formation. PMID:20842177

  3. The distribution of genomic variations in human iPSCs is related to replication timing reorganization during reprogramming

    PubMed Central

    Lu, Junjie; Li, Hu; Hu, Ming; Sasaki, Takayo; Baccei, Anna; Gilber, David M.; Liu, Jun S.; Collins, James J.; Lerou, Paul H.

    2014-01-01

    SUMMARY Cell fate change involves significant genome reorganization, including change in replication timing, but how these changes are related to genetic variation has not been examined. To study how change in replication timing that occurs during reprogramming impacts the copy number variation (CNV) landscape, we generated genome-wide replication timing profiles of induced pluripotent stem cells (iPSCs) and their parental fibroblasts. A significant portion of the genome changes replication timing as a result of reprogramming, indicative of overall genome reorganization. We found that early and late replicating domains in iPSCs are differentially affected by copy number gains and losses, and that in particular CNV gains accumulate in regions of the genome that change to earlier replication during the reprogramming process. This differential relationship was present irrespective of reprogramming method. Overall, our findings reveal a functional association between reorganization of replication timing and the CNV landscape that emerges during reprogramming. PMID:24685138

  4. Early events of metastasis in the microcirculation involve changes in gene expression of cancer cells. Tracking mRNA levels of metastasizing cancer cells in the chick embryo chorioallantoic membrane.

    PubMed Central

    Shioda, T.; Munn, L. L.; Fenner, M. H.; Jain, R. K.; Isselbacher, K. J.

    1997-01-01

    The early events of metastasis involve multiple interactions between cancer cells and the host microcirculation during cancer cell arrest, adhesion, and extravasation. These interactions may lead to changes in gene expression of the metastasizing cancer cells, although such changes have never been demonstrated directly. To test this hypothesis, B16-F10 murine melanoma cells were injected intravenously into the chick embryo chorioallantoic membrane (CAM), and mRNA levels in the metastasizing cancer cells were evaluated by species-specific reverse transcription polymerase chain reaction. Unlike standard mouse models of experimental metastasis, the CAM model showed successful extravasation of a large number of the arrested cancer cells in the CAM microcirculation without significant cancer cell death, providing a unique opportunity to keep track of mRNA levels in cancer cells during the early phases of metastasis. Using this model, we were able to demonstrate directly the temporal induction of cancer cell genes that potentially affect metastatic efficiency, namely, Fos (5 to 60 minutes after injection), vascular permeability factor (4 to 7 hours), and urokinase plasminogen activator (> 9 hours). In conclusion, using the CAM system, we have observed an alteration of gene expression in cancer cells in the early phases of metastasis, most likely as a consequence of host-cancer cell interactions. These changes may influence the metastatic behavior of cancer cells. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9176401

  5. Paleoceanographic changes of the Late Pliensbachian-Early Toarcian interval: a possible link to the genesis of an Oceanic Anoxic Event

    NASA Astrophysics Data System (ADS)

    Bailey, T. R.; Rosenthal, Y.; McArthur, J. M.; van de Schootbrugge, B.; Thirlwall, M. F.

    2003-07-01

    Secular records of the elemental and isotopic composition of belemnite calcite were studied in Pliensbachian and Toarcian sections from the Yorkshire coast, UK, and Southern Germany, to investigate oceanographic change during an interval prior to and including the Toarcian Oceanic Anoxic Event (OAE). Records from Southern Germany are correlated to the UK stratigraphy using strontium isotope stratigraphy. The geochemical trends measured from belemnite calcite are consistent between the two sections, and are interpreted in terms of temperature and salinity of the northwest European epi-continental sea. The data suggest that a dramatic environmental change coincided with the Toarcian OAE. Belemnite Mg/Ca, Sr/Ca, and Na/Ca ratios increase by a factor of between 1.7 and 2 coincident with a 3‰ negative shift in ? 18O from the mid- tenuicostatum zone until the lower falciferum zone of the UK ammonite biostratigraphy (a period of ˜0.6-0.7 Myr). Taken at face value, the Mg/Ca and ? 18O data argue for an abrupt warming of 6-7°C and substantial freshening during this interval. Global warming accompanied by an accelerated hydrological cycle and increased runoff is proposed to explain these changes. Prior to these events, data from lower in the Yorkshire section suggest a possible cooling accompanied by a shift to more saline waters during the period from the upper Pliensbachian margaritatus zone to the Toarcian lower tenuicostatum zone. This earlier event may also have been important in causing density stratification in the northwest European epi-continental sea.

  6. Speculations on events in the very early universe beyond the standard model: 0th generation stage immediately following the big bang

    E-print Network

    Mladen Georgiev

    2010-02-18

    We suggest that by virtue of the very early processes immediately following the big bang incipient 1st generation particles are created forming periodic strings to confine the quarks. These strings may be described either by the Laplace equation, due to vanishing space charges, or by Poisson-Boltzmann (PB) equation, due to finite charges. We also propose that the supersymmetry created by the big bang is broken through extended vibronic mixing at the end of the 0th generation giving rise to the diversity of atoms and molecules at the later stages of the evolving universe. We choose quark confinement by electrostatic strings supplied by 2D solutions of the PB equation.

  7. Impact of Early Interferon Beta1b Treatment on Disease Evolution Over 5Years in Patients with a First Event Suggestive of Multiple Sclerosis

    Microsoft Academic Search

    L Kappos; G Edan; H-P Hartung; D H Miller; X Montalbán; F Barkhof; L Bauer; V Lanius; C Metzig; C Pohl; R Sandbrink

    2008-01-01

    Background: TheBENEFITstudy(BEtaseron ®\\/BEtaferon ®inNewlyEmergingMS For Initial Treatment) was designed to evaluate the impact of early treatment initiationwithinterferonbeta-1b(IFNB-1b;Betaseron ®\\/Betaferon ®)inpatients withafirsteventsuggestiveofmultiplesclerosis(MS). Objective: Topresentthe5-yearresults. Methods: Intheplacebo-controlledphase,patientswererandomizedtoIFNB-1b 250 µg or placebo, subcutaneously every other day, for 2 years or until clinicallydefiniteMS(CDMS),ifearlier.Patientscouldthenenrollinafollow-up phase and were offered, but not required to take, IFNB-1b. Patients and physicians remained blinded to the initial treatment allocation. Patients initially

  8. The timing of early life events and growth rate estimates of age-0?year group brill Scophthalmus rhombus along the west coast of Ireland.

    PubMed

    Haynes, P S; Brophy, D; McGrath, D

    2014-01-01

    The timing of spawning and hatching, larval durations and growth exhibited by juvenile brill Scophthalmus rhombus captured along the Irish west coast were estimated using otolith microstructure analysis. Scophthalmus rhombus were estimated to have hatched between February and May, with fish settling onto nursery grounds between March and June. Fish collected later on in the season exhibited higher otolith growth rates in comparison to earlier collected fish. This is the first study to describe the early life history of a commercially valuable but understudied flatfish species. PMID:24383806

  9. The effects of nuclear reprogramming on mitochondrial DNA replication.

    PubMed

    Kelly, Richard D W; Sumer, Huseyin; McKenzie, Matthew; Facucho-Oliveira, Joao; Trounce, Ian A; Verma, Paul J; St John, Justin C

    2013-02-01

    Undifferentiated mouse embryonic stem cells (ESCs) possess low numbers of mitochondrial DNA (mtDNA), which encodes key subunits associated with the generation of ATP through oxidative phosphorylation (OXPHOS). As ESCs differentiate, mtDNA copy number is regulated by the nuclear-encoded mtDNA replication factors, which initiate a major replication event on Day 6 of differentiation. Here, we examined mtDNA replication events in somatic cells reprogrammed to pluripotency, namely somatic cell-ES (SC-ES), somatic cell nuclear transfer ES (NT-ES) and induced pluripotent stem (iPS) cells, all at low-passage. MtDNA copy number in undifferentiated iPS cells was similar to ESCs whilst SC-ES and NT-ES cells had significantly increased levels, which correlated positively and negatively with Nanog and Sox2 expression, respectively. During pluripotency and differentiation, the expression of the mtDNA-specific replication factors, PolgA and Peo1, were differentially expressed in iPS and SC-ES cells when compared to ESCs. Throughout differentiation, reprogrammed somatic cells were unable to accumulate mtDNA copy number, characteristic of ESCs, especially on Day 6. In addition, iPS and SC-ES cells were also unable to regulate ATP content in a manner similar to differentiating ESCs prior to Day 14. The treatment of reprogrammed somatic cells with an inhibitor of de novo DNA methylation, 5-Azacytidine, prior to differentiation enabled iPS cells, but not SC-ES and NT-ES cells, to accumulate mtDNA copies per cell in a manner similar to ESCs. These data demonstrate that the reprogramming process disrupts the regulation of mtDNA replication during pluripotency but this can be re-established through the use of epigenetic modifiers. PMID:21994000

  10. 36 CFR 910.64 - Replication.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...Terms § 910.64 Replication. Replication means the process of using modern methods and materials to reproduce the exact form and details of a vanished building, structure, object, or portion thereof, as it appeared at a particular...

  11. 36 CFR 910.64 - Replication.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...Terms § 910.64 Replication. Replication means the process of using modern methods and materials to reproduce the exact form and details of a vanished building, structure, object, or portion thereof, as it appeared at a particular...

  12. Redefining bacterial origins of replication as centralized information processors

    PubMed Central

    Marczynski, Gregory T.; Rolain, Thomas; Taylor, James A.

    2015-01-01

    In this review we stress the differences between eukaryotes and bacteria with respect to their different cell cycles, replication mechanisms and genome organizations. One of the most basic and underappreciated differences is that a bacterial chromosome uses only one ori while eukaryotic chromosome uses multiple oris. Consequently, eukaryotic oris work redundantly in a cell cycle divided into separate phases: First inactive replication proteins assemble on eukaryotic oris, and then they await conditions (in the separate “S-phase”) that activate only the ori-bound and pre-assembled replication proteins. S-phase activation (without re-assembly) ensures that a eukaryotic ori “fires” (starts replication) only once and that each chromosome consistently duplicates only once per cell cycle. This precise chromosome duplication does not require precise multiple ori firing in S-phase. A eukaryotic ori can fire early, late or not at all. The single bacterial ori has no such margin for error and a comparable imprecision is lethal. Single ori usage is not more primitive; it is a totally different strategy that distinguishes bacteria. We further argue that strong evolutionary pressures created more sophisticated single ori systems because bacteria experience extreme and rapidly changing conditions. A bacterial ori must rapidly receive and process much information in “real-time” and not just in “cell cycle time.” This redefinition of bacterial oris as centralized information processors makes at least two important predictions: First that bacterial oris use many and yet to be discovered control mechanisms and second that evolutionarily distinct bacteria will use many very distinct control mechanisms. We review recent literature that supports both predictions. We will highlight three key examples and describe how negative-feedback, phospho-relay, and chromosome-partitioning systems act to regulate chromosome replication. We also suggest future studies and discuss using replication proteins as novel antibiotic targets. PMID:26136739

  13. Mutator phenotypes due to DNA replication infidelity

    PubMed Central

    Arana, Mercedes E.; Kunkel, Thomas A.

    2011-01-01

    This article considers the fidelity of DNA replication performed by eukaryotic DNA polymerases involved in replicating the nuclear genome. DNA replication fidelity can vary widely depending on the DNA polymerase, the composition of the error, the flanking sequence, the presence of DNA damage and the ability to correct errors. As a consequence, defects in processes that determine DNA replication fidelity can confer strong mutator phenotypes whose specificity can help determine the molecular nature of the defect. PMID:20934516

  14. Eukaryotic Translation Initiation Factor 4E Is a Feed-Forward Translational Coactivator of Transforming Growth Factor ? Early Protransforming Events in Breast Epithelial Cells.

    PubMed

    Decarlo, Lindsey; Mestel, Celine; Barcellos-Hoff, Mary-Helen; Schneider, Robert J

    2015-08-01

    Eukaryotic translation initiation factor 4E (eIF4E) is overexpressed early in breast cancers in association with disease progression and reduced survival. Much remains to be understood regarding the role of eIF4E in human cancer. We determined, using immortalized human breast epithelial cells, that elevated expression of eIF4E translationally activates the transforming growth factor ? (TGF-?) pathway, promoting cell invasion, a loss of cell polarity, increased cell survival, and other hallmarks of early neoplasia. Overexpression of eIF4E is shown to facilitate the selective translation of integrin ?1 mRNA, which drives the translationally controlled assembly of a TGF-? receptor signaling complex containing ?3?1 integrins, ?-catenin, TGF-? receptor I, E-cadherin, and phosphorylated Smad2/3. This receptor complex acutely sensitizes nonmalignant breast epithelial cells to activation by typically substimulatory levels of activated TGF-?. TGF-? can promote cellular differentiation or invasion and transformation. As a translational coactivator of TGF-?, eIF4E confers selective mRNA translation, reprogramming nonmalignant cells to an invasive phenotype by reducing the set point for stimulation by activated TGF-?. Overexpression of eIF4E may be a proinvasive facilitator of TGF-? activity. PMID:25986608

  15. Activation of 3':5'-cyclic AMP-dependent protein kinase and induction of ornithine decarboxylase as early events in induction of mixed-function oxygenases.

