Science.gov

Sample records for element binding factor

  1. Effect of oxidative DNA damage in promoter elements on transcription factor binding.

    PubMed Central

    Ghosh, R; Mitchell, D L

    1999-01-01

    Reactive oxygen species produced by endogenous metabolic activity and exposure to a multitude of exogenous agents impact cells in a variety of ways. The DNA base damage 8-oxodeoxyguanosine (8-oxodG) is a prominent indicator of oxidative stress and has been well-characterized as a premutagenic lesion in mammalian cells and putative initiator of the carcinogenic process. Commensurate with the recent interest in epigenetic pathways of cancer causation we investigated how 8-oxodG alters the interaction between cis elements located on gene promoters and sequence-specific DNA binding proteins associated with these promoters. Consensus binding sequences for the transcription factors AP-1, NF-kappaB and Sp1 were modified site-specifically at guanine residues and electrophoretic mobility shift assays were performed to assess DNA-protein interactions. Our results indicate that whereas a single 8-oxodG was sufficient to inhibit transcription factor binding to AP-1 and Sp1 sequences it had no effect on binding to NF-kappaB, regardless of its position. We conclude from these data that minor alterations in base composition at a crucial position within some, but not all, promoter elements have the ability to disrupt transcription factor binding. The lack of inhibition by damaged NF-kappaB sequences suggests that DNA-protein contact sites may not be as determinative for stable p50 binding to this promoter as other, as yet undefined, structural parameters. PMID:10454620

  2. GAGA factor binding to DNA via a single trinucleotide sequence element.

    PubMed Central

    Wilkins, R C; Lis, J T

    1998-01-01

    GAGA transcription factor (GAF) is an essential protein in Drosophila , important for the transcriptional regulation of numerous genes. GAF binds to GA repeats in the promoters of these genes via a DNA-binding domain containing a single zinc finger. While GAF binding sites are typically composed of 3.5 GA repeats, the Drosophila hsp70 gene contains much smaller elements, some of which are as little as three bases (GAG) in length. Interestingly, the binding of GAF to more distant trinucleotide elements is relatively strong and not appreciably affected by the removal of larger GA arrays in the promoter. Moreover, a simple synthetic GAG sequence is sufficient to bind GAF in vitro . Here we directly compare the affinity of GAF for different sequence elements by immunoprecipitation and gel mobility shift analysis. Furthermore, our measures of the concentration of GAF in vivo indicate that it is a highly abundant nuclear protein, prevalent enough to occupy a sizable fraction of correspondingly abundant trinucleotide sites. PMID:9592153

  3. Chimeric murine interferon regulatory factor-2 (IRF-2) binds to IRF-E (IRF binding element), VREβ (virus response element) but not to VREα1.

    PubMed

    Prakash, Krishna; Kumar, Pardeep; Mukherjee, Somnath; Rath, P C

    2014-12-01

    Interferon regulatory factor-2 (IRF-2) is a multifunctional transcription factor having gene activation, repression and synergistic effect in conjunction with IRF-1. IRF-2 is also involved in type I IFN signalling by repressing INFβ gene. So far, the molecular mechanism of its DNA binding activity remains elusive. We have carried out molecular sub-cloning, expression and electrophoretically mobility shift assay study of chimeric murine IRF-2. Here, we report expression of chimeric murine IRF-2 as GST-IRF-2 fusion protein in Escherichia coli/BL21 cells and demonstrated DNA binding activity by gel retardation technique using radio (32) P-labelled IRF-E motif (GAAAGT)4 , virus response element (VRE) of human INFβ and IFNα1 gene. We observed five different masses DNA/GST-IRF-2 complexes (1-5) with IRF-E motif, three different masses DNA/GST-IRF-2 complexes (1-3) with VREß , but we could not observe any complex of DNA/GST-IRF-2 with VREα1 . The specific binding on IRF-E motif was confirmed by carrying out 100-X fold cold competition with (32) P-labelled IRF-E motif. In contrast to specific binding on VREß , we used negative control where we observed no binding complex, but we observed complexes with clones IPTG-induced extract. As far as binding on VREα1 is concerned, we could not observe any complex in negative control as well as in IPTG-inducible clones extract. Chimeric IRF-2 binds with IRF-E motif and VREβ but not with VREα1. This study is first of its kind and paves the way to understand the differential DNA binding and molecular mechanism of DNA binding activity of the IRF-2 molecule, which is crucial for its function(s). PMID:25251598

  4. A constitutive heat shock element-binding factor is immunologically identical to the Ku autoantigen.

    PubMed

    Kim, D; Ouyang, H; Yang, S H; Nussenzweig, A; Burgman, P; Li, G C

    1995-06-23

    Analysis of the heat shock element (HSE)-binding proteins in extracts of rodent cells, during heat shock and their post-heat shock recovery, indicates that the regulation of heat shock response involves a constitutive HSE-binding factor (CHBF), in addition to the heat-inducible heat shock factor HSF1. We purified the CHBF to apparent homogeneity from HeLa cells using column chromatographic techniques including an HSE oligonucleotide affinity column. The purified CHBF consists of two polypeptides with apparent molecular masses of 70 and 86 kDa. Immunoblot and gel mobility shift analysis verify that CHBF is identical or closely related to the Ku autoantigen. The DNA binding characteristics of CHBF to double-stranded or single-stranded DNA are similar to that of Ku autoantigen. In gel mobility shift analysis using purified CHBF and recombinant human HSF1, CHBF competes with HSF1 for the binding of DNA sequences containing HSEs in vitro. Furthermore, when Rat-1 cells were co-transfected with human Ku expression vectors and the hsp70-promoter-driven luciferase reporter gene, thermal induction of luciferase is significantly suppressed relative to cells transfected with only the hsp70-luciferase construct. These data suggest a role of CHBF (or Ku protein) in the regulation of heat response in vivo. PMID:7797514

  5. Allele Frequencies of Variants in Ultra Conserved Elements Identify Selective Pressure on Transcription Factor Binding

    PubMed Central

    Silla, Toomas; Kepp, Katrin; Tai, E. Shyong; Goh, Liang; Davila, Sonia; Ivkovic, Tina Catela; Calin, George A.; Voorhoeve, P. Mathijs

    2014-01-01

    Ultra-conserved genes or elements (UCGs/UCEs) in the human genome are extreme examples of conservation. We characterized natural variations in 2884 UCEs and UCGs in two distinct populations; Singaporean Chinese (n = 280) and Italian (n = 501) by using a pooled sample, targeted capture, sequencing approach. We identify, with high confidence, in these regions the abundance of rare SNVs (MAF<0.5%) of which 75% is not present in dbSNP137. UCEs association studies for complex human traits can use this information to model expected background variation and thus necessary power for association studies. By combining our data with 1000 Genome Project data, we show in three independent datasets that prevalent UCE variants (MAF>5%) are more often found in relatively less-conserved nucleotides within UCEs, compared to rare variants. Moreover, prevalent variants are less likely to overlap transcription factor binding site. Using SNPfold we found no significant influence of RNA secondary structure on UCE conservation. All together, these results suggest UCEs are not under selective pressure as a stretch of DNA but are under differential evolutionary pressure on the single nucleotide level. PMID:25369454

  6. FootprintDB: Analysis of Plant Cis-Regulatory Elements, Transcription Factors, and Binding Interfaces.

    PubMed

    Contreras-Moreira, Bruno; Sebastian, Alvaro

    2016-01-01

    FootprintDB is a database and search engine that compiles regulatory sequences from open access libraries of curated DNA cis-elements and motifs, and their associated transcription factors (TFs). It systematically annotates the binding interfaces of the TFs by exploiting protein-DNA complexes deposited in the Protein Data Bank. Each entry in footprintDB is thus a DNA motif linked to the protein sequence of the TF(s) known to recognize it, and in most cases, the set of predicted interface residues involved in specific recognition. This chapter explains step-by-step how to search for DNA motifs and protein sequences in footprintDB and how to focus the search to a particular organism. Two real-world examples are shown where this software was used to analyze transcriptional regulation in plants. Results are described with the aim of guiding users on their interpretation, and special attention is given to the choices users might face when performing similar analyses. PMID:27557773

  7. Activation of Sterol Regulatory Element Binding Factors by Fenofibrate and Gemfibrozil Stimulates Myelination in Zebrafish

    PubMed Central

    Ashikawa, Yoshifumi; Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio

    2016-01-01

    Oligodendrocytes are major myelin-producing cells and play essential roles in the function of a healthy nervous system. However, they are also one of the most vulnerable neural cell types in the central nervous system (CNS), and myelin abnormalities in the CNS are found in a wide variety of neurological disorders, including multiple sclerosis, adrenoleukodystrophy, and schizophrenia. There is an urgent need to identify small molecular weight compounds that can stimulate myelination. In this study, we performed comparative transcriptome analysis to identify pharmacodynamic effects common to miconazole and clobetasol, which have been shown to stimulate myelination by mouse oligodendrocyte progenitor cells (OPCs). Of the genes differentially expressed in both miconazole- and clobetasol-treated mouse OPCs compared with untreated cells, we identified differentially expressed genes (DEGs) common to both drug treatments. Gene ontology analysis revealed that these DEGs are significantly associated with the sterol biosynthetic pathway, and further bioinformatics analysis suggested that sterol regulatory element binding factors (SREBFs) might be key upstream regulators of the DEGs. In silico screening of a public database for chemicals associated with SREBF activation identified fenofibrate, a peroxisome proliferator-activated receptor α (PPARα) agonist, as a drug that increases the expression of known SREBF targets, raising the possibility that fenofibrate may also stimulate myelination. To test this, we performed in vivo imaging of zebrafish expressing a fluorescent reporter protein under the control of the myelin basic protein (mbp) promoter. Treatment of zebrafish with fenofibrate significantly increased expression of the fluorescent reporter compared with untreated zebrafish. This increase was attenuated by co-treatment with fatostatin, a specific inhibitor of SREBFs, confirming that the fenofibrate effect was mediated via SREBFs. Furthermore, incubation of zebrafish

  8. The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element

    PubMed Central

    Cichocki, Frank; Hanson, Rebecca J.; Lenvik, Todd; Pitt, Michelle; McCullar, Valarie; Li, Hongchuan; Anderson, Stephen K.

    2009-01-01

    The killer cell immunoglobulin-like receptor (KIR) repertoire of natural killer (NK) cells determines their ability to detect infected or transformed target cells. Although epigenetic mechanisms play a role in KIR gene expression, work in the mouse suggests that other regulatory elements may be involved at specific stages of NK-cell development. Here we report the effects of the transcription factor c-Myc on KIR expression. c-Myc directly binds to, and promotes transcription from, a distal element identified upstream of most KIR genes. Binding of endogenous c-Myc to the distal promoter element is significantly enhanced upon interleukin-15 (IL-15) stimulation in peripheral blood NK cells and correlates with an increase in KIR transcription. In addition, the overexpression of c-Myc during NK-cell development promotes transcription from the distal promoter element and contributes to the overall transcription of multiple KIR genes. Our data demonstrate the significance of the 5′ promoter element upstream of the conventional KIR promoter region and support a model whereby IL-15 stimulates c-Myc binding at the distal KIR promoter during NK-cell development to promote KIR transcription. This finding provides a direct link between NK-cell activation signals and KIR expression required for acquisition of effector function during NK-cell education. PMID:18987359

  9. Isolation of transcription factors binding auxin response elements using a yeast one-hybrid system.

    PubMed

    Qi, Mei; Huang, Meijuan; Chen, Fan

    2002-04-01

    Plant hormones play an important role during higher plant embryogenesis. Auxin is central to the development of vascular tissues, formation of lateral and adventitious roots, control of apical dominance, and tropic responses. Auxin response element (AuxRE), present in the promoters of many auxin-induced genes, can confer auxin responsiveness. Using carrot somatic embryo under specific developmental phase, a cDNA expression library was constructed. Several plasmids were recombined containing the tetramer of AuxRE as a bait. After screening by a yeast one-hy-brid system, one positive clone was confirmed and characterized. Electrophoretic mobility shift assay showed that AxRF1 protein expressed in yeast cell could bind AuxRE in vitro. It suggests that AxRF1 participates in regulation of the expression of auxin responsive gene during carrot somatic embryogenesis. PMID:18763077

  10. Sequences far downstream from the classical tRNA promoter elements bind RNA polymerase III transcription factors.

    PubMed Central

    Young, L S; Rivier, D H; Sprague, K U

    1991-01-01

    We have examined the interaction of transcription factors TFIIIC and TFIIID with a silkworm alanine tRNA gene. Previous functional analysis showed that the promoter for this gene is unusually large compared with the classical tRNA promoter elements (the A and B boxes) and includes sequences downstream from the transcription termination site. The goal of the experiments reported here was to determine which sequences within the full promoter make stable contacts with transcription factors. We show that when TFIIIC and TFIIID are combined, a complex is formed with the tRNA(Ala)C gene. Neither factor alone can form this complex. DNase I digestion of gene-factor complexes reveals that most of the tRNA(Ala)C promoter is in contact with factors. The protected region extends from -1 to at least +136 and includes both the A and B boxes and the previously identified downstream promoter sequences. Analysis of mutant promoters shows that sequence-specific contacts throughout the protected region are required for binding. The role of 3'-flanking sequences in transcription factor binding explains the contribution of these sequences to the tRNA(Ala)C promoter. We discuss the possibility that such sequences affect promoter strength in other tRNA genes. Images PMID:1996100

  11. STUbL-mediated degradation of the transcription factor MATα2 requires degradation elements that coincide with corepressor binding sites

    PubMed Central

    Hickey, Christopher M.; Hochstrasser, Mark

    2015-01-01

    The yeast transcription factor MATα2 (α2) is a short-lived protein known to be ubiquitylated by two distinct pathways, one involving the ubiquitin-conjugating enzymes (E2s) Ubc6 and Ubc7 and the ubiquitin ligase (E3) Doa10 and the other operating with the E2 Ubc4 and the heterodimeric E3 Slx5/Slx8. Although Slx5/Slx8 is a small ubiquitin-like modifier (SUMO)-targeted ubiquitin ligase (STUbL), it does not require SUMO to target α2 but instead directly recognizes α2. Little is known about the α2 determinants required for its Ubc4- and STUbL-mediated degradation or how these determinants substitute for SUMO in recognition by the STUbL pathway. We describe two distinct degradation elements within α2, both of which are necessary for α2 recognition specifically by the Ubc4 pathway. Slx5/Slx8 can directly ubiquitylate a C-terminal fragment of α2, and mutating one of the degradation elements impairs this ubiquitylation. Surprisingly, both degradation elements identified here overlap specific interaction sites for α2 corepressors: the Mcm1 interaction site in the central α2 linker and the Ssn6 (Cyc8) binding site in the α2 homeodomain. We propose that competitive binding to α2 by the ubiquitylation machinery and α2 cofactors is balanced so that α2 can function in transcription repression yet be short lived enough to allow cell-type switching. PMID:26246605

  12. Isolation and Functional Characterization of a Novel Gene Encoding a Dehydration Responsive Element Binding Transcription Factor from Populus euphratica.

    PubMed

    Wei, Li; Ma, Jiangtao; Wang, Suomin; Wu, Yanmin

    2016-01-01

    Dehydration responsive element binding (DREB) transcription factors (TFs) play a key role in regulating abiotic stress related genes. A new gene (PeDREB2b) encoding an unidentified DRE-binding protein was isolated from 20% PEG6000 treated Populus euphratica Oliv. seedlings by RT-PCR and RACE. Full length of PeDREB2b cDNA was 1110 bp, and an ORF of 870 bp, which encoded 289-amino-acids polypeptide, were included. The deduced amino acid sequence analysis revealed that this protein was a putative AP2/EREBP transcription factor with a conserved AP2/EREBP domain of 64 amino acids and a potential nuclear localization signal (NLS). Based on phylogenetic characterization, PeDREB2b was classified as a member of A-5 group belonged to the DREB family. The PeDREB2b gene is induced by salinization, low temperature, drought and phytohormones GA3, NAA and 6BA, but not by ABA treatment. The fact that the product of PeDREB2b as a DREB transcription factor was verified in our further experiment: the nuclear localization of the gene when it was expressed transiently as a GFP fusion in onion epidermal cells. In addition, PeDREB2b was capable of activating reporter gene expression. To study the salt and drought stress responses for PeDREB2b transgenic Arabidopsis thaliana in detail, integrated physiological, biochemical and genetic approach methods were used. Results indicated that the PeDREB2b gene was over-expressed under stress-inducible rd29A promotor in transgenic plants alleviates the adverse effects of environmental stresses. PMID:27001404

  13. Light-dependent and circadian clock-regulated activation of sterol regulatory element-binding protein, X-box-binding protein 1, and heat shock factor pathways.

    PubMed

    Hatori, Megumi; Hirota, Tsuyoshi; Iitsuka, Michiko; Kurabayashi, Nobuhiro; Haraguchi, Shogo; Kokame, Koichi; Sato, Ryuichiro; Nakai, Akira; Miyata, Toshiyuki; Tsutsui, Kazuyoshi; Fukada, Yoshitaka

    2011-03-22

    The circadian clock is phase-delayed or -advanced by light when given at early or late subjective night, respectively. Despite the importance of the time-of-day-dependent phase responses to light, the underlying molecular mechanism is poorly understood. Here, we performed a comprehensive analysis of light-inducible genes in the chicken pineal gland, which consists of light-sensitive clock cells representing a prototype of the clock system. Light stimulated expression of 62 genes and 40 ESTs by >2.5-fold, among which genes responsive to the heat shock and endoplasmic reticulum stress as well as their regulatory transcription factors heat shock factor (HSF)1, HSF2, and X-box-binding protein 1 (XBP1) were strongly activated when a light pulse was given at late subjective night. In contrast, the light pulse at early subjective night caused prominent induction of E4bp4, a key regulator in the phase-delaying mechanism of the pineal clock, along with activation of a large group of cholesterol biosynthetic genes that are targets of sterol regulatory element-binding protein (SREBP) transcription factor. We found that the light pulse stimulated proteolytic formation of active SREBP-1 that, in turn, transactivated E4bp4 expression, linking SREBP with the light-input pathway of the pineal clock. As an output of light activation of cholesterol biosynthetic genes, we found light-stimulated pineal production of a neurosteroid, 7α-hydroxypregnenolone, demonstrating a unique endocrine function of the pineal gland. Intracerebroventricular injection of 7α-hydroxypregnenolone activated locomotor activities of chicks. Our study on the genome-wide gene expression analysis revealed time-of-day-dependent light activation of signaling pathways and provided molecular connection between gene expression and behavior through neurosteroid release from the pineal gland. PMID:21383147

  14. Acute-phase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level.

    PubMed Central

    Wegenka, U M; Buschmann, J; Lütticken, C; Heinrich, P C; Horn, F

    1993-01-01

    Interleukin-6 (IL-6) is known to be a major mediator of the acute-phase response in liver. We show here that IL-6 triggers the rapid activation of a nuclear factor, termed acute-phase response factor (APRF), both in rat liver in vivo and in human hepatoma (HepG2) cells in vitro. APRF bound to IL-6 response elements in the 5'-flanking regions of various acute-phase protein genes (e.g., the alpha 2-macroglobulin, fibrinogen, and alpha 1-acid glycoprotein genes). These elements contain a characteristic hexanucleotide motif, CTGGGA, known to be required for the IL-6 responsiveness of these genes. Analysis of the binding specificity of APRF revealed that it is different from NF-IL6 and NF-kappa B, transcription factors known to be regulated by cytokines and involved in the transcriptional regulation of acute-phase protein genes. In HepG2 cells, activation of APRF was observed within minutes after stimulation with IL-6 or leukemia-inhibitory factor and did not require ongoing protein synthesis. Therefore, a preexisting inactive form of APRF is activated by a posttranslational mechanism. We present evidence that this activation occurs in the cytoplasm and that a phosphorylation is involved. These results lead to the conclusions that APRF is an immediate target of the IL-6 signalling cascade and is likely to play a central role in the transcriptional regulation of many IL-6-induced genes. Images PMID:7678052

  15. Binding of transcription factors to Presenilin 1 and 2 promoter cis-acting elements varies during the development of mouse cerebral cortex.

    PubMed

    Kumar, Ashish; Thakur, M K

    2016-08-15

    Previously, we reported differential expression of Presenilin (PS)1 and 2 and epigenetic modifications of their gene promoter in the cerebral cortex of mice during development. We identified the crucial role of DNA methylation and H3K9/14 acetylation in stage specific PS expression during brain development. Interestingly, we noted differential DNA methylation in putative binding sites of transcription factors considered pivotal for brain development. This prompted us to study the binding of transcription factors to cis-acting elements of PS1 and PS2 promoter in the cerebral cortex of mice during development. In-silico analysis revealed various cis-acting elements of PS1 and PS2 promoter and their putative transcription factors. We selected those cis-acting elements that were proven by wet lab experiments to interact with the transcription factors crucial for brain development. Electrophoretic mobility shift assay revealed that the binding of nuclear proteins to PS1 promoter cis-acting elements like HSF-1, Cdx1, Ets-1 and Sp1 significantly increased at embryonic day (E) 12.5, postnatal day (P) 45 and 20 weeks (w) as compared to P0. The binding pattern of these factors correlated well with the PS1 expression profile, indicating their cumulative influence on PS1 gene transcription. For PS2 promoter, the binding of Nkx2.2 and HFH-2 was high at prenatal stages (E12.5 and E18.5) while that of Cdx1 and NF-κB was maximum at postnatal stages (P45 and 20w). Taken together, our study shows that the binding of HSF-1, Cdx1, Ets-1 and Sp1 to PS1 promoter and that of Nkx2.2, HFH-2, Cdx1 and NF-κB to PS2 promoter regulate their differential expression during brain development. PMID:27177724

  16. The signalling pathways of interleukin-6 and gamma interferon converge by the activation of different transcription factors which bind to common responsive DNA elements.

    PubMed Central

    Yuan, J; Wegenka, U M; Lütticken, C; Buschmann, J; Decker, T; Schindler, C; Heinrich, P C; Horn, F

    1994-01-01

    Interleukin-6 (IL-6) and gamma interferon (IFN-gamma) induce a partially overlapping set of genes, including the genes for interferon regulatory factor 1 (IRF-1), intercellular adhesion molecule 1 (ICAM-1), and the acute-phase protein alpha 2-macroglobulin. We report here that the rat alpha 2-macroglobulin promoter is activated by IFN-gamma in human hepatoma (HepG2) cells and that the IFN-gamma response element maps to the same site previously defined as the acute-phase response element (APRE), which binds the IL-6-activated transcription factor APRF (acute-phase response factor). As was reported for fibroblasts, the IFN-gamma-regulated transcription factor GAF is phosphorylated at tyrosine after IFN-gamma treatment of HepG2 cells. IFN-gamma posttranslationally activates a protein which specifically binds to the alpha 2-macroglobulin APRE. This protein is shown to be identical or closely related to GAF. Although APRF and GAF are shown to represent different proteins, their binding sequence specificities are very similar. APRF and GAF bind equally well to the APRE sequences of various acute-phase protein genes as well as to the IFN-gamma response elements of the IRF-1, ICAM-1, and other IFN-gamma-inducible genes. Transient transfection analysis revealed that the IFN-gamma response elements of the IRF-1 and ICAM-1 promoters are able to confer responsiveness to both IFN-gamma and IL-6 onto a heterologous promoter. Therefore, APRF and GAF are likely to be involved in the transcriptional induction of these immediate-early genes by IL-6 and IFN-gamma, respectively. Taken together, these results demonstrate that two functionally distinct hormones, IL-6 and IFN-gamma, act through common regulatory elements to which different transcription factors sharing almost the same sequence specificity bind. Images PMID:7509445

  17. The nuclear factor YY1 suppresses the human gamma interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element.

    PubMed Central

    Ye, J; Cippitelli, M; Dorman, L; Ortaldo, J R; Young, H A

    1996-01-01

    Our group has previously reported that the nuclear factor Yin-Yang 1 (YY1), a ubiquitous DNA-binding protein, is able to interact with a silencer element (BE) in the gamma interferon (IFN-gamma) promoter region. In this study, we demonstrated that YY1 can directly inhibit the activity of the IFN-gamma promoter by interacting with multiple sites in the promoter. In cotransfection assays, a YY1 expression vector significantly inhibited IFN-gamma promoter activity. Mutation of the YY1 binding site in the native IFN-gamma promoter was associated with an increase in the IFN-gamma promoter activity. Analysis of the DNA sequences of the IFN-gamma promoter revealed a second functional YY1 binding site (BED) that overlaps with an AP1 binding site. In this element, AP1 enhancer activity was suppressed by YY1. Since the nuclear level of YY1 does not change upon cell activation, our data support a model that the nuclear factor YY1 acts to suppress basal IFN-gamma transcription by interacting with the promoter at multiple DNA binding sites. This repression can occur through two mechanisms: (i) cooperation with an as-yet-unidentified AP2-like repressor protein and (ii) competition for DNA binding with the transactivating factor AP1. PMID:8756632

  18. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    PubMed

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. PMID:27099376

  19. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing

    PubMed Central

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S.; Niu, Lixin; Jiang, Cai-Zhong

    2016-01-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2. Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. PMID:27099376

  20. The basic leucine zipper transcription factor ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 is an important transcriptional regulator of abscisic acid-dependent grape berry ripening processes.

    PubMed

    Nicolas, Philippe; Lecourieux, David; Kappel, Christian; Cluzet, Stéphanie; Cramer, Grant; Delrot, Serge; Lecourieux, Fatma

    2014-01-01

    In grape (Vitis vinifera), abscisic acid (ABA) accumulates during fruit ripening and is thought to play a pivotal role in this process, but the molecular basis of this control is poorly understood. This work characterizes ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 (VvABF2), a grape basic leucine zipper transcription factor belonging to a phylogenetic subgroup previously shown to be involved in ABA and abiotic stress signaling in other plant species. VvABF2 transcripts mainly accumulated in the berry, from the onset of ripening to the harvesting stage, and were up-regulated by ABA. Microarray analysis of transgenic grape cells overexpressing VvABF2 showed that this transcription factor up-regulates and/or modifies existing networks related to ABA responses. In addition, grape cells overexpressing VvABF2 exhibited enhanced responses to ABA treatment compared with control cells. Among the VvABF2-mediated responses highlighted in this study, the synthesis of phenolic compounds and cell wall softening were the most strongly affected. VvABF2 overexpression strongly increased the accumulation of stilbenes that play a role in plant defense and human health (resveratrol and piceid). In addition, the firmness of fruits from tomato (Solanum lycopersicum) plants overexpressing VvABF2 was strongly reduced. These data indicate that VvABF2 is an important transcriptional regulator of ABA-dependent grape berry ripening. PMID:24276949

  1. Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor. beta. 1 and by the retinoblastoma gene product

    SciTech Connect

    Pietenpol, J.A.; Stein, R.W.; Moses, H.L. ); Muenger, K.; Howley, P.M. )

    1991-11-15

    Previous studies have shown that transforming growth factor {beta}1 (TGF-{beta}1) inhibition of keratinocyte proliferation involves suppression of c-myc transcription, and indirect evidence has suggested that the retinoblastoma gene product (pRB) may be involved in this process. In this study, transient expression of pRB in skin keratinocytes was shown to repress transcription of the human c-myc promoter region was required for regulation by both TGF-{beta}1 and pRB. These sequences, termed the TGF-{beta} control element (TCE), lie between positions {minus}86 and {minus}63 relative to the P1 transcription start site. Oligonucleotides containing the TCE bound to several nuclear factors in mobility-shift assays using extracts from cells with or without normal pRB. Binding of some factors was inhibited by TGF-{beta}1 treatment of TGF-{beta}-sensitive but not TGF-{beta}-insensitive cells. These data indicate that pRB can suppress c-myc transcription and growth inhibition.

  2. Transcription Enhancer Factor 1 Binds Multiple Muscle MEF2 and A/T-Rich Elements during Fast-to-Slow Skeletal Muscle Fiber Type Transitions

    PubMed Central

    Karasseva, Natalia; Tsika, Gretchen; Ji, Juan; Zhang, Aijing; Mao, Xiaoqing; Tsika, Richard

    2003-01-01

    In adult mouse skeletal muscle, β-myosin heavy chain (βMyHC) gene expression is primarily restricted to slow type I fibers; however, its expression can be induced in fast type II fibers in response to a sustained increase in load-bearing work (mechanical overload [MOV]). Our previous βMyHC transgenic and protein-DNA interaction studies have identified an A/T-rich element (βA/T-rich −269/−258) that is required for slow muscle expression and which potentiates MOV responsiveness of a 293-bp βMyHC promoter (β293wt). Despite the GATA/MEF2-like homology of this element, we found binding of two unknown proteins that were antigenically distinct from GATA and MEF2 isoforms. By using the βA/T-rich element as bait in a yeast one-hybrid screen of an MOV-plantaris cDNA library, we identified nominal transcription enhancer factor 1 (NTEF-1) as the specific βA/T-rich binding factor. Electrophoretic mobility shift assay analysis confirmed that NTEF-1 represents the enriched binding activity obtained only when the βA/T-rich element is reacted with MOV-plantaris nuclear extract. Moreover, we show that TEF proteins bind MEF2 elements located in the control region of a select set of muscle genes. In transient-coexpression assays using mouse C2C12 myotubes, TEF proteins transcriptionally activated a 293-bp βMyHC promoter devoid of any muscle CAT (MCAT) sites, as well as a minimal thymidine kinase promoter-luciferase reporter gene driven by three tandem copies of the desmin MEF2 or palindromic Mt elements or four tandem βA/T-rich elements. These novel findings suggest that in addition to exerting a regulatory effect by binding MCAT elements, TEF proteins likely contribute to regulation of skeletal, cardiac, and smooth muscle gene networks by binding select A/T-rich and MEF2 elements under basal and hypertrophic conditions. PMID:12861002

  3. BjMYB1, a transcription factor implicated in plant defence through activating BjCHI1 chitinase expression by binding to a W-box-like element.

    PubMed

    Gao, Ying; Jia, Shuangwei; Wang, Chunlian; Wang, Fujun; Wang, Fajun; Zhao, Kaijun

    2016-08-01

    We previously identified the W-box-like-4 (Wbl-4) element (GTAGTGACTCAT), one of six Wbl elements in the BjC-P promoter of the unusual chitinase gene BjCHI1 from Brassica juncea, as the core element responsive to fungal infection. Here, we report the isolation and characterization of the cognate transcription factor interacting with the Wbl-4 element. Using Wbl-4 as a target, we performed yeast one-hybrid screening of a B. juncea cDNA library and isolated an R2R3-MYB transcription factor designated as BjMYB1. BjMYB1 was localized in the nucleus of plant cells. EMSA assays confirmed that BjMYB1 binds to the Wbl-4 element. Transiently expressed BjMYB1 up-regulated the activity of the BjC-P promoter through its binding to the Wbl-4 element in tobacco (Nicotiana benthamiana) leaves. In B. juncea, BjMYB1 displayed a similar induced expression pattern as that of BjCHI1 upon infection by the fungus Botrytis cinerea Moreover, heterogeneous overexpression of BjMYB1 significantly elevated the resistance of transgenic Arabidopsis thaliana to the fungus B. cinerea These results suggest that BjMYB1 is potentially involved in host defence against fungal attack through activating the expression of BjCHI1 by binding to the Wbl-4 element in the BjC-P promoter. This finding demonstrates a novel DNA target of plant MYB transcription factors. PMID:27353280

  4. BjMYB1, a transcription factor implicated in plant defence through activating BjCHI1 chitinase expression by binding to a W-box-like element

    PubMed Central

    Gao, Ying; Jia, Shuangwei; Wang, Chunlian; Wang, Fujun; Wang, Fajun; Zhao, Kaijun

    2016-01-01

    We previously identified the W-box-like-4 (Wbl-4) element (GTAGTGACTCAT), one of six Wbl elements in the BjC-P promoter of the unusual chitinase gene BjCHI1 from Brassica juncea, as the core element responsive to fungal infection. Here, we report the isolation and characterization of the cognate transcription factor interacting with the Wbl-4 element. Using Wbl-4 as a target, we performed yeast one-hybrid screening of a B. juncea cDNA library and isolated an R2R3-MYB transcription factor designated as BjMYB1. BjMYB1 was localized in the nucleus of plant cells. EMSA assays confirmed that BjMYB1 binds to the Wbl-4 element. Transiently expressed BjMYB1 up-regulated the activity of the BjC-P promoter through its binding to the Wbl-4 element in tobacco (Nicotiana benthamiana) leaves. In B. juncea, BjMYB1 displayed a similar induced expression pattern as that of BjCHI1 upon infection by the fungus Botrytis cinerea. Moreover, heterogeneous overexpression of BjMYB1 significantly elevated the resistance of transgenic Arabidopsis thaliana to the fungus B. cinerea. These results suggest that BjMYB1 is potentially involved in host defence against fungal attack through activating the expression of BjCHI1 by binding to the Wbl-4 element in the BjC-P promoter. This finding demonstrates a novel DNA target of plant MYB transcription factors. PMID:27353280

  5. Testosterone activates mitogen-activated protein kinase and the cAMP response element binding protein transcription factor in Sertoli cells

    PubMed Central

    Fix, Charity; Jordan, Cynthia; Cano, Patricia; Walker, William H.

    2004-01-01

    The androgen testosterone is essential for the Sertoli cell to support the maturation of male germ cells and the production of spermatozoa (spermatogenesis). In the classical view of androgen action, binding of androgen to the intracellular androgen receptor (AR) produces a conformational change in AR such that the receptor–steroid complex has high affinity for specific DNA regulatory elements and is able to stimulate gene transcription. Here, we demonstrate that testosterone can act by means of an alternative, rapid, and sustainable mechanism in Sertoli cells that is independent of AR–DNA interactions. Specifically, the addition of physiological levels of testosterone to Sertoli cells stimulates the mitogen-activated protein kinase signaling pathway and causes phosphorylation of the cAMP response element binding protein transcription factor on serine 133, a modification known to be required for Sertoli cells to support spermatogenesis. Androgen-mediated activation of mitogen-activated protein kinase and cAMP response element binding protein occurs within 1 min, extends for at least 12 h and requires AR. Furthermore, androgen induces endogenous cAMP response element binding protein-mediated transcription in Sertoli cells. These newly identified mechanisms of androgen action in Sertoli cells suggest new targets for developing male contraceptive agents. PMID:15263086

  6. Hypoxia-inducible nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene.

    PubMed Central

    Semenza, G L; Nejfelt, M K; Chi, S M; Antonarakis, S E

    1991-01-01

    Human erythropoietin gene expression in liver and kidney is inducible by anemia or hypoxia. DNase I-hypersensitive sites were identified 3' to the human erythropoietin gene in liver nuclei. A 256-base-pair region of 3' flanking sequence was shown by DNase I protection and electrophoretic mobility-shift assays to bind four or more different nuclear factors, at least two of which are induced by anemia in both liver and kidney, and the region functioned as a hypoxia-inducible enhancer in transient expression assays. These results provide insight into the molecular basis for the regulation of gene expression by a fundamental physiologic stimulus, hypoxia. Images PMID:2062846

  7. Purification of the pets factor. A nuclear protein that binds to the inducible TG-rich element of the human immunodeficiency virus type 2 enhancer.

    PubMed

    Fu, G K; Markovitz, D M

    1996-08-01

    The peri-ets (pets) site is a TG-rich element found immediately adjacent to two binding sites for the ets family member Elf-1 in the human immunodeficiency virus type 2 (HIV-2) enhancer. Enhancer activation in response to T cell stimulation by phorbol myristate acetate, phytohemagglutinin, soluble or cross-linked antibodies to the T cell receptor, or antigen is mediated through this site in conjunction with its two adjacent Elf-1 binding sites, PuB1 and PuB2, and a kappaB site. Site-specific mutation of the pets element significantly reduces inducible activation of this enhancer but does not affect its transactivation by HIV-2 tat or other viral transactivators. Similar TG-rich sequences adjacent to ets-binding sites have also been found to be functionally important in the human T-cell leukemia virus type I and murine Moloney leukemia virus enhancers. As the cellular factor binding to the pets site plays a significant role in regulating the HIV-2 enhancer in both T cells and monocytes, we have purified this protein from bovine spleens and demonstrate that it is 43 kDa in size. In addition, using glycerol gradient centrifugation, Southwestern blotting, electrophoretic mobility shift assays employing purified protein eluted from a gel, and a new in solution UV cross-linking competitive assay, we show that the dominant protein binding to the pets site is 43 kDa in size. These results indicate that a nuclear protein of 43 kDa binds specifically to the pets site of the HIV-2 enhancer and may mediate transcriptional activation of this important human pathogen in response to T cell stimulation. As retroviruses generally expropriate important human regulatory proteins for their own use, the 43-kDa pets factor is also likely to play a significant role in signal transduction in T cells and in other cellular processes. PMID:8702655

  8. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis.

