Science.gov

Sample records for early replication events

  1. Improved artificial origins for phage Φ29 terminal protein-primed replication. Insights into early replication events

    PubMed Central

    Gella, Pablo; Salas, Margarita; Mencía, Mario

    2014-01-01

    The replication machinery of bacteriophage Φ29 is a paradigm for protein-primed replication and it holds great potential for applied purposes. To better understand the early replication events and to find improved origins for DNA amplification based on the Φ29 system, we have studied the end-structure of a double-stranded DNA replication origin. We have observed that the strength of the origin is determined by a combination of factors. The strongest origin (30-fold respect to wt) has the sequence CCC at the 3′ end of the template strand, AAA at the 5′ end of the non-template strand and 6 nucleotides as optimal unpairing at the end of the origin. We also show that the presence of a correctly positioned displaced strand is important because origins with 5′ or 3′ ssDNA regions have very low activity. Most of the effect of the improved origins takes place at the passage between the terminal protein-primed and the DNA-primed modes of replication by the DNA polymerase suggesting the existence of a thermodynamic barrier at that point. We suggest that the template and non-template strands of the origin and the TP/DNA polymerase complex form series of interactions that control the critical start of terminal protein-primed replication. PMID:25081208

  2. Inhibiting early-stage events in HIV-1 replication by small-molecule targeting of the HIV-1 capsid.

    PubMed

    Kortagere, Sandhya; Madani, Navid; Mankowski, Marie K; Schön, Arne; Zentner, Isaac; Swaminathan, Gokul; Princiotto, Amy; Anthony, Kevin; Oza, Apara; Sierra, Luz-Jeannette; Passic, Shendra R; Wang, Xiaozhao; Jones, David M; Stavale, Eric; Krebs, Fred C; Martín-García, Julio; Freire, Ernesto; Ptak, Roger G; Sodroski, Joseph; Cocklin, Simon; Smith, Amos B

    2012-08-01

    The HIV-1 capsid (CA) protein plays essential roles in both early and late stages of virl replication and has emerged as a novel drug target. We report hybrid structure-based virtual screening to identify small molecules with the potential to interact with the N-terminal domain (NTD) of HIV-1 CA and disrupt early, preintegration steps of the HIV-1 replication cycle. The small molecule 4,4'-[dibenzo[b,d]furan-2,8-diylbis(5-phenyl-1H-imidazole-4,2-diyl)]dibenzoic acid (CK026), which had anti-HIV-1 activity in single- and multiple-round infections but failed to inhibit viral replication in peripheral blood mononuclear cells (PBMCs), was identified. Three analogues of CK026 with reduced size and better drug-like properties were synthesized and assessed. Compound I-XW-053 (4-(4,5-diphenyl-1H-imidazol-2-yl)benzoic acid) retained all of the antiviral activity of the parental compound and inhibited the replication of a diverse panel of primary HIV-1 isolates in PBMCs, while displaying no appreciable cytotoxicity. This antiviral activity was specific to HIV-1, as I-XW-053 displayed no effect on the replication of SIV or against a panel of nonretroviruses. Direct interaction of I-XW-053 was quantified with wild-type and mutant CA protein using surface plasmon resonance and isothermal titration calorimetry. Mutation of Ile37 and Arg173, which are required for interaction with compound I-XW-053, crippled the virus at an early, preintegration step. Using quantitative PCR, we demonstrated that treatment with I-XW-053 inhibited HIV-1 reverse transcription in multiple cell types, indirectly pointing to dysfunction in the uncoating process. In summary, we have identified a CA-specific compound that targets and inhibits a novel region in the NTD-NTD interface, affects uncoating, and possesses broad-spectrum anti-HIV-1 activity. PMID:22647699

  3. Early events in the pathogenesis of foot-and-mouth disease in pigs; identification of oropharyngeal tonsils as sites of primary and sustained viral replication.

    PubMed

    Stenfeldt, Carolina; Pacheco, Juan M; Rodriguez, Luis L; Arzt, Jonathan

    2014-01-01

    A time-course study was performed to elucidate the early events of foot-and-mouth disease virus (FMDV) infection in pigs subsequent to simulated natural, intra-oropharyngeal, inoculation. The earliest detectable event was primary infection in the lingual and paraepiglottic tonsils at 6 hours post inoculation (hpi) characterized by regional localization of viral RNA, viral antigen, and infectious virus. At this time FMDV antigen was localized in cytokeratin-positive epithelial cells and CD172a-expressing leukocytes of the crypt epithelium of the paraepiglottic tonsils. De novo replication of FMDV was first detected in oropharyngeal swab samples at 12 hpi and viremia occurred at 18-24 hpi, approximately 24 hours prior to the appearance of vesicular lesions. From 12 through 78 hpi, microscopic detection of FMDV was consistently localized to cytokeratin-positive cells within morphologically characteristic segments of oropharyngeal tonsil crypt epithelium. During this period, leukocyte populations expressing CD172a, SLA-DQ class II and/or CD8 were found in close proximity to infected epithelial cells, but with little or no co-localization with viral proteins. Similarly, M-cells expressing cytokeratin-18 did not co-localize with FMDV proteins. Intra-epithelial micro-vesicles composed of acantholytic epithelial cells expressing large amounts of structural and non-structural FMDV proteins were present within crypts of the tonsil of the soft palate during peak clinical infection. These findings inculpate the paraepiglottic tonsils as the primary site of FMDV infection in pigs exposed via the gastrointestinal tract. Furthermore, the continuing replication of FMDV in the oropharyngeal tonsils during viremia and peak clinical infection with no concurrent amplification of virus occurring in the lower respiratory tract indicates that these sites are the major source of shedding of FMDV from pigs. PMID:25184288

  4. Early events in the pathogenesis of foot-and-mouth disease in pigs; identification of oropharyngeal tonsils as sites of primary and sustained viral replication

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A time-course study was performed to elucidate the early events of foot-and-mouth disease virus (FMDV) infection in pigs subsequent to simulated natural inoculation. The earliest detectable event was primary infection in the lingual and paraepiglotic tonsils at 6 hours post inoculation (hpi) charact...

  5. Early traumatic events in psychopaths.

    PubMed

    Borja, Karina; Ostrosky, Feggy

    2013-07-01

    The relationship between diverse early traumatic events and psychopathy was studied in 194 male inmates. Criminal history transcripts were revised, and clinical interviews were conducted to determine the level of psychopathy using the Psychopathy Checklist-Revised (PCL-R) Form, and the Early Trauma Inventory was applied to assess the incidence of abuse before 18 years of age. Psychopathic inmates presented a higher victimization level and were more exposed to certain types of intended abuse than sociopathic inmates, while the sum of events and emotional abuse were associated with the PCL-R score. Our studies support the influence of early adverse events in the development of psychopathic offenders. PMID:23550705

  6. DNA breaks early in replication in B cell cancers

    Cancer.gov

    Research by scientists at the NCI has identified a new class of DNA sites in cells that break early in the replication process. They found that these break sites correlate with damage often seen in B cell cancers, such as diffuse large B cell lymphoma.

  7. A CI-Independent Form of Replicative Inhibition: Turn Off of Early Replication of Bacteriophage Lambda

    PubMed Central

    Hayes, Sidney; Horbay, Monique A.; Hayes, Connie

    2012-01-01

    Several earlier studies have described an unusual exclusion phenotype exhibited by cells with plasmids carrying a portion of the replication region of phage lambda. Cells exhibiting this inhibition phenotype (IP) prevent the plating of homo-immune and hybrid hetero-immune lambdoid phages. We have attempted to define aspects of IP, and show that it is directed to repλ phages. IP was observed in cells with plasmids containing a λ DNA fragment including oop, encoding a short OOP micro RNA, and part of the lambda origin of replication, oriλ, defined by iteron sequences ITN1-4 and an adjacent high AT-rich sequence. Transcription of the intact oop sequence from its promoter, pO is required for IP, as are iterons ITN3–4, but not the high AT-rich portion of oriλ. The results suggest that IP silencing is directed to theta mode replication initiation from an infecting repλ genome, or an induced repλ prophage. Phage mutations suppressing IP, i.e., Sip, map within, or adjacent to cro or in O, or both. Our results for plasmid based IP suggest the hypothesis that there is a natural mechanism for silencing early theta-mode replication initiation, i.e. the buildup of λ genomes with oop+ oriλ+ sequence. PMID:22590552

  8. Early Word Comprehension in Infants: Replication and Extension

    ERIC Educational Resources Information Center

    Bergelson, Elika; Swingley, Daniel

    2015-01-01

    A handful of recent experimental reports have shown that infants of 6-9 months know the meanings of some common words. Here, we replicate and extend these findings. With a new set of items, we show that when young infants (age 6-16 months, n = 49) are presented with side-by-side video clips depicting various common early words, and one clip is…

  9. Mode of action of SDZ NIM 811, a nonimmunosuppressive cyclosporin A analog with activity against human immunodeficiency virus type 1 (HIV-1): interference with early and late events in HIV-1 replication.

    PubMed

    Steinkasserer, A; Harrison, R; Billich, A; Hammerschmid, F; Werner, G; Wolff, B; Peichl, P; Palfi, G; Schnitzel, W; Mlynar, E

    1995-02-01

    SDZ NIM 811 is a cyclosporin A analog that is completely devoid of immunosuppressive capacity but exhibits potent and selective anti-human immunodeficiency virus type 1 (HIV-1) activity. The mechanism of action of SDZ NIM 811 is clearly different from those of all other anti-HIV agents described so far. In cell-free assays, it is not an inhibitor of reverse transcriptase, protease, integrase, and it does not interfere with Rev or Tat function. SDZ NIM 811 does not down-regulate CD4 or inhibit fusion between infected and uninfected, CD4-expressing cells. p24 production from chronically HIV-infected cells is not impaired either. To elucidate the mode of action of SDZ NIM 811, we performed DNA PCR analysis in HIV-1 IIIB-infected MT4 cells in one cycle of virus replication. The effects of SDZ NIM 811 on the kinetics of viral DNA synthesis, appearance of two-long terminal repeat circles (2-LTR circles), and integration of DNA were studied. SDZ NIM 811 inhibited 2-LTR circle formation in a concentration-dependent manner, which is indicative of nuclear localization of preintegration complexes. Half-maximal inhibition was achieved at 0.17 microgram/ml; this concentration is close to the 50% inhibitory concentrations (0.01 to 0.2 microgram/ml) for viral growth inhibition. As expected, integration of proviral DNA into cellular DNA was also inhibited by SDZ NIM 811. Analysis of the viral particles produced by SDZ NIM 811-treated, chronically infected cells revealed amounts of capsid proteins, reverse transcriptase activity, and viral RNA comparable to those of the untreated control. However, these particles showed a dose-dependent reduction in infectivity (50% inhibitory concentration of 0.028 microgram/ml) which indicates that the assembly process is also impaired by SDZ NIM 811. Gag proteins are postulated to play a role not only in assembly but also in early steps of viral replication, e.g., nuclear localization of the preintegration complex. Recently, it was reported that

  10. The Problems of Replication in the Early Stages of Evolution: Enumeration of Variants and Spatial Configurations of Replicators

    NASA Astrophysics Data System (ADS)

    Melkikh, Alexey V.

    2014-12-01

    Two main problems of replication in the early stages of evolution are discussed: the problem of exponentially large number of conformational degrees of freedom and the problem of enumeration of variants.

  11. Early Events of DNA Photodamage

    NASA Astrophysics Data System (ADS)

    Schreier, Wolfgang J.; Gilch, Peter; Zinth, Wolfgang

    2015-04-01

    Ultraviolet (UV) radiation is a leading external hazard to the integrity of DNA. Exposure to UV radiation triggers a cascade of chemical reactions, and many molecular products (photolesions) have been isolated that are potentially dangerous for the cellular system. The early steps that take place after UV absorption by DNA have been studied by ultrafast spectroscopy. The review focuses on the evolution of excited electronic states, the formation of photolesions, and processes suppressing their formation. Emphasis is placed on lesions involving two thymine bases, such as the cyclobutane pyrimidine dimer, the (6-4) lesion, and its Dewar valence isomer.

  12. A post-entry role for CD63 in early HIV-1 replication

    SciTech Connect

    Li Guangyu; Dziuba, Natallia; Friedrich, Brian; Murray, James L.; Ferguson, Monique R.

    2011-04-10

    Macrophages and CD4{sup +} lymphocytes are the major reservoirs for HIV-1 infection. CD63 is a tetraspanin transmembrane protein, which has been shown to play an essential role during HIV-1 replication in macrophages. In this study, we further confirm the requirement of CD63 in early HIV-1 replication events in both macrophages and a CD4{sup +} cell line. Further analysis revealed that viral attachment and cell-cell fusion were unaffected by CD63 silencing. However, CD63-depleted macrophages showed a significant decrease in the initiation and completion of HIV-1 reverse transcription, affecting subsequent events of the HIV-1 life cycle. Integration of HIV-1 cDNA as well as the formation of 2-LTR circles was notably reduced. Reporter assays showed that CD63 down regulation reduced production of the early HIV protein Tat. In agreement, CD63 silencing also inhibited production of the late protein p24. These findings suggest that CD63 plays an early post-entry role prior to or at the reverse transcription step.

  13. Resolving Paradoxical Criteria for the Expansion and Replication of Early Childhood Care and Education Programs.

    ERIC Educational Resources Information Center

    Yoshikawa, Hirokazu; Rosman, Elisa Altman; Hsueh, JoAnn

    2002-01-01

    Identifies underlying paradoxical bases for expansion and replication of early childhood care and education (ECCE) programs. Presents history of ECCE in the United States. Proposes typology of expansion and replication processes, and considers paradoxes associated with replication process. Offers recommendations for funders, policymakers, and…

  14. Early Word Comprehension in Infants: Replication and Extension

    PubMed Central

    Bergelson, Elika; Swingley, Daniel

    2014-01-01

    A handful of recent experimental reports have shown that infants of 6 to 9 months know the meanings of some common words. Here, we replicate and extend these findings. With a new set of items, we show that when young infants (age 6-16 months, n=49) are presented with side-by-side video clips depicting various common early words, and one clip is named in a sentence, they look at the named video at above-chance rates. We demonstrate anew that infants understand common words by 6-9 months, and that performance increases substantially around 14 months. The results imply that 6-9 month olds’ failure to understand words not referring to objects (verbs, adjectives, performatives) in a similar prior study is not attributable to the use of dynamic video depictions. Thus, 6-9 month olds’ experience of spoken language includes some understanding of common words for concrete objects, but relatively impoverished comprehension of other words. PMID:26664329

  15. Early Events in Ionic Liquid Radiation Chemistry

    SciTech Connect

    Wishart, J.F.; Cook, A.; Rimmer, R.D.; Gohdo, M.

    2010-09-14

    Ionic liquids are interesting and useful materials whose solvation time scales are up to thousands of times longer than in conventional solvents. The extended lifetimes of pre-solvated electrons and other energetic species in ionic liquids has profound consequences for the radiolytic product distributions and reactivity patterns. We use a newly developed, multiplexed variation of pulse-probe spectroscopy to measure the kinetics of the early dynamical and reactive events in ionic liquids.

  16. Early events in axon/dendrite polarization.

    PubMed

    Cheng, Pei-lin; Poo, Mu-ming

    2012-01-01

    Differentiation of axons and dendrites is a critical step in neuronal development. Here we review the evidence that axon/dendrite formation during neuronal polarization depends on the intrinsic cytoplasmic asymmetry inherited by the postmitotic neuron, the exposure of the neuron to extracellular chemical factors, and the action of anisotropic mechanical forces imposed by the environment. To better delineate the functions of early signals among a myriad of cellular components that were shown to influence axon/dendrite formation, we discuss their functions by distinguishing their roles as determinants, mediators, or modulators and consider selective degradation of these components as a potential mechanism for axon/dendrite polarization. Finally, we examine whether these early events of axon/dendrite formation involve local autocatalytic activation and long-range inhibition, as postulated by Alan Turing for the morphogenesis of patterned biological structure. PMID:22715881

  17. An evolutionary conserved early replicating segment on the sex chromosomes of man and the great apes.

    PubMed

    Weber, B; Schempp, W; Wiesner, H

    1986-01-01

    Replication studies on prometaphase chromosomes of man, the chimpanzee, the pygmy chimpanzee, the gorilla, and the orangutan reveal great interspecific homologies between the autosomes. The early replicating X chromosomes clearly show a high degree of conservation of both the pattern and the time course of replication. An early replicating segment on the short arm of the X chromosomes of man (Xp22.3) which escapes inactivation can be found on the X chromosomes of the great apes as well. Furthermore, the most early replicating segment on the Y chromosomes of all species tested appears to be homologous to this segment on the X chromosomes. Therefore, these early replicating segments in the great apes may correspond to the pseudoautosomal segment proposed to exist in man. From further cytogenetic characterization of the Y chromosomes it is evident that structural alterations have resulted in an extreme divergence in both the euchromatic and heterochromatic parts. It is assumed, therefore, that, in contrast to the X chromosomes, the Y chromosomes have undergone a rapid evolution within the higher primates. PMID:3096642

  18. Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways.

    PubMed

    Rainey, Stephanie M; Martinez, Julien; McFarlane, Melanie; Juneja, Punita; Sarkies, Peter; Lulla, Aleksei; Schnettler, Esther; Varjak, Margus; Merits, Andres; Miska, Eric A; Jiggins, Francis M; Kohl, Alain

    2016-04-01

    The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection, and is being introduced into mosquito populations in the wild to block the transmission of arboviruses that infect humans and are a major public health concern. To investigate the mechanisms underlying this antiviral protection, we have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture with the model mosquito-borne Semliki Forest virus (SFV; Togaviridae, Alphavirus). Wolbachia provides strong antiviral protection rapidly after infection, suggesting that an early stage post-infection is being blocked. Wolbachia does appear to have major effects on events distinct from entry, assembly or exit as it inhibits the replication of an SFV replicon transfected into the cells. Furthermore, it causes a far greater reduction in the expression of proteins from the 3' open reading frame than the 5' non-structural protein open reading frame, indicating that it is blocking the replication of viral RNA. Further to this separation of the replicase proteins and viral RNA in transreplication assays shows that uncoupling of viral RNA and replicase proteins does not overcome Wolbachia's antiviral activity. This further suggests that replicative processes are disrupted, such as translation or replication, by Wolbachia infection. This may occur by Wolbachia mounting an active antiviral response, but the virus did not cause any transcriptional response by the bacterium, suggesting that this is not the case. Host microRNAs (miRNAs) have been implicated in protection, but again we found that host cell miRNA expression was unaffected by the bacterium and neither do our findings suggest any involvement of the antiviral siRNA pathway. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed to an induced

  19. Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways

    PubMed Central

    McFarlane, Melanie; Juneja, Punita; Sarkies, Peter; Lulla, Aleksei; Schnettler, Esther; Varjak, Margus; Merits, Andres; Miska, Eric A.; Jiggins, Francis M.; Kohl, Alain

    2016-01-01

    The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection, and is being introduced into mosquito populations in the wild to block the transmission of arboviruses that infect humans and are a major public health concern. To investigate the mechanisms underlying this antiviral protection, we have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture with the model mosquito-borne Semliki Forest virus (SFV; Togaviridae, Alphavirus). Wolbachia provides strong antiviral protection rapidly after infection, suggesting that an early stage post-infection is being blocked. Wolbachia does appear to have major effects on events distinct from entry, assembly or exit as it inhibits the replication of an SFV replicon transfected into the cells. Furthermore, it causes a far greater reduction in the expression of proteins from the 3´ open reading frame than the 5´ non-structural protein open reading frame, indicating that it is blocking the replication of viral RNA. Further to this separation of the replicase proteins and viral RNA in transreplication assays shows that uncoupling of viral RNA and replicase proteins does not overcome Wolbachia’s antiviral activity. This further suggests that replicative processes are disrupted, such as translation or replication, by Wolbachia infection. This may occur by Wolbachia mounting an active antiviral response, but the virus did not cause any transcriptional response by the bacterium, suggesting that this is not the case. Host microRNAs (miRNAs) have been implicated in protection, but again we found that host cell miRNA expression was unaffected by the bacterium and neither do our findings suggest any involvement of the antiviral siRNA pathway. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed to an induced

  20. The Chemistry of Early Self-Replicating Systems

    NASA Technical Reports Server (NTRS)

    Bada, Jeffrey L.

    2004-01-01

    On June 10, 2003, a symposium 'Celebrating 50 Years of Prebiotic Chemistry' honoring the 50th Anniversary of the 1953 publication of the Miller Experiment in SCIENCE was held at the University of California, San Diego. This event was organized and hosted by the NASA Specialized Center of Research and Training in Exobiology. It was sponsored by NASA, the Dean of Physical Sciences and the Department of Chemistry and Biochemistry at the University of California, San Diego (UCSD). The following events were held: 1) For the symposium, public lectures and a reception were held at UCSD on June 10, 2003 in honor of the 50th Anniversary of the Miller Experiment. The speakers were the NSCORT/Exobiology Principal Investigators Dr. Jeffrey L. Bada and Dr. Gerald F. Joyce and the moderator, Dr. Leslie Orgel; 2) A evening discussion seminar and dinner was held at UCSD with invited scientists, NSCORT investigators, NASA Headquarters Officials and the Chancellor and Officials of the University of California, San Diego. Stanley Miller has had a long history of support from the NASA Exobiology Section. This event commemorated the anniversary of his classic experiment and was a small recognition of his contributions to the field.

  1. The 6-Aminoquinolone WC5 Inhibits Human Cytomegalovirus Replication at an Early Stage by Interfering with the Transactivating Activity of Viral Immediate-Early 2 Protein ▿ †

    PubMed Central

    Loregian, Arianna; Mercorelli, Beatrice; Muratore, Giulia; Sinigalia, Elisa; Pagni, Silvana; Massari, Serena; Gribaudo, Giorgio; Gatto, Barbara; Palumbo, Manlio; Tabarrini, Oriana; Cecchetti, Violetta; Palù, Giorgio

    2010-01-01

    WC5 is a 6-aminoquinolone that potently inhibits the replication of human cytomegalovirus (HCMV) but has no activity, or significantly less activity, against other herpesviruses. Here we investigated the nature of its specific anti-HCMV activity. Structure-activity relationship studies on a small series of analogues showed that WC5 possesses the most suitable pattern of substitutions around the quinolone scaffold to give potent and selective anti-HCMV activity. Studies performed to identify the possible target of WC5 indicated that it prevents viral DNA synthesis but does not significantly affect DNA polymerase activity. In yield reduction experiments with different multiplicities of infection, the anti-HCMV activity of WC5 appeared to be highly dependent on the viral inoculum, suggesting that WC5 may act at an initial stage of virus replication. Consistently, time-of-addition and time-of-removal studies demonstrated that WC5 affects a phase of the HCMV replicative cycle that precedes viral DNA synthesis. Experiments to monitor the effects of the compound on virus attachment and entry showed that it does not inhibit either process. Evaluation of viral mRNA and protein expression revealed that WC5 targets an event of the HCMV replicative cycle that follows the transcription and translation of immediate-early genes and precedes those of early and late genes. In cell-based assays to test the effects of WC5 on the transactivating activity of the HCMV immediate-early 2 (IE2) protein, WC5 markedly interfered with IE2-mediated transactivation of viral early promoters. Finally, WC5 combined with ganciclovir in checkerboard experiments exhibited highly synergistic activity. These findings suggest that WC5 deserves further investigation as a candidate anti-HCMV drug with a novel mechanism of action. PMID:20194695

  2. Early replication dynamics of sex-linked mitochondrial DNAs in the doubly uniparental inheritance species Ruditapes philippinarum (Bivalvia Veneridae).

    PubMed

    Guerra, D; Ghiselli, F; Milani, L; Breton, S; Passamonti, M

    2016-03-01

    Mitochondrial homoplasmy, which is maintained by strictly maternal inheritance and a series of bottlenecks, is thought to be an adaptive condition for metazoans. Doubly uniparental inheritance (DUI) is a unique mode of mitochondrial transmission found in bivalve species, in which two distinct mitochondrial genome (mtDNA) lines are present, one inherited through eggs (F) and one through sperm (M). During development, the two lines segregate in a sex- and tissue-specific manner: females lose M during embryogenesis, whereas males actively segregate it in the germ line. These two pivotal events are still poorly characterized. Here we investigated mtDNA replication dynamics during embryogenesis and pre-adulthood of the venerid Ruditapes philippinarum using real-time quantitative PCR. We found that both mtDNAs do not detectably replicate during early embryogenesis, and that the M line might be lost from females around 24 h of age. A rise in mtDNA copy number was observed before the first reproductive season in both sexes, with the M mitochondrial genome replicating more than the F in males, and we associate these boosts to the early phase of gonad production. As evidence indicates that DUI relies on the same molecular machine of mitochondrial maternal inheritance that is common in most animals, our data are relevant not only to DUI but also to shed light on how differential segregations of mtDNA variants, in the same nuclear background, may be controlled during development. PMID:26626575

  3. Expression of an early gene in the flagellar regulatory hierarchy is sensitive to an interruption in DNA replication.

    PubMed Central

    Dingwall, A; Zhuang, W Y; Quon, K; Shapiro, L

    1992-01-01

    Genes involved in the biogenesis of the flagellum in Caulobacter crescentus are expressed in a temporal order and are controlled by a trans-acting regulatory hierarchy. Strains with mutations in one of these genes, flaS, cannot transcribe flagellar structural genes and divide abnormally. This gene was cloned, and it was found that its transcription is initiated early in the cell cycle. Subclones that restored motility to FlaS mutants also restored normal cell division. Although transcription of flaS was not dependent on any other known gene in the flagellar hierarchy, it was autoregulated and subject to mild negative control by other genes at the same level of the hierarchy. An additional level of control was revealed when it was found that an interruption of DNA replication caused the inhibition of flaS transcription. The flaS transcript initiation site was identified, and an apparently unique promoter sequence was found to be highly conserved among the genes at the same level of the hierarchy. The flagellar genes with this conserved 5' region all initiate transcription early in the cell cycle and are all sensitive to a disruption in DNA replication. Mutations in these genes also cause an aberrant cell division phenotype. Therefore, flagellar genes at or near the top of the hierarchy may be controlled, in part, by a unique transcription factor and may be responsive to the same DNA replication cues that mediate other cell cycle events, such as cell division. Images PMID:1372311

  4. Early events in geotropism of seedling shoots

    NASA Technical Reports Server (NTRS)

    Pickard, B. G.

    1985-01-01

    Developments during the first ten minutes of geotropic stimulation in plant seedling shoots are reviewed. Topics include induction and curvature; early processes; the relationship between auxin, electric field, calcium, and differential growth; gravity reception leading to Went-Cholodny transport; and comparison of root and shoot. Early processes reviewed are sedimentation of amyloplasts, release of ethylene, rise of electrical and auxin asymmetry, redistribution of calcium, asymmetric vascular transport, increase in tendency to deposit callose, and simulation of putative exocytotic voltage transients.

  5. Potent and selective inhibition of human immunodeficiency virus (HIV)-1 and HIV-2 replication by a class of bicyclams interacting with a viral uncoating event.

    PubMed Central

    De Clercq, E; Yamamoto, N; Pauwels, R; Baba, M; Schols, D; Nakashima, H; Balzarini, J; Debyser, Z; Murrer, B A; Schwartz, D

    1992-01-01

    A series of bicyclams have been shown to be potent and selective inhibitors of human immunodeficiency virus (HIV). The compounds are inhibitory to the replication of various HIV-1 and HIV-2 strains in various human T-cell systems, including peripheral blood lymphocytes, at 0.14-1.4 microM, without being toxic to the host cells at 2.2 mM. The bicyclam JM2763 is active against 3'-azido-3'-deoxythymidine (zidovudine; AZT)-resistant HIV-1 strains and acts additively with AZT. Mechanism of action studies revealed that the bicyclams (i.e., JM2763) interact with an early event of the retrovirus replicative cycle, which could be tentatively identified as a viral uncoating event. Images PMID:1608936

  6. DNA replication stress induces deregulation of the cell cycle events in root meristems of Allium cepa

    PubMed Central

    Żabka, Aneta; Polit, Justyna Teresa; Maszewski, Janusz

    2012-01-01

    Background and Aims Prolonged treatment of Allium cepa root meristems with changing concentrations of hydroxyurea (HU) results in either premature chromosome condensation or cell nuclei with an uncommon form of biphasic chromatin organization. The aim of the current study was to assess conditions that compromise cell cycle checkpoints and convert DNA replication stress into an abnormal course of mitosis. Methods Interphase-mitotic (IM) cells showing gradual changes of chromatin condensation were obtained following continuous 72 h treatment of seedlings with 0·75 mm HU (without renewal of the medium). HU-treated root meristems were analysed using histochemical stainings (DNA-DAPI/Feulgen; starch-iodide and DAB staining for H2O2 production), Western blotting [cyclin B-like (CBL) proteins] and immunochemistry (BrdU incorporation, detection of γ-H2AX and H3S10 phosphorylation). Key Results Continuous treatment of onion seedlings with a low concentration of HU results in shorter root meristems, enhanced production of H2O2, γ-phosphorylation of H2AX histones and accumulation of CBL proteins. HU-induced replication stress gives rise to axially elongated cells with half interphase/half mitotic structures (IM-cells) having both decondensed and condensed domains of chromatin. Long-term HU treatment results in cell nuclei resuming S phase with gradients of BrdU labelling. This suggests a polarized distribution of factors needed to re-initiate stalled replication forks. Furthermore, prolonged HU treatment extends both the relative time span and the spatial scale of H3S10 phosphorylation known in plants. Conclusions The minimum cell length and a threshold level of accumulated CBL proteins are both determining factors by which the nucleus attains commitment to induce an asynchronous course of chromosome condensation. Replication stress-induced alterations in an orderly route of the cell cycle events probably reflect a considerable reprogramming of metabolic functions of

  7. Remote Acculturation of Early Adolescents in Jamaica towards European American Culture: A Replication and Extension

    PubMed Central

    Ferguson, Gail M.; Bornstein, Marc H.

    2015-01-01

    Remote acculturation is a modern form of non-immigrant acculturation identified among early adolescents in Jamaica as “Americanization”. This study aimed to replicate the original remote acculturation findings in a new cohort of early adolescents in Jamaica (n = 222; M = 12.08 years) and to extend our understanding of remote acculturation by investigating potential vehicles of indirect and intermittent intercultural contact. Cluster analyses replicated prior findings: Relative to Traditional Jamaican adolescents (62%), Americanized Jamaican adolescents (38%) reported stronger European American cultural orientation, lower Jamaican orientation, lower family obligations, and greater conflict with parents. More U.S. media (girls) and less local media and local sports (all) were the primary vehicles of intercultural contact predicting higher odds of Americanization. U.S. food, U.S. tourism, and transnational communication were also linked to U.S. orientation. Findings have implications for acculturation research and for practice and policy targeting Caribbean youth and families. PMID:25709142

  8. Noise-Induced Mechanism for Biological Homochirality of Early Life Self-Replicators

    NASA Astrophysics Data System (ADS)

    Jafarpour, Farshid; Biancalani, Tommaso; Goldenfeld, Nigel

    2015-10-01

    The observed single-handedness of biological amino acids and sugars has long been attributed to autocatalysis. However, the stability of homochiral states in deterministic autocatalytic systems relies on cross inhibition of the two chiral states, an unlikely scenario for early life self-replicators. Here, we present a theory for a stochastic individual-level model of autocatalysis due to early life self-replicators. Without chiral inhibition, the racemic state is the global attractor of the deterministic dynamics, but intrinsic multiplicative noise stabilizes the homochiral states, in both well-mixed and spatially extended systems. We conclude that autocatalysis is a viable mechanism for homochirality, without imposing additional nonlinearities such as chiral inhibition.

  9. Noise-Induced Mechanism for Biological Homochirality of Early Life Self-Replicators.

    PubMed

    Jafarpour, Farshid; Biancalani, Tommaso; Goldenfeld, Nigel

    2015-10-01

    The observed single-handedness of biological amino acids and sugars has long been attributed to autocatalysis. However, the stability of homochiral states in deterministic autocatalytic systems relies on cross inhibition of the two chiral states, an unlikely scenario for early life self-replicators. Here, we present a theory for a stochastic individual-level model of autocatalysis due to early life self-replicators. Without chiral inhibition, the racemic state is the global attractor of the deterministic dynamics, but intrinsic multiplicative noise stabilizes the homochiral states, in both well-mixed and spatially extended systems. We conclude that autocatalysis is a viable mechanism for homochirality, without imposing additional nonlinearities such as chiral inhibition. PMID:26550754

  10. Early inductive events in ectodermal appendage morphogenesis.

    PubMed

    Biggs, Leah C; Mikkola, Marja L

    2014-01-01

    The embryonic surface ectoderm gives rise to the epidermis and ectodermal appendages including hair follicles, teeth, scales, feathers, and mammary, sweat, and salivary glands. Their early development proceeds largely the same through the induction, placode, and bud stages prior to diversification of epithelial morphogenesis which ultimately produces the wide array of mature organs. In this review we summarize the current knowledge on the molecular and cellular processes driving the shared stages of skin appendage development revealed by analysis of mouse mutants. We focus on three mammalian organs: hair follicle, tooth, and mammary gland. We reevaluate the information gained from classic epithelial-mesenchymal tissue recombination experiments in light of current molecular knowledge. We place special emphasis on the signaling pathways that mediate tissue interactions, and attempt to link the signaling outputs to changes in cellular behavior that ultimately shape the developing organ. PMID:24487243

  11. Endocrinologic events in early pregnancy failure.

    PubMed

    Aspillaga, M O; Whittaker, P G; Grey, C E; Lind, T

    1983-12-15

    Fourteen women experiencing early pregnancy failure have been studied during the time of conception and at frequent intervals until spontaneous abortion occurred. Serial measurements of serum estradiol, progesterone, 17 alpha-hydroxyprogesterone, prolactin, human placental lactogen (hPL), and human chorionic gonadotropin (hCG) were determined; regular sonar scanning allowed the time of fetal death to be determined to within 7 days in six patients and a diagnosis of blighted ovum to be made in the remainder. In all patients serum progesterone and estradiol concentrations were within the normal range up to 7 weeks but appeared to decrease from about 8 weeks' gestation whether or not a living fetus was present. The placenta continued to produce hCG and hPL but, despite the continuing presence of hCG, the levels of 17 alpha-hydroxyprogesterone declined to concentrations below those associated with normal pregnancy. These data suggest that the placenta may require a particular stimulus to take over production of progesterone and estradiol. PMID:6650626

  12. Nigericin is a potent inhibitor of the early stage of vaccinia virus replication.

    PubMed

    Myskiw, Chad; Piper, Jessica; Huzarewich, Rhiannon; Booth, Tim F; Cao, Jingxin; He, Runtao

    2010-12-01

    Poxviruses remain a significant public health concern due to their potential use as bioterrorist agents and the spread of animal borne poxviruses, such as monkeypox virus, to humans. Thus, the identification of small molecule inhibitors of poxvirus replication is warranted. Vaccinia virus is the prototypic member of the Orthopoxvirus genus, which also includes variola and monkeypox virus. In this study, we demonstrate that the carboxylic ionophore nigericin is a potent inhibitor of vaccinia virus replication in several human cell lines. In HeLa cells, we found that the 50% inhibitory concentration of nigericin against vaccinia virus was 7.9 nM, with a selectivity index of 1038. We present data demonstrating that nigericin targets vaccinia virus replication at a post-entry stage. While nigericin moderately inhibits both early vaccinia gene transcription and translation, viral DNA replication and intermediate and late gene expression are severely compromised in the presence of nigericin. Our results demonstrate that nigericin has the potential to be further developed into an effective antiviral to treat poxvirus infections. PMID:20951746

  13. Work-family enrichment and job performance: a constructive replication of affective events theory.

    PubMed

    Carlson, Dawn; Kacmar, K Michele; Zivnuska, Suzanne; Ferguson, Merideth; Whitten, Dwayne

    2011-07-01

    Based on affective events theory (AET), we hypothesize a four-step model of the mediating mechanisms of positive mood and job satisfaction in the relationship between work-family enrichment and job performance. We test this model for both directions of enrichment (work-to-family and family-to-work). We used two samples to test the model using structural equation modeling. Results from Study 1, which included 240 full-time employees, were replicated in Study 2, which included 189 matched subordinate-supervisor dyads. For the work-to-family direction, results from both samples support our conceptual model and indicate mediation of the enrichment-performance relationship for the work-to-family direction of enrichment. For the family-to-work direction, results from the first sample support our conceptual model but results from the second sample do not. Our findings help elucidate mixed findings in the enrichment and job performance literatures and contribute to an understanding of the mechanisms linking these concepts. We conclude with a discussion of the practical and theoretical implications of our findings. PMID:21728437

  14. Replisome stall events have shaped the distribution of replication origins in the genomes of yeasts

    PubMed Central

    Newman, Timothy J.; Mamun, Mohammed A.; Nieduszynski, Conrad A.; Blow, J. Julian

    2013-01-01

    During S phase, the entire genome must be precisely duplicated, with no sections of DNA left unreplicated. Here, we develop a simple mathematical model to describe the probability of replication failing due to the irreversible stalling of replication forks. We show that the probability of complete genome replication is maximized if replication origins are evenly spaced, the largest inter-origin distances are minimized, and the end-most origins are positioned close to chromosome ends. We show that origin positions in the yeast Saccharomyces cerevisiae genome conform to all three predictions thereby maximizing the probability of complete replication if replication forks stall. Origin positions in four other yeasts—Kluyveromyces lactis, Lachancea kluyveri, Lachancea waltii and Schizosaccharomyces pombe—also conform to these predictions. Equating failure rates at chromosome ends with those in chromosome interiors gives a mean per nucleotide fork stall rate of ∼5 × 10−8, which is consistent with experimental estimates. Using this value in our theoretical predictions gives replication failure rates that are consistent with data from replication origin knockout experiments. Our theory also predicts that significantly larger genomes, such as those of mammals, will experience a much greater probability of replication failure genome-wide, and therefore will likely require additional compensatory mechanisms. PMID:23963700

  15. Abnormal Early Cleavage Events Predict Early Embryo Demise: Sperm Oxidative Stress and Early Abnormal Cleavage

    PubMed Central

    Burruel, Victoria; Klooster, Katie; Barker, Christopher M.; Pera, Renee Reijo; Meyers, Stuart

    2014-01-01

    Human embryos resulting from abnormal early cleavage can result in aneuploidy and failure to develop normally to the blastocyst stage. The nature of paternal influence on early embryo development has not been directly demonstrated although many studies have suggested effects from spermatozoal chromatin packaging, DNA damage, centriolar and mitotic spindle integrity, and plasma membrane integrity. The goal of this study was to determine whether early developmental events were affected by oxidative damage to the fertilizing sperm. Survival analysis was used to compare patterns of blastocyst formation based on P2 duration. Kaplan-Meier survival curves demonstrate that relatively few embryos with short (<1 hr) P2 times reached blastocysts, and the two curves diverged beginning on day 4, with nearly all of the embryos with longer P2 times reaching blastocysts by day 6 (p < .01). We determined that duration of the 2nd to 3rd mitoses were sensitive periods in the presence of spermatozoal oxidative stress. Embryos that displayed either too long or too short cytokineses demonstrated an increased failure to reach blastocyst stage and therefore survive for further development. Although paternal-derived gene expression occurs later in development, this study suggests a specific role in early mitosis that is highly influenced by paternal factors. PMID:25307782

  16. Short-range inversions: rethinking organelle genome stability: template switching events during DNA replication destabilize organelle genomes.

    PubMed

    Tremblay-Belzile, Samuel; Lepage, Étienne; Zampini, Éric; Brisson, Normand

    2015-10-01

    In the organelles of plants and mammals, recent evidence suggests that genomic instability stems in large part from template switching events taking place during DNA replication. Although more than one mechanism may be responsible for this, some similarities exist between the different proposed models. These can be separated into two main categories, depending on whether they involve a single-strand-switching or a reciprocal-strand-switching event. Single-strand-switching events lead to intermediates containing Y junctions, whereas reciprocal-strand-switching creates Holliday junctions. Common features in all the described models include replication stress, fork stalling and the presence of inverted repeats, but no single element appears to be required in all cases. We review the field, and examine the ideas that several mechanisms may take place in any given genome, and that the presence of palindromes or inverted repeats in certain regions may favor specific rearrangements. PMID:26222836

  17. Viral terminal protein directs early organization of phage DNA replication at the bacterial nucleoid

    PubMed Central

    Muñoz-Espín, Daniel; Holguera, Isabel; Ballesteros-Plaza, David; Carballido-López, Rut; Salas, Margarita

    2010-01-01

    The mechanism leading to protein-primed DNA replication has been studied extensively in vitro. However, little is known about the in vivo organization of the proteins involved in this fundamental process. Here we show that the terminal proteins (TPs) of phages ϕ29 and PRD1, infecting the distantly related bacteria Bacillus subtilis and Escherichia coli, respectively, associate with the host bacterial nucleoid independently of other viral-encoded proteins. Analyses of phage ϕ29 revealed that the TP N-terminal domain (residues 1–73) possesses sequence-independent DNA-binding capacity and is responsible for its nucleoid association. Importantly, we show that in the absence of the TP N-terminal domain the efficiency of ϕ29 DNA replication is severely affected. Moreover, the TP recruits the phage DNA polymerase to the bacterial nucleoid, and both proteins later are redistributed to enlarged helix-like structures in an MreB cytoskeleton-dependent way. These data disclose a key function for the TP in vivo: organizing the early viral DNA replication machinery at the cell nucleoid. PMID:20823229

  18. Mosquito saliva induced cutaneous events augment Chikungunya virus replication and disease progression.

    PubMed

    Agarwal, Ankita; Joshi, Gaurav; Nagar, Durga P; Sharma, Ajay K; Sukumaran, D; Pant, Satish C; Parida, Man Mohan; Dash, Paban Kumar

    2016-06-01

    Chikungunya virus (CHIKV) is transmitted when infected mosquito probes the host skin. While probing, mosquito saliva is expectorated into host skin along with virus which contains cocktail of molecules having anti-hemostatic and immunomodulatory properties. As mosquito saliva is a critical factor during natural arboviral infection, therefore we investigated mosquito saliva induced cutaneous events that modulate CHIKV infection. The effect of mosquito saliva on CHIKV infection was examined through inoculation of suckling mice subcutaneously with either CHIKV alone or uninfected mosquito bite followed by CHIKV. Histopathological evaluation of skin revealed infiltration of transmigrated inflammatory cells. Dermal blood vessels were hyperemic and adnexa showed degenerating lesions. Severe hemorrhage was observed in dermis and hypodermis in mosquito bite+CHIKV group compared to CHIKV group. Analysis of cytokines in skin showed significant downregulation of inflammatory genes like TLR-3, IL-2, IFN-γ, TNF-α and IFN-β in mosquito bite+CHIKV group compared to CHIKV group. In contrast, significant upregulation of anti-inflammatory genes like IL-4 and IL-10 was observed. These early events might have been responsible for increased dissemination of CHIKV to serum and peripheral organs as demonstrated through >10-fold higher viremia, antigen localization, cellular infiltration and degenerative changes. Thus mosquito saliva induced early cellular infiltration and associated cytokines augment CHIKV pathogenesis in a mouse model. This mosquito improved CHIKV mouse model simulates the realistic conditions that occur naturally during infected mosquito bite to a host. It will lead to better understanding of CHIKV pathobiology and promote the evaluation of novel medical countermeasures against emerging CHIKV. PMID:26925703

  19. Method for early detection of cooling-loss events

    SciTech Connect

    Bermudez, Sergio A.; Hamann, Hendrik F.; Marianno, Fernando J.

    2015-12-22

    A method of detecting cooling-loss event early is provided. The method includes defining a relative humidity limit and change threshold for a given space, measuring relative humidity in the given space, determining, with a processing unit, whether the measured relative humidity is within the defined relative humidity limit, generating a warning in an event the measured relative humidity is outside the defined relative humidity limit and determining whether a change in the measured relative humidity is less than the defined change threshold for the given space and generating an alarm in an event the change is greater than the defined change threshold.

  20. Method for early detection of cooling-loss events

    SciTech Connect

    Bermudez, Sergio A.; Hamann, Hendrik; Marianno, Fernando J.

    2015-06-30

    A method of detecting cooling-loss event early is provided. The method includes defining a relative humidity limit and change threshold for a given space, measuring relative humidity in the given space, determining, with a processing unit, whether the measured relative humidity is within the defined relative humidity limit, generating a warning in an event the measured relative humidity is outside the defined relative humidity limit and determining whether a change in the measured relative humidity is less than the defined change threshold for the given space and generating an alarm in an event the change is greater than the defined change threshold.

  1. Operational early warning platform for extreme meteorological events

    NASA Astrophysics Data System (ADS)

    Mühr, Bernhard; Kunz, Michael

    2015-04-01

    Operational early warning platform for extreme meteorological events Most natural disasters are related to extreme weather events (e.g. typhoons); weather conditions, however, are also highly relevant for humanitarian and disaster relief operations during and after other natural disaster like earthquakes. The internet service "Wettergefahren-Frühwarnung" (WF) provides various information on extreme weather events, especially when these events are associated with a high potential for large damage. The main focus of the platform is on Central Europe, but major events are also monitored worldwide on a daily routine. WF provides high-resolution forecast maps for many weather parameters which allow detailed and reliable predictions about weather conditions during the next days in the affected areas. The WF service became operational in February 2004 and is part of the Center for Disaster Management and Risk Reduction Technology (CEDIM) since 2007. At the end of 2011, CEDIM embarked a new type of interdisciplinary disaster research termed as forensic disaster analysis (FDA) in near real time. In case of an imminent extreme weather event WF plays an important role in CEDIM's FDA group. It provides early and precise information which are always available and updated several times during a day and gives advice and assists with articles and reports on extreme events.

  2. Early nucleosome deposition on, and replication of, HSV DNA requires cell factor PCNA

    PubMed Central

    Sanders, Iryna; Boyer, Mark; Fraser, Nigel W.

    2015-01-01

    Herpes Simplex Virus (HSV) is a double stranded DNA virus that can cause lytic infections in epithelial cells of the skin and latent infections in neuronal cells of the peripheral nervous system. After virion attachment to the cell membrane, the capsid enters the cytoplasm and is transported to the nucleus. Following docking at the nuclear pore, the HSV DNA, and contents of the virion, are injected into the nucleus. The viral DNA that enters the nucleus is devoid of histones, but begins to be covered with them soon after entry. The covering of histones, in the form of nucleosomes, reaches a maximum during the early stages of infection and drops off during late infection (after DNA replication). However during latency the genome is saturated with nucleosomes. In this study, we examine the role of cell Proliferating Cell Nuclear Antigen (PCNA) a cellular DNA polymerase accessory protein (processivity factor), and cell DNA polymerases in histone deposition during the early stages of HSV infection. Using SiRNA knockdown, and a cytosine arabinoside (araC) chemical inhibitor, we conclude that PCNA is important for viral replication and histone deposition. However, cell DNA polymerases that bind PCNA do not appear to be required for these processes and PCNA does not appear to bind to the viral DNA polymerase (which has its own viral processivity factor). PMID:25672886

  3. Early apoptosis of porcine alveolar macrophages limits avian influenza virus replication and pro-inflammatory dysregulation

    PubMed Central

    Chang, Pengxiang; Kuchipudi, Suresh V.; Mellits, Kenneth H.; Sebastian, Sujith; James, Joe; Liu, Jinhua; Shelton, Holly; Chang, Kin-Chow

    2015-01-01

    Pigs are evidently more resistant to avian than swine influenza A viruses, mediated in part through frontline epithelial cells and alveolar macrophages (AM). Although porcine AM (PAM) are crucial in influenza virus control, their mode of control is unclear. To gain insight into the possible role of PAM in the mediation of avian influenza virus resistance, we compared the host effects and replication of two avian (H2N3 and H6N1) and three mammalian (swine H1N1, human H1N1 and pandemic H1N1) influenza viruses in PAM. We found that PAM were readily susceptible to initial infection with all five avian and mammalian influenza viruses but only avian viruses caused early and extensive apoptosis (by 6 h of infection) resulting in reduced virus progeny and moderated pro-inflammation. Full length viral PB1-F2 present only in avian influenza viruses is a virulence factor that targets AM for mitochondrial-associated apoptotic cell death. With the use of reverse genetics on an avian H5N1 virus, we found that full length PB1-F2 contributed to increased apoptosis and pro-inflammation but not to reduced virus replication. Taken together, we propose that early apoptosis of PAM limits the spread of avian influenza viruses and that PB1-F2 could play a contributory role in the process. PMID:26642934

  4. Early apoptosis of porcine alveolar macrophages limits avian influenza virus replication and pro-inflammatory dysregulation.

    PubMed

    Chang, Pengxiang; Kuchipudi, Suresh V; Mellits, Kenneth H; Sebastian, Sujith; James, Joe; Liu, Jinhua; Shelton, Holly; Chang, Kin-Chow

    2015-01-01

    Pigs are evidently more resistant to avian than swine influenza A viruses, mediated in part through frontline epithelial cells and alveolar macrophages (AM). Although porcine AM (PAM) are crucial in influenza virus control, their mode of control is unclear. To gain insight into the possible role of PAM in the mediation of avian influenza virus resistance, we compared the host effects and replication of two avian (H2N3 and H6N1) and three mammalian (swine H1N1, human H1N1 and pandemic H1N1) influenza viruses in PAM. We found that PAM were readily susceptible to initial infection with all five avian and mammalian influenza viruses but only avian viruses caused early and extensive apoptosis (by 6 h of infection) resulting in reduced virus progeny and moderated pro-inflammation. Full length viral PB1-F2 present only in avian influenza viruses is a virulence factor that targets AM for mitochondrial-associated apoptotic cell death. With the use of reverse genetics on an avian H5N1 virus, we found that full length PB1-F2 contributed to increased apoptosis and pro-inflammation but not to reduced virus replication. Taken together, we propose that early apoptosis of PAM limits the spread of avian influenza viruses and that PB1-F2 could play a contributory role in the process. PMID:26642934

  5. Chasing the Origin of Viruses: Capsid-Forming Genes as a Life-Saving Preadaptation within a Community of Early Replicators

    PubMed Central

    Jalasvuori, Matti; Mattila, Sari; Hoikkala, Ville

    2015-01-01

    Virus capsids mediate the transfer of viral genetic information from one cell to another, thus the origin of the first viruses arguably coincides with the origin of the viral capsid. Capsid genes are evolutionarily ancient and their emergence potentially predated even the origin of first free-living cells. But does the origin of the capsid coincide with the origin of viruses, or is it possible that capsid-like functionalities emerged before the appearance of true viral entities? We set to investigate this question by using a computational simulator comprising primitive replicators and replication parasites within a compartment matrix. We observe that systems with no horizontal gene transfer between compartments collapse due to the rapidly emerging replication parasites. However, introduction of capsid-like genes that induce the movement of randomly selected genes from one compartment to another rescues life by providing the non-parasitic replicators a mean to escape their current compartments before the emergence of replication parasites. Capsid-forming genes can mediate the establishment of a stable meta-population where parasites cause only local tragedies but cannot overtake the whole community. The long-term survival of replicators is dependent on the frequency of horizontal transfer events, as systems with either too much or too little genetic exchange are doomed to succumb to replication-parasites. This study provides a possible scenario for explaining the origin of viral capsids before the emergence of genuine viruses: in the absence of other means of horizontal gene transfer between compartments, evolution of capsid-like functionalities may have been necessary for early life to prevail. PMID:25955384

  6. Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection

    PubMed Central

    Raaben, Matthijs; Einerhand, Alexandra WC; Taminiau, Lucas JA; van Houdt, Michel; Bouma, Janneke; Raatgeep, Rolien H; Büller, Hans A; de Haan, Cornelis AM; Rossen, John WA

    2007-01-01

    Cyclooxygenases (COXs) play a significant role in many different viral infections with respect to replication and pathogenesis. Here we investigated the role of COXs in the mouse hepatitis coronavirus (MHV) infection cycle. Blocking COX activity by different inhibitors or by RNA interference affected MHV infection in different cells. The COX inhibitors reduced MHV infection at a post-binding step, but early in the replication cycle. Both viral RNA and viral protein synthesis were affected with subsequent loss of progeny virus production. Thus, COX activity appears to be required for efficient MHV replication, providing a potential target for anti-coronaviral therapy. PMID:17555580

  7. Early microbial translocation blockade reduces SIV-mediated inflammation and viral replication

    PubMed Central

    Kristoff, Jan; Haret-Richter, George; Ma, Dongzhu; Ribeiro, Ruy M.; Xu, Cuiling; Cornell, Elaine; Stock, Jennifer L.; He, Tianyu; Mobley, Adam D.; Ross, Samantha; Trichel, Anita; Wilson, Cara; Tracy, Russell; Landay, Alan; Apetrei, Cristian; Pandrea, Ivona

    2014-01-01

    Damage to the intestinal mucosa results in the translocation of microbes from the intestinal lumen into the circulation. Microbial translocation has been proposed to trigger immune activation, inflammation, and coagulopathy, all of which are key factors that drive HIV disease progression and non-HIV comorbidities; however, direct proof of a causal link is still lacking. Here, we have demonstrated that treatment of acutely SIV-infected pigtailed macaques with the drug sevelamer, which binds microbial lipopolysaccharide in the gut, dramatically reduces immune activation and inflammation and slightly reduces viral replication. Furthermore, sevelamer administration reduced coagulation biomarkers, confirming the contribution of microbial translocation in the development of cardiovascular comorbidities in SIV-infected nonhuman primates. Together, our data suggest that early control of microbial translocation may improve the outcome of HIV infection and limit noninfectious comorbidities associated with AIDS. PMID:24837437

  8. Discrete gene replication events drive coupling between the cell cycle and circadian clocks

    PubMed Central

    Paijmans, Joris; Bosman, Mark; ten Wolde, Pieter Rein; Lubensky, David K.

    2016-01-01

    Many organisms possess both a cell cycle to control DNA replication and a circadian clock to anticipate changes between day and night. In some cases, these two rhythmic systems are known to be coupled by specific, cross-regulatory interactions. Here, we use mathematical modeling to show that, additionally, the cell cycle generically influences circadian clocks in a nonspecific fashion: The regular, discrete jumps in gene-copy number arising from DNA replication during the cell cycle cause a periodic driving of the circadian clock, which can dramatically alter its behavior and impair its function. A clock built on negative transcriptional feedback either phase-locks to the cell cycle, so that the clock period tracks the cell division time, or exhibits erratic behavior. We argue that the cyanobacterium Synechococcus elongatus has evolved two features that protect its clock from such disturbances, both of which are needed to fully insulate it from the cell cycle and give it its observed robustness: a phosphorylation-based protein modification oscillator, together with its accompanying push–pull read-out circuit that responds primarily to the ratios of different phosphoform concentrations, makes the clock less susceptible to perturbations in protein synthesis; the presence of multiple, asynchronously replicating copies of the same chromosome diminishes the effect of replicating any single copy of a gene. PMID:27035936

  9. Changes in Transcription and Metabolism During the Early Stage of Replicative Cellular Senescence in Budding Yeast*

    PubMed Central

    Kamei, Yuka; Tamada, Yoshihiro; Nakayama, Yasumune; Fukusaki, Eiichiro; Mukai, Yukio

    2014-01-01

    Age-related damage accumulates and a variety of biological activities and functions deteriorate in senescent cells. However, little is known about when cellular aging behaviors begin and what cellular aging processes change. Previous research demonstrated age-related mRNA changes in budding yeast by the 18th to 20th generation, which is the average replicative lifespan of yeast (i.e. about half of the population is dead by this time point). Here, we performed transcriptional and metabolic profiling for yeast at early stages of senescence (4th, 7th, and 11th generation), that is, for populations in which most cells are still alive. Transcriptional profiles showed up- and down-regulation for ∼20% of the genes profiled after the first four generations, few further changes by the 7th generation, and an additional 12% of the genes were up- and down-regulated after 11 generations. Pathway analysis revealed that these 11th generation cells had accumulated transcripts coding for enzymes involved in sugar metabolism, the TCA cycle, and amino acid degradation and showed decreased levels of mRNAs coding for enzymes involved in amino acid biosynthetic pathways. These observations were consistent with the metabolomic profiles of aging cells: an accumulation of pyruvic acid and TCA cycle intermediates and depletion of most amino acids, especially branched-chain amino acids. Stationary phase-induced genes were highly expressed after 11 generations even though the growth medium contained adequate levels of nutrients, indicating deterioration of the nutrient sensing and/or signaling pathways by the 11th generation. These changes are presumably early indications of replicative senescence. PMID:25294875

  10. Early Holocene meltwater events in the Labrador Sea

    NASA Astrophysics Data System (ADS)

    Pearce, Christof; Jennings, Anne; Andrews, John; Hillaire-Marcel, Claude; Seidenkrantz, Marit-Solveig; Lewis, Mike

    2016-04-01

    During the early Holocene, the Labrador Sea was strongly influenced by the presence of the remainder of the Laurentide Ice Sheet and its active eastern margin. Glacial advances and retreats lead to episodic release of meltwater and icebergs with potential impact on ocean circulation and climate during the deglaciation. The purpose of this study is to use detrital carbonate (DC) records in the Labrador Sea to study the spatial variability of the carbonate events and inferred sources and routing of glacial meltwater originating from Hudson Strait (HS) as well as potential contributions from Northern Baffin Bay (NBB) ice sheet margins. We use DC in sediment cores as a proxy for glacial meltwater and ice berg drift from these areas. More than 20 sediment cores with published DC, stable oxygen isotope, and radiocarbon stratigraphies provide the data for this study. Our hypothesis is that the complex interplay of current systems, shelf and slope bathymetry and location of meltwater and ice berg injection points will affect the spatial distribution of the DC events. In addition, differences in local ocean reservoir age for shelf, slope and open ocean sites may also contribute to offsets in the apparent ages of DC events. Identification of DC peaks also is influenced by sedimentation rates and sampling resolution. To objectively correlate DC events, we study mostly published core data, removing all earlier assumptions about marine reservoir ages and assess all core chronologies with their associated errors. Our results show that none of the DC events is found in all sites and no record captures all of the DC events. Despite this, some of the larger events occur in several records and allow robust temporal and spatial mapping of the meltwater pathways. Besides the meltwater route due south along the Labrador margin on the shelf, some events show a clear signal in deeper Labrador Sea sites pointing at a more direct injection of freshwater in the subpolar gyre.

  11. Early- and Intermediate-Stage Variants of Simian Immunodeficiency Virus Replicate Efficiently in Cells Lacking CCR5

    PubMed Central

    Forte, Serene; Harmon, Mary-Elizabeth; Pineda, Mario J.; Overbaugh, Julie

    2003-01-01

    Primate lentiviruses are thought to use the chemokine receptor CCR5 as the major coreceptor for entry into cells. Here we show that some variants of simian immunodeficiency virus (SIV) replicate efficiently in peripheral blood mononuclear cells (PBMCs) lacking a functional CCR5. There were differences in the replication patterns of sequential variants that evolved during SIVMne infection; the late-stage pathogenic variants were unable to replicate in PBMCs lacking CCR5, whereas the early- and intermediate-stage viruses replicated as well in PBMCs lacking CCR5 as they did in cells with wild-type CCR5. The coreceptor specificities of these sequential variants were compared using indicator cell lines expressing known SIV coreceptors. Among the known SIV coreceptors, there were none that were functional for the early and intermediate variants but not the late-stage variants, suggesting that the coreceptor used for replication in PBMCs may be a coreceptor that has not yet been described. Because some variants replicate with high efficiency in peripheral blood cells using this as yet uncharacterized cellular receptor, this coreceptor may be important for viral entry of some target cell populations in the host. PMID:12915585

  12. Early Immunologic Events at the Tick-Host Interface

    PubMed Central

    Heinze, Dar M.; Carmical, J. Russ; Aronson, Judith F.; Thangamani, Saravanan

    2012-01-01

    Ixodes species ticks are competent vectors of tick-borne viruses including tick-borne encephalitis and Powassan encephalitis. Tick saliva has been shown to facilitate and enhance viral infection. This likely occurs by saliva-mediated modulation of host responses into patterns favorable for viral infection and dissemination. Because of the rapid kinetics of tick-borne viral transmission, this modulation must occur as early as tick attachment and initiation of feeding. In this study, cutaneous bite-site lesions were analyzed using Affymetrix mouse genome 430A 2.0 arrays and histopathology at 1, 3, 6, and 12 hours after uninfected Ixodes scapularis nymphal tick attachment. At 1 and 3 hrs after attachment, the gene expression profile is markedly different than at later time points. Upregulated gene ontology term clusters enriched at 1 and 3 hrs were related to post-translational modification. At 6 and 12 hrs, cytoskeletal rearrangements, DNA replication/cell division, inflammation, and chemotaxis were prominent clusters. At 6 and 12 hrs, extracellular matrix, signaling, and DNA binding clusters were downregulated. Histopathological analysis shows minimal inflammation at 1 and 3 hrs but an appreciable neutrophil infiltrate at 6 and 12 hrs. In addition, putative hyperemia, localized necrosis, and increased ECM deposition were identified. Putting the gene expression and histopathology analysis together suggests early tick feeding is characterized by modulation of host responses in resident cells that merges into a nascent, neutrophil-driven immune response by 12 hrs post-attachment. PMID:23077588

  13. Population resilience to catastrophic mortality events during early life stages.

    PubMed

    Ohlberger, Jan; Langangen, Øystein

    2015-07-01

    Catastrophic mortality events that drastically reduce the abundance of a population or a particular life stage can have long-term ecological and economic effects, and are of great concern in species conservation and management. Severe die-offs may be caused by natural catastrophes such as disease outbreaks and extreme climates, or human-caused disturbances such as toxic spills. Forecasting potential impacts of such disturbances is difficult and highly uncertain due to unknown future conditions, including population status and environmental conditions at the time of impact. Here, we present a framework for quantifying the range of potential, population-level effects of catastrophic events based on a hindcasting approach. A dynamic population model with Bayesian parameter estimation is used to simulate the impact of severe (50-99%) mortality events during the early life stages of Northeast Arctic cod (Gadus morhua), an abundant marine fish population of high economic value. We quantify the impact of such die-offs in terms of subsequent changes in population biomass and harvest through direct comparison of simulated and historical trends, and estimate the duration of the impact as a measure of population resilience. Our results demonstrate strong resilience to catastrophic events that affect early life stages owing to density dependence in survival and a broad population age structure. Yet, while population recovery is. relatively fast, losses in harvest and economic value can be substantial. Future research efforts should focus on long-term and indirect effects via food web interactions in order to better understand the ecological and economic ramifications of catastrophic mortality events. PMID:26485960

  14. Early Cytokine Dysregulation and Viral Replication Are Associated with Mortality During Lethal Influenza Infection

    PubMed Central

    Vogel, Alexander J.; Harris, Seth; Marsteller, Nathan; Condon, Shirley A.

    2014-01-01

    Abstract Infection with influenza A virus (IAV) leads to acute lung injury and possibly fatal complications, especially in immunocompromised, elderly, or chronically infected individuals. Therefore, it is important to study the factors that lead to pathology and mortality in infected hosts. In this report, we analyze immune responses to infection at a sublethal (0.1 LD50) and lethal (1 LD50) dose of the highly pathogenic IAV A/Puerto Rico/8/34 (PR8). Our experiments revealed that infection with a 1 LD50 dose induced peak viral titers at day 2 compared to day 4 in the 0.1 LD50 dose. Moreover, early cytokine dysregulation was observed in the lethal dose with significantly elevated levels of IFN-α, TNF-α, CXCL9, IL-6, and MCP-1 produced at day 2. Early inflammatory responses following infection with 1 LD50 correlated with a greater influx of neutrophils into the lung. However, depletion of neutrophils enhanced morbidity following IAV infection. Though no differences in CD8+ cell function were observed, CD4+ effector responses were impaired in the lungs 8 days after infection with 1 LD50. Histological analysis revealed significant pathology in lethally infected mice at day 2 and day 6 postinfection, when viral titers remained high. Treating lethally infected mice with oseltamivir inhibited viral titers to sublethal levels, and abrogated the pathology associated with the lethal dose. Together, these results suggest that early cytokine dysregulation and viral replication play a role in pulmonary damage and high mortality in lethally infected mice. PMID:24787235

  15. Impact Constraints on Major Events in Early Mars History

    NASA Technical Reports Server (NTRS)

    Frey, H. V.

    2004-01-01

    MOLA data have revealed a large population of "Quasi-Circular Depressions" (QCDs) with little or no visible expression in image data. These likely buried impact basins have important implications for the age of the lowland crust, how that compares with original highland crust, and when and how the crustal dichotomy may have formed. The buried lowlands are of Early Noachian age, likely slightly younger than the buried highlands but older than the exposed (visible) highland surface. A depopulation of large visible basins at diameters 800 to 1300 km suggests some global scale event early in martian history, maybe related to the formation of the lowlands and/or the development of Tharsis. A suggested early disappearance of the global magnetic field can be placed within a temporal sequence of formation of the very largest impact basins. The global field appears to have disappeared at about the time the lowlands formed. It seems likely the topographic crustal dichotomy was produced very early in martian history by processes which operated very quickly. Thus there appears to have been a northern lowland throughout nearly all of martian history, predating the last of the really large impacts (Hellas, Argyre and Isidis) and their likely very significant environmental consequences.

  16. APOBEC3G restricts early HIV-1 replication in the cytoplasm of target cells

    SciTech Connect

    Anderson, Jenny L.; Hope, Thomas J.

    2008-05-25

    Cellular APOBEC3G (A3G) protein is packaged into human immunodeficiency virus type 1 (HIV-1) virions in producer cells yet restricts viral replication in target cells. To characterize this restriction in target cells, the effect of A3G on generating various HIV-1 cDNA products was measured by quantitative real-time PCR. A3G decreased cDNA products from Vif-deficient HIV-1, with minor effects on early reverse transcripts and larger declines in late reverse transcripts. However, the greatest decline was typically observed in nuclear 2-LTR circles. Moreover, the magnitude of these declines varied with A3G dose. Adding integration inhibitor did not stop the A3G-mediated loss in 2-LTR circles. Moreover, obstructing HIV-1 nuclear entry using vesicular stomatitis virus matrix protein did not stop the A3G-mediated decline in late reverse transcripts. Collectively, these data suggest that A3G has important restriction activity in the cytoplasm and progressively diminishes viral cytoplasmic and nuclear cDNA forms with increasing magnitude during restriction.

  17. Discovery of gramine derivatives that inhibit the early stage of EV71 replication in vitro.

    PubMed

    Wei, Yanhong; Shi, Liqiao; Wang, Kaimei; Liu, Manli; Yang, Qingyu; Yang, Ziwen; Ke, Shaoyong

    2014-01-01

    Enterovirus 71 (EV71) is a notable causative agent of hand, foot, and mouth disease in children, which is associated with an increased incidence of severe neurological disease and death, yet there is no specific treatment or vaccine for EV71 infections. In this study, the antiviral activity of gramine and 21 gramine derivatives against EV71 was investigated in cell-based assays. Eighteen derivatives displayed some degree of inhibitory effects against EV71, in that they could effectively inhibit virus-induced cytopathic effects (CPEs), but the anti-EV71 activity of the lead compound gramine was not observed. Studies on the preliminary modes of action showed that these compounds functioned by targeting the early stage of the EV71 lifecycle after viral entry, rather than inactivating the virus directly, inhibiting virus adsorption or affecting viral release from the cells. Among these derivatives, one (compound 4s) containing pyridine and benzothiazole units showed the most potency against EV71. Further studies demonstrated that derivative 4s could profoundly inhibit viral RNA replication, protein synthesis, and virus-induced apoptosis in RD cells. These results indicate that derivative 4s might be a feasible therapeutic agent against EV71 infection and that these gramine derivatives may provide promising lead scaffolds for the further design and synthesis of potential antiviral agents. PMID:24979400

  18. Biomarker changes across the Toarcian (early Jurassic) ocean anoxic event

    NASA Astrophysics Data System (ADS)

    Cohen, A. M.; Grocke, D. R.; Grosjean, E.; Summons, R. E.; Rothman, D. H.

    2004-12-01

    The Early Toarcian oceanic anoxic event (in the Jurassic, about 183 million years ago) is marked by the global distribution of black shales rich in organic carbon. It is recorded in the geochemical record with high concentrations of organic carbon and isotopic excursions in carbonate carbon, organic carbon and nitrogen. Although there are many hypotheses regarding this anoxic event, its causes and consequences are still not well understood. Here we investigate the evolution of molecular fossils, or biomarkers, across the Toarcian ocean anoxic event in order to elucidate the dynamics of interactions within the carbon cycle during this time. The biomarkers of thirteen samples which span the bulk organic carbon isotopic excursion are studied in detail. To infer the interaction between the primary and secondary reservoirs of oceanic organic carbon, we have analysed time series of isoprenoid (pristane and phytane) and n-alkane (n-C17 and n-C18) isotopic compositions. In addition to the isotopic analyses, we trace the evolution of distributions of all hydrocarbon biomarkers. Samples are from the high-resolution and well-studied Hawsker Bottoms section. Preliminary results show that the isotopes of pristane and phytane and the n-alkanes do not trace the negative excursion of bulk δ 13Corg. In addition, there is a change in isotopic ordering between the n-alkanes and the isoprenoids.

  19. Replication RCT of Early Universal Prevention Effects on Young Adult Substance Misuse

    PubMed Central

    Spoth, Richard; Trudeau, Linda; Redmond, Cleve; Shin, Chungyeol

    2014-01-01

    Objective For many substances, more frequent and problematic use occurs in young adulthood; these types of use are predicted by the timing of initiation during adolescence. We replicated and extended an earlier study examining whether delayed substance initiation during adolescence, resulting from universal preventive interventions implemented in middle school, reduces problematic use in young adulthood. Method Participants were middle school students from 36 Iowa schools randomly assigned to the Strengthening Families Program plus Life Skills Training (SFP 10–14 + LST), LST-only, or a control condition. Self-report questionnaires were collected at 11 time points, including four during young adulthood. The intercept (average level) and rate of change (slope) in young adult frequency measures (drunkenness, alcohol-related problems, cigarettes, and illicit drugs) across ages 19–22 were modeled as outcomes influenced by growth factors describing substance initiation during adolescence. Analyses entailed testing a two-step hierarchical latent growth curve model; models included the effects of baseline risk, intervention condition assignment, and their interaction. Results Analyses showed significant indirect intervention effects on the average levels of all young adult outcomes, through effects on adolescent substance initiation growth factors, along with intervention by risk interaction effects favoring the higher-risk subsample. Additional direct effects on young adult use were observed in some cases. Relative reduction rates were larger for the higher-risk subsample at age 22, ranging from 5.8% to 36.4% on outcomes showing significant intervention effects. Conclusions Universal preventive interventions implemented during early adolescence have the potential to decrease the rates of substance use and associated problems, into young adulthood. PMID:24821095

  20. Kinetics of the early events of GPCR signalling

    PubMed Central

    Adamson, Roslin J.; Watts, Anthony

    2014-01-01

    Neurotensin receptor type 1 (NTS1) is a G protein-coupled receptor (GPCR) that affects cellular responses by initiating a cascade of interactions through G proteins. The kinetic details for these interactions are not well-known. Here, NTS1-nanodisc-Gαs and Gαi1 interactions were studied. The binding affinities of Gαi1 and Gαs to NTS1 were directly measured by surface plasmon resonance (SPR) and determined to be 15 ± 6 nM and 31 ± 18 nM, respectively. This SPR configuration permits the kinetics of early events in signalling pathways to be explored and can be used to initiate descriptions of the GPCR interactome. PMID:25447525

  1. Sequence of Events in Measles Virus Replication: Role of Phosphoprotein-Nucleocapsid Interactions

    PubMed Central

    Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia

    2014-01-01

    ABSTRACT The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, PXD and NTAIL is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the PXD F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in PXD-to-NTAIL binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the PXD-NTAIL interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. IMPORTANCE Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ∼6,700-nucleotide messenger RNAs from six

  2. Early Events in the Molecular Pathogenesis of Lung Cancer.

    PubMed

    Kadara, Humam; Scheet, Paul; Wistuba, Ignacio I; Spira, Avrum E

    2016-07-01

    The majority of cancer-related deaths in the United States and worldwide are attributed to lung cancer. There are more than 90 million smokers in the United States who represent a significant population at elevated risk for lung malignancy. In other epithelial tumors, it has been shown that if neoplastic lesions can be detected and treated at their intraepithelial stage, patient prognosis is significantly improved. Thus, new strategies to detect and treat lung preinvasive lesions are urgently needed in order to decrease the overwhelming public health burden of lung cancer. Limiting these advances is a poor knowledge of the earliest events that underlie lung cancer development and that would constitute markers and targets for early detection and prevention. This review summarizes the state of knowledge of human lung cancer pathogenesis and the molecular pathology of premalignant lung lesions, with a focus on the molecular premalignant field that associates with lung cancer development. Lastly, we highlight new approaches and models to study genome-wide alterations in human lung premalignancy in order to facilitate the discovery of new markers for early detection and prevention of this fatal disease. Cancer Prev Res; 9(7); 518-27. ©2016 AACR. PMID:27006378

  3. Differential replication of circular DNA molecules co-injected into early Xenopus laevis embryos.

    PubMed Central

    Marini, N J; Hiriyanna, K T; Benbow, R M

    1989-01-01

    Replication of co-injected supercoiled DNA molecules in fertilized Xenopus eggs was monitored through the blastula stage of development. The extent of replication, as measured by 32P-dTMP incorporation into form I DNA, was directly proportional to the number of molecules, rather than the size, of the plasmid injected. Although only a small fraction of molecules of either template was replicated, incorporation was predominantly into full length daughter molecules. Over at least a 20-fold concentration range of microinjected DNA, injection of equal masses of DNA resulted in greater incorporation into the smaller form I DNA present in molar excess. The extent of incorporation into supercoiled DNA for a particular plasmid was apparently independent of the concentration of a second, co-injected plasmid. The relative extents of replication of co-injected supercoiled templates could be altered simply by changing the molar ratios of the templates. Images PMID:2762153

  4. Classifying onset durations of early VLF events: Scattered field analysis and new insights

    NASA Astrophysics Data System (ADS)

    Kotovsky, D. A.; Moore, R. C.

    2015-08-01

    The physical processes responsible for a variety of early VLF scattering events have not yet been satisfactorily identified. Properly categorizing the early VLF event type is imperative to understand the causative physical processes involved. In this paper, the onset durations of 26 exceptionally high signal-to-noise ratio early VLF scattering events are analyzed, using scattered fields to classify events. New observations of events that exhibit "slow" amplitude changes, but "fast" scattered field changes are presented, which call into question previous analyses of early/slow events. We separately identify and analyze three early VLF events that definitively exhibit slow scattered field behavior. Additionally, we identify a significant number of events which have onset durations between the current definitions of fast and slow. Four events are observed which unambiguously exhibit a rapid initial rotation of the scattered field phasor during the first few seconds of the recovery stage. Possible physical mechanisms are discussed.

  5. Characterization of a Replication-Incompetent Pseudorabies Virus Mutant Lacking the Sole Immediate Early Gene IE180

    PubMed Central

    Wu, Brendan W.

    2014-01-01

    ABSTRACT The alphaherpesvirus pseudorabies virus (PRV) encodes a single immediate early gene called IE180. The IE180 protein is a potent transcriptional activator of viral genes involved in DNA replication and RNA transcription. A PRV mutant with both copies of IE180 deleted was constructed 20 years ago (S. Yamada and M. Shimizu, Virology 199:366–375, 1994, doi:10.1006/viro.1994.1134), but propagation of the mutant depended on complementing cell lines that expressed the toxic IE180 protein constitutively. Recently, Oyibo et al. constructed a novel set of PRV IE180 mutants and a stable cell line with inducible IE180 expression (H. Oyibo, P. Znamenskiy, H. V. Oviedo, L. W. Enquist, A. Zador, Front. Neuroanat. 8:86, 2014, doi:10.3389/fnana.2014.00086), which we characterized further here. These mutants failed to replicate new viral genomes, synthesize immediate early, early, or late viral proteins, and assemble infectious virions. The PRV IE180-null mutant did not form plaques in epithelial cell monolayers and could not spread from primary infected neurons to second-order neurons in culture. PRV IE180-null mutants lacked the property of superinfection exclusion. When PRV IE180-null mutants infected cells first, subsequent superinfecting viruses were not blocked in cell entry and formed replication compartments in epithelial cells, fibroblasts, and neurons. Cells infected with PRV IE180-null mutants survived as long as uninfected cells in culture while expressing a fluorescent reporter gene. Transcomplementation with IE180 in epithelial cells restored all mutant phenotypes to wild type. The conditional expression of PRV IE180 protein enables the propagation of replication-incompetent PRV IE180-null mutants and will facilitate construction of long-term single-cell-infecting PRV mutants for precise neural circuit tracing and high-capacity gene delivery vectors. PMID:25389174

  6. The Salmonella Typhimurium effector protein SopE transiently localizes to the early SCV and contributes to intracellular replication.