    PubMed Central

    Byus, C V; Costa, M; Sipes, I G; Brodie, B B; Russell, D H

    1976-01-01

    The parenteral administration of a single dose of 3-methylcholanthrene to rats caused an increase in the liver of the concentration of 3', 5'-cAMP and of the activity of cAMP-dependent protein kinase (ATP:protein phosphotransferase, EC 2.7.1.37). These events were followed by an increased activity of ornithine decarboxylase (L-ornithine carboxy-lase, EC 4.1.1.17), the enzyme that controls the biosynthesis of polyamines. Finally, the activity of benzo[a]pyrene hydroxylase, as well as the amount of cytochrome P-448, was increased. Similarly, after the administration of phenobarbital, there was first an increase in the cAMP concentration and in the activity of cAMP-dependent protein kinase, then the induction of ornithine decarboxylase, and finally, an enhanced activity of ethylmorphine N-demethylase and an increased content of cytochrome P-450. These data suggest that the drug-induced processes in liver that increase the activities of the oxidative, and presumably other, drug-metabolizing enzymes include the following sequence of events: (1) increase in cAMP concentration and/or activation of cAMP-dependent protein kinase; (2) induction of ornithine decarboxylase; and, (3) induction of drug-metabolizing enzymes. PMID:177981

  16. Dihydropyridines Inhibit Translation and Early Replication of Hepatitis C Virus 

    E-print Network

    Klemashevich, Cory

    2013-05-09

    Up to 170 million people are infected with Hepatitis C Virus worldwide. Chronic HCV infection is the leading cause of fibrosis, cirrhosis and liver cancer. Treatment options are currently limited to interferon based therapies alone...

  17. The Chemistry of Early Self-replicating Systems

    NASA Technical Reports Server (NTRS)

    Bada, Jeffrey L.

    2005-01-01

    The NASA Specialized Center of Research and Training in Exobiology (NSCORT/Exobiology) is a program within the University of California, San Diego, California Space Institute (Dr. Wolfgang Berger, Director). It has been funded by two 5-year Federal Demonstration Project Grants from NASA; and currently (February 1, 2003-December 31,2004) received supplemental funding to support our research completion of the NAG5-4546 Final Report for past 5 years, seminars, public lectures, and support for program administrative office. The program's specific aims have been: 1. The support and training of Postdoctoral, Graduate, and Undergraduate Fellows in Exobiology. 2. The support of research by the Principal Investigators and Fellows in the field of Exobiology. 3. Outreach programs emphasizing the dissemination and exchange of information concerning Exobiology within the scientific community, primary, secondary and college students, and the general public. 4. Public Lectures, Discussion S e m h q Seminars and Fellows Journals Club. 5. Host of the 2003 Public Lectures "Celebrating 50 Years of Prebiotic Chemistry" held at the University of California, San Diego in La Jolla, California on June 10,2003. 6. Host of the 1999 meeting of the International Society for the Study of the Origin of Life (ISSOL) held at the University of California, San Diego in La Jolla, California, from Sunday, July 11 through Friday, July 16,1999.

  18. Filter Based Directory Replication: Algorithms and Performance

    Microsoft Academic Search

    Apurva Kumar

    2005-01-01

    Directories have become an important component of the enterprise security and identity management middleware. This paper describes a novel filter based replication model for lightweight directory access protocol (LDAP) directories. Instead of replicating entire subtrees from a directory information tree (DIT), only entries matching a filter specification are replicated. Efficient algorithms for selecting such filters, keeping them synchronized with the

  19. Maintaining genome stability at the replication fork

    Microsoft Academic Search

    Dana Branzei; Marco Foiani

    2010-01-01

    Aberrant DNA replication is a major source of the mutations and chromosome rearrangements that are associated with pathological disorders. When replication is compromised, DNA becomes more prone to breakage. Secondary structures, highly transcribed DNA sequences and damaged DNA stall replication forks, which then require checkpoint factors and specialized enzymatic activities for their stabilization and subsequent advance. These mechanisms ensure that

  20. Break-induced replication repair of damaged forks induces genomic duplications in human cells.

    PubMed

    Costantino, Lorenzo; Sotiriou, Sotirios K; Rantala, Juha K; Magin, Simon; Mladenov, Emil; Helleday, Thomas; Haber, James E; Iliakis, George; Kallioniemi, Olli P; Halazonetis, Thanos D

    2014-01-01

    In budding yeast, one-ended DNA double-strand breaks (DSBs) and damaged replication forks are repaired by break-induced replication (BIR), a homologous recombination pathway that requires the Pol32 subunit of DNA polymerase delta. DNA replication stress is prevalent in cancer, but BIR has not been characterized in mammals. In a cyclin E overexpression model of DNA replication stress, POLD3, the human ortholog of POL32, was required for cell cycle progression and processive DNA synthesis. Segmental genomic duplications induced by cyclin E overexpression were also dependent on POLD3, as were BIR-mediated recombination events captured with a specialized DSB repair assay. We propose that BIR repairs damaged replication forks in mammals, accounting for the high frequency of genomic duplications in human cancers. PMID:24310611

  1. Break-induced replication repair of damaged forks induces genomic duplications in human cells

    PubMed Central

    Costantino, Lorenzo; Sotiriou, Sotirios K.; Rantala, Juha K.; Magin, Simon; Mladenov, Emil; Helleday, Thomas; Haber, James E.; Iliakis, George; Kallioniemi, Olli; Halazonetis, Thanos D.

    2014-01-01

    In budding yeast, one-ended DNA double-strand breaks (DSBs) and damaged replication forks are repaired by break-induced replication (BIR), a homologous recombination pathway that requires the Pol32 subunit of DNA polymerase delta. DNA replication stress is prevalent in cancer, but BIR has not been characterized in mammals. In a cyclin E overexpression model of DNA replication stress, POLD3, the human ortholog of POL32, was required for cell cycle progression and processive DNA synthesis. Segmental genomic duplications induced by cyclin E overexpression were also dependent on POLD3, as were BIR-mediated recombination events captured with a specialized DSB repair assay. We propose that BIR repairs damaged replication forks in mammals, accounting for the high frequency of genomic duplications in human cancers. PMID:24310611

  2. Adenovirus E1A Oncogene Induces Rereplication of Cellular DNA and Alters DNA Replication Dynamics

    PubMed Central

    Singhal, Ghata; Leo, Elisabetta; Setty, Saayi Krushna Gadham; Pommier, Yves

    2013-01-01

    The oncogenic property of the adenovirus (Ad) transforming E1A protein is linked to its capacity to induce cellular DNA synthesis which occurs as a result of its interaction with several host proteins, including pRb and p300/CBP. While the proteins that contribute to the forced induction of cellular DNA synthesis have been intensively studied, the nature of the cellular DNA replication that is induced by E1A in quiescent cells is not well understood. Here we show that E1A expression in quiescent cells leads to massive cellular DNA rereplication in late S phase. Using a single-molecule DNA fiber assay, we studied the cellular DNA replication dynamics in E1A-expressing cells. Our studies show that the DNA replication pattern is dramatically altered in E1A-expressing cells, with increased replicon length, fork velocity, and interorigin distance. The interorigin distance increased by about 3-fold, suggesting that fewer DNA replication origins are used in E1A-expressing cells. These aberrant replication events led to replication stress, as evidenced by the activation of the DNA damage response. In earlier studies, we showed that E1A induces c-Myc as a result of E1A binding to p300. Using an antisense c-Myc to block c-Myc expression, our results indicate that induction of c-Myc in E1A-expressing cells contributes to the induction of host DNA replication. Together, our results suggest that the E1A oncogene-induced cellular DNA replication stress is due to dramatically altered cellular replication events and that E1A-induced c-Myc may contribute to these events. PMID:23740993

  3. A Supernova-Induced Irradiation Event In The Early Solar System - No Direct Support From The 176Lu-$^{176}Hf Angrite Whole Rock Data

    NASA Astrophysics Data System (ADS)

    Amelin, Y. V.; Wimpenny, J.; Yin, Q.

    2011-12-01

    Radioactive decay of 176Lu to 176Hf with a half-life of 37 Ga is a powerful isotopic tracer for studying evolution of the Earth and other planets. The decay rate of 176Lu is known from the studies of terrestrial rocks and minerals, and meteorites that formed more than 10 million years after the beginning of the Solar System accretion. The excess of 176Hf correlated with Lu/Hf ratios, observed in older meteorites, was interpreted as an evidence for a gamma-ray [1] or cosmic ray [2] irradiation event of enormous magnitude that occurred during or shortly after accretion and caused accelerated decay of 176Lu by converting a fraction of nuclei to the faster decaying nuclear isomer 176mLu. A supernova event that took place in close proximity to the accreting Solar System was suggested as a source of radiation. We seek a more reliable confirmation for accelerated decay of 176Lu using the 176Lu-176Hf isotope systematics of angrites - the oldest and best preserved igneous meteorites. Lu-Hf isochron regression for whole rock samples of quenched angrites D'Orbigny and Sahara 99555, and plutonic angrites NWA 2999, NWA 4590 and NWA 4801 yields the slope of 0.08918 ± 0.0010, MSWD = 0.83, corresponding to the age of 4576 ± 49 Ma using the decay constant of 176Lu of 1.867x10-11 a-1. The significance of this isochron depends on the nature of the events that caused variation in Lu/Hf. Assuming that the data presented here and in [2] are analytically consistent and represent undisturbed geochemical systems, we seek an interpretation that explains both data sets. Irradiation with gamma-rays or cosmic rays that can penetrate rock several tens of meters thick can explain the difference in the isochron slopes, but it also predicts that the isochrons have identical y-intercepts, which contradicts the observations. The intersecting isochrons with different y-intercepts would be produced by neutrino irradiation with fluence independent of the depth within the parent bodies. A clear indication to the existence and nature of the 176Lu decay-accelerating event can be obtained from a combination of reliable internal isochrons for a quenched angrite and a plutonic angrite, and the Lu isotopic composition in these materials. Cosmic ray or gamma-ray irradiation would produce isochrons with different slopes but identical y-intercepts, and quenched angrites would have a 176Lu deficit compared to the plutonic angrites. Neutrino irradiation would produce isochrons with different slopes and different intercepts, and the 176Lu/175Lu ratio would be uniform. Other patterns would suggest open geochemical system behavior.

  4. A cis-replication element functions in both orientations to enhance replication of Turnip crinkle virus

    E-print Network

    Simon, Anne

    A cis-replication element functions in both orientations to enhance replication of Turnip crinkle Abstract Turnip crinkle virus (TCV) (family Tombusviridae, genus Carmovirus) is a positive-sense RNA virus-dependent RNA polymerase; RNA virus replication; RNA enhancer; Turnip crinkle virus; cis-acting replication

  5. Relationship between DNA replication and the nuclear matrix

    PubMed Central

    Wilson, Rosemary H C; Coverley, Dawn

    2013-01-01

    There is an extensive list of primary published work related to the nuclear matrix (NM). Here we review the aspects that are required to understand its relationship with DNA replication, while highlighting some of the difficulties in studying such a structure, and possible differences that arise from the choice of model system. We consider NM attachment regions of DNA and discuss their characteristics and potential function before reviewing data that deal specifically with functional interaction with DNA replication factors. Data have long existed indicating that newly synthesized DNA is associated with a nuclease-resistant NM, allowing the conclusion that the elongation step of DNA synthesis is immobilized within the nucleus. We review in more detail the emerging data that suggest that prereplication complex proteins and origins of replication are transiently recruited to the NM during late G1 and early S-phase. Collectively, these data suggest that the initiation step of the DNA replication process is also immobilized by attachment to the NM. We outline models that discuss the possible spatial relationships and highlight the emerging evidence that suggests there may be important differences between cell types. PMID:23134523

  6. Enhanced Deletion Formation by Aberrant DNA Replication in Escherichia Coli

    PubMed Central

    Saveson, C. J.; Lovett, S. T.

    1997-01-01

    Repeated genes and sequences are prone to genetic rearrangements including deletions. We have investigated deletion formation in Escherichia coli strains mutant for various replication functions. Deletion was selected between 787 base pair tandem repeats carried either on a ColE1-derived plasmid or on the E. coli chromosome. Only mutations in functions associated with DNA Polymerase III elevated deletion rates in our assays. Especially large increases were observed in strains mutant in dnaQ, the ? editing subunit of Pol III, and dnaB, the replication fork helicase. Mutations in several other functions also altered deletion formation: the ? polymerase (dnaE), the ? clamp loader complex (holC, dnaX), and the ? clamp (dnaN) subunits of Pol III and the primosomal proteins, dnaC and priA. Aberrant replication stimulated deletions through several pathways. Whereas the elevation in dnaB strains was mostly recA- and lexA-dependent, that in dnaQ strains was mostly recA- and lexA-independent. Deletion product analysis suggested that slipped mispairing, producing monomeric replicon products, may be preferentially increased in a dnaQ mutant and sister-strand exchange, producing dimeric replicon products, may be elevated in dnaE mutants. We conclude that aberrant Polymerase III replication can stimulate deletion events through several mechanisms of deletion and via both recA-dependent and independent pathways. PMID:9177997

  7. Social learning and the replication process: an experimental investigation.

    PubMed

    Derex, Maxime; Feron, Romain; Godelle, Bernard; Raymond, Michel

    2015-06-01

    Human cultural traits typically result from a gradual process that has been described as analogous to biological evolution. This observation has led pioneering scholars to draw inspiration from population genetics to develop a rigorous and successful theoretical framework of cultural evolution. Social learning, the mechanism allowing information to be transmitted between individuals, has thus been described as a simple replication mechanism. Although useful, the extent to which this idealization appropriately describes the actual social learning events has not been carefully assessed. Here, we used a specifically developed computer task to evaluate (i) the extent to which social learning leads to the replication of an observed behaviour and (ii) the consequences it has for fitness landscape exploration. Our results show that social learning does not lead to a dichotomous choice between disregarding and replicating social information. Rather, it appeared that individuals combine and transform information coming from multiple sources to produce new solutions. As a consequence, landscape exploration was promoted by the use of social information. These results invite us to rethink the way social learning is commonly modelled and could question the validity of predictions coming from models considering this process as replicative. PMID:25994679

  8. Early Virus-Host Interactions Dictate the Course of a Persistent Infection

    PubMed Central

    Sullivan, Brian M.; Teijaro, John R.; de la Torre, Juan Carlos; Oldstone, Michael B. A.