    PubMed

    Hai, T; Hartman, M G

    2001-07-25

    The mammalian ATF/CREB family of transcription factors represents a large group of basic region-leucine zipper (bZip) proteins which was originally defined in the late 1980s by their ability to bind to the consensus ATF/CRE site 'TGACGTCA'. Over the past decade, cDNA clones encoding identical or homologous proteins have been isolated by different laboratories and given different names. These proteins can be grouped into subgroups according to their amino acid similarity. In this review, we will briefly describe the classification of these proteins with a historical perspective of their nomenclature. We will then review three members of the ATF/CREB family of proteins: ATF3, ATF4 and ATF6. We will address four issues for each protein: (a) homologous proteins and alternative names, (b) dimer formation with other bZip proteins, (c) transcriptional activity, and (d) potential physiological functions. Although the name Activating Transcription Factor (ATF) implies that they are transcriptional activators, some of these proteins are transcriptional repressors. ATF3 homodimer is a transcriptional repressor and ATF4 has been reported to be either an activator or a repressor. We will review the reports on the transcriptional activities of ATF4, and propose potential explanations for the discrepancy. Although the physiological functions of these proteins are not well understood, some clues can be gained from studies with different approaches. When the data are available, we will address the following questions. (a) How is the expression (at the mRNA level or protein level) regulated? (b) How are the transcriptional activities regulated? (c) What are the interacting proteins (other than bZip partners)? (d) What are the consequences of ectopically expressing the gene (gain-of-function) or deleting the gene (loss-of-function)? Although answers to these questions are far from being complete, together they provide clues to the functions of these ATF proteins. Despite the

  9. Chicken ovalbumin upstream promoter-transcription factor interacts with estrogen receptor, binds to estrogen response elements and half-sites, and inhibits estrogen-induced gene expression.

    PubMed

    Klinge, C M; Silver, B F; Driscoll, M D; Sathya, G; Bambara, R A; Hilf, R

    1997-12-12

    Chicken ovalbumin upstream promoter-transcription factor (COUP-TF) was identified as a low abundance protein in bovine uterus that co-purified with estrogen receptor (ER) in a ligand-independent manner and was separated from the ER by its lower retention on estrogen response element (ERE)-Sepharose. In gel mobility shift assays, COUP-TF bound as an apparent dimer to ERE and ERE half-sites. COUP-TF bound to an ERE half-site with high affinity, Kd = 1.24 nM. In contrast, ER did not bind a single ERE half-site. None of the class II nuclear receptors analyzed, i.e. retinoic acid receptor, retinoid X receptor, thyroid receptor, peroxisome proliferator-activated receptor, or vitamin D receptor, were constituents of the COUP-TF.DNA binding complex detected in gel mobility shift assays. Direct interaction of COUP-TF with ER was indicated by GST "pull-down" and co-immunoprecipitation assays. The nature of the ER ligand influenced COUP-TF-ERE half-site binding. When ER was liganded by the antiestrogen 4-hydroxytamoxifen (4-OHT), COUP-TF-half-site interaction decreased. Conversely, COUP-TF transcribed and translated in vitro enhanced the ERE binding of purified estradiol (E2)-liganded ER but not 4-OHT-liganded ER. Co-transfection of ER-expressing MCF-7 human breast cancer cells with an expression vector for COUP-TFI resulted in a dose-dependent inhibition of E2-induced expression of a luciferase reporter gene under the control of three tandem copies of EREc38. The ability of COUP-TF to bind specifically to EREs and half-sites, to interact with ER, and to inhibit E2-induced gene expression suggests COUP-TF regulates ER action by both direct DNA binding competition and through protein-protein interactions. PMID:9395481

  10. Transcription of Angiogenin and Ribonuclease 4 Is Regulated by RNA Polymerase III Elements and a CCCTC Binding Factor (CTCF)-dependent Intragenic Chromatin Loop*

    PubMed Central

    Sheng, Jinghao; Luo, Chi; Jiang, Yuxiang; Hinds, Philip W.; Xu, Zhengping; Hu, Guo-fu

    2014-01-01

    Angiogenin (ANG) and ribonuclease 4 (RNASE4), two members of the secreted and vertebrate-specific ribonuclease superfamily, play important roles in cancers and neurodegenerative diseases. The ANG and RNASE4 genes share genetic regions with promoter activities, but the structure and regulation of these putative promotes are unknown. We have characterized the promoter regions, defined the transcription start site, and identified a mechanism of transcription regulation that involves both RNA polymerase III (Pol III) elements and CCCTC binding factor (CTCF) sites. We found that two Pol III elements within the promoter region influence ANG and RNASE4 expression in a position- and orientation-dependent manner. We also provide evidence for the presence of an intragenic chromatin loop between the two CTCF binding sites located in two introns flanking the ANG coding exon. We found that formation of this intragenic loop preferentially enhances ANG transcription. These results suggest a multilayer transcriptional regulation of ANG and RNASE4 gene locus. These data also add more direct evidence to the notion that Pol III elements are able to directly influence Pol II gene transcription. Furthermore, our data indicate that a CTCF-dependent chromatin loop is able to differentially regulate transcription of genes that share the same promoters. PMID:24659782

  11. NF-Y and USF1 transcription factor binding to CCAAT box and E-box elements activates the CP27 promoter

    PubMed Central

    Ito, Yoshihiro; Zhang, Youbin; Dangaria, Smit; Luan, Xianghong; Diekwisch, Thomas G.H.

    2010-01-01

    The maintenance and differentiation of embryonic stem cells (ES cells) depends on the regulation of gene expression through the coordinated binding of transcription factors to regulatory promoter elements. One of the genes involved in embryonic development is the chromatin factor CP27. Previously, we have shown that NF-Y interacted with the CP27 proximal promoter CCAAT-box. Here we report that CP27 gene expression in mouse ES cells is controlled by CCAAT and E-box cis-acting regulatory elements and their corresponding transcription factors NF-Y and USF1. Specifically, USF1 interacts with the E-box of the CP27 proximal promoter and NF-Y interacts with the CCAAT box. NF-Y and USF1 also interacted with each other and activated the CP27 promoter in a synergistic fashion. Together, these studies demonstrate that gene expression of the chromatin factor CP27 is regulated through the interaction of the transcription factors NF-Y and USF1 with the CP27 proximal promoter. PMID:21078375

  12. HIRF: a novel nuclear factor that binds to the human T-cell leukemia virus type I internal regulatory element (HIRE).

    PubMed

    Ariumi, Y; Copeland, T D; Nosaka, T; Hatanaka, M

    1997-04-01

    The transcription of human T-cell leukemia virus type I (HTLV-I) provirus starts from a promoter located in the 5' long terminal repeat (LTR). We have identified a second promoter at the 3' end of the pol gene. This internal promoter expresses the Tax transactivator protein, but does not require Tax for its activity. Furthermore, we have found the novel enhancer motif AGTTCTGCCC, which are located near the initiation site. We have named the sequence HIRE (HTLV-I internal regulatory element). The HIRE binding protein is a ubiquitous protein. We purified this protein from the HTLV-I producing cell line MT-2 cells by DNA affinity chromatography. SDS-PAGE analysis revealed four major bands (70, 85, 115 and more than 200 kDa) and some minor bands on the gel. We renatured each major protein and showed the 70 and 115 kDa proteins bind to DNA, although the 115 kDa protein seemed to bind nonspecifically. We have designated these components as HIRF (HTLV-I internal regulatory factor). PMID:9209287

  13. p300/cAMP-response-element-binding-protein ('CREB')-binding protein (CBP) modulates co-operation between myocyte enhancer factor 2A (MEF2A) and thyroid hormone receptor-retinoid X receptor.

    PubMed Central

    De Luca, Antonio; Severino, Anna; De Paolis, Paola; Cottone, Giuliano; De Luca, Luca; De Falco, Maria; Porcellini, Antonio; Volpe, Massimo; Condorelli, Gianluigi

    2003-01-01

    Thyroid hormone receptors (TRs) and members of the myocyte enhancer factor 2 (MEF2) family are involved in the regulation of muscle-specific gene expression during myogenesis. Physical interaction between these two factors is required to synergistically activate gene transcription. p300/cAMP-response-element-binding-protein ('CREB')-binding protein (CBP) interacting with transcription factors is able to increase their activity on target gene promoters. We investigated the role of p300 in regulating the TR-MEF2A complex. To this end, we mapped the regions of these proteins involved in physical interactions and we evaluated the expression of a chloramphenicol acetyltransferase (CAT) reporter gene in U2OS cells under control of the alpha-myosin heavy chain promoter containing the thyroid hormone response element (TRE). Our results suggested a role of p300/CBP in mediating the transactivation effects of the TR-retenoid X receptor (RxR)-MEF2A complex. Our findings showed that the same C-terminal portion of p300 binds the N-terminal domains of both TR and MEF2A, and our in vivo studies demonstrated that TR, MEF2A and p300 form a ternary complex. Moreover, by the use of CAT assays, we demonstrated that adenovirus E1A inhibits activation of transcription by TR-RxR-MEF2A-p300 but not by TR-RxR-MEF2A. Our data suggested that p300 can bind and modulate the activity of TR-RxR-MEF2A at TRE. In addition, it is speculated that p300 might modulate the activity of the TR-RxR-MEF2A complex by recruiting a hypothetical endogenous inhibitor which may act like adenovirus E1A. PMID:12371907

  14. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  15. PROGESTERONE RECEPTOR TRANSACTIVATION OF THE SECRETORY LUEKOCYTE PROTEASE INHIBITOR GENE IN ISHIKAWA ENDOMETRIAL EPHITELIAL CELLS INVOLVES RECRUITMENT OF KRUPPEL-LIKE FACTOR 9/BASIC TRANSCRIPTION ELEMENT BINDING PROTEIN-1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Progesterone receptor (PR), a ligand-inducible transcription factor mediates the physiological actions of progesterone (P) through two distinct isoforms PR-A and PR-B and numerous nuclear factors. We demonstrated previously that basic transcription element-binding protein-1 (BTEB1), a transcription ...

  16. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    PubMed Central

    Sillam-Dussès, David; Hanus, Robert; Poulsen, Michael; Roy, Virginie; Favier, Maryline

    2016-01-01

    Termites are among the few animals that themselves can digest the most abundant organic polymer, cellulose, into glucose. In mice and Drosophila, glucose can activate genes via the transcription factor carbohydrate-responsive element-binding protein (ChREBP) to induce glucose utilization and de novo lipogenesis. Here, we identify a termite orthologue of ChREBP and its downstream lipogenic targets, including acetyl-CoA carboxylase and fatty acid synthase. We show that all of these genes, including ChREBP, are upregulated in mature queens compared with kings, sterile workers and soldiers in eight different termite species. ChREBP is expressed in several tissues, including ovaries and fat bodies, and increases in expression in totipotent workers during their differentiation into neotenic mature queens. We further show that ChREBP is regulated by a carbohydrate diet in termite queens. Suppression of the lipogenic pathway by a pharmacological agent in queens elicits the same behavioural alterations in sterile workers as observed in queenless colonies, supporting that the ChREBP pathway partakes in the biosynthesis of semiochemicals that convey the signal of the presence of a fertile queen. Our results highlight ChREBP as a likely key factor for the regulation and signalling of queen fertility. PMID:27249798

  17. Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    SciTech Connect

    Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju; Liao, Yi-Ji; Lin, Sheng; Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin; Mai, Shi-Juan; Xie, Dan

    2011-12-20

    Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  18. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility.

    PubMed

    Sillam-Dussès, David; Hanus, Robert; Poulsen, Michael; Roy, Virginie; Favier, Maryline; Vasseur-Cognet, Mireille

    2016-05-01

    Termites are among the few animals that themselves can digest the most abundant organic polymer, cellulose, into glucose. In mice and Drosophila, glucose can activate genes via the transcription factor carbohydrate-responsive element-binding protein (ChREBP) to induce glucose utilization and de novo lipogenesis. Here, we identify a termite orthologue of ChREBP and its downstream lipogenic targets, including acetyl-CoA carboxylase and fatty acid synthase. We show that all of these genes, including ChREBP, are upregulated in mature queens compared with kings, sterile workers and soldiers in eight different termite species. ChREBP is expressed in several tissues, including ovaries and fat bodies, and increases in expression in totipotent workers during their differentiation into neotenic mature queens. We further show that ChREBP is regulated by a carbohydrate diet in termite queens. Suppression of the lipogenic pathway by a pharmacological agent in queens elicits the same behavioural alterations in sterile workers as observed in queenless colonies, supporting that the ChREBP pathway partakes in the biosynthesis of semiochemicals that convey the signal of the presence of a fertile queen. Our results highlight ChREBP as a likely key factor for the regulation and signalling of queen fertility. PMID:27249798

  19. AMP-activated protein kinase and carbohydrate response element binding protein: A study of two potential regulatory factors in the hepatic lipogenic program of broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study investigated the effects of fasting and refeeding on AMP-activated protein kinase (AMPK) and carbohydrate response element binding protein (ChREBP) mRNA, protein and activity levels; as well as the expression of lipogenic genes involved in regulating lipid synthesis in broiler chicken liv...

  20. A G-string positive cis-regulatory element in the LpS1 promoter binds two distinct nuclear factors distributed non-uniformly in Lytechinus pictus embryos.

    PubMed

    Xiang, M; Lu, S Y; Musso, M; Karsenty, G; Klein, W H

    1991-12-01

    The LpS1 alpha and beta genes of Lytechinus pictus are activated at the late cleavage stage of embryogenesis, with LpS1 mRNAs accumulating only in lineages contributing to aboral ectoderm. We had shown previously that 762 bp of 5' flanking DNA from the LpS1 beta gene was sufficient for proper temporal and aboral ectoderm specific expression. In the present study, we identified a strong positive cis-regulatory element at -70 bp to -75 bp in the LpS1 beta promoter with the sequence (G)6 and a similar, more distal cis-element at -721 bp to -726 bp. The proximal 'G-string' element interacted with two nuclear factors, one specific to ectoderm and one to endoderm/mesoderm nuclear extracts, whereas the distal G-string element interacted only with the ectoderm factor. The ectoderm and endoderm/mesoderm G-string factors were distinct based on their migratory behavior in electrophoretic mobility shift assays, binding site specificities, salt optima and EDTA sensitivity. The proximal G-string element shared homology with a binding site for the mammalian transcription factor IF1, a protein that binds to negative cis-regulatory elements in the mouse alpha 1(I) and alpha 2(I) collagen gene promoters. Competition experiments using wild-type and mutant oligonucleotides indicated that the ectoderm G-string factor and IF1 have similar recognition sites. Partially purified IF1 specifically bound to an oligonucleotide containing the proximal G-string of LpS1 beta. From our results, we suggest that the ectoderm G-string factor, a member of the G-rich DNA-binding protein family, activates the LpS1 gene in aboral ectoderm cells by binding to the LpS1 promoter at the proximal G-string site. PMID:1811948

  1. Redox regulation of cAMP-responsive element-binding protein and induction of manganous superoxide dismutase in nerve growth factor-dependent cell survival.

    PubMed

    Bedogni, Barbara; Pani, Giovambattista; Colavitti, Renata; Riccio, Antonella; Borrello, Silvia; Murphy, Mike; Smith, Robin; Eboli, Maria Luisa; Galeotti, Tommaso

    2003-05-01

    Reactive oxygen species (ROS) act as both signaling molecules and mediators of cell damage in the nervous system and are implicated in the pathogenesis of neurodegenerative diseases. Neurotrophic factors such as the nerve-derived growth factor (NGF) support neuronal survival during development and promote regeneration after neuronal injury through the activation of intracellular signals whose molecular effectors and downstream targets are still largely unknown. Here we present evidence that early oxidative signals initiated by NGF in PC12 cells, an NGF-responsive cell line, play a critical role in preventing apoptosis induced by serum deprivation. This redox-signaling cascade involves phosphatidylinositol 3-kinase, the small GTPase Rac-1, and the transcription factor cAMP-responsive element-binding protein (CREB), a molecule essential to promote NGF-dependent survival. We found that ROS are necessary for NGF-dependent phosphorylation of CREB, an event directly correlated with CREB activity, whereas hydrogen peroxide induces a robust CREB phosphorylation. Cells exposed to NGF show a late decrease in the intracellular content of ROS when compared with untreated cells and increased expression of the mitochondrial antioxidant enzyme manganese superoxide dismutase, a general inhibitor of cell death. Accordingly, serum deprivation-induced apoptosis was selectively inhibited by low concentrations of the mitochondrially targeted antioxidant Mito Q (mitoquinol/mitoquinone). Taken together, these data demonstrate that the oxidant-dependent activation of CREB is a component of NGF survival signaling in PC12 cells and outline an intriguing circuitry by which a cytosolic redox cascade promotes cell survival at least in part by increasing mitochondrial resistance to oxidative stress. PMID:12609977

  2. Regulation of mouse brain-selective sulfotransferase sult4a1 by cAMP response element-binding protein and activating transcription factor-2.

    PubMed

    Butcher, Neville J; Mitchell, Deanne J; Burow, Rachel; Minchin, Rodney F

    2010-09-01

    Sulfotransferase 4A1 (SULT4A1) is a novel cytosolic sulfotransferase that is primarily expressed in the brain. To date, no significant enzyme activity or biological function for the protein has been identified, although it is highly conserved between species. Mutations in the SULT4A1 gene have been linked to schizophrenia susceptibility, and recently, its stability was shown to be regulated by Pin1, a peptidyl-prolyl cis-trans isomerase implicated in several neurodegenerative diseases. In this study, we investigated the transcriptional regulation of mouse Sult4a1. Using a series of promoter deletion constructs, we identified three cAMP-responsive elements (CREs) that were required for maximal promoter activity. The CREs are located within 100 base pairs of the major transcription start site and are also present in the same region of the human SULT4A1 promoter. Electrophoretic mobility shift assays (EMSAs) identified two specific complexes that formed on each of the CREs. One complex contained cAMP response element-binding protein (CREB), and the other contained activating transcription factor-2 (ATF-2) and c-Jun. Overexpression of CREB or ATF-2 increased not only reporter promoter activity but also endogenous Sult4a1 mRNA levels in Neuro2a cells. Moreover, [d-Ala(2),N-MePhe(4),Gly-ol(5)]enkephalin (DAMGO) treatment increased both reporter promoter activity and Sult4a1 levels in mu-opioid receptor expressing Neuro2a/mu-opioid receptor cells, and EMSAs showed this to be due to increased binding of CREB and ATF-2 to the Sult4a1 promoter. We also show that DAMGO treatment increases Sult4a1 mRNA and protein levels in primary mouse neurons. These results suggest that Sult4a1 is a target gene for the mu-opioid receptor signaling pathway and other pathways involving activation of CREB and ATF-2. PMID:20571078

  3. Mechanism of regulation of bcl-2 mRNA by nucleolin and A+U-rich element-binding factor 1 (AUF1).

    PubMed

    Ishimaru, Daniella; Zuraw, Lisa; Ramalingam, Sivakumar; Sengupta, Tapas K; Bandyopadhyay, Sumita; Reuben, Adrian; Fernandes, Daniel J; Spicer, Eleanor K

    2010-08-27

    The antiapoptotic Bcl-2 protein is overexpressed in a variety of cancers, particularly leukemias. In some cell types this is the result of enhanced stability of bcl-2 mRNA, which is controlled by elements in its 3'-untranslated region. Nucleolin is one of the proteins that binds to bcl-2 mRNA, thereby increasing its half-life. Here, we examined the site on the bcl-2 3'-untranslated region that is bound by nucleolin as well as the protein binding domains important for bcl-2 mRNA recognition. RNase footprinting and RNA fragment binding assays demonstrated that nucleolin binds to a 40-nucleotide region at the 5' end of the 136-nucleotide bcl-2 AU-rich element (ARE(bcl-2)). The first two RNA binding domains of nucleolin were sufficient for high affinity binding to ARE(bcl-2). In RNA decay assays, ARE(bcl-2) transcripts were protected from exosomal decay by the addition of nucleolin. AUF1 has been shown to recruit the exosome to mRNAs. When MV-4-11 cell extracts were immunodepleted of AUF1, the rate of decay of ARE(bcl-2) transcripts was reduced, indicating that nucleolin and AUF1 have opposing roles in bcl-2 mRNA turnover. When the function of nucleolin in MV-4-11 cells was impaired by treatment with the nucleolin-targeting aptamer AS1411, association of AUF1 with bcl-2 mRNA was increased. This suggests that the degradation of bcl-2 mRNA induced by AS1411 results from both interference with nucleolin protection of bcl-2 mRNA and recruitment of the exosome by AUF1. Based on our findings, we propose a model that illustrates the opposing roles of nucleolin and AUF1 in regulating bcl-2 mRNA stability. PMID:20571027

  4. A rice dehydration-inducible SNF1-related protein kinase 2 phosphorylates an abscisic acid responsive element-binding factor and associates with ABA signaling.

    PubMed

    Chae, Min-Ju; Lee, Jung-Sook; Nam, Myung-Hee; Cho, Kun; Hong, Ji-Yeon; Yi, Sang-A; Suh, Seok-Cheol; Yoon, In-Sun

    2007-01-01

    By a differential cDNA screening technique, we have isolated a dehydration-inducible gene (designated OSRK1) that encodes a 41.8 kD protein kinase of SnRK2 family from Oryza sativa. The OSRK1 transcript level was undetectable in vegetative tissues, but significantly increased by hyperosmotic stress and Abscisic acid (ABA). To determine its biochemical properties, we expressed and isolated OSRK1 and its mutants as glutathione S-transferase fusion proteins in Escherichia coli. In vitro kinase assay showed that OSRK1 can phosphorylate itself and generic substrates as well. Interestingly, OSRK1 showed strong substrate preference for rice bZIP transcription factors and uncommon cofactor requirement for Mn(2+) over Mg(2+). By deletion of C-terminus 73 amino acids or mutations of Ser-158 and Thr-159 to aspartic acids (Asp) in the activation loop, the activity of OSRK1 was dramatically decreased. OSRK1 can transphosphorylate the inactive deletion protein. A rice family of abscisic acid-responsive element (ABRE) binding factor, OREB1 was phosphorylated in vitro by OSRK1 at multiple sites of different functional domains. MALDI-TOF analysis identified a phosphorylation site at Ser44 of OREB1 and mutation of the residue greatly decreased the substrate specificity for OSRK1. The recognition motif for OSRK1, RQSS is highly similar to the consensus substrate sequence of AMPK/SNF1 kinase family. We further showed that OSRK1 interacts with OREB1 in a yeast two-hybrid system and co-localized to nuclei by transient expression analysis of GFP-fused protein in onion epidermis. Finally, ectopic expression of OSRK1 in transgenic tobacco resulted in a reduced sensitivity to ABA in seed germination and root elongation. These findings suggest that OSRK1 is associated with ABA signaling, possibly through the phosphorylation of ABF family in vivo. The interaction between SnRK2 family kinases and ABF transcription factors may constitute an important part of cross-talk mechanism in the stress

  5. A Composite Element that Binds Basic Helix Loop Helix and Basic Leucine Zipper Transcription Factors Is Important for Gonadotropin-Releasing Hormone Regulation of the Follicle-Stimulating Hormone β Gene

    PubMed Central

    Ciccone, Nick A.; Lacza, Charlemagne T.; Hou, Melody Y.; Gregory, Susan J.; Kam, Kyung-Yoon; Xu, Shuyun; Kaiser, Ursula B.

    2008-01-01

    Although FSH plays an essential role in controlling gametogenesis, the biology of FSHβ transcription remains poorly understood, but is known to involve the complex interplay of multiple endocrine factors including GnRH. We have identified a GnRH-responsive element within the rat FSHβ promoter containing an E-box and partial cAMP response element site that are bound by the basic helix loop helix transcription factor family members, upstream stimulating factor (USF)-1/USF-2, and the basic leucine zipper member, cAMP response element-binding protein (CREB), respectively. Expression studies with CREB, USF-1/USF-2, and activating protein-1 demonstrated that the USF transcription factors increased basal transcription, an effect not observed if the cognate binding site was mutated. Conversely, expression of a dominant negative CREB mutant or CREB knockdown attenuated induction by GnRH, whereas dominant negative Fos or USF had no effect on the GnRH response. GnRH stimulation specifically induced an increase in phosphorylated CREB occupation of the FSHβ promoter, leading to the recruitment of CREB-binding protein to enhance gene transcription. In conclusion, a composite element bound by both USF and CREB serves to integrate signals for basal and GnRH-stimulated transcription of the rat FSHβ gene. PMID:18550775

  6. AthaMap web tools for database-assisted identification of combinatorial cis-regulatory elements and the display of highly conserved transcription factor binding sites in Arabidopsis thaliana.

    PubMed

    Steffens, Nils Ole; Galuschka, Claudia; Schindler, Martin; Bülow, Lorenz; Hehl, Reinhard

    2005-07-01

    The AthaMap database generates a map of cis-regulatory elements for the Arabidopsis thaliana genome. AthaMap contains more than 7.4 x 10(6) putative binding sites for 36 transcription factors (TFs) from 16 different TF families. A newly implemented functionality allows the display of subsets of higher conserved transcription factor binding sites (TFBSs). Furthermore, a web tool was developed that permits a user-defined search for co-localizing cis-regulatory elements. The user can specify individually the level of conservation for each TFBS and a spacer range between them. This web tool was employed for the identification of co-localizing sites of known interacting TFs and TFs containing two DNA-binding domains. More than 1.8 x 10(5) combinatorial elements were annotated in the AthaMap database. These elements can also be used to identify more complex co-localizing elements consisting of up to four TFBSs. The AthaMap database and the connected web tools are a valuable resource for the analysis and the prediction of gene expression regulation at http://www.athamap.de. PMID:15980498

  7. Minocycline upregulates cyclic AMP response element binding protein and brain-derived neurotrophic factor in the hippocampus of cerebral ischemia rats and improves behavioral deficits

    PubMed Central

    Zhao, Yu; Xiao, Ming; He, Wenbo; Cai, Zhiyou

    2015-01-01

    Background and purpose The cAMP response element binding protein (CREB) plays an important role in the mechanism of cognitive impairment and is also pivotal in the switch from short-term to long-term memory. Brain-derived neurotrophic factor (BDNF) seems a promising avenue in the treatment of cerebral ischemia injury since this neurotrophin could stimulate structural plasticity and repair cognitive impairment. Several findings have displayed that the dysregulation of the CREB–BDNF cascade has been involved in cognitive impairment. The aim of this study was to investigate the effect of cerebral ischemia on learning and memory as well as on the levels of CREB, phosphorylated CREB (pCREB), and BDNF, and to determine the effect of minocycline on CREB, pCREB, BDNF, and behavioral functional recovery after cerebral ischemia. Methods The animal model was established by permanent bilateral occlusion of both common carotid arteries. Behavior was evaluated 5 days before decapitation with Morris water maze and open-field task. Four days after permanent bilateral occlusion of both common carotid arteries, minocycline was administered by douche via the stomach for 4 weeks. CREB and pCREB were examined by Western blotting, reverse transcription polymerase chain reaction, and immunohistochemistry. BDNF was measured by immunohistochemistry and Western blotting. Results The model rats after minocycline treatment swam shorter distances than control rats before finding the platform (P=0.0007). The number of times the platform position was crossed for sham-operation rats was more than that of the model groups in the corresponding platform location (P=0.0021). The number of times the platform position was crossed for minocycline treatment animals was significantly increased compared to the model groups in the corresponding platform position (P=0.0016). CREB, pCREB, and BDNF were downregulated after permanent bilateral occlusion of both common carotid arteries in the model group

  8. Soy isoflavones increase quinone reductase in hepa-1c1c7 cells via estrogen receptor beta and nuclear factor erythroid 2-related factor 2 binding to the antioxidant response element.

    PubMed

    Froyen, Erik B; Steinberg, Francene M

    2011-09-01

    Soy protein and isoflavones (genistein and daidzein) have been demonstrated to increase quinone reductase (QR) activity, protein, and mRNA in animal and cell culture models. However, their mechanism of action has not been completely characterized. Additionally, it has not been determined if equol, a daidzein metabolite, can modulate QR activity and expression. Estrogen receptor beta (ERβ) is thought to be involved in stimulating QR gene transcription by anti-estrogens and phytoestrogens, along with nuclear factor erythroid 2-related factor 2 (Nrf2). This study tested the hypothesis that genistein, daidzein and equol increase quinone reductase activity, protein and mRNA via ERβ and Nrf2 binding to the QR antioxidant response element (ARE). QR expression and activity were determined using TaqMan polymerase chain reaction, protein immunoblots and activity assays. Molecular events were investigated using luciferase reporter gene assays and chromatin immunoprecipitation (ChIP). Hepa-1c1c7 cells were treated with control [0.1% (v:v) dimethyl sulfoxide (DMSO)]; 1 μmol/L β-naphthoflavone (positive control); 5 μmol/L resveratrol (ChIP positive control for ERβ binding) and 1, 5 and 25 μmol/L genistein, daidzein or equol. Treatment durations were 1 h (ChIP), 24 h (mRNA and luciferase assays) and 24 and 48 h (protein and activity). Genistein, daidzein and equol increased QR activity, protein and mRNA, with daidzein and equol having more of an impact at physiologic concentrations (1 and 5 μmol/L) compared to genistein. Furthermore, the study results demonstrate that genistein, daidzein and equol interact with the QR ARE and that daidzein and equol act via both ERβ and Nrf2 binding strongly to the QR ARE. PMID:21167702

  9. Identification of two factors which bind to the upstream sequences of a number of nuclear genes coding for mitochondrial proteins and to genetic elements important for cell division in yeast.

    PubMed Central

    Dorsman, J C; van Heeswijk, W C; Grivell, L A

    1988-01-01

    Two abundant factors, GFI and GFII which interact with the 5' flanking regions of nuclear genes coding for proteins of the mitochondrial respiratory chain have been identified. In one case (subunit VIII of QH2: cytochrome c oxidoreductase) the binding sites for both factors overlap completely and their binding is mutually exclusive. For the other 5' regions tested the GFI and GFII binding sites do not coincide. Interestingly, binding sites for GFI and GFII are also present in or at the 3' ends of the coding regions of two genes of the PHO gene family and in DNA elements important for optimal ARS and CEN function respectively. The sites recognized by GFI conform to the consensus RTCRNNNNNNACGNR, while those recognized by GFII contain the element RTCACGTG. We speculate that GFI and GFII may play a role in different cellular processes, dependent on the context of their binding sites and that one of these processes may be the coordination of the expression of genes involved in mitochondrial biogenesis with the progress of the cell cycle. Images PMID:3045755

  10. Synthetic heparin-binding growth factor analogs

    DOEpatents

    Pena, Louis A.; Zamora, Paul; Lin, Xinhua; Glass, John D.

    2007-01-23

    The invention provides synthetic heparin-binding growth factor analogs having at least one peptide chain that binds a heparin-binding growth factor receptor, covalently bound to a hydrophobic linker, which is in turn covalently bound to a non-signaling peptide that includes a heparin-binding domain. The synthetic heparin-binding growth factor analogs are useful as soluble biologics or as surface coatings for medical devices.

  11. The Basic Leucine Zipper Transcription Factor ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 Is an Important Transcriptional Regulator of Abscisic Acid-Dependent Grape Berry Ripening Processes1[W][OPEN

    PubMed Central

    Nicolas, Philippe; Lecourieux, David; Kappel, Christian; Cluzet, Stéphanie; Cramer, Grant; Delrot, Serge; Lecourieux, Fatma

    2014-01-01

    In grape (Vitis vinifera), abscisic acid (ABA) accumulates during fruit ripening and is thought to play a pivotal role in this process, but the molecular basis of this control is poorly understood. This work characterizes ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 (VvABF2), a grape basic leucine zipper transcription factor belonging to a phylogenetic subgroup previously shown to be involved in ABA and abiotic stress signaling in other plant species. VvABF2 transcripts mainly accumulated in the berry, from the onset of ripening to the harvesting stage, and were up-regulated by ABA. Microarray analysis of transgenic grape cells overexpressing VvABF2 showed that this transcription factor up-regulates and/or modifies existing networks related to ABA responses. In addition, grape cells overexpressing VvABF2 exhibited enhanced responses to ABA treatment compared with control cells. Among the VvABF2-mediated responses highlighted in this study, the synthesis of phenolic compounds and cell wall softening were the most strongly affected. VvABF2 overexpression strongly increased the accumulation of stilbenes that play a role in plant defense and human health (resveratrol and piceid). In addition, the firmness of fruits from tomato (Solanum lycopersicum) plants overexpressing VvABF2 was strongly reduced. These data indicate that VvABF2 is an important transcriptional regulator of ABA-dependent grape berry ripening. PMID:24276949

  12. Transcription factor trapping by RNA in gene regulatory elements

    PubMed Central

    Sigova, Alla A.; Abraham, Brian J.; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M.; Eric Guo, Yang; Jangi, Mohini; Giallourakis, Cosmas C.; Sharp, Phillip A.; Young, Richard A.

    2016-01-01

    Transcription factors (TFs) bind specific sequences in promoter-proximal and distal DNA elements in order to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA-binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF YY1 binds to both gene regulatory elements and also to their associated RNA species genome-wide. Reduced transcription of regulatory elements diminishes YY1 occupancy whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive feedback loop that contributes to the stability of gene expression programs. PMID:26516199

  13. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. PMID:26516199

  14. Synergy of aromatic residues and phosphoserines within the intrinsically disordered DNA-binding inhibitory elements of the Ets-1 transcription factor

    PubMed Central

    Desjardins, Geneviève; Meeker, Charles A.; Bhachech, Niraja; Currie, Simon L.; Okon, Mark; Graves, Barbara J.; McIntosh, Lawrence P.

    2014-01-01

    The E26 transformation-specific (Ets-1) transcription factor is autoinhibited by a conformationally disordered serine-rich region (SRR) that transiently interacts with its DNA-binding ETS domain. In response to calcium signaling, autoinhibition is reinforced by calmodulin-dependent kinase II phosphorylation of serines within the SRR. Using mutagenesis and quantitative DNA-binding measurements, we demonstrate that phosphorylation-enhanced autoinhibition requires the presence of phenylalanine or tyrosine (ϕ) residues adjacent to the SRR phosphoacceptor serines. The introduction of additional phosphorylated Ser-ϕ-Asp, but not Ser-Ala-Asp, repeats within the SRR dramatically reinforces autoinhibition. NMR spectroscopic studies of phosphorylated and mutated SRR variants, both within their native context and as separate trans-acting peptides, confirmed that the aromatic residues and phosphoserines contribute to the formation of a dynamic complex with the ETS domain. Complementary NMR studies also identified the SRR-interacting surface of the ETS domain, which encompasses its positively charged DNA-recognition interface and an adjacent region of neutral polar and nonpolar residues. Collectively, these studies highlight the role of aromatic residues and their synergy with phosphoserines in an intrinsically disordered regulatory sequence that integrates cellular signaling and gene expression. PMID:25024220

  15. Repression of platelet-derived growth factor A-chain gene transcription by an upstream silencer element. Participation by sequence-specific single-stranded DNA-binding proteins.

