These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Improved artificial origins for phage ?29 terminal protein-primed replication. Insights into early replication events  

PubMed Central

The replication machinery of bacteriophage ?29 is a paradigm for protein-primed replication and it holds great potential for applied purposes. To better understand the early replication events and to find improved origins for DNA amplification based on the ?29 system, we have studied the end-structure of a double-stranded DNA replication origin. We have observed that the strength of the origin is determined by a combination of factors. The strongest origin (30-fold respect to wt) has the sequence CCC at the 3? end of the template strand, AAA at the 5? end of the non-template strand and 6 nucleotides as optimal unpairing at the end of the origin. We also show that the presence of a correctly positioned displaced strand is important because origins with 5? or 3? ssDNA regions have very low activity. Most of the effect of the improved origins takes place at the passage between the terminal protein-primed and the DNA-primed modes of replication by the DNA polymerase suggesting the existence of a thermodynamic barrier at that point. We suggest that the template and non-template strands of the origin and the TP/DNA polymerase complex form series of interactions that control the critical start of terminal protein-primed replication. PMID:25081208

Gella, Pablo; Salas, Margarita; Mencía, Mario

2014-01-01

2

Tromantadine: inhibitor of early and late events in herpes simplex virus replication.  

PubMed Central

Unlike amantadine (1-adamantanamine), tromantadine (N-1-adamantyl-N-[2-(dimethyl amino)ethoxy]acetamide hydrochloride) inhibits herpes simplex virus type 1 (KOS strain)-induced cytopathic effect and virus replication with limited toxicity to the cells. Vero and HEp-2 cells tolerated up to 2 mg of tromantadine per 2 X 10(6) cells for 24-, 48-, or 96-h incubation periods with little change in cell morphology. Treatment of the cells with 10 to 50 micrograms of tromantadine reduced herpes simplex virus-induced cytopathic effect. Treatment with 100 to 500 micrograms of tromantadine inhibited herpes simplex virus-induced cytopathic effect and reduced virus production. Complete inhibition of virus production was observed with treatments of 500 micrograms to 1 mg. The antiherpetic activity of tromantadine was dependent upon the viral inoculum size and the time of addition of the compound with respect to infection. Virion synthesis and viral polypeptide synthesis were inhibited by addition of tromantadine at the time of infection or 4 h postinfection. The results are consistent with tromantadine inhibition of an early event in herpes simplex virus infection, before macromolecular synthesis, and a late event, such as assembly or release of virus. Images PMID:6297383

Rosenthal, K S; Sokol, M S; Ingram, R L; Subramanian, R; Fort, R C

1982-01-01

3

Early events in the pathogenesis of foot-and-mouth disease in pigs; identification of oropharyngeal tonsils as sites of primary and sustained viral replication.  

PubMed

A time-course study was performed to elucidate the early events of foot-and-mouth disease virus (FMDV) infection in pigs subsequent to simulated natural, intra-oropharyngeal, inoculation. The earliest detectable event was primary infection in the lingual and paraepiglottic tonsils at 6 hours post inoculation (hpi) characterized by regional localization of viral RNA, viral antigen, and infectious virus. At this time FMDV antigen was localized in cytokeratin-positive epithelial cells and CD172a-expressing leukocytes of the crypt epithelium of the paraepiglottic tonsils. De novo replication of FMDV was first detected in oropharyngeal swab samples at 12 hpi and viremia occurred at 18-24 hpi, approximately 24 hours prior to the appearance of vesicular lesions. From 12 through 78 hpi, microscopic detection of FMDV was consistently localized to cytokeratin-positive cells within morphologically characteristic segments of oropharyngeal tonsil crypt epithelium. During this period, leukocyte populations expressing CD172a, SLA-DQ class II and/or CD8 were found in close proximity to infected epithelial cells, but with little or no co-localization with viral proteins. Similarly, M-cells expressing cytokeratin-18 did not co-localize with FMDV proteins. Intra-epithelial micro-vesicles composed of acantholytic epithelial cells expressing large amounts of structural and non-structural FMDV proteins were present within crypts of the tonsil of the soft palate during peak clinical infection. These findings inculpate the paraepiglottic tonsils as the primary site of FMDV infection in pigs exposed via the gastrointestinal tract. Furthermore, the continuing replication of FMDV in the oropharyngeal tonsils during viremia and peak clinical infection with no concurrent amplification of virus occurring in the lower respiratory tract indicates that these sites are the major source of shedding of FMDV from pigs. PMID:25184288

Stenfeldt, Carolina; Pacheco, Juan M; Rodriguez, Luis L; Arzt, Jonathan

2014-01-01

4

Synchronous contextual irregularities affect early scene processing: replication and extension.  

PubMed

Whether contextual regularities facilitate perceptual stages of scene processing is widely debated, and empirical evidence is still inconclusive. Specifically, it was recently suggested that contextual violations affect early processing of a scene only when the incongruent object and the scene are presented a-synchronously, creating expectations. We compared event-related potentials (ERPs) evoked by scenes that depicted a person performing an action using either a congruent or an incongruent object (e.g., a man shaving with a razor or with a fork) when scene and object were presented simultaneously. We also explored the role of attention in contextual processing by using a pre-cue to direct subjects? attention towards or away from the congruent/incongruent object. Subjects? task was to determine how many hands the person in the picture used in order to perform the action. We replicated our previous findings of frontocentral negativity for incongruent scenes that started ~ 210 ms post stimulus presentation, even earlier than previously found. Surprisingly, this incongruency ERP effect was negatively correlated with the reaction times cost on incongruent scenes. The results did not allow us to draw conclusions about the role of attention in detecting the regularity, due to a weak attention manipulation. By replicating the 200-300 ms incongruity effect with a new group of subjects at even earlier latencies than previously reported, the results strengthen the evidence for contextual processing during this time window even when simultaneous presentation of the scene and object prevent the formation of prior expectations. We discuss possible methodological limitations that may account for previous failures to find this an effect, and conclude that contextual information affects object model selection processes prior to full object identification, with semantic knowledge activation stages unfolding only later on. PMID:24593900

Mudrik, Liad; Shalgi, Shani; Lamy, Dominique; Deouell, Leon Y

2014-04-01

5

Early events of DNA photodamage.  

PubMed

Ultraviolet (UV) radiation is a leading external hazard to the integrity of DNA. Exposure to UV radiation triggers a cascade of chemical reactions, and many molecular products (photolesions) have been isolated that are potentially dangerous for the cellular system. The early steps that take place after UV absorption by DNA have been studied by ultrafast spectroscopy. The review focuses on the evolution of excited electronic states, the formation of photolesions, and processes suppressing their formation. Emphasis is placed on lesions involving two thymine bases, such as the cyclobutane pyrimidine dimer, the (6-4) lesion, and its Dewar valence isomer. PMID:25664840

Schreier, Wolfgang J; Gilch, Peter; Zinth, Wolfgang

2015-04-01

6

A post-entry role for CD63 in early HIV-1 replication  

SciTech Connect

Macrophages and CD4{sup +} lymphocytes are the major reservoirs for HIV-1 infection. CD63 is a tetraspanin transmembrane protein, which has been shown to play an essential role during HIV-1 replication in macrophages. In this study, we further confirm the requirement of CD63 in early HIV-1 replication events in both macrophages and a CD4{sup +} cell line. Further analysis revealed that viral attachment and cell-cell fusion were unaffected by CD63 silencing. However, CD63-depleted macrophages showed a significant decrease in the initiation and completion of HIV-1 reverse transcription, affecting subsequent events of the HIV-1 life cycle. Integration of HIV-1 cDNA as well as the formation of 2-LTR circles was notably reduced. Reporter assays showed that CD63 down regulation reduced production of the early HIV protein Tat. In agreement, CD63 silencing also inhibited production of the late protein p24. These findings suggest that CD63 plays an early post-entry role prior to or at the reverse transcription step.

Li Guangyu; Dziuba, Natallia; Friedrich, Brian [Department of Internal Medicine, Division of Infectious Diseases, University of Texas Medical Branch, Galveston, TX 77555-0435 (United States); Murray, James L. [Zirus, Inc., 1384 Buford Business Boulevard, Suite 700, Buford, GA 30518 (United States); Ferguson, Monique R., E-mail: mrfergus@utmb.ed [Department of Internal Medicine, Division of Infectious Diseases, University of Texas Medical Branch, Galveston, TX 77555-0435 (United States)

2011-04-10

7

At Short Telomeres Tel1 Directs Early Replication and Phosphorylates Rif1  

PubMed Central

The replication time of Saccharomyces cerevisiae telomeres responds to TG1–3 repeat length, with telomeres of normal length replicating late during S phase and short telomeres replicating early. Here we show that Tel1 kinase, which is recruited to short telomeres, specifies their early replication, because we find a tel1? mutant has short telomeres that nonetheless replicate late. Consistent with a role for Tel1 in driving early telomere replication, initiation at a replication origin close to an induced short telomere was reduced in tel1? cells, in an S phase blocked by hydroxyurea. The telomeric chromatin component Rif1 mediates late replication of normal telomeres and is a potential substrate of Tel1 phosphorylation, so we tested whether Tel1 directs early replication of short telomeres by inactivating Rif1. A strain lacking both Rif1 and Tel1 behaves like a rif1? mutant by replicating its telomeres early, implying that Tel1 can counteract the delaying effect of Rif1 to control telomere replication time. Proteomic analyses reveals that in yku70? cells that have short telomeres, Rif1 is phosphorylated at Tel1 consensus sequences (S/TQ sites), with phosphorylation of Serine-1308 being completely dependent on Tel1. Replication timing analysis of a strain mutated at these phosphorylation sites, however, suggested that Tel1-mediated phosphorylation of Rif1 is not the sole mechanism of replication timing control at telomeres. Overall, our results reveal two new functions of Tel1 at shortened telomeres: phosphorylation of Rif1, and specification of early replication by counteracting the Rif1-mediated delay in initiation at nearby replication origins. PMID:25329891

Sridhar, Akila; Kedziora, Sylwia; Donaldson, Anne D.

2014-01-01

8

Bacteriophage and host mutants causing the rolling-circle ? DNA replication early after infection  

Microsoft Academic Search

There are two modes of bacteriophage ? DNA replication during its lytic development in Escherichia coli cells. The circle-to-circle (?) replication predominates at early stages of the phage growth, whereas rolling-circle (?) replication occurs late after infection to produce long concatemers that serve as substrates for packaging of ? DNA into phage proheads. The mechanism regulating the switch from ?

Gra?yna Konopa; Sylwia Bara?ska; Alicja W; Grzegorz W

2000-01-01

9

The Ethics of Proof in Speech Events: A Replication.  

ERIC Educational Resources Information Center

A survey attempted to determine whether forensics participants operate under a contest-oriented ethic, an educational standard, or a more general rhetorical standard of ethics. Subjects were 63 judges and 98 contestants in rhetorical events at the American Forensic Association's (AFA) National Individual Events Tournament in April 1982. A…

Thomas, David A.; Hart, Jack

10

Early Events in Ionic Liquid Radiation Chemistry  

SciTech Connect

Ionic liquids are interesting and useful materials whose solvation time scales are up to thousands of times longer than in conventional solvents. The extended lifetimes of pre-solvated electrons and other energetic species in ionic liquids has profound consequences for the radiolytic product distributions and reactivity patterns. We use a newly developed, multiplexed variation of pulse-probe spectroscopy to measure the kinetics of the early dynamical and reactive events in ionic liquids.

Wishart, J.F.; Cook, A.; Rimmer, R.D.; Gohdo, M.

2010-09-14

11

Kinetochores coordinate pericentromeric cohesion and early DNA replication by Cdc7-Dbf4 kinase recruitment.  

PubMed

Centromeres play several important roles in ensuring proper chromosome segregation. Not only do they promote kinetochore assembly for microtubule attachment, but they also support robust sister chromatid cohesion at pericentromeres and facilitate replication of centromeric DNA early in S phase. However, it is still elusive how centromeres orchestrate all these functions at the same site. Here, we show that the budding yeast Dbf4-dependent kinase (DDK) accumulates at kinetochores in telophase, facilitated by the Ctf19 kinetochore complex. This promptly recruits Sld3-Sld7 replication initiator proteins to pericentromeric replication origins so that they initiate replication early in S phase. Furthermore, DDK at kinetochores independently recruits the Scc2-Scc4 cohesin loader to centromeres in G1 phase. This enhances cohesin loading and facilitates robust pericentromeric cohesion in S phase. Thus, we have found the central mechanism by which kinetochores orchestrate early S phase DNA replication and robust sister chromatid cohesion at microtubule attachment sites. PMID:23746350

Natsume, Toyoaki; Müller, Carolin A; Katou, Yuki; Retkute, Renata; Gierli?ski, Marek; Araki, Hiroyuki; Blow, J Julian; Shirahige, Katsuhiko; Nieduszynski, Conrad A; Tanaka, Tomoyuki U

2013-06-01

12

Early events in axon/dendrite polarization.  

PubMed

Differentiation of axons and dendrites is a critical step in neuronal development. Here we review the evidence that axon/dendrite formation during neuronal polarization depends on the intrinsic cytoplasmic asymmetry inherited by the postmitotic neuron, the exposure of the neuron to extracellular chemical factors, and the action of anisotropic mechanical forces imposed by the environment. To better delineate the functions of early signals among a myriad of cellular components that were shown to influence axon/dendrite formation, we discuss their functions by distinguishing their roles as determinants, mediators, or modulators and consider selective degradation of these components as a potential mechanism for axon/dendrite polarization. Finally, we examine whether these early events of axon/dendrite formation involve local autocatalytic activation and long-range inhibition, as postulated by Alan Turing for the morphogenesis of patterned biological structure. PMID:22715881

Cheng, Pei-lin; Poo, Mu-ming

2012-01-01

13

Unraveling the early steps of prokaryotic replication Erin L Cunningham and James M Berger  

E-print Network

Unraveling the early steps of prokaryotic replication Erin L Cunningham and James M Berger In prokaryotes, many of the physical mechanisms governing the process of initiating DNA replication are now studies have shown that prokaryotic initiator structures are both modular and conserved, and have begun

Berger, James M.

14

Regulation of the switch from early to late bacteriophage k DNA replication  

Microsoft Academic Search

There are two modes of bacteriophage k DNA replication following infection of its host, Escherichia coli. Early after infection, replication occurs according to the theta (h or circle-to-circle) mode, and is later switched to the sigma (r or rolling-circle) mode. It is not known how this switch, occurring at a specific time in the infection cycle, is regulated. Here it

Sylwia Baran; Magdalena Gabig; Anna Herman-Antosiewicz; Pablo Hernandez; Jorge B. Schvartzman; Donald R. Helinski; Investigaciones Biolo

15

DNA breaks early in replication process associated with B cell cancers  

Cancer.gov

Research by scientists at the NCI has identified a new class of DNA sites in cells that break early in the replication process. They found that these break sites correlate with damage often seen in B cell cancers, such as diffuse large B cell lymphoma.

16

Expert Panel Workshop on Early-Life Events and Cancer  

Cancer.gov

NCI's Division of Cancer Control and Population Sciences (DCCPS) and Division of Cancer Epidemiology and Genetics (DCEG) sponsored an Expert Panel Workshop on Early-Life Events and Cancer on May 25, 2011. There is emerging epidemiological and animal evidence that early-life events and exposures are important determinants of cancer development later in life. However, understanding how to study the impact of early-life exposures on human cancers later in life is a new challenge for cancer research.

17

Early events in geotropism of seedling shoots  

NASA Technical Reports Server (NTRS)

Developments during the first ten minutes of geotropic stimulation in plant seedling shoots are reviewed. Topics include induction and curvature; early processes; the relationship between auxin, electric field, calcium, and differential growth; gravity reception leading to Went-Cholodny transport; and comparison of root and shoot. Early processes reviewed are sedimentation of amyloplasts, release of ethylene, rise of electrical and auxin asymmetry, redistribution of calcium, asymmetric vascular transport, increase in tendency to deposit callose, and simulation of putative exocytotic voltage transients.

Pickard, B. G.

1985-01-01

18

DNA replication stress induces deregulation of the cell cycle events in root meristems of Allium cepa  

PubMed Central

Background and Aims Prolonged treatment of Allium cepa root meristems with changing concentrations of hydroxyurea (HU) results in either premature chromosome condensation or cell nuclei with an uncommon form of biphasic chromatin organization. The aim of the current study was to assess conditions that compromise cell cycle checkpoints and convert DNA replication stress into an abnormal course of mitosis. Methods Interphase-mitotic (IM) cells showing gradual changes of chromatin condensation were obtained following continuous 72 h treatment of seedlings with 0·75 mm HU (without renewal of the medium). HU-treated root meristems were analysed using histochemical stainings (DNA-DAPI/Feulgen; starch-iodide and DAB staining for H2O2 production), Western blotting [cyclin B-like (CBL) proteins] and immunochemistry (BrdU incorporation, detection of ?-H2AX and H3S10 phosphorylation). Key Results Continuous treatment of onion seedlings with a low concentration of HU results in shorter root meristems, enhanced production of H2O2, ?-phosphorylation of H2AX histones and accumulation of CBL proteins. HU-induced replication stress gives rise to axially elongated cells with half interphase/half mitotic structures (IM-cells) having both decondensed and condensed domains of chromatin. Long-term HU treatment results in cell nuclei resuming S phase with gradients of BrdU labelling. This suggests a polarized distribution of factors needed to re-initiate stalled replication forks. Furthermore, prolonged HU treatment extends both the relative time span and the spatial scale of H3S10 phosphorylation known in plants. Conclusions The minimum cell length and a threshold level of accumulated CBL proteins are both determining factors by which the nucleus attains commitment to induce an asynchronous course of chromosome condensation. Replication stress-induced alterations in an orderly route of the cell cycle events probably reflect a considerable reprogramming of metabolic functions of chromatin combined with gradients of morphological changes spread along the nucleus. PMID:23087128

?abka, Aneta; Polit, Justyna Teresa; Maszewski, Janusz

2012-01-01

19

DNA replication origin interference increases the spacing between initiation events in human cells.  

PubMed

Mammalian DNA replication origins localize to sites that range from base pairs to tens of kilobases. A regular distribution of initiations in individual cell cycles suggests that only a limited number of these numerous potential start sites are converted into activated origins. Origin interference can silence redundant origins; however, it is currently unknown whether interference participates in spacing functional human initiation events. By using a novel hybridization strategy, genomic Morse code, on single combed DNA molecules from primary keratinocytes, we report the initiation sites present on 1.5 Mb of human chromosome 14q11.2. We confirm that initiation zones are widespread in human cells, map to intergenic regions, and contain sequence motifs found at other mammalian initiation zones. Origins used per cell cycle are less abundant than the potential sites of initiation, and their limited use increases the spacing between initiation events. Between-zone interference decreases in proportion to the distance from the active origin, whereas within-zone interference is 100% efficient. These results identify a hierarchical organization of origin activity in human cells. Functional origins govern the probability that nearby origins will fire in the context of multiple potential start sites of DNA replication, and this is mediated by origin interference. PMID:17005913

Lebofsky, Ronald; Heilig, Roland; Sonnleitner, Max; Weissenbach, Jean; Bensimon, Aaron

2006-12-01

20

Impaired Replication Capacity of Acute/Early Viruses in Persons Who Become HIV Controllers?  

PubMed Central

Human immunodeficiency virus type 1 (HIV-1) controllers maintain viremia at <2,000 RNA copies/ml without antiretroviral therapy. Viruses from controllers with chronic infection were shown to exhibit impaired replication capacities, in part associated with escape mutations from cytotoxic-T-lymphocyte (CTL) responses. In contrast, little is known about viruses during acute/early infection in individuals who subsequently become HIV controllers. Here, we examine the viral replication capacities, HLA types, and virus sequences from 18 HIV-1 controllers identified during primary infection. gag-protease chimeric viruses constructed using the earliest postinfection samples displayed significantly lower replication capacities than isolates from persons who failed to control viremia (P = 0.0003). Protective HLA class I alleles were not enriched in these early HIV controllers, but viral sequencing revealed a significantly higher prevalence of drug resistance mutations associated with impaired viral fitness in controllers than in noncontrollers (6/15 [40.0%] versus 10/80 [12.5%], P = 0.018). Moreover, of two HLA-B57-positive (B57+) controllers identified, both harbored, at the earliest time point tested, signature escape mutations within Gag that likewise impair viral replication capacity. Only five controllers did not express “protective” alleles or harbor viruses with drug resistance mutations; intriguingly, two of them displayed typical B57 signature mutations (T242N), suggesting the acquisition of attenuated viruses from B57+ donors. These data indicate that acute/early stage viruses from persons who become controllers have evidence of reduced replication capacity during the initial stages of infection which is likely associated with transmitted or acquired CTL escape mutations or transmitted drug resistance mutations. These data suggest that viral dynamics during acute infection have a major impact on HIV disease outcome. PMID:20504921

Miura, Toshiyuki; Brumme, Zabrina L.; Brockman, Mark A.; Rosato, Pamela; Sela, Jennifer; Brumme, Chanson J.; Pereyra, Florencia; Kaufmann, Daniel E.; Trocha, Alicja; Block, Brian L.; Daar, Eric S.; Connick, Elizabeth; Jessen, Heiko; Kelleher, Anthony D.; Rosenberg, Eric; Markowitz, Martin; Schafer, Kim; Vaida, Florin; Iwamoto, Aikichi; Little, Susan; Walker, Bruce D.

2010-01-01

21

Early inductive events in ectodermal appendage morphogenesis.  

PubMed

The embryonic surface ectoderm gives rise to the epidermis and ectodermal appendages including hair follicles, teeth, scales, feathers, and mammary, sweat, and salivary glands. Their early development proceeds largely the same through the induction, placode, and bud stages prior to diversification of epithelial morphogenesis which ultimately produces the wide array of mature organs. In this review we summarize the current knowledge on the molecular and cellular processes driving the shared stages of skin appendage development revealed by analysis of mouse mutants. We focus on three mammalian organs: hair follicle, tooth, and mammary gland. We reevaluate the information gained from classic epithelial-mesenchymal tissue recombination experiments in light of current molecular knowledge. We place special emphasis on the signaling pathways that mediate tissue interactions, and attempt to link the signaling outputs to changes in cellular behavior that ultimately shape the developing organ. PMID:24487243

Biggs, Leah C; Mikkola, Marja L

2014-01-01

22

Autophagy during early stages contributes to bovine viral diarrhea virus replication in MDBK cells.  

PubMed

Autophagy (or autophagocytosis) is an essential and precise control process by which cells degrade unnecessary or dysfunctional cellular components or organelles in the cytoplasm in response to nutrient depletion, exogenous pathogens, or other stimuli. This process results in the removal of damaged or surplus organelles and macromolecular complexes via a lysosome-dependent mechanism. Bovine viral diarrhea virus (BVDV) is a ssRNA virus of the Flaviviridae family (genus Pestivirus). BVDV infection results in major economic losses due to poor reproductive performance and poor calf performance in cattle herds. In our previous studies, we have shown that BVDV NADL infection significantly increases autophagy in MDBK cells. To further define the interactions between autophagy and BVDV infection, we investigated the effects of autophagy on the replication of BVDV NADL. The findings showed that autophagy was inhibited by treatment with 3-methyladenine (3-MA) or wortmannin and that the knockdown of LC3 and Beclin1 using lentivirus-mediated RNA interference (RNAi) suppressed BVDV NADL replication. In contrast, the findings showed the replication of BVDV NADL was significantly increased by treatment with the autophagy inducer rapamycin within 18?h post-infection (pi). However, the mRNA levels of BVDV NADL 5'UTRs showed a downward trend after 18?h pi, and this effect was reversed by chloroquine treatment. Therefore, we inferred that infection with BVDV NADL increases autophagy, which in turn favors BVDV NADL replication at early stages. PMID:24347372

Fu, Qiang; Shi, Huijun; Zhang, Hui; Ren, Yan; Guo, Fei; Qiao, Jun; Jia, Bin; Wang, Pengyan; Chen, Chuangfu

2014-10-01

23

DNA Replication  

NSDL National Science Digital Library

This animation, which shows DNA replication and the interactions of the various enzymes, can be used to illustrate to students the order of events in DNA replication, as well as emphasize which enzymes are involved in the process.

American Society For Microbiology

2002-01-01

24

Abnormal Early Cleavage Events Predict Early Embryo Demise: Sperm Oxidative Stress and Early Abnormal Cleavage  

PubMed Central

Human embryos resulting from abnormal early cleavage can result in aneuploidy and failure to develop normally to the blastocyst stage. The nature of paternal influence on early embryo development has not been directly demonstrated although many studies have suggested effects from spermatozoal chromatin packaging, DNA damage, centriolar and mitotic spindle integrity, and plasma membrane integrity. The goal of this study was to determine whether early developmental events were affected by oxidative damage to the fertilizing sperm. Survival analysis was used to compare patterns of blastocyst formation based on P2 duration. Kaplan-Meier survival curves demonstrate that relatively few embryos with short (<1?hr) P2 times reached blastocysts, and the two curves diverged beginning on day 4, with nearly all of the embryos with longer P2 times reaching blastocysts by day 6 (p < .01). We determined that duration of the 2nd to 3rd mitoses were sensitive periods in the presence of spermatozoal oxidative stress. Embryos that displayed either too long or too short cytokineses demonstrated an increased failure to reach blastocyst stage and therefore survive for further development. Although paternal-derived gene expression occurs later in development, this study suggests a specific role in early mitosis that is highly influenced by paternal factors. PMID:25307782

Burruel, Victoria; Klooster, Katie; Barker, Christopher M.; Pera, Renee Reijo; Meyers, Stuart

2014-01-01

25

Early Reproductive Events and Breast Cancer: Workshop Statement  

Cancer.gov

The National Cancer Institute convened the Early Reproductive Events and Breast Cancer Workshop on February 24-26, 2003. This scientific Workshop was held to present and review the information available on the risk of breast cancer associated with pregnancy. The Workshop brought together a cross-section of experts to discuss the scientific data available regarding the reproductive events in a woman's life that may impact her subsequent risk of breast cancer.

26

Viral terminal protein directs early organization of phage DNA replication at the bacterial nucleoid  

PubMed Central

The mechanism leading to protein-primed DNA replication has been studied extensively in vitro. However, little is known about the in vivo organization of the proteins involved in this fundamental process. Here we show that the terminal proteins (TPs) of phages ?29 and PRD1, infecting the distantly related bacteria Bacillus subtilis and Escherichia coli, respectively, associate with the host bacterial nucleoid independently of other viral-encoded proteins. Analyses of phage ?29 revealed that the TP N-terminal domain (residues 1–73) possesses sequence-independent DNA-binding capacity and is responsible for its nucleoid association. Importantly, we show that in the absence of the TP N-terminal domain the efficiency of ?29 DNA replication is severely affected. Moreover, the TP recruits the phage DNA polymerase to the bacterial nucleoid, and both proteins later are redistributed to enlarged helix-like structures in an MreB cytoskeleton-dependent way. These data disclose a key function for the TP in vivo: organizing the early viral DNA replication machinery at the cell nucleoid. PMID:20823229

Muñoz-Espín, Daniel; Holguera, Isabel; Ballesteros-Plaza, David; Carballido-López, Rut; Salas, Margarita

2010-01-01

27

Summary Report: Early Reproductive Events and Breast Cancer Workshop  

Cancer.gov

The Early Reproductive Events and Breast Cancer Workshop convened February 24-26, 2003, and the outcomes of the meeting were reviewed and discussed at the joint meeting of the NCI Board of Scientific Advisors (BSA) and Board of Scientific Counselors (BSC) held March 3, 2003.

28

Transcript Analysis of Early Nodulation Events in Medicago truncatula  

Microsoft Academic Search

Within the first 72 h of the interaction between rhizobia and their host plants, nodule primordium induction and infection occur. We predicted that transcription profiling of early stages of the symbiosis between Medicago truncatula roots and Sinorhizobium meliloti would identify regulated plant genes that likely condition key events in nodule initiation. Therefore, using a microarray with about 6,000 cDNAs, we

Dasharath Prasad Lohar; Natalya Sharopova; Gabriella Endre; Silvia Penuela; Deborah Samac; Christopher Town; Kevin A. T. Silverstein; Kathryn A. VandenBosch

2005-01-01

29

DNA replication initiates at different sites in early and late S phase within human ribosomal RNA genes.  

PubMed

Metazoan replication origins often contain multiple potential initiation sites, and the selection of which of the potential sites are used appears to be dependent upon multiple factors, including the state of differentiation, cell metabolism, and local transcriptional activity. Numerous studies have shown that a replication origin exists within the non-transcribed spacer region of the human ribosomal RNA gene. We here analyze nascent leading strand DNA from S phase human lymphoid cells, and find that while the majority of rDNA replicates in mid- and late S phase and preferentially initiates replication 6 kbp from the transcription start site, in very early S phase the preferred initiation site is much closer to the transcription start site and may involve rDNA promoter sequences. This early site is coincident with a minimum GC skew value, diagnostic for replication origins in bacteria and yeast. These results suggest that replication timing can influence initiation site selection. The timing and nucleolar localization of rDNA further suggest that this site likely participates in the small number of perinucleolar initiation foci observed in very early S phase cells that represent the beginning of cellular DNA replication. PMID:16082215

Coffman, Frederick D; He, Mai; Diaz, Mai-Ling; Cohen, Stanley

2005-09-01

30

Human cytomegalovirus replicates abortively in polymorphonuclear leukocytes after transfer from infected endothelial cells via transient microfusion events.  

PubMed

Using a recently developed model for in vitro generation of pp65-positive polymorphonuclear leukocytes (PMNLs), we demonstrated that PMNLs from immunocompetent subjects may harbor both infectious human cytomegalovirus (HCMV) and viral products (pp65, p72, DNA, and immediate-early [IE] and pp67 late mRNAs) as early as 60 min after coculture with human umbilical vein endothelial cells (HUVEC) or human embryonic lung fibroblasts (HELF) infected with a clinical HCMV isolate (VR6110) or other wild-type strains. The number of PMNLs positive for each viral parameter increased with coculture time. Using HELF infected with laboratory-adapted HCMV strains, only very small amounts of viral DNA and IE and late mRNAs were detected in PMNLs. A cellular mRNA, the vascular cell adhesion molecule-1 mRNA, which is abundantly present in both infected and uninfected HUVEC, was detected in much larger amounts in PMNLs cocultured with VR6110-infected cells than in controls. Coculture of PMNLs with VR6110-infected permissive cells in the presence or absence of RNA, protein, and viral DNA synthesis inhibitors showed that only IE genes were transcribed in PMNLs during coculture. Synthesis of IE transcripts in PMNLs was also supported by the finding that only the copy number of IE mRNA (and not the DNA or the pp67 mRNA) per infected PMNL increased markedly with time, and the pp67 to IE mRNA copy number ratio changed from greater than 10 in infected HUVEC to less than 1 in cocultured PMNLs. Fluorescent probe transfer experiments and electron microscopy studies indicated that transfer of infectious virus and viral products from infected cells to PMNLs is likely to be mediated by microfusion events induced by wild-type strains only. In addition, HCMV pp65 and p72 were both shown to localize in the nucleus of the same PMNLs by double immunostaining. Two different mechanisms may explain the virus presence in PMNLs: (i) one major mechanism consists of transitory microfusion events (induced by wild-type strains only) of HUVEC or HELF and PMNLs with transfer of viable virus and biologically active viral material to PMNLs; and (ii) one minor mechanism, i.e., endocytosis, occurs with both wild-type and laboratory strains and leads to the acquisition of very small amounts of viral nucleic acids. In conclusion, HCMV replicates abortively in PMNLs, and wild-type strains and their products (as well as cellular metabolites and fluorescent dyes) are transferred to PMNLs, thus providing evidence for a potential mechanism of HCMV dissemination in vivo. PMID:10823870

Gerna, G; Percivalle, E; Baldanti, F; Sozzani, S; Lanzarini, P; Genini, E; Lilleri, D; Revello, M G

2000-06-01

31

A novel class of early replicating fragile sites that contribute to genome instability in B cell lymphomas  

PubMed Central

Summary DNA double strand breaks (DSBs) in B lymphocytes arise stochastically during replication or as a result of targeted DNA damage by activation induced cytidine deaminase (AID). Here we identify recurrent, early replicating and AID independent DNA lesions, termed early replication fragile sites (ERFS), by genome-wide localization of DNA repair proteins in B cells subjected to replication stress. ERFS colocalize with highly expressed gene clusters and are enriched for repetitive elements and CpG dinucleotides. Although distinct from late-replicating common fragile sites (CFS), the stability of ERFSs and CFSs is similarly dependent on the replication-stress response kinase ATR. ERFSs break spontaneously during replication, but their fragility is increased by hydroxyurea, ATR inhibition or deregulated c-Myc expression. Moreover, greater than 50% of recurrent amplifications/deletions in human diffuse large B cell lymphoma map to ERFSs. In summary, we have identified a source of spontaneous DNA lesions that drives instability at preferred genomic sites. PMID:23352430

Barlow, Jacqueline; Faryabi, Robert B.; Callen, Elsa; Wong, Nancy; Malhowski, Amy; Chen, Hua Tang; Gutierez-Cruz, Gustavo; Sun, Hong-Wei; McKinnon, Peter; Wright, George; Casellas, Rafael; Robbiani, Davide F.; Staudt, Louis; Fernandez-Capetillo, Oscar; Nussenzweig, André

2013-01-01

32

Changes in transcription and metabolism during the early stage of replicative cellular senescence in budding yeast.  

PubMed

Age-related damage accumulates and a variety of biological activities and functions deteriorate in senescent cells. However, little is known about when cellular aging behaviors begin and what cellular aging processes change. Previous research demonstrated age-related mRNA changes in budding yeast by the 18th to 20th generation, which is the average replicative lifespan of yeast (i.e. about half of the population is dead by this time point). Here, we performed transcriptional and metabolic profiling for yeast at early stages of senescence (4th, 7th, and 11th generation), that is, for populations in which most cells are still alive. Transcriptional profiles showed up- and down-regulation for ?20% of the genes profiled after the first four generations, few further changes by the 7th generation, and an additional 12% of the genes were up- and down-regulated after 11 generations. Pathway analysis revealed that these 11th generation cells had accumulated transcripts coding for enzymes involved in sugar metabolism, the TCA cycle, and amino acid degradation and showed decreased levels of mRNAs coding for enzymes involved in amino acid biosynthetic pathways. These observations were consistent with the metabolomic profiles of aging cells: an accumulation of pyruvic acid and TCA cycle intermediates and depletion of most amino acids, especially branched-chain amino acids. Stationary phase-induced genes were highly expressed after 11 generations even though the growth medium contained adequate levels of nutrients, indicating deterioration of the nutrient sensing and/or signaling pathways by the 11th generation. These changes are presumably early indications of replicative senescence. PMID:25294875

Kamei, Yuka; Tamada, Yoshihiro; Nakayama, Yasumune; Fukusaki, Eiichiro; Mukai, Yukio

2014-11-14

33

Impact Constraints on Major Events in Early Mars History  

NASA Technical Reports Server (NTRS)

MOLA data have revealed a large population of "Quasi-Circular Depressions" (QCDs) with little or no visible expression in image data. These likely buried impact basins have important implications for the age of the lowland crust, how that compares with original highland crust, and when and how the crustal dichotomy may have formed. The buried lowlands are of Early Noachian age, likely slightly younger than the buried highlands but older than the exposed (visible) highland surface. A depopulation of large visible basins at diameters 800 to 1300 km suggests some global scale event early in martian history, maybe related to the formation of the lowlands and/or the development of Tharsis. A suggested early disappearance of the global magnetic field can be placed within a temporal sequence of formation of the very largest impact basins. The global field appears to have disappeared at about the time the lowlands formed. It seems likely the topographic crustal dichotomy was produced very early in martian history by processes which operated very quickly. Thus there appears to have been a northern lowland throughout nearly all of martian history, predating the last of the really large impacts (Hellas, Argyre and Isidis) and their likely very significant environmental consequences.

Frey, H. V.

2004-01-01

34

Replicative mechanisms of CNV formation preferentially occur as intrachromosomal events: evidence from Potocki-Lupski duplication syndrome.  

PubMed

Copy number variations (CNVs) in the human genome contribute significantly to disease. De novo CNV mutations arise via genomic rearrangements, which can occur in 'trans', i.e. via interchromosomal events, or in 'cis', i.e. via intrachromosomal events. However, what molecular mechanisms occur between chromosomes versus between or within chromatids has not been systematically investigated. We hypothesized that distinct CNV mutational mechanisms, based on their intrinsic properties, may occur in a biased intrachromosomal versus interchromosomal manner. Here, we studied 62 genomic duplications observed in association with sporadic Potocki-Lupski syndrome (PTLS), in which multiple mutational mechanisms appear to be operative. Intriguingly, more interchromosomal than intrachromosomal events were identified in recurrent PTLS duplications mediated by non-allelic homologous recombination, whereas the reciprocal distribution was found for replicative mechanisms and non-homologous end-joining, likely reflecting the differences in spacial proximity of homologous chromosomes during different mutational processes. PMID:23161748

Sun, Zhe; Liu, Pengfei; Jia, Xueyuan; Withers, Marjorie A; Jin, Li; Lupski, James R; Zhang, Feng

2013-02-15

35

Role of early signalling events in plant-insect interactions.  

PubMed

The response of plants to the stress caused by herbivores involves several different defence mechanisms. These responses begin at the plant cell plasma membrane, where insect herbivores interact physically by causing mechanical damage and chemically by introducing elicitors or by triggering plant-derived signalling molecules. The earliest plant responses to herbivore contact are represented by ion flux unbalances generated in the plant cell plasma membrane at the damaged site. Differences in the charge distribution generate plasma transmembrane potential (V m) variation, the first event, which eventually leads to the initiation of signal transduction pathways and gene expression. Calcium signalling and the generation of reactive oxygen and nitrogen species are early events closely related to V m variations. This review provides an update on recent developments and advances in plant early signalling in response to herbivory, with particular emphasis on the electrophysiological variations of the plasma membrane potential, calcium signalling, cation channel activity, production of reactive oxygen and nitrogen species, and formation of a systemically moving signal from wounded tissues. The roles of calcium-dependent protein kinases and calcineurin signalling are also discussed. PMID:25429000

Zebelo, Simon A; Maffei, Massimo E

2015-02-01

36

APOBEC3G restricts early HIV-1 replication in the cytoplasm of target cells  

SciTech Connect

Cellular APOBEC3G (A3G) protein is packaged into human immunodeficiency virus type 1 (HIV-1) virions in producer cells yet restricts viral replication in target cells. To characterize this restriction in target cells, the effect of A3G on generating various HIV-1 cDNA products was measured by quantitative real-time PCR. A3G decreased cDNA products from Vif-deficient HIV-1, with minor effects on early reverse transcripts and larger declines in late reverse transcripts. However, the greatest decline was typically observed in nuclear 2-LTR circles. Moreover, the magnitude of these declines varied with A3G dose. Adding integration inhibitor did not stop the A3G-mediated loss in 2-LTR circles. Moreover, obstructing HIV-1 nuclear entry using vesicular stomatitis virus matrix protein did not stop the A3G-mediated decline in late reverse transcripts. Collectively, these data suggest that A3G has important restriction activity in the cytoplasm and progressively diminishes viral cytoplasmic and nuclear cDNA forms with increasing magnitude during restriction.

Anderson, Jenny L. [Department of Cell and Molecular Biology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611 (United States); Hope, Thomas J. [Department of Cell and Molecular Biology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611 (United States)], E-mail: thope@northwestern.edu

2008-05-25

37

Early metabolic imprinting events increase marbling scores in fed cattle.  

PubMed

Early weaning of calves to a high concentrate diet results in greater fat deposition and suggests early postnatal metabolic imprinting events may be exploited as a management tool to improve cattle value. Our objective was to implement a short, high energy dietary intervention before a typical grazing period to manipulate intramuscular fat deposition in finishing cattle. Fall-born, Angus-sired steer calves (n = 24) were stratified by sire and randomly assigned to normal weaned (NW) or metabolic-imprinted (MIP) treatments. At 105 ± 6d (135kg), MIP calves were transitioned to a diet containing 20% CP and 1.26 Mcal/kg NEg. Metabolic-imprinted calves were fed ad libitum as a group. Normal weaned calves remained on their dam until 253 ± 6 d of age. At this time, treatment groups were combined and grazed for 156 d on a mixed summer pasture. Following the grazing phase, steers were adapted to a corn silage-based feedlot diet and performance was monitored on 28-d intervals. Calves were staged for harvest based on backfat endpoint (target 1.0 to 1.2 cm). Metabolic-imprinted calves were heavier (P < 0.05) than NW calves (341 vs. 265 ± 4.2 kg) at normal weaning age. During the grazing phase, NW steers gained more weight than (P < 0.05) MIP steers (0.69 vs. 0.35 ± 0.03 kg/d). Feedlot performance and USDA yield grade were similar (P > 0.20) between treatments. However, MIP steers produced heavier (P < 0.05) carcasses (564 vs. 524 ± 5.6 kg) with higher (P < 0.001) marbling scores (645 vs. 517 ± 23). Therefore, calves consuming a high concentrate diet for 148 d after early weaning produced higher quality carcasses. This suggests early weaning and feeding a high concentrate before grazing is a viable strategy to increase marbling deposition compared with a traditional production system. PMID:24243903

Scheffler, J M; McCann, M A; Greiner, S P; Jiang, H; Hanigan, M D; Bridges, G A; Lake, S L; Gerrard, D E

2014-01-01

38

Kinetics of the early events of GPCR signalling  

PubMed Central

Neurotensin receptor type 1 (NTS1) is a G protein-coupled receptor (GPCR) that affects cellular responses by initiating a cascade of interactions through G proteins. The kinetic details for these interactions are not well-known. Here, NTS1-nanodisc-G?s and G?i1 interactions were studied. The binding affinities of G?i1 and G?s to NTS1 were directly measured by surface plasmon resonance (SPR) and determined to be 15 ± 6 nM and 31 ± 18 nM, respectively. This SPR configuration permits the kinetics of early events in signalling pathways to be explored and can be used to initiate descriptions of the GPCR interactome. PMID:25447525

Adamson, Roslin J.; Watts, Anthony

2014-01-01

39

Association between Early Adverse Life Events and Irritable Bowel Syndrome  

PubMed Central

Background & Aims Although childhood and adult abuse are more prevalent among patients with irritable bowel syndrome (IBS) than healthy individuals (controls), other types of early adverse life events (EALs) have not been well characterized. We investigated whether different types of EALs, before an age of 18 years, are more prevalent among patients with IBS, and the effects of gender and non-gastrointestinal symptoms on the relationship between EALs and IBS. Methods EALs were evaluated in 294 IBS patients (79% women) and 435 controls (77% women) using the early trauma inventory self report form, which delineates sub-categories of general trauma and physical, emotional, and sexual abuse. Validated questionnaires assessed gastrointestinal, psychological, and somatic symptoms. Results Compared to controls, IBS patients reported a higher prevalence of general trauma (78.5% vs 62.3%), physical punishment (60.6% vs 49.2%), emotional abuse (54.9% vs 27.0%), and sexual events (31.2% vs 17.9%) (all P’s <.001). These significant differences were mainly observed in women. Of the EAL domains, emotional abuse was the strongest predictor of IBS (P<.001). Eight of the 27 EAL items were significant (P<.001) and increased the odds of having IBS by 108%–305%. Although EAL and psychological variables were related, EALs had an independent association with IBS (P=.04). Conclusion Various types of EALs are associated with development of IBS—particularly among women. Psychological distress and somatic symptoms might contribute to this relationship. When appropriate, EALs and non-gastrointestinal symptoms should be assessed in IBS patients. PMID:22178460

Bradford, Kara; Shih, Wendy; Videlock, Elizabeth; Presson, Angela P.; Naliboff, Bruce D.; Mayer, Emeran A.; Chang, Lin

2012-01-01

40

Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae.  

PubMed

Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

Camberlein, Emilie; Cohen, Jonathan M; José, Ricardo; Hyams, Catherine J; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad; Brown, Jeremy S

2015-03-01

41

Early-replicating DNA from mosquito cells is associated with a distinct EcoRI fragment  

Microsoft Academic Search

In an effort to define an origin of bi-directional DNA replication (OBR) in mosquito genomic DNA, we applied methods that take advantage of characteristic features of single-stranded DNA to methotrexate-resistant Aedes albopictus cells. The Mtx-5011-256 cells contained approximately 1000 copies of a 200kb amplicon containing the dihydrofolate reductase locus, which likely contained one or more replication origins. When Mtx-5011-256 cells

Zhong Hui Wang; Ann M Fallon

1999-01-01

42

Sigma-1 Receptor Regulates Early Steps of Viral RNA Replication at the Onset of Hepatitis C Virus Infection  

PubMed Central

Hepatitis C virus (HCV) genome replication is thought to occur in a membranous cellular compartment derived from the endoplasmic reticulum (ER). The molecular mechanisms by which these membrane-associated replication complexes are formed during HCV infection are only starting to be unraveled, and both viral and cellular factors contribute to their formation. In this study, we describe the discovery of nonopioid sigma-1 receptor (S1R) as a cellular factor that mediates the early steps of viral RNA replication. S1R is a cholesterol-binding protein that resides in lipid-rich areas of the ER and in mitochondrion-associated ER membranes (MAMs). Several functions have been ascribed to this ER-resident chaperone, many of which are related to Ca2+ signaling at the MAMs and lipid storage and trafficking. Downregulation of S1R expression by RNA interference (RNAi) in Huh-7 cells leads to a proportional decrease in susceptibility to HCV infection, as shown by reduced HCV RNA accumulation and intra- and extracellular infectivity in single-cycle infection experiments. Similar RNAi studies in persistently infected cells indicate that S1R expression is not rate limiting for persistent HCV RNA replication, as marked reduction in S1R in these cells does not lead to any decrease in HCV RNA or viral protein expression. However, subgenomic replicon transfection experiments indicate that S1R expression is rate limiting for HCV RNA replication without impairing primary translation. Overall, our data indicate that the initial steps of HCV infection are regulated by S1R, a key component of MAMs, suggesting that these structures could serve as platforms for initial RNA replication during HCV infection. PMID:23536676

Friesland, Martina; Mingorance, Lidia; Chung, Josan; Chisari, Francis V.

2013-01-01

43

Examining the Structure of the Schedule of Sexist Events: Replication and Extension  

ERIC Educational Resources Information Center

The current study reexamined the factor structure of the Lifetime and Recent scales of the Schedule of Sexist Events (SSE; Klonoff & Landrine, 1995) and conducted the first factor analysis of the SSE-Appraisal scale ( Landrine & Klonoff, 1997). Factor analyses conducted with data from 245 women yielded, for SSE-Lifetime and SSE-Appraisal scales,…

Matteson, Alicia V.; Moradi, Bonnie

2005-01-01

44

Characterization of a Replication-Incompetent Pseudorabies Virus Mutant Lacking the Sole Immediate Early Gene IE180  

PubMed Central

ABSTRACT The alphaherpesvirus pseudorabies virus (PRV) encodes a single immediate early gene called IE180. The IE180 protein is a potent transcriptional activator of viral genes involved in DNA replication and RNA transcription. A PRV mutant with both copies of IE180 deleted was constructed 20 years ago (S. Yamada and M. Shimizu, Virology 199:366–375, 1994, doi:10.1006/viro.1994.1134), but propagation of the mutant depended on complementing cell lines that expressed the toxic IE180 protein constitutively. Recently, Oyibo et al. constructed a novel set of PRV IE180 mutants and a stable cell line with inducible IE180 expression (H. Oyibo, P. Znamenskiy, H. V. Oviedo, L. W. Enquist, A. Zador, Front. Neuroanat. 8:86, 2014, doi:10.3389/fnana.2014.00086), which we characterized further here. These mutants failed to replicate new viral genomes, synthesize immediate early, early, or late viral proteins, and assemble infectious virions. The PRV IE180-null mutant did not form plaques in epithelial cell monolayers and could not spread from primary infected neurons to second-order neurons in culture. PRV IE180-null mutants lacked the property of superinfection exclusion. When PRV IE180-null mutants infected cells first, subsequent superinfecting viruses were not blocked in cell entry and formed replication compartments in epithelial cells, fibroblasts, and neurons. Cells infected with PRV IE180-null mutants survived as long as uninfected cells in culture while expressing a fluorescent reporter gene. Transcomplementation with IE180 in epithelial cells restored all mutant phenotypes to wild type. The conditional expression of PRV IE180 protein enables the propagation of replication-incompetent PRV IE180-null mutants and will facilitate construction of long-term single-cell-infecting PRV mutants for precise neural circuit tracing and high-capacity gene delivery vectors. PMID:25389174

Wu, Brendan W.

2014-01-01

45

Endotoxin Stimulates Liver Macrophages To Release Mediators That Inhibit an Early Step in Hepadnavirus Replication  

Microsoft Academic Search

Hepadnaviruses are known to be sensitive to various extracellular mediators. Therefore, bacterial endotoxin, which induces the secretion of proinflammatory mediators in the liver, was studied for its effect on hepadna- virus infection in vitro using the duck hepatitis B virus (DHBV) model. In initial experiments, endotoxin was shown to inhibit DHBV replication in primary duck hepatocyte cultures prepared by standard

UTA KLOCKER; URSULA SCHULTZ; HEINZ SCHALLER; ULRIKE PROTZER

2000-01-01

46

Rhythmic Engagement with Music in Early Childhood: A Replication and Extension  

ERIC Educational Resources Information Center

The purpose of this study was to replicate and extend previous findings on spontaneous movement and rhythmic engagement with music in infancy. Using the identical stimuli and procedures from the original study, I investigated spontaneous rhythmic movements in response to music, infant-directed speech, and contrasting rhythmic patterns in 30…

Ilari, Beatriz

2015-01-01

47

Model of early self-replication based on covalent complementarity for a copolymer of glycerate-3-phosphate and glycerol-3-phosphate  

NASA Technical Reports Server (NTRS)

Glyceraldehyde-3-phosphate acts as the substrate in a model of early self-replication of a phosphodiester copolymer of glycerate-3-phosphate and glycerol-3-phosphate. This model of self-replication is based on covalent complementarity in which information transfer is mediated by a single covalent bond, in contrast to multiple weak interactions that establish complementarity in nucleic acid replication. This replication model is connected to contemporary biochemistry through its use of glyceraldehyde-3-phosphate, a central metabolite of glycolysis and photosynthesis.

Weber, Arthur L.

1989-01-01

48

Early Events of B Cell Activation by Antigen  

NSDL National Science Digital Library

The activation of B cells confers long-lasting protection from a plethora of infectious diseases through the generation of plasma cells that produce high-affinity antibodies and memory cells. Engagement of the B cell receptor (BCR) with cognate antigen initiates intracellular signaling and subsequent internalization of antigen. Membrane-bound antigens are now considered the predominant forms that initiate B cell activation in vivo. We have shown that upon recognition of antigen on the surface of a presenting cell, the B cell undergoes a dramatic change in morphology characterized by rapid spreading followed by more prolonged contraction along the presenting surface. This two-phase response increases the amount of antigen that the B cell accumulates, internalizes, and subsequently presents to T cells. Thus, the spreading and contraction response shapes the outcome of B cell activation. We used a combination of planar lipid bilayers and total internal reflection fluorescence microscopy to investigate the early events that occur after engagement of the BCR and before B cell spreading. We observed the rapid formation of BCR-antigen microclusters, which we redefine as “microsignalosomes” because they mediate the coordinated recruitment of intracellular effectors, such as the kinases Lyn and Syk, the adaptor Vav, and phospholipase C–?2 (PLC-?2). We identified an essential role for the co-receptor CD19 in mediating spreading, and thus B cell activation, in response to membrane-bound antigen. Preliminary evidence suggests that the cellular morphology changes described in vitro are likely to occur upon recognition of antigen presented on the surface of macrophages in lymph nodes in vivo.

David Depoil (Cancer Research UK London Research Institute; Lymphocyte Interaction Laboratory REV)

2009-03-24

49

Defining the roles of the baculovirus regulatory proteins IE0 and IE1 in genome replication and early gene transactivation.  

PubMed

IE0 and IE1 of the baculovirus Autographa californica multiple nucleopolyhedrovirus are essential transregulatory proteins required for both viral DNA replication and transcriptional transactivation. IE0 is identical to IE1 except for 54 amino acids at the N-terminus but the functional differences between these two proteins remain unclear. The purpose of this study was to determine the separate roles of these critical proteins in the virus life cycle. Unlike prior studies, IE0 and IE1 were analyzed using viruses that expressed ie0 and ie1 from an identical promoter so that the timing and levels of expression were comparable. IE0 and IE1 were found to equally support viral DNA replication and budded virus (BV) production. However, specific viral promoters were selectively transactivated by IE0 relative to IE1 but only when expressed at low levels. These results indicate that IE0 preferentially transactivates specific viral genes at very early times post-infection enabling accelerated replication and BV production. PMID:25173193

Sokal, Nadia; Nie, Yingchao; Willis, Leslie G; Yamagishi, Junya; Blissard, Gary W; Rheault, Mark R; Theilmann, David A

2014-11-01

50

Event Conceptualization by Early Dutch-German Bilinguals: Insights from Linguistic and Eye-Tracking Data  

ERIC Educational Resources Information Center

This experimental study investigates event construal by early Dutch-German bilinguals, as reflected in their oral depiction of everyday events shown in video clips. The starting point is the finding that the expression of an aspectual perspective (progressive aspect), and its consequences for event construal, is dependent on the extent to which…

Flecken, Monique

2011-01-01

51

Early Jurassic mass extinction: A global long-term event Crispin T. S. Little  

E-print Network

Early Jurassic mass extinction: A global long-term event Crispin T. S. Little Department of Geology-Pliensbachian extinction event (187 Ma) has been in- terpreted either as one of 10 global periodically recurring mass extinctions of the past 250 m.y. or as a minor localized European event. Elevated levels of family extinction

Benton, Michael

52

Prolidase Is Required for Early Trafficking Events during Influenza A Virus Entry  

PubMed Central

ABSTRACT Influenza A virus (IAV) entry is a multistep process that requires the interaction of the virus with numerous host factors. In this study, we demonstrate that prolidase (PEPD) is a cellular factor required by IAV for successful entry into target cells. PEPD was selected as a candidate during an entry screen performed on nonvalidated primary hits from previously published genome-wide small interfering RNA (siRNA) screens. siRNA-mediated depletion of PEPD resulted in the decreased growth of IAV during mono- and multicycle growth. This growth defect was independent of cell type or virus strain. Furthermore, IAV restriction was apparent as early as 3 h postinfection, and experiments in the absence of protein biosynthesis revealed that the nuclear import of viral ribonucleoprotein complexes (vRNPs) was already blocked in the absence of PEPD. These results led us to investigate which step during entry was affected. Receptor expression, IAV attachment, or IAV internalization was not dependent on the presence of PEPD. However, when looking at the distribution of incoming IAV particles in PEPD-knockdown cells, we found a localization pattern that differed from that in control cells: IAV mostly localized to the cell periphery, and consequently, viral particles displayed reduced colocalization with early and late endosome markers and fusion between viral and endosomal membranes was strongly reduced. Finally, experiments using a competitive inhibitor of PEPD catalytic activity suggested that the enzymatic function of the dipeptidase is required for its proviral effect on IAV entry. In sum, this study establishes PEPD as a novel entry factor required for early endosomal trafficking of IAV. IMPORTANCE Influenza A virus (IAV) continues to be a constant threat to public health. As IAV relies on its host cell for replication, the identification of host factors required by the virus is of importance. First, such studies often reveal novel functions of cellular factors and can extend our knowledge of cellular processes. Second, we can further our understanding of processes that are required for the entry of IAV into target cells. Third, the identification of host factors that contribute to IAV entry will increase the number of potential targets for the development of novel antiviral drugs that are of urgent need. Our study identifies prolidase (PEPD) to be a novel entry factor required by IAV for correct routing within the endosomal compartment following virus internalization. Thereby, we link PEPD, which has been shown to play a role during collagen recycling and growth factor signaling, to early events of viral infection. PMID:25031340

Pohl, Marie O.; Edinger, Thomas O.

2014-01-01

53

Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication.  

PubMed

odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner. PMID:23825525

Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

2013-01-01

54

Replicating vaccines  

Technology Transfer Automated Retrieval System (TEKTRAN)

Early work on fish immunology and disease resistance demonstrated fish (like animals and humans) that survived infection were typically resistant to re-infection with the same pathogen. The concepts of resistance upon reinfection lead to the research and development of replicating (live) vaccines in...

55

The replication origin decision point is a mitogen-independent, 2-aminopurine-sensitive, G1-phase event that precedes restriction point control.  

PubMed Central

At a distinct point during G1 phase (the origin decision point [ODP]), Chinese hamster ovary (CHO) cell nuclei experience a transition (origin choice) that is required for specific recognition of the dihydrofolate reductase (DHFR) origin locus by Xenopus egg extracts. We have investigated the relationship between the ODP and progression of CHO cells through G1 phase. Selection of the DHFR origin at the ODP was rapidly inhibited by treatment of early G1-phase cells with the protein kinase inhibitor 2-aminopurine (2-AP). Inhibition of the ODP required administration of 2-AP at least 3 h prior to phosphorylation of the retinoblastoma tumor suppressor protein (Rb) and the restriction point (R point). Cells deprived of either serum or isoleucine from metaphase throughout early G1 phase acquired the capacity to replicate in Xenopus egg extract (replication licensing) and subsequently passed through the ODP on the same schedule as cells cultured in complete growth medium. After growth arrest at the R point with hypophosphorylated Rb protein, serum- or isoleucine-deprived cells experienced a gradual loss of replication licensing. However, recognition of the DHFR origin by Xenopus egg cytosol remained stable in growth-arrested cells until the point at which all nuclei had lost the capacity to initiate replication. These results provide evidence that the ODP requires a mitogen-independent protein kinase that is activated after replication licensing and prior to R-point control. PMID:9234688

Wu, J R; Gilbert, D M

1997-01-01

56

Eclipse period during replication of plasmid R1: contributions from structural events and from the copy-number control system.  

PubMed

The eclipse period (the time period during which a newly replicated plasmid copy is not available for a new replication) of plasmid R1 in Escherichia coli was determined with the classic Meselson-Stahl density-shift experiment. A mini-plasmid with the wild-type R1 replicon and a mutant with a thermo-inducible runaway-replication phenotype were used in this work. The eclipses of the chromosome and of the wild-type plasmid were 0.6 and 0.2 generation times, respectively, at temperatures ranging from 30 degrees C to 42 degrees C. The mutant plasmid had a similar eclipse at temperatures up to 38 degrees C. At 42 degrees C, the plasmid copy number increased rapidly because of the absence of replication control and replication reached a rate of 350-400 plasmid replications per cell and cell generation. During uncontrolled replication, the eclipse was about 3 min compared with 10 min at controlled replication (the wild-type plasmid at 42 degrees C). Hence, the copy-number control system contributed significantly to the eclipse. The eclipse in the absence of copy-number control (3 min) presumably is caused by structural requirements: the covalently closed circular plasmid DNA has to regain the right degree of superhelicity needed for initiation of replication and it takes time to assemble the initiation factors. PMID:14507381

Olsson, Jan A; Berg, Otto G; Dasgupta, Santanu; Nordström, Kurt

2003-10-01

57

Emotional perception: correspondence of early and late event-related potentials with cortical and subcortical functional MRI.  

PubMed

This research examines the relationship between brain activity recorded with functional magnetic resonance imaging (fMRI) and event related potentials (ERP) as these responses varied over a series of emotionally evocative and neutral pictures. We investigate the relationship of early occipitotemporal and later centroparietal emotion-modulated ERPs in one sample to fMRI estimates of neural activity in another sample in a replicated experiment. Using this approach, we aimed to link effects found in time-resolved electrocortical measures to specific neural structures across individual emotional and nonemotional picture stimuli. The centroparietal late positive potential (LPP) showed covariation with emotion-modulated regions of hemodynamic activation across multiple dorsal and ventral visual cortical structures, while the early occipitotemporal potential was not reliably associated. Subcortical and corticolimbic structures involved in the perception of motivationally relevant stimuli also related to modulation of the LPP, and were modestly associated to the amplitude of the early occipitotemporal potential. These data suggest that early occipitotemporal potentials may reflect multiple sources of modulation including motivational relevance, and supports the perspective that the slow-wave LPP represents aggregate cortical and subcortical structures involved in emotional discrimination. PMID:22560889

Sabatinelli, Dean; Keil, Andreas; Frank, David W; Lang, Peter J

2013-03-01

58

Early Control of H5N1 Influenza Virus Replication by the Type I Interferon Response in Mice?  