    PubMed

    Vonaesch, Pascale; Sellin, Mikael E; Cardini, Steven; Singh, Vikash; Barthel, Manja; Hardt, Wolf-Dietrich

    2014-12-01

    Salmonella enterica serovar Typhimurium (S. Tm) is a facultative intracellular pathogen that induces entry into non-phagocytic cells by a Type III secretion system (TTSS) and cognate effector proteins. Upon host cell entry, S. Tm expresses a second TTSS and subverts intracellular trafficking to create a replicative niche - the Salmonella-containing vacuole (SCV). SopE, a guanidyl exchange factor (GEF) for Rac1 and Cdc42, is translocated by the TTSS-1 upon host cell contact and promotes entry through triggering of actin-dependent ruffles. After host cell entry, the bulk of SopE undergoes proteasomal degradation. Here we show that a subfraction is however detectable on the nascent SCV membrane up to ∼ 6 h post infection. Membrane localization of SopE and the closely related SopE2 differentially depend on the Rho-GTPase-binding GEF domain, and to some extent involves also the unstructured N-terminus. SopE localizes transiently to the early SCV, dependent on continuous synthesis and secretion by the TTSS-1 during the intracellular state. Mutant strains lacking SopE or SopE2 are attenuated in early intracellular replication, while complementation restores this defect. Hence, the present study reveals an unanticipated role for SopE and SopE2 in establishing the Salmonella replicative niche, and further emphasizes the importance of entry effectors in later stages of host-cell manipulation. PMID:25052734

  7. Replication Study of the First Step to Success Early Intervention Program

    ERIC Educational Resources Information Center

    Lien-Thorne, Stephanie; Kamps, Debra

    2005-01-01

    This article describes a replication of the "First Step to Success" program (Walker, Stiller, Severson, & Golly, 1998) with at-risk students in the first and second grade to determine program effectiveness in decreasing inappropriate behaviors and increasing academic engagement time. This expands the "First Step to Success" program to (1) serve…

  8. Rhythmic Engagement with Music in Early Childhood: A Replication and Extension

    ERIC Educational Resources Information Center

    Ilari, Beatriz

    2015-01-01

    The purpose of this study was to replicate and extend previous findings on spontaneous movement and rhythmic engagement with music in infancy. Using the identical stimuli and procedures from the original study, I investigated spontaneous rhythmic movements in response to music, infant-directed speech, and contrasting rhythmic patterns in 30…

  9. Baculovirus resistance in codling moth (Cydia pomonella L.) caused by early block of virus replication.

    PubMed

    Asser-Kaiser, Sabine; Radtke, Pit; El-Salamouny, Said; Winstanley, Doreen; Jehle, Johannes A

    2011-02-20

    An up to 10,000-fold resistance against the biocontrol agent Cydia pomonella granulovirus (CpGV) was observed in field populations of codling moth, C. pomonella, in Europe. Following different experimental approaches, a modified peritrophic membrane, a modified midgut receptor, or a change of the innate immune response could be excluded as possible resistance mechanisms. When CpGV replication was traced by quantitative PCR in different tissues of susceptible and resistant insects after oral and intra-hemocoelic infection, no virus replication could be detected in any of the tissues of resistant insects, suggesting a systemic block prior to viral DNA replication. This conclusion was corroborated by fluorescence microscopy using a modified CpGV (bacCpGV(hsp-eGFP)) carrying enhanced green fluorescent gene (eGFP), which showed that infection in resistant insects did not spread. In conclusion, the different lines of evidence indicate that CpGV can enter but not replicate in the cells of resistant codling moth larvae. PMID:21190707

  10. Absence of the BaeR protein leads to the early initiation of DNA replication in Escherichia coli.

    PubMed

    Yao, Y; Wunier, W; Morigen, M

    2015-01-01

    Escherichia coli cells have dozens of two-component systems to sense and respond to various stimuli, and thereby cope with changing environments. BaeS/BaeR is one such two-component system, and it deals with a variety of envelope stresses. Interestingly, the ArcA/ArcB and TorS/TorR two-component systems are known to be associated with initiation of DNA replication; however, the effects of BaeS/BaeR on initiation of DNA replication remain unknown. Flow cytometry analysis revealed that the average number of replication origins (oriCs) per cell in ΔbaeR mutants was approximately 30% higher than that in wild-type cells. So was the growth rate of ΔbaeR cells. Ectopic expression of BaeR from the pbaeR plasmid reversed the ΔbaeR mutant phenotypes. The results indicate that absence of BaeR leads to the early initiation of DNA replication. Further, deletion of BaeR caused an increase in the amount of DnaA per cell, but did not change concentration of DnaA, which is the initiator protein.The average number of oriCs per cell in Δspy mutants was the same as that found in the wild-type cells although spy gene expression is controlled by BaeR. These results suggest that BaeR may indirectly affect initiation of replication by controlling expression of the dnaA gene. PMID:26681035

  11. The expression of N-terminal deletion DNA pilot proteins inhibits the early stages of phiX174 replication.

    PubMed

    Ruboyianes, Mark V; Chen, Min; Dubrava, Mathew S; Cherwa, James E; Fane, Bentley A

    2009-10-01

    The phiX174 DNA pilot protein H contains four predicted C-terminal coiled-coil domains. The region of the gene encoding these structures was cloned, expressed in vivo, and found to strongly inhibit wild-type replication. DNA and protein synthesis was investigated in the absence of de novo H protein synthesis and in wild-type-infected cells expressing the inhibitory proteins (DeltaH). The expression of the DeltaH proteins interfered with early stages of DNA replication, which did not require de novo H protein synthesis, suggesting that the inhibitory proteins interfere with the wild-type H protein that enters the cell with the penetrating DNA. As transcription and protein synthesis are dependent on DNA replication in positive single-stranded DNA life cycles, viral protein synthesis was also reduced. However, unlike DNA synthesis, efficient viral protein synthesis required de novo H protein synthesis, a novel function for this protein. A single amino acid change in the C terminus of protein H was both necessary and sufficient to confer resistance to the inhibitory DeltaH proteins, restoring both DNA and protein synthesis to wild-type levels. DeltaH proteins derived from the resistant mutant did not inhibit wild-type or resistant mutant replication. The inhibitory effects of the DeltaH proteins were lessened by the coexpression of the internal scaffolding protein, which may suppress H-H protein interactions. While coexpression relieved the block in DNA biosynthesis, viral protein synthesis remained suppressed. These data indicate that protein H's role in DNA replication and stimulating viral protein synthesis can be uncoupled. PMID:19640994

  12. Model of early self-replication based on covalent complementarity for a copolymer of glycerate-3-phosphate and glycerol-3-phosphate

    NASA Astrophysics Data System (ADS)

    Weber, Arthur L.

    1989-03-01

    Glyceraldehyde-3-phosphate acts as the substrate in a model of early self-replication of a phosphodiester copolymer of glycerate-3-phosphate and glycerol-3-phosphate. This model of self-replication is based on covalent complementarity in which information transfer is mediated by a single covalent bond, in contrast to multiple weak interactions that establish complementarity in nucleic acid replication. This replication model is connected to contemporary biochemistry through its use of glyceraldehyde-3-phosphate, a central metabolite of glycolysis and photosynthesis.

  13. Model of early self-replication based on covalent complementarity for a copolymer of glycerate-3-phosphate and glycerol-3-phosphate

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Glyceraldehyde-3-phosphate acts as the substrate in a model of early self-replication of a phosphodiester copolymer of glycerate-3-phosphate and glycerol-3-phosphate. This model of self-replication is based on covalent complementarity in which information transfer is mediated by a single covalent bond, in contrast to multiple weak interactions that establish complementarity in nucleic acid replication. This replication model is connected to contemporary biochemistry through its use of glyceraldehyde-3-phosphate, a central metabolite of glycolysis and photosynthesis.

  14. Replication stress in early S phase generates apparent micronuclei and chromosome rearrangement in fission yeast

    PubMed Central

    Sabatinos, Sarah A.; Ranatunga, Nimna S.; Yuan, Ji-Ping; Green, Marc D.; Forsburg, Susan L.

    2015-01-01

    DNA replication stress causes genome mutations, rearrangements, and chromosome missegregation, which are implicated in cancer. We analyze a fission yeast mutant that is unable to complete S phase due to a defective subunit of the MCM helicase. Despite underreplicated and damaged DNA, these cells evade the G2 damage checkpoint to form ultrafine bridges, fragmented centromeres, and uneven chromosome segregations that resembles micronuclei. These micronuclei retain DNA damage markers and frequently rejoin with the parent nucleus. Surviving cells show an increased rate of mutation and chromosome rearrangement. This first report of micronucleus-like segregation in a yeast replication mutant establishes underreplication as an important factor contributing to checkpoint escape, abnormal chromosome segregation, and chromosome instability. PMID:26246602

  15. Early Function of the Abutilon Mosaic Virus AC2 Gene as a Replication Brake

    PubMed Central

    Krenz, Björn; Deuschle, Kathrin; Deigner, Tobias; Unseld, Sigrid; Kepp, Gabi; Wege, Christina; Kleinow, Tatjana

    2015-01-01

    ABSTRACT The C2/AC2 genes of monopartite/bipartite geminiviruses of the genera Begomovirus and Curtovirus encode important pathogenicity factors with multiple functions described so far. A novel function of Abutilon mosaic virus (AbMV) AC2 as a replication brake is described, utilizing transgenic plants with dimeric inserts of DNA B or with a reporter construct to express green fluorescent protein (GFP). Their replicational release upon AbMV superinfection or the individual and combined expression of epitope-tagged AbMV AC1, AC2, and AC3 was studied. In addition, the effects were compared in the presence and in the absence of an unrelated tombusvirus suppressor of silencing (P19). The results show that AC2 suppresses replication reproducibly in all assays and that AC3 counteracts this effect. Examination of the topoisomer distribution of supercoiled DNA, which indicates changes in the viral minichromosome structure, did not support any influence of AC2 on transcriptional gene silencing and DNA methylation. The geminiviral AC2 protein has been detected here for the first time in plants. The experiments revealed an extremely low level of AC2, which was slightly increased if constructs with an intron and a hemagglutinin (HA) tag in addition to P19 expression were used. AbMV AC2 properties are discussed with reference to those of other geminiviruses with respect to charge, modification, and size in order to delimit possible reasons for the different behaviors. IMPORTANCE The (A)C2 genes encode a key pathogenicity factor of begomoviruses and curtoviruses in the plant virus family Geminiviridae. This factor has been implicated in the resistance breaking observed in agricultural cotton production. AC2 is a multifunctional protein involved in transcriptional control, gene silencing, and regulation of basal biosynthesis. Here, a new function of Abutilon mosaic virus AC2 in replication control is added as a feature of this protein in viral multiplication, providing a novel

  16. Eclipse period during replication of plasmid R1: contributions from structural events and from the copy-number control system.

    PubMed

    Olsson, Jan A; Berg, Otto G; Dasgupta, Santanu; Nordström, Kurt

    2003-10-01

    The eclipse period (the time period during which a newly replicated plasmid copy is not available for a new replication) of plasmid R1 in Escherichia coli was determined with the classic Meselson-Stahl density-shift experiment. A mini-plasmid with the wild-type R1 replicon and a mutant with a thermo-inducible runaway-replication phenotype were used in this work. The eclipses of the chromosome and of the wild-type plasmid were 0.6 and 0.2 generation times, respectively, at temperatures ranging from 30 degrees C to 42 degrees C. The mutant plasmid had a similar eclipse at temperatures up to 38 degrees C. At 42 degrees C, the plasmid copy number increased rapidly because of the absence of replication control and replication reached a rate of 350-400 plasmid replications per cell and cell generation. During uncontrolled replication, the eclipse was about 3 min compared with 10 min at controlled replication (the wild-type plasmid at 42 degrees C). Hence, the copy-number control system contributed significantly to the eclipse. The eclipse in the absence of copy-number control (3 min) presumably is caused by structural requirements: the covalently closed circular plasmid DNA has to regain the right degree of superhelicity needed for initiation of replication and it takes time to assemble the initiation factors. PMID:14507381

  17. Early Paleozoic and Early Mesozoic intraplate tectonic and magmatic events in the Cathaysia Block, South China

    NASA Astrophysics Data System (ADS)

    Shu, Liangshu; Wang, Bo; Cawood, Peter A.; Santosh, M.; Xu, Zhiqin

    2015-08-01

    The geodynamic framework of the South China Craton in the Early Paleozoic and Early Mesozoic has been modeled as developing through either oceanic convergence or intracontinental settings. On the basis of an integrated structural, geochemical, zircon U-Pb and Hf isotopic, and mica 40Ar/39Ar geochronologic study we establish that an intracontinental setting is currently the best fit for the available data. Our results suggest that widespread tectonomagmatic activity involving granite emplacement and mylonitic deformation occurred during two distinct stages: ~435-415 Ma and ~230-210 Ma. The coeval nature of emplacement of the plutons and their ductile deformation is corroborated by the subparallel orientation of the mylonitic foliation along the pluton margins, gneissose foliation in the middle part of pluton, the magmatic foliation within the plutons, and the schistosity in the surrounding metamorphosed country rocks. The 435-415 Ma granitoids exhibit peraluminous, high-K characteristics, and zircons show negative ɛHf(t) values (average -6.2, n = 66), and Paleoproterozoic two-stage model ages of circa 2.21-1.64 Ga (average 1.84 Ga). The data suggest that the Early Paleozoic plutons were derived from the partial melting of the Paleoproterozoic basement of the Cathaysia Block. The 230-210 Ma granites are potassic and have zircons with ɛHf(t) values of -2.8--8.7 (average -5.4, n = 62), corresponding to TDM2 ages ranging from 2.0 to 1.44 Ga (average 1.64 Ga), suggesting that the Early Mesozoic partial melts in Cathaysia were also derived from basement. The geochemical distinction between the two phases of granites traces continental crustal evolution with time, with the Early Mesozoic crust enriched in potassium, silicon, and aluminum, but deficient in calcium, relative to the Paleozoic crust. Kinematical investigations provide evidence for an early-stage ductile deformation with a doubly vergent thrusting pattern dated at 433 ± 1 to 428 ± 1 Ma (40Ar/39Ar furnace

  18. The replication origin decision point is a mitogen-independent, 2-aminopurine-sensitive, G1-phase event that precedes restriction point control.

    PubMed Central

    Wu, J R; Gilbert, D M

    1997-01-01

    At a distinct point during G1 phase (the origin decision point [ODP]), Chinese hamster ovary (CHO) cell nuclei experience a transition (origin choice) that is required for specific recognition of the dihydrofolate reductase (DHFR) origin locus by Xenopus egg extracts. We have investigated the relationship between the ODP and progression of CHO cells through G1 phase. Selection of the DHFR origin at the ODP was rapidly inhibited by treatment of early G1-phase cells with the protein kinase inhibitor 2-aminopurine (2-AP). Inhibition of the ODP required administration of 2-AP at least 3 h prior to phosphorylation of the retinoblastoma tumor suppressor protein (Rb) and the restriction point (R point). Cells deprived of either serum or isoleucine from metaphase throughout early G1 phase acquired the capacity to replicate in Xenopus egg extract (replication licensing) and subsequently passed through the ODP on the same schedule as cells cultured in complete growth medium. After growth arrest at the R point with hypophosphorylated Rb protein, serum- or isoleucine-deprived cells experienced a gradual loss of replication licensing. However, recognition of the DHFR origin by Xenopus egg cytosol remained stable in growth-arrested cells until the point at which all nuclei had lost the capacity to initiate replication. These results provide evidence that the ODP requires a mitogen-independent protein kinase that is activated after replication licensing and prior to R-point control. PMID:9234688

  19. Early Responsivity to Moral Events: Physiological and Behavioral Correlates?

    ERIC Educational Resources Information Center

    Lamb, Sharon; And Others

    This study investigated toddlers' reactions to morally related events to determine whether age was a factor in emotional reaction, whether the middle of the second year was a salient time for the emergence of emotional reactions to such events, and whether heart rate change could be used as a new measure of moral responsivity. While their heart…

  20. Replicating vaccines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Early work on fish immunology and disease resistance demonstrated fish (like animals and humans) that survived infection were typically resistant to re-infection with the same pathogen. The concepts of resistance upon reinfection lead to the research and development of replicating (live) vaccines in...

  1. Application of conditionally replicating adenoviruses in tumor early diagnosis technology, gene-radiation therapy and chemotherapy.

    PubMed

    Li, Shun; Ou, Mengting; Wang, Guixue; Tang, Liling

    2016-10-01

    Conditionally replicating adenoviruses (CRAds), or known as replication-selective adenoviruses, were discovered as oncolytic gene vectors several years ago. They have a strong ability of scavenging tumor and lesser toxicity to normal tissue. CRAds not only have a tumor-killing ability but also can combine with gene therapy, radiotherapy, and chemotherapy to induce tumor cell apoptosis. In this paper, we review the structure of CRAds and CRAd vectors and summarize the current application of CRAds in tumor detection as well as in radiotherapy and suicide gene-mediating chemotherapy. We also propose further research strategies that can improve the application value of CRAds, including enhancing tumor destruction effect, further reducing toxic effect, reducing immunogenicity, constructing CRAds that can target tumor stem cells, and trying to use mesenchymal stem cells (MSCs) as the carriers for oncolytic adenoviruses. As their importance to cancer diagnosis, gene-radiation, and chemotherapy, CRAds may play a considerable role in clinical diagnosis and various cancer treatments in the future. PMID:27557721

  2. Early events in cell spreading as a model for quantitative analysis of biomechanical events.

    PubMed

    Wolfenson, Haguy; Iskratsch, Thomas; Sheetz, Michael P

    2014-12-01

    In this review, we focus on the early events in the process of fibroblast spreading on fibronectin matrices of different rigidities. We present a focused position piece that illustrates the many different tests that a cell makes of its environment before it establishes mature matrix adhesions. When a fibroblast is placed on fibronectin-coated glass surfaces at 37°C, it typically spreads and polarizes within 20-40 min primarily through αvβ3 integrin binding to fibronectin. In that short period, the cell goes through three major phases that involve binding, integrin activation, spreading, and mechanical testing of the surface. The advantage of using the model system of cell spreading from the unattached state is that it is highly reproducible and the stages that the cell undergoes can thus be studied in a highly quantitative manner, in both space and time. The mechanical and biochemical parameters that matter in this example are often surprising because of both the large number of tests that occur and the precision of the tests. We discuss our current understanding of those tests, the decision tree that is involved in this process, and an extension to the behavior of the cells at longer time periods when mature adhesions develop. Because many other matrices and integrins are involved in cell-matrix adhesion, this model system gives us a limited view of a subset of cellular behaviors that can occur. However, by defining one cellular process at a molecular level, we know more of what to expect when defining other processes. Because each cellular process will involve some different proteins, a molecular understanding of multiple functions operating within a given cell can lead to strategies to selectively block a function. PMID:25468330

  3. Type I Interferon Released by Myeloid Dendritic Cells Reversibly Impairs Cytomegalovirus Replication by Inhibiting Immediate Early Gene Expression

    PubMed Central

    Holzki, Julia Katharina; Dağ, Franziska; Dekhtiarenko, Iryna; Rand, Ulfert; Casalegno-Garduño, Rosaely; Trittel, Stephanie; May, Tobias; Riese, Peggy

    2015-01-01

    ABSTRACT Cytomegalovirus (CMV) is a ubiquitous beta-herpesvirus whose reactivation from latency is a major cause of morbidity and mortality in immunocompromised hosts. Mouse CMV (MCMV) is a well-established model virus to study virus-host interactions. We showed in this study that the CD8-independent antiviral function of myeloid dendritic cells (mDC) is biologically relevant for the inhibition of MCMV replication in vivo and in vitro. In vivo ablation of CD11c+ DC resulted in higher viral titers and increased susceptibility to MCMV infection in the first 3 days postinfection. We developed in vitro coculture systems in which we cocultivated MCMV-infected endothelial cells or fibroblasts with T cell subsets and/or dendritic cells. While CD8 T cells failed to control MCMV replication, bone marrow-derived mDC reduced viral titers by a factor of up to 10,000. Contact of mDC with the infected endothelial cells was crucial for their antiviral activity. Soluble factors secreted by the mDC blocked MCMV replication at the level of immediate early (IE) gene expression, yet the viral lytic cycle reinitiated once the mDC were removed from the cells. On the other hand, the mDC did not impair MCMV replication in cells deficient for the interferon (IFN) alpha/beta receptor (IFNAR), arguing that type I interferons were critical for viral control by mDC. In light of our recent observation that type I IFN is sufficient for the induction of latency immediately upon infection, our results imply that IFN secreted by mDC may play an important role in the establishment of CMV latency. IMPORTANCE Numerous studies have focused on the infection of DC with cytomegaloviruses and on the establishment of latency within them. However, almost all of these studies have relied on the infection of DC monocultures in vitro, whereas DC are just one among many cell types present in an infection site in vivo. To mimic this aspect of the in vivo situation, we cocultured DC with infected endothelial cells

  4. Prolidase Is Required for Early Trafficking Events during Influenza A Virus Entry

    PubMed Central

    Pohl, Marie O.; Edinger, Thomas O.

    2014-01-01

    ABSTRACT Influenza A virus (IAV) entry is a multistep process that requires the interaction of the virus with numerous host factors. In this study, we demonstrate that prolidase (PEPD) is a cellular factor required by IAV for successful entry into target cells. PEPD was selected as a candidate during an entry screen performed on nonvalidated primary hits from previously published genome-wide small interfering RNA (siRNA) screens. siRNA-mediated depletion of PEPD resulted in the decreased growth of IAV during mono- and multicycle growth. This growth defect was independent of cell type or virus strain. Furthermore, IAV restriction was apparent as early as 3 h postinfection, and experiments in the absence of protein biosynthesis revealed that the nuclear import of viral ribonucleoprotein complexes (vRNPs) was already blocked in the absence of PEPD. These results led us to investigate which step during entry was affected. Receptor expression, IAV attachment, or IAV internalization was not dependent on the presence of PEPD. However, when looking at the distribution of incoming IAV particles in PEPD-knockdown cells, we found a localization pattern that differed from that in control cells: IAV mostly localized to the cell periphery, and consequently, viral particles displayed reduced colocalization with early and late endosome markers and fusion between viral and endosomal membranes was strongly reduced. Finally, experiments using a competitive inhibitor of PEPD catalytic activity suggested that the enzymatic function of the dipeptidase is required for its proviral effect on IAV entry. In sum, this study establishes PEPD as a novel entry factor required for early endosomal trafficking of IAV. IMPORTANCE Influenza A virus (IAV) continues to be a constant threat to public health. As IAV relies on its host cell for replication, the identification of host factors required by the virus is of importance. First, such studies often reveal novel functions of cellular factors and

  5. Opportunity, Community, and Early Adolescent Pregnancy: A Replication of Research with Older Teenaged Girls.

    ERIC Educational Resources Information Center

    Bickel, Robert; McDonough, Meghan; Williams, Tony

    1999-01-01

    Attempts to broaden the analytic categories for understanding early-adolescent pregnancy, suggesting an antidote to the methodological individualism that emphasizes individual and family characteristics by using broader contextual factors. Seemingly imprudent behaviors can be rendered interpretably rational when placed in social context. Without…

  6. Externalizing in Preschoolers and Early Adolescents: A Cross-Study Replication of a Family Model.

    ERIC Educational Resources Information Center

    Miller, Nancy B.; And Others

    1993-01-01

    Examined links between parents' depression, marital quality, and parenting style, and their preschool and early adolescent children's angry, defiant, and acting-out behaviors. Parents' depression was related to the quality of their marital relationship and their parenting style, but not their children's behavior. (BC)

  7. EARLY CAREER: THE HAZARDS OF EXTREME CLIMATIC EVENTS: PREDICTING IMPACTS

    EPA Science Inventory

    One of the greatest threats to water quality is water-borne pathogens, which are more common now than they have been historically. A factor implicated in the emergence of water-borne diseases is climate change-driven increases in extreme climatic events. Although climatic e...

  8. Topologically associating domains and their long-range contacts are established during early G1 coincident with the establishment of the replication-timing program

    PubMed Central

    Dileep, Vishnu; Ay, Ferhat; Sima, Jiao; Vera, Daniel L.; Noble, William S.; Gilbert, David M.

    2015-01-01

    Mammalian genomes are partitioned into domains that replicate in a defined temporal order. These domains can replicate at similar times in all cell types (constitutive) or at cell type-specific times (developmental). Genome-wide chromatin conformation capture (Hi-C) has revealed sub-megabase topologically associating domains (TADs), which are the structural counterparts of replication domains. Hi-C also segregates inter-TAD contacts into defined 3D spatial compartments that align precisely to genome-wide replication timing profiles. Determinants of the replication-timing program are re-established during early G1 phase of each cell cycle and lost in G2 phase, but it is not known when TAD structure and inter-TAD contacts are re-established after their elimination during mitosis. Here, we use multiplexed 4C-seq to study dynamic changes in chromatin organization during early G1. We find that both establishment of TADs and their compartmentalization occur during early G1, within the same time frame as establishment of the replication-timing program. Once established, this 3D organization is preserved either after withdrawal into quiescence or for the remainder of interphase including G2 phase, implying 3D structure is not sufficient to maintain replication timing. Finally, we find that developmental domains are less well compartmentalized than constitutive domains and display chromatin properties that distinguish them from early and late constitutive domains. Overall, this study uncovers a strong connection between chromatin re-organization during G1, establishment of replication timing, and its developmental control. PMID:25995270

  9. Timing of Childhood Events and Early-Adult Household Formation.

    ERIC Educational Resources Information Center

    Hill, Martha S.; And Others

    1996-01-01

    Identified a number of risk factors contributing to early household formation. Found that for girls, factors included mother's educational level and birth order; for boys, parental divorce at any stage of childhood. Risk factors common to boys and girls were age of mother at time of child's birth and race. (HTH)

  10. Marek's disease virus influences the core gut microbiome of the chicken during the early and late phases of viral replication.

    PubMed

    Perumbakkam, Sudeep; Hunt, Henry D; Cheng, Hans H

    2014-10-01

    Marek's disease (MD) is an important neoplastic disease of chickens caused by the Marek's disease virus (MDV), an oncogenic alphaherpesvirus. In this study, dysbiosis induced by MDV on the core gut flora of chicken was assessed using next generation sequence (NGS) analysis. Total fecal and cecum-derived samples from individual birds were used to estimate the influence of MDV infection on the gut microbiome of chicken. Our analysis shows that MDV infection alters the core gut flora in the total fecal samples relatively early after infection (2-7 days) and in the late phase of viral infection (28-35 days) in cecal samples, corresponding well with the life cycle of MDV. Principle component analyses of total fecal and cecal samples showed clustering at the early and late time points, respectively. The genus Lactobacillus was exclusively present in the infected samples in both total fecal and cecal bird samples. The community colonization of core gut flora was altered by viral infection, which manifested in the enrichment of several genera during the early and late phases of MDV replication. The results suggest a relationship between viral infection and microbial composition of the intestinal tract that may influence inflammation and immunosuppression of T and B cells in the host. PMID:25065611

  11. Temperature variability and early clustering of record-breaking events

    NASA Astrophysics Data System (ADS)

    Anderson, Amalia; Kostinski, Alex

    2016-05-01

    As the number of climatological studies using record-breaking statistics is growing rapidly, understanding the sensitivity of the chosen time period becomes essential. To that end, here we examine the evolving variability of monthly mean temperatures and its dependence on beginning and final year. Specifically, we use an index, α, based on record-breaking statistics and employing reversibility such that < α>=0 indicates no trend in variability. Generally, < α> has decreased between 1900 and 2013, indicating decreasing variability relative to early decades for stations from the contiguous USA (United States Historical Climatology Network, version 2.5). We find, somewhat surprisingly, that the observed decrease is due to an early excess of records beginning in 1917 (record low value) and 1921 (record high value). While detailed results depend on whether the data is gridded, detrended, etc., the general finding appears remarkably robust and holds globally as well.

  12. Catching jetted tidal disruption events early in millimetre

    NASA Astrophysics Data System (ADS)

    Yuan, Qiang; Wang, Q. Daniel; Lei, Wei-Hua; Gao, He; Zhang, Bing

    2016-09-01

    Relativistic jets can form from at least some tidal disruption events (TDEs) of (sub-)stellar objects around supermassive black holes. We detect the millimetre (MM) emission of IGR J12580+0134 - the nearest TDE known in the galaxy NGC 4845 at the distance of only 17 Mpc, based on Planck all-sky survey data. The data show significant flux jumps after the event, followed by substantial declines, in all six high-frequency Planck bands from 100 to 857 GHz. We further show that the evolution of the MM flux densities is well consistent with our model prediction from an off-axis jet, as was initially suggested from radio and X-ray observations. This detection represents the second TDE with MM detections; the other is Sw J1644+57, an on-axis jetted TDE at redshift of 0.35. Using the on- and off-axis jet models developed for these two TDEs as templates, we estimate the detection potential of similar events with the Large Millimeter Telescope (LMT) and the Atacama Large Millimeter/submillimeter Array (ALMA). Assuming an exposure of 1 h, we find that the LMT (ALMA) can detect jetted TDEs up to redshifts z ˜ 1 (2), for a typical disrupted star mass of ˜1 M⊙. The detection rates of on- and off-axis TDEs can be as high as ˜0.6 (13) and 10 (220) yr-1, respectively, for the LMT (ALMA). We briefly discuss how such observations, together with follow-up radio monitoring, may lead to major advances in understanding the jetted TDEs themselves and the ambient environment of the circumnuclear medium.

  13. Early activation of MyD88-mediated autophagy sustains HSV-1 replication in human monocytic THP-1 cells.

    PubMed

    Siracusano, Gabriel; Venuti, Assunta; Lombardo, Daniele; Mastino, Antonio; Esclatine, Audrey; Sciortino, Maria Teresa

    2016-01-01

    Autophagy is a cellular degradation pathway that exerts numerous functions in vital biological processes. Among these, it contributes to both innate and adaptive immunity. On the other hand, pathogens have evolved strategies to manipulate autophagy for their own advantage. By monitoring autophagic markers, we showed that HSV-1 transiently induced autophagosome formation during early times of the infection of monocytic THP-1 cells and human monocytes. Autophagy is induced in THP-1 cells by a mechanism independent of viral gene expression or viral DNA accumulation. We found that the MyD88 signaling pathway is required for HSV-1-mediated autophagy, and it is linked to the toll-like receptor 2 (TLR2). Interestingly, autophagy inhibition by pharmacological modulators or siRNA knockdown impaired viral replication in both THP-1 cells and human monocytes, suggest that the virus exploits the autophagic machinery to its own benefit in these cells. Taken together, these findings indicate that the early autophagic response induced by HSV-1 exerts a proviral role, improving viral production in a semi-permissive model such as THP-1 cells and human monocytes. PMID:27509841

  14. Early activation of MyD88-mediated autophagy sustains HSV-1 replication in human monocytic THP-1 cells

    PubMed Central

    Siracusano, Gabriel; Venuti, Assunta; Lombardo, Daniele; Mastino, Antonio; Esclatine, Audrey; Sciortino, Maria Teresa

    2016-01-01

    Autophagy is a cellular degradation pathway that exerts numerous functions in vital biological processes. Among these, it contributes to both innate and adaptive immunity. On the other hand, pathogens have evolved strategies to manipulate autophagy for their own advantage. By monitoring autophagic markers, we showed that HSV-1 transiently induced autophagosome formation during early times of the infection of monocytic THP-1 cells and human monocytes. Autophagy is induced in THP-1 cells by a mechanism independent of viral gene expression or viral DNA accumulation. We found that the MyD88 signaling pathway is required for HSV-1-mediated autophagy, and it is linked to the toll-like receptor 2 (TLR2). Interestingly, autophagy inhibition by pharmacological modulators or siRNA knockdown impaired viral replication in both THP-1 cells and human monocytes, suggest that the virus exploits the autophagic machinery to its own benefit in these cells. Taken together, these findings indicate that the early autophagic response induced by HSV-1 exerts a proviral role, improving viral production in a semi-permissive model such as THP-1 cells and human monocytes. PMID:27509841

  15. Stories from a Historic Event: 2008 Working Forum on Men in Early Care and Education

    ERIC Educational Resources Information Center

    Piburn, Don

    2008-01-01

    The 2008 Working Forum on Men in Early Care in Education (WFMECE) was a first-of-its-kind event and is now part of the collective history. Sponsored by the World Forum Foundation in collaboration with the Hawai'i Association for the Education of Young Children and MenTeach.org, the event extended the international dialog on changing roles for men…

  16. HIV-protease inhibitors block the replication of both vesicular stomatitis and influenza viruses at an early post-entry replication step

    SciTech Connect

    Federico, Maurizio

    2011-08-15

    The inhibitors of HIV-1 protease (PIs) have been designed to block the activity of the viral aspartyl-protease. However, it is now accepted that this family of inhibitors can also affect the activity of cell proteases. Since the replication of many virus species requires the activity of host cell proteases, investigating the effects of PIs on the life cycle of viruses other than HIV would be of interest. Here, the potent inhibition induced by saquinavir and nelfinavir on the replication of both vesicular stomatitis and influenza viruses is described. These are unrelated enveloped RNA viruses infecting target cells upon endocytosis and intracellular fusion. The PI-induced inhibition was apparently a consequence of a block at the level of the fusion between viral envelope and endosomal membranes. These findings would open the way towards the therapeutic use of PIs against enveloped RNA viruses other than HIV.

  17. Early events in the disulfide-coupled folding of BPTI.

    PubMed Central

    Bulaj, G.; Goldenberg, D. P.

    1999-01-01

    Recent studies of the refolding of reduced bovine pancreatic trypsin inhibitor (BPTI) have shown that a previously unidentified intermediate with a single disulfide is formed much more rapidly than any other one-disulfide species. This intermediate contains a disulfide that is present in the native protein (between Cys14 and 38), but it is thermodynamically less stable than the other two intermediates with single native disulfides. To characterize the role of the [14-38] intermediate and the factors that favor its formation, detailed kinetic and mutational analyses of the early disulfide-formation steps were carried out. The results of these studies indicate that the formation of [14-38] from the fully reduced protein is favored by both local electrostatic effects, which enhance the reactivities of the Cys14 and 38 thiols, and conformational tendencies that are diminished by the addition of urea and are enhanced at lower temperatures. At 25 degrees C and pH 7.3, approximately 35% of the reduced molecules were found to initially form the 14-38 disulfide, but the majority of these molecules then undergo intramolecular rearrangements to generate non-native disulfides, and subsequently the more stable intermediates with native disulfides. Amino acid replacements, other than those involving Cys residues, were generally found to have only small effects on either the rate of forming [14-38] or its thermodynamic stability, even though many of the same substitutions greatly destabilized the native protein and other disulfide-bonded intermediates. In addition, those replacements that did decrease the steady-state concentration of [14-38] did not adversely affect further folding and disulfide formation. These results suggest that the weak and transient interactions that are often detected in unfolded proteins and early folding intermediates may, in some cases, not persist or promote subsequent folding steps. PMID:10493584

  18. Replicating the Ice-Volume Signal of the Early Pleistocene with a Complex Earth System Model

    NASA Astrophysics Data System (ADS)

    Tabor, C. R.; Poulsen, C. J.; Pollard, D.

    2013-12-01

    Milankovitch theory proposes high-latitude summer insolation intensity paces the ice ages by controlling perennial snow cover amounts (Milankovitch, 1941). According to theory, the ~21 kyr cycle of precession should dominate the ice-volume records since it has the greatest influence on high-latitude summer insolation. Modeling experiments frequently support Milankovitch theory by attributing the majority of Northern Hemisphere high-latitude summer snowmelt to changes in the cycle of precession (e.g. Jackson and Broccoli, 2003). However, ice-volume proxy records, especially those of the Early Pleistocene (2.6-0.8 Ma), display variability with a period of ~41 kyr (Raymo and Lisiecki, 2005), indicative of insolation forcing from obliquity, which has a much smaller influence on summer insolation intensity than precession. Several hypotheses attempt to explain the discrepancies between Milkankovitch theory and the proxy records by invoking phenomena such as insolation gradients (Raymo and Nisancioglu, 2003), hemispheric offset (Raymo et al., 2006; Lee and Poulsen, 2009), and integrated summer energy (Huybers, 2006); however, all of these hypotheses contain caveats (Ruddiman, 2006) and have yet to be supported by modeling studies that use a complex GCM. To explore potential solutions to this '41 kyr problem,' we use an Earth system model composed of the GENESIS GCM and Land Surface model, the BIOME4 vegetation model, and the Pennsylvania State ice-sheet model. Using an asynchronous coupling technique, we run four idealized transient combinations of obliquity and precession, representing the orbital extremes of the Pleistocene (Berger and Loutre, 1991). Each experiment is run through several complete orbital cycles with a dynamic ice domain spanning North America and Greenland, and fixed preindustrial greenhouse-gas concentrations. For all orbital configurations, model results produce greater ice-volume spectral power at the frequency of obliquity despite significantly

  19. H1PVAT is a novel and potent early-stage inhibitor of poliovirus replication that targets VP1.

    PubMed

    Tijsma, Aloys; Thibaut, Hendrik Jan; Spieser, Stéphane A H; De Palma, Armando; Koukni, Mohamed; Rhoden, Eric; Oberste, Steve; Pürstinger, Gerhard; Volny-Luraghi, Antonia; Martin, Javier; Marchand, Arnaud; Chaltin, Patrick; Neyts, Johan; Leyssen, Pieter

    2014-10-01

    A novel small molecule, H1PVAT, was identified as a potent and selective inhibitor of the in vitro replication of all three poliovirus serotypes, whereas no activity was observed against other enteroviruses. Time-of-drug-addition studies revealed that the compound interfered with an early stage of virus replication. Four independently-selected H1PVAT-resistant virus variants uniformly carried the single amino acid substitution I194F in the VP1 capsid protein. Poliovirus type 1 strain Sabin, reverse-engineered to contain this substitution, proved to be completely insensitive to the antiviral effect of H1PVAT and was cross-resistant to the capsid-binding inhibitors V-073 and pirodavir. The VP1 I194F mutant had a smaller plaque phenotype than wild-type virus, and the amino acid substitution rendered the virus more susceptible to heat inactivation. Both for the wild-type and VP1 I194F mutant virus, the presence of H1PVAT increased the temperature at which the virus was inactivated, providing evidence that the compound interacts with the viral capsid, and that capsid stabilization and antiviral activity are not necessarily correlated. Molecular modeling suggested that H1PVAT binds with high affinity in the pocket underneath the floor of the canyon that is involved in receptor binding. Introduction of the I194F substitution in the model of VP1 induced a slight concerted rearrangement of the core β-barrel in this pocket, which disfavors binding of the compound. Taken together, the compound scaffold, to which H1PVAT belongs, may represent another promising class of poliovirus capsid-binding inhibitors next to V-073 and pirodavir. Potent antivirals against poliovirus will be essential in the poliovirus eradication end-game. PMID:25043639

  20. Phosphoproteome Dynamics Upon Changes in Plant Water Status Reveal Early Events Associated With Rapid Growth Adjustment in Maize Leaves*

    PubMed Central

    Bonhomme, Ludovic; Valot, Benoît; Tardieu, François; Zivy, Michel

    2012-01-01

    Plant growth adjustment during water deficit is a crucial adaptive response. The rapid fine-tuned control achieved at the post-translational level is believed to be of considerable importance for regulating early changes in plant growth reprogramming. Aiming at a better understanding of early responses to contrasting plant water statuses, we carried out a survey of the protein phosphorylation events in the growing zone of maize leaves upon a range of water regimes. In this study, the impact of mild and severe water deficits were evaluated in comparison with constant optimal watering and with recovery periods lasting 5, 10, 20, 30, 45, and 60 min. Using four biological replicates per treatment and a robust quantitative phosphoproteomic methodology based on stable-isotope labeling, we identified 3664 unique phosphorylation sites on 2496 proteins. The abundance of nearly 1250 phosphorylated peptides was reproducibly quantified and profiled with high confidence among treatments. A total of 138 phosphopeptides displayed highly significant changes according to water regimes and enabled to identify specific patterns of response to changing plant water statuses. Further quantification of protein amounts emphasized that most phosphorylation changes did not reflect protein abundance variation. During water deficit and recovery, extensive changes in phosphorylation status occurred in critical regulators directly or indirectly involved in plant growth and development. These included proteins influencing epigenetic control, gene expression, cell cycle-dependent processes and phytohormone-mediated responses. Some of the changes depended on stress intensity whereas others depended on rehydration duration, including rapid recoveries that occurred as early as 5 or 10 mins after rewatering. By combining a physiological approach and a quantitative phosphoproteomic analysis, this work provides new insights into the in vivo early phosphorylation events triggered by rapid changes in

  1. Compartmentalized replication of R5 T cell-tropic HIV-1 in the central nervous system early in the course of infection.

    PubMed

    Sturdevant, Christa Buckheit; Joseph, Sarah B; Schnell, Gretja; Price, Richard W; Swanstrom, Ronald; Spudich, Serena

    2015-03-01

    Compartmentalized HIV-1 replication within the central nervous system (CNS) likely provides a foundation for neurocognitive impairment and a potentially important tissue reservoir. The timing of emergence and character of this local CNS replication has not been defined in a population of subjects. We examined the frequency of elevated cerebrospinal fluid (CSF) HIV-1 RNA concentration, the nature of CSF viral populations compared to the blood, and the presence of a cellular inflammatory response (with the potential to bring infected cells into the CNS) using paired CSF and blood samples obtained over the first two years of infection from 72 ART-naïve subjects. Using single genome amplification (SGA) and phylodynamics analysis of full-length env sequences, we compared CSF and blood viral populations in 33 of the 72 subjects. Independent HIV-1 replication in the CNS (compartmentalization) was detected in 20% of sample pairs analyzed by SGA, or 7% of all sample pairs, and was exclusively observed after four months of infection. In subjects with longitudinal sampling, 30% showed evidence of CNS viral replication or pleocytosis/inflammation in at least one time point, and in approximately 16% of subjects we observed evolving CSF/CNS compartmentalized viral replication and/or a marked CSF inflammatory response at multiple time points suggesting an ongoing or recurrent impact of the infection in the CNS. Two subjects had one of two transmitted lineages (or their recombinant) largely sequestered within the CNS shortly after transmission, indicating an additional mechanism for establishing early CNS replication. Transmitted variants were R5 T cell-tropic. Overall, examination of the relationships between CSF viral populations, blood and CSF HIV-1 RNA concentrations, and inflammatory responses suggested four distinct states of viral population dynamics, with associated mechanisms of local viral replication and the early influx of virus into the CNS. This study considerably

  2. Prp40 and early events in splice site definition.

    PubMed

    Becerra, Soraya; Andrés-León, Eduardo; Prieto-Sánchez, Silvia; Hernández-Munain, Cristina; Suñé, Carlos

    2016-01-01

    The alternative splicing (AS) of precursor messenger RNA (pre-mRNA) is a tightly regulated process through which introns are removed to leave the resulting exons in the mRNA appropriately aligned and ligated. The AS of pre-mRNA is a key mechanism for increasing the complexity of proteins encoded in the genome. In humans, more than 90% of genes undergo AS, underscoring the importance of this process in RNA biogenesis. As such, AS misregulation underlies multiple human diseases. The splicing reaction is catalyzed by the spliceosome, a highly dynamic complex that assembles at or near the intron/exon boundaries and undergoes sequential conformational and compositional changes during splicing. The initial recognition of splice sites defines the exons that are going to be removed, which is a critical step in the highly regulated splicing process. Although the available lines of evidence are increasing, the molecular mechanisms governing AS, including the initial interactions occurring at intron/exon boundaries, and the factors that modulate these critical connections by functioning as a scaffold for active-site RNAs or proteins, remain poorly understood. In this review, we summarize the major hallmarks of the initial steps in the splicing process and the role of auxiliary factors that contribute to the assembly of the spliceosomal complex. We also discuss the role of the essential yeast Prp40 protein and its mammalian homologs in the specificity of this pre-mRNA processing event. In addition, we provide the first exhaustive phylogenetic analysis of the molecular evolution of Prp40 family members. WIREs RNA 2016, 7:17-32. doi: 10.1002/wrna.1312 For further resources related to this article, please visit the WIREs website. PMID:26494226

  3. Early Combination Antiretroviral Therapy Limits Exposure to HIV-1 Replication and Cell-Associated HIV-1 DNA Levels in Infants

    PubMed Central

    McManus, Margaret; Mick, Eric; Hudson, Richard; Mofenson, Lynne M.; Sullivan, John L.; Somasundaran, Mohan; Luzuriaga, Katherine

    2016-01-01

    The primary aim of this study was to measure HIV-1 persistence following combination antiretroviral therapy (cART) in infants and children. Peripheral blood mononuclear cell (PBMC) HIV-1 DNA was quantified prior to and after 1 year of cART in 30 children, stratified by time of initiation (early, age <3 months, ET; late, age >3 months-2 years, LT). Pre-therapy PBMC HIV-1 DNA levels correlated with pre-therapy plasma HIV-1 levels (r = 0.59, p<0.001), remaining statistically significant (p = 0.002) after adjustment for prior perinatal antiretroviral exposure and age at cART initiation. PBMC HIV-1 DNA declined significantly after 1 year of cART (Overall: -0.91±0.08 log10 copies per million PBMC, p<0.001; ET: -1.04±0.11 log10 DNA copies per million PBMC, p<0.001; LT: -0.74 ±0.13 log10 DNA copies per million PBMC, p<0.001) but rates of decline did not differ significantly between ET and LT. HIV-1 replication exposure over the first 12 months of cART, estimated as area-under-the-curve (AUC) of circulating plasma HIV-1 RNA levels, was significantly associated with PBMC HIV-1 DNA at one year (r = 0.51, p = 0.004). In 21 children with sustained virologic suppression after 1 year of cART, PBMC HIV-1 DNA levels continued to decline between years 1 and 4 (slope -0.21 log10 DNA copies per million PBMC per year); decline slopes did not differ significantly between ET and LT. PBMC HIV-1 DNA levels at 1 year and 4 years of cART correlated with age at cART initiation (1 year: p = 0.04; 4 years: p = 0.03) and age at virologic control (1 and 4 years, p = 0.02). Altogether, these data indicate that reducing exposure to HIV-1 replication and younger age at cART initiation are associated with lower HIV-1 DNA levels at and after one year of age, supporting the concept that HIV-1 diagnosis and cART initiation in infants should occur as early as possible. PMID:27104621

  4. Early Combination Antiretroviral Therapy Limits Exposure to HIV-1 Replication and Cell-Associated HIV-1 DNA Levels in Infants.

    PubMed

    McManus, Margaret; Mick, Eric; Hudson, Richard; Mofenson, Lynne M; Sullivan, John L; Somasundaran, Mohan; Luzuriaga, Katherine

    2016-01-01

    The primary aim of this study was to measure HIV-1 persistence following combination antiretroviral therapy (cART) in infants and children. Peripheral blood mononuclear cell (PBMC) HIV-1 DNA was quantified prior to and after 1 year of cART in 30 children, stratified by time of initiation (early, age <3 months, ET; late, age >3 months-2 years, LT). Pre-therapy PBMC HIV-1 DNA levels correlated with pre-therapy plasma HIV-1 levels (r = 0.59, p<0.001), remaining statistically significant (p = 0.002) after adjustment for prior perinatal antiretroviral exposure and age at cART initiation. PBMC HIV-1 DNA declined significantly after 1 year of cART (Overall: -0.91±0.08 log10 copies per million PBMC, p<0.001; ET: -1.04±0.11 log10 DNA copies per million PBMC, p<0.001; LT: -0.74 ±0.13 log10 DNA copies per million PBMC, p<0.001) but rates of decline did not differ significantly between ET and LT. HIV-1 replication exposure over the first 12 months of cART, estimated as area-under-the-curve (AUC) of circulating plasma HIV-1 RNA levels, was significantly associated with PBMC HIV-1 DNA at one year (r = 0.51, p = 0.004). In 21 children with sustained virologic suppression after 1 year of cART, PBMC HIV-1 DNA levels continued to decline between years 1 and 4 (slope -0.21 log10 DNA copies per million PBMC per year); decline slopes did not differ significantly between ET and LT. PBMC HIV-1 DNA levels at 1 year and 4 years of cART correlated with age at cART initiation (1 year: p = 0.04; 4 years: p = 0.03) and age at virologic control (1 and 4 years, p = 0.02). Altogether, these data indicate that reducing exposure to HIV-1 replication and younger age at cART initiation are associated with lower HIV-1 DNA levels at and after one year of age, supporting the concept that HIV-1 diagnosis and cART initiation in infants should occur as early as possible. PMID:27104621

  5. ABA Inhibits Embryo Cell Expansion and Early Cell Division Events During Coffee (Coffea arabica ‘Rubi’) Seed Germination

    PubMed Central

    Da Silva, E. A. Amaral; Toorop, Peter E.; Van Lammeren, André A. M.; Hilhorst, Henk W. M.

    2008-01-01

    Background and Aims Coffee seed germination represents an interplay between the embryo and the surrounding endosperm. A sequence of events in both parts of the seed determines whether germination will be successful or not. Following previous studies, the aim here was to further characterize the morphology of endosperm degradation and embryo growth with respect to morphology and cell cycle, and the influence of abscisic acid on these processes. Methods Growth of cells in a fixed region of the axis was quantified from light micrographs. Cell cycle events were measured by flow cytometry and by immunocytochemistry, using antibodies against β-tubulin. Aspects of the endosperm were visualized by light and scanning electron microscopy. Key Results The embryonic axis cells grew initially by isodiametric expansion. This event coincided with reorientation and increase in abundance of microtubules and with accumulation of β-tubulin. Radicle protrusion was characterized by a shift from isodiametric expansion to elongation of radicle cells and further accumulation of β-tubulin. Early cell division events started prior to radicle protrusion. Abscisic acid decreased the abundance of microtubules and inhibited the growth of the embryo cells, the reorganization of the microtubules, DNA replication in the embryonic axis, the formation of a protuberance and the completion of germination. The endosperm cap cells had smaller and thinner cell walls than the rest of the endosperm. Cells in the endosperm cap displayed compression followed by loss of cell integrity and the appearance of a protuberance prior to radicle protrusion. Conclusions Coffee seed germination is the result of isodiametric growth of the embryo followed by elongation, at the expense of integrity of endosperm cap cells. The cell cycle, including cell division, is initiated prior to radicle protrusion. ABA inhibits expansion of the embryo, and hence subsequent events, including germination. PMID:18617534

  6. Polyomavirus JC in the context of immunosuppression: a series of adaptive, DNA replication-driven recombination events in the development of progressive multifocal leukoencephalopathy.

    PubMed

    Johnson, Edward M; Wortman, Margaret J; Dagdanova, Ayuna V; Lundberg, Patric S; Daniel, Dianne C

    2013-01-01

    Polyomavirus JC (JCV) is the etiological agent of progressive multifocal leukoencephalopathy (PML), a demyelinating infection of oligodendrocytes in the brain. PML, a frequently fatal opportunistic infection in AIDS, has also emerged as a consequence of treatment with several new immunosuppressive therapeutic agents. Although nearly 80% of adults are seropositive, JCV attains an ability to infect glial cells in only a minority of people. Data suggest that JCV undergoes sequence alterations that accompany this ability, and these changes can be derived from an archetype strain by mutation, deletion, and duplication. While the introductory source and primary tissue reservoir of JCV remain unknown, lymphoid cells have been identified as potential intermediaries in progression of JCV to the brain. This review is focused on sequence changes in the noncoding control region (NCCR) of the virus. We propose an adaptive mechanism that involves a sequential series of DNA replication-driven NCCR recombination events involving stalled DNA replication forks at NCCR palindromic secondary structures. We shall describe how the NCCR sequence changes point to a model in which viral DNA replication drives NCCR recombination, allowing JCV adaptation to different cell types in its progression to neurovirulence. PMID:23690820

  7. Neighborhood Disadvantage, Stressful Life Events, and Adjustment Among Mexican American Early Adolescents

    PubMed Central

    Roosa, Mark W.; Burrell, Ginger L.; Nair, Rajni L.; Coxe, Stefany; Tein, Jenn-Yun; Knight, George P.

    2009-01-01

    This study examined a stress-process model in which stressful life events and association with delinquent peers mediated the relationship of neighborhood disadvantage to Mexican American early adolescents’ mental health. We also proposed that child gender, child generation, and neighborhood informal social control would moderate the relationship of neighborhood disadvantage to children’s experiences of stressful life events. With data from 738 Mexican American early adolescents, results generally provided support for the theoretical model although the relationships of neighborhood disadvantage to stressful life events and adjustment were weaker than expected. Additional research is needed to corroborate these results and determine why neighborhood disadvantage may have different relationships to adjustment for Mexican American early adolescents than for others. PMID:20711521

  8. The Importance of First Impressions: Early Events in Mycobacterium tuberculosis Infection Influence Outcome

    PubMed Central

    Cadena, Anthony M.; Fortune, Sarah M.

    2016-01-01

    ABSTRACT Tuberculosis remains a major health threat in much of the world. New vaccines against Mycobacterium tuberculosis are essential for preventing infection, disease, and transmission. However, the host immune responses that need to be induced by an effective vaccine remain unclear. Increasingly, it has become clear that early events in infection are of major importance in the eventual outcome of the infection. Studying such events in humans is challenging, as they occur within the lung and thoracic lymph nodes, and any clinical signs of early infection are relatively nonspecific. Nonetheless, clinical studies and animal models of tuberculosis have provided new insights into the local events that occur in the first few weeks of tuberculosis. Development of an effective vaccine requires a clear understanding of the successful (and detrimental) early host responses against M. tuberculosis, with the goal to improve upon natural immune responses and prevent infection or disease. PMID:27048801

  9. Evidence for an early pliocene cold event in the southern oceans

    SciTech Connect

    Burckle, L.H.; Mortlock, R.A. ); Rudolph, S. )

    1993-01-01

    Although it is generally agreed that the early Pliocene witnessed the last great climate warming before the onset of Northern Hemisphere glaciation, it is generally not recognized that this time interval also witnessed what appear to be major glaciations in both northern and southern Hemispheres. This describes a study of brief, intense warm events in the early Pliocene as well as evidence for at least one major glaciation during this time interval. 13 refs.

  10. Nup153 and Nup98 bind the HIV-1 core and contribute to the early steps of HIV-1 replication

    SciTech Connect

    Di Nunzio, Francesca; Fricke, Thomas; Miccio, Annarita; Valle-Casuso, Jose Carlos; Perez, Patricio; Souque, Philippe; Rizzi, Ermanno; Severgnini, Marco; Mavilio, Fulvio; Charneau, Pierre; Diaz-Griffero, Felipe

    2013-05-25

    The early steps of HIV-1 replication involve the entry of HIV-1 into the nucleus, which is characterized by viral interactions with nuclear pore components. HIV-1 developed an evolutionary strategy to usurp the nuclear pore machinery and chromatin in order to integrate and efficiently express viral genes. In the current work, we studied the role of nucleoporins 153 and 98 (Nup153 and Nup98) in infection of human Jurkat lymphocytes by HIV-1. We showed that Nup153-depleted cells exhibited a defect in nuclear import, while depletion of Nup 98 caused a slight defect in HIV integration. To explore the biochemical viral determinants for the requirement of Nup153 and Nup98 during HIV-1 infection, we tested the ability of these nucleoporins to interact with HIV-1 cores. Our findings showed that both nucleoporins bind HIV-1 cores suggesting that this interaction is important for HIV-1 nuclear import and/or integration. Distribution analysis of integration sites in Nup153-depleted cells revealed a reduced tendency of HIV-1 to integrate in intragenic sites, which in part could account for the large infectivity defect observed in Nup153-depleted cells. Our work strongly supports a role for Nup153 in HIV-1 nuclear import and integration. - Highlights: ► We studied the role of Nup98 and Nup153 in HIV-1 infection. ► Nup98 binds the HIV-1 core and is involved in HIV-1 integration. ► Nup153 binds the HIV-1 core and is involved in HIV-1 nuclear import. ► Depletion of Nup153 decreased the integration of HIV-1 in transcriptionally active sites.

  11. Early snowmelt events: detection, distribution, and significance in a major sub-arctic watershed

    NASA Astrophysics Data System (ADS)

    Alese Semmens, Kathryn; Ramage, Joan; Bartsch, Annett; Liston, Glen E.

    2013-03-01

    High latitude drainage basins are experiencing higher average temperatures, earlier snowmelt onset in spring, and an increase in rain on snow (ROS) events in winter, trends that climate models project into the future. Snowmelt-dominated basins are most sensitive to winter temperature increases that influence the frequency of ROS events and the timing and duration of snowmelt, resulting in changes to spring runoff. Of specific interest in this study are early melt events that occur in late winter preceding melt onset in the spring. The study focuses on satellite determination and characterization of these early melt events using the Yukon River Basin (Canada/USA) as a test domain. The timing of these events was estimated using data from passive (Advanced Microwave Scanning Radiometer—EOS (AMSR-E)) and active (SeaWinds on Quick Scatterometer (QuikSCAT)) microwave remote sensors, employing detection algorithms for brightness temperature (AMSR-E) and radar backscatter (QuikSCAT). The satellite detected events were validated with ground station meteorological and hydrological data, and the spatial and temporal variability of the events across the entire river basin was characterized. Possible causative factors for the detected events, including ROS, fog, and positive air temperatures, were determined by comparing the timing of the events to parameters from SnowModel and National Centers for Environmental Prediction North American Regional Reanalysis (NARR) outputs, and weather station data. All melt events coincided with above freezing temperatures, while a limited number corresponded to ROS (determined from SnowModel and ground data) and a majority to fog occurrence (determined from NARR). The results underscore the significant influence that warm air intrusions have on melt in some areas and demonstrate the large temporal and spatial variability over years and regions. The study provides a method for melt detection and a baseline from which to assess future change.

  12. Neighborhood Disadvantage, Stressful Life Events, and Adjustment among Mexican American Early Adolescents

    ERIC Educational Resources Information Center

    Roosa, Mark W.; Burrell, Ginger L.; Nair, Rajni L.; Coxe, Stefany; Tein, Jenn-Yun; Knight, George P.

    2010-01-01

    This study examined a stress process model in which stressful life events and association with delinquent peers mediated the relationship of neighborhood disadvantage to Mexican American early adolescents' mental health. The authors also proposed that child gender, child generation, and neighborhood informal social control would moderate the…

  13. Let's Party! How To Plan Special Events and Raise Money in Early Childhood Programs.

    ERIC Educational Resources Information Center

    Rice, Judith Anne

    This guide for early childhood program administrators provides guidelines and makes suggestions for planning special events to facilitate opportunities for parents, children, teachers, and organizations to connect in ways that strengthen individuals and communities and raise money for the organization. Part 1, "Planning," focuses on organization,…

  14. How Early Events Affect Growing Brains. An Interview with Neuroscientist Pat Levitt

    ERIC Educational Resources Information Center

    National Scientific Council on the Developing Child, 2006

    2006-01-01

    Recent advances in neuroscience show clearly how experience can change brain neurochemicals, and how this in turn affects the way the brain functions. As a result, early negative events actually get built into the growing brain's neurochemistry, altering the brain's architecture. Research is continuing to investigate how children with genetic…

  15. Controls of event-based pesticide leaching in natural soils: A systematic study based on replicated field scale irrigation experiments

    NASA Astrophysics Data System (ADS)

    Klaus, Julian; Zehe, Erwin; Elsner, Martin; Palm, Juliane; Schneider, Dorothee; Schröder, Boris; Steinbeiss, Sibylle; van Schaik, Loes; West, Stephanie

    2014-05-01

    Tile drains strongly influence the water cycle in agricultural catchment in terms of water quantity and quality. The connectivity of preferential flow to tile drains can create shortcuts for rapid transport of solutes into surface waters. The leaching of pesticides can be linked to a set of main factors including, rainfall characteristics, soil moisture, chemical properties of the pesticides, soil properties, and preferential flow paths. The connectivity of the macropore system to the tile drain is crucial for pesticide leaching. Concurring influences of the main factors, threshold responses and the role of flow paths are still poorly understood. The objective of this study is to investigate these influences by a replica series of three irrigation experiments on a tile drain field site using natural and artificial tracers together with applied pesticides. We found a clear threshold behavior in the initialization of pesticide transport that was different between the replica experiments. Pre-event soil water contributed significantly to the tile drain flow, and creates a flow path for stored pesticides from the soil matrix to the tile drain. This threshold is controlled by antecedent soil moisture and precipitation characteristics, and the interaction between the soil matrix and preferential flow system. Fast transport of pesticides without retardation and the remobilization could be attributed to this threshold and the interaction between the soil matrix and the preferential flow system. Thus, understanding of the detailed preferential flow processes clearly enhances the understanding of pesticide leaching on event and long term scale, and can further improve risk assessment and modeling approaches.

  16. Carbonate platform evidence of ocean acidification at the onset of the early Toarcian oceanic anoxic event

    NASA Astrophysics Data System (ADS)

    Trecalli, Alberto; Spangenberg, Jorge; Adatte, Thierry; Föllmi, Karl B.; Parente, Mariano

    2012-12-01

    The early Toarcian oceanic anoxic event (Early Jurassic;˜183 Myr ago) is associated with one of the largest negative carbon isotope excursion (CIE) in the whole Phanerozoic (3-7‰). Estimates of the magnitude and rate of CO2 injection in the ocean-atmosphere system are compatible with a scenario of ocean acidification. Many carbonate platforms drowned in the Pliensbachian, well before the early Toarcian event. In this paper we test the hypothesis of surface water ocean acidification by presenting data from a resilient carbonate platform: the Apennine Carbonate Platform of southern Italy. The studied sections document a dramatic shift of the carbonate factory from massive biocalcification to chemical precipitation. Lithiotis bivalves and calcareous algae (Palaeodasycladus mediterraneus), which were the most prolific carbonate producers of Pliensbachian carbonate platforms, disappear during the first phase of the early Toarcian CIE, before the most depleted values are reached. We discuss the local versus supraregional significance of this shift and propose a scenario involving abrupt decline of carbonate saturation, forced by CO2 release at the beginning of the early Toarcian CIE, followed by a calcification overshoot, driven by the recovery of ocean alkalinity. Attribution of the demise of carbonate platform hypercalcifiers to ocean acidification is supported by palaeophysiology and reinforced by experimental data on the detrimental effects of ocean acidification on recent shellfishes and calcareous algae.

  17. Chlamydia trachomatis Infection of Endocervical Epithelial Cells Enhances Early HIV Transmission Events

    PubMed Central

    Buckner, Lyndsey R.; Amedee, Angela M.; Albritton, Hannah L.; Kozlowski, Pamela A.; Lacour, Nedra; McGowin, Chris L.; Schust, Danny J.; Quayle, Alison J.

    2016-01-01

    Chlamydia trachomatis causes a predominantly asymptomatic, but generally inflammatory, genital infection that is associated with an increased risk for HIV acquisition. Endocervical epithelial cells provide the major niche for this obligate intracellular bacterium in women, and the endocervix is also a tissue in which HIV transmission can occur. The mechanism by which CT infection enhances HIV susceptibility at this site, however, is not well understood. Utilizing the A2EN immortalized endocervical epithelial cell line grown on cell culture inserts, we evaluated the direct role that CT-infected epithelial cells play in facilitating HIV transmission events. We determined that CT infection significantly enhanced the apical-to-basolateral migration of cell-associated, but not cell-free, HIVBaL, a CCR5-tropic strain of virus, across the endocervical epithelial barrier. We also established that basolateral supernatants from CT-infected A2EN cells significantly enhanced HIV replication in peripheral mononuclear cells and a CCR5+ T cell line. These results suggest that CT infection of endocervical epithelial cells could facilitate both HIV crossing the mucosal barrier and subsequent infection or replication in underlying target cells. Our studies provide a mechanism by which this common STI could potentially promote the establishment of founder virus populations and the maintenance of local HIV reservoirs in the endocervix. Development of an HIV/STI co-infection model also provides a tool to further explore the role of other sexually transmitted infections in enhancing HIV acquisition. PMID:26730599

  18. Early events in skin appendage formation: induction of epithelial placodes and condensation of dermal mesenchyme.

    PubMed

    Widelitz, R B; Chuong, C M

    1999-12-01

    The formation of skin appendages represents a morphogenetic process through which a homogeneous system is converted into a patterned system. We have pursued molecules involved in the early placode induction and mesenchymal condensation stages of this process. We found that intracellular and extracellular signaling molecules collaborate to position the location of feather primordia and initiate mesenchymal condensations mediated by adhesion molecules. During the inductive stage, cells interact in a fashion best described by a reaction-diffusion mechanism. Thus in early feather morphogenesis, low level adhesion molecules drive cell interactions. The interactions were modulated by extracellular signaling molecules, which eventually increase the level of signaling molecules at sites of feather initiation and subsequently the level of adhesion molecules (Jiang et al, 1999a). These physico-chemical events lead to the formation of dermal condensations and epithelial placodes at sites of feather primordia, thus achieving the earliest and most fundamental events of skin appendage formation: induction. PMID:10674386

  19. Early Events in the Pathogenesis of Foot-and-Mouth Disease in Cattle After Controlled Aerosol Exposure

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The goal of this study was to identify the primary sites of replication of foot-and-mouth disease virus (FMDV) in cattle subsequent to aerogenous inoculation. A novel aerosol inoculation method was developed to simulate natural, airborne transmission and thereby allow the identification of early rep...

  20. Early Reading Success and Its Relationship to Reading Achievement and Reading Volume: Replication of "10 Years Later"

    ERIC Educational Resources Information Center

    Sparks, Richard L.; Patton, Jon; Murdoch, Amy

    2014-01-01

    Cunningham and Stanovich reported a longitudinal investigation over 10 years that examined the unique influence of exposure to print in explaining individual differences on various measures of reading achievement and declarative (general) knowledge. The present study replicated their investigation with a larger number of participants and…

  1. Genetic Moderation of Stability in Attachment Security from Early Childhood to Age 18 Years: A Replication Study

    ERIC Educational Resources Information Center

    Raby, K. Lee; Roisman, Glenn I.; Booth-LaForce, Cathryn

    2015-01-01

    A longstanding question for attachment theory and research is whether genetically based characteristics of the child influence the development of attachment security and its stability over time. This study attempted to replicate and extend recent findings indicating that the developmental stability of attachment security is moderated by oxytocin…

  2. Replication-Fork Dynamics

    PubMed Central

    Duderstadt, Karl E.; Reyes-Lamothe, Rodrigo; van Oijen, Antoine M.; Sherratt, David J.

    2014-01-01

    The proliferation of all organisms depends on the coordination of enzymatic events within large multiprotein replisomes that duplicate chromosomes. Whereas the structure and function of many core replisome components have been clarified, the timing and order of molecular events during replication remains obscure. To better understand the replication mechanism, new methods must be developed that allow for the observation and characterization of short-lived states and dynamic events at single replication forks. Over the last decade, great progress has been made toward this goal with the development of novel DNA nanomanipulation and fluorescence imaging techniques allowing for the direct observation of replication-fork dynamics both reconstituted in vitro and in live cells. This article reviews these new single-molecule approaches and the revised understanding of replisome operation that has emerged. PMID:23881939

  3. An Early Warning System for Loan Risk Assessment Based on Rare Event Simulation

    NASA Astrophysics Data System (ADS)

    Zhou, Hong; Qiu, Yue; Wu, Yueqin

    System simulation is one of important tool for risk assessment. In this paper, a new method is presented to deal with credit risk assessment problems for commercial banks based on rare event simulation. The failure probability of repaying loans of listed company is taken as the criterion to measure the level of credit risk. The rare-event concept is adopted to construct the model of credit risk identification in commercial banks, and cross-entropy scheme is designed to implement the rare event simulation, based on which the loss probability can be assessed. Numerical experiments have shown that the method has a strong capability to identify the credit risk for commercial banks and offers a good tool for early warning.

  4. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  5. Modulation of in vitro transformation and the early and late modes of DNA replication of uv-irradiation Syrian hamster cells by caffeine

    SciTech Connect

    Doniger, J.; DiPaolo, J.A.

    1981-09-01

    The effect of caffeine on post-uv DNA replication was studied to determine its relevance to carcinogenesis. The level of uv-induced transformed colonies of Syrian hamster embryo cells (HEC) was increased up to fivefold when caffeine was added to cells between 0 and 6 h post-uv. The greatest increase was observed when the interval between uv irradiation and caffeine addition was 4 h. Two modes of DNA replication occurred after uv irradiation. During the early mode (0 to 3 h post-uv) the size of nascent strands, as measured by alkaline sucrose sedimentation, was smaller than those in nonirradiated cells, whereas during the late mode they recovered to normal size. Caffeine inhibited the rate of elongation of nascent strands during the early mode. When caffeine was added immediately after uv irradiation, the conversion of the early mode to the late mode was inhibited. Studies on the effects of caffeine have now been extended to the late mode. While caffeine has little effect with the fd elements beginning from the 10th day after irradiation is connected with their proliferation but not with the migration out from lymphoid organs.

  6. Factors Associated with Early Adverse Events after Coronary Artery Bypass Grafting Subsequent to Percutaneous Coronary Intervention

    PubMed Central

    Kamal, Yasser Ali; Mubarak, Yasser Shaban; Alshorbagy, Ashraf Ali

    2016-01-01

    Background A previous percutaneous coronary intervention (PCI) may affect the outcomes of patients who undergo coronary artery bypass grafting (CABG). The objective of this study was to compare the early in-hospital postoperative outcomes between patients who underwent CABG with or without previous PCI. Methods The present study included 160 patients who underwent isolated elective on-pump CABG at the department of cardiothoracic surgery, Minia University Hospital from January 2010 to December 2014. Patients who previously underwent PCI (n=38) were compared to patients who did not (n=122). Preoperative, operative, and early in-hospital postoperative data were analyzed. The end points of the study were in-hospital mortality and postoperative major adverse events. Results Non-significant differences were found between the study groups regarding preoperative demographic data, risk factors, left ventricular ejection fraction, New York Heart Association class, EuroSCORE, the presence of left main disease, reoperation for bleeding, postoperative acute myocardial infarction, a neurological deficit, need for renal dialysis, hospital stay, and in-hospital mortality. The average time from PCI to CABG was 13.9±5.4 years. The previous PCI group exhibited a significantly larger proportion of patients who experienced in-hospital major adverse events (15.8% vs. 2.5%, p=0.002). On multivariate analysis, only previous PCI was found to be a significant predictor of major adverse events (odds ratio, 0.16; 95% confidence interval, 0.03 to 0.71; p=0.01). Conclusion Previous PCI was found to have a significant effect on the incidence of early major adverse events after CABG. Further large-scale and long-term studies are recommended. PMID:27298794

  7. Multi-model data fusion to improve an early warning system for hypo-/hyperglycemic events.

    PubMed

    Botwey, Ransford Henry; Daskalaki, Elena; Diem, Peter; Mougiakakou, Stavroula G

    2014-01-01

    Correct predictions of future blood glucose levels in individuals with Type 1 Diabetes (T1D) can be used to provide early warning of upcoming hypo-/hyperglycemic events and thus to improve the patient's safety. To increase prediction accuracy and efficiency, various approaches have been proposed which combine multiple predictors to produce superior results compared to single predictors. Three methods for model fusion are presented and comparatively assessed. Data from 23 T1D subjects under sensor-augmented pump (SAP) therapy were used in two adaptive data-driven models (an autoregressive model with output correction - cARX, and a recurrent neural network - RNN). Data fusion techniques based on i) Dempster-Shafer Evidential Theory (DST), ii) Genetic Algorithms (GA), and iii) Genetic Programming (GP) were used to merge the complimentary performances of the prediction models. The fused output is used in a warning algorithm to issue alarms of upcoming hypo-/hyperglycemic events. The fusion schemes showed improved performance with lower root mean square errors, lower time lags, and higher correlation. In the warning algorithm, median daily false alarms (DFA) of 0.25%, and 100% correct alarms (CA) were obtained for both event types. The detection times (DT) before occurrence of events were 13.0 and 12.1 min respectively for hypo-/hyperglycemic events. Compared to the cARX and RNN models, and a linear fusion of the two, the proposed fusion schemes represents a significant improvement. PMID:25571076

  8. Events in Early Life are Associated with Female Reproductive Ageing: A UK Biobank Study.

    PubMed

    Ruth, Katherine S; Perry, John R B; Henley, William E; Melzer, David; Weedon, Michael N; Murray, Anna

    2016-01-01

    The available oocyte pool is determined before birth, with the majority of oocytes lost before puberty. We hypothesised that events occurring before birth, in childhood or in adolescence ('early-life risk factors') could influence the size of the oocyte pool and thus the timing of menopause. We included cross-sectional data from 273,474 women from the UK Biobank, recruited in 2006-2010 from across the UK. We analysed the association of early menopause with events occurring before adulthood in 11,781 cases (menopause aged under 45) and 173,641 controls (menopause/pre-menopausal at ≥45 years), in models controlling for potential confounding variables. Being part of a multiple birth was strongly associated with early menopause (odds ratio = 1.42, confidence interval: 1.11, 1.82, P = 8.0 × 10(-9), fully-adjusted model). Earlier age at menarche (odds ratio = 1.03, confidence interval: 1.01, 1.06, P = 2.5 × 10(-6)) and earlier year of birth were also associated with EM (odds ratio = 1.02, confidence interval: 1.00, 1.04, P = 8.0 × 10(-6)). We also confirmed previously reported associations with smoking, drinking alcohol, educational level and number of births. We identified an association between multiple births and early menopause, which connects events pre-birth, when the oocyte pool is formed, with reproductive ageing in later life. PMID:27094806

  9. Events in Early Life are Associated with Female Reproductive Ageing: A UK Biobank Study

    PubMed Central

    Ruth, Katherine S.; Perry, John R. B.; Henley, William E.; Melzer, David; Weedon, Michael N.; Murray, Anna

    2016-01-01

    The available oocyte pool is determined before birth, with the majority of oocytes lost before puberty. We hypothesised that events occurring before birth, in childhood or in adolescence (‘early-life risk factors’) could influence the size of the oocyte pool and thus the timing of menopause. We included cross-sectional data from 273,474 women from the UK Biobank, recruited in 2006–2010 from across the UK. We analysed the association of early menopause with events occurring before adulthood in 11,781 cases (menopause aged under 45) and 173,641 controls (menopause/pre-menopausal at ≥45 years), in models controlling for potential confounding variables. Being part of a multiple birth was strongly associated with early menopause (odds ratio = 1.42, confidence interval: 1.11, 1.82, P = 8.0 × 10−9, fully-adjusted model). Earlier age at menarche (odds ratio = 1.03, confidence interval: 1.01, 1.06, P = 2.5 × 10−6) and earlier year of birth were also associated with EM (odds ratio = 1.02, confidence interval: 1.00, 1.04, P = 8.0 × 10−6). We also confirmed previously reported associations with smoking, drinking alcohol, educational level and number of births. We identified an association between multiple births and early menopause, which connects events pre-birth, when the oocyte pool is formed, with reproductive ageing in later life. PMID:27094806

  10. BioSense: implementation of a National Early Event Detection and Situational Awareness System.

    PubMed

    Bradley, Colleen A; Rolka, H; Walker, D; Loonsk, J

    2005-08-26

    BioSense is a CDC initiative to support enhanced early detection, quantification, and localization of possible biologic terrorism attacks and other events of public health concern on a national level. The goals of the BioSense initiative are to advance early detection by providing the standards, infrastructure, and data acquisition for near real-time reporting, analytic evaluation and implementation, and early event detection support for state and local public health officials. BioSense collects and analyzes Department of Defense and Department of Veterans Affairs ambulatory clinical diagnoses and procedures and Laboratory Corporation of America laboratory-test orders. The application summarizes and presents analytical results and data visualizations by source, day, and syndrome for each ZIP code, state, and metropolitan area through maps, graphs, and tables. An initial proof of a concept evaluation project was conducted before the system was made available to state and local users in April 2004. User recruitment involved identifying and training BioSense administrators and users from state and local health departments. User support has been an essential component of the implementation and enhancement process. CDC initiated the BioIntelligence Center (BIC) in June 2004 to conduct internal monitoring of BioSense national data daily. BIC staff have supported state and local system monitoring, conducted data anomaly inquiries, and communicated with state and local public health officials. Substantial investments will be made in providing regional, state, and local data for early event detection and situational awareness, test beds for data and algorithm evaluation, detection algorithm development, and data management technologies, while maintaining the focus on state and local public health needs. PMID:16177687

  11. Elevated circulating branched chain amino acids are an early event in pancreatic adenocarcinoma development

    PubMed Central

    Kraft, Peter; Torrence, Margaret E.; Fiske, Brian P.; Yuan, Chen; Bao, Ying; Townsend, Mary K.; Tworoger, Shelley S.; Davidson, Shawn M.; Papagiannakopoulos, Thales; Yang, Annan; Dayton, Talya L.; Ogino, Shuji; Stampfer, Meir J.; Giovannucci, Edward L.; Qian, Zhi Rong; Rubinson, Douglas A.; Ma, Jing; Sesso, Howard D.; Gaziano, John Michael; Cochrane, Barbara B.; Liu, Simin; Wactawski–Wende, Jean; Manson, JoAnn E.; Pollak, Michael N.; Kimmelman, Alec C.; Souza, Amanda; Pierce, Kerry; Wang, Thomas J.; Gerszten, Robert E.; Fuchs, Charles S.; Heiden, Matthew G. Vander; Wolpin, Brian M.

    2014-01-01

    Most patients with pancreatic ductal adenocarcinoma (PDAC) are diagnosed with advanced disease and survive less than 12 months1. PDAC has been linked with obesity and glucose intolerance2-4, but whether changes in circulating metabolites are associated with early cancer progression is unknown. To better understand metabolic derangements associated with early disease, we profiled metabolites in prediagnostic plasma from pancreatic cancer cases and matched controls from four prospective cohort studies. We find that elevated plasma levels of branched chain amino acids (BCAAs) are associated with a greater than 2–fold increased risk of future pancreatic cancer diagnosis. This elevated risk was independent of known predisposing factors, with the strongest association observed among subjects with samples collected 2 to 5 years prior to diagnosis when occult disease is likely present. We show that plasma BCAAs are also elevated in mice with early stage pancreatic cancers driven by mutant Kras expression, and that breakdown of tissue protein accounts for the increase in plasma BCAAs that accompanies early stage disease. Together, these findings suggest that increased whole–body protein breakdown is an early event in development of PDAC. PMID:25261994

  12. Evidence for Early Local Viral Replication and Local Production of Antiviral Immunity upon Mucosal Simian-Human Immunodeficiency Virus SHIV89.6 Infection in Macaca nemestrina

    PubMed Central

    Ambrose, Zandrea; Larsen, Kay; Thompson, Jannelle; Stevens, Yvonne; Finn, Eric; Hu, Shiu-Lok; Bosch, Marnix L.

    2001-01-01

    Transmission of human immunodeficiency virus type 1 (HIV-1) is largely a result of heterosexual exposure, leading many investigators to evaluate mucosal vaccines for protection against intravaginal (i.vag.) transmission in macaque models of AIDS. Relatively little is known, however, about the dynamics of viral replication and the ensuing immune response following mucosal infection. We have utilized a simian-human immunodeficiency virus (SHIV) to study the differences in viremia, CD4 T-cell percentages, and mucosal and systemic anti-SHIV humoral and cellular immune responses during primary infection of animals infected either intravenously (i.v.) or i.vag. Positive viral cocultures, peripheral blood mononuclear cell viral load peaks, and CD4 cell declines were delayed by 1 week in the i.vag. inoculated animals compared to the animals infected i.v., demonstrating delayed viral spreading to the periphery. In contrast, mucosal anti-SHIV antibody levels were greater in magnitude and arose more rapidly and mucosal CD8+ T-cell responses were enhanced in the i.vag. group animals, whereas both the magnitudes and times of onset of systemic immune responses for the animals in the two groups did not differ. These observations demonstrate that compartmentalization of viral replication and induction of local antiviral immunity occur in the genital tract early after i.vag. but not i.v. inoculation. Induction of mucosal immunity to target this local, contained replication should be a goal in HIV vaccine development. PMID:11507204

  13. Early Events following Experimental Infection with Peste-Des-Petits Ruminants Virus Suggest Immune Cell Targeting

    PubMed Central

    Pope, Robert A.; Parida, Satya; Bailey, Dalan; Brownlie, Joe; Barrett, Thomas; Banyard, Ashley C.