    PubMed

    Liu, B; Maul, R S; Kaetzel, D M

    1996-10-18

    Platelet-derived growth factor A-chain is a potent mitogen expressed in a restricted number of normal and transformed cells. Transient transfection and deletion analysis in BSC-1 (African green monkey, renal epithelial) cells revealed that the -1680 to -1374 region of the A-chain gene repressed homologous and heterologous promoter activities by 60-80%. An S1 nuclease-hypersensitive region (5'SHS) was identified within this region (-1418 to -1388) that exhibited transcriptional silencer activity in BSC-1 and a variety of human tumor cell lines (U87, HepG2, and HeLa). Electrophoretic mobility shift assays conducted with 5'SHS oligodeoxynucleotide probes revealed several binding protein complexes that displayed unique preferences for binding to sense, antisense, and double-stranded forms of the element. Southwestern blot analysis revealed that the antisense strand of 5'SHS binds to nuclear proteins of molecular mass 97, 87, 44, and 17 kDa, whereas the double-stranded form of 5'SHS is recognized by a 70-kDa factor. Mutations within 5'SHS element indicated the necessity of a central 5'-GGGGAGGGGG-3' motif for protein binding and silencer function, while nucleotides flanking both sides of the motif were also critical for repression. These results support a model in which silencer function of 5'SHS is mediated by antisense strand binding proteins, possibly by stabilizing single-stranded DNA conformations required for interaction with enhancer sequences in the proximal promoter region of the A-chain gene. PMID:8824279

  16. Identification of a Bipartite Jasmonate-Responsive Promoter Element in the Catharanthus roseus ORCA3 Transcription Factor Gene That Interacts Specifically with AT-Hook DNA-Binding Proteins1[W

    PubMed Central

    Vom Endt, Débora; Soares e Silva, Marina; Kijne, Jan W.; Pasquali, Giancarlo; Memelink, Johan

    2007-01-01

    Jasmonates are plant signaling molecules that play key roles in defense against certain pathogens and insects, among others, by controlling the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the APETALA2-domain transcription factor ORCA3 is involved in the jasmonate-responsive activation of terpenoid indole alkaloid biosynthetic genes. ORCA3 gene expression is itself induced by jasmonate. By loss- and gain-of-function experiments, we located a 74-bp region within the ORCA3 promoter, which contains an autonomous jasmonate-responsive element (JRE). The ORCA3 JRE is composed of two important sequences: a quantitative sequence responsible for a high level of expression and a qualitative sequence that appears to act as an on/off switch in response to methyl jasmonate. We isolated 12 different DNA-binding proteins having one of four different types of DNA-binding domains, using the ORCA3 JRE as bait in a yeast (Saccharomyces cerevisiae) one-hybrid transcription factor screening. The binding of one class of proteins bearing a single AT-hook DNA-binding motif was affected by mutations in the quantitative sequence within the JRE. Two of the AT-hook proteins tested had a weak activating effect on JRE-mediated reporter gene expression, suggesting that AT-hook family members may be involved in determining the level of expression of ORCA3 in response to jasmonate. PMID:17496112

  17. Synthetic heparin-binding factor analogs

    DOEpatents

    Pena, Louis A.; Zamora, Paul O.; Lin, Xinhua; Glass, John D.

    2010-04-20

    The invention provides synthetic heparin-binding growth factor analogs having at least one peptide chain, and preferably two peptide chains branched from a dipeptide branch moiety composed of two trifunctional amino acid residues, which peptide chain or chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a linker, which may be a hydrophobic linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  18. Low-Temperature-Induced Expression of Rice Ureidoglycolate Amidohydrolase is Mediated by a C-Repeat/Dehydration-Responsive Element that Specifically Interacts with Rice C-Repeat-Binding Factor 3

    PubMed Central

    Li, Juan; Qin, Rui-Ying; Li, Hao; Xu, Rong-Fang; Yang, Ya-Chun; Ni, Da-Hu; Ma, Hui; Li, Li; Wei, Peng-Cheng; Yang, Jian-Bo

    2015-01-01

    Nitrogen recycling and redistribution are important for the environmental stress response of plants. In non-nitrogen-fixing plants, ureide metabolism is crucial to nitrogen recycling from organic sources. Various studies have suggested that the rate-limiting components of ureide metabolism respond to environmental stresses. However, the underlying regulation mechanism is not well understood. In this report, rice ureidoglycolate amidohydrolase (OsUAH), which is a recently identified enzyme catalyzing the final step of ureide degradation, was identified as low-temperature- (LT) but not abscisic acid- (ABA) regulated. To elucidate the LT regulatory mechanism at the transcriptional level, we isolated and characterized the promoter region of OsUAH (POsUAH). Series deletions revealed that a minimal region between –522 and –420 relative to the transcriptional start site was sufficient for the cold induction of POsUAH. Detailed analyses of this 103-bp fragment indicated that a C-repeat/dehydration-responsive (CRT/DRE) element localized at position –434 was essential for LT-responsive expression. A rice C-repeat-binding factors/DRE-binding proteins 1 (CBFs/DREB1s) subfamily member, OsCBF3, was screened to specifically bind to the CRT/DRE element in the minimal region both in yeast one-hybrid assays and in in vitro gel-shift analysis. Moreover, the promoter could be exclusively trans-activated by the interaction between the CRT/DRE element and OsCBF3 in vivo. These findings may help to elucidate the regulation mechanism of stress-responsive ureide metabolism genes and provide an example of the member-specific manipulation of the CBF/DREB1 subfamily. PMID:26617632

  19. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    PubMed Central

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-01-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta. PMID:11256944

  20. A Transcription Factor γMYB1 Binds to the P1BS cis-Element and Activates PLA2-γ Expression with its Co-Activator γMYB2.

    PubMed

    Nguyen, Ha Thi Kim; Kim, Soo Youn; Cho, Kwang-Moon; Hong, Jong Chan; Shin, Jeong Sheop; Kim, Hae Jin

    2016-04-01

    Phospholipase A2(PLA2) hydrolyzes phospholipid molecules to produce two products that are both precursors of second messengers of signaling pathways and signaling molecules per se.Arabidopsis thaliana PLA2 paralogs (-β,-γ and -δ) play critical roles during pollen development, pollen germination and tube growth. In this study, analysis of the PLA2-γ promoter using a deletion series revealed that the promoter region -153 to -1 is crucial for its pollen specificity. Using a yeast one-hybrid screening assay with the PLA2-γ promoter and an Arabidopsis transcription factor (TF)-only library, we isolated two novel MYB-like TFs belonging to the MYB-CC family, denoted here as γMYB1 and γMYB2. By electrophoretic mobility shift assay, we found that these two TFs bind directly to the P1BS (phosphate starvation response 1-binding sequence)cis-element of the PLA2-γ promoter. γMYB1 alone functioned as a transcriptional activator for PLA2-γ expression, whereas γMYB2 directly interacted with γMYB1 and enhanced its activation. Overexpression of γMYB1 in the mature pollen grain led to increased expression of not only the PLA2-γ gene but also of several genes whose promoters contain the P1BS cis-element and which are involved in the Pi starvation response, phospholipid biosynthesis and sugar synthesis. Based on these results, we suggest that the TF γMYB1 binds to the P1BS cis-element, activates the expression of PLA2-γ with the assistance of its co-activator, γMYB2, and regulates the expression of several target genes involved in many plant metabolic reactions. PMID:26872838

  1. Transcription factor binding predicts histone modifications in human cell lines

    PubMed Central

    Benveniste, Dan; Sonntag, Hans-Joachim; Sanguinetti, Guido; Sproul, Duncan

    2014-01-01

    Gene expression in higher organisms is thought to be regulated by a complex network of transcription factor binding and chromatin modifications, yet the relative importance of these two factors remains a matter of debate. Here, we show that a computational approach allows surprisingly accurate prediction of histone modifications solely from knowledge of transcription factor binding both at promoters and at potential distal regulatory elements. This accuracy significantly and substantially exceeds what could be achieved by using DNA sequence as an input feature. Remarkably, we show that transcription factor binding enables strikingly accurate predictions across different cell lines. Analysis of the relative importance of specific transcription factors as predictors of specific histone marks recapitulated known interactions between transcription factors and histone modifiers. Our results demonstrate that reported associations between histone marks and gene expression may be indirect effects caused by interactions between transcription factors and histone-modifying complexes. PMID:25187560

  2. Role of the Cyclic AMP Response Element Binding Complex and Activation of Mitogen-Activated Protein Kinases in Synergistic Activation of the Glycoprotein Hormone α Subunit Gene by Epidermal Growth Factor and Forskolin

    PubMed Central

    Roberson, Mark S.; Ban, Makiko; Zhang, Tong; Mulvaney, Jennifer M.

    2000-01-01

    The aim of these studies was to elucidate a role for epidermal growth factor (EGF) signaling in the transcriptional regulation of the glycoprotein hormone α subunit gene, a subunit of chorionic gonadotropin. Studies examined the effects of EGF and the adenylate cyclase activator forskolin on the expression of a transfected α subunit reporter gene in a human choriocarcinoma cell line (JEG3). At maximal doses, administration of EGF resulted in a 50% increase in a subunit reporter activity; forskolin administration induced a fivefold activation; the combined actions of EGF and forskolin resulted in synergistic activation (greater than eightfold) of the α subunit reporter. Mutagenesis studies revealed that the cyclic AMP response elements (CRE) were required and sufficient to mediate EGF-forskolin-induced synergistic activation. The combined actions of EGF and forskolin resulted in potentiated activation of extracellular signal-regulated kinase (ERK) enzyme activity compared with EGF alone. Specific blockade of ERK activation was sufficient to block EGF-forskolin-induced synergistic activation of the α subunit reporter. Pretreatment of JEG3 cells with a p38 mitogen-activated protein kinase inhibitor did not influence activation of the α reporter. However, overexpression of c-Jun N-terminal kinase (JNK)-interacting protein 1 as a dominant interfering molecule abolished the synergistic effects of EGF and forskolin on the α subunit reporter. CRE binding studies suggested that the CRE complex consisted of CRE binding protein and EGF-ERK-dependent recruitment of c-Jun–c-Fos (AP-1) to the CRE. A dominant negative form of c-Fos (A-Fos) that specifically disrupts c-Jun–c-Fos DNA binding inhibited synergistic activation of the α subunit. Thus, synergistic activation of the α subunit gene induced by EGF-forskolin requires the ERK and JNK cascades and the recruitment of AP-1 to the CRE binding complex. PMID:10779323

  3. Human T-cell leukemia virus type 1 oncoprotein tax represses ZNF268 expression through the cAMP-responsive element-binding protein/activating transcription factor pathway.

    PubMed

    Wang, Di; Guo, Ming-Xiong; Hu, Hai-Ming; Zhao, Zhou-Zhou; Qiu, Hong-Ling; Shao, Huan-Jie; Zhu, Chen-Gang; Xue, Lu; Shi, Yun-Bo; Li, Wen-Xin

    2008-06-13

    Expression of the human T-cell leukemia virus type 1 (HTLV-1) oncoprotein Tax is correlated with cellular transformation, contributing to the development of adult T-cell leukemia. In this study, we investigated the role of Tax in the regulation of the ZNF268 gene, which plays a role in the differentiation of blood cells and the pathogenesis of leukemia. We demonstrated that ZNF268 mRNA was repressed in HTLV-1-infected cells. We also showed that stable and transient expression of HTLV-1 Tax led to repression of ZNF268. In addition, by using reporter constructs that bear the human ZNF268 promoter and its mutants, we showed that Tax repressed ZNF268 promoter in a process dependent on a functional cAMP-responsive element. By using Tax, cAMP-responsive element-binding protein (CREB)-1, CREB-2, and their mutants, we further showed that Tax repressed ZNF268 through the CREB/activating transcription factor pathway. Electrophoretic mobility shift assays and chromatin immunoprecipitation demonstrated the formation of the complex of Tax.CREB-1 directly at the cAMP-responsive element both in vitro and in vivo. These findings suggest a role for ZNF268 in aberrant T-cell proliferation observed in HTLV-1-associated diseases. PMID:18375384

  4. The cAMP response element binding protein (CREB) is activated by insulin-like growth factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast.

    PubMed

    Zuloaga, R; Fuentes, E N; Molina, A; Valdés, J A

    2013-10-18

    Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP3/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA-CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation. PMID:24064350

  5. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    SciTech Connect

    Zuloaga, R.; Fuentes, E.N.; Molina, A.; Valdés, J.A.

    2013-10-18

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP{sub 3}/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation.

  6. Transcription factor binding energy vs. biological function

    NASA Astrophysics Data System (ADS)

    Djordjevic, M.; Grotewold, E.

    2007-03-01

    Transcription factors (TFs) are proteins that bind to DNA and regulate expression of genes. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of gene regulatory networks. Recent theoretical advances that we developed [1,2], allow us to infer TF-DNA interaction parameters from in-vitro selection experiments [3]. We use more than 6000 binding sequences [3], assembled under controlled conditions, to obtain protein-DNA interaction parameters for a mammalian TF with up to now unprecedented accuracy. Can one accurately identify biologically functional TF binding sites (i.e. the binding sites that regulate gene expression), even with the best possible protein-DNA interaction parameters? To address this issue we i) compare our prediction of protein binding with gene expression data, ii) use evolutionary comparison between related mammalian genomes. Our results strongly suggest that in a genome there exists a large number of randomly occurring high energy binding sites that are not biologically functional. [1] M Djordjevic, submitted to Biomol. Eng. [2] M. Djordjevic and A. M. Sengupta, Phys. Biol. 3: 13, 2006. [3] E. Roulet et al., Nature Biotech. 20: 831, 2002.

  7. ORA47 (octadecanoid-responsive AP2/ERF-domain transcription factor 47) regulates jasmonic acid and abscisic acid biosynthesis and signaling through binding to a novel cis-element.

    PubMed

    Chen, Hsing-Yu; Hsieh, En-Jung; Cheng, Mei-Chun; Chen, Chien-Yu; Hwang, Shih-Ying; Lin, Tsan-Piao

    2016-07-01

    ORA47 (octadecanoid-responsive AP2/ERF-domain transcription factor 47) of Arabidopsis thaliana is an AP2/ERF domain transcription factor that regulates jasmonate (JA) biosynthesis and is induced by methyl JA treatment. The regulatory mechanism of ORA47 remains unclear. ORA47 is shown to bind to the cis-element (NC/GT)CGNCCA, which is referred to as the O-box, in the promoter of ABI2. We proposed that ORA47 acts as a connection between ABA INSENSITIVE1 (ABI1) and ABI2 and mediates an ABI1-ORA47-ABI2 positive feedback loop. PORA47:ORA47-GFP transgenic plants were used in a chromatin immunoprecipitation (ChIP) assay to show that ORA47 participates in the biosynthesis and/or signaling pathways of nine phytohormones. Specifically, many abscisic acid (ABA) and JA biosynthesis and signaling genes were direct targets of ORA47 under stress conditions. The JA content of the P35S:ORA47-GR lines was highly induced under wounding and moderately induced under water stress relative to that of the wild-type plants. The wounding treatment moderately increased ABA accumulation in the transgenic lines, whereas the water stress treatment repressed the ABA content. ORA47 is proposed to play a role in the biosynthesis of JA and ABA and in regulating the biosynthesis and/or signaling of a suite of phytohormone genes when plants are subjected to wounding and water stress. PMID:26974851

  8. Molecular cloning and expression of chicken carbohydrate response element binding protein and Max-like protein X gene homologues

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Carbohydrate response element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c) are transcription factors that are known to be key regulators of glucose metabolism and lipid synthesis in mammals. Since ChREBP and its co-activator Max-like protein X (Mlx) have not ...

  9. Role of Hypoxia-Inducible Factor 1, α Subunit and cAMP-Response Element Binding Protein 1 in Synergistic Release of Interleukin 8 by Prostaglandin E2 and Nickel in Lung Fibroblasts

    PubMed Central

    Fabisiak, James P.

    2013-01-01

    Numerous epidemiological studies have linked exposure to particulate matter (PM) air pollution with acute respiratory infection and chronic respiratory and cardiovascular diseases. We have previously shown that soluble nickel (Ni), a common component of PM, alters the release of CXC chemokines from cultured human lung fibroblasts (HLF) in response to microbial stimuli via a pathway dependent on disrupted prostaglandin (PG)E2 signaling. The current study sought to identify the molecular events underlying Ni-induced alterations in PGE2 signaling and its effects on IL-8 production. PGE2 synergistically enhances Ni-induced IL-8 release from HLF in a concentration-dependent manner. The effects of PGE2 were mimicked by butaprost and PGE1-alcohol and inhibited with antagonists AH6809 and L-161,982, indicating PGE2 signals via PGE2 receptors 2 and 4. PGE2 and forskolin stimulated cAMP, but it was only in the presence of Ni-induced hypoxia-inducible factor 1, α subunit (HIF1A) that these agents stimulated IL-8 release. The Ni-induced HIF1A DNA binding was enhanced by PGE2 and mediated, in part, by activation of p38 MAPK. Negation of cAMP-response element binding protein 1 or HIF1A using short interfering RNA blocked the synergistic interactions between Ni and PGE2. The results of the current study provide novel information on the ability of atmospheric hypoxia-mimetic metals to disrupt the release of immune-modulating chemokines by HLF in response to PGE2. Moreover, in the presence of HIF1A, cAMP-mediated signaling pathways may be altered to exacerbate inflammatory-like processes in lung tissue, imparting a susceptibility of PM-exposed populations to adverse respiratory health effects. PMID:23526216

  10. Functional antagonism between inhibitor of DNA binding (Id) and adipocyte determination and differentiation factor 1/sterol regulatory element-binding protein-1c (ADD1/SREBP-1c) trans-factors for the regulation of fatty acid synthase promoter in adipocytes.

    PubMed Central

    Moldes, M; Boizard, M; Liepvre, X L; Fève, B; Dugail, I; Pairault, J

    1999-01-01

    We show that Id (inhibitor of DNA binding) 2 and Id3, dominant negative members of the helix-loop-helix (HLH) family, interact with the adipocyte determination and differentiation factor 1 (ADD1)/sterol regulatory element-binding protein (SREBP) 1c, a transcription factor of the basic HLH-leucine zipper family that controls the expression of several key genes of adipose metabolism. Gel mobility-shift assays performed with in vitro-translated ADD1, Id2 or Id3 proteins and a fatty acid synthase (FAS) promoter oligonucleotide showed evidence for a marked inhibition of the formation of DNA-ADD1 complexes by Id2 or Id3 proteins. Co-immunoprecipitation studies using in vitro-translated proteins demonstrated further the physical interaction of Id and ADD1/SREBP-1c proteins in the absence of DNA. Using the FAS gene as a model of an ADD1-regulated promoter in transiently transfected isolated rat adipocytes or mature 3T3-L1 adipocytes, a potent inhibition of the activity of the FAS-chloramphenicol acetyltransferase reporter gene was observed by overexpression of Id2 or Id3. Reciprocally, co-transfection of Id3 antisense and ADD1 expression vectors in preadipocytes potentiated the ADD1/SREBP-1c effect on the FAS promoter activity. Finally, in the non adipogenic NIH-3T3 cell line, most of the ADD1-mediated trans-activation of the FAS promoter was counteracted by co-transfection of Id2 or Id3 expression vectors. Previous studies have indicated Id gene expression to be down-regulated during adipogenesis [Moldes, Lasnier, Fève, Pairault and Djian (1997) Mol. Cell. Biol. 17, 1796-1804]. We here demonstrated that there was a dramatic rise of Id2 and Id3 mRNA levels when 3T3-L1 adipocytes or isolated rat fat cells were exposed to lipolytic and anti-lipogenic agents, forskolin and isoproterenol. Taken together, our data show that Id products are functionally involved in modulating ADD1/SREBP-1c transcriptional activity, and thus lipogenesis in adipocytes. PMID:10585876

  11. A pleiotropic element in the medium-chain acyl coenzyme A dehydrogenase gene promoter mediates transcriptional regulation by multiple nuclear receptor transcription factors and defines novel receptor-DNA binding motifs.

    PubMed Central

    Carter, M E; Gulick, T; Moore, D D; Kelly, D P

    1994-01-01

    We previously identified a complex regulatory element in the medium-chain acyl coenzyme A dehydrogenase gene promoter that confers transcriptional regulation by the retinoid receptors RAR and RXR and the orphan nuclear receptor HNF-4. In this study we demonstrate a trans-repressing regulatory function for the orphan receptor COUP-TF at this same nuclear receptor response element (NRRE-1). The transcriptional regulatory properties and receptor binding sequences of each nuclear receptor response element within NRRE-1 are also characterized. NRRE-1 consists of four potential nuclear hormone receptor hexamer binding sites, arranged as [<--1-(n)s-2-->-3-->(n)4<--4], three of which are used in alternative pairwise binding by COUP-TF and HNF-4 homodimers and by RAR-RXR heterodimers, as demonstrated by mobility shift assays and methylation interference analysis. Binding and transactivation studies with mutant NRRE-1 elements confirmed the existence of distinct retinoid, COUP-TF, and HNF-4 response elements that define novel receptor binding motifs: COUP-TF homodimers bound sites 1 and 3 (two hexamer repeat sequences arranged as an everted imperfect repeat separated by 14 bp or ER14), RAR-RXR heterodimers bound sites 1 and 2 (ER8), and HNF-4 homodimers bound sites 2 and 3 (imperfect DR0). Mixing cotransfection experiments demonstrated that the nuclear receptor dimers compete at NRRE-1 to modulate constitutive and ligand-mediated transcriptional activity. These data suggest a mechanism for the transcriptional modulation of genes encoding enzymes involved in cellular metabolism. Images PMID:8007945

  12. Predicting tissue specific transcription factor binding sites

    PubMed Central

    2013-01-01

    Background Studies of gene regulation often utilize genome-wide predictions of transcription factor (TF) binding sites. Most existing prediction methods are based on sequence information alone, ignoring biological contexts such as developmental stages and tissue types. Experimental methods to study in vivo binding, including ChIP-chip and ChIP-seq, can only study one transcription factor in a single cell type and under a specific condition in each experiment, and therefore cannot scale to determine the full set of regulatory interactions in mammalian transcriptional regulatory networks. Results We developed a new computational approach, PIPES, for predicting tissue-specific TF binding. PIPES integrates in vitro protein binding microarrays (PBMs), sequence conservation and tissue-specific epigenetic (DNase I hypersensitivity) information. We demonstrate that PIPES improves over existing methods on distinguishing between in vivo bound and unbound sequences using ChIP-seq data for 11 mouse TFs. In addition, our predictions are in good agreement with current knowledge of tissue-specific TF regulation. Conclusions We provide a systematic map of computationally predicted tissue-specific binding targets for 284 mouse TFs across 55 tissue/cell types. Such comprehensive resource is useful for researchers studying gene regulation. PMID:24238150

  13. Dynamics of Transcription Factor Binding Site Evolution

    PubMed Central

    Tuğrul, Murat; Paixão, Tiago; Barton, Nicholas H.; Tkačik, Gašper

    2015-01-01

    Evolution of gene regulation is crucial for our understanding of the phenotypic differences between species, populations and individuals. Sequence-specific binding of transcription factors to the regulatory regions on the DNA is a key regulatory mechanism that determines gene expression and hence heritable phenotypic variation. We use a biophysical model for directional selection on gene expression to estimate the rates of gain and loss of transcription factor binding sites (TFBS) in finite populations under both point and insertion/deletion mutations. Our results show that these rates are typically slow for a single TFBS in an isolated DNA region, unless the selection is extremely strong. These rates decrease drastically with increasing TFBS length or increasingly specific protein-DNA interactions, making the evolution of sites longer than ∼ 10 bp unlikely on typical eukaryotic speciation timescales. Similarly, evolution converges to the stationary distribution of binding sequences very slowly, making the equilibrium assumption questionable. The availability of longer regulatory sequences in which multiple binding sites can evolve simultaneously, the presence of “pre-sites” or partially decayed old sites in the initial sequence, and biophysical cooperativity between transcription factors, can all facilitate gain of TFBS and reconcile theoretical calculations with timescales inferred from comparative genomics. PMID:26545200

  14. A developmentally regulated Caulobacter flagellar promoter is activated by 3' enhancer and IHF binding elements.

    PubMed Central

    Gober, J W; Shapiro, L

    1992-01-01

    The transcription of a group of flagellar genes is temporally and spatially regulated during the Caulobacter crescentus cell cycle. These genes all share the same 5' cis-regulatory elements: a sigma 54 promoter, a binding site for integration host factor (IHF), and an enhancer sequence, known as the ftr element. We have partially purified the ftr-binding proteins, and we show that they require the same enhancer sequences for binding as are required for transcriptional activation. We have also partially purified the Caulobacter homolog of IHF and demonstrate that it can facilitate in vitro integrase-mediated lambda recombination. Using site-directed mutagenesis, we provide the first demonstration that natural enhancer sequences and IHF binding elements that reside 3' to the sigma 54 promoter of a bacterial gene, flaNQ, are required for transcription of the operon, in vivo. The IHF protein and the ftr-binding protein is primarily restricted to the predivisional cell, the cell type in which these promoters are transcribed. flaNQ promoter expression is localized to the swarmer pole of the predivisional cell, as are other flagellar promoters that possess these regulatory sequences 5' to the start site. The requirement for an IHF binding site and an ftr-enhancer element in spatially transcribed flagellar promoters indicates that a common mechanism may be responsible for both temporal and polar transcription. Images PMID:1392079

  15. Interactions Between β-Catenin and Transforming Growth Factor-β Signaling Pathways Mediate Epithelial-Mesenchymal Transition and Are Dependent on the Transcriptional Co-activator cAMP-response Element-binding Protein (CREB)-binding Protein (CBP)*

    PubMed Central

    Zhou, Beiyun; Liu, Yixin; Kahn, Michael; Ann, David K.; Han, Arum; Wang, Hongjun; Nguyen, Cu; Flodby, Per; Zhong, Qian; Krishnaveni, Manda S.; Liebler, Janice M.; Minoo, Parviz; Crandall, Edward D.; Borok, Zea

    2012-01-01

    Interactions between transforming growth factor-β (TGF-β) and Wnt are crucial to many biological processes, although specific targets, rationale for divergent outcomes (differentiation versus block of epithelial proliferation versus epithelial-mesenchymal transition (EMT)) and precise mechanisms in many cases remain unknown. We investigated β-catenin-dependent and transforming growth factor-β1 (TGF-β1) interactions in pulmonary alveolar epithelial cells (AEC) in the context of EMT and pulmonary fibrosis. We previously demonstrated that ICG-001, a small molecule specific inhibitor of the β-catenin/CBP (but not β-catenin/p300) interaction, ameliorates and reverses pulmonary fibrosis and inhibits TGF-β1-mediated α-smooth muscle actin (α-SMA) and collagen induction in AEC. We now demonstrate that TGF-β1 induces LEF/TCF TOPFLASH reporter activation and nuclear β-catenin accumulation, while LiCl augments TGF-β-induced α-SMA expression, further confirming co-operation between β-catenin- and TGF-β-dependent signaling pathways. Inhibition and knockdown of Smad3, knockdown of β-catenin and overexpression of ICAT abrogated effects of TGF-β1 on α-SMA transcription/expression, indicating a requirement for β-catenin in these Smad3-dependent effects. Following TGF-β treatment, co-immunoprecipitation demonstrated direct interaction between endogenous Smad3 and β-catenin, while chromatin immunoprecipitation (ChIP)-re-ChIP identified spatial and temporal regulation of α-SMA via complex formation among Smad3, β-catenin, and CBP. ICG-001 inhibited α-SMA expression/transcription in response to TGF-β as well as α-SMA promoter occupancy by β-catenin and CBP, demonstrating a previously unknown requisite TGF-β1/β-catenin/CBP-mediated pro-EMT signaling pathway. Clinical relevance was shown by β-catenin/Smad3 co-localization and CBP expression in AEC of IPF patients. These findings suggest a new therapeutic approach to pulmonary fibrosis by specifically

  16. Drosophila transcriptional repressor protein that binds specifically to negative control elements in fat body enhancers.

    PubMed Central

    Falb, D; Maniatis, T

    1992-01-01

    Expression of the Drosophila melanogaster Adh gene in adults requires a fat body-specific enhancer called the Adh adult enhancer (AAE). We have identified a protein in Drosophila nuclear extracts that binds specifically to a site within the AAE (adult enhancer factor 1 [AEF-1]). In addition, we have shown that AEF-1 binds specifically to two other Drosophila fat body enhancers. Base substitutions in the AEF-1 binding site that disrupt AEF-1 binding in vitro result in a significant increase in the level of Adh expression in vivo. Thus, the AEF-1 binding site is a negative regulatory element within the AAE. A cDNA encoding the AEF-1 protein was isolated and shown to act as a repressor of the AAE in cotransfection studies. The AEF-1 protein contains four zinc fingers and an alanine-rich sequence. The latter motif is found in other eukaryotic proteins known to be transcriptional repressors. Images PMID:1508206

  17. Alteration of C-MYB DNA binding to cognate responsive elements in HL-60 variant cells

    PubMed Central

    Gaillard, C; Le Rouzic, E; Créminon, C; Perbal, B

    2002-01-01

    Aims: To establish whether the MYB protein expressed in HL-60 variant cells, which are cells resistant to 12-O-tetradecanoylphorbol-13-acetate (TPA) induced differentiation, is able to bind MYB recognition elements (MREs) involved in the transcriptional regulation of myb target genes. In addition, to determine whether alterations in the binding of the MYB protein to MREs affects HL-60 cell proliferation and differentiation. Methods: Nuclear extracts of HL-60 variant cells exhibiting different degrees of resistance to TPA induced monocytic differentiation were used in electrophoretic mobility shift experiments (EMSAs), bandshift experiments performed with labelled oliogonucleotides containing the MYB consensus binding sequences. Results: The MYB protein contained in nuclear extracts from HL-60 variant cells did not bind efficiently to the MYB recognition elements identified in the mim-1 and PR264 promoters. Molecular cloning of the myb gene and analysis of the MYB protein expressed in the HL-60 variant cells established that the lack of binding did not result from a structural alteration of MYB in these cells. The lack of MRE binding did not abrogate the ability of variant HL-60s to proliferate and to undergo differentiation. Furthermore, the expression of the PR264/SC35 splicing factor was not affected as a result of the altered MYB DNA binding activity. Conclusions: Because the MYB protein expressed in HL-60 variant cells did not appear to be structurally different from the MYB protein expressed in parental HL-60 cells, it is possible that the HL-60 variant cells contain a MYB binding inhibitory factor (MBIF) that interferes with MYB binding on MREs. The increased proliferation rate of HL-60 variant cells and their reduced serum requirement argues against the need for direct MYB binding in the regulation of cell growth. PMID:12354938

  18. Neuron-restrictive Silencer Factor (NRSF) Represses Cocaine- and Amphetamine-regulated Transcript (CART) Transcription and Antagonizes cAMP-response Element-binding Protein Signaling through a Dual NRSE Mechanism*

    PubMed Central

    Zhang, Jing; Wang, Sihan; Yuan, Lin; Yang, Yinxiang; Zhang, Bowen; Liu, Qingbin; Chen, Lin; Yue, Wen; Li, Yanhua; Pei, Xuetao

    2012-01-01

    Cocaine- and amphetamine-regulated transcript (CART) peptide plays a pivotal role in neuroprotection against stroke-related brain injury. However, the regulatory mechanism on CART transcription, especially the repression mechanism, is not fully understood. Here, we show that the transcriptional repressor neuron-restrictive silencer elements (NRSF, also known as REST) represses CART expression through direct binding to two NRSF-binding elements (NRSEs) in the CART promoter and intron 1 (named pNRSE and iNRSE, respectively). EMSA show that NRSF binds to pNRSE and iNRSE directly in vitro. ChIP assays show that NRSF recruits differential co-repressor complexes including CoREST and HDAC1 to these NRSEs. The presence of both NRSEs is required for efficient repression of CART transcription as indicated by reporter gene assays. NRSF overexpression antagonizes forskolin-mediated up-regulation of CART mRNA and protein. Ischemia insult triggered by oxygen-glucose deprivation (OGD) enhances NRSF mRNA levels and then NRSF antagonizes the CREB signaling on CART activation, leading to augmented cell death. Depletion of NRSF in combination with forskolin treatment increases neuronal survival after ischemic insult. These findings reveal a novel dual NRSE mechanism by which NRSF represses CART expression and suggest that NRSF may serve as a therapeutic target for stroke treatment. PMID:23086924

  19. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.

    2015-01-01

    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  20. Genetics Home Reference: core binding factor acute myeloid leukemia

    MedlinePlus

    ... acute myeloid leukemia core binding factor acute myeloid leukemia Enable Javascript to view the expand/collapse boxes. ... Close All Description Core binding factor acute myeloid leukemia (CBF-AML) is one form of a cancer ...

  1. Hoxa5 gene regulation: A gradient of binding activity to a brachial spinal cord element.

    PubMed

    Nowling, T; Zhou, W; Krieger, K E; Larochelle, C; Nguyen-Huu, M C; Jeannotte, L; Tuggle, C K

    1999-04-01

    The Hox genes cooperate in providing positional information needed for spatial and temporal patterning of the vertebrate body axis. However, the biological mechanisms behind spatial Hox expression are largely unknown. In transgenic mice, gene fusions between Hoxa5 (previously called Hox-1.3) 5' flanking regions and the lacZ reporter gene show tissue- and time-specific expression in the brachial spinal cord in day 11-13 embryos. A 604-bp regulatory region with enhancer properties directs this spatially specific expression. Fine-detail mapping of the enhancer has identified several elements involved in region-specific expression, including an element required for expression in the brachial spinal cord. Factors in embryonic day 12.5 nuclear extracts bind this element in electrophoretic mobility shift assays (EMSA) and protect three regions from DNase digestion. All three sites contain an AAATAA sequence and mutations at these sites reduce or abolish binding. Furthermore, this element binds specific individual embryonic proteins on a protein blot. The binding activity appears as a gradient along the anterior-posterior axis with two- to threefold higher levels observed in extracts from anterior regions than from posterior regions. In parallel with the EMSA, the proteins on the protein blot also show reduced binding to probes with mutations at the AAATAA sites. Most importantly, transgenic mice carrying Hoxa5/lacZ fusions with the three AAATAA sites mutated either do not express the transgene or have altered transgene expression. The brachial spinal cord element and its binding proteins are likely to be involved in spatial expression of Hoxa5 during development. PMID:10075847

  2. Reliable prediction of transcription factor binding sites by phylogenetic verification.

    PubMed

    Li, Xiaoman; Zhong, Sheng; Wong, Wing H

    2005-11-22

    We present a statistical methodology that largely improves the accuracy in computational predictions of transcription factor (TF) binding sites in eukaryote genomes. This method models the cross-species conservation of binding sites without relying on accurate sequence alignment. It can be coupled with any motif-finding algorithm that searches for overrepresented sequence motifs in individual species and can increase the accuracy of the coupled motif-finding algorithm. Because this method is capable of accurately detecting TF binding sites, it also enhances our ability to predict the cis-regulatory modules. We applied this method on the published chromatin immunoprecipitation (ChIP)-chip data in Saccharomyces cerevisiae and found that its sensitivity and specificity are 9% and 14% higher than those of two recent methods. We also recovered almost all of the previously verified TF binding sites and made predictions on the cis-regulatory elements that govern the tight regulation of ribosomal protein genes in 13 eukaryote species (2 plants, 4 yeasts, 2 worms, 2 insects, and 3 mammals). These results give insights to the transcriptional regulation in eukaryotic organisms. PMID:16286651

  3. RNA-Binding Proteins: Splicing Factors and Disease

    PubMed Central

    Fredericks, Alger M.; Cygan, Kamil J.; Brown, Brian A.; Fairbrother, William G.

