These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Early Events in the Pathogenesis of Foot-and-Mouth Disease in Pigs; Identification of Oropharyngeal Tonsils as Sites of Primary and Sustained Viral Replication  

PubMed Central

A time-course study was performed to elucidate the early events of foot-and-mouth disease virus (FMDV) infection in pigs subsequent to simulated natural, intra-oropharyngeal, inoculation. The earliest detectable event was primary infection in the lingual and paraepiglottic tonsils at 6 hours post inoculation (hpi) characterized by regional localization of viral RNA, viral antigen, and infectious virus. At this time FMDV antigen was localized in cytokeratin-positive epithelial cells and CD172a-expressing leukocytes of the crypt epithelium of the paraepiglottic tonsils. De novo replication of FMDV was first detected in oropharyngeal swab samples at 12 hpi and viremia occurred at 18–24 hpi, approximately 24 hours prior to the appearance of vesicular lesions. From 12 through 78 hpi, microscopic detection of FMDV was consistently localized to cytokeratin-positive cells within morphologically characteristic segments of oropharyngeal tonsil crypt epithelium. During this period, leukocyte populations expressing CD172a, SLA-DQ class II and/or CD8 were found in close proximity to infected epithelial cells, but with little or no co-localization with viral proteins. Similarly, M-cells expressing cytokeratin-18 did not co-localize with FMDV proteins. Intra-epithelial micro-vesicles composed of acantholytic epithelial cells expressing large amounts of structural and non-structural FMDV proteins were present within crypts of the tonsil of the soft palate during peak clinical infection. These findings inculpate the paraepiglottic tonsils as the primary site of FMDV infection in pigs exposed via the gastrointestinal tract. Furthermore, the continuing replication of FMDV in the oropharyngeal tonsils during viremia and peak clinical infection with no concurrent amplification of virus occurring in the lower respiratory tract indicates that these sites are the major source of shedding of FMDV from pigs. PMID:25184288

Stenfeldt, Carolina; Pacheco, Juan M.; Rodriguez, Luis L.; Arzt, Jonathan

2014-01-01

2

Inhibition of early and late events of the HIV-1 replication cycle by cytoplasmic Fab intrabodies against the matrix protein, p17.  

PubMed Central

BACKGROUND: The HIV-1 matrix (MA) protein, p17, contains two subcellular localization signals that facilitate both nuclear import of the viral preintegration complex early during infection and virus particle assembly late in infection. The dual role of MA in both the afferent and efferent arms of the HIV-1 life cycle makes it an important target for intracellular immunization-based gene therapy strategies. MATERIALS AND METHODS: Here we report, using a new bicistronic vector, that an intracellular Fab antibody, or Fab intrabody, directed against a carboxy-terminal epitope of MA from the Clade B HIV-1 genotype, can inhibit HIV-1 infection when expressed in the cytoplasm of actively dividing CD4+ T cells. RESULTS: Marked inhibition of proviral gene expression occurred when single-round HIV-1 CAT virus was used for infections. In challenge experiments using both laboratory strains and syncytium-inducing primary isolates of HIV-1, a substantial reduction in the infectivity of virions released from the cells was also observed. CONCLUSIONS: This novel strategy of simultaneously blocking early and late events of the HIV-1 life cycle may prove useful in clinical gene therapy approaches for the treatment of HIV-1 infection and AIDS, particularly when combined with genetic or pharmacologic-based strategies that inhibit other HIV-1 target molecules simultaneously. Images FIG. 2 FIG. 3 FIG. 5 FIG. 6 FIG. 8 PMID:9085253

Levin, R.; Mhashilkar, A. M.; Dorfman, T.; Bukovsky, A.; Zani, C.; Bagley, J.; Hinkula, J.; Niedrig, M.; Albert, J.; Wahren, B.; Göttlinger, H. G.; Marasco, W. A.

1997-01-01

3

Early traumatic events in psychopaths.  

PubMed

The relationship between diverse early traumatic events and psychopathy was studied in 194 male inmates. Criminal history transcripts were revised, and clinical interviews were conducted to determine the level of psychopathy using the Psychopathy Checklist-Revised (PCL-R) Form, and the Early Trauma Inventory was applied to assess the incidence of abuse before 18 years of age. Psychopathic inmates presented a higher victimization level and were more exposed to certain types of intended abuse than sociopathic inmates, while the sum of events and emotional abuse were associated with the PCL-R score. Our studies support the influence of early adverse events in the development of psychopathic offenders. PMID:23550705

Borja, Karina; Ostrosky, Feggy

2013-07-01

4

Early events in ovarian oncogenesis  

Microsoft Academic Search

Ovarian cancer represents the most lethal of the gynecological neoplasms. The molecular and genetic events associated with early ovarian oncogenesis are still largely unknown, thus contributing to the lack of reliable biomarkers for disease detection. Since the majority of ovarian tumors are diagnosed at an advanced stage, the availability of early ovarian cancer tissue samples for molecular analyses is very

Dusica Cvetkovic

2003-01-01

5

Tyrosine phosphorylation events during coxsackievirus B3 replication.  

PubMed Central

In order to study cellular and viral determinants of pathogenicity, interactions between coxsackievirus B3 (CVB3) replication and cellular protein tyrosine phosphorylation were investigated. During CVB3 infection of HeLa cells, distinct proteins become phosphorylated on tyrosine residues, as detected by the use of antiphosphotyrosine Western blotting. Two proteins of 48 and 200 kDa showed enhanced tyrosine phosphorylation 4 to 5 h postinfection (p.i.), although virus-induced inhibition of cellular protein synthesis had already occurred 3 to 4 h p.i. Subcellular fractionation experiments revealed distinct localization of tyrosine-phosphorylated proteins of 48 and 200 kDa in the cytosol and membrane fractions of infected cells, respectively. In addition, in Vero cells infected with CVB3, echovirus (EV)11, or EV12, increased tyrosine phosphorylation of a 200-kDa protein was detected 6 h p.i. Herbimycin A, a specific inhibitor of Src-like protein tyrosine kinases, was shown to inhibit virus-induced tyrosine phosphorylations and to reduce the production of progeny virions. In contrast, in cells treated with the inhibitors staurosporine and calphostin C, the synthesis of progeny virions was not affected. Immunoprecipitation experiments suggested that the tyrosine-phosphorylated 200-kDa protein in CVB3-infected cells is of cellular origin. In summary, these investigations have begun to unravel the effect of CVB3 as well as EV11 and EV12 replication on cellular tyrosine phosphorylation and support the importance of tyrosine phosphorylation events for effective virus replication. Such cellular phosphorylation events triggered in the course of enterovirus infection may enhance virus replication. PMID:8985388

Huber, M; Selinka, H C; Kandolf, R

1997-01-01

6

Early Replication of Short Telomeres in Budding Yeast  

E-print Network

Early Replication of Short Telomeres in Budding Yeast Alessandro Bianchi1, * and David Shore1 1.bianchi@molbio.unige.ch DOI 10.1016/j.cell.2007.01.041 SUMMARY The maintenance of an appropriate number of telomere repeats by telomerase is essential for proper chromosome protection. The action of telomerase at the telomere terminus

Halazonetis, Thanos

7

Periodic mitotic events induced in the absence of DNA replication.  

PubMed

We have discovered and report here a means of separating a mitotic "subcycle" from the G1- and S-phase events of the mammalian cell cycle. Time-lapse videomicroscopy of Syrian hamster fibroblast (BHK) cells revealed that caffeine could induce multiple entries into mitosis while cells were blocked in DNA synthesis. As with normal mitoses, the abundance of mitosis-specific phosphoproteins was coupled with the condensation of chromatin. The BHK temperature-sensitive mutant tsBN2 also completed multiple entries into mitosis while arrested during DNA replication and raised to the restrictive temperature. Periodic mitotic events occurred even when BHK cells were exposed to low concentrations of serum or cycloheximide, conditions that prevent the cycling of BHK cells by blocking their entry into S phase. These results suggest that an oscillation governing the activation and inactivation of mitotic factors can be generated in mammalian cells and uncoupled from the G1 and DNA replication events of the normal cell cycle. This system will be useful for examining the molecular nature of mitotic factors. PMID:3480528

Schlegel, R; Pardee, A B

1987-12-01

8

Replisome stall events have shaped the distribution of replication origins in the genomes of yeasts  

E-print Network

Replisome stall events have shaped the distribution of replication origins in the genomes of yeasts due to the irreversible stalling of replication forks. We show that the probability of complete genome the probability of complete replication if replication forks stall. Origin positions in four other yeasts

Blow, J. Julian

9

Early intermediates in bacteriophage T4 DNA replication and recombination.  

PubMed Central

We investigated, by density gradients and subsequent electron microscopy, vegetative T4 DNA after single or multiple infection of Escherichia coli with wild-type T4. Our results can be summarized as follows. (i) After single infection (i.e., when early intermolecular recombination could not occur), most, if not all, T4 DNA molecules initiated the first round of replication with a single loop. (ii) After multiple infection, recombinational intermediates containing label from both parents first appeared as early as 1 min after the onset of replication, long before all parental DNA molecules had finished their first round and before secondary replication was detectable. (iii) At the same time, in multiple infections only, complex, highly branched concatemeric T4 DNA first appeared. (iv) Molecules in which two loops or several branches were arranged in tandem were only found after multiple infections. (v) Secondary loops within primary loops were seen after both single and multiple infections, but they were rare and many appeared off center. Thus, recombination in wild-type T4-infected cells occurred very early, and the generation of multiple tandem loops or branches in vegetative T4 DNA depended on recombination. These results are consistent with the previous finding (A. Luder and G. Mosig, Proc. Natl. Acad. Sci. U.S.A. 79:1101-1105, 1982) that most secondary growing points of T4 are not initiated from origin sequences but from recombinational intermediates. By these and previous results, the various DNA molecules that we observed are most readily explained as intermediates in DNA replication and recombination according to a model proposed earlier to explain various other aspects of T4 DNA metabolism (Mosig et al., p. 277-295, in D. Ray, ed., The Initiation of DNA Replication, Academic Press, Inc., New York, 1981). Images PMID:6834472

Dannenberg, R; Mosig, G

1983-01-01

10

Early events after aneurysmal subarachnoid hemorrhage.  

PubMed

The first 72 h after aneurysmal subarachnoid hemorrhage (SAH) is a critical period for the patient. Most of the deaths in the SAH patient population occur during this time, and a number of key events activate and trigger mechanisms that not only contribute to early brain injury but evolve over time and participate in the delayed complications. This review highlights the contribution of key events to the early brain injury and to overall outcome after SAH. PMID:25366594

Sehba, Fatima A; Friedrich, Victor

2015-01-01

11

The Problems of Replication in the Early Stages of Evolution: Enumeration of Variants and Spatial Configurations of Replicators  

NASA Astrophysics Data System (ADS)

Two main problems of replication in the early stages of evolution are discussed: the problem of exponentially large number of conformational degrees of freedom and the problem of enumeration of variants.

Melkikh, Alexey V.

2015-01-01

12

Early replication signals in nuclei of Chinese hamster ovary cells  

Microsoft Academic Search

DNA replication sites generally known as replicon domains were resolved as individual replication signals in interphase nuclei of permeabilized Chinese hamster ovary cells by immunofluorescent microscopy. Biotin-11-dUTP was utilized as a tool to label newly replicated DNA in permeable cells and to study the distribution of nascent DNA in pulselabel and in pulsechase experiments. Active sites of DNA replication were

G. Banfalvi; H. Tanke; A. K. Raap; J. Slats; M. van der Ploeg

1990-01-01

13

Mouse STAT2 Restricts Early Dengue Virus Replication  

PubMed Central

Summary Dengue virus encodes several interferon antagonists. Among these the NS5 protein binds STAT2, a necessary component of the type-I interferon signaling pathway, and targets it for degradation. We now demonstrate that the ability of dengue NS5 to associate with and degrade STAT2 is species specific. Thus, NS5 is able to bind and degrade human STAT2 but not mouse STAT2. This difference was exploited to demonstrate, absent manipulation of the viral genome, that NS5 mediated IFN antagonism is essential for efficient virus replication. Moreover, we demonstrate that differences in NS5 mediated binding and degradation between human and mouse STAT2 maps to a region within the STAT2 coiled-coil domain. By using STAT2?/? mice, we also demonstrate that mouse STAT2 restricts early dengue virus replication in vivo. These results suggest that overcoming this restriction through transgenic mouse technology may help in the development of a long-sought immune-competent mouse model of dengue virus infection. PMID:21075352

Ashour, Joseph; Morrison, Juliet; Laurent-Rolle, Maudry; Belicha-Villanueva, Alan; Plumlee, Courtney Ray; Bernal-Rubio, Dabeiba; Williams, Kate; Harris, Eva; Fernandez-Sesma, Ana; Schindler, Christian; García-Sastre, Adolfo

2012-01-01

14

A post-entry role for CD63 in early HIV-1 replication  

SciTech Connect

Macrophages and CD4{sup +} lymphocytes are the major reservoirs for HIV-1 infection. CD63 is a tetraspanin transmembrane protein, which has been shown to play an essential role during HIV-1 replication in macrophages. In this study, we further confirm the requirement of CD63 in early HIV-1 replication events in both macrophages and a CD4{sup +} cell line. Further analysis revealed that viral attachment and cell-cell fusion were unaffected by CD63 silencing. However, CD63-depleted macrophages showed a significant decrease in the initiation and completion of HIV-1 reverse transcription, affecting subsequent events of the HIV-1 life cycle. Integration of HIV-1 cDNA as well as the formation of 2-LTR circles was notably reduced. Reporter assays showed that CD63 down regulation reduced production of the early HIV protein Tat. In agreement, CD63 silencing also inhibited production of the late protein p24. These findings suggest that CD63 plays an early post-entry role prior to or at the reverse transcription step.

Li Guangyu; Dziuba, Natallia; Friedrich, Brian [Department of Internal Medicine, Division of Infectious Diseases, University of Texas Medical Branch, Galveston, TX 77555-0435 (United States); Murray, James L. [Zirus, Inc., 1384 Buford Business Boulevard, Suite 700, Buford, GA 30518 (United States); Ferguson, Monique R., E-mail: mrfergus@utmb.ed [Department of Internal Medicine, Division of Infectious Diseases, University of Texas Medical Branch, Galveston, TX 77555-0435 (United States)

2011-04-10

15

Changes in nucleosome repeat lengths precede replication in the early replicating metallothionein II gene region of cells synchronized in early S phase  

SciTech Connect

Previous investigations showed that inhibition of DNA synthesis by hydroxyurea, aphidicolin, or 5-fluorodeoxyuridine produced large changes in the composition and nucleosome repeat lengths of bulk chromatin. There the authors report results of investigations to determine whether the changes in nucleosome repeat lengths might be localized in the initiated replicons, as postulated. In most experiments, Chinese hamster (line CHO) cells were synchronized in G1, or they were synchronized in early S phase by allowing G1 cells to enter S phase in medium containing 1 mM hydroxyurea or 5 {mu}g mL{sup {minus}1} aphidicolin, a procedure believed to produce an accumulation of initiated replicons that arise from normally early replicating DNA. Measurements of nucleosome repeat lengths of bulk chromatin, the early replicating unexpressed metallothionein II (MTII) gene region, and a later replicating repeated sequence indicate that the changes in repeat lengths occur preferentially in the early replicating MTII gene region as G1 cells enter and become synchronized in early S phase. During that time, the MTII gene region is not replicated nor is there any evidence for induction of MTII messenger RNA. Thus, the results are consistent with the hypothesis that changes in chromatin structure occur preferentially in the early replicating (presumably initiated) replicons at initiation or that changes in chromatin structure can precede replication during inhibition of DNA synthesis. The shortened repeat lengths that precede MTII replication are, potentially, reversible, because they become elongated when the synchronized early S-phase cells are released to resume cell cycle progression.

D'Anna, J.A.; Tobey, R.A. (Los Alamos National Lab., NM (USA))

1989-04-04

16

Early Events in Ionic Liquid Radiation Chemistry  

SciTech Connect

Ionic liquids are interesting and useful materials whose solvation time scales are up to thousands of times longer than in conventional solvents. The extended lifetimes of pre-solvated electrons and other energetic species in ionic liquids has profound consequences for the radiolytic product distributions and reactivity patterns. We use a newly developed, multiplexed variation of pulse-probe spectroscopy to measure the kinetics of the early dynamical and reactive events in ionic liquids.

Wishart, J.F.; Cook, A.; Rimmer, R.D.; Gohdo, M.

2010-09-14

17

Dynamics of DNA Replication during Premeiosis and Early Meiosis in Wheat  

PubMed Central

Meiosis is a specialised cell division that involves chromosome replication, two rounds of chromosome segregation and results in the formation of the gametes. Meiotic DNA replication generally precedes chromosome pairing, recombination and synapsis in sexually developing eukaryotes. In this work, replication has been studied during premeiosis and early meiosis in wheat using flow cytometry, which has allowed the quantification of the amount of DNA in wheat anther in each phase of the cell cycle during premeiosis and each stage of early meiosis. Flow cytometry has been revealed as a suitable and user-friendly tool to detect and quantify DNA replication during early meiosis in wheat. Chromosome replication was detected in wheat during premeiosis and early meiosis until the stage of pachytene, when chromosomes are associated in pairs to further recombine and correctly segregate in the gametes. In addition, the effect of the Ph1 locus, which controls chromosome pairing and affects replication in wheat, was also studied by flow cytometry. Here we showed that the Ph1 locus plays an important role on the length of meiotic DNA replication in wheat, particularly affecting the rate of replication during early meiosis in wheat. PMID:25275307

Rey, María-Dolores; Prieto, Pilar

2014-01-01

18

Early events in axon/dendrite polarization.  

PubMed

Differentiation of axons and dendrites is a critical step in neuronal development. Here we review the evidence that axon/dendrite formation during neuronal polarization depends on the intrinsic cytoplasmic asymmetry inherited by the postmitotic neuron, the exposure of the neuron to extracellular chemical factors, and the action of anisotropic mechanical forces imposed by the environment. To better delineate the functions of early signals among a myriad of cellular components that were shown to influence axon/dendrite formation, we discuss their functions by distinguishing their roles as determinants, mediators, or modulators and consider selective degradation of these components as a potential mechanism for axon/dendrite polarization. Finally, we examine whether these early events of axon/dendrite formation involve local autocatalytic activation and long-range inhibition, as postulated by Alan Turing for the morphogenesis of patterned biological structure. PMID:22715881

Cheng, Pei-lin; Poo, Mu-ming

2012-01-01

19

Unraveling the early steps of prokaryotic replication Erin L Cunningham and James M Berger  

E-print Network

Unraveling the early steps of prokaryotic replication Erin L Cunningham and James M Berger In prokaryotes, many of the physical mechanisms governing the process of initiating DNA replication are now studies have shown that prokaryotic initiator structures are both modular and conserved, and have begun

Berger, James M.

20

Dynamics of the Genome during Early Xenopus laevis Development: Karyomeres As Independent Units of Replication  

Microsoft Academic Search

During Xenopus laevis early development, the genome is replicated in less than 15 min every 30 min. We show that during this period, DNA replication proceeds in an atypical manner. Chromosomes become surrounded by a nuclear membrane lamina forming mi- cronuclei or karyomeres. This genomic organization permits that prereplication centers gather on con- densed chromosomes during anaphase and that DNA

Jean-Marc Lemaitre; Gérard Géraud; Marcel Méchali

1998-01-01

21

Replicating Successful Early Intervention in Rural Areas: Model Program Description.  

ERIC Educational Resources Information Center

This paper describes a project to train service providers in replicating the Home Activity Program for Parents and Youngsters (HAPPY). HAPPY is a family-focused program developed to meet the educational needs of disabled children ages birth through 5 years in rural Nevada. Content of the training modules was developed from a review of literature…

Johnson, JoAnn; Whipple, Wendy

22

Essentiality of the Early Transcript in the Replication Origin of the Lactococcal Prolate Phage c2†  

PubMed Central

The genome of the prolate-headed lytic lactococcal bacteriophage c2 is organized into two divergently oriented blocks consisting of the early genes and the late genes. These blocks are separated by the noncoding origin of DNA replication. We examined the functional role of transcription of the origin in a plasmid model system. Deletion of the early promoter PE1 abolished origin function. Introduction of mutations into PE1 which did not eliminate promoter activity or replacement of PE1 with an unrelated but functional promoter did not abolish replication. The A-T-rich region upstream of PE1, which is conserved in prolate phages, was not required for plasmid replication. Replacement of the PE1 transcript template sequence with an unrelated sequence with a similar G+C content abolished replication, showing that the sequence encoding the transcript is essential for origin function. Truncated transcript and internal deletion constructs did not support replication except when the deletion was at the very 3? end of the DNA sequence coding for the transcript. The PE1 transcript could be detected for all replication-proficient constructs. Recloning in a plasmid vector allowed detection of PE1 transcripts from some fragments that did not support replication, indicating that stability of the transcript alone was not sufficient for replication. The data suggest that production of a transcript of a specific length and with a specific sequence or structure is essential for the function of the phage c2 origin in this model system. PMID:15547273

Schiemann, Anja H.; Rakonjac, Jasna; Callanan, Michael; Gordon, James; Polzin, Kayla; Lubbers, Mark W.; O'Toole, Paul W.

2004-01-01

23

Spatial distributions of early and late replicating chromatin in interphase chromosome territories.  

PubMed

The surface area of chromosome territories has been suggested as a preferred site for genes, specific RNAs, and accumulations of splicing factors. Here, we investigated the localization of sites of replication within individual chromosome territories. In vivo replication labeling with thymidine analogues IdUrd and CldUrd was combined with chromosome painting by fluorescent in situ hybridization on three-dimensionally preserved human fibroblast nuclei. Spatial distributions of replication labels over the chromosome territory, as well as the territory volume and shape, were determined by 3D image analysis. During late S-phase a previously observed shape difference between the active and inactive X-chromosome in female cells was maintained, while the volumes of the two territories did not differ significantly. Domains containing early or mid to late replicating chromatin were distributed throughout territories of chromome 8 and the active X. In the inactive X-chromosome early replicating chromatin was observed preferentially near the territory surface. Most important, we established that the process of replication takes place in foci throughout the entire chromosome territory volume, in early as well as in late S-phase. This demonstrates that activity of macromolecular enzyme complexes takes place throughout chromosome territories and is not confined to the territory surface as suggested previously. PMID:9743599

Visser, A E; Eils, R; Jauch, A; Little, G; Bakker, P J; Cremer, T; Aten, J A

1998-09-15

24

High-resolution dating of Early Aptian Oceanic Anoxic Events  

NASA Astrophysics Data System (ADS)

Ammonoid biostratigraphy is the most accurate relative dating method that exists for the Aptian. It divides the Early Aptian into four zones, for comparison, planktonic foraminifera and calcareous nannofossil biozonations only divide this substage into two zones (Fig. 1). In the study of the Early Aptian Oceanic Anoxic Event 1a (OAE 1a), the most commonly used biostratigraphy to calibrate its age has been the planktonic foraminifera biozonation. This anoxic event, also known as Livello Selli, was initially believed to be the only oceanic anoxic event that occurred within the Early Aptian. From our own and other published data, we recognized that more than one oceanic anoxic event took place within the Early Aptian. Our purpose is to clearly characterize and date these events using the ammonite biozonation. Four years ago, a second oceanic anoxic event of uppermost Early Aptian age, the Aparein level, was identified in the Basque Cantabrian Basin, in Spain. The age of this event was calibrated using ammonites. More recently, the Aparein level was pinpointed by us in northern Mexico. A potential third oceanic anoxic event was recognized, around fifteen years ago in the section of La Bédoule, in France. The onset of this possible event would correspond to a negative carbon-isotope excursion in the uppermost Late Barremian-lowermost Early Aptian. The latter hypothesis remains un-worked and only some authors have recently started to use the term pre-Selli in reference to this event. The ammonite zonation is precise enough to clearly differentiate these three Early Aptian oceanic anoxic events (Fig. 1). The pre-Selli event, began in the uppermost Late Barremian and ended in the lower part of the Deshayesites oglanlensis Zone. The OAE 1a occurred within the Roloboceras hambrovi Subzone. The Aparein level was coeval with the Dufrenoyia dufrenoyi Subzone.; Figure 1: Chronological position of the known Early Aptian oceanic anoxic events against ammonite, planktonic foraminifera and calcareous nannofossil biozonations.

Moreno-Bedmar, J.; Bover-Arnal, T.; Barragan-Manzo, R.; Company, M.; Nuñez, F.

2013-05-01

25

Essentiality of the early transcript in the replication origin of the lactococcal prolate phage c2.  

PubMed

The genome of the prolate-headed lytic lactococcal bacteriophage c2 is organized into two divergently oriented blocks consisting of the early genes and the late genes. These blocks are separated by the noncoding origin of DNA replication. We examined the functional role of transcription of the origin in a plasmid model system. Deletion of the early promoter P(E)1 abolished origin function. Introduction of mutations into P(E)1 which did not eliminate promoter activity or replacement of P(E)1 with an unrelated but functional promoter did not abolish replication. The A-T-rich region upstream of P(E)1, which is conserved in prolate phages, was not required for plasmid replication. Replacement of the P(E)1 transcript template sequence with an unrelated sequence with a similar G+C content abolished replication, showing that the sequence encoding the transcript is essential for origin function. Truncated transcript and internal deletion constructs did not support replication except when the deletion was at the very 3' end of the DNA sequence coding for the transcript. The P(E)1 transcript could be detected for all replication-proficient constructs. Recloning in a plasmid vector allowed detection of P(E)1 transcripts from some fragments that did not support replication, indicating that stability of the transcript alone was not sufficient for replication. The data suggest that production of a transcript of a specific length and with a specific sequence or structure is essential for the function of the phage c2 origin in this model system. PMID:15547273

Schiemann, Anja H; Rakonjac, Jasna; Callanan, Michael; Gordon, James; Polzin, Kayla; Lubbers, Mark W; O'Toole, Paul W

2004-12-01

26

First Step to Success: Replication and Social Validation of an Early Intervention Program.  

ERIC Educational Resources Information Center

Two studies found that the "First Step to Success" early-intervention program for at-risk kindergartners could be replicated successfully, that educators who participated in the First Step training sessions rated the quality of the training highly, and that about half of those trained actually went on to implement the program. (Author/CR)

Golly, Annemieke M.; Stiller, Bruce; Walker, Hill M.

1998-01-01

27

DNA breaks early in replication process associated with B cell cancers  

Cancer.gov

Research by scientists at the NCI has identified a new class of DNA sites in cells that break early in the replication process. They found that these break sites correlate with damage often seen in B cell cancers, such as diffuse large B cell lymphoma.

28

Ubc9- and mms21-mediated sumoylation counteracts recombinogenic events at damaged replication forks.  

PubMed

The Ubc9 SUMO-conjugating enzyme and the Siz1 SUMO ligase sumoylate several repair and recombination proteins, including PCNA. Sumoylated PCNA binds Srs2, a helicase counteracting certain recombination events. Here we show that ubc9 mutants depend on checkpoint, recombination, and replication genes for growth. ubc9 cells maintain stalled-fork stability but exhibit a Rad51-dependent accumulation of cruciform structures during replication of damaged templates. Mutations in the Mms21 SUMO ligase resemble the ubc9 mutations. However, siz1, srs2, or pcna mutants altered in sumoylation do not exhibit the ubc9/mms21 phenotype. Like ubc9/mms21 mutants, sgs1 and top3 mutants also accumulate X molecules at damaged forks, and Sgs1/BLM is sumoylated. We propose that Ubc9 and Mms21 act in concert with Sgs1 to resolve the X structures formed during replication. Our results indicate that Ubc9- and Mms21-mediated sumoylation functions as a regulatory mechanism, different from that of replication checkpoints, to prevent pathological accumulation of cruciform structures at damaged forks. PMID:17081974

Branzei, Dana; Sollier, Julie; Liberi, Giordano; Zhao, Xiaolan; Maeda, Daisuke; Seki, Masayuki; Enomoto, Takemi; Ohta, Kunihiro; Foiani, Marco

2006-11-01

29

PAR-4/LKB1 regulates DNA replication during asynchronous division of the early C. elegans embryo  

PubMed Central

Regulation of cell cycle duration is critical during development, yet the underlying molecular mechanisms are still poorly understood. The two-cell stage Caenorhabditis elegans embryo divides asynchronously and thus provides a powerful context in which to study regulation of cell cycle timing during development. Using genetic analysis and high-resolution imaging, we found that deoxyribonucleic acid (DNA) replication is asymmetrically regulated in the two-cell stage embryo and that the PAR-4 and PAR-1 polarity proteins dampen DNA replication dynamics specifically in the posterior blastomere, independently of regulators previously implicated in the control of cell cycle timing. Our results demonstrate that accurate control of DNA replication is crucial during C. elegans early embryonic development and further provide a novel mechanism by which PAR proteins control cell cycle progression during asynchronous cell division. PMID:24841566

Descoteaux, Catherine; Chartier, Nicolas T.; Pintard, Lionel; Labbé, Jean-Claude

2014-01-01

30

DNA replication origin interference increases the spacing between initiation events in human cells.  

PubMed

Mammalian DNA replication origins localize to sites that range from base pairs to tens of kilobases. A regular distribution of initiations in individual cell cycles suggests that only a limited number of these numerous potential start sites are converted into activated origins. Origin interference can silence redundant origins; however, it is currently unknown whether interference participates in spacing functional human initiation events. By using a novel hybridization strategy, genomic Morse code, on single combed DNA molecules from primary keratinocytes, we report the initiation sites present on 1.5 Mb of human chromosome 14q11.2. We confirm that initiation zones are widespread in human cells, map to intergenic regions, and contain sequence motifs found at other mammalian initiation zones. Origins used per cell cycle are less abundant than the potential sites of initiation, and their limited use increases the spacing between initiation events. Between-zone interference decreases in proportion to the distance from the active origin, whereas within-zone interference is 100% efficient. These results identify a hierarchical organization of origin activity in human cells. Functional origins govern the probability that nearby origins will fire in the context of multiple potential start sites of DNA replication, and this is mediated by origin interference. PMID:17005913

Lebofsky, Ronald; Heilig, Roland; Sonnleitner, Max; Weissenbach, Jean; Bensimon, Aaron

2006-12-01

31

Alpha interferon inhibits early stages of the human immunodeficiency virus type 1 replication cycle.  

PubMed Central

In this study, we have analyzed the effect of human alpha interferon (IFN-alpha) on a single replication cycle of human immunodeficiency virus type 1 (HIV-1) infection in the lymphocytic cell line CEM-174, which is highly sensitive to the antiviral effects of IFN. Pretreatment of cells with 50 to 500 U of recombinant human IFN-alpha per ml resulted in a marked reduction in viral RNA and protein synthesis. The effect of IFN-alpha was dose dependent and was amplified in multiple infection cycles. IFN-induced inhibition of viral protein synthesis could be detected only when cells were treated with IFN-alpha prior to infection or when IFN-alpha was added up to 10 h postinfection, but not if IFN-alpha was added at the later stages of HIV-1 replication cycle or after the HIV-1 infection was already established. Analysis of the integrated HIV-1 provirus showed a marked decrease in the levels of proviral DNA in IFN-treated cells. Thus, in contrast to the previous studies on established HIV-1 infection in T cells, in which the IFN block appeared to be at the posttranslational level, during de novo infection, IFN-alpha interferes with an early step of HIV-1 replication cycle that occurs prior to the integration of the proviral DNA. These results indicate that the early IFN block of HIV-1 replication, which has been previously observed only in primary marcophages, can also be detected in the IFN-sensitive T cells, indicating that the early IFN block is not limited to macrophages. Images PMID:1738192

Shirazi, Y; Pitha, P M

1992-01-01

32

The hyperactive X chromosome is not early replicating in mitotically active somatic cells of Drosophila nasuta males.  

PubMed

The temporal order of replication of the X chromosome(s) in mitotically dividing male and female cells in early embryos and in brain ganglia of Drosophila nasuta larvae was examined using [3H]thymidine pulse labelling and autoradiography. Both the X chromosomes in female cells and the single X chromosome in male cells replicated in complete synchrony with the autosome set in the nucleus. Thus, unlike the well-known early completion of replication by the hemizygous X chromosome in polytene nuclei in the salivary glands of male Drosophila larvae, the single X chromosome in mitotically dividing cells does not replicate earlier than the autosomes. We conclude that transcriptional hyperactivity of the single X chromosome required for dosage compensation in somatic cells of male Drosophila is not dependent upon its early replication. PMID:7729678

Lakhotia, S C; Roy, J K

1995-02-01

33

Autophagy during early stages contributes to bovine viral diarrhea virus replication in MDBK cells.  

PubMed

Autophagy (or autophagocytosis) is an essential and precise control process by which cells degrade unnecessary or dysfunctional cellular components or organelles in the cytoplasm in response to nutrient depletion, exogenous pathogens, or other stimuli. This process results in the removal of damaged or surplus organelles and macromolecular complexes via a lysosome-dependent mechanism. Bovine viral diarrhea virus (BVDV) is a ssRNA virus of the Flaviviridae family (genus Pestivirus). BVDV infection results in major economic losses due to poor reproductive performance and poor calf performance in cattle herds. In our previous studies, we have shown that BVDV NADL infection significantly increases autophagy in MDBK cells. To further define the interactions between autophagy and BVDV infection, we investigated the effects of autophagy on the replication of BVDV NADL. The findings showed that autophagy was inhibited by treatment with 3-methyladenine (3-MA) or wortmannin and that the knockdown of LC3 and Beclin1 using lentivirus-mediated RNA interference (RNAi) suppressed BVDV NADL replication. In contrast, the findings showed the replication of BVDV NADL was significantly increased by treatment with the autophagy inducer rapamycin within 18?h post-infection (pi). However, the mRNA levels of BVDV NADL 5'UTRs showed a downward trend after 18?h pi, and this effect was reversed by chloroquine treatment. Therefore, we inferred that infection with BVDV NADL increases autophagy, which in turn favors BVDV NADL replication at early stages. PMID:24347372

Fu, Qiang; Shi, Huijun; Zhang, Hui; Ren, Yan; Guo, Fei; Qiao, Jun; Jia, Bin; Wang, Pengyan; Chen, Chuangfu

2014-10-01

34

Abnormal Early Cleavage Events Predict Early Embryo Demise: Sperm Oxidative Stress and Early Abnormal Cleavage  

PubMed Central

Human embryos resulting from abnormal early cleavage can result in aneuploidy and failure to develop normally to the blastocyst stage. The nature of paternal influence on early embryo development has not been directly demonstrated although many studies have suggested effects from spermatozoal chromatin packaging, DNA damage, centriolar and mitotic spindle integrity, and plasma membrane integrity. The goal of this study was to determine whether early developmental events were affected by oxidative damage to the fertilizing sperm. Survival analysis was used to compare patterns of blastocyst formation based on P2 duration. Kaplan-Meier survival curves demonstrate that relatively few embryos with short (<1?hr) P2 times reached blastocysts, and the two curves diverged beginning on day 4, with nearly all of the embryos with longer P2 times reaching blastocysts by day 6 (p < .01). We determined that duration of the 2nd to 3rd mitoses were sensitive periods in the presence of spermatozoal oxidative stress. Embryos that displayed either too long or too short cytokineses demonstrated an increased failure to reach blastocyst stage and therefore survive for further development. Although paternal-derived gene expression occurs later in development, this study suggests a specific role in early mitosis that is highly influenced by paternal factors. PMID:25307782

Burruel, Victoria; Klooster, Katie; Barker, Christopher M.; Pera, Renee Reijo; Meyers, Stuart

2014-01-01

35

miRNA regulation of BK polyomavirus replication during early infection  

PubMed Central

Viral microRNAs (miRNAs) play an important role during infection by posttranscriptionally regulating both host and viral gene expression. However, the function of many viral miRNAs remains poorly understood. In this study, we investigated the role of the BK polyomavirus (BKPyV) miRNA in regulating virus replication. The function of the polyomavirus miRNA was investigated in archetype BKPyV, which is the transmissible form of the virus and thought to establish a persistent infection in the host urinary tract. In agreement with previous studies, we show that the BKPyV miRNA targets early mRNAs. Importantly, we show that the miRNA plays a significant role in limiting archetype BKPyV replication in a natural host cell model of infection. This regulation is accomplished through the balance of regulatory elements located within the noncoding control region that control early gene expression and miRNA expression before genome replication. We therefore provide evidence for a unique function of the polyomavirus miRNA that may have important implications for the mechanism of viral persistence. PMID:23630296

Broekema, Nicole M.; Imperiale, Michael J.

2013-01-01

36

DNA Replication  

NSDL National Science Digital Library

This animation, which shows DNA replication and the interactions of the various enzymes, can be used to illustrate to students the order of events in DNA replication, as well as emphasize which enzymes are involved in the process.

American Society For Microbiology;

2002-01-01

37

The Hemagglutinin Protein of Highly Pathogenic H5N1 Influenza Viruses Overcomes an Early Block in the Replication Cycle To Promote Productive Replication in Macrophages  

PubMed Central

Macrophages are known to be one of the first lines of defense against influenza virus infection. However, they may also contribute to severe disease caused by the highly pathogenic avian (HPAI) H5N1 influenza viruses. One reason for this may be the ability of certain influenza virus strains to productively replicate in macrophages. However, studies investigating the productive replication of influenza viruses in macrophages have been contradictory, and the results may depend on both the type of macrophages used and the specific viral strain. In this work, we investigated the ability of H1 to H16 viruses to productively replicate in primary murine alveolar macrophages and RAW264.7 macrophages. We show that only a subset of HPAI H5N1 viruses, those that cause high morbidity and mortality in mammals, can productively replicate in macrophages, as measured by the release of newly synthesized virus particles into the cell supernatant. Mechanistically, we found that these H5 strains can overcome a block early in the viral life cycle leading to efficient nuclear entry, viral transcription, translation, and ultimately replication. Studies with reassortant viruses demonstrated that expression of the hemagglutinin gene from an H5N1 virus rescued replication of H1N1 influenza virus in macrophages. This study is the first to characterize H5N1 influenza viruses as the only subtype of influenza virus capable of productive replication in macrophages and establishes the viral gene that is required for this characteristic. The ability to productively replicate in macrophages is unique to H5N1 influenza viruses and may contribute to their increased pathogenesis. PMID:23152519

Cline, Troy D.; Karlsson, Erik A.; Seufzer, Bradley J.

2013-01-01

38

Characteristics of early, long recovery VLF scattering events  

NASA Astrophysics Data System (ADS)

Experimental observations of early, long recovery VLF events (LOREs) and their causative radio atmospherics (sferics) are analyzed -- 49 events are presented, including over-sea and over-land events. We demonstrate that the phasor addition of ambient and scattered VLF fields may lead to amplitude and phase changes that have different perturbation characteristics (onset duration, recovery time, etc.), and conclude that VLF perturbations are best categorized by their associated normalized scattered field phasor. Additionally, we present observations which demonstrate that normalized scattered field characteristics can depend upon the receiving antenna orientation.

Kotovsky, D. A.; Moore, R. C.

2013-12-01

39

Hepatitis C Virus entry: the early steps in the viral replication cycle  

PubMed Central

Approximately 170 million are infected with the hepatitis C virus (HCV) world wide and an estimated 2.7 million are HCV RNA positive in the United States alone. The acute phase of the HCV infection, in majority of individuals, is asymptomatic. A large percentage of those infected with HCV are unable to clear the virus and become chronically infected. The study of the HCV replication cycle was hampered due to difficulties in growing and propagating the virus in an in vitro setting. The advent of the HCV pseudo particle (HCVpp) and HCV cell culture (HCVcc) systems have made possible the study of the HCV replication cycle, in vitro. Studies utilizing the HCVpp and HCVcc systems have increased our insight into the early steps of the viral replication cycle of HCV, such as the identification of cellular co-receptors for binding and entry. The aim of this article is to provide a review of the outstanding literature on HCV entry, specifically looking at cellular co-receptors involved and putting the data in the context of the systems used (purified viral envelope proteins, HCVpp system, HCVcc system and/or patient sera) and to also give a brief description of the cellular co-receptors themselves. PMID:19643019

Sabahi, Ali

2009-01-01

40

Analyses of Phosphorylation Events in the Rubella Virus Capsid Protein: Role in Early Replication Events  

Microsoft Academic Search

The Rubella virus capsid protein is phosphorylated prior to virus assembly. Our previous data are consistent with a model in which dynamic phosphorylation of the capsid regulates its RNA binding activity and, in turn, nucleocapsid assembly. In the present study, the process of capsid phosphorylation was examined in further detail. We show that phosphorylation of serine 46 in the RNA

LokMan J. Law; Carolina S. Ilkow; Wen-Pin Tzeng; Matthew Rawluk; David T. Stuart; Teryl K. Frey; Tom C. Hobman

2006-01-01

41

Early Events in Protein Folding Explored by Rapid Mixing Methods  

E-print Network

15 Early Events in Protein Folding Explored by Rapid Mixing Methods Heinrich Roder, Kosuke Maki for Understanding Protein Folding As with any complex reaction, time-resolved data are essential for elucidating the mechanism of protein folding. Even in cases where the whole process of folding occurs in a single step

Roder, Heinrich

42

Yatein from Chamaecyparis obtusa suppresses herpes simplex virus type 1 replication in HeLa cells by interruption the immediate-early gene expression.  

PubMed

Inhibitory effects of methanolic extracts from nine Chinese herbs on herpes simplex virus type 1 (HSV-1) replication were studied. By a bioassay-guided fractionation procedure, yatein (C(22)H(23)O(7); M.W.399) was isolated from Chamaecyparis obtusa; yatein significantly suppressed HSV-1 multiplication in HeLa cells without apparent cytotoxicity. To further localize the point in the HSV-1 replication cycle where arrest occurred, a set of key regulatory events leading to the viral multiplication was examined, including viral immediate-early (alpha) and late (gamma) gene expression and DNA replication. Results indicated that levels of glycoprotein B (gB) and gC mRNA expression in HeLa cells were impeded by yatein. Data from polymerase chain reaction showed that replication of HSV-1 DNA in HeLa cells was arrested by yatein. Furthermore, yatein decreased ICP0 and ICP4 gene expression in HeLa cells. Results of an electrophoretic mobility shift assay demonstrated that yatein interrupted the formation of alpha-trans-induction factor/C1/Oct-1/GARAT multiprotein complex. The mechanisms of antiviral action of yatein seem to be mediated, by inhibiting HSV-1 alpha gene expression, including expression of the ICP0 and ICP4 genes, and by arresting HSV-1 DNA synthesis and structural protein expression in HeLa cells. These results suggest that yatein is an antiviral agent against HSV-1 replication. PMID:16540181

Kuo, Yuh-Chi; Kuo, Yueh-Hsiung; Lin, Yuang-Lian; Tsai, Wei-Jern

2006-07-01

43

Initiation of simian virus 40 DNA replication in vitro: aphidicolin causes accumulation of early-replicating intermediates and allows determination of the initial direction of DNA synthesis.  

PubMed

Aphidicolin, a specific inhibitor of DNA polymerase alpha, provided a novel method for distinguishing between initiation of DNA synthesis at the simian virus 40 (SV40) origin of replication (ori) and continuation of replication beyond ori. In the presence of sufficient aphidicolin to inhibit total DNA synthesis by 50%, initiation of DNA replication in SV40 chromosomes or ori-containing plasmids continued in vitro, whereas DNA synthesis in the bulk of SV40 replicative intermediate DNA (RI) that had initiated replication in vivo was rapidly inhibited. This resulted in accumulation of early RI in which most nascent DNA was localized within a 600- to 700-base-pair region centered at ori. Accumulation of early RI was observed only under conditions that permitted initiation of SV40 ori-dependent, T-antigen-dependent DNA replication and only when aphidicolin was added to the in vitro system. Increasing aphidicolin concentrations revealed that DNA synthesis in the ori region was not completely resistant to aphidicolin but simply less sensitive than DNA synthesis at forks that were farther away. Since DNA synthesized in the presence of aphidicolin was concentrated in the 300 base pairs on the early gene side of ori, we conclude that the initial direction of DNA synthesis was the same as that of early mRNA synthesis, consistent with the model proposed by Hay and DePamphilis (Cell 28:767-779, 1982). The data were also consistent with initiation of the first DNA chains in ori by CV-1 cell DNA primase-DNA polymerase alpha. Synthesis of pppA/G(pN)6-8(pdN)21-23 chains on a single-stranded DNA template by a purified preparation of this enzyme was completely resistant to aphidicolin, and further incorporation of deoxynucleotide monophosphates was inhibited. Therefore, in the presence of aphidicolin, this enzyme could initiate RNA-primed DNA synthesis at ori first in the early gene direction and then in the late gene direction, but could not continue DNA synthesis for an extended distance. PMID:3025613

Decker, R S; Yamaguchi, M; Possenti, R; DePamphilis, M L

1986-11-01

44

Initiation of simian virus 40 DNA replication in vitro: aphidicolin causes accumulation of early-replicating intermediates and allows determination of the initial direction of DNA synthesis.  

PubMed Central

Aphidicolin, a specific inhibitor of DNA polymerase alpha, provided a novel method for distinguishing between initiation of DNA synthesis at the simian virus 40 (SV40) origin of replication (ori) and continuation of replication beyond ori. In the presence of sufficient aphidicolin to inhibit total DNA synthesis by 50%, initiation of DNA replication in SV40 chromosomes or ori-containing plasmids continued in vitro, whereas DNA synthesis in the bulk of SV40 replicative intermediate DNA (RI) that had initiated replication in vivo was rapidly inhibited. This resulted in accumulation of early RI in which most nascent DNA was localized within a 600- to 700-base-pair region centered at ori. Accumulation of early RI was observed only under conditions that permitted initiation of SV40 ori-dependent, T-antigen-dependent DNA replication and only when aphidicolin was added to the in vitro system. Increasing aphidicolin concentrations revealed that DNA synthesis in the ori region was not completely resistant to aphidicolin but simply less sensitive than DNA synthesis at forks that were farther away. Since DNA synthesized in the presence of aphidicolin was concentrated in the 300 base pairs on the early gene side of ori, we conclude that the initial direction of DNA synthesis was the same as that of early mRNA synthesis, consistent with the model proposed by Hay and DePamphilis (Cell 28:767-779, 1982). The data were also consistent with initiation of the first DNA chains in ori by CV-1 cell DNA primase-DNA polymerase alpha. Synthesis of pppA/G(pN)6-8(pdN)21-23 chains on a single-stranded DNA template by a purified preparation of this enzyme was completely resistant to aphidicolin, and further incorporation of deoxynucleotide monophosphates was inhibited. Therefore, in the presence of aphidicolin, this enzyme could initiate RNA-primed DNA synthesis at ori first in the early gene direction and then in the late gene direction, but could not continue DNA synthesis for an extended distance. Images PMID:3025613

Decker, R S; Yamaguchi, M; Possenti, R; DePamphilis, M L

1986-01-01

45

Replisome stall events have shaped the distribution of replication origins in the genomes of yeasts  

PubMed Central

During S phase, the entire genome must be precisely duplicated, with no sections of DNA left unreplicated. Here, we develop a simple mathematical model to describe the probability of replication failing due to the irreversible stalling of replication forks. We show that the probability of complete genome replication is maximized if replication origins are evenly spaced, the largest inter-origin distances are minimized, and the end-most origins are positioned close to chromosome ends. We show that origin positions in the yeast Saccharomyces cerevisiae genome conform to all three predictions thereby maximizing the probability of complete replication if replication forks stall. Origin positions in four other yeasts—Kluyveromyces lactis, Lachancea kluyveri, Lachancea waltii and Schizosaccharomyces pombe—also conform to these predictions. Equating failure rates at chromosome ends with those in chromosome interiors gives a mean per nucleotide fork stall rate of ?5 × 10?8, which is consistent with experimental estimates. Using this value in our theoretical predictions gives replication failure rates that are consistent with data from replication origin knockout experiments. Our theory also predicts that significantly larger genomes, such as those of mammals, will experience a much greater probability of replication failure genome-wide, and therefore will likely require additional compensatory mechanisms. PMID:23963700

Newman, Timothy J.; Mamun, Mohammed A.; Nieduszynski, Conrad A.; Blow, J. Julian

2013-01-01

46

Human Cytomegalovirus Replicates Abortively in Polymorphonuclear Leukocytes after Transfer from Infected Endothelial Cells via Transient Microfusion Events  

PubMed Central

Using a recently developed model for in vitro generation of pp65-positive polymorphonuclear leukocytes (PMNLs), we demonstrated that PMNLs from immunocompetent subjects may harbor both infectious human cytomegalovirus (HCMV) and viral products (pp65, p72, DNA, and immediate-early [IE] and pp67 late mRNAs) as early as 60 min after coculture with human umbilical vein endothelial cells (HUVEC) or human embryonic lung fibroblasts (HELF) infected with a clinical HCMV isolate (VR6110) or other wild-type strains. The number of PMNLs positive for each viral parameter increased with coculture time. Using HELF infected with laboratory-adapted HCMV strains, only very small amounts of viral DNA and IE and late mRNAs were detected in PMNLs. A cellular mRNA, the vascular cell adhesion molecule-1 mRNA, which is abundantly present in both infected and uninfected HUVEC, was detected in much larger amounts in PMNLs cocultured with VR6110-infected cells than in controls. Coculture of PMNLs with VR6110-infected permissive cells in the presence or absence of RNA, protein, and viral DNA synthesis inhibitors showed that only IE genes were transcribed in PMNLs during coculture. Synthesis of IE transcripts in PMNLs was also supported by the finding that only the copy number of IE mRNA (and not the DNA or the pp67 mRNA) per infected PMNL increased markedly with time, and the pp67 to IE mRNA copy number ratio changed from greater than 10 in infected HUVEC to less than 1 in cocultured PMNLs. Fluorescent probe transfer experiments and electron microscopy studies indicated that transfer of infectious virus and viral products from infected cells to PMNLs is likely to be mediated by microfusion events induced by wild-type strains only. In addition, HCMV pp65 and p72 were both shown to localize in the nucleus of the same PMNLs by double immunostaining. Two different mechanisms may explain the virus presence in PMNLs: (i) one major mechanism consists of transitory microfusion events (induced by wild-type strains only) of HUVEC or HELF and PMNLs with transfer of viable virus and biologically active viral material to PMNLs; and (ii) one minor mechanism, i.e., endocytosis, occurs with both wild-type and laboratory strains and leads to the acquisition of very small amounts of viral nucleic acids. In conclusion, HCMV replicates abortively in PMNLs, and wild-type strains and their products (as well as cellular metabolites and fluorescent dyes) are transferred to PMNLs, thus providing evidence for a potential mechanism of HCMV dissemination in vivo. PMID:10823870

Gerna, Giuseppe; Percivalle, Elena; Baldanti, Fausto; Sozzani, Silvano; Lanzarini, Paolo; Genini, Emilia; Lilleri, Daniele; Revello, Maria Grazia

2000-01-01

47

Early microbial translocation blockade reduces SIV-mediated inflammation and viral replication  

PubMed Central

Damage to the intestinal mucosa results in the translocation of microbes from the intestinal lumen into the circulation. Microbial translocation has been proposed to trigger immune activation, inflammation, and coagulopathy, all of which are key factors that drive HIV disease progression and non-HIV comorbidities; however, direct proof of a causal link is still lacking. Here, we have demonstrated that treatment of acutely SIV-infected pigtailed macaques with the drug sevelamer, which binds microbial lipopolysaccharide in the gut, dramatically reduces immune activation and inflammation and slightly reduces viral replication. Furthermore, sevelamer administration reduced coagulation biomarkers, confirming the contribution of microbial translocation in the development of cardiovascular comorbidities in SIV-infected nonhuman primates. Together, our data suggest that early control of microbial translocation may improve the outcome of HIV infection and limit noninfectious comorbidities associated with AIDS. PMID:24837437

Kristoff, Jan; Haret-Richter, George; Ma, Dongzhu; Ribeiro, Ruy M.; Xu, Cuiling; Cornell, Elaine; Stock, Jennifer L.; He, Tianyu; Mobley, Adam D.; Ross, Samantha; Trichel, Anita; Wilson, Cara; Tracy, Russell; Landay, Alan; Apetrei, Cristian; Pandrea, Ivona

2014-01-01

48

Changes in transcription and metabolism during the early stage of replicative cellular senescence in budding yeast.  

PubMed

Age-related damage accumulates and a variety of biological activities and functions deteriorate in senescent cells. However, little is known about when cellular aging behaviors begin and what cellular aging processes change. Previous research demonstrated age-related mRNA changes in budding yeast by the 18th to 20th generation, which is the average replicative lifespan of yeast (i.e. about half of the population is dead by this time point). Here, we performed transcriptional and metabolic profiling for yeast at early stages of senescence (4th, 7th, and 11th generation), that is, for populations in which most cells are still alive. Transcriptional profiles showed up- and down-regulation for ?20% of the genes profiled after the first four generations, few further changes by the 7th generation, and an additional 12% of the genes were up- and down-regulated after 11 generations. Pathway analysis revealed that these 11th generation cells had accumulated transcripts coding for enzymes involved in sugar metabolism, the TCA cycle, and amino acid degradation and showed decreased levels of mRNAs coding for enzymes involved in amino acid biosynthetic pathways. These observations were consistent with the metabolomic profiles of aging cells: an accumulation of pyruvic acid and TCA cycle intermediates and depletion of most amino acids, especially branched-chain amino acids. Stationary phase-induced genes were highly expressed after 11 generations even though the growth medium contained adequate levels of nutrients, indicating deterioration of the nutrient sensing and/or signaling pathways by the 11th generation. These changes are presumably early indications of replicative senescence. PMID:25294875

Kamei, Yuka; Tamada, Yoshihiro; Nakayama, Yasumune; Fukusaki, Eiichiro; Mukai, Yukio

2014-11-14

49

In Vivo Replication of Recombinant Murine Cytomegalovirus Driven by the Paralogous Major Immediate-Early Promoter Enhancer of Human Cytomegalovirus  

Microsoft Academic Search

Transcription of the major immediate-early (MIE) genes of cytomegaloviruses (CMV) is driven by a strong promoter-enhancer (MIEPE) complex. Transactivator proteins encoded by these MIE genes are essential for productive infection. Accordingly, the MIEPE is a crucial control point, and its regulation by activators and repressors is pertinent to virus replication. Since the MIEPE contains multiple regulatory elements, it was reasonable

NATASCHA K. A. GRZIMEK; JURGEN PODLECH; HANS-PETER STEFFENS; RAFAELA HOLTAPPELS; SUSANNE SCHMALZ; MATTHIAS J. REDDEHASE

1999-01-01

50

Replication initiation and elongation fork rates within a differentially expressed human multicopy locus in early S phase.  

PubMed Central

Replication of the 400 copies of the 43 kb human ribosomal RNA (rDNA) locus spans most of the S phase. To examine the basis for the unusual pattern of rDNA replication, a sensitive strategy was developed to map origins of DNA replication and measure apparent rates of fork progression within a chromosomal locus. This technique, termed differential intragenomic replication timing, revealed that initiation within the actively transcribed rDNA occurred in early S within a 10.7 kb region spanning the promoter and 5' external transcribed spacer. Forks emanating from this early bidirectional origin progressed at an apparent slow rate with the sense and anti-sense forks moving at 0.32 and 0.23 kb/min. Using a photochemical-based technique, the chromatin status of the rDNA repeats was assayed throughout the S phase. Approximately 85% of the rDNA repeats were in a transcriptionally active chromatin structure at the start of S phase. A progressive decrease in the transcription state of the rDNA loci was observed, reaching a minimum between 3 and 6 h in mid S phase. Altogether, the data suggest a link between RNA polymerase I mediated transcription and site-specific initiation of DNA replication within the rDNA multicopy locus. PMID:9358159

Scott, R S; Truong, K Y; Vos, J M

1997-01-01

51

Bacterial toxins affect early events of T lymphocyte activation.  

PubMed Central

The effects of pertussis toxin and cholera toxin on early events of T lymphocyte activation were examined in the T lymphocyte cell line, Jurkat. Pertussis toxin treatment of these T cells increased inositol phosphates production and led to increases in intracellular free calcium concentration. These effects were produced by the isolated B (binding) subunit of pertussis toxin, alone. Inositol phosphates production resulting from perturbation of the T cell antigen receptor-CD3 complex by MAb was not affected by pertussis toxin treatment but was markedly inhibited by cholera toxin. This effect of cholera toxin paralleled elevations in cAMP content. However, forskolin, in concentrations equipotent for cAMP production, was a weaker inhibitor of inositol phosphates production. Cholera toxin inhibition of inositol phosphates production did not result from inhibition of baseline incorporation of inositol into phosphoinositide substrates of phospholipase C. These studies underline the complexity of toxin effects on cellular systems and suggest that other approaches will be required to implicate guanine nucleotide-binding regulatory proteins in control of the early events of T lymphocyte activation. However, the data presented here provide a molecular basis for the clinical observations of lymphocytosis and the in vitro observations of lymphocyte mitogenesis after pertussis toxin stimulation. Images PMID:2536043

Stewart, S J; Prpic, V; Johns, J A; Powers, F S; Graber, S E; Forbes, J T; Exton, J H

1989-01-01

52

Significant changes in integrase-associated HIV-1 replication capacity between early and late isolates.  

PubMed

During the human immunodeficiency virus type 1 (HIV-1) pandemic, continuous, extensive genetic diversification of the virus has been observed. To study the effect of HIV-1 diversification on integrase-associated viral replication capacity (RC), 94 HIV-1 subtype B integrase sequences from two groups of antiretroviral-naive viruses isolated 15 y apart were amplified and recombined with an HIV-1 infectious clone. Viral RC was determined by infecting a T cell line with a long terminal repeat-driven green fluorescent protein reporter. Significant differences in integrase-mediated RC were observed between recombinant viruses from early and late isolates (p=0.0286). Integrases from late isolates had significantly lower sequence conservation scores compared to an ancestral subtype B sequence (p<0.0001). Integrase amino acid polymorphisms S17N, I72V, S119P, and D256E were associated with a lower ex vivo viral RC. These results suggest that integrase sequence diversification has affected ex vivo HIV-1 RC. PMID:23880146

Capel, Elena; Parera, Mariona; Clotet, Bonaventura; Martínez, Miguel Angel

2013-09-01

53

Discovery of gramine derivatives that inhibit the early stage of EV71 replication in vitro.  

PubMed

Enterovirus 71 (EV71) is a notable causative agent of hand, foot, and mouth disease in children, which is associated with an increased incidence of severe neurological disease and death, yet there is no specific treatment or vaccine for EV71 infections. In this study, the antiviral activity of gramine and 21 gramine derivatives against EV71 was investigated in cell-based assays. Eighteen derivatives displayed some degree of inhibitory effects against EV71, in that they could effectively inhibit virus-induced cytopathic effects (CPEs), but the anti-EV71 activity of the lead compound gramine was not observed. Studies on the preliminary modes of action showed that these compounds functioned by targeting the early stage of the EV71 lifecycle after viral entry, rather than inactivating the virus directly, inhibiting virus adsorption or affecting viral release from the cells. Among these derivatives, one (compound 4s) containing pyridine and benzothiazole units showed the most potency against EV71. Further studies demonstrated that derivative 4s could profoundly inhibit viral RNA replication, protein synthesis, and virus-induced apoptosis in RD cells. These results indicate that derivative 4s might be a feasible therapeutic agent against EV71 infection and that these gramine derivatives may provide promising lead scaffolds for the further design and synthesis of potential antiviral agents. PMID:24979400

Wei, Yanhong; Shi, Liqiao; Wang, Kaimei; Liu, Manli; Yang, Qingyu; Yang, Ziwen; Ke, Shaoyong

2014-01-01

54

Human cytomegalovirus DNA replicates after early circularization by concatemer formation, and inversion occurs within the concatemer.  