    2013-01-01

    Peste-des-petits ruminants virus (PPRV) is a viral pathogen that causes a devastating plague of small ruminants. PPRV is an economically significant disease that continues to be a major obstacle to the development of sustainable agriculture across the developing world. The current understanding of PPRV pathogenesis has been heavily assumed from the closely related rinderpest virus (RPV) and other morbillivirus infections alongside data derived from field outbreaks. There have been few studies reported that have focused on the pathogenesis of PPRV and very little is known about the processes underlying the early stages of infection. In the present study, 15 goats were challenged by the intranasal route with a virulent PPRV isolate, Côte d’Ivoire ’89 (CI/89) and sacrificed at strategically defined time-points post infection to enable pre- and post-mortem sampling. This approach enabled precise monitoring of the progress and distribution of virus throughout the infection from the time of challenge, through peak viraemia and into a period of convalescence. Observations were then related to findings of previous field studies and experimental models of PPRV to develop a clinical scoring system for PPRV. Importantly, histopathological investigations demonstrated that the initial site for virus replication is not within the epithelial cells of the respiratory mucosa, as has been previously reported, but is within the tonsillar tissue and lymph nodes draining the site of inoculation. We propose that virus is taken up by immune cells within the respiratory mucosa which then transport virus to lymphoid tissues where primary virus replication occurs, and from where virus enters circulation. Based on these findings we propose a novel clinical scoring methodology for PPRV pathogenesis and suggest a fundamental shift away from the conventional model of PPRV pathogenesis. PMID:23418464

  14. Evidence of systematic bias in sexual over- and underperception of naturally occurring events: a direct replication of Haselton (2003) in a more gender-equal culture.

    PubMed

    Bendixen, Mons

    2014-01-01

    Error Management Theory (Haselton and Buss, 2000; Haselton and Nettle, 2006) maintains that natural selection has engineered adaptations for judgment under uncertainty to minimize the overall cost of making errors, leading to universal biases in judgments of sexual interest in men and women. This study, using a sample of het erosexual Norwegian students (n = 308), was carried out as a direct replication of Haselton's (2003) original study of naturally occurring events of sexual misperception. The results strongly supported the main hypotheses in the original study, showing that women reported being subject to opposite-sex sexual overperception far more often relative to underperception, and that this difference was small for men. In support of Error Management Theory, and in contrast to Social Role / Structure Theory expectations, the pattern of misperception for women and men was largely invariant across studies and across demographic groups within a culture. The findings suggest that cross-national differences in the level of gender inequality do not influence reports of sexual over- and underperception in women and men. Beyond sex, factors associated with more sexual overperception relative to underperception were being single, young, and having attitudes condoning casual sex. PMID:25402231

  15. Effects of 60 Hz electromagnetic fields on early growth in three plant species and a replication of previous results.

    PubMed

    Davies, M S

    1996-01-01

    In an attempt to replicate the findings of Smith et al., seeds of Raphanus sativus L. (radish), Sinapsis alba L. (mustard), and Hordeum vulgare L. (barley) were grown for between 9 and 21 days in continuous electromagnetic fields (EMFs) at "ion-cyclotron resonance" conditions for stimulation of Ca(2+) (B(H) = 78.3 mu T, B(HAC) = 40 mu T peak-peak at 60 Hz, B(V) = 0). On harvesting, radish showed results similar to those of Smith et al. Dry stem weight and plant height were both significantly greater (Mann-Whitney tests, Ps < 0.05) in EMF-exposed plants than in control plants in each EMF experiment. Wet root weight was significantly greater in EMF-exposed plants in two out of three experiments, as were dry leaf weight, dry whole weight, and stem diameter. Dry root weight, wet leaf weight, and wet whole weight were significantly greater in EMF-exposed plants in one of three experiments. All significant differences indicated an increase in weight or size in the EMF-exposed plants. In each of the sham experiments, no differences between exposed and control plants were evident. Mustard plants failed to respond to the EMFs in any of the plant parameters measured. In one experiment, barley similarly failed to respond; but in another showed significantly greater wet root weight and significantly smaller stem diameter and dry seed weight at the end of the experiment in exposed plants compared to control plants. Although these results give no clue about the underlying bioelectromagnetic mechanism, they demonstrate that, at least for one EMF-sensitive biosystem, results can be independently replicated in another laboratory. Such replication is crucial in establishing the validity of bioelectromagnetic science. PMID:8860733

  16. Effects of 60 Hz electromagnetic fields on early growth in three plant species and a replication of previous results

    SciTech Connect

    Davis, M.S.

    1996-05-01

    In an attempt to replicate the findings of Smith et al., seeds of Raphanus sativus L. (radish), Sinapsis alba L. (mustard), and Hordeum vulgare L. (barley) were grown for between 9 and 21 days in continuous electromagnetic fields (EMFs) at ion-cyclotron resonance conditions for stimulation of Ca{sup 2+} (B{sub H} = 78.3 {micro}T, B{sub HAC} = 40 {micro}T peak-peak at 60 Hz, B{sub v} = 0). On harvesting, radish showed results similar to those of Smith et al. Dry stem weight and plant height were both significantly greater (Mann-Whitney tests, Ps < 0.05) in EMF-exposed plants than in control plants in each EMF experiment. Wet root weight was significantly greater in EMF-exposed plants in two out of three experiments, as were dry leaf weight, dry whole weight, and stem diameter. Dry root weight, wet leaf weight, and wet whole weight were significantly greater in EMF-exposed plants in one of three experiments. All significant differences indicated an increase in weight or size in the EMF-exposed plants. In each of the sham experiments, no differences between exposed and control plants were evident. Mustard plants failed to respond to the EMFs in any of the plant parameters measured. In one experiment, barley similarly failed to respond; but in another showed significantly greater wet root weight and significantly smaller stem diameter and dry seed weight at the end of the experiment in exposed plants compared to control plants. Although these results give no clue about the underlying bioelectromagnetic mechanism, they demonstrate that, at least for one EMF-sensitive biosystem, results can be independently replicated in another laboratory. Such replication is crucial in establishing the validity of bioelectromagnetic science.

  17. Early viral replication and induced or constitutive immunity in rainbow trout families with differential resistance to Infectious hematopoietic necrosis virus (IHNV)

    USGS Publications Warehouse

    Purcell, M.K.; LaPatra, S.E.; Woodson, J.C.; Kurath, G.; Winton, J.R.

    2010-01-01

    The main objective of this study was to assess correlates of innate resistance in rainbow trout full-sibling families that differ in susceptibility to Infectious hematopoietic necrosis virus (IHNV). As part of a commercial breeding program, full-sibling families were challenged with IHNV by waterborne exposure at the 1 g size to determine susceptibility to IHNV. Progeny from select families (N = 7 families) that varied in susceptibility (ranging from 32 to 90% cumulative percent mortality (CPM)) were challenged again at the 10 g size by intra-peritoneal injection and overall mortality, early viral replication and immune responses were evaluated. Mortality challenges included 20–40 fish per family while viral replication and immune response studies included 6 fish per family at each time point (24, 48 and 72 h post-infection (hpi)). CPM at the 1 g size was significantly correlated with CPM at the 10 g size, indicating that inherent resistance was a stable trait irrespective of size. In the larger fish, viral load was measured by quantitative reverse-transcriptase PCR in the anterior kidney and was a significant predictor of family disease outcome at 48 hpi. Type I interferon (IFN) transcript levels were significantly correlated with an individual's viral load at 48 and 72 hpi, while type II IFN gene expression was significantly correlated with an individual's viral load at 24 and 48 hpi. Mean family type I but not type II IFN gene expression was weakly associated with susceptibility at 72 hpi. There was no association between mean family susceptibility and the constitutive expression of a range of innate immune genes (e.g. type I and II IFN pathway genes, cytokine and viral recognition receptor genes). The majority of survivors from the challenge had detectable serum neutralizing antibody titers but no trend was observed among families. This result suggests that even the most resistant families experienced sufficient levels of viral replication to trigger specific

  18. Approximate entropy analysis of event-related potentials in patients with early vascular dementia.

    PubMed

    Xu, Jin; Sheng, Hengsong; Lou, Wutao; Zhao, Songzhen

    2012-06-01

    This study investigated differences in event-related potential (ERP) parameters among early vascular dementia (VD) patients, healthy elder controls (ECs), and young controls (YCs). A visual "oddball" color identification task was performed while individuals' electroencephalograms (EEGs) were recorded. Approximate entropy (ApEn), a nonlinear measure, along with P300 latencies and amplitudes were used to analyze ERP data and compare these three groups. The patients with VD showed more complex ERP waveforms and higher ApEn values than did ECs while performing the visual task. It was further found that patients with VD showed reduced P300 amplitudes and increased latencies. The results indicate that patients with VD have fewer attention resources to devote to processing stimuli, lower speed of stimulus classification, and lower synchrony in their cortical activity during the response period. We suggest that ApEn, as a measure of ERP complexity, is a promising marker for early diagnosis of VD. PMID:22659716

  19. Preserving the Past: An Early Interview Improves Delayed Event Memory in Children With Intellectual Disabilities

    PubMed Central

    Brown, Deirdre A; Lewis, Charlie N; Lamb, Michael E

    2015-01-01

    The influence of an early interview on children's (N = 194) later recall of an experienced event was examined in children with mild and moderate intellectual disabilities (CWID; 7–12 years) and typically developing (TD) children matched for chronological (7–12 years) or mental (4–9 years) age. Children previously interviewed were more informative, more accurate, and less suggestible. CWID (mild) recalled as much information as TD mental age matches, and were as accurate as TD chronological age matches. CWID (moderate) recalled less than TD mental age matches but were as accurate. Interviewers should elicit CWID's recall as early as possible and consider developmental level and severity of impairments when evaluating eyewitness testimony. PMID:25876042

  20. Association with positive outcome induces early effects in event-related brain potentials.

    PubMed

    Schacht, Annekathrin; Adler, Nele; Chen, Peiyao; Guo, Taomei; Sommer, Werner

    2012-01-01

    Emotional pictures, faces, or words elicit an early posterior negativity (EPN) in the event-related potential, starting around 200-400 ms, followed by a late positive complex (LPC). Occasionally, also very early effects of emotion (VEEEs) are seen prior to 200 ms. The present study examined whether VEEEs can be due to direct links established by reinforcement learning. In the learning session, participants learned to associate previously unknown Chinese words with monetary gain, loss, or neither. In the test session, they were required to distinguish the learned stimuli from novel distracters. Specific to stimuli associated with positive outcome a VEEE, consisting of a posterior positivity, appeared around 150 ms and an LPC between 550 and 700 ms, whereas an EPN was absent. These results show that previous association with reward can induce VEEEs, indicating that emotion effects in ERPs may arise in the absence of biologically preparedness and semantic meaning. PMID:22027086

  1. Not Just the 8.2 event: Dynamic Early Holocene Climate in Arctic Canada

    NASA Astrophysics Data System (ADS)

    Axford, Y.; Briner, J. P.; Miller, G. H.; Francis, D. R.

    2006-12-01

    Temperature reconstructions from a lake in the eastern Canadian Arctic indicate that peak warmth in the early Holocene was interrupted by two abrupt, short-lived temperature reversals at ~9.l and ~8.5 ka. Summer temperatures at Lake CF8, Baffin Island (~500 km west of Greenland) are inferred from subfossil midge (Chironomidae) assemblages. Our results indicate that the site, like others on Baffin Island, experienced exceptionally warm summers (almost 5°C warmer than present) through much of the early Holocene, presumably in response to enhanced summer insolation. After 1000 years of very warm, stable climate, warmth was interrupted by two discrete cold reversals at ~9.1 and ~8.5 ka, during which multiple cold-stenothermous midge taxa appeared in the lake and summer temperatures dropped more than 3°C. These two clearly-defined reversals, well beyond the range of background variability, were of similar amplitude and duration, and were separated by several centuries of near-peak warmth. The only Holocene events of comparable amplitude at this site are the rapid onset of Holocene warmth, and the more gradual Neoglacial cooling after 8 ka. Abrupt cooling events over the Baffin region are consistent with model simulations of the impacts of freshwater outbursts into the Labrador Sea, such as the Lake Agassiz outburst flood that occurred ~8.4 ka. That there are two discrete events recorded at this site indicates that the "8.2 event" was not uniquely significant in this region; rather, the period between approximately ~9.2 and 8 ka was characterized by repeated climate fluctuations forced by multiple outburst floods or other mechanisms. Thus global correlations among paleoclimate records need not assume that climate perturbations during this time period necessarily correlate with the draining of Lake Agassiz or the 8.2 ka cooling in central Greenland.

  2. Early maritime economy and El Nino events at Quebrada Tacahuay, Peru

    USGS Publications Warehouse

    Keefer, D.K.; DeFrance, Susan D.; Moseley, M.E.; Richardson, J. B., III; Satterlee, D.R.; Day-Lewis, A.

    1998-01-01

    The archaeological site of Quebrada Tacahuay, Peru, dates to 12,700 to 12,500 calibrated years before the present (10,770 to 10,530 carbon-14 years before the present). It contains some of the oldest evidence of maritime- based economic activity in the New World. Recovered materials include a hearth, lithic cutting tools and flakes, and abundant processed marine fauna, primarily seabirds and fish. Sediments below and above the occupation layer were probably generated by El Nino events, indicating that El Nino was active during the Pleistocene as well as during the early and middle Holocene.

  3. Early arrival of Southern Source Water in the deep North Atlantic prior to Heinrich event 2

    NASA Astrophysics Data System (ADS)

    Gutjahr, Marcus; Lippold, JöRg

    2011-06-01

    The Atlantic Meridional Overturning Circulation (AMOC) plays an important role in the Northern Hemisphere climate system. Significant interest went into the question of how excessive freshwater input through melting of continental ice can affect its overturning vigor and, hence, heat supply, to higher northern latitudes. Such forcing can be tested by investigating its behavior during extreme iceberg discharge events into the open North Atlantic during the last glacial period, the so-called Heinrich events (HE). Here we present neodymium (Nd) isotope compositions of past seawater, a sensitive chemical water mass tag, extracted from sediments of Ocean Drilling Program Site 1063 in the western North Atlantic (Bermuda Rise), covering the period surrounding HE 2, the Last Glacial Maximum, and the early deglaciation. These data are compared with a record of the kinematic circulation tracer (231Pa/230Th)xs extracted from the same sediment core. Both tracers indicate significant circulation changes preceding intense ice rafting during HE 2 by almost 2 kyr. Moreover, the Nd isotope record suggests the presence of deeply ventilating North Atlantic Deep Water early during Marine Isotope Stage 2 until it was replaced by Southern Source Water at ˜27 ka. The early switch to high (Pa/Th)xs and radiogenic ɛNd in relation to intensified ice rafting during HE 2 suggests that ice rafting into the open North Atlantic during major HE 2 was preceded by an early change of the AMOC. This opens the possibility that variations in AMOC contributed to or even triggered the ice sheet instability rather than merely responding to it.

  4. Early Cretaceous High Arctic Magmatism and the Oceanic Anoxic Event 1a

    NASA Astrophysics Data System (ADS)

    Planke, Sverre; Polteau, Stephane; Faleide, Jan Inge; Svensen, Henrik; Myklebust, Reidun; Midtkandal, Ivar; Corfu, Fernando

    2014-05-01

    The High Arctic Large Igneous Province (HALIP) comprises Early and Late Cretaceous igneous deposits extending from the Canadian Arctic Archipelago in the west to the east Siberian Island in the east. It also includes anomalously thick igneous crust in the Canada Basin. We have mapped out the distribution of HALIP volcanic extrusive and intrusive rocks in the Barents Sea based on field work and borehole data in Svalbard and extensive geophysical data in the offshore areas. The volcanic extrusive and intrusive rocks in the Barents Sea Large Igneous Province (BLIP) are present in a 700 000 km2 large region extending across the northern and eastern Barents Sea. The igneous complex is dominated by a large sill complex intruded into organic-rich Jurassic to Permian age sequences in the East Barents Basin, on Svalbard and on Franz Josef Land. Geochemical data suggest that the tholeiitic igneous rocks were likely formed during a short-lived melting event. New geochronology data (U/Pb on zircons) suggest that the igneous event occurred in the Early Aptian or Barremian. Marine and terrestrial Cretaceous shales and sandstones of the Carolinefjellet, Helvetiafjellet, and Rurikfjellet formations have recently been cored in four boreholes on Svalbard (the Longyearbyen CO2 Laboratory). We have completed a comprehensive analytical program of samples from the boreholes, including geochronology (Ar/Ar and zircon U/Pb), biostratigraphy (palynology), and geochemistry (ICP-MS, RockEval, TOC). In the boreholes, the Barremian-early Aptian Helvetiafjellet Formation is overlaid by early Aptian sapropel-rich shales of the Carolinefjellet Formation. Carbon isotope data reveal a negative excursion in this anoxic interval, most likely representing the Oceanic Anoxic Event 1a (OAE1a). The geochronology data suggest that the intrusive BLIP volcanism occurred at the tim e of the early Aptian OAE1a. We propose that the link between the BLIP and the OAE1a is a massive release of thermogenic methane

  5. Physical and sexual abuse in childhood as predictors of early onset cardiovascular events in women

    PubMed Central

    Rich-Edwards, J.W.; Mason, S.; Rexrode, K.; Spiegelman, D.; Hibert, E.; Kawachi, I.; Jun, H.J.; Wright, R.J.

    2012-01-01

    Background Although child abuse is widespread and has been associated with cardiovascular disease (CVD) risk factors, its association with CVD events is not established. Methods and Results We examined associations of child abuse with CVD events among 66,798 women in the Nurses’ Health Study 2. Proportional hazards models estimated hazard ratios (HR) and 95% confidence intervals (CI) for myocardial infarction (n=262), stroke (n=251), and total CVD (n=513). Severe physical abuse was reported by 9% and forced sex by 11% of participants. Adjusting for age, race, childhood body type, parental education and family CVD history, the HR for CVD events was 0.91 (95% CI: 0.70–1.17) for mild physical abuse, 1.02 (0.82–1.26) for moderate physical abuse, and 1.46 (1.11–1.92) for severe physical abuse compared to none. Compared to women without childhood sexual abuse, the HR was 1.10 (0.88–1.35) for unwanted sexual touching, and 1.56 (1.23–1.99) for forced sex. After adjustment for adult lifestyle and medical risk factors, the HR for severe physical abuse was 1.13 (0.85–1.51) and that for forced sex was 1.25 (0.98–1.60); these intermediates accounted for much of the association of severe child abuse with CVD. Associations were similar for retrospectively and prospectively reported events. Women with abuse were less likely to release medical records. The associations were stronger for unconfirmed self-reported events than endpoints which were corroborated with additional information or medical record review. Conclusions Severe child abuse is a prevalent risk for early adult CVD that is partially mediated by preventable risk factors. PMID:22787111

  6. Environmental controls on marine ecosystems during the early Toarcian extinction event

    NASA Astrophysics Data System (ADS)

    Danise, Silvia; Twitchett, Richard J.

    2015-04-01

    The fossil record has the potential to provide valuable insights into species response to past climate change if paleontological data are combined with appropriate proxies of environmental change. In the early Toarcian (Early Jurassic, ˜183Ma ago) rapid warming coincided with a main perturbation in the carbon cycle, seal level rise, widespread deposition of organic-rich, black shales under anoxic conditions, increased weathering rates and a biotic crisis in the marine realm, with the extinction of approximately 5% of families and 26% of genera. Because of this complex suite of inter-linked environmental and oceanographic changes, a key challenge is to determine which of these were most influential in controlling specific aspects of extinction and ecological collapse. In this study we combine high resolution palaeontological and palaeoenvironmental data from the coastal sections of the Whitby Mudstone Formation in North Yorkshire, UK, to reconstruct how climate changes controlled the structure of benthic and nektonic communities through the event, over a time period of ˜1.7 Ma. We show that benthic and nektonic ecosystems became decoupled and were driven by different environmental variables. Although rapid warming has been invoked as the main trigger of this event, the palaeotemperature proxy was a poor predictor of marine community dynamics, and abiotic factors indirectly linked to temperature, such as change in seawater dissolved oxygen concentration and nutrient inputs, were more important.

  7. Positron-emission tomography imaging of early events after transplantation of islets of Langerhans.

    PubMed

    Toso, Christian; Zaidi, Habib; Morel, Philippe; Armanet, Mathieu; Andres, Axel; Pernin, Nadine; Baertschiger, Reto; Slosman, Daniel; Bühler, Leo H; Bosco, Domenico; Berney, Thierry

    2005-02-15

    The aim of our study was to assess cell trafficking and early events after intraportal islet transplantation. Sprague-Dawley rat islets were incubated for various times, with various concentrations of 2-[F]fluoro-2deoxy-D-glucose (FDG), and in presence of various glucose concentrations. FDG-labeled syngeneic islets or FDG alone were injected in rats. Radioactivity was measured in the liver and in various organs by positron-emission tomography for 6 hours. FDG uptake increased with incubation time or FDG concentration and decreased in presence of glucose. In vivo, all islets implanted in the liver, with an uptake 4.4 times higher than controls (44.2% vs. 10.1%, P=0.02). Radioactivity in the liver decreased at the same rate after injection of labeled-islets and FDG alone. Ex vivo labeling of islets and imaging of posttransplant early events were feasible. Islets engrafted exclusively in the liver. No islet loss could be demonstrated 6 hours after transplantation. PMID:15699768

  8. The early Toarcian anoxic event: what the beginning and the end of the story are?

    NASA Astrophysics Data System (ADS)

    Mattioli, Emanuela; Plancq, Julien; Raucsik, Béla

    2010-05-01

    The early Toarcian anoxic event: what the beginning and the end of the story are? E. Mattioli (1), J. Plancq (1), and B. Rauksik (2) (1) UMR 5125 PEPS, CNRS, France; Université Lyon 1, Campus de la DOUA, Bâtiment Géode, 69622 Villeurbanne Cedex, France (emanuela.mattioli@univ-lyon1.fr) (2) Department of Earth and Environmental Sciences, University of Pannonia, Veszprém, Hungary The early Toarcian anoxic event (T-OAE) and the associated biotic crisis have received much attention in the last decade. However, the events forewarning the crisis as well as its aftermath are still poorly known. The T-OAE coincides with a prominent carbon isotope negative excursion (T-CIE) that is preceded by an excursion of similar intensity at the Pliensbachian-Toarcian boundary (Hesselbo et al., 2007). The onset of T-CIE occurred some 700 kyr later than the end of the Boundary-CIE (Suan et al., 2008a). This succession of events demonstrates that the T-OAE was a complex suite of environmental perturbations. In this work, we focused on calcareous nannofossil assemblages occurring in the Peniche section (Portugal) during the Boundary-CIE with the aim to understand if calcifying plankton reacted in a similar/different way to the two CIEs. Also, two sections and one borehole located along a W-E transect, along the NW-Tethyan shelf (in the Yorkshire coast, in the E Paris Basin, and in Mecsek Basin, respectively), were investigated to assess which way calcareous nannoplankton recovered after the crisis, and if the recovery was a synchronous event. The production by nannoplankton collapsed during the T-CIE, as demonstrated by the lowest absolute abundance of nannofossils measured in Peniche and other studied sites (Mattioli et al., 2008). Besides this nannofossil abundance decrease, also the size of the incertae sedis Schizosphaerella test was drastically reduced (Suan et al., 2008b). If a similar size decrease is also recorded during the Boundary-CIE, calcareous nannofossil abundances are

  9. Increased Axonal Ribosome Numbers Is an Early Event in the Pathogenesis of Amyotrophic Lateral Sclerosis

    PubMed Central

    Verheijen, Mark H. G.; Peviani, Marco; Hendricusdottir, Rita; Bell, Erin M.; Lammens, Martin; Smit, August B.; Bendotti, Caterina; van Minnen, Jan

    2014-01-01

    Myelinating glia cells support axon survival and functions through mechanisms independent of myelination, and their dysfunction leads to axonal degeneration in several diseases. In amyotrophic lateral sclerosis (ALS), spinal motor neurons undergo retrograde degeneration, and slowing of axonal transport is an early event that in ALS mutant mice occurs well before motor neuron degeneration. Interestingly, in familial forms of ALS, Schwann cells have been proposed to slow disease progression. We demonstrated previously that Schwann cells transfer polyribosomes to diseased and regenerating axons, a possible rescue mechanism for disease-induced reductions in axonal proteins. Here, we investigated whether elevated levels of axonal ribosomes are also found in ALS, by analysis of a superoxide dismutase 1 (SOD1)G93A mouse model for human familial ALS and a patient suffering from sporadic ALS. In both cases, we found that the disorder was associated with an increase in the population of axonal ribosomes in myelinated axons. Importantly, in SOD1G93A mice, the appearance of axonal ribosomes preceded the manifestation of behavioral symptoms, indicating that upregulation of axonal ribosomes occurs early in the pathogenesis of ALS. In line with our previous studies, electron microscopy analysis showed that Schwann cells might serve as a source of axonal ribosomes in the disease-compromised axons. The early appearance of axonal ribosomes indicates an involvement of Schwann cells early in ALS neuropathology, and may serve as an early marker for disease-affected axons, not only in ALS, but also for other central and peripheral neurodegenerative disorders. PMID:24498056

  10. Events during Early Triassic recovery from the end-Permian extinction

    NASA Astrophysics Data System (ADS)

    Tong, Jinnan; Zhang, Suxin; Zuo, Jingxun; Xiong, Xinqi

    2007-01-01

    The Palaeozoic-Mesozoic transition is characterized not only by the biggest Phanerozoic mass extinction, at the end of Permian, but also a prolonged period of recovery of the biota during the succeeding Early Triassic. The delayed recovery is generally attributed to the effects of extreme environmental conditions on the Early Triassic ecosystem. However, there has been very little study of the cause and mechanism of the environmental conditions that prevailed during the period of extinction and subsequent recovery. Research on the Permian-Triassic boundary and Lower Triassic, especially that on environmental events at the beginning of the Triassic in South China, indicates that the slowness of the recovery may be the result of three factors: (1) extreme environmental conditions that persisted through the transitional period and which were maintained by, for example, intermittent contemporary volcanism; (2) a passive evolutionary and ecologic strategy of the biota, in which r-selection taxa were dominant and K-selection forms insignificant; (3) an immature, poorly functioning ecosystem, which had difficulty in responding to and withstanding extreme environmental changes. According to data from South China, environmental changes were frequent during the Late Permian, and especially serious at the Permian-Triassic boundary. The Late Permian ecosystem was well structured and fully functioning as a result of a long period of steady development during the late Palaeozoic, and was capable of resisting general environmental changes. However, increasingly frequent and probably more extreme environmental events in the latest Permian may have led to a general collapse of this ecosystem and to the mass extinction at the end of the Permian. The Early Triassic ecosystem was immature, functioned poorly, and was unable to respond effectively to environmental changes, so that persisting extreme environmental conditions slowed ecosystem reconstruction considerably, and the recovery

  11. Universal Sequence Replication, Reversible Polymerization and Early Functional Biopolymers: A Model for the Initiation of Prebiotic Sequence Evolution

    PubMed Central

    Walker, Sara Imari; Grover, Martha A.; Hud, Nicholas V.

    2012-01-01

    Many models for the origin of life have focused on understanding how evolution can drive the refinement of a preexisting enzyme, such as the evolution of efficient replicase activity. Here we present a model for what was, arguably, an even earlier stage of chemical evolution, when polymer sequence diversity was generated and sustained before, and during, the onset of functional selection. The model includes regular environmental cycles (e.g. hydration-dehydration cycles) that drive polymers between times of replication and functional activity, which coincide with times of different monomer and polymer diffusivity. Template-directed replication of informational polymers, which takes place during the dehydration stage of each cycle, is considered to be sequence-independent. New sequences are generated by spontaneous polymer formation, and all sequences compete for a finite monomer resource that is recycled via reversible polymerization. Kinetic Monte Carlo simulations demonstrate that this proposed prebiotic scenario provides a robust mechanism for the exploration of sequence space. Introduction of a polymer sequence with monomer synthetase activity illustrates that functional sequences can become established in a preexisting pool of otherwise non-functional sequences. Functional selection does not dominate system dynamics and sequence diversity remains high, permitting the emergence and spread of more than one functional sequence. It is also observed that polymers spontaneously form clusters in simulations where polymers diffuse more slowly than monomers, a feature that is reminiscent of a previous proposal that the earliest stages of life could have been defined by the collective evolution of a system-wide cooperation of polymer aggregates. Overall, the results presented demonstrate the merits of considering plausible prebiotic polymer chemistries and environments that would have allowed for the rapid turnover of monomer resources and for regularly varying monomer

  12. Lithium-isotope evidence for enhanced silicate weathering during OAE 1a (Early Aptian Selli event)

    NASA Astrophysics Data System (ADS)

    Lechler, Maria; Pogge von Strandmann, Philip A. E.; Jenkyns, Hugh C.; Prosser, Giacomo; Parente, Mariano

    2015-12-01

    An abrupt rise in temperature, forced by a massive input of CO2 into the atmosphere, is commonly invoked as the main trigger for Oceanic Anoxic Events (OAEs). Global warming initiated a cascade of palaeoenvironmental perturbations starting with increased continental weathering and an accelerated hydrological cycle that delivered higher loads of nutrients to coastal areas, stimulating biological productivity. The end-result was widespread anoxia and deposition of black shales: the hallmarks of OAEs. In order to assess the role of weathering as both an OAE initiator and terminator (via CO2 sequestration) during the Early Aptian OAE 1a (Selli Event, ∼120 Ma) the isotopic ratio of lithium isotopes was analysed in three sections of shallow-marine carbonates from the Pacific and Tethyan realms and one basinal pelagic section from the Tethyan domain. Because the isotopic composition of lithium in seawater is largely controlled by continental silicate weathering and high- and low-temperature alteration of basaltic material, a shift to lighter δ7Li values is expected to characterize OAEs. The studied sections illustrate this phenomenon: δ7Li values decrease to a minimum coincident with the negative carbon-isotope excursion that effectively records the onset of OAE 1a. A second negative δ7Li excursion occurs coeval with the minimum in strontium isotopes after the event. The striking similarity to the strontium-isotope record argues for a common driver. The formation and destruction (weathering) of an oceanic LIP could account for the parallel trend in both isotope systems. The double-spike in lithium isotopes is probably related to a change in weathering congruencies. Such a chemostratigraphy is consistent with the hypothesis that an increase in silicate weathering, in conjunction with organic-carbon burial, led to drawdown of atmospheric CO2 during the early Aptian OAE 1a.

  13. Temporal sequence and spatial distribution of early events of fertilization in single sea urchin eggs

    SciTech Connect

    Eisen, A.; Kiehart, D.P.; Wieland, S.J.; Reynolds, G.T.

    1984-11-01

    Measurements and observations of five early events of fertilization, singly and in pairs, from single sea urchin eggs have revealed the precise temporal sequence and spatial distribution of these events. In the Arbacia punctulata egg, a wave of surface contraction occurs coincident with membrane depolarization (t = 0). These two earliest events are followed by the onset of a rapid, propagated increase in cytoplasmic-free calcium at approx.23 s as measured by calcium-aequorin luminescence. The luminescence reaches its peak value by 40 s after the membrane depolarization. The luminescence remains uniformly elevated for some time before its decay over several minutes. The onset of an increase in the pyridin nucleotide (NAD(P)H) fluorescence follows the membrane depolarization at approx.51 s. The fertilization membrane begins its elevation in a wave-like fashion coincidentally with the increase in NAD(P)H fluorescence. Similar results are observed in the Lytechinus variegatus egg. The results suggest that while the increase in cytoplasmic-free calcium may be important for many changes occurring in the egg, the elevated-free calcium is not directly responsible for the propagated wave of cortical granule exocytosis. 32 references, 10 figures.

  14. Dose and Effect Thresholds for Early Key Events in a PPARα-Mediated Mode of Action.

    PubMed

    Lake, April D; Wood, Charles E; Bhat, Virunya S; Chorley, Brian N; Carswell, Gleta K; Sey, Yusupha M; Kenyon, Elaina M; Padnos, Beth; Moore, Tanya M; Tennant, Alan H; Schmid, Judith E; George, Barbara Jane; Ross, David G; Hughes, Michael F; Corton, J Christopher; Simmons, Jane Ellen; McQueen, Charlene A; Hester, Susan D

    2016-02-01

    Current strategies for predicting adverse health outcomes of environmental chemicals are centered on early key events in toxicity pathways. However, quantitative relationships between early molecular changes in a given pathway and later health effects are often poorly defined. The goal of this study was to evaluate short-term key event indicators using qualitative and quantitative methods in an established pathway of mouse liver tumorigenesis mediated by peroxisome proliferator-activated receptor alpha (PPARα). Male B6C3F1 mice were exposed for 7 days to di (2-ethylhexyl) phthalate (DEHP), di-n-octyl phthalate (DNOP), and n-butyl benzyl phthalate (BBP), which vary in PPARα activity and liver tumorigenicity. Each phthalate increased expression of select PPARα target genes at 7 days, while only DEHP significantly increased liver cell proliferation labeling index (LI). Transcriptional benchmark dose (BMDT) estimates for dose-related genomic markers stratified phthalates according to hypothetical tumorigenic potencies, unlike BMDs for non-genomic endpoints (relative liver weights or proliferation). The 7-day BMDT values for Acot1 as a surrogate measure for PPARα activation were 29, 370, and 676 mg/kg/day for DEHP, DNOP, and BBP, respectively, distinguishing DEHP (liver tumor BMD of 35 mg/kg/day) from non-tumorigenic DNOP and BBP. Effect thresholds were generated using linear regression of DEHP effects at 7 days and 2-year tumor incidence values to anchor early response molecular indicators and a later phenotypic outcome. Thresholds varied widely by marker, from 2-fold (Pdk4 and proliferation LI) to 30-fold (Acot1) induction to reach hypothetical tumorigenic expression levels. These findings highlight key issues in defining thresholds for biological adversity based on molecular changes. PMID:26519955

  15. Age-related differences in event-related potentials for early visual processing of emotional faces.

    PubMed

    Hilimire, Matthew R; Mienaltowski, Andrew; Blanchard-Fields, Fredda; Corballis, Paul M

    2014-07-01

    With advancing age, processing resources are shifted away from negative emotional stimuli and toward positive ones. Here, we explored this 'positivity effect' using event-related potentials (ERPs). Participants identified the presence or absence of a visual probe that appeared over photographs of emotional faces. The ERPs elicited by the onsets of angry, sad, happy and neutral faces were recorded. We examined the frontocentral emotional positivity (FcEP), which is defined as a positive deflection in the waveforms elicited by emotional expressions relative to neutral faces early on in the time course of the ERP. The FcEP is thought to reflect enhanced early processing of emotional expressions. The results show that within the first 130 ms young adults show an FcEP to negative emotional expressions, whereas older adults show an FcEP to positive emotional expressions. These findings provide additional evidence that the age-related positivity effect in emotion processing can be traced to automatic processes that are evident very early in the processing of emotional facial expressions. PMID:23677489

  16. The regulation of arbuscular mycorrhizal symbiosis by phosphate in pea involves early and systemic signalling events

    PubMed Central

    Balzergue, Coline; Puech-Pagès, Virginie; Bécard, Guillaume; Rochange, Soizic F.

    2011-01-01

    Most plants form root symbioses with arbuscular mycorrhizal (AM) fungi, which provide them with phosphate and other nutrients. High soil phosphate levels are known to affect AM symbiosis negatively, but the underlying mechanisms are not understood. This report describes experimental conditions which triggered a novel mycorrhizal phenotype under high phosphate supply: the interaction between pea and two different AM fungi was almost completely abolished at a very early stage, prior to the formation of hyphopodia. As demonstrated by split-root experiments, down-regulation of AM symbiosis occurred at least partly in response to plant-derived signals. Early signalling events were examined with a focus on strigolactones, compounds which stimulate pre-symbiotic fungal growth and metabolism. Strigolactones were also recently identified as novel plant hormones contributing to the control of shoot branching. Root exudates of plants grown under high phosphate lost their ability to stimulate AM fungi and lacked strigolactones. In addition, a systemic down-regulation of strigolactone release by high phosphate supply was demonstrated using split-root systems. Nevertheless, supplementation with exogenous strigolactones failed to restore root colonization under high phosphate. This observation does not exclude a contribution of strigolactones to the regulation of AM symbiosis by phosphate, but indicates that they are not the only factor involved. Together, the results suggest the existence of additional early signals that may control the differentiation of hyphopodia. PMID:21045005

  17. Potential of breastmilk analysis to inform early events in breast carcinogenesis: rationale and considerations.

    PubMed

    Murphy, Jeanne; Sherman, Mark E; Browne, Eva P; Caballero, Ana I; Punska, Elizabeth C; Pfeiffer, Ruth M; Yang, Hannah P; Lee, Maxwell; Yang, Howard; Gierach, Gretchen L; Arcaro, Kathleen F

    2016-05-01

    This review summarizes methods related to the study of human breastmilk in etiologic and biomarkers research. Despite the importance of reproductive factors in breast carcinogenesis, factors that act early in life are difficult to study because young women rarely require breast imaging or biopsy, and analysis of critical circulating factors (e.g., hormones) is often complicated by the requirement to accurately account for menstrual cycle date. Accordingly, novel approaches are needed to understand how events such as pregnancy, breastfeeding, weaning, and post-weaning breast remodeling influence breast cancer risk. Analysis of breastmilk offers opportunities to understand mechanisms related to carcinogenesis in the breast, and to identify risk markers that may inform efforts to identify high-risk women early in the carcinogenic process. In addition, analysis of breastmilk could have value in early detection or diagnosis of breast cancer. In this article, we describe the potential for using breastmilk to characterize the microenvironment of the lactating breast with the goal of advancing research on risk assessment, prevention, and detection of breast cancer. PMID:27107568

  18. Does Silent Reading Speed in Normal Adult Readers Depend on Early Visual Processes? Evidence from Event-Related Brain Potentials

    ERIC Educational Resources Information Center

    Korinth, Sebastian Peter; Sommer, Werner; Breznitz, Zvia

    2012-01-01

    Little is known about the relationship of reading speed and early visual processes in normal readers. Here we examined the association of the early P1, N170 and late N1 component in visual event-related potentials (ERPs) with silent reading speed and a number of additional cognitive skills in a sample of 52 adult German readers utilizing a Lexical…

  19. Slip-Related Changes in Plantar Pressure Distribution, and Parameters for Early Detection of Slip Events

    PubMed Central

    Choi, Seungyoung; Cho, Hyungpil; Kang, Boram; Lee, Dong Hun; Kim, Mi Jung

    2015-01-01

    Objective To investigate differences in plantar pressure distribution between a normal gait and unpredictable slip events to predict the initiation of the slipping process. Methods Eleven male participants were enrolled. Subjects walked onto a wooden tile, and two layers of oily vinyl sheet were placed on the expected spot of the 4th step to induce a slip. An insole pressure-measuring system was used to monitor plantar pressure distribution. This system measured plantar pressure in four regions (the toes, metatarsal head, arch, and heel) for three events: the step during normal gait; the recovered step, when the subject recovered from a slip; and the uncorrected, harmful slipped step. Four variables were analyzed: peak pressure (PP), contact time (CT), the pressure-time integral (PTI), and the instant of peak pressure (IPP). Results The plantar pressure pattern in the heel was unique, as compared with other parts of the sole. In the heel, PP, CT, and PTI values were high in slipped and recovered steps compared with normal steps. The IPP differed markedly among the three steps. The IPPs in the heel for the three events were, in descending order (from latest to earliest), slipped, recovered, and normal steps, whereas in the other regions the order was normal, recovered, and slipped steps. Finally, the metatarsal head-to-heel IPP ratios for the normal, recovered, and slipped steps were 6.1±2.9, 3.1±3.0, and 2.2±2.5, respectively. Conclusion A distinctive plantar pressure pattern in the heel might be useful for early detection of a slip event to prevent slip-related injuries. PMID:26798603

  20. Spatiotemporal relationships among early events of fertilization in sea urchin eggs revealed by multiview microscopy.

    PubMed Central

    Suzuki, K; Tanaka, Y; Nakajima, Y; Hirano, K; Itoh, H; Miyata, H; Hayakawa, T; Kinosita, K

    1995-01-01

    Four early events of egg fertilization, changes in intracellular calcium concentration and intracellular pH, reorientation of the surface membrane, and the elevation of the fertilization envelope, were imaged in real time and in pairs in single sea urchin eggs. The paired imaging allowed the correlation of the four events spatially and temporally. Three of them propagated as waves starting at the sperm entry site. The earliest was the calcium wave, visualized with fluorescent indicator dyes. After a delay of 10 s there followed a large decrease in the fluorescence polarization of membrane-bound dyes, which we interpret as arising from membrane reorientation as a result of cortical granule exocytosis and microvillar elongation. With a further delay of 15 s the fertilization envelope was seen to rise in transmitted light. All three waves propagated with similar velocities of approximately 10 microns/s, supporting the view that calcium triggers the latter two events. The fluorescence polarization changed in two steps with a clear pause of 10-20 s in between. The second step, which also propagated as wave, reflects either further elongation of microvilli or straightening of irregular microvilli. This second step was abolished by cytochalasin B and was coincident with an increase in cytoplasmic pH, suggesting that pH-induced actin reorganization may play a role. The cytoplasmic alkalinization, imaged with a fluorescent probe, was quite different from the other events in that it took place homogeneously throughout the egg and slowly (over 100 s). Apparently, the alkalinization is not on a direct downstream pathway of calcium origin. An opposing possibility, that the alkalinization may in fact be triggered by the traveling calcium wave, is also discussed. Images FIGURE 1 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 PMID:7756541

  1. Project Dakota Outreach: Replicating Family Centered, Community Based Early Intervention Policy and Practice, 1991-1994. Final Report.

    ERIC Educational Resources Information Center

    Kjerland, Linda; And Others

    This project worked to help community programs and interagency groups develop fluid organizational structures and better assist staff and parents in the provision of family-centered, community-based early intervention services for young children with disabilities and their families. Highlights of the service model include transdisciplinary…

  2. Replication of an Inter-Disciplinary Approach to Early Education of Handicapped Children 0-3 Years.

    ERIC Educational Resources Information Center

    Smiley, Constance J.; And Others

    Presented is the guide to the Illinois project entitled "An Inter-Disciplinary Approach to Early Education of Handicapped Children Ages 0 - 3 Years" which includes information on funding and public awareness, diagnosis and evaluation, child development-home program, speech and language, structuring the day program, job descriptions and training,…

  3. Early Intervention with a Parent-Delivered Massage Protocol Directed at Tactile Abnormalities Decreases Severity of Autism and Improves Child-to-Parent Interactions: A Replication Study

    PubMed Central

    Silva, Louisa M. T.; Gabrielsen, Kristen R.; Budden, Sarojini S.; Buenrostro, Martha; Horton, Gretchen

    2015-01-01

    Tactile abnormalities are severe and universal in preschool children with autism. They respond well to treatment with a daily massage protocol directed at tactile abnormalities (QST massage for autism). Treatment is based on a model for autism proposing that tactile impairment poses a barrier to development. Two previous randomized controlled trials evaluating five months of massage treatment reported improvement of behavior, social/communication skills, and tactile and other sensory symptoms. This is the first report from a two-year replication study evaluating the protocol in 103 preschool children with autism. Parents gave daily treatment; trained staff gave weekly treatment and parent support. Five-month outcomes replicated earlier studies and showed normalization of receptive language (18%, P = .03), autistic behavior (32%, P = .006), total sensory abnormalities (38%, P = .0000005), tactile abnormalities (49%, P = .0002), and decreased autism severity (medium to large effect size, P = .008). In addition, parents reported improved child-to-parent interactions, bonding, and decreased parenting stress (44%, P = .00008). Early childhood special education programs are tasked with addressing sensory abnormalities and engaging parents in effective home programs. Until now, they have lacked research-based methods to do so. This program fulfills the need. It is recommended to parents and ECSE programs (ages 3–5) at autism diagnosis. PMID:25878901

  4. Early Intervention with a Parent-Delivered Massage Protocol Directed at Tactile Abnormalities Decreases Severity of Autism and Improves Child-to-Parent Interactions: A Replication Study.

    PubMed

    Silva, Louisa M T; Schalock, Mark; Gabrielsen, Kristen R; Budden, Sarojini S; Buenrostro, Martha; Horton, Gretchen

    2015-01-01

    Tactile abnormalities are severe and universal in preschool children with autism. They respond well to treatment with a daily massage protocol directed at tactile abnormalities (QST massage for autism). Treatment is based on a model for autism proposing that tactile impairment poses a barrier to development. Two previous randomized controlled trials evaluating five months of massage treatment reported improvement of behavior, social/communication skills, and tactile and other sensory symptoms. This is the first report from a two-year replication study evaluating the protocol in 103 preschool children with autism. Parents gave daily treatment; trained staff gave weekly treatment and parent support. Five-month outcomes replicated earlier studies and showed normalization of receptive language (18%, P = .03), autistic behavior (32%, P = .006), total sensory abnormalities (38%, P = .0000005), tactile abnormalities (49%, P = .0002), and decreased autism severity (medium to large effect size, P = .008). In addition, parents reported improved child-to-parent interactions, bonding, and decreased parenting stress (44%, P = .00008). Early childhood special education programs are tasked with addressing sensory abnormalities and engaging parents in effective home programs. Until now, they have lacked research-based methods to do so. This program fulfills the need. It is recommended to parents and ECSE programs (ages 3-5) at autism diagnosis. PMID:25878901

  5. Paleoceanographic change associated with the Early Aptian Oceanic Anoxic Event in the western Tethys

    NASA Astrophysics Data System (ADS)

    Westermann, S.; Matera, V.; Fiet, N.; Thierry, A.; Follmi, K. B.

    2009-12-01

    The Cretaceous oceanic anoxic events (OAEs) provide a good opportunity to study the biogeochemical pathways and feedbacks linked to environmental change. The early Aptian OAE, labelled OAE 1a, corresponds to one of the most studied anoxic events within the Cretaceous. This event is characterized by a positive excursion in δ13C, preceded by a pronounced negative spike. Here, we propose to improve our understanding of palaeoceanographic change leading to this event and test the proposed models by investigating phosphorus (P) and redox-sensitive trace-element (RSTE) contents in sections through lower Aptian sediments along a basin-shelf transect in the western Tethys. We complement our geochemical analysis by the analysis of organic matter contents. We selected three representative sections: Gorgo a Cerbara (central Italy) in the Umbria Marche basin, Glaise l’Ermitage (SE France) located in the Vocontian Trough and Cassis/La Bédoule (SE France) located along the Provencal platform. The general trend in P accumulation shows an increase at the onset of the early Aptian event followed by a rapid decrease. This suggests an increase in nutrient input, whereas the return to lower values through the first part of the anoxic event may be related to a weakened capacity to retain P in the sedimentary reservoir due to bottom-water oxygen depletion. This general pattern is contrasted by the data of Gorgo a Cerbara, which also show P-enrichments at the top of the Livello Selli. We compared these enrichments to the total organic carbon (TOC) values. The shales with the maximum TOC values correspond also to those with the highest P content. We calculated Corg:Ptot ratios and observed that the highest values correspond to the top of the Selli level. This is interpreted as a reflection of the decreased capacity of storing and preserving phosphorus in oxygen-depleted sediments. RSTE show similar behaviour in the basinal settings. In the section of Gorgo a Cerbara, the data for U, V

  6. Early Events in Phagosome Establishment Are Required for Intracellular Survival of Legionella pneumophila

    PubMed Central

    Wiater, Lawrence A.; Dunn, Kenneth; Maxfield, Frederick R.; Shuman, Howard A.

    1998-01-01

    During infection, the Legionnaires’ disease bacterium, Legionella pneumophila, survives and multiplies within a specialized phagosome that is near neutral pH and does not fuse with host lysosomes. In order to understand the molecular basis of this organism’s ability to control its intracellular fate, we have isolated and characterized a group of transposon-generated mutants which were unable to kill macrophages and were subsequently found to be defective in intracellular multiplication. These mutations define a set of 20 genes (19 icm [for intracellular multiplication] genes and dotA [for defect in organelle trafficking]). In this report, we describe a quantitative assay for phagosome-lysosome fusion (PLF) and its use to measure the levels of PLF in cells that have been infected with either wild-type L. pneumophila or one of several mutants defective in different icm genes or dotA. By using quantitative confocal fluorescence microscopy, PLF could be scored on a per-bacterium basis by determining the extent to which fluorescein-labeled L. pneumophila colocalized with host lysosomes prelabeled with rhodamine-dextran. Remarkably, mutations in the six genes that were studied resulted in maximal levels of PLF as quickly as 30 min following infection. These results indicate that several, and possibly all, of the icm and dotA gene products act at an early step during phagosome establishment to determine whether L. pneumophila-containing phagosomes will fuse with lysosomes. Although not ruled out, subsequent activity of these gene products may not be necessary for successful intracellular replication. PMID:9712800

  7. New Early Jurassic Tetrapod Assemblages Constrain Triassic-Jurassic Tetrapod Extinction Event

    NASA Astrophysics Data System (ADS)

    Olsen, P. E.; Shubin, N. H.; Anders, M. H.

    1987-08-01

    The discovery of the first definitively correlated earliest Jurassic (200 million years before present) tetrapod assemblage (Fundy basin, Newark Supergroup, Nova Scotia) allows reevaluation of the duration of the Triassic-Jurassic tetrapod extinction event. Present are tritheledont and mammal-like reptiles, prosauropod, theropod, and ornithischian dinosaurs, protosuchian and sphenosuchian crocodylomorphs, sphenodontids, and hybodont, semionotid, and palaeonisciform fishes. All of the families are known from Late Triassic and Jurassic strata from elsewhere; however, pollen and spore, radiometric, and geochemical correlation indicate an early Hettangian age for these assemblages. Because all ``typical Triassic'' forms are absent from these assemblages, most Triassic-Jurassic tetrapod extinctions occurred before this time and without the introduction of new families. As was previously suggested by studies of marine invertebrates, this pattern is consistent with a global extinction event at the Triassic-Jurassic boundary. The Manicouagan impact structure of Quebec provides dates broadly compatible with the Triassic-Jurassic boundary and, following the impact theory of mass extinctions, may be implicated in the cause.

  8. Early event-related brain potentials that reflect interest for content information in the media.

    PubMed

    Adachi, Shinobu; Morikawa, Koji; Nittono, Hiroshi

    2012-03-28

    This study investigated the relationship between event-related brain potentials (ERPs) to abridged content information in the media and the subsequent decisions to view the full content. Student volunteers participated in a task that simulated information selection on the basis of the content information. Screenshots of television clips and headlines of news articles on the Web were used as content information for the image condition and the headline condition, respectively. Following presentation of a stimulus containing content information, participants decided whether or not they would view the full content by pressing a select or a reject button. When the select button was pressed, participants were presented with a television clip or a news article. When the reject button was pressed, participants continued on to the next trial, without viewing further. In comparison with rejected stimuli, selected stimuli elicited a larger negative component, with a peak latency of ∼250 ms. The increase in the negative component was independent of the type of visual stimulus. These results suggest that interest toward content information is reflected in early-stage event-related brain potential responses. PMID:22336875

  9. Inflammation-induced microvascular insulin resistance is an early event in diet-induced obesity

    PubMed Central

    Zhao, Lina; Fu, Zhuo; Wu, Jing; Aylor, Kevin W.; Barrett, Eugene J.; Cao, Wenhong

    2015-01-01

    Endothelial dysfunction and vascular insulin resistance usually coexist and chronic inflammation engenders both. In the present study, we investigate the temporal relationship between vascular insulin resistance and metabolic insulin resistance. We assessed insulin responses in all arterial segments, including aorta, distal saphenous artery and the microvasculature, as well as the metabolic insulin responses in muscle in rats fed on a high-fat diet (HFD) for various durations ranging from 3 days to 4 weeks with or without sodium salicylate treatment. Compared with controls, HFD feeding significantly blunted insulin-mediated Akt (protein kinase B) and eNOS [endothelial nitric oxide (NO) synthase] phosphorylation in aorta in 1 week, blunted vasodilatory response in small resistance vessel in 4 weeks and microvascular recruitment in as early as 3 days. Insulin-stimulated whole body glucose disposal did not begin to progressively decrease until after 1 week. Salicylate treatment fully inhibited vascular inflammation, prevented microvascular insulin resistance and significantly improved muscle metabolic responses to insulin. We conclude that microvascular insulin resistance is an early event in diet-induced obesity and insulin resistance and inflammation plays an essential role in this process. Our data suggest microvascular insulin resistance contributes to the development of metabolic insulin resistance in muscle and muscle microvasculature is a potential therapeutic target in the prevention and treatment of diabetes and its related complications. PMID:26265791

  10. Uncovering Driver DNA Methylation Events in Nonsmoking Early Stage Lung Adenocarcinoma

    PubMed Central

    Jia, Songwei; Chen, Luonan

    2016-01-01

    As smoking rates decrease, proportionally more cases with lung adenocarcinoma occur in never-smokers, while aberrant DNA methylation has been suggested to contribute to the tumorigenesis of lung adenocarcinoma. It is extremely difficult to distinguish which genes play key roles in tumorigenic processes via DNA methylation-mediated gene silencing from a large number of differentially methylated genes. By integrating gene expression and DNA methylation data, a pipeline combined with the differential network analysis is designed to uncover driver methylation genes and responsive modules, which demonstrate distinctive expressions and network topology in tumors with aberrant DNA methylation. Totally, 135 genes are recognized as candidate driver genes in early stage lung adenocarcinoma and top ranked 30 genes are recognized as driver methylation genes. Functional annotation and the differential network analysis indicate the roles of identified driver genes in tumorigenesis, while literature study reveals significant correlations of the top 30 genes with early stage lung adenocarcinoma in never-smokers. The analysis pipeline can also be employed in identification of driver epigenetic events for other cancers characterized by matched gene expression data and DNA methylation data. PMID:27610367

  11. Early Events in the Nonadiabatic Relaxation Dynamics of 4-(N,N-Dimethylamino)benzonitrile.

    PubMed

    Kochman, Michał A; Tajti, Attila; Morrison, Carole A; Miller, R J Dwayne

    2015-03-10

    4-(N,N-Dimethylamino)benzonitrile (DMABN) is the archetypal system for dual fluorescence. Several past studies, both experimental and theoretical, have examined the mechanism of its relaxation in the gas phase following photoexcitation to the S2 state, without converging to a single description. In this contribution, we report first-principles simulations of the early events involved in this process performed using the nonadiabatic trajectory surface hopping (TSH) approach in combination with the ADC(2) electronic structure method. ADC(2) is verified to reproduce the ground- and excited-state structures of DMABN in reasonably close agreement with previous theoretical benchmarks. The TSH simulations predict that internal conversion from the S2 state to the S1 takes place as early as 8.5 fs, on average, after the initial photoexcitation, and with no significant torsion of the dimethylamino group relative to the aromatic ring. As evidenced by supporting EOM-CCSD calculations, the population transfer from S2 to S1 can be attributed to the skeletal deformation modes of the aromatic ring and the stretching of the ring-dimethylamino nitrogen bond. The non- or slightly twisted locally excited structure is the predominant product of the internal conversion, and the twisted intramolecular charge transfer structure is formed through equilibration with the locally excited structure with no change of adiabatic state. These findings point toward a new interpretation of data from previous time-resolved experiments. PMID:26579762

  12. Dysregulation of RBFOX2 Is an Early Event in Cardiac Pathogenesis of Diabetes.

    PubMed

    Nutter, Curtis A; Jaworski, Elizabeth A; Verma, Sunil K; Deshmukh, Vaibhav; Wang, Qiongling; Botvinnik, Olga B; Lozano, Mario J; Abass, Ismail J; Ijaz, Talha; Brasier, Allan R; Garg, Nisha J; Wehrens, Xander H T; Yeo, Gene W; Kuyumcu-Martinez, Muge N

    2016-06-01

    Alternative splicing (AS) defects that adversely affect gene expression and function have been identified in diabetic hearts; however, the mechanisms responsible are largely unknown. Here, we show that the RNA-binding protein RBFOX2 contributes to transcriptome changes under diabetic conditions. RBFOX2 controls AS of genes with important roles in heart function relevant to diabetic cardiomyopathy. RBFOX2 protein levels are elevated in diabetic hearts despite low RBFOX2 AS activity. A dominant-negative (DN) isoform of RBFOX2 that blocks RBFOX2-mediated AS is generated in diabetic hearts. DN RBFOX2 interacts with wild-type (WT) RBFOX2, and ectopic expression of DN RBFOX2 inhibits AS of RBFOX2 targets. Notably, DN RBFOX2 expression is specific to diabetes and occurs at early stages before cardiomyopathy symptoms appear. Importantly, DN RBFOX2 expression impairs intracellular calcium release in cardiomyocytes. Our results demonstrate that RBFOX2 dysregulation by DN RBFOX2 is an early pathogenic event in diabetic hearts. PMID:27239029

  13. Cryptotanshinone inhibits TNF-α-induced early atherogenic events in vitro.

    PubMed

    Ahmad, Zuraini; Ng, Chin Theng; Fong, Lai Yen; Bakar, Nurul Ain Abu; Hussain, Nor Hayuti Mohd; Ang, Kok Pian; Ee, Gwendoline Cheng Lian; Hakim, Muhammad Nazrul

    2016-05-01

    Endothelial dysfunction has been implicated in the pathogenesis of atherosclerosis. Salvia miltiorrhiza (danshen) is a traditional Chinese medicine that has been effectively used to treat cardiovascular disease. Cryptotanshinone (CTS), a major lipophilic compound isolated from S. miltiorrhiza, has been reported to possess cardioprotective effects. However, the anti-atherogenic effects of CTS, particularly on tumor necrosis factor-α (TNF-α)-induced endothelial cell activation, are still unclear. This study aimed to determine the effect of CTS on TNF-α-induced increased endothelial permeability, monocyte adhesion, soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular cell adhesion molecule 1 (sVCAM-1), monocyte chemoattractant protein 1 (MCP-1) and impaired nitric oxide production in human umbilical vein endothelial cells (HUVECs), all of which are early events occurring in atherogenesis. We showed that CTS significantly suppressed TNF-α-induced increased endothelial permeability, monocyte adhesion, sICAM-1, sVCAM-1 and MCP-1, and restored nitric oxide production. These observations suggest that CTS possesses anti-inflammatory properties and could be a promising treatment for the prevention of cytokine-induced early atherogenesis. PMID:26732386

  14. Membrane remodeling, an early event in benzo[alpha]pyrene-induced apoptosis

    SciTech Connect

    Tekpli, Xavier; Rissel, Mary; Huc, Laurence; Catheline, Daniel; Sergent, Odile; Rioux, Vincent; Legrand, Philippe; Holme, Jorn A.; Dimanche-Boitrel, Marie-Therese; Lagadic-Gossmann, Dominique

    2010-02-15

    Benzo[alpha]pyrene (B[alpha]P) often serves as a model for mutagenic and carcinogenic polycyclic aromatic hydrocarbons (PAHs). Our previous work suggested a role of membrane fluidity in B[alpha]P-induced apoptotic process. In this study, we report that B[alpha]P modifies the composition of cholesterol-rich microdomains (lipid rafts) in rat liver F258 epithelial cells. The cellular distribution of the ganglioside-GM1 was markedly changed following B[alpha]P exposure. B[alpha]P also modified fatty acid composition and decreased the cholesterol content of cholesterol-rich microdomains. B[alpha]P-induced depletion of cholesterol in lipid rafts was linked to a reduced expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase). Aryl hydrocarbon receptor (AhR) and B[alpha]P-related H{sub 2}O{sub 2} formation were involved in the reduced expression of HMG-CoA reductase and in the remodeling of membrane microdomains. The B[alpha]P-induced membrane remodeling resulted in an intracellular alkalinization observed during the early phase of apoptosis. In conclusion, B[alpha]P altered the composition of plasma membrane microstructures through AhR and H{sub 2}O{sub 2} dependent-regulation of lipid biosynthesis. In F258 cells, the B[alpha]P-induced membrane remodeling was identified as an early apoptotic event leading to an intracellular alkalinization.

  15. Relationship between early and late stages of information processing: an event-related potential study

    PubMed Central

    Portella, Claudio; Machado, Sergio; Arias-Carrión, Oscar; Sack, Alexander T.; Silva, Julio Guilherme; Orsini, Marco; Leite, Marco Antonio Araujo; Silva, Adriana Cardoso; Nardi, Antonio E.; Cagy, Mauricio; Piedade, Roberto; Ribeiro, Pedro

    2012-01-01

    The brain is capable of elaborating and executing different stages of information processing. However, exactly how these stages are processed in the brain remains largely unknown. This study aimed to analyze the possible correlation between early and late stages of information processing by assessing the latency to, and amplitude of, early and late event-related potential (ERP) components, including P200, N200, premotor potential (PMP) and P300, in healthy participants in the context of a visual oddball paradigm. We found a moderate positive correlation among the latency of P200 (electrode O2), N200 (electrode O2), PMP (electrode C3), P300 (electrode PZ) and the reaction time (RT). In addition, moderate negative correlation between the amplitude of P200 and the latencies of N200 (electrode O2), PMP (electrode C3), P300 (electrode PZ) was found. Therefore, we propose that if the secondary processing of visual input (P200 latency) occurs faster, the following will also happen sooner: discrimination and classification process of this input (N200 latency), motor response processing (PMP latency), reorganization of attention and working memory update (P300 latency), and RT. N200, PMP, and P300 latencies are also anticipated when higher activation level of occipital areas involved in the secondary processing of visual input rise (P200 amplitude). PMID:23355929

  16. Dysregulation of RBFOX2 is an early event in cardiac pathogenesis of diabetes

    PubMed Central

    Nutter, Curtis A.; Jaworski, Elizabeth A.; Verma, Sunil K.; Deshmukh, Vaibhav; Wang, Qiongling; Botvinnik, Olga B.; Lozano, Mario J.; Abass, Ismail J.; Ijaz, Talha; Brasier, Allan R.; Garg, Nisha J.; Wehrens, Xander H.T.; Yeo, Gene W.; Kuyumcu-Martinez, Muge N.

    2016-01-01

    Alternative splicing (AS) defects that adversely affect gene expression and function have been identified in diabetic hearts; however, the mechanisms responsible are largely unknown. Here we show that the RNA-binding protein RBFOX2 contributes to transcriptome changes under diabetic conditions. RBFOX2 controls AS of genes with important roles in heart function relevant to diabetic cardiomyopathy. RBFOX2 protein levels are elevated in diabetic hearts despite low RBFOX2 AS activity. A dominant negative (DN) isoform of RBFOX2 that blocks RBFOX2-mediated AS is generated in diabetic hearts. DN RBFOX2 interacts with wild type RBFOX2 and ectopic expression of DN RBFOX2 inhibits AS of RBFOX2 targets. Notably, DN RBFOX2 expression is specific to diabetes and occurs at early stages before cardiomyopathy symptoms appear. Importantly, DN RBFOX2 expression impairs intracellular calcium release in cardiomyocytes. Our results demonstrate that RBFOX2 dysregulation by DN RBFOX2 is an early pathogenic event in diabetic hearts. PMID:27239029

  17. Enhanced tocopherol levels during early germination events in Chamaerops humilis var. humilis seeds.

    PubMed

    Siles, Laura; Alegre, Leonor; Tijero, Verónica; Munné-Bosch, Sergi

    2015-10-01

    Most angiosperms accumulate vitamin E in the form of tocopherols in seeds, exerting a protective antioxidant role. However, several palm trees principally accumulate tocotrienols, rather than tocopherols, in seeds, as it occurs in other monocots. To unravel the protective role of either tocopherols or tocotrienols against lipid peroxidation during seed germination in Chamaerops humilis var. humilis; seed viability, natural and induced germination capacity, seed water content, malondialdehyde levels (as an indicator of the extent of lipid peroxidation) and vitamin E levels (including both tocopherols and tocotrienols) were examined at various germination phases in a simulated, natural seed bank. At the very early stages of germination (operculum removal), malondialdehyde levels increased 2.8-fold, to decrease later up to 74%, thus indicating a transient lipid peroxidation at early stages of germination. Tocopherol levels were absent in quiescent seeds and did not increase during operculum removal, but increased later presumably dampening malondialdehyde accumulation. Thereafter, tocopherols continued increasing, while lipid peroxidation levels decreased. By contrast, tocotrienols levels remained constant or even decreased as germination progressed, showing no correlation with lipid peroxidation levels. We hypothesize that despite their high tocotrienol content, seeds synthesize tocopherols during germination to protect lipids from peroxidation events. PMID:26241488

  18. Early Maternal Deprivation Enhances Voluntary Alcohol Intake Induced by Exposure to Stressful Events Later in Life

    PubMed Central

    Peñasco, Sara; Mela, Virginia; López-Moreno, Jose Antonio; Viveros, María-Paz; Marco, Eva M.

    2015-01-01

    In the present study, we aimed to assess the impact of early life stress, in the form of early maternal deprivation (MD, 24 h on postnatal day, pnd, 9), on voluntary alcohol intake in adolescent male and female Wistar rats. During adolescence, from pnd 28 to pnd 50, voluntary ethanol intake (20%, v/v) was investigated using the two-bottle free choice paradigm. To better understand the relationship between stress and alcohol consumption, voluntary alcohol intake was also evaluated following additional stressful events later in life, that is, a week of alcohol cessation and a week of alcohol cessation combined with exposure to restraint stress. Female animals consumed more alcohol than males only after a second episode of alcohol cessation combined with restraint stress. MD did not affect baseline voluntary alcohol intake but increased voluntary alcohol intake after stress exposure, indicating that MD may render animals more vulnerable to the effects of stress on alcohol intake. During adolescence, when animals had free access to alcohol, MD animals showed lower body weight gain but a higher growth rate than control animals. Moreover, the higher growth rate was accompanied by a decrease in food intake, suggesting an altered metabolic regulation in MD animals that may interact with alcohol intake. PMID:25821601

  19. Uncovering Driver DNA Methylation Events in Nonsmoking Early Stage Lung Adenocarcinoma.

    PubMed

    Zhang, Xindong; Gao, Lin; Liu, Zhi-Ping; Jia, Songwei; Chen, Luonan

    2016-01-01

    As smoking rates decrease, proportionally more cases with lung adenocarcinoma occur in never-smokers, while aberrant DNA methylation has been suggested to contribute to the tumorigenesis of lung adenocarcinoma. It is extremely difficult to distinguish which genes play key roles in tumorigenic processes via DNA methylation-mediated gene silencing from a large number of differentially methylated genes. By integrating gene expression and DNA methylation data, a pipeline combined with the differential network analysis is designed to uncover driver methylation genes and responsive modules, which demonstrate distinctive expressions and network topology in tumors with aberrant DNA methylation. Totally, 135 genes are recognized as candidate driver genes in early stage lung adenocarcinoma and top ranked 30 genes are recognized as driver methylation genes. Functional annotation and the differential network analysis indicate the roles of identified driver genes in tumorigenesis, while literature study reveals significant correlations of the top 30 genes with early stage lung adenocarcinoma in never-smokers. The analysis pipeline can also be employed in identification of driver epigenetic events for other cancers characterized by matched gene expression data and DNA methylation data. PMID:27610367

  20. Early spring, severe frost events, and drought induce rapid carbon loss in high elevation meadows.

    PubMed

    Arnold, Chelsea; Ghezzehei, Teamrat A; Berhe, Asmeret Asefaw

    2014-01-01

    By the end of the 20th century, the onset of spring in the Sierra Nevada mountain range of California has been occurring on average three weeks earlier than historic records. Superimposed on this trend is an increase in the presence of highly anomalous "extreme" years, where spring arrives either significantly late or early. The timing of the onset of continuous snowpack coupled to the date at which the snowmelt season is initiated play an important role in the development and sustainability of mountain ecosystems. In this study, we assess the impact of extreme winter precipitation variation on aboveground net primary productivity and soil respiration over three years (2011 to 2013). We found that the duration of snow cover, particularly the timing of the onset of a continuous snowpack and presence of early spring frost events contributed to a dramatic change in ecosystem processes. We found an average 100% increase in soil respiration in 2012 and 2103, compared to 2011, and an average 39% decline in aboveground net primary productivity observed over the same time period. The overall growing season length increased by 57 days in 2012 and 61 days in 2013. These results demonstrate the dependency of these keystone ecosystems on a stable climate and indicate that even small changes in climate can potentially alter their resiliency. PMID:25207640

  1. Inflammation-induced microvascular insulin resistance is an early event in diet-induced obesity.

    PubMed

    Zhao, Lina; Fu, Zhuo; Wu, Jing; Aylor, Kevin W; Barrett, Eugene J; Cao, Wenhong; Liu, Zhenqi

    2015-12-01

    Endothelial dysfunction and vascular insulin resistance usually coexist and chronic inflammation engenders both. In the present study, we investigate the temporal relationship between vascular insulin resistance and metabolic insulin resistance. We assessed insulin responses in all arterial segments, including aorta, distal saphenous artery and the microvasculature, as well as the metabolic insulin responses in muscle in rats fed on a high-fat diet (HFD) for various durations ranging from 3 days to 4 weeks with or without sodium salicylate treatment. Compared with controls, HFD feeding significantly blunted insulin-mediated Akt (protein kinase B) and eNOS [endothelial nitric oxide (NO) synthase] phosphorylation in aorta in 1 week, blunted vasodilatory response in small resistance vessel in 4 weeks and microvascular recruitment in as early as 3 days. Insulin-stimulated whole body glucose disposal did not begin to progressively decrease until after 1 week. Salicylate treatment fully inhibited vascular inflammation, prevented microvascular insulin resistance and significantly improved muscle metabolic responses to insulin. We conclude that microvascular insulin resistance is an early event in diet-induced obesity and insulin resistance and inflammation plays an essential role in this process. Our data suggest microvascular insulin resistance contributes to the development of metabolic insulin resistance in muscle and muscle microvasculature is a potential therapeutic target in the prevention and treatment of diabetes and its related complications. PMID:26265791

  2. Event-related potentials reveal early activation of body part representations in action concept comprehension.

    PubMed

    Lu, Aitao; Liu, Jing; Zhang, John X

    2012-03-01

    With tasks involving action concept comprehension, many fMRI studies have reported brain activations in sensori-motor regions specific to effectors of the referent action. There is relatively less evidence whether such activations reflect early semantic access or late conceptual re-processing. Here we recorded event-related potentials when participants recognized noun-verb pairs. For Congruent pairs, the verb was the one most commonly associated with the noun (e.g., football-kick). Compared with a control condition, verbs in Congruent pairs showed priming effects in the time windows of 100-150 ms and 210-260 ms. Such activation seems to be specific to body part but not other aspects of the action as similar priming effect was also found when the noun and verb involved different actions though sharing the same body part (e.g., football-jump), documenting for the first time the early activation of body part representations in action concept comprehension. PMID:22306088

  3. Early Spring, Severe Frost Events, and Drought Induce Rapid Carbon Loss in High Elevation Meadows

    PubMed Central

    Arnold, Chelsea; Ghezzehei, Teamrat A.; Berhe, Asmeret Asefaw

    2014-01-01

    By the end of the 20th century, the onset of spring in the Sierra Nevada mountain range of California has been occurring on average three weeks earlier than historic records. Superimposed on this trend is an increase in the presence of highly anomalous “extreme” years, where spring arrives either significantly late or early. The timing of the onset of continuous snowpack coupled to the date at which the snowmelt season is initiated play an important role in the development and sustainability of mountain ecosystems. In this study, we assess the impact of extreme winter precipitation variation on aboveground net primary productivity and soil respiration over three years (2011 to 2013). We found that the duration of snow cover, particularly the timing of the onset of a continuous snowpack and presence of early spring frost events contributed to a dramatic change in ecosystem processes. We found an average 100% increase in soil respiration in 2012 and 2103, compared to 2011, and an average 39% decline in aboveground net primary productivity observed over the same time period. The overall growing season length increased by 57 days in 2012 and 61 days in 2013. These results demonstrate the dependency of these keystone ecosystems on a stable climate and indicate that even small changes in climate can potentially alter their resiliency. PMID:25207640

  4. Epitope spreading as an early pathogenic event in pediatric multiple sclerosis

    PubMed Central

    Quintana, Francisco J.; Patel, Bonny; Yeste, Ada; Nyirenda, Mukanthu; Kenison, Jessica; Rahbari, Roya; Fetco, Dumitru; Hussain, Mohammad; O'Mahony, Julia; Magalhaes, Sandra; McGowan, Melissa; Johnson, Trina; Rajasekharan, Sathy; Narayanan, Sridar; Arnold, Douglas L.; Weiner, Howard L.; Banwell, Brenda

    2014-01-01

    Objectives: For most adults with initial clinical presentation of multiple sclerosis (MS), biological disease was likely initiated many years prior. Pediatric-onset MS provides an opportunity to study early disease processes. Methods: Using antigen microarrays, including CNS-related proteins, lipids, and other autoantigens, we studied early immunologic events involved in clinical onset of pediatric MS. Serum samples were collected at the time of incident acquired CNS demyelinating syndromes (ADS) in children who, in subsequent prospective follow-up, were ascertained to have either pediatric MS (ADS-MS) or a monophasic illness (ADS-mono). Samples were obtained both at the time of ADS presentation and 3 months into follow-up. We used an initial training set of samples to implicate antibody signatures associated with each group, and then a test set. An additional set of follow-up samples (stability set) was used as a form of internal validation. Results: Children with ADS-MS tended to have distinguishable serum antibody patterns both at the time of ADS presentation and 3 months into follow-up. At the time of ADS, serum samples from patients with ADS-MS or ADS-mono reacted against similar numbers of CNS antigens, although CNS antigens implicated in adult MS were more often targeted in children with ADS-MS. The follow-up ADS-MS samples reacted against a broader panel of CNS antigens, while corresponding ADS-mono samples exhibited a contraction of the initial antibody response. Conclusions: Our findings in this prospective cohort of pediatric-onset CNS demyelinating diseases point to an active process of epitope spreading during early stages of MS, not seen in monophasic CNS inflammatory conditions. PMID:25381299

  5. Early pulmonary events of nose-only water pipe (shisha) smoking exposure in mice

    PubMed Central

    Nemmar, Abderrahim; Hemeiri, Ahmed Al; Hammadi, Naser Al; Yuvaraju, Priya; Beegam, Sumaya; Yasin, Javed; Elwasila, Mohamed; Ali, Badreldin H; Adeghate, Ernest

    2015-01-01

    Water pipe smoking (WPS) is increasing in popularity and prevalence worldwide. Convincing data suggest that the toxicants in WPS are similar to that of cigarette smoke. However, the underlying pathophysiologic mechanisms related to the early pulmonary events of WPS exposure are not understood. Here, we evaluated the early pulmonary events of nose-only exposure to mainstream WPS generated by commercially available honey flavored “moasel” tobacco. BALB/c mice were exposed to WPS 30 min/day for 5 days. Control mice were exposed using the same protocol to atmospheric air only. We measured airway resistance using forced oscillation technique, and pulmonary inflammation was evaluated histopathologically and by biochemical analysis of bronchoalveolar lavage (BAL) fluid and lung tissue. Lung oxidative stress was evaluated biochemically by measuring the level of reactive oxygen species (ROS), lipid peroxidation (LPO), reduced glutathione (GSH), catalase, and superoxide dismutase (SOD). Mice exposed to WPS showed a significant increase in the number of neutrophils (P < 0.05) and lymphocytes (P < 0.001). Moreover, total protein (P < 0.05), lactate dehydrogenase (P < 0.005), and endothelin (P < 0.05) levels were augmented in bronchoalveolar lavage fluid. Tumor necrosis factor α (P < 0.005) and interleukin 6 (P < 0.05) concentrations were significantly increased in lung following the exposure to WPS. Both ROS (P < 0.05) and LPO (P < 0.005) in lung tissue were significantly increased, whereas the level and activity of antioxidants including GSH (P < 0.0001), catalase (P < 0.005), and SOD (P < 0.0001) were significantly decreased after WPS exposure, indicating the occurrence of oxidative stress. In contrast, airway resistance was not increased in WPS exposure. We conclude that subacute, nose-only exposure to WPS causes lung inflammation and oxidative stress without affecting pulmonary function suggesting that inflammation and oxidative stress are

  6. Subclinical alexithymia modulates early audio-visual perceptive and attentional event-related potentials

    PubMed Central

    Delle-Vigne, Dyna; Kornreich, Charles; Verbanck, Paul; Campanella, Salvatore

    2014-01-01

    Introduction: Previous studies have highlighted the advantage of using audio–visual oddball tasks (instead of unimodal ones) in order to electrophysiologically index subclinical behavioral differences. Since alexithymia is highly prevalent in the general population, we investigated whether the use of various bimodal tasks could elicit emotional effects in low- vs. high-alexithymic scorers. Methods: Fifty students (33 females and 17 males) were split into groups based on low and high scores on the Toronto Alexithymia Scale (TAS-20). During event-related potential (ERP) recordings, they were exposed to three kinds of audio–visual oddball tasks: neutral-AVN—(geometrical forms and bips), animal-AVA—(dog and cock with their respective shouts), or emotional-AVE—(faces and voices) stimuli. In each condition, participants were asked to quickly detect deviant events occurring amongst a train of repeated and frequent matching stimuli (e.g., push a button when a sad face–voice pair appeared amongst a train of neutral face–voice pairs). P100, N100, and P300 components were analyzed: P100 refers to visual perceptive and attentional processing, N100 to auditory ones, and the P300 relates to response-related stages, involving memory processes. Results: High-alexithymic scorers presented a particular pattern of results when processing the emotional stimulations, reflected in early ERP components by increased P100 and N100 amplitudes in the emotional oddball tasks [P100: F(2, 48) = 20,319, p < 0.001; N100: F(2, 96) = 8,807, p = 0.001] as compared to the animal or neutral ones. Indeed, regarding the P100, subjects exhibited a higher amplitude in the AVE condition (8.717 μV), which was significantly different from that observed during the AVN condition (4.382 μV, p < 0.001). For the N100, the highest amplitude was found in the AVE condition (−4.035 μV) and the lowest was observed in the AVN condition (−2.687 μV, p = 0.003). However, no effect was found on the

  7. Timing and evolution of ocean anoxic event during Early Cambrian in south China

    NASA Astrophysics Data System (ADS)

    Yang, J.; Jiang, S.; Pi, D.; Ling, H.

    2008-12-01

    The Precambrian/Cambrian (PC-C) interval is one of the most interesting intervals in the evolution of life because of the sudden diversification of animals with mineralized skeletons, known as "Cambrian Explosion". The Yangtze Platform in south China is one of the best occurrences that can provide excellent insights into the palaeo-environmental and biological changes across the PC-C boundary. Our study show that the ocean anoxia were widespread during the Early Cambrian period, however, the start of this anoxic event was not from the PC-C boundary (i.e., 542 Ma), but some 7 Ma later (~535 Ma) when the Niutitang Formation black rock series (black phosphorite, chert, and black shale) deposited along a thousand kilometer long NEE zone in the transitional facies in the Yangtze Platform, while the major Cambrian radiation (Changjiang fauna) took place during 521-511 Ma. During the Niutitang period, the depositional environment of the Early Cambrian sedimentary sequence in south China have evolved from an initial oxic/dysoxic to a major anoxic/euxinic environment, and then back to dysoxic/oxic environment. A Ni-Mo sulfide layer occurred in the lower part of the Niutitang black shales which contains extremely enrichments of many metals, and can serve as a marker layer in south China when the depositional environment turned into euxinic condition. Re-Os isotope study of the sulfide ores and host black shales show an age of 535 Ma. Initial Os isotopic compositions, Mo isotopic compositions, and rare earth elements and Pt group element geochemistry suggest involvement of submarine hydrothermal fluids during the metal enrichments in black shale.