    2015-01-01

    Pre-mRNA splicing is mediated by interactions of the Core Spliceosome and an array of accessory RNA binding proteins with cis-sequence elements. Splicing is a major regulatory component in higher eukaryotes. Disruptions in splicing are a major contributor to human disease. One in three hereditary disease alleles are believed to cause aberrant splicing. Hereditary disease alleles can alter splicing by disrupting a splicing element, creating a toxic RNA, or affecting splicing factors. One of the challenges of medical genetics is identifying causal variants from the thousands of possibilities discovered in a clinical sequencing experiment. Here we review the basic biochemistry of splicing, the mechanisms of splicing mutations, the methods for identifying splicing mutants, and the potential of therapeutic interventions. PMID:25985083

  4. Streptococcus pneumoniae Genome-wide Identification and Characterization of BOX Element-binding Domains.

    PubMed

    Zhang, Qiao; Wang, Changzheng; Wan, Min; Wu, Yin; Ma, Qianli

    2015-11-01

    The BOX elements are short repetitive DNA sequences that distribute randomly in intergenic regions of the Streptococcus pneumoniae genome. The function and origin of such elements are still unknown, but they were found to modulate expression of neighboring genes. Evidences suggested that the modulation's mechanism can be fulfilled by sequence-specific interaction of BOX elements with transcription factor family proteins. However, the type and function of these BOX-binding proteins still remain largely unexplored to date. In the current study we described a synthetic protocol to investigate the recognition and interaction between a highly conserved site of BOX elements and the DNA-binding domains of a variety of putative transcription factors in the pneumococcal genome. With the protocol we were able to predict those high-affinity domain binders of the conserved BOX DNA site (BOX DNA) in a high-throughput manner, and analyzed sequence-specific interaction in the domainDNA recognition at molecular level. Consequently, a number of putative transcription factor domains with both high affinity and specificity for the BOX DNA were identified, from which the helix-turn-helix (HTH) motif of a small heat shock factor was selected as a case study and tested for its binding capability toward the double-stranded BOX DNA using fluorescence anisotropy analysis. As might be expected, a relatively high affinity was detected for the interaction of HTH motif with BOX DNA with dissociation constant at nanomolar level. Molecular dynamics simulation, atomic structure examination and binding energy analysis revealed a complicated network of intensive nonbonded interactions across the complex interface, which confers both stability and specificity for the complex architecture. PMID:27491035

  5. Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements.

    PubMed

    Telorac, Jonas; Prykhozhij, Sergey V; Schöne, Stefanie; Meierhofer, David; Sauer, Sascha; Thomas-Chollier, Morgane; Meijsing, Sebastiaan H

    2016-07-27

    Out of the myriad of potential DNA binding sites of the glucocorticoid receptor (GR) found in the human genome, only a cell-type specific minority is actually bound, indicating that the presence of a recognition sequence alone is insufficient to specify where GR binds. Cooperative interactions with other transcription factors (TFs) are known to contribute to binding specificity. Here, we reasoned that sequence signals preventing GR recruitment to certain loci provide an alternative means to confer specificity. Motif analyses uncovered candidate Negative Regulatory Sequences (NRSs) that interfere with genomic GR binding. Subsequent functional analyses demonstrated that NRSs indeed prevent GR binding to nearby response elements. We show that NRS activity is conserved across species, found in most tissues and that they also interfere with the genomic binding of other TFs. Interestingly, the effects of NRSs appear not to be a simple consequence of changes in chromatin accessibility. Instead, we find that NRSs interact with proteins found at sub-nuclear structures called paraspeckles and that these proteins might mediate the repressive effects of NRSs. Together, our studies suggest that the joint influence of positive and negative sequence signals partition the genome into regions where GR can bind and those where it cannot. PMID:27016732

  6. Mouse models for core binding factor leukemia.

    PubMed

    Chin, D W L; Watanabe-Okochi, N; Wang, C Q; Tergaonkar, V; Osato, M

    2015-10-01

    RUNX1 and CBFB are among the most frequently mutated genes in human leukemias. Genetic alterations such as chromosomal translocations, copy number variations and point mutations have been widely reported to result in the malfunction of RUNX transcription factors. Leukemias arising from such alterations in RUNX family genes are collectively termed core binding factor (CBF) leukemias. Although adult CBF leukemias generally are considered a favorable risk group as compared with other forms of acute myeloid leukemia, the 5-year survival rate remains low. An improved understanding of the molecular mechanism for CBF leukemia is imperative to uncover novel treatment options. Over the years, retroviral transduction-transplantation assays and transgenic, knockin and knockout mouse models alone or in combination with mutagenesis have been used to study the roles of RUNX alterations in leukemogenesis. Although successful in inducing leukemia, the existing assays and models possess many inherent limitations. A CBF leukemia model which induces leukemia with complete penetrance and short latency would be ideal as a platform for drug discovery. Here, we summarize the currently available mouse models which have been utilized to study CBF leukemias, discuss the advantages and limitations of individual experimental systems, and propose suggestions for improvements of mouse models. PMID:26165235

  7. Dual chain synthetic heparin-binding growth factor analogs

    DOEpatents

    Zamora, Paul O.; Pena, Louis A.; Lin, Xinhua

    2012-04-24

    The invention provides synthetic heparin-binding growth factor analogs having two peptide chains each branched from a branch moiety, such as trifunctional amino acid residues, the branch moieties separated by a first linker of from 3 to about 20 backbone atoms, which peptide chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a second linker, which may be a hydrophobic second linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  8. Dual chain synthetic heparin-binding growth factor analogs

    DOEpatents

    Zamora, Paul O.; Pena, Louis A.; Lin, Xinhua

    2009-10-06

    The invention provides synthetic heparin-binding growth factor analogs having two peptide chains each branched from a branch moiety, such as trifunctional amino acid residues, the branch moieties separated by a first linker of from 3 to about 20 backbone atoms, which peptide chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a second linker, which may be a hydrophobic second linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  9. cAMP Response Element-binding Protein (CREB) and Nuclear Factor κB Mediate the Tamoxifen-induced Up-regulation of Glutamate Transporter 1 (GLT-1) in Rat Astrocytes*

    PubMed Central

    Karki, Pratap; Webb, Anton; Smith, Keisha; Lee, Kyuwon; Son, Deok-Soo; Aschner, Michael; Lee, Eunsook

    2013-01-01

    Tamoxifen (TX), a selective estrogen receptor modulator, exerts antagonistic effects on breast tissue and is used to treat breast cancer. Recent evidence also suggests that it may act as an agonist in brain tissue. We reported previously that TX enhanced the expression and function of glutamate transporter 1 (GLT-1) in rat astrocytes, an effect that was mediated by TGF-α. To gain further insight into the mechanisms that mediate TX-induced up-regulation of GLT-1 (EAAT2 in humans), we investigated its effect on GLT-1 at the transcriptional level. TX phosphorylated the cAMP response element-binding protein (CREB) and recruited CREB to the GLT-1 promoter consensus site. The effect of TX on astrocytic GLT-1 was attenuated by the inhibition of PKA, the upstream activator of the CREB pathway. In addition, the effect of TX on GLT-1 promoter activity was abolished by the inhibition of the NF-κB pathway. Furthermore, TX recruited the NF-κB subunits p65 and p50 to the NF-κB binding domain of the GLT-1 promoter. Mutation of NF-κB (triple, −583/-282/-251) or CRE (-308) sites on the GLT-1 promoter led to significant repression of the promoter activity, but neither mutant completely abolished the TX-induced GLT-1 promoter activity. Mutation of both the NF-κB (-583/-282/-251) and CRE (-308) sites led to a complete abrogation of the effect of TX on GLT-1 promoter activity. Taken together, our findings establish that TX regulates GLT-1 via the CREB and NF-κB pathways. PMID:23955341

  10. Transcription of Epstein-Barr virus-encoded nuclear antigen 1 promoter Qp is repressed by transforming growth factor-beta via Smad4 binding element in human BL cells.

    PubMed

    Liang, C L; Tsai, C N; Chung, P J; Chen, J L; Sun, C M; Chen, R H; Hong, J H; Chang, Y S

    2000-11-10

    In Epstein-Barr virus (EBV)-infected BL cells, the oncogenic EBV-encoded nuclear antigen 1 (EBNA 1) gene is directed from the latent promoter Qp. Yeast one-hybrid screen analysis using the -50 to -37 sequence of Qp as the bait was carried out to identify transcriptional factors that may control Qp activity. Results showed that Smad4 binds the -50 to -37 sequence of Qp, indicating that this promoter is potentially regulated by TGF-beta. The association of Smad4 with Qp was further confirmed by supershift of EMSA complexes using Smad4-specific antibody. The transfection of a Qp reporter construct in two EBV(+) BL cell lines, Rael and WW2, showed that Qp activity is repressed in response to the TGF-beta treatment. This repression involves the interaction of a Smad3/Smad4 complex and the transcriptional repressor TGIF, as determined by cotransfection assay and coimmunoprecipitation analysis. Results suggest that TGF-beta may transcriptionally repress Qp through the Smad4-binding site in human BL cells. PMID:11062049

  11. Ab initio prediction of transcription factor binding sites.

    PubMed

    Liu, L Angela; Bader, Joel S

    2007-01-01

    Transcription factors are DNA-binding proteins that control gene transcription by binding specific short DNA sequences. Experiments that identify transcription factor binding sites are often laborious and expensive, and the binding sites of many transcription factors remain unknown. We present a computational scheme to predict the binding sites directly from transcription factor sequence using all-atom molecular simulations. This method is a computational counterpart to recent high-throughput experimental technologies that identify transcription factor binding sites (ChIP-chip and protein-dsDNA binding microarrays). The only requirement of our method is an accurate 3D structural model of a transcription factor-DNA complex. We apply free energy calculations by thermodynamic integration to compute the change in binding energy of the complex due to a single base pair mutation. By calculating the binding free energy differences for all possible single mutations, we construct a position weight matrix for the predicted binding sites that can be directly compared with experimental data. As water-bridged hydrogen bonds between the transcription factor and DNA often contribute to the binding specificity, we include explicit solvent in our simulations. We present successful predictions for the yeast MAT-alpha2 homeodomain and GCN4 bZIP proteins. Water-bridged hydrogen bonds are found to be more prevalent than direct protein-DNA hydrogen bonds at the binding interfaces, indicating why empirical potentials with implicit water may be less successful in predicting binding. Our methodology can be applied to a variety of DNA-binding proteins. PMID:17990512

  12. Expression of the carbohydrate response element binding protein gene and related genes involved in hepatic lipogenesis during post-hatch development of broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Carbohydrate response element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c) are important regulators of glucose metabolism and lipid synthesis in mammals. In response to glucose (ChREBP) and insulin (SREBP-1c), these two transcription factors regulate the expre...

  13. Unraveling determinants of transcription factor binding outside the core binding site.

    PubMed

    Levo, Michal; Zalckvar, Einat; Sharon, Eilon; Dantas Machado, Ana Carolina; Kalma, Yael; Lotam-Pompan, Maya; Weinberger, Adina; Yakhini, Zohar; Rohs, Remo; Segal, Eran

    2015-07-01

    Binding of transcription factors (TFs) to regulatory sequences is a pivotal step in the control of gene expression. Despite many advances in the characterization of sequence motifs recognized by TFs, our ability to quantitatively predict TF binding to different regulatory sequences is still limited. Here, we present a novel experimental assay termed BunDLE-seq that provides quantitative measurements of TF binding to thousands of fully designed sequences of 200 bp in length within a single experiment. Applying this binding assay to two yeast TFs, we demonstrate that sequences outside the core TF binding site profoundly affect TF binding. We show that TF-specific models based on the sequence or DNA shape of the regions flanking the core binding site are highly predictive of the measured differential TF binding. We further characterize the dependence of TF binding, accounting for measurements of single and co-occurring binding events, on the number and location of binding sites and on the TF concentration. Finally, by coupling our in vitro TF binding measurements, and another application of our method probing nucleosome formation, to in vivo expression measurements carried out with the same template sequences serving as promoters, we offer insights into mechanisms that may determine the different expression outcomes observed. Our assay thus paves the way to a more comprehensive understanding of TF binding to regulatory sequences and allows the characterization of TF binding determinants within and outside of core binding sites. PMID:25762553

  14. Sequential coagulation factor VIIa domain binding to tissue factor

    SciTech Connect

    Oesterlund, Maria; Persson, Egon; Freskgard, Per-Ola . E-mail: msv@ifm.liu.se

    2005-12-02

    Vessel wall tissue factor (TF) is exposed to blood upon vascular damage which enables association with factor VIIa (FVIIa). This leads to initiation of the blood coagulation cascade through localization and allosteric induction of FVIIa procoagulant activity. To examine the docking pathway of the FVIIa-TF complex, various residues in the extracellular part of TF (sTF) that are known to interact with FVIIa were replaced with cysteines labelled with a fluorescent probe. By using stopped-flow fluorescence kinetic measurements in combination with surface plasmon resonance analysis, we studied the association of the resulting sTF variants with FVIIa. We found the docking trajectory to be a sequence of events in which the protease domain of FVIIa initiates contact with sTF. Thereafter, the two proteins are tethered via the first epidermal growth factor-like and finally the {gamma}-carboxyglutamic acid (Gla) domain. The two labelled sTF residues interacting with the protease domain of FVIIa bind or become eventually ordered at different rates, revealing kinetic details pertinent to the allosteric activation of FVIIa by sTF. Moreover, when the Gla domain of FVIIa is removed the difference in the rate of association for the remaining domains is much more pronounced.

  15. Cotyledon nuclear proteins bind to DNA fragments harboring regulatory elements of phytohemagglutinin genes.

    PubMed Central

    Riggs, C D; Voelker, T A; Chrispeels, M J

    1989-01-01

    The effects of deleting DNA sequences upstream from the phytohemagglutinin-L gene of Phaseolus vulgaris have been examined with respect to the level of gene product produced in the seeds of transgenic tobacco. Our studies indicate that several upstream regions quantitatively modulate expression. Between -1000 and -675, a negative regulatory element reduces expression approximately threefold relative to shorter deletion mutants that do not contain this region. Positive regulatory elements lie between -550 and -125 and, compared with constructs containing only 125 base pairs of upstream sequences (-125), the presence of these two regions can be correlated with a 25-fold and a 200-fold enhancement of phytohemagglutinin-L levels. These experiments were complemented by gel retardation assays, which demonstrated that two of the three regions bind cotyledon nuclear proteins from mid-mature seeds. One of the binding sites maps near a DNA sequence that is highly homologous to protein binding domains located upstream from the soybean seed lectin and Kunitz trypsin inhibitor genes. Competition experiments demonstrated that the upstream regions of a bean beta-phaseolin gene, the soybean seed lectin gene, and an oligonucleotide from the upstream region of the trypsin inhibitor gene can compete differentially for factor binding. We suggest that these legume genes may be regulated in part by evolutionarily conserved protein/DNA interactions. PMID:2535513

  16. Binding of heparin to human platelet factor 4.

    PubMed Central

    Cowan, S W; Bakshi, E N; Machin, K J; Isaacs, N W

    1986-01-01

    Platelet factor 4 is a small protein (Mr 7756) from the alpha-granules of blood platelets which binds strongly to and neutralizes the anticoagulant properties of heparin. From an analysis of X-ray crystallographic data a model for the binding of platelet factor 4 to heparin is proposed. PMID:3718482

  17. Identification of the endothelial cell binding site for factor IX.

    PubMed Central

    Cheung, W F; van den Born, J; Kühn, K; Kjellén, L; Hudson, B G; Stafford, D W

    1996-01-01

    We previously demonstrated that the primary region of factor IX and IXa responsible for saturable specific binding to bovine aortic endothelial cells resides in residues 3-11 at the amino terminus of factor IX. We also demonstrated that mutations of lysine to alanine at residue 5, factor IX K5A, or valine to lysine at residue 10, factor IX V10K, resulted in a molecule unable to bind to endothelial cells. Moreover, a mutation with lysine to arginine at residue 5, factor IX K5R, resulted in a factor IX molecule with increased affinity for the endothelial cell binding site. In this paper we report that collagen IV is a strong candidate for the factor IX binding site on endothelial cells. Factor IX and factor IX K5R compete with 125I-labeled factor IX for binding to tetrameric collagen IV immobilized on microtiter plates, while factor X, factor VII, and factor IX K5A or V10K fail to compete. The Kd for wild-type factor IX binding to collagen IV in the presence of heparin was 6.8 +/- 2 nM, and the Kd for factor IX K5R was 1.1 +/- 0.2 nM, which agrees well with our previously published Kd values of 7.4 and 2.4 nM for binding of the same proteins to endothelial cells. Our working assumption is that we have identified the endothelial cell binding site and that it is collagen IV. Its physiological relevance remains to be determined. PMID:8855310

  18. Far upstream element binding protein 1: a commander of transcription, translation and beyond

    PubMed Central

    Zhang, J; Chen, QM

    2016-01-01

    The far upstream binding protein 1 (FBP1) was first identified as a DNA-binding protein that regulates c-Myc gene transcription through binding to the far upstream element (FUSE) in the promoter region 1.5 kb upstream of the transcription start site. FBP1 collaborates with TFIIH and additional transcription factors for optimal transcription of the c-Myc gene. In recent years, mounting evidence suggests that FBP1 acts as an RNA-binding protein and regulates mRNA translation or stability of genes, such as GAP43, p27Kip and nucleophosmin. During retroviral infection, FBP1 binds to and mediates replication of RNA from Hepatitis C and Enterovirus 71. As a nuclear protein, FBP1 may translocate to the cytoplasm in apoptotic cells. The interaction of FBP1 with p38/JTV-1 results in FBP1 ubiquitination and degradation by the proteasomes. Transcriptional and post-transcriptional regulations by FBP1 contribute to cell proliferation, migration or cell death. FBP1 association with carcinogenesis has been reported in c-Myc dependent or independent manner. This review summarizes biochemical features of FBP1, its mechanism of action, FBP family members and the involvement of FBP1 in carcinogenesis. PMID:22926519

  19. Genomewide analysis of Drosophila GAGA factor target genes reveals context-dependent DNA binding

    PubMed Central

    van Steensel, Bas; Delrow, Jeffrey; Bussemaker, Harmen J.

    2003-01-01

    The association of sequence-specific DNA-binding factors with their cognate target sequences in vivo depends on the local molecular context, yet this context is poorly understood. To address this issue, we have performed genomewide mapping of in vivo target genes of Drosophila GAGA factor (GAF). The resulting list of ≈250 target genes indicates that GAF regulates many cellular pathways. We applied unbiased motif-based regression analysis to identify the sequence context that determines GAF binding. Our results confirm that GAF selectively associates with (GA)n repeat elements in vivo. GAF binding occurs in upstream regulatory regions, but less in downstream regions. Surprisingly, GAF binds abundantly to introns but is virtually absent from exons, even though the density of (GA)n is roughly the same. Intron binding occurs equally frequently in last introns compared with first introns, suggesting that GAF may not only regulate transcription initiation, but possibly also elongation. We provide evidence for cooperative binding of GAF to closely spaced (GA)n elements and explain the lack of GAF binding to exons by the absence of such closely spaced GA repeats. Our approach for revealing determinants of context-dependent DNA binding will be applicable to many other transcription factors. PMID:12601174

  20. Liver cells contain constitutive DNase I-hypersensitive sites at the xenobiotic response elements 1 and 2 (XRE1 and -2) of the rat cytochrome P-450IA1 gene and a constitutive, nuclear XRE-binding factor that is distinct from the dioxin receptor.

    PubMed Central

    Hapgood, J; Cuthill, S; Söderkvist, P; Wilhelmsson, A; Pongratz, I; Tukey, R H; Johnson, E F; Gustafsson, J A; Poellinger, L

    1991-01-01

    Dioxin stimulates transcription from the cytochrome P-450IA1 promoter by interaction with the intracellular dioxin receptor. Upon binding of ligand, the receptor is converted to a form which specifically interacts in vitro with two dioxin-responsive positive control elements located in close proximity to each other about 1 kb upstream of the rat cytochrome P-450IA1 gene transcription start point. In rat liver, the cytochrome P-450IA1 gene is marked at the chromatin level by two DNase I-hypersensitive sites that map to the location of the response elements and exist prior to induction of transcription by the dioxin receptor ligand beta-naphthoflavone. In addition, a DNase I-hypersensitive site is detected near the transcription initiation site and is altered in nuclease sensitivity by induction. The presence of the constitutive DNase I-hypersensitive sites at the dioxin response elements correlates with the presence of a constitutive, labile factor which specifically recognizes these elements in vitro. This factor appears to be distinct from the dioxin receptor, which is observed only in nuclear extract from treated cells. In conclusion, these data suggest that a certain protein-DNA architecture may be maintained at the response elements at different stages of gene expression. Images PMID:1652054

  1. Selective Activation of Transcription by a Novel CCAAT Binding Factor

    NASA Astrophysics Data System (ADS)

    Maity, Sankar N.; Golumbek, Paul T.; Karsenty, Gerard; de Crombrugghe, Benoit

    1988-07-01

    A novel CCAAT binding factor (CBF) composed of two different subunits has been extensively purified from rat liver. Both subunits are needed for specific binding to DNA. Addition of this purified protein to nuclear extracts of NIH 3T3 fibroblasts stimulates transcription from several promoters including the α 2(I) collagen, the α 1(I) collagen, the Rous sarcoma virus long terminal repeat (RSV-LTR), and the adenovirus major late promoter. Point mutations in the CCAAT motif that show either no binding or a decreased binding of CBF likewise abolish or reduce activation of transcription by CBF. Activation of transcription requires, therefore, the specific binding of CBF to its recognition sites.

  2. Identification and characterization of an estrogen-responsive element binding protein repressed by estradiol.

    PubMed

    Gray, W G; Gorski, J

    1996-09-10

    Cytosolic proteins from uteri of 19-day-old rats were analyzed by an electrophoresis mobility shift assay (EMSA) using a 31 base pair DNA probe containing an estrogen-responsive element (ERE) from the vitellogenin A2 gene. EMSA identified three distinct cytosolic protein-DNA complexes that are separable by Q-Sepharose anion exchange chromatography into an estrogen receptor (ER)-containing fraction (150 mM NaCl eluate) and a non-ER-containing fraction (250 mM NaCl eluate). We thus refer to the non-ER fraction as the ERE binding protein (ERE-BP). The ERE-BP-containing fraction was repressed to 40-50% of its normal levels following a single injection of estradiol. In addition, ERE-BP levels were repressed to the same extent (greater than 50%) by day 20 of the rat's gestational period. Examination of the expression pattern of ERE-BP shows that this activity is differentially expressed in both estrogen-responsive and nonresponsive tissues, with the highest levels of expression occurring in the pituitary. We next examined the specificity of ERE-BP binding by competition analysis using DNA sequences corresponding to binding sites of several known transcription factors. ERE-BP was found to be specific for both the ER binding site (ERE) and TATA binding protein binding sites. Furthermore, saturation analysis demonstrated that ERE-BP binds to the ERE and TATA binding protein sequences with an apparent Kd of 1.2 and 0.12 nM, respectively. Partial purification of ERE-BP using three chromatography steps (Q-Sepharose, hydroxyapatite, and Sephacryl S300) followed by sodium dodecyl sulfate analysis indicated the presence of three major protein bands (p102, p81, and p48) as judged by Coomassie staining. UV cross-linking of the ERE-BP/DNA complex followed by sodium dodecyl sulfate analysis-polyacrylamide gel electrophoresis analysis indicates that the 48 kDa band seen in the final, partially purified fraction correlates with the ERE-BP activity. Thus, this study has identified a

  3. Programmed factor binding to simian virus 40 GC-box replication and transcription control sequences.

    PubMed Central

    Buchanan, R L; Gralla, J D

    1990-01-01

    Nuclear footprinting revealed a temporal program involving factor binding to the repetitive GC-box DNA elements present in the simian virus 40 regulatory region. This program specified ordered and directional binding to these tandem regulatory sequences in vivo during the late phase of infection. The program was interrupted by the DNA replication inhibitor aphidicolin or by inactivation of the viral replication factor simian virus 40 T antigen, suggesting a link between viral DNA replication and new factor binding. Measurements of DNA accumulation in viruses lacking either the distal or proximal halves of the GC-box region suggested that the region has a dual role in replication control. Overall, the data point to important relationships between DNA replication and factor binding to the GC-box DNA, a multifunctional regulatory region. Images PMID:2152821

  4. Transcription factors binding to the mouse HTF9 housekeeping promoter differ between cell types.

    PubMed Central

    Somma, M P; Gambino, I; Lavia, P

    1991-01-01

    The mouse CpG island HTF9 harbours a bidirectional promoter shared by two housekeeping genes that are arranged head-to-head. We have previously identified several protein binding-elements across the CpG island, yet a short region around the initiation region was found to be capable of bidirectional transcription in transient expression assays, suggesting that the multiple elements of the HTF9 promoter are functionally redundant. We have now compared the binding activities in nuclear extracts from different cell types. Two protein-binding elements of HTF9 interact with widely distributed factors. A potentially strong Sp1 binding site was also identified, however Sp1 appeared to bind efficiently to its target sequence with extracts prepared from proliferating cultured cells, but not from adult organs. On the other hand, the CCAAT box upstream of one gene (HTF9-A) interacted with a liver-enriched factor, whereas no binding was detected with cultured fibroblasts extracts. Consistently, deletion of the CCAAT box affected transient expression from the HTF9-A promoter in hepatocyte, but not in fibroblast, cultures. Our results suggest that ubiquitous expression of housekeeping promoters results from the activation of alternative elements in different cell types. Images PMID:1886769

  5. Functional specificity of two hormone response elements present on the human apoA-II promoter that bind retinoid X receptor alpha/thyroid receptor beta heterodimers for retinoids and thyroids: synergistic interactions between thyroid receptor beta and upstream stimulatory factor 2a.

    PubMed Central

    Hatzivassiliou, Eudoxia; Koukos, George; Ribeiro, Agnes; Zannis, Vassilis; Kardassis, Dimitris

    2003-01-01

    DNA binding and mutagenesis in vitro established that the -67/-55 region of the apoA-II (apolipoprotein A-II) promoter contains a thyroid HRE (hormone response element), which strongly binds RXRalpha (retinoid X receptor alpha)/T(3)Rbeta (thyroid receptor beta) heterodimers and weakly T(3)Rbeta homodimers, but does not bind other homo- or heterodimers of RXRalpha or orphan nuclear receptors. Transactivation was abolished by point mutations in the thyroid HRE. In co-transfection experiments of HEK-293 (human embryonic kidney 293) cells, the -911/+29 human apoA-II promoter was transactivated strongly by RXRalpha/T(3)Rbeta heterodimers in the presence of RA (9- cis retinoic acid) or T(3) (tri-iodothyronine). Homopolymeric promoters containing either three copies of the -73/-40 (element AIIAB) or four copies of the -738/-712 (element AIIJ) apoA-II promoter could be transactivated by RXRalpha/T(3)Rbeta heterodimers in COS-7 cells only in the presence of T(3) or RA respectively. RXRalpha/T(3)Rbeta heterodimers and USF2a (upstream stimulatory factor 2a) synergistically transactivated the -911/+29 apoA-II promoter in the presence of T(3). USF2a also enhanced the activity of a GAL4-T(3)Rbeta fusion protein in the presence of T(3) and suppressed the activity of a GAL4-RXRalpha fusion protein in the presence of RA. These findings suggest a functional specificity of the two HREs of the apoA-II promoter for retinoids and thyroids, which is modulated by synergistic or antagonistic interactions between RXRalpha/T(3)Rbeta heterodimers and the ubiquitous transcription factor USF2a. PMID:12959642

  6. Element-by-element factorization algorithms for heat conduction

    NASA Technical Reports Server (NTRS)

    Hughes, T. J. R.; Winget, J. M.; Park, K. C.

    1983-01-01

    Element-by-element solution strategies are developed for transient heat conduction problems. Results of numerical tests indicate the effectiveness of the procedures proposed. The small database requirements and attractive architectural features of the algorithms suggest considerable potential for solving large scale problems.

  7. In Vivo Binding and Hierarchy of Assembly of the Yeast RNA Polymerase I Transcription Factors

    PubMed Central

    Bordi, Licia; Cioci, Francesco; Camilloni, Giorgio

    2001-01-01

    Transcription by RNA polymerase I in Saccharomyces cerevisiae requires a series of transcription factors that have been genetically and biochemically identified. In particular, the core factor (CF) and the upstream activation factor (UAF) have been shown in vitro to bind the core element and the upstream promoter element, respectively. We have analyzed in vivo the DNAse I footprinting of the 35S promoter in wild-type and mutant strains lacking one specific transcription factor at the time. In this way we were able to unambiguously attribute the protections by the CF and the UAF to their respective putative binding sites. In addition, we have found that in vivo a binding hierarchy exists, the UAF being necessary for CF binding. Because the CF footprinting is lost in mutants lacking a functional RNA polymerase I, we also conclude that the final step of preinitiation-complex assembly affects binding of the CF, stabilizing its contact with DNA. Thus, in vivo, the CF is recruited to the core element by the UAF and stabilized on DNA by the presence of a functional RNA polymerase I. PMID:11251085

  8. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element

    SciTech Connect

    Mao, Grace; Brody, James P.

    2007-11-09

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16 bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16 bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014 s{sup -1}. We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase.

  9. Novel Drosophila receptor that binds multiple growth factors

    SciTech Connect

    Rosner, M.R.; Thompson, K.L.; Garcia, V.; Decker, S.J.

    1986-05-01

    The authors have recently reported the identification of a novel growth factor receptor from Drosophila cell cultures that has dual binding specificity for both insulin and epidermal growth factor (EGF). This 100 kDa protein is also antigenically related to the cytoplasmic region of the mammalian EGF receptor-tyrosine kinase. They now report that this protein binds to mammalian nerve growth factor and human transforming growth factor alpha as well as insulin and EGF with apparent dissociation constants ranging from 10/sup -6/ to 10/sup -8/ M. The 100 kDa protein can be affinity-labeled with these /sup 125/I-labeled growth factors after immunoprecipitation with anti-EGF receptor antiserum. These four growth factors appear to share a common binding site, as evidenced by their ability to block affinity labelling by /sup 125/I-insulin. No significant binding to the 100 kDa protein was observed with platelet-derived growth factor, transforming growth factor beta, or glucagon. The 100 kDa Drosophila protein has a unique ligand-binding spectrum with no direct counterpart in mammalian cells and may represent an evolutionary precursor of the mammalian receptors for these growth factors.

  10. DNA binding and transcription activation by chicken interferon regulatory factor-3 (chIRF-3)

    PubMed Central

    Grant, Caroline E.; May, Donna L.; Deeley, Roger G.

    2000-01-01

    Interferon regulatory factors (IRFs) are a family of transcription factors involved in the cellular response to interferons and viral infection. Previously we isolated an IRF from a chicken embryonic liver cDNA library. Using a PCR-based binding site selection assay, we have characterised the binding specificity of chIRF-3. The optimal binding site (OBS) fits within the consensus interferon-stimulated response element (ISRE) but the specificity of chIRF-3 binding allows less variation in nucleotides outside the core IRF-binding sequence. A comparison of IRF-1 and chIRF-3 binding to ISREs in electrophoretic mobility shift assays confirmed that the binding specificity of chIRF-3 was clearly distinguishable from IRF-1. The selection assay also showed that chIRF-3 is capable of binding an inverted repeat of two half OBSs separated by 10–13 nt. ChIRF-3 appears to bind both the OBS and inverted repeat sites as a dimer with the protein–protein interaction requiring a domain between amino acids 117 and 311. In transfection experiments expression of chIRF-3 strongly activated a promoter containing the OBS. The activation domain was mapped to between amino acids 138 and 221 and a domain inhibitory to activation was also mapped to the C-terminal portion of chIRF-3. PMID:11095692

  11. An information transmission model for transcription factor binding at regulatory DNA sites

    PubMed Central

    2012-01-01

    Background Computational identification of transcription factor binding sites (TFBSs) is a rapid, cost-efficient way to locate unknown regulatory elements. With increased potential for high-throughput genome sequencing, the availability of accurate computational methods for TFBS prediction has never been as important as it currently is. To date, identifying TFBSs with high sensitivity and specificity is still an open challenge, necessitating the development of novel models for predicting transcription factor-binding regulatory DNA elements. Results Based on the information theory, we propose a model for transcription factor binding of regulatory DNA sites. Our model incorporates position interdependencies in effective ways. The model computes the information transferred (TI) between the transcription factor and the TFBS during the binding process and uses TI as the criterion to determine whether the sequence motif is a possible TFBS. Based on this model, we developed a computational method to identify TFBSs. By theoretically proving and testing our model using both real and artificial data, we found that our model provides highly accurate predictive results. Conclusions In this study, we present a novel model for transcription factor binding regulatory DNA sites. The model can provide an increased ability to detect TFBSs. PMID:22672438

  12. Domains of ERRgamma that mediate homodimerization and interaction with factors stimulating DNA binding.

    PubMed

    Hentschke, Moritz; Süsens, Ute; Borgmeyer, Uwe

    2002-08-01

    The estrogen receptor-related receptor gamma (ERRgamma/ERR3/NR3B3) is an orphan member of the nuclear receptor superfamily closely related to the estrogen receptors. To explore the DNA binding characteristics, the protein-DNA interaction was studied in electrophoretic mobility shift assays (EMSAs). In vitro translated ERRgamma binds as a homodimer to direct repeats (DR) without spacing of the nuclear receptor half-site 5'-AGGTCA-3' (DR-0), to extended half-sites, and to the inverted estrogen response element. Using ERRgamma deletion constructs, binding was found to be dependent on the presence of sequences in the ligand binding domain (LBD). A far-Western analysis revealed that ERRgamma forms dimers even in the absence of DNA. Two elements, located in the hinge region and in the LBD, respectively, are necessary for DNA-independent dimerization. DNA binding of bacterial expressed ERRgamma requires additional factors present in the serum and in cellular extracts. Fusion proteins of the germ cell nuclear factor (GCNF/NR6A1) with ERRgamma showed that the characteristic feature to be stimulated by additional factors can be transferred to a heterologous protein. The stimulating activity was further characterized and its target sequence narrowed down to a small element in the hinge region. PMID:12180985

  13. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  14. DNase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-responsive elements.

    PubMed Central

    Foufelle, F; Lepetit, N; Bosc, D; Delzenne, N; Morin, J; Raymondjean, M; Ferré, P

    1995-01-01

    We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. DNase I footprinting experiments using a + 161 nt to + 405 nt fragment of the FAS gene demonstrate that a region from + 290 nt to + 316 nt is protected by nuclear extracts from liver and spleen. This region binds two ubiquitous nuclear factors, USF/MLTF and the CAAT-binding transcription factor/nuclear factor 1 (CTF/NF1). Binding of these factors is similar in nuclear extracts from liver which does or does not express the FAS gene as observed for glucose-responsive elements in the L-pyruvate kinase and S14 genes. This suggests a posttranslational modification of a factor of the complex after glucose stimulation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7772036

  15. Conservation of transcription factor binding specificities across 600 million years of bilateria evolution.

    PubMed

    Nitta, Kazuhiro R; Jolma, Arttu; Yin, Yimeng; Morgunova, Ekaterina; Kivioja, Teemu; Akhtar, Junaid; Hens, Korneel; Toivonen, Jarkko; Deplancke, Bart; Furlong, Eileen E M; Taipale, Jussi

    2015-01-01

    Divergent morphology of species has largely been ascribed to genetic differences in the tissue-specific expression of proteins, which could be achieved by divergence in cis-regulatory elements or by altering the binding specificity of transcription factors (TFs). The relative importance of the latter has been difficult to assess, as previous systematic analyses of TF binding specificity have been performed using different methods in different species. To address this, we determined the binding specificities of 242 Drosophila TFs, and compared them to human and mouse data. This analysis revealed that TF binding specificities are highly conserved between Drosophila and mammals, and that for orthologous TFs, the similarity extends even to the level of very subtle dinucleotide binding preferences. The few human TFs with divergent specificities function in cell types not found in fruit flies, suggesting that evolution of TF specificities contributes to emergence of novel types of differentiated cells. PMID:25779349

  16. Binding of the Ah receptor to receptor binding factors in chromatin.

    PubMed

    Dunn, R T; Ruh, T S; Ruh, M F

    1993-03-01

    Dioxin induces biological responses through interaction with a specific intracellular receptor, the Ah receptor, and the subsequent interaction of the Ah receptor with chromatin. We report the binding of the Ah receptor, partially purified from rabbit liver, to receptor binding factors in chromatin. Rabbit liver chromatin proteins (CP) were isolated by adsorption of chromatin to hydroxylapatite followed by sequential extraction with 1-8 M GdnHCl. To assay for receptor binding a portion of each CP fraction was reconstituted to rabbit double-stranded DNA using a reverse gradient dialysis of 7.5 to 0 M GdnHCl. These reconstituted nucleoacidic proteins were then examined for binding to [3H]-2,3,7,8-tetrachlorodibenzo-p-dioxin ([3H]TCDD)-receptor complexes by the streptomycin filter assay. Prior to the binding assay, [3H]TCDD-receptor complexes were partially purified by step elution from DEAE-cellulose columns. CP fractions 2, 5, and 7 were found to bind to the Ah receptor with high affinity. Scatchard analysis yielded Kd values in the nanomolar range. Competition with 2-fold excess unlabeled TCDD-receptor complexes was demonstrated, and binding was reduced markedly when the receptor was prepared in the presence of 10 mM molybdate. Such chromatin receptor binding factors (RBFs) may participate in the interaction of receptor with specific DNA sequences resulting in modulation of specific gene expression. PMID:8384852

  17. Isolation and characterization of a C-repeat binding transcription factor from maize.

    PubMed

    Wang, Lei; Luo, Yanzhong; Zhang, Lan; Zhao, Jun; Hu, Zhiqiu; Fan, Yunliu; Zhang, Chunyi

    2008-08-01

    C-repeat binding proteins (CBFs) are a group of transcription factors that have been proven to be important for stress tolerance in plants. Many of these transcription factors transactivate the promoters of cold-regulated genes via binding to low temperature- or dehydration-responsive cis-elements, thus conferring plants cold acclimation. In the present study, we isolated a C-repeat binding transcription factor from maize using the yeast one-hybrid system with the C-repeat motif from the promoter of the Arabidopsis COR15a gene as bait. The isolated transcription factor is highly similar to the Arabidopsis CBF3 in their predicted amino acid sequences, and is therefore designated ZmCBF3. Point mutation analyses of the ZmCBF3-binding cis-element revealed (A/G)(C/T)CGAC as the core binding sequence. Expression analyses showed that ZmCBF3 was upregulated by both abscisic acid and low temperature, and was actively expressed during embryogenesis, suggesting that ZmCBF3 plays a role in stress response in maize. PMID:18713346

  18. Identification of the REST regulon reveals extensive transposable element-mediated binding site duplication

    PubMed Central

    Johnson, Rory; Gamblin, Richard J.; Ooi, Lezanne; Bruce, Alexander W.; Donaldson, Ian J.; Westhead, David R.; Wood, Ian C.; Jackson, Richard M.; Buckley, Noel J.