PubMed Central

Widespread distribution of highly pathogenic avian H5N1 influenza viruses in domesticated and wild birds continues to pose a threat to public health, as interspecies transmission of virus has resulted in increasing numbers of human disease cases. Although the pathogenic mechanism(s) of H5N1 influenza viruses has not been fully elucidated, it has been suggested that the ability to evade host innate responses, such as the type I interferon response, may contribute to the virulence of these viruses in mammals. We investigated the role that type I interferons (alpha/beta interferon [IFN-?/?]) might play in H5N1 pathogenicity in vivo, by comparing the kinetics and outcomes of H5N1 virus infection in IFN-?/? receptor (IFN-?/?R)-deficient and SvEv129 wild-type mice using two avian influenza A viruses isolated from humans, A/Hong Kong/483/97 (HK/483) and A/Hong Kong/486/97 (HK/486), which exhibit high and low lethality in mice, respectively. IFN-?/?R-deficient mice experienced significantly more weight loss and more rapid time to death than did wild-type mice. HK/486 virus caused a systemic infection similar to that with HK/483 virus in IFN-?/?R-deficient mice, suggesting a role for IFN-?/? in controlling the systemic spread of this H5N1 virus. HK/483 virus replicated more efficiently than HK/486 virus both in vivo and in vitro. However, replication of both viruses was significantly reduced following pretreatment with IFN-?/?. These results suggest a role for the IFN-?/? response in the control of H5N1 virus replication both in vivo and in vitro, and as such it may provide some degree of protection to the host in the early stages of infection. PMID:19297490

Szretter, Kristy J.; Gangappa, Shivaprakash; Belser, Jessica A.; Zeng, Hui; Chen, Hualan; Matsuoka, Yumiko; Sambhara, Suryaprakash; Swayne, David E.; Tumpey, Terrence M.; Katz, Jacqueline M.

2009-01-01

59

Inhibition of HIV by an anti-HIV protease synthetic peptide blocks an early step of viral replication.  

PubMed

The processing of the human immunodeficiency virus (HIV) gag and gag-pol precursor proteins by the virus-encoded protease is an essential step in maturation of infectious virus particles. Like most retroviral proteases, the HIV protease belongs to the aspartyl-protease family and can be inhibited by specific inhibitors. Twenty-four synthetic peptides known to be inhibitors of human renin were tested for inhibition of HIV replication in tissue cultures. One of them, a synthetic peptide analogue, SR41476, which has been shown to be a specific inhibitor of purified recombinant HIV1 protease in vitro, totally blocked infection with different isolates including the HIV1 LAV prototype, the highly cytopathic Zairian isolate HIV1 NDK, and HIV2 ROD, both in primary blood lymphocytes (PBL) and in the lymphoid cell lines MT4 and CEM, for at least 3 weeks. It also significantly reduced virus replication in chronically infected CEM cells, without any effect on cell proliferation. Radioimmunoprecipitation assay revealed that the inhibitor blocked processing of polyprotein precursors p55 gag and p40 gag into a mature form of gag proteins, p25 and p18. Synthetic peptide analogue SR 41476, when added before infection, efficiently inhibited formation of HIV DNA provirus and successfully suppressed synthesis of HIV-specific proteins. These results imply that the HIV protease inhibitor not only inhibited virus maturation in the late phase of the HIV replication cycle, but also interfered in the early phase, before the provirus was formed. This mechanism of antiviral activity provides new possibilities and strategies for AIDS chemotherapy. PMID:1480823

Venaud, S; Yahi, N; Fehrentz, J L; Guettari, N; Nisato, D; Hirsch, I; Chermann, J C

1992-01-01

60

Early Events in Protein Folding Explored by Rapid Mixing Methods  

E-print Network

information on the rate-limiting barrier. The effects of temperature and denaturant concentration give insight that these elementary structural events affect the overall rate of folding if they represent energetically unfavorable for Understanding Protein Folding As with any complex reaction, time-resolved data are essential for elucidating

Roder, Heinrich

61

EARLY CAREER: THE HAZARDS OF EXTREME CLIMATIC EVENTS: PREDICTING IMPACTS  

EPA Science Inventory

One of the greatest threats to water quality is water-borne pathogens, which are more common now than they have been historically. A factor implicated in the emergence of water-borne diseases is climate change-driven increases in extreme climatic events. Although climatic e...

62

The structure of the extended psychosis phenotype in early adolescence--a cross-sample replication.  

PubMed

The extended psychosis phenotype, or the expression of nonclinical positive psychotic experiences, is already prevalent in adolescence and has a dose-response risk relationship with later psychotic disorder. In 2 large adolescent general population samples (n = 5422 and n = 2230), prevalence and structure of the extended psychosis phenotype was investigated. Positive psychotic experiences, broadly defined, were reported by the majority of adolescents. Exploratory analysis with Structural Equation Modelling (Exploratory Factor Analysis followed by Confirmatory Factor Analysis [CFA]) in sample 1 suggested that psychotic experiences were best represented by 5 underlying dimensions; CFA in sample 2 provided a replication of this model. Dimensions were labeled Hallucinations, Delusions, Paranoia, Grandiosity, and Paranormal beliefs. Prevalences differed strongly, Hallucinations having the lowest and Paranoia having the highest rates. Girls reported more experiences on all dimensions, except Grandiosity, and from age 12 to 16 years rates increased. Hallucinations, Delusions, and Paranoia, but not Grandiosity and Paranormal beliefs, were associated with distress and general measures of psychopathology. Thus, only some of the dimensions of the extended psychosis phenotype in young people may represent a continuum with more severe psychopathology and predict later psychiatric disorder. PMID:20044595

Wigman, Johanna T W; Vollebergh, Wilma A M; Raaijmakers, Quinten A W; Iedema, Jurjen; van Dorsselaer, Saskia; Ormel, Johan; Verhulst, Frank C; van Os, Jim

2011-07-01

63

Synchrony between Early Jurassic extinction, oceanic anoxic event, and the Karoo-Ferrar flood basalt volcanism  

Microsoft Academic Search

A well-known second-order mass extinction took place during the Pliensbachian and Toarcian Stages of the Early Jurassic. First recognized as a minor Pliensbachian peak in the global extinction rate, it has alternatively been interpreted as a regional response to the early Toarcian oceanic anoxic event. Detailed studies established it as a global long-term event spanning five successive ammonoid zones. Here

József Pálfy; Paul L. Smith

2000-01-01

64

Status and early events from ICARUS T600  

NASA Astrophysics Data System (ADS)

The ICARUS T600 detector, a ˜ 600 t liquid Argon (LAr) TPC with unique imaging and calorimetric capabilities, is presently data taking at LNGS underground laboratory for a rich physics programme, covering cosmic neutrinos, nucleon decay search and neutrino oscillations with the CNGS neutrino beam.The successful detector commissioning and operation and the ongoing analysis of the recorded events show the excellent performance of this LAr-TPC, and opens the way to constructing very massive high quality detectors.

Guglielmi, A.; Icarus Collaboration

2012-08-01

65

Early events during neoplastic progression in Barrett's esophagus.  

PubMed

Barrett's esophagus is a condition in which the stratified squamous epithelium of the distal esophagus is replaced by specialized intestinal metaplasia. Clinical management of Barrett's esophagus, like many other "premalignant" conditions, is characterized by overdiagnosis of benign early changes that will not cause death or suffering during the lifetime of an individual and underdiagnosis of life-threatening early disease. Recent studies of a number of different types of cancer have revealed much greater genomic complexity than was previously suspected. This genomic complexity could create challenges for early detection and prevention if it develops in premalignant epithelia prior to cancer. Neoplastic progression unfolds in space and time, and Barrett's esophagus provides one of the best models for rapid advances, including "gold standard" cohort studies, to distinguish individuals who do and do not progress to cancer. Specialized intestinal metaplasia has many properties that appear to be protective adaptations to the abnormal environment of gastroesophageal reflux. A large body of evidence accumulated over several decades implicates chromosome instability in neoplastic progression from Barrett's esophagus to esophageal adenocarcinoma. Small, spatial scale studies have been used to infer the temporal order in which genomic abnormalities develop during neoplastic progression in Barrett's esophagus. These spatial studies have provided the basis for prospective cohort studies of biomarkers, including DNA content abnormalities (tetraploidy, aneuploidy) and a biomarker panel of 9p LOH, 17p LOH and DNA content abnormalities. Recent advances in SNP array technology provide a uniform platform to assess chromosome instability. PMID:22112482

Reid, Brian J

2010-01-01

66

Weekly Digest Guide The Weekly Digest is YSM's weekly events newsletter, distributed early  

E-print Network

Weekly Digest Guide The Weekly Digest is YSM's weekly events newsletter, distributed early each Friday morning to 9,000+ email recipients on the Yale campus. The Weekly Digest includes approximately. Timeline The Weekly Digest is published on Fridays for events taking place the following week. Lead time

Lee, Daeyeol

67

Calcareous nannoplankton changes across the early Toarcian oceanic anoxic event in the western Tethys  

Microsoft Academic Search

Calcareous nannoplankton were profoundly affected by environmental perturbations coincident with the early Toarcian oceanic anoxic event (T-OAE). We quantify the abundance of nannofossils across the T-OAE at three locations in Western Europe, where the event is marked by a prominent negative carbon isotope excursion (CIE). Data were treated by statistical analysis, and the Shannon diversity index was applied in order

Emanuela Mattioli; Bernard Pittet; Guillaume Suan; Samuel Mailliot

2008-01-01

68

Early Mechanistic Events in Biotin Dissociation from Streptavidin  

SciTech Connect

The streptavidin-biotin system has provided a unique opportunity to investigate the molecular details of ligand dissociation pathways. An underlying mechanistic question is whether ligand dissociation proceeds with a relatively ordered process of bond breaking and ligand escape. Here we report a joint computational and crystallographic study of the earliest events in biotin dissociation. In molecular dynamics potential of mean force simulations, a water molecule from a defined access channel intercalated into the hydrogen bond between Asp 128 and biotin, bridging them and stabilizing an intermediate state. In forced biotin dissociation simulations, this event led to subsequent bond breaking steps and ligand escape. In equilibrium simulations, the water molecule was sometimes observed to move back to the access channel with re-formation of the biotin hydrogen bond. Analysis of streptavidin crystal structures revealed a close overlap of crystallographically defined and simulated waters in the water access channel. These results suggest that biotin dissociation is initiated by stochastic coupling of water entry with lengthening of a specific biotin hydrogen-bonding interaction.

Hyre, D. E.

2002-01-01

69

Early events in polyoma virus infection: attachment, penetration, and nuclear entry.  

PubMed Central

The plaque-assay technique was used as a tool to determine the optimal conditions for adsorption of polyoma virions to host cells. Using these optimal conditions of adsorption, an electron microscopy study of the early events of infection was performed. By electron microscopy and autoradiography, it was demonstrated that both the viral coat proteins and DNA arrive simultaneously in the nucleus as early as 15 min postinfection. When horseradish peroxidase-labeled virions, pseudovirions, and capsids were used to infect cells, only the particles with nucleic acid or a factor(s) associated with the nucleic acid, i.e., histones, appeared to enter the nucleus. Moreover, when virions were used to infect either permissive or nonpermissive cells, identical early events of viral infection, i.e., adsorption, penetration, and nuclear transport, were observed, suggesting that these early events of infection are a property of the virion and not the host cell. Images PMID:183018

Mackay, R L; Consigli, R A

1976-01-01

70

Early immune events in the induction of allergic contact dermatitis.  

PubMed

The skin is a barrier site that is exposed to a wide variety of potential pathogens. As in other organs, pathogens that invade the skin are recognized by pattern-recognition receptors (PRRs). Recently, it has been recognized that PRRs are also engaged by chemical contact allergens and, in susceptible individuals, this elicits an inappropriate immune response that results in allergic contact dermatitis. In this Review, we focus on how contact allergens promote inflammation by activating the innate immune system. We also examine how innate immune cells in the skin, including mast cells and dendritic cells, cooperate with each other and with T cells and keratinocytes to initiate and drive early responses to contact allergens. PMID:22240625

Kaplan, Daniel H; Igyártó, Botond Z; Gaspari, Anthony A

2012-02-01

71

Early events in the disulfide-coupled folding of BPTI.  

PubMed Central

Recent studies of the refolding of reduced bovine pancreatic trypsin inhibitor (BPTI) have shown that a previously unidentified intermediate with a single disulfide is formed much more rapidly than any other one-disulfide species. This intermediate contains a disulfide that is present in the native protein (between Cys14 and 38), but it is thermodynamically less stable than the other two intermediates with single native disulfides. To characterize the role of the [14-38] intermediate and the factors that favor its formation, detailed kinetic and mutational analyses of the early disulfide-formation steps were carried out. The results of these studies indicate that the formation of [14-38] from the fully reduced protein is favored by both local electrostatic effects, which enhance the reactivities of the Cys14 and 38 thiols, and conformational tendencies that are diminished by the addition of urea and are enhanced at lower temperatures. At 25 degrees C and pH 7.3, approximately 35% of the reduced molecules were found to initially form the 14-38 disulfide, but the majority of these molecules then undergo intramolecular rearrangements to generate non-native disulfides, and subsequently the more stable intermediates with native disulfides. Amino acid replacements, other than those involving Cys residues, were generally found to have only small effects on either the rate of forming [14-38] or its thermodynamic stability, even though many of the same substitutions greatly destabilized the native protein and other disulfide-bonded intermediates. In addition, those replacements that did decrease the steady-state concentration of [14-38] did not adversely affect further folding and disulfide formation. These results suggest that the weak and transient interactions that are often detected in unfolded proteins and early folding intermediates may, in some cases, not persist or promote subsequent folding steps. PMID:10493584

Bulaj, G.; Goldenberg, D. P.

1999-01-01

72

Compartmentalized Replication of R5 T Cell-Tropic HIV-1 in the Central Nervous System Early in the Course of Infection  

PubMed Central

Compartmentalized HIV-1 replication within the central nervous system (CNS) likely provides a foundation for neurocognitive impairment and a potentially important tissue reservoir. The timing of emergence and character of this local CNS replication has not been defined in a population of subjects. We examined the frequency of elevated cerebrospinal fluid (CSF) HIV-1 RNA concentration, the nature of CSF viral populations compared to the blood, and the presence of a cellular inflammatory response (with the potential to bring infected cells into the CNS) using paired CSF and blood samples obtained over the first two years of infection from 72 ART-naïve subjects. Using single genome amplification (SGA) and phylodynamics analysis of full-length env sequences, we compared CSF and blood viral populations in 33 of the 72 subjects. Independent HIV-1 replication in the CNS (compartmentalization) was detected in 20% of sample pairs analyzed by SGA, or 7% of all sample pairs, and was exclusively observed after four months of infection. In subjects with longitudinal sampling, 30% showed evidence of CNS viral replication or pleocytosis/inflammation in at least one time point, and in approximately 16% of subjects we observed evolving CSF/CNS compartmentalized viral replication and/or a marked CSF inflammatory response at multiple time points suggesting an ongoing or recurrent impact of the infection in the CNS. Two subjects had one of two transmitted lineages (or their recombinant) largely sequestered within the CNS shortly after transmission, indicating an additional mechanism for establishing early CNS replication. Transmitted variants were R5 T cell-tropic. Overall, examination of the relationships between CSF viral populations, blood and CSF HIV-1 RNA concentrations, and inflammatory responses suggested four distinct states of viral population dynamics, with associated mechanisms of local viral replication and the early influx of virus into the CNS. This study considerably enhances the generalizability of our results and greatly expands our knowledge of the early interactions of HIV-1 in the CNS. PMID:25811757

Sturdevant, Christa Buckheit; Joseph, Sarah B.; Schnell, Gretja; Price, Richard W.; Swanstrom, Ronald; Spudich, Serena

2015-01-01

73

Compartmentalized Replication of R5 T Cell-Tropic HIV-1 in the Central Nervous System Early in the Course of Infection.  

PubMed

Compartmentalized HIV-1 replication within the central nervous system (CNS) likely provides a foundation for neurocognitive impairment and a potentially important tissue reservoir. The timing of emergence and character of this local CNS replication has not been defined in a population of subjects. We examined the frequency of elevated cerebrospinal fluid (CSF) HIV-1 RNA concentration, the nature of CSF viral populations compared to the blood, and the presence of a cellular inflammatory response (with the potential to bring infected cells into the CNS) using paired CSF and blood samples obtained over the first two years of infection from 72 ART-naïve subjects. Using single genome amplification (SGA) and phylodynamics analysis of full-length env sequences, we compared CSF and blood viral populations in 33 of the 72 subjects. Independent HIV-1 replication in the CNS (compartmentalization) was detected in 20% of sample pairs analyzed by SGA, or 7% of all sample pairs, and was exclusively observed after four months of infection. In subjects with longitudinal sampling, 30% showed evidence of CNS viral replication or pleocytosis/inflammation in at least one time point, and in approximately 16% of subjects we observed evolving CSF/CNS compartmentalized viral replication and/or a marked CSF inflammatory response at multiple time points suggesting an ongoing or recurrent impact of the infection in the CNS. Two subjects had one of two transmitted lineages (or their recombinant) largely sequestered within the CNS shortly after transmission, indicating an additional mechanism for establishing early CNS replication. Transmitted variants were R5 T cell-tropic. Overall, examination of the relationships between CSF viral populations, blood and CSF HIV-1 RNA concentrations, and inflammatory responses suggested four distinct states of viral population dynamics, with associated mechanisms of local viral replication and the early influx of virus into the CNS. This study considerably enhances the generalizability of our results and greatly expands our knowledge of the early interactions of HIV-1 in the CNS. PMID:25811757

Sturdevant, Christa Buckheit; Joseph, Sarah B; Schnell, Gretja; Price, Richard W; Swanstrom, Ronald; Spudich, Serena

2015-03-01

74

HIV-protease inhibitors block the replication of both vesicular stomatitis and influenza viruses at an early post-entry replication step  

SciTech Connect

The inhibitors of HIV-1 protease (PIs) have been designed to block the activity of the viral aspartyl-protease. However, it is now accepted that this family of inhibitors can also affect the activity of cell proteases. Since the replication of many virus species requires the activity of host cell proteases, investigating the effects of PIs on the life cycle of viruses other than HIV would be of interest. Here, the potent inhibition induced by saquinavir and nelfinavir on the replication of both vesicular stomatitis and influenza viruses is described. These are unrelated enveloped RNA viruses infecting target cells upon endocytosis and intracellular fusion. The PI-induced inhibition was apparently a consequence of a block at the level of the fusion between viral envelope and endosomal membranes. These findings would open the way towards the therapeutic use of PIs against enveloped RNA viruses other than HIV.

Federico, Maurizio, E-mail: maurizio.federico@iss.it

2011-08-15

75

Sambucus nigra extracts inhibit infectious bronchitis virus at an early point during replication  

PubMed Central

Background Infectious bronchitis virus (IBV) is a pathogenic chicken coronavirus. Currently, vaccination against IBV is only partially protective; therefore, better preventions and treatments are needed. Plants produce antimicrobial secondary compounds, which may be a source for novel anti-viral drugs. Non-cytotoxic, crude ethanol extracts of Rhodiola rosea roots, Nigella sativa seeds, and Sambucus nigra fruit were tested for anti-IBV activity, since these safe, widely used plant tissues contain polyphenol derivatives that inhibit other viruses. Results Dose–response cytotoxicity curves on Vero cells using trypan blue staining determined the highest non-cytotoxic concentrations of each plant extract. To screen for IBV inhibition, cells and virus were pretreated with extracts, followed by infection in the presence of extract. Viral cytopathic effect was assessed visually following an additional 24 h incubation with extract. Cells and supernatants were harvested separately and virus titers were quantified by plaque assay. Variations of this screening protocol determined the effects of a number of shortened S. nigra extract treatments. Finally, S. nigra extract-treated virions were visualized by transmission electron microscopy with negative staining. Virus titers from infected cells treated with R. rosea and N. sativa extracts were not substantially different from infected cells treated with solvent alone. However, treatment with S. nigra extracts reduced virus titers by four orders of magnitude at a multiplicity of infection (MOI) of 1 in a dose-responsive manner. Infection at a low MOI reduced viral titers by six orders of magnitude and pretreatment of virus was necessary, but not sufficient, for full virus inhibition. Electron microscopy of virions treated with S. nigra extract showed compromised envelopes and the presence of membrane vesicles, which suggested a mechanism of action. Conclusions These results demonstrate that S. nigra extract can inhibit IBV at an early point in infection, probably by rendering the virus non-infectious. They also suggest that future studies using S. nigra extract to treat or prevent IBV or other coronaviruses are warranted. PMID:24433341

2014-01-01

76

Development of fluorescent reporter tagged RIB gene cassettes for replicative transformation, early expression, and enhanced riboflavin production in Eremothecium ashbyi.  

PubMed

Eremothecium ashbyi is a riboflavin overproducing filamentous fungus in which the metabolic pathways have not been genetically characterized. Two genes of the riboflavin biosynthetic (RIB) pathway, RIB1 and RIB3, which encode GTP-cyclohydrolase II (GCH II) and 3,4-dihydroxy-2-butanone 4-phosphate (DHBP) synthase respectively, were selected for the present study. The two RIB genes under their native promoters were obtained from Ashbya gossypii genomic library. Yeast enhanced green fluorescent protein (yEGFP) and mCherry genes were tagged to the C-terminal ends of RIB1 and RIB3 genes to analyse the functionality of the RIB transgenes in E. ashbyi. Shuttle vectors with the reporter tagged RIB genes contained the Escherichia coli kan(R) gene and Saccharomyces cerevisiae ARS element. On transformation with these plasmids, the ARS element was found to be functional in E. ashbyi. The E. ashbyi transcription factors could recognize the Ashbya RIB gene promoters and express the reporter tagged RIB genes as cytoplasmic proteins, in early cell development. Replicative transformants carrying RIB1-mCherry plasmids showed 2.95 times more GCH II activity and 2.44 times more riboflavin production when compared to untransformed. This is the first report of genetic transformation of E. ashbyi and is of significance as the first step towards genetic engineering of this genus. PMID:23063183

Sengupta, Sudeshna; Kaufmann, Andreas; Chandra, T S

2012-10-01

77

Identification of frequent La Niña events during the early 1800s in the east equatorial Pacific  

NASA Astrophysics Data System (ADS)

We report measurements of near monthly ?14C and ?18O during selected decades from an east equatorial Pacific coral that grew during the past four centuries. We find that El Niño events occurred regularly during the late 1700s. During the early 1800s, El Niño events occurred less often, and La Niña conditions prevailed, which were accompanied by unprecedented, low cool season ?14C values and high cool season ?18O values. These results indicate that shallow overturning water (e.g., Central Mode Water) from the North Pacific was likely an important source of water to the Galapagos area during the early 1800s.

Druffel, Ellen R. M.; Griffin, Sheila; Vetter, Desiree; Dunbar, Robert B.; Mucciarone, David M.

2015-03-01

78

A qualitative study evaluating causality attribution for serious adverse events during early phase oncology clinical trials  

Microsoft Academic Search

Summary  \\u000a Background In early phase oncology trials, novel targeted therapies are increasingly being tested in combination with traditional agents\\u000a creating greater potential for enhanced and new toxicities. When a patient experiences a serious adverse event (SAE), investigators\\u000a must determine whether the event is attributable to the investigational drug or not. This study seeks to understand the clinical\\u000a reasoning, tools used

Som D. Mukherjee; Megan E. Coombes; Mitch Levine; Jarold Cosby; Brenda Kowaleski; Andrew Arnold

79

The early Toarcian anoxic event: what the beginning and the end of the story are?  

Microsoft Academic Search

The early Toarcian anoxic event: what the beginning and the end of the story are? E. Mattioli (1), J. Plancq (1), and B. Rauksik (2) (1) UMR 5125 PEPS, CNRS, France; Université Lyon 1, Campus de la DOUA, Bâtiment Géode, 69622 Villeurbanne Cedex, France (emanuela.mattioli@univ-lyon1.fr) (2) Department of Earth and Environmental Sciences, University of Pannonia, Veszprém, Hungary The early Toarcian

Emanuela Mattioli; Julien Plancq; Béla Raucsik

2010-01-01

80

Early snowmelt events: detection, distribution, and significance in a major sub-arctic watershed  

NASA Astrophysics Data System (ADS)

High latitude drainage basins are experiencing higher average temperatures, earlier snowmelt onset in spring, and an increase in rain on snow (ROS) events in winter, trends that climate models project into the future. Snowmelt-dominated basins are most sensitive to winter temperature increases that influence the frequency of ROS events and the timing and duration of snowmelt, resulting in changes to spring runoff. Of specific interest in this study are early melt events that occur in late winter preceding melt onset in the spring. The study focuses on satellite determination and characterization of these early melt events using the Yukon River Basin (Canada/USA) as a test domain. The timing of these events was estimated using data from passive (Advanced Microwave Scanning Radiometer—EOS (AMSR-E)) and active (SeaWinds on Quick Scatterometer (QuikSCAT)) microwave remote sensors, employing detection algorithms for brightness temperature (AMSR-E) and radar backscatter (QuikSCAT). The satellite detected events were validated with ground station meteorological and hydrological data, and the spatial and temporal variability of the events across the entire river basin was characterized. Possible causative factors for the detected events, including ROS, fog, and positive air temperatures, were determined by comparing the timing of the events to parameters from SnowModel and National Centers for Environmental Prediction North American Regional Reanalysis (NARR) outputs, and weather station data. All melt events coincided with above freezing temperatures, while a limited number corresponded to ROS (determined from SnowModel and ground data) and a majority to fog occurrence (determined from NARR). The results underscore the significant influence that warm air intrusions have on melt in some areas and demonstrate the large temporal and spatial variability over years and regions. The study provides a method for melt detection and a baseline from which to assess future change.

Alese Semmens, Kathryn; Ramage, Joan; Bartsch, Annett; Liston, Glen E.

2013-03-01

81

Compartmentalization of prokaryotic DNA replication  

Microsoft Academic Search

It becomes now apparent that prokaryotic DNA replication takes place at specific intracellular locations. Early studies indicated that chromosomal DNA replication, as well as plasmid and viral DNA replication, occurs in close association with the bacterial membrane. Moreover, over the last several years, it has been shown that some replication proteins and specific DNA sequences are localized to particular subcellular

Alicia Bravo; Gemma Serrano-Heras; Margarita Salas

2005-01-01

82

Evidence for kill-butchery events of early Upper Paleolithic age at Kostenki, Russia  

E-print Network

are found at Kostenki on the west bank of the Don River in Russia. During the 1950s, A.N. Rogachev excavatedEvidence for kill-butchery events of early Upper Paleolithic age at Kostenki, Russia John F, Universitetskaya nab., 1, 199034 St. Petersburg, Russia c Institute of the History of Material Culture, Russian

Holliday, Vance T.

83

Let's Party! How To Plan Special Events and Raise Money in Early Childhood Programs.  

ERIC Educational Resources Information Center

This guide for early childhood program administrators provides guidelines and makes suggestions for planning special events to facilitate opportunities for parents, children, teachers, and organizations to connect in ways that strengthen individuals and communities and raise money for the organization. Part 1, "Planning," focuses on organization,…

Rice, Judith Anne

84

Alterations in mitochondrial structure and function are early events of dexamethasone-induced thymocyte apoptosis  

Microsoft Academic Search

In this paper we used a multiparametric ap- proach to analyze extensively the events occurring dur- ing apoptotic cell death of thymocytes, and further- more, we asked whether alterations in mitochondrial structure and function are occurring in early stages of apoptosis. A multiparametric quantitative analysis was performed on normal or apoptotic thymocytes emerg- ing from a few-hour culture performed in

Patrice X. Petit; E. Zorn; Charles Dauguet; Bernard Mignotte; Marie-Lise Gougeon

1995-01-01

85

Early events in speciation: Polymorphism for hybrid male sterility in Drosophila  

E-print Network

Early events in speciation: Polymorphism for hybrid male sterility in Drosophila Laura K. Reed of hybrid male sterility in crosses between Drosophila mojavensis and its sister species, Drosophila variation in the Drosophila melanogaster species group. Mutations that rescue inviable hybrids have been

Markow, Therese

86

Emerging and re-emerging rickettsioses: endothelial cell infection and early disease events  

Microsoft Academic Search

Rickettsiae cause some of the most severe human infections, including epidemic typhus and Rocky Mountain spotted fever. Substantial progress has been made in research into the genomics, vector relationships, pathogenesis and immunity of these obligate, intracellular, arthropod-transmitted bacteria. This Review summarizes our understanding of the early and late events in pathogenesis and immunity, modulation of the host response to rickettsial

Nahed Ismail; David H. Walker

2008-01-01

87

Early Events During Folding of Wild-type Staphylococcal Nuclease and a Single-tryptophan  

E-print Network

Early Events During Folding of Wild-type Staphylococcal Nuclease and a Single-tryptophan Variant-flow mixing device with a dead time of 100 ms coupled with intrinsic tryptophan and 1-anilinonaphthalene-8 of staphylococcal nuclease (SNase). A variant with a unique tryptophan fluorophore in the N-terminal b-barrel domain

Roder, Heinrich

88

Interference of the Simian Virus 40 Origin of Replication by the Cytomegalovirus Immediate Early Gene Enhancer: Evidence for Competition of Active Regulatory Chromatin Conformation in a Single Domain  

PubMed Central

Replication origins are often found closely associated with transcription regulatory elements in both prokaryotic and eukaryotic cells. To examine the relationship between these two elements, we studied the effect of a strong promoter-enhancer on simian virus 40 (SV40) DNA replication. The human cytomegalovirus (CMV) immediate early gene enhancer-promoter was found to exert a strong inhibitory effect on SV40 origin-based plasmid replication in Cos-1 cells in a position- and dose-dependent manner. Deletion analysis indicated that the effect was exerted by sequences located in the enhancer portion of the CMV sequence, thus excluding the mechanism of origin occlusion by transcription. Insertion of extra copies of the SV40 origin only partially alleviated the inhibition. Analysis of nuclease-sensitive cleavage sites of chromatin containing the transfected plasmids indicate that the chromatin was cleaved at one of the regulatory sites in the plasmids containing more than one regulatory site, suggesting that only one nuclease-hypersensitive site existed per chromatin. A positive correlation was found between the degree of inhibition of DNA replication and the decrease of P1 cleavage frequency at the SV40 origin. The CMV enhancer was also found to exhibit an inhibitory effect on the CMV enhancer-promoter driving chloramphenicol acetyltransferase expression in a dose-dependent manner. Together these results suggest that inhibition of SV40 origin-based DNA replication by the CMV enhancer is due to intramolecular competition for the formation of active chromatin structure. PMID:10805748

Chen, Peng-Hui; Tseng, Wen-Bin; Chu, Yi; Hsu, Ming-Ta

2000-01-01

89

Early life events and conditions and breast cancer risk: from epidemiology to etiology.  

PubMed

Risk factors for breast cancer--documented by intensive epidemiological investigations and viewed in the context of general principles of carcinogenesis--can be integrated to an etiologic model comprising 3 principal components: the likelihood of breast cancer occurrence depends on the number of mammary tissue-specific stem cells, which is determined in early life; all growth-enhancing mammotropic hormones affect the rate of expansion of initiated clones; and while a pregnancy stimulates the replication of already initiated cells, it conveys long-term protection through differentiation of mammary tissue-specific stem cells. This perspective accommodates much of what is known about the epidemiology and natural history of breast cancer and highlights the role of early life in the origin of this cancer. PMID:18022897

Trichopoulos, Dimitrios; Adami, Hans-Olov; Ekbom, Anders; Hsieh, Chung-Cheng; Lagiou, Pagona

2008-02-01

90

Polyomavirus JC in the context of immunosuppression: a series of adaptive, DNA replication-driven recombination events in the development of progressive multifocal leukoencephalopathy.  

PubMed

Polyomavirus JC (JCV) is the etiological agent of progressive multifocal leukoencephalopathy (PML), a demyelinating infection of oligodendrocytes in the brain. PML, a frequently fatal opportunistic infection in AIDS, has also emerged as a consequence of treatment with several new immunosuppressive therapeutic agents. Although nearly 80% of adults are seropositive, JCV attains an ability to infect glial cells in only a minority of people. Data suggest that JCV undergoes sequence alterations that accompany this ability, and these changes can be derived from an archetype strain by mutation, deletion, and duplication. While the introductory source and primary tissue reservoir of JCV remain unknown, lymphoid cells have been identified as potential intermediaries in progression of JCV to the brain. This review is focused on sequence changes in the noncoding control region (NCCR) of the virus. We propose an adaptive mechanism that involves a sequential series of DNA replication-driven NCCR recombination events involving stalled DNA replication forks at NCCR palindromic secondary structures. We shall describe how the NCCR sequence changes point to a model in which viral DNA replication drives NCCR recombination, allowing JCV adaptation to different cell types in its progression to neurovirulence. PMID:23690820

Johnson, Edward M; Wortman, Margaret J; Dagdanova, Ayuna V; Lundberg, Patric S; Daniel, Dianne C

2013-01-01

91

The role of parent, teacher, and peer events in maintaining depressive symptoms during early adolescence.  

PubMed

Negative interpersonal events have been consistently identified as both antecedents and sequalae of adolescent depressive symptoms. However, little is known about the relative contributions of specific domains of interpersonal events (parents, peers or teachers) to the maintenance of depressive symptoms during early adolescence or whether a lack of positive interpersonal interactions plays a direct role in maintaining depressive symptoms. Further, few studies have examined whether positive interpersonal events moderate associations between negative events and adolescents' depressive symptoms. This study combined stress generation and exposure models to evaluate the contribution of daily events to the maintenance of depressive symptoms in a sample of 132 adolescents (53 % female) followed from ages 13 to 15. Daily phone diaries collected at age 14 assessed adolescents' negative and positive interactions with parents, teachers, and peers in a sample of adolescents from economically disadvantaged families. Negative peer events uniquely accounted for the maintenance of depressive symptoms over the 2 years period. Results did not differ by gender; however, positive parent events buffered the effects of negative parent events for females but not for males. Findings highlight the significance of peer relationships during a period of vulnerability for depressive symptoms. PMID:24975941

Herres, Joanna; Kobak, Roger

2015-02-01

92

DNA Replication Timing, Genome Stability and Cancer  

PubMed Central

Normal cellular division requires that the genome be faithfully replicated to ensure that unaltered genomic information is passed from one generation to the next. DNA replication initiates from thousands of origins scattered throughout the genome every cell cycle; however, not all origins initiate replication at the same time. A vast amount of work over the years indicates that different origins along each eukaryotic chromosome are activated in early, middle or late S phase. This temporal control of DNA replication is referred to as the replication-timing program. The replication-timing program represents a very stable epigenetic feature of chromosomes. Recent evidence has indicated that the replication-timing program can influence the spatial distribution of mutagenic events such that certain regions of the genome experience increased spontaneous mutagenesis compared to surrounding regions. This influence has helped shape the genomes of humans and other multicellular organisms and can affect the distribution of mutations in somatic cells. It is also becoming clear that the replication-timing program is deregulated in many disease states, including cancer. Aberrant DNA replication timing is associated with changes in gene expression, changes in epigenetic modifications and an increased frequency of structural rearrangements. Furthermore, certain replication timing changes can directly lead to overt genomic instability and may explain unique mutational signatures that are present in cells that have undergone the recently described processes of “chromothripsis” and “kataegis”. In this review, we will discuss how the normal replication timing program, as well as how alterations to this program, can contribute to the evolution of the genomic landscape in normal and cancerous cells. PMID:23327985

Donley, Nathan

2013-01-01

93

Chromosomal replication initiates and terminates at random sequences but at regular intervals in the ribosomal DNA of Xenopus early embryos.  

PubMed Central

We have analysed the replication of the chromosomal ribosomal DNA (rDNA) cluster in Xenopus embryos before the midblastula transition. Two-dimensional gel analysis showed that replication forks are associated with the nuclear matrix, as in differentiated cells, and gave no evidence for single-stranded replication intermediates (RIs). Bubbles, simple forks and double Ys were found in each restriction fragment analysed, showing that replication initiates and terminates without detectable sequence specificity. Quantification of the results and mathematical analysis showed that the average rDNA replicon replicates in 7.5 min and is 9-12 kbp in length. This time is close to the total S phase duration, and this replicon size is close to the maximum length of DNA which can be replicated from a single origin within this short S phase. We therefore infer that (i) most rDNA origins must be synchronously activated soon in S phase and (ii) origins must be evenly spaced, in order that no stretch of chromosomal DNA is left unreplicated at the end of S phase. Since origins are not specific sequences, it is suggested that this spatially and temporally concerted pattern of initiation matches some periodic chromatin folding, which itself need not rely on DNA sequence. Images PMID:8223461

Hyrien, O; Méchali, M

1993-01-01

94

Early events leading to renal injury in obese Zucker (fatty) rats with type II diabetes  

Microsoft Academic Search

Early events leading to renal injury in obese Zucker (fatty) rats with type II diabetes.BackgroundMore than half of the new patients admitted to dialysis therapy in some centers are diagnosed with type IIb diabetes, that is, diabetes associated with obesity. This study searched for a common final pathway of renal damage in this progressive renal disease.MethodsThe evolution of biochemical and

Terezila Machado Coimbra; Ulf Janssen; Hermann Joseph Gröne; Tammo Ostendorf; Uta Kunter; Hartmut Schmidt; Georg Brabant; Jürgen Floege

2000-01-01

95

Dissemination of a highly virulent pathogen: tracking the early events that define infection.  

PubMed

The series of events that occurs immediately after pathogen entrance into the body is largely speculative. Key aspects of these events are pathogen dissemination and pathogen interactions with the immune response as the invader moves into deeper tissues. We sought to define major events that occur early during infection of a highly virulent pathogen. To this end, we tracked early dissemination of Yersinia pestis, a highly pathogenic bacterium that causes bubonic plague in mammals. Specifically, we addressed two fundamental questions: (1) do the bacteria encounter barriers in disseminating to draining lymph nodes (LN), and (2) what mechanism does this nonmotile bacterium use to reach the LN compartment, as the prevailing model predicts trafficking in association with host cells. Infection was followed through microscopy imaging in addition to assessing bacterial population dynamics during dissemination from the skin. We found and characterized an unexpected bottleneck that severely restricts bacterial dissemination to LNs. The bacteria that do not pass through this bottleneck are confined to the skin, where large numbers of neutrophils arrive and efficiently control bacterial proliferation. Notably, bottleneck formation is route dependent, as it is abrogated after subcutaneous inoculation. Using a combination of approaches, including microscopy imaging, we tested the prevailing model of bacterial dissemination from the skin into LNs and found no evidence of involvement of migrating phagocytes in dissemination. Thus, early stages of infection are defined by a bottleneck that restricts bacterial dissemination and by neutrophil-dependent control of bacterial proliferation in the skin. Furthermore, and as opposed to current models, our data indicate an intracellular stage is not required by Y. pestis to disseminate from the skin to draining LNs. Because our findings address events that occur during early encounters of pathogen with the immune response, this work can inform efforts to prevent or control infection. PMID:25611317

Gonzalez, Rodrigo J; Lane, M Chelsea; Wagner, Nikki J; Weening, Eric H; Miller, Virginia L

2015-01-01

96

Dissemination of a Highly Virulent Pathogen: Tracking The Early Events That Define Infection  

PubMed Central

The series of events that occurs immediately after pathogen entrance into the body is largely speculative. Key aspects of these events are pathogen dissemination and pathogen interactions with the immune response as the invader moves into deeper tissues. We sought to define major events that occur early during infection of a highly virulent pathogen. To this end, we tracked early dissemination of Yersinia pestis, a highly pathogenic bacterium that causes bubonic plague in mammals. Specifically, we addressed two fundamental questions: (1) do the bacteria encounter barriers in disseminating to draining lymph nodes (LN), and (2) what mechanism does this nonmotile bacterium use to reach the LN compartment, as the prevailing model predicts trafficking in association with host cells. Infection was followed through microscopy imaging in addition to assessing bacterial population dynamics during dissemination from the skin. We found and characterized an unexpected bottleneck that severely restricts bacterial dissemination to LNs. The bacteria that do not pass through this bottleneck are confined to the skin, where large numbers of neutrophils arrive and efficiently control bacterial proliferation. Notably, bottleneck formation is route dependent, as it is abrogated after subcutaneous inoculation. Using a combination of approaches, including microscopy imaging, we tested the prevailing model of bacterial dissemination from the skin into LNs and found no evidence of involvement of migrating phagocytes in dissemination. Thus, early stages of infection are defined by a bottleneck that restricts bacterial dissemination and by neutrophil-dependent control of bacterial proliferation in the skin. Furthermore, and as opposed to current models, our data indicate an intracellular stage is not required by Y. pestis to disseminate from the skin to draining LNs. Because our findings address events that occur during early encounters of pathogen with the immune response, this work can inform efforts to prevent or control infection. PMID:25611317

Gonzalez, Rodrigo J.; Lane, M. Chelsea; Wagner, Nikki J.; Weening, Eric H.; Miller, Virginia L.

2015-01-01

97

CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication  

PubMed Central

ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression. PMID:24741094

Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

2014-01-01

98

Early Reading Success and Its Relationship to Reading Achievement and Reading Volume: Replication of "10 Years Later"  

ERIC Educational Resources Information Center

Cunningham and Stanovich reported a longitudinal investigation over 10 years that examined the unique influence of exposure to print in explaining individual differences on various measures of reading achievement and declarative (general) knowledge. The present study replicated their investigation with a larger number of participants and…

Sparks, Richard L.; Patton, Jon; Murdoch, Amy

2014-01-01

99

Early events triggering delayed vasoconstrictor receptor upregulation and cerebral ischemia after subarachnoid hemorrhage  

PubMed Central

Background Upregulation of vasoconstrictor receptors in cerebral arteries, including endothelin B (ETB) and 5-hydroxytryptamine 1B (5-HT1B) receptors, has been suggested to contribute to delayed cerebral ischemia, a feared complication after subarachnoid hemorrhage (SAH). This receptor upregulation has been shown to be mediated by intracellular signalling via the mitogen activated protein kinase kinase (MEK1/2) - extracellular regulated kinase 1/2 (ERK1/2) pathway. However, it is not known what event(s) that trigger MEK-ERK1/2 activation and vasoconstrictor receptor upregulation after SAH. We hypothesise that the drop in cerebral blood flow (CBF) and wall tension experienced by cerebral arteries in acute SAH is a key triggering event. We here investigate the importance of the duration of this acute CBF drop in a rat SAH model in which a fixed amount of blood is injected into the prechiasmatic cistern either at a high rate resulting in a short acute CBF drop or at a slower rate resulting in a prolonged acute CBF drop. Results We demonstrate that the duration of the acute CBF drop is determining for a) degree of early ERK1/2 activation in cerebral arteries, b) delayed upregulation of vasoconstrictor receptors in cerebral arteries and c) delayed CBF reduction, neurological deficits and mortality. Moreover, treatment with an inhibitor of MEK-ERK1/2 signalling during an early time window from 6 to 24 h after SAH was sufficient to completely prevent delayed vasoconstrictor receptor upregulation and improve neurological outcome several days after the SAH. Conclusions Our findings suggest a series of events where 1) the acute CBF drop triggers early MEK-ERK1/2 activation, which 2) triggers the transcriptional upregulation of vasoconstrictor receptors in cerebral arteries during the following days, where 3) the resulting enhanced cerebrovascular contractility contribute to delayed cerebral ischemia. PMID:23496889

2013-01-01

100

Modulation of in vitro transformation and the early and late modes of DNA replication of uv-irradiation Syrian hamster cells by caffeine  

SciTech Connect

The effect of caffeine on post-uv DNA replication was studied to determine its relevance to carcinogenesis. The level of uv-induced transformed colonies of Syrian hamster embryo cells (HEC) was increased up to fivefold when caffeine was added to cells between 0 and 6 h post-uv. The greatest increase was observed when the interval between uv irradiation and caffeine addition was 4 h. Two modes of DNA replication occurred after uv irradiation. During the early mode (0 to 3 h post-uv) the size of nascent strands, as measured by alkaline sucrose sedimentation, was smaller than those in nonirradiated cells, whereas during the late mode they recovered to normal size. Caffeine inhibited the rate of elongation of nascent strands during the early mode. When caffeine was added immediately after uv irradiation, the conversion of the early mode to the late mode was inhibited. Studies on the effects of caffeine have now been extended to the late mode. While caffeine has little effect with the fd elements beginning from the 10th day after irradiation is connected with their proliferation but not with the migration out from lymphoid organs.

Doniger, J.; DiPaolo, J.A.

1981-09-01

101

Elevated circulating branched chain amino acids are an early event in pancreatic adenocarcinoma development  

PubMed Central

Most patients with pancreatic ductal adenocarcinoma (PDAC) are diagnosed with advanced disease and survive less than 12 months1. PDAC has been linked with obesity and glucose intolerance2-4, but whether changes in circulating metabolites are associated with early cancer progression is unknown. To better understand metabolic derangements associated with early disease, we profiled metabolites in prediagnostic plasma from pancreatic cancer cases and matched controls from four prospective cohort studies. We find that elevated plasma levels of branched chain amino acids (BCAAs) are associated with a greater than 2–fold increased risk of future pancreatic cancer diagnosis. This elevated risk was independent of known predisposing factors, with the strongest association observed among subjects with samples collected 2 to 5 years prior to diagnosis when occult disease is likely present. We show that plasma BCAAs are also elevated in mice with early stage pancreatic cancers driven by mutant Kras expression, and that breakdown of tissue protein accounts for the increase in plasma BCAAs that accompanies early stage disease. Together, these findings suggest that increased whole–body protein breakdown is an early event in development of PDAC. PMID:25261994

Kraft, Peter; Torrence, Margaret E.; Fiske, Brian P.; Yuan, Chen; Bao, Ying; Townsend, Mary K.; Tworoger, Shelley S.; Davidson, Shawn M.; Papagiannakopoulos, Thales; Yang, Annan; Dayton, Talya L.; Ogino, Shuji; Stampfer, Meir J.; Giovannucci, Edward L.; Qian, Zhi Rong; Rubinson, Douglas A.; Ma, Jing; Sesso, Howard D.; Gaziano, John Michael; Cochrane, Barbara B.; Liu, Simin; Wactawski–Wende, Jean; Manson, JoAnn E.; Pollak, Michael N.; Kimmelman, Alec C.; Souza, Amanda; Pierce, Kerry; Wang, Thomas J.; Gerszten, Robert E.; Fuchs, Charles S.; Heiden, Matthew G. Vander; Wolpin, Brian M.

2014-01-01

102

Expansion of human cytomegalovirus (HCMV) immediate-early 1-specific CD8+ T cells and control of HCMV replication after allogeneic stem cell transplantation.  

PubMed

Recovery of human cytomegalovirus (HCMV)-specific T immunity is critical for protection against HCMV disease in the early phase after allogeneic stem cell transplantation (SCT). Using an enzyme-linked immunospot assay with overlapping 15-mer peptides spanning pp65 and immediate-early 1 HCMV proteins, we investigated which HCMV-specific CD8(+) gamma interferon-positive (IFN-gamma(+)) T-cell responses against pp65 and IE-1 were associated with control of HCMV replication in 48 recipients of unmanipulated HLA-matched allografts at 3 months (M3) and 6 months (M6) after SCT and in 23 donors. At M3 after SCT, the magnitude of the pp65-specific IFN-gamma-producing CD8(+) T-cell response was greater in recipients than in donors, regardless of HCMV status. In contrast, expansion of IE-1-specific CD8(+) T cells at M3 was associated with protection against HCMV, and no patient with this expansion had HCMV replication at M3. At M6, the number of HCMV-specific CD8(+) T cells against both pp65 and IE-1 had expanded in all recipients, regardless of their previous levels of HCMV replication. The recipients' HCMV-specific CD8(+) T cells already detectable in related donors were predominantly targeting pp65. In contrast, in 40% of the cases, the HCMV-specific CD8(+) T cells in recipients involved new CD8(+) T-cell specificities undetectable in their related donors and preferentially targeting IE-1. Taken together, these results showed that the delay in reconstituting IE-1-specific CD8(+) T cells is correlated with the lack of protection against HCMV in the first 3 months after SCT. They also show that IE-1 is a major antigenic determinant of the early restoration of protective immunity to HCMV after SCT. PMID:18684826

Sacre, Karim; Nguyen, Stéphanie; Deback, Claire; Carcelain, Guislaine; Vernant, Jean-Paul; Leblond, Véronique; Autran, Brigitte; Dhedin, Nathalie

2008-10-01

103

Notch pathway regulates female germ cell meiosis progression and early oogenesis events in fetal mouse  

PubMed Central

A critical process of early oogenesis is the entry of mitotic oogonia into meiosis, a cell cycle switch regulated by a complex gene regulatory network. Although Notch pathway is involved in numerous important aspects of oogenesis in invertebrate species, whether it plays roles in early oogenesis events in mammals is unknown. Therefore, the rationale of the present study was to investigate the roles of Notch signaling in crucial processes of early oogenesis, such as meiosis entry and early oocyte growth. Notch receptors and ligands were localized in mouse embryonic female gonads and 2 Notch inhibitors, namely DAPT and L-685,458, were used to attenuate its signaling in an in vitro culture system of ovarian tissues from 12.5 days post coitum (dpc) fetus. The results demonstrated that the expression of Stra8, a master gene for germ cell meiosis, and its stimulation by retinoic acid (RA) were reduced after suppression of Notch signaling, and the other meiotic genes, Dazl, Dmc1, and Rec8, were abolished or markedly decreased. Furthermore, RNAi of Notch1 also markedly inhibited the expression of Stra8 and SCP3 in cultured female germ cells. The increased methylation status of CpG islands within the Stra8 promoter of the oocytes was observed in the presence of DAPT, indicating that Notch signaling is probably necessary for maintaining the epigenetic state of this gene in a way suitable for RA stimulation. Furthermore, in the presence of Notch inhibitors, progression of oocytes through meiosis I was markedly delayed. At later culture periods, the rate of oocyte growth was decreased, which impaired subsequent primordial follicle assembly in cultured ovarian tissues. Taken together, these results suggested new roles of the Notch signaling pathway in female germ cell meiosis progression and early oogenesis events in mammals. PMID:24398584

Feng, Yan-Min; Liang, Gui-Jin; Pan, Bo; Qin, Xun-Si; Zhang, Xi-Feng; Chen, Chun-Lei; Li, Lan; Cheng, Shun-Feng; De Felici, Massimo; Shen, Wei

2014-01-01

104

The glutathione transferase of Nicotiana benthamiana NbGSTU4 plays a role in regulating the early replication of Bamboo mosaic virus.  

PubMed

Bamboo mosaic virus (BaMV) is a single-stranded positive-sense RNA virus. One of the plant glutathione S-transferase (GST) genes, NbGSTU4, responds as an upregulated gene in Nicotiana benthamiana post BaMV infection. In order to identify the role of NbGSTU4 in BaMV infection, the expression of NbGSTU4 was knocked down using a virus-induced gene silencing technique or was transiently expressed in N. benthamiana in BaMV inoculation. The results show a significant decrease in BaMV RNA accumulation when the expression level of NbGSTU4 is reduced; whereas the viral RNA accumulation increases when NbGSTU4 is transiently expressed. Furthermore, this study identified that the involvement of NbGSTU4 in viral RNA accumulation occurs by its participation in the viral early replication step. The findings show that the NbGSTU4 protein expressed from Escherichia coli can interact with the 3' untranslated region (UTR) of the BaMV RNA in vitro in the presence of glutathione (GSH). The addition of GSH in the in vitro replication assay shows an enhancement of minus-strand but not plus-strand RNA synthesis. The results suggest that the plant GST protein plays a role in binding viral RNA and delivering GSH to the replication complex to create a reduced condition for BaMV minus-strand RNA synthesis. PMID:23701112

Chen, I-Hsuan; Chiu, Meng-Hsuen; Cheng, Shun-Fang; Hsu, Yau-Heiu; Tsai, Ching-Hsiu

2013-08-01

105

The glutathione transferase of Nicotiana benthamiana NbGSTU4 plays a role in regulating the early replication of Bamboo mosaic virus  

PubMed Central

Bamboo mosaic virus (BaMV) is a single-stranded positive-sense RNA virus. One of the plant glutathione S-transferase (GST) genes, NbGSTU4, responds as an upregulated gene in Nicotiana benthamiana post BaMV infection. In order to identify the role of NbGSTU4 in BaMV infection, the expression of NbGSTU4 was knocked down using a virus-induced gene silencing technique or was transiently expressed in N. benthamiana in BaMV inoculation. The results show a significant decrease in BaMV RNA accumulation when the expression level of NbGSTU4 is reduced; whereas the viral RNA accumulation increases when NbGSTU4 is transiently expressed. Furthermore, this study identified that the involvement of NbGSTU4 in viral RNA accumulation occurs by its participation in the viral early replication step. The findings show that the NbGSTU4 protein expressed from Escherichia coli can interact with the 3? untranslated region (UTR) of the BaMV RNA in vitro in the presence of glutathione (GSH). The addition of GSH in the in vitro replication assay shows an enhancement of minus-strand but not plus-strand RNA synthesis. The results suggest that the plant GST protein plays a role in binding viral RNA and delivering GSH to the replication complex to create a reduced condition for BaMV minus-strand RNA synthesis. PMID:23701112

Chen, I-Hsuan; Chiu, Meng-Hsuen; Cheng, Shun-Fang; Hsu, Yau-Heiu; Tsai, Ching-Hsiu

2013-01-01

106

Early Events following Experimental Infection with Peste-Des-Petits Ruminants Virus Suggest Immune Cell Targeting  

PubMed Central

Peste-des-petits ruminants virus (PPRV) is a viral pathogen that causes a devastating plague of small ruminants. PPRV is an economically significant disease that continues to be a major obstacle to the development of sustainable agriculture across the developing world. The current understanding of PPRV pathogenesis has been heavily assumed from the closely related rinderpest virus (RPV) and other morbillivirus infections alongside data derived from field outbreaks. There have been few studies reported that have focused on the pathogenesis of PPRV and very little is known about the processes underlying the early stages of infection. In the present study, 15 goats were challenged by the intranasal route with a virulent PPRV isolate, Côte d’Ivoire ’89 (CI/89) and sacrificed at strategically defined time-points post infection to enable pre- and post-mortem sampling. This approach enabled precise monitoring of the progress and distribution of virus throughout the infection from the time of challenge, through peak viraemia and into a period of convalescence. Observations were then related to findings of previous field studies and experimental models of PPRV to develop a clinical scoring system for PPRV. Importantly, histopathological investigations demonstrated that the initial site for virus replication is not within the epithelial cells of the respiratory mucosa, as has been previously reported, but is within the tonsillar tissue and lymph nodes draining the site of inoculation. We propose that virus is taken up by immune cells within the respiratory mucosa which then transport virus to lymphoid tissues where primary virus replication occurs, and from where virus enters circulation. Based on these findings we propose a novel clinical scoring methodology for PPRV pathogenesis and suggest a fundamental shift away from the conventional model of PPRV pathogenesis. PMID:23418464

Pope, Robert A.; Parida, Satya; Bailey, Dalan; Brownlie, Joe; Barrett, Thomas; Banyard, Ashley C.

2013-01-01

107

Early events following experimental infection with Peste-Des-Petits ruminants virus suggest immune cell targeting.  

PubMed

Peste-des-petits ruminants virus (PPRV) is a viral pathogen that causes a devastating plague of small ruminants. PPRV is an economically significant disease that continues to be a major obstacle to the development of sustainable agriculture across the developing world. The current understanding of PPRV pathogenesis has been heavily assumed from the closely related rinderpest virus (RPV) and other morbillivirus infections alongside data derived from field outbreaks. There have been few studies reported that have focused on the pathogenesis of PPRV and very little is known about the processes underlying the early stages of infection. In the present study, 15 goats were challenged by the intranasal route with a virulent PPRV isolate, Côte d'Ivoire '89 (CI/89) and sacrificed at strategically defined time-points post infection to enable pre- and post-mortem sampling. This approach enabled precise monitoring of the progress and distribution of virus throughout the infection from the time of challenge, through peak viraemia and into a period of convalescence. Observations were then related to findings of previous field studies and experimental models of PPRV to develop a clinical scoring system for PPRV. Importantly, histopathological investigations demonstrated that the initial site for virus replication is not within the epithelial cells of the respiratory mucosa, as has been previously reported, but is within the tonsillar tissue and lymph nodes draining the site of inoculation. We propose that virus is taken up by immune cells within the respiratory mucosa which then transport virus to lymphoid tissues where primary virus replication occurs, and from where virus enters circulation. Based on these findings we propose a novel clinical scoring methodology for PPRV pathogenesis and suggest a fundamental shift away from the conventional model of PPRV pathogenesis. PMID:23418464

Pope, Robert A; Parida, Satya; Bailey, Dalan; Brownlie, Joe; Barrett, Thomas; Banyard, Ashley C

2013-01-01

108

Multi-events earthquake early warning algorithm using a Bayesian approach  

NASA Astrophysics Data System (ADS)

Current earthquake early warning (EEW) systems lack the ability to appropriately handle multiple concurrent earthquakes, which led to many false alarms during the 2011 Tohoku earthquake sequence in Japan. This paper uses a Bayesian probabilistic approach to handle multiple concurrent events for EEW. We implement the theory using a two-step algorithm. First, an efficient approximate Bayesian model class selection scheme is used to estimate the number of concurrent events. Then, the Rao-Blackwellized Importance Sampling method with a sequential proposal probability density function is used to estimate the earthquake parameters, that is hypocentre location, origin time, magnitude and local seismic intensity. A real data example based on 2 months data (2011 March 9-April 30) around the time of the 2011 M9 Tohoku earthquake is studied to verify the proposed algorithm. Our algorithm results in over 90 per cent reduction in the number of incorrect warnings compared to the existing EEW system operating in Japan.

Wu, S.; Yamada, M.; Tamaribuchi, K.; Beck, J. L.

2015-02-01

109

Early maritime economy and El Nino events at Quebrada Tacahuay, Peru  

USGS Publications Warehouse

The archaeological site of Quebrada Tacahuay, Peru, dates to 12,700 to 12,500 calibrated years before the present (10,770 to 10,530 carbon-14 years before the present). It contains some of the oldest evidence of maritime- based economic activity in the New World. Recovered materials include a hearth, lithic cutting tools and flakes, and abundant processed marine fauna, primarily seabirds and fish. Sediments below and above the occupation layer were probably generated by El Nino events, indicating that El Nino was active during the Pleistocene as well as during the early and middle Holocene.

Keefer, D.K.; DeFrance, S.D.; Moseley, M.E.; Richardson, J. B., III; Satterlee, D.R.; Day-Lewis, A.

1998-01-01

110

An early Miocene age for a high-temperature event in gneisses from Zabargad Island (Red Sea, Egypt): mantle diapirism?  

E-print Network

An early Miocene age for a high-temperature event in gneisses from Zabargad Island (Red Sea, Egypt outcropping on Zabargad Island (Red Sea, Egypt). This island, though of limited size (& 4 km2 ), has an almost

Demouchy, Sylvie

111

Early viral replication and induced or constitutive immunity in rainbow trout families with differential resistance to Infectious hematopoietic necrosis virus (IHNV)  

USGS Publications Warehouse

The main objective of this study was to assess correlates of innate resistance in rainbow trout full-sibling families that differ in susceptibility to Infectious hematopoietic necrosis virus (IHNV). As part of a commercial breeding program, full-sibling families were challenged with IHNV by waterborne exposure at the 1 g size to determine susceptibility to IHNV. Progeny from select families (N = 7 families) that varied in susceptibility (ranging from 32 to 90% cumulative percent mortality (CPM)) were challenged again at the 10 g size by intra-peritoneal injection and overall mortality, early viral replication and immune responses were evaluated. Mortality challenges included 20–40 fish per family while viral replication and immune response studies included 6 fish per family at each time point (24, 48 and 72 h post-infection (hpi)). CPM at the 1 g size was significantly correlated with CPM at the 10 g size, indicating that inherent resistance was a stable trait irrespective of size. In the larger fish, viral load was measured by quantitative reverse-transcriptase PCR in the anterior kidney and was a significant predictor of family disease outcome at 48 hpi. Type I interferon (IFN) transcript levels were significantly correlated with an individual's viral load at 48 and 72 hpi, while type II IFN gene expression was significantly correlated with an individual's viral load at 24 and 48 hpi. Mean family type I but not type II IFN gene expression was weakly associated with susceptibility at 72 hpi. There was no association between mean family susceptibility and the constitutive expression of a range of innate immune genes (e.g. type I and II IFN pathway genes, cytokine and viral recognition receptor genes). The majority of survivors from the challenge had detectable serum neutralizing antibody titers but no trend was observed among families. This result suggests that even the most resistant families experienced sufficient levels of viral replication to trigger specific immunity. In summary, disease outcome for each family was determined very early in the infection process and resistance was associated with lower early viral replication.