  8. Early Eocene changes in the frequency and spatial distribution of extreme precipitation events

    NASA Astrophysics Data System (ADS)

    Carmichael, Matthew; Lunt, Daniel; Pancost, Richard

    2015-04-01

    Global warming over the next 100 years is likely to result not only in changes to the spatial distribution of mean annual precipitation, but also to the seasonality of precipitation and the frequency of hydrological extremes, with far-reaching socio-economic and ecological impacts. The study of the sensitivity of the hydrological cycle to episodes of global warmth in the geologic past is receiving increased attention from the paleoclimate community, but our understanding of the occurrence of hydrological extremes remains limited. The warming associated with the Paleocene-Eocene Thermal Maximum (PETM) hyperthermal (~56 Ma) has received widespread attention given its global nature, rapid onset and transient nature. A range of geomorphological, microfossil and biomarker proxies suggest significant hydrological changes occurred at the PETM which have traditionally been interpreted in terms of changes in mean annual precipitation; recently changes in the frequency of hydrological extremes at the PETM have also been suggested. In this work, we seek to better understand whether numerical climate models run with boundary conditions appropriate for the early Eocene (56 - 49 Ma) are capable of simulating changes in the frequency of intense precipitation ('storm') events by analysing GCM-simulated precipitation rates at an hourly frequency. Our Eocene simulations are performed at x2 and x4 preindustrial CO2 using a coupled atmosphere-ocean GCM, HadCM3L. Differences in climatology between high and low CO2 may be considered analogous to the changes which occurred at the PETM. Our results indicate significant changes occur in the precipitation intensity-frequency relationships at locations which correspond to sites from which PETM proxies exist. The percentage of time during which precipitation occurs and the overall number of events lasting longer than an hour declines in the high-CO2 model. These changes tend to occur with an associated increase in mean storm precipitation

  9. The Early Toarcian Oceanic Anoxic Event: A Southern Hemisphere record from Chile

    NASA Astrophysics Data System (ADS)

    Fantasia, Alicia; Föllmi, Karl B.; Adatte, Thierry; Spangenberg, Jorge E.; Bernárdez, Enrique; Mattioli, Emanuela

    2016-04-01

    The Early Toarcian was marked by important environmental changes, marine oxygen deficiency and extensive organic-rich sediment deposition (T-OAE; ˜182 Ma, Early Jurassic). The T-OAE coincides with a marked negative carbon isotope excursion (CIE) recorded in marine carbonate, and marine and terrestrial organic carbon. This is commonly attributed to the massive release of isotopically light carbon to the atmospheric and oceanic reservoirs derived from the destabilization of methane hydrates from marine sediments and/or the emissions of thermogenic methane from the eruption of the Karoo-Ferrar LIP (e.g., Hesselbo et al., 2000; Kemp et al., 2005; Svensen et al., 2007; Mazzini et al., 2010). Moreover, in most documented marine sections, this episode is marked by a generalized crisis in carbonate production and marine invertebrate extinctions (e.g. Jenkyns, 1988; Röhl et al., 2005; Suan et al., 2001). Several studies of the T-OAE have been conducted on sediments in central and northwest Europe, but only few data are available from the Southern Hemisphere, leading to large uncertainty concerning the exact expression of this event in this part of the world. The aims of this study are to characterize the sediments deposited during the Andean equivalents of the tenuicostatum and falciferum European Zones and establish in which way the T-OAE affected this region. In the Early Jurassic, the Andean basin was in a back-arc setting with marine corridors connected to Panthalassa. In this study, we have generated new high-resolution sedimentological, geochemical and mineralogical data from the sections of El Peñon and Quebrada Asiento, located in Chile in the northeastern area of the city of Copiapó, Atacama region. The biostratigraphy of these sections has been studied by von Hillebrandt and Schidt-Effing (1981) and complemented here by a biostratigraphy based on calcareous nannofossils. The sections consist of a succession of marl, limestone and siltstone of Pliensbachian and

  10. Imaging of early acceleration phase of the 2013-2014 Boso slow slip event

    NASA Astrophysics Data System (ADS)

    Fukuda, J.; Kato, A.; Obara, K.; Miura, S.; Kato, T.

    2014-12-01

    Based on GPS and seismic data, we examine the spatiotemporal evolution of a slow slip event (SSE) and associated seismic activity that occurred off the Boso peninsula, central Japan, from December 2013 to January 2014. We use GPS data from 71 stations of the GEONET and 6 stations operated by Earthquake Research Institute of the University of Tokyo and Tohoku University around the Boso peninsula. We apply a modified version of the Network Inversion Filter to the GPS time series at the 77 stations to estimate the spatiotemporal evolution of daily cumulative slip and slip rate on the subducting Philippine Sea plate. In addition, we create an improved earthquake catalog by applying a matched filter technique to continuous seismograms and examine the spatiotemporal relations between slow slip and seismicity. We find that the SSE started in early December 2013. The spatiotemporal evolution of slow slip and seismicity is divided into two distinct phases, an earlier slow phase from early to 30 December 2013 (Phase I) and a subsequent faster phase from 30 December 2013 to 9 January 2014 (Phase II). During Phase I, slip accelerated slowly up to a maximum rate of 1.6 m/yr with potentially accelerating along-strike propagation at speeds on the order of 1 km/day or less and no accompanying seismicity. On the other hand, during Phase II, slip accelerated rapidly up to a maximum rate of 4.5 m/yr and then rapidly decelerated. The slip front propagated along strike at a constant speed of ~10 km/day. During the Phase II, slow slip was accompanied by seismic swarm activity that was highly correlated in space and time with slip rate, suggesting that the swarm activity was triggered by stress loading due to slow slip. Early slow acceleration of slip has not been identified in the past Boso SSEs in 1996, 2002, 2007, and 2011. It is not clear at this point whether the past Boso SSEs started with slow acceleration similarly to the 2013-2014 SSE. The transition from the slow to the

  11. The strontium isotope seawater curve during the early Middle Miocene and its relation to paleoceanographic events

    SciTech Connect

    Hodell, D.A. . Dept. of Geology); Woodruff, F. . Dept. Geological Sciences)

    1992-01-01

    Breaks in slope of the strontium isotope seawater curve signal fundamental changes in either rates of continental weathering, seafloor spreading (i.e., tectonic reorganizations), or submarine dissolution of marine carbonates. The authors conducted a detailed study of the change in slope of the strontium isotopic seawater curve that occurred during the early middle Miocene in three Pacific DSDP sites (289, 574, and 588). The change in slope from the rapid rise in Sr-87/Sr-86 of the early Miocene (60 ppm/Ma) to the less rapid increase of the mid- and late Miocene (22 ppm/Ma) occurred between two periods of maximum [delta]C-13 values dated between 15.5 and 15.2 Ma. This internal was followed by relatively constant Sr-87/Sr-86 values (averaging 0.70878) between 15.2 and 14.2 Ma. Sr-87/Sr-86 ratios began to increase again after 14.2 Ma, but at a reduced rate compared to the early Miocene. The break in slope in Sr-87/Sr-86 preceded the mid-Miocene increase in [delta]O-18 that represents ice growth on Antarctica, which began at 14.9 Ma and increased rapidly after 14.2 Ma. In 2 out of 3 of the sites, the break in Sr-slope between 15.5 and 15.2 Ma is accompanied by a small, but significant, decrease in Sr-87/Sr-86 values. They speculate, that this decrease in Sr-87/Sr-86 may have been related to massive dissolution of older carbonate on the sea floor associated with NH2B (Neogene Hiatus 2 of Keller and Barron, 1983). This event may have important implications for changes in carbonate chemistry of the oceans. Numerical modeling of the strontium isotope budget will be used to test the feasibility of this mechanism and to estimate the volume and age of dissolved carbonate needed to produce the observed decrease in Sr-87/Sr-86.

  12. Bmp7 mediates early signaling events during induction of chick epidermal organs.

    PubMed

    Harris, Matthew P; Linkhart, Barbara L; Fallon, John F

    2004-09-01

    The induction and specification of a large number of vertebrate organs require reciprocal signaling between an epithelium and subjacent mesenchyme. In the formation of integumentary organs, the initial inductive signaling events leading to the formation of the organ primordia stem from the mesenchyme. However, the epithelium must have the capacity to respond to these signals. We demonstrate that bone morphogenetic protein 7 (Bmp7) is an early molecular marker for epidermal organ development during development of feathers and scales of the chick. Bmp7 is expressed broadly in the preplacode epidermis and subsequently becomes localized to the forming placodes of feathers and scales. An examination of Bmp7 expression in the scaleless mutant chicken integument indicates that Bmp7 expression in the epidermis is associated with the ability to form epidermal organs. We show that BMP7 function is necessary for the formation of epidermal placodes in both feather and scale forming epidermis. In addition, precocious expression of Bmp7 in the metatarsal epidermis of the Silkie mutant or treatment of the metatarsus with ectopic BMP7 protein results in feather development from scale forming integument. From these data, we propose that Bmp7 is necessary and sufficient, in a developmental context, to mediate the competence of an epithelium to respond to inductive signals from the underlying mesenchyme to form epidermal organs in the chick. We propose that regulation of Bmp7 in localized areas of the embryonic epidermis facilitates the development of regional formation of integumentary organs. PMID:15305284

  13. Lipid peroxidation is an early event in necrosis of wheat hybrid.

    PubMed

    Dalal, M; Khanna-Chopra, R

    1999-08-19

    We previously reported enhanced superoxide anion generation in an F1 necrotic hybrid produced from normal parents (Khanna-Chopra et al., Biochem. Biophys. Res. Commun. (1998) 248, 712-715). Further investigation of the mechanism of necrosis shows the possibility of lipid peroxidation as an early event in the death of necrotic leaves. Lipid peroxidation resulting from the inability of free radical scavenging is often associated with cell death. In this study the accumulation of malondialdehyde, an end product of lipid peroxidation, was measured in hybrid leaves and those of the parents. Lipid peroxidation was higher in the hybrid leaves through out the leaf ontogeny. This was accompanied by increased membrane permeability. Cell viability measured by a TTC reduction test showed a significant correlation with conductivity. There was no apparent effect on photosynthetic pigments and maximum efficiency of PSII (Fv/Fm) until the appearance of necrotic lesions on the hybrid leaf. There seems to be a close relationship among lipid peroxidation, membrane permeability, and cell viability in the leaves undergoing necrosis. This suggests the possibility of a genetic mechanism whereby the scavenging of free radical is impaired, leading to enhanced lipid peroxidation and membrane permeability, resulting in necrosis and death of the hybrid leaves in wheat. PMID:10448077

  14. Autophagic degradation of aquaporin-2 is an early event in hypokalemia-induced nephrogenic diabetes insipidus

    PubMed Central

    Khositseth, Sookkasem; Uawithya, Panapat; Somparn, Poorichaya; Charngkaew, Komgrid; Thippamom, Nattakan; Hoffert, Jason D.; Saeed, Fahad; Michael Payne, D.; Chen, Shu-Hui; Fenton, Robert A.; Pisitkun, Trairak

    2015-01-01

    Hypokalemia (low serum potassium level) is a common electrolyte imbalance that can cause a defect in urinary concentrating ability, i.e., nephrogenic diabetes insipidus (NDI), but the molecular mechanism is unknown. We employed proteomic analysis of inner medullary collecting ducts (IMCD) from rats fed with a potassium-free diet for 1 day. IMCD protein quantification was performed by mass spectrometry using a label-free methodology. A total of 131 proteins, including the water channel AQP2, exhibited significant changes in abundance, most of which were decreased. Bioinformatic analysis revealed that many of the down-regulated proteins were associated with the biological processes of generation of precursor metabolites and energy, actin cytoskeleton organization, and cell-cell adhesion. Targeted LC-MS/MS and immunoblotting studies further confirmed the down regulation of 18 selected proteins. Electron microscopy showed autophagosomes/autophagolysosomes in the IMCD cells of rats deprived of potassium for only 1 day. An increased number of autophagosomes was also confirmed by immunofluorescence, demonstrating co-localization of LC3 and Lamp1 with AQP2 and several other down-regulated proteins in IMCD cells. AQP2 was also detected in autophagosomes in IMCD cells of potassium-deprived rats by immunogold electron microscopy. Thus, enhanced autophagic degradation of proteins, most notably including AQP2, is an early event in hypokalemia-induced NDI. PMID:26674602

  15. A Time Scale for Major Events in Early Mars Crustal Evolution

    NASA Technical Reports Server (NTRS)

    Frey, Herbert V.

    2004-01-01

    The population of visible and buried impact basins > 200 km diameter revealed by high resolution gridded MOLA data and the cumulative frequency curves derived for these pvide a basis for a chronology of major events in early martian history. The relative chronology can be given in terms of N(200) crater retention ages; 'absolute ages' can be assigued using the Hartmann-Neukum (H&N) model chronology. In terms of billions of H&N years, the crustal dichotomy formed by large impact basins at 4.12 +/- 0.08 BYA (N(200) = 3.0-3.2) and the global magnetic field died at about or slightly before the same time (4.15 +/- 0.08 BYA (N(200) = 3.5). In this chronology, the buried lowlands are approx. 120 my younger than the buried highlands, approx. 160 my younger than the highlands overall and approx. 340 my younger than the oldest crater retention surface we see, defined by the largest impact basins.

  16. Temporal sequence of events during the initiation process in Escherichia coli deoxyribonucleic acid replication: roles of the dnaA and dnaC gene products and ribonucleic acid polymerase.

    PubMed Central

    Zyskind, J W; Deen, L T; Smith, D W

    1977-01-01

    Three thermosensitive deoxyribonucleic acid (DNA) initiation mutants of Escherichia coli exposed to the restrictive temperature for one to two generations were examined for the ability to reinitiate DNA replication after returning to the permissive temperature in the presence of rifampin, chloramphenicol, or nalidixic acid. Reinitiation in the dnaA mutant was inhibited by rifampin but not by chloramphenicol, whereas renitiation was not inhibited by rifampin but not by chloramphenicol, whereas reinitiation was not inhibited in two dnaC mutants by either rifampin or chloramphenicol. To observe the rifampin inhibition, the antibiotic must be added at least 10 min before return to the permissive temperature. The rifampin inhibition of reinitiation was not observed when a rifampin-resistant ribonucleic acid ((RNA) polymerase gene was introduced into the dnaA mutant, demonstrating that RNA polymerase synthesizes one or more RNA species required for the initation of DNA replication (origin-RNA). Reinitiation at 30 degrees C was not inhibited by streptolydigin in a stretolydigin-sensitive dnaA muntant. Incubation in the presence of nalidixic acid prevented subsequent reinitiation in the dnaC28 mutant but did not inhibit reinitiation in the dnaA5 muntant. These results demonstrate that the dnaA gene product acts before or during the synthesis of an origin-RNA, RNA polymerase synthesizes this origin RNA, and the dnaC gene product is involved in a step after this RNA synthesis event. Furthermore, these results suggest that the dnaC gene product is involved in the first deoxyribounucleotide polymerization event wheareas the dnaA gene product acts prior to this event. A model is presented describing the temporal sequence of events that occur during initiation of a round of DNA replication, based on results in this and the accompanying paper. PMID:321429

  17. EFFECT OF ARSENICALS ON THE EXPRESSION OF CELL CYCLE PROTEINS AND EARLY SIGNALING EVENTS IN PRIMARY HUMAN KERATINOCYTES.

    EPA Science Inventory

    Effect of Arsenicals on the Expression of Cell Cycle Proteins and Early Signaling Events in Primary Human Keratinocytes.

    Mudipalli, A, Owen R. D. and R. J. Preston, Environmental Carcinogenesis Division, USEPA, RTP, NC 27711.

    Environmental exposure to arsenic is a m...

  18. How the timing of weather events influences early development in a large mammal.

    PubMed

    Hendrichsen, D K; Tyler, N J C

    2014-07-01

    Capturing components of the weather that drive environment-animal interactions is a perennial problem in ecology. Identifying biologically significant elements of weather conditions in sensible statistics suitable for analysis of life history variation and population dynamics is central. Meteorological variables such as temperature, precipitation, and wind modulate rates of heat loss in animals, but analysis of their effects on endothermic species is complicated by the fact that their influence on energy balance is not invariably linear, even across the thermoneutral range. Rather, the thermal load imposed by a given set of weather conditions is a function of organisms' metabolic requirement, which, crucially, may vary spontaneously both seasonally and across different life phases. We propose that the endogenous component of variation in metabolic demand introduces a temporal dimension and that, as a consequence, the specific effect of meteorological variables on energy balance and attendant life history parameters is a function of the timing of weather events with respect to the organism's metabolic rhythm(s). To test this, we examined how a spontaneous increase in metabolic demand influenced the effect of weather on early development in a large mammal. Specifically, we examined interaction between the exponential rise in the energy requirements of pregnancy and depth of snow, which restricts dams' access to forage, on the body mass of reindeer calves (Rangifer tarandus) at weaning. As expected, we detected a significant temporal component: the specific negative effect of snow on weaning mass was not constant, but increased across pregnancy. The life history response was therefore better predicted by interaction between the magnitude and the timing of weather events than by their magnitude alone. To our knowledge, this is the first demonstration of the influence of an endogenous metabolic dynamic on the impact of weather on a life history trait in a free

  19. Proxies for Redox Conditions during early Aptian Ocean Anoxic Event 1a

    NASA Astrophysics Data System (ADS)

    Brassell, S. C.

    2012-04-01

    Reports of higher concentrations of biomarkers for photic zone anoxia, namely isorenieratane and chlorobactane, in sediments that correspond to warmer episodes during the Cenomanian-Turonian oceanic anoxic event (OAE2) prompts consideration of the potential association of ocean stratification and anoxia with enhanced temperatures during other Ocean Anoxic Events (OAE). Recognition of temperature variations based on the TEX86 proxy for a sediment sequence rich in organic matter from Shatsky Rise (ODP Site 1207) corresponding to OAE1a (early Aptian) affords the opportunity for such an investigation. Moreover, the 50 cm continuous section of this OAE1a interval that was recovered enabled sampling to examine detailed stratigraphic variations in the abundances and compositions of a range of geochemical characteristics, both molecular and elemental, including possible biological responses to temperature fluctuations and other palaeoenvironmental conditions, notably the levels of oxygenation of the depositional setting. The temperature-dependent variations in biomarkers and other geochemical proxies through the OAE1a interval included: (i) decreasing concentrations of 2-methylhopanes derived from cyanobacteria with increasing temperature, and (ii) fluctuations in V concentrations that reflect temperature trends, and correspond closely with organic C contents, except where Corg >30%. Among parameters linked to levels of oxygenation, the biomarker constituents in the OAE1a interval include steroidal and hopanoid ketones consistent with an oxygenated water column, but the sediments also contain traces of isorenieratane from green sulphur bacteria suggesting intermittent photic zone anoxia. Similarly, the observed values far exceeding unity for the lycopane index [(lycopane + n-C35)/n-C31] imply anoxic bottom waters, although the location of Shatsky Rise in the mid-Pacific during the Aptian may skew this ratio because of the paucity of biological sources for n-C31. In

  20. Impact of LIP formation on marine productivity during early Aptian and latest Cenomanian Oceanic Anoxic Events

    NASA Astrophysics Data System (ADS)

    Erba, E.; Duncan, R.

    2003-04-01

    Of all the Cretaceous Oceanic Anoxic Events (OAEs), the Early Aptian OAE1a and latest Cenomanian OAE2 are truly global in nature and typically represented by carbonate crisis and Corg-rich black shales. They correlate with onset and climax of the mid-Cretaceous greenhouse, a time of exceptional warmth with accelerated burial of organic matter, carbon and strontium isotope excursions, and major biotic changes. Extraordinary rates of volcanism during the formation of Ontong Java and Caribbean Plateaus are proposed to have introduced excess CO_2 in the ocean/atmosphere system, turning the climate into a super-greenhouse state. High-resolution multidisciplinary investigations of well-dated sections indicate that marine ecosystems reacted to higher fertility and pCO2 by reducing biomineralization and increasing production of organic matter. In particular, rates of calcitization and evolutionary changes of micrite-forming calcareous nannoplankton (the biological and carbonate pump) affected the organic and inorganic carbon cycle as well as diffusion of atmospheric CO_2 in the Cretaceous ocean. Increasing geological evidence suggests that OAE1a and OAE2 were mainly oceanic productivity events, directly or indirectly controlled by submarine volcanic eruptions. High levels of volcanogenic CO_2 in the atmosphere accelerated continental weathering and increased nutrient content in oceanic surface waters via river run-off. However, only coastal eutrophication can be triggered by river input, and this mechanism cannot explain enhanced primary productivity in remote parts of large oceans like those recorded in wide-spread sediments of OAE1a and OAE2. Conversely, global productivity can be stimulated by hydrothermal megaplumes that introduce in the oceans high concentrations of dissolved and particulate metals that are biolimiting (and toxic) and, consequently, can trigger large blooms (and deaths) of primary producers. We speculate that during OAE1a and OAE2, higher productivity

  1. Combination therapy including CpG oligodeoxynucleotides and entecavir induces early viral response and enhanced inhibition of viral replication in a woodchuck model of chronic hepadnaviral infection.

    PubMed

    Meng, Zhongji; Zhang, Xiaoyong; Pei, Rongjuan; Zhang, Ejuan; Kemper, Thekla; Vollmer, Jörg; Davis, Heather L; Glebe, Dieter; Gerlich, Wolfram; Roggendorf, Michael; Lu, Mengji

    2016-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate immune cells via TLR9 and are potentially useful immunomodulators for the treatment of chronic viral infections. In the present study, different classes of CpGs were tested for their capacities for innate immune activation and antiviral activities in the woodchuck model. A class P CpG ODN was found to stimulate interferon (IFN) production in woodchuck peripheral blood mononuclear cells (PBMCs) in vitro, and following subcutaneous administration in vivo, it was observed to induce IFN and MxA expression in woodchuck PBMCs. Combination treatment with CpG ODN and entecavir (ETV) led to effective suppression of the woodchuck hepatitis virus (WHV) load in the woodchucks, with early viral responses and inhibition of replication. The woodchuck hepatitis surface antigen (WHsAg) serum concentrations were strongly decreased by CpG and ETV together but not by either agent alone, indicating synergistic effects. However, viral control post-treatment was still transient, similar to that observed with ETV alone. Significantly elevated levels of serum aspartate aminotransferase (AST) but not of alanine aminotransferase (ALT) in some of the woodchucks receiving CpG ODN were noted, but these increases were resolved before the completion of treatment and were not associated with an elevated serum bilirubin level or coagulation disorders, suggesting the absence of a significant safety concern. PMID:26585244

  2. Replication origins and a sequence involved in coordinate induction of the immediate-early gene family are conserved in an intergenic region of herpes simplex virus.

    PubMed Central

    Whitton, J L; Clements, J B

    1984-01-01

    We have determined the structure of the 5' portion of herpes simplex virus type 2 (HSF-2) immediate-early (IE) mRNA-3 and have obtained the DNA sequence specifying the N terminus of its encoded polypeptide, Vmw182, its untranslated leader and the intergenic region between IEmRNAs-3 & 4/5. Comparison of the HSV-2 intergenic sequences with the HSV-1 equivalent region identifies several conserved regions: (1) an AT-rich element with core consensus TAATGARAT which is likely to be the 'activator' sequence through which coordinate induction of the IE gene family is mediated. (2) GC-rich and GA-rich tracts, found in a wide variety of eukaryotic promoters, which vary in position and orientation between HSV-2 and HSV-1 and which represent modulators of transcription. (3) TATA homologies present 15-25 base pairs (bp) upstream of mRNA 5' termini. (4) a 137bp direct repeat in HSV-2 which contains sequence almost identical to the HSV-1 replication origin. Images PMID:6322134

  3. Stress and "Storm and Stress" in Early Adolescence: The Relationship of Negative Events with Dysphoric Affect.

    ERIC Educational Resources Information Center

    Larson, Reed; Ham, Mark

    1993-01-01

    Fifth through ninth graders reported their daily emotional states, and they and their parents reported on the students' life events. Older students experienced more negative events than younger students. The experience of multiple negative events had a stronger association with negative affect for older students than for younger students. (BC)

  4. Misbinding of color and motion in human early visual cortex: Evidence from event-related potentials.

    PubMed

    Zhang, Yanyu; Zhang, Xilin; Wang, Yizhou; Fang, Fang

    2016-05-01

    One of the central tasks for the visual system is to integrate visual features into objects, which is referred to as the binding problem. To study the binding mechanisms, it has been suggested to use phenomena of feature misbinding to separate active feature binding from feature co-occurence. Taking advantage of a steady-state misbinding of color and motion, we performed psychophysical and event-related potential (ERP) adaptation experiments to investigate the neural mechanisms of the misbinding (i.e., the active color-motion binding). Human subjects adapted to the misbinding of color and motion, as well as their correct binding that was used for identifying neural processes associated with the co-occurrence of color and motion. We found that adaptation to the misbinding and the correct binding could generate color-contingent motion aftereffects (CCMAEs), but in opposite directions. ERP adaptation effects manifested in the earliest ERP component C1. The C1 latency in the misbinding condition was 11ms longer than that in the correct binding condition. In the correct binding condition, the C1 adaptation effect (i.e., the C1 amplitude reduction after adaptation) took place in the peak phase of the C1. The dipole source of the adaptation effect was located in V1. In the misbinding condition, the C1 adaptation effect occurred in the descending phase of the C1 and its dipole source was in V2. In both conditions, the C1 adaptation effects correlated with the CCMAEs across individual subjects. These findings provide human electrophysiological evidence that active feature binding takes place in early visual cortex, but at later processing stages than feature co-occurrence. PMID:27038562

  5. Evaluation of an early warning system for glacial lake outburst flood (GLOF) events in Huaraz, Peru

    NASA Astrophysics Data System (ADS)

    McKinney, D. C.; Somos-Valenzuela, M. A.

    2014-12-01

    People in Cordillera Blanca range in Peru have a long history dealing with natural disasters associated to high mountains; particularly Glacier Lakes Outburst Flood (GLOF). Examples in the Cordillera Blanca vary from a GLOF that occurred in 1941 that killed more than 5000 people in the city of Huaraz to recent events from Lake Artison Baja in 2012 and Lake 513 on 2010, which were not devastating thanks to safety systems previously installed in those lakes. However, glaciers continue melting leaving new lakes or changing the characteristics of lakes that were previously controlled making safety systems obsolete that worked successfully in the past protecting communities downstream. Lake Palcacocha has evolved from being safe after the installation of a safety system in 1970 to an imminent source of GLOF risk due to the expansion that has occurred during the last 40 years increasing from a volume of 500,000 to 17 million m3. In response to this risk the community in Huaraz is planning an Early Warning System (EWS) that will allow the population to mobilize to a safe area in case a GLOF occurs. In this work we present an adaptation of the LifeSIM model to calculate the benefits from such an EWS using 2007 census data and a FLO-2D flood simulation model. The outputs are the number of people in Huaraz that could lose their life due to a GLOF. Our results indicate that without an EWS around 19,773 people could lose their life; whereas, if an EWS is installed the number of victims reduces to 7344. Finally, if mobilization of the affected population is improved the value reduces to 2865. The results show the importance of the EWS as well as informing and training the population to how to react if a GLOF occurs.

  6. Shorter Exposures to Harder X-Rays Trigger Early Apoptotic Events in Xenopus laevis Embryos

    PubMed Central

    Dong, JiaJia; Mury, Sean P.; Drahos, Karen E.; Moscovitch, Marko

    2010-01-01

    Background A long-standing conventional view of radiation-induced apoptosis is that increased exposure results in augmented apoptosis in a biological system, with a threshold below which radiation doses do not cause any significant increase in cell death. The consequences of this belief impact the extent to which malignant diseases and non-malignant conditions are therapeutically treated and how radiation is used in combination with other therapies. Our research challenges the current dogma of dose-dependent induction of apoptosis and establishes a new parallel paradigm to the photoelectric effect in biological systems. Methodology/Principal Findings We explored how the energy of individual X-ray photons and exposure time, both factors that determine the total dose, influence the occurrence of cell death in early Xenopus embryo. Three different experimental scenarios were analyzed and morphological and biochemical hallmarks of apoptosis were evaluated. Initially, we examined cell death events in embryos exposed to increasing incident energies when the exposure time was preset. Then, we evaluated the embryo's response when the exposure time was augmented while the energy value remained constant. Lastly, we studied the incidence of apoptosis in embryos exposed to an equal total dose of radiation that resulted from increasing the incoming energy while lowering the exposure time. Conclusions/Significance Overall, our data establish that the energy of the incident photon is a major contributor to the outcome of the biological system. In particular, for embryos exposed under identical conditions and delivered the same absorbed dose of radiation, the response is significantly increased when shorter bursts of more energetic photons are used. These results suggest that biological organisms display properties similar to the photoelectric effect in physical systems and provide new insights into how radiation-mediated apoptosis should be understood and utilized for therapeutic

  7. Early aberrant DNA methylation events in a mouse model of acute myeloid leukemia

    PubMed Central

    2014-01-01

    Background Aberrant DNA methylation is frequently found in human malignancies including acute myeloid leukemia (AML). While most studies focus on later disease stages, the onset of aberrant DNA methylation events and their dynamics during leukemic progression are largely unknown. Methods We screened genome-wide for aberrant CpG island methylation in three disease stages of a murine AML model that is driven by hypomorphic expression of the hematopoietic transcription factor PU.1. DNA methylation levels of selected genes were correlated with methylation levels of CD34+ cells and lineage negative, CD127-, c-Kit+, Sca-1+ cells; common myeloid progenitors; granulocyte-macrophage progenitors; and megakaryocyte-erythroid progenitors. Results We identified 1,184 hypermethylated array probes covering 762 associated genes in the preleukemic stage. During disease progression, the number of hypermethylated genes increased to 5,465 in the late leukemic disease stage. Using publicly available data, we found a significant enrichment of PU.1 binding sites in the preleukemic hypermethylated genes, suggesting that shortage of PU.1 makes PU.1 binding sites in the DNA accessible for aberrant methylation. Many known AML associated genes such as RUNX1 and HIC1 were found among the preleukemic hypermethylated genes. Nine novel hypermethylated genes, FZD5, FZD8, PRDM16, ROBO3, CXCL14, BCOR, ITPKA, HES6 and TAL1, the latter four being potential PU.1 targets, were confirmed to be hypermethylated in human normal karyotype AML patients, underscoring the relevance of the mouse model for human AML. Conclusions Our study identified early aberrantly methylated genes as potential contributors to onset and progression of AML. PMID:24944583

  8. Time perception of simultaneous and sequential events in early-onset schizophrenia.

    PubMed

    de Montalembert, M; Coulon, N; Cohen, D; Bonnot, O; Tordjman, S

    2016-08-01

    Timing disorders in schizophrenia are a well-known phenomenon. However, no studies have yet assessed the role of temporal distortions in early-onset schizophrenia (EOS), despite evidence that distorted time perception may share genetic risk factors with schizophrenia and may be a useful indicator in identifying individuals at risk for schizophrenia. In the present study, we investigated the ability of 10 patients with EOS (mean age = 21.5 years, SD = 6) matched with 20 healthy control participants (mean age = 25.3 years, SD = 4.6) in order to compare the durations of two visual events, presented either sequentially or overlapping in time, along with neuropsychological assessments of attention, working memory, and executive functions. Each participant had to judge a total of 336 stimuli. We found that temporal overlap had a greater negative effect on ability to judge the duration of a pair of stimuli in EOS patients than in healthy control participants. In addition, EOS patients showed impairments in attention and executive functions. Furthermore, in EOS patients, the scores for executive and attentional functions were significantly correlated with accuracy of temporal estimation in the overlap condition (r = 0.31, p < 0.05 and r = 0.57, p < 0.05, respectively). These preliminary results suggest that impairments in neuropsychological functions participate in the deficit in time estimation observed in patients with EOS. These conclusions highlight the importance of testing time perception in patients with EOS and could contribute to the development of cognitive remediation-based therapy for these patients. PMID:27388526

  9. The Early Toarcian Oceanic Anoxic Event and its sedimentary record in Switzerland

    NASA Astrophysics Data System (ADS)

    Fantasia, Alicia; Föllmi, Karl B.; Adatte, Thierry; Spangenberg, Jorge E.; Montero-Serrano, Jean-Carlos

    2015-04-01

    In the Jurassic period, the Early Toarcian Oceanic Anoxic Event (T-OAE), about 183 Ma ago, was a global perturbation of paleoclimatic and paleoenvironmental conditions. This episode was associated with a crisis in marine carbonate accumulation, climate warming, an increase in sea level, ocean acidification, enhanced continental weathering, whereas organic-rich sediments are noticeable for example in the Atlantic and in the Tethys. This episode is associated with a negative carbon excursion, which is recorded both in marine and terrestrial environments. The cause(s) of this environmental crisis remain(s) still controversial. Nevertheless, the development of negative δ13C excursions is commonly interpreted as due to the injection of isotopically-light carbon associated with gas hydrate dissociation, the thermal metamorphism of carbon-rich sediments and input of thermogenic and volcanogenic carbon related to the formation of the Karoo-Ferrar basaltic province in southern Gondwana (Hesselbo et al., 2000, 2007; Beerling et al., 2002; Cohen et al., 2004, 2007; McElwain et al., 2005, Beerling and Brentnall, 2007; Svensen et al., 2007; Hermoso et al., 2009, 2012; Mazzini et al., 2010). Several studies of the T-OAE have been conducted on sediments in central and northwest Europe, but only few data are available concerning the Swiss sedimentary records. Therefore, we focused on two sections in the Jura Plateau (canton Aargau): the Rietheim section (Montero-Serrano et al., submitted) and the Gipf section (current study). A multidisciplinary approach has been chosen and the tools to be used are based on sedimentological observations (sedimentary condensation, etc.), biostratigraphy, mineralogy (bulk-rock composition), facies and microfacies analysis (presence or absence of benthos), clay-mineralogy composition (climatic conditions), major and trace-element analyses (productivity, redox conditions, etc.), phosphorus (trophic levels, anoxia), carbon isotopes and organic

  10. Transfection of Arabidopsis protoplasts with a Plum pox virus (PPV) infectious clone for studying early molecular events associated with PPV infection.

    PubMed

    Raghupathy, Mohan B; Griffiths, Jonathan S; Stobbs, Lorne W; Brown, Daniel C W; Brandle, James E; Wang, Aiming

    2006-09-01

    The development of novel strategies against plant viral diseases relies on a better understanding of molecular virus-host interactions. Here, we report an easy, efficient and reproducible protocol for Arabidopsis protoplast isolation and transfection to study the infection and replication of a potyvirus, Plum pox virus (PPV). Macerozyme and cellulose were used to release protoplasts from Arabidopsis leaf tissues, and polyethylene glycol-mediated DNA uptake was employed for transfection of a PPV infectious clone. Protoplast viability was monitored by fluorescein diacetate staining, and transfection efficiency was estimated by transient expression of the green fluorescent protein. The protocol allowed production of 95% viable mesophyll protoplasts and a successful transfection rate of 35%. The system was used further in a time-course experiment to investigate PPV viral RNA accumulation. It was found that 3 h post-transfection (hpt) in the transfected protoplasts viral RNA increased by about 150-fold and progressively accumulated to reach the maximum at 12 hpt. Viral RNA then decreased dramatically at 24 hpt reaching 40% of its peak level. Considering the availability of the whole genome microarrays, and other genomic resources of Arabidopsis, the synchronized single-cell (protoplast) infection system will be useful for elucidating early molecular events associated with PPV infection. PMID:16777241

  11. The Cenozoic Diversity of Agglutinated Foraminifera - Evidence for a late Oligocene to early Miocene diversification event

    NASA Astrophysics Data System (ADS)

    Kaminski, Michael; Setoyama, Eiichi; Kender, Sev; Cetean, Claudia

    2014-05-01

    The agglutinated foraminifera are among the most abundant micro-organisms in the deep marine environment and have a diversity record extending back to the late Precambrian. We present an updated diversity curve for agglutinated foraminiferal genera based on the stratigraphic ranges of all the agglutinated genera recognized as valid in the classification of Kaminski (2014). The data set for this analysis is based on the stratigraphic ranges of agglutinated genera published in Foraminiferal Genera and their Classification, which has been subsequently updated based on published studies and our new observations. The mean standing diversity of agglutinated foraminiferal genera was compiled by counting the number of boundary crossers rather than the number of genera in each stage. In this study, we report the stratigraphic and geographical occurrence of a benthic foraminiferal diversification event that has previously received little attention. In the latest Oligocene to earliest Miocene a number of trochospiral agglutinated genera with alveolar or canaliculate walls first appeared in the fossil record. Our studies of late Oligocene of the Congo fan, offshore Angola (Kender et al., 2008; Cetean and Kaminski, 2011) have revealed a diverse assemblage that includes new taxa of deep-water agglutinated foraminifera. In a biostratigraphic study of the Miocene foraminiferal assemblages Kender et al. (2008) noted steadily increasing diversity and proportions of infaunal agglutinated foraminiferal morphotypes over the lower Miocene interval. The proportion of infaunal agglutinated foraminifera assigned to the order Textularida increased dramatically in the lower mid-Miocene, suggesting expansion of the oxygen minimum zone into deeper waters. In addition to the trochospiral alveolar genera, several species of Reticulophragmium and Cyclammina display rapid diversification into numerous separate lineages that are at present not reflected in our generic diversity record owing to

  12. Organic geochemistry of the early Toarcian oceanic anoxic event in Hawsker Bottoms, Yorkshire, England

    NASA Astrophysics Data System (ADS)

    French, K. L.; Sepúlveda, J.; Trabucho-Alexandre, J.; Gröcke, D. R.; Summons, R. E.

    2014-03-01

    A comprehensive organic geochemical investigation of the Hawsker Bottoms outcrop section in Yorkshire, England has provided new insights about environmental conditions leading into and during the Toarcian oceanic anoxic event (T-OAE; ∼183 Ma). Rock-Eval and molecular analyses demonstrate that the section is uniformly within the early oil window. Hydrogen index (HI), organic petrography, polycyclic aromatic hydrocarbon (PAH) distributions, and tricyclic terpane ratios mark a shift to a lower relative abundance of terrigenous organic matter supplied to the sampling locality during the onset of the T-OAE and across a lithological transition. Unlike other ancient intervals of anoxia and extinction, biomarker indices of planktonic community structure do not display major changes or anomalous values. Depositional environment and redox indicators support a shift towards more reducing conditions in the sediment porewaters and the development of a seasonally stratified water column during the T-OAE. In addition to carotenoid biomarkers for green sulfur bacteria (GSB), we report the first occurrence of okenane, a marker of purple sulfur bacteria (PSB), in marine samples younger than ∼1.64 Ga. Based on modern observations, a planktonic source of okenane's precursor, okenone, would require extremely shallow photic zone euxinia (PZE) and a highly restricted depositional environment. However, due to coastal vertical mixing, the lack of planktonic okenone production in modern marine sulfidic environments, and building evidence of okenone production in mat-dwelling Chromatiaceae, we propose a sedimentary source of okenone as an alternative. Lastly, we report the first parallel compound-specific δC13 record in marine- and terrestrial-derived biomarkers across the T-OAE. The δC13 records of short-chain n-alkanes, acyclic isoprenoids, and long-chain n-alkanes all encode negative carbon isotope excursions (CIEs), and together, they support an injection of isotopically light

  13. Measures of maturation in early fossil hominins: events at the first transition from australopiths to early Homo.

    PubMed

    Dean, M Christopher

    2016-07-01

    An important question in palaeoanthropology is whether, among the australopiths and the first fossil hominins attributed to early Homo, there was a shift towards a more prolonged period of growth that can be distinguished from that of the living great apes and whether between the end of weaning and the beginning of puberty there was a slow period of growth as there is in modern humans. Evidence for the pace of growth in early fossil hominins comes from preserved tooth microstructure. A record of incremental growth in enamel and dentine persists, which allows us to reconstruct tooth growth and compare key measures of dental maturation with modern humans and living great apes. Despite their diverse diets and way of life, it is currently difficult to identify any clear differences in the timing of dental development among living great apes, australopiths and the earliest hominins attributed to the genus Homo There is, however, limited evidence that some early hominins may have attained a greater proportion of their body mass and stature relatively earlier in the growth period than is typical of modern humans today.This article is part of the themed issue 'Major transitions in human evolution'. PMID:27298465

  14. Immune biomarker panel monitoring utilizing IDO enzyme activity and CD4 ATP levels: prediction of acute rejection versus viral replication events

    PubMed Central

    Dharnidharka, Vikas R.; Gupta, Sushil; Khasawneh, Eihab Al; Haafiz, Allah; Shuster, Jonathan J.; Theriaque, Douglas W.; Shahlaee, Amir H.; Garrett, Timothy J.

    2011-01-01

    Infections have become as important an event as acute rejection post-transplant for long-term allograft survival. Less invasive biomarkers tested so far predict risk for one event or the other, not both. We prospectively tested blood and urine monthly for twelve months post-transplant from children receiving a kidney transplant. The indoleamine 2,3 dioxygenase (IDO) enzyme pathway was assessed by mass spectrometry assays using the ratio of product L-kynurenine (kyn) to substrate tryptophan (trp). Kyn/trp ratios and blood CD4 T-cell ATP levels were correlated with acute rejection or major infection events or stable group (no events) in the next 30 days. The 25 subjects experienced 6 discrete episodes of acute rejection in 5 subjects and 16 discrete events of major infection in 14 subjects (7 BK viruria, 6 cytomegaloviremia, 1 Epstein-Barr and cytomegaloviremia, 2 transplant pyelonephritis). Mean serum kyn/trp ratios were significantly elevated in the group that experienced acute rejection (p = 0.02).Within-subject analyses revealed that over time, urine kyn/trp ratios showed an increase (p = 0.01) and blood CD4-ATP levels showed a decrease (p = 0.007) prior to a major infection event. These pilot results suggest that a panel of biomarkers together can predict over- or under-immunosuppression, but need independent validation. PMID:21492353

  15. Early Verb Learning: How Do Children Learn How to Compare Events?

    ERIC Educational Resources Information Center

    Childers, Jane B.; Parrish, Rebecca; Olson, Christina V.; Burch, Clare; Fung, Gavin; McIntyre, Kevin P.

    2016-01-01

    An important problem verb learners must solve is how to extend verbs. Children could use cross-situational information to guide their extensions; however, comparing events is difficult. In 2 studies, researchers tested whether children benefit from initially seeing a pair of similar events ("progressive alignment") while learning new…

  16. A replication-competent retrovirus arising from a split-function packaging cell line was generated by recombination events between the vector, one of the packaging constructs, and endogenous retroviral sequences.

    PubMed

    Chong, H; Starkey, W; Vile, R G

    1998-04-01

    Previously we reported the presence of a replication-competent retrovirus in supernatant from a vector-producing line derived from a widely used split-function amphotropic packaging cell line. Rigorous routine screening of all retroviral stocks produced in our laboratory has not, previously or since, indicated the presence of such a virus. Replication-competent retroviruses have never previously been used in our laboratory, and stringent screening of all routinely used cell lines has not revealed the presence of any helper viruses. Therefore, it is highly unlikely that this virus represents an adventitious cross-contaminant or had been imported unknowingly with our cell line stocks. PCR studies with DNA from infected cell lines and Northern blot analysis and reverse transcriptase PCR with RNA from infected cells suggest that the helper virus arose by recombination events, at sites of partial homology, between sequences in the vector, one of the packaging constructs, and endogenous retroviral elements. These recombinations were not present in stocks of the packaging cell line or in an initial stock of the vector-producing line, indicating that these events occurred while the vector-producing line was being passaged for harvest of supernatant stocks. PMID:9525583

  17. A new reporter mouse cytomegalovirus reveals maintained immediate-early gene expression but poor virus replication in cycling liver sinusoidal endothelial cells

    PubMed Central

    2013-01-01

    Background The MCMV major immediate early promoter/enhancer (MIEP) is a bidirectional promoter that drives the expression of the three immediate early viral genes, namely ie1, ie2 and ie3. The regulation of their expression is intensively studied, but still incompletely understood. Methods We constructed a reporter MCMV, (MCMV-MIEPr) expressing YFP and tdTomato under the control of the MIEP as proxies of ie1 and ie2, respectively. Moreover, we generated a liver sinusoidal endothelial cell line (LSEC-uniLT) where cycling is dependent on doxycycline. We used these novel tools to study the kinetics of MIEP-driven gene expression in the context of infection and at the single cell level by flow cytometry and by live imaging of proliferating and G0-arrested cells. Results MCMV replicated to higher titers in G0-arrested LSEC, and cycling cells showed less cytopathic effect or YFP and tdTomato expression at 5 days post infection. In the first 24 h post infection, however, there was no difference in MIEP activity in cycling or G0-arrested cells, although we could observe different profiles of MIEP gene expression in different cell types, like LSECs, fibroblasts or macrophages. We monitored infected LSEC-uniLT in G0 by time lapse microscopy over five days and noticed that most cells survived infection for at least 96 h, arguing that quick lysis of infected cells could not account for the spread of the virus. Interestingly, we noticed a strong correlation between the ratio of median YFP and tdTomato expression and length of survival of infected cells. Conclusion By means of our newly developed genetic tools, we showed that the expression pattern of MCMV IE1 and IE2 genes differs between macrophages, endothelial cells and fibroblasts. Substantial and cell-cycle independent differences in the ie1 and ie2 transcription could also be observed within individual cells of the same population, and marked ie2 gene expression was associated with longer survival of the infected cells

  18. Microgravity Effects on the Early Events of Biological Nitrogen Fixation in Medicago Truncatula: Results from the SyNRGE Experiment

    NASA Technical Reports Server (NTRS)

    Stutte, Gary W.; Roberts, Michael

    2012-01-01

    SyNRGE (Symbiotic Nodulation in a Reduced Gravity Environment) was a sortie mission on STS-135 in the Biological Research in Canisters (BRIC) hardware to study the effect of microgravity on a plant-microbe symbiosis resulting in biological nitrogen fixation. Medicago truncatula, a model species for th legume family, was inoculated with its bacterial symbiont, Sinorhizobium meliloti, to observe early biomolecular events associated with infection and nodulation in Petri Dish Fixation Units (PDFU's).

  19. Early events in tissues during infection with pathogenic (SIVmac239) and nonpathogenic (SIVmac1A11) molecular clones of simian immunodeficiency virus.

    PubMed Central

    Lackner, A. A.; Vogel, P.; Ramos, R. A.; Kluge, J. D.; Marthas, M.

    1994-01-01

    The extent of virus replication, tissue distribution, localization of virus within tissues, and the presence of pathological lesions was examined early after experimental infection of rhesus monkeys with simian immunodeficiency virus (SIV). Three strains of SIV were used: molecularly cloned pathogenic SIVmac239; molecularly cloned nonpathogenic SIVmac1A11; and uncloned pathogenic SIVmac. The major targets of infection in all animals at 2 weeks postinoculation were the thymus and spleen. The distribution of virus within lymphoid organs varied with the viral inoculum: nonpathogenic SIVmac1A11 was present primarily within lymphoid follicles and in the thymic cortex; SIVmac239 was present primarily within periarteriolar lymphoid sheaths in the spleen, the paracortex of lymph nodes, and the medulla of the thymus; uncloned SIVmac was present in all these areas but tended to parallel the distribution of SIVmac239. Animals inoculated with nonpathogenic SIVmac1A11 had fewer SIV-positive cells by in situ hybridization and after 13 weeks postinoculation, virus was undetectable in any tissue from these animals. No significant pathological abnormalities were recognized in animals inoculated with this nonpathogenic virus. In contrast, nearly half of the animals inoculated with either SIVmac or SIVmac239 developed significant pathological lesions, including opportunistic infections by 13 weeks postinoculation, highlighting the virulence of these viruses. Our results indicate marked differences in tissue distribution between pathogenic and nonpathogenic molecular clones of SIV during the acute phase of infection. The most striking differences were the absence of SIVmac1A11 from the central nervous system and thymic medulla. The prominent early involvement of the thymus suggests that infection of this organ is a key event in the induction of immune suppression by SIV. Images Figure 1 Figure 2 Figure 3 PMID:8053500

  20. Modeling Temporal Processes in Early Spacecraft Design: Application of Discrete-Event Simulations for Darpa's F6 Program

    NASA Technical Reports Server (NTRS)

    Dubos, Gregory F.; Cornford, Steven

    2012-01-01

    While the ability to model the state of a space system over time is essential during spacecraft operations, the use of time-based simulations remains rare in preliminary design. The absence of the time dimension in most traditional early design tools can however become a hurdle when designing complex systems whose development and operations can be disrupted by various events, such as delays or failures. As the value delivered by a space system is highly affected by such events, exploring the trade space for designs that yield the maximum value calls for the explicit modeling of time.This paper discusses the use of discrete-event models to simulate spacecraft development schedule as well as operational scenarios and on-orbit resources in the presence of uncertainty. It illustrates how such simulations can be utilized to support trade studies, through the example of a tool developed for DARPA's F6 program to assist the design of "fractionated spacecraft".

  1. Serotonin Transporter-Linked Polymorphic Region (5-HTTLPR) Genotype and Stressful Life Events Interact to Predict Preschool-Onset Depression: A Replication and Developmental Extension

    ERIC Educational Resources Information Center

    Bogdan, Ryan; Agrawal, Arpana; Gaffrey, Michael S.; Tillman, Rebecca; Luby, Joan L.

    2014-01-01

    Background: Scientific enthusiasm about gene × environment interactions, spurred by the 5-HTTLPR (serotonin transporter-linked polymorphic region) × SLEs (stressful life events) interaction predicting depression, have recently been tempered by sober realizations of small effects and meta-analyses reaching opposing conclusions. These mixed findings…

  2. Massive Expansion of Marine Archaea During The Early Albian Oceanic Anoxic Event 1B

    NASA Astrophysics Data System (ADS)

    Kuypers, M. M.; Kuypers, M. M.; Blokker, P.; Erbacher, J.; Kinkel, H.; Pancost, R. D.; Pancost, R. D.; Schouten, S.; Sinninghe Damsté, J. S.

    2001-12-01

    Oceanic anoxic events (OAEs), periods of globally enhanced burial of organic matter (OM) in the marine realm, played an important role in the mid-Cretaceous `greenhouse climate' by effectively reducing atmospheric carbon dioxide concentrations. It is generally believed that these OAEs were caused either by decreased remineralisation or increased production of phytoplanktonic OM. Here we show that enhanced organic carbon (OC) burial during the early Albian OAE1b (~112 My) was caused by a different process. Combined biogeochemical and stable carbon isotopic analyses indicate that black shales from this period contain up to 80% of OC derived from archaea. Archaea-derived isoprenoidal tetraether membrane lipids and free and macromolecularly bound isoprenoid alkanes are abundantly present in these black shales. More specifically the presence of certain ether lipids (cyclic biphytane tetraethers) indicates representatives of the pelagic archaea. To the best of our knowledge this is the earliest fossil evidence for marine planktonic archaea, extending their geological record by more than 60 million years. The diversity of archaeal lipids recovered from the OAE1b black shales suggests that they derive from a multitude of archaeal species. However, the specific 13C enrichment of all such lipids indicates a common `heavy' (13C-rich) carbon source for the archaea and/or a common pathway of carbon-fixation with a reduced 13C fractionation effect compared to the Calvin cycle used by algae, cyanobacteria and higher plants. The large differences (up to 12%) in 13C/12C ratios between the algal biomarkers and the much more abundant archaeal molecular fossils suggest that the latter were not living heterotrophically on photoautotrophic biomass. It seems likely that the archaea present during OAE1b used a chemical energy source (possibly ammonium) for carbon fixation since photoautotrophy within the domain of the Archaea is restricted to only a few species from hypersaline

  3. [Eventful life stories. Members of student fraternities persecuted in Silesia in the early 19th century].

    PubMed

    Schmidt, Walter

    2003-01-01

    This study supplemented by three charts and a list of biographies, is, for the first time, encompassing their life-data, their resumés and even their professional careers as well as political commitments shown by more than 200 Silesian students. They, at the University of Breslau, but also at other German universities, had joined the student fraternities in the 20-ies and early 30-ies of the 19th century and, in consequence, were persecuted by state authorities, notably in Prussia and, in the majority of cases, had been sentenced to prison terms of varying degrees. The first demagogic persecution, which happened in the first half of the twenties, culminating in 1822 in the Breslau Arminen Trail and ending up with the staging of the Youth-Association-Trail in 1826, had implicated about 100 Silesians, with a smaller portion of them - apart from teh three Youth-Association Silesians who were sentenced to five years imprisonment in a fortress - getting away with a relatively short "political fortress imprisonment". Later a considerable part of them made a career in the prussian judicial authority, in the institutions of higher learning, as parish priests, physicians and scientists, whereas any political engagement remained a rare exception. Out of the 137 Silesian members of the student fraternities affected by the second wave of persecution, the overwhelming majority of them being Protestants and originating partly from the middle classes, mostly artisans, and from intellectual background, with about a hundred of them being given essentially higher sentences ranging from six years up to capital punishment and, in the event of reprieves, they had to serve their sentences between six months and four-to-six years in a fortress. The majority of them made a medium-level professional career, never exceeding the medium ranks, as judicial officers, lawyers in state or communal services, parish priests, teachers or physicians. However, from this group of persecuted persons, a

  4. Early terrestrial impact events: Archean spherule layers in the Barberton Greenstone Belt, South Africa

    NASA Astrophysics Data System (ADS)

    Ozdemir, Seda; Koeberl, Christian; Schulz, Toni; Reimold, W. Uwe; Hofmann, Axel

    2015-04-01

    In addition to the oldest known impact structure on Earth, the 2.02-billion-year-old Vredefort Structure in South Africa, the evidence of Early Earth impact events are Archean spherule beds in South Africa and Australia. These spherules have been interpreted as condensation products from impact plumes and molten impact ejecta or/and impact ejecta that were melted during atmospheric re-entry [e.g., 1,2]. The 3.2-3.5 Ga spherule layers in the Barberton Greenstone Belt in South Africa currently represent the oldest known remnants of impact deposits on Earth. Aiming at identification of extraterrestrial components and to determine the diagenetic and metamorphic history of spherule layer intersections recently recovered in the CT3 drill core from the northeastern part of the Barberton Greenstone Belt, we have studied samples from these layers in terms of petrography and geochemistry. All samples, including spherule layer intersections and intercalating country rocks, were studied for mineral identification by optical and electron microscopy, as well as electron microprobe analysis (EPMA) at Natural History Museum Vienna and Museum für Naturkunde Berlin (MfN). Major and trace element compositions were determined via X-ray fluorescence spectrometry at MfN and instrumental neutron activation analysis (INAA) at University of Vienna. Os isotopes were measured by thermal ionization mass spectrometry (N-TIMS) at University of Vienna. Eighteen spherule beds are distributed over 150 meter drill core in CT3. Spherules are variably, deformed or undeformed. The high number of these layers may have been caused by tectonic duplication. Spherule beds are intercalated with shale, chert, carbonate, and/or sulfide deposits (country rocks). The size range of spherules is 0.5 to 2 mm, and some layers exhibit gradation. Shapes of spherules differ from spherical to ovoid, as well as teardrops, and spherules commonly show off-center vesicles, which have been interpreted as a primary

  5. Is epigenetics an important link between early life events and adult disease?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Epigenetic mechanisms provide one potential explanation for how environmental influences in early life cause long-term changes in chronic disease susceptibility. Whereas epigenetic dysregulation is increasingly implicated in various rare developmental syndromes and cancer, the role of epigenetics in...

  6. Major events in the late Precambrian to early Triassic geohistory of the Arabian Peninsula

    SciTech Connect

    Stump, T.E.; Connally, T.C.; Van der Eem, J.G.L.A. )

    1993-09-01

    The late Precambrian to Early Triassic of the Arabian Peninsula occur in five supergroups. Their geohistory resulted from sedimentation along fluvial to midshelf facies tracts, eustatic oscillation and periodic uplift. The first supergroup, Plate Precambrian-Middle Cambrian, includes the Siq/Salib and Yatib formations. Deposited by north-eastward-flowing braided streams, they eroded and buried an Arabian shield topography. The Saq Formation lies in angular unconformity on the Siq which documents early Middle Cambrian uplift. Supergroup two, Middle Cambrian-middle Caradocian, the Burj and Saq formations, the Hanadir, Kahfah, and Ra'an members, Qasim Formation, were deposited on a stable continental margin in fluvio-deltaic to midshelf settings. Coastal onlap occurred in the Middle Cambrian, early Llanvirn, middle Llandeilo and early Caradoc. Middle Caradocian uplift deeply eroded parts of central and southern Arabia. Supergroup three of middle Caradocian-early Llandoverian are the Quwarah Member, Qasim Formation and the Zarqa/Sarah formations. They were deposited in a fluvio-deltaic shallow shelf. Late Ashgill uplift, combined with glacially induced sea level lowering, incised valleys up to 2000 ft (610 m) deep. Supergroup four, early Llandovery-Middle Carboniferous, includes the Qalibah, Tawil, Jauf, Jubah and Berwath formations. They were deposited in a fluvio-deltaic marine, river dominated system. The Quysaiba and Sharawra members, Qalibah Formation, were the offshore clays and prodelta sands, the Tawil-Jubah were the fluvial to delta front, and the Berwath the delta plain facies. Deep pre-Tawil erosion documents late Silurian-Early Devonian uplift. The fifth supergroup are the Juwayl, Unayzah, Khuff and Sudair formations. The first two units were deposited in a glacio-fluvial system which eroded and infilled a Hercynian topography. The Khuff transgression occurred during the Artinsklan-Tartarian and the Early Triassic regressive Sudair documents renewed uplift.

  7. Middle Devonian to Early Carboniferous event stratigraphy of Devils Gate and Northern Antelope Range sections, Nevada, U.S.A

    USGS Publications Warehouse

    Sandberg, C.A.; Morrow, J.R.; Poole, F.G.; Ziegler, W.

    2003-01-01

    The classic type section of the Devils Gate Limestone at Devils Gate Pass is situated on the eastern slope of a proto-Antler forebulge that resulted from convergence of the west side of the North American continent with an ocean plate. The original Late Devonian forebulge, the site of which is now located between Devils Gate Pass and the Northern Antelope Range, separated the continental-rise to deep-slope Woodruff basin on the west from the backbulge Pilot basin on the east. Two connections between these basins are recorded by deeper water siltstone beds at Devils Gate; the older one is the lower tongue of the Woodruff Formation, which forms the basal unit of the upper member of the type Devils Gate, and the upper one is the overlying, thin lower member of the Pilot Shale. The forebulge and the backbulge Pilot basin originated during the middle Frasnian (early Late Devonian) Early hassi Zone, shortly following the Alamo Impact within the punctata Zone in southern Nevada. Evidence of this impact is recorded by coeval and reworked shocked quartz grains in the Northern Antelope Range and possibly by a unique bypass-channel or megatsunami-uprush sandy diamictite within carbonate-platform rocks of the lower member of the type Devils Gate Limestone. Besides the Alamo Impact and three regional events, two other important global events are recorded in the Devils Gate section. The semichatovae eustatic rise, the maximum Late Devonian flooding event, coincides with the sharp lithogenetic change at the discordant boundary above the lower member of the Devils Gate Limestone. Most significantly, the Devils Gate section contains the thickest and most complete rock record in North America across the late Frasnian linguiformis Zone mass extinction event. Excellent exposures include not only the extinction shale, but also a younger. Early triangularis Zone tsunamite breccia, produced by global collapse of carbonate platforms during a shallowing event that continued into the next

  8. Seismology-based early identification of dam-formation landquake events

    NASA Astrophysics Data System (ADS)

    Wu, Y. M.; Chao, W. A.

    2015-12-01

    Flooding resulting from the bursting of dams formed by landquake events such as rock avalanches, landslides and debris flows can lead to serious bank erosion and inundation of populated areas near rivers. Seismic waves can be generated by landquake events which can be described as time-dependent forces (unloading/reloading cycles) acting on the Earth. In this study, we conduct inversions of long-period (LP, period ≥ 20 sec) waveforms for different source mechanisms. Results show that single-force (SF) mechanism better explains the observed seismograms generated by landquake events. We then perform inversions for the landquake force histories (LFHs) of ten events, which provide quantitative characterization of the initiation, propagation and termination stages of the slope failures. When the results obtained from LP waveforms are analyzed together with high-frequency (HF, 1-3 Hz) seismic signals, we find a relatively strong late-arriving seismic phase (dubbed Dam-forming phase or D-phase) recorded clearly in the HF waveforms at the closest stations, which potentially marks the time when the collapsed masses sliding into river and perhaps even impacting the topographic barrier on the opposite bank. Consequently, our approach to analyzing the LP and HF waveforms developed in this study has a high potential for identifying five dam-forming landquake events (DFLEs) in near real-time using broadband seismic records, which can provide timely warnings of the impending floods to downstream residents.

  9. Carbonate platform drowning events along the northern Tethyan margin during the early Cretaceous

    NASA Astrophysics Data System (ADS)

    Föllmi, K. B.; van de Schootbrugge, B.; Godet, A.; Bodin, S.; Linder, P.; Adatte, Th.

    2003-04-01

    During the early Cretaceous, the carbonate platform attached to the northern Tethyan margin experienced a series of platform drowning episodes, which can be widely traced. The five episodes recognized cover the early Valanginian to early Hauterivian (D1), middle Hauterivian (D2), late Hauterivian to early Barremian (D3), early to early late Aptian (D4), and late Aptian to early Albian (D5). The particular sensitivity towards drowning in this platform system was probably related to its marginal paleoposition (ca. 30 degree N) with regards to reef growth, to its attachment to the European continent (a periodic source of reef-unfriendly weathering products), as well as to prevailing paleoceanographic conditions (sea-level change, upwelling intensity, presence or absence of connections to the boreal realm). Drowning episodes are usually preceded by changes in carbonate production from a chlorozoan to a foramol mode, with important increases in accumulation rates. The drowning episodes themselves are documented by erosional surfaces and/or by the formation of strongly condensed beds rich in coarse sand, glauconite, phosphate, and biosilica. The presence of ammonites is a key to their dating. If resolvable, the onset of drowning appears to be diachronous, and its evolution is by stepwise onlap onto the platform (D1, D4). Termination of drowning appears in all cases synchronous. Drowning episodes D1, D4, and D5 are correlated to positive excursions in the delta C-13 record, albeit with a slight diachronity in their onsets (drowning episodes lead the delta C-13 record), whereas episode D2 correlates to a negative excursion and episode D3 to a long and steady increase in delta C-13 values. This suggests that no uniform mechanism can be assumed for all five episodes but that each episode needs to be examined in its own context. An important element in all episodes is the change in weathering style and intensity in the continental hinterland, which profoundly affected

  10. [The effect of life change events on cognitive and socio-emotional development in early childhood].

    PubMed

    Ihle, W; Löffler, W; Esser, G; Laucht, M; Schmidt, M H

    1992-06-01

    The present study investigates the role of life events of differing durations in the cognitive and social-emotional development of infants. A total of 354 children were examined at the ages of 3 and 24 months and the children's parents were interviewed about the occurrence of live events in this interval. The total number of life events was a significant predictor of changes in the level of cognitive and social-emotional functioning. Changes in the caregiver and marital discord were the best predictors of a child's social-emotional development, and serious illness in the child and changes in the caregiver were the best predictors of a child's cognitive development. PMID:1509822

  11. Early and late event-related potentials are modulated by infant and adult faces of high and low attractiveness.

    PubMed

    Hahn, Amanda C; Symons, Lawrence A; Kredel, Taylor; Hanson, Kevin; Hodgson, Lianne; Schiavone, Lori; Jantzen, K J

    2016-04-01

    The processing of infant faces may be somewhat distinct from that of adult faces. Indeed, recent neuroimaging studies have provided evidence of an early, "baby-specific" neural response whereby infant faces are perceived more rapidly than adult faces. Using event-related potentials, the present study aimed to determine whether the preferential response to infant faces is present at both early and late stages of face processing, and to investigate the effects of esthetic appearance on the processing of adult and infant faces by directly manipulating the perceived attractiveness or cuteness within a given face identity. Here, we find evidence for enhanced processing of infant faces, relative to adult faces, at both early (N170, P2) and late (LPC) stages of face processing. We also find that the esthetic appearance of both infant and adult faces modulates early neural responses, with enhanced responses to less attractive/cute faces as compared to more attractive/cute faces. Overall, our results provide additional evidence for a preferential response to infant faces at early stages of processing, and provide new evidence that this preferential response occurs at later stages of face processing as well, independent of the esthetic quality of the face or observer sex. PMID:26160142

  12. Contrasting ice sheet response to early and late summer rapid supraglacial lake drainage events on the Greenland Ice Sheet

    NASA Astrophysics Data System (ADS)

    Stevens, L. A.; Behn, M. D.; Das, S. B.; Joughin, I. R.; Herring, T.; King, M. A.; McGuire, J. J.

    2013-12-01

    Across much of the ablation region of the western Greenland Ice Sheet, hydro-fracture events related to supraglacial lake drainages rapidly deliver large volumes of meltwater to the bed and create conduits providing efficient surface-to-bed drainage networks for the remainder of the summer melt season. Using a network of 20 GPS stations installed in 2011, and supplemented with a smaller network operating back to 2006, we observe ice surface motion during a series of lake draining hydro-fracture events. These data are used to investigate (1) the location and propagation geometry of the fracture opening and (2) the acceleration of ice in response to the rapid input of surface meltwater to the bed. Observations at the same location show varying surface motion following early versus late summer rapid lake drainage events from multiple years. During a late-season (July 29) rapid drainage in 2006, results from a single GPS station show velocity in the direction of mean ice flow and surface uplift returned to pre-drainage values within ~24 hours (Das et al., 2008), indicating the large subglacial meltwater pulse was efficiently dissipated into the subglacial hydrologic network. In contrast, an early-season (June 11) rapid drainage at the same lake in 2011 induced uplift that persisted for much longer. Specifically, we find that elevations at stations nearest the moulin did not return to pre-drainage elevations for 4 to 8 days post-drainage, suggesting a more inefficient subglacial hydrologic system during the early summer season. These results indicate that the ice-sheet response is modulated, at least in part, by the seasonal evolution of the subglacial hydrological system. We also plan to investigate new GPS data from 2 rapid drainage events in the early portion of the melt season in 2012 and 2013. Findings from these events will ultimately improve our understanding of the mechanics of ice-sheet hydro-fracture and the influence of surface meltwater on ice-sheet flow.

  13. Modeling and analysis of early events in T-lymphocyte antigen-activated intracellular-signaling pathways

    NASA Astrophysics Data System (ADS)

    Zheng, Yanan; Balakrishnan, Venkataramanan; Buzzard, Greg; Geahlen, Robert; Harrison, Marietta; Rundell, Ann

    2005-12-01

    The T-cell antigen-activated signaling pathway is a highly regulated intracellular biochemical system that is crucial for initiating an appropriate adaptive immune response. To improve the understanding of the complex regulatory mechanisms controlling the early events in T-cell signaling, a detailed mathematical model was developed that utilizes ordinary differential equations to describe chemical reactions of the signaling pathway. The model parameter values were constrained by experimental data on the activation of a specific signaling intermediate and indicated an initial rapid cascade of phosphorylation events followed by a comparatively slow signal downregulation. Nonlinear analysis of the model suggested that thresholding and bistability occur as a result of the embedded positive and negative feedback loops within the model. These nonlinear system properties may enhance the T-cell receptor specificity and provide sub-threshold noise filtering with switch-like behavior to ensure proper cell response. Additional analysis using a reduced second-order model led to further understanding of the observed system behavior. Moreover, the interactions between the positive and negative feedback loops enabled the model to exhibit, among a variety of other feasible dynamics, a sustained oscillation that corresponds to a stable limit cycle in the two-dimensional phase plane. Quantitative analysis in this paper has helped identify potential regulatory mechanisms in the early T-cell signaling events. This integrated approach provides a framework to quantify and discover the ensemble of interconnected T-cell antigen-activated signaling pathways from limited experimental data.

  14. Risk Factors for Preschool Depression: The Mediating Role of Early Stressful Life Events

    ERIC Educational Resources Information Center

    Luby, Joan L.; Belden, Andy C.; Spitznagel, Edward

    2006-01-01

    Background: Family history of mood disorders and stressful life events are both established risk factors for childhood depression. However, the role of mediators in risk trajectories, which are potential targets for intervention, remains understudied. To date, there have been no investigations of mediating relationships between risk factors and…

  15. Seismology-based early identification of dam-formation landquake events

    NASA Astrophysics Data System (ADS)

    Chao, Wei-An; Zhao, Li; Chen, Su-Chin; Wu, Yih-Min; Chen, Chi-Hsuan; Huang, Hsin-Hua

    2016-01-01

    Flooding resulting from the bursting of dams formed by landquake events such as rock avalanches, landslides and debris flows can lead to serious bank erosion and inundation of populated areas near rivers. Seismic waves can be generated by landquake events which can be described as time-dependent forces (unloading/reloading cycles) acting on the Earth. In this study, we conduct inversions of long-period (LP, period ≥20 s) waveforms for the landquake force histories (LFHs) of ten events, which provide quantitative characterization of the initiation, propagation and termination stages of the slope failures. When the results obtained from LP waveforms are analyzed together with high-frequency (HF, 1-3 Hz) seismic signals, we find a relatively strong late-arriving seismic phase (dubbed Dam-forming phase or D-phase) recorded clearly in the HF waveforms at the closest stations, which potentially marks the time when the collapsed masses sliding into river and perhaps even impacting the topographic barrier on the opposite bank. Consequently, our approach to analyzing the LP and HF waveforms developed in this study has a high potential for identifying five dam-forming landquake events (DFLEs) in near real-time using broadband seismic records, which can provide timely warnings of the impending floods to downstream residents.

  16. It's the Little Things: Exploring the Importance of Commonplace Events for Early-Career Teachers' Motivation

    ERIC Educational Resources Information Center

    Kitching, Karl; Morgan, Mark; O'Leary, Michael

    2009-01-01

    This paper seeks to provide a rationale for further researching the everyday events that keep teachers motivated or that discourage them. We put forward the idea that routine Affect Triggering Incidents (ATIs) are an important area for researchers to investigate in terms of how they impact teacher motivation and resilience. Two groups of…

  17. Exposure to Potentially Traumatic Events in Early Childhood: Differential Links to Emergent Psychopathology

    ERIC Educational Resources Information Center

    Briggs-Gowan, Margaret J.; Carter, Alice S.; Clark, Roseanne; Augustyn, Marilyn; McCarthy, Kimberly J.; Ford, Julian D.

    2010-01-01

    Research NeedsObjective: To examine associations between exposure to potentially traumatic events (PTEs) and clinical patterns of symptoms and disorders in preschool children. Method: Two hundred and thirteen referred and non-referred children, ages 24 to 48 months (MN = 34.9, SD = 6.7 months) were studied. Lifetime exposure to PTEs (family…

  18. Early Processing of Emotional Faces in Children with Autism: An Event-Related Potential Study

    ERIC Educational Resources Information Center

    Batty, Magali; Meaux, Emilie; Wittemeyer, Kerstin; Roge, Bernadette; Taylor, Margot J.

    2011-01-01

    Social deficits are one of the most striking manifestations of autism spectrum disorders (ASDs). Among these social deficits, the recognition and understanding of emotional facial expressions has been widely reported to be affected in ASDs. We investigated emotional face processing in children with and without autism using event-related potentials…

  19. Early Event-Related Potentials Correlate with Inspection Time and Intelligence.

    ERIC Educational Resources Information Center

    Caryl, P. G.

    1994-01-01

    Vertex event-related potentials (ERPs) were obtained from undergraduates performing an inspection time task together with measures of inspection time (n=35) and mental ability (n=28). Techniques that reveal changes over time in the relationship between ERP measures and psychometric indices were presented. (SLD)

  20. Origins of Early Adolescents' Hope: Personality, Parental Attachment, and Stressful Life Events

    ERIC Educational Resources Information Center

    Otis, Kristin L.; Huebner, E. Scott; Hills, Kimberly J.

    2016-01-01

    Psychology has recently increased attention to identifying psychological qualities in individuals that indicate positive mental health, such as hope. In an effort to understand further the origins of hope, we examined the relations among parental attachment, stressful life events, personality variables, and hope in a sample of 647 middle school…

  1. Mood Reactivity to Daily Negative Events in Early Adolescence: Relationship to Risk for Psychopathology

    ERIC Educational Resources Information Center

    Schneiders, Josien; Nicolson, Nancy A.; Berkhof, Johannes; Feron, Frans J.; van Os, Jim; deVries, Marten W.

    2006-01-01

    Emotional responses to negative daily experiences in young adolescents may provide important clues to the development of psychopathology, but research is lacking. This study assessed momentary mood reactivity to daily events as a function of risk profile in a school sample, ages 11-14. High-risk (HR, n = 25) and low-risk (LR, n = 106) subgroups…

  2. Traumatic and Stressful Events in Early Childhood: Can Treatment Help Those at Highest Risk?

    ERIC Educational Resources Information Center

    Ippen, Chandra Ghosh; Harris, William W.; Van Horn, Patricia; Lieberman, Alicia F.

    2011-01-01

    Objective: This study involves a reanalysis of data from a randomized controlled trial to examine whether child-parent psychotherapy (CPP), an empirically based treatment focusing on the parent-child relationship as the vehicle for child improvement, is efficacious for children who experienced multiple traumatic and stressful life events (TSEs).…

  3. Riding the Wave to Reach the Masses: Natural Events in Early Twentieth Century Portuguese Daily Press

    ERIC Educational Resources Information Center

    Simoes, Ana; Carneiro, Ana; Diogo, Maria Paula

    2012-01-01

    This paper brings together science communicated in newspapers in Portugal by looking at how news on natural events were communicated in two different newspapers--the capital newspaper "Diario de Noticias" ("Daily News") and the "Diario dos Acores" ("Azores Daily"). In particular, we look at how the 1900 solar eclipse, a hot topic throughout…

  4. Seismology-based early identification of dam-formation landquake events.

    PubMed

    Chao, Wei-An; Zhao, Li; Chen, Su-Chin; Wu, Yih-Min; Chen, Chi-Hsuan; Huang, Hsin-Hua

    2016-01-01

    Flooding resulting from the bursting of dams formed by landquake events such as rock avalanches, landslides and debris flows can lead to serious bank erosion and inundation of populated areas near rivers. Seismic waves can be generated by landquake events which can be described as time-dependent forces (unloading/reloading cycles) acting on the Earth. In this study, we conduct inversions of long-period (LP, period ≥20 s) waveforms for the landquake force histories (LFHs) of ten events, which provide quantitative characterization of the initiation, propagation and termination stages of the slope failures. When the results obtained from LP waveforms are analyzed together with high-frequency (HF, 1-3 Hz) seismic signals, we find a relatively strong late-arriving seismic phase (dubbed Dam-forming phase or D-phase) recorded clearly in the HF waveforms at the closest stations, which potentially marks the time when the collapsed masses sliding into river and perhaps even impacting the topographic barrier on the opposite bank. Consequently, our approach to analyzing the LP and HF waveforms developed in this study has a high potential for identifying five dam-forming landquake events (DFLEs) in near real-time using broadband seismic records, which can provide timely warnings of the impending floods to downstream residents. PMID:26753931

  5. Seismology-based early identification of dam-formation landquake events

    PubMed Central

    Chao, Wei-An; Zhao, Li; Chen, Su-Chin; Wu, Yih-Min; Chen, Chi-Hsuan; Huang, Hsin-Hua

    2016-01-01

    Flooding resulting from the bursting of dams formed by landquake events such as rock avalanches, landslides and debris flows can lead to serious bank erosion and inundation of populated areas near rivers. Seismic waves can be generated by landquake events which can be described as time-dependent forces (unloading/reloading cycles) acting on the Earth. In this study, we conduct inversions of long-period (LP, period ≥20 s) waveforms for the landquake force histories (LFHs) of ten events, which provide quantitative characterization of the initiation, propagation and termination stages of the slope failures. When the results obtained from LP waveforms are analyzed together with high-frequency (HF, 1–3 Hz) seismic signals, we find a relatively strong late-arriving seismic phase (dubbed Dam-forming phase or D-phase) recorded clearly in the HF waveforms at the closest stations, which potentially marks the time when the collapsed masses sliding into river and perhaps even impacting the topographic barrier on the opposite bank. Consequently, our approach to analyzing the LP and HF waveforms developed in this study has a high potential for identifying five dam-forming landquake events (DFLEs) in near real-time using broadband seismic records, which can provide timely warnings of the impending floods to downstream residents. PMID:26753931

  6. The Competitive Interplay between Allosteric HIV-1 Integrase Inhibitor BI/D and LEDGF/p75 during the Early Stage of HIV-1 Replication Adversely Affects Inhibitor Potency.

    PubMed

    Feng, Lei; Dharmarajan, Venkatasubramanian; Serrao, Erik; Hoyte, Ashley; Larue, Ross C; Slaughter, Alison; Sharma, Amit; Plumb, Matthew R; Kessl, Jacques J; Fuchs, James R; Bushman, Frederic D; Engelman, Alan N; Griffin, Patrick R; Kvaratskhelia, Mamuka

    2016-05-20

    Allosteric HIV-1 integrase inhibitors (ALLINIs) have recently emerged as a promising class of antiretroviral agents and are currently in clinical trials. In infected cells, ALLINIs potently inhibit viral replication by impairing virus particle maturation but surprisingly exhibit a reduced EC50 for inhibiting HIV-1 integration in target cells. To better understand the reduced antiviral activity of ALLINIs during the early stage of HIV-1 replication, we investigated the competitive interplay between a potent representative ALLINI, BI/D, and LEDGF/p75 with HIV-1 integrase. While the principal binding sites of BI/D and LEDGF/p75 overlap at the integrase catalytic core domain dimer interface, we show that the inhibitor and the cellular cofactor induce markedly different multimerization patterns of full-length integrase. LEDGF/p75 stabilizes an integrase tetramer through the additional interactions with the integrase N-terminal domain, whereas BI/D induces protein-protein interactions in C-terminal segments that lead to aberrant, higher-order integrase multimerization. We demonstrate that LEDGF/p75 binds HIV-1 integrase with significantly higher affinity than BI/D and that the cellular protein is able to reverse the inhibitor induced aberrant, higher-order integrase multimerization in a dose-dependent manner in vitro. Consistent with these observations, alterations of the cellular levels of LEDGF/p75 markedly affected BI/D EC50 values during the early steps of HIV-1 replication. Furthermore, genome-wide sequencing of HIV-1 integration sites in infected cells demonstrate that LEDGF/p75-dependent integration site selection is adversely affected by BI/D treatment. Taken together, our studies elucidate structural and mechanistic details of the interplay between LEDGF/p75 and BI/D during the early stage of HIV-1 replication. PMID:26910179

  7. TP53 mutations are early events in chronic lymphocytic leukemia disease progression and precede evolution to complex karyotypes.