    2006-01-01

    The genome-wide mapping of gene-regulatory motifs remains a major goal that will facilitate the modelling of gene-regulatory networks and their evolution. The repressor element 1 is a long, conserved transcription factor-binding site which recruits the transcriptional repressor REST to numerous neuron-specific target genes. REST plays important roles in multiple biological processes and disease states. To map RE1 sites and target genes, we created a position specific scoring matrix representing the RE1 and used it to search the human and mouse genomes. We identified 1301 and 997 RE1s inhuman and mouse genomes, respectively, of which >40% are novel. By employing an ontological analysis we show that REST target genes are significantly enriched in a number of functional classes. Taking the novel REST target gene CACNA1A as an experimental model, we show that it can be regulated by multiple RE1s of different binding affinities, which are only partially conserved between human and mouse. A novel BLAST methodology indicated that many RE1s belong to closely related families. Most of these sequences are associated with transposable elements, leading us to propose that transposon-mediated duplication and insertion of RE1s has led to the acquisition of novel target genes by REST during evolution. PMID:16899447

  19. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements

    PubMed Central

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; d'Alché-Buc, Florence; Benoit, Gérard

    2015-01-01

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated with RAR/RXR genomic redistribution during the differentiation process. In-depth analysis of RAR/RXR binding sites occupancy dynamics and composition show that in undifferentiated cells, RAR/RXR interact with genomic regions characterized by binding of pluripotency-associated factors and high prevalence of the non-canonical DR0-containing RA response element. By contrast, in differentiated cells, RAR/RXR bound regions are enriched in functional Sox17 binding sites and are characterized with a higher frequency of the canonical DR5 motif. Our data offer an unprecedentedly detailed view on the action of RA in triggering pluripotent cell differentiation and demonstrate that RAR/RXR action is mediated via two different sets of regulatory regions tightly associated with cell differentiation status. PMID:25897113

  20. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements.

    PubMed

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; d'Alché-Buc, Florence; Benoit, Gérard

    2015-05-26

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated with RAR/RXR genomic redistribution during the differentiation process. In-depth analysis of RAR/RXR binding sites occupancy dynamics and composition show that in undifferentiated cells, RAR/RXR interact with genomic regions characterized by binding of pluripotency-associated factors and high prevalence of the non-canonical DR0-containing RA response element. By contrast, in differentiated cells, RAR/RXR bound regions are enriched in functional Sox17 binding sites and are characterized with a higher frequency of the canonical DR5 motif. Our data offer an unprecedentedly detailed view on the action of RA in triggering pluripotent cell differentiation and demonstrate that RAR/RXR action is mediated via two different sets of regulatory regions tightly associated with cell differentiation status. PMID:25897113

  1. RNA binding specificity of Ebola virus transcription factor VP30.

    PubMed

    Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K

    2016-09-01

    The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences. PMID:27315567

  2. Binding Site Graphs: A New Graph Theoretical Framework for Prediction of Transcription Factor Binding Sites

    PubMed Central

    Reddy, Timothy E; DeLisi, Charles; Shakhnovich, Boris E

    2007-01-01

    Computational prediction of nucleotide binding specificity for transcription factors remains a fundamental and largely unsolved problem. Determination of binding positions is a prerequisite for research in gene regulation, a major mechanism controlling phenotypic diversity. Furthermore, an accurate determination of binding specificities from high-throughput data sources is necessary to realize the full potential of systems biology. Unfortunately, recently performed independent evaluation showed that more than half the predictions from most widely used algorithms are false. We introduce a graph-theoretical framework to describe local sequence similarity as the pair-wise distances between nucleotides in promoter sequences, and hypothesize that densely connected subgraphs are indicative of transcription factor binding sites. Using a well-established sampling algorithm coupled with simple clustering and scoring schemes, we identify sets of closely related nucleotides and test those for known TF binding activity. Using an independent benchmark, we find our algorithm predicts yeast binding motifs considerably better than currently available techniques and without manual curation. Importantly, we reduce the number of false positive predictions in yeast to less than 30%. We also develop a framework to evaluate the statistical significance of our motif predictions. We show that our approach is robust to the choice of input promoters, and thus can be used in the context of predicting binding positions from noisy experimental data. We apply our method to identify binding sites using data from genome scale ChIP–chip experiments. Results from these experiments are publicly available at http://cagt10.bu.edu/BSG. The graphical framework developed here may be useful when combining predictions from numerous computational and experimental measures. Finally, we discuss how our algorithm can be used to improve the sensitivity of computational predictions of transcription factor

  3. T-cell factor (TCF/LEF1) binding elements (TBEs) of FasL (Fas ligand or CD95 ligand) bind and cluster Fas (CD95) and form complexes with the TCF-4 and b-catenin transcription factors in vitro and in vivo which result in triggering cell death and/or cell activation.

    PubMed

    Liu, Xia; Huang, Yuwei; Zhang, Yuanyuan; Li, Xiaohong; Liu, Chun; Huang, Shen; Xu, Dezhi; Wu, Yang; Liu, Xiaojuan

    2016-08-01

    T-cell factor 4 (TCF4) is an important transcription factor of the Wnt signaling system. β-catenin, an upstream protein of TCF4, accumulates in the cytoplasm, then translocates to the nucleus to activate the β-catenin/T-cell factor/lymphoid enhancer factor (TCF/LEF) transcriptional machinery and regulates target genes. Previous studies showed that TCF4 was involved in cell proliferation and apoptosis. However, its expression and function in central nervous system injury are unclear. We performed a traumatic brain injury (TBI) model in adult rats. The expression of TCF4 in the brain cortex detected by Western blot increased after TBI. Double immunofluorescence staining revealed that TCF4 was expressed by neurons and microglia. In addition, co-localization of TCF4 with active caspase-3 or proliferating cell nuclear antigen was observed in neurons and microglia, respectively, suggesting that TCF4 might participate in neuronal apoptosis and microglial proliferation after TBI. To further investigate the functions of TCF4, PC12 and HAPI cells were employed to establish a neuronal apoptosis and microglial proliferation model in vitro, respectively. Knocking down TCF4 with siRNA proved the pro-apoptotic and pro-proliferation effect of TCF4 in PC12 and HAPI cells, respectively. Taken together, TCF4 might promote neuronal apoptosis and microglial proliferation after TBI. PMID:27090258

  4. Identifying differential transcription factor binding in ChIP-seq

    PubMed Central

    Wu, Dai-Ying; Bittencourt, Danielle; Stallcup, Michael R.; Siegmund, Kimberly D.

    2015-01-01

    ChIP seq is a widely used assay to measure genome-wide protein binding. The decrease in costs associated with sequencing has led to a rise in the number of studies that investigate protein binding across treatment conditions or cell lines. In addition to the identification of binding sites, new studies evaluate the variation in protein binding between conditions. A number of approaches to study differential transcription factor binding have recently been developed. Several of these methods build upon established methods from RNA-seq to quantify differences in read counts. We compare how these new approaches perform on different data sets from the ENCODE project to illustrate the impact of data processing pipelines under different study designs. The performance of normalization methods for differential ChIP-seq depends strongly on the variation in total amount of protein bound between conditions, with total read count outperforming effective library size, or variants thereof, when a large variation in binding was studied. Use of input subtraction to correct for non-specific binding showed a relatively modest impact on the number of differential peaks found and the fold change accuracy to biological validation, however a larger impact might be expected for samples with more extreme copy number variations between them. Still, it did identify a small subset of novel differential regions while excluding some differential peaks in regions with high background signal. These results highlight proper scaling for between-sample data normalization as critical for differential transcription factor binding analysis and suggest bioinformaticians need to know about the variation in level of total protein binding between conditions to select the best analysis method. At the same time, validation using fold-change estimates from qRT-PCR suggests there is still room for further method improvement. PMID:25972895

  5. Quantitative modeling of transcription factor binding specificities using DNA shape.

    PubMed

    Zhou, Tianyin; Shen, Ning; Yang, Lin; Abe, Namiko; Horton, John; Mann, Richard S; Bussemaker, Harmen J; Gordân, Raluca; Rohs, Remo

    2015-04-14

    DNA binding specificities of transcription factors (TFs) are a key component of gene regulatory processes. Underlying mechanisms that explain the highly specific binding of TFs to their genomic target sites are poorly understood. A better understanding of TF-DNA binding requires the ability to quantitatively model TF binding to accessible DNA as its basic step, before additional in vivo components can be considered. Traditionally, these models were built based on nucleotide sequence. Here, we integrated 3D DNA shape information derived with a high-throughput approach into the modeling of TF binding specificities. Using support vector regression, we trained quantitative models of TF binding specificity based on protein binding microarray (PBM) data for 68 mammalian TFs. The evaluation of our models included cross-validation on specific PBM array designs, testing across different PBM array designs, and using PBM-trained models to predict relative binding affinities derived from in vitro selection combined with deep sequencing (SELEX-seq). Our results showed that shape-augmented models compared favorably to sequence-based models. Although both k-mer and DNA shape features can encode interdependencies between nucleotide positions of the binding site, using DNA shape features reduced the dimensionality of the feature space. In addition, analyzing the feature weights of DNA shape-augmented models uncovered TF family-specific structural readout mechanisms that were not revealed by the DNA sequence. As such, this work combines knowledge from structural biology and genomics, and suggests a new path toward understanding TF binding and genome function. PMID:25775564

  6. Varying levels of complexity in transcription factor binding motifs

    PubMed Central

    Keilwagen, Jens; Grau, Jan

    2015-01-01

    Binding of transcription factors to DNA is one of the keystones of gene regulation. The existence of statistical dependencies between binding site positions is widely accepted, while their relevance for computational predictions has been debated. Building probabilistic models of binding sites that may capture dependencies is still challenging, since the most successful motif discovery approaches require numerical optimization techniques, which are not suited for selecting dependency structures. To overcome this issue, we propose sparse local inhomogeneous mixture (Slim) models that combine putative dependency structures in a weighted manner allowing for numerical optimization of dependency structure and model parameters simultaneously. We find that Slim models yield a substantially better prediction performance than previous models on genomic context protein binding microarray data sets and on ChIP-seq data sets. To elucidate the reasons for the improved performance, we develop dependency logos, which allow for visual inspection of dependency structures within binding sites. We find that the dependency structures discovered by Slim models are highly diverse and highly transcription factor-specific, which emphasizes the need for flexible dependency models. The observed dependency structures range from broad heterogeneities to sparse dependencies between neighboring and non-neighboring binding site positions. PMID:26116565

  7. In vivo interaction of the Escherichia coli integration host factor with its specific binding sites.

    PubMed

    Engelhorn, M; Boccard, F; Murtin, C; Prentki, P; Geiselmann, J

    1995-08-11

    The histone-like protein integration host factor (IHF) of Escherichia coli binds to specific binding sites on the chromosome or on mobile genetic elements, and is involved in many cellular processes. We have analyzed the interaction of IHF with five different binding sites in vitro and in vivo using UV laser footprinting, a technique that probes the immediate environment and conformation of a segment of DNA. Using this generally applicable technique we can directly compare the binding modes and interaction strengths of a DNA binding protein in its physiological environment within the cell to measurements performed in vitro. We conclude that the interactions between IHF and its specific binding sites are identical in vitro and in vivo. The footprinting signal is consistent with the model of IHF-binding to DNA proposed by Yang and Nash (1989). The occupancy of binding sites varies with the concentration of IHF in the cell and allows to estimate the concentration of free IHF protein in the cell. PMID:7659518

  8. In vivo interaction of the Escherichia coli integration host factor with its specific binding sites.

    PubMed

    Engelhorn, M; Boccard, F; Murtin, C; Prentki, P; Geiselmann, J

    1995-09-11

    The histone-like protein integration host factor (IHF) of Escherichia coli binds to specific binding sites on the chromosome or on mobile genetic elements, and is involved in many cellular processes. We have analyzed the interaction of IHF with five different binding sites in vitro and in vivo using UV laser footprinting, a technique that probes the immediate environment and conformation of a segment of DNA. Using this generally applicable technique we can directly compare the binding modes and interaction strengths of a DNA binding protein in its physiological environment within the cell to measurements performed in vitro. We conclude that the interactions between IHF and its specific binding sites are identical in vitro and in vivo. The footprinting signal is consistent with the model of IHF-binding to DNA proposed by Yang and Nash (1989). The occupancy of binding sites varies with the concentration of IHF in the cell and allows to estimate the concentration of free IHF protein in the cell. PMID:7567442

  9. Phorbol 12-myristate 13-acetate promotes nuclear translocation of hepatic steroid response element binding protein-2.

    PubMed

    Wong, Tsz Yan; Tan, Yan Qin; Lin, Shu-Mei; Leung, Lai K

    2016-06-01

    Sterol regulatory element-binding protein (SREBP)-2 is a pivotal transcriptional factor in cholesterol metabolism. Factors interfering with the proper functioning of SREBP-2 potentially alter plasma lipid profiles. Phorbol 12-myristate 13-acetate (PMA), which is a common protein kinase C (PKC) activator, was shown to promote the post-translational processing and nuclear translocation of SREBP-2 in hepatic cells in the current study. Following SREBP-2 translocation, the transcripts of its target genes HMGCR and LDLR were upregulated as demonstrated by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay. Electrophoretic mobility shift assays (EMSA) also demonstrated an induced DNA-binding activity on the sterol response element (SRE) domain under PMA treatment. The increase of activated Srebp-2 without the concurrent induced mRNA expression was also observed in an animal model. As the expression of SREBP-2 was not increased by PMA, the activation of PKC was the focus of investigation. Specific PKC isozyme inhibition and overexpression supported that PKCβ was responsible for the promoting effect. Further studies showed that the mitogen-activated protein kinases (MAPKs) extracellular signal-regulated kinases (ERK) and c-Jun N-terminal kinases (JNK), but not 5' adenosine monophosphate-activated protein kinase (AMPK), were the possible downstream signaling proteins of PKCβ. In conclusion, this study illustrated that PKCβ increased SREBP-2 nuclear translocation in a pathway mediated by MEK/ERK and JNK, rather than the one dictated by AMPK. These results revealed a novel signaling target of PKCβ in the liver cells. PMID:27032751

  10. Ets transcription factors bind and transactivate the core promoter of the von Willebrand factor gene.

    PubMed

    Schwachtgen, J L; Janel, N; Barek, L; Duterque-Coquillaud, M; Ghysdael, J; Meyer, D; Kerbiriou-Nabias, D

    1997-12-18

    von Willebrand factor (vWF) gene expression is restricted to endothelial cells and megakaryocytes. Previous results demonstrated that basal transcription of the human vWF gene is mediated through a promoter located between base pairs -89 and +19 (cap site: +1) which is functional in endothelial and non endothelial cells. Two DNA repeats TTTCCTTT correlating with inverted consensus binding sites for the Ets family of transcription factors are present in the -56/-36 sequence. In order to analyse whether these DNA elements are involved in transcription, human umbilical vein endothelial cells (HUVEC), bovine calf pulmonary endothelial cell line (CPAE), HeLa and COS cells were transfected with constructs containing deletions of the -89/+19 fragment, linked to the chloramphenicol acetyl transferase (CAT) reporter gene. The -60/+19 region exhibits significant promoter activity in HUVEC and CPAE cells only. The -42/+19 fragment is not active. Mutations of the -60/+19 promoter fragment in the 5' (-56/-49) Ets binding site abolish transcription in endothelial cells whereas mutations in the 3' (-43/-36) site does not. The -60/-33 fragment forms three complexes with proteins from HUVEC nuclear extracts in electrophoretic mobility shift assay which are dependent on the presence of the 5' Ets binding site. Binding of recombinant Ets-1 protein to the -60/-33 fragment gives a complex which also depends on the 5' site. The -60/+19 vWF gene core promoter is transactivated in HeLa cells by cotransfecting with Ets-1 or Erg (Ets-related gene) expression plasmids. In contrast to the wild type construct, transcription of the 5' site mutants is not increased by these expressed proteins. The results indicate that the promoter activity of the -60/+19 region of the vWF gene depends on transcription factors of the Ets family of which several members like Ets-1, Ets-2 and Erg are expressed in endothelium. Cotransfection of Ets-1 and Erg expression plasmids is sufficient to induce the -60/+19 v

  11. A Potential Structural Switch for Regulating DNA-Binding by TEAD Transcription Factors.

    PubMed

    Lee, Dong-Sun; Vonrhein, Clemens; Albarado, Diana; Raman, C S; Veeraraghavan, Sudha

    2016-06-19

    TEA domain (TEAD) transcription factors are essential for the normal development of eukaryotes and are the downstream effectors of the Hippo tumor suppressor pathway. Whereas our earlier work established the three-dimensional structure of the highly conserved DNA-binding domain using solution NMR spectroscopy, the structural basis for regulating the DNA-binding activity remains unknown. Here, we present the X-ray crystallographic structure and activity of a TEAD mutant containing a truncated L1 loop, ΔL1 TEAD DBD. Unexpectedly, the three-dimensional structure of the ΔL1 TEAD DBD reveals a helix-swapped homodimer wherein helix 1 is swapped between monomers. Furthermore, each three-helix bundle in the domain-swapped dimer is a structural homolog of MYB-like domains. Our investigations of the DNA-binding activity reveal that although the formation of the three-helix bundle by the ΔL1 TEAD DBD is sufficient for binding to an isolated M-CAT-like DNA element, multimeric forms are deficient for cooperative binding to tandemly duplicated elements, indicating that the L1 loop contributes to the DNA-binding activity of TEAD. These results suggest that switching between monomeric and domain-swapped forms may regulate DNA selectivity of TEAD proteins. PMID:27016204

  12. Crystal Structure and DNA Binding of the Homeodomain of the Stem Cell Transcription Factor Nanog

    SciTech Connect

    Jauch, Ralf; Ng, Calista Keow Leng; Saikatendu, Kumar Singh; Stevens, Raymond C.; Kolatkar, Prasanna R.

    2010-02-08

    The transcription factor Nanog is an upstream regulator in early mammalian development and a key determinant of pluripotency in embryonic stem cells. Nanog binds to promoter elements of hundreds of target genes and regulates their expression by an as yet unknown mechanism. Here, we report the crystal structure of the murine Nanog homeodomain (HD) and analysis of its interaction with a DNA element derived from the Tcf3 promoter. Two Nanog amino acid pairs, unique among HD sequences, appear to affect the mechanism of nonspecific DNA recognition as well as maintain the integrity of the structural scaffold. To assess selective DNA recognition by Nanog, we performed electrophoretic mobility shift assays using a panel of modified DNA binding sites and found that Nanog HD preferentially binds the TAAT(G/T)(G/T) motif. A series of rational mutagenesis experiments probing the role of six variant residues of Nanog on its DNA binding function establish their role in affecting binding affinity but not binding specificity. Together, the structural and functional evidence establish Nanog as a distant member of a Q50-type HD despite having considerable variation at the sequence level.

  13. Tracing the Evolution of Lineage-Specific Transcription Factor Binding Sites in a Birth-Death Framework

    PubMed Central

    Ma, Jian

    2014-01-01

    Changes in cis-regulatory element composition that result in novel patterns of gene expression are thought to be a major contributor to the evolution of lineage-specific traits. Although transcription factor binding events show substantial variation across species, most computational approaches to study regulatory elements focus primarily upon highly conserved sites, and rely heavily upon multiple sequence alignments. However, sequence conservation based approaches have limited ability to detect lineage-specific elements that could contribute to species-specific traits. In this paper, we describe a novel framework that utilizes a birth-death model to trace the evolution of lineage-specific binding sites without relying on detailed base-by-base cross-species alignments. Our model was applied to analyze the evolution of binding sites based on the ChIP-seq data for six transcription factors (GATA1, SOX2, CTCF, MYC, MAX, ETS1) along the lineage toward human after human-mouse common ancestor. We estimate that a substantial fraction of binding sites (∼58–79% for each factor) in humans have origins since the divergence with mouse. Over 15% of all binding sites are unique to hominids. Such elements are often enriched near genes associated with specific pathways, and harbor more common SNPs than older binding sites in the human genome. These results support the ability of our method to identify lineage-specific regulatory elements and help understand their roles in shaping variation in gene regulation across species. PMID:25144359

  14. High-resolution DNA-binding specificity analysis of yeast transcription factors

    PubMed Central

    Zhu, Cong; Byers, Kelsey J.R.P.; McCord, Rachel Patton; Shi, Zhenwei; Berger, Michael F.; Newburger, Daniel E.; Saulrieta, Katrina; Smith, Zachary; Shah, Mita V.; Radhakrishnan, Mathangi; Philippakis, Anthony A.; Hu, Yanhui; De Masi, Federico; Pacek, Marcin; Rolfs, Andreas; Murthy, Tal; LaBaer, Joshua; Bulyk, Martha L.

    2009-01-01

    Transcription factors (TFs) regulate the expression of genes through sequence-specific interactions with DNA-binding sites. However, despite recent progress in identifying in vivo TF binding sites by microarray readout of chromatin immunoprecipitation (ChIP-chip), nearly half of all known yeast TFs are of unknown DNA-binding specificities, and many additional predicted TFs remain uncharacterized. To address these gaps in our knowledge of yeast TFs and their cis regulatory sequences, we have determined high-resolution binding profiles for 89 known and predicted yeast TFs, over more than 2.3 million gapped and ungapped 8-bp sequences (“k-mers”). We report 50 new or significantly different direct DNA-binding site motifs for yeast DNA-binding proteins and motifs for eight proteins for which only a consensus sequence was previously known; in total, this corresponds to over a 50% increase in the number of yeast DNA-binding proteins with experimentally determined DNA-binding specificities. Among other novel regulators, we discovered proteins that bind the PAC (Polymerase A and C) motif (GATGAG) and regulate ribosomal RNA (rRNA) transcription and processing, core cellular processes that are constituent to ribosome biogenesis. In contrast to earlier data types, these comprehensive k-mer binding data permit us to consider the regulatory potential of genomic sequence at the individual word level. These k-mer data allowed us to reannotate in vivo TF binding targets as direct or indirect and to examine TFs' potential effects on gene expression in ∼1700 environmental and cellular conditions. These approaches could be adapted to identify TFs and cis regulatory elements in higher eukaryotes. PMID:19158363

  15. The scs' boundary element: characterization of boundary element-associated factors.

    PubMed

    Hart, C M; Zhao, K; Laemmli, U K

    1997-02-01

    Boundary elements are thought to define the peripheries of chromatin domains and to restrict enhancer-promoter interactions to their target genes within their domains. We previously characterized a cDNA encoding the BEAF-32A protein (32A), which binds with high affinity to the scs' boundary element from the Drosophila melanogaster 87A7 hsp70 locus. Here, we report a second protein, BEAF-32B, that differs from 32A only in its amino terminus. Unlike 32A, it has the same DNA binding specificity as the complete BEAF activity affinity purified from Drosophila. We characterize three domains in these proteins. Heterocomplex formation is mediated by their identical carboxy-terminal domains, and DNA binding is mediated by their unique amino-terminal domains. The identical middle domains of 32A and 32B are dispensable for the functions described here, although they may be important for boundary element function. 32A and 32B apparently form trimers, and the ratio of 32A to 32B varies at different loci on polytene chromosomes as judged by immunofluorescence. The scs' element contains a high- and low-affinity binding site for BEAF. We observed that interaction with the low-affinity site is facilitated by binding to the high-affinity site some 200 bp distant. PMID:9001253

  16. Identification of a novel AU-rich-element-binding protein which is related to AUF1.

    PubMed Central

    Dean, Jonathan L E; Sully, Gareth; Wait, Robin; Rawlinson, Lesley; Clark, Andrew R; Saklatvala, Jeremy

    2002-01-01

    The AU-rich element (ARE) is an important instability determinant for a large number of early-response-gene mRNAs. AREs also mediate the stabilization of certain pro-inflammatory mRNAs, such as tumour necrosis factor (TNF)-alpha and cyclo-oxygenase-2 (COX-2), in response to inflammatory stimuli. To understand how AREs control mRNA stability, it is necessary to identify trans-acting factors. We have purified a new ARE-binding protein and identified it as CArG box-binding factor-A (CBF-A). The amino acid sequence of CBF-A is highly similar to that of the ARE-binding protein AUF1. Recombinant CBF-A bound the COX-2 and TNF-alpha AREs, but not a non-specific control RNA. In contrast, in an electrophoretic-mobility-shift assay (EMSA) of crude RAW 264.7 macrophage-like cell extracts, an antiserum that recognizes both AUF1 and CBF-A failed to supershift complexes formed on the TNF-alpha ARE, but did supershift a complex specific for the COX-2 ARE. CBF-A exists as two isoforms, p37 and p42, that differ by a 47-amino-acid insertion close to the C-terminus. By expressing epitope-tagged isoforms of CBF-A it was shown that the p42 isoform binds the COX-2 ARE in EMSA of crude cell extracts. In a HeLa-cell tetracycline-regulated reporter system, overexpression of the p42 CBF-A isoform resulted in stabilization of a COX-2 ARE reporter mRNA. Epitope-tagged p42 CBF-A expressed in HeLa cells co-immunoprecipitated with endogenous COX-2 mRNA, but not glyceraldehyde-3-phosphate dehydrogenase mRNA, as shown by reverse-transcription PCR. The similarity between CBF-A and AUF1 suggests that CBF-A could be re-named AUF2. PMID:12086581

  17. Specific binding of atrial natriuretic factor in brain microvessels

    SciTech Connect

    Chabrier, P.E.; Roubert, P.; Braquet, P.

    1987-04-01

    Cerebral capillaries constitute the blood-brain barrier. Studies of specific receptors (neurotransmitters or hormones) located on this structure can be performed by means of radioligand-binding techniques on isolated brain microvessels. The authors examined on pure bovine cerebral microvessel preparations the binding of atrial natriuretic factor (ANF), using /sup 125/I-labeled ANF. Saturation and competition experiments demonstrated the presence of a single class of ANF-binding sites with high affinity and with a binding capacity of 58 fmol/mg of protein. The binding of /sup 125/I-labeled ANF to brain microvessels is specific, reversible, and time dependent, as is shown by association-dissociation experiments. The demonstration of specific ANF-binding sites on brain microvessels supposes a physiological role of ANF on brain microvasculature. The coexistence of ANF and angiotensin II receptors on this cerebrovascular tissue suggests that the two circulating peptides may act as mutual antagonists in the regulation of brain microcirculation and/or blood-brain barrier function.

  18. Architecture and RNA binding of the human negative elongation factor

    PubMed Central

    Vos, Seychelle M; Pöllmann, David; Caizzi, Livia; Hofmann, Katharina B; Rombaut, Pascaline; Zimniak, Tomasz; Herzog, Franz; Cramer, Patrick

    2016-01-01

    Transcription regulation in metazoans often involves promoter-proximal pausing of RNA polymerase (Pol) II, which requires the 4-subunit negative elongation factor (NELF). Here we discern the functional architecture of human NELF through X-ray crystallography, protein crosslinking, biochemical assays, and RNA crosslinking in cells. We identify a NELF core subcomplex formed by conserved regions in subunits NELF-A and NELF-C, and resolve its crystal structure. The NELF-AC subcomplex binds single-stranded nucleic acids in vitro, and NELF-C associates with RNA in vivo. A positively charged face of NELF-AC is involved in RNA binding, whereas the opposite face of the NELF-AC subcomplex binds NELF-B. NELF-B is predicted to form a HEAT repeat fold, also binds RNA in vivo, and anchors the subunit NELF-E, which is confirmed to bind RNA in vivo. These results reveal the three-dimensional architecture and three RNA-binding faces of NELF. DOI: http://dx.doi.org/10.7554/eLife.14981.001 PMID:27282391

  19. Specific Binding of Atrial Natriuretic Factor in Brain Microvessels

    NASA Astrophysics Data System (ADS)

    Chabrier, Pierre E.; Roubert, Pierre; Braquet, Pierre

    1987-04-01

    Cerebral capillaries constitute the blood--brain barrier. Studies of specific receptors (neurotransmitters or hormones) located on this structure can be performed by means of radioligand-binding techniques on isolated brain microvessels. We examined on pure bovine cerebral microvessel preparations the binding of atrial natriuretic factor (ANF), using 125I-labeled ANF. Saturation and competition experiments demonstrated the presence of a single class of ANF-binding sites with high affinity (dissociation constant, ≈ 10-10 M) and with a binding capacity of 58 fmol/mg of protein. The binding of 125I-labeled ANF to brain microvessels is specific, reversible, and time dependent, as is shown by association-dissociation experiments. The demonstration of specific ANF-binding sites on brain microvessels supposes a physiological role of ANF on brain microvasculature. The coexistence of ANF and angiotensin II receptors on this cerebrovascular tissue suggests that the two circulating peptides may act as mutual antagonists in the regulation of brain microcirculation and/or blood--brain barrier function.

  20. Nucleosome-driven transcription factor binding and gene regulation.

    PubMed

    Ballaré, Cecilia; Castellano, Giancarlo; Gaveglia, Laura; Althammer, Sonja; González-Vallinas, Juan; Eyras, Eduardo; Le Dily, Francois; Zaurin, Roser; Soronellas, Daniel; Vicent, Guillermo P; Beato, Miguel

    2013-01-10

    Elucidating the global function of a transcription factor implies the identification of its target genes and genomic binding sites. The role of chromatin in this context is unclear, but the dominant view is that factors bind preferentially to nucleosome-depleted regions identified as DNaseI-hypersensitive sites (DHS). Here we show by ChIP, MNase, and DNaseI assays followed by deep sequencing that the progesterone receptor (PR) requires nucleosomes for optimal binding and function. In breast cancer cells treated with progestins, we identified 25,000 PR binding sites (PRbs). The majority of these sites encompassed several copies of the hexanucleotide TGTYCY, which is highly abundant in the genome. We found that functional PRbs accumulate around progesterone-induced genes, mainly in enhancers. Most of these sites overlap with DHS but exhibit high nucleosome occupancy. Progestin stimulation results in remodeling of these nucleosomes with displacement of histones H1 and H2A/H2B dimers. Our results strongly suggest that nucleosomes are crucial for PR binding and hormonal gene regulation. PMID:23177737

  1. DNA methylation presents distinct binding sites for human transcription factors.

    PubMed

    Hu, Shaohui; Wan, Jun; Su, Yijing; Song, Qifeng; Zeng, Yaxue; Nguyen, Ha Nam; Shin, Jaehoon; Cox, Eric; Rho, Hee Sool; Woodard, Crystal; Xia, Shuli; Liu, Shuang; Lyu, Huibin; Ming, Guo-Li; Wade, Herschel; Song, Hongjun; Qian, Jiang; Zhu, Heng

    2013-01-01

    DNA methylation, especially CpG methylation at promoter regions, has been generally considered as a potent epigenetic modification that prohibits transcription factor (TF) recruitment, resulting in transcription suppression. Here, we used a protein microarray-based approach to systematically survey the entire human TF family and found numerous purified TFs with methylated CpG (mCpG)-dependent DNA-binding activities. Interestingly, some TFs exhibit specific binding activity to methylated and unmethylated DNA motifs of distinct sequences. To elucidate the underlying mechanism, we focused on Kruppel-like factor 4 (KLF4), and decoupled its mCpG- and CpG-binding activities via site-directed mutagenesis. Furthermore, KLF4 binds specific methylated or unmethylated motifs in human embryonic stem cells in vivo. Our study suggests that mCpG-dependent TF binding activity is a widespread phenomenon and provides a new framework to understand the role and mechanism of TFs in epigenetic regulation of gene transcription. DOI:http://dx.doi.org/10.7554/eLife.00726.001. PMID:24015356

  2. DNA methylation presents distinct binding sites for human transcription factors

    PubMed Central

    Hu, Shaohui; Wan, Jun; Su, Yijing; Song, Qifeng; Zeng, Yaxue; Nguyen, Ha Nam; Shin, Jaehoon; Cox, Eric; Rho, Hee Sool; Woodard, Crystal; Xia, Shuli; Liu, Shuang; Lyu, Huibin; Ming, Guo-Li; Wade, Herschel; Song, Hongjun; Qian, Jiang; Zhu, Heng

    2013-01-01

    DNA methylation, especially CpG methylation at promoter regions, has been generally considered as a potent epigenetic modification that prohibits transcription factor (TF) recruitment, resulting in transcription suppression. Here, we used a protein microarray-based approach to systematically survey the entire human TF family and found numerous purified TFs with methylated CpG (mCpG)-dependent DNA-binding activities. Interestingly, some TFs exhibit specific binding activity to methylated and unmethylated DNA motifs of distinct sequences. To elucidate the underlying mechanism, we focused on Kruppel-like factor 4 (KLF4), and decoupled its mCpG- and CpG-binding activities via site-directed mutagenesis. Furthermore, KLF4 binds specific methylated or unmethylated motifs in human embryonic stem cells in vivo. Our study suggests that mCpG-dependent TF binding activity is a widespread phenomenon and provides a new framework to understand the role and mechanism of TFs in epigenetic regulation of gene transcription. DOI: http://dx.doi.org/10.7554/eLife.00726.001 PMID:24015356

  3. Meningococcal Factor H Binding Protein Vaccine Antigens with Increased Thermal Stability and Decreased Binding of Human Factor H.