    2015-01-01

    Many persistent viral infections are characterized by a hypofunctional T cell response and the upregulation of negative immune regulators. These events occur days after the initiation of infection. However, the very early host-virus interactions that determine the establishment of viral persistence remain poorly uncharacterized. Here we show that to establish persistence, LCMV must counteract an innate anti-viral immune response within eight hours after infection. While the virus triggers cytoplasmic RNA sensing pathways soon after infection, LCMV counteracts this pathway through a rapid increase in viral titers leading to a dysfunctional immune response characterized by a high cytokine and chemokine expression profile. This altered immune environment allows for viral replication in the splenic white pulp as well as infection of immune cells essential to an effective anti-viral immune response. Our findings illustrate how early events during infection critically dictate the characteristics of the immune response to infection and facilitate either virus control and clearance or persistence. PMID:25569216

  9. The Chinese Hamster Dihydrofolate Reductase Replication Origin Decision Point Follows Activation of Transcription and Suppresses Initiation of Replication within Transcription Units

    PubMed Central

    Sasaki, Takayo; Ramanathan, Sunita; Okuno, Yukiko; Kumagai, Chiharu; Shaikh, Seemab S.; Gilbert, David M.

    2006-01-01

    Chinese hamster ovary (CHO) cells select specific replication origin sites within the dihydrofolate reductase (DHFR) locus at a discrete point during G1 phase, the origin decision point (ODP). Origin selection is sensitive to transcription but not protein synthesis inhibitors, implicating a pretranslational role for transcription in origin specification. We have constructed a DNA array covering 121 kb surrounding the DHFR locus, to comprehensively investigate replication initiation and transcription in this region. When nuclei isolated within the first 3 h of G1 phase were stimulated to initiate replication in Xenopus egg extracts, replication initiated without any detectable preference for specific sites. At the ODP, initiation became suppressed from within the Msh3, DHFR, and 2BE2121 transcription units. Active transcription was mostly confined to these transcription units, and inhibition of transcription by alpha-amanitin resulted in the initiation of replication within transcription units, indicating that transcription is necessary to limit initiation events to the intergenic region. However, the resumption of DHFR transcription after mitosis took place prior to the ODP and so is not on its own sufficient to suppress initiation of replication. Together, these results demonstrate a remarkable flexibility in sequence selection for initiating replication and implicate transcription as one important component of origin specification at the ODP. PMID:16428457

  10. Synchronous down-modulation of miR-17 family members is an early causative event in the retinal angiogenic switch.

    PubMed

    Nunes, Diana N; Dias-Neto, Emmanuel; Cardó-Vila, Marina; Edwards, Julianna K; Dobroff, Andrey S; Giordano, Ricardo J; Mandelin, Jami; Brentani, Helena P; Hasselgren, Catrin; Yao, Virginia J; Marchiò, Serena; Pereira, Carlos A B; Passetti, Fabio; Calin, George A; Sidman, Richard L; Arap, Wadih; Pasqualini, Renata

    2015-03-24

    Six members of the microRNA-17 (miR-17) family were mapped to three different chromosomes, although they share the same seed sequence and are predicted to target common genes, among which are those encoding hypoxia-inducible factor-1? (HIF1A) and VEGFA. Here, we evaluated the in vivo expression profile of the miR-17 family in the murine retinopathy of prematurity (ROP) model, whereby Vegfa expression is highly enhanced at the early stage of retinal neovascularization, and we found simultaneous reduction of all miR-17 family members at this stage. Using gene reporter assays, we observed binding of these miRs to specific sites in the 3' UTRs of Hif1a and Vegfa. Furthermore, overexpression of these miRs decreased HIF1A and VEGFA expression in vitro. Our data indicate that this miR-17 family elicits a regulatory synergistic down-regulation of Hif1a and Vegfa expression in this biological model. We propose the existence of a coordinated regulatory network, in which diverse miRs are synchronously regulated to target the Hif1a transcription factor, which in turn, potentiates and reinforces the regulatory effects of the miRs on Vegfa to trigger and sustain a significant physiological response. PMID:25775553

  11. A metabolic switch toward lipid use in glycolytic muscle is an early pathologic event in a mouse model of amyotrophic lateral sclerosis

    PubMed Central

    Palamiuc, Lavinia; Schlagowski, Anna; Ngo, Shyuan T; Vernay, Aurelia; Dirrig-Grosch, Sylvie; Henriques, Alexandre; Boutillier, Anne-Laurence; Zoll, Joffrey; Echaniz-Laguna, Andoni; Loeffler, Jean-Philippe; René, Frédérique

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) is the most common fatal motor neuron disease in adults. Numerous studies indicate that ALS is a systemic disease that affects whole body physiology and metabolic homeostasis. Using a mouse model of the disease (SOD1G86R), we investigated muscle physiology and motor behavior with respect to muscle metabolic capacity. We found that at 65 days of age, an age described as asymptomatic, SOD1G86R mice presented with improved endurance capacity associated with an early inhibition in the capacity for glycolytic muscle to use glucose as a source of energy and a switch in fuel preference toward lipids. Indeed, in glycolytic muscles we showed progressive induction of pyruvate dehydrogenase kinase 4 expression. Phosphofructokinase 1 was inhibited, and the expression of lipid handling molecules was increased. This mechanism represents a chronic pathologic alteration in muscle metabolism that is exacerbated with disease progression. Further, inhibition of pyruvate dehydrogenase kinase 4 activity with dichloroacetate delayed symptom onset while improving mitochondrial dysfunction and ameliorating muscle denervation. In this study, we provide the first molecular basis for the particular sensitivity of glycolytic muscles to ALS pathology. PMID:25820275

  12. Florbetaben PET in the Early Diagnosis of Alzheimer's Disease: A Discrete Event Simulation to Explore Its Potential Value and Key Data Gaps

    PubMed Central

    Guo, Shien; Getsios, Denis; Hernandez, Luis; Cho, Kelly; Lawler, Elizabeth; Altincatal, Arman; Lanes, Stephan; Blankenburg, Michael

    2012-01-01

    The growing understanding of the use of biomarkers in Alzheimer's disease (AD) may enable physicians to make more accurate and timely diagnoses. Florbetaben, a beta-amyloid tracer used with positron emission tomography (PET), is one of these diagnostic biomarkers. This analysis was undertaken to explore the potential value of florbetaben PET in the diagnosis of AD among patients with suspected dementia and to identify key data that are needed to further substantiate its value. A discrete event simulation was developed to conduct exploratory analyses from both US payer and societal perspectives. The model simulates the lifetime course of disease progression for individuals, evaluating the impact of their patient management from initial diagnostic work-up to final diagnosis. Model inputs were obtained from specific analyses of a large longitudinal dataset from the New England Veterans Healthcare System and supplemented with data from public data sources and assumptions. The analyses indicate that florbetaben PET has the potential to improve patient outcomes and reduce costs under certain scenarios. Key data on the use of florbetaben PET, such as its influence on time to confirmation of final diagnosis, treatment uptake, and treatment persistency, are unavailable and would be required to confirm its value. PMID:23326754

  13. Oxidative stress and mitochondrial dysfunctions are early events in narciclasine-induced programmed cell death in tobacco Bright Yellow-2 cells.

    PubMed

    Lu, Hongxia; Wan, Qi; Wang, Huahua; Na, Xiaofan; Wang, Xiaomin; Bi, Yurong

    2012-01-01

    Narciclasine (NCS) is a plant growth inhibitor isolated from the secreted mucilage of Narcissus tazetta bulbs. It is a commonly used anticancer agent in animal systems. In this study, we provide evidence to show that NCS also acts as an agent in inducing programmed cell death (PCD) in tobacco Bright Yellow-2 (TBY-2) cell cultures. NCS treatment induces typical PCD-associated morphological and biochemical changes, namely cell shrinkage, chromatin condensation and nuclear DNA degradation. To investigate possible signaling events, we analyzed the production of reactive oxygen species (ROS) and the function of mitochondria during PCD induced by NCS. A biphasic behavior burst of hydrogen peroxide (H(2)O(2)) was detected in TBY-2 cells treated with NCS, and mitochondrial transmembrane potential (MTP) loss occurred after a slight increase. Pre-incubation with antioxidant catalase (CAT) and N-acetyl-L-cysteine (NAC) not only significantly decreased the H(2)O(2) production but also effectively retarded the decrease of MTP and reduced the percentage of cells undergoing PCD after NCS treatment. In conclusion, our results suggest that NCS induces PCD in plant cells; the oxidative stress (accumulation of H(2)O(2)) and the MTP loss play important roles during NCS-induced PCD. PMID:21916896

  14. Lake dwellers occupation gap in Lake Geneva (France-Switzerland) possibly explained by an earthquake-mass movement-tsunami event during Early Bronze Age

    NASA Astrophysics Data System (ADS)

    Kremer, Katrina; Marillier, François; Hilbe, Michael; Simpson, Guy; Dupuy, David; Yrro, Ble J. F.; Rachoud-Schneider, Anne-Marie; Corboud, Pierre; Bellwald, Benjamin; Wildi, Walter; Girardclos, Stéphanie

    2014-01-01

    High-resolution seismic and sediment core data from the ‘Grand Lac’ basin of Lake Geneva reveal traces of repeated slope instabilities with one main slide-evolved mass-flow (minimum volume 0.13 km3) that originated from the northern lateral slope of the lake near the city of Lausanne. Radiocarbon dating of organic remains sampled from the top of the main deposit gives an age interval of 1865-1608 BC. This date coincides with the age interval for a mass movement event described in the ‘Petit Lac’ basin of Lake Geneva (1872-1622 BC). Because multiple mass movements took place at the same time in different parts of the lake, we consider the most likely trigger mechanism to be a strong earthquake (Mw 6) that occurred in the period between 1872 and 1608 BC. Based on numerical simulations, we show the major deposit near Lausanne would have generated a tsunami with local wave heights of up to 6 m. The combined effects of the earthquake and the following tsunami provide a possible explanation for a gap in lake dwellers occupation along the shores of Lake Geneva revealed by dendrochronological dating of two palafitte archaeological sites.

  15. Studies on early events of Borrelia burgdorferi-induced cytokine production in immunodeficient SCID mice by using a tissue chamber model for acute inflammation.

    PubMed Central

    Hurtenbach, U.; Museteanu, C.; Gasser, J.; Schaible, U. E.; Simon, M. M.

    1995-01-01

    Lyme arthritis, one of the common features of Borrelia burgdorferi infection in the human, is associated with the production of various monocyte derived cytokines. To investigate the expression and regulation of cytokines during the acute phase of spirochete induced inflammation, a perforated Teflon chamber was implanted under the dorsal skin of severe combined immunodeficiency (SCID) and immunocompetent co-isogenic C.B-17 mice. The histology of the surrounding chamber tissue exhibited sterile inflammation with several features reminiscent of an inflamed synovium, i.e. infiltration of polymorphonuclear and mononuclear cells, fibroblast-like cells and neovascularization. The experimental inoculation of Borrelia burgdorferi into the chamber resulted in the production of TNF-alpha, IL-1 and IL-6 into the chamber exudate, in both the immunodeficient, disease susceptible SCID and the immunocompetent, disease resistant C.B-17 mice. Peak levels of TNF-alpha were reached at 2 hours and of IL-1 and IL-6 at 6 hours after infection; by 24 hours, cytokine levels were only marginal (IL-1, IL-6) or non-detectable (TNF-alpha). Experimental infection by s.c. injection distant from the tissue chamber led to colonization of the spirochetes into the chamber, suggesting a tropism of the bacteria for this tissue. Thus, this model provides a system for studying acute events of Borellia burgdorferi induced cytokine regulation in a complex cellular, synovium-like environment that the bacterium encounters in vivo. Images Figure 1 Figure 2 Figure 3 PMID:7786761

  16. The characteris+cs of tsunamis Historical tsunami events

    E-print Network

    Chen, Po

    #12;·The characteris+cs of tsunamis ·Historical tsunami events ·The early characteris+cs of tsunamis ·Historical record of tsunami events ·The early warning systems Reference: Intergovernmental Oceanographic Commission. 2008. Tsunami Glossary

  17. Mouse hepatitis coronavirus RNA replication depends on GBF1-mediated ARF1 activation.

    PubMed

    Verheije, Monique H; Raaben, Matthijs; Mari, Muriel; Te Lintelo, Eddie G; Reggiori, Fulvio; van Kuppeveld, Frank J M; Rottier, Peter J M; de Haan, Cornelis A M