    PubMed

    Lazarian, Gregory; Tausch, Eugen; Eclache, Virginie; Sebaa, Amel; Bianchi, Vincent; Letestu, Remi; Collon, Jean-Francois; Lefebvre, Valerie; Gardano, Laura; Varin-Blank, Nadine; Soussi, Thierry; Stilgenbauer, Stephen; Cymbalista, Florence; Baran-Marszak, Fanny

    2016-10-15

    TP53 abnormalities lead to resistance to purine analogues and are found in over 40% of patients with refractory chronic lymphocytic leukemia (CLL). At diagnosis, no more than 5% of patients carry the 17p deletion, most cases harbour mutations within the other TP53 allele. The incidence of a TP53 mutation as the only alteration is approximately 5%, but this depends on the sensitivity of the technique. Recently, having a complex karyotype has been considered a strong adverse prognostic factor. However, there are no longitudinal studies simultaneously examining the presence of the 17p deletion, TP53 mutations and karyotype abnormalities. We conducted a retrospective longitudinal study of 31 relapsed/refractory CLL patients. Two to six blood samples per patient were analyzed, with a median follow-up of 8 years. In this report, we assessed the sequence of events of TP53 clonal evolution and correlated the presence of TP53 abnormalities to genetic instability during progression and treatment. Next-generation sequencing allowed the early detection of TP53 mutated clones and was able to be performed on a routine basis, demonstrating an excellent correlation between the Illumina and Ion Torrent technologies. We concluded that TP53 mutations are early events and precede clonal evolution to complex karyotypes. We strongly recommend the early and iterated detection of TP53 mutations in progressive cases. PMID:27270786

  8. A novel preclinical method to quantitatively evaluate early-stage metastatic events at the murine blood-brain barrier.

    PubMed

    Adkins, Chris E; Nounou, Mohamed I; Mittapalli, Rajendar K; Terrell-Hall, Tori B; Mohammad, Afroz S; Jagannathan, Rajaganapathi; Lockman, Paul R

    2015-01-01

    The observation that approximately 15% of women with disseminated breast cancer will develop symptomatic brain metastases combined with treatment guidelines discouraging single-agent chemotherapeutic strategies facilitates the desire for novel strategies aimed at outright brain metastasis prevention. Effective and robust preclinical methods to evaluate early-stage metastatic processes, brain metastases burden, and overall mean survival are lacking. Here, we develop a novel method to quantitate early metastatic events (arresting and extravasation) in addition to traditional end time-point parameters such as tumor burden and survival in an experimental mouse model of brain metastases of breast cancer. Using this method, a reduced number of viable brain-seeking metastatic cells (from 3,331 ± 263 cells/brain to 1,079 ± 495 cells/brain) were arrested in brain one week postinjection after TGFβ knockdown. Treatment with a TGFβ receptor inhibitor, galunisertib, reduced the number of arrested cells in brain to 808 ± 82 cells/brain. Furthermore, we observed a reduction in the percentage of extravasated cells (from 63% to 30%) compared with cells remaining intralumenal when TGFβ is knocked down or inhibited with galunisertib (40%). The observed reduction of extravasated metastatic cells in brain translated to smaller and fewer brain metastases and resulted in prolonged mean survival (from 36 days to 62 days). This method opens up potentially new avenues of metastases prevention research by providing critical data important to early brain metastasis of breast cancer events. PMID:25348853

  9. A novel preclinical method to quantitatively evaluate early-stage metastatic events at the murine blood-brain barrier

    PubMed Central

    Adkins, Chris E; Nounou, Mohamed I; Mittapalli, Rajendar K; Terrell-Hall, Tori B; Mohammad, Afroz S; Jagannathan, Rajaganapathi; Lockman, Paul R

    2014-01-01

    The observation that approximately 15% of women with disseminated breast cancer will develop symptomatic brain metastases combined with treatment guidelines discouraging single-agent chemotherapeutic strategies facilitates the desire for novel strategies aimed at outright brain metastasis prevention. Effective and robust preclinical methods to evaluate early stage metastatic processes, brain metastases burden, and overall mean survival are lacking. Here, we develop a novel method to quantitate early metastatic events (arresting and extravasation) in addition to traditional end time-point parameters such as tumor burden and survival in an experimental mouse model of brain metastases of breast cancer. Using this method, a reduced number of viable brain seeking metastatic cells (from 3331 ± 263 cells/brain to 1079 ± 495 cells/brain) arrested in brain one week post injection after TGFβ knockdown. Treatment with a TGFβ receptor inhibitor, galunisertib, reduced the number of arrested cells in brain to 808 ± 82 cells/brain. Further, we observed a reduction in the percent of extravasated cells (from 63% to 30%) compared to cells remaining intralumenal when TGFβ is knocked down or inhibited with galunisertib (40%). The observed reduction of extravasated metastatic cells in brain translated to smaller and fewer brain metastases and resulted in prolonged mean survival (from 36 days to 62 days). This method opens up potentially new avenues of metastases prevention research by providing critical data important to early brain metastasis of breast cancer events. PMID:25348853

  10. Molecular replication

    NASA Technical Reports Server (NTRS)

    Orgel, L. E.

    1986-01-01

    The object of our research program is to understand how polynucleotide replication originated on the primitive Earth. This is a central issue in studies of the origins of life, since a process similar to modern DNA and RNA synthesis is likely to have formed the basis for the most primitive system of genetic information transfer. The major conclusion of studies so far is that a preformed polynucleotide template under many different experimental conditions will facilitate the synthesis of a new oligonucleotide with a sequence complementary to that of the template. It has been shown, for example, that poly(C) facilitates the synthesis of long oligo(G)s and that the short template CCGCC facilities the synthesis of its complement GGCGG. Very recently we have shown that template-directed synthesis is not limited to the standard oligonucleotide substrates. Nucleic acid-like molecules with a pyrophosphate group replacing the phosphate of the standard nucleic acid backbone are readily synthesized from deoxynucleotide 3'-5'-diphosphates on appropriate templates.

  11. Early Top-Down Influences on Bistable Perception Revealed by Event-Related Potentials

    ERIC Educational Resources Information Center

    Pitts, Michael A.; Gavin, William J.; Nerger, Janice L.

    2008-01-01

    A longstanding debate exists in the literature concerning bottom-up vs. top-down influences on bistable perception. Recently, a technique has been developed to measure early changes in brain activity (via ERPs) related to perceptual reversals (Kornmeier & Bach, 2004). An ERP component, the reversal negativity (RN) has been identified, and is…

  12. IL-17A mediates inflammatory and tissue remodelling events in early human tendinopathy.

    PubMed

    Millar, Neal L; Akbar, Moeed; Campbell, Abigail L; Reilly, James H; Kerr, Shauna C; McLean, Michael; Frleta-Gilchrist, Marina; Fazzi, Umberto G; Leach, William J; Rooney, Brian P; Crowe, Lindsay A N; Murrell, George A C; McInnes, Iain B

    2016-01-01

    Increasingly, inflammatory mediators are considered crucial to the onset and perpetuation of tendinopathy. We sought evidence of interleukin 17A (IL-17A) expression in early human tendinopathy and thereafter, explored mechanisms whereby IL-17A mediated inflammation and tissue remodeling in human tenocytes. Torn supraspinatus tendon (established pathology) and matched intact subscapularis tendon (representing 'early pathology') along with control biopsies were collected from patients undergoing shoulder surgery. Markers of inflammation and IL-17A were quantified by RT-PCR and immunohistochemistry. Human tendon cells were derived from hamstring tendon obtained during ACL reconstruction. In vitro effects of IL-17A upon tenocytes were measured using RT-PCR, multiplex cytokine assays, apoptotic proteomic profiling, immunohistochemistry and annexin V FACS staining. Increased expression of IL-17A was detected in 'early tendinopathy' compared to both matched samples and non-matched control samples (p < 0.01) by RT-PCR and immunostaining. Double immunofluoresence staining revealed IL-17A expression in leukocyte subsets including mast cells, macrophages and T cells. IL-17A treated tenocytes exhibited increased production of proinflammatory cytokines (p < 0.001), altered matrix regulation (p < 0.01) with increased Collagen type III and increased expression of several apoptosis related factors. We propose IL-17A as an inflammatory mediator within the early tendinopathy processes thus providing novel therapeutic approaches in the management of tendon disorders. PMID:27263531

  13. Introduction: Cortical event-related potentials and early language development: Variations with age and nutrition

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There is increasing evidence in the form of language-relevant sensory processing and discrimination that the foundations for speech perception are present at birth and are subject to significant modification during the first year of life. However, charting the course of early language development is...

  14. IL-17A mediates inflammatory and tissue remodelling events in early human tendinopathy

    PubMed Central

    Millar, Neal L.; Akbar, Moeed; Campbell, Abigail L.; Reilly, James H.; Kerr, Shauna C.; McLean, Michael; Frleta-Gilchrist, Marina; Fazzi, Umberto G.; Leach, William J.; Rooney, Brian P.; Crowe, Lindsay A. N.; Murrell, George A. C.; McInnes, Iain B.

    2016-01-01

    Increasingly, inflammatory mediators are considered crucial to the onset and perpetuation of tendinopathy. We sought evidence of interleukin 17A (IL-17A) expression in early human tendinopathy and thereafter, explored mechanisms whereby IL-17A mediated inflammation and tissue remodeling in human tenocytes. Torn supraspinatus tendon (established pathology) and matched intact subscapularis tendon (representing ‘early pathology’) along with control biopsies were collected from patients undergoing shoulder surgery. Markers of inflammation and IL-17A were quantified by RT-PCR and immunohistochemistry. Human tendon cells were derived from hamstring tendon obtained during ACL reconstruction. In vitro effects of IL-17A upon tenocytes were measured using RT-PCR, multiplex cytokine assays, apoptotic proteomic profiling, immunohistochemistry and annexin V FACS staining. Increased expression of IL-17A was detected in ‘early tendinopathy’ compared to both matched samples and non-matched control samples (p < 0.01) by RT-PCR and immunostaining. Double immunofluoresence staining revealed IL-17A expression in leukocyte subsets including mast cells, macrophages and T cells. IL-17A treated tenocytes exhibited increased production of proinflammatory cytokines (p < 0.001), altered matrix regulation (p < 0.01) with increased Collagen type III and increased expression of several apoptosis related factors. We propose IL-17A as an inflammatory mediator within the early tendinopathy processes thus providing novel therapeutic approaches in the management of tendon disorders. PMID:27263531

  15. Early Events in Foamy Virus—Host Interaction and Intracellular Trafficking

    PubMed Central

    Berka, Ursula; Hamann, Martin Volker; Lindemann, Dirk

    2013-01-01

    Here we review viral and cellular requirements for entry and intracellular trafficking of foamy viruses (FVs) resulting in integration of viral sequences into the host cell genome. The virus encoded glycoprotein harbors all essential viral determinants, which are involved in absorption to the host membrane and triggering the uptake of virus particles. However, only recently light was shed on some details of FV’s interaction with its host cell receptor(s). Latest studies indicate glycosaminoglycans of cellular proteoglycans, particularly heparan sulfate, to be of utmost importance. In a species-specific manner FVs encounter endogenous machineries of the target cell, which are in some cases exploited for fusion and further egress into the cytosol. Mostly triggered by pH-dependent endocytosis, viral and cellular membranes fuse and release naked FV capsids into the cytoplasm. Intact FV capsids are then shuttled along microtubules and are found to accumulate nearby the centrosome where they can remain in a latent state for extended time periods. Depending on the host cell cycle status, FV capsids finally disassemble and, by still poorly characterized mechanisms, the preintegration complex gets access to the host cell chromatin. Host cell mitosis finally allows for viral genome integration, ultimately starting a new round of viral replication. PMID:23567621

  16. The "terminal Triassic catastrophic extinction event" in perspective: a review of carboniferous through Early Jurassic terrestrial vertebrate extinction patterns

    USGS Publications Warehouse

    Weems, R.E.

    1992-01-01

    A catastrophic terminal Triassic extinction event among terrestrial vertebrates is not supported by available evidence. The current model for such an extinction is based on at least eight weak or untenable assumptions: (1) a terminal Triassic extinction-inducing asteroid impact occurred, (2) a terminal Triassic synchronous mass extinction of terrestrial vertebrates occurred, (3) a concurrent terminal Triassic marine extinction occurred, (4) all terrestrial vertebrate families have similar diversities and ecologies, (5) changes in familial diversity can be gauged accurately from the known fossil record, (6) extinction of families can be compared through time without normalizing for changes in familial diversity through time, (7) extinction rates can be compared without normalizing for differing lengths of geologic stages, and (8) catastrophic mass extinctions do not select for small size. These assumptions have resulted in unsupportable and (or) erroneous conclusions. Carboniferous through Early Jurassic terrestrial vertebrate families mostly have evolution and extinction patterns unlike the vertebrate evolution and extinction patterns during the terminal Cretaceous event. Only the Serpukhovian (mid Carboniferous) extinction event shows strong analogy to the terminal Cretaceous event. Available data suggest no terminal Triassic extinction anomaly, but rather a prolonged and nearly steady decline in the global terrestrial vertebrate extinction rate throughout the Triassic and earliest Jurassic. ?? 1992.

  17. Modeling evidences for global warming, Arctic seawater freshening, and sluggish oceanic circulation during the Early Toarcian anoxic event

    NASA Astrophysics Data System (ADS)

    Dera, Guillaume; Donnadieu, Yannick

    2012-06-01

    The paleoecological disturbances recorded during the Early Toarcian warming event (183 Myr ago), including marine anoxia, sea level rise, seawater acidification, carbonate production crisis, and species extinctions, are often regarded as past examples of Earth's possible responses to the rapid emergence of super greenhouse conditions. However, physical mechanisms explaining both the global and local expressions of paleoenvironmental events are still highly debated. Here we analyze the paleoclimatic and paleoceanographic consequences of increases in atmospheric pCO2 levels at a multiscale resolution using a fully coupled ocean-atmosphere model (FOAM). We show that, in association with stronger high-latitude precipitation rates and enhanced continental runoff, the demise of polar sea ice due to the global warming event involved a regional freshening of Arctic surface seawaters. These disturbances lead to progressive slowdowns of the global oceanic circulation accountable for widespread ocean stratification and bottom anoxia processes in deep oceanic settings and epicontinental basins. In agreement with very negative oxygen isotope values measured on fossil shells from the NW Tethys, our simulations also show that recurrent discharges of brackish and nutrient-rich Arctic surface waters through the Viking Corridor could have led to both vertical and geographical gradients in salinity and seawater δ18O in the NW Tethyan seas. Locally contrasted conditions in water mass density and rises in productivity rates due to strong nutrient supplies could partly explain the regional severity of the anoxic event in the restricted Euro-boreal domains, as it has been previously suggested and modeled regionally.

  18. Ar-Ar Dating of Martian Meteorite, Dhofar 378: An Early Shock Event?

    NASA Technical Reports Server (NTRS)

    Park, J.; Bogard, D. D.

    2006-01-01

    Martian meteorite, Dhofar 378 (Dho378) is a basaltic shergottite from Oman, weighing 15 g, and possessing a black fusion crust. Chemical similarities between Dho378 and the Los Angeles 001 shergottite suggests that they might have derived from the same Mars locale. The plagioclase in other shergottites has been converted to maskelenite by shock, but Dho378 apparently experienced even more intense shock heating, estimated at 55-75 GPa. Dho378 feldspar (approximately 43 modal %) melted, partially flowed and vesiculated, and then partially recrystallized. Areas of feldspathic glass are appreciably enriched in K, whereas individual plagioclases show a range in the Or/An ratio of approximately 0.18-0.017. Radiometric dating of martian shergottites indicate variable formation times of 160-475 Myr, whereas cosmic ray exposure (CRE) ages of shergottites indicate most were ejected from Mars within the past few Myr. Most determined Ar-39-Ar-40 ages of shergottites appear older than other radiometric ages because of the presence of large amounts of martian atmosphere or interior Ar-40. Among all types of meteorites and returned lunar rocks, the impact event that initiated the CRE age very rarely reset the Ar-Ar age. This is because a minimum time and temperature is required to facilitate Ar diffusion loss. It is generally assumed that the shock-texture characteristics in martian meteorites were produced by the impact events that ejected the rocks from Mars, although the time of these shock events (as opposed to CRE ages) are not directly dated. Here we report Ar-39-Ar-40 dating of Dho378 plagioclase. We suggest that the determined age dates the intense shock heating event this meteorite experienced, but that it was not the impact that initiated the CRE age.

  19. Parental Substance Abuse As an Early Traumatic Event. Preliminary Findings on Neuropsychological and Personality Functioning in Young Drug Addicts Exposed to Drugs Early

    PubMed Central

    Parolin, Micol; Simonelli, Alessandra; Mapelli, Daniela; Sacco, Marianna; Cristofalo, Patrizia

    2016-01-01

    Parental substance use is a major risk factor for child development, heightening the risk of drug problems in adolescence and young adulthood, and exposing offspring to several types of traumatic events. First, prenatal drug exposure can be considered a form of trauma itself, with subtle but long-lasting sequelae at the neuro-behavioral level. Second, parents' addiction often entails a childrearing environment characterized by poor parenting skills, disadvantaged contexts and adverse childhood experiences (ACEs), leading to dysfunctional outcomes. Young adults born from/raised by parents with drug problems and diagnosed with a Substance Used Disorder (SUD) themselves might display a particularly severe condition in terms of cognitive deficits and impaired personality function. This preliminary study aims to investigate the role of early exposure to drugs as a traumatic event, capable of affecting the psychological status of young drug addicts. In particular, it intends to examine the neuropsychological functioning and personality profile of young adults with severe SUDs who were exposed to drugs early in their family context. The research involved three groups, each consisting of 15 young adults (aged 18–24): a group of inpatients diagnosed with SUDs and exposed to drugs early, a comparison group of non-exposed inpatients and a group of non-exposed youth without SUDs. A neuropsychological battery (Esame Neuropsicologico Breve-2), an assessment procedure for personality disorders (Shedler-Westen Assessment Procedure-200) and the Symptom CheckList-90-Revised were administered. According to present preliminary results, young drug addicts exposed to drugs during their developmental age were characterized by elevated rates of neuropsychological impairments, especially at the expense of attentive and executive functions (EF); personality disorders were also common but did not differentiate them from non-exposed youth with SUDs. Alternative multi-focused prevention and

  20. Parental Substance Abuse As an Early Traumatic Event. Preliminary Findings on Neuropsychological and Personality Functioning in Young Drug Addicts Exposed to Drugs Early.

    PubMed

    Parolin, Micol; Simonelli, Alessandra; Mapelli, Daniela; Sacco, Marianna; Cristofalo, Patrizia

    2016-01-01

    Parental substance use is a major risk factor for child development, heightening the risk of drug problems in adolescence and young adulthood, and exposing offspring to several types of traumatic events. First, prenatal drug exposure can be considered a form of trauma itself, with subtle but long-lasting sequelae at the neuro-behavioral level. Second, parents' addiction often entails a childrearing environment characterized by poor parenting skills, disadvantaged contexts and adverse childhood experiences (ACEs), leading to dysfunctional outcomes. Young adults born from/raised by parents with drug problems and diagnosed with a Substance Used Disorder (SUD) themselves might display a particularly severe condition in terms of cognitive deficits and impaired personality function. This preliminary study aims to investigate the role of early exposure to drugs as a traumatic event, capable of affecting the psychological status of young drug addicts. In particular, it intends to examine the neuropsychological functioning and personality profile of young adults with severe SUDs who were exposed to drugs early in their family context. The research involved three groups, each consisting of 15 young adults (aged 18-24): a group of inpatients diagnosed with SUDs and exposed to drugs early, a comparison group of non-exposed inpatients and a group of non-exposed youth without SUDs. A neuropsychological battery (Esame Neuropsicologico Breve-2), an assessment procedure for personality disorders (Shedler-Westen Assessment Procedure-200) and the Symptom CheckList-90-Revised were administered. According to present preliminary results, young drug addicts exposed to drugs during their developmental age were characterized by elevated rates of neuropsychological impairments, especially at the expense of attentive and executive functions (EF); personality disorders were also common but did not differentiate them from non-exposed youth with SUDs. Alternative multi-focused prevention and

  1. Early trimpi events from lightning-induced electric fields in the ionosphere: An alternative explanation. (Reannouncement with new availability information)

    SciTech Connect

    Burke, W.J.

    1992-12-31

    Two classes of Trimpi modulation of VLF signals in the Earth-ionosphere waveguide have been identified in the literature. The more common type occurs 1 s or more after causative lightning strokes, the second in less than 100 ms. The authors explore the possibility that these early Trimpi events result from lightning-generated, electric field impulses lowering the mirror altitudes of trapped electrons. To overcome the mirror force on energetic electrons, upward-directed electric fields with strength of a few tens of mV/m are required. This is well within the range of electric field observed on sounding rockets above thunderstorms.

  2. An early warning indicator for atmospheric blocking events using transfer operators

    SciTech Connect

    Tantet, Alexis Burgt, Fiona R. van der; Dijkstra, Henk A.

    2015-03-15

    The existence of persistent midlatitude atmospheric flow regimes with time-scales larger than 5–10 days and indications of preferred transitions between them motivates to develop early warning indicators for such regime transitions. In this paper, we use a hemispheric barotropic model together with estimates of transfer operators on a reduced phase space to develop an early warning indicator of the zonal to blocked flow transition in this model. It is shown that the spectrum of the transfer operators can be used to study the slow dynamics of the flow as well as the non-Markovian character of the reduction. The slowest motions are thereby found to have time scales of three to six weeks and to be associated with meta-stable regimes (and their transitions) which can be detected as almost-invariant sets of the transfer operator. From the energy budget of the model, we are able to explain the meta-stability of the regimes and the existence of preferred transition paths. Even though the model is highly simplified, the skill of the early warning indicator is promising, suggesting that the transfer operator approach can be used in parallel to an operational deterministic model for stochastic prediction or to assess forecast uncertainty.

  3. Age Dating Merger Events in Early Type Galaxies via the Detection of AGB Light

    NASA Technical Reports Server (NTRS)

    Bothun, G.

    2005-01-01

    A thorough statistical analysis of the J-H vs. H-K color plane of all detected early type galaxies in the 2MASS catalog with velocities less than 5000 km/s has been performed. This all sky survey is not sensitive to one particular galactic environment and therefore a representative range of early type galaxy environments have been sampled. Virtually all N-body simulation so major mergers produces a central starburst due to rapid collection of gas. This central starburst is of sufficient amplitude to change the stellar population in the central regions of the galaxy. Intermediate age populations are given away by the presence of AGB stars which will drive the central colors redder in H-K relative to the J- H baseline. This color anomaly has a lifetime of 2-5 billion years depending on the amplitude of the initial starburst Employing this technique on the entire 2MASS sample (several hundred galaxies) reveals that the AGB signature occurs less than 1% of the time. This is a straightforward indication that virtually all nearby early type galaxies have not had a major merger occur within the last few billion years.

  4. The onset of childhood amnesia in childhood: A prospective investigation of the course and determinants of forgetting of early-life events

    PubMed Central

    Bauer, Patricia J.; Larkina, Marina

    2013-01-01

    The present research was an examination of the onset of childhood amnesia and how it relates to maternal narrative style, an important determinant of autobiographical memory development. Children and their mothers discussed unique events when the children were 3 years of age. Different subgroups of children were tested for recall of the events at ages 5, 6, 7, 8, and 9 years. At the later session, they were interviewed by an experimenter about the events discussed 2 to 6 years previously with their mothers (early-life events). Children ages 5, 6, and 7 remembered 60% or more of the early-life events. In contrast, children ages 8 and 9 years remembered fewer than 40% of the early-life events. Overall maternal narrative style predicted children's contributions to mother-child conversations at age 3 years; it did not have cross-lagged relations to memory for early-life events at ages 5 to 9 years. Maternal deflections of the conversational turn to the child predicted the amount of information children later reported about the early-life events. The findings have implications for our understanding of the onset of childhood amnesia and the achievement of an adult-like distribution of memories in the school years. They highlight the importance of forgetting processes in explanations of the amnesia. PMID:24236647

  5. SeismoGeodesy: Combination of High Rate, Real-time GNSS and Accelerometer Observations and Rapid Seismic Event Notification for Earth Quake Early Warning and Volcano Monitoring

    NASA Astrophysics Data System (ADS)

    Jackson, Michael; Zimakov, Leonid; Moessmer, Matthias

    2015-04-01

    Scientific GNSS networks are moving towards a model of real-time data acquisition, epoch-by-epoch storage integrity, and on-board real-time position and displacement calculations. This new paradigm allows the integration of real-time, high-rate GNSS displacement information with acceleration and velocity data to create very high-rate displacement records. The mating of these two instruments allows the creation of a new, very high-rate (200 Hz) displacement observable that has the full-scale displacement characteristics of GNSS and high-precision dynamic motions of seismic technologies. It is envisioned that these new observables can be used for earthquake early warning studies, volcano monitoring, and critical infrastructure monitoring applications. Our presentation will focus on the characteristics of GNSS, seismic, and strong motion sensors in high dynamic environments, including historic earthquakes replicated on a shake table over a range of displacements and frequencies. We will explore the optimum integration of these sensors from a filtering perspective including simple harmonic impulses over varying frequencies and amplitudes and under the dynamic conditions of various earthquake scenarios. We will also explore the tradeoffs between various GNSS processing schemes including real-time precise point positioning (PPP) and real-time kinematic (RTK) as applied to seismogeodesy. In addition we will discuss implementation of a Rapid Seismic Event Notification System that provides quick delivery of digital data from seismic stations to the acquisition and processing center and a full data integrity model for real-time earthquake notification that provides warning prior to significant ground shaking.

  6. Ar-39-Ar-40 Evidence for Early Impact Events on the LL Parent Body

    NASA Technical Reports Server (NTRS)

    Dixon, E. T.; Bogard, D. D.; Garrison, D. H.; Rubin, A. E.

    2006-01-01

    We determined Ar-39-Ar-40 ages of eight LL chondrites, and one igneous inclusion from an LL chondrite, with the object of understanding the thermal history of the LL-chondrite parent body. The meteorites in this study have a range of petrographic types from LL3.3 to LL6, and shock stages from S1 to S4. These meteorites reveal a range of K-Ar ages from 23.66 to 24.50 Ga, and peak ages from 23.74 to 24.55 Ga. Significantly, three of the eight chondrites (LL4, 5, 6) have K-Ar ages of -4.27 Ga. One of these (MIL99301) preserves an Ar-39-Ar-40 age of 4.23 +/- 0.03 Ga from low-temperature extractions, and an older age of 4.52 +/- 0.08 Ga from the highest temperature extractions. In addition, an igneous-textured impact melt DOM85505,22 has a peak Ar-39-Ar-40 age of >= 4.27 Ga. We interpret these results as evidence for impact events that occurred at about 4.27 Ga on the LL parent body that produced local impact melts, reset the Ar-39-Ar-40 ages of some meteorites, and exhumed (or interred) others, resulting in a range of cooling ages. The somewhat younger peak age of 3.74 Ga from GR095658 (LL3.3) suggests an additional impact event close to timing of impact-reset ages of some other ordinary chondrites between 3.6-3.8 Ga. The results from MIL99301 suggest that some apparently unshocked (Sl) chondrites may have substantially reset Ar-39-Ar-40 ages. A previous petrographic investigation of MIL99301 suggested that reheating to temperatures less than or equal to type 4 petrographic conditions (600C) caused fractures in olivine to anneal, resulting in a low apparent shock stage of S1 (unshocked). The Ar-39-Ar-40 age spectrum of MIL99301 is consistent with this interpretation. Older ages from high-T extractions may date an earlier impact event at 4.52 +/- 0.08 Ga, whereas younger ages from lower-T extractions date a later impact event at 4.23 Ar-39-Ar-40 0.03 Ga that may have caused annealing of feldspar and olivine

  7. Do early-life events permanently alter behavioral and hormonal responses to stressors?

    PubMed

    Anisman, H; Zaharia, M D; Meaney, M J; Merali, Z

    1998-01-01

    Early-life stimulation (e.g., brief handling) attenuates the behavioral and neuroendocrine responses to stressors encountered in adulthood, particularly with respect to activation of hypothalamic-pituitary-adrenal (HPA) activity. In contrast, if neonates were subjected to a more severe stressor, such as protracted separation from the dam or exposure to an endotoxin, then the adult response to a stressor was exaggerated. These early-life experiences program HPA functioning, including negative feedback derived from stimulation of hippocampal glucocorticoid receptors, and corticotropin-releasing hormone (CRH) and arginine vasopressin (AVP) coexpression in PVN neurons, to modify the response to subsequent stressor experiences. The persistent variations of HPA activity observed in handled/stimulated animals may stem from alterations in dam-pup interactions (e.g. increased arched-back feeding, licking, grooming). In addition genetic makeup is critical in determining stress reactivity. For instance, BALB/cByJ mice are more reactive to stressors than C57BL/6ByJ mice, exhibiting greater HPA hormonal alterations and behavioral disturbances. BALB/cByJ also fail to acquire a spatial learning response in a Morris water-maze paradigm, which has been shown to be correlated with hippocampal cell loss associated with aging. Early-life handling of BALB/cByJ mice prevented these performance deficits and attenuated the hypersecretion of ACTH and corticosterone elicited by stressors. The stressor reactivity may have been related to maternal and genetic factors. When BALB/cByJ mice were raised by a C57BL/6ByJ dam, the excessive stress-elicited HPA activity was reduced, as were the behavioral impairments. However, cross-fostering the more resilient C57BL/6ByJ mice to a BALB/cByJ dam failed to elicit the behavioral disturbances. It is suggested that genetic factors may influence dam-pup interactive styles and may thus proactively influence the response to subsequent stressors among

  8. Knockin' on pollen's door: live cell imaging of early polarization events in germinating Arabidopsis pollen

    PubMed Central

    Vogler, Frank; Konrad, Sebastian S. A.; Sprunck, Stefanie

    2015-01-01

    Pollen tubes are an excellent system for studying the cellular dynamics and complex signaling pathways that coordinate polarized tip growth. Although several signaling mechanisms acting in the tip-growing pollen tube have been described, our knowledge on the subcellular and molecular events during pollen germination and growth site selection at the pollen plasma membrane is rather scarce. To simultaneously track germinating pollen from up to 12 genetically different plants we developed an inexpensive and easy mounting technique, suitable for every standard microscope setup. We performed high magnification live-cell imaging during Arabidopsis pollen activation, germination, and the establishment of pollen tube tip growth by using fluorescent marker lines labeling either the pollen cytoplasm, vesicles, the actin cytoskeleton or the sperm cell nuclei and membranes. Our studies revealed distinctive vesicle and F-actin polarization during pollen activation and characteristic growth kinetics during pollen germination and pollen tube formation. Initially, the germinating Arabidopsis pollen tube grows slowly and forms a uniform roundish bulge, followed by a transition phase with vesicles heavily accumulating at the growth site before switching to rapid tip growth. Furthermore, we found the two sperm cells to be transported into the pollen tube after the phase of rapid tip growth has been initiated. The method presented here is suitable to quantitatively study subcellular events during Arabidopsis pollen germination and growth, and for the detailed analysis of pollen mutants with respect to pollen polarization, bulging, or growth site selection at the pollen plasma membrane. PMID:25954283

  9. B cells from patients with systemic lupus erythematosus display abnormal antigen receptor-mediated early signal transduction events.

    PubMed Central

    Liossis, S N; Kovacs, B; Dennis, G; Kammer, G M; Tsokos, G C

    1996-01-01

    To understand the molecular mechanisms that are responsible for the B cell overactivity that is observed in patients with SLE, we have conducted experiments in which the surface immunoglobulin (sIg)-mediated early cell signaling events were studied. The anti-sIgM-mediated free intracytoplasmic calcium ([Ca2+]i) responses were significantly higher in SLE B cells compared with responses of normal individuals and to those of patients with other systemic autoimmune rheumatic diseases. The anti-IgD mAb induced [Ca2+]i responses were also higher in lupus B cells than in controls. The magnitude of anti-sIgM-mediated Ca2+ release from intracellular stores was also increased in B cells from SLE patients compared with normal controls. The amount of inositol phosphate metabolites produced upon crosslinking of sIgM was slightly higher in patients with lupus than in normal controls, although the difference was not statistically significant. In contrast, the degree of anti-sIgM-induced protein tyrosine phosphorylation was obviously increased in lupus patients. Our study demonstrates clearly for the first time that SLE B cells exhibit aberrant early signal transduction events, including augmented calcium responses after crosslinking of the B cell receptor and increased antigen-receptor-mediated phosphorylation of protein tyrosine residues. Because the above abnormalities did not correlate with disease activity or treatment status, we propose that they may have pathogenic significance. PMID:8958217

  10. Toward a Molecular Theory of Early and Late Events in Monomer to Amyloid Fibril Formation

    NASA Astrophysics Data System (ADS)

    Straub, John E.; Thirumalai, D.

    2011-05-01

    Quantitative understanding of the kinetics of fibril formation and the molecular mechanism of transition from monomers to fibrils is needed to obtain insights into the growth of amyloid fibrils and more generally self-assembly multisubunit protein complexes. Significant advances using computations of protein aggregation in a number of systems have established generic and sequence-specific aspects of the early steps in oligomer formation. Theoretical considerations, which view oligomer and fibril growth as diffusion in a complex energy landscape, and computational studies, involving minimal lattice and coarse-grained models, have revealed general principles governing the transition from monomeric protein to ordered fibrillar aggregates. Detailed atomistic calculations have explored the early stages of the protein aggregation pathway for a number of amyloidogenic proteins, most notably amyloid β- (Aβ-) protein and fragments from proteins linked to various diseases. These computational studies have provided insights into the role of sequence, role of water, and specific interatomic interactions underlying the thermodynamics and dynamics of elementary kinetic steps in the aggregation pathway. Novel methods are beginning to illustrate the structural basis for the production of Aβ-peptides through interactions with secretases in the presence of membranes. We show that a variety of theoretical approaches, ranging from scaling arguments to minimal models to atomistic simulations, are needed as a complement to experimental studies probing the principles governing protein aggregation.

  11. Early Paleozoic magmatic events in the eastern Klamath Mountains, northern California

    SciTech Connect

    Wallin, E.T.; Mattinson, J.M.; Potter, A.W.

    1988-02-01

    New U-Pb zircon ages for nine samples of tonalite and pegmatitic trondhjemite from the Trinity ophiolite and associated melange reveal a complex history of magmatic activity extending back into the earliest Cambrian, much older than previously believed. Earlier investigations, based on limited data, recognized lower Paleozoic crustal elements in the eastern Klamath terrane (EKT) ranging in age from Middle Ordovician to Early to Middle Devonian. The new work in the Yreka-Callahan area of the EKT confirms the Ordovician (440-475 Ma) and younger ages, but reveals for the first time the presence of tonalitic rocks that crystallized during a narrow time interval at about 565-570 Ma. The authors also recognize younger, Late Silurian magmatism at 412 Ma. In the context of available mapping, these ages indicate that the Trinity ophiolite is broadly polygenetic because parts of it yield crystallization ages that span approximately 150 m.y. Superjacent dismembered units of probable early Paleozoic age may be tectonostratigraphically equivalent to the Sierra City melange in the northern Sierra Nevada.

  12. Early Paleozoic magmatic events in the eastern Klamath Mountains, northern California

    NASA Astrophysics Data System (ADS)

    Wallin, E. Timothy; Mattinson, James M.; Potter, A. W.

    1988-02-01

    New U-Pb zircon ages for nine samples of tonalite and pegmatitic trondhjemite from the Trinity ophiolite and associated melange reveal a complex history of magmatic activity extending back into the earliest Cambrian, much older than previously believed. Earlier investigations, based on limited data, recognized lower Paleozoic crustal elements in the eastern Klamath terrane (EKT) ranging in age from Middle Ordovician to Early to Middle Devonian. The new work in the Yreka-Callahan area of the EKT confirms the Ordovician (440-475 Ma) and younger ages, but reveals for the first time the presence of tonalitic rocks that crystallized during a narrow time interval at about 565-570 Ma. We also recognize younger, Late Silurian magmatism at 412 Ma. In the context of available mapping, these ages indicate that the Trinity ophiolite is broadly polygenetic because parts of it yield crystallization ages that span approximately 150 m.y. Superjacent dismembered units of probable early Paleozoic age may be tectonostratigraphically equivalent to the Sierra City melange in the northern Sierra Nevada.

  13. Metabolic events mediating early killing of host cells infected by Shigella flexneri.

    PubMed

    Sansonetti, P J; Mounier, J

    1987-07-01

    J774, a continuous macrophage cell-line, was infected by M90T, an invasive isolate of Shigella flexneri serotype 5 and BS176, its non invasive derivative--which does not harbor the 220 kbase virulence plasmid pWR100. Killing of host cells by intracellular M90T, commenced one hour after infection and was completed by 4 hours. Intracellular BS176 did not kill cells during the same period. Cell protein biosynthesis was totally inhibited by both strains within 2 hours of infection thus indicating that shiga-like toxin 1 (SLT1) could not account for early killing. On the other hand a sharp decrease in intracellular ATP was observed after 1 hour in cells infected with M90T. No significant increase in ATPase activity could be detected. A sharp increase in pyruvate production starting immediately after infection indicated impairement in mitochondrial respiration, which accounts for most ATP produced intracellularly. In addition, fermentation appeared to be totally blocked thus leaving no chance of the infected cells regenerating NAD. Concurrent increase in cAMP concentration within the first hour of infection may contribute to the rapid and efficient cell killing. Cells infected by BS176 always showed an intermediate phenotype (i.e. ATP depletion, pyruvate increase, lactate decrease). Early lysis of the phagocytic vacuole by M90T may account for this difference by allowing toxic products of the bacteria to diffuse more efficiently within the cytosol. PMID:2848171

  14. Astrochronology of the Valanginian Stage (Early Cretaceous) : implications for the origin of the Weissert Event

    NASA Astrophysics Data System (ADS)

    Martinez, Mathieu; Deconinck, Jean-François; Pellenard, Pierre; Reboulet, Stéphane; Riquier, Laurent

    2013-04-01

    Due to the scarcity of available radioisotopic ages in the Lower Cretaceous, the Geologic Time Scale presents uncertainties that impact palaeoceanographic and palaeoclimatic reconstructions. Particularly, the chronological relationship between the Mid-Valanginian carbon-isotope excursion (namely the 'Weissert Event') and the activity of the Paraná-Etendeka Large Igneous Province is debated. To better constrain this relationship, an astrochronology of the Valanginian Stage is proposed based on high-resolution gamma-ray spectrometry measurements performed on five biostratigraphically well-constrained sections throughout the Vocontian Basin (SE France). The Valanginian sediments of the Vocontian Basin are composed of decimetric hemipelagic marl-limestone alternations. These lithologic cycles are attributed to orbital forcing because marls and limestones display significant differences within clay mineralogy, geochemistry and faunal assemblages and these marl-limestone alternations are correlated throughout the Western Tethys and the Atlantic Ocean. Among the analyzed sections, Vergol (GSSP candidate for the Berriasian-Valanginian boundary), La Charce (GSSP candidate for the Valanginian-Hauterivian boundary) and Angles (Valanginian Hypostratotype) are standard sections for the Valanginian Stage since all ammonite zones and subzones are precisely identified and bounded. Spectral analyses were performed using the multi-taper method and amplitude spectrograms on the gamma-ray signals. The comparison between sedimentary frequency ratios derived from the spectral analyses and orbital frequency ratios calculated from astronomical solutions allows the identification of a pervasive dominance of the precession and the 405 kyr-eccentricity cycles throughout the Valanginian Stage. A duration of 5.1 myr is proposed for the Valanginian Stage on the base of the recognition of the 405 kyr-eccentricity cycles. This duration is in agreement with the orbital calibration proposed from

  15. Early Oligocene geomagnetic field behavior from ODP Site 1128: Complex records of short-period polarity events

    NASA Astrophysics Data System (ADS)

    Molina-Garza, R. S.; Fuller, M. D.

    2001-12-01

    At Site 1128, in the Great Australian Bight, Leg 182 of the Ocean Drilling Program recovered a thick (~350 m) section of Upper Eocene and Lower Oligocene marine calcareous clays. Shipboard measurements established a magnetostratigraphy that can unambiguously be correlated to chrons C13n to C10n of the global polarity time scale (GPTS), and a less complete record of chrons C17n to C15r (due to poor core recovery). Correlation to the GPTS is further supported by available biostratigraphic data. For the Lower Oligocene sequence, average sedimentation rate is estimated at ~4 cm/kyr. The sediments recovered thus allow to test for the completeness and reliability of the geomagnetic field polarity during the Early Oligocene. The original shipboard long-core measurements suggested the presence of additional short polarity events or geomagnetic field excursions during chrons C13n, C12r, C11r, and C11n. In order to examine the reliability of the record and the nature of possible short-polarity events, we obtained discrete samples from the entire sequence at ~1 m intervals, with a closer sample spacing in critical intervals (~10 cm). The natural remanence of these sediments is normally simple. After removing a small soft overprint, the magnetization decays towards the origin with distributed coercivities and distributed unblocking temperatures. Demagnetization behavior and other rock magnetic data indicate that the remanence resides primarily in a cubic phase such as magnetite or maghemite, with a small contribution from hematite. Discrete samples from chron C12r did not reproduce the long-core record for two of the supposed events, single samples suggest the presence of short events or cryptochrons near the base of both C13n and C12r, and multiple samples suggest the existence of short-period normal polarity events during C11r and near the top of C12r. The records of these events are, however, complex. Demagnetization results indicate that the magnetization consists of an

  16. Early age-related changes in episodic memory retrieval as revealed by event-related potentials.

    PubMed

    Guillaume, Cécile; Clochon, Patrice; Denise, Pierre; Rauchs, Géraldine; Guillery-Girard, Bérengère; Eustache, Francis; Desgranges, Béatrice

    2009-01-28

    Familiarity is better preserved than recollection in ageing. The age at which changes first occur and the slope of the subsequent decline, however, remain unclear. In this study, we investigated changes in episodic memory, by using event-related potentials (ERPs) in young (m=24), middle-aged (m=58) and older (m=70) adults. Although behavioural performance did not change before the age of 65 years, changes in ERP correlates were already present in the middle-aged adults. The ERP correlates of recollection and monitoring processes were the first to be affected by ageing, with a linear decrease as age increased. Conversely, the ERP correlate of familiarity remained unchanged, at least up to the age of 65 years. These results suggest a differential time course for the age effects on episodic retrieval. PMID:19104457

  17. Phosphoproteomic Analyses Reveal Early Signaling Events in the Osmotic Stress Response1[W][OPEN

    PubMed Central

    E. Stecker, Kelly; Minkoff, Benjamin B.; Sussman, Michael R.

    2014-01-01

    Elucidating how plants sense and respond to water loss is important for identifying genetic and chemical interventions that may help sustain crop yields in water-limiting environments. Currently, the molecular mechanisms involved in the initial perception and response to dehydration are not well understood. Modern mass spectrometric methods for quantifying changes in the phosphoproteome provide an opportunity to identify key phosphorylation events involved in this process. Here, we have used both untargeted and targeted isotope-assisted mass spectrometric methods of phosphopeptide quantitation to characterize proteins in Arabidopsis (Arabidopsis thaliana) whose degree of phosphorylation is rapidly altered by hyperosmotic treatment. Thus, protein phosphorylation events responsive to 5 min of 0.3 m mannitol treatment were first identified using 15N metabolic labeling and untargeted mass spectrometry with a high-resolution ion-trap instrument. The results from these discovery experiments were then validated using targeted Selected Reaction Monitoring mass spectrometry with a triple quadrupole. Targeted Selected Reaction Monitoring experiments were conducted with plants treated under nine different environmental perturbations to determine whether the phosphorylation changes were specific for osmosignaling or involved cross talk with other signaling pathways. The results indicate that regulatory proteins such as members of the mitogen-activated protein kinase family are specifically phosphorylated in response to osmotic stress. Proteins involved in 5′ messenger RNA decapping and phosphatidylinositol 3,5-bisphosphate synthesis were also identified as targets of dehydration-induced phosphoregulation. The results of these experiments demonstrate the utility of targeted phosphoproteomic analysis in understanding protein regulation networks and provide new insight into cellular processes involved in the osmotic stress response. PMID:24808101

  18. Risk of Cerebrovascular Events in Elderly Patients After Radiation Therapy Versus Surgery for Early-Stage Glottic Cancer

    SciTech Connect

    Hong, Julian C.; Kruser, Tim J.; Gondi, Vinai; Mohindra, Pranshu; Cannon, Donald M.; Harari, Paul M.; Bentzen, Søren M.

    2013-10-01

    Purpose: Comprehensive neck radiation therapy (RT) has been shown to increase cerebrovascular disease (CVD) risk in advanced-stage head-and-neck cancer. We assessed whether more limited neck RT used for early-stage (T1-T2 N0) glottic cancer is associated with increased CVD risk, using the Surveillance, Epidemiology, and End Results (SEER)-Medicare linked database. Methods and Materials: We identified patients ≥66 years of age with early-stage glottic laryngeal cancer from SEER diagnosed from 1992 to 2007. Patients treated with combined surgery and RT were excluded. Medicare CPT codes for carotid interventions, Medicare ICD-9 codes for cerebrovascular events, and SEER data for stroke as the cause of death were collected. Similarly, Medicare CPT and ICD-9 codes for peripheral vascular disease (PVD) were assessed to serve as an internal control between treatment groups. Results: A total of 1413 assessable patients (RT, n=1055; surgery, n=358) were analyzed. The actuarial 10-year risk of CVD was 56.5% (95% confidence interval 51.5%-61.5%) for the RT cohort versus 48.7% (41.1%-56.3%) in the surgery cohort (P=.27). The actuarial 10-year risk of PVD did not differ between the RT (52.7% [48.1%-57.3%]) and surgery cohorts (52.6% [45.2%-60.0%]) (P=.89). Univariate analysis showed an increased association of CVD with more recent diagnosis (P=.001) and increasing age (P=.001). On multivariate Cox analysis, increasing age (P<.001) and recent diagnosis (P=.002) remained significantly associated with a higher CVD risk, whereas the association of RT and CVD remained not statistically significant (HR=1.11 [0.91-1.37,] P=.31). Conclusions: Elderly patients with early-stage laryngeal cancer have a high burden of cerebrovascular events after surgical management or RT. RT and surgery are associated with comparable risk for subsequent CVD development after treatment in elderly patients.

  19. Hyaluronan-based pericellular matrix: substrate electrostatic charges and early cell adhesion events.

    PubMed

    Fotia, Caterina; Messina, Grazia M L; Marletta, Giovanni; Baldini, Nicola; Ciapetti, Gabriela

    2013-01-01

    Cells are surrounded by a hyaluronan-rich coat called 'pericellular matrix' (PCM), mainly constituted by hyaluronan, a long-chain linear polysaccharide which is secreted and resorbed by the cell, depending on its activity. Cell attachment to a surface is mediated by PCM before integrins and focal adhesions are involved. As hyaluronan is known to bear a negative charge at physiological pH, the relevance of its electrical properties in driving the early cell adhesion steps has been studied, exploring how PCM mediates cell adhesion to charged surfaces, such as polyelectrolyte multilayer (PEM) films. Poly(ethylene imine) (PEI) and poly(sodium 4-styrene sulphonate) (PSS), assembled as PEI/PSS and PEI/PSS/PEI layers, were used. The nanoscale morphology of such layers was analysed by atomic force microscopy, and the detailed surface structure was analysed by X-ray photoemission spectroscopy. PCM-coated and PCM-depleted MG63 osteoblast-like cells were used, and cell density, morphology and adhesive structures were analysed during early steps of cell attachment to the PEM surfaces (1-6 h). The present study demonstrates that the pericellular matrix is involved in cell adhesion to material surfaces, and its arrangement depends on the cell interaction with the surface. Moreover, the PCM/surface interaction is not simply driven by electrostatic effects, as the cell response may be affected by specific chemical groups at the material surface. In the development of biomimetic surfaces promoting cell adhesion and function, the role of this unrecognised outer cell structure has to be taken into account. PMID:24052426

  20. Deletion at Fragile Sites is a Common and Early Event in Barrett’s Esophagus

    PubMed Central

    Lai, Lisa A.; Kostadinov, Rumen; Barrett, Michael T.; Peiffer, Daniel A.; Pokholok, Dimitry; Odze, Robert; Sanchez, Carissa A.; Maley, Carlo C.; Reid, Brian J.; Gunderson, Kevin L.; Rabinovitch, Peter S.

    2011-01-01

    Barrett’s esophagus is a premalignant intermediate to esophageal adenocarcinoma, which develops in the context of chronic inflammation and exposure to bile and acid. We asked whether there might be common genomic alterations that could be identified as potential clinical biomarker(s) for Barrett’s esophagus by whole genome profiling. We detected copy number alterations and/or loss of heterozygosity (LOH) at fifty-six fragile sites in 20 patients with premalignant Barrett’s esophagus (BE). Chromosomal fragile sites are particularly sensitive to DNA breaks and have been shown to be frequent sites of rearrangement or loss in many human cancers. 78% of all genomic alterations detected by array-CGH were associated with fragile sites. Copy number losses in early BE were observed at particularly high frequency at FRA3B (81%), FRA9A/C (71.4%), FRA5E (52.4%) and FRA 4D (52.4%), and at lower frequencies in other fragile sites, including FRA1K (42.9%), FRAXC (42.9%), FRA 12B (33.3%) and FRA16D (33.3%). Due to the consistency of the region of copy number loss, we were able to verify these results by quantitative PCR which detected loss of FRA3B and FRA16D, in 83% and 40% of early molecular stage BE patients respectively. LOH in these cases was confirmed via pyrosequencing at FRA3B and FRA16D (75% and 70% respectively). Deletion and genomic instability at FRA3B and other fragile sites could thus be a biomarker of genetic damage in BE patients and a potential biomarker of cancer risk. PMID:20647332

  1. Deletion at fragile sites is a common and early event in Barrett's esophagus.

    PubMed

    Lai, Lisa A; Kostadinov, Rumen; Barrett, Michael T; Peiffer, Daniel A; Pokholok, Dimitry; Odze, Robert; Sanchez, Carissa A; Maley, Carlo C; Reid, Brian J; Gunderson, Kevin L; Rabinovitch, Peter S

    2010-08-01

    Barrett's esophagus (BE) is a premalignant intermediate to esophageal adenocarcinoma, which develops in the context of chronic inflammation and exposure to bile and acid. We asked whether there might be common genomic alterations that could be identified as potential clinical biomarker(s) for BE by whole genome profiling. We detected copy number alterations and/or loss of heterozygosity at 56 fragile sites in 20 patients with premalignant BE. Chromosomal fragile sites are particularly sensitive to DNA breaks and are frequent sites of rearrangement or loss in many human cancers. Seventy-eight percent of all genomic alterations detected by array-CGH were associated with fragile sites. Copy number losses in early BE were observed at particularly high frequency at FRA3B (81%), FRA9A/C (71.4%), FRA5E (52.4%), and FRA 4D (52.4%), and at lower frequencies in other fragile sites, including FRA1K (42.9%), FRAXC (42.9%), FRA 12B (33.3%), and FRA16D (33.3%). Due to the consistency of the region of copy number loss, we were able to verify these results by quantitative PCR, which detected the loss of FRA3B and FRA16D, in 83% and 40% of early molecular stage BE patients, respectively. Loss of heterozygosity in these cases was confirmed through pyrosequencing at FRA3B and FRA16D (75% and 70%, respectively). Deletion and genomic instability at FRA3B and other fragile sites could thus be a biomarker of genetic damage in BE patients and a potential biomarker of cancer risk. PMID:20647332

  2. MSH6 and MUTYH Deficiency Is a Frequent Event in Early-Onset Colorectal Cancer

    PubMed Central

    Giráldez, María Dolores; Balaguer, Francesc; Bujanda, Luis; Cuatrecasas, Miriam; Muñoz, Jenifer; Alonso-Espinaco, Virginia; Larzabal, Mikel; Petit, Anna; Gonzalo, Victoria; Ocaña, Teresa; Moreira, Leticia; Enríquez-Navascués, José María; Boland, C. Richard; Goel, Ajay; Castells, Antoni; Castellví-Bel, Sergi

    2011-01-01

    Purpose Early-onset colorectal cancer (CRC) is suggestive of a hereditary predisposition. Lynch syndrome is the most frequent CRC hereditary cause. The MUTYH gene has also been related to hereditary CRC. A systematic characterization of these two diseases has not been reported previously in this population. Experimental Design We studied a retrospectively collected series of 140 patients ≤50 years old diagnosed with nonpolyposis CRC. Demographic, clinical, and familial features were obtained. Mismatch repair (MMR) deficiency was determined by microsatellite instability (MSI) analysis, and immunostaining for MLH1, MSH2, MSH6, and PMS2 proteins. Germline MMR mutations were evaluated in all MMR-deficient cases. Tumor samples with loss of MLH1 or MSH2 protein expression were analyzed for somatic methylation. Germline MUTYH mutations were evaluated in all cases. BRAF V600E and KRAS somatic mutational status was also determined. Results Fifteen tumors (11.4%) were MSI, and 20 (14.3%) showed loss of protein expression (7 for MLH1/PMS2, 2 for isolated MLH1, 3 for MSH2/MSH6, 7 for isolated MSH6, and 1 for MSH6/PMS2). We identified 11 (7.8%) germline MMR mutations, 4 in MLH1, 1 in MSH2, and 6 in MSH6. Methylation analysis revealed one case with somatic MLH1 methylation. Biallelic MUTYH mutations were detected in four (2.8%) cases. KRAS and BRAF V600E mutations were present in 39 (27.9%) and 5 (3.6%) cases, respectively. Conclusions Loss of MSH6 expression is the predominant cause of MMR deficiency in early-onset CRC. Our findings prompt the inclusion of MSH6 and MUTYH screening as part of the genetic counseling of these patients and their relatives. PMID:20924129

  3. Senescent Fibroblasts Enhance Early Skin Carcinogenic Events via a Paracrine MMP-PAR-1 Axis

    PubMed Central

    Malaquin, Nicolas; Vercamer, Chantal; Bouali, Fatima; Martien, Sébastien; Deruy, Emeric; Wernert, Nicolas; Chwastyniak, Maggy; Pinet, Florence; Abbadie, Corinne; Pourtier, Albin

    2013-01-01

    The incidence of carcinoma increases greatly with aging, but the cellular and molecular mechanisms underlying this correlation are only partly known. It is established that senescent fibroblasts promote the malignant progression of already-transformed cells through secretion of inflammatory mediators. We investigated here whether the senescent fibroblast secretome might have an impact on the very first stages of carcinogenesis. We chose the cultured normal primary human epidermal keratinocyte model, because after these cells reach the senescence plateau, cells with transformed and tumorigenic properties systematically and spontaneously emerge from the plateau. In the presence of medium conditioned by autologous senescent dermal fibroblasts, a higher frequency of post-senescence emergence was observed and the post-senescence emergent cells showed enhanced migratory properties and a more marked epithelial-mesenchymal transition. Using pharmacological inhibitors, siRNAs, and blocking antibodies, we demonstrated that the MMP-1 and MMP-2 matrix metalloproteinases, known to participate in late stages of cancer invasion and metastasis, are responsible for this enhancement of early migratory capacity. We present evidence that MMPs act by activating the protease-activated receptor 1 (PAR-1), whose expression is specifically increased in post-senescence emergent keratinocytes. The physiopathological relevance of these results was tested by analyzing MMP activity and PAR-1 expression in skin sections. Both were higher in skin sections from aged subjects than in ones from young subjects. Altogether, our results suggest that during aging, the dermal and epidermal skin compartments might be activated coordinately for initiation of skin carcinoma, via a paracrine axis in which MMPs secreted by senescent fibroblasts promote very early epithelial-mesenchymal transition of keratinocytes undergoing transformation and oversynthesizing the MMP-activatable receptor PAR-1. PMID:23675494

  4. Event-related brain potentials reveal the time-course of language change detection in early bilinguals.

    PubMed

    Kuipers, Jan-Rouke; Thierry, Guillaume

    2010-05-01

    Using event-related brain potentials, we investigated the temporal course of language change detection in proficient bilinguals as compared to matched controls. Welsh-English bilingual participants and English controls were presented with a variant of the oddball paradigm involving picture-word pairs. The language of the spoken word was manipulated such that English was the frequent stimulus (75%) and Welsh the infrequent stimulus (25%). We also manipulated semantic relatedness between pictures and words, such that only half of the pictures were followed by a word that corresponded with the identity of the picture. The P2 wave was significantly modulated by language in the bilingual group only, suggesting that this group detected a language change as early as 200 ms after word onset. Monolinguals also reliably detected the language change, but at a later stage of semantic integration (N400 range), since Welsh words were perceived as meaningless. The early detection of a language change in bilinguals triggered stimulus re-evaluation mechanisms reflected by a significant P600 modulation by Welsh words. Furthermore, compared to English unrelated words, English words matching the picture identity elicited significantly greater P2 amplitudes in the bilingual group only, suggesting that proficient bilinguals validate an incoming word against their expectation based on the context. Overall, highly proficient bilinguals appear to detect language changes very early on during speech perception and to consciously monitor language changes when they occur. PMID:20117220

  5. BMP pathway suppression is an early event in inflammation-driven colon neoplasmatogenesis of uPA-deficient mice.

    PubMed

    Karagiannis, George S; Afaloniati, Hara; Karamanavi, Elisavet; Poutahidis, Theofilos; Angelopoulou, Katerina

    2016-02-01

    The suppression of the bone morphogenetic protein (BMP) signaling pathway has been recently shown to promote adenoma-to-carcinoma transition in sporadic colon cancer. However, its role in the evolution of early preneoplastic changes to neoplasia remains elusive. In the present study, we aimed to investigate the gene expression levels of multiple extracellular BMP family constituents, including BMP ligands/receptors and inhibitors, during the early stages of inflammation-associated colon carcinogenesis. For that, we used the recently developed urokinase-type plasminogen activator (uPA)-deficient mouse model of colonic polypoidogenesis, in which adenomatous polyps arise several months after the induction of dextran sodium sulfate (DSS) colitis. In DSS-treated wild-type mice, the preneoplastic lesions which did not eventually evolve to adenomas resided in a colitic microenvironment characterized by a balanced upregulation of both BMP ligands, i.e., Bmp4/7 and BMP inhibitors, such as chordin, noggin, and gremlin-1. In the uPA-deficient tumor-promoting inflammatory microenvironment, however, there was a clear evidence for BMP pathway suppression. By contrast to DSS-treated wild-type controls, the inflammation-associated Bmp4 upregulation was abolished, and the BMP signaling suppression was further enhanced by a particularly high increase of gremlin-1 expression. These findings propose that BMP pathway suppression in colon cancer could be associated with very early stages of the preneoplasia-to-neoplasia sequence of events. PMID:26358253

  6. Perturbation of bile acid homeostasis is an early pathogenesis event of drug induced liver injury in rats.

    PubMed

    Yamazaki, Makoto; Miyake, Manami; Sato, Hiroko; Masutomi, Naoya; Tsutsui, Naohisa; Adam, Klaus-Peter; Alexander, Danny C; Lawton, Kay A; Milburn, Michael V; Ryals, John A; Wulff, Jacob E; Guo, Lining

    2013-04-01

    Drug-induced liver injury (DILI) is a significant consideration for drug development. Current preclinical DILI assessment relying on histopathology and clinical chemistry has limitations in sensitivity and discordance with human. To gain insights on DILI pathogenesis and identify potential biomarkers for improved DILI detection, we performed untargeted metabolomic analyses on rats treated with thirteen known hepatotoxins causing various types of DILI: necrosis (acetaminophen, bendazac, cyclosporine A, carbon tetrachloride, ethionine), cholestasis (methapyrilene and naphthylisothiocyanate), steatosis (tetracycline and ticlopidine), and idiosyncratic (carbamazepine, chlorzoxasone, flutamide, and nimesulide) at two doses and two time points. Statistical analysis and pathway mapping of the nearly 1900 metabolites profiled in the plasma, urine, and liver revealed diverse time and dose dependent metabolic cascades leading to DILI by the hepatotoxins. The most consistent change induced by the hepatotoxins, detectable even at the early time point/low dose, was the significant elevations of a panel of bile acids in the plasma and urine, suggesting that DILI impaired hepatic bile acid uptake from the circulation. Furthermore, bile acid amidation in the hepatocytes was altered depending on the severity of the hepatotoxin-induced oxidative stress. The alteration of the bile acids was most evident by the necrosis and cholestasis hepatotoxins, with more subtle effects by the steatosis and idiosyncratic hepatotoxins. Taking together, our data suggest that the perturbation of bile acid homeostasis is an early event of DILI. Upon further validation, selected bile acids in the circulation could be potentially used as sensitive and early DILI preclinical biomarkers. PMID:23360887

  7. Riding the Wave to Reach the Masses: Natural Events in Early Twentieth Century Portuguese Daily Press

    NASA Astrophysics Data System (ADS)

    Simões, Ana; Carneiro, Ana; Diogo, Maria Paula

    2012-03-01

    This paper brings together science communicated in newspapers in Portugal by looking at how news on natural events were communicated in two different newspapers—the capital newspaper Diário de Notícias ( Daily News) and the Diário dos Açores ( Azores Daily). In particular, we look at how the 1900 solar eclipse, a hot topic throughout Europe, was reported by the capital newspaper, and how news on seismology were conveyed in the period 1907-1910 in the newspaper published in Azores, an archipelago with a significant seismic and volcanic activity. We argue that the importance conceded to these scientific news was related to their overwhelming features, that their dissimilar presentation stemmed from their local relevance allied to their different nature, predictable in the case of eclipses, and unpredictable in the case of earthquakes, and that behind these two instances of science journalism laid an attempt by the scientific and political communities to gain the support of the general public to such an extent that these two specific instances of science journalism transcended their usual features to become successful forms of expository science.

  8. FOXO3a loss is a frequent early event in high-grade pelvic serous carcinogenesis.

    PubMed

    Levanon, K; Sapoznik, S; Bahar-Shany, K; Brand, H; Shapira-Frommer, R; Korach, J; Hirsch, M S; Roh, M H; Miron, A; Liu, J F; Vena, N; Ligon, A H; Fotheringham, S; Bailey, D; Flavin, R J; Birrer, M J; Drapkin, R I

    2014-08-28

    Serous ovarian carcinoma is the most lethal gynecological malignancy in Western countries. The molecular events that underlie the development of the disease have been elusive for many years. The recent identification of the fallopian tube secretory epithelial cells (FTSECs) as the cell-of-origin for most cases of this disease has led to studies aimed at elucidating new candidate therapeutic pathways through profiling of normal FTSECs and serous carcinomas. Here we describe the results of transcriptional profiles that identify the loss of the tumor suppressive transcription factor FOXO3a in a vast majority of high-grade serous ovarian carcinomas. We show that FOXO3a loss is a hallmark of the earliest stages of serous carcinogenesis and occurs both at the DNA, RNA and protein levels. We describe several mechanisms responsible for FOXO3a inactivity, including chromosomal deletion (chromosome 6q21), upregulation of miRNA-182 and destabilization by activated PI3K and MEK. The identification of pathways involved in the pathogenesis of ovarian cancer can advance the management of this disease from being dependant on surgery and cytotoxic chemotherapy alone to the era of targeted therapy. Our data strongly suggest FOXO3a as a possible target for clinical intervention. PMID:24077281

  9. Salt stress sensing and early signalling events in plant roots: Current knowledge and hypothesis.

    PubMed

    Shabala, Sergey; Wu, Honghong; Bose, Jayakumar

    2015-12-01

    Soil salinity is a major environmental constraint to crop production. While the molecular identity and functional expression of Na(+) transport systems mediating Na(+) exclusion from the cytosol has been studied in detail, far less is known about the mechanisms by which plants sense high Na(+) levels in the soil and the rapid signalling events that optimise plant performance under saline conditions. This review aims to fill this gap. We first discuss the nature of putative salt stress sensors, candidates which include Na(+) transport systems, mechanosensory proteins, proteins with regulatory Na(+) binding sites, sensing mediated by cyclic nucleotide-gated channels, purine receptors, annexin and voltage gating. We suggest that several transport proteins may be clustered together to form a microdomain in a lipid raft, allowing rapid changes in the activity of an individual protein to be translated into stress-induced Ca(2+) and H2O2 signatures. The pathways of stress signalling to downstream targets are discussed, and the kinetics and specificity of salt stress signalling between glycophytes and halophytes is compared. We argue that these sensing mechanisms operate in parallel, providing plants with a robust system for decoding information about the specific nature and severity of the imposed salt stress. PMID:26706063

  10. Early membrane rupture events during neutrophil-mediated antibody-dependent tumor cell cytolysis.

    PubMed

    Kindzelskii, A L; Petty, H R

    1999-03-15

    Although cell-mediated cytolysis is a fundamental immune effector response, its mechanism remains poorly understood at the cellular level. In this report, we image for the first time transient ruptures, as inferred by cytoplasmic marker release, in tumor cell membranes during Ab-dependent cellular cytolysis. The cytosol of IgG-opsonized YAC tumor cells was labeled with tetra-methylrhodamine diacetate followed by the formation of tumor cell-neutrophil conjugates. We hypothesized that tumor cell cytolysis proceeds via a series of discrete membrane rupture/resealing events that contribute to marker release. To test this hypothesis, we occluded the fluorescence image of the labeled tumor cells by passing an opaque disk into a field-conjugated plane between the light source and the sample. Multiple small bursts of fluorescent label release from tumor cells could be detected using a photomultiplier tube. Similarly, multiple fluorescent plumes were observed at various sites around the perimeter of a target. These findings support a multihit model of target cytolysis and suggest that cytolytic release is not focused at specific sites. Cytolytic bursts were generally observed at 20-s intervals, which match the previously described reduced nicotinamide-adenine dinucleotide phosphate and superoxide release oscillation periods for neutrophils; we speculate that metabolic oscillations of the effector cell drive the membrane damage of the target. PMID:10092769

  11. A Threshold-Based Earthquake Early-Warning System for Offshore Events in Southern Iberia

    NASA Astrophysics Data System (ADS)

    Picozzi, M.; Colombelli, S.; Zollo, A.; Carranza, M.; Buforn, E.

    2015-09-01

    The south of the Iberian Peninsula is situated at the convergence of the Eurasian and African plates. This region experiences large earthquakes with long separation in time, the best known of which was the great 1755 Lisbon Earthquake, which occurred SW of San Vicente Cape (SW Iberian Peninsula). The high risk of damaging earthquakes has recently led Carranza et al. (Geophys. Res. Lett. 40, 2013) to investigate the feasibility of an EEWS in this region. Analysis of the geometry for the Iberian seismic networks and the San Vicente Cape area led the authors to conclude that a threshold-based approach, which would not require real-time location of the earthquake, might be the best option for an EEWS in SW Iberia. In this work we investigate this hypothesis and propose a new EEW approach that extends standard P-wave threshold-based single-station analysis to the whole network. The proposed method enables real-time estimation of the potential damage at stations that are triggered by P-waves and those which are not triggered, with the advantage of greater lead-times for release of alerts. Results of tests made with synthetic data mimicking the scenario of the great 1755 Lisbon Earthquake, and those conducted by applying the new approach to available recordings, indicate that an EEW estimation of the potential damage associated with an event in the San Vicente Cape area can be obtained for a very large part of the Iberian Peninsula.

  12. Early events responsible for aluminum toxicity symptoms in suspension-cultured tobacco cells.

    PubMed

    Sivaguru, Mayandi; Yamamoto, Yoko; Rengel, Zdenko; Ahn, Sung Ju; Matsumoto, Hideaki

    2005-01-01

    We investigated the aluminum (Al)-induced alterations in zeta potential, plasma membrane (PM) potential and intracellular calcium levels to elucidate their interaction with callose production induced by Al toxicity. A noninvasive confocal laser microscopy has been used to analyse the live tobacco (Nicotiana tabacum) cell events by means of fluorescent probes Fluo-3 acetoxymethyl ester (intracellular calcium) and DiBAC4 (PM potential) as well as to monitor callose accumulation. Log-phase cells showed no detectable changes in the PM potential during the first 30 min of Al treatment, but sustained large depolarization from 60 min onwards. Measurement of zeta potential confirmed the depolarization effect of Al, but the kinetics were different. The Al-treated cells showed a moderate increase in intracellular Ca2+ levels and callose production in 1 h, which coincided with the time course of PM depolarization. Compared with the Al treatment, cyclopiazonic acid, an inhibitor of endoplasmic reticulum Ca(2+)-ATPase, facilitated a higher increase in intracellular Ca2+ levels, but resulted in accumulation of only moderate levels of callose. Calcium channel modulators and Al induced similar levels of callose in the initial 1 h of treatment. Callose production induced by Al toxicity is dependent on both depolarization of the PM and an increase in intracellular Ca2+ levels. PMID:15720625

  13. Probing the early events associated with liquid ammonia pretreatment of native crystalline cellulose.

    PubMed

    Bellesia, Giovanni; Chundawat, Shishir P S; Langan, Paul; Dale, Bruce E; Gnanakaran, S

    2011-08-18

    Various chemicals are being explored for catalyzing efficient lignocellulose deconstruction. In particular, when liquid ammonia is used to convert the naturally occurring cellulose crystalline phase I(β), to cellulose III(I), the rearrangement of the hydrogen bond network in cellulose III(I) results in enhanced hydrolysis yields. We use molecular dynamics simulations to analyze the interaction between a cellulose I(β) fibril and ammonia. Our simulations reveal that early structural changes in the fibril are driven by the rapid formation of an extended hydrogen bond network between the solvent-exposed surface chains and ammonia that precedes ammonia penetration into the fibril. The emergence of this hydrogen bond network causes relative shifting of the cellulose layers within the fibril that in turn leads to the formation of channels orthogonal to the (100) and (-100) fibril surfaces. The channels allow ammonia molecules to penetrate into the cellulose fibril. These findings provide avenues for improving existing chemical pretreatments to make them more effective and economical. PMID:21728311

  14. Early effects of neighborhood density and phonotactic probability of spoken words on event-related potentials.

    PubMed

    Hunter, Cynthia R

    2013-12-01

    All current models of spoken word recognition propose that sound-based representations of spoken words compete with, or inhibit, one another during recognition. In addition, certain models propose that higher probability sublexical units facilitate recognition under certain circumstances. Two experiments were conducted examining ERPs to spoken words and nonwords simultaneously varying in phonotactic probability and neighborhood density. Results showed that the amplitude of the P2 potential was greater for high probability-density words and nonwords, suggesting an early inhibitory effect of neighborhood density. In order to closely examine the role of phonotactic probability, effects of initial phoneme frequency were also examined. The latency of the P2 potential was shorter for words with high initial-consonant probability, suggesting a facilitative effect of phonotactic probability. The current results are consistent with findings from previous studies using reaction time and eye-tracking paradigms and provide new insights into the time-course of lexical and sublexical activation and competition. PMID:24129200

  15. Joint Effect of Early Microvascular Damage in the Eye & Kidney on Risk of Cardiovascular Events

    PubMed Central

    Yip, Wanfen; Sabanayagam, Charumathi; Ong, Peng Guan; Patel, Uptal D; Chow, Khuan Yew; Tai, E Shyong; Ling, Lieng H; Wong, Tien Yin; Cheung, Carol Yim-lui

    2016-01-01

    Microalbuminuria is associated with an increased risk of cardiovascular disease (CVD), but not all individuals require treatment. Retinal microvascular abnormalities and microalbuminuria reflect early systemic microvascular changes. We examined the joint effect of retinal abnormalities and microalbuminuria on CVD risk in an Asian cohort. We conducted a prospective, population-based study. Retinal abnormalities were defined as presence of retinopathy and/or retinal venular widening. Microalbuminuria was defined as urinary albumin: creatinine ratio between 30–300 mg/g. Incident CVD was defined as newly diagnosed clinical stroke, acute myocardial infarction or CVD death. Cox regression models were performed to determine the associations between retinal abnormalities and microalbuminuria with risk of CVD, while controlling for established risk factors. 3,496 participants (aged ≥ 40) were free of prevalent CVD. During the follow-up (5.8 years), 126 (3.60%) participants developed CVD. Persons presenting with both retinal abnormalities and microalbuminuria were 6.71 times (95% CI, 2.68, 16.79) as likely to have incident CVD compared with those without either abnormalities. There was a significant interaction effect between retinal abnormalities and microalbuminuria on incident CVD. Assessment of retinal abnormalities in patients with microalbuminuria may provide additional value in identifying persons at risk of developing CVD. PMID:27273133

  16. A comparative study of diversification events: the early Paleozoic versus the Mesozoic

    NASA Technical Reports Server (NTRS)

    Erwin, D. H.; Valentine, J. W.; Sepkoski, J. J. Jr; Sepkoski JJ, J. r. (Principal Investigator)

    1987-01-01

    We compare two major long-term diversifications of marine animal families that began during periods of low diversity but produced strikingly different numbers of phyla, classes, and orders. The first is the early-Paleozoic diversification (late Vendian-Ordovician; 182 MY duration) and the other the Mesozoic phase of the post-Paleozoic diversification (183 MY duration). The earlier diversification was associated with a great burst of morphological invention producing many phyla, classes, and orders and displaying high per taxon rates of family origination. The later diversification lacked novel morphologies recognized as phyla and classes, produced fewer orders, and displayed lower per taxon rates of family appearances. The chief difference between the diversifications appears to be that the earlier one proceeded from relatively narrow portions of adaptive space, whereas the latter proceeded from species widely scattered among adaptive zones and representing a variety of body plans. This difference is believed to explain the major differences in the products of these great radiations. Our data support those models that hold that evolutionary opportunity is a major factor in the outcome of evolutionary processes.

  17. Two novel nodal-related genes initiate early inductive events in Xenopus Nieuwkoop center.

    PubMed

    Takahashi, S; Yokota, C; Takano, K; Tanegashima, K; Onuma, Y; Goto, J; Asashima, M

    2000-12-01

    In vertebrates, Nodal-related protein plays crucial roles in mesoderm and endoderm induction. Here we describe two novel Xenopus nodal-related genes, Xnr5 and Xnr6, which are first zygotically expressed at the mid-blastula transition, in the dorsal-vegetal region including the Nieuwkoop center. Xnr5 and Xnr6 were isolated by expression screening of a library enriched with immediate-early-type transcripts, and are strong inducers of both mesoderm and endoderm. They also induce the other nodal-related genes in the animal cap. In embryos, cerberus-short (nodal-specific inhibitor) can inhibit Xnr1 and Xnr2 express to the same extent goosecoid, but not Xnr5 and Xnr6 transcription. Xnr5 and Xnr6 are regulated completely cell autonomously, differently from other Xnrs in the cell-dissociated embryos. The expression of Xnr5 and Xnr6 is regulated by maternal VegT and (beta)-catenin, but does not require TGF-(beta) signaling. Therefore, expression of Xnr5 and Xnr6 is controlled by different mechanisms from other Xnr family genes. PMID:11076754

  18. Joint Effect of Early Microvascular Damage in the Eye &Kidney on Risk of Cardiovascular Events.

    PubMed

    Yip, Wanfen; Sabanayagam, Charumathi; Ong, Peng Guan; Patel, Uptal D; Chow, Khuan Yew; Tai, E Shyong; Ling, Lieng H; Wong, Tien Yin; Cheung, Carol Yim-Lui

    2016-01-01

    Microalbuminuria is associated with an increased risk of cardiovascular disease (CVD), but not all individuals require treatment. Retinal microvascular abnormalities and microalbuminuria reflect early systemic microvascular changes. We examined the joint effect of retinal abnormalities and microalbuminuria on CVD risk in an Asian cohort. We conducted a prospective, population-based study. Retinal abnormalities were defined as presence of retinopathy and/or retinal venular widening. Microalbuminuria was defined as urinary albumin: creatinine ratio between 30-300 mg/g. Incident CVD was defined as newly diagnosed clinical stroke, acute myocardial infarction or CVD death. Cox regression models were performed to determine the associations between retinal abnormalities and microalbuminuria with risk of CVD, while controlling for established risk factors. 3,496 participants (aged ≥ 40) were free of prevalent CVD. During the follow-up (5.8 years), 126 (3.60%) participants developed CVD. Persons presenting with both retinal abnormalities and microalbuminuria were 6.71 times (95% CI, 2.68, 16.79) as likely to have incident CVD compared with those without either abnormalities. There was a significant interaction effect between retinal abnormalities and microalbuminuria on incident CVD. Assessment of retinal abnormalities in patients with microalbuminuria may provide additional value in identifying persons at risk of developing CVD. PMID:27273133

  19. Paleoceanographic Implications of the Terrestrial Carbon-Isotope Record of the Early Toarcian (Jurassic) Oceanic Anoxic Event

    NASA Astrophysics Data System (ADS)

    Hesselbo, S.; Jenkyns, H. C.; Duarte, L. V.

    2005-12-01

    Macrofossil wood in two European sections representing the Toarcian (Early Jurassic) Oceanic Anoxic Event (OAE) have previously been shown to exhibit a large (~ -6 to -7 %) shift in d13C values which has been interpreted as a massive and geologically short-lived perturbation to the global carbon cycle. This interpretation has recently been challenged on the basis of a compilation of carbon-isotope data from belemnites collected from sections in northern Europe that exhibit carbon isotope values that are heavier than expected at the peak of the OAE. Here we present new carbon isotope measurements from wood collected from a marine record of the early Toarcian at Peniche, Portugal, a section currently under consideration as a GSSP for the base of the Toarcian. A large negative excursion (~ -7%) is confirmed for the OAE in these samples. These cannot have been severely impregnated by hydrocarbons of marine origin and the ages are well defined by ammonite biostratigraphy and by Sr-isotope stratigraphy. Carbon-isotope data is also presented for an early diagenetic silica nodule that formed within jet from the Toarcian of the Yorkshire coast, northeast England; values are indistinguishable from those of stratigraphically equivalent jet samples from which solvent extractable hydrocarbons had been removed. Thus, the early Toarcian negative carbon-isotope excursion is confirmed as a phenomenon of the global shallow-ocean, biosphere and atmosphere. It is likely that the anomalously heavy values obtained from belemnites from the OAE interval derive their isotopic signature from localized and possibly seasonal water masses characterized by dissolved inorganic carbon strongly enriched in heavy carbon by very high organic productivity.