    PubMed

    Rossi, Raffaella; Konar, Monica; Beernink, Peter T

    2016-06-01

    Neisseria meningitidis causes cases of bacterial meningitis and sepsis. Factor H binding protein (FHbp) is a component of two licensed meningococcal serogroup B vaccines. FHbp recruits the complement regulator factor H (FH) to the bacterial surface, which inhibits the complement alternative pathway and promotes immune evasion. Binding of human FH impairs the protective antibody responses to FHbp, and mutation of FHbp to decrease binding of FH can increase the protective responses. In a previous study, we identified two amino acid substitutions in FHbp variant group 2 that increased its thermal stability by 21°C and stabilized epitopes recognized by protective monoclonal antibodies (MAbs). Our hypothesis was that combining substitutions to increase stability and decrease FH binding would increase protective antibody responses in the presence of human FH. In the present study, we generated four new FHbp single mutants that decreased FH binding and retained binding of anti-FHbp MAbs and immunogenicity in wild-type mice. From these mutants, we selected two, K219N and G220S, to combine with the stabilized double-mutant FHbp antigen. The two triple mutants decreased FH binding >200-fold, increased the thermal stability of the N-terminal domain by 21°C, and bound better to an anti-FHbp MAb than the wild-type FHbp. In human-FH-transgenic mice, the FHbp triple mutants elicited 8- to 15-fold-higher protective antibody responses than the wild-type FHbp antigen. Collectively, the data suggest that mutations to eliminate binding of human FH and to promote conformational stability act synergistically to optimize FHbp immunogenicity. PMID:27021245

  4. Purification and characterization of a heat-shock element binding protein from yeast.

    PubMed Central

    Sorger, P K; Pelham, H R

    1987-01-01

    The promoters of heat shock genes are activated when cells are stressed. Activation is dependent on a specific DNA sequence, the heat-shock element (HSE). We describe the purification to homogeneity of an HSE-binding protein from yeast (Saccharomyces cerevisiae), using sequential chromatography of whole cell extracts on heparin-agarose, calf thymus DNA-Sepharose and an affinity column consisting of a repetitive synthetic HSE sequence coupled to Sepharose. The protein runs as a closely spaced doublet of approximately 150 kd on SDS-polyacrylamide gels; mild proteolysis generates a stable 70-kd fragment which retains DNA binding activity. The relative affinities of the protein for a range of variant HSE sequences correlates with the ability of these sequences to support heat-inducible transcription in vivo, suggesting that this polypeptide is involved in the activation of heat-shock promoters. However, the protein was purified from unshocked yeast, and may therefore represent an unactivated form of heat-shock transcription factor. Study of the purified protein should help to define the mechanistic basis of the heat-shock response. Images Fig. 2. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:3319580

  5. Functional significance of factor H binding to Neisseria meningitidis.

    PubMed

    Schneider, Muriel C; Exley, Rachel M; Chan, Hannah; Feavers, Ian; Kang, Yu-Hoi; Sim, Robert B; Tang, Christoph M

    2006-06-15

    Neisseria meningitidis is an important cause of septicemia and meningitis. To cause disease, the bacterium must successfully survive in the bloodstream where it has to avoid being killed by host innate immune mechanisms, particularly the complement system. A number of pathogenic microbes bind factor H (fH), the negative regulator of the alternative pathway of complement activation, to promote their survival in vivo. In this study, we show that N. meningitidis binds fH to its surface. Binding to serogroups A, B, and C N. meningitidis strains was detected by FACS and Far Western blot analysis, and occurred in the absence of other serum factors such as C3b. Unlike Neisseria gonorrhoeae, binding of fH to N. meningitidis was independent of sialic acid on the bacterium, either as a component of its LPS or its capsule. Characterization of the major fH binding partner demonstrated that it is a 33-kDa protein; examination of insertion mutants showed that porins A and B, outer membrane porins expressed by N. meningitidis, do not contribute significantly to fH binding. We examined the physiological consequences of fH bound to the bacterial surface. We found that fH retains its activity as a cofactor of factor I when bound to the bacterium and contributes to the ability of N. meningitidis to avoid complement-mediated killing in the presence of human serum. Therefore, the recruitment of fH provides another mechanism by which this important human pathogen evades host innate immunity. PMID:16751403

  6. Polyelectrolyte Complex for Heparin Binding Domain Osteogenic Growth Factor Delivery.

    PubMed

    Wing Moon Lam, Raymond; Abbah, Sunny Akogwu; Ming, Wang; Naidu, Mathanapriya; Ng, Felly; Tao, Hu; Goh Cho Hong, James; Ting, Kang; Hee Kit, Wong

    2016-01-01

    During reconstructive bone surgeries, supraphysiological amounts of growth factors are empirically loaded onto scaffolds to promote successful bone fusion. Large doses of highly potent biological agents are required due to growth factor instability as a result of rapid enzymatic degradation as well as carrier inefficiencies in localizing sufficient amounts of growth factor at implant sites. Hence, strategies that prolong the stability of growth factors such as BMP-2/NELL-1, and control their release could actually lower their efficacious dose and thus reduce the need for larger doses during future bone regeneration surgeries. This in turn will reduce side effects and growth factor costs. Self-assembled PECs have been fabricated to provide better control of BMP-2/NELL-1 delivery via heparin binding and further potentiate growth factor bioactivity by enhancing in vivo stability. Here we illustrate the simplicity of PEC fabrication which aids in the delivery of a variety of growth factors during reconstructive bone surgeries. PMID:27585207

  7. A nucleolar localizing Rev binding element inhibits HIV replication

    PubMed Central

    Michienzi, Alessandro; De Angelis, Fernanda G; Bozzoni, Irene; Rossi, John J

    2006-01-01

    The Rev protein of the human immunodeficiency virus (HIV) facilitates the nuclear export of intron containing viral mRNAs allowing formation of infectious virions. Rev traffics through the nucleolus and shuttles between the nucleus and cytoplasm. Rev multimerization and interaction with the export protein CRM1 takes place in the nucleolus. To test the importance of Rev nucleolar trafficking in the HIV-1 replication cycle, we created a nucleolar localizing Rev Response Element (RRE) decoy and tested this for its anti-HIV activity. The RRE decoy provided marked inhibition of HIV-1 replication in both the CEM T-cell line and in primary CD34+ derived monocytes. These results demonstrate that titration of Rev in the nucleolus impairs HIV-1 replication and supports a functional role for Rev trafficking in this sub-cellular compartment. PMID:16712721

  8. The Forkhead Transcription Factor FOXM1 Controls Cell Cycle-Dependent Gene Expression through an Atypical Chromatin Binding Mechanism

    PubMed Central

    Chen, Xi; Müller, Gerd A.; Quaas, Marianne; Fischer, Martin; Han, Namshik; Stutchbury, Benjamin; Engeland, Kurt

    2013-01-01

    There are nearly 50 forkhead (FOX) transcription factors encoded in the human genome and, due to sharing a common DNA binding domain, they are all thought to bind to similar DNA sequences. It is therefore unclear how these transcription factors are targeted to specific chromatin regions to elicit specific biological effects. Here, we used chromatin immunoprecipitation followed by sequencing (ChIP-seq) to investigate the genome-wide chromatin binding mechanisms used by the forkhead transcription factor FOXM1. In keeping with its previous association with cell cycle control, we demonstrate that FOXM1 binds and regulates a group of genes which are mainly involved in controlling late cell cycle events in the G2 and M phases. However, rather than being recruited through canonical RYAAAYA forkhead binding motifs, FOXM1 binding is directed via CHR (cell cycle genes homology region) elements. FOXM1 binds these elements through protein-protein interactions with the MMB transcriptional activator complex. Thus, we have uncovered a novel and unexpected mode of chromatin binding of a FOX transcription factor that allows it to specifically control cell cycle-dependent gene expression. PMID:23109430

  9. Regulatory elements responsible for inducible expression of the granulocyte colony-stimulating factor gene in macrophages.

    PubMed Central

    Nishizawa, M; Nagata, S

    1990-01-01

    Granulocyte colony-stimulating factor (G-CSF) plays an essential role in granulopoiesis during bacterial infection. Macrophages produce G-CSF in response to bacterial endotoxins such as lipopolysaccharide (LPS). To elucidate the mechanism of the induction of G-CSF gene in macrophages or macrophage-monocytes, we have examined regulatory cis elements in the promoter of mouse G-CSF gene. Analyses of linker-scanning and internal deletion mutants of the G-CSF promoter by the chloramphenicol acetyltransferase assay have indicated that at least three regulatory elements are indispensable for the LPS-induced expression of the G-CSF gene in macrophages. When one of the three elements was reiterated and placed upstream of the TATA box of the G-CSF promoter, it mediated inducibility as a tissue-specific and orientation-independent enhancer. Although this element contains a conserved NF-kappa B-like binding site, the gel retardation assay and DNA footprint analysis with nuclear extracts from macrophage cell lines demonstrated that nuclear proteins bind to the DNA sequence downstream of the NF-kappa B-like element, but not to the conserved element itself. The DNA sequence of the binding site was found to have some similarities to the LPS-responsive element which was recently identified in the promoter of the mouse class II major histocompatibility gene. Images PMID:1691438

  10. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    DOE Data Explorer

    Loots, Gabriela G. [LLNL; Ovcharenko, I. [LLNL

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. This database of evolutionary conserved regions (ECRs) in vertebrate genomes features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a comprehensive collection of promoters in all vertebrate genomes generated using multiple sources of gene annotation. The database also contains a collection of annotated transcription factor binding sites (TFBSs) in evolutionary conserved and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and fugu genomes. (taken from paper in Journal: Bioinformatics, November 7, 2006, pp. 122-124

  11. A Unique DNA Binding Domain Converts T-Cell Factors into Strong Wnt Effectors▿

    PubMed Central

    Atcha, Fawzia A.; Syed, Adeela; Wu, Beibei; Hoverter, Nate P.; Yokoyama, Noriko N.; Ting, Ju-Hui T.; Munguia, Jesus E.; Mangalam, Harry J.; Marsh, J. Lawrence; Waterman, Marian L.

    2007-01-01

    Wnt regulation of gene expression requires binding of LEF/T-cell factor (LEF/TCF) transcription factors to Wnt response elements (WREs) and recruitment of the activator β-catenin. There are significant differences in the abilities of LEF/TCF family members to regulate Wnt target genes. For example, alternatively spliced isoforms of TCF-1 and TCF-4 with a C-terminal “E” tail are uniquely potent in their activation of LEF1 and CDX1. Here we report that the mechanism responsible for this unique activity is an auxiliary 30-amino-acid DNA interaction motif referred to here as the “cysteine clamp” (or C-clamp). The C-clamp contains invariant cysteine, aromatic, and basic residues, and surface plasmon resonance (SPR) studies with recombinant C-clamp protein showed that it binds double-stranded DNA but not single-stranded DNA or RNA (equilibrium dissociation constant = 16 nM). CASTing (Cyclic Amplification and Selection of Targets) experiments were used to test whether this motif influences WRE recognition. Full-length LEF-1, TCF-1E, and TCF-1E with a mutated C-clamp all bind nearly identical WREs (TYYCTTTGATSTT), showing that the C-clamp does not alter WRE specificity. However, a GC element downstream of the WRE (RCCG) is enriched in wild-type TCF-1E binding sites but not in mutant TCF-1E binding sites. We conclude that the C-clamp is a sequence-specific DNA binding motif. C-clamp mutations destroy the ability of β-catenin to regulate the LEF1 promoter, and they severely impair the ability of TCF-1 to regulate growth in colon cancer cells. Thus, E-tail isoforms of TCFs utilize two DNA binding activities to access a subset of Wnt targets important for cell growth. PMID:17893322

  12. Retinoic acid receptors recognize the mouse genome through binding elements with diverse spacing and topology.

    PubMed

    Moutier, Emmanuel; Ye, Tao; Choukrallah, Mohamed-Amin; Urban, Sylvia; Osz, Judit; Chatagnon, Amandine; Delacroix, Laurence; Langer, Diana; Rochel, Natacha; Moras, Dino; Benoit, Gerard; Davidson, Irwin

    2012-07-27

    Retinoic acid receptors (RARs) heterodimerize with retinoid X receptors (RXRs) and bind to RA response elements (RAREs) in the regulatory regions of their target genes. Although previous studies on limited sets of RA-regulated genes have defined canonical RAREs as direct repeats of the consensus RGKTCA separated by 1, 2, or 5 nucleotides (DR1, DR2, DR5), we show that in mouse embryoid bodies or F9 embryonal carcinoma cells, RARs occupy a large repertoire of sites with DR0, DR8, and IR0 (inverted repeat 0) elements. Recombinant RAR-RXR binds these non-canonical spacings in vitro with comparable affinities to DR2 and DR5. Most DR8 elements comprise three half-sites with DR2 and DR0 spacings. This specific half-site organization constitutes a previously unrecognized but frequent signature of RAR binding elements. In functional assays, DR8 and IR0 elements act as independent RAREs, whereas DR0 does not. Our results reveal an unexpected diversity in the spacing and topology of binding elements for the RAR-RXR heterodimer. The differential ability of RAR-RXR bound to DR0 compared to DR2, DR5, and DR8 to mediate RA-dependent transcriptional activation indicates that half-site spacing allosterically regulates RAR function. PMID:22661711

  13. Retinoic Acid Receptors Recognize the Mouse Genome through Binding Elements with Diverse Spacing and Topology*

    PubMed Central

    Moutier, Emmanuel; Ye, Tao; Choukrallah, Mohamed-Amin; Urban, Sylvia; Osz, Judit; Chatagnon, Amandine; Delacroix, Laurence; Langer, Diana; Rochel, Natacha; Moras, Dino; Benoit, Gerard; Davidson, Irwin

    2012-01-01

    Retinoic acid receptors (RARs) heterodimerize with retinoid X receptors (RXRs) and bind to RA response elements (RAREs) in the regulatory regions of their target genes. Although previous studies on limited sets of RA-regulated genes have defined canonical RAREs as direct repeats of the consensus RGKTCA separated by 1, 2, or 5 nucleotides (DR1, DR2, DR5), we show that in mouse embryoid bodies or F9 embryonal carcinoma cells, RARs occupy a large repertoire of sites with DR0, DR8, and IR0 (inverted repeat 0) elements. Recombinant RAR-RXR binds these non-canonical spacings in vitro with comparable affinities to DR2 and DR5. Most DR8 elements comprise three half-sites with DR2 and DR0 spacings. This specific half-site organization constitutes a previously unrecognized but frequent signature of RAR binding elements. In functional assays, DR8 and IR0 elements act as independent RAREs, whereas DR0 does not. Our results reveal an unexpected diversity in the spacing and topology of binding elements for the RAR-RXR heterodimer. The differential ability of RAR-RXR bound to DR0 compared to DR2, DR5, and DR8 to mediate RA-dependent transcriptional activation indicates that half-site spacing allosterically regulates RAR function. PMID:22661711

  14. Mitochondrial Cyclic AMP Response Element-binding Protein (CREB) Mediates Mitochondrial Gene Expression and Neuronal Survival*S

    PubMed Central

    Lee, Junghee; Kim, Chun-Hyung; Simon, David K.; Aminova, Lyaylya R.; Andreyev, Alexander Y.; Kushnareva, Yulia E.; Murphy, Anne N.; Lonze, Bonnie E.; Kim, Kwang-Soo; Ginty, David D.; Ferrante, Robert J.; Ryu, Hoon; Ratan, Rajiv R.

    2008-01-01

    Cyclic AMP response element-binding protein (CREB) is a widely expressed transcription factor whose role in neuronal protection is now well established. Here we report that CREB is present in the mitochondrial matrix of neurons and that it binds directly to cyclic AMP response elements (CREs) found within the mitochondrial genome. Disruption of CREB activity in the mitochondria decreases the expression of a subset of mitochondrial genes, including the ND5 subunit of complex I, down-regulates complex I-dependent mitochondrial respiration, and increases susceptibility to 3-nitropropionic acid, a mitochondrial toxin that induces a clinical and pathological phenotype similar to Huntington disease. These results demonstrate that regulation of mitochondrial gene expression by mitochondrial CREB, in part, underlies the protective effects of CREB and raise the possibility that decreased mitochondrial CREB activity contributes to the mitochondrial dysfunction and neuronal loss associated with neurodegenerative disorders. PMID:16207717

  15. Does binding of complement factor H to the meningococcal vaccine antigen, factor H binding protein, decrease protective serum antibody responses?

    PubMed

    Granoff, Dan M; Ram, Sanjay; Beernink, Peter T

    2013-08-01

    Factor H binding protein (fHbp) is a principal antigen in a multicomponent meningococcal vaccine recently licensed in Europe for prevention of serogroup B diseases. The protein recruits the complement downregulator, factor H (fH), to the bacterial surface, which enables the organism to resist complement-mediated bacteriolysis. Binding is specific for human fH. In preclinical studies, mice and rabbits immunized with fHbp vaccines developed serum bactericidal antibody responses, which in humans predict protection against developing meningococcal disease. These studies, however, were in animals whose fH did not bind to the vaccine antigen. Here we review the immunogenicity of fHbp vaccines in human fH transgenic mice. The data suggest that animals with high serum human fH concentrations have impaired protective antibody responses. Further, mutant fHbp vaccines with single amino acid substitutions that decrease fH binding are superior immunogens, possibly by unmasking epitopes in the fH binding site that are important for eliciting serum bactericidal antibody responses. Humans immunized with fHbp vaccines develop serum bactericidal antibody, but achieving broad coverage in infants required incorporation of additional antigens, including outer membrane vesicles, which increased rates of fever and local reactions at the injection site. The experimental results in transgenic mice predict that fHbp immunogenicity can be improved in humans by using mutant fHbp vaccines with decreased fH binding. These results have important public health implications for developing improved fHbp vaccines for control of serogroup B meningococcal disease and for development of vaccines against other microbes that bind host molecules. PMID:23740919

  16. Dietary and nutritional manipulation of the nuclear transcription factors peroxisome proliferator-activated receptor and sterol regulatory element-binding proteins as a tool for reversing the primary diseases of premature death and delaying aging.

    PubMed

    Kurtak, Karen A

    2014-04-01

    Evolution over 2.1 billion years has equipped us with a biochemical pathway that has the power to literally reverse the primary disease etiologies that have become the leading causes of death and aging in the developed world. Activation of the peroxisome proliferator-activated receptor (PPAR) pathway arrests inflammatory signaling throughout the body, reverses damage to tissues, reverses insulin resistance, and can even dissolve beta-amyloid plaque in the brain. It has played a critical role in the evolution of the metazoans and the successful migration of humans to all corners of the Earth. For two decades, various pharmaceuticals have been designed to activate the PPAR pathway but have consistently fallen short of expectations. There is nothing wrong with these drugs. The problem has been the standard "healthy" diet creating mixed signals that render the drugs ineffective. This article explores the ongoing dance between the two primary nuclear receptors that mediate gene regulation of fatty acids. It discusses their interaction with sirtuins and telomerase, optimization of their obligate heterodimers, and why manipulation of dietary and nutritional factors, like the ketogenic diet, is the most effective means of activation. These are effective tools that we can start implementing now to slow, and in some cases reverse, the diseases of aging. PMID:24713058

  17. Novel DNA-binding element within the C-terminal extension of the nuclear receptor DNA-binding domain

    PubMed Central

    Jakób, Michał; Kołodziejczyk, Robert; Orłowski, Marek; Krzywda, Szymon; Kowalska, Agnieszka; Dutko-Gwóźdź, Joanna; Gwóźdź, Tomasz; Kochman, Marian; Jaskólski, Mariusz; Ożyhar, Andrzej

    2007-01-01

    The heterodimer of the ecdysone receptor (EcR) and ultraspiracle (Usp), members of the nuclear receptors superfamily, is considered as the functional receptor for ecdysteroids initiating molting and metamorphosis in insects. Here we report the 1.95 Å structure of the complex formed by the DNA-binding domains (DBDs) the EcR and the Usp, bound to the natural pseudopalindromic response element. Comparison of the structure with that obtained previously, using an idealized response element, shows how the EcRDBD, which has been previously reported to possess extraordinary flexibility, accommodates DNA-induced structural changes. Part of the C-terminal extension (CTE) of the EcRDBD folds into an α-helix whose location in the minor groove does not match any of the locations previously observed for nuclear receptors. Mutational analyses suggest that the α-helix is a component of EcR-box, a novel element indispensable for DNA-binding and located within the nuclear receptor CTE. This element seems to be a general feature of all known EcRs. PMID:17426125

  18. Variable structure motifs for transcription factor binding sites

    PubMed Central

    2010-01-01

    Background Classically, models of DNA-transcription factor binding sites (TFBSs) have been based on relatively few known instances and have treated them as sites of fixed length using position weight matrices (PWMs). Various extensions to this model have been proposed, most of which take account of dependencies between the bases in the binding sites. However, some transcription factors are known to exhibit some flexibility and bind to DNA in more than one possible physical configuration. In some cases this variation is known to affect the function of binding sites. With the increasing volume of ChIP-seq data available it is now possible to investigate models that incorporate this flexibility. Previous work on variable length models has been constrained by: a focus on specific zinc finger proteins in yeast using restrictive models; a reliance on hand-crafted models for just one transcription factor at a time; and a lack of evaluation on realistically sized data sets. Results We re-analysed binding sites from the TRANSFAC database and found motivating examples where our new variable length model provides a better fit. We analysed several ChIP-seq data sets with a novel motif search algorithm and compared the results to one of the best standard PWM finders and a recently developed alternative method for finding motifs of variable structure. All the methods performed comparably in held-out cross validation tests. Known motifs of variable structure were recovered for p53, Stat5a and Stat5b. In addition our method recovered a novel generalised version of an existing PWM for Sp1 that allows for variable length binding. This motif improved classification performance. Conclusions We have presented a new gapped PWM model for variable length DNA binding sites that is not too restrictive nor over-parameterised. Our comparison with existing tools shows that on average it does not have better predictive accuracy than existing methods. However, it does provide more interpretable

  19. Coregulation of transcription factor binding and nucleosome occupancy through DNA features of mammalian enhancers.

    PubMed

    Barozzi, Iros; Simonatto, Marta; Bonifacio, Silvia; Yang, Lin; Rohs, Remo; Ghisletti, Serena; Natoli, Gioacchino

    2014-06-01

    Transcription factors (TFs) preferentially bind sites contained in regions of computationally predicted high nucleosomal occupancy, suggesting that nucleosomes are gatekeepers of TF binding sites. However, because of their complexity mammalian genomes contain millions of randomly occurring, unbound TF consensus binding sites. We hypothesized that the information controlling nucleosome assembly may coincide with the information that enables TFs to bind cis-regulatory elements while ignoring randomly occurring sites. Hence, nucleosomes would selectively mask genomic sites that can be contacted by TFs and thus be potentially functional. The hematopoietic pioneer TF Pu.1 maintained nucleosome depletion at macrophage-specific enhancers that displayed a broad range of nucleosome occupancy in other cell types and in reconstituted chromatin. We identified a minimal set of DNA sequence and shape features that accurately predicted both Pu.1 binding and nucleosome occupancy genome-wide. These data reveal a basic organizational principle of mammalian cis-regulatory elements whereby TF recruitment and nucleosome deposition are controlled by overlapping DNA sequence features. PMID:24813947

  20. Modeling the relationship of epigenetic modifications to transcription factor binding

    PubMed Central

    Liu, Liang; Jin, Guangxu; Zhou, Xiaobo

    2015-01-01

    Transcription factors (TFs) and epigenetic modifications play crucial roles in the regulation of gene expression, and correlations between the two types of factors have been discovered. However, methods for quantitatively studying the correlations remain limited. Here, we present a computational approach to systematically investigating how epigenetic changes in chromatin architectures or DNA sequences relate to TF binding. We implemented statistical analyses to illustrate that epigenetic modifications are predictive of TF binding affinities, without the need of sequence information. Intriguingly, by considering genome locations relative to transcription start sites (TSSs) or enhancer midpoints, our analyses show that different locations display various relationship patterns. For instance, H3K4me3, H3k9ac and H3k27ac contribute more in the regions near TSSs, whereas H3K4me1 and H3k79me2 dominate in the regions far from TSSs. DNA methylation plays relatively important roles when close to TSSs than in other regions. In addition, the results show that epigenetic modification models for the predictions of TF binding affinities are cell line-specific. Taken together, our study elucidates highly coordinated, but location- and cell type-specific relationships between epigenetic modifications and binding affinities of TFs. PMID:25820421

  1. Evolutionary optimization of transcription factor binding motif detection.

    PubMed

    Zhang, Zhao; Wang, Ze; Mai, Guoqin; Luo, Youxi; Zhao, Miaomiao; Zhou, Fengfeng

    2015-01-01

    All the cell types are under strict control of how their genes are transcribed into expressed transcripts by the temporally dynamic orchestration of the transcription factor binding activities. Given a set of known binding sites (BSs) of a given transcription factor (TF), computational TFBS screening technique represents a cost efficient and large scale strategy to complement the experimental ones. There are two major classes of computational TFBS prediction algorithms based on the tertiary and primary structures, respectively. A tertiary structure based algorithm tries to calculate the binding affinity between a query DNA fragment and the tertiary structure of the given TF. Due to the limited number of available TF tertiary structures, primary structure based TFBS prediction algorithm is a necessary complementary technique for large scale TFBS screening. This study proposes a novel evolutionary algorithm to randomly mutate the weights of different positions in the binding motif of a TF, so that the overall TFBS prediction accuracy is optimized. The comparison with the most widely used algorithm, Position Weight Matrix (PWM), suggests that our algorithm performs better or the same level in all the performance measurements, including sensitivity, specificity, accuracy and Matthews correlation coefficient. Our data also suggests that it is necessary to remove the widely used assumption of independence between motif positions. The supplementary material may be found at: http://www.healthinformaticslab.org/supp/ . PMID:25387969

  2. Transcription Factor AP1 Potentiates Chromatin Accessibility and Glucocorticoid Receptor Binding

    PubMed Central

    Biddie, Simon C.; John, Sam; Sabo, Pete J.; Thurman, Robert E.; Johnson, Thomas A.; Schiltz, R. Louis; Miranda, Tina B.; Sung, Myong-Hee; Trump, Saskia; Lightman, Stafford L.; Vinson, Charles; Stamatoyannopoulos, John A.; Hager, Gordon L.

    2011-01-01

    Summary Ligand-dependent transcription by the nuclear receptor glucocorticoid receptor (GR) is mediated by interactions with co-regulators. The role of these interactions in determining selective binding of GR to regulatory elements remains unclear. Recent findings indicate a large fraction of genomic GR binding coincides with chromatin that is accessible prior to hormone treatment, suggesting that receptor binding is dictated by proteins that maintain chromatin in an open state. Combining DNaseI accessibility and chromatin immunoprecipitation with high-throughput sequencing, we identify the activator protein 1 (AP1) as a major partner for productive GR-chromatin interactions. AP1 is critical for GR-regulated transcription and recruitment to co-occupied regulatory elements, illustrating an extensive AP1-GR interaction network. Importantly, the maintenance of baseline chromatin accessibility facilitates GR recruitment and is dependent on AP1 binding. We propose a model where the basal occupancy of transcription factors act to prime chromatin and direct inducible transcription factors to select regions in the genome. PMID:21726817

  3. Binding of a liver-specific factor to the human albumin gene promoter and enhancer

    SciTech Connect

    Frain, M.; Hardon, E.; Ciliberto, G. ); Sala-Trepat, J.M. )

    1990-03-01

    A segment of 1,022 base pairs (bp) of the 5{prime}-flanking region of the human albumin gene, fused to a reporter gene, directs hepatoma-specific transcription. Three functionally distinct regions have been defined by deletion analysis: a negative element located between bp {minus}673 and {minus}486, an enhancer essential for efficient albumin transcription located between bp {minus}486 and {minus}221, and a promoter spanning a region highly conserved throughout evolution. Protein-binding studies have demonstrated that a liver {ital trans}-acting factor which interacts with the enhancer region is the well-characterized transcription factor LF-B1, which binds to promoters of several liver-specific genes. A synthetic oligodeoxynucleotide containing the LF-B1-binding site is sufficient to act as a tissue-specific transcriptional enhancer when placed in front of the albumin promoter. The fact that the same binding site functions in both an enhancer and a promoter suggests that these two elements influence the initiation of transcription through similar mechanisms.

  4. S phase-specific DNA-binding proteins interacting with the Hex and Oct motifs in type I element of the wheat histone H3 promoter.

    PubMed

    Minami, M; Meshi, T; Iwabuchi, M

    2000-01-11

    The type I element (CCACGTCANCGATCCGCG), consisting of the Hex motif (CCACGTCA) and the reverse-oriented Oct motif (GATCCGCG), is necessary and sufficient to confer the S phase-specific transcription of the wheat histone H3 (TH012) gene. The transcriptional regulation via the type I element is thought to occur through interactions between transcription factors which bind specifically to the Hex and Oct motifs. Here we report S phase-specific DNA-binding proteins interacting with the type I element in partially synchronized wheat cultured cells. Hex motif-binding proteins found here resembled HBP-1a, as reported previously in terms of DNA-binding specificity. DNA-binding activities of the HBP-1a-like proteins were modulated by phosphorylation/dephosphorylation. In the electrophoretic mobility shift assay of the wheat nuclear extract, we also found three Oct motif-specific binding proteins, named OBRF (octamer-binding regulatory factor)-1, -2 and -3. One of the HBP-1a-like proteins and OBRF-1 appeared predominantly at the S phase. Thus, it was supposed that these two factors play a crucial role in the S phase-specific regulation of wheat histone gene expression. PMID:10675046

  5. Cellular Actions of Insulin-Like Growth Factor Binding Proteins

    PubMed Central

    Ferry, R. J.; Katz, L. E. L.; Grimberg, Adda; Cohen, P.; Weinzimer, S. A.

    2014-01-01

    The insulin-like growth factors (IGFs), insulin-like growth factor binding proteins (IGFBPs), and the IGFBP proteases are involved in the regulation of somatic growth and cellular proliferation both in vivo and in vitro. IGFs are potent mitogenic agents whose actions are determined by the availability of free IGFs to interact with the IGF receptors. IGFBPs comprise a family of proteins that bind IGFs with high affinity and specificity and thereby regulate IGF-dependent actions. IGFBPs have recently emerged as IGF-independent regulators of cell growth. Various IGFBP association proteins as well as cleavage of IGFBPs by specific proteases modulate levels of free IGFs and IGFBPs. The ubiquity and complexity of the IGF axis promise exciting discoveries and applications for the future. PMID:10226802

  6. Purification of a novel MHC class I element binding activity from thymus nuclear extracts reveals that thymic RBP-Jkappa/CBF1 binds to NF-kappaB-like elements.

    PubMed

    Shirakata, Y; Shuman, J D; Coligan, J E

    1996-06-15

    We purified a DNA binding protein that recognizes a portion of the MHC class I regulatory element region 1/NF-kappaB binding site whose expression correlates with the expression of a MHC class I transgene in the thymus. The N-terminal amino acid sequence and the molecular size matched the RBP-Jkappa protein, also known as the EBV C-promoter binding factor, CBF1. Anti-peptide sera reactive with RBP-Jkappa/CBF1 also reacted with this protein in gel mobility shift assays. Although RBP-Jkappa/CBF1 is ubiquitously expressed, binding to the MHC class Ia NF-kappaB site was limited to the thymus. Comparison of the DNA binding specificities of RBP-Jkappa/CBF1 in thymic and splenic nuclear extracts revealed strong binding from both extracts to an IFN-beta kappaB site containing the RBP-Jkappa/CBF1 consensus sequence (CGTGGGAA). In contrast, only the thymic nuclear extract showed strong DNA binding activity with probes containing the NF-kappaB recognition sequences present in the MHC class Ia, IL-2Ralpha, and granulocyte-macrophage CSF promoters. Thus, RBP-Jkappa/CBF1 in thymic extracts demonstrates a clearly distinguishable DNA binding specificity that correlates with tissue-specific expression of a class I transgene. This, coupled with the fact that our previous study showed enhanced expression of the transgene in CD4+CD8+ thymocytes, suggests that RBP-Jkappa/CBF1 may play a role in the development of the immune system. PMID:8648111

  7. A universal transcription pause sequence is an element of initiation factor σ70-dependent pausing.

    PubMed

    Bird, Jeremy G; Strobel, Eric J; Roberts, Jeffrey W

    2016-08-19

    The Escherichia coli σ70 initiation factor is required for a post-initiation, promoter-proximal pause essential for regulation of lambdoid phage late gene expression; potentially, σ70 acts at other sites during transcription elongation as well. The pause is induced by σ70 binding to a repeat of the promoter -10 sequence. After σ70 binding, further RNA synthesis occurs as DNA is drawn (or 'scrunched') into the enzyme complex, presumably exactly as occurs during initial synthesis from the promoter; this synthesis then pauses at a defined site several nucleotides downstream from the active center position when σ70 first engages the -10 sequence repeat. We show that the actual pause site in the stabilized, scrunched complex is the 'elemental pause sequence' recognized from its frequent occurrence in the E. coli genome. σ70 binding and the elemental pause sequence together, but neither alone, produce a substantial transcription pause. PMID:27098041

  8. AthaMap: from in silico data to real transcription factor binding sites.

    PubMed

    Bülow, Lorenz; Steffens, Nils Ole; Galuschka, Claudia; Schindler, Martin; Hehl, Reinhard

    2006-01-01

    AthaMap generates a map for cis-regulatory sequences for the whole Arabidopsis thaliana genome. AthaMap was initially developed by matrix-based detection of putative transcription factor binding sites (TFBS) mostly determined from random binding site selection experiments. Now, also experimentally verified TFBS have been included for 48 different Arabidopsis thaliana transcription factors (TF). Based on these sequences, 89,416 very similar putative TFBS were determined within the genome of A. thaliana and annotated to AthaMap. Matrix- and single sequence-based binding sites can be included in colocalization analysis for the identification of combinatorial cis-regulatory elements. As an example, putative target genes of the WRKY18 transcription factor that is involved in plant-pathogen interaction were determined. New functions of AthaMap include descriptions for all annotated Arabidopsis thaliana genes and direct links to TAIR, TIGR and MIPS. Transcription factors used in the binding site determination are linked to TAIR and TRANSFAC databases. AthaMap is freely available at http://www.athamap.de. PMID:16922688

  9. SeqGL Identifies Context-Dependent Binding Signals in Genome-Wide Regulatory Element Maps

    PubMed Central

    Setty, Manu; Leslie, Christina S.

    2015-01-01

    Genome-wide maps of transcription factor (TF) occupancy and regions of open chromatin implicitly contain DNA sequence signals for multiple factors. We present SeqGL, a novel de novo motif discovery algorithm to identify multiple TF sequence signals from ChIP-, DNase-, and ATAC-seq profiles. SeqGL trains a discriminative model using a k-mer feature representation together with group lasso regularization to extract a collection of sequence signals that distinguish peak sequences from flanking regions. Benchmarked on over 100 ChIP-seq experiments, SeqGL outperformed traditional motif discovery tools in discriminative accuracy. Furthermore, SeqGL can be naturally used with multitask learning to identify genomic and cell-type context determinants of TF binding. SeqGL successfully scales to the large multiplicity of sequence signals in DNase- or ATAC-seq maps. In particular, SeqGL was able to identify a number of ChIP-seq validated sequence signals that were not found by traditional motif discovery algorithms. Thus compared to widely used motif discovery algorithms, SeqGL demonstrates both greater discriminative accuracy and higher sensitivity for detecting the DNA sequence signals underlying regulatory element maps. SeqGL is available at http://cbio.mskcc.org/public/Leslie/SeqGL/. PMID:26016777

  10. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    SciTech Connect

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil Lee, Zang Hee

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  11. Heparin-binding properties of human serum spreading factor.

    PubMed

    Barnes, D W; Reing, J E; Amos, B

    1985-08-01

    Human serum spreading factor (SF) is a blood glycoprotein that promotes attachment and spreading and influences growth, migration, and differentiation of a variety of animal cells in culture. SF purified from human plasma or serum by chromatographic methods reported previously (Barnes, D. W., and Silnutzer, J. (1983) J. Biol. Chem. 258, 12548-12552) does not bind to heparin-Sepharose under conditions of physiological ionic strength and pH. In a further examination of the heparin-binding properties of human serum SF, we found that exposure of purified SF to 8 M urea altered several properties of the protein, including heparin affinity, and these alterations remained after removal of the urea from SF solutions. Urea-treated SF bound to heparin under physiological conditions, and salt concentrations of 0.4 M or higher were required for elution of urea-treated SF from heparin-Sepharose at pH 7.0. The alteration of heparin-binding properties of SF also was observed upon exposure of the protein to heat or acid. Treatment of SF with urea, heat, or acid resulted additionally in greatly decreased cell spreading-promoting activity of the molecule. The decreased biological activity was associated with a reduced ability of the treated SF to bind to the cell culture substratum, a prerequisite for the attachment-promoting activity of the molecule. Experiments examining the heparin-binding properties of native SF in unfractionated human plasma indicated that the major portion of SF in blood did not bind to heparin under conditions of physiological ionic strength and pH. PMID:2410408

  12. Compact, universal DNA microarrays to comprehensively determine transcription-factor binding site specificities

    PubMed Central

    Berger, Michael F.; Philippakis, Anthony A.; Qureshi, Aaron M.; He, Fangxue S.; Estep, Preston W.; Bulyk, Martha L.