    2008-06-01

    Coronaviruses induce in infected cells the formation of double membrane vesicles, which are the sites of RNA replication. Not much is known about the formation of these vesicles, although recent observations indicate an important role for the endoplasmic reticulum in the formation of the mouse hepatitis coronavirus (MHV) replication complexes (RCs). We now show that MHV replication is sensitive to brefeldin A (BFA). Consistently, expression of a dominant-negative mutant of ARF1, known to mimic the action of the drug, inhibited MHV infection profoundly. Immunofluorescence analysis and quantitative electron microscopy demonstrated that BFA did not block the formation of RCs per se, but rather reduced their number. MHV RNA replication was not sensitive to BFA in MDCK cells, which are known to express the BFA-resistant guanine nucleotide exchange factor GBF1. Accordingly, individual knockdown of the Golgi-resident targets of BFA by transfection of small interfering RNAs (siRNAs) showed that GBF1, but not BIG1 or BIG2, was critically involved in MHV RNA replication. ARF1, the cellular effector of GBF1, also appeared to be involved in MHV replication, as siRNAs targeting this small GTPase inhibited MHV infection significantly. Collectively, our results demonstrate that GBF1-mediated ARF1 activation is required for efficient MHV RNA replication and reveal that the early secretory pathway and MHV replication complex formation are closely connected. PMID:18551169

  18. Human PIF1 helicase supports DNA replication and cell growth under oncogenic-stress

    PubMed Central

    Gagou, Mary E.; Ganesh, Anil; Phear, Geraldine; Robinson, Darren; Petermann, Eva; Cox, Angela; Meuth, Mark

    2014-01-01

    Unwinding duplex DNA is a critical processing step during replication, repair and transcription. Pif1 are highly conserved non-processive 5?->3? DNA helicases with well-established roles in maintenance of yeast genome stability. However, the function of the sole member of Pif1 family in humans remains unclear. Human PIF1 is essential for tumour cell viability, particularly during replication stress, but is dispensable in non-cancerous cells and Pif1 deficient mice. Here we report that suppression of PIF1 function slows replication fork rates and increases arrested forks during normal cycling conditions. Importantly, PIF1-dependent replication impediments impair S-phase progression and reduce proliferation rates of RAS oncogene-transformed fibroblasts, where replication fork slowing is exacerbated, but not parental, non-cancerous cells. Disrupted fork movement upon PIF1-depletion does not enhance double-stranded break formation or DNA damage responses but affects resumption of DNA synthesis after prolonged replication inhibitor exposure, accompanied by diminished new origin firing and mainly S-phase entry. Taken together, we characterised a functional role for human PIF1 in DNA replication that becomes important for cell growth under oncogenic stress. Given that oncogenes induce high levels of replication stress during the early stages of tumorigenesis, this function of PIF1 could become critical during cancer development. PMID:25359767

  19. Engineering Event-Based Systems with Scopes

    Microsoft Academic Search

    Ludger Fiege; Mira Mezini; Gero Mühl; Alejandro P. Buchmann

    2002-01-01

    Event notification services enable loose coupling and they are therefore becoming an essential part of distributed systems' design. How- ever, the development of event services follows the early stages of pro- gramming language evolution, disregarding the need for efficient mech- anisms to structure event-based applications. In this paper, the well- known notion of scopes is introduced to event-based systems. We

  20. How to securely replicate services

    NASA Technical Reports Server (NTRS)

    Reiter, Michael; Birman, Kenneth

    1992-01-01

    A method is presented for constructing replicated services that retain their availability and integrity despite several servers and clients corrupted by an intruder, in addition to others failing benignly. More precisely, a service is replicated by n servers in such a way that a correct client will accept a correct server's response if, for some prespecified parameter k, at least k servers are correct and fewer than k servers are corrupt. The issue of maintaining causality among client requests is also addressed. A security breach resulting from an intruder's ability to effect a violation of causality in the sequence of requests processed by the service is illustrated. An approach to counter this problem is proposed that requires fewer than k servers to be corrupt and that is live if at least k+b servers are correct, where b is the assumed maximum total number of corrupt servers in any system run. An important and novel feature of these schemes is that the client need not be able to identify or authenticate even a single server. Instead, the client is required only to possess at most two public keys for the service. The practicality of these schemes is illustrated through a discussion of several issues pertinent to their implementation and use, and their intended role in a secure version of the Isis system is also described.

  1. Loss of human leucocyte antigen class I and gain of class II expression are early events in carcinogenesis: clues from a study of Barrett's oesophagus

    PubMed Central

    Rajendra, S; Ackroyd, R; Karim, N; Mohan, C; Ho, J J; Kutty, M K

    2006-01-01

    Background Human leucocyte antigen (HLA) expression is altered in oesophageal carcinomas compared with normal tissue. It is unclear, however, whether this phenotype precedes malignant transformation or results as a consequence of it. Aim To investigate HLA class I and II expression in Barrett's oesophagus and normal squamous oesophageal tissue. Methods Asian patients with Barrett's oesophagus (n?=?64) and a control group (n?=?60) with a normal oesophagus but without reflux symptoms were recruited using endoscopic and histopathological criteria. Tissue samples were stained with monoclonal antibodies specific for HLA?ABC, HLA?DR ? chain or HLA?DP/DQ/DR, and scored semiquantitatively. The results of immunohistochemical staining were correlated with clinical and histopathological characteristics of patients. Results Marked expression of HLA?ABC was observed in 50% of Barrett's oesophagus sections as compared with 68.3% of controls (p?=?0.038). HLA?DR staining was seen in 51.6% of Barrett's oesophagus samples versus 11.7% of controls (p<0.001). Expression of HLA?DP/DQ/DR was evident in 73.4% of oesophageal intestinal metaplasia tissue as opposed to 18.3% of controls (p<0.001). Importantly, a total loss of HLA?ABC and a concomitant gain of HLA?DP/DQ/DR expression were seen in 37.5% of patients with Barrett's oesophagus but in none of the controls (p<0.001). Interestingly, this phenotype was associated positively with dysplasia (adjusted p, p*?=?0.031) but negatively with non?steroidal anti?inflammatory drug use (p*?=?0.004). Conclusions HLA class I expression is down regulated and class II expression is up regulated in Barrett's oesophagus. As these changes predate malignant transformation, altered major histocompatibility complex expression may be a key event in disease progression, possibly in facilitating evasion from immune surveillance. PMID:16467164

  2. Improved Early Event-Free Survival With Imatinib in Philadelphia Chromosome–Positive Acute Lymphoblastic Leukemia: A Children's Oncology Group Study

    PubMed Central

    Schultz, Kirk R.; Bowman, W. Paul; Aledo, Alexander; Slayton, William B.; Sather, Harland; Devidas, Meenakshi; Wang, Chenguang; Davies, Stella M.; Gaynon, Paul S.; Trigg, Michael; Rutledge, Robert; Burden, Laura; Jorstad, Dean; Carroll, Andrew; Heerema, Nyla A.; Winick, Naomi; Borowitz, Michael J.; Hunger, Stephen P.; Carroll, William L.; Camitta, Bruce

    2009-01-01

    Purpose Imatinib mesylate is a targeted agent that may be used against Philadelphia chromosome–positive (Ph+) acute lymphoblastic leukemia (ALL), one of the highest risk pediatric ALL groups. Patients and Methods We evaluated whether imatinib (340 mg/m2/d) with an intensive chemotherapy regimen improved outcome in children ages 1 to 21 years with Ph+ ALL (N = 92) and compared toxicities to Ph? ALL patients (N = 65) given the same chemotherapy without imatinib. Exposure to imatinib was increased progressively in five patient cohorts that received imatinib from 42 (cohort 1; n = 7) to 280 continuous days (cohort 5; n = 50) before maintenance therapy. Patients with human leukocyte antigen (HLA) –identical sibling donors underwent blood and marrow transplantation (BMT) with imatinib given for 6 months following BMT. Results Continuous imatinib exposure improved outcome in cohort 5 patients with a 3-year event-free survival (EFS) of 80% ± 11% (95% CI, 64% to 90%), more than twice historical controls (35% ± 4%; P < .0001). Three-year EFS was similar for patients in cohort 5 treated with chemotherapy plus imatinib (88% ± 11%; 95% CI, 66% to 96%) or sibling donor BMT (57% ± 22%; 95% CI, 30.4% to 76.1%). There were no significant toxicities associated with adding imatinib to intensive chemotherapy. The higher imatinib dosing in cohort 5 appears to improve survival by having an impact on the outcome of children with a higher burden of minimal residual disease after induction. Conclusion Imatinib plus intensive chemotherapy improved 3-year EFS in children and adolescents with Ph+ ALL, with no appreciable increase in toxicity. BMT plus imatinib offered no advantage over BMT alone. Additional follow-up is required to determine the impact of this treatment on long-term EFS and determine whether chemotherapy plus imatinib can replace BMT. PMID:19805687

  3. Quantitative Multigene FISH on Breast Carcinomas Identifies der(1;16)(q10;p10) as an Early Event in Luminal A Tumors

    PubMed Central

    Rye, Inga H; Lundin, Pär; Månér, Susanne; Fjelldal, Renathe; Naume, Bjørn; Wigler, Michael; Hicks, James; Børresen-Dale, Anne-Lise; Zetterberg, Anders; Russnes, Hege G

    2015-01-01

    In situ detection of genomic alterations in cancer provides information at the single cell level, making it possible to investigate genomic changes in cells in a tissue context. Such topological information is important when studying intratumor heterogeneity as well as alterations related to different steps in tumor progression. We developed a quantitative multigene fluorescence in situ hybridization (QM FISH) method to detect multiple genomic regions in single cells in complex tissues. As a “proof of principle” we applied the method to breast cancer samples to identify partners in whole arm (WA) translocations. WA gain of chromosome arm 1q and loss of chromosome arm 16q are among the most frequent genomic events in breast cancer. By designing five specific FISH probes based on breakpoint information from comparative genomic hybridization array (aCGH) profiles, we visualized chromosomal translocations in clinical samples at the single cell level. By analyzing aCGH data from 295 patients with breast carcinoma with known molecular subtype, we found concurrent WA gain of 1q and loss of 16q to be more frequent in luminal A tumors compared to other molecular subtypes. QM FISH applied to a subset of samples (n?=?26) identified a derivative chromosome der(1;16)(q10;p10), a result of a centromere-close translocation between chromosome arms 1q and 16p. In addition, we observed that the distribution of cells with the translocation varied from sample to sample, some had a homogenous cell population while others displayed intratumor heterogeneity with cell-to-cell variation. Finally, for one tumor with both preinvasive and invasive components, the fraction of cells with translocation was lower and more heterogeneous in the preinvasive tumor cells compared to the cells in the invasive component. © 2014 The Authors Genes, Chromosomes & Cancer Published by Wiley Periodicals, Inc. PMID:25546585

  4. Yeast replicative aging: a paradigm for defining conserved longevity interventions.

    PubMed

    Wasko, Brian M; Kaeberlein, Matt

    2014-02-01

    The finite replicative life span of budding yeast mother cells was demonstrated as early as 1959, but the idea that budding yeast could be used to model aging of multicellular eukaryotes did not enter the scientific mainstream until relatively recently. Despite continued skepticism by some, there are now abundant data that several interventions capable of extending yeast replicative life span have a similar effect in multicellular eukaryotes including nematode worms, fruit flies, and rodents. In particular, dietary restriction, mTOR signaling, and sirtuins are among the most studied longevity interventions in the field. Here, we describe key conserved longevity pathways in yeast and discuss relationships that may help explain how such broad conservation of aging processes could have evolved. PMID:24119093

  5. Pregnancy serum facilitates hepatitis E virus replication in vitro.

    PubMed

    Bi, Yanhong; Yang, Chenchen; Yu, Wenhai; Zhao, Xianchen; Zhao, Chengcheng; He, Zhanlong; Jing, Shenrong; Wang, Huixuan; Huang, Fen

    2015-05-01

    Hepatitis E virus (HEV) infection causes high mortality in pregnant women. However, the pathogenic mechanisms of HEV infection in pregnant women remain unknown. In this study, the roles of pregnancy serum in HEV infection were investigated using an efficient cell culture system. HEV infection was exacerbated by supplementing with pregnancy serum, especially theat in third trimester of pregnancy. Oestrogen receptors (ER-? and ER-?) were activated in cells supplemented with pregnancy serum and were significantly inhibited during HEV infection. Type I IFN, especially IFN-?, showed delayed upregulation in HEV-infected cells supplemented with the serum in the third trimester of pregnancy, which indicated that delayed IFN-? expression may facilitate viral replication. Results suggested that pregnancy serum accelerated HEV replication by suppressing oestrogen receptors and type I IFN in the early stage of infection. PMID:25614592

  6. Flavin-dependent thymidylate synthase X limits chromosomal DNA replication

    PubMed Central

    Escartin, Frédéric; Skouloubris, Stéphane; Liebl, Ursula; Myllykallio, Hannu

    2008-01-01

    We have investigated the hitherto unexplored possibility that differences in the catalytic efficiencies of thymidylate synthases ThyX and ThyA, enzymes that produce the essential DNA precursor dTMP, have influenced prokaryotic genome evolution. We demonstrate that DNA replication speed in bacteria and archaea that contain the low-activity ThyX enzyme is up to 10-fold decreased compared with species that contain the catalytically more efficient ThyA. Our statistical studies of >400 genomes indicated that ThyA proteins are preferred for the replication of large genomes, providing further evidence that the thymidylate metabolism is limiting expansion of prokaryotic genomes. Because both ThyX and ThyA participate in frequent reciprocal gene replacement events, our observations indicate that the bacterial metabolism continues to modulate the size and composition of prokaryotic genomes. We also propose that the increased kinetic efficiency of thymidylate synthesis has contributed to extending the prokaryotic evolutionary potential. PMID:18621705