PubMed Central

To determine the replicative mechanism for human cytomegalovirus (HCMV) DNA, field inversion gel electrophoresis was used to separate HCMV replicative DNAs during lytic infection. Unit-length circular HCMV genomes lacking terminal restriction fragments were detected starting 4 h after infection even when cells were treated with aphidicolin, phosphonoacetic acid, or cycloheximide. Viral DNA synthesis began 24 h after infection and produced large amounts of high-molecular-weight replicative DNA that was a precursor of progeny genomes. Replicative DNA contained rare terminal restriction fragments, and long-arm termini were much less frequent than short-arm termini. Replicative DNA was not composed of unit-length circles because low-dose gamma irradiation of replicative DNA generated numerous random high-molecular-weight fragments rather than unit-length molecules. PacI digestion of replicative DNA from a recombinant HCMV with two closely spaced PacI sites revealed that replicative DNA is concatemeric and genome segment inversion occurs after concatemer synthesis. These results show that after circularization of the parental genome, DNA synthesis produces concatemers and genomic inversion occurs within concatemeric DNA. The results further suggest that concatemers acquire genomic termini during the cleavage/packaging process which preferentially inserts short-arm termini into empty capsids, causing a predominance of short-arm termini on the concatemer. Images PMID:8289333

McVoy, M A; Adler, S P

1994-01-01

55

Cannabinoid/Endocannabinoid signaling impact on early pregnancy events.  

PubMed

It has been known for decades that marijuana and its major psychoactive component ??-tetrahydrocannabinol (THC) alter both male and female reproductive functions in humans and laboratory animals. The discovery of cannabinoid-like molecules (endocannabinoids), anandamide (AEA) and 2-arachidonylglycerol (2AG), as well as G-protein-coupled cannabinoid/endocannabinoid receptors CB? and CB?, created an opportunity to study the adverse and beneficial effects of cannabinoids/endocannabinoids on fertility using molecular, physiological and genetic approaches. In fact, studies to explore the significance of cannabinoid/endocannabinoid signaling in reproduction have revealed some intriguing physiological roles in early pregnant events. This review summarizes some aspects of these signaling molecules in preimplantation and implantation biology utilizing genetically engineered mouse models. PMID:21104387

Sun, Xiaofei; Dey, Sudhansu K

2009-01-01

56

Kinetics of the early events of GPCR signalling  

PubMed Central

Neurotensin receptor type 1 (NTS1) is a G protein-coupled receptor (GPCR) that affects cellular responses by initiating a cascade of interactions through G proteins. The kinetic details for these interactions are not well-known. Here, NTS1-nanodisc-G?s and G?i1 interactions were studied. The binding affinities of G?i1 and G?s to NTS1 were directly measured by surface plasmon resonance (SPR) and determined to be 15 ± 6 nM and 31 ± 18 nM, respectively. This SPR configuration permits the kinetics of early events in signalling pathways to be explored and can be used to initiate descriptions of the GPCR interactome. PMID:25447525

Adamson, Roslin J.; Watts, Anthony

2014-01-01

57

Kinetics of the early events of GPCR signalling.  

PubMed

Neurotensin receptor type 1 (NTS1) is a G protein-coupled receptor (GPCR) that affects cellular responses by initiating a cascade of interactions through G proteins. The kinetic details for these interactions are not well-known. Here, NTS1-nanodisc-G?s and G?i1 interactions were studied. The binding affinities of G?i1 and G?s to NTS1 were directly measured by surface plasmon resonance (SPR) and determined to be 15±6nM and 31±18nM, respectively. This SPR configuration permits the kinetics of early events in signalling pathways to be explored and can be used to initiate descriptions of the GPCR interactome. PMID:25447525

Adamson, Roslin J; Watts, Anthony

2014-12-20

58

Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae.  

PubMed

Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

Camberlein, Emilie; Cohen, Jonathan M; José, Ricardo; Hyams, Catherine J; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad; Brown, Jeremy S

2015-03-01

59

"Early" virus-specific RNA may contain information necessary for chromosome replication and mitosis induced by Simian Virus 40.  

PubMed

Simian Virus 40 (SV40) induces in "contact-inhibited" tissue culture cells of mouse kidney an abortive infection that leads to the appearance of intra-nuclear SV40-specific tumor (T-) antigen, followed by replication of the mouse-cell chromatin and mitosis, while no viral progeny DNA or capsid protein is produced. Synthesis of "early" SV40-specific RNA ("19S RNA") begins a few hours before the appearance of T-antigen and appears to be switched off after the onset of chromatin replication. As the most simple working hypothesis that can account for the experimental results available, we assume that early SV40 RNA contains information necessary for production of T-antigen and that this antigen (or an unknown early virus-specific function that would simply parallel the appearance of T-antigen) activates or de-inhibits a cellular regulatory element that governs chromosome replication and mitosis. The experimental results agree with the idea that SV40 acts primarily as a mitogen. PMID:4352646

May, E; May, P; Weil, R

1973-06-01

60

Sigma-1 Receptor Regulates Early Steps of Viral RNA Replication at the Onset of Hepatitis C Virus Infection  

PubMed Central

Hepatitis C virus (HCV) genome replication is thought to occur in a membranous cellular compartment derived from the endoplasmic reticulum (ER). The molecular mechanisms by which these membrane-associated replication complexes are formed during HCV infection are only starting to be unraveled, and both viral and cellular factors contribute to their formation. In this study, we describe the discovery of nonopioid sigma-1 receptor (S1R) as a cellular factor that mediates the early steps of viral RNA replication. S1R is a cholesterol-binding protein that resides in lipid-rich areas of the ER and in mitochondrion-associated ER membranes (MAMs). Several functions have been ascribed to this ER-resident chaperone, many of which are related to Ca2+ signaling at the MAMs and lipid storage and trafficking. Downregulation of S1R expression by RNA interference (RNAi) in Huh-7 cells leads to a proportional decrease in susceptibility to HCV infection, as shown by reduced HCV RNA accumulation and intra- and extracellular infectivity in single-cycle infection experiments. Similar RNAi studies in persistently infected cells indicate that S1R expression is not rate limiting for persistent HCV RNA replication, as marked reduction in S1R in these cells does not lead to any decrease in HCV RNA or viral protein expression. However, subgenomic replicon transfection experiments indicate that S1R expression is rate limiting for HCV RNA replication without impairing primary translation. Overall, our data indicate that the initial steps of HCV infection are regulated by S1R, a key component of MAMs, suggesting that these structures could serve as platforms for initial RNA replication during HCV infection. PMID:23536676

Friesland, Martina; Mingorance, Lidia; Chung, Josan; Chisari, Francis V.

2013-01-01

61

Response of Jakobshavn Isbræ to early Holocene abrupt climate events  

NASA Astrophysics Data System (ADS)

Located in central-west Greenland, the Fjord Stade moraine complex represents an important phase of Greenland Ice Sheet deglaciation since the Last Glacial Maximum. However, the Fjord Stade moraines are only indirectly dated to between ~ 10 and 7.7 cal ka BP, making it difficult to evaluate the relationship between past ice-margin fluctuations and temperature change given current chronological uncertainties. In addition, the Fjord Stade moraine complex consists of two separate moraines, the older Marrait moraine and the younger Tasiussaq moraine. This distinction has often been neglected, making correlation of different moraine segments across central-west Greenland problematic. Here, we present new mapping and radiocarbon-dated lake sediments, with previously published 10Be surface exposure ages to precisely constrain the age of the Marrait and Tasiussaq moraines at the mouth of Jakobshavn Isbræ, Greenland’s largest outlet glacier. Following local deglaciation at 10.2±0.1 ka (n = 5), preliminary data suggests Jakobshavn Isbræ advanced to deposit that Marrait moraine at ~9.2-9.1 cal yr BP based on radiocarbon dates from a threshold lake adjacent to the Marrait moraine. Following deposition of the Marrait moraine, 10Be ages indicate Jakobshavn Isbræ experienced a second advance culminating in deposition of the Tasiussaq moraine just before 8.0±0.2 ka (n = 5). Our chronology suggests that the Fjord Stade moraines located at the mouth of Jakobshavn Isfjord, represent advances of the ice margin in response to early Holocene, centennial-scale abrupt climate events (i.e. 9.3 and 8.2 ka events).

Young, N. E.; Briner, J. P.; Rood, D. H.; Finkel, R. C.

2010-12-01

62

Characterization of a Replication-Incompetent Pseudorabies Virus Mutant Lacking the Sole Immediate Early Gene IE180  

PubMed Central

ABSTRACT The alphaherpesvirus pseudorabies virus (PRV) encodes a single immediate early gene called IE180. The IE180 protein is a potent transcriptional activator of viral genes involved in DNA replication and RNA transcription. A PRV mutant with both copies of IE180 deleted was constructed 20 years ago (S. Yamada and M. Shimizu, Virology 199:366–375, 1994, doi:10.1006/viro.1994.1134), but propagation of the mutant depended on complementing cell lines that expressed the toxic IE180 protein constitutively. Recently, Oyibo et al. constructed a novel set of PRV IE180 mutants and a stable cell line with inducible IE180 expression (H. Oyibo, P. Znamenskiy, H. V. Oviedo, L. W. Enquist, A. Zador, Front. Neuroanat. 8:86, 2014, doi:10.3389/fnana.2014.00086), which we characterized further here. These mutants failed to replicate new viral genomes, synthesize immediate early, early, or late viral proteins, and assemble infectious virions. The PRV IE180-null mutant did not form plaques in epithelial cell monolayers and could not spread from primary infected neurons to second-order neurons in culture. PRV IE180-null mutants lacked the property of superinfection exclusion. When PRV IE180-null mutants infected cells first, subsequent superinfecting viruses were not blocked in cell entry and formed replication compartments in epithelial cells, fibroblasts, and neurons. Cells infected with PRV IE180-null mutants survived as long as uninfected cells in culture while expressing a fluorescent reporter gene. Transcomplementation with IE180 in epithelial cells restored all mutant phenotypes to wild type. The conditional expression of PRV IE180 protein enables the propagation of replication-incompetent PRV IE180-null mutants and will facilitate construction of long-term single-cell-infecting PRV mutants for precise neural circuit tracing and high-capacity gene delivery vectors. PMID:25389174

Wu, Brendan W.

2014-01-01

63

Examining the Structure of the Schedule of Sexist Events: Replication and Extension  

ERIC Educational Resources Information Center

The current study reexamined the factor structure of the Lifetime and Recent scales of the Schedule of Sexist Events (SSE; Klonoff & Landrine, 1995) and conducted the first factor analysis of the SSE-Appraisal scale ( Landrine & Klonoff, 1997). Factor analyses conducted with data from 245 women yielded, for SSE-Lifetime and SSE-Appraisal scales,…

Matteson, Alicia V.; Moradi, Bonnie

2005-01-01

64

The human cytomegalovirus major immediate-early distal enhancer region is required for efficient viral replication and immediate-early gene expression.  

PubMed

The human cytomegalovirus (HCMV) major immediate-early (MIE) genes, encoding IE1 p72 and IE2 p86, are activated by a complex enhancer region (base positions -65 to -550) that operates in a cell type- and differentiation-dependent manner. The expression of MIE genes is required for HCMV replication. Previous studies analyzing functions of MIE promoter-enhancer segments suggest that the distal enhancer region variably modifies MIE promoter activity, depending on cell type, stimuli, or state of differentiation. To further understand the mechanism by which the MIE promoter is regulated, we constructed and analyzed several different recombinant HCMVs that lack the distal enhancer region (-300 to -582, -640, or -1108). In human fibroblasts, the HCMVs without the distal enhancer replicate normally at high multiplicity of infection (MOI) but replicate poorly at low MOI in comparison to wild-type virus (WT) or HCMVs that lack the neighboring upstream unique region and modulator (-582 or -640 to -1108). The growth aberrancy was normalized after restoring the distal enhancer in a virus lacking this region. For HCMVs without a distal enhancer, the impairment in replication at low MOI corresponds to a deficiency in production of MIE RNAs compared to WT or virus lacking the unique region and modulator. An underproduction of viral US3 RNA was also evident at low MOI. Whether lower production of IE1 p72 and IE2 p86 causes a reduction in expression of the immediate-early (IE) class US3 gene remains to be determined. We conclude that the MIE distal enhancer region possesses a mechanism for augmenting viral IE gene expression and genome replication at low MOI, but this regulatory function is unnecessary at high MOI. PMID:10644329

Meier, J L; Pruessner, J A

2000-02-01

65

The Human Cytomegalovirus Major Immediate-Early Distal Enhancer Region Is Required for Efficient Viral Replication and Immediate-Early Gene Expression  

PubMed Central

The human cytomegalovirus (HCMV) major immediate-early (MIE) genes, encoding IE1 p72 and IE2 p86, are activated by a complex enhancer region (base positions -65 to -550) that operates in a cell type- and differentiation-dependent manner. The expression of MIE genes is required for HCMV replication. Previous studies analyzing functions of MIE promoter-enhancer segments suggest that the distal enhancer region variably modifies MIE promoter activity, depending on cell type, stimuli, or state of differentiation. To further understand the mechanism by which the MIE promoter is regulated, we constructed and analyzed several different recombinant HCMVs that lack the distal enhancer region (-300 to -582, -640, or -1108). In human fibroblasts, the HCMVs without the distal enhancer replicate normally at high multiplicity of infection (MOI) but replicate poorly at low MOI in comparison to wild-type virus (WT) or HCMVs that lack the neighboring upstream unique region and modulator (-582 or -640 to -1108). The growth aberrancy was normalized after restoring the distal enhancer in a virus lacking this region. For HCMVs without a distal enhancer, the impairment in replication at low MOI corresponds to a deficiency in production of MIE RNAs compared to WT or virus lacking the unique region and modulator. An underproduction of viral US3 RNA was also evident at low MOI. Whether lower production of IE1 p72 and IE2 p86 causes a reduction in expression of the immediate-early (IE) class US3 gene remains to be determined. We conclude that the MIE distal enhancer region possesses a mechanism for augmenting viral IE gene expression and genome replication at low MOI, but this regulatory function is unnecessary at high MOI. PMID:10644329

Meier, Jeffery L.; Pruessner, Jonathan A.

2000-01-01

66

National Replication of a Model for Early Childhood Special Education Program Development: The Model Program Development (MPD) Outreach Project. Final Report.  

ERIC Educational Resources Information Center

This final report describes the outcome of a program designed to affect the quality of early childhood special education services in participating states though the replication and dissemination of a validated Model for Early Childhood Special Education Program Development. The Model for Program Development (MPD) was designed to enable early

Fox, Wayne L.; Capone, Angela; Hull, Karla; Dennis, Ruth E.; Ross-Allen, Jane

67

Replication Study of the First Step to Success Early Intervention Program  

ERIC Educational Resources Information Center

This article describes a replication of the "First Step to Success" program (Walker, Stiller, Severson, & Golly, 1998) with at-risk students in the first and second grade to determine program effectiveness in decreasing inappropriate behaviors and increasing academic engagement time. This expands the "First Step to Success" program to (1) serve…

Lien-Thorne, Stephanie; Kamps, Debra

2005-01-01

68

Model of early self-replication based on covalent complementarity for a copolymer of glycerate-3-phosphate and glycerol-3-phosphate  

NASA Technical Reports Server (NTRS)

Glyceraldehyde-3-phosphate acts as the substrate in a model of early self-replication of a phosphodiester copolymer of glycerate-3-phosphate and glycerol-3-phosphate. This model of self-replication is based on covalent complementarity in which information transfer is mediated by a single covalent bond, in contrast to multiple weak interactions that establish complementarity in nucleic acid replication. This replication model is connected to contemporary biochemistry through its use of glyceraldehyde-3-phosphate, a central metabolite of glycolysis and photosynthesis.

Weber, Arthur L.

1989-01-01

69

Defining the roles of the baculovirus regulatory proteins IE0 and IE1 in genome replication and early gene transactivation.  

PubMed

IE0 and IE1 of the baculovirus Autographa californica multiple nucleopolyhedrovirus are essential transregulatory proteins required for both viral DNA replication and transcriptional transactivation. IE0 is identical to IE1 except for 54 amino acids at the N-terminus but the functional differences between these two proteins remain unclear. The purpose of this study was to determine the separate roles of these critical proteins in the virus life cycle. Unlike prior studies, IE0 and IE1 were analyzed using viruses that expressed ie0 and ie1 from an identical promoter so that the timing and levels of expression were comparable. IE0 and IE1 were found to equally support viral DNA replication and budded virus (BV) production. However, specific viral promoters were selectively transactivated by IE0 relative to IE1 but only when expressed at low levels. These results indicate that IE0 preferentially transactivates specific viral genes at very early times post-infection enabling accelerated replication and BV production. PMID:25173193

Sokal, Nadia; Nie, Yingchao; Willis, Leslie G; Yamagishi, Junya; Blissard, Gary W; Rheault, Mark R; Theilmann, David A

2014-11-01

70

Effect of Exposure to UV-C Irradiation and Monochloramine on Adenovirus Serotype 2 Early Protein Expression and DNA Replication?  

PubMed Central

The mechanisms of adenovirus serotype 2 inactivation with either UV light (with a narrow emission spectrum centered at 254 nm) or monochloramine were investigated by assessing the potential inhibition of two key steps of the adenovirus life cycle, namely, E1A protein synthesis and viral genomic replication. E1A early protein synthesis was assayed by using immunoblotting, while the replication of viral DNA was analyzed by using slot blotting. Disinfection experiments were performed in phosphate buffer solutions at pH 8 and room temperature (UV) or 20°C (monochloramine). Experimental results revealed that normalized E1A levels at 12 h postinfection (p.i.) were statistically the same as the corresponding decrease in survival ratio for both UV and monochloramine disinfection. Normalized DNA levels at 24 h p.i. were also found to be statistically the same as the corresponding decrease in survival ratio for monochloramine disinfection. In contrast, for UV disinfection, genomic DNA levels were much lower than E1A or survival ratios, possibly as a result of a delay in DNA replication for UV-treated virions compared to that for controls. Future efforts will determine the pre-E1A synthesis step in the adenovirus life cycle affected by exposure to UV and monochloramine, with the goal of identifying the viral molecular target of these two disinfectants. PMID:18424543

Sirikanchana, Kwanrawee; Shisler, Joanna L.; Mariñas, Benito J.

2008-01-01

71

Recombinant plasmids carrying promoters, genes and the origin of DNA replication of the early region of bacteriophage T7.  

PubMed

Two full-length contiguous HpaI fragments of the 0 to 18.2% region of T7 H DNA (HpF-H and HpG) were inserted into plasmids pHV14 or pC194 using oligo(dG . dC) connectors or synthetic HindIII adaptors. Amplification of the two early T7 fragments was achieved by transforming lysostaphin-treated S. aureus W57 with the hybrid plasmids. Experimental evidence is presented suggesting that neither of these T7 segments can be cloned in an intact form in E. coli. One of the hybrids, pHV14-HpF-H, proved to be unstable even in B. subtilis 168. The supercoiled recombinant plasmids were tested for their capacity to support RNA synthesis by purified E. coli or T7 RNA polymerases and to serve as templates in a cell-free T7 DNA replication system. The results of these in vitro studies indicate the presence of active "early" promoters in the cloned fragment HpF-H and active "late" promoters, as well as a functional origin of replication in the cloned fragment HpG. PMID:7433121

Scherzinger, E; Lauppe, H F; Voll, N; Wanke, M

1980-03-25

72

Early events in cell spreading as a model for quantitative analysis of biomechanical events.  

PubMed

In this review, we focus on the early events in the process of fibroblast spreading on fibronectin matrices of different rigidities. We present a focused position piece that illustrates the many different tests that a cell makes of its environment before it establishes mature matrix adhesions. When a fibroblast is placed on fibronectin-coated glass surfaces at 37°C, it typically spreads and polarizes within 20-40 min primarily through ?v?3 integrin binding to fibronectin. In that short period, the cell goes through three major phases that involve binding, integrin activation, spreading, and mechanical testing of the surface. The advantage of using the model system of cell spreading from the unattached state is that it is highly reproducible and the stages that the cell undergoes can thus be studied in a highly quantitative manner, in both space and time. The mechanical and biochemical parameters that matter in this example are often surprising because of both the large number of tests that occur and the precision of the tests. We discuss our current understanding of those tests, the decision tree that is involved in this process, and an extension to the behavior of the cells at longer time periods when mature adhesions develop. Because many other matrices and integrins are involved in cell-matrix adhesion, this model system gives us a limited view of a subset of cellular behaviors that can occur. However, by defining one cellular process at a molecular level, we know more of what to expect when defining other processes. Because each cellular process will involve some different proteins, a molecular understanding of multiple functions operating within a given cell can lead to strategies to selectively block a function. PMID:25468330

Wolfenson, Haguy; Iskratsch, Thomas; Sheetz, Michael P

2014-12-01

73

Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication.  

PubMed

odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner. PMID:23825525

Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

2013-01-01

74

Replicating vaccines  

Technology Transfer Automated Retrieval System (TEKTRAN)

Early work on fish immunology and disease resistance demonstrated fish (like animals and humans) that survived infection were typically resistant to re-infection with the same pathogen. The concepts of resistance upon reinfection lead to the research and development of replicating (live) vaccines in...

75

Marek's disease virus influences the core gut microbiome of the chicken during the early and late phases of viral replication.  

PubMed

Marek's disease (MD) is an important neoplastic disease of chickens caused by the Marek's disease virus (MDV), an oncogenic alphaherpesvirus. In this study, dysbiosis induced by MDV on the core gut flora of chicken was assessed using next generation sequence (NGS) analysis. Total fecal and cecum-derived samples from individual birds were used to estimate the influence of MDV infection on the gut microbiome of chicken. Our analysis shows that MDV infection alters the core gut flora in the total fecal samples relatively early after infection (2-7 days) and in the late phase of viral infection (28-35 days) in cecal samples, corresponding well with the life cycle of MDV. Principle component analyses of total fecal and cecal samples showed clustering at the early and late time points, respectively. The genus Lactobacillus was exclusively present in the infected samples in both total fecal and cecal bird samples. The community colonization of core gut flora was altered by viral infection, which manifested in the enrichment of several genera during the early and late phases of MDV replication. The results suggest a relationship between viral infection and microbial composition of the intestinal tract that may influence inflammation and immunosuppression of T and B cells in the host. PMID:25065611

Perumbakkam, Sudeep; Hunt, Henry D; Cheng, Hans H

2014-10-01

76

Eclipse period during replication of plasmid R1: contributions from structural events and from the copy-number control system.  

PubMed

The eclipse period (the time period during which a newly replicated plasmid copy is not available for a new replication) of plasmid R1 in Escherichia coli was determined with the classic Meselson-Stahl density-shift experiment. A mini-plasmid with the wild-type R1 replicon and a mutant with a thermo-inducible runaway-replication phenotype were used in this work. The eclipses of the chromosome and of the wild-type plasmid were 0.6 and 0.2 generation times, respectively, at temperatures ranging from 30 degrees C to 42 degrees C. The mutant plasmid had a similar eclipse at temperatures up to 38 degrees C. At 42 degrees C, the plasmid copy number increased rapidly because of the absence of replication control and replication reached a rate of 350-400 plasmid replications per cell and cell generation. During uncontrolled replication, the eclipse was about 3 min compared with 10 min at controlled replication (the wild-type plasmid at 42 degrees C). Hence, the copy-number control system contributed significantly to the eclipse. The eclipse in the absence of copy-number control (3 min) presumably is caused by structural requirements: the covalently closed circular plasmid DNA has to regain the right degree of superhelicity needed for initiation of replication and it takes time to assemble the initiation factors. PMID:14507381

Olsson, Jan A; Berg, Otto G; Dasgupta, Santanu; Nordström, Kurt

2003-10-01

77

Aneuploidy as an Early Mechanistic Event in Metal Carcinogenesis  

PubMed Central

Aneuploidy has recently been proposed as an initiating event for carcinogenesis. There is significant evidence that carcinogenic metals induce aneuploidy. Here we review the mechanisms for how carcinogenic metals may induce aneuploidy and the evidence that carcinogenic metals induce an aneugenic effect which can destabilize the genome leading to genomic instability and cancer. PMID:21118142

Wise, Sandra S.; Wise, John Pierce

2014-01-01

78

Updated and revised nomenclature for description of early pregnancy events  

Microsoft Academic Search

The nomenclature used to describe clinical events in earl y pregnancy has been criticized for lack of clarity and pro- moting confusion. There is no agreed glossary of terms or consensus regarding important gestational milestones. In particular there are old and poorly descriptive terms such as 'missed abortion' and 'blighted ovum', which have per- sisted since their introduction many years

Roy G. Farquharson; Eric Jauniaux; Niek Exalto; Liverpool L

2005-01-01

79

Early events leading to fate decisions during leech embryogenesis  

E-print Network

This paper reviews leech development up to the 12-cell embryo. Oogenesis proceeds by a system of nurse cells elsewhere.1,5 Oogenesis What follows is a summary of several descriptive studies that made use of light and electron micros- copy to reconstruct the events occuring during leech oogenesis.6-14 The female germinal

Weisblat, David A.

80

Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.  

PubMed

Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns. PMID:19144709

Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

2009-04-01

81

Iron accumulation in multiple sclerosis: an early pathogenic event.  

PubMed

Iron has been shown to accumulate in deep gray matter structures in many forms of multiple sclerosis (MS), but detecting its presence early in the disease course (e.g., clinically isolated syndrome [CIS]) has been less clear. Here, we review a recent study where MRI scanning at 7 T together with susceptibility mapping was performed to assess iron deposition in CIS and control subjects. Susceptibility indicative of iron deposition was found to be increased in the globus pallidus, caudate, putamen and pulvinar of CIS patients compared with controls. The findings suggest that iron deposition is a pathological change that occurs early in the development of MS. Identifying the mechanisms of iron accumulation and determining whether iron promotes pathogenesis in MS are important areas of future research. PMID:23448214

LeVine, Steven M; Bilgen, Mehmet; Lynch, Sharon G

2013-03-01

82

Weekly Digest Guide The Weekly Digest is YSM's weekly events newsletter, distributed early  

E-print Network

Weekly Digest Guide The Weekly Digest is YSM's weekly events newsletter, distributed early each Friday morning to 9,000+ email recipients on the Yale campus. The Weekly Digest includes approximately. Timeline The Weekly Digest is published on Fridays for events taking place the following week. Lead time

Lee, Daeyeol

83

Early Interventions Following Exposure to Traumatic Events–Implications for Practice from Recent Research  

Microsoft Academic Search

It is has been argued that early interventions for individuals, groups or others affected by traumatic events should not be routinely offered as there is the danger of causing more harm. The notion of ‘watchful waiting’ has been espoused in clinical guidelines for the assessment and treatment of PTSD. Instead, a more proactive early intervention is suggested for potentially traumatic

Atle Dyregrov; Stephen Regel

2011-01-01

84

Early Interventions Following Exposure to Traumatic Events: Implications for Practice From Recent Research  

Microsoft Academic Search

It is has been argued that early interventions for individuals, groups or others affected by traumatic events should not be routinely offered as there is the danger of causing more harm. The notion of “watchful waiting” has been espoused in clinical guidelines for the assessment and treatment of posttraumatic stress disorder (PTSD). Instead, a more proactive early intervention is suggested

Atle Dyregrov; Stephen Regel

2012-01-01

85

Events during Early Triassic recovery from the end-Permian extinction  

E-print Network

Events during Early Triassic recovery from the end-Permian extinction Jinnan Tong a,, Suxin Zhang Phanerozoic mass extinction, at the end of Permian, but also a prolonged period of recovery of the biota during the succeeding Early Triassic. The delayed recovery is generally attributed to the effects

Tong, Jinnan

86

The apoptotic suppressor P35 is required early during baculovirus replication and is targeted to the cytosol of infected cells.  

PubMed Central

The p35 gene of Autographa californica nuclear polyhedrosis virus (AcMNPV) is required to block virus-induced apoptosis. The trans-dominant activity of p35 suppresses premature cell death and facilitates AcMNPV replication in a cell line- and host-specific manner. To characterize the p35 gene product (P35), a specific polyclonal antiserum was raised. As revealed by immunoblot analyses of wild-type AcMNPV-infected cells, P35 appeared early (8 to 12 h) and accumulated through the late stages of infection (24 to 36 h). Biochemical fractionation of cells both early and late in infection and indirect immunochemical staining demonstrated that P35 localized predominantly to the cytosol (150,000 x g supernatant); comparatively minor quantities of P35 were associated with intracellular membranes. The cytoplasmic localization of P35 was independent of virus infection. The functional significance of the early and late synthesis of P35 was examined by constructing recombinant viruses in which the timing and level of p35 expression were altered. Delaying P35 synthesis by placing p35 under exclusive control of a strong, very late promoter failed to suppress intracellular DNA fragmentation and apoptotic blebbing in most cells. Thus, earlier expression of p35 was required to block virus-induced apoptosis. Site-specific mutagenesis of the p35 promoter demonstrated that low levels of P35 were sufficient to block apoptosis, whereas higher levels were required to maintain wild-type virus gene expression. Consistent with an early role in infection, P35 was also detected in the budded form of AcMNPV. Because of the lack of sequence similarity and its cytosolic targeting, P35 may function in a manner that is mechanistically distinct from other apoptotic regulators, including Bcl-2 and the adenovirus E1B 19-kDa protein. Images PMID:8189486

Hershberger, P A; LaCount, D J; Friesen, P D

1994-01-01

87

A New Observation Technique Applied to Early/Fast VLF Scattering Events  

NASA Astrophysics Data System (ADS)

Early/fast very low frequency (VLF, 3-30 kHz) events are understood to result from ionospheric conductivity changes associated with lightning. Early/fast amplitude and phase perturbations have been observed coincidentally with various optical observations of transient luminous events (TLEs), including elves, sprites, and sprite halos, each of which can have temporal characteristics consistent with those of early/fast VLF events. It is yet unresolved, however, whether a specific type of TLE is directly related to the ionospheric conductivity changes responsible for the typical early/fast event. In this paper, we present spread spectrum VLF scattering observations of early/fast events. The spread spectrum analysis technique determines the amplitude and phase of a subionospherically propagating VLF signal as a function of time during the early/fast event and as a function of frequency across the 200 Hz bandwidth of the VLF transmission. VLF scattering observations, each identified with causative lightning logged by the National Lightning Detection Network (NLDN), are compared with the predictions of the Long-Wave Propagation Capability (LWPC) code, a three-dimensional earth-ionosphere waveguide propagation and scattering model. Theoretical predictions for VLF scattering from ionization changes associated with elves are compared with those associated with sprite halos, and each are compared with experimental observations. Results indicate that the observed frequency dependence of VLF scattering during early/fast events results from the combination of scattering source properties and Earth-ionosphere waveguide propagation effects. Observations are more consistent with the modeled amplitude perturbations associated with sprite halos than those with elves.

Kotovsky, D. A.; Moore, R. C.

2012-12-01

88

Early immune events in the induction of allergic contact dermatitis.  

PubMed

The skin is a barrier site that is exposed to a wide variety of potential pathogens. As in other organs, pathogens that invade the skin are recognized by pattern-recognition receptors (PRRs). Recently, it has been recognized that PRRs are also engaged by chemical contact allergens and, in susceptible individuals, this elicits an inappropriate immune response that results in allergic contact dermatitis. In this Review, we focus on how contact allergens promote inflammation by activating the innate immune system. We also examine how innate immune cells in the skin, including mast cells and dendritic cells, cooperate with each other and with T cells and keratinocytes to initiate and drive early responses to contact allergens. PMID:22240625

Kaplan, Daniel H; Igyártó, Botond Z; Gaspari, Anthony A

2012-02-01

89

Replicating the Ice-Volume Signal of the Early Pleistocene with a Complex Earth System Model  

NASA Astrophysics Data System (ADS)

Milankovitch theory proposes high-latitude summer insolation intensity paces the ice ages by controlling perennial snow cover amounts (Milankovitch, 1941). According to theory, the ~21 kyr cycle of precession should dominate the ice-volume records since it has the greatest influence on high-latitude summer insolation. Modeling experiments frequently support Milankovitch theory by attributing the majority of Northern Hemisphere high-latitude summer snowmelt to changes in the cycle of precession (e.g. Jackson and Broccoli, 2003). However, ice-volume proxy records, especially those of the Early Pleistocene (2.6-0.8 Ma), display variability with a period of ~41 kyr (Raymo and Lisiecki, 2005), indicative of insolation forcing from obliquity, which has a much smaller influence on summer insolation intensity than precession. Several hypotheses attempt to explain the discrepancies between Milkankovitch theory and the proxy records by invoking phenomena such as insolation gradients (Raymo and Nisancioglu, 2003), hemispheric offset (Raymo et al., 2006; Lee and Poulsen, 2009), and integrated summer energy (Huybers, 2006); however, all of these hypotheses contain caveats (Ruddiman, 2006) and have yet to be supported by modeling studies that use a complex GCM. To explore potential solutions to this '41 kyr problem,' we use an Earth system model composed of the GENESIS GCM and Land Surface model, the BIOME4 vegetation model, and the Pennsylvania State ice-sheet model. Using an asynchronous coupling technique, we run four idealized transient combinations of obliquity and precession, representing the orbital extremes of the Pleistocene (Berger and Loutre, 1991). Each experiment is run through several complete orbital cycles with a dynamic ice domain spanning North America and Greenland, and fixed preindustrial greenhouse-gas concentrations. For all orbital configurations, model results produce greater ice-volume spectral power at the frequency of obliquity despite significantly greater summer insolation variability from the cycle of precession. We find obliquity enhances the climate sensitivity to direct insolation forcing through positive high-latitude surface feedbacks between vegetation, sea-ice, and mean-annual insolation while the seasonal dichotomy of precessional forcing leads to climate counterbalancing that dampens the annual ice-volume response. Longer cycle duration further amplifies the ice-volume response to obliquity. Our results help remedy the discrepancies between Milankovitch theory and the ice-volume proxy records. However, summer insolation intensity remains the most important factor for determining ice-volume rate-of-change in our experiments. Consequently, we still find a significant ice-volume response to precession, which is inconsistent with the Early Pleistocene records. The disconnect is likely attributable to climate phenomena not accounted for in the model or our choice of initial conditions, which are poorly constrained for the Early Pleistocene and ice-sheet modeling in general. Future work will examine the importance of initial climate conditions on ice-volume response.

Tabor, C. R.; Poulsen, C. J.; Pollard, D.

2013-12-01

90

H1PVAT is a novel and potent early-stage inhibitor of poliovirus replication that targets VP1.  

PubMed

A novel small molecule, H1PVAT, was identified as a potent and selective inhibitor of the in vitro replication of all three poliovirus serotypes, whereas no activity was observed against other enteroviruses. Time-of-drug-addition studies revealed that the compound interfered with an early stage of virus replication. Four independently-selected H1PVAT-resistant virus variants uniformly carried the single amino acid substitution I194F in the VP1 capsid protein. Poliovirus type 1 strain Sabin, reverse-engineered to contain this substitution, proved to be completely insensitive to the antiviral effect of H1PVAT and was cross-resistant to the capsid-binding inhibitors V-073 and pirodavir. The VP1 I194F mutant had a smaller plaque phenotype than wild-type virus, and the amino acid substitution rendered the virus more susceptible to heat inactivation. Both for the wild-type and VP1 I194F mutant virus, the presence of H1PVAT increased the temperature at which the virus was inactivated, providing evidence that the compound interacts with the viral capsid, and that capsid stabilization and antiviral activity are not necessarily correlated. Molecular modeling suggested that H1PVAT binds with high affinity in the pocket underneath the floor of the canyon that is involved in receptor binding. Introduction of the I194F substitution in the model of VP1 induced a slight concerted rearrangement of the core ?-barrel in this pocket, which disfavors binding of the compound. Taken together, the compound scaffold, to which H1PVAT belongs, may represent another promising class of poliovirus capsid-binding inhibitors next to V-073 and pirodavir. Potent antivirals against poliovirus will be essential in the poliovirus eradication end-game. PMID:25043639

Tijsma, Aloys; Thibaut, Hendrik Jan; Spieser, Stéphane A H; De Palma, Armando; Koukni, Mohamed; Rhoden, Eric; Oberste, Steve; Pürstinger, Gerhard; Volny-Luraghi, Antonia; Martin, Javier; Marchand, Arnaud; Chaltin, Patrick; Neyts, Johan; Leyssen, Pieter

2014-10-01

91

Anoxia as the cause of the mid-Early Cambrian (Botomian) extinction event  

NASA Astrophysics Data System (ADS)

New and revised Early Cambrian biostratigraphic data allow a quantitative analysis of changes in biotic diversity and extinction rate. The mid-Early Cambrian extinction can now be resolved into two distinct events: the well-known early Toyonian Hawke Bay regression event, and a newly observed but more severe disruption during the early Botomian, here named the Sinsk event. During the Sinsk event, the shallow-water benthos of the so-called Tommotian fauna, together with archaeocyaths and some trilobites, underwent a rapid decline. The Sinsk event is characterized by the significant accumulation of nonbioturbated laminated black shales in tropical shallow waters. Lamination is due to the fine alternation of clay- and organic-rich laminae with calcite-rich laminae containing abundant monospecific acritarchs. These shales are enriched by pyrite and elements typical of anoxic conditions and support a benthic biota of dysaerobic character. Our observations suggest that the extinction during the early Botomian was caused by extensive encroachment of anoxic waters onto epicontinental seas, associated with eutrophication and resultant phytoplankton blooms.

Zhuravlev, Andrey Yu.; Wood, Rachel A.

1996-04-01

92

HIV-protease inhibitors block the replication of both vesicular stomatitis and influenza viruses at an early post-entry replication step  

SciTech Connect

The inhibitors of HIV-1 protease (PIs) have been designed to block the activity of the viral aspartyl-protease. However, it is now accepted that this family of inhibitors can also affect the activity of cell proteases. Since the replication of many virus species requires the activity of host cell proteases, investigating the effects of PIs on the life cycle of viruses other than HIV would be of interest. Here, the potent inhibition induced by saquinavir and nelfinavir on the replication of both vesicular stomatitis and influenza viruses is described. These are unrelated enveloped RNA viruses infecting target cells upon endocytosis and intracellular fusion. The PI-induced inhibition was apparently a consequence of a block at the level of the fusion between viral envelope and endosomal membranes. These findings would open the way towards the therapeutic use of PIs against enveloped RNA viruses other than HIV.

Federico, Maurizio, E-mail: maurizio.federico@iss.it

2011-08-15

93

Live cell imaging of early autophagy events: omegasomes and beyond.  

PubMed

Autophagy is a cellular response triggered by the lack of nutrients, especially the absence of amino acids. Autophagy is defined by the formation of double membrane structures, called autophagosomes, that sequester cytoplasm, long-lived proteins and protein aggregates, defective organelles, and even viruses or bacteria. Autophagosomes eventually fuse with lysosomes leading to bulk degradation of their content, with the produced nutrients being recycled back to the cytoplasm. Therefore, autophagy is crucial for cell homeostasis, and dysregulation of autophagy can lead to disease, most notably neurodegeneration, ageing and cancer. Autophagosome formation is a very elaborate process, for which cells have allocated a specific group of proteins, called the core autophagy machinery. The core autophagy machinery is functionally complemented by additional proteins involved in diverse cellular processes, e.g. in membrane trafficking, in mitochondrial and lysosomal biology. Coordination of these proteins for the formation and degradation of autophagosomes constitutes the highly dynamic and sophisticated response of autophagy. Live cell imaging allows one to follow the molecular contribution of each autophagy-related protein down to the level of a single autophagosome formation event and in real time, therefore this technique offers a high temporal and spatial resolution. Here we use a cell line stably expressing GFP-DFCP1, to establish a spatial and temporal context for our analysis. DFCP1 marks omegasomes, which are precursor structures leading to autophagosomes formation. A protein of interest (POI) can be marked with either a red or cyan fluorescent tag. Different organelles, like the ER, mitochondria and lysosomes, are all involved in different steps of autophagosome formation, and can be marked using a specific tracker dye. Time-lapse microscopy of autophagy in this experimental set up, allows information to be extracted about the fourth dimension, i.e. time. Hence we can follow the contribution of the POI to autophagy in space and time. PMID:23929131

Karanasios, Eleftherios; Stapleton, Eloise; Walker, Simon A; Manifava, Maria; Ktistakis, Nicholas T

2013-01-01

94

Nup153 and Nup98 bind the HIV-1 core and contribute to the early steps of HIV-1 replication  

PubMed Central

The early steps of HIV-1 replication involve the entry of HIV-1 into the nucleus, which is characterized by viral interactions with nuclear pore components. HIV-1 developed an evolutionary strategy to usurp the nuclear pore machinery and chromatin in order to integrate and efficiently express viral genes. In the current work, we studied the role of nucleoporins 153 and 98 (Nup153 and Nup98) in infection of human Jurkat lymphocytes by HIV-1. We showed that Nup153-depleted cells exhibited a defect in nuclear import, while depletion of Nup 98 caused a slight defect in HIV integration. To explore the biochemical viral determinants for the requirement of Nup153 and Nup98 during HIV-1 infection, we tested the ability of these nucleoporins to interact with HIV-1 cores. Our findings showed that both nucleoporins bind HIV-1 cores suggesting that this interaction is important for HIV-1 nuclear import and/or integration. Distribution analysis of integration sites in Nup153-depleted cells revealed a reduced tendency of HIV-1 to integrate in intragenic sites, which in part could account for the large infectivity defect observed in Nup153-depleted cells. Our work strongly supports a role for Nup153 in HIV-1 nuclear import and integration. PMID:23523133

Di Nunzio, Francesca; Fricke, Thomas; Miccio, Annarita; Valle-Casuso, Jose Carlos; Perez, Patricio; Souque, Philippe; Rizzi, Ermanno; Severgnini, Marco; Mavilio, Fulvio; Charneau, Pierre; Diaz-Griffero, Felipe

2013-01-01

95

Requirement of multiple cis-acting elements in the human cytomegalovirus major immediate-early distal enhancer for viral gene expression and replication.  

PubMed

We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer's orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at -300 or -345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication. PMID:11739696

Meier, Jeffery L; Keller, Michael J; McCoy, James J

2002-01-01

96

Requirement of Multiple cis-Acting Elements in the Human Cytomegalovirus Major Immediate-Early Distal Enhancer for Viral Gene Expression and Replication  

PubMed Central

We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer’s orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at ?300 or ?345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication. PMID:11739696

Meier, Jeffery L.; Keller, Michael J.; McCoy, James J.

2002-01-01

97

Evidence for an early pliocene cold event in the southern oceans  

SciTech Connect

Although it is generally agreed that the early Pliocene witnessed the last great climate warming before the onset of Northern Hemisphere glaciation, it is generally not recognized that this time interval also witnessed what appear to be major glaciations in both northern and southern Hemispheres. This describes a study of brief, intense warm events in the early Pliocene as well as evidence for at least one major glaciation during this time interval. 13 refs.

Burckle, L.H.; Mortlock, R.A. (Columbia Univ., Palisades, NY (United States)); Rudolph, S. (State Univ. of New York, Oswego, NY (United States))

1993-01-01

98

Early snowmelt events: detection, distribution, and significance in a major sub-arctic watershed  

NASA Astrophysics Data System (ADS)

High latitude drainage basins are experiencing higher average temperatures, earlier snowmelt onset in spring, and an increase in rain on snow (ROS) events in winter, trends that climate models project into the future. Snowmelt-dominated basins are most sensitive to winter temperature increases that influence the frequency of ROS events and the timing and duration of snowmelt, resulting in changes to spring runoff. Of specific interest in this study are early melt events that occur in late winter preceding melt onset in the spring. The study focuses on satellite determination and characterization of these early melt events using the Yukon River Basin (Canada/USA) as a test domain. The timing of these events was estimated using data from passive (Advanced Microwave Scanning Radiometer—EOS (AMSR-E)) and active (SeaWinds on Quick Scatterometer (QuikSCAT)) microwave remote sensors, employing detection algorithms for brightness temperature (AMSR-E) and radar backscatter (QuikSCAT). The satellite detected events were validated with ground station meteorological and hydrological data, and the spatial and temporal variability of the events across the entire river basin was characterized. Possible causative factors for the detected events, including ROS, fog, and positive air temperatures, were determined by comparing the timing of the events to parameters from SnowModel and National Centers for Environmental Prediction North American Regional Reanalysis (NARR) outputs, and weather station data. All melt events coincided with above freezing temperatures, while a limited number corresponded to ROS (determined from SnowModel and ground data) and a majority to fog occurrence (determined from NARR). The results underscore the significant influence that warm air intrusions have on melt in some areas and demonstrate the large temporal and spatial variability over years and regions. The study provides a method for melt detection and a baseline from which to assess future change.

Alese Semmens, Kathryn; Ramage, Joan; Bartsch, Annett; Liston, Glen E.

2013-03-01

99

Let's Party! How To Plan Special Events and Raise Money in Early Childhood Programs.  

ERIC Educational Resources Information Center

This guide for early childhood program administrators provides guidelines and makes suggestions for planning special events to facilitate opportunities for parents, children, teachers, and organizations to connect in ways that strengthen individuals and communities and raise money for the organization. Part 1, "Planning," focuses on organization,…

Rice, Judith Anne

100

Rapid Determination of Event Source Parameters in Southern California for earthquake early warning  

Microsoft Academic Search

The rapid increase in the number of seismic stations in earthquake prone regions, combined with the implementation of near real time data transmission technologies, provides the potential for earthquake early warning. In the absence of earthquake prediction methodologies in the foreseeable future, the rapid detection and analysis of a seismic event on its initiation, allowing the issuance of a ground

R. M. Allen; H. Kanamori

2001-01-01

101

Early events in speciation: Polymorphism for hybrid male sterility in Drosophila  

E-print Network

Early events in speciation: Polymorphism for hybrid male sterility in Drosophila Laura K. Reed of hybrid male sterility in crosses between Drosophila mojavensis and its sister species, Drosophila variation in the Drosophila melanogaster species group. Mutations that rescue inviable hybrids have been

Markow, Therese

102

Neighborhood Disadvantage, Stressful Life Events, and Adjustment among Mexican American Early Adolescents  

ERIC Educational Resources Information Center

This study examined a stress process model in which stressful life events and association with delinquent peers mediated the relationship of neighborhood disadvantage to Mexican American early adolescents' mental health. The authors also proposed that child gender, child generation, and neighborhood informal social control would moderate the…

Roosa, Mark W.; Burrell, Ginger L.; Nair, Rajni L.; Coxe, Stefany; Tein, Jenn-Yun; Knight, George P.

2010-01-01

103

1 Modeling and Analysis of Early Events in T-Lymphocyte Antigen ...  

E-print Network

identify potential regulatory mechanisms in the early T-cell signaling events. ...... U.S. Bhalla, Robustness of the Bistable Behavior of a Biological Signaling .... M. Naramura, I. Jang, H. Kole, F. Huang, D. Haines, and H. Gu, c-Cbl and Cbl-b.

Greg

104

COLORECTAL CANCER Increased microvascular blood content is an early event in  

E-print Network

COLORECTAL CANCER Increased microvascular blood content is an early event in colon carcinogenesis R, we utilised 4D-ELF to probe the preneoplastic colonic microvasculature. Methods: Colonic mucosal content from the endoscopically normal mid transverse colon in 37 patients undergoing screening

Ottino, Julio M.

105

How Early Events Affect Growing Brains. An Interview with Neuroscientist Pat Levitt  

ERIC Educational Resources Information Center

Recent advances in neuroscience show clearly how experience can change brain neurochemicals, and how this in turn affects the way the brain functions. As a result, early negative events actually get built into the growing brain's neurochemistry, altering the brain's architecture. Research is continuing to investigate how children with genetic…

National Scientific Council on the Developing Child, 2006

2006-01-01

106

Environmental change during the Late Berriasian - Early Valanginian: a prelude to the late Early Valanginian carbon-isotope event?  

NASA Astrophysics Data System (ADS)

The Valanginian period is well known for a positive excursion in marine and terrestrial ?13C records, which has been interpreted as the consequence of a major perturbation in the global carbon cycle (Lini et al., 1992; Erba et al., 2004). In contrast to the positive ?13C excursions of the Early Aptian and latest Cenomanian, marine organic-rich sediments have only been recognized from a few localities (van de Schootbrugge et al., 2003; Reboulet et al., 2003; Gröcke et al., 2005; Westermann et al., in press). The ?13C excursion began in the late Early Valanginian (campylotoxus ammonite zone) and gradually ended during the Late Valanginian. It is associated with a phase of widespread carbonate-platform drowning on the shelf (Föllmi et al., 1994) and a decline in calcareous nannofossils in the pelagic realm (Erba et al., 2004). As a triggering mechanism, numerous authors invoke the formation of the Parañà-Etendeka flood basalt. The correlation of this episode with the Valanginian ?13C event depends, however, on the absolute ages attributed to the Valanginian stage. The recent geological timescale by Ogg et al. (2008) shows that the major eruptional phase occurred during the Late Valanginian. This may imply that the late Early Valanginian ?13C event resulted from a combination of different factors. Important paleoenvironmental change occurred already in the latest Berriasian and earliest Valanginian, prior to the positive ?13C excursion. An increase in nutrient input near the onset of the ?13C excursion (campylotoxus ammonite zone), which may be considered as a trigger of the carbon cycle perturbation, has been identified in different studies, (Hennig, 2003; Duchamp-Alphonse et al., 2007; Bornemann & Mutterlose, 2008). Heterozoan faunal associations became dominant since the Early Valanginian on the northern Tethyan Helvetic platform and may indicate the beginning of sea-water eutrophication (Föllmi et al., 2007). Clay assemblages in the Tethys and Western European basins show that the climate became more humid during the Late Berriasian (Hallam et al., 1991, Schnyder et al., 2009). The aim of this project is to precisely characterize and date paleoenvironmental and paleoclimatic change during the latest Berriasian-Early Valanginian time interval in order to decipher if they can be viewed as precursor events, linked with the late Early Valanginian ?13C event. Three key sections have been studied: Capriolo (N Italy), Montclus (SE France) and Musfallen (E Switzerland) located in the Lombardian and Vocontian basins and on the Helvetic platform, respectively. Phosphorus and stable-isotope analyses have been performed, in addition to clay-mineralogy and facies determinations. The three sections show similar and comparable trends: The phosphorus content (in ppm) is higher in Late Berriasian sediments (compared to Early Berriasian and Valanginian deposits) and this period is also characterised by a decrease in ?13C values. This is interpreted as the result of enhanced continental weathering, which would be coeval with a change to a more humid climate during the Late Berriasian (Schnyder et al., 2009). References: Bornemann, A. and Mutterlose, J. (2008). "Calcareous nannofossil and d13C records from the Early Cretaceous of the Western Atlantic ocean: evidence of enhanced fertilization accross the Berriasian-Valanginian transition." palaios 23: 821-832. Duchamp-Alphonse, S., Gardin, S., Fiet, N., Bartolini, A., Blamart, D. and Pagel, M. (2007). "Fertilization of the northwestern Tethys (Vocontian basin, SE France) during the Valanginian carbon isotope perturbation: Evidence from calcareous nannofossils and trace element data." Palaeogeography, Palaeoclimatology, Palaeoecology 243(1-2): 132-151. Föllmi, K.B., Weissert, H., Bisping, M. & Funk, H. 1994: Phosphogenesis, carbon-isotope stratigraphy, and carbonate-platform evolution along the Lower Cretaceous northern tethyan margin. Geological Society of America, Bulletin 106, 729-746. F^llmi, K.B., Bodin, S., Godet, A., Linder, P. and Van de Scho

Morales, Chloé; Schnyder, Johann; Spangenberg, Jorge; Adatte, Thierry; Westermann, Stephane; Föllmi, Karl

2010-05-01

107

ENERGETIC PARTICLE CROSS-FIELD PROPAGATION EARLY IN A SOLAR EVENT  

SciTech Connect

Solar energetic particles (SEPs) have been observed to easily spread across heliographic longitudes, and the mechanisms responsible for this behavior remain unclear. We use full-orbit simulations of a 10 MeV proton beam in a turbulent magnetic field to study to what extent the spread across the mean field can be described as diffusion early in a particle event. We compare the full-orbit code results to solutions of a Fokker-Planck equation including spatial and pitch angle diffusion, and of one including also propagation of the particles along random-walking magnetic field lines. We find that propagation of the particles along meandering field lines is the key process determining their cross-field spread at 1 AU at the beginning of the simulated event. The mean square displacement of the particles an hour after injection is an order of magnitude larger than that given by the diffusion model, indicating that models employing spatial cross-field diffusion cannot be used to describe early evolution of an SEP event. On the other hand, the diffusion of the particles from their initial field lines is negligible during the first 5 hr, which is consistent with the observations of SEP intensity dropouts. We conclude that modeling SEP events must take into account the particle propagation along meandering field lines for the first 20 hr of the event.

Laitinen, T.; Dalla, S.; Marsh, M. S. [Jeremiah Horrocks Institute, University of Central Lancashire, PR1 2HE Preston (United Kingdom)

2013-08-20

108

Dissemination of a highly virulent pathogen: tracking the early events that define infection.  

PubMed

The series of events that occurs immediately after pathogen entrance into the body is largely speculative. Key aspects of these events are pathogen dissemination and pathogen interactions with the immune response as the invader moves into deeper tissues. We sought to define major events that occur early during infection of a highly virulent pathogen. To this end, we tracked early dissemination of Yersinia pestis, a highly pathogenic bacterium that causes bubonic plague in mammals. Specifically, we addressed two fundamental questions: (1) do the bacteria encounter barriers in disseminating to draining lymph nodes (LN), and (2) what mechanism does this nonmotile bacterium use to reach the LN compartment, as the prevailing model predicts trafficking in association with host cells. Infection was followed through microscopy imaging in addition to assessing bacterial population dynamics during dissemination from the skin. We found and characterized an unexpected bottleneck that severely restricts bacterial dissemination to LNs. The bacteria that do not pass through this bottleneck are confined to the skin, where large numbers of neutrophils arrive and efficiently control bacterial proliferation. Notably, bottleneck formation is route dependent, as it is abrogated after subcutaneous inoculation. Using a combination of approaches, including microscopy imaging, we tested the prevailing model of bacterial dissemination from the skin into LNs and found no evidence of involvement of migrating phagocytes in dissemination. Thus, early stages of infection are defined by a bottleneck that restricts bacterial dissemination and by neutrophil-dependent control of bacterial proliferation in the skin. Furthermore, and as opposed to current models, our data indicate an intracellular stage is not required by Y. pestis to disseminate from the skin to draining LNs. Because our findings address events that occur during early encounters of pathogen with the immune response, this work can inform efforts to prevent or control infection. PMID:25611317

Gonzalez, Rodrigo J; Lane, M Chelsea; Wagner, Nikki J; Weening, Eric H; Miller, Virginia L

2015-01-01

109

Dissemination of a Highly Virulent Pathogen: Tracking The Early Events That Define Infection  

PubMed Central

The series of events that occurs immediately after pathogen entrance into the body is largely speculative. Key aspects of these events are pathogen dissemination and pathogen interactions with the immune response as the invader moves into deeper tissues. We sought to define major events that occur early during infection of a highly virulent pathogen. To this end, we tracked early dissemination of Yersinia pestis, a highly pathogenic bacterium that causes bubonic plague in mammals. Specifically, we addressed two fundamental questions: (1) do the bacteria encounter barriers in disseminating to draining lymph nodes (LN), and (2) what mechanism does this nonmotile bacterium use to reach the LN compartment, as the prevailing model predicts trafficking in association with host cells. Infection was followed through microscopy imaging in addition to assessing bacterial population dynamics during dissemination from the skin. We found and characterized an unexpected bottleneck that severely restricts bacterial dissemination to LNs. The bacteria that do not pass through this bottleneck are confined to the skin, where large numbers of neutrophils arrive and efficiently control bacterial proliferation. Notably, bottleneck formation is route dependent, as it is abrogated after subcutaneous inoculation. Using a combination of approaches, including microscopy imaging, we tested the prevailing model of bacterial dissemination from the skin into LNs and found no evidence of involvement of migrating phagocytes in dissemination. Thus, early stages of infection are defined by a bottleneck that restricts bacterial dissemination and by neutrophil-dependent control of bacterial proliferation in the skin. Furthermore, and as opposed to current models, our data indicate an intracellular stage is not required by Y. pestis to disseminate from the skin to draining LNs. Because our findings address events that occur during early encounters of pathogen with the immune response, this work can inform efforts to prevent or control infection. PMID:25611317

Gonzalez, Rodrigo J.; Lane, M. Chelsea; Wagner, Nikki J.; Weening, Eric H.; Miller, Virginia L.

2015-01-01

110

Molecular replication  

NASA Technical Reports Server (NTRS)

Recent experiments demonstrating nonenzymatic replication in molecular systems are reviewed. The difficulties facing nonenzymatic replication are discussed along with specificity, fidelity, and mutation in nonenzymatic replication. The prospects for research in this area are considered.

Orgel, Leslie E.

1992-01-01

111

Early Events in Helix Unfolding Under External Forces: A Milestoning Analysis  

PubMed Central

Initial events of helix breakage as a function of load are considered using Molecular Dynamics simulations and Milestoning analysis. A helix length of ~100 amino acids is considered as a model for typical helices found in molecular machines and as a model that minimizes end effects for early events of unfolding. Transitions of individual amino acids (averaged over the helix’s interior residues) are examined and its surrounding hydrogen bonds are considered. Dense kinetic networks are constructed that, with Milestoning analysis, provide the overall kinetics of early breakage events. Network analysis and selection of MaxFlux pathways illustrate that load impacts unfolding mechanisms in addition to time scales. At relatively high (100pN) load levels, the principal intermediate is the 310-helix, while at relatively low (10pN) levels the ?-helix is significantly populated, albeit not as an unfolding intermediate. Coarse variables are examined at different levels of resolution; the rate of unfolding illustrates remarkable stability under changes in the coarsening. Consistent prediction of about ~5ns for the time of a single amino-acid unfolding event are obtained. Hydrogen bonds are much faster coarse variables (by about 2 orders of magnitude) compared to backbone torsional transition, which gates unfolding and thereby provides the appropriate coarse variable for the initiation of unfolding. PMID:22471347

Kreuzer, Steven M; Elber, Ron; Moon, Tess J

2012-01-01

112

CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication  

PubMed Central

ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression. PMID:24741094

Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

2014-01-01

113

Reduced Expression of the Immediate-Early Protein IE0 Enables Efficient Replication of Autographa californica Multiple Nucleopolyhedrovirus in Poorly Permissive Spodoptera littoralis Cells†  

PubMed Central

Infection of Spodoptera littoralis SL2 cells with the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) results in apoptosis and low yields of viral progeny, in contrast to infection with S. littoralis nucleopolyhedrovirus (SlNPV). By cotransfecting SL2 cells with AcMNPV genomic DNA and a cosmid library representing the complete SlNPV genome, we were able to rescue AcMNPV replication and to isolate recombinant virus vAcSL2, which replicated efficiently in SL2 cells. Moreover, vAcSL2 showed enhanced infectivity for S. littoralis larvae compared to AcMNPV. The genome of vAcSL2 carried a 519-bp insert fragment that increased the distance between the TATA element and the transcriptional initiation site (CAGT) of immediate-early gene ie0. This finding correlated with low steady-state levels of IE0 and higher steady-state levels of IE1 (the product of the ie1 gene, a major AcMNPV transactivator, and a multifunctional protein) than of IE0. Mutagenesis of the ie0 promoter locus by insertion of the chloramphenical acetyltransferase (cat) gene yielded a new recombinant AcMNPV with replication properties identical to those of vAcSL2. Thus, the analysis indicated that increasing the steady-state levels of IE1 relative to IE0 should enable AcMNPV replication in SL2 cells. This suggestion was confirmed by constructing a recombinant AcMNPV bearing an extra copy of the ie1 gene under the control of the Drosophila hsp70 promoter. These results suggest that IE0 plays a role in the regulation of AcMNPV infection and show, for the first time, that significant improvement in the ability of AcMNPV to replicate in a poorly permissive cell line and organism can be achieved by increasing the expression of the main multiple functional protein, IE1. PMID:12477858

Lu, Liqun; Du, Quansheng; Chejanovsky, Nor

2003-01-01

114

Early Reading Success and Its Relationship to Reading Achievement and Reading Volume: Replication of "10 Years Later"  

ERIC Educational Resources Information Center

Cunningham and Stanovich reported a longitudinal investigation over 10 years that examined the unique influence of exposure to print in explaining individual differences on various measures of reading achievement and declarative (general) knowledge. The present study replicated their investigation with a larger number of participants and…

Sparks, Richard L.; Patton, Jon; Murdoch, Amy

2014-01-01

115

Murine gammaherpesvirus 68 open reading frame 45 plays an essential role during the immediate-early phase of viral replication.  