  20. The PRESSCA operational early warning system for landslide forecasting: the 11-12 November 2013 rainfall event in Central Italy.

    NASA Astrophysics Data System (ADS)

    Ciabatta, Luca; Brocca, Luca; Ponziani, Francesco; Berni, Nicola; Stelluti, Marco; Moramarco, Tommaso

    2014-05-01

    The Umbria Region, located in Central Italy, is one of the most landslide risk prone area in Italy, almost yearly affected by landslides events at different spatial scales. For early warning procedures aimed at the assessment of the hydrogeological risk, the rainfall thresholds represent the main tool for the Italian Civil Protection System. As shown in previous studies, soil moisture plays a key-role in landslides triggering. In fact, acting on the pore water pressure, soil moisture influences the rainfall amount needed for activating a landslide. In this work, an operational physically-based early warning system, named PRESSCA, that takes into account soil moisture for the definition of rainfall thresholds is presented. Specifically, the soil moisture conditions are evaluated in PRESSCA by using a distributed soil water balance model that is recently coupled with near real-time satellite soil moisture product obtained from ASCAT (Advanced SCATterometer) and from in-situ monitoring data. The integration of three different sources of soil moisture information allows to estimate the most accurate possible soil moisture condition. Then, both observed and forecasted rainfall data are compared with the soil moisture-based thresholds in order to obtain risk indicators over a grid of ~ 5 km. These indicators are then used for the daily hydrogeological risk evaluation and management by the Civil Protection regional service, through the sharing/delivering of near real-time landslide risk scenarios (also through an open source web platform: www.cfumbria.it). On the 11th-12th November, 2013, Umbria Region was hit by an exceptional rainfall event with up to 430mm/72hours that resulted in significant economic damages, but fortunately no casualties among the population. In this study, the results during the rainfall event of PRESSCA system are described, by underlining the model capability to reproduce, two days in advance, landslide risk scenarios in good spatial and temporal

  1. Complement inhibition decreases early fibrogenic events in the lung of septic baboons

    PubMed Central

    Silasi-Mansat, Robert; Zhu, Hua; Georgescu, Constantin; Popescu, Narcis; Keshari, Ravi S; Peer, Glenn; Lupu, Cristina; Taylor, Fletcher B; Pereira, Heloise Anne; Kinasewitz, Gary; Lambris, John D; Lupu, Florea

    2015-01-01

    Acute respiratory distress syndrome (ARDS) induced by severe sepsis can trigger persistent inflammation and fibrosis. We have shown that experimental sepsis in baboons recapitulates ARDS progression in humans, including chronic inflammation and long-lasting fibrosis in the lung. Complement activation products may contribute to the fibroproliferative response, suggesting that complement inhibitors are potential therapeutic agents. We have been suggested that treatment of septic baboons with compstatin, a C3 convertase inhibitor protects against ARDS-induced fibroproliferation. Baboons challenged with 109 cfu/kg (LD50) live E. coli by intravenous infusion were treated or not with compstatin at the time of challenge or 5 hrs thereafter. Changes in the fibroproliferative response at 24 hrs post-challenge were analysed at both transcript and protein levels. Gene expression analysis showed that sepsis induced fibrotic responses in the lung as early as 24 hrs post-bacterial challenge. Immunochemical and biochemical analysis revealed enhanced collagen synthesis, induction of profibrotic factors and increased cell recruitment and proliferation. Specific inhibition of complement with compstatin down-regulated sepsis-induced fibrosis genes, including transforming growth factor-beta (TGF-β), connective tissue growth factor (CTGF), tissue inhibitor of metalloproteinase 1 (TIMP1), various collagens and chemokines responsible for fibrocyte recruitment (e.g. chemokine (C-C motif) ligand 2 (CCL2) and 12 (CCL12)). Compstatin decreased the accumulation of myofibroblasts and proliferating cells, reduced the production of fibrosis mediators (TGF-β, phospho-Smad-2 and CTGF) and inhibited collagen deposition. Our data demonstrate that complement inhibition effectively attenuates collagen deposition and fibrotic responses in the lung after severe sepsis. Inhibiting complement could prove an attractive strategy for preventing sepsis-induced fibrosis of the lung. PMID:26337158

  2. High-content analysis of sequential events during the early phase of influenza A virus infection.

    PubMed

    Banerjee, Indranil; Yamauchi, Yohei; Helenius, Ari; Horvath, Peter

    2013-01-01

    Influenza A virus (IAV) represents a worldwide threat to public health by causing severe morbidity and mortality every year. Due to high mutation rate, new strains of IAV emerge frequently. These IAVs are often drug-resistant and require vaccine reformulation. A promising approach to circumvent this problem is to target host cell determinants crucial for IAV infection, but dispensable for the cell. Several RNAi-based screens have identified about one thousand cellular factors that promote IAV infection. However, systematic analyses to determine their specific functions are lacking. To address this issue, we developed quantitative, imaging-based assays to dissect seven consecutive steps in the early phases of IAV infection in tissue culture cells. The entry steps for which we developed the assays were: virus binding to the cell membrane, endocytosis, exposure to low pH in endocytic vacuoles, acid-activated fusion of viral envelope with the vacuolar membrane, nucleocapsid uncoating in the cytosol, nuclear import of viral ribonucleoproteins, and expression of the viral nucleoprotein. We adapted the assays to automated microscopy and optimized them for high-content screening. To quantify the image data, we performed both single and multi-parametric analyses, in combination with machine learning. By time-course experiments, we determined the optimal time points for each assay. Our quality control experiments showed that the assays were sufficiently robust for high-content analysis. The methods we describe in this study provide a powerful high-throughput platform to understand the host cell processes, which can eventually lead to the discovery of novel anti-pathogen strategies. PMID:23874633

  3. Isochromosome 1q as an early genetic event in a child with intracranial ependymoma characterized by molecular cytogenetics.

    PubMed

    Granzow, M; Popp, S; Weber, S; Schoell, B; Holtgreve-Grez, H; Senf, L; Hager, D; Boschert, J; Scheurlen, W; Jauch, A

    2001-10-01

    Data concerning cytogenetic features of childhood ependymoma are rare. In this article, a gain of 1q was identified as the sole alteration in a primary childhood infratentorial ependymoma by comparative genomic hybridization (CGH). A recurrence of this brain tumor was studied using multiplex-fluorescence in situ hybridization (M-FISH) in addition to CGH and G-banding analysis. In accordance with the primary tumor, a gain of 1q corresponding to an isochromosome 1q was observed indicating an early event in the tumor development. Furthermore, M-FISH classified several other rearranged chromosomes including 6q and 17p that have previously been found to be involved in the development and progression of childhood ependymoma. PMID:11672779

  4. Dexamethasone modulates TCR zeta chain expression and antigen receptor-mediated early signaling events in human T lymphocytes.

    PubMed

    Nambiar, M P; Enyedy, E J; Fisher, C U; Warke, V G; Juang, Y T; Tsokos, G C

    2001-02-25

    Dexamethasone is a potent anti-inflammatory and immunosupressive agent that has complex, yet incompletely defined, effects on the immune response. Here, we explored the effect of dexamethasone on the expression of TCR zeta chain and TCR/CD3-induced early signaling events in human T lymphocytes. Immunoblotting studies using TCR zeta chain specific mAb showed a dose-dependent biphasic effect of dexamethasone on TCR zeta chain expression, that is, it was increased when cells were incubated with 10 nM, whereas the expression was decreased when incubated with 100 nM dexamethasone. The dose-dependent biphasic effect of dexamethsone on the TCR zeta chain expression was also revealed by FACS analysis of permeabilized cells. Time course studies showed that upregulation of the TCR zeta chain at 10 nM dexamethasone reached maximum levels at 24 h and remained elevated up to 48 h. Other subunits of the TCR/CD3 complex were minimally affected under these conditions. The increased expression of the TCR zeta chain following treatment with 10 nM dexamethasone correlated with increased anti-CD3 antibody-induced tyrosine phosphorylation of the TCR zeta chain and downstream signaling intermediate ZAP-70 and PLC gamma with faster kinetics. Similarly, the induction of TCR zeta chain expression at 10 nM dexamethasone correlated with increased and more sustained TCR/CD3-mediated [Ca(2+)](i) response. Reporter gene assays using TCR zeta chain promoter-driven luciferase gene constructs in Jurkat cells showed that treatment with 10 nM dexamethasone increased TCR zeta chain promoter activity and that the region between -160 and +58 was responsible for the observed effect. These results suggest that dexamethasone primarily acts at the transcriptional level and differentially modulates TCR zeta chain expression and antigen receptor-mediated early signaling events in human peripheral T lymphocytes. PMID:11277620

  5. Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II

    SciTech Connect

    Sample, Robert; Bryan, Locke; Long, Scott; Majji, Sai; Hoskins, Glenn; Sinning, Allan; Olivier, Jake; Chinchar, V. Gregory . E-mail: vchinchar@microbio.umsmed.edu

    2007-02-20

    Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

  6. Multiple-Threshold Event Detection and Other Enhancements to the Virtual Seismologist (VS) Earthquake Early Warning Algorithm

    NASA Astrophysics Data System (ADS)

    Fischer, M.; Caprio, M.; Cua, G. B.; Heaton, T. H.; Clinton, J. F.; Wiemer, S.

    2009-12-01

    The Virtual Seismologist (VS) algorithm is a Bayesian approach to earthquake early warning (EEW) being implemented by the Swiss Seismological Service at ETH Zurich. The application of Bayes’ theorem in earthquake early warning states that the most probable source estimate at any given time is a combination of contributions from a likelihood function that evolves in response to incoming data from the on-going earthquake, and selected prior information, which can include factors such as network topology, the Gutenberg-Richter relationship or previously observed seismicity. The VS algorithm was one of three EEW algorithms involved in the California Integrated Seismic Network (CISN) real-time EEW testing and performance evaluation effort. Its compelling real-time performance in California over the last three years has led to its inclusion in the new USGS-funded effort to develop key components of CISN ShakeAlert, a prototype EEW system that could potentially be implemented in California. A significant portion of VS code development was supported by the SAFER EEW project in Europe. We discuss recent enhancements to the VS EEW algorithm. We developed and continue to test a multiple-threshold event detection scheme, which uses different association / location approaches depending on the peak amplitudes associated with an incoming P pick. With this scheme, an event with sufficiently high initial amplitudes can be declared on the basis of a single station, maximizing warning times for damaging events for which EEW is most relevant. Smaller, non-damaging events, which will have lower initial amplitudes, will require more picks to be declared an event to reduce false alarms. This transforms the VS codes from a regional EEW approach reliant on traditional location estimation (and it requirement of at least 4 picks as implemented by the Binder Earthworm phase associator) to a hybrid on-site/regional approach capable of providing a continuously evolving stream of EEW

  7. Size-resolved aerosol chemical analysis of extreme haze pollution events during early 2013 in urban Beijing, China.

    PubMed

    Tian, Shili; Pan, Yuepeng; Liu, Zirui; Wen, Tianxue; Wang, Yuesi

    2014-08-30

    Using size-resolved filter sampling and chemical characterization, high concentrations of water-soluble ions, carbonaceous species and heavy metals were found in both fine (PM2.1) and coarse (PM2.1-9) particles in Beijing during haze events in early 2013. Even on clear days, average mass concentration of submicron particles (PM1.1) was several times higher than that previously measured in most of abroad urban areas. A high concentration of particulate matter on haze days weakens the incident solar radiation, which reduces the generation rate of secondary organic carbon in PM1.1. We show that the peak mass concentration of particles shifted from 0.43-0.65μm on clear days to 0.65-1.1μm on lightly polluted days and to 1.1-2.1μm on heavily polluted days. The peak shifts were also found for the following species: organic carbon, elemental carbon, NH4(+), SO4(2-), NO3(-), K, Cu, Zn, Cd and Pb. Our findings demonstrate that secondary inorganic aerosols (36%) and organic matter (26%) dominated the fine particle mass on heavily polluted days, while their contribution reduced to 29% and 18%, respectively, on clear days. Besides fine particles, anthropogenic chemical species also substantially accumulated in the coarse mode, which suggests that particles with aerodynamic diameter larger than 2.1μm cannot be neglected during severe haze events. PMID:25106045

  8. Events of elevated somatic cell counts in high-producing dairy cows are associated with daily body weight loss in early lactation.

    PubMed

    van Straten, M; Friger, M; Shpigel, N Y

    2009-09-01

    The objective of this study was to determine associations between body weight (BW) and body condition score (BCS) variables indicating a more severe negative energy balance in early lactation and events of somatic cell counts (SCC) >250,000 cells/mL and SCC >400,000 cells/mL in dairy cows. We studied lactations from 634 primiparous and 1,086 multiparous Israeli Holstein dairy cows originating from 7 commercial dairy farms. Generalized mixed models with a random herd effect were used to quantify the effects of BW and BCS variables in early lactation on events of elevated SCC. Data were analyzed using 2 different approaches. In the first approach, only first events in a lactation were taken into account, whereas in the second approach, all events in a lactation were analyzed and repeated events from the same cow were accounted for. Although no associations were found between the different BW and BCS variables and first events of elevated SCC, associations were present between these variables and events of elevated SCC when all events were analyzed. The cumulative incidence of a lactation with multiple events of SCC >250,000 cells/mL was 8.8 and 27.7% for primiparous and multiparous cows, respectively. The odds of an event of SCC >250,000 cells/mL were 25% greater for cows belonging to the upper quartile in relative BW loss from calving to nadir BW (loss >12.3, 15.0, and 15.7% for first-, second-, and third- parity and greater cows, respectively) compared with cows losing less relative BW. Odds of an event were 44% greater for cows with ketosis when compared with cows without. The cumulative incidence of a lactation with multiple events of SCC >400,000 cells/mL was 4.1 and 14.3% for primiparous and multiparous cows, respectively. The odds of an event of SCC >400,000 cells/mL were 43% greater for cows belonging to the upper quartile in relative BW loss from calving to nadir BW compared with cows losing less relative BW. Odds of an event were 33% greater for cows with

  9. Glycoprotein from street rabies virus BD06 induces early and robust immune responses when expressed from a non-replicative adenovirus recombinant.

    PubMed

    Wang, Shuchao; Sun, Chenglong; Zhang, Shoufeng; Zhang, Xiaozhuo; Liu, Ye; Wang, Ying; Zhang, Fei; Wu, Xianfu; Hu, Rongliang

    2015-09-01

    The rabies virus (RABV) glycoprotein (G) is responsible for inducing neutralizing antibodies against rabies virus. Development of recombinant vaccines using the G genes from attenuated strains rather than street viruses is a regular practice. In contrast to this scenario, we generated three human adenovirus type 5 recombinants using the G genes from the vaccine strains SRV9 and Flury-LEP, and the street RABV strain BD06 (nrAd5-SRV9-G, nrAd5-Flury-LEP-G, and nrAd5-BD06-G). These recombinants were non-replicative, but could grow up to ~10(8) TCID50/ml in helper HEK293AD cells. Expression of the G protein was verified by immunostaining, quantitative PCR and cytometry. Animal experiments revealed that immunization with nrAd5-BD06-G can induce a higher seroconversion rate, a higher neutralizing antibody level, and a longer survival time after rabies virus challenge in mice when compared with the other two recombinants. Moreover, the expression of granulocyte-macrophage colony-stimulating factor (GM-CSF) was significantly higher in mice immunized with nrAd5-BD06-G, which might also contribute to the increased protection. These results show that the use of street RABV G for non-replicative systems may be an alternative for developing effective recombinant rabies vaccines. PMID:26143474

  10. Early psychosocial interventions after disasters, terrorism and other shocking events: is there a gap between norms and practice in Europe?

    PubMed Central

    Te Brake, Hans

    2013-01-01

    Background Internationally, several initiatives exist to describe standards for post-disaster psychosocial care. Objective This study explored the level of consensus of experts within Europe on a set of recommendations on early psychosocial intervention after shocking events (Dutch guidelines), and to what degree these standards are implemented into mental health care practice. Methods Two hundred and six (mental) health care professionals filled out a questionnaire to assess the extent to which they consider the guidelines’ scope and recommendations relevant and part of the regular practice in their own country. Forty-five European experts from 24 EU countries discussed the guidelines at an international seminar. Results The data suggest overall agreement on the standards although many of the recommendations appear not (yet) to be embedded in everyday practice. Conclusions Although large consensus exists on standards for early psychosocial care, a chasm between norms and practice appears to exist throughout the EU, stressing the general need for investments in guideline development and implementation. PMID:23393613

  11. Differential Network Analyses of Alzheimer’s Disease Identify Early Events in Alzheimer’s Disease Pathology

    DOE PAGESBeta

    Xia, Jing; Rocke, David M.; Perry, George; Ray, Monika

    2014-01-01

    In late-onset Alzheimer’s disease (AD), multiple brain regions are not affected simultaneously. Comparing the gene expression of the affected regions to identify the differences in the biological processes perturbed can lead to greater insight into AD pathogenesis and early characteristics. We identified differentially expressed (DE) genes from single cell microarray data of four AD affected brain regions: entorhinal cortex (EC), hippocampus (HIP), posterior cingulate cortex (PCC), and middle temporal gyrus (MTG). We organized the DE genes in the four brain regions into region-specific gene coexpression networks. Differential neighborhood analyses in the coexpression networks were performed to identify genes with lowmore » topological overlap (TO) of their direct neighbors. The low TO genes were used to characterize the biological differences between two regions. Our analyses show that increased oxidative stress, along with alterations in lipid metabolism in neurons, may be some of the very early events occurring in AD pathology. Cellular defense mechanisms try to intervene but fail, finally resulting in AD pathology as the disease progresses. Furthermore, disease annotation of the low TO genes in two independent protein interaction networks has resulted in association between cancer, diabetes, renal diseases, and cardiovascular diseases.« less

  12. Mitochondrial D310 mutations in colorectal adenomas: an early but not causative genetic event during colorectal carcinogenesis.

    PubMed

    Legras, Antoine; Lièvre, Astrid; Bonaiti-Pellié, Catherine; Cottet, Vanessa; Pariente, Alexandre; Nalet, Bernard; Lafon, Jacques; Faivre, Jean; Bonithon-Kopp, Claire; Goasguen, Nicolas; Penna, Christophe; Olschwang, Sylviane; Laurent-Puig, Pierre

    2008-05-15

    Somatic mutations of the D310 sequence of the mitochondrial DNA are reported in human cancers, including colorectal cancers (CRC). The presence of these mutations at early or late steps of colorectal carcinogenesis is unknown. Their prevalence increased significantly with the number of cytosines in the D310 sequence of the matched normal tissue (D310 polymorphism), suggesting that this polymorphism could be a risk factor for CRC. The aim of this study was (i) to investigate the prevalence of D310 mutations in 64 colorectal adenomas and 36 liver metastases from 15 CRC patients, (ii) to assess the relation between D310 polymorphism and the risk of colorectal adenoma in a case-control study including 613 cases with colorectal adenoma and 572 polyp-free (PF) controls. D310 mutations were found in colorectal adenomas and liver metastases from CRC patients in 27 and 33%, respectively and so are an early genetic event in colorectal carcinogenesis. The frequency of the mutations increased significantly with the number of cytosines in the matched normal tissue D310 sequence (p < 0.001) but the distribution of D310 polymorphisms was not significantly different between adenoma cases (large (>9 mm) and small (<5 mm) adenomas) and PF controls (C(4)-C(7)TC(6): 47, 52 and 49%; C(8)TC(6): 44, 39 and 41%; C(9)-C(10)TC(6): 9, 9 and 10%, respectively; p > 0.05), suggesting that germline D310 polymorphism is not a risk factor for colorectal adenomas. Considering their high frequency in colorectal adenomas, mitochondrial D310 mutations could represent a biomarker for early detection of CRC although their causative role in colorectal carcinogenesis remains uncertain. PMID:18224678

  13. Perturbation of bile acid homeostasis is an early pathogenesis event of drug induced liver injury in rats

    SciTech Connect

    Yamazaki, Makoto; Miyake, Manami; Sato, Hiroko; Masutomi, Naoya; Tsutsui, Naohisa; Adam, Klaus-Peter; Alexander, Danny C.; Lawton, Kay A.; Milburn, Michael V.; Ryals, John A.; Wulff, Jacob E.; Guo, Lining

    2013-04-01

    Drug-induced liver injury (DILI) is a significant consideration for drug development. Current preclinical DILI assessment relying on histopathology and clinical chemistry has limitations in sensitivity and discordance with human. To gain insights on DILI pathogenesis and identify potential biomarkers for improved DILI detection, we performed untargeted metabolomic analyses on rats treated with thirteen known hepatotoxins causing various types of DILI: necrosis (acetaminophen, bendazac, cyclosporine A, carbon tetrachloride, ethionine), cholestasis (methapyrilene and naphthylisothiocyanate), steatosis (tetracycline and ticlopidine), and idiosyncratic (carbamazepine, chlorzoxasone, flutamide, and nimesulide) at two doses and two time points. Statistical analysis and pathway mapping of the nearly 1900 metabolites profiled in the plasma, urine, and liver revealed diverse time and dose dependent metabolic cascades leading to DILI by the hepatotoxins. The most consistent change induced by the hepatotoxins, detectable even at the early time point/low dose, was the significant elevations of a panel of bile acids in the plasma and urine, suggesting that DILI impaired hepatic bile acid uptake from the circulation. Furthermore, bile acid amidation in the hepatocytes was altered depending on the severity of the hepatotoxin-induced oxidative stress. The alteration of the bile acids was most evident by the necrosis and cholestasis hepatotoxins, with more subtle effects by the steatosis and idiosyncratic hepatotoxins. Taking together, our data suggest that the perturbation of bile acid homeostasis is an early event of DILI. Upon further validation, selected bile acids in the circulation could be potentially used as sensitive and early DILI preclinical biomarkers. - Highlights: ► We used metabolomics to gain insights on drug induced liver injury (DILI) in rats. ► We profiled rats treated with thirteen hepatotoxins at two doses and two time points. ► The toxins decreased the

  14. Early-Life Events, Including Mode of Delivery and Type of Feeding, Siblings and Gender, Shape the Developing Gut Microbiota

    PubMed Central

    Cetinyurek Yavuz, Aysun; Ben-Amor, Kaouther; Roelofs, Mieke; Ishikawa, Eiji; Kubota, Hiroyuki; Swinkels, Sophie; Sakai, Takafumi; Oishi, Kenji; Kushiro, Akira; Knol, Jan

    2016-01-01

    Colonization of the infant gut is believed to be critically important for a healthy growth as it influences gut maturation, metabolic, immune and brain development in early life. Understanding factors that influence this process is important, since an altered colonization has been associated with a higher risk of diseases later in life. Fecal samples were collected from 108 healthy neonates in the first half year of life. The composition and functionality of the microbiota was characterized by measuring 33 different bacterial taxa by qPCR/RT qPCR, and 8 bacterial metabolites. Information regarding gender, place and mode of birth, presence of siblings or pets; feeding pattern and antibiotic use was collected by using questionnaires. Regression analysis techniques were used to study associations between microbiota parameters and confounding factors over time. Bacterial DNA was detected in most meconium samples, suggesting bacterial exposure occurs in utero. After birth, colonization by species of Bifidobacterium, Lactobacillus and Bacteroides was influenced by mode of delivery, type of feeding and presence of siblings, with differences found at species level and over time. Interestingly, infant-type bifidobacterial species such as B. breve or B. longum subsp infantis were confirmed as early colonizers apparently independent of the factors studied here, while B. animalis subsp. lactis presence was found to be dependent solely on the type of feeding, indicating that it might not be a common infant gut inhabitant. One interesting and rather unexpected confounding factor was gender. This study contributes to our understanding of the composition of the microbiota in early life and the succession process and the evolution of the microbial community as a function of time and events occurring during the first 6 months of life. Our results provide new insights that could be taken into consideration when selecting nutritional supplementation strategies to support the

  15. Early-Life Events, Including Mode of Delivery and Type of Feeding, Siblings and Gender, Shape the Developing Gut Microbiota.

    PubMed

    Martin, Rocio; Makino, Hiroshi; Cetinyurek Yavuz, Aysun; Ben-Amor, Kaouther; Roelofs, Mieke; Ishikawa, Eiji; Kubota, Hiroyuki; Swinkels, Sophie; Sakai, Takafumi; Oishi, Kenji; Kushiro, Akira; Knol, Jan

    2016-01-01

    Colonization of the infant gut is believed to be critically important for a healthy growth as it influences gut maturation, metabolic, immune and brain development in early life. Understanding factors that influence this process is important, since an altered colonization has been associated with a higher risk of diseases later in life. Fecal samples were collected from 108 healthy neonates in the first half year of life. The composition and functionality of the microbiota was characterized by measuring 33 different bacterial taxa by qPCR/RT qPCR, and 8 bacterial metabolites. Information regarding gender, place and mode of birth, presence of siblings or pets; feeding pattern and antibiotic use was collected by using questionnaires. Regression analysis techniques were used to study associations between microbiota parameters and confounding factors over time. Bacterial DNA was detected in most meconium samples, suggesting bacterial exposure occurs in utero. After birth, colonization by species of Bifidobacterium, Lactobacillus and Bacteroides was influenced by mode of delivery, type of feeding and presence of siblings, with differences found at species level and over time. Interestingly, infant-type bifidobacterial species such as B. breve or B. longum subsp infantis were confirmed as early colonizers apparently independent of the factors studied here, while B. animalis subsp. lactis presence was found to be dependent solely on the type of feeding, indicating that it might not be a common infant gut inhabitant. One interesting and rather unexpected confounding factor was gender. This study contributes to our understanding of the composition of the microbiota in early life and the succession process and the evolution of the microbial community as a function of time and events occurring during the first 6 months of life. Our results provide new insights that could be taken into consideration when selecting nutritional supplementation strategies to support the

  16. Early impact event and fluid activity on H chondrite parent body registered in the Pułtusk meteorite

    NASA Astrophysics Data System (ADS)

    Krzesinska, Agata

    2015-04-01

    Impact is one of the most important processes affecting asteroids, but it is neglected as a source for heat of these bodies. Recent modeling work show, however, that impact into warm planetesimals is able to cause global-scale temperature increase to the point of melting of silicates [1]. An obvious consequence of this fact is that the impact activity in early evolution of asteroids may promote formation of melt and its differentiation. H chondrites provide some lines of evidence for an early, 4.4 Ga impact event on their parent body. The event resulted in formation of heavily shocked and melted H chondrites with old gas retention ages [2, 3], including Portales Valley, an unique metal-rich breccia [e.g. 4]. The impact led also, very likely, to unmixing of silicate and metal-sulfide melts and to formation of silicate-iron non-magmatic IIE meteorites [5]. Additional evidence for this event, and for melting it caused, may come from highly equilibrated and recrystallized fragments of the Pułtusk meteorite containing vein-like metal accumulations [6]. In the Pułtusk, vein-like metal accumulations are kamacite-rich, and basically depleted in sulfides. They form many tendrils into the equilibrated, well recrystallized chondritic rock. Marked feature of the chondritic rock at the contact with accumulations is presence of unusually large phosphate and feldspar grains. The minerals bear record of crystallization from melt. Both vein-like metal accumulations and chondritic rock record, however, slow cooling rate. Phopshates are in the meteorite represented by merrillite and apatite, predominantly intergrown with each other. Merrillite poikilitically encloses silicate grains. It is probably of magmatic origin, since it contains detectable amount of potassium and high content of sodium. Apatite contains varying concentrations of chlorine, fluorine and missing structural component. Content of Cl and F are negatively correlated and both elements are heterogeneously distributed

  17. Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-κB and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling

    PubMed Central

    Scherbik, S. V.; Pulit-Penaloza, J. A.; Basu, M.; Courtney, S. C.

    2013-01-01

    Although infections with “natural” West Nile virus (WNV) and the chimeric W956IC WNV infectious clone virus produce comparable peak virus yields in type I interferon (IFN) response-deficient BHK cells, W956IC infection produces higher levels of “unprotected” viral RNA at early times after infection. Analysis of infections with these two viruses in IFN-competent cells showed that W956IC activated NF-κB, induced higher levels of IFN-β, and produced lower virus yields than WNV strain Eg101. IPS-1 was required for both increased induction of IFN-β and decreased yields of W956IC. In Eg101-infected cells, phospho-STAT1/STAT2 nuclear translocation was blocked at all times analyzed, while some phospho-STAT1/STAT2 nuclear translocation was still detected at 8 h after infection in W956IC-infected mouse embryonic fibroblasts (MEFs), and early viral protein levels were lower in these cells. A set of additional chimeras was made by replacing various W956IC gene regions with the Eg101 equivalents. As reported previously, for three of these chimeras, the low early RNA phenotype of Eg101 was restored in BHK cells. Analysis of infections with two of these chimeric viruses in MEFs detected lower early viral RNA levels, higher early viral protein levels, lower early IFN-β levels, and higher virus yields similar to those seen after Eg101 infection. The data suggest that replicase protein interactions directly or indirectly regulate genome switching between replication and translation at early times in favor of translation to minimize NF-κB activation and IFN induction by decreasing the amount of unprotected viral RNA, to produce sufficient viral protein to block canonical type I IFN signaling, and to efficiently remodel cell membranes for exponential genome amplification. PMID:23678179

  18. Subsurface warming in the subpolar North Atlantic during rapid climate events in the Early and Mid-Pleistocene

    NASA Astrophysics Data System (ADS)

    Hernández-Almeida, Iván; Sierro, Francisco; Cacho, Isabel; Abel Flores, José

    2014-05-01

    A new high-resolution reconstruction of the temperature and salinity of the subsurface waters using paired Mg/Ca-δ18O measurements on the planktonic foraminifera Neogloboquadrina pachyderma sinistrorsa (sin.) was conducted on a deep-sea sediment core in the subpolar North Atlantic (Site U1314). This study aims to reconstruct millennial-scale subsurface hydrography variations during the Early and Mid-Pleistocene (MIS 31-19). These rapid climate events are characterized by abrupt shifts between warm/cold conditions, and ice-sheet oscillations, as evidenced by major ice rafting events recorded in the North Atlantic sediments (Hernández-Almeida et al., 2012), similar to those found during the Last Glacial period (Marcott et al, 2011). The Mg/Ca derived paleotemperature and salinity oscillations prior and during IRD discharges at Site U1314 are related to changes in intermediate circulation. The increases in Mg/Ca paleotemperatures and salinities during the IRD event are preceded by short episodes of cooling and freshening of subsurface waters. The response of the AMOC to this perturbation is an increased of warm and salty water coming from the south, transported to high latitudes in the North Atlantic beneath the thermocline. This process is accompanied by a southward shift in the convection cell from the Nordic Seas to the subpolar North Atlantic and better ventilation of the North Atlantic at mid-depths. Poleward transport of warm and salty subsurface subtropical waters causes intense basal melting and thinning of marine ice-shelves, that culminates in large-scale instability of the ice sheets, retreat of the grounding line and iceberg discharge. The mechanism proposed involves the coupling of the AMOC with ice-sheet dynamics, and would explain the presence of these fluctuations before the establishment of high-amplitude 100-kyr glacial cycles. Hernández-Almeida, I., Sierro, F.J., Cacho, I., Flores, J.A., 2012. Impact of suborbital climate changes in the North

  19. Bacteriophage replication modules.

    PubMed

    Weigel, Christoph; Seitz, Harald

    2006-05-01

    Bacteriophages (prokaryotic viruses) are favourite model systems to study DNA replication in prokaryotes, and provide examples for every theoretically possible replication mechanism. In addition, the elucidation of the intricate interplay of phage-encoded replication factors with 'host' factors has always advanced the understanding of DNA replication in general. Here we review bacteriophage replication based on the long-standing observation that in most known phage genomes the replication genes are arranged as modules. This allows us to discuss established model systems--f1/fd, phiX174, P2, P4, lambda, SPP1, N15, phi29, T7 and T4--along with those numerous phages that have been sequenced but not studied experimentally. The review of bacteriophage replication mechanisms and modules is accompanied by a compendium of replication origins and replication/recombination proteins (available as supplementary material online). PMID:16594962

  20. Replication of Tobamovirus RNA.

    PubMed

    Ishibashi, Kazuhiro; Ishikawa, Masayuki

    2016-08-01

    Tobacco mosaic virus and other tobamoviruses have served as models for studying the mechanisms of viral RNA replication. In tobamoviruses, genomic RNA replication occurs via several steps: (a) synthesis of viral replication proteins by translation of the genomic RNA; (b) translation-coupled binding of the replication proteins to a 5'-terminal region of the genomic RNA; (c) recruitment of the genomic RNA by replication proteins onto membranes and formation of a complex with host proteins TOM1 and ARL8; (d) synthesis of complementary (negative-strand) RNA in the complex; and (e) synthesis of progeny genomic RNA. This article reviews current knowledge on tobamovirus RNA replication, particularly regarding how the genomic RNA is specifically selected as a replication template and how the replication proteins are activated. We also focus on the roles of the replication proteins in evading or suppressing host defense systems. PMID:27296148

  1. Evidence of resilience to past climate change in Southwest Asia: Early farming communities and the 9.2 and 8.2 ka events

    NASA Astrophysics Data System (ADS)

    Flohr, Pascal; Fleitmann, Dominik; Matthews, Roger; Matthews, Wendy; Black, Stuart

    2016-03-01

    Climate change is often cited as a major factor in social change. The so-called 8.2 ka event was one of the most pronounced and abrupt Holocene cold and arid events. The 9.2 ka event was similar, albeit of a smaller magnitude. Both events affected the Northern Hemisphere climate and caused cooling and aridification in Southwest Asia. Yet, the impacts of the 8.2 and 9.2 ka events on early farming communities in this region are not well understood. Current hypotheses for an effect of the 8.2 ka event vary from large-scale site abandonment and migration (including the Neolithisation of Europe) to continuation of occupation and local adaptation, while impacts of the 9.2 ka have not previously been systematically studied. In this paper, we present a thorough assessment of available, quality-checked radiocarbon (14C) dates for sites from Southwest Asia covering the time interval between 9500 and 7500 cal BP, which we interpret in combination with archaeological evidence. In this way, the synchronicity between changes observed in the archaeological record and the rapid climate events is tested. It is shown that there is no evidence for a simultaneous and widespread collapse, large-scale site abandonment, or migration at the time of the events. However, there are indications for local adaptation. We conclude that early farming communities were resilient to the abrupt, severe climate changes at 9250 and 8200 cal BP.

  2. Using Simcyp to project human oral pharmacokinetic variability in early drug research to mitigate mechanism-based adverse events.

    PubMed

    Shaffer, Christopher L; Scialis, Renato J; Rong, Haojing; Obach, R Scott

    2012-03-01

    Positive allosteric modulators ('potentiators') of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) have been shown to display a mechanism-based exposure-response continuum in preclinical species with procognitive electrophysiological and behavioral effects ('efficacy') at low exposures and motor coordination disruptions at progressively higher exposures. Due to the dose-capping nature of such motor coordination deficits, an exposure threshold-mediated adverse event (C(AE) ), the adequacy of separation between the maximal total plasma compound concentration (C(max) ) at a predicted clinically efficacious oral dose and this adverse event (AE) was explored in early drug research with three AMPAR potentiators considered potential candidates for clinical trials. In vitro metabolism studies in human liver microsomes and human hepatocytes demonstrated the metabolic clearance for each compound was predominately due to cytochromes P450 (CYP). Thus, for each compound's anticipated clinically efficacious dose, human C(max) variability following oral administration was assessed using Simcyp software, which combines its virtual human populations database using extensive demographic, physiological and genomic information with routinely collected compound-specific in vitro biochemical data to simulate and predict drug disposition. Using a combination of experimentally determined recombinant human CYP intrinsic clearances for CYP1A2, CYP2C8, CYP2C9, CYP2C19, CYP2D6 and CYP3A4, human binding factors, expected fraction absorbed and estimated steady-state volume of distribution, Simcyp simulations demonstrated that two of the three potentiators had acceptable projected C(max) variability (i.e. the 95th percentile C(max) did not breach C(AE) ). This evaluation aided in the selection of compounds for preclinical progression, and represents a novel application of pharmacologically based pharmacokinetic (PBPK) software approaches to predict interpatient

  3. Early Results of Three-Year Monitoring of Red Wood Ants’ Behavioral Changes and Their Possible Correlation with Earthquake Events

    PubMed Central

    Berberich, Gabriele; Berberich, Martin; Grumpe, Arne; Wöhler, Christian; Schreiber, Ulrich

    2013-01-01

    Simple Summary For three years (2009–2012), two red wood ant mounds (Formica rufa-group), located at the seismically active Neuwied Basin (Eifel, Germany), have been monitored 24/7 by high-resolution cameras. Early results show that ants have a well-identifiable standard daily routine. Correlation with local seismic events suggests changes in the ants’ behavior hours before the earthquake: the nocturnal rest phase and daily activity are suppressed, and standard daily routine does not resume until the next day. At present, an automated image evaluation routine is being applied to the video streams. Based on this automated approach, a statistical analysis of the ant behavior will be carried out. Abstract Short-term earthquake predictions with an advance warning of several hours or days are currently not possible due to both incomplete understanding of the complex tectonic processes and inadequate observations. Abnormal animal behaviors before earthquakes have been reported previously, but create problems in monitoring and reliability. The situation is different with red wood ants (RWA; Formica rufa-group (Hymenoptera: Formicidae)). They have stationary mounds on tectonically active, gas-bearing fault systems. These faults may be potential earthquake areas. For three years (2009–2012), two red wood ant mounds (Formica rufa-group), located at the seismically active Neuwied Basin (Eifel, Germany), have been monitored 24/7 by high-resolution cameras with both a color and an infrared sensor. Early results show that ants have a well-identifiable standard daily routine. Correlation with local seismic events suggests changes in the ants’ behavior hours before the earthquake: the nocturnal rest phase and daily activity are suppressed, and standard daily routine does not resume until the next day. At present, an automated image evaluation routine is being applied to the more than 45,000 hours of video streams. Based on this automated approach, a statistical analysis of

  4. Cardiovascular events in early RA are a result of inflammatory burden and traditional risk factors: a five year prospective study

    PubMed Central

    2011-01-01

    Introduction Co-morbidity and mortality due to cardiovascular disease (CVD) are increased in patients with rheumatoid arthritis (RA). Most published studies in this field are retrospective or cross sectional. We investigated the presence of traditional and disease related risk factors for CVD at the onset of RA and during the first five years following diagnosis. We also evaluated their potential for predicting a new cardiovascular event (CVE) during the five-year follow-up period and the modulatory effect of pharmacological treatment. Methods All patients from the four northern-most counties of Sweden with early RA are, since December 1995, consecutively recruited at diagnosis (T0) into a large survey on the progress of the disease. Information regarding cardiovascular co-morbidity and related predictors was collected from clinical records and supplemented with questionnaires. By April 2008, 700 patients had been included of whom 442 patients had reached the five-year follow-up (T5). Results Among the 442 patients who reached T5 during the follow-up period, treatment for hypertension increased from 24.5 to 37.4% (P < 0.001)), diagnosis of diabetes mellitus (DM) from 7.1 to 9.5% (P < 0.01) whilst smoking decreased from 29.8 to 22.4% (P < 0.001) and the BMI from 26.3 to 25.8 (P < 0.05), respectively. By T5, 48 patients had suffered a new CVE of which 12 were fatal. A total of 23 patients died during the follow-up period. Age at disease onset, male sex, a previous CVE, DM, treatment for hypertension, triglyceride level, cumulative disease activity (area under the curve (AUC) disease activity score (DAS28)), extra-articular disease, corticosteroid use, shorter duration of treatment with disease modifying anti-rheumatic drugs (DMARDs) and use of COX-2 inhibitors increased the hazard rate for a new CVE. A raised erythrocyte sedimentation rate (ESR) at inclusion and AUC DAS28 at six months increased the hazard rate of CVE independently whilst DMARD treatment was

  5. Rapid changes in the redox conditions of the western Tethys Ocean during the early Aptian oceanic anoxic event

    NASA Astrophysics Data System (ADS)

    Westermann, Stéphane; Stein, Melody; Matera, Virginie; Fiet, Nicolas; Fleitmann, Dominik; Adatte, Thierry; Föllmi, Karl B.

    2013-11-01

    The early Aptian (125 to 121 Ma) records an episode of severe environmental change including a major perturbation of the carbon cycle, an oceanic anoxic event (OAE 1a, 122.5 Ma), a platform drowning episode and a biocalcification crisis. We propose to trace changes in the oxygenation state of the ocean during the early Aptian anoxic event using the redox-sensitive trace-element (RSTE) distribution, phosphorus accumulation rates (PARs) and organic-matter characterization in three different basins of the western Tethys. The following sections have been investigated: Gorgo a Cerbara (central Italy) in the Umbria Marche basin, Glaise (SE France) in the Vocontian basin and Cassis/La Bédoule (SE France) located in the Provencal basin. In the Gorgo a Cerbara section, RSTE distributions show a low background level along the main part of the section, contrasted by different maxima in concentrations within the Selli level. In the Glaise section, the Goguel level displays a weak increase in RSTE contents coeval with moderate TOC values. At Cassis/La Bédoule, no significant RSTE enrichments have been observed in sediments equivalent to the Selli level. These differences in the records of the geochemical proxies of the Selli level or its equivalent indicate the deposition under different redox conditions, probably related to the paleogeography. Our data indicate the development of anoxic-euxinic conditions in the deeper part of the Tethys during OAE 1a, whereas in the shallower environments, conditions were less reducing. Moreover, at Gorgo a Cerbara, the Selli level is characterized by rapid changes in the intensity of reducing conditions in the water column. Ocean eutrophication seems to be a major factor in the development and the persistence of anoxia as suggested by the PAR evolution. Higher PAR values at the onset of OAE 1a suggest an increase in nutrient input, whereas the return to lower values through the first part of the OAE 1a interval may be related to the

  6. Calcium isotope evidence for dramatic increase of continental weathering during the Toarcian oceanic anoxic event (Early Jurassic)

    NASA Astrophysics Data System (ADS)

    Brazier, Jean-Michel; Suan, Guillaume; Tacail, Théo; Simon, Laurent; Martin, Jeremy E.; Mattioli, Emanuela; Balter, Vincent

    2015-02-01

    The early Toarcian was punctuated by pulses of massive carbon injection that are thought to have triggered, through increased greenhouse conditions, elevated continental discharge and nutrient input, marine anoxia, seawater acidification and species extinctions. Nevertheless, the mode and tempo of changes in continental weathering across this interval remains highly debated, leading to considerable uncertainty about the main causes of these perturbations. In this study we present calcium isotope measurements (δ44/40Ca) of well-preserved brachiopods and bulk rock samples from the hemipelagic strata of Pliensbachian-Toarcian age of Peniche in Portugal in order to constrain changes in the calcium cycle and hence changes in continental weathering during the early Toarcian. The data reveal a similar trend as carbon isotope data from the same section and show negative excursions of about 0.5‰ at the Pliensbachian-Toarcian transition (Pl-To) and at the base of the Toarcian Oceanic Anoxic Event (T-OAE) interval. The comparison of δ44/40Ca ratios recorded in brachiopods and bulk rock corrected for variable dolomite contribution indicates that these excursions reflect changes in the global isotopic composition of seawater rather than changes in the dominant mineralogy of calcifying organisms or in hydrological budget of the considered basin. Box modeling results suggest that the Pl-To and T-OAE δ44/40Ca excursions can be explained by a transient 90% decrease of carbonate accumulation due to seawater acidification followed by a 500% increase in continental weathering rates. The sharp increases in continental weathering inferred from the δ44/40Ca ratios seem overall consistent with lower Toarcian sedimentological and biotic records that document rapid crises in carbonate production followed by episodes of increased calcium carbonate burial. Nevertheless, the maximum of carbonate burial recorded by most NW European basinal successions occurs several hundreds of kyrs after

  7. Postweaning Exposure to Dietary Zearalenone, a Mycotoxin, Promotes Premature Onset of Puberty and Disrupts Early Pregnancy Events in Female Mice

    PubMed Central

    Ye, Xiaoqin

    2013-01-01

    Zearalenone (ZEA) is a mycotoxin commonly found in contaminated livestock feed and human food with levels in the range of ppb and low ppm. It was hypothesized that ZEA, an endocrine disruptor, could affect puberty and early pregnancy. To test this hypothesis, newly weaned (3 weeks old) C57BL/6J female mice were exposed to 0, 0.002, 4, 10, and 40 ppm ZEA and 0.05 ppm diethylstilbestrol (positive control) in phytoestrogen-free AIN-93G diet. Females exposed to 10 and 40 ppm ZEA diets showed earlier onset of vaginal opening. Those treated with 40 ppm ZEA diet also had earlier first copulation plug and irregular estrous cyclicity. At 8 weeks old, all females were mated with untreated stud males on AIN-93G diet during mating. Treatment resumed upon identification of a vaginal plug on gestation day 0.5 (D0.5). Embryo implantation was assessed on D4.5. Exposure to 40 ppm ZEA diet resulted in reduced percentage of plugged mice with implantation sites, distended uterine appearance, and retained expression of progesterone receptor in D4.5 uterine epithelium. To determine the exposure timing and mechanisms of disrupted embryo implantation, four groups of females were fed with 0 or 40 ppm ZEA diets during premating (weaning to mating) and postmating (D0.5–D4.5), respectively. Premating exposure to 40 ppm ZEA diet reduced fertilization rate, whereas postmating exposure to 40 ppm ZEA diet delayed embryo transport and preimplantation embryo development, which subsequently affected embryo implantation. These data demonstrate that postweaning exposure to dietary ZEA can promote premature onset of puberty and disrupt early pregnancy events. PMID:23291560

  8. Early Jurassic schizosphaerellid crisis in Cantabria, Spain: Implications for calcification rates and phytoplankton evolution across the Toarcian oceanic anoxic event

    NASA Astrophysics Data System (ADS)

    Tremolada, Fabrizio; van de Schootbrugge, Bas; Erba, Elisabetta

    2005-06-01

    The Toarcian oceanic anoxic event (˜183 Myr ago) represents a global perturbation marked by increasing organic carbon burial and a general decrease in calcium carbonate production likely triggered by elevated carbon dioxide levels in the atmosphere. Here we present quantitative analyses of calcareous nannofossil diversity and abundance from the Castillo de Pedroso section in Cantabria, northern Spain. We compare these data with geochemical data (C and O isotopes) obtained from biogenic and bulk carbonate records in order to highlight the response of calcareous phytoplankton to major climatic and paleoceanographic changes. The Pliensbachian/Toarcian boundary is characterized by an abrupt decrease in abundance of Schizosphaerella punctulata, the most important lithogenic contributor to (hemi) pelagic carbonates in the Early Jurassic. The early Toarcian nannofloral assemblages show an increase in abundance of Mitrolithus jansae and small-sized r-selected taxa and a progressive decrease in S. punctulata percentages. The deep dwellers M. jansae and S. punctulata experienced a major crisis slightly prior to the deposition of the Toarcian black shales that are characterized by high abundances of eutrophic taxa such as Lotharingius spp. and Biscutum spp. The return of S. punctulata associated with lower percentages of eutrophic taxa was observed just above the Toarcian black shales. The Toarcian episode reveals that high CO2 levels and increasing primary productivity probably triggered a shift in abundance from highly calcified nannoliths such as S. punctulata and M. jansae to small-sized r-selected coccoliths that overall record a biocalcification crisis at the onset and during the Toarcian episode.

  9. Lesion development and replication kinetics during early infection in cattle inoculated with vesicular stomatitis New Jersey virus via scarification and black fly (Simulium vittatum) bite

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vesicular stomatitis viruses are the causative agents of vesicular stomatitis, an economically important contagious disease of livestock that occurs in North, Central, and South America. Little is known regarding the early stages of infection in natural hosts. Twelve adult Holstein steers were inocu...

  10. Tetraspanin CD63 is a regulator of HIV-1 replication

    PubMed Central

    Fu, Enqing; Pan, Lei; Xie, Yonghong; Mu, Deguang; Liu, Wei; Jin, Faguang; Bai, Xuefan

    2015-01-01

    Macrophages and CD4+ T-cells are the major reservoirs for HIV-1 infection. CD63 is a tetraspanin transmembrane protein, which has been shown to play an essential role during HIV-1 replication in macrophages. In this study, we further confirm the requirement of CD63 in HIV-1 replication events in primary human CD4+ T-cells, dendritic cells, and a CD4+ cell line. Most interestingly, we also show the evidences for the co-localization and internalization of CD63 and HIV-1 major receptor CD4 in primary human macrophages and CD4+ cell line by confocal microscopy and Co-Immunoprecipitation assay. Analysis revealed that CD63-depleted CD4+ T-cells, dendritic cells, and a cell line showed significant decrease in HIV-1 production. Further analysis showed that CD63 down regulation reduced production of the early HIV protein Tat, and affected HIV protein Gag by CD63-Gag interaction. In agreement, CD63 silencing also inhibited production of the late protein p24. Furthermore, we revealed that CD63 silencing has no effect on HIV-1 replication with extensive viral challenge (MOI > 0.2). These findings suggest that CD63 plays a dual-role both in early and late HIV-1 life cycle with a range of HIV-1 infection (MOI < 0.2). PMID:25973004

  11. Repression of osteocyte Wnt/β-catenin signaling is an early event in the progression of renal osteodystrophy.

    PubMed

    Sabbagh, Yves; Graciolli, Fabiana Giorgeti; O'Brien, Stephen; Tang, Wen; dos Reis, Luciene Machado; Ryan, Susan; Phillips, Lucy; Boulanger, Joseph; Song, Wenping; Bracken, Christina; Liu, Shiguang; Ledbetter, Steven; Dechow, Paul; Canziani, Maria Eugenia F; Carvalho, Aluizio B; Jorgetti, Vanda; Moyses, Rosa M A; Schiavi, Susan C

    2012-08-01

    Chronic kidney disease-mineral bone disorder (CKD-MBD) is defined by abnormalities in mineral and hormone metabolism, bone histomorphometric changes, and/or the presence of soft-tissue calcification. Emerging evidence suggests that features of CKD-MBD may occur early in disease progression and are associated with changes in osteocyte function. To identify early changes in bone, we utilized the jck mouse, a genetic model of polycystic kidney disease that exhibits progressive renal disease. At 6 weeks of age, jck mice have normal renal function and no evidence of bone disease but exhibit continual decline in renal function and death by 20 weeks of age, when approximately 40% to 60% of them have vascular calcification. Temporal changes in serum parameters were identified in jck relative to wild-type mice from 6 through 18 weeks of age and were subsequently shown to largely mirror serum changes commonly associated with clinical CKD-MBD. Bone histomorphometry revealed progressive changes associated with increased osteoclast activity and elevated bone formation relative to wild-type mice. To capture the early molecular and cellular events in the progression of CKD-MBD we examined cell-specific pathways associated with bone remodeling at the protein and/or gene expression level. Importantly, a steady increase in the number of cells expressing phosphor-Ser33/37-β-catenin was observed both in mouse and human bones. Overall repression of Wnt/β-catenin signaling within osteocytes occurred in conjunction with increased expression of Wnt antagonists (SOST and sFRP4) and genes associated with osteoclast activity, including receptor activator of NF-κB ligand (RANKL). The resulting increase in the RANKL/osteoprotegerin (OPG) ratio correlated with increased osteoclast activity. In late-stage disease, an apparent repression of genes associated with osteoblast function was observed. These data confirm that jck mice develop progressive biochemical changes in CKD-MBD and suggest

  12. Archaeal DNA replication.

    PubMed

    Kelman, Lori M; Kelman, Zvi

    2014-01-01

    DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed. PMID:25421597

  13. Subsurface North Atlantic warming as a trigger of rapid cooling events: evidence from the early Pleistocene (MIS 31-19)

    NASA Astrophysics Data System (ADS)

    Hernández-Almeida, I.; Sierro, F.-J.; Cacho, I.; Flores, J.-A.

    2015-04-01

    Subsurface water column dynamics in the subpolar North Atlantic were reconstructed in order to improve the understanding of the cause of abrupt ice-rafted detritus (IRD) events during cold periods of the early Pleistocene. We used paired Mg / Ca and δ18O measurements of Neogloboquadrina pachyderma (sinistral - sin.), deep-dwelling planktonic foraminifera, to estimate the subsurface temperatures and seawater δ18O from a sediment core from Gardar Drift, in the subpolar North Atlantic. Carbon isotopes of benthic and planktonic foraminifera from the same site provide information about the ventilation and water column nutrient gradient. Mg / Ca-based temperatures and seawater δ18O suggest increased subsurface temperatures and salinities during ice-rafting, likely due to northward subsurface transport of subtropical waters during periods of weaker Atlantic Meridional Overturning Circulation (AMOC). Planktonic carbon isotopes support this suggestion, showing coincident increased subsurface ventilation during deposition of IRD. Subsurface accumulation of warm waters would have resulted in basal warming and break-up of ice-shelves, leading to massive iceberg discharges in the North Atlantic. The release of heat stored at the subsurface to the atmosphere would have helped to restart the AMOC. This mechanism is in agreement with modelling and proxy studies that observe a subsurface warming in the North Atlantic in response to AMOC slowdown during Marine Isotope Stage (MIS) 3.

  14. Subsurface North Atlantic warming as a trigger of rapid cooling events: evidences from the Early Pleistocene (MIS 31-19)

    NASA Astrophysics Data System (ADS)

    Hernández-Almeida, I.; Sierro, F.-J.; Cacho, I.; Flores, J.-A.

    2014-10-01

    Subsurface water column dynamics in the subpolar North Atlantic were reconstructed in order to improve the understanding of the cause of abrupt IRD events during cold periods of the Early Pleistocene. We used Mg / Ca-based temperatures of deep-dwelling (Neogloboquadrina pachyderma sinistral) planktonic foraminifera and paired Mg / Ca-δ18O measurements to estimate the subsurface temperatures and δ18O of seawater at Site U1314. Carbon isotopes on benthic and planktonic foraminifera from the same site provide information about the ventilation and water column nutrient gradient. Mg / Ca-based temperatures and δ18O of seawater suggest increased temperatures and salinities during ice-rafting, likely due to enhanced northward subsurface transport of subtropical waters during periods of AMOC reduction. Planktonic carbon isotopes support this suggestion, showing coincident increased subsurface ventilation during deposition of ice-rafted detritus (IRD). Warm waters accumulated at subsurface would result in basal warming and break-up of ice-shelves, leading to massive iceberg discharges in the North Atlantic. Release of heat and salt stored at subsurface would help to restart the AMOC. This mechanism is in agreement with modelling and proxy studies that observe a subsurface warming in the North Atlantic in response to AMOC slowdown during the MIS3.

  15. Microgravity Effects on the Early Events of Biological Nitrogen Fixation in Medicago Truncatula: Results from the SyNRGE Experiment

    NASA Astrophysics Data System (ADS)

    Stutte, Gary W.; Roberts, Michael S.

    2013-02-01

    SyNRGE (Symbiotic Nodulation in a Reduced Gravity Environment) was a sortie mission on STS-135 in the Biological Research in Canisters (BRIC) hardware to study the effect of μg on a plant-microbe symbiosis resulting in biological nitrogen fixation. Medicago truncatula, a model species for the legume family, was inoculated with its bacterial symbiont, Sinorhizobium meliloti, to observe early biomolecular events associated with infection and nodulation in Petri Dish Fixation Units (PDFU’s). Two sets of experiments were conducted in orbit and in 24-hour delayed ground controls. Experiments were designed to determine if S. meliloti would infect M. truncatula and initiate biomolecular changes associated with nodule formation and if the μg environment altered the host plant and/or bacteria to induce nodule formation upon return to 1g. Initial analysis results demonstrate that the legumes and bacteria cultivated in μg have potential to develop a symbiotic interaction, but suggest that μg alters their ability to form nodules upon return to 1g. (Research supported by NASA ESMD/ Advance Capabilities Division grant NNX10AR09A)

  16. High-resolution late Maastrichtian early Danian oceanic 87Sr/86Sr record: Implications for Cretaceous-Tertiary boundary events

    NASA Astrophysics Data System (ADS)

    Vonhof, H. B.; Smit, J.

    1997-04-01

    A high-resolution late Maastrichtian early Danian seawater 87Sr/86Sr reference curve is constructed from two Cretaceous-Tertiary boundary (K-T boundary) sections: Bidart (France) and El Kef (Tunisia). The 87Sr/86Sr curve shows maxima at 0.3 0.4 Ma before the K-T boundary and at the K-T boundary. The first maximum could mark the onset of a major outflow of the Deccan Traps. The second maximum, a rapid 0.000 06 87Sr/86Sr, shift, extends from ˜3 4 m below to ˜1 m above the K-T boundary. This profile probably results from diagenetic smoothing of an originally sharp K-T boundary 87Sr/86Sr anomaly, rather than from a gradual process. The sharp shift could result from (1) the vaporization of the Chicxulub target rocks, (2) global wildfires, and (3) acid-rain leaching of soils and sialic surface rocks. Of these three possibilities, only Sr release by soil leaching combined with increased rainfall associated with the K-T event appears to be sufficiently large to produce the observed K-T 87Sr/86Sr anomaly.

  17. MGMT promoter hypermethylation is a frequent, early, and consistent event in astrocytoma progression, and not correlated with TP53 mutation

    PubMed Central

    Groenendijk, Floris H.; Taal, Walter; Dubbink, Hendrikus J.; Haarloo, Cathleen R.; Kouwenhoven, Mathilde C.; van den Bent, Martin J.; Kros, Johan M.

    2010-01-01

    Hypermethylation of the MGMT gene promoter and mutation of the TP53 tumor-suppressor gene are frequently present in diffuse astrocytomas. However, there is only anecdotal information about MGMT methylation status and TP53 mutations during progression of low-grade diffuse astrocytoma (AII) to anaplastic astrocytoma (AIII) and secondary glioblastoma (sGB). In this study biopsy specimens from 51 patients with astrocytic tumors with radiologically proved progression from low to high-grade malignancy were investigated for the presence and consistency of MGMT promoter hypermethylation and TP53 mutations. For 27 patients biopsy samples both of primary tumors and their recurrences were available. For the other 24 patients histology of either the low-grade lesion or the high-grade recurrence was available. It was found that MGMT promoter hypermethylation and TP53 mutations are both frequent and early events in the progression of astrocytomas and that their status is consistent over time. No correlation was found between MGMT methylation status and the presence of TP53 mutations. In addition, no correlation was found between MGMT promoter hypermethylation and the type of TP53 mutations. These results argue against the putative TP53 G:C>A:T transition mutations suggested to occur preferentially in MGMT hypermethylated tumors. PMID:20593220

  18. Altered expression of CKs 14/20 is an early event in a rat model of multistep bladder carcinogenesis.

    PubMed

    Gil da Costa, Rui M; Oliveira, Paula A; Vasconcelos-Nóbrega, Carmen; Arantes-Rodrigues, Regina; Pinto-Leite, Rosário; Colaço, Aura A; de la Cruz, Luis F; Lopes, Carlos

    2015-10-01

    Cytokeratins (CKs) 14 and 20 are promising markers for diagnosing urothelial lesions and for studying their prognosis and histogenesis. This work aimed to study the immunohistochemical staining patterns of CK14/20 during multistep carcinogenesis leading to papillary bladder cancer in a rat model. Thirty female Fischer 344 rats were divided into three groups: group 1 (control); group 2, which received N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) for 20 weeks plus 1 week without treatment; and group 3, which received BBN for 20 weeks plus 8 weeks without treatment. Bladder lesions were classified histologically. CK14 and CK20 immunostaining was assessed according to its distribution and intensity. In control animals, 0-25% of basal cells and umbrella cells stained positive for CK14 and CK20 respectively. On groups 2 and 3, nodular hyperplastic lesions showed normal CK20 and moderately increased CK14 staining (26-50% of cells). Dysplasia, squamous metaplasia, papilloma, papillary tumours of low malignant potential and low- and high-grade papillary carcinomas showed increased CK14 and CK20 immunostaining in all epithelial layers. Altered CK14 and CK20 expression is an early event in urothelial carcinogenesis and is present in a wide spectrum of urothelial superficial neoplastic and preneoplastic lesions. PMID:26515584

  19. Early Results of Three-Year Monitoring of Red Wood Ants' Behavioral Changes and Their Possible Correlation with Earthquake Events.

    PubMed

    Berberich, Gabriele; Berberich, Martin; Grumpe, Arne; Wöhler, Christian; Schreiber, Ulrich

    2013-01-01

    Short-term earthquake predictions with an advance warning of several hours or days are currently not possible due to both incomplete understanding of the complex tectonic processes and inadequate observations. Abnormal animal behaviors before earthquakes have been reported previously, but create problems in monitoring and reliability. The situation is different with red wood ants (RWA; Formica rufa-group (Hymenoptera: Formicidae)). They have stationary mounds on tectonically active, gas-bearing fault systems. These faults may be potential earthquake areas. For three years (2009-2012), two red wood ant mounds (Formica rufa-group), located at the seismically active Neuwied Basin (Eifel, Germany), have been monitored 24/7 by high-resolution cameras with both a color and an infrared sensor. Early results show that ants have a well-identifiable standard daily routine. Correlation with local seismic events suggests changes in the ants' behavior hours before the earthquake: the nocturnal rest phase and daily activity are suppressed, and standard daily routine does not resume until the next day. At present, an automated image evaluation routine is being applied to the more than 45,000 hours of video streams. Based on this automated approach, a statistical analysis of the ants' behavior will be carried out. In addition, other parameters (climate, geotectonic and biological), which may influence behavior, will be included in the analysis. PMID:26487310

  20. Early life events carry over to influence pre-migratory condition in a free-living songbird.

    PubMed

    Mitchell, Greg W; Guglielmo, Christopher G; Wheelwright, Nathaniel T; Freeman-Gallant, Corey R; Norris, D Ryan

    2011-01-01

    Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1(st) year survival and nestling mass in migratory Savannah sparrows (Passerculus sandwichensis). We also use a brood manipulation experiment to show that nestlings from smaller broods have higher mass in the nest relative to individuals from larger broods. Having established these relationships, we then use three years of field data involving multiple captures of individuals throughout the pre-migratory period and a multi-level path model to examine the hypothesis that conditions during development limit survival during migration by affecting an individual's ability to accumulate sufficient lean tissue and fat mass prior to migration. We found a positive relationship between fat mass during the pre-migratory period (Sept-Oct) and nestling mass and a negative indirect relationship between pre-migratory fat mass and fledging date. Our results provide the first evidence that conditions during development limit survival during migration through their effect on fat stores. These results are particularly important given recent evidence showing that body condition of songbirds at fledging is affected by climate change and anthropogenic changes to landscape structure. PMID:22194925

  1. Replication in Practice: Lessons from Five Lead Agencies

    ERIC Educational Resources Information Center

    McGonigel, Mary

    2005-01-01

    This article describes the replication efforts of five programs funded by the Pritzker Early Childhood Foundation and determines what methods are key to replication success. Before replication can take place, the lead agency must have substantial evidence of its effectiveness and know its core elements. It must also think carefully about how its…

  2. Inhibition of the FACT Complex Reduces Transcription from the Human Cytomegalovirus Major Immediate Early Promoter in Models of Lytic and Latent Replication.

    PubMed

    O'Connor, Christine M; Nukui, Masatoshi; Gurova, Katerina V; Murphy, Eain A

    2016-04-01

    The successful colonization of the majority of the population by human cytomegalovirus is a direct result of the virus's ability to establish and, more specifically, reactivate from latency. The underlying cellular factors involved in viral reactivation remain unknown. Here, we show that the host complexfacilitateschromatintranscription (FACT) binds to the major immediate early promoter (MIEP) and that inhibition of this complex reduces MIEP transactivation, thus inhibiting viral reactivation. PMID:26865717

  3. Replicating repetitive DNA.

    PubMed

    Tognetti, Silvia; Speck, Christian

    2016-05-27

    The function and regulation of repetitive DNA, the 'dark matter' of the genome, is still only rudimentarily understood. Now a study investigating DNA replication of repetitive centromeric chromosome segments has started to expose a fascinating replication program that involves suppression of ATR signalling, in particular during replication stress. PMID:27230530

  4. Transcriptomic dose-and-time-course indicators of early key events in a cytotoxicity-mediated mode of action for rodent urinary bladder tumorigenesis

    EPA Science Inventory

    TRANSCRIPTOMIC DOSE- AND TIME-COURSE INDICATORS OF EARLY KEY EVENTS IN A CYTOTOXICITY-MEDIATED MODE OF ACTION FOR RODENT URINARY BLADDER TUMORIGENESISDiuron is a substituted urea compound used globally as an herbicide. Urinary bladder tumors were induced in rats after chronic die...

  5. Early Events in the Life of Apple Roots: Variation in Root Growth Rate is Linked to Mycorrhizal and Nonmycorrhizal Fungal Colonization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A study was conducted to characterize early events of mycorrhizal and nonmycorrhizal fungal colonization in newly-emerging roots of mature apple (Malus domestica) trees and to determine the relationship to fine root growth rate and development. New roots were traced on root windows to measure growt...

  6. Dose-response modeling of early molecular and cellular key events in the CAR-mediated hepatocarcinogenesis pathway.

    PubMed

    Geter, David R; Bhat, Virunya S; Gollapudi, B Bhaskar; Sura, Radhakrishna; Hester, Susan D

    2014-04-01

    Low-dose extrapolation and dose-related transitions are paramount in the ongoing debate regarding the quantification of cancer risks for nongenotoxic carcinogens. Phenobarbital (PB) is a prototypical nongenotoxic carcinogen that activates the constitutive androstane receptor (CAR) resulting in rodent liver tumors. In this study, male and female CD-1 mice administered dietary PB at 0, 0.15, 1.5, 15, 75, or 150 mg/kg-day for 2 or 7 days to characterize multiple apical and molecular endpoints below, at (∼75 mg/kg-day), and above the carcinogenic dose level of PB and examine these responses using benchmark dose modeling. Linear toxicokinetics were observed for all doses. Increased liver weight, hepatocellular hypertrophy, and mitotic figures were seen at 75 and 150 mg/kg-day. CAR activation, based on Cyp2b qPCR and pentoxyresorufin dealkylase activity, occurred at doses ≥ 1.5 mg/kg-day. The no-observable transcriptional effect level for global gene expression was 15 mg/kg-day. At 2 days, several xenobiotic metabolism and cell protective pathways were activated at lower doses and to a greater degree in females. However, hepatocellular proliferation, quantified by bromodeoxyuridine immunohistochemistry, was the most sensitive indicator of PB exposure with female mice more sensitive than males, contrary to sex-specific differences in sensitivity to hepatocarcinogenesis. Taken together, the identification of low-dose cellular and molecular transitions in the subtumorigenic dose range aids the understanding of early key events in CAR-mediated hepatocarcinogenesis. PMID:24449422

  7. Increased apoptosis and proliferative capacity are early events in cyst formation in autosomal-dominant, polycystic kidney disease.

    PubMed

    Ibrahim, Salwa

    2007-01-01

    Previous studies have highlighted epithelial proliferation and apoptosis in the cyst lining as common features in animal models of cystic disease. In this study, we sought to evaluate the timing and extent of these changes in renal tissue obtained from patients with autosomal-dominant, polycystic kidney disease (ADPKD) subjected for nephrectomy for a variety of clinical indications. Cell proliferation was assessed using an antibody to proliferating cell nuclear antigen (PCNA), and apoptosis was evaluated by the use of terminal deoxynucleotidyl transferase (TdT) digoxigenin-deoxyuridine (dUTP) nick end-labeling technique (ApopTag(R)). The origin of cystic structures was evaluated using antibodies to epithelial membrane antigen (EMA). The lineage of interstitial mononuclear cells was assessed by anti CD 45 and CD 68 monoclonal antibodies. We found an increased rate of proliferation within the epithelium, not only of cystic, but also of noncystic, tubules that was significantly higher than the corresponding values from normal kidney (p pound 0.0001). Apoptotic index values were significantly increased within the epithelium lining noncystic and cystic structures (p < 0.001). In the interstitium, increased proliferation and apoptosis rates were also noted. Interstitial infiltrates were dense and consisted mainly of CD 68-positive macrophages and CD 45-positive lymphocytes. The present study demonstrated that changes in cell turnover are early events in cyst formation. The observation of mild proportionate elevation of both proliferation and apoptosis values of the epithelium lining cysts explains the lack of increase risk of renal cell carcinoma in ADPKD. The development of heavy interstitial inflammation could contribute to progressive tubulointerstitial scarring, leading to progressive renal failure. PMID:18040538

  8. Peptide YY expression is an early event in colonic endocrine cell differentiation: evidence from normal and transgenic mice.

    PubMed

    Upchurch, B H; Fung, B P; Rindi, G; Ronco, A; Leiter, A B

    1996-04-01

    The hormone peptide YY is produced by endocrine cells in the pancreas, ileum and colon. We have previously shown that peptide YY is coexpressed in all four islet cell types in the murine pancreas when they first appear, suggesting a common peptide YY-producing progenitor. In the colon, peptide YY has been frequently identified in glucagon-expressing L-type endocrine cells. Characterization of colonic endocrine tumors in transgenic mice expressing simian virus 40 large T antigen under the control of the peptide YY gene 5' flanking region revealed tumor cells producing not only peptide YY and glucagon, but also neurotensin, cholecystokinin, substance P, serotonin, secretin, and gastrin. This suggested that multiple enteroendocrine lineages were related to peptide YY-producing cells. Subsequent examination of the ontogeny of colonic endocrine differentiation in nontransgenic mice revealed that peptide YY was the first hormone to appear during development, at embryonic day 15.5. Between embryonic days 16.5 and 18.5, cells expressing glucagon, cholecystokinin, substance P, serotonin, secretin, neurotensin, gastrin and somatostatin first appeared and peptide YY was coexpressed in each cell type at this time. Peptide YY coexpression continued in a significant fraction of most enteroendocrine cell types throughout fetal and postnatal development and into adulthood, with the exception of serotonin-producing cells. This latter population of cells expanded dramatically after birth with rare coexpression of peptide YY. These studies indicate that expression of peptide YY is an early event in colonic endocrine differentiation and support the existence of a common progenitor for all endocrine cells in the colon. PMID:8620842

  9. Strong alkalinization of Chara cell surface in the area of cell wall incision as an early event in mechanoperception.

    PubMed

    Bulychev, Alexander A; Alova, Anna V; Bibikova, Tatiana N

    2013-11-01

    Mechanical wounding of cell walls occurring in plants under the impact of pathogens or herbivores can be mimicked by cell wall incision with a glass micropipette. Measurements of pH at the surface of Chara corallina internodes following microperforation of cell wall revealed a rapid (10-30s) localized alkalinization of the apoplast after a lag period of 10-20s. The pH increase induced by incision could be as large as 3 pH units and relaxed slowly, with a halftime up to 20min. The axial pH profile around the incision zone was bell-shaped and localized to a small area, extending over a distance of about 100μm. The pH response was suppressed by lowering cell turgor upon the replacement of artificial pond water (APW) with APW containing 50mM sorbitol. Stretching of the plasma membrane during its impression into the cell wall defect is likely to activate the Ca(2+) channels, as evidenced from sensitivity of the incision-induced alkalinization to the external calcium concentration and to the addition of Ca(2+)-channel blockers, such as La(3+), Gd(3+), and Zn(2+). The maximal pH values attained at the incision site (~10.0) were close to pH in light-dependent alkaline zones of Chara cells. The involvement of cytoskeleton in the origin of alkaline patch was documented by observations that the incision-induced pH transients were suppressed by the inhibitors of microtubules (oryzalin and taxol) and, to a lesser extent, by the actin inhibitor (cytochalasin B). The results indicate that the localized increase in apoplastic pH is an early event in mechanoperception and depends on light, cytoskeleton, and intracellular calcium. PMID:23850637

  10. Overexpression of cellular inhibitor of apoptosis protein 2 is an early event in the progression of pancreatic cancer

    PubMed Central

    Esposito, Irene; Kleeff, Jörg; Abiatari, Ivane; Shi, Xined; Giese, Nathalia; Bergmann, Frank; Roth, Wilfried; Friess, Helmut; Schirmacher, Peter

    2007-01-01

    Aim To determine the role of two antiapoptotic proteins of the inhibitor of apoptosis protein family, cellular inhibitor of apoptosis protein 1 (cIAP1) and cellular inhibitor of apoptosis protein 2 (cIAP2), in human pancreatic carcinogenesis. Methods mRNA levels were measured in pancreatic tissues and pancreatic cancer cell lines by quantitative reverse transcriptase PCR. Protein expression was assessed in pancreatic cancer cell lines by immunoblotting and in pancreatic tissues by immunohistochemistry, and correlated with pathological and survival data. Results cIAP1 expression was constantly high in non‐neoplastic pancreatic tissues, in pancreatic intraepithelial neoplasia (PanIN) lesions, as well as in a subset of primary and metastatic pancreatic ductal adenocarcinomas (PDAC), and a preferential cytoplasmatic localisation was observed in the tumour tissues. cIAP1 expression was rare in a cohort of cystic tumours. cIAP2 mRNA levels were significantly higher (2.4 fold) in PDAC than in normal tissues. cIAP2 protein was overexpressed in PDAC, and was detectable in low‐ and high‐grade PanIN lesions. Moreover, cIAP2 was often expressed in pancreatic cystic tumours. cIAP1 and cIAP2 mRNA and protein were detected in all the examined cell lines. Survival analysis revealed a shorter survival in patients with cIAP1/cIAP2‐positive tumours. Conclusions cIAP1 might contribute to the regulation of the apoptotic process in the normal and in the neoplastic pancreas, depending on its subcellular localisation. Overexpression of cIAP2 is a common and early event in the progression of pancreatic cancer, and could therefore potentially influence the important pathophysiological aspects of PDAC, such as anoikis or chemoresistance. PMID:16775116

  11. Increased cytosine DNA-methyltransferase activity is target-cell-specific and an early event in lung cancer.

    PubMed Central

    Belinsky, S A; Nikula, K J; Baylin, S B; Issa, J P

    1996-01-01

    The association between increased DNA-methyltransferase (DNA-MTase) activity and tumor development suggest a fundamental role for this enzyme in the initiation and progression of cancer. A true functional role for DNA-MTase in the neoplastic process would be further substantiated if the target cells affected by the initiating carcinogen exhibit changes in enzyme activity. This hypothesis was addressed by examining DNA-MTase activity in alveolar type II (target) and Clara (nontarget) cells from A/J and C3H mice that exhibit high and low susceptibility, respectively, for lung tumor formation. Increased DNA-MTase activity was found only in the target alveolar type II cells of the susceptible A/J mouse and caused a marked increase in overall DNA methylation in these cells. Both DNA-MTase and DNA methylation changes were detected 7 days after carcinogen exposure and, thus, were early events in neoplastic evolution. Increased gene expression was also detected by RNA in situ hybridization in hypertrophic alveolar type II cells of carcinogen-treated A/J mice, indicating that elevated levels of expression may be a biomarker for premalignancy. Enzyme activity increased incrementally during lung cancer progression and coincided with increased expression of the DNA-MTase activity are strongly associated with neoplastic development and constitute a key step in carcinogenesis. The detection of premalignant lung disease through increased DNA-MTase expression and the possibility of blocking the deleterious effects of this change with specific inhibitors will offer new intervention strategies for lung cancer. Images Fig. 2 PMID:8633014

  12. Nucleotides in the polyomavirus enhancer that control viral transcription and DNA replication.

    PubMed Central

    Tang, W J; Berger, S L; Triezenberg, S J; Folk, W R

    1987-01-01

    The polyomavirus enhancer is required in cis for high-level expression of the viral early region and for replication of the viral genome. We introduced multiple mutations in the enhancer which reduced transcription and DNA replication. Polyomaviruses with these mutant enhancers formed very small plaques in whole mouse embryo cells. Revertants of the viral mutants were isolated and characterized. Reversion occurred by any of the following events: restoration of guanosines at nucleotide (nt) 5134 and nt 5140 within the adenovirus 5 E1A enhancer core AGGAAGTGACT; acquisition of an A----G mutation at nt 5258, which is the same mutation that enables polyomavirus to grow in embryonal carcinoma F9 cells; duplication of mutated sequences between nt 5146 and 5292 (including sequences homologous with immunoglobulin G, simian virus 40, and bovine papillomavirus enhancer elements). Reversion restored both the replicative and transcriptional functions of the viruses. Revertants that acquired the F9 mutation at nt 5258 grew at least 20-fold better than the original mutant in whole mouse embryo cells, but replicated only marginally better than the original mutant in 3T6 cells. Viruses with a reversion of the mutation at nt 5140 replicated equally well in both types of cells. Since individual nucleotides in the polyomavirus enhancer simultaneously altered DNA replication and transcription in specific cell types, it is likely that these processes rely upon a common element, such as an enhancer-binding protein. Images PMID:3037332

  13. Plate tectonics hiati as the cause of global glaciations: 1. Early Proterozoic events and the rise of oxygen

    NASA Astrophysics Data System (ADS)

    Osmaston, M. F.