  7. Overcoming natural replication barriers: differential helicase requirements.

    PubMed

    Anand, Ranjith P; Shah, Kartik A; Niu, Hengyao; Sung, Patrick; Mirkin, Sergei M; Freudenreich, Catherine H

    2012-02-01

    DNA sequences that form secondary structures or bind protein complexes are known barriers to replication and potential inducers of genome instability. In order to determine which helicases facilitate DNA replication across these barriers, we analyzed fork progression through them in wild-type and mutant yeast cells, using 2-dimensional gel-electrophoretic analysis of the replication intermediates. We show that the Srs2 protein facilitates replication of hairpin-forming CGG/CCG repeats and prevents chromosome fragility at the repeat, whereas it does not affect replication of G-quadruplex forming sequences or a protein-bound repeat. Srs2 helicase activity is required for hairpin unwinding and fork progression. Also, the PCNA binding domain of Srs2 is required for its in vivo role of replication through hairpins. In contrast, the absence of Sgs1 or Pif1 helicases did not inhibit replication through structural barriers, though Pif1 did facilitate replication of a telomeric protein barrier. Interestingly, replication through a protein barrier but not a DNA structure barrier was modulated by nucleotide pool levels, illuminating a different mechanism by which cells can regulate fork progression through protein-mediated stall sites. Our analyses reveal fundamental differences in the replication of DNA structural versus protein barriers, with Srs2 helicase activity exclusively required for fork progression through hairpin structures. PMID:21984413

  8. Self-replication of DNA rings.

    PubMed

    Kim, Junghoon; Lee, Junwye; Hamada, Shogo; Murata, Satoshi; Ha Park, Sung

    2015-06-01

    Biology provides numerous examples of self-replicating machines, but artificially engineering such complex systems remains a formidable challenge. In particular, although simple artificial self-replicating systems including wooden blocks, magnetic systems, modular robots and synthetic molecular systems have been devised, such kinematic self-replicators are rare compared with examples of theoretical cellular self-replication. One of the principal reasons for this is the amount of complexity that arises when you try to incorporate self-replication into a physical medium. In this regard, DNA is a prime candidate material for constructing self-replicating systems due to its ability to self-assemble through molecular recognition. Here, we show that DNA T-motifs, which self-assemble into ring structures, can be designed to self-replicate through toehold-mediated strand displacement reactions. The inherent design of these rings allows the population dynamics of the systems to be controlled. We also analyse the replication scheme within a universal framework of self-replication and derive a quantitative metric of the self-replicability of the rings. PMID:25961509

  9. Overcoming natural replication barriers: differential helicase requirements

    PubMed Central

    Anand, Ranjith P.; Shah, Kartik A.; Niu, Hengyao; Sung, Patrick; Mirkin, Sergei M.; Freudenreich, Catherine H.

    2012-01-01

    DNA sequences that form secondary structures or bind protein complexes are known barriers to replication and potential inducers of genome instability. In order to determine which helicases facilitate DNA replication across these barriers, we analyzed fork progression through them in wild-type and mutant yeast cells, using 2-dimensional gel-electrophoretic analysis of the replication intermediates. We show that the Srs2 protein facilitates replication of hairpin-forming CGG/CCG repeats and prevents chromosome fragility at the repeat, whereas it does not affect replication of G-quadruplex forming sequences or a protein-bound repeat. Srs2 helicase activity is required for hairpin unwinding and fork progression. Also, the PCNA binding domain of Srs2 is required for its in vivo role of replication through hairpins. In contrast, the absence of Sgs1 or Pif1 helicases did not inhibit replication through structural barriers, though Pif1 did facilitate replication of a telomeric protein barrier. Interestingly, replication through a protein barrier but not a DNA structure barrier was modulated by nucleotide pool levels, illuminating a different mechanism by which cells can regulate fork progression through protein-mediated stall sites. Our analyses reveal fundamental differences in the replication of DNA structural versus protein barriers, with Srs2 helicase activity exclusively required for fork progression through hairpin structures. PMID:21984413

  10. Self-replication of DNA rings

    NASA Astrophysics Data System (ADS)

    Kim, Junghoon; Lee, Junwye; Hamada, Shogo; Murata, Satoshi; Ha Park, Sung

    2015-06-01

    Biology provides numerous examples of self-replicating machines, but artificially engineering such complex systems remains a formidable challenge. In particular, although simple artificial self-replicating systems including wooden blocks, magnetic systems, modular robots and synthetic molecular systems have been devised, such kinematic self-replicators are rare compared with examples of theoretical cellular self-replication. One of the principal reasons for this is the amount of complexity that arises when you try to incorporate self-replication into a physical medium. In this regard, DNA is a prime candidate material for constructing self-replicating systems due to its ability to self-assemble through molecular recognition. Here, we show that DNA T-motifs, which self-assemble into ring structures, can be designed to self-replicate through toehold-mediated strand displacement reactions. The inherent design of these rings allows the population dynamics of the systems to be controlled. We also analyse the replication scheme within a universal framework of self-replication and derive a quantitative metric of the self-replicability of the rings.

  11. Links between genome replication and chromatin landscapes.

    PubMed

    Sequeira-Mendes, Joana; Gutierrez, Crisanto

    2015-07-01

    Post-embryonic organogenesis in plants requires the continuous production of cells in the organ primordia, their expansion and a coordinated exit to differentiation. Genome replication is one of the most important processes that occur during the cell cycle, as the maintenance of genomic integrity is of primary relevance for development. As it is chromatin that must be duplicated, a strict coordination occurs between DNA replication, the deposition of new histones, and the introduction of histone modifications and variants. In turn, the chromatin landscape affects several stages during genome replication. Thus, chromatin accessibility is crucial for the initial stages and to specify the location of DNA replication origins with different chromatin signatures. The chromatin landscape also determines the timing of activation during the S phase. Genome replication must occur fully, but only once during each cell cycle. The re-replication avoidance mechanisms rely primarily on restricting the availability of certain replication factors; however, the presence of specific histone modifications are also revealed as contributing to the mechanisms that avoid re-replication, in particular for heterochromatin replication. We provide here an update of genome replication mostly focused on data from Arabidopsis, and the advances that genomic approaches are likely to provide in the coming years. The data available, both in plants and animals, point to the relevance of the chromatin landscape in genome replication, and require a critical evaluation of the existing views about the nature of replication origins, the mechanisms of origin specification and the relevance of epigenetic modifications for genome replication. PMID:25847096

  12. An HIV-1 Replication Pathway Utilizing Reverse Transcription Products That Fail To Integrate

    PubMed Central

    Trinité, Benjamin; Ohlson, Eric C.; Voznesensky, Igor; Rana, Shashank P.; Chan, Chi N.; Mahajan, Saurabh; Alster, Jason; Burke, Sean A.; Wodarz, Dominik

    2013-01-01

    Integration is a central event in the replication of retroviruses, yet ?90% of HIV-1 reverse transcripts fail to integrate, resulting in accumulation of unintegrated viral DNA in cells. However, understanding what role, if any, unintegrated viral DNA plays in the natural history of HIV-1 has remained elusive. Unintegrated HIV-1 DNA is reported to possess a limited capacity for gene expression restricted to early gene products and is considered a replicative dead end. Although the majority of peripheral blood CD4+ T cells are refractory to infection, nonactivated CD4 T cells present in lymphoid and mucosal tissues are major targets for infection. Treatment with cytokine interleukin-2 (IL-2), IL-4, IL-7, or IL-15 renders CD4+ T cells permissive to HIV-1 infection in the absence of cell activation and proliferation and provides a useful model for infection of resting CD4+ T cells. We found that infection of cytokine-treated resting CD4+ T cells in the presence of raltegravir or with integrase active-site mutant HIV-1 yielded de novo virus production following subsequent T cell activation. Infection with integration-competent HIV-1 naturally generated a population of cells generating virus from unintegrated DNA. Latent infection persisted for several weeks and could be activated to virus production by a combination of a histone deacetylase inhibitor and a protein kinase C activator or by T cell activation. HIV-1 Vpr was essential for unintegrated HIV-1 gene expression and de novo virus production in this system. Bypassing integration by this mechanism may allow the preservation of genetic information that otherwise would be lost. PMID:24049167

  13. Replication initiates at multiple locations on an autonomously replicating plasmid in human cells.

    PubMed Central

    Krysan, P J; Calos, M P

    1991-01-01

    We have used a two-dimensional gel electrophoresis mapping technique to determine where DNA replication initiates on a plasmid which utilizes a fragment of human DNA to replicate autonomously in human cells. Replication was found to initiate at multiple locations on the plasmid carrying the human sequence, in contrast to the pattern seen for an Epstein-Barr virus vector which served as a control with a fixed origin. The family of repeats, a portion of the Epstein-Barr virus origin of replication which is present our plasmid, was shown to function as a replication fork barrier. The nature of the stalled replicative intermediates on the human DNA-based plasmid further indicated that replication did not initiate at a single fixed position each time the plasmid replicated. The results suggest that the replication apparatus used to duplicate DNA in human cells may not have precise sequence requirements which target initiation to specific locations. Images PMID:1996103

  14. Chromosome replication dynamics in the archaeon Sulfolobus acidocaldarius

    PubMed Central

    Duggin, Iain G.; McCallum, Simon A.; Bell, Stephen D.

    2008-01-01

    The “baby machine” provides a means of generating synchronized cultures of minimally perturbed cells. We describe the use of this technique to establish the key cell-cycle parameters of hyperthermophilic archaea of the genus Sulfolobus. The 3 DNA replication origins of Sulfolobus acidocaldarius were mapped by 2D gel analysis to near 0 (oriC2), 579 (oriC1), and 1,197 kb (oriC3) on the 2,226-kb circular genome, and we present a direct demonstration of their activity within the first few minutes of a synchronous cell cycle. We also detected X-shaped DNA molecules at the origins in log-phase cells, but these were not directly associated with replication initiation or ongoing chromosome replication in synchronized cells. Whole-genome marker frequency analyses of both synchronous and log-phase cultures showed that origin utilization was close to 100% for all 3 origins per round of replication. However, oriC2 was activated slightly later on average compared with oriC1 and oriC3. The DNA replication forks moved bidirectionally away from each origin at ?88 bp per second in synchronous culture. Analysis of the 3 Orc1/Cdc6 initiator proteins showed a uniformity of cellular abundance and origin binding throughout the cell cycle. In contrast, although levels of the MCM helicase were constant across the cell cycle, its origin localization was regulated, because it was strongly enriched at all 3 origins in early S phase. PMID:18922777

  15. Chromosome replication dynamics in the archaeon Sulfolobus acidocaldarius.

    PubMed

    Duggin, Iain G; McCallum, Simon A; Bell, Stephen D

    2008-10-28

    The "baby machine" provides a means of generating synchronized cultures of minimally perturbed cells. We describe the use of this technique to establish the key cell-cycle parameters of hyperthermophilic archaea of the genus Sulfolobus. The 3 DNA replication origins of Sulfolobus acidocaldarius were mapped by 2D gel analysis to near 0 (oriC2), 579 (oriC1), and 1,197 kb (oriC3) on the 2,226-kb circular genome, and we present a direct demonstration of their activity within the first few minutes of a synchronous cell cycle. We also detected X-shaped DNA molecules at the origins in log-phase cells, but these were not directly associated with replication initiation or ongoing chromosome replication in synchronized cells. Whole-genome marker frequency analyses of both synchronous and log-phase cultures showed that origin utilization was close to 100% for all 3 origins per round of replication. However, oriC2 was activated slightly later on average compared with oriC1 and oriC3. The DNA replication forks moved bidirectionally away from each origin at approximately 88 bp per second in synchronous culture. Analysis of the 3 Orc1/Cdc6 initiator proteins showed a uniformity of cellular abundance and origin binding throughout the cell cycle. In contrast, although levels of the MCM helicase were constant across the cell cycle, its origin localization was regulated, because it was strongly enriched at all 3 origins in early S phase. PMID:18922777

  16. An unusual early Holocene diatom event north of the Getz Ice Shelf (Amundsen Sea): Implications for West Antarctic Ice Sheet development

    NASA Astrophysics Data System (ADS)

    Esper, O.; Gersonde, R.; Hillenbrand, C.; Kuhn, G.; Smith, J.

    2011-12-01

    Modern global change affects not only the polar north but also, and to increasing extent, the southern high latitudes, especially the Antarctic regions covered by the West Antarctic Ice Sheet (WAIS). Consequently, knowledge of the mechanisms controlling past WAIS dynamics and WAIS behaviour at the last deglaciation is critical to predict its development in a future warming world. Geological and palaeobiological information from major drainage areas of the WAIS, like the Amundsen Sea Embayment, shed light on the history of the WAIS glaciers. Sediment records obtained from a deep inner shelf basin north of Getz Ice Shelf document a deglacial warming in three phases. Above a glacial diamicton and a sediment package barren of microfossils that document sediment deposition by grounded ice and below an ice shelf or perennial sea ice cover (possibly fast ice), respectively, a sediment section with diatom assemblages dominated by sea ice taxa indicates ice shelf retreat and seasonal ice-free conditions. This conclusion is supported by diatom-based summer temperature reconstructions. The early retreat was followed by a phase, when exceptional diatom ooze was deposited around 12,500 cal. years B.P. [1]. Microscopical inspection of this ooze revealed excellent preservation of diatom frustules of the species Corethron pennatum together with vegetative Chaetoceros, thus an assemblage usually not preserved in the sedimentary record. Sediments succeeding this section contain diatom assemblages indicating rather constant Holocene cold water conditions with seasonal sea ice. The deposition of the diatom ooze can be related to changes in hydrographic conditions including strong advection of nutrients. However, sediment focussing in the partly steep inner shelf basins cannot be excluded as a factor enhancing the thickness of the ooze deposits. It is not only the presence of the diatom ooze but also the exceptional preservation and the species composition of the diatom assemblage, which point to specific scenarios involving e.g. changes in the food web that can be related to warmer surface water temperatures. Such warming of shelf waters may be related with an overshooting Atlantic Meridional Overturning Circulation (AMOC) and strong injection of warmer North Atlantic Deep Water into the Southern Ocean water masses at Termination I as reported by [2]. Such finding may highlight the effects of AMOC changes on Antarctic ice shelf extent and coastal ecosystems. [1] Hillenbrand et al., 2010. J. Quat. Sci. 25 (3), 280-295. [2] Barker et al., 2010. Nature Geosci. 3, 567-571.