PubMed

Murine gammaherpesvirus 68 (MHV-68) has been developed as a model for the human gammaherpesviruses Epstein-Barr virus and human herpesvirus 8/Kaposi's sarcoma-associated herpesvirus (HHV-8/KSHV), which are associated with several types of human diseases. Open reading frame 45 (ORF45) is conserved among the members of the Gammaherpesvirinae subfamily and has been suggested to be a virion tegument protein. The repression of ORF45 expression by small interfering RNAs inhibits MHV-68 viral replication. However, the gene product of MHV-68 ORF45 and its function have not yet been well characterized. In this report, we show that MHV-68 ORF45 is a phosphorylated nuclear protein. We constructed an ORF45-null MHV-68 mutant virus (45STOP) by the insertion of translation termination codons into the portion of the gene encoding the N terminus of ORF45. We demonstrated that the ORF45 protein is essential for viral gene expression immediately after the viral genome enters the nucleus. These defects in viral replication were rescued by providing ORF45 in trans or in an ORF45-null revertant (45STOP.R) virus. Using a transcomplementation assay, we showed that the function of ORF45 in viral replication is conserved with that of its KSHV homologue. Finally, we found that the C-terminal 23 amino acids that are highly conserved among the Gammaherpesvirinae subfamily are critical for the function of ORF45 in viral replication. PMID:15795297

Jia, Qingmei; Chernishof, Vasili; Bortz, Eric; Mchardy, Ian; Wu, Ting-Ting; Liao, Hsiang-I; Sun, Ren

2005-04-01

116

Modulation of in vitro transformation and the early and late modes of DNA replication of uv-irradiation Syrian hamster cells by caffeine  

SciTech Connect

The effect of caffeine on post-uv DNA replication was studied to determine its relevance to carcinogenesis. The level of uv-induced transformed colonies of Syrian hamster embryo cells (HEC) was increased up to fivefold when caffeine was added to cells between 0 and 6 h post-uv. The greatest increase was observed when the interval between uv irradiation and caffeine addition was 4 h. Two modes of DNA replication occurred after uv irradiation. During the early mode (0 to 3 h post-uv) the size of nascent strands, as measured by alkaline sucrose sedimentation, was smaller than those in nonirradiated cells, whereas during the late mode they recovered to normal size. Caffeine inhibited the rate of elongation of nascent strands during the early mode. When caffeine was added immediately after uv irradiation, the conversion of the early mode to the late mode was inhibited. Studies on the effects of caffeine have now been extended to the late mode. While caffeine has little effect with the fd elements beginning from the 10th day after irradiation is connected with their proliferation but not with the migration out from lymphoid organs.

Doniger, J.; DiPaolo, J.A.

1981-09-01

117

In vivo intratumoral Epstein-Barr virus replication is associated with XBP1 activation and early-onset post-transplant lymphoproliferative disorders with prognostic implications.  

PubMed

Post-transplant lymphoproliferative disorders are life-threatening complications following hematopoietic or solid organ transplantation. They represent a spectrum of mostly EBV-driven lymphoplasmacytic proliferations. While the oncogenic effect of EBV is related to latent infection, lytic infection also has a role in lymphomagenesis. In vitro, EBV replication is linked to plasma cell differentiation and XBP1 activation, although this phenomenon has never been addressed in vivo. We analyzed for the first time latent and lytic intratumoral EBV infection in a series of 35 adult patients with a diagnosis of post-transplant lymphoproliferative disorder (26M/9F, median age 54 years). A complete EBV study was performed including the analysis of the latent EBER, latent membrane protein-11, and EBV nuclear antigens as well as the immediate-early BZLF1/ZEBRA and early BMRF1/EADE31 lytic genes. XBP1 activation was assessed by nuclear protein expression. EBV infection was observed in 28 (80%) cases being latency II and III the most frequently observed 22 (79%). Intratumoral EBV replication was detected in 17 (60%) cases. Among these, XBP1 activation was observed in 11/12 evaluable cases associated with strong cytoplasmic immunoglobulin expression consistent with plasma cell differentiation. Intriguingly, the combination of latency III infection and EBV replication identified a high-risk subgroup of patients with significantly shorter survival (overall survival at 1 year 18% vs 48%) and early-onset (median of 7 vs 26 months) post-transplant lymphoproliferative disorder. Moreover, these patients appear to be more heavily immunosuppressed, so they exhibit lower rates of rejection and graft vs host disease but higher rates of cytomegalovirus reactivation. In conclusion, EBV replication is associated with plasma cell differentiation and XBP1 activation with prognostic implications. Both latency III and lytic EBV infection are related to aggressive and early-onset post-transplant lymphoproliferative disorder. These results suggest that immunohistochemical study of latent and lytic EBV genes in the clinical practice may help to select higher-risk patients to new therapies including antiviral treatments. PMID:24762547

Gonzalez-Farre, Blanca; Rovira, Jordina; Martinez, Daniel; Valera, Alexandra; Garcia-Herrera, Adriana; Marcos, Maria Angeles; Sole, Carla; Roue, Gael; Colomer, Dolors; Gonzalvo, Elena; Ribera-Cortada, Imma; Araya, Monica; Lloreta, Josep; Colomo, Luis; Campo, Elias; Lopez-Guillermo, Armando; Martinez, Antonio

2014-12-01

118

Mutational analysis of open reading frames 62 and 71, encoding the varicella-zoster virus immediate-early transactivating protein, IE62, and effects on replication in vitro and in skin xenografts in the SCID-hu mouse in vivo.  

PubMed

The varicella-zoster virus (VZV) genome has unique long (U(L)) and unique short (U(S)) segments which are flanked by internal repeat (IR) and terminal repeat (TR) sequences. The immediate-early 62 (IE62) protein, encoded by open reading frame 62 (ORF62) and ORF71 in these repeats, is the major VZV transactivating protein. Mutational analyses were done with VZV cosmids generated from parent Oka (pOka), a low-passage clinical isolate, and repair experiments were done with ORF62 from pOka and vaccine Oka (vOka), which is derived from pOka. Transfections using VZV cosmids from which ORF62, ORF71, or the ORF62/71 gene pair was deleted showed that VZV replication required at least one copy of ORF62. The insertion of ORF62 from pOka or vOka into a nonnative site in U(S) allowed VZV replication in cell culture in vitro, although the plaque size and yields of infectious virus were decreased. Targeted mutations in binding sites reported to affect interaction with IE4 protein and a putative ORF9 protein binding site were not lethal. Single deletions of ORF62 or ORF71 from cosmids permitted recovery of infectious virus, but recombination events repaired the defective repeat region in some progeny viruses, as verified by PCR and Southern hybridization. VZV infectivity in skin xenografts in the SCID-hu model required ORF62 expression; mixtures of single-copy recombinant Oka Delta 62 (rOka Delta 62) or rOka Delta 71 and repaired rOka generated by recombination of the single-copy deletion mutants were detected in some skin implants. Although insertion of ORF62 into the nonnative site permitted replication in cell culture, ORF62 expression from its native site was necessary for cell-cell spread in differentiated human skin tissues in vivo. PMID:12719553

Sato, Bunji; Ito, Hideki; Hinchliffe, Stewart; Sommer, Marvin H; Zerboni, Leigh; Arvin, Ann M

2003-05-01

119

Mutational Analysis of Open Reading Frames 62 and 71, Encoding the Varicella-Zoster Virus Immediate-Early Transactivating Protein, IE62, and Effects on Replication In Vitro and in Skin Xenografts in the SCID-hu Mouse In Vivo  

PubMed Central

The varicella-zoster virus (VZV) genome has unique long (UL) and unique short (US) segments which are flanked by internal repeat (IR) and terminal repeat (TR) sequences. The immediate-early 62 (IE62) protein, encoded by open reading frame 62 (ORF62) and ORF71 in these repeats, is the major VZV transactivating protein. Mutational analyses were done with VZV cosmids generated from parent Oka (pOka), a low-passage clinical isolate, and repair experiments were done with ORF62 from pOka and vaccine Oka (vOka), which is derived from pOka. Transfections using VZV cosmids from which ORF62, ORF71, or the ORF62/71 gene pair was deleted showed that VZV replication required at least one copy of ORF62. The insertion of ORF62 from pOka or vOka into a nonnative site in US allowed VZV replication in cell culture in vitro, although the plaque size and yields of infectious virus were decreased. Targeted mutations in binding sites reported to affect interaction with IE4 protein and a putative ORF9 protein binding site were not lethal. Single deletions of ORF62 or ORF71 from cosmids permitted recovery of infectious virus, but recombination events repaired the defective repeat region in some progeny viruses, as verified by PCR and Southern hybridization. VZV infectivity in skin xenografts in the SCID-hu model required ORF62 expression; mixtures of single-copy recombinant Oka?62 (rOka?62) or rOka?71 and repaired rOka generated by recombination of the single-copy deletion mutants were detected in some skin implants. Although insertion of ORF62 into the nonnative site permitted replication in cell culture, ORF62 expression from its native site was necessary for cell-cell spread in differentiated human skin tissues in vivo. PMID:12719553

Sato, Bunji; Ito, Hideki; Hinchliffe, Stewart; Sommer, Marvin H.; Zerboni, Leigh; Arvin, Ann M.

2003-01-01

120

Early Events following Experimental Infection with Peste-Des-Petits Ruminants Virus Suggest Immune Cell Targeting  

PubMed Central

Peste-des-petits ruminants virus (PPRV) is a viral pathogen that causes a devastating plague of small ruminants. PPRV is an economically significant disease that continues to be a major obstacle to the development of sustainable agriculture across the developing world. The current understanding of PPRV pathogenesis has been heavily assumed from the closely related rinderpest virus (RPV) and other morbillivirus infections alongside data derived from field outbreaks. There have been few studies reported that have focused on the pathogenesis of PPRV and very little is known about the processes underlying the early stages of infection. In the present study, 15 goats were challenged by the intranasal route with a virulent PPRV isolate, Côte d’Ivoire ’89 (CI/89) and sacrificed at strategically defined time-points post infection to enable pre- and post-mortem sampling. This approach enabled precise monitoring of the progress and distribution of virus throughout the infection from the time of challenge, through peak viraemia and into a period of convalescence. Observations were then related to findings of previous field studies and experimental models of PPRV to develop a clinical scoring system for PPRV. Importantly, histopathological investigations demonstrated that the initial site for virus replication is not within the epithelial cells of the respiratory mucosa, as has been previously reported, but is within the tonsillar tissue and lymph nodes draining the site of inoculation. We propose that virus is taken up by immune cells within the respiratory mucosa which then transport virus to lymphoid tissues where primary virus replication occurs, and from where virus enters circulation. Based on these findings we propose a novel clinical scoring methodology for PPRV pathogenesis and suggest a fundamental shift away from the conventional model of PPRV pathogenesis. PMID:23418464

Pope, Robert A.; Parida, Satya; Bailey, Dalan; Brownlie, Joe; Barrett, Thomas; Banyard, Ashley C.

2013-01-01

121

Multi-events earthquake early warning algorithm using a Bayesian approach  

NASA Astrophysics Data System (ADS)

Current earthquake early warning (EEW) systems lack the ability to appropriately handle multiple concurrent earthquakes, which led to many false alarms during the 2011 Tohoku earthquake sequence in Japan. This paper uses a Bayesian probabilistic approach to handle multiple concurrent events for EEW. We implement the theory using a two-step algorithm. First, an efficient approximate Bayesian model class selection scheme is used to estimate the number of concurrent events. Then, the Rao-Blackwellized Importance Sampling method with a sequential proposal probability density function is used to estimate the earthquake parameters, that is hypocentre location, origin time, magnitude and local seismic intensity. A real data example based on 2 months data (2011 March 9-April 30) around the time of the 2011 M9 Tohoku earthquake is studied to verify the proposed algorithm. Our algorithm results in over 90 per cent reduction in the number of incorrect warnings compared to the existing EEW system operating in Japan.

Wu, S.; Yamada, M.; Tamaribuchi, K.; Beck, J. L.

2015-02-01

122

Psychopathy-related differences in selective attention are captured by an early event-related potential.  

PubMed

According to the response modulation model, the poorly regulated behavior of psychopathic individuals reflects a problem reallocating attention to process peripheral information while engaged in goal-directed behavior (Patterson & Newman, 1993). We evaluated this tenet using male prisoners and an early event-related potential component (P140) to index attentional processing. In all task conditions, participants viewed and categorized letter stimuli that could also be used to predict electric shocks. Instructions focused attention either on the threat-relevant dimension of the letters or an alternative, threat-irrelevant dimension. Offenders with high scores on Hare's (2003) Psychopathy Checklist-Revised displayed a larger P140 under alternative versus threat conditions. Beyond demonstrating psychopathy-related differences in early attention, these findings suggest that psychopathic individuals find it easier to ignore threat-related distractors when they are peripheral versus central to their goal-directed behavior. PMID:22452763

Baskin-Sommers, Arielle; Curtin, John J; Li, Wen; Newman, Joseph P

2012-10-01

123

Controls of event-based pesticide leaching in natural soils: A systematic study based on replicated field scale irrigation experiments  

NASA Astrophysics Data System (ADS)

Tile drains strongly influence the water cycle in agricultural catchment in terms of water quantity and quality. The connectivity of preferential flow to tile drains can create shortcuts for rapid transport of solutes into surface waters. The leaching of pesticides can be linked to a set of main factors including, rainfall characteristics, soil moisture, chemical properties of the pesticides, soil properties, and preferential flow paths. The connectivity of the macropore system to the tile drain is crucial for pesticide leaching. Concurring influences of the main factors, threshold responses and the role of flow paths are still poorly understood. The objective of this study is to investigate these influences by a replica series of three irrigation experiments on a tile drain field site using natural and artificial tracers together with applied pesticides. We found a clear threshold behavior in the initialization of pesticide transport that was different between the replica experiments. Pre-event soil water contributed significantly to the tile drain flow, and creates a flow path for stored pesticides from the soil matrix to the tile drain. This threshold is controlled by antecedent soil moisture and precipitation characteristics, and the interaction between the soil matrix and preferential flow system. Fast transport of pesticides without retardation and the remobilization could be attributed to this threshold and the interaction between the soil matrix and the preferential flow system. Thus, understanding of the detailed preferential flow processes clearly enhances the understanding of pesticide leaching on event and long term scale, and can further improve risk assessment and modeling approaches.

Klaus, Julian; Zehe, Erwin; Elsner, Martin; Palm, Juliane; Schneider, Dorothee; Schröder, Boris; Steinbeiss, Sibylle; van Schaik, Loes; West, Stephanie

2014-05-01

124

Rapid Eye Movement Sleep Behavioral Events: A New Marker for Neurodegeneration in Early Parkinson Disease?  

PubMed Central

Objective: To analyze potential markers in sleep for early recognition of neurodegenerative disease in newly diagnosed, unmedicated patients with Parkinson disease (PD) compared to controls. Methods: Videopolysomnography (vPSG) was available in 158 newly diagnosed, unmedicated patients with PD and 110 age-, sex-, and education-matched healthy controls (HC). Rapid eye movement (REM) sleep was analyzed for REM without atonia (RWA) and studied by review of time-synchronized video. Motor behaviors and/or vocalizations in REM sleep with a purposeful component other than comfort moves were identified as REM sleep behavioral events (RBE). Two or more events had to be present to be classified as “RBE positive.” RBE subjects included rapid eye movement sleep behavior disorder (RBD) and non-RBD subjects based on the presence or absence of RWA > 18.2%. Results: RBE were detected in 81 of 158 patients with de novo PD (51%) and 17 of 110 HC (15%) (P < 0.001). RBD was identified in 40/81 RBE-positive patients with PD (25% of all PD patients) and 2 of 17 RBE-positive HC (2% of all controls). RBE-positive patients showed no specific motor or neuropsychological features compared to RBE-negative patients. Patients with PD and HC with RBE had more REM sleep (P = 0.002) and a higher periodic leg movements in sleep index (P = 0.022) compared to subjects without RBE. Conclusion: This first description of REM sleep behavioral events (RBE) shows it occurs more frequently in patients with de novo Parkinson disease (PD) than in healthy controls and may be an early sign of neurodegeneration and precede rapid eye movement sleep behavior disorder (RBD). There is no specific phenotype of PD associated with newly defined RBE or RBD at this early stage. Citation: Sixel-Döring F; Trautmann E; Mollenhauer B; Trenkwalder C. Rapid eye movement sleep behavioral events: a new marker for neurodegeneration in early Parkinson disease? SLEEP 2014;37(3):431-438. PMID:24587564

Sixel-Döring, Friederike; Trautmann, Ellen; Mollenhauer, Brit; Trenkwalder, Claudia

2014-01-01

125

Early maritime economy and El Nino events at Quebrada Tacahuay, Peru  

USGS Publications Warehouse

The archaeological site of Quebrada Tacahuay, Peru, dates to 12,700 to 12,500 calibrated years before the present (10,770 to 10,530 carbon-14 years before the present). It contains some of the oldest evidence of maritime- based economic activity in the New World. Recovered materials include a hearth, lithic cutting tools and flakes, and abundant processed marine fauna, primarily seabirds and fish. Sediments below and above the occupation layer were probably generated by El Nino events, indicating that El Nino was active during the Pleistocene as well as during the early and middle Holocene.

Keefer, D.K.; DeFrance, S.D.; Moseley, M.E.; Richardson, J. B., III; Satterlee, D.R.; Day-Lewis, A.

1998-01-01

126

Early Cretaceous High Arctic Magmatism and the Oceanic Anoxic Event 1a  

NASA Astrophysics Data System (ADS)

The High Arctic Large Igneous Province (HALIP) comprises Early and Late Cretaceous igneous deposits extending from the Canadian Arctic Archipelago in the west to the east Siberian Island in the east. It also includes anomalously thick igneous crust in the Canada Basin. We have mapped out the distribution of HALIP volcanic extrusive and intrusive rocks in the Barents Sea based on field work and borehole data in Svalbard and extensive geophysical data in the offshore areas. The volcanic extrusive and intrusive rocks in the Barents Sea Large Igneous Province (BLIP) are present in a 700 000 km2 large region extending across the northern and eastern Barents Sea. The igneous complex is dominated by a large sill complex intruded into organic-rich Jurassic to Permian age sequences in the East Barents Basin, on Svalbard and on Franz Josef Land. Geochemical data suggest that the tholeiitic igneous rocks were likely formed during a short-lived melting event. New geochronology data (U/Pb on zircons) suggest that the igneous event occurred in the Early Aptian or Barremian. Marine and terrestrial Cretaceous shales and sandstones of the Carolinefjellet, Helvetiafjellet, and Rurikfjellet formations have recently been cored in four boreholes on Svalbard (the Longyearbyen CO2 Laboratory). We have completed a comprehensive analytical program of samples from the boreholes, including geochronology (Ar/Ar and zircon U/Pb), biostratigraphy (palynology), and geochemistry (ICP-MS, RockEval, TOC). In the boreholes, the Barremian-early Aptian Helvetiafjellet Formation is overlaid by early Aptian sapropel-rich shales of the Carolinefjellet Formation. Carbon isotope data reveal a negative excursion in this anoxic interval, most likely representing the Oceanic Anoxic Event 1a (OAE1a). The geochronology data suggest that the intrusive BLIP volcanism occurred at the tim e of the early Aptian OAE1a. We propose that the link between the BLIP and the OAE1a is a massive release of thermogenic methane from contact aureoles of thermally altered sediments surrounding the hot sill intrusions in the BLIP. We estimate that about 9000 Gt of carbon was potentially degassed from the contact aureoles in the East Barents Basin. A rapid release of isotopically light metamorphic greenhouse gases to the atmosphere is therefore a possible trigger for the OAE1a and the associated negative carbon isotope excursion. Subsequent lava degassing from the HALIP or the Ontong Java Plateau may have caused the subsequent increase in isotopically heavy carbon.

Planke, Sverre; Polteau, Stephane; Faleide, Jan Inge; Svensen, Henrik; Myklebust, Reidun; Midtkandal, Ivar; Corfu, Fernando

2014-05-01

127

Early viral replication and induced or constitutive immunity in rainbow trout families with differential resistance to Infectious hematopoietic necrosis virus (IHNV)  

USGS Publications Warehouse

The main objective of this study was to assess correlates of innate resistance in rainbow trout full-sibling families that differ in susceptibility to Infectious hematopoietic necrosis virus (IHNV). As part of a commercial breeding program, full-sibling families were challenged with IHNV by waterborne exposure at the 1 g size to determine susceptibility to IHNV. Progeny from select families (N = 7 families) that varied in susceptibility (ranging from 32 to 90% cumulative percent mortality (CPM)) were challenged again at the 10 g size by intra-peritoneal injection and overall mortality, early viral replication and immune responses were evaluated. Mortality challenges included 20–40 fish per family while viral replication and immune response studies included 6 fish per family at each time point (24, 48 and 72 h post-infection (hpi)). CPM at the 1 g size was significantly correlated with CPM at the 10 g size, indicating that inherent resistance was a stable trait irrespective of size. In the larger fish, viral load was measured by quantitative reverse-transcriptase PCR in the anterior kidney and was a significant predictor of family disease outcome at 48 hpi. Type I interferon (IFN) transcript levels were significantly correlated with an individual's viral load at 48 and 72 hpi, while type II IFN gene expression was significantly correlated with an individual's viral load at 24 and 48 hpi. Mean family type I but not type II IFN gene expression was weakly associated with susceptibility at 72 hpi. There was no association between mean family susceptibility and the constitutive expression of a range of innate immune genes (e.g. type I and II IFN pathway genes, cytokine and viral recognition receptor genes). The majority of survivors from the challenge had detectable serum neutralizing antibody titers but no trend was observed among families. This result suggests that even the most resistant families experienced sufficient levels of viral replication to trigger specific immunity. In summary, disease outcome for each family was determined very early in the infection process and resistance was associated with lower early viral replication.

Purcell, M.K.; LaPatra, S.E.; Woodson, J.C.; Kurath, G.; Winton, J.R.

2010-01-01

128

Inhibition of S-Phase Cyclin-Dependent Kinase Activity Blocks Expression of Epstein-Barr Virus Immediate-Early and Early Genes, Preventing Viral Lytic Replication  

Microsoft Academic Search

The induction of lytic replication of the Epstein-Barr virus (EBV) completely arrests cell cycle progression, in spite of elevation of S-phase cyclin-dependent kinase (CDK) activity, thereby causing accumulation of hyperphosphorylated forms of retinoblastoma (Rb) protein (A. Kudoh, M. Fujita, T. Kiyono, K. Kuzushima, Y. Sugaya, S. Izuta, Y. Nishiyama, and T. Tsurumi, J. Virol. 77:851-861, 2003). Thus, the EBV lytic

Ayumi Kudoh; Tohru Daikoku; Yutaka Sugaya; Hiroki Isomura; Masatoshi Fujita; Tohru Kiyono; Yukihiro Nishiyama; Tatsuya Tsurumi

2004-01-01

129

Effects of 60 Hz electromagnetic fields on early growth in three plant species and a replication of previous results  

SciTech Connect

In an attempt to replicate the findings of Smith et al., seeds of Raphanus sativus L. (radish), Sinapsis alba L. (mustard), and Hordeum vulgare L. (barley) were grown for between 9 and 21 days in continuous electromagnetic fields (EMFs) at ion-cyclotron resonance conditions for stimulation of Ca{sup 2+} (B{sub H} = 78.3 {micro}T, B{sub HAC} = 40 {micro}T peak-peak at 60 Hz, B{sub v} = 0). On harvesting, radish showed results similar to those of Smith et al. Dry stem weight and plant height were both significantly greater (Mann-Whitney tests, Ps < 0.05) in EMF-exposed plants than in control plants in each EMF experiment. Wet root weight was significantly greater in EMF-exposed plants in two out of three experiments, as were dry leaf weight, dry whole weight, and stem diameter. Dry root weight, wet leaf weight, and wet whole weight were significantly greater in EMF-exposed plants in one of three experiments. All significant differences indicated an increase in weight or size in the EMF-exposed plants. In each of the sham experiments, no differences between exposed and control plants were evident. Mustard plants failed to respond to the EMFs in any of the plant parameters measured. In one experiment, barley similarly failed to respond; but in another showed significantly greater wet root weight and significantly smaller stem diameter and dry seed weight at the end of the experiment in exposed plants compared to control plants. Although these results give no clue about the underlying bioelectromagnetic mechanism, they demonstrate that, at least for one EMF-sensitive biosystem, results can be independently replicated in another laboratory. Such replication is crucial in establishing the validity of bioelectromagnetic science.

Davis, M.S. [Univ. of Sunderland (United Kingdom). Ecology Centre] [Univ. of Sunderland (United Kingdom). Ecology Centre

1996-05-01

130

Increased Axonal Ribosome Numbers Is an Early Event in the Pathogenesis of Amyotrophic Lateral Sclerosis  

PubMed Central

Myelinating glia cells support axon survival and functions through mechanisms independent of myelination, and their dysfunction leads to axonal degeneration in several diseases. In amyotrophic lateral sclerosis (ALS), spinal motor neurons undergo retrograde degeneration, and slowing of axonal transport is an early event that in ALS mutant mice occurs well before motor neuron degeneration. Interestingly, in familial forms of ALS, Schwann cells have been proposed to slow disease progression. We demonstrated previously that Schwann cells transfer polyribosomes to diseased and regenerating axons, a possible rescue mechanism for disease-induced reductions in axonal proteins. Here, we investigated whether elevated levels of axonal ribosomes are also found in ALS, by analysis of a superoxide dismutase 1 (SOD1)G93A mouse model for human familial ALS and a patient suffering from sporadic ALS. In both cases, we found that the disorder was associated with an increase in the population of axonal ribosomes in myelinated axons. Importantly, in SOD1G93A mice, the appearance of axonal ribosomes preceded the manifestation of behavioral symptoms, indicating that upregulation of axonal ribosomes occurs early in the pathogenesis of ALS. In line with our previous studies, electron microscopy analysis showed that Schwann cells might serve as a source of axonal ribosomes in the disease-compromised axons. The early appearance of axonal ribosomes indicates an involvement of Schwann cells early in ALS neuropathology, and may serve as an early marker for disease-affected axons, not only in ALS, but also for other central and peripheral neurodegenerative disorders. PMID:24498056

Verheijen, Mark H. G.; Peviani, Marco; Hendricusdottir, Rita; Bell, Erin M.; Lammens, Martin; Smit, August B.; Bendotti, Caterina; van Minnen, Jan

2014-01-01

131

The early Toarcian anoxic event: what the beginning and the end of the story are?  

NASA Astrophysics Data System (ADS)

The early Toarcian anoxic event: what the beginning and the end of the story are? E. Mattioli (1), J. Plancq (1), and B. Rauksik (2) (1) UMR 5125 PEPS, CNRS, France; Université Lyon 1, Campus de la DOUA, Bâtiment Géode, 69622 Villeurbanne Cedex, France (emanuela.mattioli@univ-lyon1.fr) (2) Department of Earth and Environmental Sciences, University of Pannonia, Veszprém, Hungary The early Toarcian anoxic event (T-OAE) and the associated biotic crisis have received much attention in the last decade. However, the events forewarning the crisis as well as its aftermath are still poorly known. The T-OAE coincides with a prominent carbon isotope negative excursion (T-CIE) that is preceded by an excursion of similar intensity at the Pliensbachian-Toarcian boundary (Hesselbo et al., 2007). The onset of T-CIE occurred some 700 kyr later than the end of the Boundary-CIE (Suan et al., 2008a). This succession of events demonstrates that the T-OAE was a complex suite of environmental perturbations. In this work, we focused on calcareous nannofossil assemblages occurring in the Peniche section (Portugal) during the Boundary-CIE with the aim to understand if calcifying plankton reacted in a similar/different way to the two CIEs. Also, two sections and one borehole located along a W-E transect, along the NW-Tethyan shelf (in the Yorkshire coast, in the E Paris Basin, and in Mecsek Basin, respectively), were investigated to assess which way calcareous nannoplankton recovered after the crisis, and if the recovery was a synchronous event. The production by nannoplankton collapsed during the T-CIE, as demonstrated by the lowest absolute abundance of nannofossils measured in Peniche and other studied sites (Mattioli et al., 2008). Besides this nannofossil abundance decrease, also the size of the incertae sedis Schizosphaerella test was drastically reduced (Suan et al., 2008b). If a similar size decrease is also recorded during the Boundary-CIE, calcareous nannofossil abundances are very high, and assemblages seem not to record an environmental stress. The study of the calcareous nannofossil assemblages along a W-E transect in the NW-Tethyan shelf shows a progressive, but significant decrease in abundance fluxes from W to E, and the lowest fluxes are recorded in the Mecsek Basin that was closer to the oceanic Tethys. A progressive re-colonization of the lower photic zone by deep-dweller nannofossil taxa, mainly Crepidolithus crassus, is observed in the aftermath of the anoxic event, but this re-colonization occurred earlier in the Mecsek Basin, probably because of more effective marine connections with the open-ocean. This set of data indicates that: (1) environmental deterioration was recurrent until it reached its acme during the T-OAE; (2) post-crisis recovery of surface water environments was not synchronous, depending on palaeoceanographic conditions occurring within the western Tethys. Our scenario implies an intrinsically long-lasting suite of events and argues in favour of long-lasting CO2 degassing, most likely related to the emplacement of the large igneous province of Karoo-Ferrar as the main cause of the Toarcian environmental perturbations. Acknowledgements. We would like to thank John McArthur for kindly providing us the Toarcian samples from the Yorkshire coast. Hesselbo et al. (2007). Carbon-isotope record of the Early Jurassic (Toarcian) oceanic anoxic event from fossil wood and marine carbonate (Lusitanian Basin, Portugal), Earth Planet. Sci. Lett. 253, 455- 470. Mattioli et al. (2008). Calcareous nannoplankton changes across the early Toarcian oceanic anoxic event in the western Tethys. Paleoceanography 23, PA3208, doi:10.1029/2007PA001435, 2008. Suan et al. (2008a). Duration of the Early Toarcian carbon isotope excursion deduced from spectral analysis: Consequence for its possible causes. Earth Planet. Sci. Lett. 267, 666-679. Suan et al. (2008b). Evidence for major environmental perturbation prior to and during the Toarcian (Early Jurassic) oceanic anoxic event from the Lusitanian Basin, Portugal. Paleoceanography 23,

Mattioli, Emanuela; Plancq, Julien; Raucsik, Béla

2010-05-01

132

Heterologous microarray experiments allow the identification of the early events associated with potato tuber cold sweetening  

PubMed Central

Background Since its discovery more than 100 years ago, potato (Solanum tuberosum) tuber cold-induced sweetening (CIS) has been extensively investigated. Several carbohydrate-associated genes would seem to be involved in the process. However, many uncertainties still exist, as the relative contribution of each gene to the process is often unclear, possibly as the consequence of the heterogeneity of experimental systems. Some enzymes associated with CIS, such as ?-amylases and invertases, have still to be identified at a sequence level. In addition, little is known about the early events that trigger CIS and on the involvement/association with CIS of genes different from carbohydrate-associated genes. Many of these uncertainties could be resolved by profiling experiments, but no GeneChip is available for the potato, and the production of the potato cDNA spotted array (TIGR) has recently been discontinued. In order to obtain an overall picture of early transcriptional events associated with CIS, we investigated whether the commercially-available tomato Affymetrix GeneChip could be used to identify which potato cold-responsive gene family members should be further studied in detail by Real-Time (RT)-PCR (qPCR). Results A tomato-potato Global Match File was generated for the interpretation of various aspects of the heterologous dataset, including the retrieval of best matching potato counterparts and annotation, and the establishment of a core set of highly homologous genes. Several cold-responsive genes were identified, and their expression pattern was studied in detail by qPCR over 26 days. We detected biphasic behaviour of mRNA accumulation for carbohydrate-associated genes and our combined GeneChip-qPCR data identified, at a sequence level, enzymatic activities such as ?-amylases and invertases previously reported as being involved in CIS. The GeneChip data also unveiled important processes accompanying CIS, such as the induction of redox- and ethylene-associated genes. Conclusion Our Global Match File strategy proved critical for accurately interpretating heterologous datasets, and suggests that similar approaches may be fruitful for other species. Transcript profiling of early events associated with CIS revealed a complex network of events involving sugars, redox and hormone signalling which may be either linked serially or act in parallel. The identification, at a sequence level, of various enzymes long known as having a role in CIS provides molecular tools for further understanding the phenomenon. PMID:18416834

Bagnaresi, Paolo; Moschella, Anna; Beretta, Ottavio; Vitulli, Federico; Ranalli, Paolo; Perata, Pierdomenico

2008-01-01

133

Cybernetic origins of replication  

NASA Astrophysics Data System (ADS)

An evolutionary progression leading toward replication is resolved into several phases; (a) the replication of RNA segments by self-priming and -templating, (b) the replication of single stranded molecules by elongation and controlled scission, (c) replication of complementary duplexes and (d) replication of DNA. The initial phase is suggested by evidence for the existence of tandem repeats in an early population of molecules presumed to be ancestral to today's structurl RNAs. Relics of these repeats are seen in the positioning of sequence matches between transfer and ribosomal RNAs. Conservation of the positions of the matches is indicated by persistence of a periodicity in their spacings along the molecules. Selection is viewed as a vector, with a source and a focus. The evolutionary progression entails shifts in the source of selection, from external catalysts to the replicating molecule itself, and in its focus, from substrate to replicator, to the products of the replicator's activity. When the source and focus of selection are the same selection becomes internalized, and replication and Darwinian evolution follow. Catalytic specificity is regarded as an antecedent to natural selection. Shifting of the source and focus of selection and switches in evolution's ‘vehicle’, the most fundamental thing that evolves, result in profound changes in the modes of evolution. Control provides a conceptual framwork within which entry into a Darwinian mode of evolution, and ultimately liberation from Darwinian evolution might be explained.

Bloch, David P.

1988-03-01

134

Temporal sequence and spatial distribution of early events of fertilization in single sea urchin eggs  

SciTech Connect

Measurements and observations of five early events of fertilization, singly and in pairs, from single sea urchin eggs have revealed the precise temporal sequence and spatial distribution of these events. In the Arbacia punctulata egg, a wave of surface contraction occurs coincident with membrane depolarization (t = 0). These two earliest events are followed by the onset of a rapid, propagated increase in cytoplasmic-free calcium at approx.23 s as measured by calcium-aequorin luminescence. The luminescence reaches its peak value by 40 s after the membrane depolarization. The luminescence remains uniformly elevated for some time before its decay over several minutes. The onset of an increase in the pyridin nucleotide (NAD(P)H) fluorescence follows the membrane depolarization at approx.51 s. The fertilization membrane begins its elevation in a wave-like fashion coincidentally with the increase in NAD(P)H fluorescence. Similar results are observed in the Lytechinus variegatus egg. The results suggest that while the increase in cytoplasmic-free calcium may be important for many changes occurring in the egg, the elevated-free calcium is not directly responsible for the propagated wave of cortical granule exocytosis. 32 references, 10 figures.

Eisen, A.; Kiehart, D.P.; Wieland, S.J.; Reynolds, G.T.

1984-11-01

135

Universal Sequence Replication, Reversible Polymerization and Early Functional Biopolymers: A Model for the Initiation of Prebiotic Sequence Evolution  

PubMed Central

Many models for the origin of life have focused on understanding how evolution can drive the refinement of a preexisting enzyme, such as the evolution of efficient replicase activity. Here we present a model for what was, arguably, an even earlier stage of chemical evolution, when polymer sequence diversity was generated and sustained before, and during, the onset of functional selection. The model includes regular environmental cycles (e.g. hydration-dehydration cycles) that drive polymers between times of replication and functional activity, which coincide with times of different monomer and polymer diffusivity. Template-directed replication of informational polymers, which takes place during the dehydration stage of each cycle, is considered to be sequence-independent. New sequences are generated by spontaneous polymer formation, and all sequences compete for a finite monomer resource that is recycled via reversible polymerization. Kinetic Monte Carlo simulations demonstrate that this proposed prebiotic scenario provides a robust mechanism for the exploration of sequence space. Introduction of a polymer sequence with monomer synthetase activity illustrates that functional sequences can become established in a preexisting pool of otherwise non-functional sequences. Functional selection does not dominate system dynamics and sequence diversity remains high, permitting the emergence and spread of more than one functional sequence. It is also observed that polymers spontaneously form clusters in simulations where polymers diffuse more slowly than monomers, a feature that is reminiscent of a previous proposal that the earliest stages of life could have been defined by the collective evolution of a system-wide cooperation of polymer aggregates. Overall, the results presented demonstrate the merits of considering plausible prebiotic polymer chemistries and environments that would have allowed for the rapid turnover of monomer resources and for regularly varying monomer/polymer diffusivities. PMID:22493682

Walker, Sara Imari; Grover, Martha A.; Hud, Nicholas V.

2012-01-01

136

Effect of metallic cations on the efficiency of DNA amplification. Implications for nucleic acid replication during early stages of life  

NASA Astrophysics Data System (ADS)

The process of catalysis of biochemical reactions has been essential since the first organic molecules appeared on Earth. As the complexity of the ensemble of primitive biomolecules was very low, primitive catalysts had necessarily to be very simple molecules or ions. The evolution of catalysts had to be in parallel with the evolution of the molecular species reacting. An example of this parallel evolution is nucleic acid polymerization. Synthesis of primitive short oligonucleotides could have been catalysed by metal ions either in solution or on the surface of minerals such as montmorillonite clays. Some oligonucleotides could start to function as templates for the synthesis of complementary copies and there is experimental evidence supporting the role also played by metal ions in this process. In later stages of evolution, a group of enzymatic proteins, nucleic acid polymerases, has been selected to catalyse nucleic acid replication. The presence of Mg2+ in the active centre of these enzymes suggests that evolution has preserved some of the primitive catalysts, including them as cofactors of more complex molecules. However, the reasons why Mg2+ was selected among other ions that possibly were present in primitive environments are unknown. In this paper we try to approach this question by analysing the amplification efficiency of the polymerase chain reaction of a DNA fragment in the presence of different metal ions. In some cases the conditions of the reaction have been displaced from optimum (by the presence of nucleotide imbalances and a suboptimal Mg2+concentration). The results obtained permit one to draw interesting conclusions about how some metallic cations can help replication to proceed in conditions of limited substrate availability, a circumstance that could have been frequent at prebiotic stages, when nucleic acid synthesis was dependent on the physico-chemical conditions of the environment.

Arribas, María; de Vicente, Aránzazu; Arias, Armando; Lázaro, Ester

2005-04-01

137

Paleoceanographic change associated with the Early Aptian Oceanic Anoxic Event in the western Tethys  

NASA Astrophysics Data System (ADS)

The Cretaceous oceanic anoxic events (OAEs) provide a good opportunity to study the biogeochemical pathways and feedbacks linked to environmental change. The early Aptian OAE, labelled OAE 1a, corresponds to one of the most studied anoxic events within the Cretaceous. This event is characterized by a positive excursion in ?13C, preceded by a pronounced negative spike. Here, we propose to improve our understanding of palaeoceanographic change leading to this event and test the proposed models by investigating phosphorus (P) and redox-sensitive trace-element (RSTE) contents in sections through lower Aptian sediments along a basin-shelf transect in the western Tethys. We complement our geochemical analysis by the analysis of organic matter contents. We selected three representative sections: Gorgo a Cerbara (central Italy) in the Umbria Marche basin, Glaise l’Ermitage (SE France) located in the Vocontian Trough and Cassis/La Bédoule (SE France) located along the Provencal platform. The general trend in P accumulation shows an increase at the onset of the early Aptian event followed by a rapid decrease. This suggests an increase in nutrient input, whereas the return to lower values through the first part of the anoxic event may be related to a weakened capacity to retain P in the sedimentary reservoir due to bottom-water oxygen depletion. This general pattern is contrasted by the data of Gorgo a Cerbara, which also show P-enrichments at the top of the Livello Selli. We compared these enrichments to the total organic carbon (TOC) values. The shales with the maximum TOC values correspond also to those with the highest P content. We calculated Corg:Ptot ratios and observed that the highest values correspond to the top of the Selli level. This is interpreted as a reflection of the decreased capacity of storing and preserving phosphorus in oxygen-depleted sediments. RSTE show similar behaviour in the basinal settings. In the section of Gorgo a Cerbara, the data for U, V, Mo, Co, As show a low background level, constrasted by different maxima in concentrations near the top of the Selli level. In the Glaise section, a weak increase is observed just after the negative spike in ?13C whereas in the Cassis/La Bédoule section, no significant enrichments have been observed in sediments equivalent to the Selli level. The different behaviour of the RSTE in the studied sections may be related to the palaeogeographic setting of the studied sections. These data seem to indicate anoxic conditions in the basin. In shallower-water environments, conditions may have been less reducing. Moreover, in Gorgo a Cerbara, three distinct enrichments have been observed. This seems to indicate fluctuations in the intensity of water-column anoxia during the shift in ?13C. Our results show that the expression of the OAE 1a is different following the palaeogeographic setting. The stratigraphic evolution of P contents suggests an increase in nutrient input at the onset of the anoxic event, just after the negative spike in ?13C. RSTE and high C:P values may indicate anoxia conditions in the deep environment characterized by several anoxic phases with intermittent return to less oxygen-depleted conditions.

Westermann, S.; Matera, V.; Fiet, N.; Thierry, A.; Follmi, K. B.

2009-12-01

138

Evidence of systematic bias in sexual over- and underperception of naturally occurring events: a direct replication of Haselton (2003) in a more gender-equal culture.  

PubMed

Error Management Theory (Haselton and Buss, 2000; Haselton and Nettle, 2006) maintains that natural selection has engineered adaptations for judgment under uncertainty to minimize the overall cost of making errors, leading to universal biases in judgments of sexual interest in men and women. This study, using a sample of het erosexual Norwegian students (n = 308), was carried out as a direct replication of Haselton's (2003) original study of naturally occurring events of sexual misperception. The results strongly supported the main hypotheses in the original study, showing that women reported being subject to opposite-sex sexual overperception far more often relative to underperception, and that this difference was small for men. In support of Error Management Theory, and in contrast to Social Role / Structure Theory expectations, the pattern of misperception for women and men was largely invariant across studies and across demographic groups within a culture. The findings suggest that cross-national differences in the level of gender inequality do not influence reports of sexual over- and underperception in women and men. Beyond sex, factors associated with more sexual overperception relative to underperception were being single, young, and having attitudes condoning casual sex. PMID:25402231

Bendixen, Mons

2014-01-01

139

Late Palaeozoic and Early Mesozoic Circum-Pacific Events and their Global Correlation  

NASA Astrophysics Data System (ADS)

The interval between the Carboniferous and Jurassic eras is marked by major changes in the structure and character of the Earth and is associated with massive earthquakes, volcanic activity, and large-scale changes of life at the Permian-Triassic and the Triassic-Jurassic boundaries. In this volume, an international assemblage of geologists reveals a wide range of information about these events in the circum-Pacific region, as a conclusion to International Geological Correlation Programme Project 272. They explore the nature of the changes in the Late Paleozoic and Early Mesozoic, and suggest issues for future investigation through the study of paleontology, biostratigraphy, tectonics, magmatic and volcanic development, ore deposition, paleography and climate. As the circum-Pacific region becomes increasingly important for hydrocarbon and mineral exploration, this book will be an invaluable resource for researchers and students in stratigraphy and paleontology.

Dickins, J. M.; Zunyi, Yang; Hongfu, Yin; Lucas, S. G.; Acharyya, S. K.

1997-07-01

140

Imaging of the early acceleration phase of the 2013-2014 Boso slow slip event  

NASA Astrophysics Data System (ADS)

We analyze GPS and seismic data to examine the spatiotemporal evolution of a slow slip event (SSE) near Boso Peninsula, central Japan, from December 2013 to January 2014. The evolution of this SSE and its associated seismicity is divided into two distinct phases. Slip initially accelerated slowly with low slip rates, low propagation speeds, and no accompanying seismicity during the early phase and then accelerated more rapidly with higher slip rates, a higher propagation speed, and local earthquake swarm activity during the later phase. The seismicity was highly correlated in space and time with slip rate, suggesting that the swarm activity was triggered by stress loading due to the slow slip. The transition from the slow to faster phase shares some similarities with the nucleation of megathrust earthquakes inferred from foreshock activities, suggesting that SSEs may provide insights into the nucleation of large earthquakes.

Fukuda, Jun'ichi; Kato, Aitaro; Obara, Kazushige; Miura, Satoshi; Kato, Teruyuki

2014-11-01

141

Auditory event-related brain potentials for an early discrimination between normal and pathological brain aging.  

PubMed

The brain as a system with gradually decreasing resources maximizes its chances by reorganizing neural networks to ensure efficient performance. Auditory event-related potentials were recorded in 28 healthy volunteers comprising 14 young and 14 elderly subjects in auditory discrimination motor task (low frequency tone - right hand movement and high frequency tone - left hand movement). The amplitudes of the sensory event-related potential components (N1, P2) were more pronounced with increasing age for either tone and this effect for P2 amplitude was more pronounced in the frontal region. The latency relationship of N1 between the groups was tone-dependent, while that of P2 was tone-independent with a prominent delay in the elderly group over all brain regions. The amplitudes of the cognitive components (N2, P3) diminished with increasing age and the hemispheric asymmetry of N2 (but not for P3) reduced with increasing age. Prolonged N2 latency with increasing age was widespread for either tone while between-group difference in P3 latency was tone-dependent. High frequency tone stimulation and movement requirements lead to P3 delay in the elderly group. The amplitude difference of the sensory components between the age groups could be due to a general greater alertness, less expressed habituation, or decline in the ability to retreat attentional resources from the stimuli in the elderly group. With aging, a neural circuit reorganization of the brain activity affects the cognitive processes. The approach used in this study is useful for an early discrimination between normal and pathological brain aging for early treatment of cognitive alterations and dementia. PMID:25206434

Dushanova, Juliana; Christov, Mario

2013-05-25

142

Auditory event-related brain potentials for an early discrimination between normal and pathological brain aging?  

PubMed Central

The brain as a system with gradually decreasing resources maximizes its chances by reorganizing neural networks to ensure efficient performance. Auditory event-related potentials were recorded in 28 healthy volunteers comprising 14 young and 14 elderly subjects in auditory discrimination motor task (low frequency tone – right hand movement and high frequency tone – left hand movement). The amplitudes of the sensory event-related potential components (N1, P2) were more pronounced with increasing age for either tone and this effect for P2 amplitude was more pronounced in the frontal region. The latency relationship of N1 between the groups was tone-dependent, while that of P2 was tone-independent with a prominent delay in the elderly group over all brain regions. The amplitudes of the cognitive components (N2, P3) diminished with increasing age and the hemispheric asymmetry of N2 (but not for P3) reduced with increasing age. Prolonged N2 latency with increasing age was widespread for either tone while between-group difference in P3 latency was tone-dependent. High frequency tone stimulation and movement requirements lead to P3 delay in the elderly group. The amplitude difference of the sensory components between the age groups could be due to a general greater alertness, less expressed habituation, or decline in the ability to retreat attentional resources from the stimuli in the elderly group. With aging, a neural circuit reorganization of the brain activity affects the cognitive processes. The approach used in this study is useful for an early discrimination between normal and pathological brain aging for early treatment of cognitive alterations and dementia. PMID:25206434

Dushanova, Juliana; Christov, Mario

2013-01-01

143

Early Spring, Severe Frost Events, and Drought Induce Rapid Carbon Loss in High Elevation Meadows  

PubMed Central

By the end of the 20th century, the onset of spring in the Sierra Nevada mountain range of California has been occurring on average three weeks earlier than historic records. Superimposed on this trend is an increase in the presence of highly anomalous “extreme” years, where spring arrives either significantly late or early. The timing of the onset of continuous snowpack coupled to the date at which the snowmelt season is initiated play an important role in the development and sustainability of mountain ecosystems. In this study, we assess the impact of extreme winter precipitation variation on aboveground net primary productivity and soil respiration over three years (2011 to 2013). We found that the duration of snow cover, particularly the timing of the onset of a continuous snowpack and presence of early spring frost events contributed to a dramatic change in ecosystem processes. We found an average 100% increase in soil respiration in 2012 and 2103, compared to 2011, and an average 39% decline in aboveground net primary productivity observed over the same time period. The overall growing season length increased by 57 days in 2012 and 61 days in 2013. These results demonstrate the dependency of these keystone ecosystems on a stable climate and indicate that even small changes in climate can potentially alter their resiliency. PMID:25207640

Arnold, Chelsea; Ghezzehei, Teamrat A.; Berhe, Asmeret Asefaw

2014-01-01

144

Membrane remodeling, an early event in benzo[alpha]pyrene-induced apoptosis  

SciTech Connect

Benzo[alpha]pyrene (B[alpha]P) often serves as a model for mutagenic and carcinogenic polycyclic aromatic hydrocarbons (PAHs). Our previous work suggested a role of membrane fluidity in B[alpha]P-induced apoptotic process. In this study, we report that B[alpha]P modifies the composition of cholesterol-rich microdomains (lipid rafts) in rat liver F258 epithelial cells. The cellular distribution of the ganglioside-GM1 was markedly changed following B[alpha]P exposure. B[alpha]P also modified fatty acid composition and decreased the cholesterol content of cholesterol-rich microdomains. B[alpha]P-induced depletion of cholesterol in lipid rafts was linked to a reduced expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase). Aryl hydrocarbon receptor (AhR) and B[alpha]P-related H{sub 2}O{sub 2} formation were involved in the reduced expression of HMG-CoA reductase and in the remodeling of membrane microdomains. The B[alpha]P-induced membrane remodeling resulted in an intracellular alkalinization observed during the early phase of apoptosis. In conclusion, B[alpha]P altered the composition of plasma membrane microstructures through AhR and H{sub 2}O{sub 2} dependent-regulation of lipid biosynthesis. In F258 cells, the B[alpha]P-induced membrane remodeling was identified as an early apoptotic event leading to an intracellular alkalinization.

Tekpli, Xavier; Rissel, Mary; Huc, Laurence [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France); Catheline, Daniel [Laboratoire de Biochimie, INRA-Agrocampus Rennes, 35042 Rennes (France); Sergent, Odile [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France); Rioux, Vincent; Legrand, Philippe [Laboratoire de Biochimie, INRA-Agrocampus Rennes, 35042 Rennes (France); Holme, Jorn A. [Division of Environmental Medicine, Norwegian Institute of Public Health, P.O. Box 404 Torshov, N-4303 Oslo (Norway); Dimanche-Boitrel, Marie-Therese [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France); Lagadic-Gossmann, Dominique, E-mail: dominique.lagadic@univ-rennes1.f [EA 4427 SeRAIC, Equipe labellisee Ligue contre le Cancer, Universite de Rennes 1, IFR 140, 35043 Rennes cedex (France)

2010-02-15

145

Aberrant Methylation of the Maspin Promoter Is an Early Event in Human Breast Cancer1  

PubMed Central

Abstract The maspin gene functions as a tumor suppressor in human breasts, and its expression is frequently lost during breast cancer progression. In vitro models of human breast cancer indicate that the loss of maspin expression is closely linked to aberrant methylation of the maspin promoter. We conducted a study on 30 archival ductal carcinoma in situ (DCIS) specimens to determine if aberrant methylation of the maspin promoter occurred in vivo, and whether it occurred early in breast cancer evolution. Healthy tissue obtained from reduction mammoplasty was used as normal control. Results from immunohistochemical analysis indicate that maspin expression is lost in a substantial fraction of DCIS specimens (57%). Bisulfite sequencing of DNA isolated from laser capture-microdissected normal and neoplastic ducts showed that loss of maspin expression was often, but not always, linked to aberrant methylation of the maspin promoter, suggesting that other mechanisms, in addition to aberrant methylation, participate and/or cooperate to silence maspin gene expression. Taken together, these results indicate that aberrant methylation of the maspin promoter is an early event in human breast cancer. PMID:15256060

Futscher, Bernard W.; O'Meara, Megan M.; Kim, Christina J.; Rennels, Margaret A.; Lu, Di; Gruman, Lynn M.; Seftor, Richard E. B.; Hendrix, Mary J. C.; Domann, Frederick E.

2004-01-01

146

Involuntary attention impairment in early Parkinson's disease: an event-related potential study.  

PubMed

Dopaminergic nigro-striatal depletion interferes with the detection of novel stimuli. This suggests that Parkinson's disease (PD) may generate from the initial stages a failure in involuntary attention (IA), which can be studied through the distraction potential, composed by the mismatch negativity (MMN), the P3a and the reorientation negativity (RON). This study analyzed IA using event-related potentials (ERPs) in patients with early PD with and without dopaminergic replacement therapy. Twenty-five medicated, and 17 non-medicated patients with early PD were studied, as well as 20 healthy control subjects. All subjects performed an auditory distraction task while a digital EEG was being recorded. The distraction potential was obtained by averaging methodology. Each wave was analyzed with a Repeated Measures ANOVA test. The MMN was obtained in all subjects and no significant differences in mean amplitude were found among the groups. There was a main effect of group for the amplitude of P3a (F(2,59)=4.8, p=0.01, ?=0.411), with a significant lower amplitude in the medicated group compared to the control group (MD=-1.03, p=0.003). RON also showed a main effect of group (F(2,59)=4.8, p=0.01, ?=0.467), with significantly lower amplitudes in non-medicated patients with respect to both the control and medicated groups (MD=1.19, p=0.01, MD=1.27, p=0.005, respectively). There were no significant differences in the latencies of any of the waves among the groups. The main finding of this study was the reduction in the IA in early PD. Reorientation of attention (RON) showed a dopaminergic modulation in these patients. These results represent the basis for future in depth studies on the involvement of IA in executive impairments in PD. PMID:21443924

Solís-Vivanco, Rodolfo; Ricardo-Garcell, Josefina; Rodríguez-Camacho, Mario; Prado-Alcalá, Roberto A; Rodríguez, Ulises; Rodríguez-Violante, Mayela; Rodríguez-Agudelo, Yaneth

2011-05-16

147

A catastrophic event in Lake Geneva region during the Early Bronze Age?  

NASA Astrophysics Data System (ADS)

Similarly to steep oceanic continental margins, lake slopes can collapse, producing large sublacustrine landslides and tsunamis. Lake sediments are excellent natural archives of such mass movements and their study allows the reconstructions of these prehistoric events, such as the 563 AD large tsunami over Lake Geneva (Kremer et al, 2012). In Lake Geneva, more than 100 km of high-resolution seismic reflection profiles reveal the late Holocene sedimentation history. The seismic record shows a succession of five large lens-shaped seismic units (A to I), characterized by transparent/chaotic seismic facies with irregular lower boundaries, and interpreted as mass-movement deposits. These units are interbedded with parallel, continuous and strong amplitude reflections, interpreted as the 'background' lake sediments. The oldest dated mass movement (Unit D) covers a surface of 22 km2 in the deep basin, near the city of Lausanne. This deposit has an estimated minimum volume of 0.18 km3 and thus was very likely tsunamigenic (Kremer et al, 2012). A 12-m-long sediment core confirms the seismic interpretation of the mass movement unit and shows that the uppermost 3 m of Unit D are characterized by deformed hemipelagic sediments topped by a 5 cm thick turbidite. This deposit can be classified as a slump whose scar can be interpreted in the seismic data and visualized by multibeam bathymetry. This slump of Lausanne was likely triggered by an earthquake but a spontaneous slope collapse cannot be excluded (Girardclos et al, 2007). Radiocarbon dating of plant macro-remains reveals that the unit D happened during Early Bronze Age. Three other mass wasting deposits occurred during the same time period and may have been triggered during the same event, either by a single earthquake or by a tsunami generated by the slump of Lausanne. Although the exact trigger mechanism of the all these mass-wasting deposits remains unknown, a tsunami likely generated by this event may have affected the installation of palafittic villages on the shore of Lake Geneva during the Early Bronze Age. References: Girardclos S., Schmidt O.T., Sturm M., Ariztegui D., Pugin A., Anselmetti F.S., 2007, The 1996 AD delta collapse and large turbidite in Lake Brienz, Marine Geology (241), 137-154. Kremer K., Simpson G., Girardclos S., 2012, Giant Lake Geneva tsunami in 563 AD, Nature Geoscience (5), 756-757. This project is financed by the Swiss National Foundation project nr. 200021-121666/1 and the Fondation Ernest Boninchi.

Kremer, Katrina; Yrro, Blé; Marillier, François; Hilbe, Michael; Corboud, Pierre; Rachoud-Schneider, Anne-Marie; Girardclos, Stéphanie

2013-04-01

148

Dating the end-Triassic and Early Jurassic mass extinctions, correlative large igneous provinces, and isotopic events  

Microsoft Academic Search

The end-Triassic marks one of the five biggest mass extinctions, and was followed by a well-known second-order extinction event in the Early Jurassic. Previously pub- lished geological time scales were inadequate for correlation of extinctions with other global events and to unravel their dynamics. Here we present a revised time scale based on high-precision U-Pb ages integrated with ammonoid biochronology

Jozsef Palfy; Paul L. Smith; James K. Mortensen

149

Extracellular matrix disruption is an early event in the pathogenesis of skeletal disease in mucopolysaccharidosis I.  