Purcell, M.K.; LaPatra, S.E.; Woodson, J.C.; Kurath, G.; Winton, J.R.

2010-01-01

112

Effects of 60 Hz electromagnetic fields on early growth in three plant species and a replication of previous results  

SciTech Connect

In an attempt to replicate the findings of Smith et al., seeds of Raphanus sativus L. (radish), Sinapsis alba L. (mustard), and Hordeum vulgare L. (barley) were grown for between 9 and 21 days in continuous electromagnetic fields (EMFs) at ion-cyclotron resonance conditions for stimulation of Ca{sup 2+} (B{sub H} = 78.3 {micro}T, B{sub HAC} = 40 {micro}T peak-peak at 60 Hz, B{sub v} = 0). On harvesting, radish showed results similar to those of Smith et al. Dry stem weight and plant height were both significantly greater (Mann-Whitney tests, Ps < 0.05) in EMF-exposed plants than in control plants in each EMF experiment. Wet root weight was significantly greater in EMF-exposed plants in two out of three experiments, as were dry leaf weight, dry whole weight, and stem diameter. Dry root weight, wet leaf weight, and wet whole weight were significantly greater in EMF-exposed plants in one of three experiments. All significant differences indicated an increase in weight or size in the EMF-exposed plants. In each of the sham experiments, no differences between exposed and control plants were evident. Mustard plants failed to respond to the EMFs in any of the plant parameters measured. In one experiment, barley similarly failed to respond; but in another showed significantly greater wet root weight and significantly smaller stem diameter and dry seed weight at the end of the experiment in exposed plants compared to control plants. Although these results give no clue about the underlying bioelectromagnetic mechanism, they demonstrate that, at least for one EMF-sensitive biosystem, results can be independently replicated in another laboratory. Such replication is crucial in establishing the validity of bioelectromagnetic science.

Davis, M.S. [Univ. of Sunderland (United Kingdom). Ecology Centre] [Univ. of Sunderland (United Kingdom). Ecology Centre

1996-05-01

113

Cybernetic origins of replication  

NASA Astrophysics Data System (ADS)

An evolutionary progression leading toward replication is resolved into several phases; (a) the replication of RNA segments by self-priming and -templating, (b) the replication of single stranded molecules by elongation and controlled scission, (c) replication of complementary duplexes and (d) replication of DNA. The initial phase is suggested by evidence for the existence of tandem repeats in an early population of molecules presumed to be ancestral to today's structurl RNAs. Relics of these repeats are seen in the positioning of sequence matches between transfer and ribosomal RNAs. Conservation of the positions of the matches is indicated by persistence of a periodicity in their spacings along the molecules. Selection is viewed as a vector, with a source and a focus. The evolutionary progression entails shifts in the source of selection, from external catalysts to the replicating molecule itself, and in its focus, from substrate to replicator, to the products of the replicator's activity. When the source and focus of selection are the same selection becomes internalized, and replication and Darwinian evolution follow. Catalytic specificity is regarded as an antecedent to natural selection. Shifting of the source and focus of selection and switches in evolution's ‘vehicle’, the most fundamental thing that evolves, result in profound changes in the modes of evolution. Control provides a conceptual framwork within which entry into a Darwinian mode of evolution, and ultimately liberation from Darwinian evolution might be explained.

Bloch, David P.

1988-03-01

114

Cyclin E deregulation is an early event in the development of breast cancer.  

PubMed

Cyclin E has been shown to be overexpressed in some human breast cancers, however, data to support deregulation of cyclin E as an early event in human mammary tumor development is lacking. We analyzed surgical specimens from 183 patients with breast carcinomas and evaluated cyclin E expression in areas of invasive carcinoma, adjacent carcinoma in situ (CIS), and non-neoplastic breast parenchyma. Overexpression of cyclin E was seen in one-third of invasive carcinoma samples, one-third of the CIS component and nearly half of the non-neoplastic breast epithelial cells adjacent to carcinoma (44% vs. 33%, P < or = 0.05). Nuclear labeling for cyclin E was highly concordant between areas of in invasive carcinoma, CIS and non-neoplastic breast epithelial cells from the same patient (P < 0.0001). Localization of cyclin E to the cytoplasm was seen in a small proportion of tumor samples. Our findings suggest that cyclin E deregulation is an early event in the progression from histologically benign mammary epithelial cells to invasive carcinoma and occurs through both overexpression and altered cellular localization. PMID:19107593

Shaye, Alexandra; Sahin, Aysegul; Hao, Qiang; Hunt, Kelly; Keyomarsi, Khandan; Bedrosian, Isabelle

2009-06-01

115

The early Toarcian anoxic event: what the beginning and the end of the story are?  

NASA Astrophysics Data System (ADS)

The early Toarcian anoxic event: what the beginning and the end of the story are? E. Mattioli (1), J. Plancq (1), and B. Rauksik (2) (1) UMR 5125 PEPS, CNRS, France; Université Lyon 1, Campus de la DOUA, Bâtiment Géode, 69622 Villeurbanne Cedex, France (emanuela.mattioli@univ-lyon1.fr) (2) Department of Earth and Environmental Sciences, University of Pannonia, Veszprém, Hungary The early Toarcian anoxic event (T-OAE) and the associated biotic crisis have received much attention in the last decade. However, the events forewarning the crisis as well as its aftermath are still poorly known. The T-OAE coincides with a prominent carbon isotope negative excursion (T-CIE) that is preceded by an excursion of similar intensity at the Pliensbachian-Toarcian boundary (Hesselbo et al., 2007). The onset of T-CIE occurred some 700 kyr later than the end of the Boundary-CIE (Suan et al., 2008a). This succession of events demonstrates that the T-OAE was a complex suite of environmental perturbations. In this work, we focused on calcareous nannofossil assemblages occurring in the Peniche section (Portugal) during the Boundary-CIE with the aim to understand if calcifying plankton reacted in a similar/different way to the two CIEs. Also, two sections and one borehole located along a W-E transect, along the NW-Tethyan shelf (in the Yorkshire coast, in the E Paris Basin, and in Mecsek Basin, respectively), were investigated to assess which way calcareous nannoplankton recovered after the crisis, and if the recovery was a synchronous event. The production by nannoplankton collapsed during the T-CIE, as demonstrated by the lowest absolute abundance of nannofossils measured in Peniche and other studied sites (Mattioli et al., 2008). Besides this nannofossil abundance decrease, also the size of the incertae sedis Schizosphaerella test was drastically reduced (Suan et al., 2008b). If a similar size decrease is also recorded during the Boundary-CIE, calcareous nannofossil abundances are very high, and assemblages seem not to record an environmental stress. The study of the calcareous nannofossil assemblages along a W-E transect in the NW-Tethyan shelf shows a progressive, but significant decrease in abundance fluxes from W to E, and the lowest fluxes are recorded in the Mecsek Basin that was closer to the oceanic Tethys. A progressive re-colonization of the lower photic zone by deep-dweller nannofossil taxa, mainly Crepidolithus crassus, is observed in the aftermath of the anoxic event, but this re-colonization occurred earlier in the Mecsek Basin, probably because of more effective marine connections with the open-ocean. This set of data indicates that: (1) environmental deterioration was recurrent until it reached its acme during the T-OAE; (2) post-crisis recovery of surface water environments was not synchronous, depending on palaeoceanographic conditions occurring within the western Tethys. Our scenario implies an intrinsically long-lasting suite of events and argues in favour of long-lasting CO2 degassing, most likely related to the emplacement of the large igneous province of Karoo-Ferrar as the main cause of the Toarcian environmental perturbations. Acknowledgements. We would like to thank John McArthur for kindly providing us the Toarcian samples from the Yorkshire coast. Hesselbo et al. (2007). Carbon-isotope record of the Early Jurassic (Toarcian) oceanic anoxic event from fossil wood and marine carbonate (Lusitanian Basin, Portugal), Earth Planet. Sci. Lett. 253, 455- 470. Mattioli et al. (2008). Calcareous nannoplankton changes across the early Toarcian oceanic anoxic event in the western Tethys. Paleoceanography 23, PA3208, doi:10.1029/2007PA001435, 2008. Suan et al. (2008a). Duration of the Early Toarcian carbon isotope excursion deduced from spectral analysis: Consequence for its possible causes. Earth Planet. Sci. Lett. 267, 666-679. Suan et al. (2008b). Evidence for major environmental perturbation prior to and during the Toarcian (Early Jurassic) oceanic anoxic event from the Lusitanian Basin, Portugal. Paleoceanography 23,

Mattioli, Emanuela; Plancq, Julien; Raucsik, Béla

2010-05-01

116

Increased Axonal Ribosome Numbers Is an Early Event in the Pathogenesis of Amyotrophic Lateral Sclerosis  

PubMed Central

Myelinating glia cells support axon survival and functions through mechanisms independent of myelination, and their dysfunction leads to axonal degeneration in several diseases. In amyotrophic lateral sclerosis (ALS), spinal motor neurons undergo retrograde degeneration, and slowing of axonal transport is an early event that in ALS mutant mice occurs well before motor neuron degeneration. Interestingly, in familial forms of ALS, Schwann cells have been proposed to slow disease progression. We demonstrated previously that Schwann cells transfer polyribosomes to diseased and regenerating axons, a possible rescue mechanism for disease-induced reductions in axonal proteins. Here, we investigated whether elevated levels of axonal ribosomes are also found in ALS, by analysis of a superoxide dismutase 1 (SOD1)G93A mouse model for human familial ALS and a patient suffering from sporadic ALS. In both cases, we found that the disorder was associated with an increase in the population of axonal ribosomes in myelinated axons. Importantly, in SOD1G93A mice, the appearance of axonal ribosomes preceded the manifestation of behavioral symptoms, indicating that upregulation of axonal ribosomes occurs early in the pathogenesis of ALS. In line with our previous studies, electron microscopy analysis showed that Schwann cells might serve as a source of axonal ribosomes in the disease-compromised axons. The early appearance of axonal ribosomes indicates an involvement of Schwann cells early in ALS neuropathology, and may serve as an early marker for disease-affected axons, not only in ALS, but also for other central and peripheral neurodegenerative disorders. PMID:24498056

Verheijen, Mark H. G.; Peviani, Marco; Hendricusdottir, Rita; Bell, Erin M.; Lammens, Martin; Smit, August B.; Bendotti, Caterina; van Minnen, Jan

2014-01-01

117

Heterologous microarray experiments allow the identification of the early events associated with potato tuber cold sweetening  

PubMed Central

Background Since its discovery more than 100 years ago, potato (Solanum tuberosum) tuber cold-induced sweetening (CIS) has been extensively investigated. Several carbohydrate-associated genes would seem to be involved in the process. However, many uncertainties still exist, as the relative contribution of each gene to the process is often unclear, possibly as the consequence of the heterogeneity of experimental systems. Some enzymes associated with CIS, such as ?-amylases and invertases, have still to be identified at a sequence level. In addition, little is known about the early events that trigger CIS and on the involvement/association with CIS of genes different from carbohydrate-associated genes. Many of these uncertainties could be resolved by profiling experiments, but no GeneChip is available for the potato, and the production of the potato cDNA spotted array (TIGR) has recently been discontinued. In order to obtain an overall picture of early transcriptional events associated with CIS, we investigated whether the commercially-available tomato Affymetrix GeneChip could be used to identify which potato cold-responsive gene family members should be further studied in detail by Real-Time (RT)-PCR (qPCR). Results A tomato-potato Global Match File was generated for the interpretation of various aspects of the heterologous dataset, including the retrieval of best matching potato counterparts and annotation, and the establishment of a core set of highly homologous genes. Several cold-responsive genes were identified, and their expression pattern was studied in detail by qPCR over 26 days. We detected biphasic behaviour of mRNA accumulation for carbohydrate-associated genes and our combined GeneChip-qPCR data identified, at a sequence level, enzymatic activities such as ?-amylases and invertases previously reported as being involved in CIS. The GeneChip data also unveiled important processes accompanying CIS, such as the induction of redox- and ethylene-associated genes. Conclusion Our Global Match File strategy proved critical for accurately interpretating heterologous datasets, and suggests that similar approaches may be fruitful for other species. Transcript profiling of early events associated with CIS revealed a complex network of events involving sugars, redox and hormone signalling which may be either linked serially or act in parallel. The identification, at a sequence level, of various enzymes long known as having a role in CIS provides molecular tools for further understanding the phenomenon. PMID:18416834

Bagnaresi, Paolo; Moschella, Anna; Beretta, Ottavio; Vitulli, Federico; Ranalli, Paolo; Perata, Pierdomenico

2008-01-01

118

Assemblage level and intraspecific response of calcareous nannofossils during early Eocene hyperthermal events.  

NASA Astrophysics Data System (ADS)

The composition of calcareous nannofossils across the early Eocene has been investigated at the equatorial Atlantic (Demerara Rise; ODP Site 1260A, 277.17 - 227.04 mbsf & 1260B, 256.16 - 235.10 mbsf), including the Paleocene - Eocene Thermal Maximum (PETM), Eocene thermal maximum 2 (ETM2) = Eocene layer of mysterious origin (Elmo) and ETM3 ("X"-event). These hyperthermal events are marked by a substantial input of isotopically light carbon into the oceans, related to a general warming trend, which led to ocean acidification. Perturbations of the carbon system are thought to have caused significant changes in the composition of marine biota. The PETM interval of Site 1260, defined by the onset and the termination of a negative carbon isotope anomaly with a value of ~ - 2 ‰, is 1.39 m thick (1260A, 276.87 - 275.48 mbsf). The lowermost 65 cm thick interval (1260A, 276.87 - 276.22 mbsf) with a carbonate content lower than 20 % includes a distinctive basal clay layer of approximately 40 cm thickness. The ETM2 is 78 cm thick (1260B, 238.93 - 238.15 mbsf) and marked by a negative carbon isotope excursion of ~ - 1 ‰. The final ETM3 is 17cm thick (1260A, 227.06 - 226.89 mbsf) and shows a negative shift of the carbon isotopes of - 1.2 ‰. The PETM is preceded by two short eutrophic events, where the nannofossil-based productivity index shows very high values, with concomitant low temperatures, the latter eutrophic event is directly preceding the onset of the carbon isotope excursion. The PETM excursion flora can be divided in three groups: 1) Small taxa - or taxa with a big aperture, like Coccolithus minimus, Coccolithus latus and Coccolithus foraminis, which are regarded as stress forms of Coccolithus pelagicus, reacting to possible surface water acidification during the initial phase of the PETM. 2) The large sized Coccolithus bownii, which appears as an acme during the body and early recovery, may profit from increasing pH and decreasing DIC conditions. 3) Teratoid ("malformed") discoasters are not restricted to the PETM and are therefore rather related to higher temperatures then to changes of the oceans carbonate system. Size measurements in the common species of C. pelagicus, including several ecophenotypes like C. minimus and C. latus, show marked changes during the events.

Joachim, C.; Mutterlose, J.

2012-04-01

119

Early detection of cell activation events by means of attenuated total reflection Fourier transform infrared spectroscopy  

NASA Astrophysics Data System (ADS)

Activation of Jurkat T-cells in culture following treatment with anti-CD3 (Cluster of Differentiation 3) antibody is detectable by interrogating the treated T-cells using the Attenuated Total Reflection-Fourier Transform Infrared (ATR-FTIR) Spectroscopy technique. Cell activation was detected within 75 min after the cells encountered specific immunoglobulin molecules. Spectral markers noted following ligation of the CD3 receptor with anti CD3 antibody provides proof-of-concept that ATR-FTIR spectroscopy is a sensitive measure of molecular events subsequent to cells interacting with anti-CD3 Immunoglobulin G. The resultant ligation of the CD3 receptor results in the initiation of well defined, specific signaling pathways that parallel the measurable molecular events detected using ATR-FTIR. Paired t-test with post-hoc Bonferroni corrections for multiple comparisons has resulted in the identification of statistically significant spectral markers (p < 0.02) at 1367 and 1358 cm-1. Together, these data demonstrate that early treatment-specific cellular events can be measured by ATR-FTIR and that this technique can be used to identify specific agents via the responses of the cell biosensor at different time points postexposure.

Titus, Jitto; Filfili, Chadi; Hilliard, Julia K.; Ward, John A.; Unil Perera, A. G.

2014-06-01

120

Spatiotemporal relationships among early events of fertilization in sea urchin eggs revealed by multiview microscopy.  

PubMed Central

Four early events of egg fertilization, changes in intracellular calcium concentration and intracellular pH, reorientation of the surface membrane, and the elevation of the fertilization envelope, were imaged in real time and in pairs in single sea urchin eggs. The paired imaging allowed the correlation of the four events spatially and temporally. Three of them propagated as waves starting at the sperm entry site. The earliest was the calcium wave, visualized with fluorescent indicator dyes. After a delay of 10 s there followed a large decrease in the fluorescence polarization of membrane-bound dyes, which we interpret as arising from membrane reorientation as a result of cortical granule exocytosis and microvillar elongation. With a further delay of 15 s the fertilization envelope was seen to rise in transmitted light. All three waves propagated with similar velocities of approximately 10 microns/s, supporting the view that calcium triggers the latter two events. The fluorescence polarization changed in two steps with a clear pause of 10-20 s in between. The second step, which also propagated as wave, reflects either further elongation of microvilli or straightening of irregular microvilli. This second step was abolished by cytochalasin B and was coincident with an increase in cytoplasmic pH, suggesting that pH-induced actin reorganization may play a role. The cytoplasmic alkalinization, imaged with a fluorescent probe, was quite different from the other events in that it took place homogeneously throughout the egg and slowly (over 100 s). Apparently, the alkalinization is not on a direct downstream pathway of calcium origin. An opposing possibility, that the alkalinization may in fact be triggered by the traveling calcium wave, is also discussed. Images FIGURE 1 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 PMID:7756541

Suzuki, K; Tanaka, Y; Nakajima, Y; Hirano, K; Itoh, H; Miyata, H; Hayakawa, T; Kinosita, K

1995-01-01

121

An Early Warning System for Hypoglycemic/Hyperglycemic Events Based on Fusion of Adaptive Prediction Models  

PubMed Central

Introduction Early warning of future hypoglycemic and hyperglycemic events can improve the safety of type 1 diabetes mellitus (T1DM) patients. The aim of this study is to design and evaluate a hypoglycemia/hyperglycemia early warning system (EWS) for T1DM patients under sensor-augmented pump (SAP) therapy. Methods The EWS is based on the combination of data-driven online adaptive prediction models and a warning algorithm. Three modeling approaches have been investigated: (i) autoregressive (ARX) models, (ii) auto-regressive with an output correction module (cARX) models, and (iii) recurrent neural network (RNN) models. The warning algorithm performs postprocessing of the models? outputs and issues alerts if upcoming hypoglycemic/hyperglycemic events are detected. Fusion of the cARX and RNN models, due to their complementary prediction performances, resulted in the hybrid autoregressive with an output correction module/recurrent neural network (cARN)-based EWS. Results The EWS was evaluated on 23 T1DM patients under SAP therapy. The ARX-based system achieved hypoglycemic (hyperglycemic) event prediction with median values of accuracy of 100.0% (100.0%), detection time of 10.0 (8.0) min, and daily false alarms of 0.7 (0.5). The respective values for the cARX-based system were 100.0% (100.0%), 17.5 (14.8) min, and 1.5 (1.3) and, for the RNN-based system, were 100.0% (92.0%), 8.4 (7.0) min, and 0.1 (0.2). The hybrid cARN-based EWS presented outperforming results with 100.0% (100.0%) prediction accuracy, detection 16.7 (14.7) min in advance, and 0.8 (0.8) daily false alarms. Conclusion Combined use of cARX and RNN models for the development of an EWS outperformed the single use of each model, achieving accurate and prompt event prediction with few false alarms, thus providing increased safety and comfort. PMID:23759402

Daskalaki, Elena; Nørgaard, Kirsten; Züger, Thomas; Prountzou, Aikaterini; Diem, Peter; Mougiakakou, Stavroula

2013-01-01

122

Reliability of demographic and socioeconomic variables in predicting early initiation of breastfeeding: a replication analysis using the Kenya Demographic and Health Survey data  

PubMed Central

Objectives Examine the reliability of sociodemographic variables in predicting initiation of breastfeeding within an hour of birth (EarlyBF), using data from 1998, 2003 and 2008–2009. Study design A replication analysis using the Kenya Demographic and Health Survey (KDHS) data collected in 1998, 2003 and 2008–2009. The candidate predictor variables were child's gender, home or health facility place of birth, vaginal or caesarean mode of birth, urban or rural setting, province of residence, Wealth Index and maternal education, occupation, literacy and media exposure. Setting Kenya. Participants 6375 dyads of mothers aged 15–49 and their children aged 0–23?months (2125 dyads in each of the survey years). Results Mode of birth and province were statistically significant predictors of EarlyBF in 1998, 2003 and 2008–2009. Children delivered through caesarean section were non-EarlyBF in 1998 (OR 2.63, 95% CI 1.72 to 4.04), 2003 (OR 3.36, 95% CI 1.83 to 6.16) and 2008 (OR 3.51, 95% CI 2.17 to 5.69). The same was true of those living in the Western province in 1998 (OR 2.67, 95% CI 1.61 to 4.43), 2003 (OR 4.92, 95% CI 3.01 to 8.04) and 2008 (OR 6.07, 95% CI 3.54 to 10.39). Conclusions The 1998 KDHS data do not provide the basis for reliable prediction of EarlyBF, with reliability conceptualised as replicability of findings using highly similar data sets from 2003 and 2008–2009. Most of the demographic and socioeconomic variables were unreliable predictors of EarlyBF. We speculate that activities in parts or all of Kenya changed the analysis context in the period between 1998 and 2008–2009, and these changes were of a sufficient magnitude to affect the relationships under investigation. The degree to which this is a general problem in child health research is not known, calling for further research to investigate this methodological issue with other health end points and other data. PMID:24939811

Matanda, Dennis J; Mittelmark, Maurice B; Urke, Helga B; Amugsi, Dickson A

2014-01-01

123

Early Intervention with a Parent-Delivered Massage Protocol Directed at Tactile Abnormalities Decreases Severity of Autism and Improves Child-to-Parent Interactions: A Replication Study  

PubMed Central

Tactile abnormalities are severe and universal in preschool children with autism. They respond well to treatment with a daily massage protocol directed at tactile abnormalities (QST massage for autism). Treatment is based on a model for autism proposing that tactile impairment poses a barrier to development. Two previous randomized controlled trials evaluating five months of massage treatment reported improvement of behavior, social/communication skills, and tactile and other sensory symptoms. This is the first report from a two-year replication study evaluating the protocol in 103 preschool children with autism. Parents gave daily treatment; trained staff gave weekly treatment and parent support. Five-month outcomes replicated earlier studies and showed normalization of receptive language (18%, P = .03), autistic behavior (32%, P = .006), total sensory abnormalities (38%, P = .0000005), tactile abnormalities (49%, P = .0002), and decreased autism severity (medium to large effect size, P = .008). In addition, parents reported improved child-to-parent interactions, bonding, and decreased parenting stress (44%, P = .00008). Early childhood special education programs are tasked with addressing sensory abnormalities and engaging parents in effective home programs. Until now, they have lacked research-based methods to do so. This program fulfills the need. It is recommended to parents and ECSE programs (ages 3–5) at autism diagnosis.

Silva, Louisa M. T.; Gabrielsen, Kristen R.; Budden, Sarojini S.; Buenrostro, Martha; Horton, Gretchen

2015-01-01

124

Early Intervention with a Parent-Delivered Massage Protocol Directed at Tactile Abnormalities Decreases Severity of Autism and Improves Child-to-Parent Interactions: A Replication Study.  

PubMed

Tactile abnormalities are severe and universal in preschool children with autism. They respond well to treatment with a daily massage protocol directed at tactile abnormalities (QST massage for autism). Treatment is based on a model for autism proposing that tactile impairment poses a barrier to development. Two previous randomized controlled trials evaluating five months of massage treatment reported improvement of behavior, social/communication skills, and tactile and other sensory symptoms. This is the first report from a two-year replication study evaluating the protocol in 103 preschool children with autism. Parents gave daily treatment; trained staff gave weekly treatment and parent support. Five-month outcomes replicated earlier studies and showed normalization of receptive language (18%, P = .03), autistic behavior (32%, P = .006), total sensory abnormalities (38%, P = .0000005), tactile abnormalities (49%, P = .0002), and decreased autism severity (medium to large effect size, P = .008). In addition, parents reported improved child-to-parent interactions, bonding, and decreased parenting stress (44%, P = .00008). Early childhood special education programs are tasked with addressing sensory abnormalities and engaging parents in effective home programs. Until now, they have lacked research-based methods to do so. This program fulfills the need. It is recommended to parents and ECSE programs (ages 3-5) at autism diagnosis. PMID:25878901

Silva, Louisa M T; Schalock, Mark; Gabrielsen, Kristen R; Budden, Sarojini S; Buenrostro, Martha; Horton, Gretchen

2015-01-01

125

The lncRNA NRON modulates HIV-1 replication in a NFAT-dependent manner and is differentially regulated by early and late viral proteins  

PubMed Central

A majority of the human genome is transcribed into noncoding RNAs, of which the functions of long noncoding RNAs (lncRNAs) are poorly understood. Many host proteins and RNAs have been characterized for their roles in HIV/AIDS pathogenesis, but there is only one lncRNA, NEAT1, which is shown to affect the HIV-1 life cycle. We profiled 90 disease-related lncRNAs and found NRON (noncoding repressor of Nuclear Factor of Activated T cells [NFAT]) to be one of several lncRNAs whose expression was significantly altered following HIV-1 infection. The regulation of NRON expression during the HIV-1 life cycle was complex; its levels were reduced by the early viral accessory protein Nef and increased by the late protein Vpu. Consequently, Nef and Vpu also modulated activity of the transcription factor NFAT. The knockdown of NRON enhanced HIV-1 replication through increased activity of NFAT and the viral LTR. Using siRNA-mediated NFAT knockdown, we show the effects of NRON on HIV-1 replication to be mediated by NFAT, and the viral Nef and Vpu proteins to modulate NFAT activity through their effects on NRON. These findings add the lncRNA, NRON to the vast repertoire of host factors utilized by HIV for infection and persistence. PMID:25728138

Imam, Hasan; Shahr Bano, Aalia; Patel, Paresh; Holla, Prasida; Jameel, Shahid

2015-01-01

126

Early somatosensory event-related potentials reveal attentional bias for internal stimuli in social anxiety.  

PubMed

The present study used event-related brain potentials (ERPs) to investigate allocation of attentional resources to internal and external stimuli in individuals with social anxiety. High and low socially anxious individuals were presented with depictions of various facial expressions or household objects, followed by an internal (vibration presented to the finger) or external probe (the letter "E"). Participants were told that the vibration signals physiological changes and were asked to detect both probes. High socially anxious individuals showed larger front-central N140 amplitudes in response to vibratory internal probes as compared to non-anxious controls. ERPs elicited by picture stimuli and external probes and reaction times in response to both probe types did not differ between high and low social anxiety individuals. Early somatosensory ERPs reveal an attentional bias for internal stimuli that does not appear in overt behavior. PMID:22285128

Kanai, Yoshihiro; Nittono, Hiroshi; Kubo, Kenta; Sasaki-Aoki, Shoko; Iwanaga, Makoto

2012-03-01

127

Imaging of the early acceleration phase of the 2013-2014 Boso slow slip event  

NASA Astrophysics Data System (ADS)

We analyze GPS and seismic data to examine the spatiotemporal evolution of a slow slip event (SSE) near Boso Peninsula, central Japan, from December 2013 to January 2014. The evolution of this SSE and its associated seismicity is divided into two distinct phases. Slip initially accelerated slowly with low slip rates, low propagation speeds, and no accompanying seismicity during the early phase and then accelerated more rapidly with higher slip rates, a higher propagation speed, and local earthquake swarm activity during the later phase. The seismicity was highly correlated in space and time with slip rate, suggesting that the swarm activity was triggered by stress loading due to the slow slip. The transition from the slow to faster phase shares some similarities with the nucleation of megathrust earthquakes inferred from foreshock activities, suggesting that SSEs may provide insights into the nucleation of large earthquakes.

Fukuda, Jun'ichi; Kato, Aitaro; Obara, Kazushige; Miura, Satoshi; Kato, Teruyuki

2014-11-01

128

Interferon-beta treatment increases human papillomavirus early gene transcription and viral plasmid genome replication by activating interferon regulatory factor (IRF)-1.  

PubMed

Interferons (IFNs) have been used to treat mucosal lesions caused by human papillomavirus (HPV) infection, such as intraepithelial precursor lesions to cancer of the uterine cervix, genital warts or recurrent respiratory papillomatosis, to potentially reduce or eliminate replicating HPV plasmid genomes. Mucosal HPVs have evolved mechanisms that impede IFN-beta synthesis and downregulate genes induced by IFN. Here we show that these HPV types directly subvert a cellular transcriptional response to IFN-beta as a potential boost in infection. Treatment with low levels of human IFN-beta induced initial amplification of HPV-16 and HPV-11 plasmid genomes and increased HPV-16 or HPV-31 DNA copy numbers up to 6-fold in HPV-immortalized keratinocytes. IFN treatment also increased early gene transcription from the major early gene promoters in HPV-16, HPV-31 and HPV-11. Furthermore, mutagenesis of the viral genomes and ectopic interferon regulatory factor (IRF) expression in transfection experiments using IRF-1(-/-), IRF-2(-/-) and dual knockout cell lines determined that these responses are due to the activation of IRF-1 interaction with a conserved interferon response element demonstrated in several mucosal HPV early gene promoters. Our results provide a molecular explanation for the varying clinical outcomes of IFN therapy of papillomatoses and define an assay for the modulation of the HPV gene program by IFNs as well as other cytokines and signaling molecules in infection and therapy. PMID:19541854

Lace, Michael J; Anson, James R; Klingelhutz, Aloysius J; Harada, Hisashi; Taniguchi, Tadatsugu; Bossler, Aaron D; Haugen, Thomas H; Turek, Lubomir P

2009-08-01

129

The influence of early phase remodeling events on the biomechanical properties of engineered vascular tissues  

PubMed Central

Objectives Over the last decade the use of ex vivo-derived materials designed for use as implant scaffolds has increased significantly. This is particularly so in the area of regenerative medicine, or tissue engineering, where the natural chemical and biomechanical properties has been shown to be advantageous. By focusing on detailed events that occur during early phase remodeling processes our objective was to detail progressive changes in graft biomechanics to further our understanding of these processes. Methods Using perfusion bioreactor system and acellular human umbilical veins (HUV) as a model 3D vascular scaffold, human myofibroblasts were seeded and cultured under either static or defined pulsatile conditions. Cell function in relation to graft mechanical properties were assessed. Results Cells were shown to have doubled in density from approximately 1 × 106 to 2 × 106 ± 0.4 × 106 cells/cm ringlet while static cultures remained unchanged. In both static and dynamic systems the materials compressive stiffness and ultimate tensile strength remained unchanged. However the Young’s modulus values increased significantly in the physiological range while in the failure range a significant reduction (66%) was shown under dynamic conditions. Conclusions We have shown that as pulse and flow conditions are modulated, complex mechanical changes are occurring that modifies the elastic modulus differentially in both physiological and failure ranges. It is clear that mechanical properties play an important role in graft patency, and that a dynamic relationship between structure and function occurs during graft remodeling. These investigations have shown as cells migrate into this model ex vivo scaffold significant variation in material elasticity occurs that may have important implications in our understanding of early stage vascular remodeling events. PMID:21872418

Tosun, Zehra; Montoya, Carolina Villegas; McFetridge, Peter S.

2011-01-01

130

Impact of viral factors on very early in vivo replication profiles in simian immunodeficiency virus SIVagm-infected African green monkeys.  

PubMed

To better understand which factors govern the levels of viral loads in early lentiviral infections of primates, we developed a model that allows distinguishing between the influences of host and viral factors on viremia. Herein we report that two species of African green monkeys (Chlorocebus sabaeus and C. pygerythrus) infected with their respective wild-type simian immunodeficiency virus SIVagm viruses (SIVagm.sab92018 and SIVagm.ver644) consistently showed reproducible differences in viremia during primary infection but not at later stages of infection. Cross-infections of SIVagm.sab92018 and SIVagm.ver644 into, respectively, C. pygerythrus and C. sabaeus revealed that the dynamics of viral replication during primary infection were dependent on the viral strain used for the infection but not on the host. Hence, the kinetics of SIVagm.sab92018 and SIVagm.ver644 were similar in both sabaeus and vervet animals, indicating that the difference in viremia levels between the two groups during the early phase of infection was not associated with the host. Coreceptor usage for these two strains showed a larger coreceptor repertoire for SIVagm.sab92018, which is able to efficiently use CXCR4 in addition to CCR5, than for SIVagm.ver644, which showed a classical CCR5 coreceptor usage pattern. These differences could not be explained by different charges of the V3 loop for SIVagm.sab92018 and for SIVagm.ver644. In conclusion, our study showed that the extent of virus replication during the primary infection is primarily dependent on viral determinants. PMID:15858009

Pandrea, Ivona; Kornfeld, Christopher; Ploquin, Mickael J-Y; Apetrei, Cristian; Faye, Abdourahmane; Rouquet, Pierre; Roques, Pierre; Simon, François; Barré-Sinoussi, Françoise; Müller-Trutwin, Michaela C; Diop, Ousmane M

2005-05-01

131

New early Jurassic tetrapod assemblages constrain Triassic-Jurassic tetrapod extinction event.  

PubMed

The discovery of the first definitively correlated earliest Jurassic (200 million years before present) tetrapod assemblage (Fundy basin, Newark Supergroup, Nova Scotia) allows reevaluation of the duration of the Triassic-Jurassic tetrapod extinction event. Present are tritheledont and mammal-like reptiles, prosauropod, theropod, and ornithischian dinosaurs, protosuchian and sphenosuchian crocodylomorphs, sphenodontids, and hybodont, semionotid, and palaeonisciform fishes. All of the families are known from Late Triassic and Jurassic strata from elsewhere; however, pollen and spore, radiometric, and geochemical correlation indicate an early Hettangian age for these assemblages. Because all "typical Triassic" forms are absent from these assemblages, most Triassic-Jurassic tetrapod extinctions occurred before this time and without the introduction of new families. As was previously suggested by studies of marine invertebrates, this pattern is consistent with a global extinction event at the Triassic-Jurassic boundary. The Manicouagan impact structure of Quebec provides dates broadly compatible with the Triassic-Jurassic boundary and, following the impact theory of mass extinctions, may be implicated in the cause. PMID:3616622

Olsen, P E; Shubin, N H; Anders, M H

1987-08-28

132

Membrane remodeling, an early event in benzo[alpha]pyrene-induced apoptosis  

SciTech Connect

Benzo[alpha]pyrene (B[alpha]P) often serves as a model for mutagenic and carcinogenic polycyclic aromatic hydrocarbons (PAHs). Our previous work suggested a role of membrane fluidity in B[alpha]P-induced apoptotic process. In this study, we report that B[alpha]P modifies the composition of cholesterol-rich microdomains (lipid rafts) in rat liver F258 epithelial cells. The cellular distribution of the ganglioside-GM1 was markedly changed following B[alpha]P exposure. B[alpha]P also modified fatty acid composition and decreased the cholesterol content of cholesterol-rich microdomains. B[alpha]P-induced depletion of cholesterol in lipid rafts was linked to a reduced expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase). Aryl hydrocarbon receptor (AhR) and B[alpha]P-related H{sub 2}O{sub 2} formation were involved in the reduced expression of HMG-CoA reductase and in the remodeling of membrane microdomains. The B[alpha]P-induced membrane remodeling resulted in an intracellular alkalinization observed during the early phase of apoptosis. In conclusion, B[alpha]P altered the composition of plasma membrane microstructures through AhR and H{sub 2}O{sub 2} dependent-regulation of lipid biosynthesis. In F258 cells, the B[alpha]P-induced membrane remodeling was identified as an early apoptotic event leading to an intracellular alkalinization.

Tekpli, Xavier; Rissel, Mary; Huc, Laurence [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France); Catheline, Daniel [Laboratoire de Biochimie, INRA-Agrocampus Rennes, 35042 Rennes (France); Sergent, Odile [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France); Rioux, Vincent; Legrand, Philippe [Laboratoire de Biochimie, INRA-Agrocampus Rennes, 35042 Rennes (France); Holme, Jorn A. [Division of Environmental Medicine, Norwegian Institute of Public Health, P.O. Box 404 Torshov, N-4303 Oslo (Norway); Dimanche-Boitrel, Marie-Therese [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France); Lagadic-Gossmann, Dominique, E-mail: dominique.lagadic@univ-rennes1.f [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France)

2010-02-15

133

Early Spring, Severe Frost Events, and Drought Induce Rapid Carbon Loss in High Elevation Meadows  

PubMed Central

By the end of the 20th century, the onset of spring in the Sierra Nevada mountain range of California has been occurring on average three weeks earlier than historic records. Superimposed on this trend is an increase in the presence of highly anomalous “extreme” years, where spring arrives either significantly late or early. The timing of the onset of continuous snowpack coupled to the date at which the snowmelt season is initiated play an important role in the development and sustainability of mountain ecosystems. In this study, we assess the impact of extreme winter precipitation variation on aboveground net primary productivity and soil respiration over three years (2011 to 2013). We found that the duration of snow cover, particularly the timing of the onset of a continuous snowpack and presence of early spring frost events contributed to a dramatic change in ecosystem processes. We found an average 100% increase in soil respiration in 2012 and 2103, compared to 2011, and an average 39% decline in aboveground net primary productivity observed over the same time period. The overall growing season length increased by 57 days in 2012 and 61 days in 2013. These results demonstrate the dependency of these keystone ecosystems on a stable climate and indicate that even small changes in climate can potentially alter their resiliency. PMID:25207640

Arnold, Chelsea; Ghezzehei, Teamrat A.; Berhe, Asmeret Asefaw

2014-01-01

134

Early maternal deprivation enhances voluntary alcohol intake induced by exposure to stressful events later in life.  

PubMed

In the present study, we aimed to assess the impact of early life stress, in the form of early maternal deprivation (MD, 24?h on postnatal day, pnd, 9), on voluntary alcohol intake in adolescent male and female Wistar rats. During adolescence, from pnd 28 to pnd 50, voluntary ethanol intake (20%, v/v) was investigated using the two-bottle free choice paradigm. To better understand the relationship between stress and alcohol consumption, voluntary alcohol intake was also evaluated following additional stressful events later in life, that is, a week of alcohol cessation and a week of alcohol cessation combined with exposure to restraint stress. Female animals consumed more alcohol than males only after a second episode of alcohol cessation combined with restraint stress. MD did not affect baseline voluntary alcohol intake but increased voluntary alcohol intake after stress exposure, indicating that MD may render animals more vulnerable to the effects of stress on alcohol intake. During adolescence, when animals had free access to alcohol, MD animals showed lower body weight gain but a higher growth rate than control animals. Moreover, the higher growth rate was accompanied by a decrease in food intake, suggesting an altered metabolic regulation in MD animals that may interact with alcohol intake. PMID:25821601

Peñasco, Sara; Mela, Virginia; López-Moreno, Jose Antonio; Viveros, María-Paz; Marco, Eva M

2015-01-01

135

Differential Network Analyses of Alzheimer's Disease Identify Early Events in Alzheimer's Disease Pathology  

PubMed Central

In late-onset Alzheimer's disease (AD), multiple brain regions are not affected simultaneously. Comparing the gene expression of the affected regions to identify the differences in the biological processes perturbed can lead to greater insight into AD pathogenesis and early characteristics. We identified differentially expressed (DE) genes from single cell microarray data of four AD affected brain regions: entorhinal cortex (EC), hippocampus (HIP), posterior cingulate cortex (PCC), and middle temporal gyrus (MTG). We organized the DE genes in the four brain regions into region-specific gene coexpression networks. Differential neighborhood analyses in the coexpression networks were performed to identify genes with low topological overlap (TO) of their direct neighbors. The low TO genes were used to characterize the biological differences between two regions. Our analyses show that increased oxidative stress, along with alterations in lipid metabolism in neurons, may be some of the very early events occurring in AD pathology. Cellular defense mechanisms try to intervene but fail, finally resulting in AD pathology as the disease progresses. Furthermore, disease annotation of the low TO genes in two independent protein interaction networks has resulted in association between cancer, diabetes, renal diseases, and cardiovascular diseases. PMID:25147748

Perry, George; Ray, Monika

2014-01-01

136

Early spring, severe frost events, and drought induce rapid carbon loss in high elevation meadows.  

PubMed

By the end of the 20th century, the onset of spring in the Sierra Nevada mountain range of California has been occurring on average three weeks earlier than historic records. Superimposed on this trend is an increase in the presence of highly anomalous "extreme" years, where spring arrives either significantly late or early. The timing of the onset of continuous snowpack coupled to the date at which the snowmelt season is initiated play an important role in the development and sustainability of mountain ecosystems. In this study, we assess the impact of extreme winter precipitation variation on aboveground net primary productivity and soil respiration over three years (2011 to 2013). We found that the duration of snow cover, particularly the timing of the onset of a continuous snowpack and presence of early spring frost events contributed to a dramatic change in ecosystem processes. We found an average 100% increase in soil respiration in 2012 and 2103, compared to 2011, and an average 39% decline in aboveground net primary productivity observed over the same time period. The overall growing season length increased by 57 days in 2012 and 61 days in 2013. These results demonstrate the dependency of these keystone ecosystems on a stable climate and indicate that even small changes in climate can potentially alter their resiliency. PMID:25207640

Arnold, Chelsea; Ghezzehei, Teamrat A; Berhe, Asmeret Asefaw

2014-01-01

137

Early Maternal Deprivation Enhances Voluntary Alcohol Intake Induced by Exposure to Stressful Events Later in Life  

PubMed Central

In the present study, we aimed to assess the impact of early life stress, in the form of early maternal deprivation (MD, 24?h on postnatal day, pnd, 9), on voluntary alcohol intake in adolescent male and female Wistar rats. During adolescence, from pnd 28 to pnd 50, voluntary ethanol intake (20%, v/v) was investigated using the two-bottle free choice paradigm. To better understand the relationship between stress and alcohol consumption, voluntary alcohol intake was also evaluated following additional stressful events later in life, that is, a week of alcohol cessation and a week of alcohol cessation combined with exposure to restraint stress. Female animals consumed more alcohol than males only after a second episode of alcohol cessation combined with restraint stress. MD did not affect baseline voluntary alcohol intake but increased voluntary alcohol intake after stress exposure, indicating that MD may render animals more vulnerable to the effects of stress on alcohol intake. During adolescence, when animals had free access to alcohol, MD animals showed lower body weight gain but a higher growth rate than control animals. Moreover, the higher growth rate was accompanied by a decrease in food intake, suggesting an altered metabolic regulation in MD animals that may interact with alcohol intake.

Peñasco, Sara; Mela, Virginia; López-Moreno, Jose Antonio; Viveros, María-Paz; Marco, Eva M.

2015-01-01

138

Early events leading to erythroid differentiation in mouse Friend cells revealed by cell fusion experiments  

SciTech Connect

Cell fusion with two genetically marked Friend (murine erythroleukemia) cells has made it possible to characterize the very early events leading to erythroid differentiation, particularly the nature of reactions initiated by inducers such as dimethyl sulfoxide. We have found that brief exposure of Friend cells to dimethyl sulfoxide (as well as butyric acid or hexamethylene-bisacetamide) induces an early cellular activity required for erythroid differentiation which is detected only by fusion with ultraviolet-irradiated cells. The induction process of this activity consists of at least two distinct stages. In the first stage, the reaction proceeds without supply of metabolites from the medium and exhibits sensitivity to tumor promoters. The second stage is tightly coupled to cellular metabolic activity, notably protein synthesis. Under normal conditions, the induced activity is short-lived, suggesting turnover of the molecules responsible for this activity. There appears to be a signal produced following dimethyl sulfoxide pulse which acts as an inducer for this activity. The signal remains active for as long as 40 hr when protein synthesis is blocked.

Kaneko, T.; Nomura, S.; Oishi, M.

1984-05-01

139

Conditional human immunodeficiency virus type 1 protease mutants show no role for the viral protease early in virus replication.  

PubMed Central

The human immunodeficiency virus type 1 protease plays a critical role in the proteolytic processing of precursor polyproteins during virion maturation. Contradictory evidence has been obtained for a possible role for the protease early after infection, i.e., during DNA synthesis and/or integration. We have reexamined this question by using conditional mutants of the protease. In one set of experiments, protease mutants that confer a temperature-sensitive phenotype for processing were used to assess the need for protease activity early after infection. No significant difference from results with wild-type virus was seen when infections were carried out at either 35 or 40 degrees C. In a separate set of experiments, infections were carried out in the presence of a protease inhibitor. In this case, both wild-type virus and a drug-resistant variant were used, the latter as a control to ensure a specific effect of the inhibitor. Infection with either virus was not inhibited at drug concentrations that were up to 10-fold higher than those needed to inhibit intracellular processing by the viral protease. The results obtained by both of these experimental protocols provide evidence that the human immunodeficiency virus type 1 protease does not play a role early after infection. PMID:8709202

Kaplan, A H; Manchester, M; Smith, T; Yang, Y L; Swanstrom, R

1996-01-01

140

Early Cretaceous &Tertiary metamorphic events of the Pelagonian Zone in the E. Thessaly area, Greece  

NASA Astrophysics Data System (ADS)

The area occupied by what is known as the Pelagonian Zone is composed of several tectonic units showing different Alpine tectonometamorphic evolution. The lowermost unit is exposed as tectonic window in the Olympos and Ossa area and has been affected by a low grade metamorphism of post-Eocene age. Two main tectonometamorphic units are exposed as nappes over the Olympos window: the Makrynitsa-Ambelakia Unit (relevant to the Cyclades Blueschist Unit), and the Pelagonian Nappe. They show dominant differences on their mineral parageneses and, consequently, the P-T path during their metamorphic evolution. The Ambelakia-Makrynitsa Unit has experienced a Late Cretaceous/Early Tertiary HP/LT metamorphism. In glaucophane-bearing rocks glaucophane is in equilibrium with lawsonite, phengite (Si=3.55), chlorite and sphene defining a lawsonite blueschist facies metamorphism at T~280 0C and P~9 kbar. This HP/LT metamorphism had been terminated by 54 Ma (Lips et al., 1998). On the contrary, the Pelagonian Nappe provides evidence of two main Alpine metamorphic events. The first one of albite-epidote-amphibolite facies at T~ 500-550 0C and P~10-11 kbar led to the formation of garnet with prograde zoning pattern, coexisting with phengite, barroisite/Na-rich hornblende, epidote and albite. Rb-Sr phengite-whole rock dating on phengite biotite gneisses from the Ossa area yielded Early Cretaceous ages (114-110 Ma) for this metamorphic event. It is related to the obduction of the Axios ophiolites over the Pelagonian microcontinent. Riebeckite/glaucophane, stilpnomelane, chlorite and phengite neoblasts characterize the second metamorphic event at HP/LT conditions that is contemporaneous with the HP/LT metamorphism of the Makrynitsa-Ambelakia Unit. It is related to underthrusting of the Makrynitsa-Ambelakia Unit under the Pelagonian microcontinent. A retrograde greenschist facies overprinting affected both units during exhumation. Lips, A.L.W., White, S.H., Wijbrans, J.R., 1998: Tectonophysics, 298, 133-153.

Perraki, M.; Hoinkes, G.; Mposkos, E.; Thoeni, M.

2003-04-01

141

A catastrophic event in Lake Geneva region during the Early Bronze Age?  

NASA Astrophysics Data System (ADS)

Similarly to steep oceanic continental margins, lake slopes can collapse, producing large sublacustrine landslides and tsunamis. Lake sediments are excellent natural archives of such mass movements and their study allows the reconstructions of these prehistoric events, such as the 563 AD large tsunami over Lake Geneva (Kremer et al, 2012). In Lake Geneva, more than 100 km of high-resolution seismic reflection profiles reveal the late Holocene sedimentation history. The seismic record shows a succession of five large lens-shaped seismic units (A to I), characterized by transparent/chaotic seismic facies with irregular lower boundaries, and interpreted as mass-movement deposits. These units are interbedded with parallel, continuous and strong amplitude reflections, interpreted as the 'background' lake sediments. The oldest dated mass movement (Unit D) covers a surface of 22 km2 in the deep basin, near the city of Lausanne. This deposit has an estimated minimum volume of 0.18 km3 and thus was very likely tsunamigenic (Kremer et al, 2012). A 12-m-long sediment core confirms the seismic interpretation of the mass movement unit and shows that the uppermost 3 m of Unit D are characterized by deformed hemipelagic sediments topped by a 5 cm thick turbidite. This deposit can be classified as a slump whose scar can be interpreted in the seismic data and visualized by multibeam bathymetry. This slump of Lausanne was likely triggered by an earthquake but a spontaneous slope collapse cannot be excluded (Girardclos et al, 2007). Radiocarbon dating of plant macro-remains reveals that the unit D happened during Early Bronze Age. Three other mass wasting deposits occurred during the same time period and may have been triggered during the same event, either by a single earthquake or by a tsunami generated by the slump of Lausanne. Although the exact trigger mechanism of the all these mass-wasting deposits remains unknown, a tsunami likely generated by this event may have affected the installation of palafittic villages on the shore of Lake Geneva during the Early Bronze Age. References: Girardclos S., Schmidt O.T., Sturm M., Ariztegui D., Pugin A., Anselmetti F.S., 2007, The 1996 AD delta collapse and large turbidite in Lake Brienz, Marine Geology (241), 137-154. Kremer K., Simpson G., Girardclos S., 2012, Giant Lake Geneva tsunami in 563 AD, Nature Geoscience (5), 756-757. This project is financed by the Swiss National Foundation project nr. 200021-121666/1 and the Fondation Ernest Boninchi.

Kremer, Katrina; Yrro, Blé; Marillier, François; Hilbe, Michael; Corboud, Pierre; Rachoud-Schneider, Anne-Marie; Girardclos, Stéphanie

2013-04-01

142

Early pulmonary events of nose-only water pipe (shisha) smoking exposure in mice  

PubMed Central

Water pipe smoking (WPS) is increasing in popularity and prevalence worldwide. Convincing data suggest that the toxicants in WPS are similar to that of cigarette smoke. However, the underlying pathophysiologic mechanisms related to the early pulmonary events of WPS exposure are not understood. Here, we evaluated the early pulmonary events of nose-only exposure to mainstream WPS generated by commercially available honey flavored “moasel” tobacco. BALB/c mice were exposed to WPS 30 min/day for 5 days. Control mice were exposed using the same protocol to atmospheric air only. We measured airway resistance using forced oscillation technique, and pulmonary inflammation was evaluated histopathologically and by biochemical analysis of bronchoalveolar lavage (BAL) fluid and lung tissue. Lung oxidative stress was evaluated biochemically by measuring the level of reactive oxygen species (ROS), lipid peroxidation (LPO), reduced glutathione (GSH), catalase, and superoxide dismutase (SOD). Mice exposed to WPS showed a significant increase in the number of neutrophils (P < 0.05) and lymphocytes (P < 0.001). Moreover, total protein (P < 0.05), lactate dehydrogenase (P < 0.005), and endothelin (P < 0.05) levels were augmented in bronchoalveolar lavage fluid. Tumor necrosis factor ? (P < 0.005) and interleukin 6 (P < 0.05) concentrations were significantly increased in lung following the exposure to WPS. Both ROS (P < 0.05) and LPO (P < 0.005) in lung tissue were significantly increased, whereas the level and activity of antioxidants including GSH (P < 0.0001), catalase (P < 0.005), and SOD (P < 0.0001) were significantly decreased after WPS exposure, indicating the occurrence of oxidative stress. In contrast, airway resistance was not increased in WPS exposure. We conclude that subacute, nose-only exposure to WPS causes lung inflammation and oxidative stress without affecting pulmonary function suggesting that inflammation and oxidative stress are early markers of WPS exposure that precede airway dysfunction. Our data provide information on the initial steps involved in the respiratory effects of WPS, which constitute the underlying causal chain of reactions leading to the long-term effects of WPS. PMID:25780090

Nemmar, Abderrahim; Hemeiri, Ahmed Al; Hammadi, Naser Al; Yuvaraju, Priya; Beegam, Sumaya; Yasin, Javed; Elwasila, Mohamed; Ali, Badreldin H; Adeghate, Ernest

2015-01-01

143

Early pulmonary events of nose-only water pipe (shisha) smoking exposure in mice.  

PubMed

Water pipe smoking (WPS) is increasing in popularity and prevalence worldwide. Convincing data suggest that the toxicants in WPS are similar to that of cigarette smoke. However, the underlying pathophysiologic mechanisms related to the early pulmonary events of WPS exposure are not understood. Here, we evaluated the early pulmonary events of nose-only exposure to mainstream WPS generated by commercially available honey flavored "moasel" tobacco. BALB/c mice were exposed to WPS 30 min/day for 5 days. Control mice were exposed using the same protocol to atmospheric air only. We measured airway resistance using forced oscillation technique, and pulmonary inflammation was evaluated histopathologically and by biochemical analysis of bronchoalveolar lavage (BAL) fluid and lung tissue. Lung oxidative stress was evaluated biochemically by measuring the level of reactive oxygen species (ROS), lipid peroxidation (LPO), reduced glutathione (GSH), catalase, and superoxide dismutase (SOD). Mice exposed to WPS showed a significant increase in the number of neutrophils (P < 0.05) and lymphocytes (P < 0.001). Moreover, total protein (P < 0.05), lactate dehydrogenase (P < 0.005), and endothelin (P < 0.05) levels were augmented in bronchoalveolar lavage fluid. Tumor necrosis factor ? (P < 0.005) and interleukin 6 (P < 0.05) concentrations were significantly increased in lung following the exposure to WPS. Both ROS (P < 0.05) and LPO (P < 0.005) in lung tissue were significantly increased, whereas the level and activity of antioxidants including GSH (P < 0.0001), catalase (P < 0.005), and SOD (P < 0.0001) were significantly decreased after WPS exposure, indicating the occurrence of oxidative stress. In contrast, airway resistance was not increased in WPS exposure. We conclude that subacute, nose-only exposure to WPS causes lung inflammation and oxidative stress without affecting pulmonary function suggesting that inflammation and oxidative stress are early markers of WPS exposure that precede airway dysfunction. Our data provide information on the initial steps involved in the respiratory effects of WPS, which constitute the underlying causal chain of reactions leading to the long-term effects of WPS. PMID:25780090

Nemmar, Abderrahim; Hemeiri, Ahmed Al; Hammadi, Naser Al; Yuvaraju, Priya; Beegam, Sumaya; Yasin, Javed; Elwasila, Mohamed; Ali, Badreldin H; Adeghate, Ernest

2015-03-01

144

Subclinical alexithymia modulates early audio-visual perceptive and attentional event-related potentials  

PubMed Central

Introduction: Previous studies have highlighted the advantage of using audio–visual oddball tasks (instead of unimodal ones) in order to electrophysiologically index subclinical behavioral differences. Since alexithymia is highly prevalent in the general population, we investigated whether the use of various bimodal tasks could elicit emotional effects in low- vs. high-alexithymic scorers. Methods: Fifty students (33 females and 17 males) were split into groups based on low and high scores on the Toronto Alexithymia Scale (TAS-20). During event-related potential (ERP) recordings, they were exposed to three kinds of audio–visual oddball tasks: neutral-AVN—(geometrical forms and bips), animal-AVA—(dog and cock with their respective shouts), or emotional-AVE—(faces and voices) stimuli. In each condition, participants were asked to quickly detect deviant events occurring amongst a train of repeated and frequent matching stimuli (e.g., push a button when a sad face–voice pair appeared amongst a train of neutral face–voice pairs). P100, N100, and P300 components were analyzed: P100 refers to visual perceptive and attentional processing, N100 to auditory ones, and the P300 relates to response-related stages, involving memory processes. Results: High-alexithymic scorers presented a particular pattern of results when processing the emotional stimulations, reflected in early ERP components by increased P100 and N100 amplitudes in the emotional oddball tasks [P100: F(2, 48) = 20,319, p < 0.001; N100: F(2, 96) = 8,807, p = 0.001] as compared to the animal or neutral ones. Indeed, regarding the P100, subjects exhibited a higher amplitude in the AVE condition (8.717 ?V), which was significantly different from that observed during the AVN condition (4.382 ?V, p < 0.001). For the N100, the highest amplitude was found in the AVE condition (?4.035 ?V) and the lowest was observed in the AVN condition (?2.687 ?V, p = 0.003). However, no effect was found on the later P300 component. Conclusions: Our findings suggest that high-alexithymic scorers require heightened early attentional resources in comparison to low scorers, particularly when confronted with emotional bimodal stimuli. PMID:24624070

Delle-Vigne, Dyna; Kornreich, Charles; Verbanck, Paul; Campanella, Salvatore

2014-01-01

145

Extracellular matrix disruption is an early event in the pathogenesis of skeletal disease in mucopolysaccharidosis I.  

PubMed

Progressive skeletal and connective tissue disease represents a significant clinical burden in all of the mucopolysaccharidoses. Despite the introduction of enzyme replacement strategies for many of the mucopolysaccharidoses, symptomatology related to bone and joint disease appears to be recalcitrant to current therapies. In order to address these unmet medical needs a clearer understanding of skeletal and connective tissue disease pathogenesis is required. Historically the pathogenesis of the mucopolysaccharidoses has been assumed to directly relate to progressive storage of glycosaminoglycans. It is now apparent for many lysosomal storage disorders that more complex pathogenic mechanisms underlie patients' clinical symptoms. We have used proteomic and genome wide expression studies in the murine mucopolysaccharidosis I model to identify early pathogenic events occurring in micro-dissected growth plate tissue. Studies were conducted using 3 and 5-week-old mice thus representing a time at which no obvious morphological changes of bone or joints have taken place. An unbiased iTRAQ differential proteomic approach was used to identify candidates followed by validation with multiple reaction monitoring mass spectrometry and immunohistochemistry. These studies reveal significant decreases in six key structural and signaling extracellular matrix proteins; biglycan, fibromodulin, PRELP, type I collagen, lactotransferrin, and SERPINF1. Genome-wide expression studies in embryonic day 13.5 limb cartilage and 5 week growth plate cartilage followed by specific gene candidate qPCR studies in the 5week growth plate identified fourteen significantly deregulated mRNAs (Adamts12, Aspn, Chad, Col2a1, Col9a1, Hapln4, Lum, Matn1, Mmp3, Ogn, Omd, P4ha2, Prelp, and Rab32). The involvement of biglycan, PRELP and fibromodulin; all members of the small leucine repeat proteoglycan family is intriguing, as this protein family is implicated in the pathogenesis of late onset osteoarthritis. Taken as a whole, our data indicates that alteration of the extracellular matrix represents a very early event in the pathogenesis of the mucopolysaccharidoses and implies that biomechanical failure of chondro-osseous tissue may underlie progressive bone and joint disease symptoms. These findings have important therapeutic implications. PMID:25410057

Heppner, Jonathan M; Zaucke, Frank; Clarke, Lorne A

2015-02-01

146

Early Virological and Immunological Events in Asymptomatic Epstein-Barr Virus Infection in African Children  

PubMed Central

Epstein-Barr virus (EBV) infection often occurs in early childhood and is asymptomatic. However, if delayed until adolescence, primary infection may manifest as acute infectious mononucleosis (AIM), a febrile illness characterised by global CD8+ T-cell lymphocytosis, much of it reflecting a huge expansion of activated EBV-specific CD8+ T-cells. While the events of AIM have been intensely studied, little is known about how these relate to asymptomatic primary infection. Here Gambian children (14–18 months old, an age at which many acquire the virus) were followed for the ensuing six months, monitoring circulating EBV loads, antibody status against virus capsid antigen (VCA) and both total and virus-specific CD8+ T-cell numbers. Many children were IgG anti-VCA-positive and, though no longer IgM-positive, still retained high virus loads comparable to AIM patients and had detectable EBV-specific T-cells, some still expressing activation markers. Virus loads and the frequency/activation status of specific T-cells decreased over time, consistent with resolution of a relatively recent primary infection. Six children with similarly high EBV loads were IgM anti-VCA-positive, indicating very recent infection. In three of these donors with HLA types allowing MHC-tetramer analysis, highly activated EBV-specific T-cells were detectable in the blood with one individual epitope response reaching 15% of all CD8+ T-cells. That response was culled and the cells lost activation markers over time, just as seen in AIM. However, unlike AIM, these events occurred without marked expansion of total CD8+ numbers. Thus asymptomatic EBV infection in children elicits a virus-specific CD8+ T-cell response that can control the infection without over-expansion; conversely, in AIM it appears the CD8 over-expansion, rather than virus load per se, is the cause of disease symptoms. PMID:25816224

Jayasooriya, Shamanthi; de Silva, Thushan I.; Njie-jobe, Jainaba; Sanyang, Chilel; Leese, Alison M.; Bell, Andrew I.; McAulay, Karen A.; Yanchun, Peng; Long, Heather M.; Dong, Tao; Whittle, Hilton C.; Rickinson, Alan B.; Rowland-Jones, Sarah L.; Hislop, Andrew D.; Flanagan, Katie L.