    2003-04-01

    Plate tectonics is the main way in which the Earth's internal heat is brought to the surface and lost, so it seems that global tectonics should not stop and start. Consequently the long-standing fact that, globally, no orogenic granitoid or greenstone U-Pb ages have been found in the 2.45--2.22 Ga interval has been attributed to defective sampling. Here I argue that this interval was indeed a prolonged hiatus in plate tectonics, being the first of two. The other, but differently caused, was in the late Proterozoic and is the topic of Part 2. The feature common to both hiati, and relevant to global glaciation, is that mid-ocean ridges (MORs) die and subside, potentially lowering sea-level by several kilometres, causing loss of atmospheric CO2 by weathering and an increase in planetary albedo. For the origin of the first hiatus we must first go back to formation of the core. The current iron-percolation model is invalidated by the fact that its corollary, the arrival of a water and siderophile-rich "late veneer" at the end of percolation, would be required to arrive some 60 Ma after the Moon, which never had a late veneer, was already in Earth orbit. The available alternative [1] would have given the early Earth a wet and low-viscosity convecting mantle able to dispose of the early heat with high efficiency; so that by 2.8 Ga MORs began to deepen, exposing cratons to massive weathering which lowered atmospheric CO2. The well-documented late Archaean acceleration of crustal addition to cratons, or, more precisely, of TTG-granitoid intrusion of greenstone belts, is also, paradoxically, evidence of waning mantle heat. Such wide-belt intrusion, grouped into quasi-coeval 'events', are examples of post-subduction magmatism (PSM), marking interruption of flat-slab subduction under a greenstone belt when a microcraton arrived [2]. On each occasion the TTG, derived from the subducted and reheated oceanic crust, advected subducting-plate heat to the surface that would

  14. Role of the SV40 enhancer in the early to late shift in viral transcription.

    PubMed Central

    Kelly, J J; Wildeman, A G

    1991-01-01

    Simian virus 40 large tumor antigen is a multifunctional protein, with two of its roles being the promotion of viral DNA replication and replication-independent activation of viral transcription. Replication leads to a shift in transcription from the early-early to the late and late-early cap sites, through mechanisms poorly understood. The viral transcription enhancer contains sequences important for both early and late transcription, and we therefore have carried out experiments to evaluate its role in these events. We find that the ability of replication to lead to a shift diminishes when early-early transcription is made increasingly stronger by multimerizing the enhancer, and suggest that replication might lead to the shift by interfering with the ability of the enhancer to direct initiation to those sites. The natural situation in the virus of having two copies of this element might represent a compromise between maximizing both T antigen expression early in infection and late gene expression after replication begins. We also show that replication-independent transcription activation by T antigen is bidirectional and involves at least in part elements to which the factor TEF-1 binds. Images PMID:1662364

  15. The evolution of replicators.

    PubMed Central

    Szathmáry, E

    2000-01-01

    Replicators of interest in chemistry, biology and culture are briefly surveyed from a conceptual point of view. Systems with limited heredity have only a limited evolutionary potential because the number of available types is too low. Chemical cycles, such as the formose reaction, are holistic replicators since replication is not based on the successive addition of modules. Replicator networks consisting of catalytic molecules (such as reflexively autocatalytic sets of proteins, or reproducing lipid vesicles) are hypothetical ensemble replicators, and their functioning rests on attractors of their dynamics. Ensemble replicators suffer from the paradox of specificity: while their abstract feasibility seems to require a high number of molecular types, the harmful effect of side reactions calls for a small system size. No satisfactory solution to this problem is known. Phenotypic replicators do not pass on their genotypes, only some aspects of the phenotype are transmitted. Phenotypic replicators with limited heredity include genetic membranes, prions and simple memetic systems. Memes in human culture are unlimited hereditary, phenotypic replicators, based on language. The typical path of evolution goes from limited to unlimited heredity, and from attractor-based to modular (digital) replicators. PMID:11127914

  16. Replicational organization of three weakly expressed loci in Physarum polycephalum.

    PubMed

    Maric, Chrystelle; Swanston, Emma; Bailey, Juliet; Pierron, Gérard

    2002-06-01

    We previously mapped early-activated replication origins in the promoter regions of five abundantly transcribed genes in the slime mold Physarum polycephalum. This physical linkage between origins and genes is congruent with the preferential early replication of the active genes in mammalian cells. To determine how general this replicational organization is in the synchronous plasmodium of Physarum, we analyzed the replication of three weakly expressed genes. Bromodeoxyuridine (BrdUrd) density-shift and gene dosage experiments indicated that the redB (regulated in development) and redE genes replicate early, whereas redA replicates in mid-S phase. Bi-dimensional gel electrophoresis revealed that redA coincides with an origin that appears to be activated within a large temporal window in S phase so that the replication of the gene is not well defined temporally. The early replication of the redB and redE genes is due to the simultaneous activation of flanking origins at the onset of S phase. As a result, these two genes correspond to termination sites of DNA replication. Our data demonstrate that not all the Physarum promoters are preferred sites of initiation but, so far, all the expressed genes analyzed in detail either coincide with a replication origin or are embedded into a cluster of early firing replicons. PMID:12034812

  17. Self-replicating systems.

    PubMed

    Clixby, Gregory; Twyman, Lance

    2016-05-01

    Over the past 25 years, there has been a surge of development in research towards self-replication and self-replicating systems. The interest in these systems relates to one of the most fundamental questions posed in all fields of science - How did life on earth begin? Investigating how the self-replication process evolved may hold the key to understanding the emergence and evolution of living systems and, ultimately, gain a clear insight into the origin of life on earth. This introductory review aims to highlight the fundamental prerequisites of self-replication along with the important research that has been conducted over the past few decades. PMID:27086507

  18. Combination of High Rate, Real-Time GNSS and Accelerometer Observations and Rapid Seismic Event Notification for Earthquake Early Warning and Volcano Monitoring with a Focus on the Pacific Rim.

    NASA Astrophysics Data System (ADS)

    Zimakov, L. G.; Passmore, P.; Raczka, J.; Alvarez, M.; Jackson, M.

    2014-12-01

    Scientific GNSS networks are moving towards a model of real-time data acquisition, epoch-by-epoch storage integrity, and on-board real-time position and displacement calculations. This new paradigm allows the integration of real-time, high-rate GNSS displacement information with acceleration and velocity data to create very high-rate displacement records. The mating of these two instruments allows the creation of a new, very high-rate (200 sps) displacement observable that has the full-scale displacement characteristics of GNSS and high-precision dynamic motions of seismic technologies. It is envisioned that these new observables can be used for earthquake early warning studies, volcano monitoring, and critical infrastructure monitoring applications. Our presentation will focus on the characteristics of GNSS, seismic, and strong motion sensors in high dynamic environments, including historic earthquakes in Southern California and the Pacific Rim, replicated on a shake table, over a range of displacements and frequencies. We will explore the optimum integration of these sensors from a filtering perspective including simple harmonic impulses over varying frequencies and amplitudes and under the dynamic conditions of various earthquake scenarios. In addition we will discuss implementation of a Rapid Seismic Event Notification System that provides quick delivery of digital data from seismic stations to the acquisition and processing center and a full data integrity model for real-time earthquake notification that provides warning prior to significant ground shaking.

  19. Cardiovascular events prior to or early after diagnosis of systemic lupus erythematosus in the systemic lupus international collaborating clinics cohort

    PubMed Central

    Urowitz, M B; Gladman, D D; Anderson, N M; Su, J; Romero-Diaz, J; Bae, S C; Fortin, P R; Sanchez-Guerrero, J; Clarke, A; Bernatsky, S; Gordon, C; Hanly, J G; Wallace, D J; Isenberg, D; Rahman, A; Merrill, J; Ginzler, E; Alarcón, G S; Fessler, B F; Petri, M; Bruce, I N; Khamashta, M; Aranow, C; Dooley, M; Manzi, S; Ramsey-Goldman, R; Sturfelt, G; Nived, O; Steinsson, K; Zoma, A; Ruiz-Irastorza, G; Lim, S; Kalunian, K C; Ỉnanç, M; van Vollenhoven, R; Ramos-Casals, M; Kamen, D L; Jacobsen, S; Peschken, C; Askanase, A; Stoll, T

    2016-01-01

    Objective To describe the frequency of myocardial infarction (MI) prior to the diagnosis of systemic lupus erythematosus (SLE) and within the first 2 years of follow-up. Methods The systemic lupus international collaborating clinics (SLICC) atherosclerosis inception cohort enters patients within 15 months of SLE diagnosis. MIs were reported and attributed on a specialised vascular event form. MIs were confirmed by one or more of the following: abnormal ECG, typical or atypical symptoms with ECG abnormalities and elevated enzymes (≥2 times upper limit of normal), or abnormal stress test, echocardiogram, nuclear scan or angiogram. Descriptive statistics were used. Results 31 of 1848 patients who entered the cohort had an MI. Of those, 23 patients had an MI prior to SLE diagnosis or within the first 2 years of disease. Of the 23 patients studied, 60.9% were female, 78.3% were Caucasian, 8.7% black, 8.7% Hispanic and 4.3% other. The mean age at SLE diagnosis was 52.5±15.0 years. Of the 23 MIs that occurred, 16 MIs occurred at a mean of 6.1±7.0 years prior to diagnosis and 7 occurred within the first 2 years of follow-up. Risk factors associated with early MI in univariate analysis are male sex, Caucasian, older age at diagnosis, hypertension, hypercholesterolaemia, family history of MI and smoking. In multivariate analysis only age (OR=1.06 95% CI 1.03 to 1.09), hypertension (OR=5.01, 95% CI 1.38 to 18.23), hypercholesterolaemia (OR=4.43, 95% CI 1.51 to 12.99) and smoking (OR=7.50, 95% CI 2.38 to 23.57) remained significant risk factors. Conclusions In some patients with lupus, MI may develop even before the diagnosis of SLE or shortly thereafter, suggesting that there may be a link between autoimmune inflammation and atherosclerosis. PMID:27099765

  20. Infection of Brachypodium distachyon by formae speciales of Puccinia graminis: early infection events and host-pathogen incompatibility.

    PubMed

    Figueroa, Melania; Alderman, Stephen; Garvin, David F; Pfender, William F

    2013-01-01

    Puccinia graminis causes stem rust, a serious disease of cereals and forage grasses. Important formae speciales of P. graminis and their typical hosts are P. graminis f. sp. tritici (Pg-tr) in wheat and barley, P. graminis f. sp. lolii (Pg-lo) in perennial ryegrass and tall fescue, and P. graminis f. sp. phlei-pratensis (Pg-pp) in timothy grass. Brachypodium distachyon is an emerging genetic model to study fungal disease resistance in cereals and temperate grasses. We characterized the P. graminis-Brachypodium pathosystem to evaluate its potential for investigating incompatibility and non-host resistance to P. graminis. Inoculation of eight Brachypodium inbred lines with Pg-tr, Pg-lo or Pg-pp resulted in sporulating lesions later accompanied by necrosis. Histological analysis of early infection events in one Brachypodium inbred line (Bd1-1) indicated that Pg-lo and Pg-pp were markedly more efficient than Pg-tr at establishing a biotrophic interaction. Formation of appressoria was completed (60-70% of germinated spores) by 12 h post-inoculation (hpi) under dark and wet conditions, and after 4 h of subsequent light exposure fungal penetration structures (penetration peg, substomatal vesicle and primary infection hyphae) had developed. Brachypodium Bd1-1 exhibited pre-haustorial resistance to Pg-tr, i.e. infection usually stopped at appressorial formation. By 68 hpi, only 0.3% and 0.7% of the Pg-tr urediniospores developed haustoria and colonies, respectively. In contrast, development of advanced infection structures by Pg-lo and Pg-pp was significantly more common; however, Brachypodium displayed post-haustorial resistance to these isolates. By 68 hpi the percentage of urediniospores that only develop a haustorium mother cell or haustorium in Pg-lo and Pg-pp reached 8% and 5%, respectively. The formation of colonies reached 14% and 13%, respectively. We conclude that Brachypodium is an apt grass model to study the molecular and genetic components of incompatiblity

  1. The influence of the thermal environment and other early life events on growth rate of piglets during lactation.

    PubMed

    Pedersen, L J; Schild, S-L Aa; Malmkvist, J

    2015-09-01

    The effects of early life events on average daily weight gain from birth to day 21 (ADG) of suckling pigs kept at different room temperatures (15°C, 20°C and 25°C) from birth to weaning were investigated. Data were collected from litters born by 61 sows in a loose housing system. The ADG for piglets with low birth weight (estimated for birth weights below the 10% percentile) was estimated to be 20 to 30 g higher per day at room temperature 20°C to 25°C compared with 15°C. In contrast, the ADG during the lactation period decreased for larger piglets (estimated for birth weights above the 10% percentile) by 28 g/day at room temperature 25°C compared with 15°C. Thus, high ambient temperatures (20°C to 25°C) are favourable for the growth in smaller piglets during lactation. Neither latency to first suckle nor birth-induced hypoxia, measured as concentration of umbilical cord lactate, affected the growth rate of the piglets. Lowest rectal temperature during the first 24 h after birth had a long-term negative effect on ADG (P<0.05), so that piglets with a lowest rectal temperature of 32.8°C (10% percentile) had an ADG which was on average 19 g lower per day than piglets with a rectal temperature of 37.3°C (90% percentile). Our results showed that hypothermia at birth, low birth weight and high number of suckling piglets lead to reduced ADG during the suckling period. The results suggest that keeping the room temperature at 20°C during lactation to some extent could compensate for the otherwise negative effects of low birth weight on ADG in piglets without decreasing the ADG of high birth weight piglets. However, to avoid hypothermia in the smallest piglets it may be beneficial to increase the room temperature above 20°C during the farrowing period of loose housed sows. PMID:26094618

  2. Infection of Brachypodium distachyon by Formae Speciales of Puccinia graminis: Early Infection Events and Host-Pathogen Incompatibility

    PubMed Central

    Figueroa, Melania; Alderman, Stephen; Garvin, David F.; Pfender, William F.

    2013-01-01

    Puccinia graminis causes stem rust, a serious disease of cereals and forage grasses. Important formae speciales of P. graminis and their typical hosts are P. graminis f. sp. tritici (Pg-tr) in wheat and barley, P. graminis f. sp. lolii (Pg-lo) in perennial ryegrass and tall fescue, and P. graminis f. sp. phlei-pratensis (Pg-pp) in timothy grass. Brachypodium distachyon is an emerging genetic model to study fungal disease resistance in cereals and temperate grasses. We characterized the P. graminis-Brachypodium pathosystem to evaluate its potential for investigating incompatibility and non-host resistance to P. graminis. Inoculation of eight Brachypodium inbred lines with Pg-tr, Pg-lo or Pg-pp resulted in sporulating lesions later accompanied by necrosis. Histological analysis of early infection events in one Brachypodium inbred line (Bd1-1) indicated that Pg-lo and Pg-pp were markedly more efficient than Pg-tr at establishing a biotrophic interaction. Formation of appressoria was completed (60–70% of germinated spores) by 12 h post-inoculation (hpi) under dark and wet conditions, and after 4 h of subsequent light exposure fungal penetration structures (penetration peg, substomatal vesicle and primary infection hyphae) had developed. Brachypodium Bd1-1 exhibited pre-haustorial resistance to Pg-tr, i.e. infection usually stopped at appressorial formation. By 68 hpi, only 0.3% and 0.7% of the Pg-tr urediniospores developed haustoria and colonies, respectively. In contrast, development of advanced infection structures by Pg-lo and Pg-pp was significantly more common; however, Brachypodium displayed post-haustorial resistance to these isolates. By 68 hpi the percentage of urediniospores that only develop a haustorium mother cell or haustorium in Pg-lo and Pg-pp reached 8% and 5%, respectively. The formation of colonies reached 14% and 13%, respectively. We conclude that Brachypodium is an apt grass model to study the molecular and genetic components of incompatiblity

  3. Single-Cell and Single-Cycle Analysis of HIV-1 Replication.

    PubMed

    Holmes, Mowgli; Zhang, Fengwen; Bieniasz, Paul D

    2015-06-01

    The dynamics of the late stages of the HIV-1 life cycle are poorly documented. Viral replication dynamics are typically measured in populations of infected cells, but asynchrony that is introduced during the early steps of HIV-1 replication complicates the measurement of the progression of subsequent steps and can mask replication dynamics and their variation in individual infected cells. We established microscopy-based methods to dynamically measure HIV-1-encoded reporter gene and antiviral gene expression in individual infected cells. We coupled these measurements with conventional analyses to quantify delays in the HIV-1 replication cycle imposed by the biphasic nature of HIV-1 gene expression and by the assembly-inhibiting property of the matrix domain of Gag. We further related the dynamics of restriction factor (APOBEC3G) removal to the dynamics of HIV-1 replication in individual cells. These studies provide a timeline for key events in the HIV-1 replication cycle, and reveal that the interval between the onset of early and late HIV-1 gene expression is only ~3 h, but matrix causes a ~6-12 h delay in the generation of extracellular virions. Interestingly, matrix delays particle assembly to a time at which APOBEC3G has largely been removed from the cell. Thus, a need to prepare infected cells to be efficient producers of infectious HIV-1 may provide an impetus for programmed delays in HIV-1 virion genesis. Our findings also emphasize the significant heterogeneity in the length of the HIV-1 replication cycle in homogenous cell populations and suggest that a typical infected cell generates new virions for only a few hours at the end of a 48 h lifespan. Therefore, small changes in the lifespan of infected cells might have a large effect on viral yield in a single cycle and the overall clinical course in infected individuals. PMID:26086614

  4. Improved cell survival by the reduction of immediate-early gene expression in replication-defective mutants of herpes simplex virus type 1 but not by mutation of the virion host shutoff function.

    PubMed Central

    Johnson, P A; Wang, M J; Friedmann, T

    1994-01-01

    Derivatives of herpes simplex virus type 1 (HSV-1) have elicited considerable interest as gene transfer vectors because of their ability to infect a wide range of cell types efficiently, including fully differentiated neurons. However, it has been found that infection of many types of cell with vectors derived from replication-defective mutants of HSV-1 is associated with cytopathic effects (CPE). We have previously shown that viral gene expression played an important role in the induction of CPE caused by an HSV-1 mutant deleted for the essential immediate-early gene 3 (IE 3) (P.A. Johnson, A. Miyanohara, F. Levine, T. Cahill, and T. Friedmann, J. Virol. 66:2952-2965, 1992). We have investigated which viral genes might be responsible for CPE by comparing the ability of each of the individual genes expressed by an IE 3 deletion mutant during a nonproductive infection to inhibit biochemical transformation after cotransfection of BHK or CV-1 cells with a selectable marker gene. Transfection of IE genes 1,2, and 4 individually all caused a marked inhibition of colony formation, while transfection of IE 5 and the large subunit of ribonucleotide reductase had little effect. These results suggested that it would be necessary to mutate or reduce the expression of nearly all HSV-1 IE genes to reduce virus-induced CPE. Therefore, we have used VP16 mutants, which are unable to transinduce IE gene expression (C. I. Ace, T. A. McKee, J. M. Ryan, J. M. Cameron, and C. M. Preston, J. Virol. 63:2260-2269, 1989), to derive two replication-defective strains: 14H delta 3, which is deleted for both copies of IE 3, and in 1850 delta 42, which has a deletion in the essential early gene UL42. The IE 3-VP16 double mutant, 14H delta 3, is significantly less toxic than a single IE 3 deletion mutant over a range of multiplicities of infection, as measured in a cell-killing assay, and has an enhanced ability to persist in infected cells in a biologically retrievable form. In contrast, the UL

  5. The DNA repair endonuclease Mus81 facilitates fast DNA replication in the absence of exogenous damage

    PubMed Central

    Fu, Haiqing; Martin, Melvenia M.; Regairaz, Marie; Huang, Liang; You, Yang; Lin, Chi-Mei; Ryan, Michael; Kim, RyangGuk; Shimura, Tsutomu; Pommier, Yves; Aladjem, Mirit I.

    2015-01-01

    The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication initiation events. In the absence of Mus81 endonuclease activity, DNA synthesis is slowed and replication initiation events are more frequent. In addition, Mus81 deficient cells fail to recover from exposure to low doses of replication inhibitors and cell viability is dependent on the XPF endonuclease. Despite an increase in replication initiation frequency, cells lacking Mus81 use the same pool of replication origins as Mus81-expressing cells. Therefore, decelerated DNA replication in Mus81 deficient cells does not initiate from cryptic or latent origins not used during normal growth. These results indicate that Mus81 plays a key role in determining the rate of DNA replication without activating a novel group of replication origins. PMID:25879486

  6. Who Needs Replication?

    ERIC Educational Resources Information Center

    Porte, Graeme

    2013-01-01

    In this paper, the editor of a recent Cambridge University Press book on research methods discusses replicating previous key studies to throw more light on their reliability and generalizability. Replication research is presented as an accepted method of validating previous research by providing comparability between the original and replicated…

  7. Tectonic setting of the North Gondwana margin during the Early Ordovician: A comparison of the Ollo de Sapo and Famatina magmatic events

    NASA Astrophysics Data System (ADS)

    Del Greco, Kassandra; Johnston, Stephen T.; Shaw, Jessica

    2016-06-01

    This paper presents a comparison of compiled geochronological and geochemical data from the Ollo de Sapo and Famatina magmatic events. The Ollo de Sapo magmatic sequence is located in northwest Iberia and was emplaced during the early-Ordovician from 495 to 474 Ma. The Famatina Complex is a magmatic sequence located in Northern Argentina that was emplaced during the early- to mid-Ordovician from 483 to 463 Ma. These magmatic events are currently interpreted to have been emplaced in different tectonic settings despite both having occurred along the North Gondwana margin. Geochronological data indicates that these magmatic events occurred contemporaneously over at least 9 m.y. and therefore can provide a snapshot of the northern Gondwana margin during the mid-Ordovician. Major element data indicates that both magmatic suites are calc-alkaline to alkali-calcic and trace element and REE data show magmatic signatures that are indistinguishable. This study highlights the similarity between the Ollo de Sapo and the Famatina magmatic suites and discusses alternative models for their emplacement based on paleomagnetic and paleobiogeographical data. These data indicate that the Ollo de Sapo was likely emplaced in a subduction zone setting, while the Famatina magmatic suite may be of parautochthonous origin to Gondwana, implying that the Pampeanan margin may not have been active during the early- to mid-Ordovician.

  8. ATP Depletion Via Mitochondrial F1F0 Complex by Lethal Factor is an Early Event in B. Anthracis-Induced Sudden Cell Death.

    PubMed

    Woodberry, Mitchell W; Aguilera-Aguirre, Leopoldo; Bacsi, Attila; Chopra, Ashok K; Kurosky, Alexander; Peterson, Johnny W; Boldogh, Istvan

    2009-01-01

    Bacillus anthracis' primary virulence factor is a tripartite anthrax toxin consisting of edema factor (EF), lethal factor (LF) and protective antigen (PA). In complex with PA, EF and LF are internalized via receptor-mediated endocytosis. EF is a calmodulin-dependent adenylate cyclase that induces tissue edema. LF is a zinc-metalloprotease that cleaves members of mitogen-activated protein kinase kinases. Lethal toxin (LT: PA plus LF)-induced death of macrophages is primarily attributed to expression of the sensitive Nalp1b allele, inflammasome formation and activation of caspase-1, but early events that initiate these processes are unknown. Here we provide evidence that an early essential event in pyroptosis of alveolar macrophages is LF-mediated depletion of cellular ATP. The underlying mechanism involves interaction of LF with F1F0-complex gamma and beta subunits leading to increased ATPase activity in mitochondria. In support, mitochondrial DNA-depleted MH-S cells have decreased F1F0 ATPase activity due to the lack of F06 and F08 polypeptides and show increased resistance to LT. We conclude that ATP depletion is an important early event in LT-induced sudden cell death and its prevention increases survival of toxin-sensitive cells. PMID:26124678

  9. Reanalyses of Anomalous Gravitational Microlensing Events in the OGLE-III Early Warning System Database with Combined Data

    NASA Astrophysics Data System (ADS)

    Jeong, J.; Park, H.; Han, C.; Gould, A.; Udalski, A.; Szymański, M. K.; Pietrzyński, G.; Soszyński, I.; Poleski, R.; Ulaczyk, K.; Wyrzykowski, Ł.; OGLE Collaboration; Abe, F.; Bennett, D. P.; Bond, I. A.; Botzler, C. S.; Freeman, M.; Fukui, A.; Fukunaga, D.; Itow, Y.; Koshimoto, N.; Masuda, K.; Matsubara, Y.; Muraki, Y.; Namba, S.; Ohnishi, K.; Rattenbury, N. J.; Saito, To.; Sullivan, D. J.; Sweatman, W. L.; Sumi, T.; Suzuki, D.; Tristram, P. J.; Tsurumi, N.; Wada, K.; Yamai, N.; Yock, P. C. M.; Yonehara, A.; MOA Collaboration; Albrow, M. D.; Batista, V.; Beaulieu, J.-P.; Caldwell, J. A. R.; Cassan, A.; Cole, A.; Coutures, C.; Dieters, S.; Dominik, M.; Dominis Prester, D.; Donatowicz, J.; Fouqué, P.; Greenhill, J.; Hoffman, M.; Huber, M.; Jørgensen, U. G.; Kane, S. R.; Kubas, D.; Martin, R.; Marquette, J.-B.; Menzies, J.; Pitrou, C.; Pollard, K.; Sahu, K. C.; Vinter, C.; Wambsganss, J.; Williams, A.; PLANET Collaboration; Allen, W.; Bolt, G.; Choi, J.-Y.; Christie, G. W.; DePoy, D. L.; Drummond, J.; Gaudi, B. S.; Hwang, K.-H.; Jung, Y. K.; Lee, C.-U.; Mallia, F.; Maoz, D.; Maury, A.; McCormick, J.; Monard, L. A. G.; Moorhouse, D.; Natusch, T.; Ofek, E. O.; Park, B.-G.; Pogge, R. W.; Santallo, R.; Shin, I.-G.; Thornley, G.; Yee, J. C.; μFUN Collaboration; Bramich, D. M.; Burgdorf, M.; Horne, K.; Hundertmark, M.; Kains, N.; Snodgrass, C.; Steele, I.; Street, R.; Tsapras, Y.; RoboNet Collaboration

    2015-05-01

    We reanalyze microlensing events in the published list of anomalous events that were observed from the Optical Gravitational Lensing Experiment (OGLE) lensing survey conducted during the 2004-2008 period. In order to check the existence of possible degenerate solutions and extract extra information, we conduct analyses based on combined data from other survey and follow-up observation and consider higher-order effects. Among the analyzed events, we present analyses of eight events for which either new solutions are identified or additional information is obtained. We find that the previous binary-source interpretations of five events are better interpreted by binary-lens models. These events include OGLE-2006-BLG-238, OGLE-2007-BLG-159, OGLE-2007-BLG-491, OGLE-2008-BLG-143, and OGLE-2008-BLG-210. With additional data covering caustic crossings, we detect finite-source effects for six events including OGLE-2006-BLG-215, OGLE-2006-BLG-238, OGLE-2006-BLG-450, OGLE-2008-BLG-143, OGLE-2008-BLG-210, and OGLE-2008-BLG-513. Among them, we are able to measure the Einstein radii of three events for which multi-band data are available. These events are OGLE-2006-BLG-238, OGLE-2008-BLG-210, and OGLE-2008-BLG-513. For OGLE-2008-BLG-143, we detect higher-order effects induced by the changes of the observer’s position caused by the orbital motion of the Earth around the Sun. In addition, we present degenerate solutions resulting from the known close/wide or ecliptic degeneracy. Finally, we note that the masses of the binary companions of the lenses of OGLE-2006-BLG-450 and OGLE-2008-BLG-210 are in the brown-dwarf regime.

  10. The spectral absorption coefficient at 254 nm as a real-time early warning proxy for detecting faecal pollution events at alpine karst water resources.

    PubMed

    Stadler, H; Klock, E; Skritek, P; Mach, R L; Zerobin, W; Farnleitner, A H

    2010-01-01

    Because spring water quality from alpine karst aquifers can change very rapidly during event situations, water abstraction management has to be performed in near real-time. Four summer events (2005-2008) at alpine karst springs were investigated in detail in order to evaluate the spectral absorption coefficient at 254 nm (SAC254) as a real-time early warning proxy for faecal pollution. For the investigation Low-Earth-Orbit (LEO) Satellite-based data communication between portable hydrometeorological measuring stations and an automated microbiological sampling device was used. The method for event triggered microbial sampling and analyzing was already established and described in a previous paper. Data analysis including on-line event characterisation (i.e. precipitation, discharge, turbidity, SAC254) and comprehensive E. coli determination (n>800) indicated that SAC254 is a useful early warning proxy. Irrespective of the studied event situations SAC254 always increased 3 to 6 hours earlier than the onset of faecal pollution, featuring different correlation phases. Furthermore, it seems also possible to use SAC254 as a real-time proxy parameter for estimating the extent of faecal pollution after establishing specific spring and event-type calibrations that take into consideration the variability of the occurrence and the transferability of faecal material It should be highlighted that diffuse faecal pollution from wildlife and live stock sources was responsible for spring water contamination at the investigated catchments. In this respect, the SAC254 can also provide useful information to support microbial source tracking efforts where different situations of infiltration have to be investigated. PMID:20962406

  11. Replication origins and timing of temporal replication in budding yeast: how to solve the conundrum?

    PubMed

    Barberis, Matteo; Spiesser, Thomas W; Klipp, Edda

    2010-05-01

    Similarly to metazoans, the budding yeast Saccharomyces cereviasiae replicates its genome with a defined timing. In this organism, well-defined, site-specific origins, are efficient and fire in almost every round of DNA replication. However, this strategy is neither conserved in the fission yeast Saccharomyces pombe, nor in Xenopus or Drosophila embryos, nor in higher eukaryotes, in which DNA replication initiates asynchronously throughout S phase at random sites. Temporal and spatial controls can contribute to the timing of replication such as Cdk activity, origin localization, epigenetic status or gene expression. However, a debate is going on to answer the question how individual origins are selected to fire in budding yeast. Two opposing theories were proposed: the "replicon paradigm" or "temporal program" vs. the "stochastic firing". Recent data support the temporal regulation of origin activation, clustering origins into temporal blocks of early and late replication. Contrarily, strong evidences suggest that stochastic processes acting on origins can generate the observed kinetics of replication without requiring a temporal order. In mammalian cells, a spatiotemporal model that accounts for a partially deterministic and partially stochastic order of DNA replication has been proposed. Is this strategy the solution to reconcile the conundrum of having both organized replication timing and stochastic origin firing also for budding yeast? In this review we discuss this possibility in the light of our recent study on the origin activation, suggesting that there might be a stochastic component in the temporal activation of the replication origins, especially under perturbed conditions. PMID:21037857

  12. A major 2.1 Ga event of mafic magmatism in west Africa: An Early stage of crustal accretion

    NASA Astrophysics Data System (ADS)

    Abouchami, Wafa; Boher, Muriel; Michard, Annie; Albarede, Francis

    1990-10-01

    environments. Back-arc or low-Ti continental flood basalts provide a marginally good agreement but still face some difficulties. Oceanic flood basalts similar to those which form oceanic plateaus (e.g. in the Nauru basin) and later accreted to continents as allochtonous terranes represent the most acceptable modern analogue of many Proterozoic basalts. It is suggested that deep plumes piercing young lithosphere can generate huge amounts of tholeiites in a short time. Birimian basalts, like many Early Proterozoic basalts, may also be viewed as recent equivalents of the Archean greenstone belts. The modern komatiite of Gorgona Island is suggested to fit this model of intraplate volcanism. Although the 2.1 Ga magmatic event in West Africa has gone virtually unnoticed in the literature, it extends over several thousand kilometers and compares with the distribution of mantle-derived magmatic activity in other major orogenic provinces (e.g. Superior). It shows that the growth rate of continents cannot be extrapolated from the data obtained solely from the best studied continents (North America, Europe, Australia). If such large crustal segments were overlooked, a spurious pattern of episodic activity of the mantle could arise.

  13. A global profile of replicative polymerase usage

    PubMed Central

    Müller, Carolin A.; Miyabe, Izumi; Brooks, Tony; Retkute, Renata; Hubank, Mike; Nieduszyski, Conrad A.; Carr, Antony M.

    2014-01-01

    Three eukaryotic DNA polymerases are essential for genome replication. Polα-primase initiates each synthesis event and is rapidly replaced by processive DNA polymerases: Polε replicates the leading strand while Polδ performs lagging strand synthesis. However, it is not known whether this division of labour is maintained across the whole genome or how uniform it is within single replicons. Using S. pombe, we have developed a polymerase usage sequencing (Pu-seq) strategy to map polymerase usage genome–wide. Pu–seq provides direct replication origin location and efficiency data and indirect estimates of replication timing. We confirm that the division of labour is broadly maintained across an entire genome. However, our data suggest a subtle variability in the usage of the two polymerases within individual replicons. We propose this results from occasional leading strand initiation by Polδ followed by exchange for Polε. PMID:25664722

  14. H3K4me3 demethylation by the histone demethylase KDM5C/JARID1C promotes DNA replication origin firing

    PubMed Central

    Rondinelli, Beatrice; Schwerer, Hélène; Antonini, Elena; Gaviraghi, Marco; Lupi, Alessio; Frenquelli, Michela; Cittaro, Davide; Segalla, Simona; Lemaitre, Jean-Marc; Tonon, Giovanni

    2015-01-01

    DNA replication is a tightly regulated process that initiates from multiple replication origins and leads to the faithful transmission of the genetic material. For proper DNA replication, the chromatin surrounding origins needs to be remodeled. However, remarkably little is known on which epigenetic changes are required to allow the firing of replication origins. Here, we show that the histone demethylase KDM5C/JARID1C is required for proper DNA replication at early origins. JARID1C dictates the assembly of the pre-initiation complex, driving the binding to chromatin of the pre-initiation proteins CDC45 and PCNA, through the demethylation of the histone mark H3K4me3. Fork activation and histone H4 acetylation, additional early events involved in DNA replication, are not affected by JARID1C downregulation. All together, these data point to a prominent role for JARID1C in a specific phase of DNA replication in mammalian cells, through its demethylase activity on H3K4me3. PMID:25712104

  15. Paleoceanographic changes and population dynamics in two left-coiling events of Pulleniatina during early Pleistocene, ODP 1115B, western equatorial Pacific

    NASA Astrophysics Data System (ADS)

    Chiang, M.; Wei, K.; Chuang, C.; Lo, L.

    2013-12-01

    The alternately left-coiling (LC) and right-coiling (RC) dominance in the populations of planktonic foraminifera Pulleniatina genus defined a series L events during the past 4 Ma. These L events have been used as useful biostratigraphic markers for the Indo-Pacific region, especially the L5 event, which marks the top of Gelasian stage in Early Pleistocene. However, previous studies emphasized on the stratigraphic application of the L events and have little attention on the L events itself. This study focuses on the population dynamics of Pu. during L events and tries to examine the mechanism triggering the L events by studying Core ODP 1115 B (9°11' S, 151°34' E, water depth 1149 m) in Solomon Sea, western equatorial Pacific. Owing to the variance in morphology, we lumped all species of Pu. genus into a 'Pulleniatina complex' rather than subdividing them into different species. Specimens larger than 250 μm in each sample were sieved into six size-fractions. The Pu. complex as well as their coiling direction were identified under a stereomicroscope. To avoid biased sampling, we examined all Pu. complex specimens larger than 250 μm. LC and RC relative percentages as well as absolute abundances of Pu. complex in each size-fraction were counted, respectively. In setting LC relative percentage >50% as a threshold, we recognized a distinctive L6 event (~ 2.202 - 2.175 Ma, began between MIS 85 - 84 and ended between MIS 83 - 82), a prominent L5 event (~ 2.147 - 1.875 Ma, began between MIS 82 - 81 and ended between MIS 71 - 70), and could not find a clear L4 event as reported by Saito (1976). The onset of the L5 event was marked by a dramatic reduction of absolute abundance of RC forms that give observers an impression of LC forms dominance. During the L5 event, the LC relative percentages fluctuated by 20 to 40%. The ending of the L5event was characterized by a slow recovery of RC forms in absolute abundance. L6 event was the result of two sudden significant changes

  16. Modeling DNA Replication.

    ERIC Educational Resources Information Center

    Bennett, Joan

    1998-01-01

    Recommends the use of a model of DNA made out of Velcro to help students visualize the steps of DNA replication. Includes a materials list, construction directions, and details of the demonstration using the model parts. (DDR)

  17. Combined oxygen- and carbon-isotope records through the Early Jurassic: multiple global events and two modes of carbon-cycle/temperature coupling

    NASA Astrophysics Data System (ADS)

    Hesselbo, S. P.; Korte, C.

    2010-12-01

    The Jurassic comprises some 55 million years of Earth history. However, within the Jurassic, only one major environmental change (hyperthermal) event is really well known - the Early Toarcian Oceanic Anoxic Event (OAE) at ~183 Ma - and until very recently the extent to which the accompanying environmental changes were global has been strongly debated. Nevertheless, partly as a result of the international effort to define Global Stratotype Sections and Points (GSSPs), much more is now being discovered about environmental changes taking place at and around the other Jurassic Age (Stage) boundaries, to the extent that meaningful comparisons between these events can begin to be made. Here we present new carbon and oxygen isotope data from mollusks (bivalves and belemnites) and brachiopods collected through the marine Early Jurassic succession of NE England, including the Sinemurian-Plienbachian boundary GSSP. All materials have been screened by chemical analysis and scanning electron microscopy to check for diagenetic alteration. Analysis of carbon isotopes from marine calcite is supplemented by analysis of carbon-isotope values from fossil wood collected through the same section. It is demonstrated that both long-term and short-term carbon-isotope shifts from the UK Early Jurassic represent global changes in carbon cycle balances. The Sinemurian-Pliensbachian boundary event is an event of global significance and shows several similarities to the Toarcian OAE (relative sea-level change, carbon-isotope signature), but also some significant contrasts (oxygen-isotope based paleotemperatures which provide no evidence for warming). Significant contrast in oxygen- and carbon-isotope co-variation also occurs on a long timescale. There appear to be two modes in the co-variation of carbon and oxygen isotopes through this time interval: mode 1 shows positive correlation and may be explained by conventional sources and sinks for carbon-dioxide; mode 2, representing negative

  18. Glacioeustatic fluctuation: The mechanism linking stable isotope events and sequence stratigraphy from the early Oligocene to middle Miocene

    SciTech Connect

    Abreu, V. ); Haddad, G. )

    1996-01-01

    One of the most difficult challenges of sequence stratigraphy is the establishment of synchronism between events observed in widely-separated basins. Problems arise because the resolution of the best stratigraphic methods is not good enough to establish the synchronism of similar-aged events on a global scale. Unless a common mechanism affecting global eustasy is assumed, such as variations in the ice volume, there is no a priori reason to expect that sequences of similar age in widely-separated basins are indeed synchronous. The stable oxygen isotope composition of marine carbonates is a proxy for sea level which has been underutilized in sequence stratigraphy. Identification of isotope events is based on d[sup 18]O data from DSDP and ODP sites 522, 529, 563, 608, and 747 drilled in the Atlantic and Indian oceans. These records were used to define Oligocene and Miocene oxygen isotope zones. In addition, we present isotope data from PETROBRAS Well A drilled in the Campos Basin (Brazil). Ages of isotope events correspond well with the ages of sequence boundaries and maximum flooding surfaces. Because of the good correlation between the isotope and sequence stratigraphic records, we reconfirm that ice-volume change is the common mechanism driving sea-level fluctuations from the Oligocene to present.

  19. Glacioeustatic fluctuation: The mechanism linking stable isotope events and sequence stratigraphy from the early Oligocene to middle Miocene

    SciTech Connect

    Abreu, V.; Haddad, G.

    1996-12-31

    One of the most difficult challenges of sequence stratigraphy is the establishment of synchronism between events observed in widely-separated basins. Problems arise because the resolution of the best stratigraphic methods is not good enough to establish the synchronism of similar-aged events on a global scale. Unless a common mechanism affecting global eustasy is assumed, such as variations in the ice volume, there is no a priori reason to expect that sequences of similar age in widely-separated basins are indeed synchronous. The stable oxygen isotope composition of marine carbonates is a proxy for sea level which has been underutilized in sequence stratigraphy. Identification of isotope events is based on d{sup 18}O data from DSDP and ODP sites 522, 529, 563, 608, and 747 drilled in the Atlantic and Indian oceans. These records were used to define Oligocene and Miocene oxygen isotope zones. In addition, we present isotope data from PETROBRAS Well A drilled in the Campos Basin (Brazil). Ages of isotope events correspond well with the ages of sequence boundaries and maximum flooding surfaces. Because of the good correlation between the isotope and sequence stratigraphic records, we reconfirm that ice-volume change is the common mechanism driving sea-level fluctuations from the Oligocene to present.

  20. DNA Replication Origins

    PubMed Central

    Leonard, Alan C.; Méchali, Marcel

    2013-01-01

    The onset of genomic DNA synthesis requires precise interactions of specialized initiator proteins with DNA at sites where the replication machinery can be loaded. These sites, defined as replication origins, are found at a few unique locations in all of the prokaryotic chromosomes examined so far. However, replication origins are dispersed among tens of thousands of loci in metazoan chromosomes, thereby raising questions regarding the role of specific nucleotide sequences and chromatin environment in origin selection and the mechanisms used by initiators to recognize replication origins. Close examination of bacterial and archaeal replication origins reveals an array of DNA sequence motifs that position individual initiator protein molecules and promote initiator oligomerization on origin DNA. Conversely, the need for specific recognition sequences in eukaryotic replication origins is relaxed. In fact, the primary rule for origin selection appears to be flexibility, a feature that is modulated either by structural elements or by epigenetic mechanisms at least partly linked to the organization of the genome for gene expression. PMID:23838439

  1. Replication of lightweight mirrors

    NASA Astrophysics Data System (ADS)

    Chen, Ming Y.; Matson, Lawrence E.; Lee, Heedong; Chen, Chenggang

    2009-08-01

    The fabrication of lightweight mirror assemblages via a replication technique offers great potential for eliminating the high cost and schedule associated with the grinding and polishing steps needed for conventional glass or SiC mirrors. A replication mandrel is polished to an inverse figure shape and to the desired finish quality. It is then, coated with a release layer, the appropriate reflective layer, and followed by a laminate for coefficient of thermal expansion (CTE) tailorability and strength. This optical membrane is adhered to a mirror structural substrate with a low shrinkage, CTE tailored adhesive. Afterwards, the whole assembly is separated from the mandrel. The mandrel is then cleaned and reused for the next replication run. The ultimate goal of replication is to preserve the surface finish and figure of the optical membrane upon its release from the mandrel. Successful replication requires a minimization of the residual stresses within the optical coating stack, the curing stresses from the adhesive and the thermal stress resulting from CTE mismatch between the structural substrate, the adhesive, and the optical membrane. In this paper, the results on replicated trials using both metal/metal and ceramic/ceramic laminates adhered to light weighted structural substrates made from syntactic foams (both inorganic and organic) will be discussed.

  2. Orbital control on carbon cycle alterations and hyperthermal events in a cooling world: the late Early to Mid Eocene record at Possagno (southern Alps, Italy)

    NASA Astrophysics Data System (ADS)

    Galeotti, Simone; Sprovieri, Mario; Moretti, Matteo; Rio, Domenico; Fornaciari, Eliana; Giusberti, Luca; Agnini, Claudia; Backman, Jan; Lanci, Luca; Luciani, Valeria

    2013-04-01

    The late Early Eocene to Middle Eocene ~50-45 Million years ago (Ma) time interval in the middle bathyal, pelagic/hemipelagic succession of the Western Tethys Possagno section (southern Alps, Veneto), contains several episodes of negative carbon isotope excursions (CIEs) and concomitant dissolution of carbonates. These episodes are superimposed on a long term global climate cooling that started at about 51 Ma following the Early Eocene Climatic Optimum (EECO). Spectral analysis indicates that CIEs and dissolution events are paced by orbital forcing, confirming the global significance of previous finding on the same interval from Western and Southern Atlantic and Equatorial Pacific sites. The frequency and magnitude of CIEs through time is controlled by long-term modulations of orbital parameters, including long eccentricity (400 kyr) and a 1.2 million year modulation. Highest frequency of events - at the orbital scale - is observed across the EECO, which provides an observational basis to validate theoretical models predicting a threshold effect resulting from orbital forcing superimposed on gradually changing mean global boundary conditions. The observation of the 1.2 million year beat (long-term modulation of obliquity) together with previously published observation of enhanced obliquity (41 kyr) forcing across major CIEs and dissolution intervals indicates that high latitude feedbacks to orbital forcing played a fundamental role in the emplacement of the hyperthermals. The observed orbital forcing signature closely match that of early Eocene hyperthermals, suggesting similar driving processes.

  3. Impacts of a water stress followed by an early frost event on beech (Fagus sylvatica L.) susceptibility to Scolytine ambrosia beetles - Research strategy and first results

    NASA Astrophysics Data System (ADS)

    La Spina, Sylvie; de Cannière, Charles; Molenberg, Jean-Marc; Vincke, Caroline; Deman, Déborah; Grégoire, Jean-Claude

    2010-05-01

    Climate change tends to induce more frequent abiotic and biotic extreme events, having large impacts on tree vitality. Weakened trees are then more susceptible to secondary insect outbreaks, as it happened in Belgium in the early 2000s: after an early frost event, secondary Scolytine ambrosia beetles attacks were observed on beech trees. In this study, we test if a combination of stress, i.e. a soil water deficit preceding an early frost, could render trees more attractive to beetles. An experimental study was set in autumn 2008. Two parcels of a beech forest were covered with plastic tents to induce a water stress by rain interception. The parcels were surrounded by 2-meters depth trenches to avoid water supply by streaming. Soil water content and different indicators of tree water use (sap flow, predawn leaf water potential, tree radial growth) were followed. In autumn 2010, artificial frost injuries will be inflicted to trees using dry ice. Trees attractivity for Scolytine insects, and the success of insect colonization will then be studied. The poster will focus on experiment setting and first results (impacts of soil water deficit on trees).

  4. Combined magnetic fabrics and microstructures: evidence of an early magmatic event in the Paleoproterozoic Teofilandia granitoids (Sao Francisco craton, Brazil)

    NASA Astrophysics Data System (ADS)

    Nascimento, H. S.; Bouchez, J. L.; Nedelec, A.; Sabate, P.

    2003-04-01

    The study area concerns the southern part of the Paleoproterozoic (2.2--2.0 Ga) Itapicuru Greenstone Belt (Serrinha Block), eastern border of the Sao Francisco craton (Brazil). This is a problematic area, occupied by the Teofilandia granitoids (granites, granodiorites, tonalites, gneisses), where the overall N-S map structures rotate to E-W toward the south of the Serrinha Block. A set of 160 sampling stations covering ˜220 km^2 have been subjected to a detailed structural study combining magnetic fabrics AND microstructural characters. Three types of microstructures, corresponding to three successive events, helped to sort the different magnetic fabrics. (1) Purely magmatic microstructures, sometimes slightly overprinted by the following events, characterize preserved sectors that carry N-S trending magnetic lineations. Around these relictual sectors (2) the granitoids display typical high-T orthogneissic microstructures, attesting for their pervasive deformation in the solid-state parallel to E-W (±30^o), as observed in the field and attested by the E-W trending magnetic lineations. Finally (3) low-T/high-stress, sub-mylonitic microstructures under greenschist facies conditions, affect the area with various intensities, and are associated with E-W trending magnetic lineations. We conclude that the Teofilandia granitoids reveal their N-S-directed emplacement at ˜2.1 Ga, probably coeval with the N-S stretch of the whole Rio Itapicuru belt, within the relictual cores of kilometer-thick lenses that were preserved from the following events. The pervasive high-T structures, with foliations dipping to the south and E-W stretching directions, are ascribed to a lateral ramp of the shear event that accompanied the convergence of the Serrinha block with the Salvador Curaca mobile belt. The final, low-T/high stress event is likely coeval with the hydrothermal episode responsible for the gold mineralizations of the Teofilandia area at 2.08 Ga.

  5. Associations of Mother-Child Reminiscing about Negative Past Events, Coping, and Self-Concept in Early Childhood

    ERIC Educational Resources Information Center

    Goodvin, Rebecca; Romdall, Lisa

    2013-01-01

    Parent-child reminiscing conversations in early childhood have received theoretical attention as a forum for children's self-concept development, but this has been little addressed in empirical work. This study examines associations between emotion reminiscing and children's self-concepts and, building from the reminiscing and…

  6. A replicator-specific binding protein essential for site-specific initiation of DNA replication in mammalian cells.

    PubMed

    Zhang, Ya; Huang, Liang; Fu, Haiqing; Smith, Owen K; Lin, Chii Mei; Utani, Koichi; Rao, Mishal; Reinhold, William C; Redon, Christophe E; Ryan, Michael; Kim, RyangGuk; You, Yang; Hanna, Harlington; Boisclair, Yves; Long, Qiaoming; Aladjem, Mirit I

    2016-01-01

    Mammalian chromosome replication starts from distinct sites; however, the principles governing initiation site selection are unclear because proteins essential for DNA replication do not exhibit sequence-specific DNA binding. Here we identify a replication-initiation determinant (RepID) protein that binds a subset of replication-initiation sites. A large fraction of RepID-binding sites share a common G-rich motif and exhibit elevated replication initiation. RepID is required for initiation of DNA replication from RepID-bound replication origins, including the origin at the human beta-globin (HBB) locus. At HBB, RepID is involved in an interaction between the replication origin (Rep-P) and the locus control region. RepID-depleted murine embryonic fibroblasts exhibit abnormal replication fork progression and fewer replication-initiation events. These observations are consistent with a model, suggesting that RepID facilitates replication initiation at a distinct group of human replication origins. PMID:27272143

  7. A replicator-specific binding protein essential for site-specific initiation of DNA replication in mammalian cells

    PubMed Central

    Zhang, Ya; Huang, Liang; Fu, Haiqing; Smith, Owen K.; Lin, Chii Mei; Utani, Koichi; Rao, Mishal; Reinhold, William C.; Redon, Christophe E.; Ryan, Michael; Kim, RyangGuk; You, Yang; Hanna, Harlington; Boisclair, Yves; Long, Qiaoming; Aladjem, Mirit I.

    2016-01-01

    Mammalian chromosome replication starts from distinct sites; however, the principles governing initiation site selection are unclear because proteins essential for DNA replication do not exhibit sequence-specific DNA binding. Here we identify a replication-initiation determinant (RepID) protein that binds a subset of replication-initiation sites. A large fraction of RepID-binding sites share a common G-rich motif and exhibit elevated replication initiation. RepID is required for initiation of DNA replication from RepID-bound replication origins, including the origin at the human beta-globin (HBB) locus. At HBB, RepID is involved in an interaction between the replication origin (Rep-P) and the locus control region. RepID-depleted murine embryonic fibroblasts exhibit abnormal replication fork progression and fewer replication-initiation events. These observations are consistent with a model, suggesting that RepID facilitates replication initiation at a distinct group of human replication origins. PMID:27272143

  8. Rumination as a Mechanism Linking Stressful Life Events to Symptoms of Depression and Anxiety: Longitudinal Evidence in Early Adolescents and Adults

    PubMed Central

    Michl, Louisa C.; McLaughlin, Katie A.; Shepherd, Kathrine; Nolen-Hoeksema, Susan

    2014-01-01

    Rumination is a well-established risk factor for the onset of major depression and anxiety symptomatology in both adolescents and adults. Despite the robust associations between rumination and internalizing psychopathology, there is a dearth of research examining factors that might lead to a ruminative response style. In the current study, we examined whether social environmental experiences were associated with rumination. Specifically, we evaluated whether self-reported exposure to stressful life events predicted subsequent increases in rumination. We also investigated whether rumination served as a mechanism underlying the longitudinal association between self-reported stressful life events and internalizing symptoms. Self-reported stressful life events, rumination, and symptoms of depression and anxiety were assessed in 2 separate longitudinal samples. A sample of early adolescents (N = 1,065) was assessed at 3 time points spanning 7 months. A sample of adults (N = 1,132) was assessed at 2 time points spanning 12 months. In both samples, self-reported exposure to stressful life events was associated longitudinally with increased engagement in rumination. In addition, rumination mediated the longitudinal relationship between self-reported stressors and symptoms of anxiety in both samples and the relationship between self-reported life events and symptoms of depression in the adult sample. Identifying the psychological and neurobiological mechanisms that explain a greater propensity for rumination following stressors remains an important goal for future research. This study provides novel evidence for the role of stressful life events in shaping characteristic responses to distress, specifically engagement in rumination, highlighting potentially useful targets for interventions aimed at preventing the onset of depression and anxiety. PMID:23713497

  9. Correlating carbon and oxygen isotope events in early to middle Miocene shallow marine carbonates in the Mediterranean region using orbitally tuned chemostratigraphy and lithostratigraphy

    PubMed Central

    Piller, Werner E.; Reuter, Markus; Harzhauser, Mathias

    2015-01-01

    Abstract During the Miocene prominent oxygen isotope events (Mi‐events) reflect major changes in glaciation, while carbonate isotope maxima (CM‐events) reflect changes in organic carbon burial, particularly during the Monterey carbon isotope excursion. However, despite their importance to the global climate history they have never been recorded in shallow marine carbonate successions. The Decontra section on the Maiella Platform (central Apennines, Italy), however, allows to resolve them for the first time in such a setting during the early to middle Miocene. The present study improves the stratigraphic resolution of parts of the Decontra section via orbital tuning of high‐resolution gamma ray (GR) and magnetic susceptibility data to the 405 kyr eccentricity metronome. The tuning allows, within the established biostratigraphic, sequence stratigraphic, and isotope stratigraphic frameworks, a precise correlation of the Decontra section with pelagic records of the Mediterranean region, as well as the global paleoclimatic record and the global sea level curve. Spectral series analyses of GR data further indicate that the 405 kyr orbital cycle is particularly well preserved during the Monterey Event. Since GR is a direct proxy for authigenic uranium precipitation during increased burial of organic carbon in the Decontra section, it follows the same long‐term orbital pacing as observed in the carbon isotope records. The 405 kyr GR beat is thus correlated with the carbon isotope maxima observed during the Monterey Event. Finally, the Mi‐events can now be recognized in the δ18O record and coincide with plankton‐rich, siliceous, or phosphatic horizons in the lithology of the section. PMID:27546980

  10. Rumination as a mechanism linking stressful life events to symptoms of depression and anxiety: longitudinal evidence in early adolescents and adults.

    PubMed

    Michl, Louisa C; McLaughlin, Katie A; Shepherd, Kathrine; Nolen-Hoeksema, Susan

    2013-05-01

    Rumination is a well-established risk factor for the onset of major depression and anxiety symptomatology in both adolescents and adults. Despite the robust associations between rumination and internalizing psychopathology, there is a dearth of research examining factors that might lead to a ruminative response style. In the current study, we examined whether social environmental experiences were associated with rumination. Specifically, we evaluated whether self-reported exposure to stressful life events predicted subsequent increases in rumination. We also investigated whether rumination served as a mechanism underlying the longitudinal association between self-reported stressful life events and internalizing symptoms. Self-reported stressful life events, rumination, and symptoms of depression and anxiety were assessed in 2 separate longitudinal samples. A sample of early adolescents (N = 1,065) was assessed at 3 time points spanning 7 months. A sample of adults (N = 1,132) was assessed at 2 time points spanning 12 months. In both samples, self-reported exposure to stressful life events was associated longitudinally with increased engagement in rumination. In addition, rumination mediated the longitudinal relationship between self-reported stressors and symptoms of anxiety in both samples and the relationship between self-reported life events and symptoms of depression in the adult sample. Identifying the psychological and neurobiological mechanisms that explain a greater propensity for rumination following stressors remains an important goal for future research. This study provides novel evidence for the role of stressful life events in shaping characteristic responses to distress, specifically engagement in rumination, highlighting potentially useful targets for interventions aimed at preventing the onset of depression and anxiety. PMID:23713497

  11. The onset of the Early Eocene Climatic Optimum, including the K/X event, at Branch Stream, Clarence Valley, New Zealand

    NASA Astrophysics Data System (ADS)

    Slotnick, B. S.; Dickens, G. R.; Hollis, C. J.; Crampton, J. S.; Strong, P.; Dallanave, E.; Philips, A.

    2014-12-01

    The Early Eocene Climatic Optimum (EECO), lasting from ~53-50 Ma, has been characterized as the warmest sustained interval through the Cenozoic. It was comprised of a broad temperature maximum with elevated atmospheric pCO2, noticeable shifts in carbon cycling, and a variety of faunal and floral changes. This included one, and likely additional, brief (<200 kyr) intervals of extreme warming, the K/X event. At least for the most prominent events, the long-term drop in δ13C and short-term Carbon Isotope Excursions (CIEs) have been coupled to massive fluxes of 13C-depleted carbon into the exogenic system and global climate change. However, much about EECO remains unknown because of a lack of detailed and coupled proxy records; we are currently generating useful records to better characterize lithological and geochemical signatures of EECO. Here, we help rectify this problem by presenting a new lithologic and carbon isotopic record for a ~84-m-thick section of early Eocene upper slope calcareous-rich sediments, now lithified and exposed along Branch Stream, New Zealand. Comparison of new carbon isotopic and lithologic records of this greatly expanded section to nearby Mead Stream identifies multiple negative CIEs in short succession and generally more marl during lowermost EECO (~53.3-51.7 Ma), with the most prominent of these equating to the K/X event. The early Eocene lithologic and δ13C records at Branch and Mead Streams are remarkably similar to each other, with the following distinctions: sequences at Branch Stream are thicker and generally have a wider range of δ13C across CIEs. Both expanded sections are marked by terrigenous dilution, best explained by enhanced seasonal precipitation, elevated greenhouse-gas concentrations, and likely global warming. These data indicate lowermost EECO can be described as a time with a general δ13C low superimposed by a series of short-term climate perturbations.

  12. The E. coli DNA Replication Fork.

    PubMed

    Lewis, J S; Jergic, S; Dixon, N E

    2016-01-01

    DNA replication in Escherichia coli initiates at oriC, the origin of replication and proceeds bidirectionally, resulting in two replication forks that travel in opposite directions from the origin. Here, we focus on events at the replication fork. The replication machinery (or replisome), first assembled on both forks at oriC, contains the DnaB helicase for strand separation, and the DNA polymerase III holoenzyme (Pol III HE) for DNA synthesis. DnaB interacts transiently with the DnaG primase for RNA priming on both strands. The Pol III HE is made up of three subassemblies: (i) the αɛθ core polymerase complex that is present in two (or three) copies to simultaneously copy both DNA strands, (ii) the β2 sliding clamp that interacts with the core polymerase to ensure its processivity, and (iii) the seven-subunit clamp loader complex that loads β2 onto primer-template junctions and interacts with the α polymerase subunit of the core and the DnaB helicase to organize the two (or three) core polymerases. Here, we review the structures of the enzymatic components of replisomes, and the protein-protein and protein-DNA interactions that ensure they remain intact while undergoing substantial dynamic changes as they function to copy both the leading and lagging strands simultaneously during coordinated replication. PMID:27241927

  13. Events occurring during the previous lactation, the dry period, and peripartum as risk factors for early lactation mastitis in cows receiving 2 different intramammary dry cow therapies.

    PubMed

    Pinedo, P J; Fleming, C; Risco, C A

    2012-12-01

    The objective of this study was to investigate the association between mastitis events occurring during the previous lactation, the dry period, and the peripartum period on the incidence of early lactation mastitis in cows receiving ceftiofur hydrochloride or penicillin dihydrostreptomycin as intramammary dry cow antibiotic therapy. Cows (n=402) from 2 large dairy farms in Central Florida were enrolled in the study at the time of dry-off processing and were randomly assigned to 1 of 2 dry cow therapies: ceftiofur hydrochloride or penicillin dihydrostreptomycin. Composite milk samples were collected at dry-off and after calving for bacteriological examination and somatic cell count. Peripartal health disorders were monitored during the first 30 d of lactation and included calving difficulty, metritis, ketosis, and left displaced abomasum. Milk production and individual somatic cell scores (SCS) were recorded monthly by the Dairy Herd Improvement Association. The main outcome variables were the risk of clinical mastitis during the first 30 and 60 d of lactation, and the risk of subclinical mastitis at the first 2 monthly Dairy Herd Improvement Association tests after calving (up to 70 d in milk). Additionally, the SCS and the presence of mastitis pathogens in milk at dry-off and at calving were analyzed. Explanatory variables consisted of events occurring during the previous lactation, at dry-off and during the dry period, at calving, and within the first 30 d after calving. Multiple events occurring during the previous lactation had a significant effect on the incidence of mastitis in the subsequent lactation. These events included low milk yield, intermediate lactation length, clinical mastitis, and lactation SCS average. Similarly, intramammary infections with environmental bacteria at dry-off increased the chances of clinical mastitis the first month after calving. Dry-off therapy had a significant effect on mastitis incidence; cows treated with ceftiofur

  14. High resolution chronology of late Cretaceous-early Tertiary events determined from 21,000 yr orbital-climatic cycles in marine sediments

    NASA Technical Reports Server (NTRS)

    Herbert, Timothy D.; Dhondt, Steven

    1988-01-01

    A number of South Atlantic sites cored by the Deep Sea Drilling Project (DSDP) recovered late Cretaceous and early Tertiary sediments with alternating light-dark, high-low carbonate content. The sedimentary oscillations were turned into time series by digitizing color photographs of core segments at a resolution of about 5 points/cm. Spectral analysis of these records indicates prominent periodicity at 25 to 35 cm in the Cretaceous intervals, and about 15 cm in the early Tertiary sediments. The absolute period of the cycles that is determined from paleomagnetic calibration at two sites is 20,000 to 25,000 yr, and almost certainly corresponds to the period of the earth's precessional cycle. These sequences therefore contain an internal chronometer to measure events across the K/T extinction boundary at this scale of resolution. The orbital metronome was used to address several related questions: the position of the K/T boundary within magnetic chron 29R, the fluxes of biogenic and detrital material to the deep sea immediately before and after the K/T event, the duration of the Sr anomaly, and the level of background climatic variability in the latest Cretaceous time. The carbonate/color cycles that were analyzed contain primary records of ocean carbonate productivity and chemistry, as evidenced by bioturbational mixing of adjacent beds and the weak lithification of the rhythmic sequences. It was concluded that sedimentary sequences that contain orbital cyclicity are capable of providing resolution of dramatic events in earth history with much greater precision than obtainable through radiometric methods. The data show no evidence for a gradual climatic deterioration prior to the K/T extinction event, and argue for a geologically rapid revolution at this horizon.

  15. Key Immune Events of the Pathomechanisms of Early Cardioembolic Stroke: Multi-Database Mining and Systems Biology Approach.

    PubMed

    Wu, Chia-Chou; Chen, Bor-Sen

    2016-01-01

    While inflammation has generally been regarded as a negative factor in stroke recovery, this viewpoint has recently been challenged by demonstrating that inflammation is a necessary and sufficient factor for regeneration in the zebrafish brain injury model. This close relationship with inflammation suggests that a re-examination of the immune system's role in strokes is necessary. We used a systems biology approach to investigate the role of immune-related functions via their interactions with other molecular functions in early cardioembolic stroke. Based on protein interaction models and on microarray data from the blood of stroke subjects and healthy controls, networks were constructed to delineate molecular interactions at four early stages (pre-stroke, 3 h, 5 h and 24 h after stroke onset) of cardioembolic stroke. A comparative analysis of functional networks identified interactions of immune-related functions with other molecular functions, including growth factors, neuro/hormone and housekeeping functions. These provide a potential pathomechanism for early stroke pathophysiology. In addition, several potential targets of miRNA and methylation regulations were derived based on basal level changes observed in the core networks and literature. The results provide a more comprehensive understanding of stroke progression mechanisms from an immune perspective and shed light on acute stroke treatments. PMID:26927091

  16. Early Solar System Alkali Fractionation Events Recorded by K-Ca Isotopes in the Yamato-74442 LL-Chondritic Breccia

    NASA Technical Reports Server (NTRS)

    Tatsunori, T.; Misawa, K.; Okano, O.; Shih, C.-Y.; Nyquist, L. E.; Simon, J. I.; Tappa, M. J.; Yoneda, S.

    2015-01-01

    Radiogenic ingrowth of Ca-40 due to decay of K-40 occurred early in the solar system history causing the Ca-40 abundance to vary within different early-former reservoirs. Marshall and DePaolo ] demonstrated that the K-40/Ca-40 decay system could be a useful radiogenic tracer for studies of terrestrial rocks. Shih et al. [3,4] determined 40K/40Ca ages of lunar granitic rock fragments and discussed the chemical characteristics of their source materials. Recently, Yokoyama et al. [5] showed the application of the K-40/Ca-40 chronometer for high K/Ca materials in ordinary chondrites (OCs). High-precision calcium isotopic data are needed to constrain mixing processes among early solar system materials and the time of planetesimal formation. To better constrain the solar system calcium isotopic compositions among astromaterials, we have determined the calcium isotopic compositions of OCs and an angrite. We further estimated a source K/Ca ratio for alkali-rich fragments in a chondritic breccia using the estimated solar system initial Ca-40/Ca-44.

  17. Deciphering early events involved in hyperosmotic stress-induced programmed cell death in tobacco BY-2 cells

    PubMed Central

    Monetti, Emanuela; Kadono, Takashi; Bouteau, François

    2014-01-01

    Hyperosmotic stresses represent one of the major constraints that adversely affect plants growth, development, and productivity. In this study, the focus was on early responses to hyperosmotic stress- (NaCl and sorbitol) induced reactive oxygen species (ROS) generation, cytosolic Ca2+ concentration ([Ca2+]cyt) increase, ion fluxes, and mitochondrial potential variations, and on their links in pathways leading to programmed cell death (PCD). By using BY-2 tobacco cells, it was shown that both NaCl- and sorbitol-induced PCD seemed to be dependent on superoxide anion (O2·–) generation by NADPH-oxidase. In the case of NaCl, an early influx of sodium through non-selective cation channels participates in the development of PCD through mitochondrial dysfunction and NADPH-oxidase-dependent O2·– generation. This supports the hypothesis of different pathways in NaCl- and sorbitol-induced cell death. Surprisingly, other shared early responses, such as [Ca2+]cyt increase and singlet oxygen production, do not seem to be involved in PCD. PMID:24420571

  18. Key Immune Events of the Pathomechanisms of Early Cardioembolic Stroke: Multi-Database Mining and Systems Biology Approach

    PubMed Central

    Wu, Chia-Chou; Chen, Bor-Sen

    2016-01-01

    While inflammation has generally been regarded as a negative factor in stroke recovery, this viewpoint has recently been challenged by demonstrating that inflammation is a necessary and sufficient factor for regeneration in the zebrafish brain injury model. This close relationship with inflammation suggests that a re-examination of the immune system’s role in strokes is necessary. We used a systems biology approach to investigate the role of immune-related functions via their interactions with other molecular functions in early cardioembolic stroke. Based on protein interaction models and on microarray data from the blood of stroke subjects and healthy controls, networks were constructed to delineate molecular interactions at four early stages (pre-stroke, 3 h, 5 h and 24 h after stroke onset) of cardioembolic stroke. A comparative analysis of functional networks identified interactions of immune-related functions with other molecular functions, including growth factors, neuro/hormone and housekeeping functions. These provide a potential pathomechanism for early stroke pathophysiology. In addition, several potential targets of miRNA and methylation regulations were derived based on basal level changes observed in the core networks and literature. The results provide a more comprehensive understanding of stroke progression mechanisms from an immune perspective and shed light on acute stroke treatments. PMID:26927091

  19. Challenges in Replicating Interventions

    PubMed Central

    Bell, Stephanie G; Newcomer, Susan F; Bachrach, Christine; Borawski, Elaine; Jemmott, John L; Morrison, Diane; Stanton, Bonita; Tortolero, Susan; Zimmerman, Richard

    2007-01-01

    Purpose This paper describes and reflects on an effort to document, through a set of six interventions, the process of adapting effective youth risk behavior interventions for new settings. It provides insights into how this might best be accomplished. It discusses six studies funded by NIH starting in 1999. The studies were funded in response to a Request for Applications [RFA] to replicate HIV prevention interventions for youth. Researchers were to select an HIV risk reduction intervention program shown to be effective in one adolescent population and to replicate it in a new community or different adolescent population. This was to be done while systematically documenting those processes and aspects of the intervention hypothesized to be critical to the development of community-based, culturally sensitive programs. The replication was to assess the variations necessary to gain cooperation, implement a locally feasible and meaningful intervention, and evaluate the outcomes in the new setting. Methods This paper lays out the rationale for this initiative and describes the goals and the approaches to adaptation of the funded researchers. Results The paper discusses issues relevant to all interventions, those unique to replication and to these replications in particular. It then reflects on the processes and the consequences of the adaptations. It does not address the further challenges in taking a successful intervention “to scale.” Conclusions Replications of effective interventions face all of the challenges of implementation design plus additional challenges of balancing fidelity to the original intervention and sensitivity to the needs of new populations. PMID:17531757

  20. Ancient DNA from South-East Europe Reveals Different Events during Early and Middle Neolithic Influencing the European Genetic Heritage.

    PubMed

    Hervella, Montserrat; Rotea, Mihai; Izagirre, Neskuts; Constantinescu, Mihai; Alonso, Santos; Ioana, Mihai; Lazăr, Cătălin; Ridiche, Florin; Soficaru, Andrei Dorian; Netea, Mihai G; de-la-Rua, Concepcion

    2015-01-01

    The importance of the process of Neolithization for the genetic make-up of European populations has been hotly debated, with shifting hypotheses from a demic diffusion (DD) to a cultural diffusion (CD) model. In this regard, ancient DNA data from the Balkan Peninsula, which is an important source of information to assess the process of Neolithization in Europe, is however missing. In the present study we show genetic information on ancient populations of the South-East of Europe. We assessed mtDNA from ten sites from the current territory of Romania, spanning a time-period from the Early Neolithic to the Late Bronze Age. mtDNA data from Early Neolithic farmers of the Starčevo Criş culture in Romania (Cârcea, Gura Baciului and Negrileşti sites), confirm their genetic relationship with those of the LBK culture (Linienbandkeramik Kultur) in Central Europe, and they show little genetic continuity with modern European populations. On the other hand, populations of the Middle-Late Neolithic (Boian, Zau and Gumelniţa cultures), supposedly a second wave of Neolithic migration from Anatolia, had a much stronger effect on the genetic heritage of the European populations. In contrast, we find a smaller contribution of Late Bronze Age migrations to the genetic composition of Europeans. Based on these findings, we propose that permeation of mtDNA lineages from a second wave of Middle-Late Neolithic migration from North-West Anatolia into the Balkan Peninsula and Central Europe represent an important contribution to the genetic shift between Early and Late Neolithic populations in Europe, and consequently to the genetic make-up of modern European populations. PMID:26053041

  1. Ancient DNA from South-East Europe Reveals Different Events during Early and Middle Neolithic Influencing the European Genetic Heritage

    PubMed Central

    Hervella, Montserrat; Rotea, Mihai; Izagirre, Neskuts; Constantinescu, Mihai; Alonso, Santos; Ioana, Mihai; Lazăr, Cătălin; Ridiche, Florin; Soficaru, Andrei Dorian; Netea, Mihai G.; de-la-Rua, Concepcion

    2015-01-01

    The importance of the process of Neolithization for the genetic make-up of European populations has been hotly debated, with shifting hypotheses from a demic diffusion (DD) to a cultural diffusion (CD) model. In this regard, ancient DNA data from the Balkan Peninsula, which is an important source of information to assess the process of Neolithization in Europe, is however missing. In the present study we show genetic information on ancient populations of the South-East of Europe. We assessed mtDNA from ten sites from the current territory of Romania, spanning a time-period from the Early Neolithic to the Late Bronze Age. mtDNA data from Early Neolithic farmers of the Starčevo Criş culture in Romania (Cârcea, Gura Baciului and Negrileşti sites), confirm their genetic relationship with those of the LBK culture (Linienbandkeramik Kultur) in Central Europe, and they show little genetic continuity with modern European populations. On the other hand, populations of the Middle-Late Neolithic (Boian, Zau and Gumelniţa cultures), supposedly a second wave of Neolithic migration from Anatolia, had a much stronger effect on the genetic heritage of the European populations. In contrast, we find a smaller contribution of Late Bronze Age migrations to the genetic composition of Europeans. Based on these findings, we propose that permeation of mtDNA lineages from a second wave of Middle-Late Neolithic migration from North-West Anatolia into the Balkan Peninsula and Central Europe represent an important contribution to the genetic shift between Early and Late Neolithic populations in Europe, and consequently to the genetic make-up of modern European populations. PMID:26053041

  2. Training-related changes in early visual processing of functionally illiterate adults: evidence from event-related brain potentials

    PubMed Central

    2013-01-01

    Background Event-related brain potentials (ERPs) were used to investigate training-related changes in fast visual word recognition of functionally illiterate adults. Analyses focused on the left-lateralized occipito-temporal N170, which represents the earliest processing of visual word forms. Event-related brain potentials were recorded from 20 functional illiterates receiving intensive literacy training for adults, 10 functional illiterates not participating in the training and 14 regular readers while they read words, pseudowords or viewed symbol strings. Subjects were required to press a button whenever a stimulus was immediately repeated. Results Attending intensive literacy training was associated with improvements in reading and writing skills and with an increase of the word-related N170 amplitude. For untrained functional illiterates and regular readers no changes in literacy skills or N170 amplitude were observed. Conclusions Results of the present study suggest that the word-related N170 can still be modulated in adulthood as a result of the improvements in literacy skills. PMID:24330622

  3. Replicated Composite Optics Development

    NASA Technical Reports Server (NTRS)

    Engelhaupt, Darell

    1997-01-01

    Advanced optical systems for applications such as grazing incidence Wolter I x-ray mirror assemblies require extraordinary mirror surfaces in ten-ns of fine surface finish and figure. The impeccable mirror surface is on the inside of the rotational mirror form. One practical method of producing devices with these requirements is to first fabricate an exterior surface for the optical device then replicate that surface to have the inverse component with lightweight characteristics. The replicate optic is not better than the master or mandrel from which it is made. This task is a continuance of previous studies to identify methods and materials for forming these extremely low roughness optical components.

  4. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    PubMed

    Ohmayer, Uli; Gil-Hernández, Álvaro; Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  5. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors

    PubMed Central

    Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  6. The influence of the air plasma jet on early adherent events of L929 fibroblasts on cell culture polystyrene plate

    NASA Astrophysics Data System (ADS)

    Lee, Jung-Hwan; Kwon, Jae-Sung; Om, Ji-Yeon; Kim, Yong-Hee; Choi, Eun-Ha; Kim, Kwang-Mahn; Kim, Kyoung-Nam

    2012-10-01

    Recently, atmospheric pressure plasma was applied to biological field. The aim of this study was to identify whether the air plasma jet increases fibroblast early attachment under moving motion on the cell culture polystyrene plate. Polystyrene plate was treated with plasma jet using compressed air. After 2 minutes of treatment, L929 was seeded on polystyrene plate as well as on untreated plate. Cells were allowed to attach for 4 hours under 70 RPM. FE-SEM, confocal microscopy and RT-PCR were used to evaluate characters of cells. The results suggested that plasma treatment on the polystyrene plate altered surface energy without change of roughness. In occasion of treatment plate, attached L292 were significantly found but not found on untreated surface. Also, despite the small area of treated center by the flame of the plasma jet, cells were also attached on round surface of the area covered by the flame, which suggests that the effect was not only due to the jet flame but perhaps due to the jet interacting with surrounding atmosphere. In the light of this study, the air plasma jet could be useful for early attachment of L292 on the polystyrene plate under moving motion and can be applied to biomaterials.

  7. Frog Virus 3 DNA Replication Occurs in Two Stages

    PubMed Central

    Goorha, R.

    1982-01-01

    Viral DNA synthesis in frog virus 3 (FV3)-infected cells occurs both in the nucleus and in the cytoplasm (Goorha et al., Virology 84:32-51, 1978). Relationships between viral DNA molecules synthesized in these two compartments and their role in the virus replication were examined. The data presented here suggest that (i) FV3 DNA replicated in two stages and (ii) nucleus and cytoplasm were the sites of stages 1 and 2 of DNA replication, respectively. Stages 1 and 2 were further distinguished by their temporal appearance during infection and by the sizes of the replicating DNA as determined by sedimentation in neutral sucrose gradients. In stage 1, replicating molecules, between the size of unit and twice the unit length, were produced early in infection (2 h postinfection). In contrast, stage 2 of DNA replication occurred only after 3 h postinfection, and replicating molecules were large concatemers. Results of pulse-chase experiments showed that the concatemeric DNA served as the precursor for the production of mature FV3 DNA. Denaturation of concatemeric DNA with alkali or digestion with S1 nuclease reduced it to less than genome size molecules, indicating the presence of extensive single-stranded regions. Analysis of replicating DNA by equilibrium centrifugation in CsCl gradients after a pulse-chase suggested that these single-stranded regions were subsequently repaired. Based on these and previous data, a scheme of FV3 replication is presented. According to this scheme, FV3 utilizes the nucleus for early transcription and stage 1 of DNA replication. The viral DNA is then transported to the cytoplasm, where it participates in stage 2 DNA replication to form a concatemeric replication complex. The processing of concatemers to produce mature viral DNA and virus assembly also occurs in the cytoplasm. This mode of replication is strikingly different from any other known DNA virus. PMID:7109033

  8. The Early Miocene "Bisciaro volcaniclastic event" (northern Apennines, Italy): a key study for the geodynamic evolution of the central-western Mediterranean

    NASA Astrophysics Data System (ADS)

    Guerrera, Francesco; Martín-Martín, Manuel; Raffaelli, Giuliana; Tramontana, Mario

    2015-06-01

    The Early Miocene Bisciaro Fm., a marly limestone succession cropping out widely in the Umbria-Romagna-Marche Apennines, is characterized by a high amount of volcaniclastic content, characterizing this unit as a peculiar event of the Adria Plate margin. Because of this volcaniclastic event, also recognizable in different sectors of the central-western Mediterranean chains, this formation is proposed as a "marker" for the geodynamic evolution of the area. In the Bisciaro Fm., the volcaniclastic supply starts with the "Raffaello" bed (Earliest Aquitanian) that marks the base of the formation and ends in the lower portion of the Schlier Fm. (Late Burdigalian-Langhian p.p.). Forty-one studied successions allowed the recognition of three main petrofacies: (1) Pyroclastic Deposits (volcanic materials more than 90 %) including the sub-petrofacies 1A, Vitroclastic/crystallo- vitroclastic tuffs; 1B, Bentonitic deposits; and 1C, Ocraceous and blackish layers; (2) Resedimented Syn-Eruptive Volcanogenic Deposits (volcanic material 30-90 %) including the sub-petrofacies 2A, High- density volcanogenic turbidites; 2B, Low- density volcanogenic turbidites; 2C, Crystal- rich volcanogenic deposits; and 2D, Glauconitic- rich volcaniclastites; (3) Mixing of Volcaniclastic Sediments with Marine Deposits (volcanic material 5-30 %, mixed with marine sediments: marls, calcareous marls, and marly limestones). Coeval volcaniclastic deposits recognizable in different tectonic units of the Apennines, Maghrebian, and Betic Chains show petrofacies and chemical-geochemical features related to a similar calc-alkaline magmatism. The characterization of this event led to the hypothesis of a co-genetic relationship between volcanic activity centres (primary volcanic systems) and depositional basins (depositional processes) in the Early Miocene palaeogeographic and palaeotectonic evolution of the central-western Mediterranean region. The results support the proposal of a geodynamic model of this area

  9. A Protocolised Once a Day Modified Early Warning Score (MEWS) Measurement Is an Appropriate Screening Tool for Major Adverse Events in a General Hospital Population

    PubMed Central

    Ludikhuize, Jeroen; Kramer, Mark H. H.