PubMed

Progressive skeletal and connective tissue disease represents a significant clinical burden in all of the mucopolysaccharidoses. Despite the introduction of enzyme replacement strategies for many of the mucopolysaccharidoses, symptomatology related to bone and joint disease appears to be recalcitrant to current therapies. In order to address these unmet medical needs a clearer understanding of skeletal and connective tissue disease pathogenesis is required. Historically the pathogenesis of the mucopolysaccharidoses has been assumed to directly relate to progressive storage of glycosaminoglycans. It is now apparent for many lysosomal storage disorders that more complex pathogenic mechanisms underlie patients' clinical symptoms. We have used proteomic and genome wide expression studies in the murine mucopolysaccharidosis I model to identify early pathogenic events occurring in micro-dissected growth plate tissue. Studies were conducted using 3 and 5-week-old mice thus representing a time at which no obvious morphological changes of bone or joints have taken place. An unbiased iTRAQ differential proteomic approach was used to identify candidates followed by validation with multiple reaction monitoring mass spectrometry and immunohistochemistry. These studies reveal significant decreases in six key structural and signaling extracellular matrix proteins; biglycan, fibromodulin, PRELP, type I collagen, lactotransferrin, and SERPINF1. Genome-wide expression studies in embryonic day 13.5 limb cartilage and 5week growth plate cartilage followed by specific gene candidate qPCR studies in the 5week growth plate identified fourteen significantly deregulated mRNAs (Adamts12, Aspn, Chad, Col2a1, Col9a1, Hapln4, Lum, Matn1, Mmp3, Ogn, Omd, P4ha2, Prelp, and Rab32). The involvement of biglycan, PRELP and fibromodulin; all members of the small leucine repeat proteoglycan family is intriguing, as this protein family is implicated in the pathogenesis of late onset osteoarthritis. Taken as a whole, our data indicates that alteration of the extracellular matrix represents a very early event in the pathogenesis of the mucopolysaccharidoses and implies that biomechanical failure of chondro-osseous tissue may underlie progressive bone and joint disease symptoms. These findings have important therapeutic implications. PMID:25410057

Heppner, Jonathan M; Zaucke, Frank; Clarke, Lorne A

2015-02-01

150

Subclinical alexithymia modulates early audio-visual perceptive and attentional event-related potentials  

PubMed Central

Introduction: Previous studies have highlighted the advantage of using audio–visual oddball tasks (instead of unimodal ones) in order to electrophysiologically index subclinical behavioral differences. Since alexithymia is highly prevalent in the general population, we investigated whether the use of various bimodal tasks could elicit emotional effects in low- vs. high-alexithymic scorers. Methods: Fifty students (33 females and 17 males) were split into groups based on low and high scores on the Toronto Alexithymia Scale (TAS-20). During event-related potential (ERP) recordings, they were exposed to three kinds of audio–visual oddball tasks: neutral-AVN—(geometrical forms and bips), animal-AVA—(dog and cock with their respective shouts), or emotional-AVE—(faces and voices) stimuli. In each condition, participants were asked to quickly detect deviant events occurring amongst a train of repeated and frequent matching stimuli (e.g., push a button when a sad face–voice pair appeared amongst a train of neutral face–voice pairs). P100, N100, and P300 components were analyzed: P100 refers to visual perceptive and attentional processing, N100 to auditory ones, and the P300 relates to response-related stages, involving memory processes. Results: High-alexithymic scorers presented a particular pattern of results when processing the emotional stimulations, reflected in early ERP components by increased P100 and N100 amplitudes in the emotional oddball tasks [P100: F(2, 48) = 20,319, p < 0.001; N100: F(2, 96) = 8,807, p = 0.001] as compared to the animal or neutral ones. Indeed, regarding the P100, subjects exhibited a higher amplitude in the AVE condition (8.717 ?V), which was significantly different from that observed during the AVN condition (4.382 ?V, p < 0.001). For the N100, the highest amplitude was found in the AVE condition (?4.035 ?V) and the lowest was observed in the AVN condition (?2.687 ?V, p = 0.003). However, no effect was found on the later P300 component. Conclusions: Our findings suggest that high-alexithymic scorers require heightened early attentional resources in comparison to low scorers, particularly when confronted with emotional bimodal stimuli. PMID:24624070

Delle-Vigne, Dyna; Kornreich, Charles; Verbanck, Paul; Campanella, Salvatore

2014-01-01

151

A Candida albicans early stage biofilm detachment event in rich medium  

PubMed Central

Background Dispersal from Candida albicans biofilms that colonize catheters is implicated as a primary factor in the link between contaminated catheters and life threatening blood stream infections (BSI). Appropriate in vitro C. albicans biofilm models are needed to probe factors that induce detachment events. Results Using a flow through system to culture C. albicans biofilms we characterized a detachment process which culminates in dissociation of an entire early stage biofilm from a silicone elastomer surface. We analyzed the transcriptome response at time points that bracketed an abrupt transition in which a strong adhesive association with the surface is weakened in the initial stages of the process, and also compared batch and biofilm cultures at relevant time points. K means analysis of the time course array data revealed categories of genes with similar patterns of expression that were associated with adhesion, biofilm formation and glycoprotein biosynthesis. Compared to batch cultures the biofilm showed a pattern of expression of metabolic genes that was similar to the C. albicans response to hypoxia. However, the loss of strong adhesion was not obviously influenced by either the availability of oxygen in the medium or at the silicone elastomer surface. The detachment phenotype of mutant strains in which selected genes were either deleted or overexpressed was characterized. The microarray data indicated that changes associated with the detachment process were complex and, consistent with this assessment, we were unable to demonstrate that transcriptional regulation of any single gene was essential for loss of the strong adhesive association. Conclusion The massive dispersal of the early stage biofilm from a biomaterial surface that we observed is not orchestrated at the level of transcriptional regulation in an obvious manner, or is only regulated at this level by a small subpopulation of cells that mediate adhesion to the surface. PMID:19187560

2009-01-01

152

Early events of fertilization in sea urchin eggs are sensitive to actin-binding organic molecules.  

PubMed

We previously demonstrated that many aspects of the intracellular Ca(2+) increase in fertilized eggs of starfish are significantly influenced by the state of the actin cytoskeleton. In addition, the actin cytoskeleton appeared to play comprehensive roles in modulating cortical granules exocytosis and sperm entry during the early phase of fertilization. In the present communication, we have extended our work to sea urchin which is believed to have bifurcated from the common ancestor in the phylogenetic tree some 500 million years ago. To corroborate our earlier findings in starfish, we have tested how the early events of fertilization in sea urchin eggs are influenced by four different actin-binding drugs that promote either depolymerization or stabilization of actin filaments. We found that all the actin drugs commonly blocked sperm entry in high doses and significantly reduced the speed of the Ca(2+) wave. At low doses, however, cytochalasin B and phalloidin increased the rate of polyspermy. Overall, certain aspects of Ca(2+) signaling in these eggs were in line with the morphological changes induced by the actin drugs. That is, the time interval between the cortical flash and the first Ca(2+) spot at the sperm interaction site (the latent period) was significantly prolonged in the eggs pretreated with cytochalasin B or latrunculin A, whereas the Ca(2+) decay kinetics after the peak was specifically attenuated in the eggs pretreated with jasplakinolide or phalloidin. In addition, the sperm interacting with the eggs pretreated with actin drugs often generated multiple Ca(2+) waves, but tended to fail to enter the egg. Thus, our results indicated that generation of massive Ca(2+) waves is neither indicative of sperm entry nor sufficient for cortical granules exocytosis in the inseminated sea urchin eggs, whereas the structure and functionality of the actin cytoskeleton are the major determining factors in the two processes. PMID:24960199

Chun, Jong T; Limatola, Nunzia; Vasilev, Filip; Santella, Luigia

2014-08-01

153

Timing and evolution of ocean anoxic event during Early Cambrian in south China  

NASA Astrophysics Data System (ADS)

The Precambrian/Cambrian (PC-C) interval is one of the most interesting intervals in the evolution of life because of the sudden diversification of animals with mineralized skeletons, known as "Cambrian Explosion". The Yangtze Platform in south China is one of the best occurrences that can provide excellent insights into the palaeo-environmental and biological changes across the PC-C boundary. Our study show that the ocean anoxia were widespread during the Early Cambrian period, however, the start of this anoxic event was not from the PC-C boundary (i.e., 542 Ma), but some 7 Ma later (~535 Ma) when the Niutitang Formation black rock series (black phosphorite, chert, and black shale) deposited along a thousand kilometer long NEE zone in the transitional facies in the Yangtze Platform, while the major Cambrian radiation (Changjiang fauna) took place during 521-511 Ma. During the Niutitang period, the depositional environment of the Early Cambrian sedimentary sequence in south China have evolved from an initial oxic/dysoxic to a major anoxic/euxinic environment, and then back to dysoxic/oxic environment. A Ni-Mo sulfide layer occurred in the lower part of the Niutitang black shales which contains extremely enrichments of many metals, and can serve as a marker layer in south China when the depositional environment turned into euxinic condition. Re-Os isotope study of the sulfide ores and host black shales show an age of 535 Ma. Initial Os isotopic compositions, Mo isotopic compositions, and rare earth elements and Pt group element geochemistry suggest involvement of submarine hydrothermal fluids during the metal enrichments in black shale.

Yang, J.; Jiang, S.; Pi, D.; Ling, H.

2008-12-01

154

Transcript Analysis of Early Nodulation Events in Medicago truncatula12[W  

PubMed Central

Within the first 72 h of the interaction between rhizobia and their host plants, nodule primordium induction and infection occur. We predicted that transcription profiling of early stages of the symbiosis between Medicago truncatula roots and Sinorhizobium meliloti would identify regulated plant genes that likely condition key events in nodule initiation. Therefore, using a microarray with about 6,000 cDNAs, we compared transcripts from inoculated and uninoculated roots corresponding to defined stages between 1 and 72 h post inoculation (hpi). Hundreds of genes of both known and unknown function were significantly regulated at these time points. Four stages of the interaction were recognized based on gene expression profiles, and potential marker genes for these stages were identified. Some genes that were regulated differentially during stages I (1 hpi) and II (6–12 hpi) of the interaction belong to families encoding proteins involved in calcium transport and binding, reactive oxygen metabolism, and cytoskeleton and cell wall functions. Genes involved in cell proliferation were found to be up-regulated during stages III (24–48 hpi) and IV (72 hpi). Many genes that are homologs of defense response genes were up-regulated during stage I but down-regulated later, likely facilitating infection thread progression into the root cortex. Additionally, genes putatively involved in signal transduction and transcriptional regulation were found to be differentially regulated in the inoculated roots at each time point. The findings shed light on the complexity of coordinated gene regulation and will be useful for continued dissection of the early steps in symbiosis. PMID:16377745

Lohar, Dasharath Prasad; Sharopova, Natalya; Endre, Gabriella; Peñuela, Silvia; Samac, Deborah; Town, Christopher; Silverstein, Kevin A.T.; VandenBosch, Kathryn A.

2006-01-01

155

Early signals of synoptic-scale atmospheric anomalies associated with the summer low temperature events in Northeast China  

NASA Astrophysics Data System (ADS)

Following a description of the climatology of the boreal summer persistent low temperature (LT) events of the Northeast (NE) China, this paper explores the synoptic characteristics of these events by decomposing atmospheric variables into three components: the daily climate, the zonal-averaged anomaly and the synoptic-scale anomaly. The synoptic-scale anomaly is used to construct the anomalous synoptic charts which tend to perform better compared to traditionally defined synoptic charts in terms of revealing synoptic characteristics of these LT events. Based on the analysis of 21 persistent LT events occurring during summers of 1961-2008 in NE China, we show that temperature anomaly at 850 hPa and geopotential height anomaly at 300 hPa were two critical early signals prior to the occurrences of these persistent LT events.

Qian, Weihong; Jiang, Man

2014-04-01

156

The strontium isotope seawater curve during the early Middle Miocene and its relation to paleoceanographic events  

SciTech Connect

Breaks in slope of the strontium isotope seawater curve signal fundamental changes in either rates of continental weathering, seafloor spreading (i.e., tectonic reorganizations), or submarine dissolution of marine carbonates. The authors conducted a detailed study of the change in slope of the strontium isotopic seawater curve that occurred during the early middle Miocene in three Pacific DSDP sites (289, 574, and 588). The change in slope from the rapid rise in Sr-87/Sr-86 of the early Miocene (60 ppm/Ma) to the less rapid increase of the mid- and late Miocene (22 ppm/Ma) occurred between two periods of maximum [delta]C-13 values dated between 15.5 and 15.2 Ma. This internal was followed by relatively constant Sr-87/Sr-86 values (averaging 0.70878) between 15.2 and 14.2 Ma. Sr-87/Sr-86 ratios began to increase again after 14.2 Ma, but at a reduced rate compared to the early Miocene. The break in slope in Sr-87/Sr-86 preceded the mid-Miocene increase in [delta]O-18 that represents ice growth on Antarctica, which began at 14.9 Ma and increased rapidly after 14.2 Ma. In 2 out of 3 of the sites, the break in Sr-slope between 15.5 and 15.2 Ma is accompanied by a small, but significant, decrease in Sr-87/Sr-86 values. They speculate, that this decrease in Sr-87/Sr-86 may have been related to massive dissolution of older carbonate on the sea floor associated with NH2B (Neogene Hiatus 2 of Keller and Barron, 1983). This event may have important implications for changes in carbonate chemistry of the oceans. Numerical modeling of the strontium isotope budget will be used to test the feasibility of this mechanism and to estimate the volume and age of dissolved carbonate needed to produce the observed decrease in Sr-87/Sr-86.

Hodell, D.A. (Univ. of Florida, Gainesville, FL (United States). Dept. of Geology); Woodruff, F. (Univ. of Southern California, Los Angeles, CA (United States). Dept. Geological Sciences)

1992-01-01

157

A comparison of early family life events amongst monozygotic twin women with lifetime anorexia nervosa, bulimia nervosa, or major depression  

Microsoft Academic Search

Objectives: To investigate the differen- tial profile of early family life events asso- ciated with lifetime anorexia nervosa (AN), bulimia nervosa (BN), and major depression (MD). Method: Only data from the monozy- gotic twins (n 5 622) were examined from a community sample of female twins who had participated in three waves of data collection. Eating disorder and MD diagnoses

Tracey D. Wade; Nathan Gillespie; Nicholas G. Martin

2007-01-01

158

Abnormal mitochondrial dynamics and synaptic degeneration as early events in Alzheimer's disease: Implications to mitochondria-targeted antioxidant therapeutics  

Microsoft Academic Search

Synaptic pathology and mitochondrial oxidative damage are early events in Alzheimer's disease (AD) progression. Loss of synapses and synaptic damage are the best correlates of cognitive deficits found in AD patients. Recent research on amyloid beta (A?) and mitochondria in AD revealed that A? accumulates in synapses and synaptic mitochondria, leading to abnormal mitochondrial dynamics and synaptic degeneration in AD

P. Hemachandra Reddy; Raghav Tripathi; Quang Troung; Tirumala; Tejaswini P. Reddy; Vishwanath Anekonda; Ulziibat P. Shirendeb; Marcus J. Calkins; Arubala P. Reddy; Peizhong Mao; Maria Manczak

159

BioSystems xxx (2005) xxxxxx A network model of early events in epidermal growth factor receptor  

E-print Network

BioSystems xxx (2005) xxx­xxx A network model of early events in epidermal growth factor receptor.06.014 BIO-2484; No. of Pages 16 #12;2 M.L. Blinov et al. / BioSystems xxx (2005) xxx­xxx lent character

Blinov, Michael L.

160

Early Life Events Carry Over to Influence Pre-Migratory Condition in a Free-Living Songbird  

Microsoft Academic Search

Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1st year survival and

Greg W. Mitchell; Christopher G. Guglielmo; Nathaniel T. Wheelwright; Corey R. Freeman-Gallant; D. Ryan Norris

2011-01-01

161

EFFECT OF ARSENICALS ON THE EXPRESSION OF CELL CYCLE PROTEINS AND EARLY SIGNALING EVENTS IN PRIMARY HUMAN KERATINOCYTES.  

EPA Science Inventory

Effect of Arsenicals on the Expression of Cell Cycle Proteins and Early Signaling Events in Primary Human Keratinocytes. Mudipalli, A, Owen R. D. and R. J. Preston, Environmental Carcinogenesis Division, USEPA, RTP, NC 27711. Environmental exposure to arsenic is a m...

162

Redox Signaling Is an Early Event in the Pathogenesis of Renovascular Hypertension  

PubMed Central

Activation of the renin-angiotensin-aldosterone system plays a critical role in the development of chronic renal damage in patients with renovascular hypertension. Although angiotensin II (Ang II) promotes oxidative stress, inflammation, and fibrosis, it is not known how these pathways intersect to produce chronic renal damage. We tested the hypothesis that renal parenchymal cells are subjected to oxidant stress early in the development of RVH and produce signals that promote influx of inflammatory cells, which may then propagate chronic renal injury. We established a reproducible murine model of RVH by placing a tetrafluoroethhylene cuff on the right renal artery. Three days after cuff placement, renal tissue demonstrates no histologic abnormalities despite up regulation of both pro- and anti-oxidant genes. Mild renal atrophy was observed after seven days and was associated with induction of Tnf? and influx of CD3+ T cells and F4/80+ macrophages. By 28 days, kidneys developed severe renal atrophy with interstitial inflammation and fibrosis, despite normalization of plasma renin activity. Based on these considerations, we propose that renal parenchymal cells initiate a progressive cascade of events leading to oxidative stress, interstitial inflammation, renal fibrosis, and atrophy. PMID:24025423

Hartono, Stella P.; Knudsen, Bruce E.; Zubair, Adeel S.; Nath, Karl A.; Textor, Stephen J.; Lerman, Lilach O.; Grande, Joseph P.

2013-01-01

163

Gender, facial attractiveness, and early and late event-related potential components.  

PubMed

Facial attractiveness has been an interesting topic in cognitive psychology due to its key role in human communication and experience. The evaluation of attractiveness is adjusted by many factors including gender differences and cultural biases. In this paper, event-related potential (ERP) activity was recorded in an oddball paradigm from 10 Chinese men and 10 Chinese women who judged attractiveness of faces. Participants were told to detect faces with neutral expression and judge their attractiveness among a train of neutral objects that were presented more frequently than the faces. The ERP analyses showed that there was enhanced detection over early (P1, N170, P2, N300) and late (P3b) components in both genders. This suggests that a biased electrophysiological response to attractive faces compared to unattractive faces could indicate the involvement of emotion and reward pathways in judging facial attractiveness. Specifically, there were delayed P1 and P3b latencies in response to attractive faces with slower response times in men compared to women. From an evolutionary perspective, this may suggest that men attribute more value to facial appearances, especially attractive features, than women do, as evidenced by their cognitive load while processing attractive faces compared to unattractive faces. PMID:23351053

Zhang, Zimu; Deng, Zhidong

2012-12-01

164

Impact of early and late winter icing events on sub-arctic dwarf shrubs.  

PubMed

Polar regions are predicted to undergo large increases in winter temperature and an increased frequency of freeze-thaw cycles, which can cause ice layers in the snow pack and ice encasement of vegetation. Early or late winter timing of ice encasement could, however, modify the extent of damage caused to plants. To determine impacts of the date of ice encasement, a novel field experiment was established in sub-arctic Sweden, with icing events simulated in January and March 2008 and 2009. In the subsequent summers, reproduction, phenology, growth and mortality, as well as physiological indicators of leaf damage were measured in the three dominant dwarf shrubs: Vaccinium uliginosum, Vaccinium vitis-idaea and Empetrum nigrum. It was hypothesised that January icing would be more damaging compared to March icing due to the longer duration of ice encasement. Following 2 years of icing, E. nigrum berry production was 83% lower in January-iced plots compared to controls, and V. vitis-idaea electrolyte leakage was increased by 69%. Conversely, electrolyte leakage of E. nigrum was 25% lower and leaf emergence of V. vitis-idaea commenced 11 days earlier in March-iced plots compared to control plots in 2009. There was no effect of icing on any of the other parameters measured, indicating that overall these study species have moderate to high tolerance to ice encasement. Even much longer exposure under the January icing treatment does not clearly increase damage. PMID:23574610

Preece, C; Phoenix, G K

2013-04-10

165

How the timing of weather events influences early development in a large mammal.  

PubMed

Capturing components of the weather that drive environment-animal interactions is a perennial problem in ecology. Identifying biologically significant elements of weather conditions in sensible statistics suitable for analysis of life history variation and population dynamics is central. Meteorological variables such as temperature, precipitation, and wind modulate rates of heat loss in animals, but analysis of their effects on endothermic species is complicated by the fact that their influence on energy balance is not invariably linear, even across the thermoneutral range. Rather, the thermal load imposed by a given set of weather conditions is a function of organisms' metabolic requirement, which, crucially, may vary spontaneously both seasonally and across different life phases. We propose that the endogenous component of variation in metabolic demand introduces a temporal dimension and that, as a consequence, the specific effect of meteorological variables on energy balance and attendant life history parameters is a function of the timing of weather events with respect to the organism's metabolic rhythm(s). To test this, we examined how a spontaneous increase in metabolic demand influenced the effect of weather on early development in a large mammal. Specifically, we examined interaction between the exponential rise in the energy requirements of pregnancy and depth of snow, which restricts dams' access to forage, on the body mass of reindeer calves (Rangifer tarandus) at weaning. As expected, we detected a significant temporal component: the specific negative effect of snow on weaning mass was not constant, but increased across pregnancy. The life history response was therefore better predicted by interaction between the magnitude and the timing of weather events than by their magnitude alone. To our knowledge, this is the first demonstration of the influence of an endogenous metabolic dynamic on the impact of weather on a life history trait in a free-living mammal. Evaluating weather variables with respect to endogenous variation in metabolic demand adds biological realism and is likely to improve understanding of the influence of environmental variation on life history traits in many ecological contexts. PMID:25163108

Hendrichsen, D K; Tyler, N J C

2014-07-01

166

Shorter Exposures to Harder X-Rays Trigger Early Apoptotic Events in Xenopus laevis Embryos  

PubMed Central

Background A long-standing conventional view of radiation-induced apoptosis is that increased exposure results in augmented apoptosis in a biological system, with a threshold below which radiation doses do not cause any significant increase in cell death. The consequences of this belief impact the extent to which malignant diseases and non-malignant conditions are therapeutically treated and how radiation is used in combination with other therapies. Our research challenges the current dogma of dose-dependent induction of apoptosis and establishes a new parallel paradigm to the photoelectric effect in biological systems. Methodology/Principal Findings We explored how the energy of individual X-ray photons and exposure time, both factors that determine the total dose, influence the occurrence of cell death in early Xenopus embryo. Three different experimental scenarios were analyzed and morphological and biochemical hallmarks of apoptosis were evaluated. Initially, we examined cell death events in embryos exposed to increasing incident energies when the exposure time was preset. Then, we evaluated the embryo's response when the exposure time was augmented while the energy value remained constant. Lastly, we studied the incidence of apoptosis in embryos exposed to an equal total dose of radiation that resulted from increasing the incoming energy while lowering the exposure time. Conclusions/Significance Overall, our data establish that the energy of the incident photon is a major contributor to the outcome of the biological system. In particular, for embryos exposed under identical conditions and delivered the same absorbed dose of radiation, the response is significantly increased when shorter bursts of more energetic photons are used. These results suggest that biological organisms display properties similar to the photoelectric effect in physical systems and provide new insights into how radiation-mediated apoptosis should be understood and utilized for therapeutic purposes. PMID:20126466

Dong, JiaJia; Mury, Sean P.; Drahos, Karen E.; Moscovitch, Marko

2010-01-01

167

Early monitoring of the human polyomavirus BK replication and sequencing analysis in a cohort of adult kidney transplant patients treated with basiliximab  

PubMed Central

Background Nowadays, better immunosuppressors have decreased the rates of acute rejection in kidney transplantation, but have also led to the emergence of BKV-associated nephropathy (BKVAN). Therefore, we prospectively investigated BKV load in plasma and urine samples in a cohort of kidney transplants, receiving basiliximab combined with a mycophenolate mofetil-based triple immunotherapy, to evaluate the difference between BKV replication during the first 3 months post-transplantation, characterized by the non-depleting action of basiliximab, versus the second 3 months, in which the maintenance therapy acts alone. We also performed sequencing analysis to assess whether a particular BKV subtype/subgroup or transcriptional control region (TCR) variants were present. Methods We monitored BK viruria and viremia by quantitative polymerase chain reaction (Q-PCR) at 12 hours (Tx), 1 (T1), 3 (T2) and 6 (T3) months post-transplantation among 60 kidney transplant patients. Sequencing analysis was performed by nested-PCR with specific primers for TCR and VP1 regions. Data were statistically analyzed using ?2 test and Student's t-test. Results BKV was detected at Tx in 4/60 urine and in 16/60 plasma, with median viral loads of 3,70 log GEq/mL and 3,79 log GEq/mL, respectively, followed by a significant increase of both BKV-positive transplants (32/60) and median values of viruria (5,78 log GEq/mL) and viremia (4,52 log GEq/mL) at T2. Conversely, a significantly decrease of patients with viruria and viremia (17/60) was observed at T3, together with a reduction of the median urinary and plasma viral loads (4,09 log GEq/mL and 4,00 log GEq/mL, respectively). BKV TCR sequence analysis always showed the presence of archetypal sequences, with a few single-nucleotide substitutions and one nucleotide insertion that, interestingly, were all representative of the particular subtypes/subgroups we identified by VP1 sequencing analysis: I/b-2 and IV/c-2. Conclusions Our results confirm previous studies indicating that BKV replication may occur during the early hours after kidney transplantation, reaches the highest incidence in the third post-transplantation month and then decreases within the sixth month, maybe due to induction therapy. Moreover, it might become clinically useful whether specific BKV subtypes or rearrangements could be linked to a particular disease state in order to detect them before BKVAN onset. PMID:21849069

2011-01-01

168

Dissociation of centrosome replication events from cycles of DNA synthesis and mitotic division in hydroxyurea-arrested Chinese hamster ovary cells  

Microsoft Academic Search

Relatively little is known about the mecha- nisms used by somatic cells to regulate the replication of the centrosome complex. Centrosome doubling was studied in CHO cells by electron microscopy and im- munofluorescence microscopy using human autoim- mune anticentrosome antiserum, and by Northern blotting using the cDNA encoding portion of the cen- trosome autoantigen pericentriolar material (PCM)-I. Centrosome doubling could

Ron Balczon; Liming Bao; Warren E. Zimmer; Kevin Brown; Raymond P. Zinkowski; B. R. Brinkley II

1995-01-01

169

Organic geochemistry of the early Toarcian oceanic anoxic event in Hawsker Bottoms, Yorkshire, England  

NASA Astrophysics Data System (ADS)

A comprehensive organic geochemical investigation of the Hawsker Bottoms outcrop section in Yorkshire, England has provided new insights about environmental conditions leading into and during the Toarcian oceanic anoxic event (T-OAE; ?183 Ma). Rock-Eval and molecular analyses demonstrate that the section is uniformly within the early oil window. Hydrogen index (HI), organic petrography, polycyclic aromatic hydrocarbon (PAH) distributions, and tricyclic terpane ratios mark a shift to a lower relative abundance of terrigenous organic matter supplied to the sampling locality during the onset of the T-OAE and across a lithological transition. Unlike other ancient intervals of anoxia and extinction, biomarker indices of planktonic community structure do not display major changes or anomalous values. Depositional environment and redox indicators support a shift towards more reducing conditions in the sediment porewaters and the development of a seasonally stratified water column during the T-OAE. In addition to carotenoid biomarkers for green sulfur bacteria (GSB), we report the first occurrence of okenane, a marker of purple sulfur bacteria (PSB), in marine samples younger than ?1.64 Ga. Based on modern observations, a planktonic source of okenane's precursor, okenone, would require extremely shallow photic zone euxinia (PZE) and a highly restricted depositional environment. However, due to coastal vertical mixing, the lack of planktonic okenone production in modern marine sulfidic environments, and building evidence of okenone production in mat-dwelling Chromatiaceae, we propose a sedimentary source of okenone as an alternative. Lastly, we report the first parallel compound-specific ?C13 record in marine- and terrestrial-derived biomarkers across the T-OAE. The ?C13 records of short-chain n-alkanes, acyclic isoprenoids, and long-chain n-alkanes all encode negative carbon isotope excursions (CIEs), and together, they support an injection of isotopically light carbon that impacted both the atmospheric and marine carbon reservoirs. To date, molecular ?C13 records of the T-OAE display a negative CIE that is smaller in magnitude compared to the bulk organic ?C13 excursion. Although multiple mechanisms could explain this observation, our molecular, petrographic, and Rock-Eval data suggest that variable mixing of terrigenous and marine organic matter is an important factor affecting the bulk organic ?C13 records of the T-OAE.

French, K. L.; Sepúlveda, J.; Trabucho-Alexandre, J.; Gröcke, D. R.; Summons, R. E.

2014-03-01

170

The Cenozoic Diversity of Agglutinated Foraminifera - Evidence for a late Oligocene to early Miocene diversification event  

NASA Astrophysics Data System (ADS)

The agglutinated foraminifera are among the most abundant micro-organisms in the deep marine environment and have a diversity record extending back to the late Precambrian. We present an updated diversity curve for agglutinated foraminiferal genera based on the stratigraphic ranges of all the agglutinated genera recognized as valid in the classification of Kaminski (2014). The data set for this analysis is based on the stratigraphic ranges of agglutinated genera published in Foraminiferal Genera and their Classification, which has been subsequently updated based on published studies and our new observations. The mean standing diversity of agglutinated foraminiferal genera was compiled by counting the number of boundary crossers rather than the number of genera in each stage. In this study, we report the stratigraphic and geographical occurrence of a benthic foraminiferal diversification event that has previously received little attention. In the latest Oligocene to earliest Miocene a number of trochospiral agglutinated genera with alveolar or canaliculate walls first appeared in the fossil record. Our studies of late Oligocene of the Congo fan, offshore Angola (Kender et al., 2008; Cetean and Kaminski, 2011) have revealed a diverse assemblage that includes new taxa of deep-water agglutinated foraminifera. In a biostratigraphic study of the Miocene foraminiferal assemblages Kender et al. (2008) noted steadily increasing diversity and proportions of infaunal agglutinated foraminiferal morphotypes over the lower Miocene interval. The proportion of infaunal agglutinated foraminifera assigned to the order Textularida increased dramatically in the lower mid-Miocene, suggesting expansion of the oxygen minimum zone into deeper waters. In addition to the trochospiral alveolar genera, several species of Reticulophragmium and Cyclammina display rapid diversification into numerous separate lineages that are at present not reflected in our generic diversity record owing to their poorly established taxonomy. Genera such as Alveovalvulina, Guppyella, Goesella, and Alveovalvulinella, are typical of assemblages found in subtropical oxygen minimum zones, especially in West Africa and the Caribbean. These agglutinated genera are not found in coeval assemblages from the northern high latitudes (Kaminski et al. 2005), suggesting they are restricted to the low-latitude OMZ. It is likely that the global warming of the latest Oligocene to Early Miocene contributed to intensification of dysoxic conditions in low-latitude upwelling regions, possibly from enhanced productivity and reduced deep-sea ventilation, creating an expanded niche for these organisms that flourished in low-oxygen conditions with high particulate organic matter input. We believe a more detailed phylogenetic approach to these agglutinated genera would result in the description of new genera for individual lineages and refinement of the foraminiferal diversity record.

Kaminski, Michael; Setoyama, Eiichi; Kender, Sev; Cetean, Claudia

2014-05-01

171

Interrelationships between Yeast Ribosomal Protein Assembly Events and Transient Ribosome Biogenesis Factors Interactions in Early Pre-Ribosomes  

PubMed Central

Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA). Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins) and ribosome precursors (pre-ribosomes) are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU) processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains. PMID:22431976

Jakob, Steffen; Ohmayer, Uli; Neueder, Andreas; Hierlmeier, Thomas; Perez-Fernandez, Jorge; Hochmuth, Eduard; Deutzmann, Rainer; Griesenbeck, Joachim; Tschochner, Herbert; Milkereit, Philipp

2012-01-01

172

PKR and RNase L Contribute to Protection against Lethal West Nile Virus Infection by Controlling Early Viral Spread in the Periphery and Replication in Neurons  

PubMed Central

West Nile virus (WNV) is a neurotropic, mosquito-borne flavivirus that can cause lethal meningoencephalitis. Type I interferon (IFN) plays a critical role in controlling WNV replication, spread, and tropism. In this study, we begin to examine the effector mechanisms by which type I IFN inhibits WNV infection. Mice lacking both the interferon-induced, double-stranded-RNA-activated protein kinase (PKR) and the endoribonuclease of the 2?,5?-oligoadenylate synthetase-RNase L system (PKR?/? × RL?/?) were highly susceptible to subcutaneous WNV infection, with a 90% mortality rate compared to the 30% mortality rate observed in congenic wild-type mice. PKR?/? × RL?/? mice had increased viral loads in their draining lymph nodes, sera, and spleens, which led to early viral entry into the central nervous system (CNS) and higher viral burden in neuronal tissues. Although mice lacking RNase L showed a higher CNS viral burden and an increased mortality, they were less susceptible than the PKR?/? × RL?/? mice; thus, we also infer an antiviral role for PKR in the control of WNV infection. Notably, a deficiency in both PKR and RNase L resulted in a decreased ability of type I IFN to inhibit WNV in primary macrophages and cortical neurons. In contrast, the peripheral neurons of the superior cervical ganglia of PKR?/? × RL?/? mice showed no deficiency in the IFN-mediated inhibition of WNV. Our data suggest that PKR and RNase L contribute to IFN-mediated protection in a cell-restricted manner and control WNV infection in peripheral tissues and some neuronal subtypes. PMID:16809306

Samuel, Melanie A.; Whitby, Kevin; Keller, Brian C.; Marri, Anantha; Barchet, Winfried; Williams, Bryan R. G.; Silverman, Robert H.; Gale, Michael; Diamond, Michael S.

2006-01-01

173

Early CMV replication and subsequent chronic GVHD have a significant anti-leukemic effect after allogeneic HSCT in acute myeloid leukemia.  

PubMed

Early cytomegalovirus (CMV) replication (eCMV) after allogeneic hematopoietic stem cell transplantation (allo-HSCT) has been suggested as an independent factor that reduces leukemia relapse risk. We retrospectively analyzed 74 patients with acute myeloid leukemia (AML) who underwent allo-HSCT between August 2006 and September 2012. All recipients were CMV seropositive. In 52 patients, eCMV occurred at a median of 35 days (range, 11-92) after allo-HSCT. Univariate analysis revealed that the factors associated with a reduction in the 5-year cumulative incidence of relapse (CIR) included the first complete remission status at allo-HSCT, non-adverse cytogenetics and molecular abnormalities, pre-transplant serum ferritin level <1,400 mg/dL, chronic graft-versus-host disease (cGVHD), and eCMV. In sub-group analysis, according to the existence of eCMV and cGVHD, those with both eCMV and cGVHD showed the lowest 5-year CIR (P?

Jang, Ji Eun; Kim, Soo Jeong; Cheong, June-Won; Hyun, Shin Young; Kim, Yun Deok; Kim, Yu Ri; Kim, Jin Seok; Min, Yoo Hong

2015-02-01

174

Early cellular events in multiple sclerosis Intimations of an extrinsic myelinolytic antigen  

Microsoft Academic Search

In a previous immunohistological study of tissues from unusually early cases of MS cluster analysis revealed a progression of demyelination through five distinct stages (Gay F, Drye T, Dick G, et al. The application of multifactorial cluster analysis in the staging of plaques in early multiple sclerosis. Identification and characterization of the primary demyelinating lesion. Brain 1997;120:1461-83). Tissues from six

Frederick W. Gay

2006-01-01

175

Events during Early Triassic recovery from the end-Permian extinction  

Microsoft Academic Search

The Palaeozoic–Mesozoic transition is characterized not only by the biggest Phanerozoic mass extinction, at the end of Permian, but also a prolonged period of recovery of the biota during the succeeding Early Triassic. The delayed recovery is generally attributed to the effects of extreme environmental conditions on the Early Triassic ecosystem. However, there has been very little study of the

Jinnan Tong; Suxin Zhang; Jingxun Zuo; Xinqi Xiong

2007-01-01

176

Is epigenetics an important link between early life events and adult disease?  

Technology Transfer Automated Retrieval System (TEKTRAN)

Epigenetic mechanisms provide one potential explanation for how environmental influences in early life cause long-term changes in chronic disease susceptibility. Whereas epigenetic dysregulation is increasingly implicated in various rare developmental syndromes and cancer, the role of epigenetics in...

177

Major events in the late Precambrian to early Triassic geohistory of the Arabian Peninsula  

SciTech Connect

The late Precambrian to Early Triassic of the Arabian Peninsula occur in five supergroups. Their geohistory resulted from sedimentation along fluvial to midshelf facies tracts, eustatic oscillation and periodic uplift. The first supergroup, Plate Precambrian-Middle Cambrian, includes the Siq/Salib and Yatib formations. Deposited by north-eastward-flowing braided streams, they eroded and buried an Arabian shield topography. The Saq Formation lies in angular unconformity on the Siq which documents early Middle Cambrian uplift. Supergroup two, Middle Cambrian-middle Caradocian, the Burj and Saq formations, the Hanadir, Kahfah, and Ra'an members, Qasim Formation, were deposited on a stable continental margin in fluvio-deltaic to midshelf settings. Coastal onlap occurred in the Middle Cambrian, early Llanvirn, middle Llandeilo and early Caradoc. Middle Caradocian uplift deeply eroded parts of central and southern Arabia. Supergroup three of middle Caradocian-early Llandoverian are the Quwarah Member, Qasim Formation and the Zarqa/Sarah formations. They were deposited in a fluvio-deltaic shallow shelf. Late Ashgill uplift, combined with glacially induced sea level lowering, incised valleys up to 2000 ft (610 m) deep. Supergroup four, early Llandovery-Middle Carboniferous, includes the Qalibah, Tawil, Jauf, Jubah and Berwath formations. They were deposited in a fluvio-deltaic marine, river dominated system. The Quysaiba and Sharawra members, Qalibah Formation, were the offshore clays and prodelta sands, the Tawil-Jubah were the fluvial to delta front, and the Berwath the delta plain facies. Deep pre-Tawil erosion documents late Silurian-Early Devonian uplift. The fifth supergroup are the Juwayl, Unayzah, Khuff and Sudair formations. The first two units were deposited in a glacio-fluvial system which eroded and infilled a Hercynian topography. The Khuff transgression occurred during the Artinsklan-Tartarian and the Early Triassic regressive Sudair documents renewed uplift.

Stump, T.E.; Connally, T.C.; Van der Eem, J.G.L.A. (Saudi Aramco, Dhahran (Saudi Arabia))

1993-09-01

178

Elevation of circulating branched-chain amino acids is an early event in human pancreatic adenocarcinoma development.  

PubMed

Most patients with pancreatic ductal adenocarcinoma (PDAC) are diagnosed with advanced disease and survive less than 12 months. PDAC has been linked with obesity and glucose intolerance, but whether changes in circulating metabolites are associated with early cancer progression is unknown. To better understand metabolic derangements associated with early disease, we profiled metabolites in prediagnostic plasma from individuals with pancreatic cancer (cases) and matched controls from four prospective cohort studies. We find that elevated plasma levels of branched-chain amino acids (BCAAs) are associated with a greater than twofold increased risk of future pancreatic cancer diagnosis. This elevated risk was independent of known predisposing factors, with the strongest association observed among subjects with samples collected 2 to 5 years before diagnosis, when occult disease is probably present. We show that plasma BCAAs are also elevated in mice with early-stage pancreatic cancers driven by mutant Kras expression but not in mice with Kras-driven tumors in other tissues, and that breakdown of tissue protein accounts for the increase in plasma BCAAs that accompanies early-stage disease. Together, these findings suggest that increased whole-body protein breakdown is an early event in development of PDAC. PMID:25261994

Mayers, Jared R; Wu, Chen; Clish, Clary B; Kraft, Peter; Torrence, Margaret E; Fiske, Brian P; Yuan, Chen; Bao, Ying; Townsend, Mary K; Tworoger, Shelley S; Davidson, Shawn M; Papagiannakopoulos, Thales; Yang, Annan; Dayton, Talya L; Ogino, Shuji; Stampfer, Meir J; Giovannucci, Edward L; Qian, Zhi Rong; Rubinson, Douglas A; Ma, Jing; Sesso, Howard D; Gaziano, John M; Cochrane, Barbara B; Liu, Simin; Wactawski-Wende, Jean; Manson, JoAnn E; Pollak, Michael N; Kimmelman, Alec C; Souza, Amanda; Pierce, Kerry; Wang, Thomas J; Gerszten, Robert E; Fuchs, Charles S; Vander Heiden, Matthew G; Wolpin, Brian M

2014-10-01

179

Yatein from Chamaecyparis obtusa suppresses herpes simplex virus type 1 replication in HeLa cells by interruption the immediate-early gene expression  

Microsoft Academic Search

Inhibitory effects of methanolic extracts from nine Chinese herbs on herpes simplex virus type 1 (HSV-1) replication were studied. By a bioassay-guided fractionation procedure, yatein (C22H23O7; M.W.399) was isolated from Chamaecyparis obtusa; yatein significantly suppressed HSV-1 multiplication in HeLa cells without apparent cytotoxicity. To further localize the point in the HSV-1 replication cycle where arrest occurred, a set of key

Yuh-Chi Kuo; Yueh-Hsiung Kuo; Yuang-Lian Lin; Wei-Jern Tsai

2006-01-01

180

Modeling and analysis of early events in T-lymphocyte antigen-activated intracellular-signaling pathways  

NASA Astrophysics Data System (ADS)

The T-cell antigen-activated signaling pathway is a highly regulated intracellular biochemical system that is crucial for initiating an appropriate adaptive immune response. To improve the understanding of the complex regulatory mechanisms controlling the early events in T-cell signaling, a detailed mathematical model was developed that utilizes ordinary differential equations to describe chemical reactions of the signaling pathway. The model parameter values were constrained by experimental data on the activation of a specific signaling intermediate and indicated an initial rapid cascade of phosphorylation events followed by a comparatively slow signal downregulation. Nonlinear analysis of the model suggested that thresholding and bistability occur as a result of the embedded positive and negative feedback loops within the model. These nonlinear system properties may enhance the T-cell receptor specificity and provide sub-threshold noise filtering with switch-like behavior to ensure proper cell response. Additional analysis using a reduced second-order model led to further understanding of the observed system behavior. Moreover, the interactions between the positive and negative feedback loops enabled the model to exhibit, among a variety of other feasible dynamics, a sustained oscillation that corresponds to a stable limit cycle in the two-dimensional phase plane. Quantitative analysis in this paper has helped identify potential regulatory mechanisms in the early T-cell signaling events. This integrated approach provides a framework to quantify and discover the ensemble of interconnected T-cell antigen-activated signaling pathways from limited experimental data.

Zheng, Yanan; Balakrishnan, Venkataramanan; Buzzard, Greg; Geahlen, Robert; Harrison, Marietta; Rundell, Ann

2005-12-01

181

A novel preclinical method to quantitatively evaluate early-stage metastatic events at the murine blood-brain barrier.  

PubMed

The observation that approximately 15% of women with disseminated breast cancer will develop symptomatic brain metastases combined with treatment guidelines discouraging single-agent chemotherapeutic strategies facilitates the desire for novel strategies aimed at outright brain metastasis prevention. Effective and robust preclinical methods to evaluate early-stage metastatic processes, brain metastases burden, and overall mean survival are lacking. Here, we develop a novel method to quantitate early metastatic events (arresting and extravasation) in addition to traditional end time-point parameters such as tumor burden and survival in an experimental mouse model of brain metastases of breast cancer. Using this method, a reduced number of viable brain-seeking metastatic cells (from 3,331 ± 263 cells/brain to 1,079 ± 495 cells/brain) were arrested in brain one week postinjection after TGF? knockdown. Treatment with a TGF? receptor inhibitor, galunisertib, reduced the number of arrested cells in brain to 808 ± 82 cells/brain. Furthermore, we observed a reduction in the percentage of extravasated cells (from 63% to 30%) compared with cells remaining intralumenal when TGF? is knocked down or inhibited with galunisertib (40%). The observed reduction of extravasated metastatic cells in brain translated to smaller and fewer brain metastases and resulted in prolonged mean survival (from 36 days to 62 days). This method opens up potentially new avenues of metastases prevention research by providing critical data important to early brain metastasis of breast cancer events. Cancer Prev Res; 8(1); 68-76. ©2014 AACR. PMID:25348853

Adkins, Chris E; Nounou, Mohamed I; Mittapalli, Rajendar K; Terrell-Hall, Tori B; Mohammad, Afroz S; Jagannathan, Rajaganapathi; Lockman, Paul R

2015-01-01

182

The "terminal Triassic catastrophic extinction event" in perspective: a review of carboniferous through Early Jurassic terrestrial vertebrate extinction patterns  

USGS Publications Warehouse

A catastrophic terminal Triassic extinction event among terrestrial vertebrates is not supported by available evidence. The current model for such an extinction is based on at least eight weak or untenable assumptions: (1) a terminal Triassic extinction-inducing asteroid impact occurred, (2) a terminal Triassic synchronous mass extinction of terrestrial vertebrates occurred, (3) a concurrent terminal Triassic marine extinction occurred, (4) all terrestrial vertebrate families have similar diversities and ecologies, (5) changes in familial diversity can be gauged accurately from the known fossil record, (6) extinction of families can be compared through time without normalizing for changes in familial diversity through time, (7) extinction rates can be compared without normalizing for differing lengths of geologic stages, and (8) catastrophic mass extinctions do not select for small size. These assumptions have resulted in unsupportable and (or) erroneous conclusions. Carboniferous through Early Jurassic terrestrial vertebrate families mostly have evolution and extinction patterns unlike the vertebrate evolution and extinction patterns during the terminal Cretaceous event. Only the Serpukhovian (mid Carboniferous) extinction event shows strong analogy to the terminal Cretaceous event. Available data suggest no terminal Triassic extinction anomaly, but rather a prolonged and nearly steady decline in the global terrestrial vertebrate extinction rate throughout the Triassic and earliest Jurassic. ?? 1992.

Weems, R.E.

1992-01-01

183

Traumatic and Stressful Events in Early Childhood: Can Treatment Help Those at Highest Risk?  

ERIC Educational Resources Information Center

Objective: This study involves a reanalysis of data from a randomized controlled trial to examine whether child-parent psychotherapy (CPP), an empirically based treatment focusing on the parent-child relationship as the vehicle for child improvement, is efficacious for children who experienced multiple traumatic and stressful life events (TSEs).…

Ippen, Chandra Ghosh; Harris, William W.; Van Horn, Patricia; Lieberman, Alicia F.

2011-01-01

184

Exposure to Potentially Traumatic Events in Early Childhood: Differential Links to Emergent Psychopathology  

ERIC Educational Resources Information Center

Research NeedsObjective: To examine associations between exposure to potentially traumatic events (PTEs) and clinical patterns of symptoms and disorders in preschool children. Method: Two hundred and thirteen referred and non-referred children, ages 24 to 48 months (MN = 34.9, SD = 6.7 months) were studied. Lifetime exposure to PTEs (family…

Briggs-Gowan, Margaret J.; Carter, Alice S.; Clark, Roseanne; Augustyn, Marilyn; McCarthy, Kimberly J.; Ford, Julian D.

2010-01-01

185

Riding the Wave to Reach the Masses: Natural Events in Early Twentieth Century Portuguese Daily Press  

ERIC Educational Resources Information Center

This paper brings together science communicated in newspapers in Portugal by looking at how news on natural events were communicated in two different newspapers--the capital newspaper "Diario de Noticias" ("Daily News") and the "Diario dos Acores" ("Azores Daily"). In particular, we look at how the 1900 solar eclipse, a hot topic throughout…

Simoes, Ana; Carneiro, Ana; Diogo, Maria Paula

2012-01-01

186

Modeling and Analysis of Early Events in T-Lymphocyte Antigen ...  

E-print Network

signaling intermediate and indicated an initial rapid cascade of phosphorylation events followed ... model led to further understanding of the observed system behavior. .... reactions are modeled with first or second order kinetics. ... Molecule diffusion is assumed to be rapid so no spatial information is included in the model

Greg Buzzard

187

Mood Reactivity to Daily Negative Events in Early Adolescence: Relationship to Risk for Psychopathology  

ERIC Educational Resources Information Center

Emotional responses to negative daily experiences in young adolescents may provide important clues to the development of psychopathology, but research is lacking. This study assessed momentary mood reactivity to daily events as a function of risk profile in a school sample, ages 11-14. High-risk (HR, n = 25) and low-risk (LR, n = 106) subgroups…

Schneiders, Josien; Nicolson, Nancy A.; Berkhof, Johannes; Feron, Frans J.; van Os, Jim; deVries, Marten W.

2006-01-01

188

Spiders do not evoke greater early posterior negativity in the event-related potential as snakes.  

PubMed

It has been long believed that both snakes and spiders are archetypal fear stimuli for humans. Furthermore, snakes have been assumed as stronger threat cues for nonhuman primates. However, it is still unclear whether spiders hold a special status in human perception. The current study explored to what extent spider pictures draw early visual attention [as assessed with early posterior negativity (EPN)] when compared with insects similar to spiders. To measure the EPN, participants watched a random rapid serial presentation of pictures, which consisted of two conditions: spider condition (spider, wasp, bumblebee, beetle) and snake condition (snake, bird). EPN amplitudes revealed no significant difference between spider, wasp, bumblebee, and beetle pictures, whereas EPN amplitudes were significantly larger for snake pictures relative to bird pictures. In addition, EPN amplitudes were significantly larger for snake pictures relative to spider pictures. These results suggest that the early visual attentional capture of animate objects is stronger for snakes, whereas spiders do not appear to hold special early attentional value. PMID:25026534

He, Hongshen; Kubo, Kenta; Kawai, Nobuyuki

2014-09-10

189

Introduction: Cortical event-related potentials and early language development: Variations with age and nutrition  

Technology Transfer Automated Retrieval System (TEKTRAN)

There is increasing evidence in the form of language-relevant sensory processing and discrimination that the foundations for speech perception are present at birth and are subject to significant modification during the first year of life. However, charting the course of early language development is...

190

Early folding events protect aggregation-prone regions of a ?-rich protein  

PubMed Central

Summary Protein folding and aggregation inevitably compete with one another. This competition is even keener for proteins with frustrated landscapes, such as those rich in ?-structure. Interestingly, despite their rugged energy landscapes and high ?-sheet content, intracellular lipid-binding proteins (iLBPs) appear to successfully avoid aggregation, as they are not implicated in aggregation diseases. In this study, we used a canonical iLBP, cellular retinoic acid-binding protein 1 (CRABP1), to better understand how folding is favored over aggregation. Analysis of folding kinetics of point mutants reveals that the folding pathway of CRABP1 involves early barrel closure. This folding mechanism protects sequences in CRABP1 that comprise cores of aggregates as identified by NMR. The amino acid conservation pattern in other iLBPs suggests that early barrel closure may be a general strategy for successful folding and minimization of aggregation. We suggest that folding mechanisms more broadly may incorporate steps that disfavor aggregation. PMID:23454187

Budyak, Ivan L.; Krishnan, Beena; Marcelino-Cruz, Anna M.; Ferrolino, Mylene C.; Zhuravleva, Anastasia; Gierasch, Lila M.

2013-01-01

191

Ar-Ar Dating of Martian Meteorite, Dhofar 378: An Early Shock Event?  

NASA Technical Reports Server (NTRS)

Martian meteorite, Dhofar 378 (Dho378) is a basaltic shergottite from Oman, weighing 15 g, and possessing a black fusion crust. Chemical similarities between Dho378 and the Los Angeles 001 shergottite suggests that they might have derived from the same Mars locale. The plagioclase in other shergottites has been converted to maskelenite by shock, but Dho378 apparently experienced even more intense shock heating, estimated at 55-75 GPa. Dho378 feldspar (approximately 43 modal %) melted, partially flowed and vesiculated, and then partially recrystallized. Areas of feldspathic glass are appreciably enriched in K, whereas individual plagioclases show a range in the Or/An ratio of approximately 0.18-0.017. Radiometric dating of martian shergottites indicate variable formation times of 160-475 Myr, whereas cosmic ray exposure (CRE) ages of shergottites indicate most were ejected from Mars within the past few Myr. Most determined Ar-39-Ar-40 ages of shergottites appear older than other radiometric ages because of the presence of large amounts of martian atmosphere or interior Ar-40. Among all types of meteorites and returned lunar rocks, the impact event that initiated the CRE age very rarely reset the Ar-Ar age. This is because a minimum time and temperature is required to facilitate Ar diffusion loss. It is generally assumed that the shock-texture characteristics in martian meteorites were produced by the impact events that ejected the rocks from Mars, although the time of these shock events (as opposed to CRE ages) are not directly dated. Here we report Ar-39-Ar-40 dating of Dho378 plagioclase. We suggest that the determined age dates the intense shock heating event this meteorite experienced, but that it was not the impact that initiated the CRE age.

Park, J.; Bogard, D. D.

2006-01-01

192

Age Dating Merger Events in Early Type Galaxies via the Detection of AGB Light  

NASA Technical Reports Server (NTRS)

A thorough statistical analysis of the J-H vs. H-K color plane of all detected early type galaxies in the 2MASS catalog with velocities less than 5000 km/s has been performed. This all sky survey is not sensitive to one particular galactic environment and therefore a representative range of early type galaxy environments have been sampled. Virtually all N-body simulation so major mergers produces a central starburst due to rapid collection of gas. This central starburst is of sufficient amplitude to change the stellar population in the central regions of the galaxy. Intermediate age populations are given away by the presence of AGB stars which will drive the central colors redder in H-K relative to the J- H baseline. This color anomaly has a lifetime of 2-5 billion years depending on the amplitude of the initial starburst Employing this technique on the entire 2MASS sample (several hundred galaxies) reveals that the AGB signature occurs less than 1% of the time. This is a straightforward indication that virtually all nearby early type galaxies have not had a major merger occur within the last few billion years.

Bothun, G.

2005-01-01

193

B cells from patients with systemic lupus erythematosus display abnormal antigen receptor-mediated early signal transduction events.  

PubMed Central

To understand the molecular mechanisms that are responsible for the B cell overactivity that is observed in patients with SLE, we have conducted experiments in which the surface immunoglobulin (sIg)-mediated early cell signaling events were studied. The anti-sIgM-mediated free intracytoplasmic calcium ([Ca2+]i) responses were significantly higher in SLE B cells compared with responses of normal individuals and to those of patients with other systemic autoimmune rheumatic diseases. The anti-IgD mAb induced [Ca2+]i responses were also higher in lupus B cells than in controls. The magnitude of anti-sIgM-mediated Ca2+ release from intracellular stores was also increased in B cells from SLE patients compared with normal controls. The amount of inositol phosphate metabolites produced upon crosslinking of sIgM was slightly higher in patients with lupus than in normal controls, although the difference was not statistically significant. In contrast, the degree of anti-sIgM-induced protein tyrosine phosphorylation was obviously increased in lupus patients. Our study demonstrates clearly for the first time that SLE B cells exhibit aberrant early signal transduction events, including augmented calcium responses after crosslinking of the B cell receptor and increased antigen-receptor-mediated phosphorylation of protein tyrosine residues. Because the above abnormalities did not correlate with disease activity or treatment status, we propose that they may have pathogenic significance. PMID:8958217

Liossis, S N; Kovacs, B; Dennis, G; Kammer, G M; Tsokos, G C

1996-01-01

194

Ar-39-Ar-40 Evidence for Early Impact Events on the LL Parent Body  

NASA Technical Reports Server (NTRS)

We determined Ar-39-Ar-40 ages of eight LL chondrites, and one igneous inclusion from an LL chondrite, with the object of understanding the thermal history of the LL-chondrite parent body. The meteorites in this study have a range of petrographic types from LL3.3 to LL6, and shock stages from S1 to S4. These meteorites reveal a range of K-Ar ages from 23.66 to 24.50 Ga, and peak ages from 23.74 to 24.55 Ga. Significantly, three of the eight chondrites (LL4, 5, 6) have K-Ar ages of -4.27 Ga. One of these (MIL99301) preserves an Ar-39-Ar-40 age of 4.23 +/- 0.03 Ga from low-temperature extractions, and an older age of 4.52 +/- 0.08 Ga from the highest temperature extractions. In addition, an igneous-textured impact melt DOM85505,22 has a peak Ar-39-Ar-40 age of >= 4.27 Ga. We interpret these results as evidence for impact events that occurred at about 4.27 Ga on the LL parent body that produced local impact melts, reset the Ar-39-Ar-40 ages of some meteorites, and exhumed (or interred) others, resulting in a range of cooling ages. The somewhat younger peak age of 3.74 Ga from GR095658 (LL3.3) suggests an additional impact event close to timing of impact-reset ages of some other ordinary chondrites between 3.6-3.8 Ga. The results from MIL99301 suggest that some apparently unshocked (Sl) chondrites may have substantially reset Ar-39-Ar-40 ages. A previous petrographic investigation of MIL99301 suggested that reheating to temperatures less than or equal to type 4 petrographic conditions (600C) caused fractures in olivine to anneal, resulting in a low apparent shock stage of S1 (unshocked). The Ar-39-Ar-40 age spectrum of MIL99301 is consistent with this interpretation. Older ages from high-T extractions may date an earlier impact event at 4.52 +/- 0.08 Ga, whereas younger ages from lower-T extractions date a later impact event at 4.23 Ar-39-Ar-40 0.03 Ga that may have caused annealing of feldspar and olivine

Dixon, E. T.; Bogard, D. D.; Garrison, D. H.; Rubin, A. E.

2006-01-01

195

High-affinity RNA Aptamers Against the HIV-1 Protease Inhibit Both In Vitro Protease Activity and Late Events of Viral Replication.  

PubMed

HIV-1 aspartyl protease (PR) plays a key role in virion morphogenesis, underscoring the effectiveness of protease inhibitors (PI). Despite their utility, side effects and drug-resistance remains a problem. We report the development of RNA aptamers as inhibitors of HIV-1 PR for potential use in anti-HIV gene therapy. Employing Systematic Evolution of Ligands by Exponential Enrichment (SELEX), we isolated four unique families of anti-HIV-1 PR RNA aptamers displaying moderate binding affinities (Kd = 92-140 nmol/l) and anti-PR inhibitory activity (Kis = 138-647 nmol/l). Second-generation RNA aptamers selected from partially randomized pools based on two of the aptamer sequences displayed striking enhancements in binding (Kds = 2-22 nmol/l) and inhibition (Kis = 31-49 nmol/l). The aptamers were specific in that they did not bind either the related HIV-2 protease, or the cellular aspartyl protease, Cathepsin D. Site-directed mutagenesis of a second-generation aptamer to probe the predicted secondary structure indicated that the stem-loops SL2 and SL3 and the stem P1 were essential for binding and that only the 3'-most 17 nucleotides were dispensable. Anti-PR aptamers inhibited HIV replication in vitro and the degree of inhibition was higher for second-generation aptamers with greater affinity and the inhibition was abrogated for a nonbinding aptamer variant. PMID:25689224

Duclair, Sonald; Gautam, Archana; Ellington, Andrew; Prasad, Vinayaka R

2015-01-01

196

Proteomic analysis of the Cyanophora paradoxa muroplast provides clues on early events in plastid endosymbiosis.  

PubMed

Glaucophytes represent the first lineage of photosynthetic eukaryotes of primary endosymbiotic origin that diverged after plastid establishment. The muroplast of Cyanophora paradoxa represents a primitive plastid that resembles its cyanobacterial ancestor in pigment composition and the presence of a peptidoglycan wall. To attain insights into the evolutionary history of cyanobiont integration and plastid development, it would thus be highly desirable to obtain knowledge on the composition of the glaucophyte plastid proteome. Here, we provide the first proteomic analysis of the muroplast of C. paradoxa. Mass spectrometric analysis of the muroplast proteome identified 510 proteins with high confidence. The protein repertoire of the muroplast revealed novel paths for reduced carbon flow and export to the cytosol through a sugar phosphate transporter of chlamydial origin. We propose that C. paradoxa possesses a primordial plastid mirroring the situation in the early protoalga. PMID:23212214

Facchinelli, Fabio; Pribil, Mathias; Oster, Ulrike; Ebert, Nina J; Bhattacharya, Debashish; Leister, Dario; Weber, Andreas P M

2013-02-01

197

Phosphoproteomic Analyses Reveal Early Signaling Events in the Osmotic Stress Response1[W][OPEN  

PubMed Central

Elucidating how plants sense and respond to water loss is important for identifying genetic and chemical interventions that may help sustain crop yields in water-limiting environments. Currently, the molecular mechanisms involved in the initial perception and response to dehydration are not well understood. Modern mass spectrometric methods for quantifying changes in the phosphoproteome provide an opportunity to identify key phosphorylation events involved in this process. Here, we have used both untargeted and targeted isotope-assisted mass spectrometric methods of phosphopeptide quantitation to characterize proteins in Arabidopsis (Arabidopsis thaliana) whose degree of phosphorylation is rapidly altered by hyperosmotic treatment. Thus, protein phosphorylation events responsive to 5 min of 0.3 m mannitol treatment were first identified using 15N metabolic labeling and untargeted mass spectrometry with a high-resolution ion-trap instrument. The results from these discovery experiments were then validated using targeted Selected Reaction Monitoring mass spectrometry with a triple quadrupole. Targeted Selected Reaction Monitoring experiments were conducted with plants treated under nine different environmental perturbations to determine whether the phosphorylation changes were specific for osmosignaling or involved cross talk with other signaling pathways. The results indicate that regulatory proteins such as members of the mitogen-activated protein kinase family are specifically phosphorylated in response to osmotic stress. Proteins involved in 5? messenger RNA decapping and phosphatidylinositol 3,5-bisphosphate synthesis were also identified as targets of dehydration-induced phosphoregulation. The results of these experiments demonstrate the utility of targeted phosphoproteomic analysis in understanding protein regulation networks and provide new insight into cellular processes involved in the osmotic stress response. PMID:24808101

E. Stecker, Kelly; Minkoff, Benjamin B.; Sussman, Michael R.

2014-01-01

198

CISN ShakeAlert: Faster Warning Information Through Multiple Threshold Event Detection in the Virtual Seismologist (VS) Early Warning Algorithm  

NASA Astrophysics Data System (ADS)

The Virtual Seismologist (VS) earthquake early warning (EEW) algorithm is one of 3 EEW approaches being incorporated into the California Integrated Seismic Network (CISN) ShakeAlert system, a prototype EEW system that could potentially be implemented in California. The VS algorithm, implemented by the Swiss Seismological Service at ETH Zurich, is a Bayesian approach to EEW, wherein the most probable source estimate at any given time is a combination of contributions from a likehihood function that evolves in response to incoming data from the on-going earthquake, and selected prior information, which can include factors such as network topology, the Gutenberg-Richter relationship or previously observed seismicity. The VS codes have been running in real-time at the Southern California Seismic Network since July 2008, and at the Northern California Seismic Network since February 2009. We discuss recent enhancements to the VS EEW algorithm that are being integrated into CISN ShakeAlert. We developed and continue to test a multiple-threshold event detection scheme, which uses different association / location approaches depending on the peak amplitudes associated with an incoming P pick. With this scheme, an event with sufficiently high initial amplitudes can be declared on the basis of a single station, maximizing warning times for damaging events for which EEW is most relevant. Smaller, non-damaging events, which will have lower initial amplitudes, will require more picks to initiate an event declaration, with the goal of reducing false alarms. This transforms the VS codes from a regional EEW approach reliant on traditional location estimation (and the requirement of at least 4 picks as implemented by the Binder Earthworm phase associator) into an on-site/regional approach capable of providing a continuously evolving stream of EEW information starting from the first P-detection. Real-time and offline analysis on Swiss and California waveform datasets indicate that the multiple-threshold approach is faster and more reliable for larger events than the earlier version of the VS codes. In addition, we provide evolutionary estimates of the probability of false alarms (PFA), which is an envisioned output stream of the CISN ShakeAlert system. The real-time decision-making approach envisioned for CISN ShakeAlert users, where users specify a threshhold PFA in addition to thresholds on peak ground motion estimates, has the potential to increase the available warning time for users with high tolerance to false alarms without compromising the needs of users with lower tolerances to false alarms.