2015-01-01

147

Over-expression of 14-3-3zeta is an early event in oral cancer  

PubMed Central

Background The functional and clinical significance of 14-3-3 proteins in human cancers remain largely undetermined. Earlier, we have reported differential expression of 14-3-3? mRNA in oral squamous cell carcinoma (OSCC) by differential display. Methods The clinical relevance of 14-3-3? protein in oral tumorigenesis was determined by immunohistochemistry in paraffin embedded sections of oral pre-malignant lesions (OPLs), OSCCs and histologically normal oral tissues and corroborated by Western Blotting. Co-immunoprecipitation assays were carried out to determine its association with NF?B, ?-catenin and Bcl-2. Results Intense immunostaining of 14-3-3? protein was observed in 61/89 (69%) OPLs and 95/120 (79%) OSCCs. Immunohistochemistry showed significant increase in expression of 14-3-3? protein from normal mucosa to OPLs to OSCCs (ptrend < 0.001). Significant increase in expression of 14-3-3? protein was observed as early as in hyperplasia (p = 0.009), with further elevation in moderate and severe dysplasia, that was sustained in OSCCs. These findings were validated by Western blotting. Using Co-immunoprecipitation, we demonstrated that 14-3-3? protein binds to NF?B, ?-catenin and Bcl-2, suggesting its involvement in cellular signaling, leading to proliferation of oral cancer cells. Conclusion Our findings suggest that over-expression of 14-3-3? is an early event in oral tumorigenesis and may have an important role in its development and progression. Thus, 14-3-3? may serve as an important molecular target for designing novel therapy for oral cancer. PMID:17764575

Matta, Ajay; Bahadur, Sudhir; Duggal, Ritu; Gupta, Siddhartha D; Ralhan, Ranju

2007-01-01

148

Impaired neurogenesis is an early event in the etiology of familial Alzheimer's disease in transgenic mice.  

PubMed

Formation of new neurons in the adult brain takes place in the subventricular zone and in the subgranule layer of the dentate gyrus throughout life. Neurogenesis is thought to play a role in hippocampus- and olfaction-dependent learning and memory. However, whether impairments in neurogenesis take place in learning and memory disorders, such as Alzheimer's disease, is yet to be established. Importantly, it remains to be elucidated whether neurogenic impairments play a role in the course of the disease or are the result of extensive neuropathology. We now report that transgenic mice harboring familial Alzheimer's disease-linked mutant APPswe/PS1DeltaE9 exhibit severe impairments in neurogenesis that are evident as early as 2 months of age. These mice exhibit a significant reduction in the proliferation of neural progenitor cells and their neuronal differentiation. Interestingly, levels of hyperphosphorylated tau, the cytotoxic precursor of the Alzheimer's disease hallmark neurofibrillary tangles, are particularly high in the neurogenic niches. Isolation of neural progenitor cells in culture reveals that APPswe/PS1DeltaE9-expressing neurospheres exhibit impaired proliferation and tau hyperphosphorylation compared with wildtype neurospheres isolated from nontransgenic littermates. This study suggests that impaired neurogenesis is an early critical event in the course of Alzheimer's disease that may underlie memory impairments, at least in part, and exacerbate neuronal vulnerability in the hippocampal formation and olfaction circuits. Furthermore, impaired neurogenesis is the result of both intrinsic pathology in neural progenitor cells and extrinsic neuropathology in the neurogenic niches. Finally, hyperphosphorylation of the microtubule-associated protein tau, a critical player in cell proliferation, neuronal maturation, and axonal transport, is a major contributor to impaired neurogenesis in Alzheimer's disease. PMID:20209626

Demars, Michael; Hu, Yuan-Shih; Gadadhar, Archana; Lazarov, Orly

2010-08-01

149

Impact of early and late winter icing events on sub-arctic dwarf shrubs.  

PubMed

Polar regions are predicted to undergo large increases in winter temperature and an increased frequency of freeze-thaw cycles, which can cause ice layers in the snow pack and ice encasement of vegetation. Early or late winter timing of ice encasement could, however, modify the extent of damage caused to plants. To determine impacts of the date of ice encasement, a novel field experiment was established in sub-arctic Sweden, with icing events simulated in January and March 2008 and 2009. In the subsequent summers, reproduction, phenology, growth and mortality, as well as physiological indicators of leaf damage were measured in the three dominant dwarf shrubs: Vaccinium uliginosum, Vaccinium vitis-idaea and Empetrum nigrum. It was hypothesised that January icing would be more damaging compared to March icing due to the longer duration of ice encasement. Following 2 years of icing, E. nigrum berry production was 83% lower in January-iced plots compared to controls, and V. vitis-idaea electrolyte leakage was increased by 69%. Conversely, electrolyte leakage of E. nigrum was 25% lower and leaf emergence of V. vitis-idaea commenced 11 days earlier in March-iced plots compared to control plots in 2009. There was no effect of icing on any of the other parameters measured, indicating that overall these study species have moderate to high tolerance to ice encasement. Even much longer exposure under the January icing treatment does not clearly increase damage. PMID:23574610

Preece, C; Phoenix, G K

2013-04-10

150

A Time Scale for Major Events in Early Mars Crustal Evolution  

NASA Technical Reports Server (NTRS)

The population of visible and buried impact basins > 200 km diameter revealed by high resolution gridded MOLA data and the cumulative frequency curves derived for these pvide a basis for a chronology of major events in early martian history. The relative chronology can be given in terms of N(200) crater retention ages; 'absolute ages' can be assigued using the Hartmann-Neukum (H&N) model chronology. In terms of billions of H&N years, the crustal dichotomy formed by large impact basins at 4.12 +/- 0.08 BYA (N(200) = 3.0-3.2) and the global magnetic field died at about or slightly before the same time (4.15 +/- 0.08 BYA (N(200) = 3.5). In this chronology, the buried lowlands are approx. 120 my younger than the buried highlands, approx. 160 my younger than the highlands overall and approx. 340 my younger than the oldest crater retention surface we see, defined by the largest impact basins.

Frey, Herbert V.

2004-01-01

151

Eye coding mechanisms in early human face event-related potentials.  

PubMed

In humans, the N170 event-related potential (ERP) is an integrated measure of cortical activity that varies in amplitude and latency across trials. Researchers often conjecture that N170 variations reflect cortical mechanisms of stimulus coding for recognition. Here, to settle the conjecture and understand cortical information processing mechanisms, we unraveled the coding function of N170 latency and amplitude variations in possibly the simplest socially important natural visual task: face detection. On each experimental trial, 16 observers saw face and noise pictures sparsely sampled with small Gaussian apertures. Reverse-correlation methods coupled with information theory revealed that the presence of the eye specifically covaries with behavioral and neural measurements: the left eye strongly modulates reaction times and lateral electrodes represent mainly the presence of the contralateral eye during the rising part of the N170, with maximum sensitivity before the N170 peak. Furthermore, single-trial N170 latencies code more about the presence of the contralateral eye than N170 amplitudes and early latencies are associated with faster reaction times. The absence of these effects in control images that did not contain a face refutes alternative accounts based on retinal biases or allocation of attention to the eye location on the face. We conclude that the rising part of the N170, roughly 120-170 ms post-stimulus, is a critical time-window in human face processing mechanisms, reflecting predominantly, in a face detection task, the encoding of a single feature: the contralateral eye. PMID:25385898

Rousselet, Guillaume A; Ince, Robin A A; van Rijsbergen, Nicola J; Schyns, Philippe G

2014-01-01

152

Point mutations of ras oncogenes are an early event in thyroid tumorigenesis.  

PubMed

Identifying the nature of the genetic mutations in thyroid neoplasms and their prevalence in the various tumor phenotypes is critical to understanding their pathogenesis. Mutational activation of ras oncogenes in human tumors occurs predominantly through point mutations in two functional regions of the molecules, codons 12, 13 (GTP-binding domain) or codon 61 (GTPase domain). We examined the prevalence of point mutations in codons 12, 13, and 61 of the oncogenes K-ras, N-ras, and H-ras in benign and malignant human thyroid tumors by hybridization of PCR-amplified tumor DNA with synthetic oligodeoxynucleotide probes. None of the eight normal thyroid tissues harbored point mutations. Four of nineteen nodules from multinodular goiters (21%), 6/24 microfollicular adenomas (25%), 3/14 papillary carcinomas (21%), and 0/3 follicular carcinomas contained ras point mutations. The predominant mutation was a valine for glycine substitution in codon 12 of H-ras. None of the multinodular goiter tumors known to be polyclonal (and thus due to hyperplasia) had point mutations, whereas one of the two monoclonal adenomas arising in nodular glands contained in H-ras codon 12 valine substitution, which was confirmed by sequencing the tumor DNA. These data show that ras activation is about equally prevalent in benign and malignant thyroid neoplasms, and thus may be an early event in the tumorigenic process. PMID:2283998

Namba, H; Rubin, S A; Fagin, J A

1990-10-01

153

Early Life Events Carry Over to Influence Pre-Migratory Condition in a Free-Living Songbird  

Microsoft Academic Search

Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1st year survival and

Greg W. Mitchell; Christopher G. Guglielmo; Nathaniel T. Wheelwright; Corey R. Freeman-Gallant; D. Ryan Norris

2011-01-01

154

BioSystems xxx (2005) xxxxxx A network model of early events in epidermal growth factor receptor  

E-print Network

BioSystems xxx (2005) xxx­xxx A network model of early events in epidermal growth factor receptor.06.014 BIO-2484; No. of Pages 16 #12;2 M.L. Blinov et al. / BioSystems xxx (2005) xxx­xxx lent character

Blinov, Michael L.

155

EFFECT OF ARSENICALS ON THE EXPRESSION OF CELL CYCLE PROTEINS AND EARLY SIGNALING EVENTS IN PRIMARY HUMAN KERATINOCYTES.  

EPA Science Inventory

Effect of Arsenicals on the Expression of Cell Cycle Proteins and Early Signaling Events in Primary Human Keratinocytes. Mudipalli, A, Owen R. D. and R. J. Preston, Environmental Carcinogenesis Division, USEPA, RTP, NC 27711. Environmental exposure to arsenic is a m...

156

Emergence of infectious simian virus 40 whose AT tract in the replication origin/early promoter region is substituted by cellular or viral DNAs.  

PubMed

In simian virus 40 (SV40) and several other polyomaviruses, the TATA box of the early promoter is embedded in an AT tract that is also an essential part of the replication origin. We generated an 'AT trap', an SV40 genome lacking the AT tract and unable to grow in CV-1 monkey cells. Co-transfection of the AT trap with oligonucleotides containing AT tracts of human polyomaviruses, a poly(A?:?T) tract or variants of the SV40 WT sequence all restored infectious virus. In a transfection of the AT trap without a suitable oligonucleotide, an AT-rich segment was incorporated, stemming either from bovine (calf serum) or monkey (host cell) DNA. Similarly, when cells were grown with human serum, a human DNA segment was captured by SV40 to substitute for the missing AT stretch. We conclude that the virus is quite opportunistic in accepting heterologous substitutes, and that even low-abundance DNA from serum can be incorporated into the viral genome. PMID:25385869

Keiser, Simon; Schmidt, Katharina; Bethge, Tobias; Steiger, Julia; Hirsch, Hans H; Schaffner, Walter; Georgiev, Oleg

2015-03-01

157

The level of claudin-7 is reduced as an early event in colorectal carcinogenesis  

PubMed Central

Background Compromised epithelial barriers are found in dysplastic tissue of the gastrointestinal tract. Claudins are transmembrane proteins important for tight junctions. Claudins regulate the paracellular transport and are crucial for maintaining a functional epithelial barrier. Down-regulation of the oncogenic serine protease, matriptase, induces leakiness in epithelial barriers both in vivo and in vitro. We found in an in-silico search tight co-regulation between matriptase and claudin-7 expression. We have previously shown that the matriptase expression level decreases during colorectal carcinogenesis. In the present study we investigated whether claudin-7 expression is likewise decreased during colorectal carcinogenesis, thereby causing or contributing to the compromised epithelial leakiness of dysplastic tissue. Methods The mRNA level of claudin-7 (CLDN7) was determined in samples from 18 healthy individuals, 100 individuals with dysplasia and 121 colorectal cancer patients using quantitative real time RT-PCR. In addition, immunohistochemical stainings were performed on colorectal adenomas and carcinomas, to confirm the mRNA findings. Results A 2.7-fold reduction in the claudin-7 mRNA level was found when comparing the biopsies from healthy individuals with the biopsies of carcinomas (p < 0.001). Reductions in the claudin-7 mRNA levels were also detected in mild/moderate dysplasia (p < 0.001), severe dysplasia (p < 0.01) and carcinomas (p < 0.01), compared to a control sample from the same individual. The decrease at mRNA level was confirmed at the protein level by immunohistochemical stainings. Conclusions Our results show that the claudin-7 mRNA level is decreased already as an early event in colorectal carcinogenesis, probably contributing to the compromised epithelial barrier in adenomas. PMID:21310043

2011-01-01

158

Phase noise reveals early category-specific modulation of the event-related potentials  

PubMed Central

Previous studies have found that the amplitude of the early event-related potential (ERP) components evoked by faces, such as N170 and P2, changes systematically as a function of noise added to the stimuli. This change has been linked to an increased perceptual processing demand and to enhanced difficulty in perceptual decision making about faces. However, to date it has not yet been tested whether noise manipulation affects the neural correlates of decisions about face and non-face stimuli similarly. To this end, we measured the ERPs for faces and cars at three different phase noise levels. Subjects performed the same two-alternative age-discrimination task on stimuli chosen from young–old morphing continua that were created from faces as well as cars and were calibrated to lead to similar performances at each noise-level. Adding phase noise to the stimuli reduced performance and enhanced response latency for the two categories to the same extent. Parallel to that, phase noise reduced the amplitude and prolonged the latency of the face-specific N170 component. The amplitude of the P1 showed category-specific noise dependence: it was enhanced over the right hemisphere for cars and over the left hemisphere for faces as a result of adding phase noise to the stimuli, but remained stable across noise levels for cars over the left and for faces over the right hemisphere. Moreover, noise modulation altered the category-selectivity of the N170, while the P2 ERP component, typically associated with task decision difficulty, was larger for the more noisy stimuli regardless of stimulus category. Our results suggest that the category-specificity of noise-induced modulations of ERP responses starts at around 100 ms post-stimulus. PMID:24795689

Németh, Kornél; Kovács, Petra; Vakli, Pál; Kovács, Gyula; Zimmer, Márta

2014-01-01

159

Kinetic modelling of DNA replication initiation in budding yeast.  

PubMed

DNA replication is restricted to a specific time window of the cell cycle, called S phase. Successful progression through S phase requires replication to be properly regulated to ensure that the entire genome is duplicated exactly once, without errors, in a timely fashion. As a result, DNA replication has evolved into a tightly regulated process involving the coordinated action of numerous factors that function in all phases of the cell cycle. Biochemical mechanisms driving the eukaryotic cell division cycle have been the subject of a number of mathematical models. However, cell cycle networks reported in literature so far have not addressed the steps of DNA replication events. In particular, the assembly of the replication machinery is crucial for the timing of S phase. This event, called "initiation", which occurs in late M / early G1 of the cell cycle, starts with the assembly of the pre-replicative complex (pre-RC) at the origins of replication on the DNA. Its activation depends on the availability of different kinase complexes, cyclin-dependent kinases (CDKs) and Dbf-dependent kinase (DDK), which phosphorylate specific components of the pre-RC to convert it into the pre-initiation complex (pre-IC). We have developed an ODE-based model of the network responsible for this process in budding yeast by using mass-action kinetics. We considered all steps from the assembly of the first components at the DNA replication origin up to the active replisome that recruits the polymerases and verified the computational dynamics with the available literature data. Our results highlighted the link between activation of CDK and DDK and the step-by-step formation of both pre-RC and pre-IC, suggesting S-CDK (Cdk1-Clb5,6) to be the main regulator of the process. PMID:22081585

Barberis, Matteo; Spiesser, Thomas W; Klipp, Edda

2010-01-01

160

Replication of the Chicken  Globin Locus: Early-Firing Origins at the 5' HS4 Insulator and the  - and  AGlobin Genes Show Opposite Epigenetic Modifications  

Microsoft Academic Search

Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken -globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the -globin domain from an adjacent

Marie-Noelle Prioleau; Marie-Claude Gendron; Olivier Hyrien

2003-01-01

161

Caffeine-Induced Uncoupling of Mitosis from the Completion of DNA Replication in Mammalian Cells  

Microsoft Academic Search

Caffeine was shown to induce mitotic events in mammalian cells before DNA replication (S phase) was completed. Synchronized BHK cells that were arrested in early S phase underwent premature chromosome condensation, nuclear envelope breakdown, morphological ``rounding up,'' and mitosis-specific phosphoprotein synthesis when they were exposed to caffeine. These mitotic responses occurred only after the cells had entered S phase and

Robert Schlegel; Arthur B. Pardee

1986-01-01

162

Organic geochemistry of the early Toarcian oceanic anoxic event in Hawsker Bottoms, Yorkshire, England  

NASA Astrophysics Data System (ADS)

A comprehensive organic geochemical investigation of the Hawsker Bottoms outcrop section in Yorkshire, England has provided new insights about environmental conditions leading into and during the Toarcian oceanic anoxic event (T-OAE; ?183 Ma). Rock-Eval and molecular analyses demonstrate that the section is uniformly within the early oil window. Hydrogen index (HI), organic petrography, polycyclic aromatic hydrocarbon (PAH) distributions, and tricyclic terpane ratios mark a shift to a lower relative abundance of terrigenous organic matter supplied to the sampling locality during the onset of the T-OAE and across a lithological transition. Unlike other ancient intervals of anoxia and extinction, biomarker indices of planktonic community structure do not display major changes or anomalous values. Depositional environment and redox indicators support a shift towards more reducing conditions in the sediment porewaters and the development of a seasonally stratified water column during the T-OAE. In addition to carotenoid biomarkers for green sulfur bacteria (GSB), we report the first occurrence of okenane, a marker of purple sulfur bacteria (PSB), in marine samples younger than ?1.64 Ga. Based on modern observations, a planktonic source of okenane's precursor, okenone, would require extremely shallow photic zone euxinia (PZE) and a highly restricted depositional environment. However, due to coastal vertical mixing, the lack of planktonic okenone production in modern marine sulfidic environments, and building evidence of okenone production in mat-dwelling Chromatiaceae, we propose a sedimentary source of okenone as an alternative. Lastly, we report the first parallel compound-specific ?C13 record in marine- and terrestrial-derived biomarkers across the T-OAE. The ?C13 records of short-chain n-alkanes, acyclic isoprenoids, and long-chain n-alkanes all encode negative carbon isotope excursions (CIEs), and together, they support an injection of isotopically light carbon that impacted both the atmospheric and marine carbon reservoirs. To date, molecular ?C13 records of the T-OAE display a negative CIE that is smaller in magnitude compared to the bulk organic ?C13 excursion. Although multiple mechanisms could explain this observation, our molecular, petrographic, and Rock-Eval data suggest that variable mixing of terrigenous and marine organic matter is an important factor affecting the bulk organic ?C13 records of the T-OAE.

French, K. L.; Sepúlveda, J.; Trabucho-Alexandre, J.; Gröcke, D. R.; Summons, R. E.

2014-03-01

163

Low ABCB1 Gene Expression Is an Early Event in Colorectal Carcinogenesis  

PubMed Central

The ABCB1/MDR1 gene product ABCB1/P-glycoprotein is implicated in the development of colorectal cancer (CRC). NFKB1 encodes transcription factors regulating expression of a number of genes including ABCB1. We have previously found association between the ABCB1 C-rs3789243-T polymorphism and CRC risk and interactions between the ABCB1 C-rs3789243-T and C3435T polymorphisms and meat intake in relation to CRC risk (Andersen, BMC Cancer, 2009, 9, 407). ABCB1 and NFKB1 mRNA levels were assessed in intestinal tissue from 122 CRC cases, 101 adenoma cases (12 with severe dysplasia, 89 with mild-moderate dysplasia) and from 18 healthy individuals, together with gene polymorphisms in ABCB1 and NFKB1. ABCB1 mRNA levels were highest in the healthy individuals and significantly lower in mild/moderate and severe dysplasia tissue (P<0.05 for both), morphologically normal tissues close to the tumour (P<0.05), morphologically normal tissue at a distance from the tumour (P<0.05) and CRC tissue (P<0.001). Furthermore, ABCB1 mRNA levels were lower in adenomas and carcinomas compared to morphologically normal tissue from the same individuals (P<0.01). The ABCB1 C-rs3789243-T and NFKB1 -94ins/del homozygous variant genotypes were associated with low ABCB1 mRNA levels in morphologically normal sigmoid tissue from adenoma cases (P<0.05 for both). NFKB1 mRNA levels were lower in both tumour and normal tissue from cancer patients (P<0.001) as compared to healthy individuals but we were unable to show association between NFKB1 -94ins/del genotype and NFKB1 mRNA levels. This study suggests that low ABCB1 mRNA levels are an early event in CRC development and that the two polymorphisms affect ABCB1 mRNA levels whereas low NFKB1 mRNA levels occur later in carcinogenesis. Low ABCB1 protein levels may promote colorectal carcinogenesis through increasing intracellular exposure to carcinogenic ABCB1 substrates. PMID:23977225

Andersen, Vibeke; Vogel, Ulla; Godiksen, Sine; Frenzel, Franz B.; Sæbø, Mona; Hamfjord, Julian

2013-01-01

164

Microgravity Effects on the Early Events of Biological Nitrogen Fixation in Medicago Truncatula: Results from the SyNRGE Experiment  

NASA Technical Reports Server (NTRS)

SyNRGE (Symbiotic Nodulation in a Reduced Gravity Environment) was a sortie mission on STS-135 in the Biological Research in Canisters (BRIC) hardware to study the effect of microgravity on a plant-microbe symbiosis resulting in biological nitrogen fixation. Medicago truncatula, a model species for th legume family, was inoculated with its bacterial symbiont, Sinorhizobium meliloti, to observe early biomolecular events associated with infection and nodulation in Petri Dish Fixation Units (PDFU's).

Stutte, Gary W.; Roberts, Michael

2012-01-01

165

Monosomy 22 and trisomy 14 may be early events in the tumorigenesis of adult granulosa cell tumor.  

PubMed

The finding of monosomy 22 and trisomy 14 in a case of adult type of granulosa-thecoma cell tumor and the available information from the literature allow for the hypothesis that, especially monosomy 22, but also trisomy 14, may be early events in the tumorigenesis of adult sex cord-stromal tumors in general, and of granulosa-thecoma cell tumors in particular. PMID:10432935

Van den Berghe, I; Dal Cin, P; De Groef, K; Michielssen, P; Van den Berghe, H

1999-07-01

166

580 KY DURATION OF THE EARLY JURASSIC FLOOD BASALT EVENT IN EASTERN NORTH AMERICA ESTIMATED USING MILANKOVITCH CYCLOSTRATIGRAPHY  

Microsoft Academic Search

Early Jurassic-age tholeiitic flood basalts of the Newark Supergroup of the eastern United States are interbedded with strata composed of a hierarchy of lake-level sedimentary cycles of Milankovitch climate cycle origin. Based principally on the Newark basin section, known from continuous core, these cycles constrain the duration of the extrusive and associated intrusive event in exposed basins to 580±10 Ky

Paul E. Olsen; Roy W. Schlische; Michael S. Fedosh

167

Minimal region sufficient for genome dimerization in the human immunodeficiency virus type 1 virion and its potential roles in the early stages of viral replication.  

PubMed

It has been suggested that the dimer initiation site/dimer linkage sequence (DIS/DLS) region of the human immunodeficiency virus type 1 (HIV-1) RNA genome plays an important role at various stages of the viral life cycle. Recently we found that the duplication of the DIS/DLS region on viral RNA caused the production of partially monomeric RNAs in virions, indicating that this region indeed mediates RNA-RNA interaction. In this report, we followed up on this finding to identify the necessary and sufficient region for RNA dimerization in the virion of HIV-1. The region thus identified was 144 bases in length, extending from the junction of R/U5 and U5/L stem-loops to the end of SL4. The trans-acting responsive element, polyadenylation signal, primer binding site, upper stem-loop of U5/L, and SL2 were not needed for the function of this region. The insertion of this region into the ectopic location of the viral genome did not affect the level of virion production by transfection. However, the resultant virions contained monomerized genomes and showed drastic reductions in infectivity. A reduction was observed especially in the reverse transcription process. An attempt to generate a replication-competent virus with monomerized genome was performed by the long-term culture of mutant virus-infected cells. All recovered viruses were wild-type revertants, indicating a fatal defect of the mutation. These results suggest that genome dimerization or DIS/DLS itself also plays an important role in the early stages of virus infection. PMID:17507464

Sakuragi, Jun-Ichi; Sakuragi, Sayuri; Shioda, Tatsuo

2007-08-01

168

Modeling Temporal Processes in Early Spacecraft Design: Application of Discrete-Event Simulations for Darpa's F6 Program  

NASA Technical Reports Server (NTRS)

While the ability to model the state of a space system over time is essential during spacecraft operations, the use of time-based simulations remains rare in preliminary design. The absence of the time dimension in most traditional early design tools can however become a hurdle when designing complex systems whose development and operations can be disrupted by various events, such as delays or failures. As the value delivered by a space system is highly affected by such events, exploring the trade space for designs that yield the maximum value calls for the explicit modeling of time.This paper discusses the use of discrete-event models to simulate spacecraft development schedule as well as operational scenarios and on-orbit resources in the presence of uncertainty. It illustrates how such simulations can be utilized to support trade studies, through the example of a tool developed for DARPA's F6 program to assist the design of "fractionated spacecraft".

Dubos, Gregory F.; Cornford, Steven

2012-01-01

169

Prediction of solar particle event proton doses using early dose rate measurements.  

PubMed

A methodology for predicting solar particle event doses using Bayesian inference is being developed. As part of this development, we have tested criteria for categorization of new solar particle events (SPE) using calculated asymptotic doses and dose rates for the 22 SPEs that occurred in 2001. In 9 out of 22 events, our criteria for categorization would have over-predicted the range of asymptotic doses in which the tested events would have fallen. In two cases, our methodology under-predicted the dose range in which the event would have fallen. In order to better predict a new event's group category and thus, to better restrict the Bayesian inference predictive model parameter space, we have reexamined our dose rate criteria for categorization of new events. We report the updating of the grouping criteria using data from the 22 SPEs of 2001, as well as five additional SPEs. Using the revised grouping criteria, we present an analysis of group categorization prediction results for the first ten SPEs of 2002. PMID:15835054

Neal, John S; Townsend, Lawrence W

2005-01-01

170

Middle Devonian to Early Carboniferous event stratigraphy of Devils Gate and Northern Antelope Range sections, Nevada, U.S.A  

USGS Publications Warehouse

The classic type section of the Devils Gate Limestone at Devils Gate Pass is situated on the eastern slope of a proto-Antler forebulge that resulted from convergence of the west side of the North American continent with an ocean plate. The original Late Devonian forebulge, the site of which is now located between Devils Gate Pass and the Northern Antelope Range, separated the continental-rise to deep-slope Woodruff basin on the west from the backbulge Pilot basin on the east. Two connections between these basins are recorded by deeper water siltstone beds at Devils Gate; the older one is the lower tongue of the Woodruff Formation, which forms the basal unit of the upper member of the type Devils Gate, and the upper one is the overlying, thin lower member of the Pilot Shale. The forebulge and the backbulge Pilot basin originated during the middle Frasnian (early Late Devonian) Early hassi Zone, shortly following the Alamo Impact within the punctata Zone in southern Nevada. Evidence of this impact is recorded by coeval and reworked shocked quartz grains in the Northern Antelope Range and possibly by a unique bypass-channel or megatsunami-uprush sandy diamictite within carbonate-platform rocks of the lower member of the type Devils Gate Limestone. Besides the Alamo Impact and three regional events, two other important global events are recorded in the Devils Gate section. The semichatovae eustatic rise, the maximum Late Devonian flooding event, coincides with the sharp lithogenetic change at the discordant boundary above the lower member of the Devils Gate Limestone. Most significantly, the Devils Gate section contains the thickest and most complete rock record in North America across the late Frasnian linguiformis Zone mass extinction event. Excellent exposures include not only the extinction shale, but also a younger. Early triangularis Zone tsunamite breccia, produced by global collapse of carbonate platforms during a shallowing event that continued into the next younger Famennian Stage. The Northern Antelope Range section is located near the top of the west side of the proto-Antler forebulge. Because of its unusual, tectonically active location, unmatched at any other Nevada localities, this section records only four regional and global events during a timespan slightly longer than that of the Devils Gate section. The global semichatovae rise and late Frasnian mass extinction event are largely masked because of the depositional complexities resulting from this location.

Sandberg, C.A.; Morrow, J.R.; Poole, F.G.; Ziegler, W.

2003-01-01

171

Is epigenetics an important link between early life events and adult disease?  

Technology Transfer Automated Retrieval System (TEKTRAN)

Epigenetic mechanisms provide one potential explanation for how environmental influences in early life cause long-term changes in chronic disease susceptibility. Whereas epigenetic dysregulation is increasingly implicated in various rare developmental syndromes and cancer, the role of epigenetics in...

172

1 Modeling and Analysis of Early Events in T-Lymphocyte Antigen ...  

E-print Network

improve the understanding of the complex regulatory mechanisms controlling the early ... Cellular signaling pathways comprise complex and interconnected networks of ... duration of TCR-antigen engagement influences the cellular response. ...... activities of membrane-proximal protein tyrosine kinases and phosphatases.

Greg

173

Major events in the late Precambrian to early Triassic geohistory of the Arabian Peninsula  

SciTech Connect

The late Precambrian to Early Triassic of the Arabian Peninsula occur in five supergroups. Their geohistory resulted from sedimentation along fluvial to midshelf facies tracts, eustatic oscillation and periodic uplift. The first supergroup, Plate Precambrian-Middle Cambrian, includes the Siq/Salib and Yatib formations. Deposited by north-eastward-flowing braided streams, they eroded and buried an Arabian shield topography. The Saq Formation lies in angular unconformity on the Siq which documents early Middle Cambrian uplift. Supergroup two, Middle Cambrian-middle Caradocian, the Burj and Saq formations, the Hanadir, Kahfah, and Ra'an members, Qasim Formation, were deposited on a stable continental margin in fluvio-deltaic to midshelf settings. Coastal onlap occurred in the Middle Cambrian, early Llanvirn, middle Llandeilo and early Caradoc. Middle Caradocian uplift deeply eroded parts of central and southern Arabia. Supergroup three of middle Caradocian-early Llandoverian are the Quwarah Member, Qasim Formation and the Zarqa/Sarah formations. They were deposited in a fluvio-deltaic shallow shelf. Late Ashgill uplift, combined with glacially induced sea level lowering, incised valleys up to 2000 ft (610 m) deep. Supergroup four, early Llandovery-Middle Carboniferous, includes the Qalibah, Tawil, Jauf, Jubah and Berwath formations. They were deposited in a fluvio-deltaic marine, river dominated system. The Quysaiba and Sharawra members, Qalibah Formation, were the offshore clays and prodelta sands, the Tawil-Jubah were the fluvial to delta front, and the Berwath the delta plain facies. Deep pre-Tawil erosion documents late Silurian-Early Devonian uplift. The fifth supergroup are the Juwayl, Unayzah, Khuff and Sudair formations. The first two units were deposited in a glacio-fluvial system which eroded and infilled a Hercynian topography. The Khuff transgression occurred during the Artinsklan-Tartarian and the Early Triassic regressive Sudair documents renewed uplift.

Stump, T.E.; Connally, T.C.; Van der Eem, J.G.L.A. (Saudi Aramco, Dhahran (Saudi Arabia))

1993-09-01

174

Elevation of circulating branched-chain amino acids is an early event in human pancreatic adenocarcinoma development.  

PubMed

Most patients with pancreatic ductal adenocarcinoma (PDAC) are diagnosed with advanced disease and survive less than 12 months. PDAC has been linked with obesity and glucose intolerance, but whether changes in circulating metabolites are associated with early cancer progression is unknown. To better understand metabolic derangements associated with early disease, we profiled metabolites in prediagnostic plasma from individuals with pancreatic cancer (cases) and matched controls from four prospective cohort studies. We find that elevated plasma levels of branched-chain amino acids (BCAAs) are associated with a greater than twofold increased risk of future pancreatic cancer diagnosis. This elevated risk was independent of known predisposing factors, with the strongest association observed among subjects with samples collected 2 to 5 years before diagnosis, when occult disease is probably present. We show that plasma BCAAs are also elevated in mice with early-stage pancreatic cancers driven by mutant Kras expression but not in mice with Kras-driven tumors in other tissues, and that breakdown of tissue protein accounts for the increase in plasma BCAAs that accompanies early-stage disease. Together, these findings suggest that increased whole-body protein breakdown is an early event in development of PDAC. PMID:25261994

Mayers, Jared R; Wu, Chen; Clish, Clary B; Kraft, Peter; Torrence, Margaret E; Fiske, Brian P; Yuan, Chen; Bao, Ying; Townsend, Mary K; Tworoger, Shelley S; Davidson, Shawn M; Papagiannakopoulos, Thales; Yang, Annan; Dayton, Talya L; Ogino, Shuji; Stampfer, Meir J; Giovannucci, Edward L; Qian, Zhi Rong; Rubinson, Douglas A; Ma, Jing; Sesso, Howard D; Gaziano, John M; Cochrane, Barbara B; Liu, Simin; Wactawski-Wende, Jean; Manson, JoAnn E; Pollak, Michael N; Kimmelman, Alec C; Souza, Amanda; Pierce, Kerry; Wang, Thomas J; Gerszten, Robert E; Fuchs, Charles S; Vander Heiden, Matthew G; Wolpin, Brian M

2014-10-01

175

Early Decrease in Respiration and Uncoupling Event Independent of Cytochrome c Release in PC12 Cells Undergoing Apoptosis  

PubMed Central

Cytochrome c is a key molecule in mitochondria-mediated apoptosis. It also plays a pivotal role in cell respiration. The switch between these two functions occurs at the moment of its release from mitochondria. This process is therefore extremely relevant for the fate of the cell. Since cytochrome c mediates respiration, we studied the changes in respiratory chain activity during the early stages of apoptosis in order to contribute to unravel the mechanisms of cytochrome c release. We found that, during staurosporine (STS)- induced apoptosis in PC12 cells, respiration is affected before the release of cytochrome c, as shown by a decrease in the endogenous uncoupled respiration and an uncoupling event, both occurring independently of cytochrome c release. The decline in the uncoupled respiration occurs also upon Bcl-2 overexpression (which inhibits cytochrome c release), while the uncoupling event is inhibited by Bcl-2. We also observed that the first stage of nuclear condensation during STS-induced apoptosis does not depend on the release of cytochrome c into the cytosol and is a reversibile event. These findings may contribute to understand the mechanisms affecting mitochondria during the early stages of apoptosis and priming them for the release of apoptogenic factors. PMID:22666257

Berghella, Libera; Ferraro, Elisabetta

2012-01-01

176

A novel preclinical method to quantitatively evaluate early-stage metastatic events at the murine blood-brain barrier.  

PubMed

The observation that approximately 15% of women with disseminated breast cancer will develop symptomatic brain metastases combined with treatment guidelines discouraging single-agent chemotherapeutic strategies facilitates the desire for novel strategies aimed at outright brain metastasis prevention. Effective and robust preclinical methods to evaluate early-stage metastatic processes, brain metastases burden, and overall mean survival are lacking. Here, we develop a novel method to quantitate early metastatic events (arresting and extravasation) in addition to traditional end time-point parameters such as tumor burden and survival in an experimental mouse model of brain metastases of breast cancer. Using this method, a reduced number of viable brain-seeking metastatic cells (from 3,331 ± 263 cells/brain to 1,079 ± 495 cells/brain) were arrested in brain one week postinjection after TGF? knockdown. Treatment with a TGF? receptor inhibitor, galunisertib, reduced the number of arrested cells in brain to 808 ± 82 cells/brain. Furthermore, we observed a reduction in the percentage of extravasated cells (from 63% to 30%) compared with cells remaining intralumenal when TGF? is knocked down or inhibited with galunisertib (40%). The observed reduction of extravasated metastatic cells in brain translated to smaller and fewer brain metastases and resulted in prolonged mean survival (from 36 days to 62 days). This method opens up potentially new avenues of metastases prevention research by providing critical data important to early brain metastasis of breast cancer events. PMID:25348853

Adkins, Chris E; Nounou, Mohamed I; Mittapalli, Rajendar K; Terrell-Hall, Tori B; Mohammad, Afroz S; Jagannathan, Rajaganapathi; Lockman, Paul R

2015-01-01

177

Predicting Addiction Potential on the Basis of Early Traumatic Events, Dissociative Experiences, and Suicide Ideation  

PubMed Central

Background: There is a great deal of medical literature suggesting that substance use disorder is a serious clinical concern, affecting general population and associated with considerable economic, societal, and personal costs. Objectives: This study sought to clarify the relationship between early trauma, dissociative experience, and suicide ideation as predictive factors of active and passive addiction potential (A/PAP) in high-school students. Patients and Methods: Three hundred students with the mean age of 15.72 y were selected via multistage random sampling. All participants were asked to complete Iranian addiction potential scale, early trauma inventory, dissociative experiences scale, and Beck’s suicide ideation scale. Analyzing data was done using canonical correlation. Results: Structural coefficients showed that the pattern of high scores in A/PAP correlates with the pattern of high scores in early trauma, dissociative experience and suicide ideation. The findings of the study showed that the combination of low A/PAP can probably decrease the likelihood of early trauma, dissociative experience and suicide ideation. Conclusions: Early trauma, dissociative experience, and suicide ideation can predict A/PAP and explain the considerable variance of survival index. PMID:25741480

Sajadi, Seyedeh Fatemeh; Hajjari, Zahra; Zargar, Yadollah; Mehrabizade Honarmand, Mahnaz; Arshadi, Nasrin

2014-01-01

178

Self-enhancing bias in personality, subjective happiness, and perception of life-events: A replication in a Korean aged sample  

Microsoft Academic Search

Interrelations among self-enhancing bias in personality, subjective happiness, and perception of life-events have been examined. Elderly people with higher subjective happiness, compared to those with lower happiness, were predicted to have higher self-enhancing bias in personality, and perceive negative life-events less negatively. One hundred and forty elderly Korean citizens were assessed as to their tendency to self-enhance and to perceive

J. Y. Lee; G. S. Im

2007-01-01

179

Riding the Wave to Reach the Masses: Natural Events in Early Twentieth Century Portuguese Daily Press  

ERIC Educational Resources Information Center

This paper brings together science communicated in newspapers in Portugal by looking at how news on natural events were communicated in two different newspapers--the capital newspaper "Diario de Noticias" ("Daily News") and the "Diario dos Acores" ("Azores Daily"). In particular, we look at how the 1900 solar eclipse, a hot topic throughout…

Simoes, Ana; Carneiro, Ana; Diogo, Maria Paula

2012-01-01

180

Exposure to Potentially Traumatic Events in Early Childhood: Differential Links to Emergent Psychopathology  

ERIC Educational Resources Information Center

Research NeedsObjective: To examine associations between exposure to potentially traumatic events (PTEs) and clinical patterns of symptoms and disorders in preschool children. Method: Two hundred and thirteen referred and non-referred children, ages 24 to 48 months (MN = 34.9, SD = 6.7 months) were studied. Lifetime exposure to PTEs (family…

Briggs-Gowan, Margaret J.; Carter, Alice S.; Clark, Roseanne; Augustyn, Marilyn; McCarthy, Kimberly J.; Ford, Julian D.

2010-01-01

181

Traumatic and Stressful Events in Early Childhood: Can Treatment Help Those at Highest Risk?  

ERIC Educational Resources Information Center

Objective: This study involves a reanalysis of data from a randomized controlled trial to examine whether child-parent psychotherapy (CPP), an empirically based treatment focusing on the parent-child relationship as the vehicle for child improvement, is efficacious for children who experienced multiple traumatic and stressful life events (TSEs).…

Ippen, Chandra Ghosh; Harris, William W.; Van Horn, Patricia; Lieberman, Alicia F.

2011-01-01

182

New Early Jurassic Tetrapod Assemblages Constrain Triassic-Jurassic Tetrapod Extinction Event  

Microsoft Academic Search

The discovery of the first definitively correlated earliest Jurassic (200 million years before present) tetrapod assemblage (Fundy basin, Newark Supergroup, Nova Scotia) allows reevaluation of the duration of the Triassic-Jurassic tetrapod extinction event. Present are tritheledont and mammal-like reptiles, prosauropod, theropod, and ornithischian dinosaurs, protosuchian and sphenosuchian crocodylomorphs, sphenodontids, and hybodont, semionotid, and palaeonisciform fishes. All of the families are

P. E. Olsen; N. H. Shubin; M. H. Anders

1987-01-01

183

The "terminal Triassic catastrophic extinction event" in perspective: a review of carboniferous through Early Jurassic terrestrial vertebrate extinction patterns  

USGS Publications Warehouse

A catastrophic terminal Triassic extinction event among terrestrial vertebrates is not supported by available evidence. The current model for such an extinction is based on at least eight weak or untenable assumptions: (1) a terminal Triassic extinction-inducing asteroid impact occurred, (2) a terminal Triassic synchronous mass extinction of terrestrial vertebrates occurred, (3) a concurrent terminal Triassic marine extinction occurred, (4) all terrestrial vertebrate families have similar diversities and ecologies, (5) changes in familial diversity can be gauged accurately from the known fossil record, (6) extinction of families can be compared through time without normalizing for changes in familial diversity through time, (7) extinction rates can be compared without normalizing for differing lengths of geologic stages, and (8) catastrophic mass extinctions do not select for small size. These assumptions have resulted in unsupportable and (or) erroneous conclusions. Carboniferous through Early Jurassic terrestrial vertebrate families mostly have evolution and extinction patterns unlike the vertebrate evolution and extinction patterns during the terminal Cretaceous event. Only the Serpukhovian (mid Carboniferous) extinction event shows strong analogy to the terminal Cretaceous event. Available data suggest no terminal Triassic extinction anomaly, but rather a prolonged and nearly steady decline in the global terrestrial vertebrate extinction rate throughout the Triassic and earliest Jurassic. ?? 1992.

Weems, R.E.

1992-01-01

184

Early childhood behavior trajectories and the likelihood of experiencing a traumatic event and PTSD by young adulthood  

PubMed Central

This study modeled children's trajectories of teacher rated aggressive-disruptive behavior problems assessed at six time points between the ages of 6 and 11 and explored the likelihood of being exposed to DSM-IV qualifying traumatic events and posttraumatic stress disorder (PTSD) in 837 urban first graders (71% African American) followed-up for 15 years. Childhood trajectories of chronic high or increasing aggressive-disruptive behavior distinguished males more likely to be exposed to an assaultive violence event as compared to males with a constant course of low behavior problems (ORchronic high = 2.8, 95% CI = 1.3, 6.1 and ORincreasing = 4.5, 95% CI = 2.3, 9.1, respectively). Among females, exposure to traumatic events and vulnerability to PTSD did not vary by behavioral trajectory. The findings illustrate that repeated assessments of disruptive classroom behavior during early school years identifies more fully males at increased risk for PTSD-level traumatic events, than a single measure at school entry does. PMID:19139797

Schaeffer, Cindy M.; Petras, Hanno; Ialongo, Nicholas S.; Breslau, Naomi

2015-01-01

185

End-Binding Protein 1 (EB1) Up-regulation is an Early Event in Colorectal Carcinogenesis  

PubMed Central

End-binding protein (EB1) is a microtubule protein that binds to the tumor suppressor adenomatous polyposis coli (APC). While EB1 is implicated as a potential oncogene, its role in cancer progression is unknown. Therefore, we analyzed EB1/APC expression at the earliest stages of colorectal carcinogenesis and in the uninvolved mucosa ("field effect") of human and animal tissue. We also performed siRNA-knockdown in colon cancer cell lines. EB1 is up-regulated in early and field carcinogenesis in the colon, and the cellular/nano-architectural effect of EB1 knockdown depended on the genetic context. Thus, dysregulation of EB1 is an important early event in colon carcinogenesis. PMID:24492008

Stypula-Cyrus, Yolanda; Mutyal, Nikhil N.; Cruz, Mart Angelo Dela; Kunte, Dhananjay P.; Radosevich, Andrew J.; Wali, Ramesh; Roy, Hemant K.; Backman, Vadim

2014-01-01

186

Early Top-Down Influences on Bistable Perception Revealed by Event-Related Potentials  

ERIC Educational Resources Information Center

A longstanding debate exists in the literature concerning bottom-up vs. top-down influences on bistable perception. Recently, a technique has been developed to measure early changes in brain activity (via ERPs) related to perceptual reversals (Kornmeier & Bach, 2004). An ERP component, the reversal negativity (RN) has been identified, and is…

Pitts, Michael A.; Gavin, William J.; Nerger, Janice L.

2008-01-01

187

Introduction: Cortical event-related potentials and early language development: Variations with age and nutrition  

Technology Transfer Automated Retrieval System (TEKTRAN)

There is increasing evidence in the form of language-relevant sensory processing and discrimination that the foundations for speech perception are present at birth and are subject to significant modification during the first year of life. However, charting the course of early language development is...

188

Paleomagnetic and Geochronologic Data from Central Asia: Inferences for Early Paleozoic Tectonic Evolution and Timing of Worldwide Glacial Events  

NASA Astrophysics Data System (ADS)

The Neoproterozoic to early Paleozoic Ural-Mongol belt that runs through Central Asia is crucial for determining the enigmatic amalgamation of microcontinents that make up the Eurasian subcontinent. Two unique models have been proposed for the evolution of Ural-Mongol belt. One involves a complex assemblage of cratonic blocks that have collided and rifted apart during diachronous opening and closing of Neoproterozoic to Devonian aged ocean basins. The opposing model of Sengor and Natal"in proposes a long-standing volcanic arc system that connected Central Asian blocks with the Baltica continent. The Aktau-Mointy and Dzabkhan microcontinents in Kazakhstan and Central Mongolia make up the central section of the Ural-Mongol belt, and both contain glacial sequences characteristic of the hypothesized snowball earth event. These worldwide glaciations are currently under considerable debate, and paleomagnetic data from these microcontients are a useful contribution to the snowball controversy. We have sampled volcanic and sedimentary sequences in Central Mongolia, Kazakhstan and Kyrgyzstan for paleomagnetic and geochronologic study. U-Pb data, 13C curves and abundant fossil records place age constraints on sequences that contain glacial deposits of the hypothesized snowball earth events. Carbonates in the Zavkhan Basin in Mongolia are likely remagnetized, but fossil evidence within the sequence suggests a readjusted age control on two glacial events that were previously labeled as Sturtian and Marinoan. U-Pb ages from both Kazakhstan and Mongolian volcanic sequences imply a similar evolution history of the areas as part of the Ural-Mongol fold belt, and these ages paired with paleomagnetic and 13C records have important tectonic implications. We will present these data in order to place better constraints on the Precambrian to early Paleozoic tectonic evolution of Central Asia and the timing of glacial events recorded in the area.

Gregory, L. C.; Meert, J. G.; Levashova, N.; Grice, W. C.; Gibsher, A.; Rybanin, A.

2007-12-01

189

Regulation of mouse satellite DNA replication time.  

PubMed Central

The satellite DNA sequences located near the centromeric regions of mouse chromosomes replicate very late in S in both fibroblast and lymphocyte cells and are heavily methylated at CpG residues. F9 teratocarcinoma cells, on the other hand, contain satellite sequences which are undermethylated and replicate much earlier in S. DNA methylation probably plays some role in the control of satellite replication time since 5-azacytidine treatment of RAG fibroblasts causes a dramatic temporal shift of replication to mid S. In contrast to similar changes accompanying the inactivation of the X-chromosome, early replication of satellite DNA is not associated with an increase in local chromosomal DNase I sensitivity. Fusion of F9 with mouse lymphocytes caused a dramatic early shift in the timing of the normally late replicating lymphocyte satellite heterochromatin, suggesting that trans-activating factors may be responsible for the regulation of replication timing. Images PMID:3366119

Selig, S; Ariel, M; Goitein, R; Marcus, M; Cedar, H

1988-01-01

190

Ar-Ar Dating of Martian Meteorite, Dhofar 378: An Early Shock Event?  

NASA Technical Reports Server (NTRS)

Martian meteorite, Dhofar 378 (Dho378) is a basaltic shergottite from Oman, weighing 15 g, and possessing a black fusion crust. Chemical similarities between Dho378 and the Los Angeles 001 shergottite suggests that they might have derived from the same Mars locale. The plagioclase in other shergottites has been converted to maskelenite by shock, but Dho378 apparently experienced even more intense shock heating, estimated at 55-75 GPa. Dho378 feldspar (approximately 43 modal %) melted, partially flowed and vesiculated, and then partially recrystallized. Areas of feldspathic glass are appreciably enriched in K, whereas individual plagioclases show a range in the Or/An ratio of approximately 0.18-0.017. Radiometric dating of martian shergottites indicate variable formation times of 160-475 Myr, whereas cosmic ray exposure (CRE) ages of shergottites indicate most were ejected from Mars within the past few Myr. Most determined Ar-39-Ar-40 ages of shergottites appear older than other radiometric ages because of the presence of large amounts of martian atmosphere or interior Ar-40. Among all types of meteorites and returned lunar rocks, the impact event that initiated the CRE age very rarely reset the Ar-Ar age. This is because a minimum time and temperature is required to facilitate Ar diffusion loss. It is generally assumed that the shock-texture characteristics in martian meteorites were produced by the impact events that ejected the rocks from Mars, although the time of these shock events (as opposed to CRE ages) are not directly dated. Here we report Ar-39-Ar-40 dating of Dho378 plagioclase. We suggest that the determined age dates the intense shock heating event this meteorite experienced, but that it was not the impact that initiated the CRE age.

Park, J.; Bogard, D. D.

2006-01-01

191

Analysis of the viral replication cycle of adenovirus serotype 2 after inactivation by free chlorine.  

PubMed

Free chlorine is effective at inactivating a wide range of waterborne viral pathogens including human adenovirus (HAdV), but the mechanisms by which free chlorine inactivates HAdV and other human viruses remain to be elucidated. Such advances in fundamental knowledge are key for development of new disinfection technologies and novel sensors to detect infectious viruses in drinking water. We developed and tested a quantitative assay to analyze several steps in the HAdV replication cycle upon increasing free chlorine exposure. We used quantitative polymerase chain reaction (qPCR) to detect HAdV genomic DNA as a means to quantify attachment and genome replication of untreated and treated virions. Also, we used quantitative reverse-transcription PCR (RT-qPCR) to quantify the transcription of E1A (first early protein) and hexon mRNA. We compared these replication cycle events to virus inactivation kinetics to determine what stage of the virus replication cycle was inhibited as a function of free chlorine exposure. We observed that adenovirus inactivated at levels up to 99.99% by free chlorine still attached to host cells; however, viral DNA synthesis and early E1A and late hexon gene transcription were inhibited. We conclude that free chlorine exposure interferes with a replication cycle event occurring postbinding but prior to early viral protein synthesis. PMID:25756747

Gall, Aimee M; Shisler, Joanna L; Mariñas, Benito J

2015-04-01

192

Early events in rabies virus infection of the central nervous system in skunks ( Mephitis mephitis )  

Microsoft Academic Search

Twenty-four striped skunks were inoculated intramuscularly (long digital extensor muscle of right pelvic limb) with street\\u000a rabies virus. Groups of two clinically normal skunks were killed at various times after inoculation; skunks that developed\\u000a rabies were killed in early stages of the clinical signs. Four clinically normal skunks (numbered 1–4) had slight infection\\u000a in lumbar spinal ganglia, spinal cord and

K. M. Charlton; G. A. Casey; A. I. Wandeler; S. Nadin-Davis

1995-01-01

193

An early warning indicator for atmospheric blocking events using transfer operators  

E-print Network

The existence of persistent midlatitude atmospheric flow regimes with time-scales larger than 5-10 days and indications of preferred transitions between them motivates to develop early warning indicators for such regime transitions. In this paper, we use a hemispheric barotropic model together with estimates of transfer operators on a reduced phase space to develop an early warning indicator of the zonal to blocked flow transition in this model. It is shown that, the spectrum of the transfer operators can be used to study the slow dynamics of the flow as well as the non-Markovian character of the reduction. The slowest motions are thereby found to have time scales of three to six weeks and to be associated with meta-stable regimes (and their transitions) which can be detected as almost-invariant sets of the transfer operator. From the energy budget of the model, we are able to explain the meta-stability of the regimes and the existence of preferred transition paths. Even though the model is highly simplified, the skill of the early warning indicator is promising, suggesting that the transfer operator approach can be used in parallel to an operational deterministic model for stochastic prediction or to assess forecast uncertainty.

Alexis Tantet; Fiona R. van der Burgt; Henk A. Dijkstra

2015-03-14

194

An early warning indicator for atmospheric blocking events using transfer operators  

NASA Astrophysics Data System (ADS)

The existence of persistent midlatitude atmospheric flow regimes with time-scales larger than 5-10 days and indications of preferred transitions between them motivates to develop early warning indicators for such regime transitions. In this paper, we use a hemispheric barotropic model together with estimates of transfer operators on a reduced phase space to develop an early warning indicator of the zonal to blocked flow transition in this model. It is shown that the spectrum of the transfer operators can be used to study the slow dynamics of the flow as well as the non-Markovian character of the reduction. The slowest motions are thereby found to have time scales of three to six weeks and to be associated with meta-stable regimes (and their transitions) which can be detected as almost-invariant sets of the transfer operator. From the energy budget of the model, we are able to explain the meta-stability of the regimes and the existence of preferred transition paths. Even though the model is highly simplified, the skill of the early warning indicator is promising, suggesting that the transfer operator approach can be used in parallel to an operational deterministic model for stochastic prediction or to assess forecast uncertainty.

Tantet, Alexis; van der Burgt, Fiona R.; Dijkstra, Henk A.

2015-03-01

195

Age Dating Merger Events in Early Type Galaxies via the Detection of AGB Light  

NASA Technical Reports Server (NTRS)

A thorough statistical analysis of the J-H vs. H-K color plane of all detected early type galaxies in the 2MASS catalog with velocities less than 5000 km/s has been performed. This all sky survey is not sensitive to one particular galactic environment and therefore a representative range of early type galaxy environments have been sampled. Virtually all N-body simulation so major mergers produces a central starburst due to rapid collection of gas. This central starburst is of sufficient amplitude to change the stellar population in the central regions of the galaxy. Intermediate age populations are given away by the presence of AGB stars which will drive the central colors redder in H-K relative to the J- H baseline. This color anomaly has a lifetime of 2-5 billion years depending on the amplitude of the initial starburst Employing this technique on the entire 2MASS sample (several hundred galaxies) reveals that the AGB signature occurs less than 1% of the time. This is a straightforward indication that virtually all nearby early type galaxies have not had a major merger occur within the last few billion years.

Bothun, G.

2005-01-01

196

Early Holocene catastrophic mass-wasting event and fan-delta development on the Hua-tung coast, eastern Taiwan  

NASA Astrophysics Data System (ADS)

Landslides and debris flows rarely occurred during historical times in the tectonically active Coastal Range of eastern Taiwan. This topographic stability, however, contrasts greatly with the widespread existence of terraced alluvial fans and fan-deltas on the Hua-tung coast which fringes the range. This study focuses on the two largest fan-terrace systems on the Hua-tung coast, both of which consist of alluvial fans (plane-view areas up to 8 km 2) larger than their contributing catchments. Stratigraphic data show that both systems were in sandy, wave-dominated settings during de-glacial times. The systems were then disturbed by a catastrophic landslide/debris-flow event (or events), which brought enormous amounts of gravel (Facies Gm) into the systems, deforming previously-deposited marine sands (Facies Sm) and shallowing the seafloor. The combined Gm/Sm complex yields multiple radiocarbon dates ranging from 11.3 to 8.3 ka cal BP, with a cluster around 8.6 ka cal BP. This mass-wasting event has been unique since the emergence of its contributing catchment 0.2-0.3 Ma ago. The low frequency of such an event could reflect the great resistance of rock mass in the source areas to weathering and erosion. The common blockage of valley floors by giant-boulder piles, which limits channel incision and sediment transport, could also increase the apparent stability of the mountain. The trigger of landslides in the Coastal Range has been linked to large earthquakes. Additionally, we propose that the great magnitude and duration of the observed early Holocene event were caused by the contemporaneous prolonged rainfall (and/or high frequency of typhoons) associated with the East Asian summer monsoon maximum.

Hsieh, Meng-Long; Liew, Ping-Mei; Chen, Hua-Wen

2011-11-01

197

Serotonin Transporter-Linked Polymorphic Region (5-HTTLPR) Genotype and Stressful Life Events Interact to Predict Preschool-Onset Depression: A Replication and Developmental Extension  

ERIC Educational Resources Information Center

Background: Scientific enthusiasm about gene × environment interactions, spurred by the 5-HTTLPR (serotonin transporter-linked polymorphic region) × SLEs (stressful life events) interaction predicting depression, have recently been tempered by sober realizations of small effects and meta-analyses reaching opposing conclusions. These mixed findings…

Bogdan, Ryan; Agrawal, Arpana; Gaffrey, Michael S.; Tillman, Rebecca; Luby, Joan L.

2014-01-01

198

Magnetostratigraphy of Plio-Pleistocene sediments in a 1700-m core from Osaka Bay, southwestern Japan and short geomagnetic events in the middle Matuyama and early Brunhes chrons  

Microsoft Academic Search

A magnetic polarity stratigraphy spanning more than the past 3.2 Myr was determined for a long 1545 m continuous sedimentary sequence of marine, fluvial, and lacustrine deposits from the Osaka Basin, southwestern Japan. Additionally two short geomagnetic reversal events were identified: a short event at about 0.69 Ma lasting for about 7 kyr in the early Brunhes chron around the

D. K Biswas; M Hyodo; Y Taniguchi; M Kaneko; S Katoh; H Sato; Y Kinugasa; K Mizuno

1999-01-01

199

Pp. 119-134 in Major Events in Early Vertebrate Evolution: Palaeontology, Phylogeny, Genetics and Development (Per E. Ahlberg, Editor). London, Taylor & Francis. 2001.Chapter 8  

E-print Network

Pp. 119-134 in Major Events in Early Vertebrate Evolution: Palaeontology, Phylogeny, Genetics and early history of vertebrates are assem- bled and analysed for phylogeny and times of divergence fossil evidence of bilaterian animals. By inference, urochordates, hemichordates, and echinoderms

Hedges, Blair

200

Ar-39-Ar-40 Evidence for Early Impact Events on the LL Parent Body  

NASA Technical Reports Server (NTRS)

We determined Ar-39-Ar-40 ages of eight LL chondrites, and one igneous inclusion from an LL chondrite, with the object of understanding the thermal history of the LL-chondrite parent body. The meteorites in this study have a range of petrographic types from LL3.3 to LL6, and shock stages from S1 to S4. These meteorites reveal a range of K-Ar ages from 23.66 to 24.50 Ga, and peak ages from 23.74 to 24.55 Ga. Significantly, three of the eight chondrites (LL4, 5, 6) have K-Ar ages of -4.27 Ga. One of these (MIL99301) preserves an Ar-39-Ar-40 age of 4.23 +/- 0.03 Ga from low-temperature extractions, and an older age of 4.52 +/- 0.08 Ga from the highest temperature extractions. In addition, an igneous-textured impact melt DOM85505,22 has a peak Ar-39-Ar-40 age of >= 4.27 Ga. We interpret these results as evidence for impact events that occurred at about 4.27 Ga on the LL parent body that produced local impact melts, reset the Ar-39-Ar-40 ages of some meteorites, and exhumed (or interred) others, resulting in a range of cooling ages. The somewhat younger peak age of 3.74 Ga from GR095658 (LL3.3) suggests an additional impact event close to timing of impact-reset ages of some other ordinary chondrites between 3.6-3.8 Ga. The results from MIL99301 suggest that some apparently unshocked (Sl) chondrites may have substantially reset Ar-39-Ar-40 ages. A previous petrographic investigation of MIL99301 suggested that reheating to temperatures less than or equal to type 4 petrographic conditions (600C) caused fractures in olivine to anneal, resulting in a low apparent shock stage of S1 (unshocked). The Ar-39-Ar-40 age spectrum of MIL99301 is consistent with this interpretation. Older ages from high-T extractions may date an earlier impact event at 4.52 +/- 0.08 Ga, whereas younger ages from lower-T extractions date a later impact event at 4.23 Ar-39-Ar-40 0.03 Ga that may have caused annealing of feldspar and olivine

Dixon, E. T.; Bogard, D. D.; Garrison, D. H.; Rubin, A. E.