    2016-01-01

    Background The Modified Early Warning Score (MEWS) was developed to timely recognise clinically deteriorating hospitalised patients. However, the ability of the MEWS in predicting serious adverse events (SAEs) in a general hospital population has not been examined prospectively. The aims were to (1) analyse protocol adherence to a MEWS protocol in a real-life setting and (2) to determine the predictive value of protocolised daily MEWS measurement on SAEs: death, cardiac arrests, ICU-admissions and readmissions. Methods All adult patients admitted to 6 hospital wards in October and November 2015 were included. MEWS were checked each morning by the research team. For each critical score (MEWS ≥ 3), the clinical staff was inquired about the actions performed. 30-day follow-up for SAEs was performed to compare between patients with and without a critical score. Results 1053 patients with 3673 vital parameter measurements were included, 200 (19.0%) had a critical score. The protocol adherence was 89.0%. 18.2% of MEWS were calculated wrongly. Patients with critical scores had significant higher rates of unplanned ICU admissions [7.0% vs 1.3%, p < 0.001], in-hospital mortality [6.0% vs 0.8%, p < 0.001], 30-day readmission rates [18.6% vs 10.8%, p < 0.05], and a longer length of stay [15.65 (SD: 15.7 days) vs 6.09 (SD: 6.9), p < 0.001]. Specificity of MEWS related to composite adverse events was 83% with a negative predicting value of 98.1%. Conclusions Protocol adherence was high, even though one-third of the critical scores were calculated wrongly. Patients with a MEWS ≥ 3 experienced significantly more adverse events. The negative predictive value of early morning MEWS < 3 was 98.1%, indicating the reliability of this score as a screening tool. PMID:27494719

  10. Readiness of the ATLAS Spanish Federated Tier-2 for the Physics Analysis of the early collision events at the LHC

    NASA Astrophysics Data System (ADS)

    Oliver, E.; Nadal, J.; Pardo, J.; Amorós, G.; Borrego, C.; Campos, M.; Del Cano, L.; Del Peso, J.; Espinal, X.; Fassi, F.; Fernández, A.; Fernández, P.; González, S.; Kaci, M.; Lamas, A.; March, L.; Muñoz, L.; Pacheco, A.; Salt, J.; Sánchez, J.; Villaplana, M.; Vives, R.

    2010-04-01

    In this contribution an evaluation of the readiness parameters for the Spanish ATLAS Federated Tier-2 is presented, regarding the ATLAS data taking which is expected to start by the end of the year 2009. Special attention will be paid to the Physics Analysis from different points of view: Data Management, Simulated events Production and Distributed Analysis Tests. Several use cases of Distributed Analysis in GRID infrastructures and local interactive analysis in non-Grid farms, are provided, in order to evaluate the interoperability between both environments, and to compare the different performances. The prototypes for local computing infrastructures for data analysis are described. Moreover, information about a local analysis facilities, called Tier-3, is given.

  11. Wedelolactone mitigates UVB induced oxidative stress, inflammation and early tumor promotion events in murine skin: plausible role of NFkB pathway.

    PubMed

    Ali, Farrah; Khan, Bilal Azhar; Sultana, Sarwat

    2016-09-01

    UVB (Ultra-violet B) radiation is one of the major etiological factors in various dermal pathology viz. dermatitis, actinic folliculitis, solar urticaria, psoriasis and cancer among many others. UVB causes toxic manifestation in tissues by inciting inflammatory and tumor promoting events. We have designed this study to assess the anti-inflammatory and anti-tumor promotion effect of Wedelolactone (WDL) a specific IKK inhibitor. Results indicate significant restoration of anti-oxidative enzymes due to WDL treatments. We also found that WDL was effective in mitigating inflammatory markers consisting of MPO (myeloperoxidase), Mast cells trafficking, Langerhans cells suppression and COX 2 expression up regulation due to UVB exposure. We also deduce that WDL presented a promising intervention in attenuating early tumor promotion events caused by UVB exposure as indicated by the results of ODC (Ornithine Decarboxylase), Thymidine assay, Vimentin and VEGF (Vascular-endothelial growth factor) expression. This study was able to provide substantial cues for the therapeutic ability of Wedelolactone against inflammatory and tumor promoting events in murine skin depicting plausible role of NFkB pathway. PMID:27164422

  12. Ability to delay neuropathological events associated with astrocytic MAO-B increase in a Parkinsonian mouse model: implications for early intervention on disease progression.

    PubMed

    Siddiqui, Almas; Mallajosyula, Jyothi K; Rane, Anand; Andersen, Julie K

    2010-11-01

    We previously demonstrated that elevation of astrocytic monoamine oxidase B (MAO-B) levels in a doxycycline (dox)-inducible transgenic mouse model following 14 days of dox induction results in several neuropathologic features similar to those observed in the Parkinsonian midbrain (Mallajosyula et al., 2008). These include a specific, selective and progressive loss of dopaminergic neurons of the substantia nigra (SN), selective decreases in mitochondrial complex I (CI) activity and increased oxidative stress. Here, we report that the temporal sequence of events following MAO-B elevation initially involves increased oxidative stress followed by CI inhibition and finally neurodegeneration. Furthermore, dox removal (DR) at days 3 and 5 of MAO-B induction was sufficient to arrest further increases in oxidative stress as well as subsequent neurodegenerative events. In order to assess the contribution of MAO-B-induced oxidative stress to later events, we compared the impact of DR which reverses the MAO-B increase with treatment of animals with the lipophilic antioxidant compound EUK-189. EUK-189 was found to be as effective as DR in halting downstream CI inhibition and also significantly attenuated SN DA cell loss as a result of astrocytic MAO-B induction. This suggests that MAO-B-mediated ROS contributes to neuropathology associated with this model and that antioxidant treatment can arrest further progression of dopaminergic cell death. This has implications for early intervention therapies. PMID:20655384

  13. E. coli minichromosome replication in vitro and in vivo: comparative analyses of replication intermediates.

    PubMed

    Munson, B R; Hucul, J A; Maier, P G; Krajewski, C A; Helmstetter, C E

    1987-10-01

    The process of replication of Escherichia coli minichromosomes was examined by following the intermediates formed in vitro and in vivo. Replication initiated on a supercoiled closed circular (CC) monomer, proceeded rapidly to a late but incomplete stage in polymerization (the LC form) in both systems, passed more slowly through a series of open and closed circular catenated dimers with varying extents of intertwining between the monomer units, and then yielded, after decatenation, the supercoiled CC monomer. The replication patterns of two different minichromosomes were similar, although the LC form and the multiply intertwined dimers were much more evident in the smaller pAL4 than in pAL2. The same basic replication scheme was seen in vitro and in vivo but completion of polymerization and processing of the dimers were slower in vitro. Some radioactivity was detected in OC monomer early during replication, consistent with occasional decatenation of LC structures to produce OC molecules which then completed replication to form CC molecules. However, progression to CC catenated dimers prior to formation of CC monomers represented the major replication pathway. PMID:3307923

  14. The Eukaryotic Replication Machine.

    PubMed

    Zhang, D; O'Donnell, M

    2016-01-01

    The cellular replicating machine, or "replisome," is composed of numerous different proteins. The core replication proteins in all cell types include a helicase, primase, DNA polymerases, sliding clamp, clamp loader, and single-strand binding (SSB) protein. The core eukaryotic replisome proteins evolved independently from those of bacteria and thus have distinct architectures and mechanisms of action. The core replisome proteins of the eukaryote include: an 11-subunit CMG helicase, DNA polymerase alpha-primase, leading strand DNA polymerase epsilon, lagging strand DNA polymerase delta, PCNA clamp, RFC clamp loader, and the RPA SSB protein. There are numerous other proteins that travel with eukaryotic replication forks, some of which are known to be involved in checkpoint regulation or nucleosome handling, but most have unknown functions and no bacterial analogue. Recent studies have revealed many structural and functional insights into replisome action. Also, the first structure of a replisome from any cell type has been elucidated for a eukaryote, consisting of 20 distinct proteins, with quite unexpected results. This review summarizes the current state of knowledge of the eukaryotic core replisome proteins, their structure, individual functions, and how they are organized at the replication fork as a machine. PMID:27241931

  15. Non-Verbal Reasoning Ability and Academic Achievement as Moderators of the Relation between Adverse Life Events and Emotional and Behavioural Problems in Early Adolescence: The Importance of Moderator and Outcome Specificity

    ERIC Educational Resources Information Center

    Flouri, Eirini; Tzavidis, Nikos

    2011-01-01

    This study was carried out to model the functional form of the effect of contextual risk (number of adverse life events) on emotional and behavioural problems in early adolescence, and to test how intelligence and academic achievement compare as moderators of this effect. The effect of number of adverse life events on emotional and behavioural…

  16. Early use of orthographic information in spoken word recognition: Event-related potential evidence from the Korean language.

    PubMed

    Kwon, Youan; Choi, Sungmook; Lee, Yoonhyoung

    2016-04-01

    This study examines whether orthographic information is used during prelexical processes in spoken word recognition by investigating ERPs during spoken word processing for Korean words. Differential effects due to orthographic syllable neighborhood size and sound-to-spelling consistency on P200 and N320 were evaluated by recording ERPs from 42 participants during a lexical decision task. The results indicate that P200 was smaller for words whose orthographic syllable neighbors are large in number rather than those that are small. In addition, a word with a large orthographic syllable neighborhood elicited a smaller N320 effect than a word with a small orthographic syllable neighborhood only when the word had inconsistent sound-to-spelling mapping. The results provide support for the assumption that orthographic information is used early during the prelexical spoken word recognition process. PMID:26669620

  17. High-Throughput Tag-Sequencing Analysis of Early Events Induced by Ochratoxin A in HepG-2 Cells.

    PubMed

    Zhang, Yu; Qi, Xiaozhe; Zheng, Juanjuan; Luo, YunBo; Huang, Kunlun; Xu, Wentao

    2016-01-01

    Ochratoxin A (OTA) is produced by fungi of the species Aspergillus and Penicillium. OTA has displayed hepatotoxicity in mammals. Although recent studies have indicated that OTA influences liver function, little is known regarding its impact on differential early liver toxicity. In this study, we report high-throughput tag-sequencing (Tag-seq) analysis of the transcriptome using Solexa Analyzer platform after 4 h of OTA treatment on HepG-2 cells. The analyses of differentially expressed genes revealed the substantial changes. A total of 21,449 genes were identified and quantified, with 2726 displaying significantly altered expression levels. Expression level data were then integrated with a network of gene-gene interactions, and biological pathways to obtain a systems-level view of changes in the transcriptome that occur with OTA resistance. Our data suggest that OTA exposure leads to an imbalance in zinc finger expression and shed light on splicing factor and mitochondrial-based mechanisms. PMID:26377828

  18. Early events in preprotein recognition in E. coli: interaction of SRP and trigger factor with nascent polypeptides.

    PubMed Central

    Valent, Q A; Kendall, D A; High, S; Kusters, R; Oudega, B; Luirink, J

    1995-01-01

    In Escherichia coli, components of a signal recognition particle (SRP) and its receptor have been identified which appear to be essential for efficient translocation of several proteins. In this study we use cross-linking to demonstrate that E. coli SRP interacts with a variety of nascent presecretory proteins and integral inner membrane proteins. Evidence is presented that the interaction is correlated with the hydrophobicity of the core region of the signal sequence and thereby with its ability to promote transport in vivo. A second E. coli component, which is identified as trigger factor, can be efficiently cross-linked to all tested nascent chains derived from both secreted and cytosolic proteins. We propose that SRP and trigger factor act as secretion-specific and general molecular chaperone respectively, early in protein synthesis. Images PMID:8521806

  19. Ligand dynamics and early signaling events in the heme domain of the sensor protein Dos from Escherichia coli.

    PubMed

    Yamashita, Taku; Bouzhir-Sima, Latifa; Lambry, Jean-Christophe; Liebl, Ursula; Vos, Marten H

    2008-01-25

    In the heme-based sensor Dos from Escherichia coli, the ferrous heme is coordinated by His-77 and Met-95. The latter residue is replaced upon oxygen binding or oxidation of the heme. Here we investigate the early signaling processes upon dissociation of the distal ligand using ultrafast spectroscopy and site-directed mutagenesis. Geminate CO rebinding to the heme domain DosH appears insensitive to replacement of Met-95, in agreement with the notion that this residue is oriented out of the heme pocket in the presence of external ligands. A uniquely slow 35-ps phase in rebinding of the flexible methionine side chain after dissociation from ferrous DosH is completely abolished in rebinding of the more rigid histidine side chain in the M95H mutant protein, where only the 7-ps phase, common to all 6-coordinate heme proteins, is observed. Temperature-dependence studies indicate that all rebinding of internal and external ligands is essentially barrierless, but that CfigsO escape from the heme pocket is an activated process. Solvent viscosity studies combined with molecular dynamics simulations show that there are two configurations in the ferrous 6-coordinate protein, involving two isomers of the Met-95 side chain, of which the structural changes extend to the solvent-exposed backbone, which is part of the flexible FG loop. One of these configurations has considerable motional freedom in the Met-95-dissociated state. We suggest that this configuration corresponds to an early signaling intermediate state, is responsible for the slow rebinding, and allows small ligands in the protein to efficiently compete for binding with the heme. PMID:18039668

  20. Muscle Tissue Damage Induced by the Venom of Bothrops asper: Identification of Early and Late Pathological Events through Proteomic Analysis

    PubMed Central

    Herrera, Cristina; Macêdo, Jéssica Kele A.; Feoli, Andrés; Escalante, Teresa; Rucavado, Alexandra; Gutiérrez, José María; Fox, Jay W.

    2016-01-01

    The time-course of the pathological effects induced by the venom of the snake Bothrops asper in muscle tissue was investigated by a combination of histology, proteomic analysis of exudates collected in the vicinity of damaged muscle, and immunodetection of extracellular matrix proteins in exudates. Proteomic assay of exudates has become an excellent new methodological tool to detect key biomarkers of tissue alterations for a more integrative perspective of snake venom-induced pathology. The time-course analysis of the intracellular proteins showed an early presence of cytosolic and mitochondrial proteins in exudates, while cytoskeletal proteins increased later on. This underscores the rapid cytotoxic effect of venom, especially in muscle fibers, due to the action of myotoxic phospholipases A2, followed by the action of proteinases in the cytoskeleton of damaged muscle fibers. Similarly, the early presence of basement membrane (BM) and other extracellular matrix (ECM) proteins in exudates reflects the rapid microvascular damage and hemorrhage induced by snake venom metalloproteinases. The presence of fragments of type IV collagen and perlecan one hour after envenoming suggests that hydrolysis of these mechanically/structurally-relevant BM components plays a key role in the genesis of hemorrhage. On the other hand, the increment of some ECM proteins in the exudate at later time intervals is likely a consequence of the action of endogenous matrix metalloproteinases (MMPs) or of de novo synthesis of ECM proteins during tissue remodeling as part of the inflammatory reaction. Our results offer relevant insights for a more integrative and systematic understanding of the time-course dynamics of muscle tissue damage induced by B. asper venom and possibly other viperid venoms. PMID:27035343

  1. Muscle Tissue Damage Induced by the Venom of Bothrops asper: Identification of Early and Late Pathological Events through Proteomic Analysis.

    PubMed

    Herrera, Cristina; Macêdo, Jéssica Kele A; Feoli, Andrés; Escalante, Teresa; Rucavado, Alexandra; Gutiérrez, José María; Fox, Jay W

    2016-04-01

    The time-course of the pathological effects induced by the venom of the snake Bothrops asper in muscle tissue was investigated by a combination of histology, proteomic analysis of exudates collected in the vicinity of damaged muscle, and immunodetection of extracellular matrix proteins in exudates. Proteomic assay of exudates has become an excellent new methodological tool to detect key biomarkers of tissue alterations for a more integrative perspective of snake venom-induced pathology. The time-course analysis of the intracellular proteins showed an early presence of cytosolic and mitochondrial proteins in exudates, while cytoskeletal proteins increased later on. This underscores the rapid cytotoxic effect of venom, especially in muscle fibers, due to the action of myotoxic phospholipases A2, followed by the action of proteinases in the cytoskeleton of damaged muscle fibers. Similarly, the early presence of basement membrane (BM) and other extracellular matrix (ECM) proteins in exudates reflects the rapid microvascular damage and hemorrhage induced by snake venom metalloproteinases. The presence of fragments of type IV collagen and perlecan one hour after envenoming suggests that hydrolysis of these mechanically/structurally-relevant BM components plays a key role in the genesis of hemorrhage. On the other hand, the increment of some ECM proteins in the exudate at later time intervals is likely a consequence of the action of endogenous matrix metalloproteinases (MMPs) or of de novo synthesis of ECM proteins during tissue remodeling as part of the inflammatory reaction. Our results offer relevant insights for a more integrative and systematic understanding of the time-course dynamics of muscle tissue damage induced by B. asper venom and possibly other viperid venoms. PMID:27035343

  2. More evidence for a glacial world prior to the middle Miocene oxygen-isotope enrichment event: resolution of early Miocene glacioeustatic sea-level cyclicity from North Carolina

    SciTech Connect

    Synder, S.W.; Synder, S.W.; Waters, V.J.; Steinmetz, J.C.; Hine, A.C.; Riggs, S.R.

    1985-01-01

    Benthic delta/sup 18/O analyses from DSDP sites worldwide have documented a positive excursion (similarly ordered + 1.5%) through the early-middle Miocene. These data are traditionally interpreted as marking the transition from an ice-free world to one that was extensively glaciated. Recently, however, this doctrine has been challenged, and an alternative hypothesis suggests the benthic delta/sup 18/O excursion primarily reflects a temperature drop within a previously glaciated world. Within the North Carolina continental margin, a chronostratigraphic framework consisting of 6 discrete early Miocene depositional sequences was established via stratigraphic interpretations from over 21,000 Km of high-resolution seismic reflection profiles. Each sequence is bound by unconformities which were mapped throughout the continental margin. Biostratigraphic analyses of 140 vibracores penetrating these sequences demonstrate that each sequence is a consequence of 4th-order (10/sup 5/yrs) sea-level cyclicity, similar in duration (100-300 Ka) and amplitude (100-150 m) to the glacioeustatic sea-level fluctuations of the Quaternary Epoch. Recognition of late Burdigalian high-frequency (4th-order) sea-level cyclicity demonstrates that continental ice-sheets were large enough during the early Miocene to drive eustatic sea-level fluctuations with Milankovitch-type periodicities. This further supports Matthews (1984) hypothesis that continental ice-caps existed on Antarctica PRIOR to the well-documented middle Miocene benthic delta/sup 18/O global enrichment event.

  3. Pre-sowing Seed Treatments in Direct-seeded Early Rice: Consequences for Emergence, Seedling Growth and Associated Metabolic Events under Chilling Stress.

    PubMed

    Wang, Weiqin; Chen, Qian; Hussain, Saddam; Mei, Junhao; Dong, Huanglin; Peng, Shaobing; Huang, Jianliang; Cui, Kehui; Nie, Lixiao

    2016-01-01

    Double direct-seeding for double rice cropping is a simplified, labor saving, and efficient cropping system to improve multiple-crop index and total rice production in central China. However, poor crop establishment of direct-seeded early rice due to chilling stress is the main obstacle to wide spread of this system. A series of experiments were conducted to unravel the effects of pre-sowing seed treatments on emergence, seedling growth and associated metabolic events of direct-seeded early rice under chilling stress. Two seed priming treatments and two seed coating treatments were used in all the experiments. A non-treated control treatment was also maintained for comparison. In both the field and growth chamber studies, seed priming with selenium or salicylic acid significantly enhanced the emergence and seedling growth of rice compared with non-treated control. Nevertheless, such positive effects were not apparent for seed coating treatments. Better emergence and vigorous seedling growth of rice after seed priming was associated with enhanced α-amylase activity, higher soluble sugars contents, and greater respiration rate in primed rice seedlings under chilling stress. Taking together, these findings may provide new avenues for understanding and advancing priming-induced chilling tolerance in direct-seeded early rice in double rice cropping system. PMID:26782108

  4. Pre-sowing Seed Treatments in Direct-seeded Early Rice: Consequences for Emergence, Seedling Growth and Associated Metabolic Events under Chilling Stress

    PubMed Central

    Wang, Weiqin; Chen, Qian; Hussain, Saddam; Mei, Junhao; Dong, Huanglin; Peng, Shaobing; Huang, Jianliang; Cui, Kehui; Nie, Lixiao

    2016-01-01

    Double direct-seeding for double rice cropping is a simplified, labor saving, and efficient cropping system to improve multiple-crop index and total rice production in central China. However, poor crop establishment of direct-seeded early rice due to chilling stress is the main obstacle to wide spread of this system. A series of experiments were conducted to unravel the effects of pre-sowing seed treatments on emergence, seedling growth and associated metabolic events of direct-seeded early rice under chilling stress. Two seed priming treatments and two seed coating treatments were used in all the experiments. A non-treated control treatment was also maintained for comparison. In both the field and growth chamber studies, seed priming with selenium or salicylic acid significantly enhanced the emergence and seedling growth of rice compared with non-treated control. Nevertheless, such positive effects were not apparent for seed coating treatments. Better emergence and vigorous seedling growth of rice after seed priming was associated with enhanced α-amylase activity, higher soluble sugars contents, and greater respiration rate in primed rice seedlings under chilling stress. Taking together, these findings may provide new avenues for understanding and advancing priming-induced chilling tolerance in direct-seeded early rice in double rice cropping system. PMID:26782108

  5. Replicative DNA polymerases.

    PubMed

    Johansson, Erik; Dixon, Nicholas

    2013-06-01

    In 1959, Arthur Kornberg was awarded the Nobel Prize for his work on the principles by which DNA is duplicated by DNA polymerases. Since then, it has been confirmed in all branches of life that replicative DNA polymerases require a single-stranded template to build a complementary strand, but they cannot start a new DNA strand de novo. Thus, they also depend on a primase, which generally assembles a short RNA primer to provide a 3'-OH that can be extended by the replicative DNA polymerase. The general principles that (1) a helicase unwinds the double-stranded DNA, (2) single-stranded DNA-binding proteins stabilize the single-stranded DNA, (3) a primase builds a short RNA primer, and (4) a clamp loader loads a clamp to (5) facilitate the loading and processivity of the replicative polymerase, are well conserved among all species. Replication of the genome is remarkably robust and is performed with high fidelity even in extreme environments. Work over the last decade or so has confirmed (6) that a common two-metal ion-promoted mechanism exists for the nucleotidyltransferase reaction that builds DNA strands, and (7) that the replicative DNA polymerases always act as a key component of larger multiprotein assemblies, termed replisomes. Furthermore (8), the integrity of replisomes is maintained by multiple protein-protein and protein-DNA interactions, many of which are inherently weak. This enables large conformational changes to occur without dissociation of replisome components, and also means that in general replisomes cannot be isolated intact. PMID:23732474

  6. Coordinate initiation of chromosome and minichromosome replication in Escherichia coli.

    PubMed Central

    Helmstetter, C E; Leonard, A C

    1987-01-01

    Escherichia coli minichromosomes harboring as little as 327 base pairs of DNA from the chromosomal origin of replication (oriC) were found to replicate in a discrete burst during the division cycle of cells growing with generation times between 25 and 60 min at 37 degrees C. The mean cell age at minichromosome replication coincided with the mean age at initiation of chromosome replication at all growth rates, and furthermore, the age distributions of the two events were indistinguishable. It is concluded that initiation of replication from oriC is controlled in the same manner on minichromosomes and chromosomes over the entire range of growth rates and that the timing mechanism acts within the minimal oriC nucleotide sequence required for replication. Images PMID:3301802

  7. Replicating Cardiovascular Condition-Birth Month Associations.

    PubMed

    Li, Li; Boland, Mary Regina; Miotto, Riccardo; Tatonetti, Nicholas P; Dudley, Joel T

    2016-01-01

    Independent replication is vital for study findings drawn from Electronic Health Records (EHR). This replication study evaluates the relationship between seasonal effects at birth and lifetime cardiovascular condition risk. We performed a Season-wide Association Study on 1,169,599 patients from Mount Sinai Hospital (MSH) to compute phenome-wide associations between birth month and CVD. We then evaluated if seasonal patterns found at MSH matched those reported at Columbia University Medical Center. Coronary arteriosclerosis, essential hypertension, angina, and pre-infarction syndrome passed phenome-wide significance and their seasonal patterns matched those previously reported. Atrial fibrillation, cardiomyopathy, and chronic myocardial ischemia had consistent patterns but were not phenome-wide significant. We confirm that CVD risk peaks for those born in the late winter/early spring among the evaluated patient populations. The replication findings bolster evidence for a seasonal birth month effect in CVD. Further study is required to identify the environmental and developmental mechanisms. PMID:27624541

  8. The QT dispersion and QTc dispersion in patients presenting with acute neurological events and its impact on early prognosis

    PubMed Central

    Rahar, Kailash Kumar; Pahadiya, Hans Raj; Barupal, Kishan Gopal; Mathur, C. P.; Lakhotia, Manoj

    2016-01-01

    Aims: To find out and investigate whether the QT dispersion and QTc dispersion is related to type and prognosis of the acute stroke in patients presenting within 24 h of the onset of stroke. Settings and Design: This was a observational study conducted at Mahatma Gandhi Hospital, Dr. SN. Medical College, Jodhpur, during January 2014 to January 2015. Subjects and Methods: The patients presented within 24 h of onset of acute stroke (hemorrhagic, infarction, or transient ischemic event) were included in the study. The stroke was confirmed by computed tomography scan and magnetic resonance imaging. Patients with (i) altered sensorium because of metabolic, infective, seizures, trauma, or tumor; (ii) prior history of cardiovascular disease, electrocardiographic abnormalities’ because of dyselectrolytemia; and (iii) and patients who were on drugs (antiarrhythmic drugs, antipsychotic drugs, erythromycin, theophylline, etc.,) which known to cause electrocardiogram changes, were excluded from the study. National Institute of Health Stroke Score (NIHSS) was calculated at the time of admission and Modified Rankin Scale (MRS) at the time of discharge. Fifty age- and sex-matched healthy controls included. Statistical Analysis Used: Student's t-test, ANOVA, and area under curve for sensitivity and specificity for the test. Results: We included 52 patients (male/female: 27/25) and 50 controls (26/24). The mean age of patients was 63.17 ± 08.90 years. Of total patients, infarct was found in 32 (61.53%), hemorrhage in 18 (34.61%), transient ischemic attack (TIA) in 1 (1.9%), and subarachnoid hemorrhage in 1 (1.9%) patient. The QT dispersion and QTc dispersion were significantly higher in cases as compare to controls. (87.30 ± 24.42 vs. 49.60 ± 08.79 ms; P < 0.001) and (97.53 ± 27.36 vs. 56.28 ± 09.86 ms; P < 0.001). Among various types of stroke, the mean QT dispersion and QTc dispersion were maximum and significantly higher in hemorrhagic stroke as compared to infarct and

  9. Multifaceted Regulation of Translational Readthrough by RNA Replication Elements in a Tombusvirus

    PubMed Central

    Cimino, Peter A.; Nicholson, Beth L.; Wu, Baodong; Xu, Wei; White, K. Andrew

    2011-01-01

    Translational readthrough of stop codons by ribosomes is a recoding event used by a variety of viruses, including plus-strand RNA tombusviruses. Translation of the viral RNA-dependent RNA polymerase (RdRp) in tombusviruses is mediated using this strategy and we have investigated this process using a variety of in vitro and in vivo approaches. Our results indicate that readthrough generating the RdRp requires a novel long-range RNA-RNA interaction, spanning a distance of ∼3.5 kb, which occurs between a large RNA stem-loop located 3'-proximal to the stop codon and an RNA replication structure termed RIV at the 3'-end of the viral genome. Interestingly, this long-distance RNA-RNA interaction is modulated by mutually-exclusive RNA structures in RIV that represent a type of RNA switch. Moreover, a different long-range RNA-RNA interaction that was previously shown to be necessary for viral RNA replicase assembly was also required for efficient readthrough production of the RdRp. Accordingly, multiple replication-associated RNA elements are involved in modulating the readthrough event in tombusviruses and we propose an integrated mechanistic model to describe how this regulatory network could be advantageous by (i) providing a quality control system for culling truncated viral genomes at an early stage in the replication process, (ii) mediating cis-preferential replication of viral genomes, and (iii) coordinating translational readthrough of the RdRp with viral genome replication. Based on comparative sequence analysis and experimental data, basic elements of this regulatory model extend to other members of Tombusviridae, as well as to viruses outside of this family. PMID:22174683

  10. Astrochronology of the Valanginian-Hauterivian stages (Early Cretaceous): Chronological relationships between the Paraná-Etendeka large igneous province and the Weissert and the Faraoni events

    NASA Astrophysics Data System (ADS)

    Martinez, Mathieu; Deconinck, Jean-François; Pellenard, Pierre; Riquier, Laurent; Company, Miguel; Reboulet, Stéphane; Moiroud, Mathieu

    2015-08-01

    The Geological Time Scale shows large uncertainties on durations and ages of Berriasian to Albian stages (Early Cretaceous), which impact climate and paleoceanographic reconstructions. Here, we provide a new astrochronology of the Hauterivian Stage anchored on (1) recent biostratigraphically well-constrained published radio-isotopic dates, and (2) a previously published astrochronology of the Valanginian Stage. A new duration of the Hauterivian Stage is assessed here at 5.93 ± 0.41 myr. The retained age model, anchored on a latest CA-ID-TIMS U-Pb age from a tuff level in the Hauterivian of the Neuquén Basin (Argentina), dates the base of the Valanginian Stage at - 137.05 ± 1.0 Ma, the base of the Hauterivian Stage at - 131.96 ± 1.0 Ma, and the top of the Hauterivian Stage at - 126.02 ± 1.0 Ma. In addition, the onset of the mid-Valanginian Weissert Event is dated at - 135.22 ± 1.0 Ma and the onset of the Faraoni Event at - 126.73 ± 1.0 Ma. The duration of the mid-Valanginian carbon-isotope excursion, associated to the Weissert Event, is assessed at 5.85 myr, with a rapid phase of increasing δ13C values (0.60 myr), a phase of stable δ13C values (1.48 myr), and smooth decrease in δ13C values (3.77 myr). The calibration provided here highlights that the onset of the activity of the Paraná-Etendeka province and the start of the Weissert Event coincided, suggesting that the Paraná-Etendeka province may have played a major role on the climatic and oceanographic changes during the mid-Valanginian.

  11. Event-related potential study of intentional and incidental retrieval of item and source memory during early childhood.

    PubMed

    Robey, Alison; Riggins, Tracy

    2016-07-01

    The event related potential (ERP) technique is a useful methodology for studying neural changes underlying memory development during childhood. However, systematic comparisons of differences in memory tasks and retrieval demands are lacking. To address this gap, the present study explored the effects of memory task (i.e., item versus source) and retrieval paradigm (i.e., intentional versus incidental) on 4- to 5-year-old children's memory performance and associated electrophysiological responses. Children were familiarized with items in a play-like setting and then asked to retrieve item or source memory details while their brain activity was recorded (intentional retrieval) or while they passively viewed images of the items with no explicit task (incidental retrieval). Memory assessments for the incidental groups followed ERP recording. Analyses of the ERP data suggested that the brain's response during intentional retrieval of source information differed from the other three conditions. These results are discussed within a two-component framework of memory development (e.g., Shing et al., 2010), and implications for future methodological decisions are presented. © 2016 Wiley Periodicals, Inc. Dev Psychobiol 58: 556-567, 2016. PMID:26969036

  12. Initiation and early evolution of the Franklin magmatic event preserved in the 720 Ma Natkusiak Formation, Victoria Island, Canadian Arctic

    NASA Astrophysics Data System (ADS)

    Williamson, Nicole M. B.; Ootes, Luke; Rainbird, Robert H.; Bédard, Jean H.; Cousens, Brian

    2016-03-01

    Our understanding of the onset and evolution of flood basalt volcanism is rooted in the study of the character and internal architecture of its eruptive products. Neoproterozoic continental flood basalts of the ca. 720 Ma Franklin magmatic event are preserved as the Natkusiak Formation and are exposed within the Minto Inlier on Victoria Island, Northwest Territories, Canada. The 200 m volcanic succession evaluated in this study has features similar to those of other continental flood basalt provinces and consists of four volcanic units: a basal unit of laterally discontinuous flows with evidence for lava-sediment interactions, a mafic volcaniclastic deposit emplaced as a mass flow, a quartz-rich volcanic sandstone that records the re-establishment of small river channels, and a unit of thick, high-titanium tholeiitic sheet flows that mark the onset of the main phase of flood volcanism. The basal units show marked lateral thickness variations that imply the existence of paleotopography during their eruption and/or deposition. In addition, two newly discovered volcanic vent complexes within the Natkusiak succession preserve the products of explosive, vent-forming basaltic pyroclastic fall eruptions. Differences in major element geochemistry between the basal and upper basaltic flow units, in conjunction with the lithological characteristics of each volcanic unit, are used to correlate the units on a scale of over 100 km from the south of the Minto Inlier to the north.

  13. Early transcriptional events in the udder and teat after intra-mammary Escherichia coli and Staphylococcus aureus challenge.

    PubMed

    Petzl, Wolfram; Günther, Juliane; Mühlbauer, Katharina; Seyfert, Hans-Martin; Schuberth, Hans-Joachim; Hussen, Jamal; Sauter-Louis, Carola; Hafner-Marx, Angela; Zerbe, Holm

    2016-05-01

    Intra-mammary bacterial infections can result in harmful clinical mastitis or subclinical mastitis with persistent infections. Research during the last decades closely examined the pathophysiology of inflamed udders. Initial events after pathogen perception but before the onset of mastitis have not been examined in vivo The objective of this study was to develop a mastitis model in cows by monitoring initial transcriptional pathogen-specific host response before clinical signs occur. We applied a short-term infection model to analyse transcripts encoding chemokines, cytokines and antimicrobial molecules in the teat cistern (TC) and lobulo-alveolar parenchyma (LP) up to 3 h after challenge with E and Staphylococcus aureus Both pathogens elicited an immune reaction by 1 h after challenge. Escherichia coli induced all analysed factors (CCL20, CXCL8, TNF, IL6, IL12B, IL10, LAP, S100A9); however, S. aureus failed to induce IL12B, IL10, LAP and S100A9 expression. The E. coli-induced up-regulation was 25-105 times greater than that after S. aureus challenge. Almost all the responses were restricted to the TC. The short-term mastitis model demonstrates that a divergent pathogen-specific response is generated during the first h. It confirms that the first transcripts are generated in the TC prior to a response in the LP. PMID:27012912

  14. Mutations altering the gammaretrovirus endoproteolytic motif affect glycosylation of the envelope glycoprotein and early events of the virus life cycle

    SciTech Connect

    Argaw, Takele; Wilson, Carolyn A.

    2015-01-15

    Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectors with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription. - Highlights: • Env cleavage signal impacts infectivity of gammaretroviruses. • Non-infectious mutants have hyper-glycosylated envelope that bind target cells. • Non-infectious mutants have defects in the formation of the double-stranded DNA. • Env cleavage motif has functions beyond cleavage of the env precursor.

  15. An event-related potential study of older children with an early history of failure to thrive.

    PubMed

    Dykman, R A; Ackerman, P T; Loizou, P C; Casey, P H

    2000-01-01

    Elementary and junior high school children (n = 13), who were diagnosed with nonorganic failure to thrive (FTT) as infants and toddlers, were compared with a normal control group (n = 14) on visual event-related potentials (ERPs) elicited during a primed lexical decision task. Positive stimuli were real words that were identical to the priming stimuli; negative stimuli were nonpronounceable letter strings. Although the groups did not differ in word-list reading level, the former FTT group had slower reaction (decision) times and did not show ERP evidence of priming in the N400 epoch. Anterior sites yielded better separation of the real words and letter strings than posterior sites. A late anterior component between 500 msec to 650 msec poststimulus onset showed the largest condition effect for both groups. The control group had a larger negative going late anterior component to words than the FTT group. The combined reaction time and ERP findings point to less automatized word recognition in the FTT group. PMID:11280964

  16. Transantarctic disjunctions in Schistochilaceae (Marchantiophyta) explained by early extinction events, post-Gondwanan radiations and palaeoclimatic changes.

    PubMed

    Sun, Yu; He, Xiaolan; Glenny, David

    2014-07-01

    The liverworts are the first diverging land plant group with origins in the Ordovician. The family Schistochilaceae exhibits diverse morphology and widely disjunct geographic ranges within the Southern Hemisphere. The family has been presented as a classic example of Gondwanan biogeographic distribution, with extant species ranges resulting from vicariance events. In this study, we present results that elucidate the origin and diversification of Schistochilaceae. We conducted a comprehensive time-calibrated, molecular-based phylogenetic analysis and different approaches for ancestral range inference of the family. Schistochilaceae is inferred to have originated in the Late Cretaceous, in an ancestral area including southern South America, West Antarctica and New Zealand. Despite a family origin at c. 100Ma, most of the diversification of Schistochilaceae occurred in New Zealand after the 80Ma opening of the Tasman Sea that isolated New Zealand from the rest of Gondwana. Most dispersals were transoceanic. The northward migration of the Schistochilaceae is probably linked with the spread of temperate vascular plant forest ecosystems that have Late Cretaceous southern origins and have maintained suitable environments for the family throughout the Cenozoic. The distribution and biogeographic history of the family is very similar to that of Nothofagaceae. PMID:24680916

  17. Early folding events during light harvesting complex II assembly in vitro monitored by pulsed electron paramagnetic resonance.

    PubMed

    Fehr, Niklas; García-Rubio, Inés; Jeschke, Gunnar; Paulsen, Harald

    2016-06-01

    Efficient energy transfer in the major light harvesting complex II (LHCII) of green plants is facilitated by the precise alignment of pigments due to the protein matrix they are bound to. Much is known about the import of the LHCII apoprotein into the chloroplast via the TOC/TIC system and its targeting to the thylakoid membrane but information is sparse about when and where the pigments are bound and how this is coordinated with protein folding. In vitro, the LHCII apoprotein spontaneously folds and binds its pigments if the detergent-solubilized protein is combined with a mixture of chlorophylls a and b and carotenoids. In the present work, we employed this approach to study apoprotein folding and pigment binding in a time-resolved manner by using pulsed electron paramagnetic resonance (EPR). Intra-molecular distances were measured before folding, after 255 ms and 40 s folding time in the absence of cryoprotectant, and in the fully folded and assembled LHCII. In accordance with earlier results, the most of the folding of the three membrane-spanning alpha helices precedes their apposition into the final tertiary structure. However, their formation follows different kinetics, partially extending into the final phase of LHCII formation during which much of the condensation of the pigment-protein structure occurs, presumably governed by the binding of chlorophyll b. A rough timetable is proposed to sort partial events into the LHCII formation process. PMID:27063475

  18. Mutations altering the gammaretrovirus endoproteolytic motif affect glycosylation of the envelope glycoprotein and early events of the virus life cycle.

    PubMed

    Argaw, Takele; Wilson, Carolyn A

    2015-01-15

    Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectors with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription. PMID:25462351

  19. Inhomogeneous DNA replication kinetics is associated with immune system response

    NASA Astrophysics Data System (ADS)

    Bechhoefer, John; Gauthier, Michel G.; Norio, Paolo

    2013-03-01

    In eukaryotic organisms, DNA replication is initiated at ``origins,'' launching ``forks'' that spread bidirectionally to replicate the genome. The distribution and firing rate of these origins and the fork progression velocity form the ``replication program.'' Previous models of DNA replication in eukaryotes have assumed firing rates and replication fork velocities to be homogeneous across the genome. But large variations in origin activity and fork velocity do occur. Here, we generalize our replication model to allow for arbitrary spatial variation of initiation rates and fork velocities in a given region of the genome. We derive and solve rate equations for the forks and replication probability, to obtain the mean-field replication program. After testing the model on simulations, we analyze the changes in replication program that occur during B cell development in the mouse. B cells play a major role in the adaptive immune system by producing the antibodies. We show that the process of cell differentiation is associated with a change in replication program, where the zones of high origin initiation rates located in the immunoglobulin heavy-chain locus shift their position as the locus prepares to undergo the recombination events responsible for generating antibody specificity. This work was funded by HSFP and NSERC-Canada (MGG and JB) and by NIH-NIGMS grant R01GM080606 (PN).

  20. The Many Roles of PCNA in Eukaryotic DNA Replication.

    PubMed

    Boehm, E M; Gildenberg, M S; Washington, M T

    2016-01-01

    Proliferating cell nuclear antigen (PCNA) plays critical roles in many aspects of DNA replication and replication-associated processes, including translesion synthesis, error-free damage bypass, break-induced replication, mismatch repair, and chromatin assembly. Since its discovery, our view of PCNA has evolved from a replication accessory factor to the hub protein in a large protein-protein interaction network that organizes and orchestrates many of the key events at the replication fork. We begin this review article with an overview of the structure and function of PCNA. We discuss the ways its many interacting partners bind and how these interactions are regulated by posttranslational modifications such as ubiquitylation and sumoylation. We then explore the many roles of PCNA in normal DNA replication and in replication-coupled DNA damage tolerance and repair processes. We conclude by considering how PCNA can interact physically with so many binding partners to carry out its numerous roles. We propose that there is a large, dynamic network of linked PCNA molecules at and around the replication fork. This network would serve to increase the local concentration of all the proteins necessary for DNA replication and replication-associated processes and to regulate their various activities. PMID:27241932

  1. W Phase Inversion and Tsunami Inundation Modeling for Tsunami Early Warning: Case Study for the 2011 Tohoku Event

    NASA Astrophysics Data System (ADS)

    Gusman, Aditya Riadi; Tanioka, Yuichiro

    2014-07-01

    Centroid moment tensor solutions for the 2011 Tohoku earthquake are determined by W phase inversions using 5 and 10 min data recorded by the Full Range Seismograph Network of Japan (F-net). By a scaling relation of moment magnitude to rupture area and an assumption of rigidity of 4 × 1010 N m-2, simple rectangular earthquake fault models are estimated from the solutions. Tsunami inundations in the Sendai Plain, Minamisanriku, Rikuzentakata, and Taro are simulated using the estimated fault models. Then the simulated tsunami inundation area and heights are compared with the observations. Even the simulated tsunami heights and inundations from the W phase solution that used only 5 min data are considerably similar to the observations. The results are improved when using 10 min of W phase data. These show that the W phase solutions are reliable to be used for tsunami inundation modeling. Furthermore, the technique that combines W phase inversion and tsunami inundation modeling can produce results that have sufficient accuracy for tsunami early warning purposes.

  2. CCR4 Controls the Suppressive Effects of Regulatory T Cells on Early and Late Events during Severe Sepsis

    PubMed Central

    Molinaro, Raphael; Pecli, Cyntia; Guilherme, Rafael F.; Alves-Filho, José Carlos; Cunha, Fernando Q.; Canetti, Claudio; Kunkel, Steven L.; Bozza, Marcelo T.; Benjamim, Claudia F.

    2015-01-01

    Sepsis is a deadly disease characterized by an overwhelming release of inflammatory mediators and the activation of different types of cells. This altered state of cell activation, termed leukocyte reprogramming, contributes to patient outcome. However, the understanding of the process underlying sepsis and the role of regulatory T cells (Tregs) in sepsis remains to be elucidated. In this study, we investigated the role of CCR4, the CCL17/CCL22 chemokine receptor, in the innate and acquired immune responses during severe sepsis and the role of Tregs in effecting the outcome. In contrast with wild-type (WT) mice subjected to cecal ligation and puncture (CLP) sepsis, CCR4-deficient (CCR4-/-) septic mice presented an increased survival rate, significant neutrophil migration toward the infection site, a low bacterial count in the peritoneum, and reduced lung inflammation and serum cytokine levels. Thus, a better early host response may favor an adequate long-term response. Consequently, the CCR4-/- septic mice were not susceptible to secondary fungal infection, in contrast with the WT septic mice. Furthermore, Tregs cells from the CCR4-/- septic mice showed reduced suppressive effects on neutrophil migration (both in vivo and in vitro), lymphocyte proliferation and ROS production from activated neutrophils, in contrast with what was observed for Tregs from the WT septic mice. These data show that CCR4 is involved in immunosuppression after severe sepsis and suggest that CCR4+ Tregs negatively modulate the short and long-term immune responses. PMID:26197455

  3. Event-related potential evidence for the early activation of literal meaning during comprehension of conventional lexical metaphors.

    PubMed

    Lu, Aitao; Zhang, John X

    2012-07-01

    Among different types of metaphors, lexical metaphors are special in that they have been highly lexicalized and often suggested to be processed like non-metaphorical words. The present study examined two types of Chinese metaphorical words which are conceptualized through body parts. One has both a metaphorical meaning and a literal meaning actively in use, with the former dominant over the latter, referred to as the Met+Lit words. The other has only metaphorical meaning, referred to as Met-only words. In two experiments, lexical metaphor words were presented following a body-related picture and participants judged whether the picture and word were semantically related (Experiment 1) or made lexical decision on the word ignoring the picture (Experiment 2). The N400 ERP responses showed a clear semantic priming effect for the Met+Lit words compared with the non-ambiguous neutral words, with latencies comparable to that in Met-only words in both experiments. The results were interpreted to indicate that the literal meaning as a subordinate meaning was activated during the early comprehension of conventional lexical metaphors, supporting the notion of dual access to metaphorical meaning and literal meaning in metaphor processing. PMID:22561889

  4. Biomarkers Provide Clues to Early Events in the Pathogenesis of Breast Implant-Associated Anaplastic Large Cell Lymphoma.

    PubMed

    Kadin, Marshall E; Deva, Anand; Xu, Haiying; Morgan, John; Khare, Pranay; MacLeod, Roderick A F; Van Natta, Bruce W; Adams, William P; Brody, Garry S; Epstein, Alan L

    2016-07-01

    Almost 200 women worldwide have been diagnosed with breast implant-associated anaplastic large cell lymphoma (BIA-ALCL). The unique location and specific lymphoma type strongly suggest an etio-pathologic link between breast implants and BIA-ALCL. It is postulated that chronic inflammation via bacterial infection may be an etiological factor. BIA-ALCL resembles primary cutaneous ALCL (pcALCL) in morphology, activated T-cell phenotype, and indolent clinical course. Gene expression array analysis, flow cytometry, and immunohistochemistry were used to study pcALCL and BIA-ALCL cell lines. Clinical samples were also studied to characterize transcription factor and cytokine profiles of tumor cells and surrounding lymphocytes. BIA-ALCL and pcALCL were found to have common expression of transcription factors SOCS3, JunB, SATB1, and a cytokine profile suggestive of a Th1 phenotype. Similar patterns were observed in a CD30+ cutaneous lymphoproliferative disorder (LPD). The patterns of cytokine and transcription factor expression suggest that BIA-ALCL is likely to arise from chronic bacterial antigen stimulation of T-cells. Further analysis of cytokine and transcription factor profiles may allow early detection and treatment of BIA-ALCL leading to better prognosis and survival. LEVEL OF EVIDENCE 5: Risk. PMID:26979456

  5. An examination of backgrounds to early-run minimum-bias events in ATLAS at the LHC

    NASA Astrophysics Data System (ADS)

    Stradling, Alden Reid

    2008-10-01

    The initial stages of the Large Hadron Collider (LHC) run will be a source of critical information---about the ATLAS detector and about the physics of pp collisions at s = 14 TeV, including parton distribution evolution and the cross-section of sigmapp. The accelerator itself will be the source of some detector interest, as we have a first look at what have so far been speculations on the quality of the vacuum in the experimental insertion, and the cleanliness of the beam from the accelerator. The shakedown period, with its low beam squeeze, low luminosity, and undemanding trigger menus, will be very useful in addressing some of these questions, as it lacks the pileup and radiation levels that will arrive with higher luminosity---making it an important opportunity to investigate minimum-bias events in relative isolation. For the short lifetime of the Minimum Bias Trigger Scintillators (MBTS), which are expected to fail within a few months of running, they will aid in discriminating the minimum bias signal of inelastic non-single-diffractive pp collisions. Using single- or double-coincidence signatures, the MBTS system and other trigger and analysis strategies attempt to avoid triggering on otherwise empty bunch crossings and eliminate the effects of beam-gas collisions and beam-halo effects which would lead these spurious triggers and reduce the general minimum-bias trigger efficiency. An examination of the effects of beam halo and beam-gas interactions on the minimum-bias trigger response is made. The signatures of the beam halo and beam gas are examined from the standard ATLAS tracking reconstruction.

  6. Late Carboniferous-early Permian events in the Trans-European Suture Zone: Tectonic and acid magmatic evidence from Poland

    NASA Astrophysics Data System (ADS)

    Żelaźniewicz, A.; Oberc-Dziedzic, T.; Fanning, C. M.; Protas, A.; Muszyński, A.

    2016-04-01

    The Trans-European Suture Zone (TESZ) links the East and West European Platforms. It is concealed under Meso-Cenozoic cover. Available seismic data show that the lower crustal layer in the TESZ is an attenuated, ~ 200 km wide, SW margin of Baltica. The attenuation occurred when Rodinia broke-up, which gave rise to evolution of the thinned, thus relatively unstable margin of Baltica. It accommodated accretions during Phanerozoic events. We focus on acid magmatism, specifically granitoid, observed close to the SW border of the TESZ in Poland. This border is defined by the Dolsk Fault Zone (DFZ) and the Kraków-Lubliniec Fault Zone (KLFZ) on which dextral wrenching developed as a result of the Variscan collision between Laurussia and Gondwana. The granitoids at the DFZ and KLFZ were dated at ~ 300 Ma. In the Variscan foreland that overlaps the TESZ, orogenic thickening continued to ~ 307-306 Ma, possibly contributed to melting of the thickened upper continental crust (εNd300 = - 6.0 to - 4.5) and triggered the tectonically controlled magmatism. The wrenching on the TESZ border faults caused tensional openings in the basement, which promoted magmatic centers with extrusions of rhyolites and extensive ignimbrites. The Chrzypsko-Paproć and Małopolska magmatic centers were developed at the DFZ and KLFZ, respectively. The magmatic edifices commenced at ~ 302 Ma with relatively poorly evolved granites, which carried both suprasubduction and anorogenic signatures, then followed by more evolved volcanic rocks (up to 293 Ma). Their geochemistry and inherited zircons suggest that the felsic magmas were mainly derived from upper crustal rocks, with some mantle additions, which included Sveconorwegian and older Baltican components. The complex TESZ, with Baltica basement in the lower crust, was susceptible to transient effects of mantle upwelling that occurred by the end of the Variscan orogeny and resulted in an episode of the "flare-up" magmatism in the North German

  7. Telomere replication: poised but puzzling

    PubMed Central

    Sampathi, Shilpa; Chai, Weihang

    2011-01-01

    Abstract Faithful replication of chromosomes is essential for maintaining genome stability. Telomeres, the chromosomal termini, pose quite a challenge to replication machinery due to the complexity in their structures and sequences. Efficient and complete replication of chromosomes is critical to prevent aberrant telomeres as well as to avoid unnecessary loss of telomere DNA. Compelling evidence supports the emerging picture of synergistic actions between DNA replication proteins and telomere protective components in telomere synthesis. This review discusses the actions of various replication and telomere-specific binding proteins that ensure accurate telomere replication and their roles in telomere maintenance and protection. PMID:21122064

  8. Exogenous γ-aminobutyric Acid (GABA) Application Improved Early Growth, Net Photosynthesis, and Associated Physio-Biochemical Events in Maize.

    PubMed

    Li, Wu; Liu, Jianhua; Ashraf, Umair; Li, Gaoke; Li, Yuliang; Lu, Wenjia; Gao, Lei; Han, Fuguang; Hu, Jianguang

    2016-01-01

    γ-aminobutyric acid (GABA) is an endogenous signaling molecule and involved in growth regulations and plant development, however, a little information is available on the consequences of exogenous GABA application on growth, development, and associated physio-biochemical processes in maize. The present study examined the GABA-induced regulations in early growth, net photosynthetic rate, gas exchange, osmoregulation, and enzymatic activities in three maize cultivars, i.e., Yuecainuo 6, Zhengtian 68, and Yuecainuo 2. Two levels of GABA, i.e., 0 mg L(-1) and 50 mg L(-1), in solution form, with total application volume of 100 ml per pot containing 15 maize seedlings were exogenously applied. Results revealed that exogenous GABA application improved seedling growth in terms of seedling length and biomass accumulation in all maize cultivars at both 3 and 7 days after treatment (DAT). It also promoted net photosynthesis and variably affected gas exchange attributes, i.e., stomatal conductance (Gs), intercellular CO2 concentration (Ci), and transpiration rate (Tr), as well as leaves SPAD value. Furthermore, lipid peroxidation [in terms of malondialdehyde (MDA)] under GABA treated maize seedlings were also remained variable; however, osmolyte accumulation (protein and proline) and activities of anti-oxidants enzymes, i.e., super-oxide dismutase and peroxidase were also affected differently at both 3 and 7 DAT in all maize cultivars. Furthermore, enzymes involved in nitrogen metabolism, e.g., nitrate reductase and glutamine synthetase were improved. These results suggest the involvement of GABA in various physio-metablical mechanisms which might lead to improvement in morphological growth of maize. In future, research is still needed at molecular and genetic levels to unravel the involvement of GABA-mediated regulations in growth and its associated physio-biochemical mechanisms. PMID:27446149

  9. Exogenous γ-aminobutyric Acid (GABA) Application Improved Early Growth, Net Photosynthesis, and Associated Physio-Biochemical Events in Maize

    PubMed Central

    Li, Wu; Liu, Jianhua; Ashraf, Umair; Li, Gaoke; Li, Yuliang; Lu, Wenjia; Gao, Lei; Han, Fuguang; Hu, Jianguang

    2016-01-01

    γ-aminobutyric acid (GABA) is an endogenous signaling molecule and involved in growth regulations and plant development, however, a little information is available on the consequences of exogenous GABA application on growth, development, and associated physio-biochemical processes in maize. The present study examined the GABA-induced regulations in early growth, net photosynthetic rate, gas exchange, osmoregulation, and enzymatic activities in three maize cultivars, i.e., Yuecainuo 6, Zhengtian 68, and Yuecainuo 2. Two levels of GABA, i.e., 0 mg L-1 and 50 mg L-1, in solution form, with total application volume of 100 ml per pot containing 15 maize seedlings were exogenously applied. Results revealed that exogenous GABA application improved seedling growth in terms of seedling length and biomass accumulation in all maize cultivars at both 3 and 7 days after treatment (DAT). It also promoted net photosynthesis and variably affected gas exchange attributes, i.e., stomatal conductance (Gs), intercellular CO2 concentration (Ci), and transpiration rate (Tr), as well as leaves SPAD value. Furthermore, lipid peroxidation [in terms of malondialdehyde (MDA)] under GABA treated maize seedlings were also remained variable; however, osmolyte accumulation (protein and proline) and activities of anti-oxidants enzymes, i.e., super-oxide dismutase and peroxidase were also affected differently at both 3 and 7 DAT in all maize cultivars. Furthermore, enzymes involved in nitrogen metabolism, e.g., nitrate reductase and glutamine synthetase were improved. These results suggest the involvement of GABA in various physio-metablical mechanisms which might lead to improvement in morphological growth of maize. In future, research is still needed at molecular and genetic levels to unravel the involvement of GABA-mediated regulations in growth and its associated physio-biochemical mechanisms. PMID:27446149

  10. Early events in the pathogenesis of chronic obstructive pulmonary disease. Smoking-induced reprogramming of airway epithelial basal progenitor cells.

    PubMed

    Shaykhiev, Renat; Crystal, Ronald G

    2014-12-01

    The airway epithelium is the primary site of the earliest pathologic changes induced by smoking, contributing to the development of chronic obstructive pulmonary disease (COPD). The normal human airway epithelium is composed of several major cell types, including differentiated ciliated and secretory cells, intermediate undifferentiated cells, and basal cells (BC). BC contain the stem/progenitor cell population responsible for maintenance of the normally differentiated airway epithelium. Although inflammatory and immune processes play a significant role in the pathogenesis of COPD, the earliest lesions include hyperplasia of the BC population, suggesting that the disease may start with this cell type. Apart from BC hyperplasia, smoking induces a number of COPD-relevant airway epithelial remodeling phenotypes that are likely initiated in the BC population, including mucous cell hyperplasia, squamous cell metaplasia, epithelial-mesenchymal transition, altered ciliated and nonmucous secretory cell differentiation, and suppression of junctional barrier integrity. Significant progress has been recently made in understanding the biology of human airway BC, including gene expression features, stem/progenitor, and other functions, including interaction with other airway cell types. Accumulating evidence suggests that human airway BC function as both sensors and cellular sources of various cytokines and growth factors relevant to smoking-associated airway injury, as well as the origin of various molecular and histological phenotypes relevant to the pathogenesis of COPD. In the context of these considerations, we suggest that early BC-specific smoking-induced molecular changes are critical to the pathogenesis of COPD, and these represent a candidate target for novel therapeutic approaches to prevent COPD progression in susceptible individuals. PMID:25525728

  11. Carcinogen exposure differentially modulates RAR-beta promoter hypermethylation, an early and frequent event in mouse lung carcinogenesis.

    PubMed

    Vuillemenot, Brian R; Pulling, Leah C; Palmisano, William A; Hutt, Julie A; Belinsky, Steven A

    2004-04-01

    The retinoic acid receptor beta (RAR-beta) gene encodes one of the primary receptors for retinoic acid, an important signaling molecule in lung growth, differentiation and carcinogenesis. RAR-beta has been shown to be down-regulated by methylation in human lung cancer. We have used previously lung tumors induced in mice to evaluate the timing and effect of specific carcinogen exposures on targeting genes altered in human lung cancer. These studies were extended to characterize the role of methylation of the RAR-beta gene in murine lung cancers. After treatment with the demethylating agent 5-aza-2'-deoxycytidine (DAC), RAR-beta was re-expressed in silenced cell lines or expressed at a higher rate than without DAC, supporting methylation as the inactivating mechanism. Bisulfite sequencing detected dense methylation in the area of the CpG island that contained the 5' untranslated region and the first translated exon in non-expressing cell lines, compared with minimal and heterogeneous methylation in normal mouse lung. Methylation-specific PCR revealed that this gene is targeted differentially by carcinogen exposures with the detection of methylated alleles in virtually all primary tumors associated with cigarette smoke or 4-methylnitrosamino-1-(3-pyridyl)-butanone (NNK) in contrast to half of tumors induced by methylene chloride or vinyl carbamate. RAR-beta methylation was also detected in 54% of preneoplastic hyperplasias induced by treatment with NNK. Bisulfite sequencing of both premalignant and malignant lesions detected dense methylation in the same area observed in cell lines, substantiating that this gene is functionally inactivated at the earliest histologic stage of adenocarcinoma development. These studies demonstrate that aberrant methylation of RAR-beta is an early and common alteration in murine lung tumors induced by several environmentally relevant exposures. PMID:14656941

  12. Characterization of early events involved in human dendritic cell maturation induced by sensitizers: Cross talk between MAPK signalling pathways

    SciTech Connect

    Trompezinski, Sandra; Migdal, Camille; Tailhardat, Magalie; Le Varlet, Beatrice; Courtellemont, Pascal; Haftek, Marek; Serres, Mireille

    2008-08-01

    Dendritic cells (DCs), efficient-antigen presenting cells play an important role in initiating and regulating immune responses. DC maturation following exposure to nickel or DNCB induced an up-regulation of phenotypic markers and inflammatory cytokine secretion. Early intracellular mechanisms involved in DC maturation required to be precise. To address this purpose, DCs derived from human monocytes were treated with sensitizers (nickel, DNCB or thimerosal) in comparison with an irritant (SDS). Our data confirming the up-regulation of CD86, CD54 and cytokine secretion (IL-8 and TNF{alpha}) induced by sensitizers but not by SDS, signalling transduction involved in DC maturation was investigated using these chemicals. Kinase activity measurement was assessed using two new sensitive procedures (Face{sup TM} and CBA) requiring few cells. SDS did not induce changes in signalling pathways whereas NiSO{sub 4}, DNCB and thimerosal markedly activated p38 MAPK and JNK, in contrast Erk1/2 phosphorylation was completely inhibited by DNCB or thimerosal and only activated by nickel. A pre-treatment with p38 MAPK inhibitor (SB203580) suppressed Erk1/2 inhibition induced by DNCB or thimerosal demonstrating a direct interaction between p38 MAPK and Erk1/2. A pre-treatment with an antioxidant, N-acetyl-L-cysteine (NAC) markedly reduced Erk1/2 inhibition and p38 MAPK phosphorylation induced by DNCB and thimerosal, suggesting a direct activation of p38 MAPK via an oxidative stress and a regulation of MAPK signalling pathways depending on chemicals. Because of a high sensitivity of kinase activity measurements, these procedures will be suitable for weak or moderate sensitizer screening.

  13. Hepatitis D Virus Replication.

    PubMed

    Taylor, John M

    2015-11-01

    This work reviews specific related aspects of hepatitis delta virus (HDV) reproduction, including virion structure, the RNA genome, the mode of genome replication, the delta antigens, and the assembly of HDV using the envelope proteins of its helper virus, hepatitis B virus (HBV). These topics are considered with perspectives ranging from a history of discovery through to still-unsolved problems. HDV evolution, virus entry, and associated pathogenic potential and treatment of infections are considered in other articles in this collection. PMID:26525452

  14. ACH-806, an NS4A antagonist, inhibits hepatitis C virus replication by altering the composition of viral replication complexes.

    PubMed

    Yang, Wengang; Sun, Yongnian; Hou, Xiaohong; Zhao, Yongsen; Fabrycki, Joanne; Chen, Dawei; Wang, Xiangzhu; Agarwal, Atul; Phadke, Avinash; Deshpande, Milind; Huang, Mingjun

    2013-07-01

    Treatment of hepatitis C patients with direct-acting antiviral drugs involves the combination of multiple small-molecule inhibitors of distinctive mechanisms of action. ACH-806 (or GS-9132) is a novel, small-molecule inhibitor specific for hepatitis C virus (HCV). It inhibits viral RNA replication in HCV replicon cells and was active in genotype 1 HCV-infected patients in a proof-of-concept clinical trial (1). Here, we describe a potential mechanism of action (MoA) wherein ACH-806 alters viral replication complex (RC) composition and function. We found that ACH-806 did not affect HCV polyprotein translation and processing, the early events of the formation of HCV RC. Instead, ACH-806 triggered the formation of a homodimeric form of NS4A with a size of 14 kDa (p14) both in replicon cells and in Huh-7 cells where NS4A was expressed alone. p14 production was negatively regulated by NS3, and its appearance in turn was associated with reductions in NS3 and, especially, NS4A content in RCs due to their accelerated degradation. A previously described resistance substitution near the N terminus of NS3, where NS3 interacts with NS4A, attenuated the reduction of NS3 and NS4A conferred by ACH-806 treatment. Taken together, we show that the compositional changes in viral RCs are associated with the antiviral activity of ACH-806. Small molecules, including ACH-806, with this novel MoA hold promise for further development and provide unique tools for clarifying the functions of NS4A in HCV replication. PMID:23629709

  15. Evidence for Proterozoic and late Cretaceous-early Tertiary ore-forming events in the Coeur d'Alene district, Idaho and Montana

    USGS Publications Warehouse

    Leach, D.L.; Hofstra, A.H.; Church, S.E.; Snee, L.W.; Vaughn, R.B.; Zartman, R.E.

    1998-01-01

    New 40Ar/39Ar age spectra on sericite and lead isotope data on tetrahedrite, siderite, galena, bournonite, and stibnite, together with previously published isotopic, geochemical, and geologic studies provide evidence for two major vein-forming events in the Coeur d'Alene district and surrounding area of the Belt basin. The data suggest that the zinc- and lead-rich veins (e.g., Bunker Hill and Star-Morning mines) formed in the Proterozoic (1.0 Ga), whereas the silver-rich veins (e.g., Silver belt mines), antimony veins (e.g., US Antimony mine), and gold-bearing quartz veins (Murry subdistrict) formed in Late Cretaceous to early Tertiary time.

  16. Antiviral mode of action of a synthetic brassinosteroid against Junin virus replication.

    PubMed

    Castilla, Viviana; Larzábal, Mariano; Sgalippa, Natalia Aguirre; Wachsman, Mónica B; Coto, Celia E

    2005-11-01

    The antiviral mode of action of the synthetic brassinosteroid (22S,23S)-3beta-bromo-5alpha,22,23-trihydroxystigmastan-6-one (6b) against Junin virus replication in Vero cells was investigated. Time-related experiments showed that 6b mainly affects an early event of virus growth cycle. Neither adsorption nor internalization of viral particles was the target of the inhibitory action. The analysis of the effect of 6b on viral RNA synthesis demonstrated that the presence of the compound adversely affects virus RNA replication by preventing the synthesis of full length antigenomic RNA. Although 6b was most effective the earlier it was added to the cells after infection with JV, a high level of inhibition of JV yield and fusion activity of newly synthesized viral glycoproteins was still detected when the compound was present during the last hours of infection. Therefore, we cannot rule out an inhibitory action of 6b on later events of JV replicative cycle. PMID:16171877

  17. Circulating Endothelial Cells and Endothelial Function predict Major Adverse Cardiac Events and Early Adverse Left Ventricular Remodeling in Patients with ST-Segment Elevation Myocardial Infarction

    PubMed Central

    Magdy, Abdel Hamid; Bakhoum, Sameh; Sharaf, Yasser; Sabry, Dina; El-Gengehe, Ahmed T; Abdel-Latif, Ahmed

    2016-01-01

    Endothelial progenitor cells (EPCs) and circulating endothelial cells (CECs) are mobilized from the bone marrow and increase in the early phase after ST-elevation myocardial infarction (STEMI). The aim of this study was to assess the prognostic significance of CECs and indices of endothelial dysfunction in patients with STEMI. In 78 patients with acute STEMI, characterization of CD34+/VEGFR2+ CECs, and indices of endothelial damage/dysfunction such as brachial artery flow mediated dilatation (FMD) were determined. Blood samples for CECs assessment and quantification were obtained within 24 hours of admission and FMD was assessed during the index hospitalization. At 30 days follow up, the primary composite end point of major cardiac adverse events (MACE) consisting of all-cause mortality, recurrent non-fatal MI, or heart failure and the secondary endpoint of early adverse left ventricular (LV) remodeling were analyzed. The 17 patients (22%) who developed MACE had significantly higher CEC level (P = 0.004), vWF level (P =0.028), and significantly lower FMD (P = 0.006) compared to the remaining patients. Logistic regression analysis showed that CECs level and LV ejection fraction were independent predictors of MACE. The areas under the receiver operating characteristic curves (ROC) for CEC level, FMD, and the logistic model with both markers were 0.73, 0.75, and 0.82 respectively for prediction of the MACE. The 16 patients who developed the secondary endpoint had significantly higher CEC level compared to remaining patients (p =0.038). In conclusion, increased circulating endothelial cells and endothelial dysfunction predicted the occurrence of major adverse cardiac events and adverse cardiac remodeling in patients with STEMI. PMID:26864952

  18. Translocation of a hydrocarbon fluorescent probe between Epstein-Barr virus and lymphoid cells: an assay for early events in viral infection.

    PubMed

    Rosenthal, K S; Yanovich, S; Inbar, M; Strominger, J L

    1978-10-01

    Translocation of the hydrocarbon fluorescent probe diphenylhexatriene (DPH) between membranes was studied by fluorescence polarization (P) analysis. First, using a model system, the high P value (0.324) of DPH-labeled cholesterol/phosphatidylcholine liposomes and the low P value (0.157) of DPH-labeled phosphatidylcholine liposomes allowed detection of DPH translocation between interacting liposomes. This was monitored by the change in P in either direction. Early events during cell-virus interactions were similarly studied by monitoring DPH translocation. The P value of DPH-labeled Epstein-Barr Virus (EBV) was significantly higher (0.350-0.392) than the P value of DPH-labeled lymphoid cells (0.238-0.289). Hence, DPH translocation could be detected by changes in P following incubation of DPH-labeled EBV and nonlabeled cells. A marked decrease in P was observed after incubation of DPH-labeled EBV with either nonlabeled lymphoblastoid Raji cells or fresh human B lymphocytes. However, only a slight decrease in P was obtained when DPH-labeled EBV was incubated with either nonlabeled fresh human T lymphocytes or fresh T or B rabbit lymphocytes. Moreover, incubation of fresh human B lymphocytes with the purified C3 component of complement (a putative inhibitor for the EBV receptor) prior to the addition of DPH-labeled EBV abolished the observed decrease in the P value. Most of these experiments were carried out with both the P3HR-1 and the B95-8 strains of EBV. DPH translocation, as determined by fluorescence polarization analysis, is, therefore, measuring some early event during interaction of this enveloped virus and mammalian cells. The potential applicability of this technique to other viruses is illustrated by an experiment with Semliki Forest virus. PMID:217012

  19. Remote Correlation of Paleoceanographic Events in the Northern Parts of Bering and Barents Seas during the Termination I and Early Holocene

    NASA Astrophysics Data System (ADS)

    Ivanova, E. V.; Ovsepyan, E.; Murdmaa, I.; de Vernal, A.; Risebrobakken, B.; Seitkalieva, E.; Radionova, E.; Alekhina, G.

    2014-12-01

    The Barents and Bering seas are closely linked to the High Arctic and to the THC by marine gateways as well as by land-sea and ocean-atmosphere interactions. Our multi-proxy time series demonstrate that these remote seas exhibited dramatic changes during the deglaciation through a succession of global and regional paleoceanographic events including the beginning of Termination I (BT1), Heinrich-1 or Oldest Dryas (OD), Bølling-Allerød (B/A), Younger Dryas (YD) and early Holocene (EH). In the NW Barents Sea, the increased subsurface-to-bottom Atlantic water inflow via the Kvitøya-Erik Eriksen trough (cores S 2519 and S 2528) is inferred at the late OD, late B/A and late YD/EH transition. These events are generally coupled with the strengthened AMOC. A remarkable sea surface warming and sea ice retreat are documented at ~ 13 ka BP. Surface warming and strong Atlantic water inflow were followed by intense iceberg calving in the Erik Eriksen Trough as indicated by the high IRD content of Core S-2519. The rock fragments are unsorted and mainly angular suggesting their ice-rafted (likely iceberg-rafted) origin. Svalbard glaciers apparently derived the material dominated by black schistous mudstones, hard limestones with coral remains, fine-grained sandstones from nearby islands, and icebergs spread it in the Kvitøya-Erik Eriksen Trough during the early deglaciation. The ice rafted coarse terrigenous material supply during the BT1 is also suggested for the NW Bering Sea. In the NW Pacific, NW Bering Sea and Sea of Okhotsk, surface bioproductivity peaked at B/A and EH mainly due to the global warming, enhanced nutrient supply by surface currents from the flooded northeastern shelf, intensified vertical mixing and water exchange through the opened straits. Oxygen-depleted bottom water at intermediate depths characterized several locations including the NW Bering Sea (Core SO201-2-85KL).

  20. Demonstration of a Novel Synchrophasor-based Situational Awareness System: Wide Area Power System Visualization, On-line Event Replay and Early Warning of Grid Problems

    SciTech Connect

    Rosso, A.

    2012-12-31

    Since the large North Eastern power system blackout on August 14, 2003, U.S. electric utilities have spent lot of effort on preventing power system cascading outages. Two of the main causes of the August 14, 2003 blackout were inadequate situational awareness and inadequate operator training In addition to the enhancements of the infrastructure of the interconnected power systems, more research and development of advanced power system applications are required for improving the wide-area security monitoring, operation and planning in order to prevent large- scale cascading outages of interconnected power systems. It is critically important for improving the wide-area situation awareness of the operators or operational engineers and regional reliability coordinators of large interconnected systems. With the installation of large number of phasor measurement units (PMU) and the related communication infrastructure, it will be possible to improve the operators’ situation awareness and to quickly identify the sequence of events during a large system disturbance for the post-event analysis using the real-time or historical synchrophasor data. The purpose of this project was to develop and demonstrate a novel synchrophasor-based comprehensive situational awareness system for control centers of power transmission systems. The developed system named WASA (Wide Area Situation Awareness) is intended to improve situational awareness at control centers of the power system operators and regional reliability coordinators. It consists of following main software modules: • Wide-area visualizations of real-time frequency, voltage, and phase angle measurements and their contour displays for security monitoring. • Online detection and location of a major event (location, time, size, and type, such as generator or line outage). • Near-real-time event replay (in seconds) after a major event occurs. • Early warning of potential wide-area stability problems. The system has been

  1. Reworked pyroclastic beds in the early Miocene of Patagonia: Reaction in response to high sediment supply during explosive volcanic events

    NASA Astrophysics Data System (ADS)

    Cuitiño, José I.; Scasso, Roberto A.

    2013-05-01

    Two meter-scale pyroclastic levels are interbedded within the early Miocene succession of the Estancia 25 de Mayo (Patagoniense transgression) and Santa Cruz formations in the foreland Austral (or Magallanes) Basin, Argentina. The Lower Pyroclastic Level (LPL) is a tabular body interbedded within offshore marine deposits, laterally continuous for 30 km and varying in thickness from few centimeters to around 4 m. Grain-size grades from coarse to extremely fine ash with upward-fining along with a northeastern-fining trends. Structureless fine to very fine tuffs dominate and rare parallel laminations are the only tractive sedimentary structures. The Upper Pyroclastic Level (UPL) lies within low energy fluvial deposits and is laterally discontinuous, and it is composed by lenticular bodies reaching a maximum of 15 m thick and 100 m wide, with a concave-up base and a plane top. Grain-size range is similar to the LPL but it coarsens upward. The lower portion of the UPL shows parallel lamination, current ripple lamination and mud drapes with large pumice lapilli and plant debris, whereas the upper portion shows parallel lamination and trough cross-stratification. Both pyroclastic levels are composed mainly of pumice grains and glass shards with minor proportions of quartz and plagioclase crystals and lithic fragments. The LPL shows no mixing with epiclastic material whereas the UPL shows an upward increase in epiclastic material, and an upward increment in the scale of cross-bedding. The large thickness in relation to the possible emission center and the content of plant debris of the LPL does not suggest a direct, submarine, ash-fallout origin. The LPL is interpreted as a deposit of hyperpycnal-flows generated at the coastal zone when tephra-laden rivers plunged into the ocean. Large amounts of well preserved plant debris support the hypothesis of a terrestrial source of the sediments. The UPL is entirely composed of tractive deposits, so an ash fallout origin is

  2. Down-regulation of ANAPC13 and CLTCL1: Early Events in the Progression of Preinvasive Ductal Carcinoma of the Breast.

    PubMed

    Sens-Abuázar, Carolina; Napolitano E Ferreira, Elisa; Osório, Cynthia Aparecida Bueno Toledo; Krepischi, Ana Cristina Victorino; Ricca, Tatiana Iervolino; Castro, Nadia Pereira; da Cunha, Isabela Werneck; Maciel, Maria do Socorro; Rosenberg, Carla; Brentani, Maria Mitzi; Soares, Fernando Augusto; Rocha, Rafael Malagoli; Carraro, Dirce Maria

    2012-04-01

    Alterations in the gene expression profile in epithelial cells during breast ductal carcinoma (DC) progression have been shown to occur mainly between pure ductal carcinoma in situ (DCIS) to the in situ component of a lesion with coexisting invasive ductal carcinoma (DCIS-IDC) implying that the molecular program for invasion is already established in the preinvasive lesion. For assessing early molecular alterations in epithelial cells that trigger tumorigenesis and testing them as prognostic markers for breast ductal carcinoma progression, we analyzed, by reverse transcription-quantitative polymerase chain reaction, eight genes previously identified as differentially expressed between epithelial tumor cells populations captured from preinvasive lesions with distinct malignant potential, pure DCIS and the in situ component of DCIS-IDC. ANAPC13 and CLTCL1 down-regulation revealed to be early events of DC progression that anticipated the invasiveness manifestation. Further down-regulation of ANAPC13 also occurred after invasion appearance and the presence of the protein in invasive tumor samples was associated with higher rates of overall and disease-free survival in breast cancer patients. Furthermore, tumors with low levels of ANAPC13 displayed increased copy number alterations, with significant gains at 1q (1q23.1-1q32.1), 8q, and 17q (17q24.2), regions that display common imbalances in breast tumors, suggesting that down-regulation of ANAPC13 contributes to genomic instability in this disease. PMID:22496928

  3. Investigating the impact of parental status and depression symptoms on the early perceptual coding of infant faces: an event-related potential study.

    PubMed

    Noll, Laura K; Mayes, Linda C; Rutherford, Helena J V

    2012-01-01

    Infant faces are highly salient social stimuli that appear to elicit intuitive parenting behaviors in healthy adult women. Behavioral and observational studies indicate that this effect may be modulated by experiences of reproduction, caregiving, and psychiatric symptomatology that affect normative attention and reward processing of infant cues. However, relatively little is known about the neural correlates of these effects. Using the event-related potential (ERP) technique, this study investigated the impact of parental status (mother, non-mother) and depression symptoms on early visual processing of infant faces in a community sample of adult women. Specifically, the P1 and N170 ERP components elicited in response to infant face stimuli were examined. While characteristics of the N170 were not modulated by parental status, a statistically significant positive correlation was observed between depression symptom severity and N170 amplitude. This relationship was not observed for the P1. These results suggest that depression symptoms may modulate early neurophysiological responsiveness to infant cues, even at sub-clinical levels. PMID:22435403

  4. A study of the topoisomerase II activity in HIV-1 replication using the ferrocene derivatives as probes.

    PubMed

    Kondapi, Anand K; Satyanarayana, Nathamu; Saikrishna, A D

    2006-06-15

    Human Topoisomerase II is present in two isoforms, 170KDa alpha and 180KDa beta. Both the isoforms play a crucial role in maintenance of topological changes during DNA replication and recombination. It has been shown that Topoisomerase II activity is required for HIV-1 replication and the enzyme is phosphorylated during early time points of HIV-1 replication. In the present study, we have studied the molecular action of Topoisomerase II inhibitors, azalactone ferrocene (AzaFecp), Thiomorpholide amido methyl ferrocene (ThioFecp), and Ruthenium benzene amino pyridine (Ru(ben)Apy) on cell proliferation and also on various events of HIV-1 replication cycle. The Topoisomerase II beta over-expressing neuroblastoma cell line shows a higher sensitivity to these compounds compared to the Sup-T1 cell line. All the three Topoisomerase II inhibitors show significant anti-HIV activity at nanomolar concentrations against an Indian isolate of HIV-1(93IN101) in Sup-T1 cell line. An analysis of action of these compounds on proviral DNA synthesis at 5h of post-infection shows that they inhibit proviral DNA synthesis as well as the formation of pre-integration complexes completely. Further analysis, using polymerase chain reaction and western blot, showed that both the Topoisomerase II alpha and beta isoforms are present in the pre-integration complexes, suggesting their significant role in HIV-1 replication. PMID:16712776

  5. Modulation of HCV Replication After Combination Antiretroviral Therapy in HCV/HIV Coinfected Patients

    PubMed Central

    Sherman, Kenneth E.; Guedj, Jeremie; Shata, Mohamed Tarek; Blackard, Jason T.; Rouster, Susan D.; Castro, Mario; Feinberg, Judith; Sterling, Richard K.; Goodman, Zachary; Aronow, Bruce J.; Perelson, Alan S.

    2015-01-01

    The hepatitis C virus (HCV) is an important contributor to morbidity and mortality in patients coinfected with human immunodeficiency virus (HIV). Coinfection results in increased HCV replication and more rapid rates of liver disease progression. The effect of HIV combination antiretroviral therapy (cART)