Cua, G. B.; Fischer, M.; Caprio, M.; Heaton, T. H.; Cisn Earthquake Early Warning Project Team

2010-12-01

199

The PRESSCA operational early warning system for landslide forecasting: the 11-12 November 2013 rainfall event in Central Italy.  

NASA Astrophysics Data System (ADS)

The Umbria Region, located in Central Italy, is one of the most landslide risk prone area in Italy, almost yearly affected by landslides events at different spatial scales. For early warning procedures aimed at the assessment of the hydrogeological risk, the rainfall thresholds represent the main tool for the Italian Civil Protection System. As shown in previous studies, soil moisture plays a key-role in landslides triggering. In fact, acting on the pore water pressure, soil moisture influences the rainfall amount needed for activating a landslide. In this work, an operational physically-based early warning system, named PRESSCA, that takes into account soil moisture for the definition of rainfall thresholds is presented. Specifically, the soil moisture conditions are evaluated in PRESSCA by using a distributed soil water balance model that is recently coupled with near real-time satellite soil moisture product obtained from ASCAT (Advanced SCATterometer) and from in-situ monitoring data. The integration of three different sources of soil moisture information allows to estimate the most accurate possible soil moisture condition. Then, both observed and forecasted rainfall data are compared with the soil moisture-based thresholds in order to obtain risk indicators over a grid of ~ 5 km. These indicators are then used for the daily hydrogeological risk evaluation and management by the Civil Protection regional service, through the sharing/delivering of near real-time landslide risk scenarios (also through an open source web platform: www.cfumbria.it). On the 11th-12th November, 2013, Umbria Region was hit by an exceptional rainfall event with up to 430mm/72hours that resulted in significant economic damages, but fortunately no casualties among the population. In this study, the results during the rainfall event of PRESSCA system are described, by underlining the model capability to reproduce, two days in advance, landslide risk scenarios in good spatial and temporal agreement with the occurred actual conditions. High-resolution risk scenarios (100mx100m), obtained by coupling PRESSCA forecasts with susceptibility and vulnerability layers, are also produced. The results show good relationship between the PRESSCA forecast and the reported landslides to the Civil Protection Service during the rainfall event, confirming the system robustness. The good forecasts of PRESSCA system have surely contributed to start well in advance the Civil Protection operations (alerting local authorities and population).

Ciabatta, Luca; Brocca, Luca; Ponziani, Francesco; Berni, Nicola; Stelluti, Marco; Moramarco, Tommaso

2014-05-01

200

Molecular replication  

NASA Technical Reports Server (NTRS)

The object of our research program is to understand how polynucleotide replication originated on the primitive Earth. This is a central issue in studies of the origins of life, since a process similar to modern DNA and RNA synthesis is likely to have formed the basis for the most primitive system of genetic information transfer. The major conclusion of studies so far is that a preformed polynucleotide template under many different experimental conditions will facilitate the synthesis of a new oligonucleotide with a sequence complementary to that of the template. It has been shown, for example, that poly(C) facilitates the synthesis of long oligo(G)s and that the short template CCGCC facilities the synthesis of its complement GGCGG. Very recently we have shown that template-directed synthesis is not limited to the standard oligonucleotide substrates. Nucleic acid-like molecules with a pyrophosphate group replacing the phosphate of the standard nucleic acid backbone are readily synthesized from deoxynucleotide 3'-5'-diphosphates on appropriate templates.

Orgel, L. E.

1986-01-01

201

A Threshold-Based Earthquake Early-Warning System for Offshore Events in Southern Iberia  

NASA Astrophysics Data System (ADS)

The south of the Iberian Peninsula is situated at the convergence of the Eurasian and African plates. This region experiences large earthquakes with long separation in time, the best known of which was the great 1755 Lisbon Earthquake, which occurred SW of San Vicente Cape (SW Iberian Peninsula). The high risk of damaging earthquakes has recently led uc(Carranza) et al. (Geophys. Res. Lett. 40, 2013) to investigate the feasibility of an EEWS in this region. Analysis of the geometry for the Iberian seismic networks and the San Vicente Cape area led the authors to conclude that a threshold-based approach, which would not require real-time location of the earthquake, might be the best option for an EEWS in SW Iberia. In this work we investigate this hypothesis and propose a new EEW approach that extends standard P-wave threshold-based single-station analysis to the whole network. The proposed method enables real-time estimation of the potential damage at stations that are triggered by P-waves and those which are not triggered, with the advantage of greater lead-times for release of alerts. Results of tests made with synthetic data mimicking the scenario of the great 1755 Lisbon Earthquake, and those conducted by applying the new approach to available recordings, indicate that an EEW estimation of the potential damage associated with an event in the San Vicente Cape area can be obtained for a very large part of the Iberian Peninsula.

Picozzi, M.; Colombelli, S.; Zollo, A.; Carranza, M.; Buforn, E.

2014-12-01

202

Repression of early lateral root initiation events by transient water deficit in barley and maize  

PubMed Central

The formation of lateral roots (LRs) is a key driver of root system architecture and developmental plasticity. The first stage of LR formation, which leads to the acquisition of founder cell identity in the pericycle, is the primary determinant of root branching patterns. The fact that initiation events occur asynchronously in a very small number of cells inside the parent root has been a major difficulty in the study of the molecular regulation of branching patterns. Inducible systems that trigger synchronous lateral formation at predictable sites have proven extremely valuable in Arabidopsis to decipher the first steps of LR formation. Here, we present a LR repression system for cereals that relies on a transient water-deficit treatment, which blocks LR initiation before the first formative divisions. Using a time-lapse approach, we analysed the dynamics of this repression along growing roots and were able to show that it targets a very narrow developmental window of the initiation process. Interestingly, the repression can be exploited to obtain negative control root samples where LR initiation is absent. This system could be instrumental in the analysis of the molecular basis of drought-responsive as well as intrinsic pathways of LR formation in cereals. PMID:22527396

Babé, Aurélie; Lavigne, Tristan; Séverin, Jean-Philippe; Nagel, Kerstin A.; Walter, Achim; Chaumont, François; Batoko, Henri; Beeckman, Tom; Draye, Xavier

2012-01-01

203

Ellagic Acid Suppresses Lipid Accumulation by Suppressing Early Adipogenic Events and Cell Cycle Arrest.  

PubMed

Ellagic acid (EA) is a natural polyphenol found in various fruits and vegetables. In this study, we examined the inhibitory effect of EA on fat accumulation in 3T3-L1 cells during adipogenesis. Our data showed that EA reduced fat accumulation by down-regulating adipogenic markers such as peroxisome proliferator activated receptor ? (PPAR?) and the CCAAT/enhancer binding protein ? (C/EBP?) at the mRNA and protein levels in a dose-dependent manner. We found that the decrease in adipogenic markers resulted from reduced expression of some early adipogenic transcription factors such as KLF4, KLF5, Krox20, and C/EBP? within 24?h. Also, these inhibitions were correlated with down-regulation of TG synthetic enzymes, causing inhibition of triglyceride (TG) levels in 3T3-L1 cells investigated by ORO staining and in zebrafish investigated by TG assay. Additionally, the cell cycle analysis showed that EA inhibited cell cycle progression by arresting cells at the G0/G1 phase. Copyright © 2014 John Wiley & Sons, Ltd. PMID:25462071

Woo, Mi-Seon; Choi, Hyeon-Son; Seo, Min-Jung; Jeon, Hui-Jeon; Lee, Boo-Yong

2014-12-01

204

Event Checklist Event Title: _____________________________________________________________  

E-print Network

Event Checklist Event Title: _____________________________________________________________ Event:______________________ Fax:________________ Email:_________________ Account #/Funding Source__________________________________________________ Event Location:_____________________________________ Room #______________ Event Date

Almor, Amit

205

Early cerebrovascular and parenchymal events following prenatal exposure to the putative neurotoxin methylazoxymethanol.  

PubMed

One of the most common causes of neurological disabilities are malformations of cortical development (MCD). A useful animal model of MCD consists of prenatal exposure to methylazoxymethanol (MAM), resulting in a postnatal phenotype characterized by cytological aberrations reminiscent of human MCD. Although postnatal effects of MAM are likely a consequence of prenatal events, little is known on how the developing brain reacts to MAM. General assumption is the effects of prenatally administered MAM are short lived (24 h) and neuroblast-specific. MAM persisted for several days after exposure in utero in both maternal serum and fetal brain, but at levels lower than predicted by a neurotoxic action. MAM levels and time course were consistent with a different mechanism of indirect neuronal toxicity. The most prominent acute effects of MAM were cortical swelling associated with mild cortical disorganization and neurodegeneration occurring in absence of massive neuronal cell death. Delayed or aborted vasculogenesis was demonstrated by MAM's ability to hinder vessel formation. In vitro, MAM reduced synthesis and release of VEGF by endothelial cells. Decreased expression of VEGF, AQP1, and lectin-B was consistent with a vascular target in prenatal brain. The effects of MAM on cerebral blood vessels persisted postnatally, as indicated by capillary hypodensity in heterotopic areas of adult rat brain. In conclusion, these results show that MAM does not act only as a neurotoxin per se, but may additionally cause a short-lived toxic effect secondary to cerebrovascular dysfunction, possibly due to a direct anti-angiogenic effect of MAM itself. PMID:17398107

Bassanini, Stefania; Hallene, Kerri; Battaglia, Giorgio; Finardi, Adele; Santaguida, Stefano; Cipolla, Marilyn; Janigro, Damir

2007-05-01

206

The Roles of Chromatin Remodelling Factors in Replication  

Microsoft Academic Search

Dynamic changes of chromatin structure control DNA-dependent events, including DNA replication.\\u000a Along with DNA, chromatin organization must be replicated to maintain genetic and epigenetic information\\u000a through cell generations. Chromatin remodelling is important for several steps in replication: determination\\u000a and activation of origins of replication, replication machinery progression, chromatin assembly and\\u000a DNA repair. Histone chaperones such as the FACT complex assist

Ana Neves-Costa; Patrick Varga-Weisz

207

Perillyl Alcohol Protects Against Fe-NTA-Induced Nephrotoxicity and Early Tumor Promotional Events in Rat Experimental Model  

PubMed Central

Plants have been widely used as protective agents against a wide variety of processes and compounds that damage tissues via free radical mechanisms. Perillyl alcohol (PA) is a naturally occurring monoterpene found in the essential oils of numerous species of plants including mints, cherries and celery seeds. This monocyclic monoterpene has shown antioxidant and therapeutic activity in various studies against various xenobiotics. In this study, we have analyzed the effects of PA against single intraperitoneal dose of ferric nitrilotriacetate (Fe-NTA) (9 mg iron per kg body weight)-induced nephrotoxicity and early tumor promotional events. The pretreatment of Fe-NTA-treated rats with 0.5% per kg body weight dose and 1% per kg body weight dose of PA for seven consecutive days significantly reversed the Fe-NTA-induced malondialdehyde formation, xanthine oxidase activity (P < 0.001), ornithine decarboxylase activity (P < 0.001) and 3[H]thymidine incorporation in renal DNA (P < 0.001) with simultaneous significant depletion in serum toxicity markers blood urea nitrogen and creatinine (P < 0.001). Significant restoration at both the doses was recorded in depleted renal glutathione content, and its dependent enzymes with prophylactic treatment of PA. Present results suggest that PA potentially attenuates against Fe-NTA-induced oxidative damage and tumor promotional events that preclude its development as a future drug to avert the free radical-induced toxicity. PMID:18227911

Jahangir, Tamanna

2007-01-01

208

Size-resolved aerosol chemical analysis of extreme haze pollution events during early 2013 in urban Beijing, China.  

PubMed

Using size-resolved filter sampling and chemical characterization, high concentrations of water-soluble ions, carbonaceous species and heavy metals were found in both fine (PM2.1) and coarse (PM2.1-9) particles in Beijing during haze events in early 2013. Even on clear days, average mass concentration of submicron particles (PM1.1) was several times higher than that previously measured in most of abroad urban areas. A high concentration of particulate matter on haze days weakens the incident solar radiation, which reduces the generation rate of secondary organic carbon in PM1.1. We show that the peak mass concentration of particles shifted from 0.43-0.65?m on clear days to 0.65-1.1?m on lightly polluted days and to 1.1-2.1?m on heavily polluted days. The peak shifts were also found for the following species: organic carbon, elemental carbon, NH4(+), SO4(2-), NO3(-), K, Cu, Zn, Cd and Pb. Our findings demonstrate that secondary inorganic aerosols (36%) and organic matter (26%) dominated the fine particle mass on heavily polluted days, while their contribution reduced to 29% and 18%, respectively, on clear days. Besides fine particles, anthropogenic chemical species also substantially accumulated in the coarse mode, which suggests that particles with aerodynamic diameter larger than 2.1?m cannot be neglected during severe haze events. PMID:25106045

Tian, Shili; Pan, Yuepeng; Liu, Zirui; Wen, Tianxue; Wang, Yuesi

2014-08-30

209

Examining Human T-Lymphotropic Virus Type 1 Infection and Replication by Cell-Free Infection with Recombinant Virus Vectors  

Microsoft Academic Search

A sensitive and quantitative cell-free infection assay, utilizing recombinant human T-cell leukemia virus type 1 (HTLV-1)-based vectors, was developed in order to analyze early events in the virus replication cycle. Previous difficulties with the low infectivity and restricted expression of the virus have prevented a clear understanding of these events. Virus stocks were generated by transfecting cells with three plasmids:

DAVID DERSE; SHAWN A. HILL; PATRICIA A. LLOYD; HYE-KYUNG CHUNG; BARRY A. MORSE

2001-01-01

210

Early psychosocial interventions after disasters, terrorism and other shocking events: is there a gap between norms and practice in Europe?  

PubMed Central

Background Internationally, several initiatives exist to describe standards for post-disaster psychosocial care. Objective This study explored the level of consensus of experts within Europe on a set of recommendations on early psychosocial intervention after shocking events (Dutch guidelines), and to what degree these standards are implemented into mental health care practice. Methods Two hundred and six (mental) health care professionals filled out a questionnaire to assess the extent to which they consider the guidelines’ scope and recommendations relevant and part of the regular practice in their own country. Forty-five European experts from 24 EU countries discussed the guidelines at an international seminar. Results The data suggest overall agreement on the standards although many of the recommendations appear not (yet) to be embedded in everyday practice. Conclusions Although large consensus exists on standards for early psychosocial care, a chasm between norms and practice appears to exist throughout the EU, stressing the general need for investments in guideline development and implementation. PMID:23393613

Te Brake, Hans

2013-01-01

211

Early event-related potentials indicate context-specific target processing for eye and hand motor systems?  

PubMed Central

Concurrent eye and hand movements toward a common visual target require different motor programs based on identical visual input. We used event-related brain potentials (ERP) to determine if and when the processing of the visual target differs for the two motor systems. The N2, an index for target evaluation, was more negative for the target of a hand than of an eye movement in two experiments. A possible interpretation for this finding is different visual target processing. Targets for hand movements require a different weighting of visual information, for example concerning features such as surface structure which are important for hand but not for eye movements. In experiment 2, the early C1-component, which had an average maximum at 67 ms following target onset, was significantly more negative when subjects pointed at the stimuli. Traditionally, the C1 has been regarded as a sensory component, but recent studies have linked it to higher order processing, such as attention and expectations. Thus, the present data indicate that target processing for eye or hand movements is already context-specific during early visual information processing. We suggest that differences in a target’s relevance for upcoming movements modify target processing as well as sensory expectations. PMID:23968690

Wehrspaun, Claudia C.; Pfabigan, Daniela M.; Sailer, Uta

2013-01-01

212

Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II  

SciTech Connect

Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

Sample, Robert [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Bryan, Locke [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Long, Scott [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Majji, Sai [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Hoskins, Glenn [Department of Anatomy, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Sinning, Allan [Department of Anatomy, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Olivier, Jake [Department of Preventive Medicine, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Chinchar, V. Gregory [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States)]. E-mail: vchinchar@microbio.umsmed.edu

2007-02-20

213

Reactivation of the Human Cytomegalovirus Major Immediate-Early Regulatory Region and Viral Replication in Embryonal NTera2 Cells: Role of Trichostatin A, Retinoic Acid, and Deletion of the 21-Base-Pair Repeats and Modulator  

PubMed Central

Inactivity of the human cytomegalovirus (HCMV) major immediate-early regulatory region (MIERR), which is composed of promoter, enhancer, unique region, and modulator, is linked to lack of HCMV replication in latently infected cells and in other nonpermissive cell types, including human embryonal NTera2 carcinoma (NT2) cells. I refined the embryonal NT2 cell model to enable characterization of the unknown mechanistic basis for silencing of HCMV MIERR-dependent transcription and viral replication in nonpermissive cells. These infected NT2 cells contain nonreplicating viral genomes with electrophoretic mobility equivalent to a supercoiled, bacterial artificial chromosome of comparable molecular weight. MIERR-dependent transcription is minimal to negligible. Increasing the availability of positive-acting transcription factors by retinoic acid (RA) treatment after infection is largely insufficient in reactivating the MIERR. In contrast, trichostatin A (TSA), a histone deacetylase inhibitor, reactivates MIERR-dependent transcription. Contrary to prior findings produced from transfected MIERR segments, deletion of the 21-bp repeats and modulator from the MIERR in the viral genome does not relieve MIERR silencing. To demonstrate that MIERR silencing likely results from enhancer inactivity, I examined an HCMV with a heterologous MIERR promoter that is enhancer dependent but exempt from IE2 p86-mediated negative autoregulation. This heterologous promoter, like its neighboring native MIERR promoter, exhibits immediate-early transcriptional kinetics in fibroblasts. In embryonal NT2 cells, the heterologous MIERR promoter is transcriptionally inactive. This silence is relieved by TSA but not by RA. Remarkably, TSA-induced reactivation of MIERR-dependent transcription from quiescent viral genomes is followed by release of infectious virus. I conclude that a mechanism of active repression imposes a block to MIERR-dependent transcription and viral replication in embryonal NT2 cells. Because TSA overcomes the block, viral gene silencing may involve histone deacetylase-based modification of viral chromatin, which might account for the covalently closed circular conformation of quiescent HCMV genomes. PMID:11160656

Meier, Jeffery L.

2001-01-01

214

Perturbation of bile acid homeostasis is an early pathogenesis event of drug induced liver injury in rats  

SciTech Connect

Drug-induced liver injury (DILI) is a significant consideration for drug development. Current preclinical DILI assessment relying on histopathology and clinical chemistry has limitations in sensitivity and discordance with human. To gain insights on DILI pathogenesis and identify potential biomarkers for improved DILI detection, we performed untargeted metabolomic analyses on rats treated with thirteen known hepatotoxins causing various types of DILI: necrosis (acetaminophen, bendazac, cyclosporine A, carbon tetrachloride, ethionine), cholestasis (methapyrilene and naphthylisothiocyanate), steatosis (tetracycline and ticlopidine), and idiosyncratic (carbamazepine, chlorzoxasone, flutamide, and nimesulide) at two doses and two time points. Statistical analysis and pathway mapping of the nearly 1900 metabolites profiled in the plasma, urine, and liver revealed diverse time and dose dependent metabolic cascades leading to DILI by the hepatotoxins. The most consistent change induced by the hepatotoxins, detectable even at the early time point/low dose, was the significant elevations of a panel of bile acids in the plasma and urine, suggesting that DILI impaired hepatic bile acid uptake from the circulation. Furthermore, bile acid amidation in the hepatocytes was altered depending on the severity of the hepatotoxin-induced oxidative stress. The alteration of the bile acids was most evident by the necrosis and cholestasis hepatotoxins, with more subtle effects by the steatosis and idiosyncratic hepatotoxins. Taking together, our data suggest that the perturbation of bile acid homeostasis is an early event of DILI. Upon further validation, selected bile acids in the circulation could be potentially used as sensitive and early DILI preclinical biomarkers. - Highlights: ? We used metabolomics to gain insights on drug induced liver injury (DILI) in rats. ? We profiled rats treated with thirteen hepatotoxins at two doses and two time points. ? The toxins decreased the liver's ability to uptake bile acid from the circulation. ? Oxidative stress induced by the toxins altered bile acid biosynthesis in the liver. ? Selected bile acids in the plasma and urine could be sensitive DILI biomarkers.

Yamazaki, Makoto; Miyake, Manami; Sato, Hiroko; Masutomi, Naoya; Tsutsui, Naohisa [Mitsubishi Tanabe Pharma Corporation, Kisarazu, Chiba 292-0818 (Japan); Adam, Klaus-Peter; Alexander, Danny C.; Lawton, Kay A.; Milburn, Michael V.; Ryals, John A.; Wulff, Jacob E. [Metabolon Inc., 617 Davis Drive, Suite 400, Durham, NC 27713 (United States); Guo, Lining, E-mail: lguo@metabolon.com [Metabolon Inc., 617 Davis Drive, Suite 400, Durham, NC 27713 (United States)

2013-04-01

215

Replication Checkpoint: Tuning and Coordination of Replication Forks in S Phase  

PubMed Central

Checkpoints monitor critical cell cycle events such as chromosome duplication and segregation. They are highly conserved mechanisms that prevent progression into the next phase of the cell cycle when cells are unable to accomplish the previous event properly. During S phase, cells also provide a surveillance mechanism called the DNA replication checkpoint, which consists of a conserved kinase cascade that is provoked by insults that block or slow down replication forks. The DNA replication checkpoint is crucial for maintaining genome stability, because replication forks become vulnerable to collapse when they encounter obstacles such as nucleotide adducts, nicks, RNA-DNA hybrids, or stable protein-DNA complexes. These can be exogenously induced or can arise from endogenous cellular activity. Here, we summarize the initiation and transduction of the replication checkpoint as well as its targets, which coordinate cell cycle events and DNA replication fork stability. PMID:24705211

Hustedt, Nicole; Gasser, Susan M.; Shimada, Kenji

2013-01-01

216

Impact of the large-scale dynamics on the ARM Arctic cloud and radiation measurements and early snowmelt events  

NASA Astrophysics Data System (ADS)

In the last 3 decades the average temperature over the Northern Alaska has increased by about 2.3 °C with the maximum during the spring (3.9 °C) and the minimum during the summer (1.5 °C). This warming has resulted in an average 8-day advance in snowmelt date over Northern Alaska, and a 10% decrease in the extent of snow cover observed from satellites. Therefore it is necessary to identify the factors influencing this trend, especially during the spring because changes in the spring snowmelt date will significantly affect the surface radiation budget. In this study, we use 10 years (1998-2007) of surface observations collected from the Atmospheric Radiation Measurement (ARM) North Slope of Alaska (NSA) site and NCEP reanalysis, and find that there are more clouds in the warm season (May-October) than in the cold season (November - April), which exhibits a strong association with the large-scale dynamics. The net surface radiation budget indicates that the Arctic surface loses radiative energy during October - April and gains radiative energy during May-September, and clouds tend to enhance snow melting in spring and impede the solidification of permafrost in autumn. We have identified the years of 2002, 2005, and 2007 as years with abnormally early snowmelt, where the date of the spring snowmelt is approximately 10 days earlier than average. Large-scale dynamics and previous winter snow fall are certainly two of the factors affecting the snowmelt over this region. Using NCEP reanalysis data, we have developed a pattern which positions the Aleutian Low (AL) in the center of the Bering Sea and a ridge building over eastern Alaska during the early snowmelt events. This large-scale pattern supports warm moist air advection over northern Alaska, increasing the areal clouds and thus supporting early snowmelt. We will use the integrated ARM NSA radiation and cloud, snow depth and accumulation, and NCEP reanalysis data over the Western Arctic to investigate the 2002, 2005 and 2007 spring snowmelt events.

Crosby, K. M.; Dong, X.; Xi, B.; Long, C. N.

2008-05-01

217

A Novel DDB2-ATM Feedback Loop Regulates Human Cytomegalovirus Replication  

PubMed Central

Human cytomegalovirus (HCMV) genome replication requires host DNA damage responses (DDRs) and raises the possibility that DNA repair pathways may influence viral replication. We report here that a nucleotide excision repair (NER)-associated-factor is required for efficient HCMV DNA replication. Mutations in genes encoding NER factors are associated with xeroderma pigmentosum (XP). One of the XP complementation groups, XPE, involves mutation in ddb2, which encodes DNA damage binding protein 2 (DDB2). Infectious progeny virus production was reduced by >2 logs in XPE fibroblasts compared to levels in normal fibroblasts. The levels of immediate early (IE) (IE2), early (E) (pp65), and early/late (E/L) (gB55) proteins were decreased in XPE cells. These replication defects were rescued by infection with a retrovirus expressing DDB2 cDNA. Similar patterns of reduced viral gene expression and progeny virus production were also observed in normal fibroblasts that were depleted for DDB2 by RNA interference (RNAi). Mature replication compartments (RCs) were nearly absent in XPE cells, and there were 1.5- to 2.0-log reductions in viral DNA loads in infected XPE cells relative to those in normal fibroblasts. The expression of viral genes (UL122, UL44, UL54, UL55, and UL84) affected by DDB2 status was also sensitive to a viral DNA replication inhibitor, phosphonoacetic acid (PAA), suggesting that DDB2 affects gene expression upstream of or events associated with the initiation of DNA replication. Finally, a novel, infection-associated feedback loop between DDB2 and ataxia telangiectasia mutated (ATM) was observed in infected cells. Together, these results demonstrate that DDB2 and a DDB2-ATM feedback loop influence HCMV replication. PMID:24335308

E, Xiaofei; Savidis, George; Chin, Christopher R.; Wang, Shixia; Lu, Shan; Brass, Abraham L.

2014-01-01

218

A novel DDB2-ATM feedback loop regulates human cytomegalovirus replication.  

PubMed

Human cytomegalovirus (HCMV) genome replication requires host DNA damage responses (DDRs) and raises the possibility that DNA repair pathways may influence viral replication. We report here that a nucleotide excision repair (NER)-associated-factor is required for efficient HCMV DNA replication. Mutations in genes encoding NER factors are associated with xeroderma pigmentosum (XP). One of the XP complementation groups, XPE, involves mutation in ddb2, which encodes DNA damage binding protein 2 (DDB2). Infectious progeny virus production was reduced by >2 logs in XPE fibroblasts compared to levels in normal fibroblasts. The levels of immediate early (IE) (IE2), early (E) (pp65), and early/late (E/L) (gB55) proteins were decreased in XPE cells. These replication defects were rescued by infection with a retrovirus expressing DDB2 cDNA. Similar patterns of reduced viral gene expression and progeny virus production were also observed in normal fibroblasts that were depleted for DDB2 by RNA interference (RNAi). Mature replication compartments (RCs) were nearly absent in XPE cells, and there were 1.5- to 2.0-log reductions in viral DNA loads in infected XPE cells relative to those in normal fibroblasts. The expression of viral genes (UL122, UL44, UL54, UL55, and UL84) affected by DDB2 status was also sensitive to a viral DNA replication inhibitor, phosphonoacetic acid (PAA), suggesting that DDB2 affects gene expression upstream of or events associated with the initiation of DNA replication. Finally, a novel, infection-associated feedback loop between DDB2 and ataxia telangiectasia mutated (ATM) was observed in infected cells. Together, these results demonstrate that DDB2 and a DDB2-ATM feedback loop influence HCMV replication. PMID:24335308

E, Xiaofei; Savidis, George; Chin, Christopher R; Wang, Shixia; Lu, Shan; Brass, Abraham L; Kowalik, Timothy F

2014-02-01

219

Impact of COX2 genotype, ER status and body constitution on risk of early events in different treatment groups of breast cancer patients  

PubMed Central

The COX2 rs5277 (306G>C) polymorphism has been associated with inflammation-associated cancers. In breast cancer, tumor COX-2 expression has been associated with increased estrogen levels in estrogen receptor (ER)-positive and activated Akt-pathway in ER-negative tumors. Our study investigated the impact of COX2 genotypes on early breast cancer events and treatment response in relation to tumor ER status and body constitution. In Sweden, between 2002 and 2008, 634 primary breast cancer patients, aged 25–99 years, were included. Disease-free survival was assessed for 570 rs5277-genotyped patients. Body measurements and questionnaires were obtained preoperatively. Clinical data, patient- and tumor-characteristics were obtained from questionnaires, patients' charts, population registries and pathology reports. Minor allele(C) frequency was 16.1%. Genotype was not linked to COX-2 tumor expression. Median follow-up was 5.1 years. G/G genotype was not associated with early events in patients with ER-positive tumors, adjusted HR 0.77 (0.46–1.29), but conferred an over 4-fold increased risk in patients with ER-negative tumors, adjusted HR 4.41 (1.21–16.02)(pinteraction = 0.015). Chemotherapy-treated G/G-carriers with a breast volume ?850 ml had an increased risk of early events irrespective of ER status, adjusted HR 8.99 (1.14–70.89). Endocrine-treated C-allele carriers with ER-positive tumors and a breast volume ?850 ml had increased risk of early events, adjusted HR 2.30 (1.12–4.75). COX2 genotype, body constitution and ER status had a combined effect on the risk of early events and treatment response. The high risk for early events in certain subgroups of patients suggests that COX2 genotype in combination with body measurements may identify patients in need of more personalized treatment. PMID:24599585

Markkula, Andrea; Simonsson, Maria; Rosendahl, Ann H; Gaber, Alexander; Ingvar, Christian; Rose, Carsten; Jernström, Helena

2014-01-01

220

Calcium isotope evidence for dramatic increase of continental weathering during the Toarcian oceanic anoxic event (Early Jurassic)  

NASA Astrophysics Data System (ADS)

The early Toarcian was punctuated by pulses of massive carbon injection that are thought to have triggered, through increased greenhouse conditions, elevated continental discharge and nutrient input, marine anoxia, seawater acidification and species extinctions. Nevertheless, the mode and tempo of changes in continental weathering across this interval remains highly debated, leading to considerable uncertainty about the main causes of these perturbations. In this study we present calcium isotope measurements (?44/40Ca) of well-preserved brachiopods and bulk rock samples from the hemipelagic strata of Pliensbachian-Toarcian age of Peniche in Portugal in order to constrain changes in the calcium cycle and hence changes in continental weathering during the early Toarcian. The data reveal a similar trend as carbon isotope data from the same section and show negative excursions of about 0.5‰ at the Pliensbachian-Toarcian transition (Pl-To) and at the base of the Toarcian Oceanic Anoxic Event (T-OAE) interval. The comparison of ?44/40Ca ratios recorded in brachiopods and bulk rock corrected for variable dolomite contribution indicates that these excursions reflect changes in the global isotopic composition of seawater rather than changes in the dominant mineralogy of calcifying organisms or in hydrological budget of the considered basin. Box modeling results suggest that the Pl-To and T-OAE ?44/40Ca excursions can be explained by a transient 90% decrease of carbonate accumulation due to seawater acidification followed by a 500% increase in continental weathering rates. The sharp increases in continental weathering inferred from the ?44/40Ca ratios seem overall consistent with lower Toarcian sedimentological and biotic records that document rapid crises in carbonate production followed by episodes of increased calcium carbonate burial. Nevertheless, the maximum of carbonate burial recorded by most NW European basinal successions occurs several hundreds of kyrs after that predicted by box modeling results. This mismatch either implies that the European records of carbonate accumulation do not reflect global trends or that the fundamental processes related to the removal of excess alkalinity caused by increased continental weathering are more complex than previously appreciated. Based on the amount of Ca input simulated by box modeling, the injection of tens of thousands of gigatons of carbon with an isotopic composition (?13C) comprised between - 6 ‰ and - 14 ‰ appears as the most likely causes of the ?13C excursions characterizing these two events. These results indicate that environmental and biotic changes of the Pl-To and T-OAE were mainly caused a cascade of environmental changes triggered by the massive carbon emissions from the Karoo-Ferrar volcanism.

Brazier, Jean-Michel; Suan, Guillaume; Tacail, Théo; Simon, Laurent; Martin, Jeremy E.; Mattioli, Emanuela; Balter, Vincent

2015-02-01

221

Rapid changes in the redox conditions of the western Tethys Ocean during the early Aptian oceanic anoxic event  

NASA Astrophysics Data System (ADS)

The early Aptian (125 to 121 Ma) records an episode of severe environmental change including a major perturbation of the carbon cycle, an oceanic anoxic event (OAE 1a, 122.5 Ma), a platform drowning episode and a biocalcification crisis. We propose to trace changes in the oxygenation state of the ocean during the early Aptian anoxic event using the redox-sensitive trace-element (RSTE) distribution, phosphorus accumulation rates (PARs) and organic-matter characterization in three different basins of the western Tethys. The following sections have been investigated: Gorgo a Cerbara (central Italy) in the Umbria Marche basin, Glaise (SE France) in the Vocontian basin and Cassis/La Bédoule (SE France) located in the Provencal basin. In the Gorgo a Cerbara section, RSTE distributions show a low background level along the main part of the section, contrasted by different maxima in concentrations within the Selli level. In the Glaise section, the Goguel level displays a weak increase in RSTE contents coeval with moderate TOC values. At Cassis/La Bédoule, no significant RSTE enrichments have been observed in sediments equivalent to the Selli level. These differences in the records of the geochemical proxies of the Selli level or its equivalent indicate the deposition under different redox conditions, probably related to the paleogeography. Our data indicate the development of anoxic-euxinic conditions in the deeper part of the Tethys during OAE 1a, whereas in the shallower environments, conditions were less reducing. Moreover, at Gorgo a Cerbara, the Selli level is characterized by rapid changes in the intensity of reducing conditions in the water column. Ocean eutrophication seems to be a major factor in the development and the persistence of anoxia as suggested by the PAR evolution. Higher PAR values at the onset of OAE 1a suggest an increase in nutrient input, whereas the return to lower values through the first part of the OAE 1a interval may be related to the weakened capacity to retain P in the sedimentary reservoir due to bottom-water oxygen depletion. This general pattern is contrasted by the data of Gorgo a Cerbara, where the sediments deposited during the OAE 1a interval show P-enrichments (mainly authigenic P). This is associated with maxima in TOC values and Corg:Ptot ratios, suggesting that a part of the remobilized P was trapped in the sediments and as such prevented from returning to the water column.

Westermann, Stéphane; Stein, Melody; Matera, Virginie; Fiet, Nicolas; Fleitmann, Dominik; Adatte, Thierry; Föllmi, Karl B.

2013-11-01

222

Using Simcyp to project human oral pharmacokinetic variability in early drug research to mitigate mechanism-based adverse events.  

PubMed

Positive allosteric modulators ('potentiators') of the ?-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) have been shown to display a mechanism-based exposure-response continuum in preclinical species with procognitive electrophysiological and behavioral effects ('efficacy') at low exposures and motor coordination disruptions at progressively higher exposures. Due to the dose-capping nature of such motor coordination deficits, an exposure threshold-mediated adverse event (C(AE) ), the adequacy of separation between the maximal total plasma compound concentration (C(max) ) at a predicted clinically efficacious oral dose and this adverse event (AE) was explored in early drug research with three AMPAR potentiators considered potential candidates for clinical trials. In vitro metabolism studies in human liver microsomes and human hepatocytes demonstrated the metabolic clearance for each compound was predominately due to cytochromes P450 (CYP). Thus, for each compound's anticipated clinically efficacious dose, human C(max) variability following oral administration was assessed using Simcyp software, which combines its virtual human populations database using extensive demographic, physiological and genomic information with routinely collected compound-specific in vitro biochemical data to simulate and predict drug disposition. Using a combination of experimentally determined recombinant human CYP intrinsic clearances for CYP1A2, CYP2C8, CYP2C9, CYP2C19, CYP2D6 and CYP3A4, human binding factors, expected fraction absorbed and estimated steady-state volume of distribution, Simcyp simulations demonstrated that two of the three potentiators had acceptable projected C(max) variability (i.e. the 95th percentile C(max) did not breach C(AE) ). This evaluation aided in the selection of compounds for preclinical progression, and represents a novel application of pharmacologically based pharmacokinetic (PBPK) software approaches to predict interpatient variability. PMID:22213407

Shaffer, Christopher L; Scialis, Renato J; Rong, Haojing; Obach, R Scott

2012-03-01

223

Early Life Events Carry Over to Influence Pre-Migratory Condition in a Free-Living Songbird  

PubMed Central

Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1st year survival and nestling mass in migratory Savannah sparrows (Passerculus sandwichensis). We also use a brood manipulation experiment to show that nestlings from smaller broods have higher mass in the nest relative to individuals from larger broods. Having established these relationships, we then use three years of field data involving multiple captures of individuals throughout the pre-migratory period and a multi-level path model to examine the hypothesis that conditions during development limit survival during migration by affecting an individual's ability to accumulate sufficient lean tissue and fat mass prior to migration. We found a positive relationship between fat mass during the pre-migratory period (Sept–Oct) and nestling mass and a negative indirect relationship between pre-migratory fat mass and fledging date. Our results provide the first evidence that conditions during development limit survival during migration through their effect on fat stores. These results are particularly important given recent evidence showing that body condition of songbirds at fledging is affected by climate change and anthropogenic changes to landscape structure. PMID:22194925

Mitchell, Greg W.; Guglielmo, Christopher G.; Wheelwright, Nathaniel T.; Freeman-Gallant, Corey R.; Norris, D. Ryan

2011-01-01

224

Characterization of the early events leading to totipotency in an Arabidopsis protoplast liquid culture by temporal transcript profiling.  

PubMed

The molecular mechanisms underlying plant cell totipotency are largely unknown. Here, we present a protocol for the efficient regeneration of plants from Arabidopsis thaliana protoplasts. The specific liquid medium used in our study leads to a high rate of reentry into the cell cycle of most cell types, providing a powerful system to study dedifferentiation/regeneration processes in independent somatic cells. To identify the early events in the establishment of totipotency, we monitored the genome-wide transcript profiles of plantlets and protoplast-derived cells (PdCs) during the first week of culture. Plant cells rapidly dedifferentiated. Then, we observed the reinitiation and reorientation of protein synthesis, accompanied by the reinitiation of cell division and de novo cell wall synthesis. Marked changes in the expression of chromatin-associated genes, especially of those in the histone variant family, were observed during protoplast culture. Surprisingly, the epigenetic status of PdCs and well-established cell cultures differed, with PdCs exhibiting rare reactivated transposons and epigenetic changes. The differentially expressed genes identified in this study are interesting candidates for investigating the molecular mechanisms underlying plant cell plasticity and totipotency. One of these genes, the plant-specific transcription factor ABERRANT LATERAL ROOT FORMATION4, is required for the initiation of protoplast division. PMID:23903317

Chupeau, Marie-Christine; Granier, Fabienne; Pichon, Olivier; Renou, Jean-Pierre; Gaudin, Valérie; Chupeau, Yves

2013-07-01

225

Subsurface North Atlantic warming as a trigger of rapid cooling events: evidences from the Early Pleistocene (MIS 31-19)  

NASA Astrophysics Data System (ADS)

Subsurface water column dynamics in the subpolar North Atlantic were reconstructed in order to improve the understanding of the cause of abrupt IRD events during cold periods of the Early Pleistocene. We used Mg / Ca-based temperatures of deep-dwelling (Neogloboquadrina pachyderma sinistral) planktonic foraminifera and paired Mg / Ca-?18O measurements to estimate the subsurface temperatures and ?18O of seawater at Site U1314. Carbon isotopes on benthic and planktonic foraminifera from the same site provide information about the ventilation and water column nutrient gradient. Mg / Ca-based temperatures and ?18O of seawater suggest increased temperatures and salinities during ice-rafting, likely due to enhanced northward subsurface transport of subtropical waters during periods of AMOC reduction. Planktonic carbon isotopes support this suggestion, showing coincident increased subsurface ventilation during deposition of ice-rafted detritus (IRD). Warm waters accumulated at subsurface would result in basal warming and break-up of ice-shelves, leading to massive iceberg discharges in the North Atlantic. Release of heat and salt stored at subsurface would help to restart the AMOC. This mechanism is in agreement with modelling and proxy studies that observe a subsurface warming in the North Atlantic in response to AMOC slowdown during the MIS3.

Hernández-Almeida, I.; Sierro, F.-J.; Cacho, I.; Flores, J.-A.

2014-10-01

226

[Early signs of cognitive impairment in patients with obstructive sleep apnea hypopnea syndrome: an event-related potential study].  

PubMed

This study seeks to explore the early signs of cognitive impairment in patients with obstructive sleep apnea hypopnea syndrome (OSAHS). According to polysomnography, twenty patients diagnosed with OSAHS and twenty normal controls underwent event-related potential (ERP) examination including mismatch negativity (MMN) and P300. Compared with normal controls, OSAHS patients showed significantly prolonged latency of MMN and P300 at Cz. After controlling age and body mass index (BMI), MMN latency positively correlated with apnea hypopnea index (AHI), oxygen reduction index, stage N1 sleep and arousal index, while MMN latency negatively correlated with stage N3 sleep and mean blood oxygen saturation; and P300 latency positively related to AHI and oxygen reduction index; no relationships were found among MMN latency, MMN amplitude, P300 latency and P300 amplitude. These results suggest that the brain function of automatic processing and controlled processing aere impaired in OSAHS patients, and these dysfunction are correlated with nocturnal repeatedly hypoxemia and sleep structure disturbance. PMID:25464805

Zou, Ke; Sun, Yuanfeng; Tang, Xiangdong; Lei, Fei; Du, Lina; Chen, Zhesi; Yan, Tingting; Zheng, Zhong

2014-08-01

227

[Early signs of cognitive impairment in patients with obstructive sleep apnea hypopnea syndrome: an event-related potential study].  

PubMed

This study seeks to explore the early signs of cognitive impairment in patients with obstructive sleep apnea hypopnea syndrome (OSAHS). According to polysomnography, twenty patients diagnosed with OSAHS and twenty normal controls underwent event-related potential (ERP) examination including mismatch negativity (MMN) and P300. Compared with normal controls, OSAHS patients showed significantly prolonged latency of MMN and P300 at Cz. After controlling age and body mass index (BMI), MMN latency positively correlated with apnea hypopnea index (AHI), oxygen reduction index, stage N1 sleep and arousal index, while MMN latency negatively correlated with stage N3 sleep and mean blood oxygen saturation; and P300 latency positively related to AHI and oxygen reduction index; no relationships were found among MMN latency, MMN amplitude, P300 latency and P300 amplitude. These results suggest that the brain function of automatic processing and controlled processing aere impaired in OSAHS patients, and these dysfunction are correlated with nocturnal repeatedly hypoxemia and sleep structure disturbance. PMID:25508436

Zou, Ke; Sun, Yuanfeng; Tang, Xiangdong; Lei, Fei; Du, Lina; Chen, Zhesi; Yan, Tingting; Zheng, Zhong

2014-08-01

228

Early life events carry over to influence pre-migratory condition in a free-living songbird.  

PubMed

Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1(st) year survival and nestling mass in migratory Savannah sparrows (Passerculus sandwichensis). We also use a brood manipulation experiment to show that nestlings from smaller broods have higher mass in the nest relative to individuals from larger broods. Having established these relationships, we then use three years of field data involving multiple captures of individuals throughout the pre-migratory period and a multi-level path model to examine the hypothesis that conditions during development limit survival during migration by affecting an individual's ability to accumulate sufficient lean tissue and fat mass prior to migration. We found a positive relationship between fat mass during the pre-migratory period (Sept-Oct) and nestling mass and a negative indirect relationship between pre-migratory fat mass and fledging date. Our results provide the first evidence that conditions during development limit survival during migration through their effect on fat stores. These results are particularly important given recent evidence showing that body condition of songbirds at fledging is affected by climate change and anthropogenic changes to landscape structure. PMID:22194925

Mitchell, Greg W; Guglielmo, Christopher G; Wheelwright, Nathaniel T; Freeman-Gallant, Corey R; Norris, D Ryan

2011-01-01

229

Early and late HIV-1 membrane fusion events are impaired by sphinganine lipidated peptides that target the fusion site  

PubMed Central

Lipid-conjugated peptides have advanced the understanding of membrane protein functions and the roles of lipids in the membrane milieu. These lipopeptides modulate various biological systems such as viral fusion. A single function has been suggested for the lipid, binding to the membrane and thus elevating the local concentration of the peptide at the target site. In the present paper, we challenged this argument by exploring in-depth the antiviral mechanism of lipopeptides, which comprise sphinganine, the lipid backbone of DHSM (dihydrosphingomyelin), and an HIV-1 envelope-derived peptide. Surprisingly, we discovered a partnership between the lipid and the peptide that impaired early membrane fusion events by reducing CD4 receptor lateral diffusion and HIV-1 fusion peptide-mediated lipid mixing. Moreover, only the joint function of sphinganine and its conjugate peptide disrupted HIV-1 fusion protein assembly and folding at the later fusion steps. Via imaging techniques we revealed for the first time the direct localization of these lipopeptides to the virus–cell and cell–cell contact sites. Overall, the findings of the present study may suggest lipid–protein interactions in various biological systems and may help uncover a role for elevated DHSM in HIV-1 and its target cell membranes. PMID:24766462

Klug, Yoel A.; Ashkenazi, Avraham; Viard, Mathias; Porat, Ziv; Blumenthal, Robert; Shai, Yechiel

2014-01-01

230

The use of an E1-deleted, replication-defective adenovirus recombinant expressing the rabies virus glycoprotein for early vaccination of mice against rabies virus.  

PubMed Central

An E1-deleted, replication-defective adenovirus recombinant of the human strain 5 expressing the rabies virus glycoprotein, termed Adrab.gp, was tested in young mice. Mice immunized at birth with the Adrab.gp construct developed antibodies to rabies virus and cytokine-secreting lymphocytes and were protected against subsequent challenge. Maternal immunity to rabies virus strongly interferes with vaccination of the offspring with a traditional inactivated rabies virus vaccine. The immune response to the rabies virus glycoprotein, as presented by the Adrab.gp vaccine, on the other hand, was not impaired by maternal immunity. Even neonatal immunization of mice born to rabies virus-immune dams with Adrab.gp construct resulted in a long-lasting protective immune response to rabies virus, suggesting that this type of vaccine could be useful for immunization shortly after birth. Nevertheless, pups born to Adrab.gp virus-immune dams showed an impaired immune response to the rabies virus glycoprotein upon vaccination with the Adrab.gp virus, indicating that maternal immunity to the vaccine carrier affected the offspring's immune response to rabies virus. PMID:9094641

Wang, Y; Xiang, Z; Pasquini, S; Ertl, H C

1997-01-01

231

Early Algebra, Early Arithmetic  

NSDL National Science Digital Library

This site offers a variety of early algebra resources for teachers in grades 1-6, parents, researchers, policy makers, administrators, and curriculum developers. Site includes early algebra activities, handouts and overheads in PDF format (requires Acrobat Reader), articles, short reviews of articles and books focusing on early math and early algebra, news and events, and more. A valuable source for pre algebra activities in the elementary classroom.

National Science Foundation (NSF)

2007-12-12

232

Amplification of JNK Signaling Is Necessary To Complete the Murine Gammaherpesvirus 68 Lytic Replication Cycle  

PubMed Central

Several studies have previously defined host-derived signaling events capable of driving lytic gammaherpesvirus replication or enhancing immediate-early viral gene expression. Yet signaling pathways that regulate later stages of the productive gammaherpesvirus replication cycle are still poorly defined. In this study, we utilized a mass spectrometric approach to identify c-Jun as an abundant cellular phosphoprotein present in late stages of lytic murine gammaherpesvirus 68 (MHV68) infection. Kinetically, c-Jun phosphorylation was enhanced as infection progressed, and this correlated with enhanced phosphorylation of the c-Jun amino-terminal kinases JNK1 and JNK2 and activation of AP-1 transcription. These events were dependent on progression beyond viral immediate-early gene expression, but not dependent on viral DNA replication. Both pharmacologic and dominant-negative blockade of JNK1/2 activity inhibited viral replication, and this correlated with inhibition of viral DNA synthesis and reduced viral gene expression. These data suggest a model in which MHV68 by necessity amplifies and usurps JNK/c-Jun signaling as infection progresses in order to facilitate late stages of the MHV68 lytic infection cycle. PMID:23015701

Stahl, James A.; Paden, Clinton R.; Chavan, Shweta S.; MacLeod, Veronica; Edmondson, Ricky D.; Speck, Samuel H.

2012-01-01

233

Peptide YY expression is an early event in colonic endocrine cell differentiation: evidence from normal and transgenic mice.  

PubMed

The hormone peptide YY is produced by endocrine cells in the pancreas, ileum and colon. We have previously shown that peptide YY is coexpressed in all four islet cell types in the murine pancreas when they first appear, suggesting a common peptide YY-producing progenitor. In the colon, peptide YY has been frequently identified in glucagon-expressing L-type endocrine cells. Characterization of colonic endocrine tumors in transgenic mice expressing simian virus 40 large T antigen under the control of the peptide YY gene 5' flanking region revealed tumor cells producing not only peptide YY and glucagon, but also neurotensin, cholecystokinin, substance P, serotonin, secretin, and gastrin. This suggested that multiple enteroendocrine lineages were related to peptide YY-producing cells. Subsequent examination of the ontogeny of colonic endocrine differentiation in nontransgenic mice revealed that peptide YY was the first hormone to appear during development, at embryonic day 15.5. Between embryonic days 16.5 and 18.5, cells expressing glucagon, cholecystokinin, substance P, serotonin, secretin, neurotensin, gastrin and somatostatin first appeared and peptide YY was coexpressed in each cell type at this time. Peptide YY coexpression continued in a significant fraction of most enteroendocrine cell types throughout fetal and postnatal development and into adulthood, with the exception of serotonin-producing cells. This latter population of cells expanded dramatically after birth with rare coexpression of peptide YY. These studies indicate that expression of peptide YY is an early event in colonic endocrine differentiation and support the existence of a common progenitor for all endocrine cells in the colon. PMID:8620842

Upchurch, B H; Fung, B P; Rindi, G; Ronco, A; Leiter, A B

1996-04-01

234

Strong alkalinization of Chara cell surface in the area of cell wall incision as an early event in mechanoperception.  

PubMed

Mechanical wounding of cell walls occurring in plants under the impact of pathogens or herbivores can be mimicked by cell wall incision with a glass micropipette. Measurements of pH at the surface of Chara corallina internodes following microperforation of cell wall revealed a rapid (10-30s) localized alkalinization of the apoplast after a lag period of 10-20s. The pH increase induced by incision could be as large as 3 pH units and relaxed slowly, with a halftime up to 20min. The axial pH profile around the incision zone was bell-shaped and localized to a small area, extending over a distance of about 100?m. The pH response was suppressed by lowering cell turgor upon the replacement of artificial pond water (APW) with APW containing 50mM sorbitol. Stretching of the plasma membrane during its impression into the cell wall defect is likely to activate the Ca(2+) channels, as evidenced from sensitivity of the incision-induced alkalinization to the external calcium concentration and to the addition of Ca(2+)-channel blockers, such as La(3+), Gd(3+), and Zn(2+). The maximal pH values attained at the incision site (~10.0) were close to pH in light-dependent alkaline zones of Chara cells. The involvement of cytoskeleton in the origin of alkaline patch was documented by observations that the incision-induced pH transients were suppressed by the inhibitors of microtubules (oryzalin and taxol) and, to a lesser extent, by the actin inhibitor (cytochalasin B). The results indicate that the localized increase in apoplastic pH is an early event in mechanoperception and depends on light, cytoskeleton, and intracellular calcium. PMID:23850637

Bulychev, Alexander A; Alova, Anna V; Bibikova, Tatiana N

2013-11-01

235

Overexpression of cellular inhibitor of apoptosis protein 2 is an early event in the progression of pancreatic cancer  

PubMed Central

Aim To determine the role of two antiapoptotic proteins of the inhibitor of apoptosis protein family, cellular inhibitor of apoptosis protein 1 (cIAP1) and cellular inhibitor of apoptosis protein 2 (cIAP2), in human pancreatic carcinogenesis. Methods mRNA levels were measured in pancreatic tissues and pancreatic cancer cell lines by quantitative reverse transcriptase PCR. Protein expression was assessed in pancreatic cancer cell lines by immunoblotting and in pancreatic tissues by immunohistochemistry, and correlated with pathological and survival data. Results cIAP1 expression was constantly high in non?neoplastic pancreatic tissues, in pancreatic intraepithelial neoplasia (PanIN) lesions, as well as in a subset of primary and metastatic pancreatic ductal adenocarcinomas (PDAC), and a preferential cytoplasmatic localisation was observed in the tumour tissues. cIAP1 expression was rare in a cohort of cystic tumours. cIAP2 mRNA levels were significantly higher (2.4 fold) in PDAC than in normal tissues. cIAP2 protein was overexpressed in PDAC, and was detectable in low? and high?grade PanIN lesions. Moreover, cIAP2 was often expressed in pancreatic cystic tumours. cIAP1 and cIAP2 mRNA and protein were detected in all the examined cell lines. Survival analysis revealed a shorter survival in patients with cIAP1/cIAP2?positive tumours. Conclusions cIAP1 might contribute to the regulation of the apoptotic process in the normal and in the neoplastic pancreas, depending on its subcellular localisation. Overexpression of cIAP2 is a common and early event in the progression of pancreatic cancer, and could therefore potentially influence the important pathophysiological aspects of PDAC, such as anoikis or chemoresistance. PMID:16775116

Esposito, Irene; Kleeff, Jörg; Abiatari, Ivane; Shi, Xined; Giese, Nathalia; Bergmann, Frank; Roth, Wilfried; Friess, Helmut; Schirmacher, Peter

2007-01-01

236

Quantitative Analysis of the Processes and Signaling Events Involved in Early HIV-1 Infection of T Cells  

PubMed Central

Lymphocyte invasion by HIV-1 is a complex, highly regulated process involving many different types of molecules that is prompted by the virus's association with viral receptors located at the cell-surface membrane that culminates in the formation of a fusion pore through which the virus enters the cell. A great deal of work has been done to identify the key actors in the process and determine the regulatory interactions; however, there have been no reports to date of attempts being made to fully understand the system dynamics through a systemic, quantitative modeling approach. In this paper, we introduce a dynamic mathematical model that integrates the available information on the molecular events involved in lymphocyte invasion. Our model shows that moesin activation is induced by virus signaling, while filamin-A is mobilized by the receptor capping. Actin disaggregation from the cap is facilitated by cofilin. Cofilin is inactivated by HIV-1 signaling in activated lymphocytes, while in resting lymphocytes another signal is required to activate cofilin in the later stages in order to accelerate the decay of the aggregated actin as a restriction factor for the viral entry. Furthermore, stopping the activation signaling of moesin is sufficient to liberate the actin filaments from the cap. The model also shows the positive effect of gelsolin on actin capping by means of the nucleation effect. These findings allow us to propose novel approaches in the search for new therapeutic strategies. In particular, gelsolin inhibition is seen as a promising target for preventing HIV-1 entry into lymphocytes, due to its role in facilitating the capping needed for the invasion. Also it is shown that HIV-1 should overcome the cortical actin barrier during early infection and predicts the different susceptibility of CD4+ T cells to be infected in terms of actin cytoskeleton dynamics driven by associated cellular factors. PMID:25105875

Santos, Guido; Valenzuela-Fernández, Agustín; Torres, Néstor V.

2014-01-01

237

Generation of Unique Poliovirus RNA Replication Organelles  

PubMed Central

ABSTRACT Poliovirus (PV), a model for interactions of picornaviruses with host cells, replicates its genomic RNA in association with cellular membranes. The origin of PV replication membranes has not been determined. Hypotheses about the origin of replication membranes, based largely on localization of viral proteins, include modification of coat protein complex I (COPI) and/or COPII secretory pathway vesicles and subversion of autophagic membranes. Here, we use an antibody against double-stranded RNA (dsRNA) to identify replication complexes by detection of dsRNA replication intermediates. dsRNA signal is dependent on virus genome replication and colocalizes with the viral integral membrane protein 3A, which is part of the RNA replication complex. We show that early in infection, dsRNA does not colocalize with a marker for autophagic vesicles, making it unlikely that autophagosomes contribute to the generation of PV RNA replication membranes. We also find that dsRNA does not colocalize with a marker of the COPII coat, Sec31, and, in fact, we demonstrate proteasome-dependent loss of full-length Sec31 during PV infection. These data indicate that COPII vesicles are an unlikely source of PV replication membranes. We show that the Golgi resident G-protein Arf1 and its associated guanine nucleotide exchange factor (GEF), GBF1, transiently colocalize with dsRNA early in infection. In uninfected cells, Arf1 nucleates COPI coat formation, although during infection the COPI coat itself does not colocalize with dsRNA. Phosphatidylinositol-4-phosphate, which is associated with enterovirus-induced vesicles, tightly colocalizes with Arf1/GBF1 throughout infection. Our data point to a noncanonical role for some of the COPI-generating machinery in producing unique replication surfaces for PV RNA replication. PMID:24570367

Richards, Alexsia L.; Soares-Martins, Jamária A. P.; Riddell, Geoffrey T.; Jackson, William T.

2014-01-01

238

Impact of COX2 genotype, ER status and body constitution on risk of early events in different treatment groups of breast cancer patients.  