2006-01-01

201

Loss of pectin is an early event during infection of cocoyam roots by Pythium myriotylum.  

PubMed

Cocoyam (Xanthosoma sagittifolium) is an important tuber crop in most tropical zones of Africa and America. In Cameroon, its cultivation is hampered by a soil-borne fungus Pythium myriotylum which is responsible for root rot disease. The mechanism of root colonisation by the fungus has yet to be elucidated. In this study, using microscopical and immunocytochemical methods, we provide a new evidence regarding the mode of action of the fungus and we describe the reaction of the plant to the early stages of fungal invasion. We show that the fungal attack begins with the colonisation of the peripheral and epidermal cells of the root apex. These cells are rapidly lost upon infection, while cortical and stele cells are not. Labelling with the cationic gold, which binds to negatively charged wall polymers such as pectins, is absent in cortical cells and in the interfacial zone of the infected roots while it is abundant in the cell walls of stele cells. A similar pattern of labelling is also found when using the anti-pectin monoclonal antibody JIM5, but not with anti-xyloglucan antibodies. This suggests that early during infection, the fungus causes a significant loss of pectin probably via degradation by hydrolytic enzymes that diffuse and act away from the site of attack. Additional support for pectin loss is the demonstration, via sugar analysis, that a significant decrease in galacturonic acid content occurred in infected root cell walls. In addition, we demonstrate that one of the early reactions of X. sagittifolium to the fungal invasion is the formation of wall appositions that are rich in callose and cellulose. PMID:16160840

Boudjeko, Thaddée; Andème-Onzighi, Christine; Vicré, Maïté; Balangé, Alain-Pierre; Ndoumou, Denis Omokolo; Driouich, Azeddine

2006-01-01

202

Risk of Cerebrovascular Events in Elderly Patients After Radiation Therapy Versus Surgery for Early-Stage Glottic Cancer  

SciTech Connect

Purpose: Comprehensive neck radiation therapy (RT) has been shown to increase cerebrovascular disease (CVD) risk in advanced-stage head-and-neck cancer. We assessed whether more limited neck RT used for early-stage (T1-T2 N0) glottic cancer is associated with increased CVD risk, using the Surveillance, Epidemiology, and End Results (SEER)-Medicare linked database. Methods and Materials: We identified patients ?66 years of age with early-stage glottic laryngeal cancer from SEER diagnosed from 1992 to 2007. Patients treated with combined surgery and RT were excluded. Medicare CPT codes for carotid interventions, Medicare ICD-9 codes for cerebrovascular events, and SEER data for stroke as the cause of death were collected. Similarly, Medicare CPT and ICD-9 codes for peripheral vascular disease (PVD) were assessed to serve as an internal control between treatment groups. Results: A total of 1413 assessable patients (RT, n=1055; surgery, n=358) were analyzed. The actuarial 10-year risk of CVD was 56.5% (95% confidence interval 51.5%-61.5%) for the RT cohort versus 48.7% (41.1%-56.3%) in the surgery cohort (P=.27). The actuarial 10-year risk of PVD did not differ between the RT (52.7% [48.1%-57.3%]) and surgery cohorts (52.6% [45.2%-60.0%]) (P=.89). Univariate analysis showed an increased association of CVD with more recent diagnosis (P=.001) and increasing age (P=.001). On multivariate Cox analysis, increasing age (P<.001) and recent diagnosis (P=.002) remained significantly associated with a higher CVD risk, whereas the association of RT and CVD remained not statistically significant (HR=1.11 [0.91-1.37,] P=.31). Conclusions: Elderly patients with early-stage laryngeal cancer have a high burden of cerebrovascular events after surgical management or RT. RT and surgery are associated with comparable risk for subsequent CVD development after treatment in elderly patients.

Hong, Julian C.; Kruser, Tim J. [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin (United States); Gondi, Vinai [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin (United States); Central Dupage Hospital Cancer Center, Warrenville, Illinois (United States); Mohindra, Pranshu; Cannon, Donald M.; Harari, Paul M. [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin (United States); Bentzen, Søren M., E-mail: bentzen@humonc.wisc.edu [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin (United States)

2013-10-01

203

An early warning indicator for atmospheric blocking events using transfer operators  

E-print Network

The existence of persistent midlatitude atmospheric flow regimes with time-scales larger than 5-10 days and indications of preferred transitions between them motivates to develop early warning indicators for such regime transitions. In this paper, we use a hemispheric barotropic model together with estimates of transfer operators on a reduced phase space to develop an early warning indicator of the zonal to blocked flow transition in this model. It is shown that, the spectrum of the transfer operators can be used to study the slow dynamics of the flow as well as the non-Markovian character of the reduction. The slowest motions are thereby found to have time scales of three to six weeks and to be associated with meta-stable regimes (and their transitions) which can be detected as almost-invariant sets of the transfer operator. From the energy budget of the model, we are able to explain the meta-stability of the regimes and the existence of preferred transition paths. Even though the model is highly simplified,...

Tantet, Alexis; Dijkstra, Henk A

2015-01-01

204

High-affinity RNA Aptamers Against the HIV-1 Protease Inhibit Both In Vitro Protease Activity and Late Events of Viral Replication  

PubMed Central

HIV-1 aspartyl protease (PR) plays a key role in virion morphogenesis, underscoring the effectiveness of protease inhibitors (PI). Despite their utility, side effects and drug-resistance remains a problem. We report the development of RNA aptamers as inhibitors of HIV-1 PR for potential use in anti-HIV gene therapy. Employing Systematic Evolution of Ligands by Exponential Enrichment (SELEX), we isolated four unique families of anti-HIV-1 PR RNA aptamers displaying moderate binding affinities (Kd = 92–140 nmol/l) and anti-PR inhibitory activity (Kis = 138–647 nmol/l). Second-generation RNA aptamers selected from partially randomized pools based on two of the aptamer sequences displayed striking enhancements in binding (Kds = 2–22 nmol/l) and inhibition (Kis = 31–49 nmol/l). The aptamers were specific in that they did not bind either the related HIV-2 protease, or the cellular aspartyl protease, Cathepsin D. Site-directed mutagenesis of a second-generation aptamer to probe the predicted secondary structure indicated that the stem-loops SL2 and SL3 and the stem P1 were essential for binding and that only the 3'-most 17 nucleotides were dispensable. Anti-PR aptamers inhibited HIV replication in vitro and the degree of inhibition was higher for second-generation aptamers with greater affinity and the inhibition was abrogated for a nonbinding aptamer variant. PMID:25689224

Duclair, Sonald; Gautam, Archana; Ellington, Andrew; Prasad, Vinayaka R

2015-01-01

205

High-affinity RNA Aptamers Against the HIV-1 Protease Inhibit Both In Vitro Protease Activity and Late Events of Viral Replication.  

PubMed

HIV-1 aspartyl protease (PR) plays a key role in virion morphogenesis, underscoring the effectiveness of protease inhibitors (PI). Despite their utility, side effects and drug-resistance remains a problem. We report the development of RNA aptamers as inhibitors of HIV-1 PR for potential use in anti-HIV gene therapy. Employing Systematic Evolution of Ligands by Exponential Enrichment (SELEX), we isolated four unique families of anti-HIV-1 PR RNA aptamers displaying moderate binding affinities (Kd = 92-140 nmol/l) and anti-PR inhibitory activity (Kis = 138-647 nmol/l). Second-generation RNA aptamers selected from partially randomized pools based on two of the aptamer sequences displayed striking enhancements in binding (Kds = 2-22 nmol/l) and inhibition (Kis = 31-49 nmol/l). The aptamers were specific in that they did not bind either the related HIV-2 protease, or the cellular aspartyl protease, Cathepsin D. Site-directed mutagenesis of a second-generation aptamer to probe the predicted secondary structure indicated that the stem-loops SL2 and SL3 and the stem P1 were essential for binding and that only the 3'-most 17 nucleotides were dispensable. Anti-PR aptamers inhibited HIV replication in vitro and the degree of inhibition was higher for second-generation aptamers with greater affinity and the inhibition was abrogated for a nonbinding aptamer variant. PMID:25689224

Duclair, Sonald; Gautam, Archana; Ellington, Andrew; Prasad, Vinayaka R

2015-01-01

206

Human cytomegalovirus function inhibits replication of herpes simplex virus  

SciTech Connect

Human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of herpes simplex virus type 1 (HSV-1). A delay in HSV replication of 15 h as well as a consistent, almost 3 log inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 h after superinfection were observed compared with controls infected with HSV alone. Treatment of HCMV-infected HEL cells with cycloheximide (100 ..mu..g/ml) for 3 or 24 h was demonstrated effective in blocking HCMV protein synthesis, as shown by immunoprecipitation with HCMV antibody-positive polyvalent serum. Cycloheximide treatment of HCMV-infected HEL cells and removal of the cycloheximide block before superinfection inhibited HSV-1 replication more efficiently than non-drug-treated superinfected controls. HCMV DNA-negative temperature-sensitive mutants restricted HSV as efficiently as wild-type HCMV suggesting that immediate-early and/or early events which occur before viral DNA synthesis are sufficient for inhibition of HSV. Inhibition of HSV-1 in HCMV-infected HEL cells was unaffected by elevated temperature (40.5/sup 0/C). However, prior UV irradiation of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HSV-2 replication was similarly inhibited in HCMV-infected HEL cells. Superinfection of HCMV-infected HEL cells with HSV-1 labeled with (/sup 3/H)thymidine provided evidence that the labeled virus could penetrate to the nucleus of cells after superinfection. Evidence for penetration of superinfecting HSV into HCMV-infected cells was also provided by blot hybridization of HSV DNA synthesized in cells infected with HSV alone versus superinfected cell cultures at 0 and 48 h after superinfection.

Cockley, K.D.; Shiraki, K.; Rapp, F.

1988-01-01

207

Phosphoproteomic Analyses Reveal Early Signaling Events in the Osmotic Stress Response1[W][OPEN  

PubMed Central

Elucidating how plants sense and respond to water loss is important for identifying genetic and chemical interventions that may help sustain crop yields in water-limiting environments. Currently, the molecular mechanisms involved in the initial perception and response to dehydration are not well understood. Modern mass spectrometric methods for quantifying changes in the phosphoproteome provide an opportunity to identify key phosphorylation events involved in this process. Here, we have used both untargeted and targeted isotope-assisted mass spectrometric methods of phosphopeptide quantitation to characterize proteins in Arabidopsis (Arabidopsis thaliana) whose degree of phosphorylation is rapidly altered by hyperosmotic treatment. Thus, protein phosphorylation events responsive to 5 min of 0.3 m mannitol treatment were first identified using 15N metabolic labeling and untargeted mass spectrometry with a high-resolution ion-trap instrument. The results from these discovery experiments were then validated using targeted Selected Reaction Monitoring mass spectrometry with a triple quadrupole. Targeted Selected Reaction Monitoring experiments were conducted with plants treated under nine different environmental perturbations to determine whether the phosphorylation changes were specific for osmosignaling or involved cross talk with other signaling pathways. The results indicate that regulatory proteins such as members of the mitogen-activated protein kinase family are specifically phosphorylated in response to osmotic stress. Proteins involved in 5? messenger RNA decapping and phosphatidylinositol 3,5-bisphosphate synthesis were also identified as targets of dehydration-induced phosphoregulation. The results of these experiments demonstrate the utility of targeted phosphoproteomic analysis in understanding protein regulation networks and provide new insight into cellular processes involved in the osmotic stress response. PMID:24808101

E. Stecker, Kelly; Minkoff, Benjamin B.; Sussman, Michael R.

2014-01-01

208

Hyaluronan-based pericellular matrix: substrate electrostatic charges and early cell adhesion events.  

PubMed

Cells are surrounded by a hyaluronan-rich coat called 'pericellular matrix' (PCM), mainly constituted by hyaluronan, a long-chain linear polysaccharide which is secreted and resorbed by the cell, depending on its activity. Cell attachment to a surface is mediated by PCM before integrins and focal adhesions are involved. As hyaluronan is known to bear a negative charge at physiological pH, the relevance of its electrical properties in driving the early cell adhesion steps has been studied, exploring how PCM mediates cell adhesion to charged surfaces, such as polyelectrolyte multilayer (PEM) films. Poly(ethylene imine) (PEI) and poly(sodium 4-styrene sulphonate) (PSS), assembled as PEI/PSS and PEI/PSS/PEI layers, were used. The nanoscale morphology of such layers was analysed by atomic force microscopy, and the detailed surface structure was analysed by X-ray photoemission spectroscopy. PCM-coated and PCM-depleted MG63 osteoblast-like cells were used, and cell density, morphology and adhesive structures were analysed during early steps of cell attachment to the PEM surfaces (1-6 h). The present study demonstrates that the pericellular matrix is involved in cell adhesion to material surfaces, and its arrangement depends on the cell interaction with the surface. Moreover, the PCM/surface interaction is not simply driven by electrostatic effects, as the cell response may be affected by specific chemical groups at the material surface. In the development of biomimetic surfaces promoting cell adhesion and function, the role of this unrecognised outer cell structure has to be taken into account. PMID:24052426

Fotia, Caterina; Messina, Grazia M L; Marletta, Giovanni; Baldini, Nicola; Ciapetti, Gabriela

2013-01-01

209

CENTRIOLE REPLICATION  

PubMed Central

Sperm formation was studied in the fern, Marsilea, and the cycad, Zamia, with particular emphasis on the centrioles. In Marsilea, the mature sperm possesses over 100 flagella, the basal bodies of which have the typical cylindrical structure of centrioles. Earlier observations by light microscopy suggested that these centrioles arise by fragmentation of a body known as the blepharoplast. In the youngest spermatids the blepharoplast is a hollow sphere approximately 0.8 µ in diameter. Its wall consists of closely packed immature centrioles, or procentrioles. The procentrioles are short cylinders which progressively lengthen during differentiation of the spermatid. At the same time they migrate to the surface of the cell, where each of them puts out a flagellum. A blepharoplast is found at each pole of the spindle during the last antheridial mitosis, and two blepharoplasts are found in the cytoplasm before this mitosis. Blepharoplasts are also found in the preceding cell generation, but their ultimate origin is obscure. Before the last mitosis the blepharoplasts are solid, consisting of a cluster of radially arranged tubules which bear some structural similarity to centrioles. In Zamia, similar stages are found during sperm formation, although here the number of flagella on each sperm is close to 20,000 and the blepharoplast measures about 10 µ in diameter. These observations are discussed in relation to theories of centriole replication. PMID:5950730

Mizukami, Ikuko; Gall, Joseph

1966-01-01

210

Expression of human E46K-mutated ?-synuclein in BAC-transgenic rats replicates early-stage Parkinson's disease features and enhances vulnerability to mitochondrial impairment.  

PubMed

Parkinson's disease (PD), the second most common neurodegenerative disorder, is etiologically heterogeneous, with most cases thought to arise from a combination of environmental factors and genetic predisposition; about 10% of cases are caused by single gene mutations. While neurotoxin models replicate many of the key behavioral and neurological features, they often have limited relevance to human exposures. Genetic models replicate known disease-causing mutations, but are mostly unsuccessful in reproducing major features of PD. In this study, we created a BAC (bacterial artificial chromosome) transgenic rat model of PD expressing the E46K mutation of ?-synuclein, which is pathogenic in humans. The mutant protein was expressed at levels ~2-3-fold above endogenous ?-synuclein levels. At 12 months of age, there was no overt damage to the nigrostriatal dopamine system; however, (i) alterations in striatal neurotransmitter metabolism, (ii) accumulation and aggregation of ?-synuclein in nigral dopamine neurons, and (iii) evidence of oxidative stress suggest this model replicates several preclinical features of PD. Further, when these animals were exposed to rotenone, a mitochondrial toxin linked to PD, they showed heightened sensitivity, indicating that ?-synuclein expression modulates the vulnerability to mitochondrial impairment. We conclude that these animals are well-suited to examination of gene-environment interactions that are relevant to PD. PMID:23153578

Cannon, Jason R; Geghman, Kindiya D; Tapias, Victor; Sew, Thomas; Dail, Michelle K; Li, Chenjian; Greenamyre, J Timothy

2013-02-01

211

The PRESSCA operational early warning system for landslide forecasting: the 11-12 November 2013 rainfall event in Central Italy.  

NASA Astrophysics Data System (ADS)

The Umbria Region, located in Central Italy, is one of the most landslide risk prone area in Italy, almost yearly affected by landslides events at different spatial scales. For early warning procedures aimed at the assessment of the hydrogeological risk, the rainfall thresholds represent the main tool for the Italian Civil Protection System. As shown in previous studies, soil moisture plays a key-role in landslides triggering. In fact, acting on the pore water pressure, soil moisture influences the rainfall amount needed for activating a landslide. In this work, an operational physically-based early warning system, named PRESSCA, that takes into account soil moisture for the definition of rainfall thresholds is presented. Specifically, the soil moisture conditions are evaluated in PRESSCA by using a distributed soil water balance model that is recently coupled with near real-time satellite soil moisture product obtained from ASCAT (Advanced SCATterometer) and from in-situ monitoring data. The integration of three different sources of soil moisture information allows to estimate the most accurate possible soil moisture condition. Then, both observed and forecasted rainfall data are compared with the soil moisture-based thresholds in order to obtain risk indicators over a grid of ~ 5 km. These indicators are then used for the daily hydrogeological risk evaluation and management by the Civil Protection regional service, through the sharing/delivering of near real-time landslide risk scenarios (also through an open source web platform: www.cfumbria.it). On the 11th-12th November, 2013, Umbria Region was hit by an exceptional rainfall event with up to 430mm/72hours that resulted in significant economic damages, but fortunately no casualties among the population. In this study, the results during the rainfall event of PRESSCA system are described, by underlining the model capability to reproduce, two days in advance, landslide risk scenarios in good spatial and temporal agreement with the occurred actual conditions. High-resolution risk scenarios (100mx100m), obtained by coupling PRESSCA forecasts with susceptibility and vulnerability layers, are also produced. The results show good relationship between the PRESSCA forecast and the reported landslides to the Civil Protection Service during the rainfall event, confirming the system robustness. The good forecasts of PRESSCA system have surely contributed to start well in advance the Civil Protection operations (alerting local authorities and population).

Ciabatta, Luca; Brocca, Luca; Ponziani, Francesco; Berni, Nicola; Stelluti, Marco; Moramarco, Tommaso

2014-05-01

212

Early events responsible for aluminum toxicity symptoms in suspension-cultured tobacco cells.  

PubMed

We investigated the aluminum (Al)-induced alterations in zeta potential, plasma membrane (PM) potential and intracellular calcium levels to elucidate their interaction with callose production induced by Al toxicity. A noninvasive confocal laser microscopy has been used to analyse the live tobacco (Nicotiana tabacum) cell events by means of fluorescent probes Fluo-3 acetoxymethyl ester (intracellular calcium) and DiBAC4 (PM potential) as well as to monitor callose accumulation. Log-phase cells showed no detectable changes in the PM potential during the first 30 min of Al treatment, but sustained large depolarization from 60 min onwards. Measurement of zeta potential confirmed the depolarization effect of Al, but the kinetics were different. The Al-treated cells showed a moderate increase in intracellular Ca2+ levels and callose production in 1 h, which coincided with the time course of PM depolarization. Compared with the Al treatment, cyclopiazonic acid, an inhibitor of endoplasmic reticulum Ca(2+)-ATPase, facilitated a higher increase in intracellular Ca2+ levels, but resulted in accumulation of only moderate levels of callose. Calcium channel modulators and Al induced similar levels of callose in the initial 1 h of treatment. Callose production induced by Al toxicity is dependent on both depolarization of the PM and an increase in intracellular Ca2+ levels. PMID:15720625

Sivaguru, Mayandi; Yamamoto, Yoko; Rengel, Zdenko; Ahn, Sung Ju; Matsumoto, Hideaki

2005-01-01

213

FOXO3a loss is a frequent early event in high-grade pelvic serous carcinogenesis.  

PubMed

Serous ovarian carcinoma is the most lethal gynecological malignancy in Western countries. The molecular events that underlie the development of the disease have been elusive for many years. The recent identification of the fallopian tube secretory epithelial cells (FTSECs) as the cell-of-origin for most cases of this disease has led to studies aimed at elucidating new candidate therapeutic pathways through profiling of normal FTSECs and serous carcinomas. Here we describe the results of transcriptional profiles that identify the loss of the tumor suppressive transcription factor FOXO3a in a vast majority of high-grade serous ovarian carcinomas. We show that FOXO3a loss is a hallmark of the earliest stages of serous carcinogenesis and occurs both at the DNA, RNA and protein levels. We describe several mechanisms responsible for FOXO3a inactivity, including chromosomal deletion (chromosome 6q21), upregulation of miRNA-182 and destabilization by activated PI3K and MEK. The identification of pathways involved in the pathogenesis of ovarian cancer can advance the management of this disease from being dependant on surgery and cytotoxic chemotherapy alone to the era of targeted therapy. Our data strongly suggest FOXO3a as a possible target for clinical intervention. PMID:24077281

Levanon, K; Sapoznik, S; Bahar-Shany, K; Brand, H; Shapira-Frommer, R; Korach, J; Hirsch, M S; Roh, M H; Miron, A; Liu, J F; Vena, N; Ligon, A H; Fotheringham, S; Bailey, D; Flavin, R J; Birrer, M J; Drapkin, R I

2014-08-28

214

A Threshold-Based Earthquake Early-Warning System for Offshore Events in Southern Iberia  

NASA Astrophysics Data System (ADS)

The south of the Iberian Peninsula is situated at the convergence of the Eurasian and African plates. This region experiences large earthquakes with long separation in time, the best known of which was the great 1755 Lisbon Earthquake, which occurred SW of San Vicente Cape (SW Iberian Peninsula). The high risk of damaging earthquakes has recently led uc(Carranza) et al. (Geophys. Res. Lett. 40, 2013) to investigate the feasibility of an EEWS in this region. Analysis of the geometry for the Iberian seismic networks and the San Vicente Cape area led the authors to conclude that a threshold-based approach, which would not require real-time location of the earthquake, might be the best option for an EEWS in SW Iberia. In this work we investigate this hypothesis and propose a new EEW approach that extends standard P-wave threshold-based single-station analysis to the whole network. The proposed method enables real-time estimation of the potential damage at stations that are triggered by P-waves and those which are not triggered, with the advantage of greater lead-times for release of alerts. Results of tests made with synthetic data mimicking the scenario of the great 1755 Lisbon Earthquake, and those conducted by applying the new approach to available recordings, indicate that an EEW estimation of the potential damage associated with an event in the San Vicente Cape area can be obtained for a very large part of the Iberian Peninsula.

Picozzi, M.; Colombelli, S.; Zollo, A.; Carranza, M.; Buforn, E.

2014-12-01

215

A comparative study of diversification events: the early Paleozoic versus the Mesozoic  

NASA Technical Reports Server (NTRS)

We compare two major long-term diversifications of marine animal families that began during periods of low diversity but produced strikingly different numbers of phyla, classes, and orders. The first is the early-Paleozoic diversification (late Vendian-Ordovician; 182 MY duration) and the other the Mesozoic phase of the post-Paleozoic diversification (183 MY duration). The earlier diversification was associated with a great burst of morphological invention producing many phyla, classes, and orders and displaying high per taxon rates of family origination. The later diversification lacked novel morphologies recognized as phyla and classes, produced fewer orders, and displayed lower per taxon rates of family appearances. The chief difference between the diversifications appears to be that the earlier one proceeded from relatively narrow portions of adaptive space, whereas the latter proceeded from species widely scattered among adaptive zones and representing a variety of body plans. This difference is believed to explain the major differences in the products of these great radiations. Our data support those models that hold that evolutionary opportunity is a major factor in the outcome of evolutionary processes.

Erwin, D. H.; Valentine, J. W.; Sepkoski, J. J. Jr; Sepkoski JJ, J. r. (Principal Investigator)

1987-01-01

216

VUV-optical oscillator strength distributions of molecules and their implications to early events in radiation chemistry  

NASA Astrophysics Data System (ADS)

Absolute photoabsorption cross sections of C 6H 12 isomers, i.e. cyclohexane, l-hexene, and tetramethylene, in the VUV region have been measured using synchroton radiation. The obtained cross sections of C 6H 12 isomers in this experiment together with those of C 2H 6O and C 3H 8O isomers, i.e. alcohols and ethers, in our previous paper have been analyzed and found to almost satisfy the Thomas-Kuhn-Reiche sum rule. Common new features of the oscillator strength distributions obtained from the photoabsorption cross sections have been found in each isomer group. These experimental results have been discussed with emphasis on their implications to early events in radiation chemistry, such as estimation of the energy deposition spectra of these molecules and the G value of the dissociation of superexcited states.

Koizumi, H.; Shinsaka, K.; Hatano, Y.

217

Early cerebrovascular and parenchymal events following prenatal exposure to the putative neurotoxin methylazoxymethanol  

PubMed Central

One of the most common causes of neurological disabilities are malformations of cortical development (MCD). A useful animal model of MCD consists of prenatal exposure to methylazoxymethanol (MAM), resulting in a postnatal phenotype characterized by cytological aberrations reminiscent of human MCD. Although postnatal effects of MAM are likely a consequence of prenatal events, little is known on how the developing brain reacts to MAM. General assumption is the effects of prenatally administered MAM are short lived (24 h) and neuroblast-specific. MAM persisted for several days after exposure in utero in both maternal serum and fetal brain, but at levels lower than predicted by a neurotoxic action. MAM levels and time course were consistent with a different mechanism of indirect neuronal toxicity. The most prominent acute effects of MAM were cortical swelling associated with mild cortical disorganization and neurodegeneration occurring in absence of massive neuronal cell death. Delayed or aborted vasculogenesis was demonstrated by MAM's ability to hinder vessel formation. In vitro, MAM reduced synthesis and release of VEGF by endothelial cells. Decreased expression of VEGF, AQP1, and lectin-B was consistent with a vascular target in prenatal brain. The effects of MAM on cerebral blood vessels persisted postnatally, as indicated by capillary hypodensity in heterotopic areas of adult rat brain. In conclusion, these results show that MAM does not act only as a neurotoxin per se, but may additionally cause a short-lived toxic effect secondary to cerebrovascular dysfunction, possibly due to a direct anti-angiogenic effect of MAM itself. PMID:17398107

Bassanini, Stefania; Hallene, Kerri; Battaglia, Giorgio; Finardi, Adele; Santaguida, Stefano; Cipolla, Marilyn; Janigro, Damir

2011-01-01

218

The actin cytoskeleton participates in the early events of autophagosome formation upon starvation induced autophagy  

PubMed Central

Autophagy is a process by which cytoplasmic material is sequestered in a double-membrane vesicle destined for degradation. Nutrient deprivation stimulates the pathway and the number of autophagosomes in the cell increases in response to such stimulus. In the current report we have demonstrated that actin is necessary for starvation-mediated autophagy. When the actin cytoskeleton is depolymerized, the increase in autophagic vacuoles in response to the starvation stimulus was abolished without affecting maturation of remaining autophagosomes. In addition, actin filaments colocalized with ATG14, BECN1/Beclin1 and PtdIns3P-rich structures, and some of them have a typical omegasome shape stained with the double FYVE domain or ZFYVE1/DFCP1. In contrast, no major colocalization between actin and ULK1, ULK2, ATG5 or MAP1LC3/LC3 was observed. Taken together, our data indicate that actin has a role at very early stages of autophagosome formation linked to the PtdIns3P generation step. In addition, we have found that two members of the Rho family of proteins, RHOA and RAC1 have a regulatory function on starvation-mediated autophagy, but with opposite roles. Indeed, RHOA has an activatory role whereas Rac has an inhibitory one. We have also found that inhibition of the RHOA effector ROCK impaired the starvation-mediated autophagic response. We propose that actin participates in the initial membrane remodeling stage when cells require an enhanced rate of autophagosome formation, and this actin function would be tightly regulated by different members of the Rho family. PMID:22863730

Aguilera, Milton Osmar; Berón, Walter; Colombo, María Isabel

2012-01-01

219

Co-ordination of early and late ripening events in apples is regulated through differential sensitivities to ethylene  

PubMed Central

In this study, it is shown that anti-sense suppression of Malus domestica 1-AMINO-CYCLOPROPANE-CARBOXYLASE OXIDASE (MdACO1) resulted in fruit with an ethylene production sufficiently low to be able to assess ripening in the absence of ethylene. Exposure of these fruit to different concentrations of exogenous ethylene showed that flesh softening, volatile biosynthesis, and starch degradation, had differing ethylene sensitivity and dependency. Early ripening events such as the conversion of starch to sugars showed a low dependency for ethylene, but a high sensitivity to low concentrations of ethylene (0.01 ?l l?1). By contrast, later ripening events such as flesh softening and ester volatile production showed a high dependency for ethylene but were less sensitive to low concentrations (needing 0.1 ?l l?1 for a response). A sustained exposure to ethylene was required to maintain ripening, indicating that the role of ethylene may go beyond that of ripening initiation. These results suggest a conceptual model for the control of individual ripening characters in apple, based on both ethylene dependency and sensitivity. PMID:19429839

Johnston, Jason W.; Gunaseelan, Kularajathaven; Pidakala, Paul; Wang, Mindy; Schaffer, Robert J.

2009-01-01

220

Size-resolved aerosol chemical analysis of extreme haze pollution events during early 2013 in urban Beijing, China.  

PubMed

Using size-resolved filter sampling and chemical characterization, high concentrations of water-soluble ions, carbonaceous species and heavy metals were found in both fine (PM2.1) and coarse (PM2.1-9) particles in Beijing during haze events in early 2013. Even on clear days, average mass concentration of submicron particles (PM1.1) was several times higher than that previously measured in most of abroad urban areas. A high concentration of particulate matter on haze days weakens the incident solar radiation, which reduces the generation rate of secondary organic carbon in PM1.1. We show that the peak mass concentration of particles shifted from 0.43-0.65?m on clear days to 0.65-1.1?m on lightly polluted days and to 1.1-2.1?m on heavily polluted days. The peak shifts were also found for the following species: organic carbon, elemental carbon, NH4(+), SO4(2-), NO3(-), K, Cu, Zn, Cd and Pb. Our findings demonstrate that secondary inorganic aerosols (36%) and organic matter (26%) dominated the fine particle mass on heavily polluted days, while their contribution reduced to 29% and 18%, respectively, on clear days. Besides fine particles, anthropogenic chemical species also substantially accumulated in the coarse mode, which suggests that particles with aerodynamic diameter larger than 2.1?m cannot be neglected during severe haze events. PMID:25106045

Tian, Shili; Pan, Yuepeng; Liu, Zirui; Wen, Tianxue; Wang, Yuesi

2014-08-30

221

Altering second-order configurations reduces the adaptation effects on early face-sensitive event-related potential components  

PubMed Central

The spatial distances among the features of a face are commonly referred to as second-order relations, and the coding of these properties is often regarded as a cornerstone in face recognition. Previous studies have provided mixed results regarding whether the N170, a face-sensitive component of the event-related potential, is sensitive to second-order relations. Here we investigated this issue in a gender discrimination paradigm following long-term (5 s) adaptation to normal or vertically stretched male and female faces, considering that the latter manipulation substantially alters the position of the inner facial features. Gender-ambiguous faces were more likely judged to be female following adaptation to a male face and vice versa. This aftereffect was smaller but statistically significant after being adapted to vertically stretched when compared to unstretched adapters. Event-related potential recordings revealed that adaptation effects measured on the amplitude of the N170 show strong modulations by the second-order relations of the adapter: reduced N170 amplitude was observed, however, this reduction was smaller in magnitude after being adapted to stretched when compared to unstretched faces. These findings suggest early face-processing, as reflected in the N170 component, proceeds by extracting the spatial relations of inner facial features. PMID:24971058

Vakli, Pál; Németh, Kornél; Zimmer, Márta; Schweinberger, Stefan R.; Kovács, Gyula

2014-01-01

222

Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II  

SciTech Connect

Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

Sample, Robert [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Bryan, Locke [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Long, Scott [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Majji, Sai [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Hoskins, Glenn [Department of Anatomy, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Sinning, Allan [Department of Anatomy, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Olivier, Jake [Department of Preventive Medicine, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Chinchar, V. Gregory [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States)]. E-mail: vchinchar@microbio.umsmed.edu

2007-02-20

223

Femtosecond transient absorption spectroscopy study of the early events of norfloxacin in aqueous solutions with varying pH values.  

PubMed

The photophysics and photochemistry of norfloxacin (NF) have been investigated in aqueous solutions of different pH using femtosecond transient absorption spectroscopy (fs-TA). Resonance Raman spectroscopic experiments on NF have also been conducted in aqueous solutions of different pH to characterize the vibrational and structural information on the initial forms of NF. The experimental results in combination with density functional theory calculations of the key intermediates help us to elucidate the early events for NF after photoexcitation in aqueous solutions with varying pH values. The fs-TA results indicate that NF mainly underwent photophysical processes on the early delay time scale (before 3 ns), and no photochemical reactions occurred on this time scale. Specifically, after the irradiation of NF, the molecule reaches a higher excited singlet Sn and then decays to the lowest-lying excited singlet state S1 followed by intersystem crossing to transform into the lowest-lying triplet state T1 with a high efficiency, with an exception that there is a lower efficiency observed in basic aqueous solution due to the generation of an intramolecular electron transfer as an additional pathway to waste energy. PMID:25356524

Su, Tao; Li, Ming-De; Ma, Jiani; Wong, Naikei; Phillips, David Lee

2014-11-26

224

A novel DDB2-ATM feedback loop regulates human cytomegalovirus replication.  

PubMed

Human cytomegalovirus (HCMV) genome replication requires host DNA damage responses (DDRs) and raises the possibility that DNA repair pathways may influence viral replication. We report here that a nucleotide excision repair (NER)-associated-factor is required for efficient HCMV DNA replication. Mutations in genes encoding NER factors are associated with xeroderma pigmentosum (XP). One of the XP complementation groups, XPE, involves mutation in ddb2, which encodes DNA damage binding protein 2 (DDB2). Infectious progeny virus production was reduced by >2 logs in XPE fibroblasts compared to levels in normal fibroblasts. The levels of immediate early (IE) (IE2), early (E) (pp65), and early/late (E/L) (gB55) proteins were decreased in XPE cells. These replication defects were rescued by infection with a retrovirus expressing DDB2 cDNA. Similar patterns of reduced viral gene expression and progeny virus production were also observed in normal fibroblasts that were depleted for DDB2 by RNA interference (RNAi). Mature replication compartments (RCs) were nearly absent in XPE cells, and there were 1.5- to 2.0-log reductions in viral DNA loads in infected XPE cells relative to those in normal fibroblasts. The expression of viral genes (UL122, UL44, UL54, UL55, and UL84) affected by DDB2 status was also sensitive to a viral DNA replication inhibitor, phosphonoacetic acid (PAA), suggesting that DDB2 affects gene expression upstream of or events associated with the initiation of DNA replication. Finally, a novel, infection-associated feedback loop between DDB2 and ataxia telangiectasia mutated (ATM) was observed in infected cells. Together, these results demonstrate that DDB2 and a DDB2-ATM feedback loop influence HCMV replication. PMID:24335308

E, Xiaofei; Savidis, George; Chin, Christopher R; Wang, Shixia; Lu, Shan; Brass, Abraham L; Kowalik, Timothy F

2014-02-01

225

Interleukin-1 receptor antagonist (IL1RN) is associated with suppression of early carcinogenic events in human oral malignancies.  

PubMed

Inflammatory abnormalities have been implicated in the pathogenesis of various human diseases, including cancer. Interleukin-1 receptor antagonist (IL1RN) is a potent anti-inflammatory molecule that modulates the biological activity of the proinflammatory cytokine, interleukin-1. The aim of this study was to examine the expression of IL1RN in oral squamous cell carcinomas (OSCCs), and to determine its clinical significance. Expression levels of IL1RN in matched normal and tumor specimens from 39 OSCCs were evaluated using real-time quantitative polymerase chain reaction methods, and immunohistochemical analysis. Protein expression of IL1RN was also examined in 18 oral premalignant lesions (OPLs). Expression of IL1RN mRNA was significantly downregulated in OSCCs compared with normal tissues. Decreased expression of IL1RN protein was also observed in OPLs and OSCCs. The IL1RN expression level was lower in the OPL cases with severe dysplasia compared to those with mild/moderate dysplasia. Significantly downregulated IL1RN expression was observed in all OSCC lesion sites examined when compared with the matched normal tissues. However, the decreased level of IL1RN expression did not correspond with tumor progression. Noteworthy, IL1RN expression was higher in the advanced OSCC cases (T3/T4) compared to early cases (T1/T2). Among OSCC samples, relatively higher IL1RN expression was associated with active tumor development in the OSCCs occurring in the buccal mucosa, oral floor, fauces and gingiva, but not the tongue. These data suggest that IL1RN may exhibit opposing characteristics in oral malignancies depending on the stage of cancer development, suppressing early carcinogenic events, yet promoting tumor development in some lesion sites. Thus, IL1RN could represent a reliable biomarker for the early diagnosis of OSCCs. Furthermore, IL1RN may possess unknown and complex functions in the developed OSCC. PMID:25738940

Shiiba, Masashi; Saito, Kengo; Yamagami, Hitomi; Nakashima, Dai; Higo, Morihiro; Kasamatsu, Atsushi; Sakamoto, Yosuke; Ogawara, Katsunori; Uzawa, Katsuhiro; Takiguchi, Yuichi; Tanzawa, Hideki

2015-05-01

226

Perturbation of bile acid homeostasis is an early pathogenesis event of drug induced liver injury in rats  

SciTech Connect

Drug-induced liver injury (DILI) is a significant consideration for drug development. Current preclinical DILI assessment relying on histopathology and clinical chemistry has limitations in sensitivity and discordance with human. To gain insights on DILI pathogenesis and identify potential biomarkers for improved DILI detection, we performed untargeted metabolomic analyses on rats treated with thirteen known hepatotoxins causing various types of DILI: necrosis (acetaminophen, bendazac, cyclosporine A, carbon tetrachloride, ethionine), cholestasis (methapyrilene and naphthylisothiocyanate), steatosis (tetracycline and ticlopidine), and idiosyncratic (carbamazepine, chlorzoxasone, flutamide, and nimesulide) at two doses and two time points. Statistical analysis and pathway mapping of the nearly 1900 metabolites profiled in the plasma, urine, and liver revealed diverse time and dose dependent metabolic cascades leading to DILI by the hepatotoxins. The most consistent change induced by the hepatotoxins, detectable even at the early time point/low dose, was the significant elevations of a panel of bile acids in the plasma and urine, suggesting that DILI impaired hepatic bile acid uptake from the circulation. Furthermore, bile acid amidation in the hepatocytes was altered depending on the severity of the hepatotoxin-induced oxidative stress. The alteration of the bile acids was most evident by the necrosis and cholestasis hepatotoxins, with more subtle effects by the steatosis and idiosyncratic hepatotoxins. Taking together, our data suggest that the perturbation of bile acid homeostasis is an early event of DILI. Upon further validation, selected bile acids in the circulation could be potentially used as sensitive and early DILI preclinical biomarkers. - Highlights: ? We used metabolomics to gain insights on drug induced liver injury (DILI) in rats. ? We profiled rats treated with thirteen hepatotoxins at two doses and two time points. ? The toxins decreased the liver's ability to uptake bile acid from the circulation. ? Oxidative stress induced by the toxins altered bile acid biosynthesis in the liver. ? Selected bile acids in the plasma and urine could be sensitive DILI biomarkers.

Yamazaki, Makoto; Miyake, Manami; Sato, Hiroko; Masutomi, Naoya; Tsutsui, Naohisa [Mitsubishi Tanabe Pharma Corporation, Kisarazu, Chiba 292-0818 (Japan); Adam, Klaus-Peter; Alexander, Danny C.; Lawton, Kay A.; Milburn, Michael V.; Ryals, John A.; Wulff, Jacob E. [Metabolon Inc., 617 Davis Drive, Suite 400, Durham, NC 27713 (United States); Guo, Lining, E-mail: lguo@metabolon.com [Metabolon Inc., 617 Davis Drive, Suite 400, Durham, NC 27713 (United States)

2013-04-01

227

Outreach: Replicating Services for Young Handicapped Children.  

ERIC Educational Resources Information Center

Presented are eight author contributed chapters dealing with the outreach and replication of federally funded early education programs for handicapped children. M. Karnes and R. Zehrbach consider decisions regarding identification and assessment of replicable products (such as curricula and audiovisual presentations). Discussed by D. Stedman are…

Gunn, Lynn, Ed.

228

Impact of the large-scale dynamics on the ARM Arctic cloud and radiation measurements and early snowmelt events  

NASA Astrophysics Data System (ADS)

In the last 3 decades the average temperature over the Northern Alaska has increased by about 2.3 °C with the maximum during the spring (3.9 °C) and the minimum during the summer (1.5 °C). This warming has resulted in an average 8-day advance in snowmelt date over Northern Alaska, and a 10% decrease in the extent of snow cover observed from satellites. Therefore it is necessary to identify the factors influencing this trend, especially during the spring because changes in the spring snowmelt date will significantly affect the surface radiation budget. In this study, we use 10 years (1998-2007) of surface observations collected from the Atmospheric Radiation Measurement (ARM) North Slope of Alaska (NSA) site and NCEP reanalysis, and find that there are more clouds in the warm season (May-October) than in the cold season (November - April), which exhibits a strong association with the large-scale dynamics. The net surface radiation budget indicates that the Arctic surface loses radiative energy during October - April and gains radiative energy during May-September, and clouds tend to enhance snow melting in spring and impede the solidification of permafrost in autumn. We have identified the years of 2002, 2005, and 2007 as years with abnormally early snowmelt, where the date of the spring snowmelt is approximately 10 days earlier than average. Large-scale dynamics and previous winter snow fall are certainly two of the factors affecting the snowmelt over this region. Using NCEP reanalysis data, we have developed a pattern which positions the Aleutian Low (AL) in the center of the Bering Sea and a ridge building over eastern Alaska during the early snowmelt events. This large-scale pattern supports warm moist air advection over northern Alaska, increasing the areal clouds and thus supporting early snowmelt. We will use the integrated ARM NSA radiation and cloud, snow depth and accumulation, and NCEP reanalysis data over the Western Arctic to investigate the 2002, 2005 and 2007 spring snowmelt events.

Crosby, K. M.; Dong, X.; Xi, B.; Long, C. N.

2008-05-01

229

Self-replicating colloidal clusters  

PubMed Central

We construct schemes for self-replicating clusters of spherical particles, validated with computer simulations in a finite-temperature heat bath. Each particle has stickers uniformly distributed over its surface, and the rules for self-replication are encoded into the specificity and strength of interactions. Geometrical constraints imply that a compact cluster can copy itself only with help of a catalyst, a smaller cluster that increases the surface area to form a template. Replication efficiency requires optimizing interaction energies to destabilize all kinetic traps along the reaction pathway, as well as initiating a trigger event that specifies when the new cluster disassociates from its parent. Although there is a reasonably wide parameter range for self-replication, there is a subtle balance between the speed of the reaction, and the error rate. As a proof of principle, we construct interactions that self-replicate an octahedron, requiring a two-particle dimer for a catalyst. The resulting self-replication scheme is a hypercycle, and computer simulations confirm the exponential growth of both octahedron and catalyst replicas. PMID:24449887

Zeravcic, Zorana; Brenner, Michael P.

2014-01-01

230

The Intense Arctic Cyclone of Early August 2012: A Dynamically Driven Cyclogenesis Event  

NASA Astrophysics Data System (ADS)

A series of surface cyclones formed along an anomalously strong northeast-southwest oriented baroclinic zone over north-central Russia on 1-3 August 2012. These cyclones moved northeastward, intensified slowly, and crossed the coast of Russia by 4 August. The last cyclone in the series strengthened rapidly as it moved poleward over the Arctic Ocean on 5-6 August, achieved a minimum sea level pressure of < 965 hPa by 6 August, and was arguably the most intense storm system to impact the Arctic Ocean in the modern data record going back to the International Geophysical Year in 1957-1958. The purpose of this presentation is to illustrate the structure and life cycle of this Arctic Ocean cyclone from a multiscale perspective. Anticyclonic wave breaking in the upper troposphere across Russia in late July and very early August 2012 created an anomalously strong baroclinic zone across northern Asia between 60-80°N. During 1-5 August, negative 850 hPa temperature anomalies between -2° and -4°C were found poleward of 70-75°N between 90°E and the Dateline over the Arctic Ocean while positive 850 hPa temperature anomalies of 8-9°C were found over eastern Russia near 60°N. The associated anomalously strong 850 hPa meridional temperature gradient of ~10°C (2000 km)-1 helped to sustain an anomalously strong (20-30 m s-1) 250 hPa jet along the coast of northeastern Russia. A local wind speed maximum (~50 m s-1 ) embedded in this 250 hPa jet corridor contributed to the extreme intensity of the trailing (last) surface cyclone in the series. Although the dominant surface cyclone in the series of surface cyclones intensified most rapidly over the relatively ice free Arctic Ocean, the impact of surface heat and moisture fluxes appeared to be secondary to jet-driven dynamical processes in the deepening process. Anomalously high observed 1000-500 hPa thickness values between 564-570 dam, precipitable water values between 30-40 mm, and CAPE values between 500-1000 J kg-1 in the warm sector of the developing cyclone over north-central Russia were indicative of the enhanced baroclinicity and instability in the cyclone warm sector and the ability of lower tropospheric warm-air advection to sustain deep ascent in the intensifying cyclone. The relative importance of dynamical versus thermodynamical forcing to the cyclogenesis process as well as the bulk upscale effects of the intense cyclone on the larger scale higher-latitude circulation and the distribution of sea ice will be discussed. A noteworthy aspect of the post-storm polar environment was the upscale growth of a midlevel cyclonic circulation to include most of the Arctic Ocean. The off-pole displacement of this midlevel cyclonic circulation toward northern Canada by mid-August may have contributed to the termination of the 2012 summer-long intensive heat wave over most of the continental United States.

Bosart, L. F.; Turchioe, A.; Adamchcik, E.

2013-12-01

231

Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-?B and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling  

PubMed Central

Although infections with “natural” West Nile virus (WNV) and the chimeric W956IC WNV infectious clone virus produce comparable peak virus yields in type I interferon (IFN) response-deficient BHK cells, W956IC infection produces higher levels of “unprotected” viral RNA at early times after infection. Analysis of infections with these two viruses in IFN-competent cells showed that W956IC activated NF-?B, induced higher levels of IFN-?, and produced lower virus yields than WNV strain Eg101. IPS-1 was required for both increased induction of IFN-? and decreased yields of W956IC. In Eg101-infected cells, phospho-STAT1/STAT2 nuclear translocation was blocked at all times analyzed, while some phospho-STAT1/STAT2 nuclear translocation was still detected at 8 h after infection in W956IC-infected mouse embryonic fibroblasts (MEFs), and early viral protein levels were lower in these cells. A set of additional chimeras was made by replacing various W956IC gene regions with the Eg101 equivalents. As reported previously, for three of these chimeras, the low early RNA phenotype of Eg101 was restored in BHK cells. Analysis of infections with two of these chimeric viruses in MEFs detected lower early viral RNA levels, higher early viral protein levels, lower early IFN-? levels, and higher virus yields similar to those seen after Eg101 infection. The data suggest that replicase protein interactions directly or indirectly regulate genome switching between replication and translation at early times in favor of translation to minimize NF-?B activation and IFN induction by decreasing the amount of unprotected viral RNA, to produce sufficient viral protein to block canonical type I IFN signaling, and to efficiently remodel cell membranes for exponential genome amplification. PMID:23678179

Scherbik, S. V.; Pulit-Penaloza, J. A.; Basu, M.; Courtney, S. C.

2013-01-01

232

Subsurface warming in the subpolar North Atlantic during rapid climate events in the Early and Mid-Pleistocene  

NASA Astrophysics Data System (ADS)

A new high-resolution reconstruction of the temperature and salinity of the subsurface waters using paired Mg/Ca-?18O measurements on the planktonic foraminifera Neogloboquadrina pachyderma sinistrorsa (sin.) was conducted on a deep-sea sediment core in the subpolar North Atlantic (Site U1314). This study aims to reconstruct millennial-scale subsurface hydrography variations during the Early and Mid-Pleistocene (MIS 31-19). These rapid climate events are characterized by abrupt shifts between warm/cold conditions, and ice-sheet oscillations, as evidenced by major ice rafting events recorded in the North Atlantic sediments (Hernández-Almeida et al., 2012), similar to those found during the Last Glacial period (Marcott et al, 2011). The Mg/Ca derived paleotemperature and salinity oscillations prior and during IRD discharges at Site U1314 are related to changes in intermediate circulation. The increases in Mg/Ca paleotemperatures and salinities during the IRD event are preceded by short episodes of cooling and freshening of subsurface waters. The response of the AMOC to this perturbation is an increased of warm and salty water coming from the south, transported to high latitudes in the North Atlantic beneath the thermocline. This process is accompanied by a southward shift in the convection cell from the Nordic Seas to the subpolar North Atlantic and better ventilation of the North Atlantic at mid-depths. Poleward transport of warm and salty subsurface subtropical waters causes intense basal melting and thinning of marine ice-shelves, that culminates in large-scale instability of the ice sheets, retreat of the grounding line and iceberg discharge. The mechanism proposed involves the coupling of the AMOC with ice-sheet dynamics, and would explain the presence of these fluctuations before the establishment of high-amplitude 100-kyr glacial cycles. Hernández-Almeida, I., Sierro, F.J., Cacho, I., Flores, J.A., 2012. Impact of suborbital climate changes in the North Atlantic on ice sheet dynamics at the Mid-Pleistocene Transition. Paleoceanography 27, PA3214. Marcott, S.A., Clark, P.U., Padman, L., Klinkhammer, G.P., Springer, S.R., Liu, Z., Otto-Bliesner, B.L., Carlson, A.E., Ungerer, A., Padman, J., He, F., Cheng, J., Schmittner, A., 2011. Ice-shelf collapse from subsurface warming as a trigger for Heinrich events. Proceedings of the National Academy of Sciences 108, 13415-13419

Hernández-Almeida, Iván; Sierro, Francisco; Cacho, Isabel; Abel Flores, José

2014-05-01

233

Impact of COX2 genotype, ER status and body constitution on risk of early events in different treatment groups of breast cancer patients  

PubMed Central

The COX2 rs5277 (306G>C) polymorphism has been associated with inflammation-associated cancers. In breast cancer, tumor COX-2 expression has been associated with increased estrogen levels in estrogen receptor (ER)-positive and activated Akt-pathway in ER-negative tumors. Our study investigated the impact of COX2 genotypes on early breast cancer events and treatment response in relation to tumor ER status and body constitution. In Sweden, between 2002 and 2008, 634 primary breast cancer patients, aged 25–99 years, were included. Disease-free survival was assessed for 570 rs5277-genotyped patients. Body measurements and questionnaires were obtained preoperatively. Clinical data, patient- and tumor-characteristics were obtained from questionnaires, patients' charts, population registries and pathology reports. Minor allele(C) frequency was 16.1%. Genotype was not linked to COX-2 tumor expression. Median follow-up was 5.1 years. G/G genotype was not associated with early events in patients with ER-positive tumors, adjusted HR 0.77 (0.46–1.29), but conferred an over 4-fold increased risk in patients with ER-negative tumors, adjusted HR 4.41 (1.21–16.02)(pinteraction = 0.015). Chemotherapy-treated G/G-carriers with a breast volume ?850 ml had an increased risk of early events irrespective of ER status, adjusted HR 8.99 (1.14–70.89). Endocrine-treated C-allele carriers with ER-positive tumors and a breast volume ?850 ml had increased risk of early events, adjusted HR 2.30 (1.12–4.75). COX2 genotype, body constitution and ER status had a combined effect on the risk of early events and treatment response. The high risk for early events in certain subgroups of patients suggests that COX2 genotype in combination with body measurements may identify patients in need of more personalized treatment. PMID:24599585

Markkula, Andrea; Simonsson, Maria; Rosendahl, Ann H; Gaber, Alexander; Ingvar, Christian; Rose, Carsten; Jernström, Helena

2014-01-01

234

Decoupling of carbon isotope records between organic matter and carbonate prior to the Toarcian Oceanic Anoxic Event (Early Jurassic)  

NASA Astrophysics Data System (ADS)

Across the Pliensbachian-Toarcian boundary (P-To, Early Jurassic), ca. 1 Myr before the Toarcian Oceanic Anoxic Event (T-OAE), an initial negative carbon isotope excursion has been documented in western Tethys sedimentary rocks. In carbonate, its amplitude (2-3 permil) is similar to the subsequent excursion recorded at the onset of the T-OAE. Being also associated with a rapid warming event, the significance of this first carbon isotope shift, in terms of paleoenvironmental interpretation and triggering mechanism, remains however elusive. Taking advantage of expanded and rather continuous sections in the High Atlas of Morocco, several high-resolution, paired organic-inorganic carbon isotope records have been obtained across the Upper Pliensbachian - Lower Toarcian interval. At the onset of the T-OAE, an abrupt 1-2 permil negative shift is recorded in both organic and inorganic phases, succeeded by a relatively longer term 1-2 permil negative trend and a final slow return to pre-excursion conditions. In accordance with previous interpretations, this pattern indicates a perturbation of the entire exogenic carbon isotope reservoir at the onset of the T-OAE by the sudden release of isotopically light carbon into the atmosphere. By contrast, there is no negative shift in carbon isotopes for the P-To event recorded in bulk organic matter of Morocco. Given the strong dominance of terrestrial particles in the bulk organic matter fraction, this absence indicates that massive input of 12C-rich carbon into the atmosphere is not likely to have happened during the P-To event. A pronounced (2 permil) and abrupt negative shift in carbon isotope is however recorded in the bulk carbonate phase. We suggest that this decoupling between organic and inorganic phase is due to changes in the nature of the bulk carbonate phase. Indeed, the negative shift occurs at the lithological transition between Pliensbachian-lowermost Toarcian limestone-marl alternations and the Lower Toarcian marl-dominated deposits. Before the P-To event, vigorous shallow-water carbonate factories were responsible for the bulk of carbonate production and export into the basin. Being dominated by aragonite precipitation, they tend to have a more positive carbon isotope signature than carbonate produced offshore. The demise of the shallow water platforms during the P-To event has led to a drastic reduction in the amount of carbonate in the rock record (indicated by the switch from limestone-marl alternations to a marl-dominated sequence), as well as to a marked decrease in the production and export of isotopically heavy carbon, ultimately recorded by a negative shift in the isotopic signature of the bulk carbonate fraction. This study highlights the need of paired organic-inorganic carbon isotope record in order to fully distinguish regional from global perturbation in the carbon cycle.

Bodin, Stephane; Kothe, Tim; Krencker, Francois-Nicolas; Suan, Guillaume; Heimhofer, Ulrich; Immenhauser, Adrian

2014-05-01

235

Rapid changes in the redox conditions of the western Tethys Ocean during the early Aptian oceanic anoxic event  

NASA Astrophysics Data System (ADS)

The early Aptian (125 to 121 Ma) records an episode of severe environmental change including a major perturbation of the carbon cycle, an oceanic anoxic event (OAE 1a, 122.5 Ma), a platform drowning episode and a biocalcification crisis. We propose to trace changes in the oxygenation state of the ocean during the early Aptian anoxic event using the redox-sensitive trace-element (RSTE) distribution, phosphorus accumulation rates (PARs) and organic-matter characterization in three different basins of the western Tethys. The following sections have been investigated: Gorgo a Cerbara (central Italy) in the Umbria Marche basin, Glaise (SE France) in the Vocontian basin and Cassis/La Bédoule (SE France) located in the Provencal basin. In the Gorgo a Cerbara section, RSTE distributions show a low background level along the main part of the section, contrasted by different maxima in concentrations within the Selli level. In the Glaise section, the Goguel level displays a weak increase in RSTE contents coeval with moderate TOC values. At Cassis/La Bédoule, no significant RSTE enrichments have been observed in sediments equivalent to the Selli level. These differences in the records of the geochemical proxies of the Selli level or its equivalent indicate the deposition under different redox conditions, probably related to the paleogeography. Our data indicate the development of anoxic-euxinic conditions in the deeper part of the Tethys during OAE 1a, whereas in the shallower environments, conditions were less reducing. Moreover, at Gorgo a Cerbara, the Selli level is characterized by rapid changes in the intensity of reducing conditions in the water column. Ocean eutrophication seems to be a major factor in the development and the persistence of anoxia as suggested by the PAR evolution. Higher PAR values at the onset of OAE 1a suggest an increase in nutrient input, whereas the return to lower values through the first part of the OAE 1a interval may be related to the weakened capacity to retain P in the sedimentary reservoir due to bottom-water oxygen depletion. This general pattern is contrasted by the data of Gorgo a Cerbara, where the sediments deposited during the OAE 1a interval show P-enrichments (mainly authigenic P). This is associated with maxima in TOC values and Corg:Ptot ratios, suggesting that a part of the remobilized P was trapped in the sediments and as such prevented from returning to the water column.

Westermann, Stéphane; Stein, Melody; Matera, Virginie; Fiet, Nicolas; Fleitmann, Dominik; Adatte, Thierry; Föllmi, Karl B.

2013-11-01

236

Promoter hypermethylation of CDH13 is a common, early event in human esophageal adenocarcinogenesis and correlates with clinical risk factors.  