  17. Human parainfluenza virus serotypes differ in their kinetics of replication and cytokine secretion in human tracheobronchial airway epithelium.

    PubMed

    Schaap-Nutt, Anne; Liesman, Rachael; Bartlett, Emmalene J; Scull, Margaret A; Collins, Peter L; Pickles, Raymond J; Schmidt, Alexander C

    2012-11-25

    Human parainfluenza viruses (PIVs) cause acute respiratory illness in children, the elderly, and immunocompromised patients. PIV3 is a common cause of bronchiolitis and pneumonia, whereas PIV1 and 2 are frequent causes of upper respiratory tract illness and croup. To assess how PIV1, 2, and 3 differ with regard to replication and induction of type I interferons, interleukin-6, and relevant chemokines, we infected primary human airway epithelium (HAE) cultures from the same tissue donors and examined replication kinetics and cytokine secretion. PIV1 replicated to high titer yet did not induce cytokine secretion until late in infection, while PIV2 replicated less efficiently but induced an early cytokine peak. PIV3 replicated to high titer but induced a slower rise in cytokine secretion. The T cell chemoattractants CXCL10 and CXCL11 were the most abundant chemokines induced. Differences in replication and cytokine secretion might explain some of the differences in PIV serotype-specific pathogenesis and epidemiology. PMID:22959894

  18. The ZRANB3 translocase associates with poly-ubiquitinated PCNA to promote fork restart and limit recombination after replication stress

    PubMed Central

    Ciccia, Alberto; Nimonkar, Amitabh V.; Hu, Yiduo; Hajdu, Ildiko; Achar, Yathish Jagadheesh; Izhar, Lior; Petit, Sarah A.; Adamson, Britt; Yoon, John C.; Kowalczykowski, Stephen C.; Livingston, David M.; Haracska, Lajos; Elledge, Stephen J.

    2012-01-01

    Summary Completion of DNA replication after replication stress depends on PCNA, which undergoes mono-ubiquitination to stimulate direct bypass of DNA lesions by specialized DNA polymerases or is poly-ubiquitinated to promote recombination dependent DNA synthesis across DNA lesions by template switching mechanisms. Here we report that the ZRANB3 translocase, a SNF2 family member related to the SIOD disorder SMARCAL1 protein, is recruited by poly-ubiquitinated PCNA to promote fork restart following replication arrest. ZRANB3 depletion in mammalian cells results in an increased frequency of sister chromatid exchange and DNA damage sensitivity after treatment with agents that cause replication stress. Using in vitro biochemical assays, we show that recombinant ZRANB3 remodels DNA structures mimicking stalled replication forks and disassembles recombination intermediates. We therefore propose that ZRANB3 maintains genomic stability at stalled or collapsed replication forks by facilitating fork restart and limiting inappropriate recombination that could occur during template switching events. PMID:22704558

  19. Climate Events

    NSDL National Science Digital Library

    American Museum of Natural History

    This detailed animated map shows global weather and climate events from the beginning of 2009 to the present. As the animation plays, specific events are highlighted to provide context and details for the viewer.

  20. Exploiting replicative stress to treat cancer.

    PubMed

    Dobbelstein, Matthias; Sørensen, Claus Storgaard

    2015-06-01

    DNA replication in cancer cells is accompanied by stalling and collapse of the replication fork and signalling in response to DNA damage and/or premature mitosis; these processes are collectively known as 'replicative stress'. Progress is being made to increase our understanding of the mechanisms that govern replicative stress, thus providing ample opportunities to enhance replicative stress for therapeutic purposes. Rather than trying to halt cell cycle progression, cancer therapeutics could aim to increase replicative stress by further loosening the checkpoints that remain available to cancer cells and ultimately inducing the catastrophic failure of proliferative machineries. In this Review, we outline current and future approaches to achieve this, emphasizing the combination of conventional chemotherapy with targeted approaches. PMID:25953507

  1. Topologically-associating domains are stable units of replication-timing regulation

    PubMed Central

    Pope, Benjamin D.; Ryba, Tyrone; Dileep, Vishnu; Yue, Feng; Wu, Weisheng; Denas, Olgert; Vera, Daniel L.; Wang, Yanli; Hansen, R. Scott; Canfield, Theresa K.; Thurman, Robert E.; Cheng, Yong; Gülsoy, Günhan; Dennis, Jonathan H.; Snyder, Michael P.; Stamatoyannopoulos, John A.; Taylor, James; Hardison, Ross C.; Kahveci, Tamer; Ren, Bing; Gilbert, David M.

    2014-01-01

    Summary Eukaryotic chromosomes replicate in a temporal order known as the replication-timing program1. During mammalian development, at least half the genome changes replication timing, primarily in units of 400–800 kb (“replication domains”; RDs), whose positions are preserved in different cell types, conserved between species, and appear to confine long-range effects of chromosome rearrangements2–7. Early and late replication correlate strongly with open and closed chromatin compartments identified by high-resolution chromosome conformation capture (Hi-C), and, to a lesser extent, lamina-associated domains (LADs)4,5,8,9. Recent Hi-C mapping has unveiled a substructure of topologically-associating domains (TADs) that are largely conserved in their positions between cell types and are similar in size to RDs8,10. However, TADs can be further sub-stratified into smaller domains, challenging the significance of structures at any particular scale11,12. Moreover, attempts to reconcile TADs and LADs to replication-timing data have not revealed a common, underlying domain structure8,9,13. Here, we localize boundaries of RDs to the early-replicating border of replication-timing transitions and map their positions in 18 human and 13 mouse cell types. We demonstrate that, collectively, RD boundaries share a near one-to-one correlation with TAD boundaries, whereas within a cell type, adjacent TADs that replicate at similar times obscure RD boundaries, largely accounting for the previously reported lack of alignment. Moreover, cell-type specific replication timing of TADs partitions the genome into two large-scale sub-nuclear compartments revealing that replication-timing transitions are indistinguishable from late-replicating regions in chromatin composition and lamina association and accounting for the reduced correlation of replication timing to LADs and heterochromatin. Our results reconcile cell type specific sub-nuclear compartmentalization with developmentally stable chromosome domains and offer a unified model for large-scale chromosome structure and function. PMID:25409831

  2. LINEs of evidence: noncanonical DNA replication as an epigenetic determinant

    PubMed Central

    2013-01-01

    LINE-1 (L1) retrotransposons are repetitive elements in mammalian genomes. They are capable of synthesizing DNA on their own RNA templates by harnessing reverse transcriptase (RT) that they encode. Abundantly expressed full-length L1s and their RT are found to globally influence gene expression profiles, differentiation state, and proliferation capacity of early embryos and many types of cancer, albeit by yet unknown mechanisms. They are essential for the progression of early development and the establishment of a cancer-related undifferentiated state. This raises important questions regarding the functional significance of L1 RT in these cell systems. Massive nuclear L1-linked reverse transcription has been shown to occur in mouse zygotes and two-cell embryos, and this phenomenon is purported to be DNA replication independent. This review argues against this claim with the goal of understanding the nature of this phenomenon and the role of L1 RT in early embryos and cancers. Available L1 data are revisited and integrated with relevant findings accumulated in the fields of replication timing, chromatin organization, and epigenetics, bringing together evidence that strongly supports two new concepts. First, noncanonical replication of a portion of genomic full-length L1s by means of L1 RNP-driven reverse transcription is proposed to co-exist with DNA polymerase-dependent replication of the rest of the genome during the same round of DNA replication in embryonic and cancer cell systems. Second, the role of this mechanism is thought to be epigenetic; it might promote transcriptional competence of neighboring genes linked to undifferentiated states through the prevention of tethering of involved L1s to the nuclear periphery. From the standpoint of these concepts, several hitherto inexplicable phenomena can be explained. Testing methods for the model are proposed. Reviewers This article was reviewed by Dr. Philip Zegerman (nominated by Dr. Orly Alter), Dr. I. King Jordan, and Dr. Panayiotis (Takis) Benos. For the complete reviews, see the Reviewers’ Reports section. PMID:24034780

  3. DNA Replication via Entanglement Swapping

    E-print Network

    Onur Pusuluk; Cemsinan Deliduman

    2011-03-31

    Quantum effects are mainly used for the determination of molecular shapes in molecular biology, but quantum information theory may be a more useful tool to understand the physics of life. Organic molecules and quantum circuits/protocols can be considered as hardware and software of living systems that are co-optimized during evolution. We try to model DNA replication in this sense as a multi-body entanglement swapping with a reliable qubit representation of the nucleotides. In our model molecular recognition of a nucleotide triggers an intrabase entanglement corresponding to a superposition state of different tautomer forms. Then, base pairing occurs by swapping intrabase entanglements with interbase entanglements. We examine possible realizations of quantum circuits to be used to obtain intrabase entanglement and swapping protocols to be employed to obtain interbase entanglement. Finally, we discuss possible ways for computational and experimental verification of the model.

  4. Hepadnavirus Genome Replication and Persistence.

    PubMed

    Hu, Jianming; Seeger, Christoph

    2015-01-01

    Hallmarks of the hepadnavirus replication cycle are the formation of covalently closed circular DNA (cccDNA) and the reverse transcription of a pregenomic RNA (pgRNA) in core particles leading to synthesis of the relaxed circular DNA (rcDNA) genome. cccDNA, the template for viral RNA transcription, is the basis for the persistence of these viruses in infected hepatocytes. In this review, we summarize the current state of knowledge on the mechanisms of hepadnavirus reverse transcription and the biochemical and structural properties of the viral reverse transcriptase (RT). We highlight important gaps in knowledge regarding cccDNA biosynthesis and stability. In addition, we discuss the impact of current antiviral therapies on viral persistence, particularly on cccDNA. PMID:26134841

  5. Valveless diffuser micropumps fabricated using thermoplastic replication

    Microsoft Academic Search

    Anders Olsson; Olle Larsson; Johan Holm; Lars Lundbladh; Ove Öhman; Göran Stemme

    1998-01-01

    This paper presents valve-less diffuser micropumps fabricated using thermoplastic replication. Thermoplastic replication is very suitable for a valve-less diffuser pump due to its simple planar geometry. Two different thermoplastic replication methods have been tested: hot embossing and injection molding. We use 0.1 and 0.2 mm deep precision-milled brass mold inserts and 20 and 80 ?m deep microelectroformed nickel mold inserts

  6. Valveless diffuser micropumps fabricated using thermoplastic replication

    Microsoft Academic Search

    Anders Olsson; Olle Larsson; Johan Holm; Lars Lundbladh; Ove Ohman; Goran Stemme

    1997-01-01

    Here we present the first valve-less diffuser micropumps fabricated using thermoplastic replication. Due to its simple planar geometry the valve-less diffuser pump is very suitable for thermoplastic replication. Two different thermoplastic replication methods have been used: hot embossing and injection molding. As mold inserts we used 0.1 and 0.2 mm deep precision milled brass mold inserts and 20 and 80

  7. PRACTI Replication for Large-Scale Systems

    Microsoft Academic Search

    Mike Dahlin; Lei Gao; Amol Nayate; Arun Venkataramani; Praveen Yalagandula; Jiandan Zheng

    2004-01-01

    Many replication mechanisms for large scale distributed systems exist, but they require a designer to compro- mise a system's replication policy (e.g., by requiring full replication of all data to all nodes), consistency policy (e.g., by supporting per-object coherence but not multi- object consistency), or topology policy (e.g., by assum- ing a hierarchical organization of nodes.) In this paper, we

  8. Comparison of three replication strategies in complex multicellular organisms: Asexual replication, sexual replication with identical gametes, and sexual replication with distinct sperm and egg gametes

    NASA Astrophysics Data System (ADS)

    Tannenbaum, Emmanuel

    2008-01-01

    This paper studies the mutation-selection balance in three simplified replication models. The first model considers a population of organisms replicating via the production of asexual spores. The second model considers a sexually replicating population that produces identical gametes. The third model considers a sexually replicating population that produces distinct sperm and egg gametes. All models assume diploid organisms whose genomes consist of two chromosomes, each of which is taken to be functional if equal to some master sequence, and defective otherwise. In the asexual population, the asexual diploid spores develop directly into adult organisms. In the sexual populations, the haploid gametes enter a haploid pool, where they may fuse with other haploids. The resulting immature diploid organisms then proceed to develop into mature organisms. Based on an analysis of all three models, we find that, as organism size increases, a sexually replicating population can only outcompete an asexually replicating population if the adult organisms produce distinct sperm and egg gametes. A sexual replication strategy that is based on the production of large numbers of sperm cells to fertilize a small number of eggs is found to be necessary in order to maintain a sufficiently low cost for sex for the strategy to be selected for over a purely asexual strategy. We discuss the usefulness of this model in understanding the evolution and maintenance of sexual replication as the preferred replication strategy in complex, multicellular organisms.