    2015-01-01

    Transcription factors (TFs) regulate the expression of genes involved in myriad cellular processes through sequence-specific interactions with DNA. In order to predict DNA regulatory elements and the TFs targeting them with greater accuracy, detailed knowledge of the binding preferences of TFs is needed. Protein binding microarray (PBM) technology permits rapid, high-throughput characterization of the in vitro DNA binding specificities of proteins1. Here, we present a novel, maximally compact, synthetic DNA sequence design that represents all possible DNA sequence variants of a given length k (i.e., all “k-mers”) on a single, universal microarray. We constructed such all k-mer microarrays covering all 10 base pair (bp) binding sites by converting high-density single-stranded oligonucleotide arrays to double-stranded DNA arrays. Using these microarrays, we comprehensively determined the binding specificities over a full range of affinities for five TFs of diverse structural classes from yeast, worm, mouse, and human. Importantly, the unbiased coverage of all k-mers permits an interrogation of binding site preferences, including nucleotide interdependencies, at unprecedented resolution. PMID:16998473

  13. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  14. Gene size differentially affects the binding of yeast transcription factor tau to two intragenic regions.

    PubMed Central

    Baker, R E; Camier, S; Sentenac, A; Hall, B D

    1987-01-01

    Yeast transcription factor tau (transcription factor IIIC) specifically interacts with tRNA genes, binding to both the A block and the B block elements of the internal promoter. To study the influence of A block-B block spacing, we analyzed the binding of purified tau protein to a series of internally deleted yeast tRNA(3Leu) genes with A and B blocks separated by 0 to 74 base pairs. Optimal binding occurred with genes having A block-B block distances of 30-60 base pairs; the relative helical orientation of the A and B blocks was unimportant. Results from DNase I "footprinting" and lambda exonuclease protection experiments were consistent with these findings and further revealed that changes in A block-B block distance primarily affect the ability of tau to interact with A block sequences; B block interactions are unaltered. When the A block-B block distance is 17 base pairs or less, tau interacts with a sequence located 15 base pairs upstream of the normal A block, and a new RNA initiation site is observed by in vitro transcription. We propose that the initial binding of tau to the B block activates transcription by enhancing its ability to bind at the A block, and that the A block interaction ultimately directs initiation by RNA polymerase III. Images PMID:2827154

  15. Telomerase RNA stem terminus element affects template boundary element function, telomere sequence, and shelterin binding

    PubMed Central

    Webb, Christopher J.; Zakian, Virginia A.

    2015-01-01

    The stem terminus element (STE), which was discovered 13 y ago in human telomerase RNA, is required for telomerase activity, yet its mode of action is unknown. We report that the Schizosaccharomyces pombe telomerase RNA, TER1 (telomerase RNA 1), also contains a STE, which is essential for telomere maintenance. Cells expressing a partial loss-of-function TER1 STE allele maintained short stable telomeres by a recombination-independent mechanism. Remarkably, the mutant telomere sequence was different from that of wild-type cells. Generation of the altered sequence is explained by reverse transcription into the template boundary element, demonstrating that the STE helps maintain template boundary element function. The altered telomeres bound less Pot1 (protection of telomeres 1) and Taz1 (telomere-associated in Schizosaccharomyces pombe 1) in vivo. Thus, the S. pombe STE, although distant from the template, ensures proper telomere sequence, which in turn promotes proper assembly of the shelterin complex. PMID:26305931

  16. Saccharin and Cyclamate Inhibit Binding of Epidermal Growth Factor

    NASA Astrophysics Data System (ADS)

    Lee, L. S.

    1981-02-01

    The binding of 125I-labeled mouse epidermal growth factor (EGF) to 18 cell lines, including HeLa (human carcinoma), MDCK (dog kidney cells), HTC (rat hepatoma), K22 (rat liver), HF (human foreskin), GM17 (human skin fibroblasts), XP (human xeroderma pigmentosum fibroblasts), and 3T3-L1 (mouse fibroblasts), was inhibited by saccharin and cyclamate. The human cells were more sensitive to inhibition by these sweeteners than mouse or rat cells. EGF at doses far above the physiological levels reversed the inhibition in rodent cells but not in HeLa cells. In HeLa cells, the doses of saccharin and cyclamate needed for 50% inhibition were 3.5 and 9.3 mg/ml, respectively. Glucose, 2-deoxyglucose, sucrose, and xylitol did not inhibit EGF binding. Previous studies have shown that phorbol esters, strongly potent tumor promoters, also inhibit EGF binding to tissue culture cells. To explain the EGF binding inhibition by such greatly dissimilar molecules as phorbol esters, saccharin, and cyclamate, it is suggested that they operate through the activation of a hormone response control unit.

  17. Identification of cellular factors binding to acetylated HIV-1 integrase.

    PubMed

    Allouch, Awatef; Cereseto, Anna

    2011-11-01

    The viral protein integrase (IN) catalyzes the integration of the HIV-1 cDNA into the host cellular genome. We have recently demonstrated that IN is acetylated by a cellular histone acetyltransferase, p300, which modifies three lysines located in the C-terminus of the viral factor (Cereseto et al. in EMBO J 24:3070-3081, 2005). This modification enhances IN catalytic activity, as demonstrated by in vitro assays. Consistently, mutations introduced in the targeted lysines greatly decrease the efficiency of HIV-1 integration. Acetylation was proven to regulate protein functions by modulating protein-protein interactions. HIV-1 to efficiently complete its replication steps, including the integration reaction, requires interacting with numerous cellular factors. Therefore, we sought to investigate whether acetylation might modulate the interaction between IN and the cellular factors. To this aim we performed a yeast two-hybrid screening that differs from the screenings so far performed (Rain et al. in Methods 47:291-297, 2009; Studamire and Goff in Retrovirology 5:48, 2008) for using as bait IN constitutively acetylated. From this analysis we have identified thirteen cellular factors involved in transcription, chromatin remodeling, nuclear transport, RNA binding, protein synthesis regulation and microtubule organization. To validate these interactions, binding assays were performed showing that acetylation increases the affinity of IN with specific factors. Nevertheless, few two-hybrid hits bind with the same affinity the acetylated and the unmodified IN. These results further underlie the relevance of IN post-translational modification by acetylation in HIV-1 replication cycle. PMID:20016921

  18. Understanding variation in transcription factor binding by modeling transcription factor genome-epigenome interactions.

    PubMed

    Chen, Chieh-Chun; Xiao, Shu; Xie, Dan; Cao, Xiaoyi; Song, Chun-Xiao; Wang, Ting; He, Chuan; Zhong, Sheng

    2013-01-01

    Despite explosive growth in genomic datasets, the methods for studying epigenomic mechanisms of gene regulation remain primitive. Here we present a model-based approach to systematically analyze the epigenomic functions in modulating transcription factor-DNA binding. Based on the first principles of statistical mechanics, this model considers the interactions between epigenomic modifications and a cis-regulatory module, which contains multiple binding sites arranged in any configurations. We compiled a comprehensive epigenomic dataset in mouse embryonic stem (mES) cells, including DNA methylation (MeDIP-seq and MRE-seq), DNA hydroxymethylation (5-hmC-seq), and histone modifications (ChIP-seq). We discovered correlations of transcription factors (TFs) for specific combinations of epigenomic modifications, which we term epigenomic motifs. Epigenomic motifs explained why some TFs appeared to have different DNA binding motifs derived from in vivo (ChIP-seq) and in vitro experiments. Theoretical analyses suggested that the epigenome can modulate transcriptional noise and boost the cooperativity of weak TF binding sites. ChIP-seq data suggested that epigenomic boost of binding affinities in weak TF binding sites can function in mES cells. We showed in theory that the epigenome should suppress the TF binding differences on SNP-containing binding sites in two people. Using personal data, we identified strong associations between H3K4me2/H3K9ac and the degree of personal differences in NFκB binding in SNP-containing binding sites, which may explain why some SNPs introduce much smaller personal variations on TF binding than other SNPs. In summary, this model presents a powerful approach to analyze the functions of epigenomic modifications. This model was implemented into an open source program APEG (Affinity Prediction by Epigenome and Genome, http://systemsbio.ucsd.edu/apeg). PMID:24339764

  19. Direct binding of hepatocyte growth factor and vascular endothelial growth factor to CD44v6

    PubMed Central

    Volz, Yvonne; Koschut, David; Matzke-Ogi, Alexandra; Dietz, Marina S.; Karathanasis, Christos; Richert, Ludovic; Wagner, Moritz G.; Mély, Yves; Heilemann, Mike; Niemann, Hartmut H.; Orian-Rousseau, Véronique

    2015-01-01

    CD44v6, a member of the CD44 family of transmembrane glycoproteins is a co-receptor for two receptor tyrosine kinases (RTKs), Met and VEGFR-2 (vascular endothelial growth factor receptor 2). CD44v6 is not only required for the activation of these RTKs but also for signalling. In order to understand the role of CD44v6 in Met and VEGFR-2 activation and signalling we tested whether CD44v6 binds to their ligands, HGF (hepatocyte growth factor) and VEGF (vascular endothelial growth factor), respectively. FACS analysis and cellular ELISA showed binding of HGF and VEGF only to cells expressing CD44v6. Direct binding of CD44v6 to HGF and VEGF was demonstrated in pull-down assays and the binding affinities were determined using MicroScale Thermophoresis, fluorescence correlation spectroscopy and fluorescence anisotropy. The binding affinity of CD44v6 to HGF is in the micromolar range in contrast with the high-affinity binding measured in the case of VEGF and CD44v6, which is in the nanomolar range. These data reveal a heparan sulfate-independent direct binding of CD44v6 to the ligands of Met and VEGFR-2 and suggest different roles of CD44v6 for these RTKs. PMID:26181364

  20. Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.

    PubMed

    Rushton, P J; Hooley, R; Lazarus, C M

    1992-09-01

    Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes. PMID:1511135

  1. Binding among Select Episodic Elements Is Altered via Active Short-Term Retrieval

    ERIC Educational Resources Information Center

    Bridge, Donna J.; Voss, Joel L.

    2015-01-01

    Of the many elements that comprise an episode, are any disproportionately bound to the others? We tested whether active short-term retrieval selectively increases binding. Individual objects from multiobject displays were retrieved after brief delays. Memory was later tested for the other objects. Cueing with actively retrieved objects facilitated…

  2. Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

    PubMed Central

    Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

    2016-01-01

    Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

  3. Overlapping sites for constitutive and induced DNA binding factors involved in interferon-stimulated transcription.

    PubMed Central

    Dale, T C; Rosen, J M; Guille, M J; Lewin, A R; Porter, A G; Kerr, I M; Stark, G R

    1989-01-01

    A 14 bp interferon (IFN)-stimulated response element (ISRE) from 6-16, a human gene regulated by alpha-IFN, confers IFN inducibility on a heterologous thymidine kinase promoter. A 39 bp double-stranded oligonucleotide corresponding to a 5' region of 6-16 which includes the ISRE competes for factors required for gene expression by alpha-IFN in transfected cells and a single base change (A-11 to C) within the ISRE (GGGAAAATGAAACT) abolishes this competition. Band-shift assays performed with whole-cell extracts and the 39 bp oligonucleotide reveal specific complexes formed by rapidly induced and constitutive factors, both of which fail to bind to the A-11 to C oligonucleotide. A detailed footprinting analysis reveals that these two types of factors bind to overlapping sites within the ISRE, but in very different ways. These data were used to design oligonucleotides which decreased the formation of the inducible complex without affecting the constitutive one. Changes at the 5' margin of the ISRE and upstream of it markedly decrease formation of the induced but not the constitutive complex and also abolish the ability of the 39 bp sequence to function as an inducible enhancer with the thymidine kinase promoter. Thus, induction of 6-16 transcription in IFN-treated cells is likely to be stimulated by binding of the induced factor to the ISRE and upstream sequences, while the subsequent suppression of transcription may involve competition for the ISRE by the other class of factors. Images PMID:2721502

  4. Distinct binding and immunogenic properties of the gonococcal homologue of meningococcal factor h binding protein.

    PubMed

    Jongerius, Ilse; Lavender, Hayley; Tan, Lionel; Ruivo, Nicola; Exley, Rachel M; Caesar, Joseph J E; Lea, Susan M; Johnson, Steven; Tang, Christoph M

    2013-01-01

    Neisseria meningitidis is a leading cause of sepsis and meningitis. The bacterium recruits factor H (fH), a negative regulator of the complement system, to its surface via fH binding protein (fHbp), providing a mechanism to avoid complement-mediated killing. fHbp is an important antigen that elicits protective immunity against the meningococcus and has been divided into three different variant groups, V1, V2 and V3, or families A and B. However, immunisation with fHbp V1 does not result in cross-protection against V2 and V3 and vice versa. Furthermore, high affinity binding of fH could impair immune responses against fHbp. Here, we investigate a homologue of fHbp in Neisseria gonorrhoeae, designated as Gonococcal homologue of fHbp (Ghfp) which we show is a promising vaccine candidate for N. meningitidis. We demonstrate that Gfhp is not expressed on the surface of the gonococcus and, despite its high level of identity with fHbp, does not bind fH. Substitution of only two amino acids in Ghfp is sufficient to confer fH binding, while the corresponding residues in V3 fHbp are essential for high affinity fH binding. Furthermore, immune responses against Ghfp recognise V1, V2 and V3 fHbps expressed by a range of clinical isolates, and have serum bactericidal activity against N. meningitidis expressing fHbps from all variant groups. PMID:23935503

  5. Ubiquitous and neuronal DNA-binding proteins interact with a negative regulatory element of the human hypoxanthine phosphoribosyltransferase gene.

    PubMed Central

    Rincón-Limas, D E; Amaya-Manzanares, F; Niño-Rosales, M L; Yu, Y; Yang, T P; Patel, P I

    1995-01-01

    The hypoxanthine phosphoribosyltransferase (HPRT) gene is constitutively expressed at low levels in all tissues but at higher levels in the brain; the significance and mechanism of this differential expression are unknown. We previously identified a 182-bp element (hHPRT-NE) within the 5'-flanking region of the human HPRT (hHPRT) gene, which is involved not only in conferring neuronal specificity but also in repressing gene expression in nonneuronal tissues. Here we report that this element interacts with different nuclear proteins, some of which are present specifically in neuronal cells (complex I) and others of which are present in cells showing constitutive expression of the gene (complex II). In addition, we found that complex I factors are expressed in human NT2/D1 cells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation. We also mapped the binding sites for both complexes to a 60-bp region (Ff; positions -510 to -451) which, when analyzed in transfection assays, functioned as a repressor element analogous to the full-length hHPRT-NE sequence. Methylation interference footprintings revealed a minimal unique DNA motif, 5'-GGAAGCC-3', as the binding site for nuclear proteins from both neuronal and nonneuronal sources. However, site-directed mutagenesis of the footprinted region indicated that different nucleotides are essential for the associations of these two complexes. Moreover, UV cross-linking experiments showed that both complexes are formed by the association of several different proteins. Taken together, these data suggest that differential interaction of DNA-binding factors with this regulatory element plays a crucial role in the brain-preferential expression of the gene, and they should lead to the isolation of transcriptional regulators important in neuronal expression of the HPRT gene. PMID:8524221

  6. Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon.

    PubMed

    Gooding, C; Roberts, G C; Smith, C W

    1998-01-01

    Splicing of exons 2 and 3 of a-tropomyosin (TM) involves mutually exclusive selection of either exon 3, which occurs in most cells, or of exon 2 in smooth muscle (SM) cells. The SM-specific selection of exon 2 results from the inhibition of exon 3. At least two essential cis-acting elements are required for exon 3 inhibition, the upstream and downstream regulatory elements (URE and DRE). These elements are essential for repression of TM exon 3 in SM cells, and also mediate a low level of repression of exon 3 in an in vitro 5' splice site competition assay in HeLa extracts. Here, we show that the DRE consists of at least two discrete components, a short region containing a number of UGC motifs, and an essential pyrimidine-rich tract (DY). We show that the specific sequence of the DY element is important and that DY is able to bind to factors in HeLa nuclear extracts that mediate a low background level of exon 3 skipping. Deletion of a sequence within DY identified as an optimal binding site for PTB impairs (1) regulation of splicing in vivo, (2) skipping of exon 3 in an in vitro 5' splice site competition, (3) the ability of DY competitors to affect the 5' splice site competition in vitro, and (4) binding of PTB to DY. Addition of recombinant PTB to in vitro splicing reactions is able to partially reverse the effects of the DY competitor RNA. The data are consistent with a model for regulation of TM splicing that involves the participation of both tissue-specific and general inhibitory factors and in which PTB plays a role in repressing both splice sites of exon 3. PMID:9436911

  7. Structural Requirements for Sterol Regulatory Element-binding Protein (SREBP) Cleavage in Fission Yeast*

    PubMed Central

    Cheung, Rocky; Espenshade, Peter J.

    2013-01-01

    Sterol regulatory element-binding proteins (SREBPs) are central regulators of cellular lipid synthesis and homeostasis. Mammalian SREBPs are proteolytically activated and liberated from the membrane by Golgi Site-1 and Site-2 proteases. Fission yeast SREBPs, Sre1 and Sre2, employ a different mechanism that genetically requires the Golgi Dsc E3 ligase complex for cleavage activation. Here, we established Sre2 as a model to define structural requirements for SREBP cleavage. We showed that Sre2 cleavage does not require the N-terminal basic helix-loop-helix zipper transcription factor domain, thus separating cleavage of Sre2 from its transcription factor function. From a mutagenesis screen of 94 C-terminal residues of Sre2, we isolated 15 residues required for cleavage and further identified a glycine-leucine sequence required for Sre2 cleavage. Importantly, the glycine-leucine sequence is located at a conserved distance before the first transmembrane segment of both Sre1 and Sre2 and cleavage occurs in between this sequence and the membrane. Bioinformatic analysis revealed a broad conservation of this novel glycine-leucine motif in SREBP homologs of ascomycete fungi, including the opportunistic human pathogen Aspergillus fumigatus where SREBP is required for virulence. Consistent with this, the sequence was also required for cleavage of the oxygen-responsive transcription factor Sre1 and adaptation to hypoxia, demonstrating functional conservation of this cleavage recognition motif. These cleavage mutants will aid identification of the fungal SREBP protease and facilitate functional dissection of the Dsc E3 ligase required for SREBP activation and fungal pathogenesis. PMID:23729666

  8. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling

    PubMed Central

    Lisse, Thomas S.; Hewison, Martin; Adams, John S.

    2011-01-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as “vitamin D or estrogen response element-binding proteins”, behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. PMID:21236284

  9. Growth factors with heparin binding affinity in human synovial fluid

    SciTech Connect

    Hamerman, D.; Taylor, S.; Kirschenbaum, I.; Klagsbrun, M.; Raines, E.W.; Ross, R.; Thomas, K.A.

    1987-12-01

    Synovial effusions were obtained from the knees of 15 subjects with joint trauma, menisceal or ligamentous injury, or osteoarthritis. Heparin-Sepharose affinity chromatography of these synovial fluids revealed, in general, three major peaks of mitogenic activity as measured by incorporation of /sup 3/H-thymidine into 3T3 cells. Gradient elution patterns showed activities at 0.5M NaCl, which is characteristic of platelet derived growth factor, and at 1.1 M NaCl and 1.6M NaCl, indicative of acidic and basic fibroblast growth factors, respectively. The identities of these mitogenic fractions were confirmed by specific immunologic and receptor-binding assays. The presence of platelet derived, acidic and basic fibroblast growth factors in the synovial fluid may contribute to wound healing in the arthritic joint.

  10. POBO, transcription factor binding site verification with bootstrapping

    PubMed Central

    Kankainen, Matti; Holm, Liisa

    2004-01-01

    Transcription factors can either activate or repress target genes by binding onto short nucleotide sequence motifs in the promoter regions of these genes. Here, we present POBO, a promoter bootstrapping program, for gene expression data. POBO can be used to detect, compare and verify predetermined transcription factor binding site motifs in the promoters of one or two clusters of co-regulated genes. The program calculates the frequencies of the motif in the input promoter sets. A bootstrap analysis detects significantly over- or underrepresented motifs. The output of the program presents bootstrapped results in picture and text formats. The program was tested with published data from transgenic WRKY70 microarray experiments. Intriguingly, motifs recognized by the WRKY transcription factors of plant defense pathways are similarly enriched in both up- and downregulated clusters. POBO analysis suggests slightly modified hypothetical motifs that discriminate between up- and downregulated clusters. In conclusion, POBO allows easy, fast and accurate verification of putative regulatory motifs. The statistical tests implemented in POBO can be useful in eliminating false positives from the results of pattern discovery programs and increasing the reliability of true positives. POBO is freely available from http://ekhidna.biocenter.helsinki.fi:9801/pobo. PMID:15215385

  11. Octamer-binding transcription factors: genomics and functions.

    PubMed

    Zhao, Feng-Qi

    2013-01-01

    The Octamer-binding proteins (Oct) are a group of highly conserved transcription factors that specifically bind to the octamer motif (ATGCAAAT) and closely related sequences in promoters and enhancers of a wide variety of genes. Oct factors belong to the larger family of POU domain factors that are characterized by the presence of an amino-terminal specific subdomain (POUS) and a carboxyl-terminal homeo-subdomain (POUH). Eleven Oct proteins have been named (Oct1-11), and currently, eight genes encoding Oct proteins (Oct1, Oct2, Oct3/4, Oct6, Oct7, Oct8, Oct9, and Oct11) have been cloned. Oct1 and Oct2 are widely expressed in adult tissues, while other Oct proteins are much more restricted in their expression patterns. Oct proteins are implicated in crucial and versatile biological events, such as embryogenesis, neurogenesis, immunity, and body glucose and amino acid metabolism. The aberrant expression and null function of Oct proteins have also been linked to various diseases, including deafness, diabetes and cancer. In this review, I will report both the genomic structure and major functions of individual Oct proteins in physiological and pathological processes. PMID:23747866

  12. Regulation of cyclic AMP response element-binding protein during neuroglial interactions.

    PubMed

    Qin, LiMei; Bouchard, Ron; Pugazhenthi, Subbiah

    2016-03-01

    Communications between neurons and glial cells play an important role in regulating homeostasis in the central nervous system. cAMP response element-binding protein (CREB), a transcription factor, is down-regulated by neurotoxins, which are known to be released by activated glial cells. To determine the role of CREB signaling in neuroglial interactions, we used three neuroglial coculture models consisting of human neuroprogenitor cell (NPC)-derived neurons and human microglia. Conditioned medium from the Abeta (Aβ)-activated microglia decreased CREB phosphorylation and brain-derived neurotrophic factor promoter activity (47%), whereas the same medium induced (p < 0.01) the promoter of CXCL10, a chemokine, in NPC-derived neuron-rich cultures. These effects were reversed when microglia were exposed to Aβ in the presence of minocycline, an anti-inflammatory agent. The expression of CREB targets, including brain-derived neurotrophic factor, synapsin-1, and BIRC3 decreased by 50-65% (p < 0.01) in neurons isolated by laser capture microdissection in close proximity of microglia in neuroglial mixed cultures. Neuronal survival actively modulated microglial behavior when neurons and microglia were cocultured side-by-side on semicircles of ACLAR membrane. Neuronal injury, caused by the over-expression of dominant negative form of CREB, exacerbated Aβ-mediated microglial activation, whereas CREB over-expression resulted in decreased microglial activation. Decreases in the levels of neuronal markers were observed when NPCs were differentiated in the presence of proinflammatory cytokines IL-1β, tumor necrosis factor α, or IL-6. Instead, the NPCs differentiated into a glial phenotype, and these effects were more pronounced in the presence of tumor necrosis factor α. Our findings suggest that CREB down-regulation is an important component of defective neuroglial communications in the brain during neuroinflammation. Neuroglial interactions were examined using coculture

  13. Conservation of transcription factor binding specificities across 600 million years of bilateria evolution

    PubMed Central

    Nitta, Kazuhiro R; Jolma, Arttu; Yin, Yimeng; Morgunova, Ekaterina; Kivioja, Teemu; Akhtar, Junaid; Hens, Korneel; Toivonen, Jarkko; Deplancke, Bart; Furlong, Eileen E M; Taipale, Jussi

    2015-01-01

    Divergent morphology of species has largely been ascribed to genetic differences in the tissue-specific expression of proteins, which could be achieved by divergence in cis-regulatory elements or by altering the binding specificity of transcription factors (TFs). The relative importance of the latter has been difficult to assess, as previous systematic analyses of TF binding specificity have been performed using different methods in different species. To address this, we determined the binding specificities of 242 Drosophila TFs, and compared them to human and mouse data. This analysis revealed that TF binding specificities are highly conserved between Drosophila and mammals, and that for orthologous TFs, the similarity extends even to the level of very subtle dinucleotide binding preferences. The few human TFs with divergent specificities function in cell types not found in fruit flies, suggesting that evolution of TF specificities contributes to emergence of novel types of differentiated cells. DOI: http://dx.doi.org/10.7554/eLife.04837.001 PMID:25779349

  14. Hepatocyte uptake and nuclear binding of epidermal growth factor (EGF)

    SciTech Connect

    Moriarity, D.M.; Underwood, T.

    1987-05-01

    The internalization of /sup 125/I-EGF and its cell-membrane receptor by target cells suggests a possible intracellular role for EGF and/or its receptor. They have examined the uptake of /sup 125/I-EGF by primary cultures of adult rat hepatocytes after 1, 24 and 48 hours of incubation in the presence of the growth factor. A significant increase in the association of radioactivity with various nuclear fractions was observed between 1 and 24 hours incubation. After 1 hour approximately 2% of the total specific binding was associated with both the nuclear sap proteins extractable with 0.14 M NaCl and with the residual nucleoplasm, while about 1% or less was associated with the nuclear membrane and the chromatin fractions. After 24 hours the percentage associated with the nuclear membrane and chromatin fractions increased 2-4 fold. Binding of /sup 125/I-EGF to isolated nuclei from intact livers of adult rats followed by fractionation of the nuclei after incubation with /sup 125/I-EGF indicated that after 60 min at 37/sup 0/C there was a substantial amount of specific binding associated with the nucleoplasm, nuclear membranes and chromatin fractions. These data indicate that specific interactions of EGF with nuclear components occur in both intact normal hepatocytes and in isolated nuclei from intact liver.

  15. Estimating binding properties of transcription factors from genome-wide binding profiles.

    PubMed

    Zabet, Nicolae Radu; Adryan, Boris

    2015-01-01

    The binding of transcription factors (TFs) is essential for gene expression. One important characteristic is the actual occupancy of a putative binding site in the genome. In this study, we propose an analytical model to predict genomic occupancy that incorporates the preferred target sequence of a TF in the form of a position weight matrix (PWM), DNA accessibility data (in the case of eukaryotes), the number of TF molecules expected to be bound specifically to the DNA and a parameter that modulates the specificity of the TF. Given actual occupancy data in the form of ChIP-seq profiles, we backwards inferred copy number and specificity for five Drosophila TFs during early embryonic development: Bicoid, Caudal, Giant, Hunchback and Kruppel. Our results suggest that these TFs display thousands of molecules that are specifically bound to the DNA and that whilst Bicoid and Caudal display a higher specificity, the other three TFs (Giant, Hunchback and Kruppel) display lower specificity in their binding (despite having PWMs with higher information content). This study gives further weight to earlier investigations into TF copy numbers that suggest a significant proportion of molecules are not bound specifically to the DNA. PMID:25432957

  16. Two initiator-like elements are required for the combined activation of the human apolipoprotein C-III promoter by upstream stimulatory factor and hepatic nuclear factor-4.

    PubMed

    Pastier, Daniele; Lacorte, Jean-Marc; Chambaz, Jean; Cardot, Philippe; Ribeiro, Agnes

    2002-04-26

    Human apoC-III (-890/+24) promoter activity is strongly activated by hepatic nuclear factor (HNF)-4 through its binding to the proximal (-87/-72) element B. This site overlaps the binding site for an activity that we identified as the ubiquitously expressed upstream stimulatory factor (USF) (Ribeiro, A., Pastier, D., Kardassis, D., Chambaz, J., and Cardot, P. (1999) J. Biol. Chem. 274, 1216-1225). In the present study, we characterized the relationship between USF and HNF-4 in the activation of human apoC-III transcription. Although USF and HNF-4 binding to element B is mutually exclusive, co-transfection experiments in HepG2 cells surprisingly showed a combined effect of USF and HNF-4 in the transactivation of the (-890/+24) apoC-III promoter. This effect only requires the proximal region (-99/+24) of the apoC-III promoter and depends neither on USF binding to its cognate site in element B nor on a USF-dependent facilitation of HNF-4 binding to its site. By contrast, we found by electrophoretic mobility shift assay and footprinting analysis two USF low affinity binding sites, located within the proximal promoter at positions -58/-31 (element II) and -19/-4 (element I), which are homologous to initiator-like element sequence. Co-transfection experiments in HepG2 cells show that a mutation in element II reduces 2-fold the USF transactivation effect on the proximal promoter of apoC-III and that a mutation in element I inhibits the combined effect of USF and HNF-4. In conclusion, these initiator-like elements are directly involved in the transactivation of the apoC-III promoter by USF and are necessary to the combined effect between USF and HNF-4 for the apoC-III transcription. PMID:11839757

  17. Long-Term Memory for Place Learning Is Facilitated by Expression of cAMP Response Element-Binding Protein in the Dorsal Hippocampus

    ERIC Educational Resources Information Center

    Brightwell, Jennifer J.; Smith, Clayton A.; Neve, Rachael L.; Colombo, Paul J.

    2007-01-01

    Extensive research has shown that the hippocampus is necessary for consolidation of long-term spatial memory in rodents. We reported previously that rats using a place strategy to solve a cross maze task showed sustained phosphorylation of hippocampus cyclic AMP response element-binding protein (CREB), a transcription factor implicated in…

  18. Cloning, expression and purification of the factor H binding protein and its interaction with factor H

    PubMed Central

    Yarian, Fatemeh; Bandehpour, Mojgan; Seyed, Negar; Kazemi, Bahram

    2016-01-01

    Background and Objective: Neisseria meningitidis is a leading cause of meningitis and sepsis worldwide. The factor H binding protein (fHBP) is a key virulence factor of Neisseria meningitidis that is able to selectively bind to human factor H, the key regulator of the alternative complement pathway, which it has important implications for meningococcal pathogenesis and vaccine design. The aims of present research were cloning, expression, purification of fHbp and confirmation of the interaction between serum factor H (fH) and produced factor H binding protein. Materials and Methods: A 820 base pairs fhbp gene fragment was amplified by PCR and cloned into expression vector pET28a (+) in Bam HI and SalI restriction enzymes sites. Recombinant DNA was expressed in BL21 (DE3) cell. fHBP protein was purified by Ni-NTA agarose resin. Coupling of recombinant protein into CNBr activated Sepharose 4B resin was carried out for application in serum fH protein purification. (fH-fHBP) interaction was confirmed by SDS-PAGE and far-western blotting. Results and Conclusions: SDS-PAGE results showed a 35 kDa protein band. 150 kDa fH protein was purified by designed Sepharose 4B resin. Far-western blotting confirmed (fH-fHBP) interaction and proper folding of factor H binding protein. PMID:27092222

  19. Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology.

    PubMed Central

    Katsani, K R; Hajibagheri, M A; Verrijzer, C P

    1999-01-01

    The POZ domain is a conserved protein-protein interaction motif present in a variety of transcription factors involved in development, chromatin remodelling and human cancers. Here, we study the role of the POZ domain of the GAGA transcription factor in promoter recognition. Natural target promoters for GAGA typically contain multiple GAGA-binding elements. Our results show that the POZ domain mediates strong co-operative binding to multiple sites but inhibits binding to single sites. Protein cross-linking and gel filtration chromatography experiments established that the POZ domain is required for GAGA oligomerization into higher order complexes. Thus, GAGA oligomerization increases binding specificity by selecting only promoters with multiple sites. Electron microscopy revealed that GAGA binds to multiple sites as a large oligomer and induces bending of the promoter DNA. Our results indicate a novel mode of DNA binding by GAGA, in which a large GAGA complex binds multiple GAGA elements that are spread out over a region of a few hundred base pairs. We suggest a model in which the promoter DNA is wrapped around a GAGA multimer in a conformation that may exclude normal nucleosome formation. PMID:9927429

  20. Purification of folate binding factor in normal umbilical cord serum.

    PubMed Central

    Kamen, B A; Caston, J D

    1975-01-01

    Human umbilical cord serum was found to contain both free folate and folate complexed to a high-molecular weight factor. The complexed folate was bound to a very high affinity binder and was present in concentrations equivalent to as much as 60 ng of 5-methyltetrahydrofolic acid per ml of serum. Acidification of the serum caused disassociation of the folate-binder complex. Released folates were separated from binder by Sephadex gel filtration, zonal centrifugation through sucrose gradients, or adsorption onto activated charcoal. The separated binding factor, either saturated or unsaturated with folate, had a molecular weight of about 40,000 on Sephadex G-200 chromatography. Binding of [3H]pteroylglutamic acid was rapid and, as in the original endogenous folate-binder complex, was essentially irreversible at neutral pH. The affinity and specificity of the binder were examined by competition experiments using [3H]pteroylglutamic acid and nonradioactive folate derivatives. Oxidized folates were bound in preference to reduced derivatives, but only three to four times more unlabeled 5-methyltetrahydrofolic acid than pteroylglutamic acid was required to produce an equal level of competition. The strong affinity for 5-methyltetrahydrofolic acid, the main serum folate, suggests that the binder could be part of the mechanism by which the fetus concentrates maternally supplied folate for its growth and development. PMID:676

  1. Identification and purification of a Drosophila protein that binds to the terminal 31-base-pair inverted repeats of the P transposable element

    SciTech Connect

    Rio, D.C.; Rubin, G.M.

    1988-12-01

    We have used DNase I footprinting and partially fractionated nuclear extracts from Drosophila Kc tissue culture cells to identify DNA-binding proteins that interact with the terminal repeats of P transposable elements. We have identified a binding activity that interacts specifically with a region of the 31-base-pair terminal inverted repeats that is directly adjacent to the duplication of target site DNA. Binding occurs to both the 5' and 3' inverted terminal repeats irrespective of the sequence of the duplicated target DNA. UV photochemical crosslinking studies suggest that the binding activity resides in a polypeptide of 65-70 kDa. Biochemical fractionation and oligonucleotide affinity chromatography have been used to purify the binding activity to near homogeneity and identify a polypeptide of 66 kDa in the highly purified preparations. The site to which binding occurs is included in a region absolutely required for P element transposition, suggesting that this binding protein may be a cellular factor involved in P element transposition.

  2. Minimalistic predictor of protein binding energy: contribution of solvation factor to protein binding.

    PubMed

    Choi, Jeong-Mo; Serohijos, Adrian W R; Murphy, Sean; Lucarelli, Dennis; Lofranco, Leo L; Feldman, Andrew; Shakhnovich, Eugene I

    2015-02-17

    It has long been known that solvation plays an important role in protein-protein interactions. Here, we use a minimalistic solvation-based model for predicting protein binding energy to estimate quantitatively the contribution of the solvation factor in protein binding. The factor is described by a simple linear combination of buried surface areas according to amino-acid types. Even without structural optimization, our minimalistic model demonstrates a predictive power comparable to more complex methods, making the proposed approach the basis for high throughput applications. Application of the model to a proteomic database shows that receptor-substrate complexes involved in signaling have lower affinities than enzyme-inhibitor and antibody-antigen complexes, and they differ by chemical compositions on interfaces. Also, we found that protein complexes with components that come from the same genes generally have lower affinities than complexes formed by proteins from different genes, but in this case the difference originates from different interface areas. The model was implemented in the software PYTHON, and the source code can be found on the Shakhnovich group webpage: http://faculty.chemistry.harvard.edu/shakhnovich/software. PMID:25692584

  3. Factors influencing trace element composition in human teeth

    SciTech Connect

    Tandon, L.; Iyengar, G.V.