PubMed

Although the CDH13 gene has been shown to undergo epigenetic silencing by promoter methylation in many types of tumors, hypermethylation of this gene in Barrett's-associated esophageal adenocarcinogenesis has not been studied. Two hundred fifty-nine human esophageal tissues were therefore examined for CDH13 promoter hypermethylation by real-time methylation-specific PCR. CDH13 hypermethylation showed discriminative receiver-operator characteristic curve profiles, sharply demarcating esophageal adenocarcinoma (EAC) from esophageal squamous cell carcinoma (ESCC) and normal esophagus (NE) (p < 0.0001). CDH13 normalized methylation values (NMV) were significantly higher in Barrett's esophagus (BE), dysplastic BE (D) and EAC than in NE (p < 0.0000001). CDH13 hypermethylation frequency was 0% in NE but increased early during neoplastic progression, rising to 70% in BE, 77.5% in D and 76.1% in EAC. Both CDH13 hypermethylation frequency and its mean NMV were significantly higher in BE with than without accompanying EAC. In contrast, only 5 (19.2%) of 26 ESCCs exhibited CDH13 hypermethylation. Furthermore, both CDH13 hypermethylation frequency and its mean NMV were significantly higher in EAC than in ESCC, as well as in BE or D vs. ESCC. Interestingly, mean CDH13 NMV was significantly lower in short-segment than in long-segment BE, a known clinical risk factor for neoplastic progression. Similarly, BE segment length was significantly lower in specimens with unmethylated than with methylated CDH13 promoters. 5-aza-2'-deoxycytidine treatment of OE33 EAC and KYSE220 ESCC cells reduced CDH13 methylation and increased CDH13 mRNA expression. These findings suggest that hypermethylation of CDH13 is a common, tissue-specific event in human EAC, occurs early during BE-associated neoplastic progression, and correlates with known clinical neoplastic progression risk factors. PMID:18729198

Jin, Zhe; Cheng, Yulan; Olaru, Alexandru; Kan, Takatsugu; Yang, Jian; Paun, Bogdan; Ito, Tetsuo; Hamilton, James P; David, Stefan; Agarwal, Rachana; Selaru, Florin M; Sato, Fumiaki; Abraham, John M; Beer, David G; Mori, Yuriko; Shimada, Yutaka; Meltzer, Stephen J

2008-11-15

237

Postweaning Exposure to Dietary Zearalenone, a Mycotoxin, Promotes Premature Onset of Puberty and Disrupts Early Pregnancy Events in Female Mice  

PubMed Central

Zearalenone (ZEA) is a mycotoxin commonly found in contaminated livestock feed and human food with levels in the range of ppb and low ppm. It was hypothesized that ZEA, an endocrine disruptor, could affect puberty and early pregnancy. To test this hypothesis, newly weaned (3 weeks old) C57BL/6J female mice were exposed to 0, 0.002, 4, 10, and 40 ppm ZEA and 0.05 ppm diethylstilbestrol (positive control) in phytoestrogen-free AIN-93G diet. Females exposed to 10 and 40 ppm ZEA diets showed earlier onset of vaginal opening. Those treated with 40 ppm ZEA diet also had earlier first copulation plug and irregular estrous cyclicity. At 8 weeks old, all females were mated with untreated stud males on AIN-93G diet during mating. Treatment resumed upon identification of a vaginal plug on gestation day 0.5 (D0.5). Embryo implantation was assessed on D4.5. Exposure to 40 ppm ZEA diet resulted in reduced percentage of plugged mice with implantation sites, distended uterine appearance, and retained expression of progesterone receptor in D4.5 uterine epithelium. To determine the exposure timing and mechanisms of disrupted embryo implantation, four groups of females were fed with 0 or 40 ppm ZEA diets during premating (weaning to mating) and postmating (D0.5–D4.5), respectively. Premating exposure to 40 ppm ZEA diet reduced fertilization rate, whereas postmating exposure to 40 ppm ZEA diet delayed embryo transport and preimplantation embryo development, which subsequently affected embryo implantation. These data demonstrate that postweaning exposure to dietary ZEA can promote premature onset of puberty and disrupt early pregnancy events. PMID:23291560

Ye, Xiaoqin

2013-01-01

238

Impaired Neurogenesis is an early event in the etiology of Familial Alzheimer’s disease in transgenic mice  

PubMed Central

Formation of new neurons in the adult brain takes place in the subventricular zone and in the subgranule layer of the dentate gyrus throughout life. Neurogenesis is thought to play a role in hippocampus- and olfaction-dependent learning and memory. However, whether impairments in neurogenesis take place in learning and memory disorders, such as Alzheimer’s disease, is yet to be established. More importantly, it remains to be elucidated whether neurogenic impairments play a role in the course of the disease or are the result of extensive neuropathology. We now report that transgenic mice harboring Familial Alzheimer’s disease-linked mutant APPswe/PS1?E9 exhibit severe impairments in neurogenesis that are evident as early as two months of age. These mice exhibit a significant reduction in the proliferation of neural progenitor cells and their neuronal differentiation. Interestingly, levels of hyperphosphorylated tau, the cytotoxic precursor of the Alzheimer’s disease hallmark neurofibrillary tangles, are particularly high in the neurogenic niches. Isolation of neural progenitor cells in culture reveals that APPswe/PS1?E9-expressing neurospheres exhibit impaired proliferation and tau hyperphosphorylation compared to wild type neurospheres isolated from nontransgenic littermates. This study suggests that impaired neurogenesis is an early critical event in the course of Alzheimer’s disease that may underlie memory impairments, at least in part, and exacerbate neuronal vulnerability in the hippocampal formation and olfaction circuits. Furthermore, impaired neurogenesis is the result of both intrinsic pathology in neural progenitor cells and extrinsic neuropathology in the neurogenic niches. Finally, hyperphosphorylation of the microtubule-associated protein tau, a critical player in cell proliferation, neuronal maturation and axonal transport is a major contributor to impaired neurogenesis in Alzheimer’s disease. PMID:20209626

Demars, Michael; Hu, Yuan-Shih; Gadadhar, Archana; Lazarov, Orly

2013-01-01

239

High ABCC2 and Low ABCG2 Gene Expression Are Early Events in the Colorectal Adenoma-Carcinoma Sequence.  

PubMed

Development of colorectal cancer (CRC) may result from a dysfunctional interplay between diet, gut microbes and the immune system. The ABC transport proteins ABCB1 (P-glycoprotein, Multidrug resistance protein 1, MDR1), ABCC2 (MRP2) and ABCG2 (BCRP) are involved in transport of various compounds across the epithelial barrier. Low mRNA level of ABCB1 has previously been identified as an early event in colorectal carcinogenesis (Andersen et al., PLoS One. 2013 Aug 19;8(8):e72119). ABCC2 and ABCG2 mRNA levels were assessed in intestinal tissue from 122 CRC cases, 106 adenoma cases (12 with severe dysplasia, 94 with mild-moderate dysplasia) and from 18 controls with normal endoscopy. We found significantly higher level of ABCC2 in adenomas with mild to moderate dysplasia and carcinoma tissue compared to the levels in unaffected tissue from the same individual (P = 0.037, P = 0.037, and P<0.0001) and in carcinoma and distant unaffected tissue from CRC cases compared to the level in the healthy individuals (P = 0.0046 and P = 0.036). Furthermore, ABCG2 mRNA levels were significantly lower in adenomas and carcinomas compared to the level in unaffected tissue from the same individuals and compared to tissue from healthy individuals (P<0.0001 for all). The level of ABCB2 in adjacent normal tissue was significantly higher than in tissue from healthy individuals (P = 0.011). In conclusion, this study found that ABCC2 and ABCG2 expression levels were altered already in mild/moderate dysplasia in carcinogenesis suggesting that these ABC transporters are involved in the early steps of carcinogenesis as previously reported for ABCB1. These results suggest that dysfunctional transport across the epithelial barrier may contribute to colorectal carcinogenesis. PMID:25793771

Andersen, Vibeke; Vogel, Lotte K; Kopp, Tine Iskov; Sæbø, Mona; Nonboe, Annika W; Hamfjord, Julian; Kure, Elin H; Vogel, Ulla

2015-01-01

240

High ABCC2 and Low ABCG2 Gene Expression Are Early Events in the Colorectal Adenoma-Carcinoma Sequence  

PubMed Central

Development of colorectal cancer (CRC) may result from a dysfunctional interplay between diet, gut microbes and the immune system. The ABC transport proteins ABCB1 (P-glycoprotein, Multidrug resistance protein 1, MDR1), ABCC2 (MRP2) and ABCG2 (BCRP) are involved in transport of various compounds across the epithelial barrier. Low mRNA level of ABCB1 has previously been identified as an early event in colorectal carcinogenesis (Andersen et al., PLoS One. 2013 Aug 19;8(8):e72119). ABCC2 and ABCG2 mRNA levels were assessed in intestinal tissue from 122 CRC cases, 106 adenoma cases (12 with severe dysplasia, 94 with mild-moderate dysplasia) and from 18 controls with normal endoscopy. We found significantly higher level of ABCC2 in adenomas with mild to moderate dysplasia and carcinoma tissue compared to the levels in unaffected tissue from the same individual (P = 0.037, P = 0.037, and P<0.0001) and in carcinoma and distant unaffected tissue from CRC cases compared to the level in the healthy individuals (P = 0.0046 and P = 0.036). Furthermore, ABCG2 mRNA levels were significantly lower in adenomas and carcinomas compared to the level in unaffected tissue from the same individuals and compared to tissue from healthy individuals (P<0.0001 for all). The level of ABCB2 in adjacent normal tissue was significantly higher than in tissue from healthy individuals (P = 0.011). In conclusion, this study found that ABCC2 and ABCG2 expression levels were altered already in mild/moderate dysplasia in carcinogenesis suggesting that these ABC transporters are involved in the early steps of carcinogenesis as previously reported for ABCB1. These results suggest that dysfunctional transport across the epithelial barrier may contribute to colorectal carcinogenesis. PMID:25793771

Andersen, Vibeke; Vogel, Lotte K; Kopp, Tine Iskov; Sæbø, Mona; Nonboe, Annika W.; Hamfjord, Julian; Kure, Elin H.; Vogel, Ulla

2015-01-01

241

Lesion development and replication kinetics during early infection in cattle inoculated with vesicular stomatitis New Jersey virus via scarification and black fly (Simulium vittatum) bite  

Technology Transfer Automated Retrieval System (TEKTRAN)

Vesicular stomatitis viruses are the causative agents of vesicular stomatitis, an economically important contagious disease of livestock that occurs in North, Central, and South America. Little is known regarding the early stages of infection in natural hosts. Twelve adult Holstein steers were inocu...

242

Early and late HIV-1 membrane fusion events are impaired by sphinganine lipidated peptides that target the fusion site  

PubMed Central

Lipid-conjugated peptides have advanced the understanding of membrane protein functions and the roles of lipids in the membrane milieu. These lipopeptides modulate various biological systems such as viral fusion. A single function has been suggested for the lipid, binding to the membrane and thus elevating the local concentration of the peptide at the target site. In the present paper, we challenged this argument by exploring in-depth the antiviral mechanism of lipopeptides, which comprise sphinganine, the lipid backbone of DHSM (dihydrosphingomyelin), and an HIV-1 envelope-derived peptide. Surprisingly, we discovered a partnership between the lipid and the peptide that impaired early membrane fusion events by reducing CD4 receptor lateral diffusion and HIV-1 fusion peptide-mediated lipid mixing. Moreover, only the joint function of sphinganine and its conjugate peptide disrupted HIV-1 fusion protein assembly and folding at the later fusion steps. Via imaging techniques we revealed for the first time the direct localization of these lipopeptides to the virus–cell and cell–cell contact sites. Overall, the findings of the present study may suggest lipid–protein interactions in various biological systems and may help uncover a role for elevated DHSM in HIV-1 and its target cell membranes. PMID:24766462

Klug, Yoel A.; Ashkenazi, Avraham; Viard, Mathias; Porat, Ziv; Blumenthal, Robert; Shai, Yechiel

2014-01-01

243

Subsurface North Atlantic warming as a trigger of rapid cooling events: evidences from the Early Pleistocene (MIS 31-19)  

NASA Astrophysics Data System (ADS)

Subsurface water column dynamics in the subpolar North Atlantic were reconstructed in order to improve the understanding of the cause of abrupt IRD events during cold periods of the Early Pleistocene. We used Mg / Ca-based temperatures of deep-dwelling (Neogloboquadrina pachyderma sinistral) planktonic foraminifera and paired Mg / Ca-?18O measurements to estimate the subsurface temperatures and ?18O of seawater at Site U1314. Carbon isotopes on benthic and planktonic foraminifera from the same site provide information about the ventilation and water column nutrient gradient. Mg / Ca-based temperatures and ?18O of seawater suggest increased temperatures and salinities during ice-rafting, likely due to enhanced northward subsurface transport of subtropical waters during periods of AMOC reduction. Planktonic carbon isotopes support this suggestion, showing coincident increased subsurface ventilation during deposition of ice-rafted detritus (IRD). Warm waters accumulated at subsurface would result in basal warming and break-up of ice-shelves, leading to massive iceberg discharges in the North Atlantic. Release of heat and salt stored at subsurface would help to restart the AMOC. This mechanism is in agreement with modelling and proxy studies that observe a subsurface warming in the North Atlantic in response to AMOC slowdown during the MIS3.

Hernández-Almeida, I.; Sierro, F.-J.; Cacho, I.; Flores, J.-A.

2014-10-01

244

The dimerization of the yeast cytochrome bc1 complex is an early event and is independent of Rip1.  

PubMed

In Saccharomyces cerevisiae the mature cytochrome bc1 complex exists as an obligate homo-dimer in which each monomer consists of ten distinct protein subunits inserted into or bound to the inner mitochondrial membrane. Among them, the Rieske iron-sulfur protein (Rip1), besides its catalytic role in electron transfer, may be implicated in the bc1 complex dimerization. Indeed, Rip1 has the globular domain containing the catalytic center in one monomer while the transmembrane helix interacts with the adjacent monomer. In addition, the lack of Rip1 leads to the accumulation of an immature bc1 intermediate, only loosely associated with cytochrome c oxidase. In this study we have investigated the biogenesis of the yeast cytochrome bc1 complex using epitope tagged proteins to purify native assembly intermediates. We showed that the dimerization process is an early event during bc1 complex biogenesis and that the presence of Rip1, differently from previous proposals, is not essential for this process. We also investigated the multi-step model of bc1 assembly thereby lending further support to the existence of bona fide subcomplexes during bc1 maturation in the inner mitochondrial membrane. Finally, a new model of cytochrome bc1 complex assembly, in which distinct intermediates sequentially interact during bc1 maturation, has been proposed. PMID:25683140

Conte, Annalea; Papa, Benedetta; Ferramosca, Alessandra; Zara, Vincenzo

2015-05-01

245

Early life events carry over to influence pre-migratory condition in a free-living songbird.  

PubMed

Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1(st) year survival and nestling mass in migratory Savannah sparrows (Passerculus sandwichensis). We also use a brood manipulation experiment to show that nestlings from smaller broods have higher mass in the nest relative to individuals from larger broods. Having established these relationships, we then use three years of field data involving multiple captures of individuals throughout the pre-migratory period and a multi-level path model to examine the hypothesis that conditions during development limit survival during migration by affecting an individual's ability to accumulate sufficient lean tissue and fat mass prior to migration. We found a positive relationship between fat mass during the pre-migratory period (Sept-Oct) and nestling mass and a negative indirect relationship between pre-migratory fat mass and fledging date. Our results provide the first evidence that conditions during development limit survival during migration through their effect on fat stores. These results are particularly important given recent evidence showing that body condition of songbirds at fledging is affected by climate change and anthropogenic changes to landscape structure. PMID:22194925

Mitchell, Greg W; Guglielmo, Christopher G; Wheelwright, Nathaniel T; Freeman-Gallant, Corey R; Norris, D Ryan

2011-01-01

246

Early Life Events Carry Over to Influence Pre-Migratory Condition in a Free-Living Songbird  

PubMed Central

Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1st year survival and nestling mass in migratory Savannah sparrows (Passerculus sandwichensis). We also use a brood manipulation experiment to show that nestlings from smaller broods have higher mass in the nest relative to individuals from larger broods. Having established these relationships, we then use three years of field data involving multiple captures of individuals throughout the pre-migratory period and a multi-level path model to examine the hypothesis that conditions during development limit survival during migration by affecting an individual's ability to accumulate sufficient lean tissue and fat mass prior to migration. We found a positive relationship between fat mass during the pre-migratory period (Sept–Oct) and nestling mass and a negative indirect relationship between pre-migratory fat mass and fledging date. Our results provide the first evidence that conditions during development limit survival during migration through their effect on fat stores. These results are particularly important given recent evidence showing that body condition of songbirds at fledging is affected by climate change and anthropogenic changes to landscape structure. PMID:22194925

Mitchell, Greg W.; Guglielmo, Christopher G.; Wheelwright, Nathaniel T.; Freeman-Gallant, Corey R.; Norris, D. Ryan

2011-01-01

247

Incidence of early postoperative cognitive dysfunction and other adverse events in elderly patients undergoing elective total hip replacement (THR).  

PubMed

In elderly patients cognitive dysfunction and other adverse events (AEs) can impair the outcome of surgical procedures. As THR is performed with increasing frequency in aging populations, it is important to know the impact of these problems on the postoperative result. In this prospective cohort study 60 patients older than 65 years (66.7% female, 33.3% male) who received THR were included. The cognitive function was measured preoperatively, one week and six months postoperatively by the mini-mental state test (MMSE). Shortly after surgery 4 patients (6.7%) developed postoperative cognitive dysfunction, which has recovered at six-months-follow-up. In 41 patients (68.3%) AEs were recorded. Postoperative anemia occurred as the most common AE (n=32; 53.3%). During hospital stay older patients are at an increased risk for AEs. The incidence of postoperative cognitive dysfunction was observed less often than expected. Further research is necessary to assess the effect of early interventions in case of cognitive dysfunction. With use of a simple and quickly performed test like the MMSE patients can be effectively screened for impaired cognitive function. Secure identification of those patients is mandatory to avoid complications with harmful long-term effects. PMID:21288579

Postler, A; Neidel, J; Günther, K-P; Kirschner, S

2011-01-01

248

Stimulation of Na/sup +//H/sup +/ antiport is an early event in hypertrophy of renal proximal tubular cells  

SciTech Connect

Renal hypertrophy in vivo is achieved by an increase in protein content per cell and an increase in cell size with minimal hyperplasia. Hypertrophied renal tubular cells remain quiescent and demonstrate an increase in transcellular transport rates. This situation was simulated in vitro by exposing a confluent, quiescent primary culture of rabbit renal proximal tubular cells to either insulin, prostaglandin E/sub 1/, or hypertonic NaCl for 24 or 48 hr. Protein per cell increased by 20-30% with little or no increase in (/sup 3/H)thymidine incorporation into DNA. Mean cell volume was also increased in insulin- and hypertonic NaCl-treated but not in prostaglandin E/sub 1/-treated cells. Two hours of exposure to the growth stimuli increased amiloride-sensitive Na/sup +/ uptake, Na-dependent H/sup +/ efflux, and ouabain-sensitive Rb/sup +/ uptake, indicating that stimulation of Na/sup +//H/sup +/ antiport (exchange) occurs as an early event in their action. Hypertrophied cells continued to demonstrate enhanced Na/sup +//H/sup +/ antiport after the growth stimuli were removed for 3 hr, by which time their acute effects are reversed.

Fine, L.G.; Badie-Dezfooly, B.; Lowe, A.G.; Hamzeh, A.; Wells, J.; Salehmoghaddam, S.

1985-03-01

249

Indirect comparisons of adverse events and dropout rates in early Parkinson's disease trials of pramipexole, ropinirole, and rasagiline.  

PubMed

The comparative safety profiles of monotherapeutic treatments for Parkinson's disease (PD) can provide valuable therapeutic information. The objective of this study was to perform an indirect comparison of Adverse Events (AEs) and Dropout Rates (DRs) among clinical trials of pramipexole, ropinirole, and rasagiline. Outcomes analyzed included DRs, total AEs, and AE categories: Cognitive (CG), Gastrointestinal (GI), and Sleep/Fatigue (SF). The odds-ratio (OR) and Credible Interval (CrI) of outcomes between products using placebo as common comparator was calculated using indirect meta-analytical methods. AEs incidences for subjects receiving rasagiline were not significantly different from placebo, whereas DRs were significantly lower than for placebo (OR = 0.55; 95% CrI = 0.34-0.88). Patients receiving pramipexole or ropinirole had higher incidence of all AEs and DRs than patients taking rasagiline, except for the nonsignificant incidence of CG for ropinirole vs. rasagiline (1.76; 0.69-4.70). The incidence of GI (2.11; 1.13-4.06) and SF (2.75; 1.42-5.47) was significantly higher for ropinirole than for pramipexole, whereas the incidence of CG was significantly lower for ropinirole than for pramipexole (0.22; 0.07-0.69). Findings suggest that subjects with early PD treated with rasagiline have fewer AEs and DRs than those treated with pramipexole or ropinirole. GI and SF AEs were highest for subjects treated with ropinirole, while individuals treated with pramipexole exhibited the highest incidence of cognitive AEs. PMID:22304415

Zagmutt, Francisco J; Tarrants, Marcy L

2012-07-01

250

Early Events in the Life of Apple Roots: Variation in Root Growth Rate is Linked to Mycorrhizal and Nonmycorrhizal Fungal Colonization  

Technology Transfer Automated Retrieval System (TEKTRAN)

A study was conducted to characterize early events of mycorrhizal and nonmycorrhizal fungal colonization in newly-emerging roots of mature apple (Malus domestica) trees and to determine the relationship to fine root growth rate and development. New roots were traced on root windows to measure growt...

251

Genetic and Functional Analysis of DD44, a Sex-Linked Gene From the Dioecious Plant Silene latifolia, Provides Clues to Early Events in Sex Chromosome Evolution  

Microsoft Academic Search

Silene latifolia is a dioecious plant with heteromorphic sex chromosomes. The sex chromosomes of S. latifolia provide an opportunity to study the early events in sex chromosome evolution because of their relatively recent emergence. In this article, we present the genetic and physical mapping, expression analysis, and molecular evolutionary analysis of a sex-linked gene from S. latifolia, DD44 (Differential Display

Richard C. Moore; Olga Kozyreva; Sabine Lebel-Hardenack; Jiri Siroky; Roman Hobza; Boris Vyskot; Sarah R. Grant

252

Quantitative Analysis of the Processes and Signaling Events Involved in Early HIV-1 Infection of T Cells  

PubMed Central

Lymphocyte invasion by HIV-1 is a complex, highly regulated process involving many different types of molecules that is prompted by the virus's association with viral receptors located at the cell-surface membrane that culminates in the formation of a fusion pore through which the virus enters the cell. A great deal of work has been done to identify the key actors in the process and determine the regulatory interactions; however, there have been no reports to date of attempts being made to fully understand the system dynamics through a systemic, quantitative modeling approach. In this paper, we introduce a dynamic mathematical model that integrates the available information on the molecular events involved in lymphocyte invasion. Our model shows that moesin activation is induced by virus signaling, while filamin-A is mobilized by the receptor capping. Actin disaggregation from the cap is facilitated by cofilin. Cofilin is inactivated by HIV-1 signaling in activated lymphocytes, while in resting lymphocytes another signal is required to activate cofilin in the later stages in order to accelerate the decay of the aggregated actin as a restriction factor for the viral entry. Furthermore, stopping the activation signaling of moesin is sufficient to liberate the actin filaments from the cap. The model also shows the positive effect of gelsolin on actin capping by means of the nucleation effect. These findings allow us to propose novel approaches in the search for new therapeutic strategies. In particular, gelsolin inhibition is seen as a promising target for preventing HIV-1 entry into lymphocytes, due to its role in facilitating the capping needed for the invasion. Also it is shown that HIV-1 should overcome the cortical actin barrier during early infection and predicts the different susceptibility of CD4+ T cells to be infected in terms of actin cytoskeleton dynamics driven by associated cellular factors. PMID:25105875

Santos, Guido; Valenzuela-Fernández, Agustín; Torres, Néstor V.

2014-01-01

253

Use of structured triacylglycerols containing predominantly stearic and oleic acids to probe early events in metabolic processing of dietary fat.  

PubMed

Early events in the metabolic processing of dietary triacylglycerol may have an important impact on subsequent development of risk factors for coronary heart disease. We have used structured triacylglycerols containing predominantly stearic or oleic acids at the sn -2 position to probe aspects of the processing of dietary fatty acids presented to adipose tissue in chylomicron-triacylglycerol. Studies were conducted on 14 healthy women who were given meals containing 85 g carbohydrate and 60 g of either of the two structured triacylglycerols in random order. Systemic concentrations and arterio-venous differences across adipose tissue for plasma triacylglycerol and non-esterified fatty acids were measured, together with analysis of the fatty acid composition of the relevant fractions. The stereo-specific structure of the ingested triacylglycerol was largely preserved in chylomicron-triacylglycerol. Systemic concentrations of total and individual non-esterified fatty acids were not significantly different after ingestion of the two fats, nor were their rates of release across adipose tissue. The composition of non-esterified fatty acids released from adipose tissue changed after the meal to reflect more closely the composition of the triacylglycerol ingested, but again no significant differences were observed between the two test meals. There was no detectable release of monoacylglycerol from adipose tissue after either test meal. We conclude that the environment for lipoprotein lipase action in adipose tissue in vivo is likely to be highly organized, such that there is no release of monoacylglycerol, nor preferential uptake or release of fatty acids from chylomicron-triacylglycerol according to the nature or the position within triacylglycerol of the fatty acid. PMID:10508209

Summers, L K; Fielding, B A; Herd, S L; Ilic, V; Clark, M L; Quinlan, P T; Frayn, K N

1999-10-01

254

Strong alkalinization of Chara cell surface in the area of cell wall incision as an early event in mechanoperception.  

PubMed

Mechanical wounding of cell walls occurring in plants under the impact of pathogens or herbivores can be mimicked by cell wall incision with a glass micropipette. Measurements of pH at the surface of Chara corallina internodes following microperforation of cell wall revealed a rapid (10-30s) localized alkalinization of the apoplast after a lag period of 10-20s. The pH increase induced by incision could be as large as 3 pH units and relaxed slowly, with a halftime up to 20min. The axial pH profile around the incision zone was bell-shaped and localized to a small area, extending over a distance of about 100?m. The pH response was suppressed by lowering cell turgor upon the replacement of artificial pond water (APW) with APW containing 50mM sorbitol. Stretching of the plasma membrane during its impression into the cell wall defect is likely to activate the Ca(2+) channels, as evidenced from sensitivity of the incision-induced alkalinization to the external calcium concentration and to the addition of Ca(2+)-channel blockers, such as La(3+), Gd(3+), and Zn(2+). The maximal pH values attained at the incision site (~10.0) were close to pH in light-dependent alkaline zones of Chara cells. The involvement of cytoskeleton in the origin of alkaline patch was documented by observations that the incision-induced pH transients were suppressed by the inhibitors of microtubules (oryzalin and taxol) and, to a lesser extent, by the actin inhibitor (cytochalasin B). The results indicate that the localized increase in apoplastic pH is an early event in mechanoperception and depends on light, cytoskeleton, and intracellular calcium. PMID:23850637

Bulychev, Alexander A; Alova, Anna V; Bibikova, Tatiana N

2013-11-01

255

Mouse Norovirus 1 Utilizes the Cytoskeleton Network To Establish Localization of the Replication Complex Proximal to the Microtubule Organizing Center  

PubMed Central

Human noroviruses (family Caliciviridae) are the leading cause of nonbacterial gastroenteritis worldwide. Although Human noroviruses are significant enteric pathogens, there exists no reliable vaccine or therapy to treat infected individuals. To date, attempts to cultivate Human noroviruses within the laboratory have met with little success; however, the related murine norovirus mouse norovirus 1 (MNV-1) has provided an ideal model system to study norovirus replication due to the ease with which the virus is cultivated and the ability to infect a small animal model with this virus. Previously we have identified the association between MNV-1 and components of the host secretory pathway and proposed a role for the viral open reading frame 1 proteins in the replication cycle. Here we describe for the first time a role for cytoskeletal components in early MNV-1 replication events. We show that the MNV-1 utilizes microtubules to position the replication complex adjacent to the microtubule organizing center. Chemical disruption of the microtubule network disperses the sites of MNV-1 replication throughout the cell and impairs production of viral protein and infectious virus. Furthermore, we demonstrate the ability of MNV-1 to redistribute acetylated tubulin to the replication complex and that this association is potentially mediated via the MNV-1 major structural protein, VP1. Transient expression of MNV-1 VP1 exhibited extensive colocalization with both ?-tubulin and acetylated tubulin and was observed to alter the distribution of acetylated tubulin in transfected cells. This study highlights the role of the cytoskeleton in early virus replication events and demonstrates the importance of this interaction in establishing the intracellular location of MNV-1 replication complexes. PMID:22301146

Hyde, Jennifer L.; Gillespie, Leah K.

2012-01-01

256

Spatial regulation and organization of DNA replication within the nucleus  

Microsoft Academic Search

Duplication of chromosomal DNA is a temporally and spatially regulated process. The timing of DNA replication initiation at\\u000a various origins is highly coordinated; some origins fire early and others late during S phase. Moreover, inside the nuclei,\\u000a the bulk of DNA replication is physically organized in replication factories, consisting of DNA polymerases and other replication\\u000a proteins. In this review article,

Toyoaki Natsume; Tomoyuki U. Tanaka

2010-01-01

257

Fragile Site Instability in Saccharomyces cerevisiae Causes Loss of Heterozygosity by Mitotic Crossovers and Break-Induced Replication  

PubMed Central

Loss of heterozygosity (LOH) at tumor suppressor loci is a major contributor to cancer initiation and progression. Both deletions and mitotic recombination can lead to LOH. Certain chromosomal loci known as common fragile sites are susceptible to DNA lesions under replication stress, and replication stress is prevalent in early stage tumor cells. There is extensive evidence for deletions stimulated by common fragile sites in tumors, but the role of fragile sites in stimulating mitotic recombination that causes LOH is unknown. Here, we have used the yeast model system to study the relationship between fragile site instability and mitotic recombination that results in LOH. A naturally occurring fragile site, FS2, exists on the right arm of yeast chromosome III, and we have analyzed LOH on this chromosome. We report that the frequency of spontaneous mitotic BIR events resulting in LOH on the right arm of yeast chromosome III is higher than expected, and that replication stress by low levels of polymerase alpha increases mitotic recombination 12-fold. Using single-nucleotide polymorphisms between the two chromosome III homologs, we mapped the locations of recombination events and determined that FS2 is a strong hotspot for both mitotic reciprocal crossovers and break-induced replication events under conditions of replication stress. PMID:24068975

Miller, Shaylynn D.; Casper, Anne M.

2013-01-01

258

Activation of Human Herpesvirus Replication by Apoptosis  

PubMed Central

A central feature of herpesvirus biology is the ability of herpesviruses to remain latent within host cells. Classically, exposure to inducing agents, like activating cytokines or phorbol esters that stimulate host cell signal transduction events, and epigenetic agents (e.g., butyrate) was thought to end latency. We recently showed that Kaposi's sarcoma-associated herpesvirus (KSHV, or human herpesvirus-8 [HHV-8]) has another, alternative emergency escape replication pathway that is triggered when KSHV's host cell undergoes apoptosis, characterized by the lack of a requirement for the replication and transcription activator (RTA) protein, accelerated late gene kinetics, and production of virus with decreased infectivity. Caspase-3 is necessary and sufficient to initiate the alternative replication program. HSV-1 was also recently shown to initiate replication in response to host cell apoptosis. These observations suggested that an alternative apoptosis-triggered replication program might be a general feature of herpesvirus biology and that apoptosis-initiated herpesvirus replication may have clinical implications, particularly for herpesviruses that almost universally infect humans. To explore whether an alternative apoptosis-initiated replication program is a common feature of herpesvirus biology, we studied cell lines latently infected with Epstein-Barr virus/HHV-4, HHV-6A, HHV-6B, HHV-7, and KSHV. We found that apoptosis triggers replication for each HHV studied, with caspase-3 being necessary and sufficient for HHV replication. An alternative apoptosis-initiated replication program appears to be a common feature of HHV biology. We also found that commonly used cytotoxic chemotherapeutic agents activate HHV replication, which suggests that treatments that promote apoptosis may lead to activation of latent herpesviruses, with potential clinical significance. PMID:23885073

Prasad, Alka; Remick, Jill

2013-01-01

259

The record of Tethyan planktonic foraminifera at the early Paleogene hyperthermal events and Middle Eocene Climatic Optimum in northeastern Italy: are they comparable?  

NASA Astrophysics Data System (ADS)

The early Paleogene is one of the more climatically and evolutionary dynamic periods in the Earth history that records a pronounced warming trend peaking in the Early Eocene, and a successive composite transition towards the modern icehouse world. Ever increasingly scientific attention is dedicated to definitely comprehend timing, nature and characters of the complex, non-linear evolution of the Paleogene climate. Several complete and expanded Paleogene successions (Forada, Possagno, Alano, Farra), with a sound magneto-biochronostratigraphic and stable isotope record crop out in the Venetian Southern Alps (Northeast Italy). Recent studies (Giusberti et. al., 2007; Luciani et al., 2007; Agnini et al., 2008) and unpublished data document the presence in these section of the main short-lived warming events (hyperthermals) of the Eocene (Paleocene-Eocene Thermal Maximum, PETM, ca 55 Ma, Eocene Layer of Mysterious Origin (ELMO, ca 53,6 Ma), X-event (ca 52.5 Ma), of the Early Eocene Climatic Optimum (EECO, ca 50-52 Ma) and of the Middle Eocene Climatic Optimum (MECO, ca 40 Ma; Zachos et al., 2001. 2008). All these events are typified by marked negative shifts in ?13C curves that correspond to carbonate decrease related to rise of the carbonate compensation depth in turn induced by large introduction in the ocean-atmosphere system of CO2. Common features to the warming events are pronounced and complex changes in planktonic foraminiferal assemblages, indicating strong environmental perturbations that perfectly parallel the variations of the stable isotope curves in all the examined events. These strict correspondences indicate close cause-effect relationships between changes in environmental conditions and modifications of the assemblages. Our analysis shows that the most striking variations are recorded by the PETM and MECO assemblages that reflect highly perturbed environments. The ELMO, X-event and EECO exhibit planktic foraminiferal responses that are similar to, though less intense than, those observed across the PETM and the MECO. In addition, sedimentological and quantitative micropaleontological data from the hyperthermal events from the Venetian Southern Alps essentially suggest as the main response to the pronounced warmth, increased weathering and runoff as well as sea surface eutrophication. A pronounced shift from relatively oligotrophic to eutrophic, opportunist planktonic foraminiferal assemblages was observed at the MECO as well, thus showing analogies with the hyperthermal events recorded in the same area. The taxa indicating eutrophic environmental conditions are however different at the MECO from the Alano section; on the other hand we can expect that the planktonic foraminiferal taxa indicating analogous scenarios might be different in different Eocene time-intervals. Remarkably, the PETM and MECO events record a significant occurrence of giant and malformed foraminifera, evidence of transient alteration in the ocean chemistry, including possible pH oscillations and increase in trace metal content. Our data suggests therefore that a major threshold in the photic zone ocean chemistry has been passed only for those prominent events. In conclusion, from the biotic response to the hyperthermal events, to the EECO and MECO we deduce that the most important effect of pronounced warming, that is the aspect common to all these events, has been the eutrophication of surface waters, as a consequence of modification in the hydrological cycle. The location adjacent to land masses of the studied Tethyan setting evidently facilitated the terrigenous input that was apparently the main responsible for the increase in nutrient availability during the cited Paleogene warming events. Finally, several lines of evidence indicate that PETM, EECO and MECO were linked to permanent changes in planktonic foraminiferal evolution beside the transient, ecologically controlled variations. Even though the true mechanisms forcing evolution of life on Earth are still unexplained, our record of the major climatic Paleogene events suggests a

Luciani, Valeria; Giusberti, Luca; Agnini, Claudia; Fornaciari, Eliana; Rio, Domenico

2010-05-01

260

Global organization of replication time zones of the mouse genome  

PubMed Central

The division of genomes into distinct replication time zones has long been established. However, an in-depth understanding of their organization and their relationship to transcription is incomplete. Taking advantage of a novel synchronization method (“baby machine”) and of genomic DNA microarrays, we have, for the first time, mapped replication times of the entire mouse genome at a high temporal resolution. Our data revealed that although most of the genome has a distinct time of replication either early, middle, or late S phase, a significant portion of the genome is replicated asynchronously. Analysis of the replication map revealed the genomic scale organization of the replication time zones. We found that the genomic regions between early and late replication time zones often consist of extremely large replicons. Analysis of the relationship between replication and transcription revealed that early replication is frequently correlated with the transcription potential of a gene and not necessarily with its actual transcriptional activity. These findings, along with the strong conservation found between replication timing in human and mouse genomes, emphasize the importance of replication timing in transcription regulation. PMID:18669478

Farkash-Amar, Shlomit; Lipson, Doron; Polten, Andreas; Goren, Alon; Helmstetter, Charles; Yakhini, Zohar; Simon, Itamar

2008-01-01

261

The Madotz Urgonian platform (Aralar, northern Spain): Paleoecological changes in response to Early Aptian global environmental events  

E-print Network

The Madotz Urgonian platform (Aralar, northern Spain): Paleoecological changes in response to Early Tecnología, Universidad del País Vasco, Apartado 644, 48080 Bilbao, Spain a b s t r a c ta r t i c l e i n f-rich facies Early Aptian Aralar N Spain Sudden addition of carbon dioxide to the atmosphere can reduce the Ca

Gilli, Adrian

262

The spectral absorption coefficient at 254?nm as a real-time early warning proxy for detecting faecal pollution events at alpine karst water resources.  

PubMed

Because spring water quality from alpine karst aquifers can change very rapidly during event situations, water abstraction management has to be performed in near real-time. Four summer events (2005-2008) at alpine karst springs were investigated in detail in order to evaluate the spectral absorption coefficient at 254?nm (SAC254) as a real-time early warning proxy for faecal pollution. For the investigation Low-Earth-Orbit (LEO) Satellite-based data communication between portable hydrometeorological measuring stations and an automated microbiological sampling device was used. The method for event triggered microbial sampling and analyzing was already established and described in a previous paper. Data analysis including on-line event characterisation (i.e. precipitation, discharge, turbidity, SAC254) and comprehensive E. coli determination (n>800) indicated that SAC254 is a useful early warning proxy. Irrespective of the studied event situations SAC254 always increased 3 to 6 hours earlier than the onset of faecal pollution, featuring different correlation phases. Furthermore, it seems also possible to use SAC254 as a real-time proxy parameter for estimating the extent of faecal pollution after establishing specific spring and event-type calibrations that take into consideration the variability of the occurrence and the transferability of faecal material It should be highlighted that diffuse faecal pollution from wildlife and live stock sources was responsible for spring water contamination at the investigated catchments. In this respect, the SAC254 can also provide useful information to support microbial source tracking efforts where different situations of infiltration have to be investigated. PMID:20962406

Stadler, H; Klock, E; Skritek, P; Mach, R L; Zerobin, W; Farnleitner, A H

2010-01-01

263

Defining the replication program through the chromatin landscape  

PubMed Central

DNA replication is an essential cell cycle event required for the accurate and timely duplication of the chromosomes. It is essential that the genome is replicated accurately and completely within the confines of S-phase. Failure to completely copy the genome has the potential to result in catastrophic genomic instability. Replication initiates in a coordinated manner from multiple locations, termed origins of replication, distributed across each of the chromosomes. The selection of these origins of replication is a dynamic process responding to both developmental and tissue specific signals. In this review, we explore the role of the local chromatin environment in regulating the DNA replication program at the level of origin selection and activation. Finally, there is increasing molecular evidence that the DNA replication program itself affects the chromatin landscape, suggesting that DNA replication is critical for both genetic and epigenetic inheritance. PMID:21417598

Ding, Queying; MacAlpine, David M.

2011-01-01

264

Reanalyses of Anomalous Gravitational Microlensing Events in the OGLE-III Early Warning System Database with Combined Data  

E-print Network

We reanalyze microlensing events in the published list of anomalous events that were observed from the OGLE lensing survey conducted during 2004-2008 period. In order to check the existence of possible degenerate solutions and extract extra information, we conduct analyses based on combined data from other survey and follow-up observation and consider higher-order effects. Among the analyzed events, we present analyses of 8 events for which either new solutions are identified or additional information is obtained. We find that the previous binary-source interpretations of 5 events are better interpreted by binary-lens models. These events include OGLE-2006-BLG-238, OGLE-2007-BLG-159, OGLE-2007-BLG-491, OGLE-2008-BLG-143, and OGLE-2008-BLG-210. With additional data covering caustic crossings, we detect finite-source effects for 6 events including OGLE-2006-BLG-215, OGLE-2006-BLG-238, OGLE-2006-BLG-450, OGLE-2008-BLG-143, OGLE-2008-BLG-210, and OGLE-2008-BLG-513. Among them, we are able to measure the Einstein ...

Jeong, J; Han, C; Gould, A; Udalski, A; Szyma?ski, M K; Pietrzy?ski, G; Soszy?ski, I; Poleski, R; Ulaczyk, K; Wyrzykowski, ?; Abe, F; Bennett, D P; Bond, I A; Botzler, C S; Freeman, M; Fukui, A; Fukunaga, D; Itow, Y; Koshimoto, N; Masuda, K; Matsubara, Y; Muraki, Y; Namba, S; Ohnishi, K; Rattenbury, N J; Saito, To; Sullivan, D J; Sweatman, W L; Sumi, T; Suzuki, D; Tristram, P J; Tsurumi, N; Wada, K; Yamai, N; Yock, P C M; Yonehara, A; Albrow, M D; Batista, V; Beaulieu, J -P; Caldwell, J A R; Cassan, A; Cole, A; Coutures, C; Dieters, S; Dominik, M; Prester, D Dominis; Donatowicz, J; Fouqué, P; Greenhill, J; Hoffman, M; Huber, M; Jørgensen, U G; Kane, S R; Kubas, D; Martin, R; Marquette, J -B; Menzies, J; Pitrou, C; Pollard, K; Sahu, K C; Vinter, C; Wambsganss, J; Williams, A; Allen, W; Bolt, G; Choi, J -Y; Christie, G W; DePoy, D L; Drummond, J; Gaudi, B S; Hwang, K -H; Jung, Y K; Lee, C -U; Mallia, F; Maoz, D; Maury, A; McCormick, J; Monard, L A G; Moorhouse, D; Natusch, T; Ofek, E O; Park, B -G; Pogge, R W; Santallo, R; Shin, I -G; Thornley, G; Yee, J C; Bramich, D M; Horne, K; Hundertmark, M; Kains, N; Snodgrass, C; Steele, I; Street, R; Tsapras, Y

2015-01-01

265

Mechanism of chromosomal DNA replication initiation and replication fork stabilization in eukaryotes.  

PubMed

Chromosomal DNA replication is one of the central biological events occurring inside cells. Due to its large size, the replication of genomic DNA in eukaryotes initiates at hundreds to tens of thousands of sites called DNA origins so that the replication could be completed in a limited time. Further, eukaryotic DNA replication is sophisticatedly regulated, and this regulation guarantees that each origin fires once per S phase and each segment of DNA gets duplication also once per cell cycle. The first step of replication initiation is the assembly of pre-replication complex (pre-RC). Since 1973, four proteins, Cdc6/Cdc18, MCM, ORC and Cdt1, have been extensively studied and proved to be pre-RC components. Recently, a novel pre-RC component called Sap1/Girdin was identified. Sap1/Girdin is required for loading Cdc18/Cdc6 to origins for pre-RC assembly in the fission yeast and human cells, respectively. At the transition of G1 to S phase, pre-RC is activated by the two kinases, cyclindependent kinase (CDK) and Dbf4-dependent kinase (DDK), and subsequently, RPA, primase-pol?, PCNA, topoisomerase, Cdc45, pol?, and pol? are recruited to DNA origins for creating two bi-directional replication forks and initiating DNA replication. As replication forks move along chromatin DNA, they frequently stall due to the presence of a great number of replication barriers on chromatin DNA, such as secondary DNA structures, protein/DNA complexes, DNA lesions, gene transcription. Stalled forks must require checkpoint regulation for their stabilization. Otherwise, stalled forks will collapse, which results in incomplete DNA replication and genomic instability. This short review gives a concise introduction regarding the current understanding of replication initiation and replication fork stabilization. PMID:24699916

Wu, LiHong; Liu, Yang; Kong, DaoChun

2014-05-01

266

H3K4me3 demethylation by the histone demethylase KDM5C/JARID1C promotes DNA replication origin firing  

PubMed Central

DNA replication is a tightly regulated process that initiates from multiple replication origins and leads to the faithful transmission of the genetic material. For proper DNA replication, the chromatin surrounding origins needs to be remodeled. However, remarkably little is known on which epigenetic changes are required to allow the firing of replication origins. Here, we show that the histone demethylase KDM5C/JARID1C is required for proper DNA replication at early origins. JARID1C dictates the assembly of the pre-initiation complex, driving the binding to chromatin of the pre-initiation proteins CDC45 and PCNA, through the demethylation of the histone mark H3K4me3. Fork activation and histone H4 acetylation, additional early events involved in DNA replication, are not affected by JARID1C downregulation. All together, these data point to a prominent role for JARID1C in a specific phase of DNA replication in mammalian cells, through its demethylase activity on H3K4me3. PMID:25712104

Rondinelli, Beatrice; Schwerer, Hélène; Antonini, Elena; Gaviraghi, Marco; Lupi, Alessio; Frenquelli, Michela; Cittaro, Davide; Segalla, Simona; Lemaitre, Jean-Marc; Tonon, Giovanni

2015-01-01

267

Replication in Prevention Science  

Microsoft Academic Search

Replication research is essential for the advancement of any scientific field. In this paper, we argue that prevention science\\u000a will be better positioned to help improve public health if (a) more replications are conducted; (b) those replications are\\u000a systematic, thoughtful, and conducted with full knowledge of the trials that have preceded them; and (c) state-of-the art\\u000a techniques are used to

Jeffrey C. Valentine; Anthony Biglan; Robert F. Boruch; Felipe González Castro; Linda M. Collins; Brian R. Flay; Sheppard Kellam; Eve K. Mo?cicki; Steven P. Schinke

2011-01-01

268

Paleoceanographic changes and population dynamics in two left-coiling events of Pulleniatina during early Pleistocene, ODP 1115B, western equatorial Pacific  

NASA Astrophysics Data System (ADS)

The alternately left-coiling (LC) and right-coiling (RC) dominance in the populations of planktonic foraminifera Pulleniatina genus defined a series L events during the past 4 Ma. These L events have been used as useful biostratigraphic markers for the Indo-Pacific region, especially the L5 event, which marks the top of Gelasian stage in Early Pleistocene. However, previous studies emphasized on the stratigraphic application of the L events and have little attention on the L events itself. This study focuses on the population dynamics of Pu. during L events and tries to examine the mechanism triggering the L events by studying Core ODP 1115 B (9°11' S, 151°34' E, water depth 1149 m) in Solomon Sea, western equatorial Pacific. Owing to the variance in morphology, we lumped all species of Pu. genus into a 'Pulleniatina complex' rather than subdividing them into different species. Specimens larger than 250 ?m in each sample were sieved into six size-fractions. The Pu. complex as well as their coiling direction were identified under a stereomicroscope. To avoid biased sampling, we examined all Pu. complex specimens larger than 250 ?m. LC and RC relative percentages as well as absolute abundances of Pu. complex in each size-fraction were counted, respectively. In setting LC relative percentage >50% as a threshold, we recognized a distinctive L6 event (~ 2.202 - 2.175 Ma, began between MIS 85 - 84 and ended between MIS 83 - 82), a prominent L5 event (~ 2.147 - 1.875 Ma, began between MIS 82 - 81 and ended between MIS 71 - 70), and could not find a clear L4 event as reported by Saito (1976). The onset of the L5 event was marked by a dramatic reduction of absolute abundance of RC forms that give observers an impression of LC forms dominance. During the L5 event, the LC relative percentages fluctuated by 20 to 40%. The ending of the L5event was characterized by a slow recovery of RC forms in absolute abundance. L6 event was the result of two sudden significant changes in absolute abundance of LC forms that led to pronounced relative percentage changes in coiling direction. For the biostragtigraphic application, these characteristics make the L6 event a better biostratigraphic marker than the L5 event where Pu. is less abundant. The onsets of the L5 and L6 event were corresponding to opposite global climatic changing trends. In addition, linear regression between population parameters and environmental proxies, including those of salinity, ice volume, primary productivity and water temperature from both sea surface and thermocline show week correlations, indicating the causal relationship between the environmental changes and the population dynamics of Pu. is not as strong as expected.

Chiang, M.; Wei, K.; Chuang, C.; Lo, L.

2013-12-01

269

Inhibition of Influenza Virus Replication by Targeting Broad Host Cell Pathways  

PubMed Central

Antivirals that are currently used to treat influenza virus infections target components of the virus which can mutate rapidly. Consequently, there has been an increase in the number of resistant strains to one or many antivirals in recent years. Here we compared the antiviral effects of lysosomotropic alkalinizing agents (LAAs) and calcium modulators (CMs), which interfere with crucial events in the influenza virus replication cycle, against avian, swine, and human viruses of different subtypes in MDCK cells. We observed that treatment with LAAs, CMs, or a combination of both, significantly inhibited viral replication. Moreover, the drugs were effective even when they were administered 8 h after infection. Finally, analysis of the expression of viral acidic polymerase (PA) revealed that both drugs classes interfered with early events in the viral replication cycle. This study demonstrates that targeting broad host cellular pathways can be an efficient strategy to inhibit influenza replication. Furthermore, it provides an interesting avenue for drug development where resistance by the virus might be reduced since the virus is not targeted directly. PMID:25333287

Marois, Isabelle; Cloutier, Alexandre; Meunier, Isabelle; Weingartl, Hana M.; Cantin, André M.; Richter, Martin V.

2014-01-01

270

Orbital control on carbon cycle alterations and hyperthermal events in a cooling world: the late Early to Mid Eocene record at Possagno (southern Alps, Italy)  

NASA Astrophysics Data System (ADS)

The late Early Eocene to Middle Eocene ~50-45 Million years ago (Ma) time interval in the middle bathyal, pelagic/hemipelagic succession of the Western Tethys Possagno section (southern Alps, Veneto), contains several episodes of negative carbon isotope excursions (CIEs) and concomitant dissolution of carbonates. These episodes are superimposed on a long term global climate cooling that started at about 51 Ma following the Early Eocene Climatic Optimum (EECO). Spectral analysis indicates that CIEs and dissolution events are paced by orbital forcing, confirming the global significance of previous finding on the same interval from Western and Southern Atlantic and Equatorial Pacific sites. The frequency and magnitude of CIEs through time is controlled by long-term modulations of orbital parameters, including long eccentricity (400 kyr) and a 1.2 million year modulation. Highest frequency of events - at the orbital scale - is observed across the EECO, which provides an observational basis to validate theoretical models predicting a threshold effect resulting from orbital forcing superimposed on gradually changing mean global boundary conditions. The observation of the 1.2 million year beat (long-term modulation of obliquity) together with previously published observation of enhanced obliquity (41 kyr) forcing across major CIEs and dissolution intervals indicates that high latitude feedbacks to orbital forcing played a fundamental role in the emplacement of the hyperthermals. The observed orbital forcing signature closely match that of early Eocene hyperthermals, suggesting similar driving processes.

Galeotti, Simone; Sprovieri, Mario; Moretti, Matteo; Rio, Domenico; Fornaciari, Eliana; Giusberti, Luca; Agnini, Claudia; Backman, Jan; Lanci, Luca; Luciani, Valeria

2013-04-01

271

Impacts of a water stress followed by an early frost event on beech (Fagus sylvatica L.) susceptibility to Scolytine ambrosia beetles - Research strategy and first results  

NASA Astrophysics Data System (ADS)

Climate change tends to induce more frequent abiotic and biotic extreme events, having large impacts on tree vitality. Weakened trees are then more susceptible to secondary insect outbreaks, as it happened in Belgium in the early 2000s: after an early frost event, secondary Scolytine ambrosia beetles attacks were observed on beech trees. In this study, we test if a combination of stress, i.e. a soil water deficit preceding an early frost, could render trees more attractive to beetles. An experimental study was set in autumn 2008. Two parcels of a beech forest were covered with plastic tents to induce a water stress by rain interception. The parcels were surrounded by 2-meters depth trenches to avoid water supply by streaming. Soil water content and different indicators of tree water use (sap flow, predawn leaf water potential, tree radial growth) were followed. In autumn 2010, artificial frost injuries will be inflicted to trees using dry ice. Trees attractivity for Scolytine insects, and the success of insect colonization will then be studied. The poster will focus on experiment setting and first results (impacts of soil water deficit on trees).

La Spina, Sylvie; de Cannière, Charles; Molenberg, Jean-Marc; Vincke, Caroline; Deman, Déborah; Grégoire, Jean-Claude

2010-05-01

272

A global profile of replicative polymerase usage.  

PubMed

Three eukaryotic DNA polymerases are essential for genome replication. Polymerase (Pol) ?-primase initiates each synthesis event and is rapidly replaced by processive DNA polymerases: Pol? replicates the leading strand, whereas Pol? performs lagging-strand synthesis. However, it is not known whether this division of labor is maintained across the whole genome or how uniform it is within single replicons. Using Schizosaccharomyces pombe, we have developed a polymerase usage sequencing (Pu-seq) strategy to map polymerase usage genome wide. Pu-seq provides direct replication-origin location and efficiency data and indirect estimates of replication timing. We confirm that the division of labor is broadly maintained across an entire genome. However, our data suggest a subtle variability in the usage of the two polymerases within individual replicons. We propose that this results from occasional leading-strand initiation by Pol? followed by exchange for Pol?. PMID:25664722

Daigaku, Yasukazu; Keszthelyi, Andrea; Müller, Carolin A; Miyabe, Izumi; Brooks, Tony; Retkute, Renata; Hubank, Mike; Nieduszynski, Conrad A; Carr, Antony M

2015-03-01

273

DNA replication, transcription and translation operate with astounding speed and fidelity in bacterial cells1  

E-print Network

DNA replication, transcription and translation operate with astounding speed and fidelity of the molecular mechanisms of bacterial DNA replication, transcription and translation. Our understanding of the molecules in the reaction vessel. For processive events, such as DNA repli- cation, transcription

274

State-Machine Replication  

E-print Network

State-Machine Replication #12;The Problem Clients Server #12;The Problem Clients Server #12;The (state machine) #12;The Solution 1. Make server deterministic (state machine) State machine #12;The Solution 1. Make server deterministic (state machine) 2. Replicate server State machines #12;The Solution 1

Venkataramani, Arun

275

Project New Pride: Replication.  

ERIC Educational Resources Information Center

The Office of Juvenile Justice and Delinquency Prevention, Law Enforcement Assistance Administration, is establishing a new discretionary grant program entitled Replication of Project New Pride: A Serious Offender Youth Treatment Program. Project New Pride was chosen for replication because of its demonstrated effectiveness in Denver, Colorado,…

National Inst. for Juvenile Justice and Delinquency Prevention (Dept. of Justice/LEAA), Washington, DC.

276

Rumination as a Mechanism Linking Stressful Life Events to Symptoms of Depression and Anxiety: Longitudinal Evidence in Early Adolescents and Adults  

PubMed Central

Rumination is a well-established risk factor for the onset of major depression and anxiety symptomatology in both adolescents and adults. Despite the robust associations between rumination and internalizing psychopathology, there is a dearth of research examining factors that might lead to a ruminative response style. In the current study, we examined whether social environmental experiences were associated with rumination. Specifically, we evaluated whether self-reported exposure to stressful life events predicted subsequent increases in rumination. We also investigated whether rumination served as a mechanism underlying the longitudinal association between self-reported stressful life events and internalizing symptoms. Self-reported stressful life events, rumination, and symptoms of depression and anxiety were assessed in 2 separate longitudinal samples. A sample of early adolescents (N = 1,065) was assessed at 3 time points spanning 7 months. A sample of adults (N = 1,132) was assessed at 2 time points spanning 12 months. In both samples, self-reported exposure to stressful life events was associated longitudinally with increased engagement in rumination. In addition, rumination mediated the longitudinal relationship between self-reported stressors and symptoms of anxiety in both samples and the relationship between self-reported life events and symptoms of depression in the adult sample. Identifying the psychological and neurobiological mechanisms that explain a greater propensity for rumination following stressors remains an important goal for future research. This study provides novel evidence for the role of stressful life events in shaping characteristic responses to distress, specifically engagement in rumination, highlighting potentially useful targets for interventions aimed at preventing the onset of depression and anxiety. PMID:23713497

Michl, Louisa C.; McLaughlin, Katie A.; Shepherd, Kathrine; Nolen-Hoeksema, Susan

2014-01-01

277

Replication stress and cancer.  

PubMed

Genome instability is a hallmark of cancer, and DNA replication is the most vulnerable cellular process that can lead to it. Any condition leading to high levels of DNA damage will result in replication stress, which is a source of genome instability and a feature of pre-cancerous and cancerous cells. Therefore, understanding the molecular basis of replication stress is crucial to the understanding of tumorigenesis. Although a negative aspect of replication stress is its prominent role in tumorigenesis, a positive aspect is that it provides a potential target for cancer therapy. In this Review, we discuss the link between persistent replication stress and tumorigenesis, with the goal of shedding light on the mechanisms underlying the initiation of an oncogenic process, which should open up new possibilities for cancer diagnostics and treatment. PMID:25907220

Gaillard, Hélène; García-Muse, Tatiana; Aguilera, Andrés

2015-04-24

278

DNA Virus Replication Compartments  

PubMed Central

Viruses employ a variety of strategies to usurp and control cellular activities through the orchestrated recruitment of macromolecules to specific cytoplasmic or nuclear compartments. Formation of such specialized virus-induced cellular microenvironments, which have been termed viroplasms, virus factories, or virus replication centers, complexes, or compartments, depends on molecular interactions between viral and cellular factors that participate in viral genome expression and replication and are in some cases associated with sites of virion assembly. These virus-induced compartments function not only to recruit and concentrate factors required for essential steps of the viral replication cycle but also to control the cellular mechanisms of antiviral defense. In this review, we summarize characteristic features of viral replication compartments from different virus families and discuss similarities in the viral and cellular activities that are associated with their assembly and the functions they facilitate for viral replication. PMID:24257611

Schmid, Melanie; Speiseder, Thomas; Dobner, Thomas

2014-01-01

279

Clustering of transcriptional profiles identifies changes to insulin signaling as an early event in a mouse model of Alzheimer’s disease  

PubMed Central

Background Alzheimer’s disease affects more than 35 million people worldwide but there is no known cure. Age is the strongest risk factor for Alzheimer’s disease but it is not clear how age-related changes impact the disease. Here, we used a mouse model of Alzheimer’s disease to identify age-specific changes that occur prior to and at the onset of traditional Alzheimer-related phenotypes including amyloid plaque formation. To identify these early events we used transcriptional profiling of mouse brains combined with computational approaches including singular value decomposition and hierarchical clustering. Results Our study identifies three key events in early stages of Alzheimer’s disease. First, the most important drivers of Alzheimer’s disease onset in these mice are age-specific changes. These include perturbations of the ribosome and oxidative phosphorylation pathways. Second, the earliest detectable disease-specific changes occur to genes commonly associated with the hypothalamic-adrenal-pituitary (HPA) axis. These include the down-regulation of genes relating to metabolism, depression and appetite. Finally, insulin signaling, in particular the down-regulation of the insulin receptor substrate 4 (Irs4) gene, may be an important event in the transition from age-related changes to Alzheimer’s disease specific-changes. Conclusion A combination of transcriptional profiling combined with computational analyses has uncovered novel features relevant to Alzheimer’s disease in a widely used mouse model and offers avenues for further exploration into early stages of AD. PMID:24274089

2013-01-01

280

The Carboniferous Baralacha La basaltic dykes (Upper Lahul, Ladakh) : remnants of an early rifting event along the Indian northern plate  

E-print Network

The Carboniferous Baralacha La basaltic dykes (Upper Lahul, Ladakh) : remnants of an early rifting margin, Ladakh. Abstract. ­ The Lower Carboniferous Baralacha La basaltic dykes were emplaced along. The alkali basalts, compared to the tholeiites, have higher TiO2, rare earth and highly incompatible trace

Demouchy, Sylvie

281

Majority Vote and Decision Template Based Ensemble Classifiers Trained on Event Related Potentials for Early Diagnosis of Alzheimer's Disease  

E-print Network

for Early Diagnosis of Alzheimer's Disease Nicholas Stepenosky1 , Deborah Green2 , John Kounios2@rowan.edu ABSTRACT With the rapid increase in the population of elderly individuals affected by Alzheimer's disease templates. 1. INTRODUCTION Alzheimer's disease (AD) is the most common type of de- mentia, a degenerative

Polikar, Robi

282

Diffusion MRI detects early events in the response of a glioma model to the yeast cytosine deaminase gene therapy strategy  

Microsoft Academic Search

Detection of a therapeutic response early in the course of cancer treatment, before tumor growth delay or regression, is not currently possible in experimental models or clinical medicine. New interim measures of therapeutic response would be particularly useful in the development of cancer chemosensitization gene therapy by facilitating optimization of gene transfer protocols and prodrug dosing schedules. Diffusion MRI is

LD Stegman; A Rehemtulla; DA Hamstra; DJ Rice; SJ Jonas; KL Stout; TL Chenevert; BD Ross

2000-01-01

283

Paleomagnetic and Geochronologic Data from Central Asia: Inferences for Early Paleozoic Tectonic Evolution and Timing of Worldwide Glacial Events  

Microsoft Academic Search

The Neoproterozoic to early Paleozoic Ural-Mongol belt that runs through Central Asia is crucial for determining the enigmatic amalgamation of microcontinents that make up the Eurasian subcontinent. Two unique models have been proposed for the evolution of Ural-Mongol belt. One involves a complex assemblage of cratonic blocks that have collided and rifted apart during diachronous opening and closing of Neoproterozoic

L. C. Gregory; J. G. Meert; N. Levashova; W. C. Grice; A. Gibsher; A. Rybanin

2007-01-01

284

Comparison of Early Cortical Networks in Efficient and Inefficient Visual Search: An Event-Related Potential Study  

Microsoft Academic Search

Functional magnetic resonance imaging studies have indicated that efficient feature search (FS) and inefficient conjunction search (CS) activate partially distinct frontoparietal cortical networks. However, it remains a matter of debate whether the differences in these networks reflect differences in the early processing during FS and CS. In addition, the relationship between the differences in the networks and spatial shifts of

Ute Leonards; Julie Palix; Christoph Michel; Vicente Ibanez

2003-01-01

285

Associations of Mother-Child Reminiscing about Negative Past Events, Coping, and Self-Concept in Early Childhood  

ERIC Educational Resources Information Center

Parent-child reminiscing conversations in early childhood have received theoretical attention as a forum for children's self-concept development, but this has been little addressed in empirical work. This study examines associations between emotion reminiscing and children's self-concepts and, building from the reminiscing and…

Goodvin, Rebecca; Romdall, Lisa

2013-01-01

286

High resolution chronology of late Cretaceous-early Tertiary events determined from 21,000 yr orbital-climatic cycles in marine sediments  

NASA Technical Reports Server (NTRS)

A number of South Atlantic sites cored by the Deep Sea Drilling Project (DSDP) recovered late Cretaceous and early Tertiary sediments with alternating light-dark, high-low carbonate content. The sedimentary oscillations were turned into time series by digitizing color photographs of core segments at a resolution of about 5 points/cm. Spectral analysis of these records indicates prominent periodicity at 25 to 35 cm in the Cretaceous intervals, and about 15 cm in the early Tertiary sediments. The absolute period of the cycles that is determined from paleomagnetic calibration at two sites is 20,000 to 25,000 yr, and almost certainly corresponds to the period of the earth's precessional cycle. These sequences therefore contain an internal chronometer to measure events across the K/T extinction boundary at this scale of resolution. The orbital metronome was used to address several related questions: the position of the K/T boundary within magnetic chron 29R, the fluxes of biogenic and detrital material to the deep sea immediately before and after the K/T event, the duration of the Sr anomaly, and the level of background climatic variability in the latest Cretaceous time. The carbonate/color cycles that were analyzed contain primary records of ocean carbonate productivity and chemistry, as evidenced by bioturbational mixing of adjacent beds and the weak lithification of the rhythmic sequences. It was concluded that sedimentary sequences that contain orbital cyclicity are capable of providing resolution of dramatic events in earth history with much greater precision than obtainable through radiometric methods. The data show no evidence for a gradual climatic deterioration prior to the K/T extinction event, and argue for a geologically rapid revolution at this horizon.