PubMed

The COX2 rs5277 (306G>C) polymorphism has been associated with inflammation-associated cancers. In breast cancer, tumor COX-2 expression has been associated with increased estrogen levels in estrogen receptor (ER)-positive and activated Akt-pathway in ER-negative tumors. Our study investigated the impact of COX2 genotypes on early breast cancer events and treatment response in relation to tumor ER status and body constitution. In Sweden, between 2002 and 2008, 634 primary breast cancer patients, aged 25-99 years, were included. Disease-free survival was assessed for 570 rs5277-genotyped patients. Body measurements and questionnaires were obtained preoperatively. Clinical data, patient- and tumor-characteristics were obtained from questionnaires, patients' charts, population registries and pathology reports. Minor allele(C) frequency was 16.1%. Genotype was not linked to COX-2 tumor expression. Median follow-up was 5.1 years. G/G genotype was not associated with early events in patients with ER-positive tumors, adjusted HR 0.77 (0.46-1.29), but conferred an over 4-fold increased risk in patients with ER-negative tumors, adjusted HR 4.41 (1.21-16.02)(p(interaction) = 0.015). Chemotherapy-treated G/G-carriers with a breast volume ? 850 ml had an increased risk of early events irrespective of ER status, adjusted HR 8.99 (1.14-70.89). Endocrine-treated C-allele carriers with ER-positive tumors and a breast volume ? 850 ml had increased risk of early events, adjusted HR 2.30 (1.12-4.75). COX2 genotype, body constitution and ER status had a combined effect on the risk of early events and treatment response. The high risk for early events in certain subgroups of patients suggests that COX2 genotype in combination with body measurements may identify patients in need of more personalized treatment. PMID:24599585

Markkula, Andrea; Simonsson, Maria; Rosendahl, Ann H; Gaber, Alexander; Ingvar, Christian; Rose, Carsten; Jernström, Helena

2014-10-15

239

CCAAT/Enhancer-Binding Protein-? Is Induced during the Early Stages of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Lytic Cycle Reactivation and Together with the KSHV Replication and Transcription Activator (RTA) Cooperatively Stimulates the Viral RTA, MTA, and PAN Promoters  

PubMed Central

During the immediate-early (IE) phase of reactivation from latency, the Kaposi's sarcoma-associated herpesvirus (KSHV) replication and transcription activator protein (RTA) (or ORF50) is thought to be the most critical trigger that upregulates expression of many downstream viral lytic cycle genes, including the delayed-early (DE) gene encoding the replication-associated protein (RAP) (or K8). RAP physically interacts with and stabilizes the cellular transcription factor CCAAT/enhancer-binding protein-? (C/EBP?), leading to upregulated expression of the cellular C/EBP? and p21CIP-1 proteins followed by G0/G1 cell cycle arrest. Furthermore, RTA also interacts with C/EBP?, and both RAP and RTA cooperate with C/EBP? to activate the RAP promoter through binding to a strong proximal C/EBP binding site that also serves as an RTA-responsive element (RRE). Here we show that C/EBP? also activates the IE RTA promoter in transient-cotransfection reporter gene assays and that addition of either RTA or RAP enhances the effect. Electrophoretic mobility shift assay and deletion analysis revealed three C/EBP binding sites that mediate cooperative transactivation of the RTA promoter by C/EBP? and RTA. Furthermore, chromatin immunoprecipitation assay results showed that the endogenous C/EBP?, RTA, and RAP proteins all associate with RTA promoter sequences in tetradecanoyl phorbol acetate-induced primary effusion lymphoma (PEL) cells. Induction of endogenous KSHV RTA mRNA in PEL cells by exogenously introduced C/EBP? was confirmed by reverse transcription-PCR analysis and by double-label indirect immunofluorescence assays. Reciprocally, expression of exogenous RTA also led to an increase of endogenous C/EBP? expression that could be detected by Western immunoblot assays even in KSHV-negative DG75 cells. Cotransfected RTA also increased positive C/EBP? autoregulation of the C/EBP? promoter in transient-cotransfection reporter gene assays. Finally, C/EBP? proved to strongly activate the promoters of two other KSHV DE genes encoding PAN (polyadenylated nuclear) RNA and MTA (ORF57), which was again mediated by C/EBP binding sites that also contribute to RTA activation. Overall, these results support a model in which the cellular transcription factor C/EBP? and RTA:C/EBP? interactions play important roles both upstream and downstream of the two major KSHV regulatory proteins RTA and RAP during the early stages of lytic cycle reactivation. PMID:12915572

Wang, Shizhen Emily; Wu, Frederick Y.; Yu, Yanxing; Hayward, Gary S.

2003-01-01

240

The impact of early institutional rearing on the ability to discriminate facial expressions of emotion: an event-related potential study.  

PubMed

Event-related potentials (ERPs), in response to 4 facial expressions of fear, angry, happy, and sad, were collected from 72 institutionalized children (IG), ages 7 to 32 months, in Bucharest, Romania, and compared with ERPs from 33 children, ages 8 to 32 months, who had never been institutionalized (NIG). The NIG and IG exhibited different patterns of responding in early latency components. Moreover, group differences in amplitude were evident across all components. Such differences may point to the role of early deprivation in disrupting the development of the neural circuitry involved in the recognition of facial expressions. PMID:15693757

Parker, Susan W; Nelson, Charles A

2005-01-01

241

Archaeal DNA replication.  

PubMed

DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed. PMID:25421597

Kelman, Lori M; Kelman, Zvi

2014-01-01

242

Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo ?  

PubMed Central

To better assess the roles of frog virus 3 (FV3; genus Ranavirus, family Iridoviridae) genes in virulence and immune evasion, we have developed a reliable and efficient method to systematically knock out (KO) putative virulence genes by site-specific integration into the FV3 genome. Our approach utilizes a dual selection marker consisting of the puromycin resistance gene fused in frame with the enhanced green fluorescent protein (EGFP) reporter (Puro-EGFP cassette) under the control of the FV3 immediate-early (IE) 18K promoter. By successive rounds of selection for puromycin resistance and GFP expression, we have successfully constructed three recombinant viruses. In one, a “knock-in” mutant was created by inserting the Puro-EGFP cassette into a noncoding region of the FV3 genome (FV3-Puro/GFP). In the remaining two, KO mutants were constructed by replacement of the truncated viral homolog of eIF-2? (FV3-?vIF-2?) or the 18K IE gene (FV3-?18K) with the Puro-EGFP cassette. The specificity of recombination and the clonality of each mutant were confirmed by PCR, sequencing, and immunofluorescence microscopy. Viral replication of each recombinant in cell culture was similar to that of parental FV3; however, infection in Xenopus laevis tadpoles revealed that FV3-?vIF-2? and FV3-?18K replicated less and resulted in lower mortality than did GFP-FV3 and wild-type FV3. Our results suggest that 18K, which is conserved in all ranaviruses, and the truncated vIF-2? gene contribute to virulence. In addition, our study describes a powerful methodology that lays the foundation for the discovery of potentially new ranaviral genes involved in virulence and immune escape. PMID:21865381

Chen, Guangchun; Ward, Brian M.; Yu, Kwang H.; Chinchar, V. Gregory; Robert, Jacques

2011-01-01

243

Improved knockout methodology reveals that frog virus 3 mutants lacking either the 18K immediate-early gene or the truncated vIF-2alpha gene are defective for replication and growth in vivo.  

PubMed

To better assess the roles of frog virus 3 (FV3; genus Ranavirus, family Iridoviridae) genes in virulence and immune evasion, we have developed a reliable and efficient method to systematically knock out (KO) putative virulence genes by site-specific integration into the FV3 genome. Our approach utilizes a dual selection marker consisting of the puromycin resistance gene fused in frame with the enhanced green fluorescent protein (EGFP) reporter (Puro-EGFP cassette) under the control of the FV3 immediate-early (IE) 18K promoter. By successive rounds of selection for puromycin resistance and GFP expression, we have successfully constructed three recombinant viruses. In one, a "knock-in" mutant was created by inserting the Puro-EGFP cassette into a noncoding region of the FV3 genome (FV3-Puro/GFP). In the remaining two, KO mutants were constructed by replacement of the truncated viral homolog of eIF-2? (FV3-?vIF-2?) or the 18K IE gene (FV3-?18K) with the Puro-EGFP cassette. The specificity of recombination and the clonality of each mutant were confirmed by PCR, sequencing, and immunofluorescence microscopy. Viral replication of each recombinant in cell culture was similar to that of parental FV3; however, infection in Xenopus laevis tadpoles revealed that FV3-?vIF-2? and FV3-?18K replicated less and resulted in lower mortality than did GFP-FV3 and wild-type FV3. Our results suggest that 18K, which is conserved in all ranaviruses, and the truncated vIF-2? gene contribute to virulence. In addition, our study describes a powerful methodology that lays the foundation for the discovery of potentially new ranaviral genes involved in virulence and immune escape. PMID:21865381

Chen, Guangchun; Ward, Brian M; Yu, Kwang H; Chinchar, V Gregory; Robert, Jacques

2011-11-01

244

Membrane disruption and early events in the aggregation of the diabetes related peptide IAPP from a molecular prospective  

PubMed Central

Conspectus The aggregation of proteins is tightly controlled in living systems, and misfolded proteins are normally removed before aggregation of the misfolded protein can occur. But for reasons not clearly understood, in some individuals this degradation process breaks down, and misfolded proteins accumulate in insoluble protein aggregates (amyloid deposits) over time. Of the many proteins expressed in humans, a small but growing number have been found to form the long, highly ordered ?-sheet protein fibers that comprise amyloid deposits. Despite a lack of obvious sequence similarity, the amyloid forms of diverse proteins are strikingly similar, consisting of long, highly ordered insoluble fibers with a characteristic crossed ?-sheet pattern. Amyloidogenesis has been the focus of intense basic and clinical research, as a high proportion of amyloidogenic proteins has been linked to common degenerative diseases, including Alzheimer’s, type II diabetes, and Parkinson’s. The apparent link between amyloidogenic proteins and disease was initially attributed to the amyloid form of the protein; however, increasing evidence suggests the toxicity is due to intermediates generated during the assembly of amyloid fibers. These intermediates have been proposed to attack cells in a variety of ways, such as by generating inflammation, creating reactive oxygen species, and overloading the misfolded protein response pathway. One common, well-studied mechanism is the disruption of the plasma and organelle membranes. In this Account, we examine the early molecular-level events in the aggregation of the Islet amyloid polypeptide (IAPP, also called amylin) and its ensuing disruption of membranes. IAPP is a 37-residue peptide secreted in conjunction with insulin; it is highly amyloidogenic and often found in amyloid deposits in type II diabetics. IAPP aggregates are highly toxic to the ?-cells that produce insulin, and thus IAPP is believed to be one of the factors involved in the transition from early to later stages of type II diabetes. Using variants of IAPP that are combinations of toxic or non-toxic and amyloidogenic or nonamyloidogenic, we have shown that formation of amyloid fibers is a sufficient but not necessary condition for the disruption of ?-cells. Instead, the ability to induce membrane disruption in model membranes appears to be related to the peptide’s ability to stabilize curvature in the membrane, which in turn is related to the depth of penetration in the membrane. Although many similarities exist between IAPP and other amyloidogenic proteins, one important difference appears to be the role of small oligomers in the assembly process of amyloid fibers. In many amyloidogenic proteins, small oligomers form a distinct metastable intermediate that is frequently the most toxic species; however, in IAPP, small oligomers appear to be transient and are rapidly converted to amyloid fibers. Moreover, the aggregation and toxicity of IAPP is controlled by other cofactors present in the secretory granule from which it is released, such as zinc and insulin, in a control mechanism that is somehow unbalanced in type II diabetics. Investigations into this process are likely to give clues to the mysterious origins of type II diabetes on the molecular level. PMID:21942864

Brender, Jeffrey R.; Salamekh, Samer; Ramamoorthy, Ayyalusamy

2011-01-01

245

Iron deficiency anemia as a risk factor for cerebrovascular events in early childhood: a case-control study.  

PubMed

In recent years, iron-deficiency anemia (IDA) has been suggested to have an association with childhood-onset ischemic stroke in otherwise healthy children, but few cases have proven it thus far. In this study, we aimed to investigate whether iron-deficiency anemia is a risk factor for cerebrovascular events and childhood-onset ischemic stroke in previously healthy children. This was a case-control study that included 21 stroke cases with patients who had previously been generally healthy, and matched with age and gender of 100 healthy control subjects. Patients were included if a diagnosis of definite stroke had been made and other known etiologies of childhood onset stroke were excluded. For all subjects, iron parameters including serum iron, ferritin, transferrin, total iron binding capacity, and transferrin saturation were assessed. We screened all case patients for prothrombotic factors including level of hemoglobin S, protein C, protein S, antithrombin III, lupus anticoagulant, factor V Leiden, and prothrombin gene mutation (G20210A). Brain magnetic resonance images (MRI), magnetic resonance angiography (MRA), and magnetic resonance venography (MRV) were performed to all case patients. All case patients have normal results regarding functional, immunological, and molecular assay for prothrombotic factors screening. Our results showed that IDA was disclosed in 57.1 % of stroke cases with no identified cause, as compared to 26 % of controls. Our study suggest that previously healthy children who developed stroke are 3.8 times more likely to have IDA than healthy children, who do not develop stroke (OR, 3.8; 95 % CI:1.3-11.2 P?=?0.005). In addition, there was significant interaction between IDA and thrombocytosis among studied cases (OR, 10.5; 95 % CI, 1.0-152 P?=?0.02). There were nonsignificant differences between stroke patients with IDA and those with normal iron parameters regarding stroke subtype (P?>?0.05). Public health messages on the importance of early detection of iron-deficiency anemia in young children, especially in our developing countries so that it can be treated before a life-threatening complication like stroke develops. PMID:24141332

Azab, Seham F A; Abdelsalam, Sanaa M; Saleh, Safaa H A; Elbehedy, Rabab M; Lotfy, Sabah M; Esh, Asmaa M H; Srea, Mona A; Aziz, Khalid A

2014-04-01

246

Subcellular distribution and early signalling events of P2X7 receptors from mouse cerebellar granule neurons.  

PubMed

The subcellular distribution and early signalling events of P2X7 receptors were studied in mouse cerebellar granule neurons. Whole-cell patch-clamp recordings evidenced inwardly directed non-desensitizing currents following adenosine 5'-triphosphate (ATP; 600µM) or 2'-3'-o-(4-benzoylbenzoyl)-adenosine 5'-triphosphate (BzATP; 100µM) administration to cells bathed in a medium with no-added divalent cations (Ca(2+) and Mg(2+)). Nucleotide-activated currents were inhibited by superfusion of 2.5mM Ca(2+), 1.2mM Mg(2+) or 100nM Brilliant Blue G (BBG), hence indicating the expression of ionotropic P2X7 receptors. Fura-2 calcium imaging showed [Ca(2+)]i elevations in response to ATP or BzATP at the somas and at a small number of axodendritic regions of granule neurons. Differential sensitivity of these [Ca(2+)]i increases to three different P2X7 receptor antagonists (100nM BBG, 10?M 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester, KN-62, and 1?M 3-(5-(2,3-dichlorophenyl)-1H-tetrazol-1-yl)methyl pyridine hydrochloride hydrate, A-438079) revealed that P2X7 receptors are co-expressed with different P2Y receptors along the plasmalemma of granule neurons. Finally, experiments with the fluorescent dye YO-PRO-1 indicated that prolonged stimulation of P2X7 receptors does not lead to the opening of a membrane pore permeable to large cations. Altogether, our results emphasise the expression of functional P2X7 receptors at both the axodendritic and somatic levels in mouse cerebellar granule neurons, and favour the notion that P2X7 receptors might function in a subcellular localisation-specific manner: presynaptically, by controlling glutamate release, and on the cell somas, by supporting granule neuron survival against glutamate excytotoxicity. PMID:25446427

Sánchez-Nogueiro, Jesús; Marín-García, Patricia; Bustillo, Diego; Olivos-Oré, Luis Alcides; Miras-Portugal, María Teresa; Artalejo, Antonio R

2014-12-01

247

The record of Tethyan planktonic foraminifera at the early Paleogene hyperthermal events and Middle Eocene Climatic Optimum in northeastern Italy: are they comparable?  

NASA Astrophysics Data System (ADS)

The early Paleogene is one of the more climatically and evolutionary dynamic periods in the Earth history that records a pronounced warming trend peaking in the Early Eocene, and a successive composite transition towards the modern icehouse world. Ever increasingly scientific attention is dedicated to definitely comprehend timing, nature and characters of the complex, non-linear evolution of the Paleogene climate. Several complete and expanded Paleogene successions (Forada, Possagno, Alano, Farra), with a sound magneto-biochronostratigraphic and stable isotope record crop out in the Venetian Southern Alps (Northeast Italy). Recent studies (Giusberti et. al., 2007; Luciani et al., 2007; Agnini et al., 2008) and unpublished data document the presence in these section of the main short-lived warming events (hyperthermals) of the Eocene (Paleocene-Eocene Thermal Maximum, PETM, ca 55 Ma, Eocene Layer of Mysterious Origin (ELMO, ca 53,6 Ma), X-event (ca 52.5 Ma), of the Early Eocene Climatic Optimum (EECO, ca 50-52 Ma) and of the Middle Eocene Climatic Optimum (MECO, ca 40 Ma; Zachos et al., 2001. 2008). All these events are typified by marked negative shifts in ?13C curves that correspond to carbonate decrease related to rise of the carbonate compensation depth in turn induced by large introduction in the ocean-atmosphere system of CO2. Common features to the warming events are pronounced and complex changes in planktonic foraminiferal assemblages, indicating strong environmental perturbations that perfectly parallel the variations of the stable isotope curves in all the examined events. These strict correspondences indicate close cause-effect relationships between changes in environmental conditions and modifications of the assemblages. Our analysis shows that the most striking variations are recorded by the PETM and MECO assemblages that reflect highly perturbed environments. The ELMO, X-event and EECO exhibit planktic foraminiferal responses that are similar to, though less intense than, those observed across the PETM and the MECO. In addition, sedimentological and quantitative micropaleontological data from the hyperthermal events from the Venetian Southern Alps essentially suggest as the main response to the pronounced warmth, increased weathering and runoff as well as sea surface eutrophication. A pronounced shift from relatively oligotrophic to eutrophic, opportunist planktonic foraminiferal assemblages was observed at the MECO as well, thus showing analogies with the hyperthermal events recorded in the same area. The taxa indicating eutrophic environmental conditions are however different at the MECO from the Alano section; on the other hand we can expect that the planktonic foraminiferal taxa indicating analogous scenarios might be different in different Eocene time-intervals. Remarkably, the PETM and MECO events record a significant occurrence of giant and malformed foraminifera, evidence of transient alteration in the ocean chemistry, including possible pH oscillations and increase in trace metal content. Our data suggests therefore that a major threshold in the photic zone ocean chemistry has been passed only for those prominent events. In conclusion, from the biotic response to the hyperthermal events, to the EECO and MECO we deduce that the most important effect of pronounced warming, that is the aspect common to all these events, has been the eutrophication of surface waters, as a consequence of modification in the hydrological cycle. The location adjacent to land masses of the studied Tethyan setting evidently facilitated the terrigenous input that was apparently the main responsible for the increase in nutrient availability during the cited Paleogene warming events. Finally, several lines of evidence indicate that PETM, EECO and MECO were linked to permanent changes in planktonic foraminiferal evolution beside the transient, ecologically controlled variations. Even though the true mechanisms forcing evolution of life on Earth are still unexplained, our record of the major climatic Paleogene events suggests a

Luciani, Valeria; Giusberti, Luca; Agnini, Claudia; Fornaciari, Eliana; Rio, Domenico

2010-05-01

248

The spectral absorption coefficient at 254nm as a real-time early warning proxy for detecting faecal pollution events at alpine karst water resources  

PubMed Central

Because spring water quality from alpine karst aquifers can change very rapidly during event situations, water abstraction management has to be performed in near real-time. Four summer events (2005-2008) at alpine karst springs were investigated in detail in order to evaluate the spectral absorption coefficient at 254nm (SAC254) as a real-time early warning proxy for faecal pollution. For the investigation Low-Earth-Orbit (LEO) Satellite-based data communication between portable hydrometeorological measuring stations and an automated microbiological sampling device was used. The method for event triggered microbial sampling and analyzing was already established and described in a previous paper (Stadler et al., Wat. Sci. Technol. 58(4): 899-909, 2008). Data analysis including on-line event characterisation (i.e. precipitation, discharge, turbidity, SAC254) and comprehensive E. coli determination (n > 800) indicated that SAC254 is a useful early warning proxy. Irrespective of the studied event situations SAC254 always increased 3 to 6 hours earlier than the onset of faecal pollution, featuring different correlation phases. Furthermore, it seems also possible to use SAC254 as a real-time proxy parameter for estimating the extent of faecal pollution after establishing specific spring and event-type calibrations that take into consideration the variability of the occurrence and the transferability of faecal material It should be highlighted that diffuse faecal pollution from wildlife and live stock sources was responsible for spring water contamination at the investigated catchments. In this respect, the SAC254 can also provide useful information to support microbial source tracking efforts where different situations of infiltration have to be investigated. PMID:20962406

Stadler, H.; Klock, E.; Skritek, P.; Mach, R.L.; Zerobin, W.; Farnleitner, A.H.

2011-01-01

249

Nitric Oxide Inhibits Rhinovirus-Induced Cytokine Production and Viral Replication in a Human Respiratory Epithelial Cell Line  

Microsoft Academic Search

To better understand the early biochemical events that occur in human rhinovirus (HRV) infections, we examined the kinetics and mechanisms of interleukin-8 (IL-8) and IL-6 production from infected epithelial cells. Several HRV strains caused IL-8 and IL-6 production, but HRV-16 induced maximal IL-8 and IL-6 mRNA expression and protein production more rapidly than did HRV-14, despite similar rates of replication

SCHERER P. SANDERS; EDWARD S. SIEKIERSKI; JACQUELINE D. PORTER; STEPHEN M. RICHARDS; DAVID PROUD

1998-01-01

250

Early detection of adverse drug events within population-based health networks: application of sequential testing methods  

Microsoft Academic Search

PURPOSE: Active surveillance of population-based health networks may improve the timeliness of detection of adverse drug events (ADEs). Active monitoring requires sequential analysis methods. Our objectives were to (1) evaluate the utility of automated healthcare claims data for near real-time drug adverse event surveillance and (2) identify key methodological issues related to the use of healthcare claims data for real-time

Jeffrey S. Brown; Martin Kulldorff; K. Arnold Chan; Robert L. Davis; David J. Graham; Parker T. Pettus; Susan E. Andrade; Marsha A. Raebel; Lisa J. Herrinton; Douglas W. Roblin; Denise M. Boudreau; David H. Smith; Jerry H. Gurwitz; Margaret J. Gunter; Richard Platt

2007-01-01

251

The Madotz Urgonian platform (Aralar, northern Spain): Paleoecological changes in response to Early Aptian global environmental events  

E-print Network

The Madotz Urgonian platform (Aralar, northern Spain): Paleoecological changes in response to Early Tecnología, Universidad del País Vasco, Apartado 644, 48080 Bilbao, Spain a b s t r a c ta r t i c l e i n f-rich facies Early Aptian Aralar N Spain Sudden addition of carbon dioxide to the atmosphere can reduce the Ca

Gilli, Adrian

252

Paleoceanographic changes and population dynamics in two left-coiling events of Pulleniatina during early Pleistocene, ODP 1115B, western equatorial Pacific  

NASA Astrophysics Data System (ADS)

The alternately left-coiling (LC) and right-coiling (RC) dominance in the populations of planktonic foraminifera Pulleniatina genus defined a series L events during the past 4 Ma. These L events have been used as useful biostratigraphic markers for the Indo-Pacific region, especially the L5 event, which marks the top of Gelasian stage in Early Pleistocene. However, previous studies emphasized on the stratigraphic application of the L events and have little attention on the L events itself. This study focuses on the population dynamics of Pu. during L events and tries to examine the mechanism triggering the L events by studying Core ODP 1115 B (9°11' S, 151°34' E, water depth 1149 m) in Solomon Sea, western equatorial Pacific. Owing to the variance in morphology, we lumped all species of Pu. genus into a 'Pulleniatina complex' rather than subdividing them into different species. Specimens larger than 250 ?m in each sample were sieved into six size-fractions. The Pu. complex as well as their coiling direction were identified under a stereomicroscope. To avoid biased sampling, we examined all Pu. complex specimens larger than 250 ?m. LC and RC relative percentages as well as absolute abundances of Pu. complex in each size-fraction were counted, respectively. In setting LC relative percentage >50% as a threshold, we recognized a distinctive L6 event (~ 2.202 - 2.175 Ma, began between MIS 85 - 84 and ended between MIS 83 - 82), a prominent L5 event (~ 2.147 - 1.875 Ma, began between MIS 82 - 81 and ended between MIS 71 - 70), and could not find a clear L4 event as reported by Saito (1976). The onset of the L5 event was marked by a dramatic reduction of absolute abundance of RC forms that give observers an impression of LC forms dominance. During the L5 event, the LC relative percentages fluctuated by 20 to 40%. The ending of the L5event was characterized by a slow recovery of RC forms in absolute abundance. L6 event was the result of two sudden significant changes in absolute abundance of LC forms that led to pronounced relative percentage changes in coiling direction. For the biostragtigraphic application, these characteristics make the L6 event a better biostratigraphic marker than the L5 event where Pu. is less abundant. The onsets of the L5 and L6 event were corresponding to opposite global climatic changing trends. In addition, linear regression between population parameters and environmental proxies, including those of salinity, ice volume, primary productivity and water temperature from both sea surface and thermocline show week correlations, indicating the causal relationship between the environmental changes and the population dynamics of Pu. is not as strong as expected.

Chiang, M.; Wei, K.; Chuang, C.; Lo, L.

2013-12-01

253

Replication in Prevention Science  

Microsoft Academic Search

Replication research is essential for the advancement of any scientific field. In this paper, we argue that prevention science\\u000a will be better positioned to help improve public health if (a) more replications are conducted; (b) those replications are\\u000a systematic, thoughtful, and conducted with full knowledge of the trials that have preceded them; and (c) state-of-the art\\u000a techniques are used to

Jeffrey C. Valentine; Anthony Biglan; Robert F. Boruch; Felipe González Castro; Linda M. Collins; Brian R. Flay; Sheppard Kellam; Eve K. Mo?cicki; Steven P. Schinke

2011-01-01

254

A major Late Devonian-Early Carboniferous (Hercynian) Thermotectonic event at the NW Margin of the Arabian-Nubian Shield: Evidence from zircon fission track dating  

NASA Astrophysics Data System (ADS)

Zircon fission track (ZFT) ages of 17 Precambrian samples from deep boreholes and outcrops in southern Israel and Sinai fall within the range 328-373 Ma (Late Devonian-Early Carboniferous). Single zircon grain age distributions are unimodal with a high chi-square probability. The age data indicate total resetting of the ZFT clocks but only partial resetting of coexisting sphenes, constraining the temperatures attained to about 225° ± 50°C, followed by relatively rapid regional cooling at the times indicated. In the study area, the lower Paleozoic section presently overlying Precambrian rocks is limited to Cambrian strata, up to 300 m thick. Further, stratigraphic evidence for sub-Carboniferous erosion is preserved only in SW Sinai. To the east, in southern Jordan, a 2-2.5 km thick lower Paleozoic succession is reported. Despite the lack of stratigraphic evidence in the study area, the ZFT data (1) strongly suggest that an equivalent or thicker section also existed, (2) constrain the timing of the erosion to Late Devonian-Early Carboniferous (Hercynian), and (3) indicate that thermal gradients may have reached ?50°C/km prior to the uplift/erosion event. Regional stratigraphic evidence indicates that the Late Devonian-Early Carboniferous event was confined to a relatively narrow belt extending from the Gulf of Suez area to the vicinity of NE Syria and SE Turkey.

Kohn, B. P.; Eyal, M.; Feinstein, S.

1992-10-01

255

Impacts of a water stress followed by an early frost event on beech (Fagus sylvatica L.) susceptibility to Scolytine ambrosia beetles - Research strategy and first results  

NASA Astrophysics Data System (ADS)

Climate change tends to induce more frequent abiotic and biotic extreme events, having large impacts on tree vitality. Weakened trees are then more susceptible to secondary insect outbreaks, as it happened in Belgium in the early 2000s: after an early frost event, secondary Scolytine ambrosia beetles attacks were observed on beech trees. In this study, we test if a combination of stress, i.e. a soil water deficit preceding an early frost, could render trees more attractive to beetles. An experimental study was set in autumn 2008. Two parcels of a beech forest were covered with plastic tents to induce a water stress by rain interception. The parcels were surrounded by 2-meters depth trenches to avoid water supply by streaming. Soil water content and different indicators of tree water use (sap flow, predawn leaf water potential, tree radial growth) were followed. In autumn 2010, artificial frost injuries will be inflicted to trees using dry ice. Trees attractivity for Scolytine insects, and the success of insect colonization will then be studied. The poster will focus on experiment setting and first results (impacts of soil water deficit on trees).

La Spina, Sylvie; de Cannière, Charles; Molenberg, Jean-Marc; Vincke, Caroline; Deman, Déborah; Grégoire, Jean-Claude

2010-05-01

256

Replication Origins and Timing of Temporal Replication in Budding Yeast: How to Solve the Conundrum?  

PubMed Central

Similarly to metazoans, the budding yeast Saccharomyces cereviasiae replicates its genome with a defined timing. In this organism, well-defined, site-specific origins, are efficient and fire in almost every round of DNA replication. However, this strategy is neither conserved in the fission yeast Saccharomyces pombe, nor in Xenopus or Drosophila embryos, nor in higher eukaryotes, in which DNA replication initiates asynchronously throughout S phase at random sites. Temporal and spatial controls can contribute to the timing of replication such as Cdk activity, origin localization, epigenetic status or gene expression. However, a debate is going on to answer the question how individual origins are selected to fire in budding yeast. Two opposing theories were proposed: the “replicon paradigm” or “temporal program” vs. the “stochastic firing”. Recent data support the temporal regulation of origin activation, clustering origins into temporal blocks of early and late replication. Contrarily, strong evidences suggest that stochastic processes acting on origins can generate the observed kinetics of replication without requiring a temporal order. In mammalian cells, a spatiotemporal model that accounts for a partially deterministic and partially stochastic order of DNA replication has been proposed. Is this strategy the solution to reconcile the conundrum of having both organized replication timing and stochastic origin firing also for budding yeast? In this review we discuss this possibility in the light of our recent study on the origin activation, suggesting that there might be a stochastic component in the temporal activation of the replication origins, especially under perturbed conditions. PMID:21037857

Barberis, Matteo; Spiesser, Thomas W.; Klipp, Edda

2010-01-01

257

Clustering of transcriptional profiles identifies changes to insulin signaling as an early event in a mouse model of Alzheimer’s disease  

PubMed Central

Background Alzheimer’s disease affects more than 35 million people worldwide but there is no known cure. Age is the strongest risk factor for Alzheimer’s disease but it is not clear how age-related changes impact the disease. Here, we used a mouse model of Alzheimer’s disease to identify age-specific changes that occur prior to and at the onset of traditional Alzheimer-related phenotypes including amyloid plaque formation. To identify these early events we used transcriptional profiling of mouse brains combined with computational approaches including singular value decomposition and hierarchical clustering. Results Our study identifies three key events in early stages of Alzheimer’s disease. First, the most important drivers of Alzheimer’s disease onset in these mice are age-specific changes. These include perturbations of the ribosome and oxidative phosphorylation pathways. Second, the earliest detectable disease-specific changes occur to genes commonly associated with the hypothalamic-adrenal-pituitary (HPA) axis. These include the down-regulation of genes relating to metabolism, depression and appetite. Finally, insulin signaling, in particular the down-regulation of the insulin receptor substrate 4 (Irs4) gene, may be an important event in the transition from age-related changes to Alzheimer’s disease specific-changes. Conclusion A combination of transcriptional profiling combined with computational analyses has uncovered novel features relevant to Alzheimer’s disease in a widely used mouse model and offers avenues for further exploration into early stages of AD. PMID:24274089

2013-01-01

258

Early Jurassic shale chemostratigraphy and UPb ages from the Neuqun Basin (Argentina): Implications for the Toarcian Oceanic Anoxic Event  

E-print Network

Neuquén Basin carbon isotopes tuff layers zircon U­Pb dating Karoo Basin New data from a Lower Jurassic discovered in the section. Dating by ID-TIMS of zircons from two tuff beds located within the carbon isotope mechanism for the Toarcian Oceanic Anoxic Event (TOAE) and the associated negative carbon isotope excursion

Svensen, Henrik

259

Glacioeustatic fluctuation: The mechanism linking stable isotope events and sequence stratigraphy from the early Oligocene to middle Miocene  

SciTech Connect

One of the most difficult challenges of sequence stratigraphy is the establishment of synchronism between events observed in widely-separated basins. Problems arise because the resolution of the best stratigraphic methods is not good enough to establish the synchronism of similar-aged events on a global scale. Unless a common mechanism affecting global eustasy is assumed, such as variations in the ice volume, there is no a priori reason to expect that sequences of similar age in widely-separated basins are indeed synchronous. The stable oxygen isotope composition of marine carbonates is a proxy for sea level which has been underutilized in sequence stratigraphy. Identification of isotope events is based on d[sup 18]O data from DSDP and ODP sites 522, 529, 563, 608, and 747 drilled in the Atlantic and Indian oceans. These records were used to define Oligocene and Miocene oxygen isotope zones. In addition, we present isotope data from PETROBRAS Well A drilled in the Campos Basin (Brazil). Ages of isotope events correspond well with the ages of sequence boundaries and maximum flooding surfaces. Because of the good correlation between the isotope and sequence stratigraphic records, we reconfirm that ice-volume change is the common mechanism driving sea-level fluctuations from the Oligocene to present.

Abreu, V. (Petrobras and Rice Univ., Houston, TX (United States)); Haddad, G. (Rice Univ., Houston, TX (United States))

1996-01-01

260

Glacioeustatic fluctuation: The mechanism linking stable isotope events and sequence stratigraphy from the early Oligocene to middle Miocene  

SciTech Connect

One of the most difficult challenges of sequence stratigraphy is the establishment of synchronism between events observed in widely-separated basins. Problems arise because the resolution of the best stratigraphic methods is not good enough to establish the synchronism of similar-aged events on a global scale. Unless a common mechanism affecting global eustasy is assumed, such as variations in the ice volume, there is no a priori reason to expect that sequences of similar age in widely-separated basins are indeed synchronous. The stable oxygen isotope composition of marine carbonates is a proxy for sea level which has been underutilized in sequence stratigraphy. Identification of isotope events is based on d{sup 18}O data from DSDP and ODP sites 522, 529, 563, 608, and 747 drilled in the Atlantic and Indian oceans. These records were used to define Oligocene and Miocene oxygen isotope zones. In addition, we present isotope data from PETROBRAS Well A drilled in the Campos Basin (Brazil). Ages of isotope events correspond well with the ages of sequence boundaries and maximum flooding surfaces. Because of the good correlation between the isotope and sequence stratigraphic records, we reconfirm that ice-volume change is the common mechanism driving sea-level fluctuations from the Oligocene to present.

Abreu, V. [Petrobras and Rice Univ., Houston, TX (United States); Haddad, G. [Rice Univ., Houston, TX (United States)

1996-12-31

261

State-Machine Replication  

E-print Network

State-Machine Replication #12;The Problem Clients Server #12;The Problem Clients Server #12;The (state machine) #12;The Solution 1. Make server deterministic (state machine) State machine #12;The Solution 1. Make server deterministic (state machine) 2. Replicate server State machines #12;The Solution 1

Venkataramani, Arun

262

Effects of adverse early-life events on aggression and anti-social behaviours in animals and humans.  

PubMed

We review the impact of early adversities on the development of violence and antisocial behaviour in humans, and present three aetiological animal models of escalated rodent aggression, each disentangling the consequences of one particular adverse early-life factor. A review of the human data, as well as those obtained with the animal models of repeated maternal separation, post-weaning social isolation and peripubertal stress, clearly shows that adverse developmental conditions strongly affect aggressive behaviour displayed in adulthood, the emotional responses to social challenges and the neuronal mechanisms activated by conflict. Although similarities between models are evident, important differences were also noted, demonstrating that the behavioural, emotional and neuronal consequences of early adversities are to a large extent dependent on aetiological factors. These findings support recent theories on human aggression, which suggest that particular developmental trajectories lead to specific forms of aggressive behaviour and brain dysfunctions. However, dissecting the roles of particular aetiological factors in humans is difficult because these occur in various combinations; in addition, the neuroscientific tools employed in humans still lack the depth of analysis of those used in animal research. We suggest that the analytical approach of the rodent models presented here may be successfully used to complement human findings and to develop integrative models of the complex relationship between early adversity, brain development and aggressive behaviour. PMID:25059307

Haller, J; Harold, G; Sandi, C; Neumann, I D

2014-10-01

263

High resolution chronology of late Cretaceous-early Tertiary events determined from 21,000 yr orbital-climatic cycles in marine sediments  

NASA Technical Reports Server (NTRS)

A number of South Atlantic sites cored by the Deep Sea Drilling Project (DSDP) recovered late Cretaceous and early Tertiary sediments with alternating light-dark, high-low carbonate content. The sedimentary oscillations were turned into time series by digitizing color photographs of core segments at a resolution of about 5 points/cm. Spectral analysis of these records indicates prominent periodicity at 25 to 35 cm in the Cretaceous intervals, and about 15 cm in the early Tertiary sediments. The absolute period of the cycles that is determined from paleomagnetic calibration at two sites is 20,000 to 25,000 yr, and almost certainly corresponds to the period of the earth's precessional cycle. These sequences therefore contain an internal chronometer to measure events across the K/T extinction boundary at this scale of resolution. The orbital metronome was used to address several related questions: the position of the K/T boundary within magnetic chron 29R, the fluxes of biogenic and detrital material to the deep sea immediately before and after the K/T event, the duration of the Sr anomaly, and the level of background climatic variability in the latest Cretaceous time. The carbonate/color cycles that were analyzed contain primary records of ocean carbonate productivity and chemistry, as evidenced by bioturbational mixing of adjacent beds and the weak lithification of the rhythmic sequences. It was concluded that sedimentary sequences that contain orbital cyclicity are capable of providing resolution of dramatic events in earth history with much greater precision than obtainable through radiometric methods. The data show no evidence for a gradual climatic deterioration prior to the K/T extinction event, and argue for a geologically rapid revolution at this horizon.

Herbert, Timothy D.; Dhondt, Steven

1988-01-01

264

DNA Virus Replication Compartments  

PubMed Central

Viruses employ a variety of strategies to usurp and control cellular activities through the orchestrated recruitment of macromolecules to specific cytoplasmic or nuclear compartments. Formation of such specialized virus-induced cellular microenvironments, which have been termed viroplasms, virus factories, or virus replication centers, complexes, or compartments, depends on molecular interactions between viral and cellular factors that participate in viral genome expression and replication and are in some cases associated with sites of virion assembly. These virus-induced compartments function not only to recruit and concentrate factors required for essential steps of the viral replication cycle but also to control the cellular mechanisms of antiviral defense. In this review, we summarize characteristic features of viral replication compartments from different virus families and discuss similarities in the viral and cellular activities that are associated with their assembly and the functions they facilitate for viral replication. PMID:24257611

Schmid, Melanie; Speiseder, Thomas; Dobner, Thomas

2014-01-01

265

DNA replication, transcription and translation operate with astounding speed and fidelity in bacterial cells1  

E-print Network

DNA replication, transcription and translation operate with astounding speed and fidelity of the molecular mechanisms of bacterial DNA replication, transcription and translation. Our understanding of the molecules in the reaction vessel. For processive events, such as DNA repli- cation, transcription

266

Defining The Neighborhoods That Escort The Oocyte Through Its Early Life Events And Into A Functional Follicle  

PubMed Central

The ovary functions to chaperone the most precious cargo for female individuals, the oocyte, to allow the passage of genetic material to subsequent generations. Within the ovary, single oocytes are surrounded by a legion of granulosa cells inside each follicle. These two cell types depend upon one another to support follicle formation and oocyte survival. The infrastructure and events that work together to ultimately form these functional follicles within the ovary are unprecedented, given that the oocyte is fated like all other neighboring cells within the embryo prior to gastrulation. This review discusses the journey of the germ cell in the context of the developing female mouse embryo, with a focus on specific signaling events and cell-cell interactions that escort the primordial germ cell as it is specified into the germ-cell fate, migrates through the hindgut into the gonad, differentiates into an oocyte, and culminates upon formation of the primordial and then primary follicle. PMID:24105719

Jorgensen, Joan S.

2014-01-01

267

Viral replication and genetics Nabil A. NIMER  

E-print Network

because much is going on inside the cell at the molecular level, such as transcription of the `incoming' viral genes to form viral mRNAs, and their translation to produce early viral proteins, including in the cytoplasm, carries many of the enzymes needed for viral transcription and replication and sets up small

268

A genome-wide transcriptome profiling reveals the early molecular events during callus initiation in Arabidopsis multiple organs.  

PubMed

Induction of a pluripotent cell mass termed callus is the first step in an in vitro plant regeneration system, which is required for subsequent regeneration of new organs or whole plants. However, the early molecular mechanism underlying callus initiation is largely elusive. Here, we analyzed the dynamic transcriptome profiling of callus initiation in Arabidopsis aerial and root explants and identified 1342 differentially expressed genes in both explants after incubation on callus-inducing medium. Detailed categorization revealed that the differentially expressed genes were mainly related to hormone homeostasis and signaling, transcriptional and post transcriptional regulations, protein phosphorelay cascades and DNA- or chromatin-modification. Further characterization showed that overexpression of two transcription factors, HB52 or CRF3, resulted in the callus formation in transgenic plants without exogenous auxin. Therefore, our comprehensive analyses provide some insight into the early molecular regulations during callus initiation and are useful for further identification of the regulators governing callus formation. PMID:22664253

Xu, Ke; Liu, Jing; Fan, Mingzhu; Xin, Wei; Hu, Yuxin; Xu, Chongyi

2012-08-01

269

Saquinavir Inhibits Early Events Associated with Establishment of HIV-1 Infection: Potential Role for Protease Inhibitors in Prevention  

PubMed Central

The maturation of newly formed human immunodeficiency virus type 1 (HIV-1) virions is a critical step for the establishment of productive infection. We investigated the potential of saquinavir (SQV), a protease inhibitor (PI) used in highly active antiretroviral therapy (HAART), as a candidate microbicide. SQV inhibited replication of clade B and clade C isolates in a dose-dependent manner in all cellular models tested: PM-1 CD4 T cells, peripheral blood mononuclear cells (PBMCs), monocyte-derived macrophages (MDMs), and immature monocyte-derived dendritic cells (iMDDCs). SQV also inhibited production of infectious virus in cervical, penile, and colorectal explants cocultured with T cells. Moreover, SQV demonstrated inhibitory potency against trans infection of T cells by in vitro-derived dendritic cells and by primary dendritic cells that emigrate from penile and cervical tissue explants. No cellular or tissue toxicity was detected in the presence of SQV, suggesting that this drug could be considered for development as a component of an effective microbicide, capable of blocking viral maturation and transmission of HIV-1 at mucosal surfaces. PMID:22664974

Stefanidou, Martha; Herrera, Carolina; Armanasco, Naomi

2012-01-01

270

Holocene glacier and climate variations in western Norway: Evidence for early Holocene glacier demise and multiple Neoglacial events  

Microsoft Academic Search

Lithostratigraphic and paleobotanical studies suggest that the Jostedalsbreen ice cap probably disappeared during the early Holocene Hypsithermal interval (ca. 8000-6000 B.P.) and re-formed about 5300 B.P. The equilibrium-line altitude was lower than the modern mean equilibrium-line altitude between 2595 ±85 and 2360 ±80 B.P., between 2250 ±65 and 2150 ±80 B.P., between 1740 ±75 and 1730 ±75 B.P., between 1430

Atle Nesje; Mons Kvamme

1991-01-01

271

Deciphering early events involved in hyperosmotic stress-induced programmed cell death in tobacco BY-2 cells  

PubMed Central

Hyperosmotic stresses represent one of the major constraints that adversely affect plants growth, development, and productivity. In this study, the focus was on early responses to hyperosmotic stress- (NaCl and sorbitol) induced reactive oxygen species (ROS) generation, cytosolic Ca2+ concentration ([Ca2+]cyt) increase, ion fluxes, and mitochondrial potential variations, and on their links in pathways leading to programmed cell death (PCD). By using BY-2 tobacco cells, it was shown that both NaCl- and sorbitol-induced PCD seemed to be dependent on superoxide anion (O2·–) generation by NADPH-oxidase. In the case of NaCl, an early influx of sodium through non-selective cation channels participates in the development of PCD through mitochondrial dysfunction and NADPH-oxidase-dependent O2·– generation. This supports the hypothesis of different pathways in NaCl- and sorbitol-induced cell death. Surprisingly, other shared early responses, such as [Ca2+]cyt increase and singlet oxygen production, do not seem to be involved in PCD. PMID:24420571

Monetti, Emanuela; Kadono, Takashi; Bouteau, François

2014-01-01

272

Proteomic Analysis of Early Reprogramming Events in Murine Somatic Cells Incubated with Xenopus laevis Oocyte Extracts Demonstrates Network Associations with Induced Pluripotency Markers  

PubMed Central

Abstract The reprogramming of somatic cells into a pluripotent/embryonic-like state holds great potential for regenerative medicine, bypassing ethical issues associated with embryonic stem cells (ESCs). Numerous methods, including somatic cell nuclear transfer (SCNT), fusion to pluripotent cells, the use of cell extracts, and expression of transcription factors, have been used to reprogram cells into ES-like cells [termed induced pluripotent stem cells (iPSCs)]. This study investigated early events in the nuclei of permeabilized murine somatic cells incubated in cytoplasmic extract prepared from Xenopus laevis germinal vesicle–stage oocytes by identifying proteins that showed significant quantitative changes using proteomic techniques. A total of 69 protein spots from two-dimensional electrophoresis were identified as being significantly altered in expression after treatment, and 38 proteins were identified by tandem mass spectrometry. Network analysis was used to highlight pathway connections and interactions between these identified proteins, which were found to be involved in many functions—primarily nuclear structure and dynamics, transcription, and translation. The pluripotency markers Klf4, c-Myc, Nanog, and POU5F1 were highlighted by the interaction network analysis, as well as other compounds/proteins known to be repressed in pluripotent cells [e.g., protein kinase C (PRKC)] or enhanced during differentiation of ESCs (e.g., retinoic acid). The network analysis also indicated additional proteins and pathways potentially involved in early reprogramming events. PMID:23768116

Liddell, Susan; Campbell, Keith H.S.

2013-01-01

273

The Early Miocene "Bisciaro volcaniclastic event" (northern Apennines, Italy): a key study for the geodynamic evolution of the central-western Mediterranean  

NASA Astrophysics Data System (ADS)

The Early Miocene Bisciaro Fm., a marly limestone succession cropping out widely in the Umbria-Romagna-Marche Apennines, is characterized by a high amount of volcaniclastic content, characterizing this unit as a peculiar event of the Adria Plate margin. Because of this volcaniclastic event, also recognizable in different sectors of the central-western Mediterranean chains, this formation is proposed as a "marker" for the geodynamic evolution of the area. In the Bisciaro Fm., the volcaniclastic supply starts with the "Raffaello" bed (Earliest Aquitanian) that marks the base of the formation and ends in the lower portion of the Schlier Fm. (Late Burdigalian-Langhian p.p.). Forty-one studied successions allowed the recognition of three main petrofacies: (1) Pyroclastic Deposits (volcanic materials more than 90 %) including the sub-petrofacies 1A, Vitroclastic/crystallo-vitroclastic tuffs; 1B, Bentonitic deposits; and 1C, Ocraceous and blackish layers; (2) Resedimented Syn-Eruptive Volcanogenic Deposits (volcanic material 30-90 %) including the sub-petrofacies 2A, High-density volcanogenic turbidites; 2B, Low-density volcanogenic turbidites; 2C, Crystal-rich volcanogenic deposits; and 2D, Glauconitic-rich volcaniclastites; (3) Mixing of Volcaniclastic Sediments with Marine Deposits (volcanic material 5-30 %, mixed with marine sediments: marls, calcareous marls, and marly limestones). Coeval volcaniclastic deposits recognizable in different tectonic units of the Apennines, Maghrebian, and Betic Chains show petrofacies and chemical-geochemical features related to a similar calc-alkaline magmatism. The characterization of this event led to the hypothesis of a co-genetic relationship between volcanic activity centres (primary volcanic systems) and depositional basins (depositional processes) in the Early Miocene palaeogeographic and palaeotectonic evolution of the central-western Mediterranean region. The results support the proposal of a geodynamic model of this area that considers previously proposed interpretations.

Guerrera, Francesco; Martín-Martín, Manuel; Raffaelli, Giuliana; Tramontana, Mario

2015-01-01

274

DNA Replication Animation  

NSDL National Science Digital Library

This resource is an animation to explain DNA replication. It is an interactive simulation activity for students. See also "Transcription and Translation Animation" to get all of the steps from DNA to protein.

Littell, Mcdougal

2012-07-19

275

Late Palaeozoic Early Mesozoic geological features of South China: Response to the Indosinian collision events in Southeast Asia  

NASA Astrophysics Data System (ADS)

This paper provides some new evidences on stratigraphic sequence, zircon SHRIMP dating from ophiolite, granitoids, and fold-and-thrust tectonic styles in the South China Block (SCB). Stratigraphic studies suggest that the eastern and central parts of the SCB show a SW-dipping palaeoslope framework during the Late Palaeozoic-Early Mesozoic. These areas were not in a deep-sea environment, but in a shallow-sea or littoral one. Coeval volcanic rocks are missing. Deep-water deposits and submarine volcanism only took place in the western part of the SCB. The three ophiolitic mélanges of the eastern SCB formed in the Neoproterozoic, but not in the Permian or the Triassic. The sedimentary rocks associated with the Neoproterozoic oceanic relics contain abundant Proterozoic acritarchs, but no radiolarians. The Early Mesozoic granitoids (235-205 Ma) belong to the post-collision peraluminous S-type granites; they are widely exposed in the central-western SCB, and rare in the eastern SCB. The fold-and-thrust belt developed in the eastern SCB shows a top-to-the-south displacement, whereas the Xuefengshan Belt of central SCB indicates a north- or northwest-directed shearing. The geodynamic settings of the different parts of the SCB during the Triassic are discussed.

Shu, Liangshu; Faure, Michel; Wang, Bo; Zhou, Xinmin; Song, Biao

2008-02-01

276

Active alleles of the human XIST gene replicate late in S phase  

SciTech Connect

The XIST gene is a strong candidate for controlling X chromosome inactivation. It has been mapped to the X inactivation control region (Xic) and is transcribed exclusively from the inactive X chromosome. XIST expression during development appears to be controlled by epigenetic modulation. Replication timing is an epigenetic modification implicated in transcriptional control and chromosomal imprinting. We have studied the replication timing of human XIST alleles on active and inactive X chromosomes present in somatic cell hybrids and fibroblast cultures. The replication timing method was based on the isolation of newly-replicated DNA from cells pulse-labeled with bromodexyuridine and separated by flow cytometry into different fractions of the cell cycle. Two human x hamster hybrid cell lines that contain active X chromosomes were found to replicate the inactive XIST allele early in S, similar to the active MIC2 gene. Active XIST alleles replicated late in S for three different hybrids containing inactive X chromosomes. MIC2 is expressed from both active and inactive X chromosomes and was found to replicate early in both active and inactive X hybrids. Male fibroblasts replicated XISt early in S, while both early and late peaks of replication were observed in female cells. The unusual replication patterns of active and inactive X alleles of XIST are similar to that of the autosomal H19 gene: late replication for active alleles and early replication for inactive alleles. This pattern of replication is a dramatic exception to the general rule that active genes replicate early in S phase. In addition to similar replication patterns, both H19 and XIST are subject to genomic imprinting and encode functional RNA products. Late replication timing for the active alleles of these genes may have functional significance. Further studies at these loci may help to eluidate the role of replication timing in the epigenetic control of imprinting, gene activity, and gene function.

Hansen, R.S.; Gartler, S.M. [Univ. of Washington, Seattle, WA (United States)

1994-09-01

277

Thermal Replication Trap  

NASA Astrophysics Data System (ADS)

The hallmark of living matter is the replication of genetic molecules and their active storage against diffusion. We have argued in the past that thermal convection can host the million-fold accumulation even of single nucleotides and at the same time trigger exponential replication [1]. Accumulation is driven by thermophoresis and convection in elongated chambers, replication by the inherent temperature cycling in convection. Optothermal pumping [2,3] allows to implement the thermal trap efficiently in a toroidal [4] or linear [5] geometry. Based on this method, we were in a position to combine accumulation and replication of DNA in the same chamber [5]. As we are missing a solid chemistry of prebiotic replication, we used as a proxy reaction for to replication the polymerase chain reaction. Convective flow both drives the DNA replicating polymerase chain reaction (PCR) while concurrent thermophoresis accumulates the replicated 143 base pair DNA in bulk solution. The time constant for accumulation is 92 s while DNA is doubled every 50 s. The length of the amplified DNA is checked with thermophoresis. Finite element simulations confirm the findings. The experiments explore conditions in pores of hydrothermal rock which can serve as a model environment for the origin of life and has prospects towards the first autonomous evolution, hosting the Darwin process by molecular selection using the thermophoretic trap. On the other side, the implemented continuous evolution will be able to breed well specified DNA or RNA molecules in the future. [4pt] [1] Baaske, Weinert, Duhr, Lemke, Russell and Braun, PNAS 104, 9346 (2007) [0pt] [2] Weinert, Kraus, Franosch and Braun, PRL 100, 164501 (2008) [0pt] [3] Weinert and Braun, Journal of Applied Physics 104, 104701 (2008) [0pt] [4] Weinert and Braun, Nano Letters 9, 4264 (2009) [0pt] [5] Mast and Braun, PRL 104, 188102 (2010)

Braun, Dieter

2011-03-01

278

Genetic Recombination of Human Immunodeficiency Virus Type 1 in One Round of Viral Replication: Effects of Genetic Distance, Target Cells, Accessory Genes, and Lack of High Negative Interference in Crossover Events  

Microsoft Academic Search

Recombination is a major mechanism that generates variation in populations of human immunodeficiency virus type 1 (HIV-1). Mutations that confer replication advantages, such as drug resistance, often cluster within regions of the HIV-1 genome. To explore how efficiently HIV-1 can assort markers separated by short distances, we developed a flow cytometry-based system to study recombination. Two HIV-1-based vectors were generated,

Terence D. Rhodes; Olga Nikolaitchik; Jianbo Chen; Douglas Powell; Wei-Shau Hu

2005-01-01

279

Recombination enhancement by replication (RER) in Rhizobium etli.  

PubMed Central

Studies in several organisms show that recombination and replication interact closely. Recombinational repair usually requires associated replication at some stage; moreover, additional replication can induce recombination through either homologous or illegitimate events. In prokaryotes, stimulation of recombination by replication is more dramatic when rolling circle replication is employed. In contrast, theta-type replication induces only a modest increase in recombination frequency. In this article, we show that induction of theta-type replication from a supernumerary origin in the symbiotic plasmid (pSym) of Rhizobium etli leads to a 1000-fold increase in deletion formation on this plasmid. These deletions span 120 kb (the symbiotic region) and have as endpoints the reiterated nitrogenase operons. We have named this phenomenon RER, for recombination enhancement by replication. RER is not affected by the position of the replication origin in the pSym, the direction of advance of the replication fork, or the distance from the origin to the recombining repeats. On the other hand, RER is dependent on an active recA allele, indicating that it is due to homologous recombination. RER displays a strong regionality restricted to the symbiotic region. The similarities and differences of RER with the recombination process observed at the terminus of replication of the Escherichia coli chromosome are discussed. PMID:10757747

Valencia-Morales, E; Romero, D

2000-01-01

280

Unraveling the Early Events of Amyloid-? Protein (A?) Aggregation: Techniques for the Determination of A? Aggregate Size  

PubMed Central

The aggregation of proteins into insoluble amyloid fibrils coincides with the onset of numerous diseases. An array of techniques is available to study the different stages of the amyloid aggregation process. Recently, emphasis has been placed upon the analysis of oligomeric amyloid species, which have been hypothesized to play a key role in disease progression. This paper reviews techniques utilized to study aggregation of the amyloid-? protein (A?) associated with Alzheimer’s disease. In particular, the review focuses on techniques that provide information about the size or quantity of oligomeric A? species formed during the early stages of aggregation, including native-PAGE, SDS-PAGE, Western blotting, capillary electrophoresis, mass spectrometry, fluorescence correlation spectroscopy, light scattering, size exclusion chromatography, centrifugation, enzyme-linked immunosorbent assay, and dot blotting. PMID:22489141

Pryor, N. Elizabeth; Moss, Melissa A.; Hestekin, Christa N.

2012-01-01

281

Frog Virus 3 DNA Replication Occurs in Two Stages  

PubMed Central

Viral DNA synthesis in frog virus 3 (FV3)-infected cells occurs both in the nucleus and in the cytoplasm (Goorha et al., Virology 84:32-51, 1978). Relationships between viral DNA molecules synthesized in these two compartments and their role in the virus replication were examined. The data presented here suggest that (i) FV3 DNA replicated in two stages and (ii) nucleus and cytoplasm were the sites of stages 1 and 2 of DNA replication, respectively. Stages 1 and 2 were further distinguished by their temporal appearance during infection and by the sizes of the replicating DNA as determined by sedimentation in neutral sucrose gradients. In stage 1, replicating molecules, between the size of unit and twice the unit length, were produced early in infection (2 h postinfection). In contrast, stage 2 of DNA replication occurred only after 3 h postinfection, and replicating molecules were large concatemers. Results of pulse-chase experiments showed that the concatemeric DNA served as the precursor for the production of mature FV3 DNA. Denaturation of concatemeric DNA with alkali or digestion with S1 nuclease reduced it to less than genome size molecules, indicating the presence of extensive single-stranded regions. Analysis of replicating DNA by equilibrium centrifugation in CsCl gradients after a pulse-chase suggested that these single-stranded regions were subsequently repaired. Based on these and previous data, a scheme of FV3 replication is presented. According to this scheme, FV3 utilizes the nucleus for early transcription and stage 1 of DNA replication. The viral DNA is then transported to the cytoplasm, where it participates in stage 2 DNA replication to form a concatemeric replication complex. The processing of concatemers to produce mature viral DNA and virus assembly also occurs in the cytoplasm. This mode of replication is strikingly different from any other known DNA virus. PMID:7109033

Goorha, R.

1982-01-01

282

Multifaceted Regulation of Translational Readthrough by RNA Replication Elements in a Tombusvirus  

PubMed Central

Translational readthrough of stop codons by ribosomes is a recoding event used by a variety of viruses, including plus-strand RNA tombusviruses. Translation of the viral RNA-dependent RNA polymerase (RdRp) in tombusviruses is mediated using this strategy and we have investigated this process using a variety of in vitro and in vivo approaches. Our results indicate that readthrough generating the RdRp requires a novel long-range RNA-RNA interaction, spanning a distance of ?3.5 kb, which occurs between a large RNA stem-loop located 3'-proximal to the stop codon and an RNA replication structure termed RIV at the 3'-end of the viral genome. Interestingly, this long-distance RNA-RNA interaction is modulated by mutually-exclusive RNA structures in RIV that represent a type of RNA switch. Moreover, a different long-range RNA-RNA interaction that was previously shown to be necessary for viral RNA replicase assembly was also required for efficient readthrough production of the RdRp. Accordingly, multiple replication-associated RNA elements are involved in modulating the readthrough event in tombusviruses and we propose an integrated mechanistic model to describe how this regulatory network could be advantageous by (i) providing a quality control system for culling truncated viral genomes at an early stage in the replication process, (ii) mediating cis-preferential replication of viral genomes, and (iii) coordinating translational readthrough of the RdRp with viral genome replication. Based on comparative sequence analysis and experimental data, basic elements of this regulatory model extend to other members of Tombusviridae, as well as to viruses outside of this family. PMID:22174683

Cimino, Peter A.; Nicholson, Beth L.; Wu, Baodong; Xu, Wei; White, K. Andrew

2011-01-01

283

Replication and Distribution of Toxoplasma gondii in the Small Intestine after Oral Infection with Tissue Cysts  

PubMed Central

Natural infection by Toxoplasma gondii occurs via oral ingestion of tissue cysts that rupture in the small intestine, releasing zoites that infect locally before disseminating throughout the host. The studies presented here used fluorescent parasites combined with flow cytometry and multiphoton microscopy techniques to understand the events associated with parasite replication in the mucosa. At 3 days postinfection with tissue cysts, parasites were localized in small foci and flow cytometry revealed parasites present in macrophages, neutrophils, and monocytes in the lamina propria. By day 6 postinfection, there were large foci of replicating parasites; however, foci unexpectedly varied in the number of villi involved and were associated with the presence of viable tachyzoites within the intestinal lumen. Consistent with the flow cytometry data, neutrophils and monocytes in the lamina propria were preferentially associated with parasite plaques. In contrast, dendritic cells comprised a small fraction of the infected immune cell population and were localized at the periphery of parasite plaques. Together, these findings reveal the formation of localized sites of parasite replication and inflammation early during infection and suggest that sustained replication of T. gondii in the gut may be a function of pathogen luminal spread. PMID:23460516

Gregg, Beth; Taylor, Betsy C.; John, Beena; Tait-Wojno, Elia D.; Girgis, Natasha M.; Miller, Natalie; Wagage, Sagie; Hunter, Christopher A.