  9. Increased replication initiation and conflicts with transcription underlie Cyclin E-induced replication stress.

    PubMed

    Jones, R M; Mortusewicz, O; Afzal, I; Lorvellec, M; García, P; Helleday, T; Petermann, E

    2013-08-01

    It has become increasingly clear that oncogenes not only provide aberrant growth signals to cells but also cause DNA damage at replication forks (replication stress), which activate the ataxia telangiectasia mutated (ATM)/p53-dependent tumor barrier. Here we studied underlying mechanisms of oncogene-induced replication stress in cells overexpressing the oncogene Cyclin E. Cyclin E overexpression is associated with increased firing of replication origins, impaired replication fork progression and DNA damage that activates RAD51-mediated recombination. By inhibiting replication initiation factors, we show that Cyclin E-induced replication slowing and DNA damage is a consequence of excessive origin firing. A significant amount of Cyclin E-induced replication slowing is due to interference between replication and transcription, which also underlies the activation of homologous recombination. Our data suggest that Cyclin E-induced replication stress is caused by deregulation of replication initiation and increased interference between replication and transcription, which results in impaired replication fork progression and DNA damage triggering the tumor barrier or cancer-promoting mutations. PMID:22945645

  10. Replication of Salmonella enterica Serovar Typhimurium in Human Monocyte-Derived Macrophages.

    PubMed

    Lathrop, Stephanie K; Binder, Kelsey A; Starr, Tregei; Cooper, Kendal G; Chong, Audrey; Carmody, Aaron B; Steele-Mortimer, Olivia

    2015-07-01

    Salmonella enterica serovar Typhimurium is a common cause of food-borne gastrointestinal illness, but additionally it causes potentially fatal bacteremia in some immunocompromised patients. In mice, systemic spread and replication of the bacteria depend upon infection of and replication within macrophages, but replication in human macrophages is not widely reported or well studied. In order to assess the ability of Salmonella Typhimurium to replicate in human macrophages, we infected primary monocyte-derived macrophages (MDM) that had been differentiated under conditions known to generate different phenotypes. We found that replication in MDM depends greatly upon the phenotype of the cells, as M1-skewed macrophages did not allow replication, while M2a macrophages and macrophages differentiated with macrophage colony-stimulating factor (M-CSF) alone (termed M0) did. We describe how additional conditions that alter the macrophage phenotype or the gene expression of the bacteria affect the outcome of infection. In M0 MDM, the temporal expression of representative genes from Salmonella pathogenicity islands 1 and 2 (SPI1 and SPI2) and the importance of the PhoP/Q two-component regulatory system are similar to what has been shown in mouse macrophages. However, in contrast to mouse macrophages, where replication is SPI2 dependent, we observed early SPI2-independent replication in addition to later SPI2-dependent replication in M0 macrophages. Only SPI2-dependent replication was associated with death of the host cell at later time points. Altogether, our results reveal a very nuanced interaction between Salmonella and human macrophages. PMID:25895967

  11. Both Chromosome Decondensation and Condensation Are Dependent on DNA Replication in C. elegans Embryos.

    PubMed

    Sonneville, Remi; Craig, Gillian; Labib, Karim; Gartner, Anton; Blow, J Julian

    2015-07-21

    During cell division, chromatin alternates between a condensed state to facilitate chromosome segregation and a decondensed form when DNA replicates. In most tissues, S phase and mitosis are separated by defined G1 and G2 gap phases, but early embryogenesis involves rapid oscillations between replication and mitosis. Using Caenorhabditis elegans embryos as a model system, we show that chromosome condensation and condensin II concentration on chromosomal axes require replicated DNA. In addition, we found that, during late telophase, replication initiates on condensed chromosomes and promotes the rapid decondensation of the chromatin. Upon replication initiation, the CDC-45-MCM-GINS (CMG) DNA helicase drives the release of condensin I complexes from chromatin and the activation or displacement of inactive MCM-2-7 complexes, which together with the nucleoporin MEL-28/ELYS tethers condensed chromatin to the nuclear envelope, thereby promoting chromatin decondensation. Our results show how, in an early embryo, the chromosome-condensation cycle is functionally linked with DNA replication. PMID:26166571

  12. [Paradoxes of replication of RNA of a bacterial virus].

    PubMed

    Chetverin, A B

    2011-01-01

    The extraordinary ability of the bacteriophage Qbeta replicase to amplify RNA outside the cell attracted attention of molecular biologists in the late 60's-early 70's. However, at that time, a number of puzzling properties of the enzyme did not received a rational explanation. Only recently, Qbeta-replicase began to uncover its secrets, promising to give a key not only to understanding the mechanism of replication of the genome of the bacterial virus, but also to the solution of more general fundamental and applied problems. PMID:21485505

  13. Evidence for an Early Cretaceous mineralizing event above the basement/sediment unconformity in the intracratonic Paris Basin: paragenetic sequence and Sm-Nd dating of the world-class Pierre-Perthuis stratabound fluorite deposit

    NASA Astrophysics Data System (ADS)

    Gigoux, Morgane; Delpech, Guillaume; Guerrot, Catherine; Pagel, Maurice; Augé, Thierry; Négrel, Philippe; Brigaud, Benjamin

    2015-04-01

    World-class stratabound fluorite deposits are spatially associated with the basement/sediment unconformity of the intracratonic Paris Basin and the Morvan Massif in Burgundy (France). The reserves are estimated to be about 5.5 Mt of fluorite within six fluorite deposits. In this study, we aim to determine the age of the major fluorite mineralization event of the Pierre-Perthuis deposit (1.4 Mt fluorite) by a combined study of the paragenetic mineral sequence and Sm-Nd dating on fluorite crystals. Fluorite occurs as isolated cubes or filling geodes in a Triassic, silicified, dolomitic formation. Three fluorite stages associated with sphalerite, pyrite, galena, barite, and quartz have been distinguished using optical, cathodoluminescence, and scanning electron microscopes. Seven crystals of the geodic fluorite stage were analyzed for their rare earth element (REE) contents and their 147Sm/144Nd and 143Nd/144Nd isotopic compositions. The normalized REE distribution displays homogeneous bell-shaped patterns for all the geodic fluorite samples with a Mid-REE enrichment over the Light-REE and Heavy-REE. The 147Sm/144Nd varies from 0.3108 to 0.5504 and the 143Nd/144Nd from 0.512313 to 0.512518. A six-point Sm-Nd isochron defines an age of 130 ± 15 Ma (initial 143Nd/144Nd = 0.512054, MSWD = 0.21). This Sm-Nd isochron provides the first age for the stratabound fluorite sediment-hosted deposit, related to an unconformity in the Paris Basin, and highlights a major Early Cretaceous fluid circulation event mainly above the basement/sediment unconformity during a flexural deformation of the Paris Basin, which relates to the rifting of the Bay of Biscay and the formation of the Ligurian Sea in the Western Europe domain.

  14. Homologous recombination repairs secondary replication induced DNA double-strand breaks after ionizing radiation.

    PubMed

    Groth, Petra; Orta, Manuel Luís; Elvers, Ingegerd; Majumder, Muntasir Mamun; Lagerqvist, Anne; Helleday, Thomas

    2012-08-01

    Ionizing radiation (IR) produces direct two-ended DNA double-strand breaks (DSBs) primarily repaired by non-homologous end joining (NHEJ). It is, however, well established that homologous recombination (HR) is induced and required for repair of a subset of DSBs formed following IR. Here, we find that HR induced by IR is drastically reduced when post-DNA damage replication is inhibited in mammalian cells. Both IR-induced RAD51 foci and HR events in the hprt gene are reduced in the presence of replication polymerase inhibitor aphidicolin (APH). Interestingly, we also detect reduced IR-induced toxicity in HR deficient cells when inhibiting post-DNA damage replication. When studying DSB formation following IR exposure, we find that apart from the direct DSBs the treatment also triggers formation of secondary DSBs peaking at 7-9 h after exposure. These secondary DSBs are restricted to newly replicated DNA and abolished by inhibiting post-DNA damage replication. Further, we find that IR-induced RAD51 foci are decreased by APH only in cells replicating at the time of IR exposure, suggesting distinct differences between IR-induced HR in S- and G2-phases of the cell cycle. Altogether, our data indicate that secondary replication-associated DSBs formed following exposure to IR are major substrates for IR-induced HR repair. PMID:22505579

  15. Plasmacytoid Dendritic Cells Are Productively Infected And Activated Through TLR-7 Early After Arenavirus Infection

    PubMed Central

    Macal, Monica; Lewis, Gavin M.; Kunz, Stefan; Flavell, Richard; Harker, James A.; Zuñiga, Elina I.

    2012-01-01

    SUMMARY The antiviral response is largely mediated by dendritic cells (DC), including conventional (c) DCs that function as antigen presenting cells and plasmacytoid (p) DCs that produce Type I interferons, making them an attractive target for viruses. We find that the Old-world arenaviruses lymphocytic choriomeningitis virus clone 13 (LCMV Cl13) and Lassa virus bind pDCs to a greater extent than cDCs. Consistently, LCMV Cl13 targets pDCs early after in vivo infection of its natural murine host and establishes a productive and robust replication cycle. pDCs co-produce type I interferons and pro-inflammatory cytokines, with the former being induced in both infected and uninfected pDCs, demonstrating a dissociation from intrinsic virus replication. TLR7 globally mediates pDC responses, limits pDC viral load and promotes rapid innate and adaptive immune cell activation. These early events likely help dictate the outcome of infections with arenaviruses and other DC-replicating viruses and shed light on potential therapeutic targets. PMID:22704622

  16. A Stochastic Model of Nonenzymatic Nucleic Acid Replication: ``Elongators'' Sequester Replicators

    E-print Network

    Fernando, Chrisantha

    A Stochastic Model of Nonenzymatic Nucleic Acid Replication: ``Elongators'' Sequester Replicators / Accepted: 22 January 2007 [Reviewing Editor: Dr. Niles Lehman] Abstract. The origin of nucleic acid template replication is a major unsolved problem in science. A novel stochastic model of nucleic acid

  17. File and Object Replication in Data Grids

    Microsoft Academic Search

    Heinz Stockinger; Asad Samar; Koen Holtman; William E. Allcock; Ian T. Foster; Brian Tierney

    2001-01-01

    Data replication is a key issue in a Data Grid and can be managed in different ways and at different levels of granularity: for example, at the file level or object level. In the High Energy Physics community, Data Grids are being developed to support the distributed analysis of experimental data. We have produced a prototype data replication tool, the

  18. File and Object Replication in Data Grids

    Microsoft Academic Search

    Heinz Stockinger; Asad Samar; Koen Holtman; Bill Allcock; Ian Foster; Brian Tierney

    2002-01-01

    Data replication is a key issue in a Data Grid and can be managed in different ways and at different levels of granularity: for example, at the file level or object level. In the High Energy Physics community, Data Grids are being developed to support the distributed analysis of experimental data. We have produced a prototype data replication tool, the

  19. A weighted voting algorithm for replicated directories

    Microsoft Academic Search

    Joshua J. Bloch; Dean S. Daniels; Alfred Z. Spector

    1987-01-01

    Weighted voting is used as the basis for a replication technique for directories. This technique affords arbitrarily high data availability as well as high concurrency. Efficient algorithms are presented for all of the standard directory operations. A structural property of the replicated directory that permits the construction of an efficient algorithm for deletion is proven. Simulation results are presented and

  20. Armed replicating adenoviruses for cancer virotherapy

    Microsoft Academic Search

    J J Cody; J T Douglas

    2009-01-01

    Conditionally replicating adenoviruses (CRAds) have many advantages as agents for cancer virotherapy and have been safely used in human clinical trials. However, replicating adenoviruses have been limited in their ability to eliminate tumors by oncolysis. Thus, the efficacy of these agents must be improved. To this end, CRAds have been engineered to express therapeutic transgenes that exert antitumor effects independent

  1. Implementing Database Replication based on Group Communication

    E-print Network

    Kemme, Bettina

    . Such research is especially challenging: #15; It requires in-depth knowledge in both database systemsImplementing Database Replication based on Group Communication Bettina Kemme School of Computer to exploit the rich semantics of group communication systems to sup- port database replication. So far

  2. Replication and Robustness in Developmental Research

    ERIC Educational Resources Information Center

    Duncan, Greg J.; Engel, Mimi; Claessens, Amy; Dowsett, Chantelle J.