Herbert, Timothy D.; Dhondt, Steven

1988-01-01

287

Events occurring during the previous lactation, the dry period, and peripartum as risk factors for early lactation mastitis in cows receiving 2 different intramammary dry cow therapies.  

PubMed

The objective of this study was to investigate the association between mastitis events occurring during the previous lactation, the dry period, and the peripartum period on the incidence of early lactation mastitis in cows receiving ceftiofur hydrochloride or penicillin dihydrostreptomycin as intramammary dry cow antibiotic therapy. Cows (n=402) from 2 large dairy farms in Central Florida were enrolled in the study at the time of dry-off processing and were randomly assigned to 1 of 2 dry cow therapies: ceftiofur hydrochloride or penicillin dihydrostreptomycin. Composite milk samples were collected at dry-off and after calving for bacteriological examination and somatic cell count. Peripartal health disorders were monitored during the first 30 d of lactation and included calving difficulty, metritis, ketosis, and left displaced abomasum. Milk production and individual somatic cell scores (SCS) were recorded monthly by the Dairy Herd Improvement Association. The main outcome variables were the risk of clinical mastitis during the first 30 and 60 d of lactation, and the risk of subclinical mastitis at the first 2 monthly Dairy Herd Improvement Association tests after calving (up to 70 d in milk). Additionally, the SCS and the presence of mastitis pathogens in milk at dry-off and at calving were analyzed. Explanatory variables consisted of events occurring during the previous lactation, at dry-off and during the dry period, at calving, and within the first 30 d after calving. Multiple events occurring during the previous lactation had a significant effect on the incidence of mastitis in the subsequent lactation. These events included low milk yield, intermediate lactation length, clinical mastitis, and lactation SCS average. Similarly, intramammary infections with environmental bacteria at dry-off increased the chances of clinical mastitis the first month after calving. Dry-off therapy had a significant effect on mastitis incidence; cows treated with ceftiofur hydrochloride had lower odds of having clinical and subclinical mastitis in the subsequent early lactation compared with cows treated with penicillin dihydrostreptomycin. PMID:22999278

Pinedo, P J; Fleming, C; Risco, C A

2012-12-01

288

Methylation: a regulator of HIV-1 replication?  

PubMed Central

Recent characterizations of methyl transferases as regulators of cellular processes have spurred investigations into how methylation events might influence the HIV-1 life cycle. Emerging evidence suggests that protein-methylation can positively and negatively regulate HIV-1 replication. How DNA- and RNA- methylation might impact HIV-1 is also discussed. PMID:17274823

Yedavalli, Venkat RK; Jeang, Kuan-Teh

2007-01-01

289

Histone acetylation controls the inactive X chromosome replication dynamics  

Microsoft Academic Search

In mammals, dosage compensation between male and female cells is achieved by inactivating one female X chromosome (Xi). Late replication of Xi was proposed to be involved in the maintenance of its silenced state. Here, we show a highly synchronous replication of the Xi within 1 to 2h during early-mid S-phase by following DNA replication in living mammalian cells with

Corella S. Casas-Delucchi; Alessandro Brero; Hans-Peter Rahn; Irina Solovei; Anton Wutz; Thomas Cremer; Heinrich Leonhardt; M. Cristina Cardoso

2011-01-01

290

Mind\\/Machine Interaction Consortium: PortREG Replication Experiments  

Microsoft Academic Search

A consortium of research groups at Freiburg, Giessen, and Princeton was formed in 1996 to pursue multidisciplinary studies of mind\\/machine interaction anomalies. The first collaborative project under- taken was an attempted replication of prior Princeton experiments that had demonstrated anomalous deviations of the outputs of electronic random event generators in correlation with prestated intentions of human operators. For this replication,

R. JAHN; B. DUNNE; G. BRADISH; Y. DOBYNS; A. LETTIERI; R. NELSON; J. MISCHO; E. BOLLER; H. BÖSCH; D. VAITL; J. HOUTKOOPER; B. WALTER

2000-01-01

291

Holocene glacier and climate variations in western Norway: Evidence for early Holocene glacier demise and multiple Neoglacial events  

Microsoft Academic Search

Lithostratigraphic and paleobotanical studies suggest that the Jostedalsbreen ice cap probably disappeared during the early Holocene Hypsithermal interval (ca. 8000-6000 B.P.) and re-formed about 5300 B.P. The equilibrium-line altitude was lower than the modern mean equilibrium-line altitude between 2595 ±85 and 2360 ±80 B.P., between 2250 ±65 and 2150 ±80 B.P., between 1740 ±75 and 1730 ±75 B.P., between 1430

Atle Nesje; Mons Kvamme

1991-01-01

292

Stable DNA replication: interplay between DNA replication, homologous recombination, and transcription.  

PubMed Central

Chromosome replication in Escherichia coli is normally initiated at oriC, the origin of chromosome replication. E. coli cells possess at least three additional initiation systems for chromosome replication that are normally repressed but can be activated under certain specific conditions. These are termed the stable DNA replication systems. Inducible stable DNA replication (iSDR), which is activated by SOS induction, is proposed to be initiated from a D-loop, an early intermediate in homologous recombination. Thus, iSDR is a form of recombination-dependent DNA replication (RDR). Analysis of iSDR and RDR has led to the proposal that homologous recombination and double-strand break repair involve extensive semiconservative DNA replication. RDR is proposed to play crucial roles in homologous recombination, double-strand break repair, restoration of collapsed replication forks, and adaptive mutation. Constitutive stable DNA replication (cSDR) is activated in mhA mutants deficient in RNase HI or in recG mutants deficient in RecG helicase. cSDR is proposed to be initiated from an R-loop that can be formed by the invasion of duplex DNA by an RNA transcript, which most probably is catalyzed by RecA protein. The third form of SDR is nSDR, which can be transiently activated in wild-type cells when rapidly growing cells enter the stationary phase. This article describes the characteristics of these alternative DNA replication forms and reviews evidence that has led to the formulation of the proposed models for SDR initiation mechanisms. The possible interplay between DNA replication, homologous recombination, DNA repair, and transcription is explored. PMID:9184011

Kogoma, T

1997-01-01

293

Early Solar System Alkali Fractionation Events Recorded by K-Ca Isotopes in the Yamato-74442 LL-Chondritic Breccia  

NASA Technical Reports Server (NTRS)

Radiogenic ingrowth of Ca-40 due to decay of K-40 occurred early in the solar system history causing the Ca-40 abundance to vary within different early-former reservoirs. Marshall and DePaolo ] demonstrated that the K-40/Ca-40 decay system could be a useful radiogenic tracer for studies of terrestrial rocks. Shih et al. [3,4] determined 40K/40Ca ages of lunar granitic rock fragments and discussed the chemical characteristics of their source materials. Recently, Yokoyama et al. [5] showed the application of the K-40/Ca-40 chronometer for high K/Ca materials in ordinary chondrites (OCs). High-precision calcium isotopic data are needed to constrain mixing processes among early solar system materials and the time of planetesimal formation. To better constrain the solar system calcium isotopic compositions among astromaterials, we have determined the calcium isotopic compositions of OCs and an angrite. We further estimated a source K/Ca ratio for alkali-rich fragments in a chondritic breccia using the estimated solar system initial Ca-40/Ca-44.

Tatsunori, T.; Misawa, K.; Okano, O.; Shih, C.-Y.; Nyquist, L. E.; Simon, J. I.; Tappa, M. J.; Yoneda, S.

2015-01-01

294

Deciphering early events involved in hyperosmotic stress-induced programmed cell death in tobacco BY-2 cells.  

PubMed

Hyperosmotic stresses represent one of the major constraints that adversely affect plants growth, development, and productivity. In this study, the focus was on early responses to hyperosmotic stress- (NaCl and sorbitol) induced reactive oxygen species (ROS) generation, cytosolic Ca(2+) concentration ([Ca(2+)]cyt) increase, ion fluxes, and mitochondrial potential variations, and on their links in pathways leading to programmed cell death (PCD). By using BY-2 tobacco cells, it was shown that both NaCl- and sorbitol-induced PCD seemed to be dependent on superoxide anion (O2·(-)) generation by NADPH-oxidase. In the case of NaCl, an early influx of sodium through non-selective cation channels participates in the development of PCD through mitochondrial dysfunction and NADPH-oxidase-dependent O2·(-) generation. This supports the hypothesis of different pathways in NaCl- and sorbitol-induced cell death. Surprisingly, other shared early responses, such as [Ca(2+)]cyt increase and singlet oxygen production, do not seem to be involved in PCD. PMID:24420571

Monetti, Emanuela; Kadono, Takashi; Tran, Daniel; Azzarello, Elisa; Arbelet-Bonnin, Delphine; Biligui, Bernadette; Briand, Joël; Kawano, Tomonori; Mancuso, Stefano; Bouteau, François

2014-03-01

295

Deciphering early events involved in hyperosmotic stress-induced programmed cell death in tobacco BY-2 cells  

PubMed Central

Hyperosmotic stresses represent one of the major constraints that adversely affect plants growth, development, and productivity. In this study, the focus was on early responses to hyperosmotic stress- (NaCl and sorbitol) induced reactive oxygen species (ROS) generation, cytosolic Ca2+ concentration ([Ca2+]cyt) increase, ion fluxes, and mitochondrial potential variations, and on their links in pathways leading to programmed cell death (PCD). By using BY-2 tobacco cells, it was shown that both NaCl- and sorbitol-induced PCD seemed to be dependent on superoxide anion (O2·–) generation by NADPH-oxidase. In the case of NaCl, an early influx of sodium through non-selective cation channels participates in the development of PCD through mitochondrial dysfunction and NADPH-oxidase-dependent O2·– generation. This supports the hypothesis of different pathways in NaCl- and sorbitol-induced cell death. Surprisingly, other shared early responses, such as [Ca2+]cyt increase and singlet oxygen production, do not seem to be involved in PCD. PMID:24420571

Monetti, Emanuela; Kadono, Takashi; Bouteau, François

2014-01-01

296

Identification of a Replication Protein and Repeats Essential for DNA Replication of the Temperate Lactococcal Bacteriophage TP901-1  

Microsoft Academic Search

DNA replication of the temperate lactococcal bacteriophage TP901-1 was shown to involve the gene product encoded by orf13 and the repeats located within the gene. Sequence analysis of 1,500 bp of the early transcribed region of the phage genome revealed a single-stranded DNA binding protein analogue (ORF12) and the putative replication protein (ORF13). The putative origin of replication was identified

S. Ostergaard; L. Brondsted; FINN K. VOGENSEN

2001-01-01

297

Proteomic Analysis of Early Reprogramming Events in Murine Somatic Cells Incubated with Xenopus laevis Oocyte Extracts Demonstrates Network Associations with Induced Pluripotency Markers  

PubMed Central

Abstract The reprogramming of somatic cells into a pluripotent/embryonic-like state holds great potential for regenerative medicine, bypassing ethical issues associated with embryonic stem cells (ESCs). Numerous methods, including somatic cell nuclear transfer (SCNT), fusion to pluripotent cells, the use of cell extracts, and expression of transcription factors, have been used to reprogram cells into ES-like cells [termed induced pluripotent stem cells (iPSCs)]. This study investigated early events in the nuclei of permeabilized murine somatic cells incubated in cytoplasmic extract prepared from Xenopus laevis germinal vesicle–stage oocytes by identifying proteins that showed significant quantitative changes using proteomic techniques. A total of 69 protein spots from two-dimensional electrophoresis were identified as being significantly altered in expression after treatment, and 38 proteins were identified by tandem mass spectrometry. Network analysis was used to highlight pathway connections and interactions between these identified proteins, which were found to be involved in many functions—primarily nuclear structure and dynamics, transcription, and translation. The pluripotency markers Klf4, c-Myc, Nanog, and POU5F1 were highlighted by the interaction network analysis, as well as other compounds/proteins known to be repressed in pluripotent cells [e.g., protein kinase C (PRKC)] or enhanced during differentiation of ESCs (e.g., retinoic acid). The network analysis also indicated additional proteins and pathways potentially involved in early reprogramming events. PMID:23768116

Liddell, Susan; Campbell, Keith H.S.

2013-01-01

298

Epitope-specific crosslinking of CD45 down-regulates membrane-associated tyrosine phosphatase activity and triggers early signalling events in human activated T cells  

PubMed Central

CD45 engagement by monoclonal antibodies on human activated T cells triggers tumour necrosis factor-? (TNF-?) gene transcription in an epitope-specific manner. To dissect the early signalling events leading to TNF-? gene expression, we established that CD45 crosslinking resulted in tyrosine phosphorylation of p56lck, ZAP-70, CD3-?, LAT and Vav. This was accompanied by down-regulation of membrane-associated protein tyrosine phosphatase activity in the absence of demonstration of enhanced p56lck, p72syk and ZAP-70 kinase activity, which remained constitutive. These early events eventually triggered an intracellular Ca2+ rise and phosphoinositide turnover. We conclude that down-regulation of membrane-associated tyrosine phosphatase activity by CD45 extracytoplasmic domain multimerization led, in an epitope-specific fashion, to unopposed tyrosine kinase activity and to the activation of the T-cell receptor/CD3 complex signalling cascade, resulting in TNF-? gene expression. This model strongly suggests that CD45 extracytoplasmic tail multimerization may contribute to the modulation T-cell functions. PMID:15554922

Spertini, François; Perret-Menoud, Veronique; Barbier, Nathalie; Chatila, Talal; Barbey, Catherine; Corthesy, Blaise

2004-01-01

299

DNA Replication Animation  

NSDL National Science Digital Library

This resource is an animation to explain DNA replication. It is an interactive simulation activity for students. See also "Transcription and Translation Animation" to get all of the steps from DNA to protein.

McDougal Littell

2012-07-19

300

The Early Miocene "Bisciaro volcaniclastic event" (northern Apennines, Italy): a key study for the geodynamic evolution of the central-western Mediterranean  

NASA Astrophysics Data System (ADS)

The Early Miocene Bisciaro Fm., a marly limestone succession cropping out widely in the Umbria-Romagna-Marche Apennines, is characterized by a high amount of volcaniclastic content, characterizing this unit as a peculiar event of the Adria Plate margin. Because of this volcaniclastic event, also recognizable in different sectors of the central-western Mediterranean chains, this formation is proposed as a "marker" for the geodynamic evolution of the area. In the Bisciaro Fm., the volcaniclastic supply starts with the "Raffaello" bed (Earliest Aquitanian) that marks the base of the formation and ends in the lower portion of the Schlier Fm. (Late Burdigalian-Langhian p.p.). Forty-one studied successions allowed the recognition of three main petrofacies: (1) Pyroclastic Deposits (volcanic materials more than 90 %) including the sub-petrofacies 1A, Vitroclastic/crystallo-vitroclastic tuffs; 1B, Bentonitic deposits; and 1C, Ocraceous and blackish layers; (2) Resedimented Syn-Eruptive Volcanogenic Deposits (volcanic material 30-90 %) including the sub-petrofacies 2A, High-density volcanogenic turbidites; 2B, Low-density volcanogenic turbidites; 2C, Crystal-rich volcanogenic deposits; and 2D, Glauconitic-rich volcaniclastites; (3) Mixing of Volcaniclastic Sediments with Marine Deposits (volcanic material 5-30 %, mixed with marine sediments: marls, calcareous marls, and marly limestones). Coeval volcaniclastic deposits recognizable in different tectonic units of the Apennines, Maghrebian, and Betic Chains show petrofacies and chemical-geochemical features related to a similar calc-alkaline magmatism. The characterization of this event led to the hypothesis of a co-genetic relationship between volcanic activity centres (primary volcanic systems) and depositional basins (depositional processes) in the Early Miocene palaeogeographic and palaeotectonic evolution of the central-western Mediterranean region. The results support the proposal of a geodynamic model of this area that considers previously proposed interpretations.

Guerrera, Francesco; Martín-Martín, Manuel; Raffaelli, Giuliana; Tramontana, Mario

2015-01-01

301

Bio- and chemostratigraphy of the Early Aptian Oceanic Anoxic Event 1a within the mid-latitudes of northwest Europe (Germany, Lower Saxony Basin)  

NASA Astrophysics Data System (ADS)

The Mid-Cretaceous period was characterised by a series of prominent anoxic events, one of these was the late Early Aptian Oceanic Anoxic Event 1a (OAE 1a). The Fischschiefer horizon is the regional sedimentary expression of this event in a small epicontinental sea in northwest Europe (Germany, Lower Saxony Basin). In the present study, two sediment cores of Lower to Upper Aptian age (Hoheneggelsen KB 9 and 40) from the Brunswick area, north Germany, have been investigated in detail with respect to their lithostratigraphy, geochemistry (CaCO3, TOC), biostratigraphy (coccoliths, nannoliths) and high-resolution chemostratigraphy (^13Ccarb and ^13Corg). Together with separately published new planktonic foraminifer data of the cores it was possible to establish a detailed time frame and to recognise the OAE 1a. The ^13C data enabled us to subdivide the deposits into isotope segments (C2-C7), which are commonly used as stratigraphic markers in coeval sediments around the world. The carbon isotope curves are compared to recently published Aptian curves from other parts of the Lower Saxony Basin, all of which record the prominent carbon isotope anomaly of the OAE 1a. A high-resolution correlation of the typical isotope trends of OAE 1a (segments C3-6) across the Lower Saxony Basin appears difficult due to an early diagenetic overprint of the primary isotope signal. These alterations can be explained by the temporary establishment of euxinic conditions the Lower Saxony Basin during OAE 1a as consequence of an interplay of different factors, such as global warming, restricted palaeogeography, increased fluvial input and intensified stable water stratification, which is supported by several lines of regional evidence.

Heldt, Matthias; Mutterlose, Joerg; Berner, Uli; Erbacher, Jochen

2013-04-01

302

Thermal Replication Trap  

NASA Astrophysics Data System (ADS)

The hallmark of living matter is the replication of genetic molecules and their active storage against diffusion. We have argued in the past that thermal convection can host the million-fold accumulation even of single nucleotides and at the same time trigger exponential replication [1]. Accumulation is driven by thermophoresis and convection in elongated chambers, replication by the inherent temperature cycling in convection. Optothermal pumping [2,3] allows to implement the thermal trap efficiently in a toroidal [4] or linear [5] geometry. Based on this method, we were in a position to combine accumulation and replication of DNA in the same chamber [5]. As we are missing a solid chemistry of prebiotic replication, we used as a proxy reaction for to replication the polymerase chain reaction. Convective flow both drives the DNA replicating polymerase chain reaction (PCR) while concurrent thermophoresis accumulates the replicated 143 base pair DNA in bulk solution. The time constant for accumulation is 92 s while DNA is doubled every 50 s. The length of the amplified DNA is checked with thermophoresis. Finite element simulations confirm the findings. The experiments explore conditions in pores of hydrothermal rock which can serve as a model environment for the origin of life and has prospects towards the first autonomous evolution, hosting the Darwin process by molecular selection using the thermophoretic trap. On the other side, the implemented continuous evolution will be able to breed well specified DNA or RNA molecules in the future. [4pt] [1] Baaske, Weinert, Duhr, Lemke, Russell and Braun, PNAS 104, 9346 (2007) [0pt] [2] Weinert, Kraus, Franosch and Braun, PRL 100, 164501 (2008) [0pt] [3] Weinert and Braun, Journal of Applied Physics 104, 104701 (2008) [0pt] [4] Weinert and Braun, Nano Letters 9, 4264 (2009) [0pt] [5] Mast and Braun, PRL 104, 188102 (2010)

Braun, Dieter

2011-03-01

303

Bridging the Faraoni and Selli oceanic anoxic events: late Hauterivian to early Aptian dysaerobic to anaerobic phases in the Tethys  

NASA Astrophysics Data System (ADS)

A detailed geochemical analysis was performed on the upper part of the Maiolica Formation in the Breggia (southern Switzerland) and Capriolo sections (northern Italy). The analysed sediments consist of well-bedded, partly siliceous, pelagic carbonate, which lodges numerous thin, dark and organic-rich layers. Stable-isotope, phosphorus, organic-carbon and a suite of redox-sensitive trace-element contents (RSTE: Mo, U, Co, V and As) were measured. The RSTE pattern and Corg:Ptot ratios indicate that most organic-rich layers were deposited under dysaerobic rather than anaerobic conditions and that latter conditions were likely restricted to short intervals in the latest Hauterivian, the early Barremian and the pre-Selli early Aptian. Correlations are both possible with organic-rich intervals in central Italy (the Gorgo a Cerbara section) and the Boreal Lower Saxony Basin, as well as with the facies and drowning pattern in the Helvetic segment of the northern Tethyan carbonate platform. Our data and correlations suggest that the latest Hauterivian witnessed the progressive installation of dysaerobic conditions in the Tethys, which went along with the onset in sediment condensation, phosphogenesis and platform drowning on the northern Tethyan margin, and which culminated in the Faraoni anoxic episode. This episode is followed by further episodes of dysaerobic conditions in the Tethys and the Lower Saxony Basin, which became more frequent and progressively stronger in the late early Barremian. Platform drowning persisted and did not halt before the latest early Barremian. The late Barremian witnessed diminishing frequencies and intensities in dysaerobic conditions, which went along with the progressive installation of the Urgonian carbonate platform. Near the Barremian-Aptian boundary, the increasing density in dysaerobic episodes in the Tethyan and Lower Saxony Basins is paralleled by a change towards heterozoan carbonate production on the northern Tethyan shelf. The following return to more oxygenated conditions is correlated with the second phase of Urgonian platform growth and the period immediately preceding and corresponding to the Selli anoxic episode is characterised by renewed platform drowning and the change to heterozoan carbonate production. Changes towards more humid climate conditions were the likely cause for the repetitive installation of dys- to anaerobic conditions in the Tethyan and Boreal basins and the accompanying changes in the evolution of the carbonate platform towards heterozoan carbonate-producing ecosystems and platform drowning.

Föllmi, K. B.; Bôle, M.; Jammet, N.; Froidevaux, P.; Godet, A.; Bodin, S.; Adatte, T.; Matera, V.; Fleitmann, D.; Spangenberg, J. E.

2012-01-01

304

Recombination enhancement by replication (RER) in Rhizobium etli.  

PubMed Central

Studies in several organisms show that recombination and replication interact closely. Recombinational repair usually requires associated replication at some stage; moreover, additional replication can induce recombination through either homologous or illegitimate events. In prokaryotes, stimulation of recombination by replication is more dramatic when rolling circle replication is employed. In contrast, theta-type replication induces only a modest increase in recombination frequency. In this article, we show that induction of theta-type replication from a supernumerary origin in the symbiotic plasmid (pSym) of Rhizobium etli leads to a 1000-fold increase in deletion formation on this plasmid. These deletions span 120 kb (the symbiotic region) and have as endpoints the reiterated nitrogenase operons. We have named this phenomenon RER, for recombination enhancement by replication. RER is not affected by the position of the replication origin in the pSym, the direction of advance of the replication fork, or the distance from the origin to the recombining repeats. On the other hand, RER is dependent on an active recA allele, indicating that it is due to homologous recombination. RER displays a strong regionality restricted to the symbiotic region. The similarities and differences of RER with the recombination process observed at the terminus of replication of the Escherichia coli chromosome are discussed. PMID:10757747

Valencia-Morales, E; Romero, D

2000-01-01

305

Evidence for Replicative Repair of DNA Double-Strand Breaks Leading to Oncogenic Translocation and Gene Amplification  

PubMed Central

Nonreciprocal translocations and gene amplifications are commonly found in human tumors. Although little is known about the mechanisms leading to such aberrations, tissue culture models predict that they can arise from DNA breakage, followed by cycles of chromatid fusion, asymmetric mitotic breakage, and replication. Mice deficient in both a nonhomologous end joining (NHEJ) DNA repair protein and the p53 tumor suppressor develop lymphomas at an early age harboring amplification of an IgH/c-myc fusion. Here we report that these chromosomal rearrangements are initiated by a recombination activating gene (RAG)-induced DNA cleavage. Subsequent DNA repair events juxtaposing IgH and c-myc are mediated by a break-induced replication pathway. Cycles of breakage-fusion-bridge result in amplification of IgH/c-myc while chromosome stabilization occurs through telomere capture. Thus, mice deficient in NHEJ provide excellent models to study the etiology of unbalanced translocations and amplification events during tumorigenesis. PMID:12186839

Difilippantonio, Michael J.; Petersen, Simone; Chen, Hua Tang; Johnson, Roger; Jasin, Maria; Kanaar, Roland; Ried, Thomas; Nussenzweig, André

2002-01-01

306

Unraveling the Early Events of Amyloid-? Protein (A?) Aggregation: Techniques for the Determination of A? Aggregate Size  

PubMed Central

The aggregation of proteins into insoluble amyloid fibrils coincides with the onset of numerous diseases. An array of techniques is available to study the different stages of the amyloid aggregation process. Recently, emphasis has been placed upon the analysis of oligomeric amyloid species, which have been hypothesized to play a key role in disease progression. This paper reviews techniques utilized to study aggregation of the amyloid-? protein (A?) associated with Alzheimer’s disease. In particular, the review focuses on techniques that provide information about the size or quantity of oligomeric A? species formed during the early stages of aggregation, including native-PAGE, SDS-PAGE, Western blotting, capillary electrophoresis, mass spectrometry, fluorescence correlation spectroscopy, light scattering, size exclusion chromatography, centrifugation, enzyme-linked immunosorbent assay, and dot blotting. PMID:22489141

Pryor, N. Elizabeth; Moss, Melissa A.; Hestekin, Christa N.

2012-01-01

307

Limiting replication initiation factors execute the temporal programme of origin firing in budding yeast.  

PubMed

Eukaryotic chromosomes are replicated from multiple origins that initiate throughout the S-phase of the cell cycle. Why all origins do not fire simultaneously at the beginning of S-phase is not known, but two kinase activities, cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK), are continually required throughout the S-phase for all replication initiation events. Here, we show that the two CDK substrates Sld3 and Sld2 and their binding partner Dpb11, together with the DDK subunit Dbf4 are in low abundance in the budding yeast, Saccharomyces cerevisiae. Over-expression of these factors is sufficient to allow late firing origins of replication to initiate early and together with deletion of the histone deacetylase RPD3, promotes the firing of heterochromatic, dormant origins. We demonstrate that the normal programme of origin firing prevents inappropriate checkpoint activation and controls S-phase length in budding yeast. These results explain how the competition for limiting DDK kinase and CDK targets at origins regulates replication initiation kinetics during S-phase and establishes a unique system with which to investigate the biological roles of the temporal programme of origin firing. PMID:22081107

Mantiero, Davide; Mackenzie, Amanda; Donaldson, Anne; Zegerman, Philip

2011-11-30

308

Replication and Distribution of Toxoplasma gondii in the Small Intestine after Oral Infection with Tissue Cysts  

PubMed Central

Natural infection by Toxoplasma gondii occurs via oral ingestion of tissue cysts that rupture in the small intestine, releasing zoites that infect locally before disseminating throughout the host. The studies presented here used fluorescent parasites combined with flow cytometry and multiphoton microscopy techniques to understand the events associated with parasite replication in the mucosa. At 3 days postinfection with tissue cysts, parasites were localized in small foci and flow cytometry revealed parasites present in macrophages, neutrophils, and monocytes in the lamina propria. By day 6 postinfection, there were large foci of replicating parasites; however, foci unexpectedly varied in the number of villi involved and were associated with the presence of viable tachyzoites within the intestinal lumen. Consistent with the flow cytometry data, neutrophils and monocytes in the lamina propria were preferentially associated with parasite plaques. In contrast, dendritic cells comprised a small fraction of the infected immune cell population and were localized at the periphery of parasite plaques. Together, these findings reveal the formation of localized sites of parasite replication and inflammation early during infection and suggest that sustained replication of T. gondii in the gut may be a function of pathogen luminal spread. PMID:23460516

Gregg, Beth; Taylor, Betsy C.; John, Beena; Tait-Wojno, Elia D.; Girgis, Natasha M.; Miller, Natalie; Wagage, Sagie; Hunter, Christopher A.

2013-01-01

309

Patch dynamics and the timing of colonization-abandonment events by male Kirtland's Warblers in an early succession habitat  

USGS Publications Warehouse

Habitat colonization and abandonment affects the distribution of a species in space and time, ultimately influencing the duration of time habitat is used and the total area of habitat occupied in any given year. Both aspects have important implications to long-term conservation planning. The importance of patch isolation and area to colonization-extinction events is well studied, but little information exists on how changing regional landscape structure and population dynamics influences the variability in the timing of patch colonization and abandonment events. We used 26 years of Kirtland's Warbler (Dendroica kirtlandii) population data taken during a habitat restoration program (1979-2004) across its historical breeding range to examine the influence of patch attributes and temporal large-scale processes, specifically the rate of habitat turnover and fraction of occupied patches, on the year-to-year timing of patch colonization and abandonment since patch origin. We found the timing of patch colonization and abandonment was influenced by patch and large-scale regional factors. In this system, larger patches were typically colonized earlier (i.e., at a younger age) and abandoned later than smaller patches. Isolated patches (i.e., patches farther from another occupied patch) were generally colonized later and abandoned earlier. Patch habitat type affected colonization and abandonment; colonization occurred at similar patch ages between plantation and wildfire areas (9 and 8.5 years, respectively), but plantations were abandoned at earlier ages (13.9 years) than wildfire areas (16.4 years) resulting in shorter use. As the fraction of occupied patches increased, patches were colonized and abandoned at earlier ages. Patches were abandoned at older ages when the influx of new habitat patches was at low and high rates. Our results provide empirical support for the temporal influence of patch dynamics (i.e., patch destruction, creation, and succession) on local colonization and extinction processes that help explain large-scale patterns of habitat occupancy. Results highlight the need for practitioners to consider the timing of habitat restoration as well as total amount and spatial arrangement of habitat to sustain populations.

Donner, D.M.; Ribic, C.A.; Probst, J.R.

2010-01-01

310

Modeling DNA Replication Intermediates  

SciTech Connect

While there is now available a great deal of information on double stranded DNA from X-ray crystallography, high resolution NMR and computer modeling, very little is known about structures that are representative of the DNA core of replication intermediates. DNA replication occurs at a single strand/double strand junction and bulged out intermediates near the junction can lead to frameshift mutations. The single stranded domains are particularly challenging. Our interest is focused on strategies for modeling the DNA of these types of replication intermediates. Modeling such structures presents special problems in addressing the multiple minimum problem and in treating the electrostatic component of the force field. We are testing a number of search strategies for locating low energy structures of these types and we are also investigating two different distance dependent dielectric functions in the coulombic term of the force field. We are studying both unmodified DNA and DNA damaged by aromatic amines, carcinogens present in the environment in tobacco smoke, barbecued meats and automobile exhaust. The nature of the structure adopted by the carcinogen modified DNA at the replication fork plays a key role in determining whether the carcinogen will cause a mutation during replication that can initiate the carcinogenic process. In the present work results are presented for unmodified DNA.

Broyde, S.; Roy, D.; Shapiro, R.

1997-06-01

311

Replication of chaos  

NASA Astrophysics Data System (ADS)

We propose a rigorous method for replication of chaos from a prior one to systems with large dimensions. Extension of the formal properties and features of a complex motion can be observed such that ingredients of chaos united as known types of chaos, Devaney's, Li-Yorke and obtained through period-doubling cascade. This is true for other appearances of chaos: intermittency, structure of the chaotic attractor, its fractal dimension, form of the bifurcation diagram, the spectra of Lyapunov exponents, etc. That is why we identify the extension of chaos through the replication as morphogenesis. To provide rigorous study of the subject, we introduce new definitions such as chaotic sets of functions, the generator and replicator of chaos, and precise description of ingredients for Devaney and Li-Yorke chaos in continuous dynamics. Appropriate simulations which illustrate the chaos replication phenomenon are provided. Moreover, in discussion form we consider inheritance of intermittency, replication of Shil'nikov orbits and quasiperiodical motions as a possible skeleton of a chaotic attractor. Chaos extension in an open chain of Chua circuits is also demonstrated.

Akhmet, M. U.; Fen, M. O.

2013-10-01

312

Chromatin replication and epigenome maintenance  

Microsoft Academic Search

Stability and function of eukaryotic genomes are closely linked to chromatin structure and organization. During cell division the entire genome must be accurately replicated and the chromatin landscape reproduced on new DNA. Chromatin and nuclear structure influence where and when DNA replication initiates, whereas the replication process itself disrupts chromatin and challenges established patterns of genome regulation. Specialized replication-coupled mechanisms

Constance Alabert; Anja Groth

2012-01-01

313

Transantarctic disjunctions in Schistochilaceae (Marchantiophyta) explained by early extinction events, post-Gondwanan radiations and palaeoclimatic changes.  

PubMed

The liverworts are the first diverging land plant group with origins in the Ordovician. The family Schistochilaceae exhibits diverse morphology and widely disjunct geographic ranges within the Southern Hemisphere. The family has been presented as a classic example of Gondwanan biogeographic distribution, with extant species ranges resulting from vicariance events. In this study, we present results that elucidate the origin and diversification of Schistochilaceae. We conducted a comprehensive time-calibrated, molecular-based phylogenetic analysis and different approaches for ancestral range inference of the family. Schistochilaceae is inferred to have originated in the Late Cretaceous, in an ancestral area including southern South America, West Antarctica and New Zealand. Despite a family origin at c. 100Ma, most of the diversification of Schistochilaceae occurred in New Zealand after the 80Ma opening of the Tasman Sea that isolated New Zealand from the rest of Gondwana. Most dispersals were transoceanic. The northward migration of the Schistochilaceae is probably linked with the spread of temperate vascular plant forest ecosystems that have Late Cretaceous southern origins and have maintained suitable environments for the family throughout the Cenozoic. The distribution and biogeographic history of the family is very similar to that of Nothofagaceae. PMID:24680916

Sun, Yu; He, Xiaolan; Glenny, David

2014-07-01

314

Mutations altering the gammaretrovirus endoproteolytic motif affect glycosylation of the envelope glycoprotein and early events of the virus life cycle.  

PubMed

Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectors with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription. PMID:25462351

Argaw, Takele; Wilson, Carolyn A

2015-01-15

315

Early event-related brain potentials and hemispheric asymmetries reveal mind-wandering while reading and predict comprehension.  

PubMed

The electroencephalogram (EEG) of mind-wandering (MW) was examined in event-related potentials (ERPs) and pre-stimulus alpha (8-12Hz), over lateral-posterior sites of left and right brain hemispheres, while individuals read text passages. After controlling for individual differences in general intelligence (g), P1-asymmetry was greater (right-minus- left) and N1 amplitudes were more negative, when individuals were not MW (i.e., they were reading attentively). Approximately 82% of variance in reading comprehension was accounted for by the predictors: g, pre-stimulus alpha, left- and right-hemisphere P1, and left-hemisphere N1 (when individuals were not MW). Together, individual differences in MW-sensitive ERPs uniquely accounted for approximately 38% of the variance in reading comprehension, over and above prediction by g and pre-stimulus alpha. The within-person effect of MW on P1-asymmetry was estimated to account for an additional 4.6% of criterion variance. Implications for EEG/ERP research into attention, language processing, hemispheric asymmetries, and individual differences are discussed. PMID:25738641

Broadway, James M; Franklin, Michael S; Schooler, Jonathan W

2015-04-01

316

W Phase Inversion and Tsunami Inundation Modeling for Tsunami Early Warning: Case Study for the 2011 Tohoku Event  

NASA Astrophysics Data System (ADS)

Centroid moment tensor solutions for the 2011 Tohoku earthquake are determined by W phase inversions using 5 and 10 min data recorded by the Full Range Seismograph Network of Japan (F-net). By a scaling relation of moment magnitude to rupture area and an assumption of rigidity of 4 × 1010 N m-2, simple rectangular earthquake fault models are estimated from the solutions. Tsunami inundations in the Sendai Plain, Minamisanriku, Rikuzentakata, and Taro are simulated using the estimated fault models. Then the simulated tsunami inundation area and heights are compared with the observations. Even the simulated tsunami heights and inundations from the W phase solution that used only 5 min data are considerably similar to the observations. The results are improved when using 10 min of W phase data. These show that the W phase solutions are reliable to be used for tsunami inundation modeling. Furthermore, the technique that combines W phase inversion and tsunami inundation modeling can produce results that have sufficient accuracy for tsunami early warning purposes.

Gusman, Aditya Riadi; Tanioka, Yuichiro

2014-07-01

317

A dihydro-pyrido-indole potently inhibits HSV-1 infection by interfering the viral immediate early transcriptional events.  

PubMed

In our continued quest for identifying novel molecules from ethnomedicinal source we have isolated an alkaloid 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole, also known as Harmaline (HM), from an ethnomedicinal herb Ophiorrhiza nicobarica. The compound exhibited a potent anti-HSV-1 activity against both wild type and clinical isolates of HSV-1. Further we demonstrated that HM did not interfere in viral entry but the recruitment of lysine-specific demethylase-1 (LSD1) and the binding of immediate-early (IE) complex on ICP0 promoter. This leads to the suppression of viral IE gene synthesis and thereby the reduced expression of ICP4 and ICP27. Moreover, HM at its virucidal concentration is nontoxic and reduced virus yields in cutaneously infected Balb/C mice. Thus, the interference in the binding of IE complex, a decisive factor for HSV lytic cycle or latency by HM reveals an interesting target for developing non-nucleotide antiherpetic agent with different mode of action than Acyclovir. PMID:24576908

Bag, Paromita; Ojha, Durbadal; Mukherjee, Hemanta; Halder, Umesh C; Mondal, Supriya; Biswas, Aruna; Sharon, Ashoke; Van Kaer, Luc; Chakrabarty, Sekhar; Das, Gobardhan; Mitra, Debashis; Chattopadhyay, Debprasad

2014-05-01

318

Early signaling events that underlie fate decisions of naive CD4+ T cells towards distinct T-helper cell subsets  

PubMed Central

Summary CD4+ T-helper (Th) cells are a major cell population that plays an important role in governing acquired immune responses to a variety of foreign antigens as well as inducing some types of autoimmune diseases. There are at least four distinct Th cell subsets (Th1, Th2, Th17, and inducible T-regulatory cells), each of which has specialized functions to control immune responses. Each of these cell types emerge from naive CD4+ T cells after encounter with foreign antigens presented by dendritic cells (DCs). Each Th cell subset expresses a unique set of transcription factors and produce hallmark cytokines. Both T-cell receptor (TCR)-mediated stimulation and the cytokine environment created by activated CD4+ T cells themselves, by `partner' DCs and/or other cell types during the course of differentiation, play an important role in the fate decisions towards distinct Th subsets. Here, we review how TCR-mediated signals in collaboration with the cytokine environment influence the fate decisions of naive CD4+ T cells towards distinct Th subsets at the early stages of activation. We also discuss the roles of TCR-proximal signaling intermediates and of the Notch pathway in regulating the differentiation to distinct Th phenotypes. PMID:23405892

Yamane, Hidehiro; Paul, William E.

2012-01-01

319

Evidence for Proterozoic and late Cretaceous-early Tertiary ore-forming events in the Coeur d'Alene district, Idaho and Montana  

USGS Publications Warehouse

New 40Ar/39Ar age spectra on sericite and lead isotope data on tetrahedrite, siderite, galena, bournonite, and stibnite, together with previously published isotopic, geochemical, and geologic studies provide evidence for two major vein-forming events in the Coeur d'Alene district and surrounding area of the Belt basin. The data suggest that the zinc- and lead-rich veins (e.g., Bunker Hill and Star-Morning mines) formed in the Proterozoic (1.0 Ga), whereas the silver-rich veins (e.g., Silver belt mines), antimony veins (e.g., US Antimony mine), and gold-bearing quartz veins (Murry subdistrict) formed in Late Cretaceous to early Tertiary time.

Leach, D.L.; Hofstra, A.H.; Church, S.E.; Snee, L.W.; Vaughn, R.B.; Zartman, R.E.

1998-01-01

320

Replication of the heterogeneous heterochromatin of the sex chromosomes of Microtus cabrerae.  

PubMed

We used bromosubstitution to investigate the mode of replication of different types of heterochromatin located in the sex chromosomes of Microtus cabrerae. Our results clearly show that, although the heterochromatin is late replicating, the replication timing of different types of constitutive heterochromatin is related to their banding properties: R-type heterochromatin replicates before G-type heterochromatin, and this replication is asynchronous in both sex chromosomes. Furthermore, the late replication behaviour of the inactive X may spread to its constitutive heterochromatin. In some cells, a region of the constitutive heterochromatin of the late replicating X spontaneously switches to early replication, which may be related to transcriptional activity. Replication behaviour of the constitutive heterochromatin in the Y chromosome is similar to that of the late replicating X. PMID:1473582

Burgos, M; Jiménez, R; Sánchez, A; Díaz de la Guardia, R

1992-12-01

321

Hypercholesterolemia induces short-term spatial memory impairments in mice: up-regulation of acetylcholinesterase activity as an early and causal event?  

PubMed

Epidemiological studies have indicated hypercholesterolemia in midlife as a risk factor for dementia in later life, bringing cholesterol to the forefront of Alzheimer's disease research. Herein, we modeled mild hypercholesterolemia in mice to evaluate biochemical and behavioral alterations linked to hypercholesterolemia. Swiss mice were fed a high fat/cholesterol diet (20 % fat and 1.25 % cholesterol) for an 8-week period (from 12 to 18 weeks old) and were tested on the object location, forced swimming and elevated plus-maze tasks. We also investigated hypercholesterolemia-induced changes on acetylcholinesterase (AChE) activity, oxidative damage, amyloid precursor protein (APP) processing and blood brain barrier (BBB) integrity within the prefrontal cortex and hippocampus. It was found that increased AChE activity within the prefrontal cortex and hippocampus is an early event associated with hypercholesterolemia-induced short-term memory impairments. We observed no signs of antioxidant imbalance and/or oxidative damage or changes in cortical and hippocampal densities of beta-site amyloid precursor protein-cleaving enzyme 1 and aquaporin-4, biomarkers of APP processing and BBB integrity, respectively. In addition, we treated SH-SY5Y human neuroblastoma cells with low-density lipoprotein (LDL) cholesterol in an attempt to manipulate cell cholesterol content. Notably, LDL cholesterol increased in a dose-dependent manner the activity of AChE in SH-SY5Y cells. The present findings provide new evidence that increased AChE activity within the prefrontal cortex and hippocampus is an early event associated with hypercholesterolemia-induced cognitive impairments. PMID:24166183

Moreira, Eduardo Luiz Gasnhar; de Oliveira, Jade; Engel, Daiane Fátima; Walz, Roger; de Bem, Andreza Fabro; Farina, Marcelo; Prediger, Rui Daniel S

2014-04-01

322

Real-time QCM-D monitoring of cancer cell death early events in a dynamic context.  

PubMed

Since a few years, the acoustic sensing of whole cell is the focus of increasing interest for monitoring the cytoskeletal cellular response to morphological modulators. We aimed at illustrating the potentialities of the quartz crystal microbalance with dissipation (QCM-D) technique for the real-time detection of the earliest morphological changes that occur at the cell-substrate interface during programmed cell death. Human breast cancer cells (MCF-7) grown on serum protein-coated gold sensors were placed in dynamic conditions under a continuous medium flow. The mass and viscoelasticity changes of the cells were tracked by monitoring the frequency and dissipation shifts during the first 4h of cell exposure to staurosporine, a well-known apoptosis inducer. We have identified a QCM-D signature characteristic of morphological modifications and cell detachment from the sensing surface that are related to the pro-apoptotic treatment. In particular, for low staurosporine doses below 1 µM, we showed that recording the dissipation shift allows to detect an early cell response which is undetectable after the same duration by the classical analytical techniques in cell biology. Furthermore, this sensing method allows quantifying the efficiency of the drug effect in less than 4h without requiring labeling and without interfering in the system, thus preventing any loss of information. In the actual context of targeted cancer therapy development, we believe that these results bring new insights in favor of the use of the non invasive QCM-D technique for quickly probing the cancer cell sensitivity to death inducer drugs. PMID:25286354

Nowacki, Laetitia; Follet, Julie; Vayssade, Muriel; Vigneron, Pascale; Rotellini, Laura; Cambay, Florian; Egles, Christophe; Rossi, Claire

2015-02-15

323

Root Secreted Metabolites and Proteins Are Involved in the Early Events of Plant-Plant Recognition Prior to Competition  

PubMed Central

The mechanism whereby organisms interact and differentiate between others has been at the forefront of scientific inquiry, particularly in humans and certain animals. It is widely accepted that plants also interact, but the degree of this interaction has been constricted to competition for space, nutrients, water and light. Here, we analyzed the root secreted metabolites and proteins involved in early plant neighbor recognition by using Arabidopsis thaliana Col-0 ecotype (Col) as our focal plant co-cultured in vitro with different neighbors [A. thaliana Ler ecotype (Ler) or Capsella rubella (Cap)]. Principal component and cluster analyses revealed that both root secreted secondary metabolites and proteins clustered separately between the plants grown individually (Col-0, Ler and Cap grown alone) and the plants co-cultured with two homozygous individuals (Col-Col, Ler-Ler and Cap-Cap) or with different individuals (Col-Ler and Col-Cap). In particularly, we observed that a greater number of defense- and stress- related proteins were secreted when our control plant, Col, was grown alone as compared to when it was co-cultured with another homozygous individual (Col-Col) or with a different individual (Col-Ler and Col-Cap). However, the total amount of defense proteins in the exudates of the co-cultures was higher than in the plant alone. The opposite pattern of expression was identified for stress-related proteins. These data suggest that plants can sense and respond to the presence of different plant neighbors and that the level of relatedness is perceived upon initial interaction. Furthermore, the role of secondary metabolites and defense- and stress-related proteins widely involved in plant-microbe associations and abiotic responses warrants reassessment for plant-plant interactions. PMID:23056382

Badri, Dayakar V.; De-la-Peña, Clelia; Lei, Zhentian; Manter, Daniel K.; Chaparro, Jacqueline M.; Guimarães, Rejane L.; Sumner, Lloyd W.; Vivanco, Jorge M.

2012-01-01

324

Demonstration of a Novel Synchrophasor-based Situational Awareness System: Wide Area Power System Visualization, On-line Event Replay and Early Warning of Grid Problems  

SciTech Connect

Since the large North Eastern power system blackout on August 14, 2003, U.S. electric utilities have spent lot of effort on preventing power system cascading outages. Two of the main causes of the August 14, 2003 blackout were inadequate situational awareness and inadequate operator training In addition to the enhancements of the infrastructure of the interconnected power systems, more research and development of advanced power system applications are required for improving the wide-area security monitoring, operation and planning in order to prevent large- scale cascading outages of interconnected power systems. It is critically important for improving the wide-area situation awareness of the operators or operational engineers and regional reliability coordinators of large interconnected systems. With the installation of large number of phasor measurement units (PMU) and the related communication infrastructure, it will be possible to improve the operators’ situation awareness and to quickly identify the sequence of events during a large system disturbance for the post-event analysis using the real-time or historical synchrophasor data. The purpose of this project was to develop and demonstrate a novel synchrophasor-based comprehensive situational awareness system for control centers of power transmission systems. The developed system named WASA (Wide Area Situation Awareness) is intended to improve situational awareness at control centers of the power system operators and regional reliability coordinators. It consists of following main software modules: • Wide-area visualizations of real-time frequency, voltage, and phase angle measurements and their contour displays for security monitoring. • Online detection and location of a major event (location, time, size, and type, such as generator or line outage). • Near-real-time event replay (in seconds) after a major event occurs. • Early warning of potential wide-area stability problems. The system has been deployed and demonstrated at the Tennessee Valley Authority (TVA) and ISO New England system using real-time synchrophasor data from openPDC. Apart from the software product, the outcome of this project consists of a set of technical reports and papers describing the mathematical foundations and computational approaches of different tools and modules, implementation issues and considerations, lessons learned, and the results of lidation processes.

Rosso, A.

2012-12-31

325

Replicated Composite Optics Development  

NASA Technical Reports Server (NTRS)

Advanced optical systems for applications such as grazing incidence Wolter I x-ray mirror assemblies require extraordinary mirror surfaces in ten-ns of fine surface finish and figure. The impeccable mirror surface is on the inside of the rotational mirror form. One practical method of producing devices with these requirements is to first fabricate an exterior surface for the optical device then replicate that surface to have the inverse component with lightweight characteristics. The replicate optic is not better than the master or mandrel from which it is made. This task is a continuance of previous studies to identify methods and materials for forming these extremely low roughness optical components.

Engelhaupt, Darell

1997-01-01

326

Late, not early mismatch responses to changes in frequency are reduced or deviant in children with dyslexia: an event-related potential study  

PubMed Central

Background Developmental disorders of oral and written language have been linked to deficits in the processing of auditory information. However, findings have been inconsistent, both for behavioural and electrophysiological measures. Methods In this study, we examined event-related potentials (ERPs) in 20 6- to 14-year-old children with developmental dyslexia and 20 age-matched controls, divided into younger (6–11 years, n?=?10) and older (11–14 years, n?=?10) age bands. We focused on early (mismatch negativity; MMN) and late (late discriminative negativity; LDN) conventional mismatch responses and associated measures derived from time-frequency analysis (inter-trial coherence and event-related spectral perturbation). Responses were elicited using an auditory oddball task, whereby a stream of 1000-Hz standards was interspersed with rare large (1,200 Hz) and small (1,030 Hz) frequency deviants. Results Conventional analyses revealed no significant differences between groups in the size of the MMN to either large or small frequency deviants. However, the younger age band of children with dyslexia showed an enhanced inter-trial coherence in the theta frequency band over the time window corresponding to the MMN to small deviants. By contrast, these same children showed a reduced-amplitude LDN for the small deviants relative to their age-matched controls, whilst the older children with dyslexia showed a shorter and less intense period of event-related desynchronization over this time window. Conclusions Initial detection and discrimination of auditory frequency change appears normal or even enhanced in children with dyslexia. Rather, deficits in late-stage auditory processing appear to be a feature of this population. PMID:25110526

2014-01-01

327

Bi-directional replication and random termination  

PubMed Central

Two-dimensional (2D) agarose gel electrophoresis was used to study termination of DNA replication in a shuttle vector, YRp7?, when it replicated in Escherichia coli, Saccharomyces cerevisiae and Xenopus egg extracts. In E.coli, the 2D gel patterns obtained were consistent with uni-directional replication initiated at a specific site, the ColE1 origin. In consequence, termination also occurred precisely at the ColE1 origin. In Xenopus egg extracts, the particular shape of the bubble arc as well as the triangular smear detected to the left of the simple-Y pattern indicated random initiation and termination. In S.cerevisiae, initiation occurred at the ARS1 origin and replication proceeded in a bi-directional manner. However, termination did not always occur at a specific site 180° across from the origin, but almost all along the south hemisphere of the plasmid. Inversion, deletion or replacement of DNA sequences located throughout this hemisphere did not eliminate random termination. Analysis of the replication intermediates of another yeast plasmid bearing a different origin, ARS305, also exhibited random termination. We propose that the random termination events observed in S.cerevisiae could be due to an asynchronous departure of both forks from the bi-directional origin in addition to differences in the rate of fork progression. These observations could be extended to all bi-directional origins. PMID:10773078

Santamaría, D.; Viguera, E.; Martínez-Robles, M. L.; Hyrien, O.; Hernández, P.; Krimer, D. B.; Schvartzman, J. B.

2000-01-01

328

Modulation of HCV Replication After Combination Antiretroviral Therapy in HCV/HIV Coinfected Patients  

PubMed Central

The hepatitis C virus (HCV) is an important contributor to morbidity and mortality in patients coinfected with human immunodeficiency virus (HIV). Coinfection results in increased HCV replication and more rapid rates of liver disease progression. The effect of HIV combination antiretroviral therapy (cART) on HCV replication has not been studied in depth. To address this issue, we enrolled a small cohort of HCV/HIV coinfected patients into a cART initiation trial, and used dynamic modeling combined with evaluation of immune responses and microarray profiles to determine how effective treatment of HIV affects HCV. Treatment with cART resulted in HCV flare and alanine aminotransferase (ALT) increase (2× or more increase from baseline) in a subset of treated patients. Subjects with evidence of hepatic injury (increased ALT) were more likely to have HCV-specific immune responses directed against HCV epitopes. Over time, HCV viral loads declined. Reproducible and biologically important gene expression changes occurred in patients who underwent successful cART, particularly with respect to downregulation of genes with known antiviral roles. Our findings suggest that the effective suppression of HIV by cART initiates a cascade of early and late events in treated patients with HCV. Early events involving downregulation of interferon-stimulated genes may lead to transiently increased viral replication and hepatic injury. At later time points, HCV viral load declines to levels comparable to those seen in the setting of HCV monoinfection. These findings support early antiretroviral therapy in those with HCV/HIV coinfection. PMID:25101888

Sherman, Kenneth E.; Guedj, Jeremie; Shata, Mohamed Tarek; Blackard, Jason T.; Rouster, Susan D.; Castro, Mario; Feinberg, Judith; Sterling, Richard K.; Goodman, Zachary; Aronow, Bruce J.; Perelson, Alan S.

2015-01-01

329

Helicase Loading at Chromosomal Origins of Replication  

E-print Network

Loading of the replicative DNA helicase at origins of replication is of central importance in DNA replication. As the first of the replication fork proteins assemble at chromosomal origins of replication, the loaded helicase ...

Bell, Stephen P.

330

Aluminum-26 in H4 chondrites: Implications for its production and its usefulness as a fine-scale chronometer for early solar system events  

NASA Astrophysics Data System (ADS)

In order to investigate whether or not 26Al can be used as a fine-scale chronometer for early-solar-system events we measured, with an ion microprobe, Mg isotopes and Al/Mg ratios in separated plagioclase, olivine, and pyroxene crystals from the H4 chondrites Ste. Marguerite, Forest Vale, Beaver Creek and Quenggouk and compared the results with the canonical 26Al/27Al ratio for Ca,Al-rich inclusions (CAIs). For Ste. Marguerite (SM) and Forest Vale (FV) Pb/Pb and Mn-Cr ages have previously been determined (Göpel et al., 1994; Polnau et al., 2000; Polnau and Lugmair, 2001). Plagioclase grains from these two meteorites show clear excesses of 26Mg. The 26Al/27Al ratios inferred from these excesses and from isotopically normal Mg in pyroxene and olivine are (2.87+/-0.64)x10-7 for SM and (1.52+/-0.52)x10-7 for FV. The differences between these ratios and the ratio of 5x10-5 in CAIs indicate time differences of 5.4+/-0.1 Ma and 6.1+/-0.2 Ma for SM and FV, respectively. These differences are in agreement with the absolute Pb/Pb ages for CAIs and SM and FV phosphates but there are large discrepancies between the U-Pb and Mn-Cr system for the relative ages for CAIs, SM and FV. For example, Mn-Cr ages of carbonates from Kaidun are older than the Pb/Pb age of CAIs. However, even if we require that CAIs are older than these carbonates, the time difference between this "adjusted" CAI age and the Mn-Cr ages of SM and FV require that 26Al was widely distributed in the early solar system at the time of CAI formation and was not mostly present in CAIs, a feature of the X-wind model proposed by Shu and collaborators (Gounelle et al., 2001; Shu et al., 2001). From this we conclude that there was enough 26Al to melt small planetary bodies as long as they formed within 2 Ma of CAIs, and that 26Al can serve as a fine-scale chronometer for early solar system events.

Zinner, Ernst; Göpel, Christa

2002-07-01

331

The spatiotemporal program of replication in the genome of Lachancea kluyveri.  

PubMed

We generated a genome-wide replication profile in the genome of Lachancea kluyveri and assessed the relationship between replication and base composition. This species diverged from Saccharomyces cerevisiae before the ancestral whole genome duplication. The genome comprises eight chromosomes among which a chromosomal arm of 1 Mb has a G + C-content much higher than the rest of the genome. We identified 252 active replication origins in L. kluyveri and found considerable divergence in origin location with S. cerevisiae and with Lachancea waltii. Although some global features of S. cerevisiae replication are conserved: Centromeres replicate early, whereas telomeres replicate late, we found that replication origins both in L. kluyveri and L. waltii do not behave as evolutionary fragile sites. In L. kluyveri, replication timing along chromosomes alternates between regions of early and late activating origins, except for the 1 Mb GC-rich chromosomal arm. This chromosomal arm contains an origin consensus motif different from other chromosomes and is replicated early during S-phase. We showed that precocious replication results from the specific absence of late firing origins in this chromosomal arm. In addition, we found a correlation between GC-content and distance from replication origins as well as a lack of replication-associated compositional skew between leading and lagging strands specifically in this GC-rich chromosomal arm. These findings suggest that the unusual base composition in the genome of L. kluyveri could be linked to replication. PMID:23355306

Agier, Nicolas; Romano, Orso Maria; Touzain, Fabrice; Cosentino Lagomarsino, Marco; Fischer, Gilles

2013-01-01

332

Early Eocene hyperthermal events ETM2, H2 and I1 as recorded by Tethyan planktic foraminifera in the Terche section (northernastern Italy)  

NASA Astrophysics Data System (ADS)

In the last years, several transient episodes of extreme warming, the so-called hyperthermals, have been recognized in addition to the well-know Paleocene-Eocene Thermal Maximum (PETM; ~55.5 Ma), superimposed on the long-term Paleocene-early Eocene warming trend peaking in the Early Eocene Climatic Optimum (EECO). To the present, perturbations produced by hyperthermals are well documented in terms of isotopic variations whereas their influence on the biota is still largely unexplored. The Terche section, located in the Venetian Pre-Alps (northeastern Italy), is an expanded latest Paleocene-lower Eocene succession deposited in a bathyal setting of a continental margin of the central-western Tethys. This section is particularly suitable to study post-PETM hyperthermals because it contains three well-exposed and expanded marly-clayey units (MUs) corresponding to intervals of negative carbon isotope excursions (CIEs). Calcareous plankton biostratigraphy allow us to refer them to the hyperthermals ETM2 (or H1; ~53.7 Ma), H2 (~53.6 Ma) and I1(~53.3 Ma). Here we present the first detailed quantitative analysis of planktic foraminiferal assemblages across these early Eocene hyperthermals events. Quantitative analysis of planktic foraminiferal genera shows a long-term trend of variation upon which higher frequency variations are superimposed. We interpret such long-term variation as the response to the long-term warming trend since it highlights a slight increase of the warm indicators, such as the acarininids, and decrease of the cold form subbotinids. The high frequency variations, instead, closely related to the CIEs and to the MUs, record a pronounced increase in acarininids (up to 68%) and a parallel marked decline in the abundances of subbotinids and other component of planktic foraminiferal assemblages. The MUs are also associated with an increase of the eutrophic radiolarians. This aspect, together with the dominance of acarininids, can be interpreted as a consequence of the extreme warmth coupled with eutrophic conditions of surface waters. The surface-dwelling acarininids, able to temporarily colonize warmer deeper and nutrient-richer waters previously occupied by Subbotina, better tolerated the relatively high eutrophic conditions which prevented the warm indices Morozovella to thrive. The increased eutrophic conditions can be related to accelerate hydrological cycle, in turn enhanced by the intense warming, as already observed for the PETM in the same area. Calcareous plankton variations during the hyperthermals in a deep-water setting could be affected by selective dissolution susceptibility due to the lysocline rise associated to these events. The planktic foraminiferal Fragmentation Index calculated in correspondence to the MUs of the Terche section presents very low values compared with those observed in other sections of the Belluno Basin across the PETM and the X-event. This indicates that the planktic foraminiferal record is not biased by dissolution and the modifications of assemblages are genuine and representative of the different genera real distributions. Our data on planktic foraminifera prove the strong effect of the hyperthermals events on the biotic component of the upper water column and show that the most intense perturbation was induced by the ETM2 that is characterized by the most pronounced CIE.