2013-01-01

284

Mutations altering the gammaretrovirus endoproteolytic motif affect glycosylation of the envelope glycoprotein and early events of the virus life cycle.  

PubMed

Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectors with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription. PMID:25462351

Argaw, Takele; Wilson, Carolyn A

2015-01-15

285

Replication of chaos  

NASA Astrophysics Data System (ADS)

We propose a rigorous method for replication of chaos from a prior one to systems with large dimensions. Extension of the formal properties and features of a complex motion can be observed such that ingredients of chaos united as known types of chaos, Devaney's, Li-Yorke and obtained through period-doubling cascade. This is true for other appearances of chaos: intermittency, structure of the chaotic attractor, its fractal dimension, form of the bifurcation diagram, the spectra of Lyapunov exponents, etc. That is why we identify the extension of chaos through the replication as morphogenesis. To provide rigorous study of the subject, we introduce new definitions such as chaotic sets of functions, the generator and replicator of chaos, and precise description of ingredients for Devaney and Li-Yorke chaos in continuous dynamics. Appropriate simulations which illustrate the chaos replication phenomenon are provided. Moreover, in discussion form we consider inheritance of intermittency, replication of Shil'nikov orbits and quasiperiodical motions as a possible skeleton of a chaotic attractor. Chaos extension in an open chain of Chua circuits is also demonstrated.

Akhmet, M. U.; Fen, M. O.

2013-10-01

286

Loss of 11p11 is a frequent and early event in sporadic nonfunctioning pancreatic neuroendocrine neoplasms  

PubMed Central

The pathogenesis of sporadic pancreatic neuroendocrine neoplasms (PNENs) is poorly understood. To gain insight into the genetic mechanisms underlying this tumor entity, we performed genome-wide screening of 16 surgical specimens from 15 patients with sporadic PNEN, combining G-band karyotyping and high resolution comparative genomic hybridization (HR-CGH). G-banding revealed abnormal karyotypes in 2 of 10 tumor samples analyzed. DNA copy number changes were detected in 13 samples, whereas three tumors showed a balanced genome. Gains were more frequent than losses in the nonfunctioning tumors (n=13). Common gains were scored at 5p12–13, 4q13–24, 5p15, 5q11–31, and 9q21–22. Common losses were scored at 11p11, 11p14–15, 11q23, 11p12–13, and 11q22. The average number of copy aberrations (ANCA index) was 12 for 13 nonfunctioning primary tumors, 4.8 for the nonfunctioning tumors with low Ki-67 (?5%), 21.2 for the tumors with high Ki-67 (<5%), 2.5 for small tumors (<3.5 cm), and 17.8 for large tumors (?3.5 cm). There was a statistically significant difference in the ANCA index between the groups defined by Ki-67 and tumor size. Nonfunctioning tumors with low Ki-67, no distant metastasis and small size had few aberrations detected by HR-CGH, but frequent loss of material from chromosomal band 11p11. The present study indicates the existence of distinct cytogenetic patterns in sporadic nonfunctioning PNEN. Loss of chromosomal band 11p11 might indicate a primary pathogenetic event in these tumors. PMID:25018013

HAUGVIK, SVEN-PETTER; GORUNOVA, LUDMILA; HAUGOM, LISBETH; EIBAK, ANNE METTE; GLADHAUG, IVAR PRYDZ; HEIM, SVERRE; MICCI, FRANCESCA

2014-01-01

287

Root Secreted Metabolites and Proteins Are Involved in the Early Events of Plant-Plant Recognition Prior to Competition  

PubMed Central

The mechanism whereby organisms interact and differentiate between others has been at the forefront of scientific inquiry, particularly in humans and certain animals. It is widely accepted that plants also interact, but the degree of this interaction has been constricted to competition for space, nutrients, water and light. Here, we analyzed the root secreted metabolites and proteins involved in early plant neighbor recognition by using Arabidopsis thaliana Col-0 ecotype (Col) as our focal plant co-cultured in vitro with different neighbors [A. thaliana Ler ecotype (Ler) or Capsella rubella (Cap)]. Principal component and cluster analyses revealed that both root secreted secondary metabolites and proteins clustered separately between the plants grown individually (Col-0, Ler and Cap grown alone) and the plants co-cultured with two homozygous individuals (Col-Col, Ler-Ler and Cap-Cap) or with different individuals (Col-Ler and Col-Cap). In particularly, we observed that a greater number of defense- and stress- related proteins were secreted when our control plant, Col, was grown alone as compared to when it was co-cultured with another homozygous individual (Col-Col) or with a different individual (Col-Ler and Col-Cap). However, the total amount of defense proteins in the exudates of the co-cultures was higher than in the plant alone. The opposite pattern of expression was identified for stress-related proteins. These data suggest that plants can sense and respond to the presence of different plant neighbors and that the level of relatedness is perceived upon initial interaction. Furthermore, the role of secondary metabolites and defense- and stress-related proteins widely involved in plant-microbe associations and abiotic responses warrants reassessment for plant-plant interactions. PMID:23056382

Badri, Dayakar V.; De-la-Peña, Clelia; Lei, Zhentian; Manter, Daniel K.; Chaparro, Jacqueline M.; Guimarães, Rejane L.; Sumner, Lloyd W.; Vivanco, Jorge M.

2012-01-01

288

Real-time QCM-D monitoring of cancer cell death early events in a dynamic context.  

PubMed

Since a few years, the acoustic sensing of whole cell is the focus of increasing interest for monitoring the cytoskeletal cellular response to morphological modulators. We aimed at illustrating the potentialities of the quartz crystal microbalance with dissipation (QCM-D) technique for the real-time detection of the earliest morphological changes that occur at the cell-substrate interface during programmed cell death. Human breast cancer cells (MCF-7) grown on serum protein-coated gold sensors were placed in dynamic conditions under a continuous medium flow. The mass and viscoelasticity changes of the cells were tracked by monitoring the frequency and dissipation shifts during the first 4h of cell exposure to staurosporine, a well-known apoptosis inducer. We have identified a QCM-D signature characteristic of morphological modifications and cell detachment from the sensing surface that are related to the pro-apoptotic treatment. In particular, for low staurosporine doses below 1µM, we showed that recording the dissipation shift allows to detect an early cell response which is undetectable after the same duration by the classical analytical techniques in cell biology. Furthermore, this sensing method allows quantifying the efficiency of the drug effect in less than 4h without requiring labeling and without interfering in the system, thus preventing any loss of information. In the actual context of targeted cancer therapy development, we believe that these results bring new insights in favor of the use of the non invasive QCM-D technique for quickly probing the cancer cell sensitivity to death inducer drugs. PMID:25286354

Nowacki, Laetitia; Follet, Julie; Vayssade, Muriel; Vigneron, Pascale; Rotellini, Laura; Cambay, Florian; Egles, Christophe; Rossi, Claire

2015-02-15

289

Detection of replication competent retrovirus and lentivirus.  

PubMed

Retroviral vectors based on murine leukemia viruses (MuLV) have been used in clinical investigations for over a decade. Alternative retroviruses, most notably vectors based on HIV-1 and other lentiviruses, are now entering into clinical trials. Although vectors are designed to be replication defective, recombination events during vector production could lead to the generation of replication competent retroviruses (RCR) or replication competent lentiviruses (RCL). Careful screening of vector prior to human use must insure that patients are not inadvertently exposed to RCR or RCL. We describe methods capable of detecting low levels of virus contamination and discuss the current regulatory guidelines for screening gene therapy products intended for human use. PMID:19110631

Sastry, Lakshmi; Cornetta, Kenneth

2009-01-01

290

Demonstration of a Novel Synchrophasor-based Situational Awareness System: Wide Area Power System Visualization, On-line Event Replay and Early Warning of Grid Problems  

SciTech Connect

Since the large North Eastern power system blackout on August 14, 2003, U.S. electric utilities have spent lot of effort on preventing power system cascading outages. Two of the main causes of the August 14, 2003 blackout were inadequate situational awareness and inadequate operator training In addition to the enhancements of the infrastructure of the interconnected power systems, more research and development of advanced power system applications are required for improving the wide-area security monitoring, operation and planning in order to prevent large- scale cascading outages of interconnected power systems. It is critically important for improving the wide-area situation awareness of the operators or operational engineers and regional reliability coordinators of large interconnected systems. With the installation of large number of phasor measurement units (PMU) and the related communication infrastructure, it will be possible to improve the operators’ situation awareness and to quickly identify the sequence of events during a large system disturbance for the post-event analysis using the real-time or historical synchrophasor data. The purpose of this project was to develop and demonstrate a novel synchrophasor-based comprehensive situational awareness system for control centers of power transmission systems. The developed system named WASA (Wide Area Situation Awareness) is intended to improve situational awareness at control centers of the power system operators and regional reliability coordinators. It consists of following main software modules: • Wide-area visualizations of real-time frequency, voltage, and phase angle measurements and their contour displays for security monitoring. • Online detection and location of a major event (location, time, size, and type, such as generator or line outage). • Near-real-time event replay (in seconds) after a major event occurs. • Early warning of potential wide-area stability problems. The system has been deployed and demonstrated at the Tennessee Valley Authority (TVA) and ISO New England system using real-time synchrophasor data from openPDC. Apart from the software product, the outcome of this project consists of a set of technical reports and papers describing the mathematical foundations and computational approaches of different tools and modules, implementation issues and considerations, lessons learned, and the results of lidation processes.

Rosso, A.

2012-12-31

291

Down-regulation of ANAPC13 and CLTCL1: Early Events in the Progression of Preinvasive Ductal Carcinoma of the Breast12  

PubMed Central

Alterations in the gene expression profile in epithelial cells during breast ductal carcinoma (DC) progression have been shown to occur mainly between pure ductal carcinoma in situ (DCIS) to the in situ component of a lesion with coexisting invasive ductal carcinoma (DCIS-IDC) implying that the molecular program for invasion is already established in the preinvasive lesion. For assessing early molecular alterations in epithelial cells that trigger tumorigenesis and testing them as prognostic markers for breast ductal carcinoma progression, we analyzed, by reverse transcription-quantitative polymerase chain reaction, eight genes previously identified as differentially expressed between epithelial tumor cells populations captured from preinvasive lesions with distinct malignant potential, pure DCIS and the in situ component of DCIS-IDC. ANAPC13 and CLTCL1 down-regulation revealed to be early events of DC progression that anticipated the invasiveness manifestation. Further down-regulation of ANAPC13 also occurred after invasion appearance and the presence of the protein in invasive tumor samples was associated with higher rates of overall and disease-free survival in breast cancer patients. Furthermore, tumors with low levels of ANAPC13 displayed increased copy number alterations, with significant gains at 1q (1q23.1–1q32.1), 8q, and 17q (17q24.2), regions that display common imbalances in breast tumors, suggesting that down-regulation of ANAPC13 contributes to genomic instability in this disease. PMID:22496928

Sens-Abuázar, Carolina; Napolitano e Ferreira, Elisa; Osório, Cynthia Aparecida Bueno Toledo; Krepischi, Ana Cristina Victorino; Ricca, Tatiana Iervolino; Castro, Nadia Pereira; da Cunha, Isabela Werneck; Maciel, Maria do Socorro; Rosenberg, Carla; Brentani, Maria Mitzi; Soares, Fernando Augusto; Rocha, Rafael Malagoli; Carraro, Dirce Maria

2012-01-01

292

Late, not early mismatch responses to changes in frequency are reduced or deviant in children with dyslexia: an event-related potential study  

PubMed Central

Background Developmental disorders of oral and written language have been linked to deficits in the processing of auditory information. However, findings have been inconsistent, both for behavioural and electrophysiological measures. Methods In this study, we examined event-related potentials (ERPs) in 20 6- to 14-year-old children with developmental dyslexia and 20 age-matched controls, divided into younger (6–11 years, n?=?10) and older (11–14 years, n?=?10) age bands. We focused on early (mismatch negativity; MMN) and late (late discriminative negativity; LDN) conventional mismatch responses and associated measures derived from time-frequency analysis (inter-trial coherence and event-related spectral perturbation). Responses were elicited using an auditory oddball task, whereby a stream of 1000-Hz standards was interspersed with rare large (1,200 Hz) and small (1,030 Hz) frequency deviants. Results Conventional analyses revealed no significant differences between groups in the size of the MMN to either large or small frequency deviants. However, the younger age band of children with dyslexia showed an enhanced inter-trial coherence in the theta frequency band over the time window corresponding to the MMN to small deviants. By contrast, these same children showed a reduced-amplitude LDN for the small deviants relative to their age-matched controls, whilst the older children with dyslexia showed a shorter and less intense period of event-related desynchronization over this time window. Conclusions Initial detection and discrimination of auditory frequency change appears normal or even enhanced in children with dyslexia. Rather, deficits in late-stage auditory processing appear to be a feature of this population. PMID:25110526

2014-01-01

293

Replicated Composite Optics Development  

NASA Technical Reports Server (NTRS)

Advanced optical systems for applications such as grazing incidence Wolter I x-ray mirror assemblies require extraordinary mirror surfaces in ten-ns of fine surface finish and figure. The impeccable mirror surface is on the inside of the rotational mirror form. One practical method of producing devices with these requirements is to first fabricate an exterior surface for the optical device then replicate that surface to have the inverse component with lightweight characteristics. The replicate optic is not better than the master or mandrel from which it is made. This task is a continuance of previous studies to identify methods and materials for forming these extremely low roughness optical components.

Engelhaupt, Darell

1997-01-01

294

Activation of c-myb is an early bone-marrow event in a murine model for acute promonocytic leukemia.  

PubMed Central

Insertional mutagenesis of c-myb by Moloney murine leukemia virus occurs in 100% of promonocytic leukemias (MMLS) induced by the virus. These leukemias, which resemble acute monocytic leukemia-M5 in humans are induced only in mice undergoing a peritoneal chronic inflammatory response. We have found that two leukemia-specific gag-myb mRNAs in MML provide molecular markers for detection of preleukemic cells in hematopoietic tissue in vivo. The two aberrant RNAs result from splicing of gag to either exon 3 or 4 of c-myb, depending on the site of proviral integration. After reverse transcription-PCR with nested primers and hybridization with specific gag-myb junction probes, one cell, having aberrant c-myb message, could be detected in a minimum of 10(5) liver cells or 10(6) spleen or bone-marrow cells. This approach was used to examine hematopoietic tissues of mice after pristane injection to induce inflammation and virus inoculation. Cells with gag-myb mRNAs could be detected as early as 2 weeks after virus inoculation. In mice receiving both pristane and virus, there was evidence of preleukemic cells in 83% of the mice by 3 weeks after virus infection. Furthermore, 100% of the mice were positive for preleukemic cells by 8 weeks, even though only 50% of mice have been shown to succumb to MML (peak time for disease latency is 12-16 weeks). Cells with these aberrant c-myb messages were initially detected in the bone marrow, but during intermediate stages of disease development these cells disseminated to the spleen, liver, and granuloma. At preleukemic times, from 3 to 8 weeks after virus infection, a lower percentage of mice were positive in the group that did not receive pristane compared with mice in the group receiving pristane. However, at 18 weeks, 100% of the mice in the group receiving virus only had evidence of cells expressing gag-myb RNA in their spleens and/or bone marrow; it is of interest that mice inoculated with virus alone never develop MML. This approach for detecting preleukemic cells will now allow the study of mechanisms by which these preleukemic cells progress to a more transformed state and, perhaps, to a more differentiated state. Images PMID:7679511

Nason-Burchenal, K; Wolff, L

1993-01-01

295

Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution  

PubMed Central

Background Glutamine synthetase (GS) is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII) are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from ?-Proteobacteria (Eubacteria) to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae), and additional green algal (Chlorophyceae and Prasinophytae) and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta) sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB) and eukaryotic (GSIIE) GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the ?-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT). Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida). However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting a cytosolic function. GSIIB sequences were absent in vascular plants where the duplication of GSIIE replaced the function of GSIIB. Conclusions Phylogenetic evidence suggests GSIIB in Chloroplastida evolved by HGT, possibly after the divergence of the primary endosymbiotic lineages. Thus while multiple GS isoenzymes are common among members of the Chloroplastida, the isoenzymes may have evolved via different evolutionary processes. The acquisition of essential enzymes by HGT may provide rapid changes in biochemical capacity and therefore be favored by natural selection. PMID:20579371

2010-01-01

296

Alternative DNA Replication Patterns Associated with Long Arm Length of Chromosomes 4 and 5 in the Cri du Chat Syndrome  

Microsoft Academic Search

Autoradiographic studies of cultured leucocytes from nine cases of the cri du chat syndrome have been carried out. The deleted chromosome 4 or 5 is early replicating in seven cases, late replicating in one case, and not clearly either, in the case of a ring chromosome 4 or 5. The long arms of the early replicating deleted chromosome are significantly

O. J. Miller; W. R. Breg; Dorothy Warburton; Dorothym A. Miller; I. L. Firschein; K. Hirschhorn

1966-01-01

297

Reworked pyroclastic beds in the early Miocene of Patagonia: Reaction in response to high sediment supply during explosive volcanic events  

NASA Astrophysics Data System (ADS)

Two meter-scale pyroclastic levels are interbedded within the early Miocene succession of the Estancia 25 de Mayo (Patagoniense transgression) and Santa Cruz formations in the foreland Austral (or Magallanes) Basin, Argentina. The Lower Pyroclastic Level (LPL) is a tabular body interbedded within offshore marine deposits, laterally continuous for 30 km and varying in thickness from few centimeters to around 4 m. Grain-size grades from coarse to extremely fine ash with upward-fining along with a northeastern-fining trends. Structureless fine to very fine tuffs dominate and rare parallel laminations are the only tractive sedimentary structures. The Upper Pyroclastic Level (UPL) lies within low energy fluvial deposits and is laterally discontinuous, and it is composed by lenticular bodies reaching a maximum of 15 m thick and 100 m wide, with a concave-up base and a plane top. Grain-size range is similar to the LPL but it coarsens upward. The lower portion of the UPL shows parallel lamination, current ripple lamination and mud drapes with large pumice lapilli and plant debris, whereas the upper portion shows parallel lamination and trough cross-stratification. Both pyroclastic levels are composed mainly of pumice grains and glass shards with minor proportions of quartz and plagioclase crystals and lithic fragments. The LPL shows no mixing with epiclastic material whereas the UPL shows an upward increase in epiclastic material, and an upward increment in the scale of cross-bedding. The large thickness in relation to the possible emission center and the content of plant debris of the LPL does not suggest a direct, submarine, ash-fallout origin. The LPL is interpreted as a deposit of hyperpycnal-flows generated at the coastal zone when tephra-laden rivers plunged into the ocean. Large amounts of well preserved plant debris support the hypothesis of a terrestrial source of the sediments. The UPL is entirely composed of tractive deposits, so an ash fallout origin is disregarded. This, together with the lenticular shape and the alluvial plain origin of the encasing sediments, suggests accumulation within fluvial channels. Cycles of upper-flow-regime parallel lamination, current-ripple lamination and mud drapes at the lower portion, suggest short-lived turbulent flows that initially filled semi-abandoned channels. They were followed by sheet floods and channel reactivation, expressed by large-scale cross-bedding. The low degree of particle mixing observed in both levels is explained by the inability of streams to erode the substrate as they are suddenly over-saturated with pyroclastic sediments during and after the eruption. The grain-size distribution of the LPL and geochemical data indicate a contemporaneous volcanic source located to the west/southwest in the Andean ranges, where the South Patagonian Batholith is presently located. Explosive volcanism deeply modifies "normal" sedimentary dynamics.

Cuitiño, José I.; Scasso, Roberto A.

2013-05-01

298

Histone lysine methylation and chromatin replication.  

PubMed

In eukaryotic organisms, the replication of the DNA sequence and its organization into chromatin are critical to maintain genome integrity. Chromatin components, such as histone variants and histone post-translational modifications, along with the higher-order chromatin structure, impact several DNA metabolic processes, including replication, transcription, and repair. In this review we focus on lysine methylation and the relationships between this histone mark and chromatin replication. We first describe studies implicating lysine methylation in regulating early steps in the replication process. We then discuss chromatin reassembly following replication fork passage, where the incorporation of a combination of newly synthesized histones and parental histones can impact the inheritance of lysine methylation marks on the daughter strands. Finally, we elaborate on how the inheritance of lysine methylation can impact maintenance of the chromatin landscape, using heterochromatin as a model chromatin domain, and we discuss the potential mechanisms involved in this process. This article is part of a Special Issue entitled: Methylation: A Multifaceted Modification - looking at transcription and beyond. PMID:24686120

Rivera, Carlos; Gurard-Levin, Zachary A; Almouzni, Geneviève; Loyola, Alejandra

2014-12-01

299

The spatiotemporal program of replication in the genome of Lachancea kluyveri.  

PubMed

We generated a genome-wide replication profile in the genome of Lachancea kluyveri and assessed the relationship between replication and base composition. This species diverged from Saccharomyces cerevisiae before the ancestral whole genome duplication. The genome comprises eight chromosomes among which a chromosomal arm of 1 Mb has a G + C-content much higher than the rest of the genome. We identified 252 active replication origins in L. kluyveri and found considerable divergence in origin location with S. cerevisiae and with Lachancea waltii. Although some global features of S. cerevisiae replication are conserved: Centromeres replicate early, whereas telomeres replicate late, we found that replication origins both in L. kluyveri and L. waltii do not behave as evolutionary fragile sites. In L. kluyveri, replication timing along chromosomes alternates between regions of early and late activating origins, except for the 1 Mb GC-rich chromosomal arm. This chromosomal arm contains an origin consensus motif different from other chromosomes and is replicated early during S-phase. We showed that precocious replication results from the specific absence of late firing origins in this chromosomal arm. In addition, we found a correlation between GC-content and distance from replication origins as well as a lack of replication-associated compositional skew between leading and lagging strands specifically in this GC-rich chromosomal arm. These findings suggest that the unusual base composition in the genome of L. kluyveri could be linked to replication. PMID:23355306

Agier, Nicolas; Romano, Orso Maria; Touzain, Fabrice; Cosentino Lagomarsino, Marco; Fischer, Gilles

2013-01-01

300

Helicase Loading at Chromosomal Origins of Replication  

E-print Network

Loading of the replicative DNA helicase at origins of replication is of central importance in DNA replication. As the first of the replication fork proteins assemble at chromosomal origins of replication, the loaded helicase ...

Bell, Stephen P.

301

The Neurogenic Effects of Exogenous Neuropeptide Y: Early Molecular Events and Long-Lasting Effects in the Hippocampus of Trimethyltin-Treated Rats  

PubMed Central

Modulation of endogenous neurogenesis is regarded as a promising challenge in neuroprotection. In the rat model of hippocampal neurodegeneration obtained by Trimethyltin (TMT) administration (8 mg/kg), characterised by selective pyramidal cell loss, enhanced neurogenesis, seizures and cognitive impairment, we previously demonstrated a proliferative role of exogenous neuropeptide Y (NPY), on dentate progenitors in the early phases of neurodegeneration. To investigate the functional integration of newly-born neurons, here we studied in adult rats the long-term effects of intracerebroventricular administration of NPY (2 µg/2 µl, 4 days after TMT-treatment), which plays an adjuvant role in neurodegeneration and epilepsy. Our results indicate that 30 days after NPY administration the number of new neurons was still higher in TMT+NPY-treated rats than in control+saline group. As a functional correlate of the integration of new neurons into the hippocampal network, long-term potentiation recorded in Dentate Gyrus (DG) in the absence of GABAA receptor blockade was higher in the TMT+NPY-treated group than in all other groups. Furthermore, qPCR analysis of Kruppel-like factor 9, a transcription factor essential for late-phase maturation of neurons in the DG, and of the cyclin-dependent kinase 5, critically involved in the maturation and dendrite extension of newly-born neurons, revealed a significant up-regulation of both genes in TMT+NPY-treated rats compared with all other groups. To explore the early molecular events activated by NPY administration, the Sonic Hedgehog (Shh) signalling pathway, which participates in the maintenance of the neurogenic hippocampal niche, was evaluated by qPCR 1, 3 and 5 days after NPY-treatment. An early significant up-regulation of Shh expression was detected in TMT+NPY-treated rats compared with all other groups, associated with a modulation of downstream genes. Our data indicate that the neurogenic effect of NPY administration during TMT-induced neurodegeneration involves early Shh pathway activation and results in a functional integration of newly-generated neurons into the local circuit. PMID:24516629

Podda, Maria Vittoria; Lattanzi, Wanda; Giannetti, Stefano; Di Maria, Valentina; Cocco, Sara; Grassi, Claudio; Michetti, Fabrizio; Geloso, Maria Concetta

2014-01-01

302

The Early Phagosomal Stage of Francisella tularensis Determines Optimal Phagosomal Escape and Francisella Pathogenicity Island Protein Expression?  

PubMed Central

Francisella tularensis is an intracellular pathogen that can survive and replicate within macrophages. Following phagocytosis and transient interactions with the endocytic pathway, F. tularensis rapidly escapes from its original phagosome into the macrophage cytoplasm, where it eventually replicates. To examine the importance of the nascent phagosome for the Francisella intracellular cycle, we have characterized early trafficking events of the F. tularensis subsp. tularensis strain Schu S4 in a murine bone marrow-derived macrophage model. Here we show that early phagosomes containing Schu S4 transiently interact with early and late endosomes and become acidified before the onset of phagosomal disruption. Inhibition of endosomal acidification with the vacuolar ATPase inhibitor bafilomycin A1 or concanamycin A prior to infection significantly delayed but did not block phagosomal escape and cytosolic replication, indicating that maturation of the early Francisella-containing phagosome (FCP) is important for optimal phagosomal escape and subsequent intracellular growth. Further, Francisella pathogenicity island (FPI) protein expression was induced during early intracellular trafficking events. Although inhibition of endosomal acidification mimicked the early phagosomal escape defects caused by mutation of the FPI-encoded IglCD proteins, it did not inhibit the intracellular induction of FPI proteins, demonstrating that this response is independent of phagosomal pH. Altogether, these results demonstrate that early phagosomal maturation is required for optimal phagosomal escape and that the early FCP provides cues other than intravacuolar pH that determine intracellular induction of FPI proteins. PMID:18852245

Chong, Audrey; Wehrly, Tara D.; Nair, Vinod; Fischer, Elizabeth R.; Barker, Jeffrey R.; Klose, Karl E.; Celli, Jean

2008-01-01

303

Attenuation of the Early Events of ?-Synuclein Aggregation: A Fluorescence Correlation Spectroscopy and Laser Scanning Microscopy Study in the Presence of Surface-Coated Fe3O4 Nanoparticles.  

PubMed

The aggregation of ?-synuclein (A-syn) has been implicated in the pathogenesis of Parkinson's disease (PD). Although the early events of aggregation and not the matured amyloid fibrils are believed to be responsible for the toxicity, it has been difficult to probe the formation of early oligomers experimentally. We studied the effect of Fe3O4 nanoparticle (NP) in the early stage of aggregation of A-syn using fluorescence correlation spectroscopy (FCS) and laser scanning microscopy. The binding between the monomeric protein and NPs was also studied using FCS at single-molecule resolution. Our data showed that the addition of bare Fe3O4 NPs accelerated the rate of early aggregation, and it did not bind the monomeric A-syn. In contrast, l-lysine (Lys)-coated Fe3O4 NPs showed strong binding with the monomeric A-syn, inhibiting the early events of aggregation. Lys-coated Fe3O4 NPs showed significantly less cell toxicity compared with bare Fe3O4 NPs and can be explored as a possible strategy to develop therapeutic application against PD. To the best of our knowledge, this report is the first example of using a small molecule to attenuate the early (and arguably the most relevant in terms of PD pathogenesis) events of A-syn aggregation. PMID:25561279

Joshi, Nidhi; Basak, Sujit; Kundu, Sangeeta; De, Goutam; Mukhopadhyay, Anindita; Chattopadhyay, Krishnananda

2015-02-01

304

Replication timing control can be maintained in extrachromosomally amplified genes.  

PubMed Central

Extrachromosomal elements are common early intermediates of gene amplification in vivo and in cell culture. The time at which several extrachromosomal elements replicate was compared with that of the corresponding amplified or unamplified chromosomal sequences. The replication timing analysis employed a retroactive synchrony method in which fluorescence-activated cell sorting was used to obtain cells at different stages of the cell cycle. Extrachromosomally amplified Syrian hamster CAD genes (CAD is an acronym for the single gene which encodes the trifunctional protein which catalyzes the first three steps of uridine biosynthesis) replicated in a narrow window of early S-phase which was approximately the same as that of chromosomally amplified CAD genes. Similarly, extrachromosomally amplified mouse adenosine deaminase genes replicated at a discrete time in early S-phase which approximated the replication time of the unamplified adenosine deaminase gene. In contrast, the multicopy extrachromosomal Epstein-Barr virus genome replicated within a narrow window in late S-phase in latently infected human Rajii cells. The data indicate that localization within a chromosome is not required for the maintenance of replication timing control. Images PMID:1678857

Carroll, S M; Trotter, J; Wahl, G M

1991-01-01

305

Telomere Replication: Poised but Puzzling  

PubMed Central

Faithful replication of chromosomes is essential for maintaining genome stability. Telomeres, the chromosomal termini, pose quite a challenge to replication machinery due to the complexity in their structures and sequences. Efficient and complete replication of chromosomes is critical to prevent aberrant telomeres as well as to avoid unnecessary loss of telomere DNA. Compelling evidence supports the emerging picture of synergistic actions between DNA replication proteins and telomere protective components in telomere synthesis. This review discusses the actions of various replication and telomere-specific binding proteins that ensure accurate telomere replication and their roles in telomere maintenance and protection. PMID:21122064

Sampathi, Shilpa; Chai, Weihang

2010-01-01

306

Evidence for Sequential and Increasing Activation of Replication Origins along Replication Timing Gradients in the Human Genome  

PubMed Central

Genome-wide replication timing studies have suggested that mammalian chromosomes consist of megabase-scale domains of coordinated origin firing separated by large originless transition regions. Here, we report a quantitative genome-wide analysis of DNA replication kinetics in several human cell types that contradicts this view. DNA combing in HeLa cells sorted into four temporal compartments of S phase shows that replication origins are spaced at 40 kb intervals and fire as small clusters whose synchrony increases during S phase and that replication fork velocity (mean 0.7 kb/min, maximum 2.0 kb/min) remains constant and narrowly distributed through S phase. However, multi-scale analysis of a genome-wide replication timing profile shows a broad distribution of replication timing gradients with practically no regions larger than 100 kb replicating at less than 2 kb/min. Therefore, HeLa cells lack large regions of unidirectional fork progression. Temporal transition regions are replicated by sequential activation of origins at a rate that increases during S phase and replication timing gradients are set by the delay and the spacing between successive origin firings rather than by the velocity of single forks. Activation of internal origins in a specific temporal transition region is directly demonstrated by DNA combing of the IGH locus in HeLa cells. Analysis of published origin maps in HeLa cells and published replication timing and DNA combing data in several other cell types corroborate these findings, with the interesting exception of embryonic stem cells where regions of unidirectional fork progression seem more abundant. These results can be explained if origins fire independently of each other but under the control of long-range chromatin structure, or if replication forks progressing from early origins stimulate initiation in nearby unreplicated DNA. These findings shed a new light on the replication timing program of mammalian genomes and provide a general model for their replication kinetics. PMID:22219720

Guilbaud, Guillaume; Rappailles, Aurélien; Baker, Antoine; Chen, Chun-Long; Arneodo, Alain; Goldar, Arach; d'Aubenton-Carafa, Yves; Thermes, Claude; Audit, Benjamin; Hyrien, Olivier

2011-01-01

307

Evaluation of Epidemic Intelligence Systems Integrated in the Early Alerting and Reporting Project for the Detection of A/H5N1 Influenza Events  

PubMed Central

The objective of Web-based expert epidemic intelligence systems is to detect health threats. The Global Health Security Initiative (GHSI) Early Alerting and Reporting (EAR) project was launched to assess the feasibility and opportunity for pooling epidemic intelligence data from seven expert systems. EAR participants completed a qualitative survey to document epidemic intelligence strategies and to assess perceptions regarding the systems performance. Timeliness and sensitivity were rated highly illustrating the value of the systems for epidemic intelligence. Weaknesses identified included representativeness, completeness and flexibility. These findings were corroborated by the quantitative analysis performed on signals potentially related to influenza A/H5N1 events occurring in March 2010. For the six systems for which this information was available, the detection rate ranged from 31% to 38%, and increased to 72% when considering the virtual combined system. The effective positive predictive values ranged from 3% to 24% and F1-scores ranged from 6% to 27%. System sensitivity ranged from 38% to 72%. An average difference of 23% was observed between the sensitivities calculated for human cases and epizootics, underlining the difficulties in developing an efficient algorithm for a single pathology. However, the sensitivity increased to 93% when the virtual combined system was considered, clearly illustrating complementarities between individual systems. The average delay between the detection of A/H5N1 events by the systems and their official reporting by WHO or OIE was 10.2 days (95% CI: 6.7–13.8). This work illustrates the diversity in implemented epidemic intelligence activities, differences in system's designs, and the potential added values and opportunities for synergy between systems, between users and between systems and users. PMID:23472077

Barboza, Philippe; Vaillant, Laetitia; Mawudeku, Abla; Nelson, Noele P.; Hartley, David M.; Madoff, Lawrence C.; Linge, Jens P.; Collier, Nigel; Brownstein, John S.; Yangarber, Roman; Astagneau, Pascal; on behalf of the Early Alerting, Reporting Project of the Global Health Security Initiative

2013-01-01

308

Amyloidogenic and non-amyloidogenic transthyretin variants interact differently with human cardiomyocytes: insights into early events of non-fibrillar tissue damage  

PubMed Central

TTR (transthyretin) amyloidoses are diseases characterized by the aggregation and extracellular deposition of the normally soluble plasma protein TTR. Ex vivo and tissue culture studies suggest that tissue damage precedes TTR fibril deposition, indicating that early events in the amyloidogenic cascade have an impact on disease development. We used a human cardiomyocyte tissue culture model system to define these events. We previously described that the amyloidogenic V122I TTR variant is cytotoxic to human cardiac cells, whereas the naturally occurring, stable and non-amyloidogenic T119M TTR variant is not. We show that most of the V122I TTR interacting with the cells is extracellular and this interaction is mediated by a membrane protein(s). In contrast, most of the non-amyloidogenic T119M TTR associated with the cells is intracellular where it undergoes lysosomal degradation. The TTR internalization process is highly dependent on membrane cholesterol content. Using a fluorescent labelled V122I TTR variant that has the same aggregation and cytotoxic potential as the native V122I TTR, we determined that its association with human cardiomyocytes is saturable with a KD near 650 nM. Only amyloidogenic V122I TTR compete with fluorescent V122I for cell-binding sites. Finally, incubation of the human cardiomyocytes with V122I TTR but not with T119M TTR, generates superoxide species and activates caspase 3/7. In summary, our results show that the interaction of the amyloidogenic V122I TTR is distinct from that of a non-amyloidogenic TTR variant and is characterized by its retention at the cell membrane, where it initiates the cytotoxic cascade. PMID:25395306

Manral, Pallavi; Reixach, Natàlia

2014-01-01

309

MKP-1 signaling events are required for early osteoclastogenesis in lineage defined progenitor populations by disrupting RANKL-induced NFATc1 nuclear translocation.  

PubMed

Cytokine-directed osteoclastogenesis is initiated in response to macrophage colony stimulating factor (M-CSF) and receptor activator of NF-?B ligand (RANKL) to drive formation of osteoclasts (OC), large bone resorptive cells of hematopoietic origin. RANKL-induced signaling activates the MAPK pathways, which initiates nuclear translocation of the master regulator of osteoclast formation, transcription factor NFATc1. Proper control over these signaling events is essential to normal OC formation response to stimuli. MAPK phosphatase 1 (MKP-1), a serine and tyrosine phosphatase encoded by the gene Dusp1, functions to dephosphorylate and subsequently inactivate MAPK (p38 and JNK) signaling essential in osteoclastogenesis. Here, we explored the role of MKP-1 during RANKL-driven osteoclastogenesis from defined (B220/CD45(-)GR1(-)CD11b(lo/-)CD115(+)) OC progenitor (dOCP) populations using WT and Dusp1(-/-) global knockout mice. Sorted cells were driven to OC by M-CSF pre-treatment followed by RANKL stimulation for 3days. OC formation and qPCR products were analyzed for maturation. Results indicate that Dusp1(-/-) dOCP form less numerous, significantly smaller and less functional OC compared to WT controls. These data were corroborated by mRNA expression of the key OC genes, Nfatc1 and Tm7sf4 (DC-STAMP), which were significantly reduced in early osteoclastogenesis in OC progenitor from Dusp1(-/-) mice. Intriguingly, our data reveals that MKP-1 may positively control OC formation in response to RANKL by regulating NFATc1 nuclear translocation. Collectively, this report supports the idea that MKP-1 signaling is essential in early osteoclastogenesis in response to RANKL-induced signaling. PMID:24269279

Valerio, Michael S; Herbert, Bethany A; Griffin, Alfred C; Wan, Zhuang; Hill, Elizabeth G; Kirkwood, Keith L

2014-03-01

310

DNA: Mutations During Replication  

NSDL National Science Digital Library

In this unit you will learn the basics of genetics. Genetics is a subject regularly seen in the news, whether it is cloning sheep, looking for cures to diseases, controlling cancer, or stem cell research. The core is always in genetics. By studying this unit on genetics you will be better able to make important decisions regarding controversial issues as well as understand what makes us all what we are. OPTIONAL REVIEW In this activity we are going to review how DNA replicates. After watching the video, answer the following questions in your notebook. How DNA Replicates 1.What is the shape and what are the building blocks of the DNA molecule? 2.Which DNA bases pair with each other? What part of the DNA molecule do ...

Hektor, Mrs.

2007-10-29

311

DNA Replicating Itself  

NSDL National Science Digital Library

A simplified representation of a DNA molecule separating to form two new molecules.   To reproduce, a cell must copy and transmit its genetic information (DNA) to all of its progeny. To do so, DNA replicates, following the process of semiconservative replication. Each strand of the original molecule acts as a template for the synthesis of a new complementary DNA molecule. The two strands of the double helix are first separated by enzymes. With the assistance of other enzymes, spare parts available inside the cell are bound to the individual strands following the rules of complementary base pairing: adenine (A) to thymine (T) and guanine (G) to cytosine (C). Two strands of DNA are obtained from one, having produced two daughter molecules which are identical to one another and to the parent molecule.

Excellence, Access

2005-03-12

312

Replicators, lineages, and interactors.  

PubMed

The target article argues that whole groups can act as interactors in an evolutionary process. We believe that Smaldino's discussion would be advanced by a more thorough analysis of the appropriate replicators and lineages for this model. We show that cultural evolution is necessarily a separate process from cultural group selection, and we also illustrate that the two processes may influence each other as demonstrated by an agent-based model of communicating food-processing skills. PMID:24970423

Taylor, Daniel J; Bryson, Joanna J

2014-06-01

313

DNA Structure, Function and Replication  

NSDL National Science Digital Library

This analysis and discussion activity can be used to introduce your students to key concepts about DNA structure, function and replication or to review these topics. This activity includes hands-on modeling of DNA replication.

Waldron, Ingrid

314

Developmental defects of enamel in primary teeth and association with early life course events: a study of 6–36 month old children in Manyara, Tanzania  

PubMed Central

Background Children with low birth weight show an increased prevalence of developmental defects of enamel in the primary dentition that subsequently may predispose to early childhood caries (ECC). Focusing 6–36 months old, the purpose of this study was to assess the frequency of enamel defects in the primary dentition and identify influences of early life course factors; socio-demographics, birth weight, child’s early illness episodes and mothers’ perceived size of the child at birth, whilst controlling for more recent life course events in terms of current breastfeeding and oral hygiene. Methods A cross-sectional study was conducted in the high fluoride area of Manyara, northern Tanzania including 1221 child-mother pairs who attended Reproductive and Child Health (RCH) clinics for immunization and/or growth monitoring. After the primary caregivers had completed face to face interviews at the health care facility, children underwent oral clinical examination whereby ECC and developmental defects of enamel were recorded using field criteria. All erupted teeth were examined and the enamel defects were assessed on buccal surfaces according to the modified DDE Index. Results The prevalence of enamel defects was 33.3%. Diffuse opacities were the most common defects identified (23.1%), followed by hypoplasia (7.6%) and demarcated opacities (5.0%). The most frequently affected teeth were the upper central incisors (29.0% - 30.5%), whereas lower central incisors (4.3% to 4.5%) were least frequently affected. Multiple logistic regression analysis, adjusting for confounding the factors revealed that having normal birth weight (equal or more than 2500 g) associated with lower odds of having enamel hypoplasia [OR 0.2 (95% CI 0.1-0.7)]. No statistically significant association occurred between birth weight and diffuse opacities, demarcated opacities or combined DDE. Conclusion Children with the history of low birth weight were more likely than their normal birth weight counterparts to present with enamel hypoplasia. In view of the frequent occurrence of enamel defects and the fact that hypoplasia may constitute a risk factor for future ECC, enamel defects should be included as a dental health indicator in epidemiological studies of children in northern Tanzania. PMID:23672512

2013-01-01

315

Characterization of the Early Events Leading to Totipotency in an Arabidopsis Protoplast Liquid Culture by Temporal Transcript Profiling[W][OPEN  

PubMed Central

The molecular mechanisms underlying plant cell totipotency are largely unknown. Here, we present a protocol for the efficient regeneration of plants from Arabidopsis thaliana protoplasts. The specific liquid medium used in our study leads to a high rate of reentry into the cell cycle of most cell types, providing a powerful system to study dedifferentiation/regeneration processes in independent somatic cells. To identify the early events in the establishment of totipotency, we monitored the genome-wide transcript profiles of plantlets and protoplast-derived cells (PdCs) during the first week of culture. Plant cells rapidly dedifferentiated. Then, we observed the reinitiation and reorientation of protein synthesis, accompanied by the reinitiation of cell division and de novo cell wall synthesis. Marked changes in the expression of chromatin-associated genes, especially of those in the histone variant family, were observed during protoplast culture. Surprisingly, the epigenetic status of PdCs and well-established cell cultures differed, with PdCs exhibiting rare reactivated transposons and epigenetic changes. The differentially expressed genes identified in this study are interesting candidates for investigating the molecular mechanisms underlying plant cell plasticity and totipotency. One of these genes, the plant-specific transcription factor ABERRANT LATERAL ROOT FORMATION4, is required for the initiation of protoplast division. PMID:23903317

Chupeau, Marie-Christine; Granier, Fabienne; Pichon, Olivier; Renou, Jean-Pierre; Gaudin, Valérie; Chupeau, Yves

2013-01-01

316

Capturing the biological impact of CDKN2A and MC1R genes as an early predisposing event in melanoma and non melanoma skin cancer.  

PubMed

Germline mutations in CDKN2A and/or red hair color variants in MC1R genes are associated with an increased susceptibility to develop cutaneous melanoma or non melanoma skin cancer. We studied the impact of the CDKN2A germinal mutation p.G101W and MC1R variants on gene expression and transcription profiles associated with skin cancer. To this end we set-up primary skin cell co-cultures from siblings of melanoma prone-families that were later analyzed using the expression array approach. As a result, we found that 1535 transcripts were deregulated in CDKN2A mutated cells, with over-expression of immunity-related genes (HLA-DPB1, CLEC2B, IFI44, IFI44L, IFI27, IFIT1, IFIT2, SP110 and IFNK) and down-regulation of genes playing a role in the Notch signaling pathway. 3570 transcripts were deregulated in MC1R variant carriers. In particular, genes related to oxidative stress and DNA damage pathways were up-regulated as well as genes associated with neurodegenerative diseases such as Parkinson's, Alzheimer and Huntington. Finally, we observed that the expression signatures indentified in phenotypically normal cells carrying CDKN2A mutations or MC1R variants are maintained in skin cancer tumors (melanoma and squamous cell carcinoma). These results indicate that transcriptome deregulation represents an early event critical for skin cancer development. PMID:24742402

Puig-Butille, Joan Anton; Escámez, María José; Garcia-Garcia, Francisco; Tell-Marti, Gemma; Fabra, Àngels; Martínez-Santamaría, Lucía; Badenas, Celia; Aguilera, Paula; Pevida, Marta; Dopazo, Joaquín; del Río, Marcela; Puig, Susana

2014-03-30

317

Capturing the biological impact of CDKN2A and MC1R genes as an early predisposing event in melanoma and non melanoma skin cancer  

PubMed Central

Germline mutations in CDKN2A and/or red hair color variants in MC1R genes are associated with an increased susceptibility to develop cutaneous melanoma or non melanoma skin cancer. We studied the impact of the CDKN2A germinal mutation p.G101W and MC1R variants on gene expression and transcription profiles associated with skin cancer. To this end we set-up primary skin cell co-cultures from siblings of melanoma prone-families that were later analyzed using the expression array approach. As a result, we found that 1535 transcripts were deregulated in CDKN2A mutated cells, with over-expression of immunity-related genes (HLA-DPB1, CLEC2B, IFI44, IFI44L, IFI27, IFIT1, IFIT2, SP110 and IFNK) and down-regulation of genes playing a role in the Notch signaling pathway. 3570 transcripts were deregulated in MC1R variant carriers. In particular, genes related to oxidative stress and DNA damage pathways were up-regulated as well as genes associated with neurodegenerative diseases such as Parkinson’s, Alzheimer and Huntington. Finally, we observed that the expression signatures indentified in phenotypically normal cells carrying CDKN2A mutations or MC1R variants are maintained in skin cancer tumors (melanoma and squamous cell carcinoma). These results indicate that transcriptome deregulation represents an early event critical for skin cancer development. PMID:24742402

Puig-Butille, Joan Anton; Escámez, María José; Garcia-Garcia, Francisco; Tell-Marti, Gemma; Fabra, Àngels; Martínez-Santamaría, Lucía; Badenas, Celia; Aguilera, Paula; Pevida, Marta; Dopazo, Joaquín; del Río, Marcela; Puig, Susana

2014-01-01

318

Replication Fork Polarity Gradients Revealed by Megabase-Sized U-Shaped Replication Timing Domains in Human Cell Lines  

PubMed Central

In higher eukaryotes, replication program specification in different cell types remains to be fully understood. We show for seven human cell lines that about half of the genome is divided in domains that display a characteristic U-shaped replication timing profile with early initiation zones at borders and late replication at centers. Significant overlap is observed between U-domains of different cell lines and also with germline replication domains exhibiting a N-shaped nucleotide compositional skew. From the demonstration that the average fork polarity is directly reflected by both the compositional skew and the derivative of the replication timing profile, we argue that the fact that this derivative displays a N-shape in U-domains sustains the existence of large-scale gradients of replication fork polarity in somatic and germline cells. Analysis of chromatin interaction (Hi-C) and chromatin marker data reveals that U-domains correspond to high-order chromatin structural units. We discuss possible models for replication origin activation within U/N-domains. The compartmentalization of the genome into replication U/N-domains provides new insights on the organization of the replication program in the human genome. PMID:22496629

Baker, Antoine; Audit, Benjamin; Chen, Chun-Long; Moindrot, Benoit; Leleu, Antoine; Guilbaud, Guillaume; Rappailles, Aurélien; Vaillant, Cédric; Goldar, Arach; Mongelard, Fabien; d'Aubenton-Carafa, Yves; Hyrien, Olivier; Thermes, Claude; Arneodo, Alain

2012-01-01

319

Trypanosoma cruzi DNA replication includes the sequential recruitment of pre-replication and replication machineries close to nuclear periphery  

PubMed Central

In eukaryotes, many nuclear processes are spatially compartmentalized. Previously, we have shown that in Trypanosoma cruzi, an early-divergent eukaryote, DNA replication occurs at the nuclear periphery where chromosomes remain constrained during the S phase of the cell cycle. We followed Orc1/Cdc6, a pre-replication machinery component and the proliferating cell nuclear antigen (PCNA), a component of replication machinery, during the cell cycle of this protozoon. We found that, at the G1 stage, TcOrc1/Cdc6 and TcPCNA are dispersed throughout the nuclear space. During the G1/S transition, TcOrc1/Cdc6 migrates to a region close to nuclear periphery. At the onset of S phase, TcPCNA is loaded onto the DNA and remains constrained close to nuclear periphery. Finally, in G2, mitosis and cytokinesis, TcOrc1/Cdc6 and TcPCNA are dispersed throughout the nuclear space. Based on these findings, we propose that DNA replication in T. cruzi is accomplished by the organization of functional machineries in a spatial-temporal manner. PMID:21738836

Calderano, Simone Guedes; de Melo Godoy, Patrícia Diogo; Motta, Maria Cristina M; Mortara, Renato A; Schenkman, Sergio

2011-01-01

320

The Role Of Oceanic Plateau Volcanism On Climate Change: Warming And Cooling Episodes Across Early Aptian Oceanic Anoxic Event 1a  

NASA Astrophysics Data System (ADS)

The early Aptian is marked by a global phenomenon of organic matter burial in oxygen-depleted oceans known as Oceanic Anoxic Event 1a (OAE 1a: ~120 Ma). Volcanism associated with the emplacement of the Ontong Java Plateau (OJP) is thought to be the main triggering mechanism for global anoxia, ocean acidification and greenhouse conditions. However, climate instability during OAE 1a is indicated by independent studies on TEX86, sporomorphs and oxygen-stable isotope but a direct connection between OJP volcanic phases and temperature variations has not been ascertained. A high-resolution integrated nannofossil-geochemical investigation of distant sections from the Tethys, the Pacific Ocean and the Boreal Realm has revealed systematic and synchronous changes. Specifically, the nannofossil Temperature Index and Os-isotope records allowed the reconstruction of a complex series of global warming and cooling events across OAE 1a and their relationships with OJP volcanism as well as weathering patterns. Two prominent volcanic phases are documented in the Os-isotope records: the first preceding OAE 1a and the second one, of major intensity, starting in the core of the negative C-isotopic anomaly. Both phases are paralleled by increased temperature, suggestive of a (super)greenhouse climate triggered by excess volcanogenic CO2. Indeed, our data indicate that the beginning of the prolonged volcanic phase during OAE 1a coincides with warmest temperatures. In the early part of OAE 1a, between the two major volcanic phases, there is a ~100 kyrs-long interval characterized by a radiogenic Os-isotope peak, suggestive of accelerated continental weathering rates, with or without volcanism cessation, following an interval of abrupt warming and preceding a cooling interlude. Arguably, warming at OAE 1a onset promoted methane hydrate dissociation (also suggested by C-isotope and biomarkers analyses), which was perhaps instrumental in triggering continental weathering. Subsequent CO2 draw down, possibly during OJP quiescence, might explain the brief cooling interlude annihilated by warmest temperatures coeval with the onset of OJP paroxysmal phase. In the second part of OAE 1a two more cooling events sandwich an interval of intermediate and fluctuating temperatures. The three cooling episodes correlate with high TOC content, suggesting that burial of organic matter acted as storage of excess CO2, thus temporarily mitigating greenhouse conditions, although under persisting OJP activity. The end of OAE 1a corresponds to the vanishing of OJP volcanism as recorded by Os-isotope. A major cooling episode decrees the conclusion of greenhouse conditions for the rest of the Aptian. Increasing data and improved chronology show that volcanism of gigantic plateaus such as OJP is qualified to cause severe global warming and also indirectly to impact temperature changes. In fact, positive and negative feedbacks vicariously governed by prolonged (and possibly pulsing) formation of oceanic plateaus may be likewise or even more influential in controlling climate variability.

Bottini, C.; Erba, E.; Mutterlose, J.

2011-12-01

321

Mitochondrial biology. Replication-transcription switch in human mitochondria.  

PubMed

Coordinated replication and expression of the mitochondrial genome is critical for metabolically active cells during various stages of development. However, it is not known whether replication and transcription can occur simultaneously without interfering with each other and whether mitochondrial DNA copy number can be regulated by the transcription machinery. We found that interaction of human transcription elongation factor TEFM with mitochondrial RNA polymerase and nascent transcript prevents the generation of replication primers and increases transcription processivity and thereby serves as a molecular switch between replication and transcription, which appear to be mutually exclusive processes in mitochondria. TEFM may allow mitochondria to increase transcription rates and, as a consequence, respiration and adenosine triphosphate production without the need to replicate mitochondrial DNA, as has been observed during spermatogenesis and the early stages of embryogenesis. PMID:25635099

Agaronyan, Karen; Morozov, Yaroslav I; Anikin, Michael; Temiakov, Dmitry

2015-01-30

322

The DNA Replication Stress Hypothesis of Alzheimer's Disease  

PubMed Central

A well-recognized theory of Alzheimer's disease (AD) pathogenesis suggests ectopic cell cycle events to mediate neurodegeneration. Vulnerable neurons of the AD brain exhibit biomarkers of cell cycle progression and DNA replication suggesting a reentry into the cell cycle. Chromosome reduplication without proper cell cycle completion and mitotic division probably causes neuronal cell dysfunction and death. However, this theory seems to require some inputs in accordance with the generally recognized amyloid cascade theory as well as to explain causes and consequences of genomic instability (aneuploidy) in the AD brain. We propose that unscheduled and incomplete DNA replication (replication stress) destabilizes (epi)genomic landscape in the brain and leads to DNA replication “catastrophe” causing cell death during the S phase (replicative cell death). DNA replication stress can be a key element of the pathogenetic cascade explaining the interplay between ectopic cell cycle events and genetic instabilities in the AD brain. Abnormal cell cycle reentry and somatic genome variations can be used for updating the cell cycle theory introducing replication stress as a missing link between cell genetics and neurobiology of AD. PMID:22262948

Yurov, Yuri B.; Vorsanova, Svetlana G.; Iourov, Ivan Y.

2011-01-01

323

Modeling Inhomogeneous DNA Replication Kinetics  

PubMed Central

In eukaryotic organisms, DNA replication is initiated at a series of chromosomal locations called origins, where replication forks are assembled proceeding bidirectionally to replicate the genome. The distribution and firing rate of these origins, in conjunction with the velocity at which forks progress, dictate the program of the replication process. Previous attempts at modeling DNA replication in eukaryotes have focused on cases where the firing rate and the velocity of replication forks are homogeneous, or uniform, across the genome. However, it is now known that there are large variations in origin activity along the genome and variations in fork velocities can also take place. Here, we generalize previous approaches to modeling replication, to allow for arbitrary spatial variation of initiation rates and fork velocities. We derive rate equations for left- and right-moving forks and for replication probability over time that can be solved numerically to obtain the mean-field replication program. This method accurately reproduces the results of DNA replication simulation. We also successfully adapted our approach to the inverse problem of fitting measurements of DNA replication performed on single DNA molecules. Since such measurements are performed on specified portion of the genome, the examined DNA molecules may be replicated by forks that originate either within the studied molecule or outside of it. This problem was solved by using an effective flux of incoming replication forks at the model boundaries to represent the origin activity outside the studied region. Using this approach, we show that reliable inferences can be made about the replication of specific portions of the genome even if the amount of data that can be obtained from single-molecule experiments is generally limited. PMID:22412853

Gauthier, Michel G.; Norio, Paolo; Bechhoefer, John

2012-01-01

324

Plasmid models for bacteriophage T4 DNA replication: requirements for fork proteins.  

PubMed Central

Bacteriophage T4 DNA replication initiates from origins at early times of infection and from recombinational intermediates as the infection progresses. Plasmids containing cloned T4 origins replicate during T4 infection, providing a model system for studying origin-dependent replication. In addition, recombination-dependent replication can be analyzed by using cloned nonorigin fragments of T4 DNA, which direct plasmid replication that requires phage-encoded recombination proteins. We have tested in vivo requirements for both plasmid replication model systems by infecting plasmid-containing cells with mutant phage. Replication of origin and nonorigin plasmids strictly required components of the T4 DNA polymerase holoenzyme complex. Recombination-dependent plasmid replication also strictly required the T4 single-stranded DNA-binding protein (gene product 32 [gp32]), and replication of origin-containing plasmids was greatly reduced by 32 amber mutations. gp32 is therefore important in both modes of replication. An amber mutation in gene 41, which encodes the replicative helicase of T4, reduced but did not eliminate both recombination- and origin-dependent plasmid replication. Therefore, gp41 may normally be utilized for replication of both plasmids but is apparently not required for either. An amber mutation in gene 61, which encodes the T4 RNA primase, did not eliminate either recombination- or origin-dependent plasmid replication. However, plasmid replication was severely delayed by the 61 amber mutation, suggesting that the protein may normally play an important, though nonessential, role in replication. We deleted gene 61 from the T4 genome to test whether the observed replication was due to residual gp61 in the amber mutant infection. The replication phenotype of the deletion mutant was identical to that of the amber mutant. Therefore, gp61 is not required for in vivo T4 replication. Furthermore, the deletion mutant is viable, demonstrating that the gp61 primase is not an essential T4 protein. Images PMID:1433501

Benson, K H; Kreuzer, K N

1992-01-01

325

Role of replication time in the control of tissue-specific gene expression.  

PubMed Central

Late-replicating chromatin in vertebrates is repressed. Housekeeping (constitutively active) genes always replicate early and are in the early-replicating R-bands. Tissue-specific genes are usually in the late-replicating G-bands and therein almost always replicate late. Within the G-bands, however, a tissue-specific gene does replicate early in those cell types that express that particular gene. While the condition of late replication may simply be coincident with gene repression, we review evidence suggesting that late replication may actively determine repression. As mammals utilize a developmental program to Lyonize (facultatively heterochromatinize) whole X chromosomes to a late-replicating and somatically heritable repressed state, similarly another program seems to Lyonize individual replicons. In frogs, all genes begin embryogenesis by replicating during a very short interval. As the developmental potency of embryonic cells becomes restricted, late-replicating DNA gradually appears. This addition to the repertoire of gene control--i.e., repression via Lyonization of individual replicons--seems to have evolved in vertebrates with G-bands being a manifestation of the mechanism. PMID:3551593

Holmquist, G P

1987-01-01

326

Universal Temporal Profile of Replication Origin Activation in Eukaryotes  

NASA Astrophysics Data System (ADS)

The complete and faithful transmission of eukaryotic genome to daughter cells involves the timely duplication of mother cell's DNA. DNA replication starts at multiple chromosomal positions called replication origin. From each activated replication origin two replication forks progress in opposite direction and duplicate the mother cell's DNA. While it is widely accepted that in eukaryotic organisms replication origins are activated in a stochastic manner, little is known on the sources of the observed stochasticity. It is often associated to the population variability to enter S phase. We extract from a growing Saccharomyces cerevisiae population the average rate of origin activation in a single cell by combining single molecule measurements and a numerical deconvolution technique. We show that the temporal profile of the rate of origin activation in a single cell is similar to the one extracted from a replicating cell population. Taking into account this observation we exclude the population variability as the origin of observed stochasticity in origin activation. We confirm that the rate of origin activation increases in the early stage of S phase and decreases at the latter stage. The population average activation rate extracted from single molecule analysis is in prefect accordance with the activation rate extracted from published micro-array data, confirming therefore the homogeneity and genome scale invariance of dynamic of replication process. All these observations point toward a possible role of replication fork to control the rate of origin activation.