    2014-01-01

    Replications and robustness checks are key elements of the scientific method and a staple in many disciplines. However, leading journals in developmental psychology rarely include explicit replications of prior research conducted by different investigators, and few require authors to establish in their articles or online appendices that their key…

  3. PrimPol breaks replication barriers.

    PubMed

    Helleday, Thomas

    2013-12-01

    Faithful bypass of replication forks encountering obstructive DNA lesions is essential to prevent fork collapse and cell death. PrimPol is a new human primase and translesion polymerase that is able to bypass fork-blocking UV-induced lesions and to restart replication by origin-independent repriming. PMID:24304914

  4. Hepatitis C virus replication in hepatocellular carcinoma

    Microsoft Academic Search

    J Niu; U Kumar; J Monjardino; R Goldin; D Rosin; H C Thomas

    1995-01-01

    Hepatitis C virus (HCV) replication is reported in both tumour and non-tumour tissue in a case of hepatocellular carcinoma. Viral replication was established by showing the presence of minus strand HCV RNA by PCR amplification, after excluding residual reverse transcriptase activity of Taq polymerase. No minus strand was found in serum derived virion RNA. PCR amplified products from both tumour

  5. On Optimal Concurrency Control for Optimistic Replication

    Microsoft Academic Search

    Weihan Wang; Cristiana Amza

    2009-01-01

    Concurrency control is a core component in optimistic replication systems. To detect concurrent updates, the system associates each replicated object with metadata, such as, version vectors or causal graphs exchanged on synchro- nization opportunities. However, the size of such metadata increases at least linearly with the number of active sites. With recent trends in cloud computing, multi-regional col- laboration, and

  6. Replication in the Harp File System

    Microsoft Academic Search

    Barbara Liskov; Sanjay Ghemawat; Robert Gruber; Paul Johnson; Liuba Shrira; Michael Williams

    1991-01-01

    This paper describes the design and implementation of the Harp file system. Harp is a replicated Unix file system accessible via the VFS interface. It provides highly available and reliable storage for files and guarantees that file operations are executed atomically in spite of concurrency and failures. It uses a novel variation of the primary copy replication technique that provides

  7. Tethering of SUUR and HP1 proteins results in delayed replication of euchromatic regions in Drosophila melanogaster polytene chromosomes.

    PubMed

    Pokholkova, Galina V; Koryakov, Dmitry E; Pindyurin, Alexey V; Kozhevnikova, Elena N; Belyakin, Stepan N; Andreyenkov, Oleg V; Belyaeva, Elena S; Zhimulev, Igor F

    2015-06-01

    We analyze how artificial targeting of Suppressor of Under-Replication (SUUR) and HP1 proteins affects DNA replication in the "open," euchromatic regions. Normally these regions replicate early in the S phase and display no binding of either SUUR or HP1. These proteins were expressed as fusions with DNA-binding domain of GAL4 and recruited to multimerized UAS integrated in three euchromatic sites of the polytene X chromosome: 3B, 8D, and 18B. Using PCNA staining as a marker of ongoing replication, we showed that targeting of SUUR(GAL4DBD) and HP1(GAL4DBD) results in delayed replication of appropriate euchromatic regions. Specifically, replication at these regions starts early, much like in the absence of the fusion proteins; however, replication completion is significantly delayed. Notably, delayed replication was insufficient to induce underreplication. Recruitment of SUUR(GAL4DBD) and HP1(GAL4DBD) had distinct effects on expression of a mini-white reporter, found near UAS. Whereas SUUR(GAL4DBD) had no measurable influence on mini-white expression, HP1(GAL4DBD) targeting silenced mini-white, even in the absence of functional SU(VAR)3-9. Furthermore, recruitment of SUUR(GAL4DBD) and HP1(GAL4DBD) had distinct effects on the protein composition of target regions. HP1(GAL4DBD) but not SUUR(GAL4DBD) could displace an open chromatin marker, CHRIZ, from the tethering sites. PMID:25398563

  8. FISH-detected delay in replication timing of mutated FMR1 alleles on both active and inactive X-chromosomes.

    PubMed

    Yeshaya, J; Shalgi, R; Shohat, M; Avivi, L

    1999-01-01

    X-chromosome inactivation and the size of the CGG repeat number are assumed to play a role in the clinical, physical, and behavioral phenotype of female carriers of a mutated FMR1 allele. In view of the tight relationship between replication timing and the expression of a given DNA sequence, we have examined the replication timing of FMR1 alleles on active and inactive X-chromosomes in cell samples (lymphocytes or amniocytes) of 25 females: 17 heterozygous for a mutated FMR1 allele with a trinucleotide repeat number varying from 58 to a few hundred, and eight homozygous for a wild-type allele. We have applied two-color fluorescence in situ hybridization (FISH) with FMR1 and X-chromosome alpha-satellite probes to interphase cells of the various genotypes: the alpha-satellite probe was used to distinguish between early replicating (active) and late replicating (inactive) X-chromosomes, and the FMR1 probe revealed the replication pattern of this locus. All samples, except one with a large trinucleotide expansion, showed an early replicating FMR1 allele on the active X-chromosome and a late replicating allele on the inactive X-chromosome. In samples of mutation carriers, both the early and the late alleles showed delayed replication compared with normal alleles, regardless of repeat size. We conclude therefore that: (1) the FMR1 locus is subjected to X-inactivation; (2) mutated FMR1 alleles, regardless of repeat size, replicate later than wild-type alleles on both the active and inactive X-chromosomes; and (3) the delaying effect of the trinucleotide expansion, even with a low repeat size, is superimposed on the delay in replication associated with X-inactivation. PMID:10480360

  9. Multiple pathways process stalled replication forks.

    PubMed

    Michel, Bénédicte; Grompone, Gianfranco; Florès, Maria-Jose; Bidnenko, Vladimir

    2004-08-31

    Impairment of replication fork progression is a serious threat to living organisms and a potential source of genome instability. Studies in prokaryotes have provided evidence that inactivated replication forks can restart by the reassembly of the replication machinery. Several strategies for the processing of inactivated replication forks before replisome reassembly have been described. Most of these require the action of recombination proteins, with different proteins being implicated, depending on the cause of fork arrest. The action of recombination proteins at blocked forks is not necessarily accompanied by a strand-exchange reaction and may prevent rather than repair fork breakage. These various restart pathways may reflect different structures at stalled forks. We review here the different strategies of fork processing elicited by different kinds of replication impairments in prokaryotes and the variety of roles played by recombination proteins in these processes. PMID:15328417

  10. Selective inhibitors of picornavirus replication.

    PubMed

    De Palma, Armando M; Vliegen, Inge; De Clercq, Erik; Neyts, Johan

    2008-11-01

    Picornaviruses cover a large family of pathogens that have a major impact on human but also on veterinary health. Although most infections in man subside mildly or asymptomatically, picornaviruses can also be responsible for severe, potentially life-threatening disease. To date, no therapy has been approved for the treatment of picornavirus infections. However, efforts to develop an antiviral that is effective in treating picornavirus-associated diseases are ongoing. In 2007, Schering-Plough, under license of ViroPharma, completed a phase II clinical trial with Pleconaril, a drug that was originally rejected by the FDA after a New Drug Application in 2001. Rupintrivir, a rhinovirus protease inhibitor developed at Pfizer, reached clinical trials but was recently halted from further development. Finally, Biota's HRV drug BTA-798 is scheduled for phase II trials in 2008. Several key steps in the picornaviral replication cycle, involving structural as well as non-structural proteins, have been identified as valuable targets for inhibition. The current review aims to highlight the most important developments during the past decades in the search for antivirals against picornaviruses. PMID:18381747

  11. Replication occurs at a nucleoskeleton.

    PubMed

    Jackson, D A; Cook, P R

    1986-06-01

    The site of S-phase DNA synthesis has been the subject of recurring controversy. All recent evidence supporting a site fixed to some nuclear sub-structure is derived from studies in which cells or nuclei have been extracted in hypertonic salt concentrations. The controversy centres on whether the resulting nuclear matrices or cages have counterparts in vivo or are simply artefacts. Using isotonic conditions throughout the isolation and analytic procedures we have now reinvestigated the site of replication. Cells are encapsulated in agarose microbeads and lysed to leave encapsulated nuclei which are nevertheless completely accessible to enzymes. After incubation with endonucleases, most chromatin can be electroeluted from beads: however, nascent DNA and active DNA polymerase remain entrapped. Since chromatin particles containing DNA the size of 125 kbp can electroelute, we conclude that the polymerizing complex is attached to a nucleoskeleton which is too large to escape. We have also studied various artefacts induced by departure from isotonic conditions. Perhaps surprisingly, the hypotonic conditions used during isolation of nuclei by conventional procedures are a significant source of artefact. PMID:3732249

  12. Event Perception

    PubMed Central

    Radvansky, Gabriel; Zacks, Jeffrey M.

    2012-01-01

    Events are central elements of human experience. Formally, they can be individuated in terms of the entities that compose them, the features of those entities, and the relations amongst entities. Psychologically, representations of events capture their spatiotemporal location, the people and objects involved, and the relations between these elements. Here, we present an account of the nature of psychological representations of events and how they are constructed and updated. Event representations are like images in that they are isomorphic to the situations they represent. However, they are like models or language in that they are constructed of components rather than being holistic. Also, they are partial representations that leave out some elements and abstract others. Representations of individual events are informed by schematic knowledge about general classes of events. Event representations are constructed in a process that segments continuous activity into discrete events. The construction of a series of event representations forms a basis for predicting the future, planning for that future, and imagining alternatives. PMID:23082236

  13. Introduction of a Fluorine Atom at C3 of 3-Deazauridine Shifts Its Antimetabolic Activity from Inhibition of CTP Synthetase to Inhibition of Orotidylate Decarboxylase, an Early Event in the de Novo Pyrimidine Nucleotide Biosynthesis Pathway*

    PubMed Central

    Balzarini, Jan; Gago, Federico; Kulik, Wim; van Kuilenburg, André B. P.; Karlsson, Anna; Peterson, Matt A.; Robins, Morris J.

    2012-01-01

    The antimetabolite prodrug 3-deazauridine (3DUrd) inhibits CTP synthetase upon intracellular conversion to its triphosphate, which selectively depletes the intracellular CTP pools. Introduction of a fluorine atom at C3 of 3DUrd shifts its antimetabolic action to inhibition of the orotidylate decarboxylase (ODC) activity of the UMP synthase enzyme complex that catalyzes an early event in pyrimidine nucleotide biosynthesis. This results in concomitant depletion of the intracellular UTP and CTP pools. The new prodrug (designated 3F-3DUrd) exerts its inhibitory activity because its monophosphate is not further converted intracellularly to its triphosphate derivative to a detectable extent. Combinations with hypoxanthine and adenine markedly potentiate the cytostatic activity of 3F-3DUrd. This is likely because of depletion of 5-phosphoribosyl-1-pyrophosphate (consumed in the hypoxanthine phosphoribosyl transferase/adenine phosphoribosyl transferase reaction) and subsequent slowing of the 5-phosphoribosyl-1-pyrophosphate-dependent orotate phosphoribosyl transferase reaction, which depletes orotidylate, the substrate for ODC. Further efficient anabolism by nucleotide kinases is compromised apparently because of the decrease in pKa brought about by the fluorine atom, which affects the ionization state of the new prodrug. The 3F-3DUrd monophosphate exhibits new inhibitory properties against a different enzyme of the pyrimidine nucleotide metabolism, namely the ODC activity of UMP synthase. PMID:22730407

  14. Inferring Where and When Replication Initiates from Genome-Wide Replication Timing Data

    NASA Astrophysics Data System (ADS)

    Baker, A.; Audit, B.; Yang, S. C.-H.; Bechhoefer, J.; Arneodo, A.

    2012-06-01

    Based on an analogy between DNA replication and one dimensional nucleation-and-growth processes, various attempts to infer the local initiation rate I(x,t) of DNA replication origins from replication timing data have been developed in the framework of phase transition kinetics theories. These works have all used curve-fit strategies to estimate I(x,t) from genome-wide replication timing data. Here, we show how to invert analytically the Kolmogorov-Johnson-Mehl-Avrami model and extract I(x,t) directly. Tests on both simulated and experimental budding-yeast data confirm the location and firing-time distribution of replication origins.

  15. On the Relationship Between Country Sex Ratios and Teen Pregnancy Rates: A Replication

    Microsoft Academic Search

    Nigel Barber

    2000-01-01

    The hypothesis that a low ratio of men to women both destabilizes marriages and makes it more likely that young women will reproduce early outside of marriage was supported by an analysis of 42 societies for which the United Nations published detailed information on population structure and teen childbearing. This study attempted to replicate the earlier finding using sex ratios

  16. Replication and transcription of human papillomavirus type 58 genome in Saccharomyces cerevisiae

    Microsoft Academic Search

    Jing Li; Xiao Wang; Juan Liu; Hong Wang; Xiao-Li Zhang; Wei Tang; Yun-Dong Sun; Xin Wang; Xiu-Ping Yu; Wei-Ming Zhao

    2010-01-01

    BACKGROUND: To establish a convenient system for the study of human papillomavirus (HPV), we inserted a Saccharomyces cerevisiae selectable marker, Ura, into HPV58 genome and transformed it into yeast. RESULTS: HPV58 genome could replicate extrachromosomally in yeast, with transcription of its early and late genes. However, with mutation of the viral E2 gene, HPV58 genome lost its mitotic stability, and

  17. Schizosaccharomyces pombe Rtf2 mediates site-specific replication termination by inhibiting replication restart.

    PubMed

    Inagawa, Takabumi; Yamada-Inagawa, Tomoko; Eydmann, Trevor; Mian, I Saira; Wang, Teresa S; Dalgaard, Jacob Z

    2009-05-12

    Here, we identify a phylogenetically conserved Schizosaccharomyces pombe factor, named Rtf2, as a key requirement for efficient replication termination at the site-specific replication barrier RTS1. We show that Rtf2, a proliferating cell nuclear antigen-interacting protein, promotes termination at RTS1 by preventing replication restart; in the absence of Rtf2, we observe the establishment of "slow-moving" Srs2-dependent replication forks. Analysis of the pmt3 (SUMO) and rtf2 mutants establishes that pmt3 causes a reduction in RTS1 barrier activity, that rtf2 and pmt3 are nonadditive, and that pmt3 (SUMO) partly suppresses the rtf2-dependent replication restart. Our results are consistent with a model in which Rtf2 stabilizes the replication fork stalled at RTS1 until completion of DNA synthesis by a converging replication fork initiated at a flanking origin. PMID:19416828