D'Onofrio, Roberta; Luciani, Valeria; Giusberti, Luca; Fornaciari, Eliana; Sprovieri, Mario

2014-05-01

333

Replicated spectrographs in astronomy  

NASA Astrophysics Data System (ADS)

As telescope apertures increase, the challenge of scaling spectrographic astronomical instruments becomes acute. The next generation of extremely large telescopes (ELTs) strain the availability of glass blanks for optics and engineering to provide sufficient mechanical stability. While breaking the relationship between telescope diameter and instrument pupil size by adaptive optics is a clear path for small fields of view, survey instruments exploiting multiplex advantages will be pressed to find cost-effective solutions. In this review we argue that exploiting the full potential of ELTs will require the barrier of the cost and engineering difficulty of monolithic instruments to be broken by the use of large-scale replication of spectrographs. The first steps in this direction have already been taken with the soon to be commissioned MUSE and VIRUS instruments for the Very Large Telescope and the Hobby-Eberly Telescope, respectively. MUSE employs 24 spectrograph channels, while VIRUS has 150 channels. We compare the information gathering power of these replicated instruments with the present state of the art in more traditional spectrographs, and with instruments under development for ELTs. Design principles for replication are explored along with lessons learned, and we look forward to future technologies that could make massively-replicated instruments even more compelling.

Hill, Gary J.

2014-06-01

334

DNA replication in thermophiles  

Microsoft Academic Search

DNA replication enzymes in the thermophilic Archaea have previously attracted attention due to their obvious use in methods such as PCR. The proofreading ability of the Pyrococcus furiosus DNA polymerase has resulted in a commercially successful product (Pfu polymerase). One of the many notable features of the Archaea is the fact that their DNA processing enzymes appear on the whole

A. I. Majerník; E. R. Jenkinson; J. P. J. Chong

2004-01-01

335

Reworked pyroclastic beds in the early Miocene of Patagonia: Reaction in response to high sediment supply during explosive volcanic events  

NASA Astrophysics Data System (ADS)

Two meter-scale pyroclastic levels are interbedded within the early Miocene succession of the Estancia 25 de Mayo (Patagoniense transgression) and Santa Cruz formations in the foreland Austral (or Magallanes) Basin, Argentina. The Lower Pyroclastic Level (LPL) is a tabular body interbedded within offshore marine deposits, laterally continuous for 30 km and varying in thickness from few centimeters to around 4 m. Grain-size grades from coarse to extremely fine ash with upward-fining along with a northeastern-fining trends. Structureless fine to very fine tuffs dominate and rare parallel laminations are the only tractive sedimentary structures. The Upper Pyroclastic Level (UPL) lies within low energy fluvial deposits and is laterally discontinuous, and it is composed by lenticular bodies reaching a maximum of 15 m thick and 100 m wide, with a concave-up base and a plane top. Grain-size range is similar to the LPL but it coarsens upward. The lower portion of the UPL shows parallel lamination, current ripple lamination and mud drapes with large pumice lapilli and plant debris, whereas the upper portion shows parallel lamination and trough cross-stratification. Both pyroclastic levels are composed mainly of pumice grains and glass shards with minor proportions of quartz and plagioclase crystals and lithic fragments. The LPL shows no mixing with epiclastic material whereas the UPL shows an upward increase in epiclastic material, and an upward increment in the scale of cross-bedding. The large thickness in relation to the possible emission center and the content of plant debris of the LPL does not suggest a direct, submarine, ash-fallout origin. The LPL is interpreted as a deposit of hyperpycnal-flows generated at the coastal zone when tephra-laden rivers plunged into the ocean. Large amounts of well preserved plant debris support the hypothesis of a terrestrial source of the sediments. The UPL is entirely composed of tractive deposits, so an ash fallout origin is disregarded. This, together with the lenticular shape and the alluvial plain origin of the encasing sediments, suggests accumulation within fluvial channels. Cycles of upper-flow-regime parallel lamination, current-ripple lamination and mud drapes at the lower portion, suggest short-lived turbulent flows that initially filled semi-abandoned channels. They were followed by sheet floods and channel reactivation, expressed by large-scale cross-bedding. The low degree of particle mixing observed in both levels is explained by the inability of streams to erode the substrate as they are suddenly over-saturated with pyroclastic sediments during and after the eruption. The grain-size distribution of the LPL and geochemical data indicate a contemporaneous volcanic source located to the west/southwest in the Andean ranges, where the South Patagonian Batholith is presently located. Explosive volcanism deeply modifies "normal" sedimentary dynamics.

Cuitiño, José I.; Scasso, Roberto A.

2013-05-01

336

Telomere Replication: Poised but Puzzling  

PubMed Central

Faithful replication of chromosomes is essential for maintaining genome stability. Telomeres, the chromosomal termini, pose quite a challenge to replication machinery due to the complexity in their structures and sequences. Efficient and complete replication of chromosomes is critical to prevent aberrant telomeres as well as to avoid unnecessary loss of telomere DNA. Compelling evidence supports the emerging picture of synergistic actions between DNA replication proteins and telomere protective components in telomere synthesis. This review discusses the actions of various replication and telomere-specific binding proteins that ensure accurate telomere replication and their roles in telomere maintenance and protection. PMID:21122064

Sampathi, Shilpa; Chai, Weihang

2010-01-01

337

The Neurogenic Effects of Exogenous Neuropeptide Y: Early Molecular Events and Long-Lasting Effects in the Hippocampus of Trimethyltin-Treated Rats  

PubMed Central

Modulation of endogenous neurogenesis is regarded as a promising challenge in neuroprotection. In the rat model of hippocampal neurodegeneration obtained by Trimethyltin (TMT) administration (8 mg/kg), characterised by selective pyramidal cell loss, enhanced neurogenesis, seizures and cognitive impairment, we previously demonstrated a proliferative role of exogenous neuropeptide Y (NPY), on dentate progenitors in the early phases of neurodegeneration. To investigate the functional integration of newly-born neurons, here we studied in adult rats the long-term effects of intracerebroventricular administration of NPY (2 µg/2 µl, 4 days after TMT-treatment), which plays an adjuvant role in neurodegeneration and epilepsy. Our results indicate that 30 days after NPY administration the number of new neurons was still higher in TMT+NPY-treated rats than in control+saline group. As a functional correlate of the integration of new neurons into the hippocampal network, long-term potentiation recorded in Dentate Gyrus (DG) in the absence of GABAA receptor blockade was higher in the TMT+NPY-treated group than in all other groups. Furthermore, qPCR analysis of Kruppel-like factor 9, a transcription factor essential for late-phase maturation of neurons in the DG, and of the cyclin-dependent kinase 5, critically involved in the maturation and dendrite extension of newly-born neurons, revealed a significant up-regulation of both genes in TMT+NPY-treated rats compared with all other groups. To explore the early molecular events activated by NPY administration, the Sonic Hedgehog (Shh) signalling pathway, which participates in the maintenance of the neurogenic hippocampal niche, was evaluated by qPCR 1, 3 and 5 days after NPY-treatment. An early significant up-regulation of Shh expression was detected in TMT+NPY-treated rats compared with all other groups, associated with a modulation of downstream genes. Our data indicate that the neurogenic effect of NPY administration during TMT-induced neurodegeneration involves early Shh pathway activation and results in a functional integration of newly-generated neurons into the local circuit. PMID:24516629

Podda, Maria Vittoria; Lattanzi, Wanda; Giannetti, Stefano; Di Maria, Valentina; Cocco, Sara; Grassi, Claudio; Michetti, Fabrizio; Geloso, Maria Concetta

2014-01-01

338

Rapamycin-Resistant mTORC1 Kinase Activity Is Required for Herpesvirus Replication?  

PubMed Central

Human cytomegalovirus (HCMV) infection has been shown to activate the mTORC1 signaling pathway. However, the phosphorylation of mTORC1 targets is differentially sensitive to the mTORC1 inhibitor rapamycin, and the drug inhibits HCMV replication to a modest extent. Using Torin1, a newly developed inhibitor that targets the catalytic site of mTOR kinase, we show that HCMV replication requires both rapamycin-sensitive and rapamycin-resistant mTOR activity. The treatment of infected cells with Torin1 inhibits the phosphorylation of rapamycin-sensitive and rapamycin-resistant mTOR targets and markedly blocks the production of virus progeny. The blockade of mTOR signaling with Torin1, but not rapamycin, disrupts the assembly of the eIF4F complex and increases the association of the translational repressor 4EBP1 to the 7-methylguanosine cap-binding complex. Torin1 does not affect HCMV entry and only modestly reduces the accumulation of the immediate-early and early viral proteins that were tested despite the disruption of the eIF4F complex. In contrast, Torin1 significantly decreases the accumulation of viral DNA and the pUL99 viral late protein. Similar mTOR signaling events were observed during murine cytomegalovirus (MCMV) infection, and we utilized murine fibroblasts containing several different mutations to dissect the mechanism by which Torin1 inhibits MCMV replication. This approach demonstrated that mTORC2 and the Akt1 and Akt2 kinases are not required for the Torin1-mediated inhibition of cytomegalovirus replication. The inhibition of MCMV replication by Torin1 was rescued in cells lacking 4EBP1, demonstrating that the inactivation of 4EBP1 by mTORC1 is critical for cytomegalovirus replication. Finally, we show that Torin1 inhibits the replication of representative members of the alpha-, beta-, and gammaherpesvirus families, demonstrating the potential of mTOR kinase inhibitors as broad-spectrum antiviral agents. PMID:20181700

Moorman, Nathaniel J.; Shenk, Thomas

2010-01-01

339

Timing of Early Proterozoic Collisional and Extensional Events in the Granulite-Gneiss-Charnockite-Granite Complex, Lake Baikal, USSR: A UPb, Rb-Sr, and Sm-Nd Isotopic Study  

Microsoft Academic Search

In the Sharyzhalgay Complex of the Lake Baikal region in eastern Siberia Early Proterozoic collisional and extensional events were separated by ca. 100 m.yr. The earlier collisional event, associated with the development of granulites and gneisses as the result of high-grade dynamothermal metamorphism, took place close to 1965 {plus minus} 4 Ma. A ²°⁷Pb\\/²°⁴Pb vs. ²°⁶Pb\\/²°⁴Pb isochron for zircon from

M. Aftalion; E. V. Bibikova; D. R. Bowes; A. M. Hopgood; L. L. Perchuk

1991-01-01

340

Control of DNA Replication by Cyclin-Dependent Kinases in Development  

Microsoft Academic Search

\\u000a Cyclin-dependent kinases (CDKs) are required for initiation of DNA replication in all eukaryotes, and appear to act at multiple\\u000a levels to control replication origin firing, depending on the cell type and stage of development. In early development of\\u000a many animals, both invertebrate and vertebrate, rapid cell cycling is coupled with transcriptional repression, and replication\\u000a initiates at closely spaced replication origins

Daniel Fisher

341

Loading mechanisms of ring helicases at replication origins.  

PubMed

Threading of DNA through the central channel of a replicative ring helicase is known as helicase loading, and is a pivotal event during replication initiation at replication origins. Once loaded, the helicase recruits the primase through a direct protein-protein interaction to complete the initial 'priming step' of DNA replication. Subsequent assembly of the polymerases and processivity factors completes the structure of the replisome. Two replisomes are assembled, one on each strand, and move in opposite directions to replicate the parental DNA during the 'elongation step' of DNA replication. Replicative helicases are the motor engines of replisomes powered by the conversion of chemical energy to mechanical energy through ATP binding and hydrolysis. Bidirectional loading of two ring helicases at a replication origin is achieved by strictly regulated and intricately choreographed mechanisms, often through the action of replication initiation and helicase-loader proteins. Current structural and biochemical data reveal a wide range of different helicase-loading mechanisms. Here we review advances in this area and discuss their implications. PMID:22417087

Soultanas, Panos

2012-04-01

342

Herpesvirus simiae (B virus): Replication of the virus and identification of viral polypeptides in infected cells  

Microsoft Academic Search

Summary The events and products of replication ofHerpesvirus simiae (B virus) in Vero cells were studied. The time course of the synthetic events of DNA replication and protein synthesis were found to be similar to the processes of the herpes simplex viruses and SA 8. Infectious progeny virus were detected by 4 hours post infection and were first found extracellularly

J. K. Hilliard; R. Eberle; S. L. Lipper; R. M. Munoz; S. A. Weiss

1987-01-01

343

Attenuation of the early events of ?-synuclein aggregation: a fluorescence correlation spectroscopy and laser scanning microscopy study in the presence of surface-coated Fe3O4 nanoparticles.  

PubMed

The aggregation of ?-synuclein (A-syn) has been implicated in the pathogenesis of Parkinson's disease (PD). Although the early events of aggregation and not the matured amyloid fibrils are believed to be responsible for the toxicity, it has been difficult to probe the formation of early oligomers experimentally. We studied the effect of Fe3O4 nanoparticle (NP) in the early stage of aggregation of A-syn using fluorescence correlation spectroscopy (FCS) and laser scanning microscopy. The binding between the monomeric protein and NPs was also studied using FCS at single-molecule resolution. Our data showed that the addition of bare Fe3O4 NPs accelerated the rate of early aggregation, and it did not bind the monomeric A-syn. In contrast, L-lysine (Lys)-coated Fe3O4 NPs showed strong binding with the monomeric A-syn, inhibiting the early events of aggregation. Lys-coated Fe3O4 NPs showed significantly less cell toxicity compared with bare Fe3O4 NPs and can be explored as a possible strategy to develop therapeutic application against PD. To the best of our knowledge, this report is the first example of using a small molecule to attenuate the early (and arguably the most relevant in terms of PD pathogenesis) events of A-syn aggregation. PMID:25561279

Joshi, Nidhi; Basak, Sujit; Kundu, Sangeeta; De, Goutam; Mukhopadhyay, Anindita; Chattopadhyay, Krishnananda

2015-02-01

344

DNA Replicating Itself  

NSDL National Science Digital Library

A simplified representation of a DNA molecule separating to form two new molecules.   To reproduce, a cell must copy and transmit its genetic information (DNA) to all of its progeny. To do so, DNA replicates, following the process of semiconservative replication. Each strand of the original molecule acts as a template for the synthesis of a new complementary DNA molecule. The two strands of the double helix are first separated by enzymes. With the assistance of other enzymes, spare parts available inside the cell are bound to the individual strands following the rules of complementary base pairing: adenine (A) to thymine (T) and guanine (G) to cytosine (C). Two strands of DNA are obtained from one, having produced two daughter molecules which are identical to one another and to the parent molecule.

Access Excellence

2005-03-12

345

DNA: Mutations During Replication  

NSDL National Science Digital Library

In this unit you will learn the basics of genetics. Genetics is a subject regularly seen in the news, whether it is cloning sheep, looking for cures to diseases, controlling cancer, or stem cell research. The core is always in genetics. By studying this unit on genetics you will be better able to make important decisions regarding controversial issues as well as understand what makes us all what we are. OPTIONAL REVIEW In this activity we are going to review how DNA replicates. After watching the video, answer the following questions in your notebook. How DNA Replicates 1.What is the shape and what are the building blocks of the DNA molecule? 2.Which DNA bases pair with each other? What part of the DNA molecule do ...

Mrs. Hektor

2007-10-29

346

Amyloidogenic and non-amyloidogenic transthyretin variants interact differently with human cardiomyocytes: insights into early events of non-fibrillar tissue damage  

PubMed Central

TTR (transthyretin) amyloidoses are diseases characterized by the aggregation and extracellular deposition of the normally soluble plasma protein TTR. Ex vivo and tissue culture studies suggest that tissue damage precedes TTR fibril deposition, indicating that early events in the amyloidogenic cascade have an impact on disease development. We used a human cardiomyocyte tissue culture model system to define these events. We previously described that the amyloidogenic V122I TTR variant is cytotoxic to human cardiac cells, whereas the naturally occurring, stable and non-amyloidogenic T119M TTR variant is not. We show that most of the V122I TTR interacting with the cells is extracellular and this interaction is mediated by a membrane protein(s). In contrast, most of the non-amyloidogenic T119M TTR associated with the cells is intracellular where it undergoes lysosomal degradation. The TTR internalization process is highly dependent on membrane cholesterol content. Using a fluorescent labelled V122I TTR variant that has the same aggregation and cytotoxic potential as the native V122I TTR, we determined that its association with human cardiomyocytes is saturable with a KD near 650 nM. Only amyloidogenic V122I TTR compete with fluorescent V122I for cell-binding sites. Finally, incubation of the human cardiomyocytes with V122I TTR but not with T119M TTR, generates superoxide species and activates caspase 3/7. In summary, our results show that the interaction of the amyloidogenic V122I TTR is distinct from that of a non-amyloidogenic TTR variant and is characterized by its retention at the cell membrane, where it initiates the cytotoxic cascade. PMID:25395306

Manral, Pallavi; Reixach, Natàlia

2014-01-01

347

Evaluation of Epidemic Intelligence Systems Integrated in the Early Alerting and Reporting Project for the Detection of A/H5N1 Influenza Events  

PubMed Central

The objective of Web-based expert epidemic intelligence systems is to detect health threats. The Global Health Security Initiative (GHSI) Early Alerting and Reporting (EAR) project was launched to assess the feasibility and opportunity for pooling epidemic intelligence data from seven expert systems. EAR participants completed a qualitative survey to document epidemic intelligence strategies and to assess perceptions regarding the systems performance. Timeliness and sensitivity were rated highly illustrating the value of the systems for epidemic intelligence. Weaknesses identified included representativeness, completeness and flexibility. These findings were corroborated by the quantitative analysis performed on signals potentially related to influenza A/H5N1 events occurring in March 2010. For the six systems for which this information was available, the detection rate ranged from 31% to 38%, and increased to 72% when considering the virtual combined system. The effective positive predictive values ranged from 3% to 24% and F1-scores ranged from 6% to 27%. System sensitivity ranged from 38% to 72%. An average difference of 23% was observed between the sensitivities calculated for human cases and epizootics, underlining the difficulties in developing an efficient algorithm for a single pathology. However, the sensitivity increased to 93% when the virtual combined system was considered, clearly illustrating complementarities between individual systems. The average delay between the detection of A/H5N1 events by the systems and their official reporting by WHO or OIE was 10.2 days (95% CI: 6.7–13.8). This work illustrates the diversity in implemented epidemic intelligence activities, differences in system's designs, and the potential added values and opportunities for synergy between systems, between users and between systems and users. PMID:23472077

Barboza, Philippe; Vaillant, Laetitia; Mawudeku, Abla; Nelson, Noele P.; Hartley, David M.; Madoff, Lawrence C.; Linge, Jens P.; Collier, Nigel; Brownstein, John S.; Yangarber, Roman; Astagneau, Pascal; on behalf of the Early Alerting, Reporting Project of the Global Health Security Initiative

2013-01-01

348

Loss of Expression and Function of SOCS3 Is an Early Event in HNSCC: Altered Subcellular Localization as a Possible Mechanism Involved in Proliferation, Migration and Invasion  

PubMed Central

Background Suppressor of cytokine signaling 3 (SOCS3) is an inducible endogenous negative regulator of signal transduction and activator of transcription 3 (STAT3). Epigenetic silencing of SOCS3 has been shown in head and neck squamous cell carcinoma (HNSCC), which is associated with increased activation of STAT3. There is scarce information on the functional role of the reduction of SOCS3 expression and no information on altered subcellular localization of SOCS3 in HNSCC. Methodology/Principal Findings We assessed endogenous SOCS3 expression in different HNSCC cell lines by RT-qPCR and western blot. Immunofluorescence and western blot were used to study the subcellular localization of endogenous SOCS3 induced by IL-6. Overexpression of SOCS3 by CMV-driven plasmids and siRNA-mediated inhibition of endogenous SOCS3 were used to verify the role of SOCS3 on tumor cell proliferation, viability, invasion and migration in vitro. In vivo relevance of SOCS3 expression in HNSCC was studied by quantitative immunohistochemistry of commercially-available tissue microarrays. Endogenous expression of SOCS3 was heterogeneous in four HNSCC cell lines and surprisingly preserved in most of these cell lines. Subcellular localization of endogenous SOCS3 in the HNSCC cell lines was predominantly nuclear as opposed to cytoplasmic in non-neoplasic epithelial cells. Overexpression of SOCS3 produced a relative increase of the protein in the cytoplasmic compartment and significantly inhibited proliferation, migration and invasion, whereas inhibition of endogenous nuclear SOCS3 did not affect these events. Analysis of tissue microarrays indicated that loss of SOCS3 is an early event in HNSCC and was correlated with tumor size and histological grade of dysplasia, but a considerable proportion of cases presented detectable expression of SOCS3. Conclusion Our data support a role for SOCS3 as a tumor suppressor gene in HNSCC with relevance on proliferation and invasion processes and suggests that abnormal subcellular localization impairs SOCS3 function in HNSCC cells. PMID:23028842

Rossa, Carlos; Sommer, Gunhild; Spolidorio, Luis C.; Rosenzweig, Steven A.; Watson, Dennis K.; Kirkwood, Keith L.

2012-01-01

349

DNA Structure, Function and Replication  

NSDL National Science Digital Library

This analysis and discussion activity can be used to introduce your students to key concepts about DNA structure, function and replication or to review these topics. This activity includes hands-on modeling of DNA replication.

Ingrid Waldron

350

Practical Database Replication  

Microsoft Academic Search

\\u000a This chapter illustrates how the concepts and algorithms described earlier in this book can be used to build practical database\\u000a replication systems. This is achieved first by addressing architectural challenges on how required functionality is provided\\u000a by generally available software componentes and then how different components can be efficiently integrated. A second set\\u000a of practical challenges arises from experience on

José Pereira; Luís Rodrigues; Nuno Carvalho; Rui Carlos Oliveira

2010-01-01

351

MKP-1 signaling events are required for early osteoclastogenesis in lineage defined progenitor populations by disrupting RANKL-induced NFATc1 nuclear translocation.  

PubMed

Cytokine-directed osteoclastogenesis is initiated in response to macrophage colony stimulating factor (M-CSF) and receptor activator of NF-?B ligand (RANKL) to drive formation of osteoclasts (OC), large bone resorptive cells of hematopoietic origin. RANKL-induced signaling activates the MAPK pathways, which initiates nuclear translocation of the master regulator of osteoclast formation, transcription factor NFATc1. Proper control over these signaling events is essential to normal OC formation response to stimuli. MAPK phosphatase 1 (MKP-1), a serine and tyrosine phosphatase encoded by the gene Dusp1, functions to dephosphorylate and subsequently inactivate MAPK (p38 and JNK) signaling essential in osteoclastogenesis. Here, we explored the role of MKP-1 during RANKL-driven osteoclastogenesis from defined (B220/CD45(-)GR1(-)CD11b(lo/-)CD115(+)) OC progenitor (dOCP) populations using WT and Dusp1(-/-) global knockout mice. Sorted cells were driven to OC by M-CSF pre-treatment followed by RANKL stimulation for 3days. OC formation and qPCR products were analyzed for maturation. Results indicate that Dusp1(-/-) dOCP form less numerous, significantly smaller and less functional OC compared to WT controls. These data were corroborated by mRNA expression of the key OC genes, Nfatc1 and Tm7sf4 (DC-STAMP), which were significantly reduced in early osteoclastogenesis in OC progenitor from Dusp1(-/-) mice. Intriguingly, our data reveals that MKP-1 may positively control OC formation in response to RANKL by regulating NFATc1 nuclear translocation. Collectively, this report supports the idea that MKP-1 signaling is essential in early osteoclastogenesis in response to RANKL-induced signaling. PMID:24269279

Valerio, Michael S; Herbert, Bethany A; Griffin, Alfred C; Wan, Zhuang; Hill, Elizabeth G; Kirkwood, Keith L

2014-03-01

352

Choreography of the Mycobacterium Replication Machinery during the Cell Cycle  

PubMed Central

ABSTRACT It has recently been demonstrated that bacterial chromosomes are highly organized, with specific positioning of the replication initiation region. Moreover, the positioning of the replication machinery (replisome) has been shown to be variable and dependent on species-specific cell cycle features. Here, we analyzed replisome positions in Mycobacterium smegmatis, a slow-growing bacterium that exhibits characteristic asymmetric polar cell extension. Time-lapse fluorescence microscopy analyses revealed that the replisome is slightly off-center in mycobacterial cells, a feature that is likely correlated with the asymmetric growth of Mycobacterium cell poles. Estimates of the timing of chromosome replication in relation to the cell cycle, as well as cell division and chromosome segregation events, revealed that chromosomal origin-of-replication (oriC) regions segregate soon after the start of replication. Moreover, our data demonstrate that organization of the chromosome by ParB determines the replisome choreography. PMID:25691599

Trojanowski, Damian; Ginda, Katarzyna; Pióro, Monika; Ho?ówka, Joanna; Skut, Partycja; Jakimowicz, Dagmara

2015-01-01

353

Replication fork recovery and regulation of common fragile sites stability.  

PubMed

The acquisition of genomic instability is a triggering factor in cancer development, and common fragile sites (CFS) are the preferential target of chromosomal instability under conditions of replicative stress in the human genome. Although the mechanisms leading to CFS expression and the cellular factors required to suppress CFS instability remain largely undefined, it is clear that DNA becomes more susceptible to breakage when replication is impaired. The models proposed so far to explain how CFS instability arises imply that replication fork progression along these regions is perturbed due to intrinsic features of fragile sites and events that directly affect DNA replication. The observation that proteins implicated in the safe recovery of stalled forks or in engaging recombination at collapsed forks increase CFS expression when downregulated or mutated suggests that the stabilization and recovery of perturbed replication forks are crucial to guarantee CFS integrity. PMID:25216703

Franchitto, Annapaola; Pichierri, Pietro

2014-12-01

354

Mitochondrial biology. Replication-transcription switch in human mitochondria.  

PubMed

Coordinated replication and expression of the mitochondrial genome is critical for metabolically active cells during various stages of development. However, it is not known whether replication and transcription can occur simultaneously without interfering with each other and whether mitochondrial DNA copy number can be regulated by the transcription machinery. We found that interaction of human transcription elongation factor TEFM with mitochondrial RNA polymerase and nascent transcript prevents the generation of replication primers and increases transcription processivity and thereby serves as a molecular switch between replication and transcription, which appear to be mutually exclusive processes in mitochondria. TEFM may allow mitochondria to increase transcription rates and, as a consequence, respiration and adenosine triphosphate production without the need to replicate mitochondrial DNA, as has been observed during spermatogenesis and the early stages of embryogenesis. PMID:25635099

Agaronyan, Karen; Morozov, Yaroslav I; Anikin, Michael; Temiakov, Dmitry

2015-01-30

355

Epigenetic changes at the insulin-like growth factor II/H19 locus in developing kidney is an early event in Wilms?tumorigenesis  

PubMed Central

Relaxation of imprinting at the insulin-like growth factor II (IFG-II)/H19 locus is a major mechanism involved in the onset of sporadic Wilms tumor and several other embryonal tumors. The high prevalence of histologically abnormal foci in kidney adjacent to Wilms tumors suggests that tumor-predisposing genetic/epigenetic lesion might also be found at high frequency in Wilms tumor-bearing kidneys. Focusing on Wilms tumors with relaxation of IFG-II imprinting, we determined the frequency of epigenetic change at the IFG-II/H19 locus in adjacent kidney. In all kidneys adjacent to these Wilms tumors, we detected substantial mosaicism for a population of cells with relaxation of IFG-II imprinting and biallelic H19 methylation, regardless of whether the patient had a tumor-predisposing syndrome or not. The high proportion of epigenetically modified cells among “normal” tissue indicates that the epigenetic error occurred very early in development, before the onset of Wilms tumor. Not only does this suggest that the major Wilms tumor-predisposing event occurs within the first few days of development, but it also suggests that sporadic Wilms tumor may represent one end of a spectrum of overgrowth disorders characterized by mosaic epigenetic change at the IFG-II/H19 locus. PMID:9144243

Okamoto, Keisei; Morison, Ian M.; Taniguchi, Takanobu; Reeve, Anthony E.

1997-01-01

356

Modifications of the chemical structure of phenolics differentially affect physiological activities in pulvinar cells of Mimosa pudica L. I. Multimode effect on early membrane events.  

PubMed

A study of the structure-activity relationship carried out on several benzoic acid-related phenolics indicates that this type of compounds hinders the osmocontractile reaction of pulvinar cells in the range of 0-100%. Tentatively, we tried to find a way that could explain this differential action. With this aim, the relationship between the inhibitory effect and important molecular physico-chemical parameters (namely lipophilicity and degree of dissociation) was drawn. In addition, the effect of a variety of these compounds was investigated on their capacity to modify the electrical transmembrane potential and induce modifications in proton fluxes. Finally, using plasma membrane vesicles purified from pulvinar tissues, we examined the effects of some selected compounds on the proton pump activity and catalytic activity of the plasma membrane H(+)-ATPase. Taken together, the results indicate that a modification of the molecular structure of phenolics may induce important variation in the activity of the compound on these early membrane events. Among the tested phenolics, salicylic acid (SA) and acetylsalicylic acid (ASA, aspirin) are of particuler note, as they showed atypical effects on the physiological processes studied. PMID:25306527

Rocher, Françoise; Dédaldéchamp, Fabienne; Saeedi, Saed; Fleurat-Lessard, Pierrette; Chollet, Jean-Francois; Roblin, Gabriel

2014-11-01

357

Characterization of the Early Events Leading to Totipotency in an Arabidopsis Protoplast Liquid Culture by Temporal Transcript Profiling[W][OPEN  

PubMed Central

The molecular mechanisms underlying plant cell totipotency are largely unknown. Here, we present a protocol for the efficient regeneration of plants from Arabidopsis thaliana protoplasts. The specific liquid medium used in our study leads to a high rate of reentry into the cell cycle of most cell types, providing a powerful system to study dedifferentiation/regeneration processes in independent somatic cells. To identify the early events in the establishment of totipotency, we monitored the genome-wide transcript profiles of plantlets and protoplast-derived cells (PdCs) during the first week of culture. Plant cells rapidly dedifferentiated. Then, we observed the reinitiation and reorientation of protein synthesis, accompanied by the reinitiation of cell division and de novo cell wall synthesis. Marked changes in the expression of chromatin-associated genes, especially of those in the histone variant family, were observed during protoplast culture. Surprisingly, the epigenetic status of PdCs and well-established cell cultures differed, with PdCs exhibiting rare reactivated transposons and epigenetic changes. The differentially expressed genes identified in this study are interesting candidates for investigating the molecular mechanisms underlying plant cell plasticity and totipotency. One of these genes, the plant-specific transcription factor ABERRANT LATERAL ROOT FORMATION4, is required for the initiation of protoplast division. PMID:23903317

Chupeau, Marie-Christine; Granier, Fabienne; Pichon, Olivier; Renou, Jean-Pierre; Gaudin, Valérie; Chupeau, Yves

2013-01-01

358

Capturing the biological impact of CDKN2A and MC1R genes as an early predisposing event in melanoma and non melanoma skin cancer  

PubMed Central

Germline mutations in CDKN2A and/or red hair color variants in MC1R genes are associated with an increased susceptibility to develop cutaneous melanoma or non melanoma skin cancer. We studied the impact of the CDKN2A germinal mutation p.G101W and MC1R variants on gene expression and transcription profiles associated with skin cancer. To this end we set-up primary skin cell co-cultures from siblings of melanoma prone-families that were later analyzed using the expression array approach. As a result, we found that 1535 transcripts were deregulated in CDKN2A mutated cells, with over-expression of immunity-related genes (HLA-DPB1, CLEC2B, IFI44, IFI44L, IFI27, IFIT1, IFIT2, SP110 and IFNK) and down-regulation of genes playing a role in the Notch signaling pathway. 3570 transcripts were deregulated in MC1R variant carriers. In particular, genes related to oxidative stress and DNA damage pathways were up-regulated as well as genes associated with neurodegenerative diseases such as Parkinson’s, Alzheimer and Huntington. Finally, we observed that the expression signatures indentified in phenotypically normal cells carrying CDKN2A mutations or MC1R variants are maintained in skin cancer tumors (melanoma and squamous cell carcinoma). These results indicate that transcriptome deregulation represents an early event critical for skin cancer development. PMID:24742402

Puig-Butille, Joan Anton; Escámez, María José; Garcia-Garcia, Francisco; Tell-Marti, Gemma; Fabra, Àngels; Martínez-Santamaría, Lucía; Badenas, Celia; Aguilera, Paula; Pevida, Marta; Dopazo, Joaquín; del Río, Marcela; Puig, Susana

2014-01-01

359

Regulation of desmocollin gene expression in the epidermis: CCAAT/enhancer-binding proteins modulate early and late events in keratinocyte differentiation.  

PubMed Central

Desmocollins (Dscs) are desmosomal cadherins that exhibit differentiation-specific patterns of expression in the epidermis. Dsc3 expression is strongest in basal cell layers, whereas Dsc1 is largely confined to upper, terminally differentiating strata. To understand better the processes by which Dsc expression is regulated in the epidermis, we have isolated Dsc3 and Dsc1 5'-flanking DNAs and analysed their activity in primary keratinocytes. In the present study, we found that transcription factors of the CCAAT/enhancer-binding protein family play a role in the regulation of expression of both Dscs and, in so doing, implicate this class of transcription factors in both early and late events in keratinocyte differentiation. We show that Dscs are differentially regulated by C/EBP (CCAAT/enhancer-binding protein) family members, with Dsc3 expression being activated by C/EBPbeta but not C/EBPalpha, and the reverse being the case for Dsc1. Expression of both Dscs is activated by another family member, C/EBPdelta. These results show for the first time how desmosomal cadherin gene expression is regulated and provide a mechanism for the control of other differentiation-specific genes in the epidermis. PMID:15030314

Smith, Conrad; Zhu, Kuichun; Merritt, Anita; Picton, Rhian; Youngs, Denise; Garrod, David; Chidgey, Martyn

2004-01-01

360

The DNA replication stress hypothesis of Alzheimer's disease.  

PubMed

A well-recognized theory of Alzheimer's disease (AD) pathogenesis suggests ectopic cell cycle events to mediate neurodegeneration. Vulnerable neurons of the AD brain exhibit biomarkers of cell cycle progression and DNA replication suggesting a reentry into the cell cycle. Chromosome reduplication without proper cell cycle completion and mitotic division probably causes neuronal cell dysfunction and death. However, this theory seems to require some inputs in accordance with the generally recognized amyloid cascade theory as well as to explain causes and consequences of genomic instability (aneuploidy) in the AD brain. We propose that unscheduled and incomplete DNA replication (replication stress) destabilizes (epi)genomic landscape in the brain and leads to DNA replication "catastrophe" causing cell death during the S phase (replicative cell death). DNA replication stress can be a key element of the pathogenetic cascade explaining the interplay between ectopic cell cycle events and genetic instabilities in the AD brain. Abnormal cell cycle reentry and somatic genome variations can be used for updating the cell cycle theory introducing replication stress as a missing link between cell genetics and neurobiology of AD. PMID:22262948

Yurov, Yuri B; Vorsanova, Svetlana G; Iourov, Ivan Y

2011-01-01

361

The DNA Replication Stress Hypothesis of Alzheimer's Disease  

PubMed Central

A well-recognized theory of Alzheimer's disease (AD) pathogenesis suggests ectopic cell cycle events to mediate neurodegeneration. Vulnerable neurons of the AD brain exhibit biomarkers of cell cycle progression and DNA replication suggesting a reentry into the cell cycle. Chromosome reduplication without proper cell cycle completion and mitotic division probably causes neuronal cell dysfunction and death. However, this theory seems to require some inputs in accordance with the generally recognized amyloid cascade theory as well as to explain causes and consequences of genomic instability (aneuploidy) in the AD brain. We propose that unscheduled and incomplete DNA replication (replication stress) destabilizes (epi)genomic landscape in the brain and leads to DNA replication “catastrophe” causing cell death during the S phase (replicative cell death). DNA replication stress can be a key element of the pathogenetic cascade explaining the interplay between ectopic cell cycle events and genetic instabilities in the AD brain. Abnormal cell cycle reentry and somatic genome variations can be used for updating the cell cycle theory introducing replication stress as a missing link between cell genetics and neurobiology of AD. PMID:22262948

Yurov, Yuri B.; Vorsanova, Svetlana G.; Iourov, Ivan Y.

2011-01-01

362

DNA replication origins in archaea  

PubMed Central

DNA replication initiation, which starts at specific chromosomal site (known as replication origins), is the key regulatory stage of chromosome replication. Archaea, the third domain of life, use a single or multiple origin(s) to initiate replication of their circular chromosomes. The basic structure of replication origins is conserved among archaea, typically including an AT-rich unwinding region flanked by several conserved repeats (origin recognition box, ORB) that are located adjacent to a replication initiator gene. Both the ORB sequence and the adjacent initiator gene are considerably diverse among different replication origins, while in silico and genetic analyses have indicated the specificity between the initiator genes and their cognate origins. These replicator–initiator pairings are reminiscent of the oriC-dnaA system in bacteria, and a model for the negative regulation of origin activity by a downstream cluster of ORB elements has been recently proposed in haloarchaea. Moreover, comparative genomic analyses have revealed that the mosaics of replicator-initiator pairings in archaeal chromosomes originated from the integration of extrachromosomal elements. This review summarizes the research progress in understanding of archaeal replication origins with particular focus on the utilization, control and evolution of multiple replication origins in haloarchaea. PMID:24808892

Wu, Zhenfang; Liu, Jingfang; Yang, Haibo; Xiang, Hua

2014-01-01

363

Role of replication time in the control of tissue-specific gene expression.  

PubMed Central

Late-replicating chromatin in vertebrates is repressed. Housekeeping (constitutively active) genes always replicate early and are in the early-replicating R-bands. Tissue-specific genes are usually in the late-replicating G-bands and therein almost always replicate late. Within the G-bands, however, a tissue-specific gene does replicate early in those cell types that express that particular gene. While the condition of late replication may simply be coincident with gene repression, we review evidence suggesting that late replication may actively determine repression. As mammals utilize a developmental program to Lyonize (facultatively heterochromatinize) whole X chromosomes to a late-replicating and somatically heritable repressed state, similarly another program seems to Lyonize individual replicons. In frogs, all genes begin embryogenesis by replicating during a very short interval. As the developmental potency of embryonic cells becomes restricted, late-replicating DNA gradually appears. This addition to the repertoire of gene control--i.e., repression via Lyonization of individual replicons--seems to have evolved in vertebrates with G-bands being a manifestation of the mechanism. PMID:3551593

Holmquist, G P

1987-01-01

364

UHU® adhesive holograms replication  

NASA Astrophysics Data System (ADS)

It is possible to apply a new recording material with high diffraction efficiency (of the order of 82.3%) to replicate computer phase or analogical holograms. This material is the all purpose adhesive UHU®. It is constituted by some components of polyvinyl, nitrates and some solvent agents; it is easily applied to any substrate. We record this material with heat generation by hand rubbing, using a mask (Kodalith® films) manufactured with lithographic techniques. The holographic replication is excellent on the new material UHU® adhesive, showing a phase modulation for refraction index and relief. This modulation is determined by the cured polymers process induced by friction, as pressure and temperature, with an anaerobic reaction. For copy of conventional holograms at high frequencies (holographic ranges), the diffraction efficiency parameter is in the neighborhood of 19.1% at first order or more, depending on diffraction efficiency of the pattern of the hologram. The hologram is elaborated in the absence of any development process and does not need to have carefully controlled conditions of the environment. Following this process, the hologram is obtained at standard atmospheric conditions of pressure and temperature.

Olivares-Pérez, A.; Toxqui-López, S.; Grijalva-Y-Ortiz, N.; Fuentes-Tapia, I.; Quintero-Romo, A.

2008-08-01

365

Shifts in replication timing actively affect histone acetylation during nucleosome reassembly  

PubMed Central

Summary The entire genome is replicated in a programmed manner with specific regions undergoing DNA synthesis at different times in S phase. Active genes generally replicate in early S phase, while repressed genes replicate late, and for some loci this process is developmentally regulated. Using a nuclear microinjection system, we demonstrate that DNA sequences originally packaged into nucleosomes containing deacetylated histones during late S become reassembled with acetylated histones after undergoing replication in early S. Conversely, a change from early to late replication timing is accompanied by repackaging into nucleosomes containing deacetylated histones. This is carried out by differential cell cycle-controlled acetylation and deacetylation of histones H3 and H4. These studies provide strong evidence that switches in replication timing may play a role in the regulation of nucleosome structure during development. PMID:19560427

Lande-Diner, Laura; Zhang, Jianmin; Cedar, Howard

2009-01-01

366

Cell-cycle regulated transcription associates with DNA replication timing in yeast and human  

E-print Network

Eukaryotic DNA replication follows a specific temporal program, with some genomic regions consistently replicating earlier than others, yet what determines this program is largely unknown. Highly transcribed regions have been observed to replicate in early S-phase in all plant and animal species studied to date, but this relationship is thought to be absent from both budding yeast and fission yeast. No association between cell-cycle regulated transcription and replication timing has been reported for any species. Here I show that in budding yeast, fission yeast, and human, the genes most highly transcribed during S-phase replicate early, whereas those repressed in S-phase replicate late. Transcription during other cell-cycle phases shows either the opposite correlation with replication timing, or no relation. The relationship is strongest near late-firing origins of replication, which is not consistent with a previously proposed model -- that replication timing may affect transcription -- and instead suggests a potential mechanism involving the recruitment of limiting replication initiation factors during S-phase. These results suggest that S-phase transcription may be an important determinant of DNA replication timing across eukaryotes, which may explain the well-established association between transcription and replication timing.

Hunter B. Fraser

2013-08-08

367

A Solution NMR Investigation into the Early Events of Amelogenin Nanosphere Self-Assembly Initiated with Sodium Chloride or Calcium Chloride†  

PubMed Central

Using solution-state NMR spectroscopy, new insights into the early events governing amelogenin supramolecular self-assembly have been identified using sodium chloride and calcium chloride to trigger the association. Two-dimensional 1H–15N HSQC spectra were recorded for 15N- and 13C-labeled murine amelogenin as a function of increasing NaCl and CaCl2 concentration beginning with solution conditions of 2% acetic acid at pH 3.0, where amelogenin was monomeric. Residue specific changes in molecular dynamics, manifested by the reduction in intensity and disappearance of 1H–15N HSQC cross-peaks, were observed with the addition of either salt to the protein. With increasing NaCl concentrations, residues between T21 and R31 near the N-terminus were affected first, suggesting that these residues may initiate amelogenin dimerization, the first step in nanosphere assembly. At higher NaCl concentrations, more residues near the N-terminus (Y12–I51) were affected, and with further additions of NaCl, residues near the C-terminus (L141–T171) began to show a similar change in molecular dynamics. With increasing CaCl2 concentrations, a similar stepwise change in molecular dynamics involving essentially the same set of amelogenin residues was observed. As the concentration of either salt was increased, a concomitant increase in the estimated overall rotational correlation time (?c) was observed, consistent with assembly. Self-assembly into a dimer or trimer was established with dynamic light scattering studies under similar conditions that showed an increase in diameter of the smallest species from 4.1 nm in the absence of salt to ~10 nm in the presence of salt. These results suggest a possible stepwise interaction mechanism, starting with the N-terminus and followed by the C-terminus, leading to amelogenin nanosphere assembly. PMID:19086270

Buchko, Garry W.; Tarasevich, Barbara J.; Bekhazi, Jacky; Snead, Malcolm L.; Shaw, Wendy J.

2009-01-01

368

The bacterial replication initiator DnaA. DnaA and oriC, the bacterial mode to initiate DNA replication  

Microsoft Academic Search

The initiation of replication is the central event in the bacterial cell cycle. Cells control the rate of DNA synthesis by modulating the frequency with which new chains are initiated, like all macromolecular synthesis. The end of the replication cycle provides a checkpoint that must be executed for cell division to occur. This review summarizes recent insight into the biochemistry,

Walter Messer

2002-01-01

369

Early bioenergetic evolution  

PubMed Central

Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. This paper outlines an energetically feasible path from a particular inorganic setting for the origin of life to the first free-living cells. The sources of energy available to early organic synthesis, early evolving systems and early cells stand in the foreground, as do the possible mechanisms of their conversion into harnessable chemical energy for synthetic reactions. With regard to the possible temporal sequence of events, we focus on: (i) alkaline hydrothermal vents as the far-from-equilibrium setting, (ii) the Wood–Ljungdahl (acetyl-CoA) pathway as the route that could have underpinned carbon assimilation for these processes, (iii) biochemical divergence, within the naturally formed inorganic compartments at a hydrothermal mound, of geochemically confined replicating entities with a complexity below that of free-living prokaryotes, and (iv) acetogenesis and methanogenesis as the ancestral forms of carbon and energy metabolism in the first free-living ancestors of the eubacteria and archaebacteria, respectively. In terms of the main evolutionary transitions in early bioenergetic evolution, we focus on: (i) thioester-dependent substrate-level phosphorylations, (ii) harnessing of naturally existing proton gradients at the vent–ocean interface via the ATP synthase, (iii) harnessing of Na+ gradients generated by H+/Na+ antiporters, (iv) flavin-based bifurcation-dependent gradient generation, and finally (v) quinone-based (and Q-cycle-dependent) proton gradient generation. Of those five transitions, the first four are posited to have taken place at the vent. Ultimately, all of these bioenergetic processes depend, even today, upon CO2 reduction with low-potential ferredoxin (Fd), generated either chemosynthetically or photosynthetically, suggesting a reaction of the type ‘reduced iron ? reduced carbon’ at the beginning of bioenergetic evolution. PMID:23754820

Sousa, Filipa L.; Thiergart, Thorsten; Landan, Giddy; Nelson-Sathi, Shijulal; Pereira, Inês A. C.; Allen, John F.; Lane, Nick; Martin, William F.

2013-01-01

370

SUMO and KSHV Replication  

PubMed Central

Small Ubiquitin-related MOdifier (SUMO) modification was initially identified as a reversible post-translational modification that affects the regulation of diverse cellular processes, including signal transduction, protein trafficking, chromosome segregation, and DNA repair. Increasing evidence suggests that the SUMO system also plays an important role in regulating chromatin organization and transcription. It is thus not surprising that double-stranded DNA viruses, such as Kaposi’s sarcoma-associated herpesvirus (KSHV), have exploited SUMO modification as a means of modulating viral chromatin remodeling during the latent-lytic switch. In addition, SUMO regulation allows the disassembly and assembly of promyelocytic leukemia protein-nuclear bodies (PML-NBs), an intrinsic antiviral host defense, during the viral replication cycle. Overcoming PML-NB-mediated cellular intrinsic immunity is essential to allow the initial transcription and replication of the herpesvirus genome after de novo infection. As a consequence, KSHV has evolved a way as to produce multiple SUMO regulatory viral proteins to modulate the cellular SUMO environment in a dynamic way during its life cycle. Remarkably, KSHV encodes one gene product (K-bZIP) with SUMO-ligase activities and one gene product (K-Rta) that exhibits SUMO-targeting ubiquitin ligase (STUbL) activity. In addition, at least two viral products are sumoylated that have functional importance. Furthermore, sumoylation can be modulated by other viral gene products, such as the viral protein kinase Orf36. Interference with the sumoylation of specific viral targets represents a potential therapeutic strategy when treating KSHV, as well as other oncogenic herpesviruses. Here, we summarize the different ways KSHV exploits and manipulates the cellular SUMO system and explore the multi-faceted functions of SUMO during KSHV’s life cycle and pathogenesis. PMID:25268162

Chang, Pei-Ching; Kung, Hsing-Jien

2014-01-01

371

Emerging players in the initiation of eukaryotic DNA replication  

PubMed Central

Faithful duplication of the genome in eukaryotes requires ordered assembly of a multi-protein complex called the pre-replicative complex (pre-RC) prior to S phase; transition to the pre-initiation complex (pre-IC) at the beginning of DNA replication; coordinated progression of the replisome during S phase; and well-controlled regulation of replication licensing to prevent re-replication. These events are achieved by the formation of distinct protein complexes that form in a cell cycle-dependent manner. Several components of the pre-RC and pre-IC are highly conserved across all examined eukaryotic species. Many of these proteins, in addition to their bona fide roles in DNA replication are also required for other cell cycle events including heterochromatin organization, chromosome segregation and centrosome biology. As the complexity of the genome increases dramatically from yeast to human, additional proteins have been identified in higher eukaryotes that dictate replication initiation, progression and licensing. In this review, we discuss the newly discovered components and their roles in cell cycle progression. PMID:23075259

2012-01-01

372

Phosphorylation of the replicative helicase by the S-phase kinase, Dbf4-Cdc7, at origins of replication in Saccharomyces cerevisiae  

E-print Network

In eukaryotic cells, events such as DNA replication and mitosis must be carefully coordinated in the cell cycle to ensure that the entire genome is duplicated before cells undergo cell division. In particular, initiation ...

Francis, Laura Ileana

2008-01-01

373

Effects of Viral Strain, Transgene Position, and Target Cell Type on Replication Kinetics, Genomic Stability, and Transgene Expression of Replication-Competent Murine Leukemia Virus-Based Vectors  

Microsoft Academic Search

The limited efficiency of in vivo gene transfer by replication-deficient retroviral vectors remains an obstacle to achieving effective gene therapy for solid tumors. One approach to circumvent this problem is the use of replication-competent retroviral vectors. However, the application of such vectors is at a comparatively early stage and the effects which virus strain, transgene cassette position, and target cell

Matthias Paar; Sonja Schwab; Doris Rosenfellner; Brian Salmons; Walter H. Gunzburg; Matthias Renner; Daniel Portsmouth

2007-01-01

374

Template Role of Double-Stranded RNA in Tombusvirus Replication  

PubMed Central

ABSTRACT Replication of plus-strand RNA [(+)RNA] viruses of plants is a relatively simple process that involves complementary minus-strand RNA [(?)RNA] synthesis and subsequent (+)RNA synthesis. However, the actual replicative form of the (?)RNA template in the case of plant (+)RNA viruses is not yet established unambiguously. In this paper, using a cell-free replication assay supporting a full cycle of viral replication, we show that replication of Tomato bushy stunt virus (TBSV) leads to the formation of double-stranded RNA (dsRNA). Using RNase digestion, DNAzyme, and RNA mobility shift assays, we demonstrate the absence of naked (?)RNA templates during replication. Time course experiments showed the rapid appearance of dsRNA earlier than the bulk production of new (+)RNAs, suggesting an active role for dsRNA in replication. Radioactive nucleotide chase experiments showed that the mechanism of TBSV replication involves the use of dsRNA templates in strand displacement reactions, where the newly synthesized plus strand replaces the original (+)RNA in the dsRNA. We propose that the use of dsRNA as a template for (+)RNA synthesis by the viral replicase is facilitated by recruited host DEAD box helicases and the viral p33 RNA chaperone protein. Altogether, this replication strategy allows TBSV to separate minus- and plus-strand syntheses in time and regulate asymmetrical RNA replication that leads to abundant (+)RNA progeny. IMPORTANCE Positive-stranded RNA viruses of plants use their RNAs as the templates for replication. First, the minus strand is synthesized by the viral replicase complex (VRC), which then serves as a template for new plus-strand synthesis. To characterize the nature of the (?)RNA in the membrane-bound viral replicase, we performed complete RNA replication of Tomato bushy stunt virus (TBSV) in yeast cell-free extracts and in plant extracts. The experiments demonstrated that the TBSV (?)RNA is present as a double-stranded RNA that serves as the template for TBSV replication. During the production of new plus strands, the viral replicase displaces the old plus strand in the dsRNA template, leading to asymmetrical RNA synthesis. The presented data are in agreement with the model that the dsRNA is present in nuclease-resistant membranous VRCs. This strategy likely allows TBSV to protect the replicating viral RNA from degradation as well as to evade the early detection of viral dsRNAs by the host surveillance system. PMID:24600009

Kovalev, Nikolay; Pogany, Judit

2014-01-01

375

Impaired DNA Replication within Progenitor Cell Pools Promotes Leukemogenesis  

PubMed Central

Impaired cell cycle progression can be paradoxically associated with increased rates of malignancies. Using retroviral transduction of bone marrow progenitors followed by transplantation into mice, we demonstrate that inhibition of hematopoietic progenitor cell proliferation impairs competition, promoting the expansion of progenitors that acquire oncogenic mutations which restore cell cycle progression. Conditions that impair DNA replication dramatically enhance the proliferative advantage provided by the expression of Bcr-Abl or mutant p53, which provide no apparent competitive advantage under conditions of healthy replication. Furthermore, for the Bcr-Abl oncogene the competitive advantage in contexts of impaired DNA replication dramatically increases leukemogenesis. Impaired replication within hematopoietic progenitor cell pools can select for oncogenic events and thereby promote leukemia, demonstrating the importance of replicative competence in the prevention of tumorigenesis. The demonstration that replication-impaired, poorly competitive progenitor cell pools can promote tumorigenesis provides a new rationale for links between tumorigenesis and common human conditions of impaired DNA replication such as dietary folate deficiency, chemotherapeutics targeting dNTP synthesis, and polymorphisms in genes important for DNA metabolism. PMID:16277552

2005-01-01

376

DNA replication and transcription programs respond to the same chromatin cues  

PubMed Central

DNA replication is a dynamic process that occurs in a temporal order along each of the chromosomes. A consequence of the temporally coordinated activation of replication origins is the establishment of broad domains (>100 kb) that replicate either early or late in S phase. This partitioning of the genome into early and late replication domains is important for maintaining genome stability, gene dosage, and epigenetic inheritance; however, the molecular mechanisms that define and establish these domains are poorly understood. The modENCODE Project provided an opportunity to investigate the chromatin features that define the Drosophila replication timing program in multiple cell lines. The majority of early and late replicating domains in the Drosophila genome were static across all cell lines; however, a small subset of domains was dynamic and exhibited differences in replication timing between the cell lines. Both origin selection and activation contribute to defining the DNA replication program. Our results suggest that static early and late replicating domains were defined at the level of origin selection (ORC binding) and likely mediated by chromatin accessibility. In contrast, dynamic domains exhibited low ORC densities in both cell types, suggesting that origin activation and not origin selection governs the plasticity of the DNA replication program. Finally, we show that the male-specific early replication of the X chromosome is dependent on the dosage compensation complex (DCC), suggesting that the transcription and replication programs respond to the same chromatin cues. Specifically, MOF-mediated hyperacetylation of H4K16 on the X chromosome promotes both the up-regulation of male-specific transcription and origin activation. PMID:24985913

Lubelsky, Yoav; Prinz, Joseph A.; DeNapoli, Leyna; Li, Yulong; Belsky, Jason A.; MacAlpine, David M.

2014-01-01

377

Fungal Pathogens: Survival and Replication within Macrophages.  

PubMed

The innate immune system is a critical line of defense against pathogenic fungi. Macrophages act at an early stage of infection, detecting and phagocytizing infectious propagules. To avoid killing at this stage, fungal pathogens use diverse strategies ranging from evasion of uptake to intracellular parasitism. This article will discuss five of the most important human fungal pathogens (Candida albicans, Aspergillus fumigatus, Cryptococcus neoformans, Coccidiodes immitis, and Histoplasma capsulatum) and consider the strategies and virulence factors adopted by each to survive and replicate within macrophages. PMID:25384769

Gilbert, Andrew S; Wheeler, Robert T; May, Robin C

2014-11-10

378

Activation of Silent Replication Origins at Autonomously Replicating Sequence Elements near the HML Locus in Budding Yeast  

PubMed Central

In the budding yeast, Saccharomyces cerevisiae, replicators can function outside the chromosome as autonomously replicating sequence (ARS) elements; however, within chromosome III, certain ARSs near the transcriptionally silent HML locus show no replication origin activity. Two of these ARSs comprise the transcriptional silencers E (ARS301) and I (ARS302). Another, ARS303, resides between HML and the CHA1 gene, and its function is not known. Here we further localized and characterized ARS303 and in the process discovered a new ARS, ARS320. Both ARS303 and ARS320 are competent as chromosomal replication origins since origin activity was seen when they were inserted at a different position in chromosome III. However, at their native locations, where the two ARSs are in a cluster with ARS302, the I silencer, no replication origin activity was detected regardless of yeast mating type, special growth conditions that induce the transcriptionally repressed CHA1 gene, trans-acting mutations that abrogate transcriptional silencing at HML (sir3, orc5), or cis-acting mutations that delete the E and I silencers containing ARS elements. These results suggest that, for the HML ARS cluster (ARS303, ARS320, and ARS302), inactivity of origins is independent of local transcriptional silencing, even though origins and silencers share key cis- and trans-acting components. Surprisingly, deletion of active replication origins located 25 kb (ORI305) and 59 kb (ORI306) away led to detection of replication origin function at the HML ARS cluster, as well as at ARS301, the E silencer. Thus, replication origin silencing at HML ARSs is mediated by active replication origins residing at long distances from HML in the chromosome. The distal active origins are known to fire early in S phase, and we propose that their inactivation delays replication fork arrival at HML, providing additional time for HML ARSs to fire as origins. PMID:10454557

Vujcic, Marija; Miller, Charles A.; Kowalski, David

1999-01-01

379

Effect of Microgravity on Early Events of Biological Nitrogen Fixation in Medicago Truncatula: Initial Results from the SyNRGE Experiment  

NASA Technical Reports Server (NTRS)

SyNRGE (Symbiotic Nodulation in a Reduced Gravity Environment) was a sortie mission on STS-135 in the Biological Research in Canisters (BRIC) hardware to study the effect of microgravity on a plant-microbe symbiosis resulting in biological nitrogen fixation. Medicago truncatula, a model species of the legume family, was inoculated with its bacterial symbiont, Sinorhizobium meliloti, to observe early events associated with infection and nodulation in Petri Dish Fixation Units (PDFUs). Two sets of experiments were conducted in orbit and in 24-hour delayed ground controls. Experiment one was designed to determine if S. meliloti infect M. truncatula and initiate physiological changes associated with nodule formation. Roots of five-day-old M. truncatula cultivar Jemalong A17 (Enodll::gus) were inoculated 24 hr before launch with either S. meliloti strain 1021 or strain ABS7 and integrated into BRIC-PDFU hardware placed in a 4 C Cold Bag for launch on Atlantis. Inoculated plants and uninoculated controls were maintained in the dark at ambient temperature in the middeck of STS-135 for 11 days before fixation in RNAlater(tM) by crew activation of the PDFU. Experiment two was designed to determine if microgravity altered the process of bacterial infection and host plant nodule formation. Seeds of two M. truncatula cultivar Jemalong A17 lines, the Enodll::gus used in experiment 1, and SUNN, a super-nodulating mutant of A17, were germinated on orbit for 11 days in the middeck cabin and returned to Earth alive inside of BRIC-PDFU's at 4 C. S. meliloti strains 1021 and ABS7 were cultivated separately in broth culture on orbit and also returned to Earth alive. After landing, flight- and groundgrown plants and bacteria were transferred from BRIC-PDFU's into Nunc(tm) 4-well plates for reciprocity crosses. Rates of plant growth and nodule development on Buffered Nodulation Medium (lacking nitrogen) were measured for 14 days. Preliminary analysis' of Experiment 1 confirms that legumes and bacteria cultivated in space 'initiate the symbiotic interaction leading to nitrogen fixation and that bacteria retain the ability to form nodules on M. truncatula roots. Initial assessment of experiment 2 shows 100% seed germination and excellent bacterial growth in microgravity.

Stutte, Gary W.; Roberts, Michael S.

2011-01-01