Goldar, Arach

2011-03-01

327

Chromatin and DNA replication.  

PubMed

The size of a eukaryotic genome presents a unique challenge to the cell: package and organize the DNA to fit within the confines of the nucleus while at the same time ensuring sufficient dynamics to allow access to specific sequences and features such as genes and regulatory elements. This is achieved via the dynamic nucleoprotein organization of eukaryotic DNA into chromatin. The basic unit of chromatin, the nucleosome, comprises a core particle with 147 bp of DNA wrapped 1.7 times around an octamer of histones. The nucleosome is a highly versatile and modular structure, both in its composition, with the existence of various histone variants, and through the addition of a series of posttranslational modifications on the histones. This versatility allows for both short-term regulatory responses to external signaling, as well as the long-term and multigenerational definition of large functional chromosomal domains within the nucleus, such as the centromere. Chromatin organization and its dynamics participate in essentially all DNA-templated processes, including transcription, replication, recombination, and repair. Here we will focus mainly on nucleosomal organization and describe the pathways and mechanisms that contribute to assembly of this organization and the role of chromatin in regulating the DNA replication program. PMID:23751185

MacAlpine, David M; Almouzni, Geneviève

2013-08-01

328

Involuntary switching of attention mediates differences in event-related responses to complex tones between early and late Spanish-English bilinguals.  

PubMed

Most research with bilinguals has used speech stimuli to demonstrate differences in auditory processing abilities. Two main factors have been identified as modulators of such differences: proficiency and age of acquisition of the second language (L2). However, whether the bilingual brain differs from the monolingual in the efficient processing of non-verbal auditory events (known to be critical to the acoustic analysis of the speech stream) remains unclear. In this EEG/ERP study, using the mismatch negativity (MMN), P3a, and late negativity (LN), we examined differences in discrimination, involuntary switching of attention and reorienting of attention between monolinguals and bilinguals as they processed complex tones. Further, we examined the role that age of acquisition plays in modulating such responses. A group of English monolinguals and a group of proficient Spanish-English bilinguals were presented with a multiple-deviant oddball paradigm with four deviant conditions (duration, frequency, silent gap, and frequency modulation). Late bilinguals, who learned English after age 10, exhibited larger MMN and P3a responses than early bilinguals, across all deviant conditions. Significant associations were found between amplitude of the responses and both age of L2 acquisition and years of L2 experience. Individuals who acquired English at later ages and had fewer years of L2 experience had larger MMN, P3a, and LN responses than those who learned it earlier. These findings demonstrate that age of L2 acquisition is an important modulator of auditory responses in bilinguals even when processing non-speech signals. Involuntary attention switching is suggested as the main factor driving these differences. PMID:20849832

Ortiz-Mantilla, Silvia; Choudhury, Naseem; Alvarez, Barbara; Benasich, April A

2010-11-29

329

A potential approach for monitoring drinking water quality from groundwater systems using organic matter fluorescence as an early warning for contamination events.  

PubMed

The fluorescence characteristics of natural organic matter in a groundwater based drinking water supply plant were studied with the aim of applying it as a technique to identify contamination of the water supply. Excitation-emission matrices were measured and modeled using parallel factor analysis (PARAFAC) and used to identify which wavelengths provide the optimal signal for monitoring contamination events. The fluorescence was characterized by four components: three humic-like and one amino acid-like. The results revealed that the relative amounts of two of the humic-like components were very stable within the supply plant and distribution net and changed in a predictable fashion depending on which wells were supplying the water. A third humic-like component and an amino acid-like component did not differ between wells. Laboratory contamination experiments with wastewater revealed that combined they could be used as an indicator of microbial contamination. Their fluorescence spectra did not overlap with the other components and therefore the raw broadband fluorescence at the wavelengths specific to their fluorescence could be used to detect contamination. Contamination could be detected at levels equivalent to the addition of 60 ?g C/L in drinking water with a TOC concentration of 3.3 mg C/L. The results of this study suggest that these types of drinking water systems, which are vulnerable to microbial contamination due to the lack of disinfectant treatment, can be easily monitored using online organic matter fluorescence as an early warning system to prompt further intensive sampling and appropriate corrective measures. PMID:21943882

Stedmon, Colin A; Seredy?ska-Sobecka, Bo?ena; Boe-Hansen, Rasmus; Le Tallec, Nicolas; Waul, Christopher K; Arvin, Erik

2011-11-15

330

Early bioenergetic evolution  

PubMed Central

Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. This paper outlines an energetically feasible path from a particular inorganic setting for the origin of life to the first free-living cells. The sources of energy available to early organic synthesis, early evolving systems and early cells stand in the foreground, as do the possible mechanisms of their conversion into harnessable chemical energy for synthetic reactions. With regard to the possible temporal sequence of events, we focus on: (i) alkaline hydrothermal vents as the far-from-equilibrium setting, (ii) the Wood–Ljungdahl (acetyl-CoA) pathway as the route that could have underpinned carbon assimilation for these processes, (iii) biochemical divergence, within the naturally formed inorganic compartments at a hydrothermal mound, of geochemically confined replicating entities with a complexity below that of free-living prokaryotes, and (iv) acetogenesis and methanogenesis as the ancestral forms of carbon and energy metabolism in the first free-living ancestors of the eubacteria and archaebacteria, respectively. In terms of the main evolutionary transitions in early bioenergetic evolution, we focus on: (i) thioester-dependent substrate-level phosphorylations, (ii) harnessing of naturally existing proton gradients at the vent–ocean interface via the ATP synthase, (iii) harnessing of Na+ gradients generated by H+/Na+ antiporters, (iv) flavin-based bifurcation-dependent gradient generation, and finally (v) quinone-based (and Q-cycle-dependent) proton gradient generation. Of those five transitions, the first four are posited to have taken place at the vent. Ultimately, all of these bioenergetic processes depend, even today, upon CO2 reduction with low-potential ferredoxin (Fd), generated either chemosynthetically or photosynthetically, suggesting a reaction of the type ‘reduced iron ? reduced carbon’ at the beginning of bioenergetic evolution. PMID:23754820

Sousa, Filipa L.; Thiergart, Thorsten; Landan, Giddy; Nelson-Sathi, Shijulal; Pereira, Inês A. C.; Allen, John F.; Lane, Nick; Martin, William F.

2013-01-01

331

Competition and cooperation in dynamic replication networks.  

PubMed

The simultaneous replication of six coiled-coil peptide mutants by reversible thiol-thioester exchange reactions is described. Experimental analysis of the time dependent evolution of networks formed by the peptides under different conditions reveals a complex web of molecular interactions and consequent mutant replication, governed by competition for resources and by autocatalytic and/or cross-catalytic template-assisted reactions. A kinetic model, first of its kind, is then introduced, allowing simulation of varied network behaviour as a consequence of changing competition and cooperation scenarios. We suggest that by clarifying the kinetic description of these relatively complex dynamic networks, both at early stages of the reaction far from equilibrium and at later stages approaching equilibrium, one lays the foundation for studying dynamic networks out-of-equilibrium in the near future. PMID:25351937

Dadon, Zehavit; Wagner, Nathaniel; Alasibi, Samaa; Samiappan, Manickasundaram; Mukherjee, Rakesh; Ashkenasy, Gonen

2015-01-01

332

Autonomous replication of plasmids bearing monkey DNA origin-enriched sequences  

SciTech Connect

Twelve clones of origin-enriched sequences (ORS) isolated from early replicating monkey (CV-1) DNA were examined for transient episomal replication in transfected CV-1, COS-7, and HeLa cells. Plasmid DNA was isolated at time intervals after transfection and screened by the Dpn I resistance assay or by the bromodeoxyuridine substitution assay to differentiate between input and replicated DNA. The authors have identified four monkey ORS (ORS3, -8, -9, and -12) that can support plasmid replication in mammalian cells. This replication is carried out in a controlled and semiconservative manner characteristic of mammalian replicons. ORS replication was most efficient in HeLa cells. Electron microscopy showed ORS8 and ORS12 plasmids of the correct size with replication bubbles. Using a unique restriction site in ORS12, we have mapped the replication bubble within the monkey DNA sequence.

Frappier, L.; Zannis-Hadjopoulos, M.

1987-10-01

333

Replication-dependent transactivation of the polyomavirus late promoter.  

PubMed Central

When a plasmid containing the wild-type polyomavirus intergenic regulatory region fused to the bacterial cat gene was introduced into mouse NIH 3T3 cells along with a plasmid coding for the early viral proteins (T antigens), chloramphenicol transacetylase enzyme activity and mRNA levels were increased about 10-fold over levels observed in the absence of early proteins. To investigate this transactivation phenomenon further, 11 specific deletion mutant derivatives of the wild-type parent plasmid were constructed and studied. One mutant (NAL) with a minimal level of chloramphenicol transacetylase expression in the absence of T antigens was capable of being transactivated more than 40-fold. A number of other mutants, however, had little capacity for transactivation. Each of these mutants had in common a defect in large T-antigen-mediated DNA replication. Interestingly, one of the transactivation-defective mutants showed a basal late promoter activity fivefold higher than that of wild type and replicated in mouse cells in the absence of large T antigen. Subsequently, a small deletion abolishing viral DNA replication was introduced into those mutants capable of transactivation. The effect of the second deletion was to eliminate both replication and transactivation. Finally, wild-type and mutant constructs were transfected into Fisher rat F-111 cells in the presence or absence of early proteins. No transactivation or replication was ever observed in these cells. We concluded from these studies that the observed transactivation of the polyomavirus late promoter by one or more of the viral early proteins was due to either higher template concentration resulting from DNA replication or replication-associated changes in template conformation. Images PMID:2154625

Cahill, K B; Roome, A J; Carmichael, G G

1990-01-01

334

SUMO and KSHV Replication  

PubMed Central

Small Ubiquitin-related MOdifier (SUMO) modification was initially identified as a reversible post-translational modification that affects the regulation of diverse cellular processes, including signal transduction, protein trafficking, chromosome segregation, and DNA repair. Increasing evidence suggests that the SUMO system also plays an important role in regulating chromatin organization and transcription. It is thus not surprising that double-stranded DNA viruses, such as Kaposi’s sarcoma-associated herpesvirus (KSHV), have exploited SUMO modification as a means of modulating viral chromatin remodeling during the latent-lytic switch. In addition, SUMO regulation allows the disassembly and assembly of promyelocytic leukemia protein-nuclear bodies (PML-NBs), an intrinsic antiviral host defense, during the viral replication cycle. Overcoming PML-NB-mediated cellular intrinsic immunity is essential to allow the initial transcription and replication of the herpesvirus genome after de novo infection. As a consequence, KSHV has evolved a way as to produce multiple SUMO regulatory viral proteins to modulate the cellular SUMO environment in a dynamic way during its life cycle. Remarkably, KSHV encodes one gene product (K-bZIP) with SUMO-ligase activities and one gene product (K-Rta) that exhibits SUMO-targeting ubiquitin ligase (STUbL) activity. In addition, at least two viral products are sumoylated that have functional importance. Furthermore, sumoylation can be modulated by other viral gene products, such as the viral protein kinase Orf36. Interference with the sumoylation of specific viral targets represents a potential therapeutic strategy when treating KSHV, as well as other oncogenic herpesviruses. Here, we summarize the different ways KSHV exploits and manipulates the cellular SUMO system and explore the multi-faceted functions of SUMO during KSHV’s life cycle and pathogenesis. PMID:25268162

Chang, Pei-Ching; Kung, Hsing-Jien

2014-01-01

335

Phosphorylation of the replicative helicase by the S-phase kinase, Dbf4-Cdc7, at origins of replication in Saccharomyces cerevisiae  

E-print Network

In eukaryotic cells, events such as DNA replication and mitosis must be carefully coordinated in the cell cycle to ensure that the entire genome is duplicated before cells undergo cell division. In particular, initiation ...

Francis, Laura Ileana

2008-01-01

336

Fungal Pathogens: Survival and Replication within Macrophages.  

PubMed

The innate immune system is a critical line of defense against pathogenic fungi. Macrophages act at an early stage of infection, detecting and phagocytizing infectious propagules. To avoid killing at this stage, fungal pathogens use diverse strategies ranging from evasion of uptake to intracellular parasitism. This article will discuss five of the most important human fungal pathogens (Candida albicans, Aspergillus fumigatus, Cryptococcus neoformans, Coccidiodes immitis, and Histoplasma capsulatum) and consider the strategies and virulence factors adopted by each to survive and replicate within macrophages. PMID:25384769

Gilbert, Andrew S; Wheeler, Robert T; May, Robin C

2014-11-10

337

Effect of Microgravity on Early Events of Biological Nitrogen Fixation in Medicago Truncatula: Initial Results from the SyNRGE Experiment  

NASA Technical Reports Server (NTRS)

SyNRGE (Symbiotic Nodulation in a Reduced Gravity Environment) was a sortie mission on STS-135 in the Biological Research in Canisters (BRIC) hardware to study the effect of microgravity on a plant-microbe symbiosis resulting in biological nitrogen fixation. Medicago truncatula, a model species of the legume family, was inoculated with its bacterial symbiont, Sinorhizobium meliloti, to observe early events associated with infection and nodulation in Petri Dish Fixation Units (PDFUs). Two sets of experiments were conducted in orbit and in 24-hour delayed ground controls. Experiment one was designed to determine if S. meliloti infect M. truncatula and initiate physiological changes associated with nodule formation. Roots of five-day-old M. truncatula cultivar Jemalong A17 (Enodll::gus) were inoculated 24 hr before launch with either S. meliloti strain 1021 or strain ABS7 and integrated into BRIC-PDFU hardware placed in a 4 C Cold Bag for launch on Atlantis. Inoculated plants and uninoculated controls were maintained in the dark at ambient temperature in the middeck of STS-135 for 11 days before fixation in RNAlater(tM) by crew activation of the PDFU. Experiment two was designed to determine if microgravity altered the process of bacterial infection and host plant nodule formation. Seeds of two M. truncatula cultivar Jemalong A17 lines, the Enodll::gus used in experiment 1, and SUNN, a super-nodulating mutant of A17, were germinated on orbit for 11 days in the middeck cabin and returned to Earth alive inside of BRIC-PDFU's at 4 C. S. meliloti strains 1021 and ABS7 were cultivated separately in broth culture on orbit and also returned to Earth alive. After landing, flight- and groundgrown plants and bacteria were transferred from BRIC-PDFU's into Nunc(tm) 4-well plates for reciprocity crosses. Rates of plant growth and nodule development on Buffered Nodulation Medium (lacking nitrogen) were measured for 14 days. Preliminary analysis' of Experiment 1 confirms that legumes and bacteria cultivated in space 'initiate the symbiotic interaction leading to nitrogen fixation and that bacteria retain the ability to form nodules on M. truncatula roots. Initial assessment of experiment 2 shows 100% seed germination and excellent bacterial growth in microgravity.

Stutte, Gary W.; Roberts, Michael S.

2011-01-01

338

Dynamic organization of DNA replication in mammalian cell nuclei: spatially and temporally defined replication of chromosome-specific alpha-satellite DNA sequences  

PubMed Central

Five distinct patterns of DNA replication have been identified during S- phase in asynchronous and synchronous cultures of mammalian cells by conventional fluorescence microscopy, confocal laser scanning microscopy, and immunoelectron microscopy. During early S-phase, replicating DNA (as identified by 5-bromodeoxyuridine incorporation) appears to be distributed at sites throughout the nucleoplasm, excluding the nucleolus. In CHO cells, this pattern of replication peaks at 30 min into S-phase and is consistent with the localization of euchromatin. As S-phase continues, replication of euchromatin decreases and the peripheral regions of heterochromatin begin to replicate. This pattern of replication peaks at 2 h into S-phase. At 5 h, perinucleolar chromatin as well as peripheral areas of heterochromatin peak in replication. 7 h into S-phase interconnecting patches of electron-dense chromatin replicate. At the end of S-phase (9 h), replication occurs at a few large regions of electron-dense chromatin. Similar or identical patterns have been identified in a variety of mammalian cell types. The replication of specific chromosomal regions within the context of the BrdU-labeling patterns has been examined on an hourly basis in synchronized HeLa cells. Double labeling of DNA replication sites and chromosome-specific alpha-satellite DNA sequences indicates that the alpha-satellite DNA replicates during mid S-phase (characterized by the third pattern of replication) in a variety of human cell types. Our data demonstrates that specific DNA sequences replicate at spatially and temporally defined points during the cell cycle and supports a spatially dynamic model of DNA replication. PMID:1740468

1992-01-01

339

Archaeology of eukaryotic DNA replication.  

PubMed

Recent advances in the characterization of the archaeal DNA replication system together with comparative genomic analysis have led to the identification of several previously uncharacterized archaeal proteins involved in replication and currently reveal a nearly complete correspondence between the components of the archaeal and eukaryotic replication machineries. It can be inferred that the archaeal ancestor of eukaryotes and even the last common ancestor of all extant archaea possessed replication machineries that were comparable in complexity to the eukaryotic replication system. The eukaryotic replication system encompasses multiple paralogs of ancestral components such that heteromeric complexes in eukaryotes replace archaeal homomeric complexes, apparently along with subfunctionalization of the eukaryotic complex subunits. In the archaea, parallel, lineage-specific duplications of many genes encoding replication machinery components are detectable as well; most of these archaeal paralogs remain to be functionally characterized. The archaeal replication system shows remarkable plasticity whereby even some essential components such as DNA polymerase and single-stranded DNA-binding protein are displaced by unrelated proteins with analogous activities in some lineages. PMID:23881942

Makarova, Kira S; Koonin, Eugene V

2013-11-01

340

Archaeology of eukaryotic DNA replication.  

PubMed

Recent advances in the characterization of the archaeal DNA replication system together with comparative genomic analysis have led to the identification of several previously uncharacterized archaeal proteins involved in replication and currently reveal a nearly complete correspondence between the components of the archaeal and eukaryotic replication machineries. It can be inferred that the archaeal ancestor of eukaryotes and even the last common ancestor of all extant archaea possessed replication machineries that were comparable in complexity to the eukaryotic replication system. The eukaryotic replication system encompasses multiple paralogs of ancestral components such that heteromeric complexes in eukaryotes replace archaeal homomeric complexes, apparently along with subfunctionalization of the eukaryotic complex subunits. In the archaea, parallel, lineage-specific duplications of many genes encoding replication machinery components are detectable as well; most of these archaeal paralogs remain to be functionally characterized. The archaeal replication system shows remarkable plasticity whereby even some essential components such as DNA polymerase and single-stranded DNA-binding protein are displaced by unrelated proteins with analogous activities in some lineages. PMID:24224208

Makarova, Kira S; Koonin, Eugene V

2013-10-01

341

Making Replication Simple with Ursa  

Microsoft Academic Search

Our goal is to qualitatively simplify devel- oping large scale data replication systems and improv- ing existing ones. To realize this goal, we address a fundamental question: What are the right abstractions for defining replication systems? Our new architecture, Ursa, defines (1) mechanisms that define abstractions for storage, communication, and consistency that automati- cally handle the bookkeeping needed to allow

N. Belarmani; M. Dahlin; A. Nayate; J. Zheng

342

Accurate Replication in Genetic Programming  

Microsoft Academic Search

Abstract One characteristic tendency of genetic program - ming is the production of considerably larger trees than expected It has been suggested that this is related to the ability of individuals to replicate ac - curately In this paper we present theoretical anal - ysis which shows that, for certain specific cases, the pressure for accurate replication induces an increase

Nicholas Freitag Mcphee; Justin Darwin Miller

1995-01-01

343

Rapid mold replication  

SciTech Connect

The desire to reduce tooling costs have driven manufacturers to investigate new manufacturing methods and materials. In the plastics injection molding industry replicating molds to meet production needs is time consuming (up to 6 months) and costly in terms of lost business. We have recently completed a feasibility study demonstrating the capability of high rate Electron Beam Physical Vapor Deposition (EBPVD) in producing mold inserts in days, not months. In the current practice a graphite mandrel, in the shape of the insert`s negative image, was exposed to a jet of metal vapor atoms emanating from an electron beam heated source of an aluminum-bronze alloy. The condensation rate of the metal atoms on the mandrel was sufficient to allow the deposit to grow at over 30 {mu}m/min or 1.2 mils per minute. The vaporization process continued for approximately 14 hours after which the mandrel and deposit were removed from the EBPVD vacuum chamber. The mandrel and condensate were easily separated resulting in a fully dense aluminum-bronze mold insert about 2.5 cm or one inch thick. This mold was subsequently cleaned and drilled for water cooling passages and mounted on a fixture for operation in an actual injection molding machine. Results of the mold`s operation were extremely successful showing great promise for this technique. This paper describes the EBPVD feasibility demonstration in more detail and discusses future development work needed to bring this technique into practice.

Heestand, G.M.; Beeler, R.G. Jr.; Brown, D.L. [and others

1995-06-01

344

Mutational Analysis of Open Reading Frames 62 and 71, Encoding the Varicella-Zoster Virus Immediate-Early Transactivating Protein, IE62, and Effects on Replication In Vitro and in Skin Xenografts in the SCID-hu Mouse In Vivo  

Microsoft Academic Search

The varicella-zoster virus (VZV) genome has unique long (UL) and unique short (US) segments which are flanked by internal repeat (IR) and terminal repeat (TR) sequences. The immediate-early 62 (IE62) protein, encoded by open reading frame 62 (ORF62) and ORF71 in these repeats, is the major VZV transactivating protein. Mutational analyses were done with VZV cosmids generated from parent Oka

Bunji Sato; Hideki Ito; Stewart Hinchliffe; Marvin H. Sommer; Leigh Zerboni; Ann M. Arvin

2003-01-01

345

Patterns of DNA replication of human chromosomes. II. Replication map and replication model.  

PubMed Central

Combining higher resolution chromosome analysis and bromodeoxyuridine (BrdU) incorporation, our study demonstrates that: (1) Human chromosomes synthesize DNA in a segmental but highly coordinated fashion. Each chromosome replicates according to its innate pattern of chromosome structure (banding). (2) R-positive bands are demonstrated as the initiation sites of DNA synthesis in all human chromosomes, including late-replicating chromosomes such as the LX and Y. (3) Replication is clearly biphasic in the sense that late-replicating elements, such as G-bands, the Yh, C-bands, and the entire LX, initiate replication after it has been completed in the autosomal R-bands (euchromatin) with minimal or no overlap. The chronological priority of R-band replication followed by G-bands is also retained in the facultative heterochromatin or late-replicating X chromosome (LX). Therefore, the inclusion of G-bands as a truly late-replicating chromatin type or G(Q)-heterochromatin is suggested. (4) Lateral asymmetry (LA) in the Y chromosome can be detected after less than half-cycle in 5-bromodeoxyuridine (BrdUrd), and the presence of at least two regions of LA in this chromosome is confirmed. (5) Finally, the replicational map of human chromosomes is presented, and a model of replication chronology is suggested. Based on this model, a system of nomenclature is proposed to place individual mitoses (or chromosomes) within S-phase, according to their pattern of replication banding. Potential applications of this methodology in clinical and theoretical cytogenetics are suggested. Images Fig. 4 Fig. 4 Fig. 1 Fig. 3 Fig. 1 Fig. 2 Fig. 4 Fig. 4 PMID:7124731

Camargo, M; Cervenka, J

1982-01-01

346

Coronavirus Replicase-Reporter Fusions Provide Quantitative Analysis of Replication and Replication Complex Formation  

PubMed Central

ABSTRACT The replication of coronaviruses occurs in association with multiple virus-induced membrane structures that evolve during the course of infection; however, the dynamics of this process remain poorly understood. Previous studies of coronavirus replication complex organization and protein interactions have utilized protein overexpression studies and immunofluorescence of fixed cells. Additionally, live-imaging studies of coronavirus replicase proteins have used fluorescent reporter molecules fused to replicase proteins, but expressed from nonnative locations, mostly late-transcribed subgenomic mRNAs, in the presence or absence of the native protein. Thus, the timing and targeting of native replicase proteins expressed in real time from native locations in the genome remain unknown. In this study, we tested whether reporter molecules could be expressed from the replicase polyprotein of murine hepatitis virus as fusions with nonstructural protein 2 or 3 and whether such reporters could define the targeting and activity of replicase proteins during infection. We demonstrate that the fusion of green fluorescent protein and firefly luciferase with either nonstructural protein 2 or 3 is tolerated and that these reporter-replicase fusions can be used to quantitate replication complex formation and virus replication. The results show that the replicase gene has flexibility to accommodate a foreign gene addition and can be used directly to study replicase complex formation and evolution during infection as well as to provide highly sensitive and specific markers for protein translation and genome replication. IMPORTANCE Coronaviruses are a family of enveloped, positive-sense RNA viruses that are important agents of disease, including severe acute respiratory syndrome coronavirus and Middle East respiratory syndrome coronavirus. Replication is associated with multiple virus-induced membrane structures that evolve during infection; however, the dynamics of this process remain poorly understood. In this study, we tested whether reporter molecules expressed from native locations within the replicase polyprotein of murine hepatitis virus as fusions with nonstructural proteins could define the expression and targeting of replicase proteins during infection in live cells. We demonstrate that the replicase gene tolerates the introduction of green fluorescent protein or firefly luciferase as fusions with replicase proteins. These viruses allow early quantitation of virus replication as well as real-time measurement of replication complexes. PMID:24623413

Freeman, Megan Culler; Graham, Rachel L.; Lu, Xiaotao; Peek, Christopher T.

2014-01-01

347

Timing of Early Proterozoic collisional and extensional events in the granulite-gneiss-charnockite-granite complex, Lake Baikal, USSR: A U-Pb, Rb-Sr, and Sm-Nd isotopic study  

SciTech Connect

In the Sharyzhalgay Complex of the Lake Baikal region in eastern Siberia Early Proterozoic collisional and extensional events were separated by ca. 100 m.yr. The earlier collisional event, associated with the development of granulites and gneisses as the result of high-grade dynamothermal metamorphism, took place close to 1965 {plus minus} 4 Ma. A {sup 207}Pb/{sup 204}Pb vs. {sup 206}Pb/{sup 204}Pb isochron for zircon from five size fractions and a six point Rb-Sr whole-rock errorchron give generally corresponding ages of 1956 {plus minus} 8 and 1963 {plus minus} 163 Ma, respectively. The later extensional event, associated with charnockitization due to the uprise of fluids and heat in a regime corresponding to the middle to upper crustal levels of a Basin and Range-type province, was initiated in the 1880-1860 Ma period. The event was continued with magmatic emplacement of granitic masses into the deep levels of caldera-like structures, possibly during the upper time range of lower concordia intercept ages of 1817 +30/{minus}32 and 1797 +40/{minus}44 Ma for two distinctly different zircon populations in a pyroxene-bearing granodiorite interpreted as an evolved (and contaminated) product of the mantle-derived magma that was the source of CO{sub 2} involved in the charnockitization. Upper intercept ages of 2784 +48/{minus}45 and 2775 +61/{minus}55 Ma indicate late Archean crust at depth as the source region of the incorporated zircon. T{sub DM} ages from Sm-Nd isotopic data show that the protolith of the lithologically layered supracrustal assemblage, subsequently polyphase deformed and polymetamorphosed in Early Proterozoic times, was also formed in Early Proterozoic (not Archean) times.

Aftalion, M. (Scottish Univ. Research and Reactor Centre, Glasgow (United Kingdom)); Bibikova, E.V. (Vernadsky Inst. of Geochemistry and Analytical Chemistry, Moscow (USSR)); Bowes, D.R. (Univ. of Glasgow (United Kingdom)); Hopwood, A.M. (Univ. of St. Andrews, Fife (United Kingdom)); Perchuk, L.L. (Inst. of Experimental Mineralogy, Moscow (USSR))

1991-11-01

348

Ultrastructural Characterization and Three-Dimensional Architecture of Replication Sites in Dengue Virus-Infected Mosquito Cells  

PubMed Central

ABSTRACT During dengue virus infection of host cells, intracellular membranes are rearranged into distinct subcellular structures such as double-membrane vesicles, convoluted membranes, and tubular structures. Recent electron tomographic studies have provided a detailed three-dimensional architecture of the double-membrane vesicles, representing the sites of dengue virus replication, but temporal and spatial evidence linking membrane morphogenesis with viral RNA synthesis is lacking. Integrating techniques in electron tomography and molecular virology, we defined an early period in virus-infected mosquito cells during which the formation of a virus-modified membrane structure, the double-membrane vesicle, is proportional to the rate of viral RNA synthesis. Convoluted membranes were absent in dengue virus-infected C6/36 cells. Electron tomographic reconstructions elucidated a high-resolution view of the replication complexes inside vesicles and allowed us to identify distinct pathways of particle formation. Hence, our findings extend the structural details of dengue virus replication within mosquito cells and highlight their differences from mammalian cells. IMPORTANCE Dengue virus induces several distinct intracellular membrane structures within the endoplasmic reticulum of mammalian cells. These structures, including double-membrane vesicles and convoluted membranes, are linked, respectively, with viral replication and viral protein processing. However, dengue virus cycles between two disparate animal groups with differing physiologies: mammals and mosquitoes. Using techniques in electron microscopy, we examined the differences between intracellular structures induced by dengue virus in mosquito cells. Additionally, we utilized techniques in molecular virology to temporally link events in virus replication to the formation of these dengue virus-induced membrane structures. PMID:24522909

Junjhon, Jiraphan; Pennington, Janice G.; Edwards, Thomas J.; Perera, Rushika; Lanman, Jason

2014-01-01

349

THE WERNER AND BLOOM SYNDROME PROTEINS HELP RESOLVE REPLICATION BLOCKAGE BY CONVERTING (REGRESSED) HOLLIDAY JUNCTIONS TO FUNCTIONAL REPLICATION FORKS  

PubMed Central

Cells cope with blockage of replication fork progression in a manner so that DNA synthesis can be completed and genomic instability minimized. Models for resolution of blocked replication involve fork regression to form Holliday junction structures. The human RecQ helicases WRN and BLM (deficient in Werner and Bloom syndromes, respectively) are critical for maintaining genomic stability and postulated to function in accurate resolution of replication blockage. Consistent with this notion, WRN and BLM localize to sites of blocked replication after certain DNA damaging treatments and exhibit enhanced activity on replication and recombination intermediates. Here we examined the actions of WRN and BLM on a special Holliday junction substrate reflective of a regressed replication fork. Our results demonstrate that, in reactions requiring ATP hydrolysis, both WRN and BLM convert this Holliday junction substrate primarily to a four-stranded replication fork structure, suggesting they target the Holliday junction to initiate branch migration. In agreement, the Holliday junction binding protein RuvA inhibits the WRN- and BLM-mediated conversion reactions. Importantly, this conversion product is suitable for replication with its leading daughter strand readily extended by DNA polymerases. Furthermore, binding to and conversion of this Holliday junction is optimal in low MgCl2, suggesting that WRN and BLM preferentially act on the square planar (open) conformation of Holliday junctions. Our findings suggest that, subsequent to fork regression events, WRN and/or BLM could re-establish functional replication forks to help overcome fork blockage. Such a function is highly consistent with phenotypes associated with WRN- and BLM-deficient cells. PMID:21736299

Machwe, Amrita; Karale, Rajashree; Xu, Xioahua; Liu, Yilun; Orren, David K.

2011-01-01

350

Novel Roles of Focal Adhesion Kinase in Cytoplasmic Entry and Replication of Influenza A Viruses  

PubMed Central

ABSTRACT Viruses modulate cellular signaling pathways at almost every step of the infection cycle. Cellular signaling pathways activated at later times of influenza infection have previously been investigated; however, early influenza virus-host cell interactions remain understudied. Focal adhesion kinase (FAK) is a cytoplasmic tyrosine kinase that regulates phosphatidylinositol 3-kinase (PI3K) activation and actin reorganization, two critical processes during influenza A virus (IAV) infection in most cell types. Using 6 influenza A virus strains (A/Puerto Rico/8/1934, A/Aichi/2/1968 × A/Puerto Rico/8/1934 reassortant [X-31], A/California/04/2009, mouse-adapted A/California/04/2009, A/WSN/1933, and A/New Caledonia/20/1999), we examined the role of FAK during IAV entry. We found that influenza virus attachment induced PI3K-dependent FAK-Y397 phosphorylation. Pharmacological FAK inhibition or expression of a kinase-dead mutant of FAK led to disruption of the actin meshwork that resulted in sequestration of IAV at the cell periphery and reduced virion localization to early endosomes. Additionally, FAK inhibition impeded viral RNA replication at later times of infection and ultimately resulted in significantly reduced viral titers in both A549 and differentiated normal human bronchial epithelial (NHBE) cells. Although not all tested strains activated FAK, all of them exhibited a reduction in viral replication in response to inhibition of FAK signaling. These findings highlight novel biphasic roles of FAK activation during IAV infection and indicate that FAK serves as a central link between receptor-mediated PI3K activation and actin reorganization during IAV infection. IMPORTANCE We found that FAK links early activation of PI3K and actin reorganization, thereby regulating influenza virus entry. Surprisingly, we also found that FAK can regulate viral RNA replication independently of its role in entry. Our study addresses a knowledge gap in the understanding of signaling events triggered by influenza virus that mediate its internalization and initiation of the infection cycle. Understanding of these fundamental molecular events will be necessary to identify novel host targets, such as FAK, and development of future anti-influenza virus therapeutics. PMID:24696469

Cline, Troy; Baranovich, Tatiana; Govorkova, Elena A.; Schultz-Cherry, Stacey

2014-01-01

351

Scrapie replication in lymphoid tissues depends on prion protein-expressing follicular dendritic cells  

Microsoft Academic Search

The immune system is central in the pathogenesis of scrapie and other transmissible spongiform encephalopathies (TSEs) or 'prion' diseases. After infecting by peripheral (intraperitoneal or oral) routes, most TSE agents replicate in spleen and lymph nodes before neuroinvasion. Characterization of the cells supporting replication in these tissues is essential to understanding early pathogenesis and may indicate potential targets for therapy,

K. L. Brown; K. Stewart; D. L. Ritchie; N. A. Mabbott; A. Williams; H. Fraser; W. I. Morrison; M. E. Bruce

1999-01-01

352

The effect of Ku on telomere replication time is mediated by telomere length but is independent of histone tail acetylation  

PubMed Central

DNA replication in Saccharomyces cerevisiae proceeds according to a temporal program. We have investigated the role of the telomere-binding Ku complex in specifying late replication of telomere-proximal sequences. Genome-wide analysis shows that regions extending up to 80 kb from telomeres replicate abnormally early in a yku70 mutant. We find that Ku does not appear to regulate replication time by binding replication origins directly, nor is its effect on telomere replication timing mediated by histone tail acetylation. We show that Ku instead regulates replication timing through its effect on telomere length, because deletion of the telomerase regulator Pif1 largely reverses the short telomere defect of a yku70 mutant and simultaneously rescues its replication timing defect. Consistent with this conclusion, deleting the genome integrity component Elg1 partially rescued both length and replication timing of yku70 telomeres. Telomere length–mediated control of replication timing requires the TG1–3 repeat-counting component Rif1, because a rif1 mutant replicates telomeric regions early, despite having extended TG1–3 tracts. Overall, our results suggest that the effect of Ku on telomere replication timing results from its impact on TG1–3 repeat length and support a model in which Rif1 measures telomere repeat length to ensure that telomere replication timing is correctly programmed. PMID:21441303

Lian, Hui-Yong; Robertson, E. Douglas; Hiraga, Shin-ichiro; Alvino, Gina M.; Collingwood, David; McCune, Heather J.; Sridhar, Akila; Brewer, Bonita J.; Raghuraman, M. K.; Donaldson, Anne D.

2011-01-01

353

Multiple roles of the replication initiation protein Cdtl during helicase loading in S. cerevisiae  

E-print Network

The faithful transmission of genetic information is critical for the events of cell division and propagation. In eukaryotic cells, chromosomal replication is carefully coordinated with the cell cycle to ensure that the ...

Takara, Thomas J. (Thomas Joji)

2011-01-01

354

Environmental magnetic fields: Influences on early embryogenesis  

SciTech Connect

A 10-mG, 50 to 60-Hz magnetic field is in the intensity and frequency range that people worldwide are often exposed to in homes and in the workplace. Studies about the effects of 50- to 100-Hz electromagnetic fields on various species of animal embryos (fish, chick, fly, sea urchin, rat, and mouse) indicate that early stages of embryonic development are responsive to fluctuating magnetic fields. Chick, sea urchin, and mouse embryos are responsive to magnetic field intensities of 10-100 mG. Results from studies on sea urchin embryos indicate that exposure to conditions of rotating 60-Hz magnetic fields, e.g., similar to those in our environment, interferes with cell proliferation at the morula stage in a manner dependent on field intensity. The cleavage stages, prior to the 64-cell stage, were not delayed by this rotating 60-Hz magnetic field suggesting that the ionic surges, DNA replication, and translational events essential for early cleavage stages were not significantly altered. Studies of histone synthesis in early sea urchin embryos indicated that the rotating 60-Hz magnetic field decreased zygotic expression of early histone genes at the morula stage and suggests that this decrease in early histone production was limiting to cell proliferation. Whether these comparative observations from animal development studies will be paralleled by results from studies of human embryogenesis, as suggested by some epidemiology studies, has yet to be established. 38 refs.

Cameron, I.L.; Hardman, W.E.; Winters, W.D.; Zimmerman, S.; Zimmerman, A.M. (Univ. of Texas Health Science Center, San Antonio (United States))

1993-04-01

355

Possible Models for DNA Replication  

NSDL National Science Digital Library

Three possible ways in which DNA can replicate are illustrated. The two original strands of DNA are shown in yellow (light); newly synthesized DNA is blue (dark). To explain the phenomenon of heredity, biological information must be accurately copied and transmitted from each cell to all of its progeny. Three ways for DNA molecules to replicate may be considered, each obeying the rules of complementary base pairing. Conservative replication would leave intact the original DNA molecule and generate a completely new molecule. Dispersive replication would produce two DNA molecules with sections of both old and new DNA interspersed along each strand. Semiconservative replication would produce molecules with both old and new DNA, but each molecule would be composed of one old strand and one new one. The replication is semiconservative. Each strand acts as a template for the synthesis of a new DNA molecule by the sequential addition of complementary base pairs, thereby generating a new DNA strand that is the complementary sequence to the parental DNA. Each daughter DNA molecule ends up with one of the original strands and one newly synthesized strand.

BEGIN:VCARD VERSION:2.1 FN:Access Excellence N:Excellence; Access REV:2005-03-12 END:VCARD

2005-03-12

356

The Biology of Replicative Senescence  

SciTech Connect

Most cells cannot divide indefinitely due to a processtermed cellular or replicative senescence. Replicative senescence appearsto be a fundamental feature of somatic cells, with the exception of mosttumour cells and possibly certain stem cells. How do cells sense thenumber of divisions they have completed? Although it has not yet beencritically tested, the telomere shortening hypothesis is currentlyperhaps the best explanation for a cell division 'counting' mechanism.Why do cells irreversibly cease proliferation after completing a finitenumber of divisions? It is now known that replicative senescence altersthe expression of a few crucial growth-regulatory genes. It is not knownhow these changes in growth-regulatory gene expression are related totelomere shortening in higher eukaryotes. However, lower eukaryotes haveprovided several plausible mechanisms. Finally, what are thephysiological consequences of replicative senescence? Several lines ofevidence suggest that, at least in human cells, replicative senescence isa powerful tumour suppressive mechanism. There is also indirect evidencethat replicative senescence contributes to ageing. Taken together,current findings suggest that, at least in mammals, replicativesenescence may have evolved to curtail tumorigenesis, but may also havethe unselected effect of contributing to age-related pathologies,including cancer.

Campisi, J.

1996-12-04

357

Duration of Symptom and ABCD2 Score as Predictors of Risk of Early Recurrent Events after Transient Ischemic Attack: A Hospital-Based Case Series Study  

PubMed Central

Background The aim of this study was to refine clinical risk factor stratification and make an optimal intervention plan to prevent ischemic stroke. Material/Methods Clinical data, including diffusion-weighted imaging (DWI) findings, were collected in a cohort of hospitalized transient ischemic attack (TIA) patients from January 2010 to December 2011. Recurrent cerebrovascular events after TIA, including recurrent TIA, minor stroke, and major stroke, were identified by face-to-face follow-up. A multivariate, ordinal, logistic regression model was used to determine significant predictors of recurrent events. Results Of 106 TIA patients, 24 (22.6%) had recurrent TIA and 20 (18.9%) had a stroke within 7 days. Hypertension, dyslipidemia, a history of ischemic stroke or TIA, and ABCD2 score were significantly associated with the recurrent events after TIA (P<0.001, P=0.02, P<0.001, P=0.02). Hypertension (RR=9.21; 95% CI, 3.07–27.61, P<0.001) and duration of symptom (RR=1.10; 95% CI, 1.02–1.17, P=0.01) as an item of ABCD2 score were highly predictive of the severity of recurrent events, whereas ABCD2 score as a whole (P=0.18) proved to be less strongly predictive. Conclusions A history of hypertension and long duration of symptom independently and significantly predict severe recurrent events after TIA within 7 days, but a high ABCD2 score was less strongly predictive of severe recurrent events. PMID:25604068

Li, Qiang; Zhu, Xiaolong; Feng, Chao; Fang, Min; Liu, Xueyuan

2015-01-01

358

Virion-Independent Transfer of Replication-Competent Hepatitis C Virus RNA between Permissive Cells.  

PubMed

In this study, we show that replication-competent subgenomic hepatitis C virus (HCV) RNA can be transferred to permissive Huh7 cells, leading to the establishment of viral RNA replication. Further, we show that these events are mediated by exosomes rather than infectious virus particles. If similar events occur in vivo, this could represent a novel, albeit inefficient, mechanism of viral spread and immune escape. PMID:25505060

Longatti, Andrea; Boyd, Bryan; Chisari, Francis V

2015-03-01

359

Rad51 Activates Polyomavirus JC Early Transcription  

PubMed Central

The human neurotropic polyomavirus JC (JCV) causes the fatal CNS demyelinating disease progressive multifocal leukoencephalopathy (PML). JCV infection is very common and after primary infection, the virus is able to persist in an asymptomatic state. Rarely, and usually only under conditions of immune impairment, JCV re-emerges to actively replicate in the astrocytes and oligodendrocytes of the brain causing PML. The regulatory events involved in the reactivation of active viral replication in PML are not well understood but previous studies have implicated the transcription factor NF-?B acting at a well-characterized site in the JCV noncoding control region (NCCR). NF-?B in turn is regulated in a number of ways including activation by cytokines such as TNF-?, interactions with other transcription factors and epigenetic events involving protein acetylation – all of which can regulate the transcriptional activity of JCV. Active JCV infection is marked by the occurrence of rapid and extensive DNA damage in the host cell and the induction of the expression of cellular proteins involved in DNA repair including Rad51, a major component of the homologous recombination-directed double-strand break DNA repair machinery. Here we show that increased Rad51 expression activates the JCV early promoter. This activation is co-operative with the stimulation caused by NF-?B p65, abrogated by mutation of the NF-?B binding site or siRNA to NF?B p65 and enhanced by the histone deacetylase inhibitor sodium butyrate. These data indicate that the induction of Rad51 resulting from infection with JCV acts through NF-?B via its binding site to stimulate JCV early transcription. We suggest that this provides a novel positive feedback mechanism to enhance viral gene expression during the early stage of JCV infection. PMID:25310191

White, Martyn K.; Kaminski, Rafal; Khalili, Kamel; Wollebo, Hassen S.

2014-01-01

360

Contribution of Impaired Early-Stage Visual Processing to Working Memory Dysfunction in Adolescents With Schizophrenia: A Study With Event-Related Potentials and Functional Magnetic Resonance Imaging  

Microsoft Academic Search

Context: Working memory (WM) deficits in patients with schizophrenia have mainly been associated with prefron- tal dysfunction. However, the contribution of perceptual deficits and abnormalities in sensory areas has not been explored. The present study closes this important gap in our understanding of WM dysfunction in schizophrenia by monitoring neural activity during WM encoding and retrieval with event-related potentials (ERPs)

Corinna Haenschel; Robert A. Bittner; Fabian Haertling; Anna Rotarska-Jagiela; Konrad Maurer; Wolf Singer; David E. J. Linden

2007-01-01

361

Elevated primary productivity of calcareous nannoplankton associated with ocean anoxic event 1b during the Aptian\\/Albian transition (Early Cretaceous)  

Microsoft Academic Search

Previous isotopic investigations of Aptian\\/Albian oceanic anoxic event (OAE) 1b from the western North Atlantic (Blake Nose) posited that increased sea surface temperatures and decreased salinity led to stratification of the upper water column, resulting in lowered dissolved oxygen and enhanced organic matter preservation. We examined calcareous nannofossils from the same site in the western North Atlantic (Blake Nose) to

Emily L. Browning; David K. Watkins

2008-01-01

362

Orbital tuning as an inverse problem: Chronology of the early Aptian oceanic anoxic event 1a (Selli Level) in the Cismon APTICORE  

Microsoft Academic Search

Orbital tuning, the process of fitting sedimentary cycles to orbital periodicities, can estimate with high resolution the timing and duration of key events in the geological record. We formulate here orbital tuning as the inverse problem of finding the variation in sedimentation rate that matches sediment cycles with orbital periodicities. Instead of obtaining a single best estimate, we apply a

A. Malinverno; E. Erba; T. D. Herbert

2010-01-01

363

A potential approach for monitoring drinking water quality from groundwater systems using organic matter fluorescence as an early warning for contamination events  

Microsoft Academic Search

The fluorescence characteristics of natural organic matter in a groundwater based drinking water supply plant were studied with the aim of applying it as a technique to identify contamination of the water supply. Excitation–emission matrices were measured and modeled using parallel factor analysis (PARAFAC) and used to identify which wavelengths provide the optimal signal for monitoring contamination events. The fluorescence

Colin A. Stedmon; Bo?ena Seredy?ska-Sobecka; Rasmus Boe-Hansen; Nicolas Le Tallec; Christopher K. Waul; Erik Arvin

2011-01-01

364

Development of a Systems Computational Model to Investigate Early Biological Events in Hepatic Activation of Constitutive Androstane Receptor (CAR) by Phenobarbital  

EPA Science Inventory

Activation of the nuclear receptor CAR (constitutive active/androstane receptor) is implicated in the control several key biological events such as metabolic pathways. Here, we combined data from literature with information obtained from in vitro assays in the US EPA ToxCast dat...

365

Developmental control of replication timing defines a new breed of chromosomal domains with a novel mechanism of chromatin unfolding.  

PubMed

We recently identified a set of chromosome domains that are early replicating uniquely in pluripotent cells. Their switch from early to late replication occurs just prior to germ layer commitment, associated with a stable form of gene silencing that is difficult to reverse. Here, we discuss results demonstrating that these domains are among the least sensitive regions in the genome to global digestion by either MNase or restriction enzymes. This inaccessible chromatin state persists whether these regions are in their physically distended early replicating or compact late replicating configuration, despite dramatic changes in 3D chromatin folding and long-range chromatin interactions, and despite large changes in transcriptional activity. This contrasts with the strong correlation between early replication, accessibility, transcriptional activity and open chromatin configuration that is observed genome-wide. We put these results in context with findings from other studies indicating that many structural (DNA sequence) and functional (density and activity of replication origins) properties of developmentally regulated replication timing ("switching") domains resemble properties of constitutively late replicating domains. This suggests that switching domains are a type of late replicating domain within which both replication timing and transcription are subject to unique or additional layers of control not experienced by the bulk of the genome. We predict that understanding the unusual structure of these domains will reveal a novel principle of chromosome folding. PMID:23023599

Takebayashi, Shin-ichiro; Ryba, Tyrone; Gilbert, David M

2012-01-01

366

Early gene expression events in the laminar abscission zone of abscission-promoted citrus leaves after a cycle of water stress/rehydration: involvement of CitbHLH1  

PubMed Central

Leaf abscission is a common response of plants to drought stress. Some species, such as citrus, have evolved a specific behaviour in this respect, keeping their leaves attached to the plant body during water stress until this is released by irrigation or rain. This study successfully reproduced this phenomenon under controlled conditions (24h of water stress followed by 24h of rehydration) and used it to construct a suppression subtractive hybridization cDNA library enriched in genes involved in the early stages of rehydration-promoted leaf abscission after water stress. Sequencing of the library yielded 314 unigenes, which were spotted onto nylon membranes. Membrane hybridization with petiole (Pet)- and laminar abscission zone (LAZ)-enriched RNA samples corresponding to early steps in leaf abscission revealed an almost exclusive preferential gene expression programme in the LAZ. The data identified major processes such as protein metabolism, cell-wall modification, signalling, control of transcription and vesicle production, and transport as the main biological processes activated in LAZs during the early steps of rehydration-promoted leaf abscission after water stress. Based on these findings, a model for the early steps of citrus leaf abscission is proposed. In addition, it is suggested that CitbHLH1, the putative citrus orthologue of Arabidopsis BIGPETAL, may play major roles in the control of abscission-related events in citrus abscission zones. PMID:23028022

Tadeo, Francisco R.

2012-01-01

367

Early gene expression events in the laminar abscission zone of abscission-promoted citrus leaves after a cycle of water stress/rehydration: involvement of CitbHLH1.  

PubMed

Leaf abscission is a common response of plants to drought stress. Some species, such as citrus, have evolved a specific behaviour in this respect, keeping their leaves attached to the plant body during water stress until this is released by irrigation or rain. This study successfully reproduced this phenomenon under controlled conditions (24h of water stress followed by 24h of rehydration) and used it to construct a suppression subtractive hybridization cDNA library enriched in genes involved in the early stages of rehydration-promoted leaf abscission after water stress. Sequencing of the library yielded 314 unigenes, which were spotted onto nylon membranes. Membrane hybridization with petiole (Pet)- and laminar abscission zone (LAZ)-enriched RNA samples corresponding to early steps in leaf abscission revealed an almost exclusive preferential gene expression programme in the LAZ. The data identified major processes such as protein metabolism, cell-wall modification, signalling, control of transcription and vesicle production, and transport as the main biological processes activated in LAZs during the early steps of rehydration-promoted leaf abscission after water stress. Based on these findings, a model for the early steps of citrus leaf abscission is proposed. In addition, it is suggested that CitbHLH1, the putative citrus orthologue of Arabidopsis BIGPETAL, may play major roles in the control of abscission-related events in citrus abscission zones. PMID:23028022

Agustí, Javier; Gimeno, Jacinta; Merelo, Paz; Serrano, Ramón; Cercós, Manuel; Conesa, Ana; Talón, Manuel; Tadeo, Francisco R

2012-10-01

368

Cytoplasmic Translocation of Polypyrimidine Tract-Binding Protein and Its Binding to Viral RNA during Japanese Encephalitis Virus Infection Inhibits Virus Replication  

PubMed Central

Japanese encephalitis virus (JEV) has a single-stranded, positive-sense RNA genome containing a single open reading frame flanked by the 5?- and 3?-non-coding regions (NCRs). The virus genome replicates via a negative-sense RNA intermediate. The NCRs and their complementary sequences in the negative-sense RNA are the sites for assembly of the RNA replicase complex thereby regulating the RNA synthesis and virus replication. In this study, we show that the 55-kDa polypyrimidine tract-binding protein (PTB) interacts in vitro with both the 5?-NCR of the positive-sense genomic RNA - 5NCR(+), and its complementary sequence in the negative-sense replication intermediate RNA - 3NCR(-). The interaction of viral RNA with PTB was validated in infected cells by JEV RNA co-immunoprecipitation and JEV RNA-PTB colocalization experiments. Interestingly, we observed phosphorylation-coupled translocation of nuclear PTB to cytoplasmic foci that co-localized with JEV RNA early during JEV infection. Our studies employing the PTB silencing and over-expression in cultured cells established an inhibitory role of PTB in JEV replication. Using RNA-protein binding assay we show that PTB competitively inhibits association of JEV 3NCR(-) RNA with viral RNA-dependent RNA polymerase (NS5 protein), an event required for the synthesis of the plus-sense genomic RNA. cAMP is known to promote the Protein kinase A (PKA)-mediated PTB phosphorylation. We show that cells treated with a cAMP analogue had an enhanced level of phosphorylated PTB in the cytoplasm and a significantly suppressed JEV replication. Data presented here show a novel, cAMP-induced, PTB-mediated, innate host response that could effectively suppress JEV replication in mammalian cells. PMID:25545659

Bhullar, Deepika; Jalodia, Richa; Kalia, Manjula; Vrati, Sudhanshu

2014-01-01

369

Cytoplasmic Translocation of Polypyrimidine Tract-Binding Protein and Its Binding to Viral RNA during Japanese Encephalitis Virus Infection Inhibits Virus Replication.  

PubMed

Japanese encephalitis virus (JEV) has a single-stranded, positive-sense RNA genome containing a single open reading frame flanked by the 5'- and 3'-non-coding regions (NCRs). The virus genome replicates via a negative-sense RNA intermediate. The NCRs and their complementary sequences in the negative-sense RNA are the sites for assembly of the RNA replicase complex thereby regulating the RNA synthesis and virus replication. In this study, we show that the 55-kDa polypyrimidine tract-binding protein (PTB) interacts in vitro with both the 5'-NCR of the positive-sense genomic RNA - 5NCR(+), and its complementary sequence in the negative-sense replication intermediate RNA - 3NCR(-). The interaction of viral RNA with PTB was validated in infected cells by JEV RNA co-immunoprecipitation and JEV RNA-PTB colocalization experiments. Interestingly, we observed phosphorylation-coupled translocation of nuclear PTB to cytoplasmic foci that co-localized with JEV RNA early during JEV infection. Our studies employing the PTB silencing and over-expression in cultured cells established an inhibitory role of PTB in JEV replication. Using RNA-protein binding assay we show that PTB competitively inhibits association of JEV 3NCR(-) RNA with viral RNA-dependent RNA polymerase (NS5 protein), an event required for the synthesis of the plus-sense genomic RNA. cAMP is known to promote the Protein kinase A (PKA)-mediated PTB phosphorylation. We show that cells treated with a cAMP analogue had an enhanced level of phosphorylated PTB in the cytoplasm and a significantly suppressed JEV replication. Data presented here show a novel, cAMP-induced, PTB-mediated, innate host response that could effectively suppress JEV replication in mammalian cells. PMID:25545659

Bhullar, Deepika; Jalodia, Richa; Kalia, Manjula; Vrati, Sudhanshu

2014-01-01

370

Structural Insights into the Coupling of Virion Assembly and Rotavirus Replication  

PubMed Central

Preface Viral replication is rapid and robust, but it is far from a chaotic process. Instead, successful production of infectious progeny requires that events occur in the correct place and at the correct time. Rotavirus, a segmented double-stranded RNA virus of the Reoviridae family, seems to govern its replication through ordered disassembly and assembly of a triple-layered icosahedral capsid. In recent years, high-resolution structural data have provided unprecedented insight into these events. In this Review, we explore the current understanding of rotavirus replication and how it compares to other Reoviridae family members. PMID:22266782

Trask, Shane D.; McDonald, Sarah M.; Patton, John T.

2013-01-01

371

Polyubiquitinated PCNA recruits the ZRANB3 translocase to maintain genomic integrity after replication stress.  

PubMed

Completion of DNA replication after replication stress depends on PCNA, which undergoes monoubiquitination to stimulate direct bypass of DNA lesions by specialized DNA polymerases or is polyubiquitinated to promote recombination-dependent DNA synthesis across DNA lesions by template switching mechanisms. Here we report that the ZRANB3 translocase, a SNF2 family member related to the SIOD disorder SMARCAL1 protein, is recruited by polyubiquitinated PCNA to promote fork restart following replication arrest. ZRANB3 depletion in mammalian cells results in an increased frequency of sister chromatid exchange and DNA damage sensitivity after treatment with agents that cause replication stress. Using in vitro biochemical assays, we show that recombinant ZRANB3 remodels DNA structures mimicking stalled replication forks and disassembles recombination intermediates. We therefore propose that ZRANB3 maintains genomic stability at stalled or collapsed replication forks by facilitating fork restart and limiting inappropriate recombination that could occur during template switching events. PMID:22704558

Ciccia, Alberto; Nimonkar, Amitabh V; Hu, Yiduo; Hajdu, Ildiko; Achar, Yathish Jagadheesh; Izhar, Lior; Petit, Sarah A; Adamson, Britt; Yoon, John C; Kowalczykowski, Stephen C; Livingston, David M; Haracska, Lajos; Elledge, Stephen J

2012-08-10

372

Glucocorticosteroids enhance replication of respiratory viruses: effect of adjuvant interferon.  

PubMed

Glucocorticosteroids (GCS) are used on a daily basis to reduce airway inflammation in asthma and chronic obstructive pulmonary disease (COPD). This treatment is usually escalated during acute disease exacerbations, events often associated with virus infections. We examined the impact of GCS on anti-viral defences and virus replication and assessed supplementary interferon (IFN) treatment. Here, we report that treatment of primary human airway cells in vitro with GCS prior to rhinovirus (RV) or influenza A virus (IAV) infection significantly reduces the expression of innate anti-viral genes and increases viral replication. Mice given intranasal treatment with GCS prior to IAV infection developed more severe disease associated with amplified virus replication and elevated inflammation in the airways. Adjuvant IFN treatment markedly reduced GCS-amplified infections in human airway cells and in mouse lung. This study demonstrates that GCS cause an extrinsic compromise in anti-viral defences, enhancing respiratory virus infections and provides a rationale for adjuvant IFN treatment. PMID:25417801

Thomas, Belinda J; Porritt, Rebecca A; Hertzog, Paul J; Bardin, Philip G; Tate, Michelle D

2014-01-01

373

Bcl2-independent chromatin cleavage is a very early event during induction of apoptosis in mouse thymocytes after treatment with either dexamethasone or ionizing radiation.  

PubMed

We have quantified the emergence of early chromatin breaks during the signal transduction phase of apoptosis in mouse thymocytes after treatment with either ionizing radiation or dexamethasone. Dexamethasone at 1 microM can induce significant levels of DNA breaks (equivalent to the amount induced directly by 7.5 Gy ionizing radiation) within 0.5 h of treatment. The execution phase of apoptosis was not observed until 4-6 h after the same treatment. The presence of the Bcl2 transgene under the control of the p56lck promoter almost completely inhibited apoptosis up to 24 h after treatment, but it had virtually no effect on the early chromatin cleavage occurring in the first 6 h. Ionizing radiation induced chromatin cleavage both directly by damaging DNA and indirectly with kinetics similar to the induction of chromatin cleavage by dexamethasone. The presence of the Bcl2 transgene had no effect on the direct or indirect radiation-induced cleavage in the first 6 h, but after the first 6 h, the Bcl2 gene inhibited further radiation-induced chromatin cleavage. These results suggest that endonucleases are activated within minutes of treatment with either dexamethasone or ionizing radiation as part of the very early signal transduction phase of apoptosis, and prior to the irreversible commitment to cell death. PMID:14565826

Hahn, Peter J; Lai, Zhi-Wei; Nevaldine, Barbara; Schiff, Ninel; Fiore, Nancy C; Silverstone, Allen E

2003-11-01

374

Identification of adenovirus genes that require template replication for expression.  

PubMed Central

The relationship between adenovirus type 2 DNA replication and expression of intermediate stage viral genes was investigated. The 1.03-kilobase mRNA from early region 1b (E1b) and the mRNAs coding for proteins IX and IVa2 were first detected between 6 and 8 h postinfection. Inhibition of viral DNA replication with hydroxyurea prevented expression of the IX and IVa2 mRNAs, but not of the E1b mRNA. Pulse-labeling experiments de