    1997-12-01

    The authors recently compiled and reviewed the literature published in or after 1978 for 45 major, minor, and trace elements in human teeth as a part of an International Atomic Energy Agency (IAEA) study. The purpose of this paper is to discuss the various factors that influence the concentration levels of certain trace elements in human teeth. The sampling practices and analytical techniques that are applicable for trace element analysis are also discussed. It is also our intention to identify reference range of values, where data permit such conclusions. The scrutiny was designed to identify only the healthy permanent teeth, and values from teeth with fillings, caries, or periodontal diseases were eliminated.

  4. Neuronal RNA granule contains ApCPEB1, a novel cytoplasmic polyadenylation element binding protein, in Aplysia sensory neuron.

    PubMed

    Chae, Yeon-Su; Lee, Seung-Hee; Cheang, Ye-Hwang; Lee, Nuribalhae; Rim, Young-Soo; Jang, Deok-Jin; Kaang, Bong-Kiun

    2010-01-31

    The cytoplasmic polyadenylation element (CPE)-binding protein (CPEB) binds to CPE containing mRNAs on their 3' untranslated regions (3'UTRs). This RNA binding protein comes out many important tasks, especially in learning and memory, by modifying the translational efficiency of target mRNAs via poly (A) tailing. Overexpressed CPEB has been reported to induce the formation of stress granules (SGs), a sort of RNA granule in mammalian cell lines. RNA granule is considered to be a potentially important factor in learning and memory. However, there is no study about RNA granule in Aplysia. To examine whether an Aplysia CPEB, ApCPEB1, forms RNA granules, we overexpressed ApCPEB1-EGFP in Aplysia sensory neurons. Consistent with the localization of mammalian CPEB, overexpressed ApCPEB1 formed granular structures, and was colocalized with RNAs and another RNA binding protein, ApCPEB, showing that ApCPEB1 positive granules are RNA-protein complexes. In addition, ApCPEB1 has a high turnover rate in RNA granules which were mobile structures. Thus, our results indicate that overexpressed ApCPEB1 is incorporated into RNA granule which is a dynamic structure in Aplysia sensory neuron. We propose that ApCPEB1 granule might modulate translation, as other RNA granules do, and furthermore, influence memory. PMID:19887896

  5. The trehalose/maltose-binding protein as the sensitive element of a glucose biosensor

    NASA Astrophysics Data System (ADS)

    Fonin, A. V.; Povarova, O. I.; Staiano, M.; D'Auria, S.; Turoverov, K. K.; Kuznetsova, I. M.

    2014-08-01

    The promising direction of the development of a modern glucometer is the construction of sensing element on the basis of stained (dyed) protein which changes its fluorescence upon glucose binding. One of the proteins that can be used for this purpose is the D-trehalose/D-maltose-binding protein (TMBP) from the thermophilic bacteria Thermococcus litoralis. We investigated the physical-chemical properties of the protein and evaluated its stability to the denaturing action of GdnHCl and heating. It was confirmed that TMBP is an extremely stable protein. In vivo, the intrinsic ligands of TMBP are trehalose and maltose, but TMBP can also bind glucose. The dissociation constant of the TMBP-glucose complex is in the range of 3-8 mM. The binding of glucose does not noticeably change the intrinsic fluorescence of the TMBP. To register protein-glucose binding, we used the fluorescence of the thiol-reactive dye BADAN attached to TMBP. Because the fluorescence of BADAN attached to the cysteine Cys182 of TMBP does not change upon glucose binding, the mutant forms ТМВР/C182S/X_Cys were created. In these mutant proteins, Cys182 is replaced by Ser, removing intrinsic binding site of BADAN and a new dye binding sites were introduced. The largest increase (by 1.4 times) in the intensity of the dye fluorescence was observed upon TMBP/C182S/A14C-BADAN-Glc complex formation. The dissociation constant of this complex is 3.4 ± 0.1 mM. We consider TMBP/C182S/A14C mutant form with attached fluorescent dye BADAN as a good basis for further research aimed to develop of series of TMBP mutant forms with different affinities to glucose labeled with fluorescent dyes.

  6. Aluminium competitive effect on rare earth elements binding to humic acid

    NASA Astrophysics Data System (ADS)

    Marsac, Rémi; Davranche, Mélanie; Gruau, Gérard; Dia, Aline; Bouhnik-Le Coz, Martine

    2012-07-01

    Competitive mechanisms between rare earth elements (REE) and aluminium for humic acid (HA) binding were investigated by combining laboratory experiments and modeling to evaluate the effect of Al on REE-HA complexation. Results indicates that Al3+ competes more efficiently with heavy REE (HREE) than with light REE (LREE) in acidic (pH = 3) and low REE/HA concentration ratio conditions providing evidence for the Al high affinity for the few HA multidentate sites. Under higher pH - 5 to 6 - and high REE/HA conditions, Al is more competitive for LREE suggesting that Al is bound to HA carboxylic rather than phenolic sites. PHREEQC/Model VI Al-HA binding parameters were optimized to simulate precisely both Al binding to HA and Al competitive effect on REE binding to HA. REE-HA binding pattern is satisfactorily simulated for the whole experimental conditions by the ΔLK1A optimization (i.e. ΔLK1A controls the distribution width of log K around log KMA). The present study provides fundamental knowledge on Al binding mechanisms to HA. Aluminium competitive effect on other cations binding to HA depends clearly on its affinity for carboxylic, phenolic or chelate ligands, which is pH dependent. Under circumneutral pH such as in natural waters, Al should lead to LREE-depleted patterns since Al is expected to be bound to weak HA carboxylic groups. As deduced from the behavior of Al species, other potential competitor cations are expected to have their own competitive effect on REE-HA binding. Therefore, in order to reliably understand and model REE-HA patterns in natural waters, a precise knowledge of the exact behavior of the different REE competitor cations is required. Finally, this study highlights the ability of the REE to be used as a “speciation probe” to precisely describe cation interactions with HA as here evidenced for Al.

  7. Selective binding of the estrogen receptor to one strand of the estrogen responsive element.

    PubMed Central

    Mukherjee, R

    1993-01-01

    The human estrogen receptor (hER) activates gene transcription by binding to cognate palindromic sequences called estrogen responsive elements (ERE). I used gel retardation assays and oligonucleotides containing the ERE from the Xenopus vitellogenin gene to study the interaction of the hER with the ERE. I observed that the hER bound to double-stranded ERE and to the single strand of the ERE that had T in the center with nearly equal affinity, but not to the strand which had A in the center. Interchanging the two central nucleotides changed the strand specificity. Binding of the hER to a single strand is extremely sensitive to temperature. Initial recognition of one of the two strands of the ERE may be involved in the binding of the hER to the ERE. Images PMID:8332462

  8. Hypoxia-inducible factor 2alpha binds to cobalt in vitro.

    PubMed

    Yuan, Y; Beitner-Johnson, D; Millhorn, D E

    2001-11-01

    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element (HRE). The alpha subunit of the HIF transcription factors is degraded by proteasome pathways during normoxia, but stabilized under hypoxic conditions. It has previously been established that cobalt causes accumulation of HIF-2alpha and HIF-1alpha. However, little is known about the mechanism by which cobalt mimics hypoxia and stabilizes these transcription factors. We show here that cobalt binds directly to HIF-2alpha in vitro with a high affinity and in an oxygen-dependent manner. We found that HIF-2alpha, which had been stabilized with a proteasome inhibitor, could bind to cobalt, whereas hypoxia-stabilized HIF-2alpha could not. Mutations within the oxygen-dependent degradation domain of HIF-2alpha prevented cobalt binding and led to accumulation of HIF-2alpha during normoxia. This suggests that transition metal such as iron may play a role in regulation of HIF-2alpha in vivo. PMID:11688986

  9. Heterogeneity in rhesus macaque complement factor H binding to meningococcal factor H binding protein (FHbp) informs selection of primates to assess immunogenicity of FHbp-based vaccines.

    PubMed

    Beernink, Peter T; Shaughnessy, Jutamas; Stefek, Heather; Ram, Sanjay; Granoff, Dan M

    2014-11-01

    Neisseria meningitidis causes disease only in humans. An important mechanism underlying this host specificity is the ability of the organism to resist complement by recruiting the complement downregulator factor H (FH) to the bacterial surface. In previous studies, binding of FH to one of the major meningococcal FH ligands, factor H binding protein (FHbp), was reported to be specific for human FH. Here we report that sera from 23 of 73 rhesus macaques (32%) tested had high FH binding to FHbp. Similar to human FH, binding of macaque FH to the meningococcal cell surface inhibited the complement alternative pathway by decreasing deposition of C3b. FH contains 20 domains (or short consensus repeats), with domains 6 and 7 being responsible for binding of human FH to FHbp. DNA sequence analyses of FH domains 6 and 7 from macaques with high or low FH binding showed a polymorphism at residue 352 in domain 6, with Tyr being associated with high binding and His with low binding. A recombinant macaque FH 6,7/Fc fragment with Tyr352 showed higher binding to FHbp than the corresponding fragment with His352. In previous studies in human FH transgenic mice, binding of FH to FHbp vaccines decreased protective antibody responses, and mutant FHbp vaccines with decreased FH binding elicited serum antibodies with greater protective activity. Thus, macaques with high FH binding to FHbp represent an attractive nonhuman primate model to investigate further the effects of FH binding on the immunogenicity of FHbp vaccines. PMID:25185576

  10. Heterogeneity in Rhesus Macaque Complement Factor H Binding to Meningococcal Factor H Binding Protein (FHbp) Informs Selection of Primates To Assess Immunogenicity of FHbp-Based Vaccines

    PubMed Central

    Beernink, Peter T.; Shaughnessy, Jutamas; Stefek, Heather; Ram, Sanjay

    2014-01-01

    Neisseria meningitidis causes disease only in humans. An important mechanism underlying this host specificity is the ability of the organism to resist complement by recruiting the complement downregulator factor H (FH) to the bacterial surface. In previous studies, binding of FH to one of the major meningococcal FH ligands, factor H binding protein (FHbp), was reported to be specific for human FH. Here we report that sera from 23 of 73 rhesus macaques (32%) tested had high FH binding to FHbp. Similar to human FH, binding of macaque FH to the meningococcal cell surface inhibited the complement alternative pathway by decreasing deposition of C3b. FH contains 20 domains (or short consensus repeats), with domains 6 and 7 being responsible for binding of human FH to FHbp. DNA sequence analyses of FH domains 6 and 7 from macaques with high or low FH binding showed a polymorphism at residue 352 in domain 6, with Tyr being associated with high binding and His with low binding. A recombinant macaque FH 6,7/Fc fragment with Tyr352 showed higher binding to FHbp than the corresponding fragment with His352. In previous studies in human FH transgenic mice, binding of FH to FHbp vaccines decreased protective antibody responses, and mutant FHbp vaccines with decreased FH binding elicited serum antibodies with greater protective activity. Thus, macaques with high FH binding to FHbp represent an attractive nonhuman primate model to investigate further the effects of FH binding on the immunogenicity of FHbp vaccines. PMID:25185576

  11. Platelet-derived growth factor binds specifically to receptors on vascular smooth muscle cells and the binding becomes nondissociable.

    PubMed Central

    Williams, L T; Tremble, P; Antoniades, H N

    1982-01-01

    Radioiodinated platelet-derived growth factor (125I-PDGF) was used in studies of PDGF binding sites on vascular smooth muscle cells. There was an excellent correlation between the ability of 125I-PDGF to stimulate cell proliferation and to bind specifically to cultured vascular smooth muscle cells. The half-maximal concentration for both processes was 0.1 nM. There were 50,000 binding sites per cell. Reduced PDGF, prepared by treatment of PDGF with 20 mM dithiothreitol, had neither the ability to bind to smooth muscle cells nor to stimulate cellular proliferation. Epidermal growth factor, nerve growth factor, fibroblast growth factor, and histone B did not compete for the binding sites at a concentration of 10 nM. 125I-PDGF binding was slowly reversible at 4 degrees C and was rapidly and totally reversible after a 1-min incubation at 37 degrees C. After continued incubation at 37 degrees C, the binding became irreversible. The half-time for formation of the nondissociable state of 125I-PDGF binding was approximately equal to 5 min at 37 degrees C. The nondissociable state of binding was not formed at 4 degrees C even after 1 hr of incubation. These data suggest that the sites we labeled are the PDGF receptors that mediate PDGF's mitogenic action and that a nondissociable state of PDGF binding is formed at 37 degrees C. It is likely that nondissociable PDGF represents internalized ligand or binding to sites that are converted to a high-affinity state after the ligand binds. PMID:6310551

  12. Identifying combinatorial regulation of transcription factors and binding motifs

    PubMed Central

    Kato, Mamoru; Hata, Naoya; Banerjee, Nilanjana; Futcher, Bruce; Zhang, Michael Q

    2004-01-01

    Background Combinatorial interaction of transcription factors (TFs) is important for gene regulation. Although various genomic datasets are relevant to this issue, each dataset provides relatively weak evidence on its own. Developing methods that can integrate different sequence, expression and localization data have become important. Results Here we use a novel method that integrates chromatin immunoprecipitation (ChIP) data with microarray expression data and with combinatorial TF-motif analysis. We systematically identify combinations of transcription factors and of motifs. The various combinations of TFs involved multiple binding mechanisms. We reconstruct a new combinatorial regulatory map of the yeast cell cycle in which cell-cycle regulation can be drawn as a chain of extended TF modules. We find that the pairwise combination of a TF for an early cell-cycle phase and a TF for a later phase is often used to control gene expression at intermediate times. Thus the number of distinct times of gene expression is greater than the number of transcription factors. We also see that some TF modules control branch points (cell-cycle entry and exit), and in the presence of appropriate signals they can allow progress along alternative pathways. Conclusions Combining different data sources can increase statistical power as demonstrated by detecting TF interactions and composite TF-binding motifs. The original picture of a chain of simple cell-cycle regulators can be extended to a chain of composite regulatory modules: different modules may share a common TF component in the same pathway or a TF component cross-talking to other pathways. PMID:15287978

  13. Structure-aided prediction of mammalian transcription factor complexes in conserved non-coding elements.

    PubMed

    Guturu, Harendra; Doxey, Andrew C; Wenger, Aaron M; Bejerano, Gill

    2013-12-19

    Mapping the DNA-binding preferences of transcription factor (TF) complexes is critical for deciphering the functions of cis-regulatory elements. Here, we developed a computational method that compares co-occurring motif spacings in conserved versus unconserved regions of the human genome to detect evolutionarily constrained binding sites of rigid TF complexes. Structural data were used to estimate TF complex physical plausibility, explore overlapping motif arrangements seldom tackled by non-structure-aware methods, and generate and analyse three-dimensional models of the predicted complexes bound to DNA. Using this approach, we predicted 422 physically realistic TF complex motifs at 18% false discovery rate, the majority of which (326, 77%) contain some sequence overlap between binding sites. The set of mostly novel complexes is enriched in known composite motifs, predictive of binding site configurations in TF-TF-DNA crystal structures, and supported by ChIP-seq datasets. Structural modelling revealed three cooperativity mechanisms: direct protein-protein interactions, potentially indirect interactions and 'through-DNA' interactions. Indeed, 38% of the predicted complexes were found to contain four or more bases in which TF pairs appear to synergize through overlapping binding to the same DNA base pairs in opposite grooves or strands. Our TF complex and associated binding site predictions are available as a web resource at http://bejerano.stanford.edu/complex. PMID:24218641

  14. Total Binding Affinity Profiles of Regulatory Regions Predict Transcription Factor Binding and Gene Expression in Human Cells

    PubMed Central

    Molineris, Ivan; Provero, Paolo

    2015-01-01

    Transcription factors regulate gene expression by binding regulatory DNA. Understanding the rules governing such binding is an essential step in describing the network of regulatory interactions, and its pathological alterations. We show that describing regulatory regions in terms of their profile of total binding affinities for transcription factors leads to increased predictive power compared to methods based on the identification of discrete binding sites. This applies both to the prediction of transcription factor binding as revealed by ChIP-seq experiments and to the prediction of gene expression through RNA-seq. Further significant improvements in predictive power are obtained when regulatory regions are defined based on chromatin states inferred from histone modification data. PMID:26599758

  15. LASAGNA-Search: an integrated web tool for transcription factor binding site search and visualization.

    PubMed

    Lee, Chic; Huang, Chun-Hsi

    2013-03-01

    The release of ChIP-seq data from the ENCyclopedia Of DNA Elements (ENCODE) and Model Organism ENCyclopedia Of DNA Elements (modENCODE) projects has significantly increased the amount of transcription factor (TF) binding affinity information available to researchers. However, scientists still routinely use TF binding site (TFBS) search tools to scan unannotated sequences for TFBSs, particularly when searching for lesser-known TFs or TFs in organisms for which ChIP-seq data are unavailable. The sequence analysis often involves multiple steps such as TF model collection, promoter sequence retrieval, and visualization; thus, several different tools are required. We have developed a novel integrated web tool named LASAGNA-Search that allows users to perform TFBS searches without leaving the web site. LASAGNA-Search uses the LASAGNA (Length-Aware Site Alignment Guided by Nucleotide Association) algorithm for TFBS alignment. Important features of LASAGNA-Search include (i) acceptance of unaligned variable-length TFBSs, (ii) a collection of 1726 TF models, (iii) automatic promoter sequence retrieval, (iv) visualization in the UCSC Genome Browser, and (v) gene regulatory network inference and visualization based on binding specificities. LASAGNA-Search is freely available at http://biogrid.engr.uconn.edu/lasagna_search/. PMID:23599922

  16. Heterogeneity of binding subunits of the human 150K insulin-like growth factor binding protein.

    PubMed

    Gelato, M C; Gaynes, L A; Greenstein, L A; Nissley, S P

    1990-04-01

    Models for the structure of the GH-dependent 150K insulin-like growth factor-binding protein (IGF-BP) complex include 1) a binding subunit of 40-60K mol wt associated with a larger nonbinding component, and 2) an oligomeric structure simply made up of six 25-28K monomeric IGF-BP complexes. To evaluate these alternative models we examined the IGF-binding characteristics and behavior on an SP-Sephadex ion exchange column of BP species identified by chemically cross-linking [125I]IGF-I and [125I]IGF-II. In addition, human serum was gel filtered on Sephadex G-200 in 0.05 M NH4HCO3, pH 8.0, and the 150K BP identified by binding of [125I]IGF-II to column fractions. When [125I]IGF-I or [125I]IGF-II was cross-linked to the 150K BP with disuccinimidyl suberate and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (10-15%) and autoradiography, four specifically labeled complexes of 20K, 24K, 33K, and 47K mol wt were identified. We examined the IGF-binding characteristics of these species by cross-linking [125I]IGF-I and [125I]IGF-II after incubation in the presence of increasing concentrations of unlabeled IGF-I or IGF-II. Formation of the 24K complex was inhibited more potently by IGF-II than IGF-I, whereas the relative potency of IGF-I vs. IGF-II for inhibition of the formation of the other complexes depended upon whether [125I]IGF-II or [125I]IGF-I was used. When the 150K BP complex generated from gel filtration on Sephadex G-200 was acid stripped, the only species seen with chemical cross-linking of either [125I]IGF-I or [125I]IGF-II was the 47K complex. By both conventional competitive binding studies and cross-linking [125I]IGF-I and [125I]IGF-II after incubation with increasing concentrations of unlabeled IGF-I or IGF-II, the formation of the 47K complex was usually more potently inhibited by IGF-I than IGF-II. When Cohn fraction IV extract was chromatographed on a SP-Sephadex column (pH 3) and cross-linking performed on the flow-through, the 47K

  17. Gene regulation in Drosophila spermatogenesis: analysis of protein binding at the translational control element TCE.

    PubMed

    Kempe, E; Muhs, B; Schäfer, M

    1993-01-01

    We have previously identified a 12 nucleotide long sequence element, the TCE, that was demonstrated to be necessary for translational control of expression in the male germ line of Drosophila melanogaster (Schäfer et al., 1990). It is conserved among all seven members of the Mst(3)CGP gene family, that encode structural proteins of the sperm tail. The TCE is invariably located in the 5' untranslated region (UTR) at position +28 relative to the transcription start site. In this paper we analyse the mode of action of this element. We show that protein binding occurs at the TCE after incubation with testis protein extracts from Drosophila melanogaster. While several proteins are associated with the translational control element in the RNA, only one of these proteins directly crosslinks to the sequence element. The binding activity is exclusively observed with testis protein extracts but can be demonstrated with testis extracts from other Drosophila species as well, indicating that regulatory proteins involved in translational regulation in the male germ line are conserved. Although binding to the TCE can occur independent of its position relative to the transcription start site of the in vitro transcripts, its function in vivo is not exerted when shifted further downstream within the 5' UTR of a fusion gene. In addition to being a translational control element the TCE also functions as a transcriptional regulator. Consequently, a DNA-protein complex is also formed at the TCE. In contrast to the RNA-protein complexes we find DNA-protein complexes with protein extracts of several tissues of Drosophila melanogaster. PMID:8111973

  18. Atrial natriuretic factor binding sites in experimental congestive heart failure

    SciTech Connect

    Bianchi, C.; Thibault, G.; Wrobel-Konrad, E.; De Lean, A.; Genest, J.; Cantin, M. )

    1989-10-01

    A quantitative in vitro autoradiographic study was performed on the aorta, renal glomeruli, and adrenal cortex of cardiomyopathic hamsters in various stages of heart failure and correlated, in some instances, with in vivo autoradiography. The results indicate virtually no correlation between the degree of congestive heart failure and the density of 125I-labeled atrial natriuretic factor ((Ser99, Tyr126)ANF) binding sites (Bmax) in the tissues examined. Whereas the Bmax was increased in the thoracic aorta in moderate and severe heart failure, there were no significant changes in the zona glomerulosa. The renal glomeruli Bmax was lower in mild and moderate heart failure compared with control and severe heart failure. The proportion of ANF B- and C-receptors was also evaluated in sections of the aorta, adrenal, and kidney of control and cardiomyopathic hamsters with severe heart failure. (Arg102, Cys121)ANF (des-(Gln113, Ser114, Gly115, Leu116, Gly117) NH2) (C-ANF) at 10(-6) M displaced approximately 505 of (Ser99, Tyr126)125I-ANF bound in the aorta and renal glomeruli and approximately 20% in the adrenal zona glomerulosa in both series of animals. These results suggest that ANF may exert a buffering effect on the vasoconstriction of heart failure and to a certain extent may inhibit aldosterone secretion. The impairment of renal sodium excretion does not appear to be related to glomerular ANF binding sites at any stage of the disease.

  19. STEROIDOGENIC FACTOR-1 IS A SPHINGOLIPID BINDING PROTEIN

    PubMed Central

    Urs, Aarti N.; Dammer, Eric; Kelly, Samuel; Wang, Elaine; Merrill, Alfred H.; Sewer, Marion B.

    2007-01-01

    Steroidogenic factor (SF1, NR5A1, Ad4BP) is an orphan nuclear receptor that is essential for steroid hormone-biosynthesis and endocrine development. Studies have found that the ability of this receptor to increase target gene expression can be regulated by post-translational modification, subnuclear localization, and protein-protein interactions. Recent crystallographic studies and our mass spectrometric analyses of the endogenous receptor have demonstrated an integral role for ligand-binding in the control of SF1 transactivation activity. Herein, we discuss our findings that sphingosine is an endogenous ligand for SF1. These studies and the structural findings of others have demonstrated that the receptor can bind both sphingolipids and phospholipids. Thus, it is likely that multiple bioactive lipids are ligands for SF1 and that these lipids will differentially act to control SF1 activity in a context-dependent manner. Finally, these findings highlight a central role for bioactive lipids as mediators of trophic-hormone stimulated steroid hormone biosynthesis. PMID:17196738

  20. Positional distribution of transcription factor binding sites in Arabidopsis thaliana

    PubMed Central

    Yu, Chun-Ping; Lin, Jinn-Jy; Li, Wen-Hsiung

    2016-01-01

    Binding of a transcription factor (TF) to its DNA binding sites (TFBSs) is a critical step to initiate the transcription of its target genes. It is therefore interesting to know where the TFBSs of a gene are likely to locate in the promoter region. Here we studied the positional distribution of TFBSs in Arabidopsis thaliana, for which many known TFBSs are now available. We developed a method to identify the locations of TFBSs in the promoter sequences of genes in A. thaliana. We found that the distribution is nearly bell-shaped with a peak at 50 base pairs (bp) upstream of the transcription start site (TSS) and 86% of the TFBSs are in the region from −1,000 bp to +200 bp with respect to the TSS. Our distribution was supported by chromatin immunoprecipitation sequencing and microarray data and DNase I hypersensitive site sequencing data. When TF families were considered separately, differences in positional preference were observed between TF families. Our study of the positional distribution of TFBSs seems to be the first in a plant. PMID:27117388

  1. N-Acetylgalactosaminyltransferase 14, a novel insulin-like growth factor binding protein-3 binding partner

    SciTech Connect

    Wu, Chen; Yao, Guangyin; Zou, Minji; Chen, Guangyu; Wang, Min; Liu, Jingqian; Wang, Jiaxi; Xu, Donggang . E-mail: xudg@nic.bmi.ac.cn

    2007-06-01

    Insulin-like growth factor binding protein-3 (IGFBP-3) is known to inhibit cell proliferation and induce apoptosis in IGF-dependent and IGF-independent manners, but the mechanism underlying IGF-independent effects is not yet clear. In a yeast two-hybrid assay, IGFBP-3 was used as the bait to screen a human fetal liver cDNA library for it interactors that may potentially mediate IGFBP-3-regulated functions. N-Acetylgalactosaminyltransferase 14 (GalNAc-T14), a member of the GalNAc-Tases family, was identified as a novel IGFBP-3 binding partner. This interaction involved the ricin-type beta-trefoil domain of GalNAc-T14. The interaction between IGFBP-3 and GalNAc-T14 was reconfirmed in vitro and in vivo, using GST pull-down, co-immunoprecipitation and mammalian two-hybrid assays. Our findings may provide new clues for further study on the mechanism behind the IGF-independent effects of IGFBP-3 promoting apoptosis. The role of GalNAc-T14 as an intracellular mediator of the effects of IGFBP-3 need to be verified in future studies.

  2. Light-regulated modification and nuclear translocation of cytosolic G-box binding factors in parsley.

    PubMed Central

    Harter, K; Kircher, S; Frohnmeyer, H; Krenz, M; Nagy, F; Schäfer, E

    1994-01-01

    Functional cell-free systems may be excellent tools with which to investigate light-dependent signal transduction mechanisms in plants. By evacuolation of parsley protoplasts and subsequent silicon oil gradient centrifugation of lysed evacuolated protoplasts, we obtained a highly pure and concentrated plasma membrane-containing cytosol. Using GT- and G-box DNA elements, we were able to demonstrate a specific localization of a pool of G-box binding activity and factors (GBFs) but not one of GT-box binding activity in this cytosolic fraction. The DNA binding activity of the cytosolic GBFs is modulated in vivo as well as in vitro by light and phosphorylation/dephosphorylation activities. The regulation of cytosolic G-box binding activity by irradiation with continuous white light and phosphorylation correlates with a light-modulated transport of GBFs to the nucleus. This was shown by a GBF-antibody cotranslocation assay in permeabilized, cell-free evacuolated parsley protoplasts. We propose that a light-regulated subcellular displacement of cytosolic GBFs to the nucleus may be an important step in the signal transduction pathway coupling photoreception to light-dependent gene expression. PMID:8205004

  3. Activation of carbohydrate response element binding protein (ChREBP) by ethanol

    PubMed Central

    Liangpunsakul, Suthat; Ross, Ruth A.; Crabb, David W.

    2012-01-01

    Carbohydrate response element binding protein (ChREBP) is a transcription factor involved in hepatic lipogenesis. Its function is in part under the control of AMP-activated protein kinase (AMPK) and protein phosphatase 2A (PP2A). Given known effects of ethanol on AMPK and PP2A, it is plausible that ethanol might enhance fatty acid synthesis by increasing the activity of ChREBP. We hypothesized that another potential pathway of ethanol-induced hepatic steatosis is mediated by activation of ChREBP. Methods The effects of ethanol on ChREBP were assessed in hepatoma cells and in C57BL/6J mice fed with the Lieber-DeCarli diet. Results When the cells were exposed to ethanol (50 mM) for 24 hrs, the activity of a liver pyruvate kinase (LPK) promoter-luciferase reporter was increased by ~4-fold. Ethanol feeding of mice resulted in the translocation of ChREBP from cytosol to the nucleus. PP2A activity was increased in the liver of ethanol-fed mice by 22%. We found no difference in the levels of hepatic Xu-5-P between ethanol-fed mice and controls. Transfection of a constitutively active AMPK expression plasmid suppressed the basal activity of the LPK luciferase reporter and abolished the effect of ethanol on the reporter activity. However, transfection of rat hepatoma cells with a dominant negative AMPK expression plasmid induced basal LPK luciferase activity by only ~20%. The effect of ethanol on ChREBP was attenuated in the presence of okadaic acid, an inhibitor of PP2A. Conclusions The effects of ethanol on AMPK and PP2A may result in activation of ChREBP, providing another potential mechanism for ethanol-induced hepatic steatosis. However, additional okadaic acid-insensitive effects appear to be important as well. PMID:23266705

  4. Far upstream element-binding protein 1 is a prognostic biomarker and promotes nasopharyngeal carcinoma progression

    PubMed Central

    Liu, Z-H; Hu, J-L; Liang, J-Z; Zhou, A-J; Li, M-Z; Yan, S-M; Zhang, X; Gao, S; Chen, L; Zhong, Q; Zeng, M-S

    2015-01-01

    Nasopharyngeal carcinoma (NPC) is a malignant epithelial tumor with tremendous invasion and metastasis capacities, and it has a high incidence in southeast Asia and southern China. Previous studies identified that far upstream element-binding protein 1 (FBP1), a transcriptional regulator of c-Myc that is one of the most frequently aberrantly expressed oncogenes in various human cancers, including NPC, is an important biomarker for many cancers. Our study aimed to investigate the expression and function of FBP1 in human NPC. Quantitative real-time RT-PCR (qRT-PCR), western blot and immunohistochemical staining (IHC) were performed in NPC cells and biopsies. Furthermore, the effect of FBP1 knockdown on cell proliferation, colony formation, side population tests and tumorigenesis in nude mice were measured by MTT, clonogenicity analysis, flow cytometry and a xenograft model, respectively. The results showed that the mRNA and protein levels of FBP1, which are positively correlated with c-Myc expression, were substantially higher in NPC than that in nasopharyngeal epithelial cells. IHC revealed that the patients with high FBP1 expression had a significantly poorer prognosis compared with the patients with low expression (P=0.020). In univariate analysis, high FBP1 and c-Myc expression predicted poorer overall survival (OS) and poorer progression-free survival. Multivariate analysis indicated that high FBP1 and c-Myc expression were independent prognostic markers. Knockdown of FBP1 reduced cell proliferation, clonogenicity and the ratio of side populations, as well as tumorigenesis in nude mice. These data indicate that FBP1 expression, which is closely correlated with c-Myc expression, is an independent prognostic factor and promotes NPC progression. Our results suggest that FBP1 can not only serve as a useful prognostic biomarker for NPC but also as a potential therapeutic target for NPC patients. PMID:26469968

  5. Neisseria meningitidis serogroup B bivalent factor H binding protein vaccine.

    PubMed

    Brendish, Nathan James; Read, Robert Charles

    2015-04-01

    With the successful development of meningococcal vaccines against other serogroups, disease caused by Neisseria meningitidis serogroup B now accounts for a disproportionate frequency compared with other serogroups, particularly in the US and Europe. Infants and adolescents bear the highest incidence of disease, which typically manifests as meningitis and septicemia. This vaccine profile article examines a bivalent factor H binding protein (fHbp; also known as LP2086) vaccine that has now been approved by the US FDA for use in 10- to 25-year olds. The manufacturer has shelved plans for further investigation of its use in infants because of high rates of fever in Phase I and II trials in that age group. PMID:25703792

  6. Functional erythroid promoters created by interaction of the transcription factor GATA-1 with CACCC and AP-1/NFE-2 elements.

    PubMed Central

    Walters, M; Martin, D I

    1992-01-01

    We have investigated interactions between the erythroid transcription factor GATA-1 and factors binding two cis-acting elements commonly linked to GATA sites in erythroid control elements. GATA-1 is present at all stages of erythroid differentiation, is necessary for erythropoiesis, and binds sites in all erythroid control elements. However, minimal promoters containing GATA-1 sites are inactive when tested in erythroid cells. Based on this observation, two erythroid cis elements, here termed CACCC and AP-1/NFE-2, were linked to GATA sites in minimal promoters. None of the elements linked only to a TATA box created an active promoter, but GATA sites linked to either CACCC or AP-1/NFE-2 elements formed strong erythroid promoters. A mutation of T to C at position -175 in the gamma-globin promoter GATA site, associated with hereditary persistence of fetal hemoglobin (HPFH), increased expression of these promoters in both fetal and adult cells. A construct bearing the beta-globin CACCC element was more active in adult and less active in fetal erythroid cells, when compared with the gamma-globin CACCC element. These studies suggest that erythroid control elements are formed by the interactions of at least three transcription factors, none of which functions alone. Images PMID:1438231

  7. The role of octamer binding transcription factors in glioblastoma multiforme.

    PubMed

    Rooj, A K; Bronisz, A; Godlewski, J

    2016-06-01

    A group of transcription factors (TF) that are master developmental regulators of the establishment and maintenance of pluripotency during embryogenesis play additional roles to control tissue homeostasis and regeneration in adults. Among these TFs, members of the octamer-binding transcription factor (OCT) gene family are well documented as major regulators controlling the self-renewal and pluripotency of stem cells isolated from different adult organs including the brain. In the last few years a large number of studies show the aberrant expression and dysfunction of OCT in different types of cancers including glioblastoma multiforme (GBM). GBM is the most common malignant primary brain tumor, and contains a subpopulation of undifferentiated stem cells (GSCs), with self-renewal and tumorigenic potential that contribute to tumor initiation, invasion, recurrence, and therapeutic resistance. In this review, we have summarized the current knowledge about OCT family in GBM and their crucial role in the initiation, maintenance and drug resistance properties of GSCs. This article is part of a Special Issue entitled: The Oct Transcription Factor Family, edited by Dr. Dean Tantin. PMID:26968235

  8. Comprehensive mutational profiling of core binding factor acute myeloid leukemia.

    PubMed

    Duployez, Nicolas; Marceau-Renaut, Alice; Boissel, Nicolas; Petit, Arnaud; Bucci, Maxime; Geffroy, Sandrine; Lapillonne, Hélène; Renneville, Aline; Ragu, Christine; Figeac, Martin; Celli-Lebras, Karine; Lacombe, Catherine; Micol, Jean-Baptiste; Abdel-Wahab, Omar; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric; Preudhomme, Claude

    2016-05-19

    Acute myeloid leukemia (AML) with t(8;21) or inv(16) have been recognized as unique entities within AML and are usually reported together as core binding factor AML (CBF-AML). However, there is considerable clinical and biological heterogeneity within this group of diseases, and relapse incidence reaches up to 40%. Moreover, translocations involving CBFs are not sufficient to induce AML on its own and the full spectrum of mutations coexisting with CBF translocations has not been elucidated. To address these issues, we performed extensive mutational analysis by high-throughput sequencing in 215 patients with CBF-AML enrolled in the Phase 3 Trial of Systematic Versus Response-adapted Timed-Sequential Induction in Patients With Core Binding Factor Acute Myeloid Leukemia and Treating Patients with Childhood Acute Myeloid Leukemia with Interleukin-2 trials (age, 1-60 years). Mutations in genes activating tyrosine kinase signaling (including KIT, N/KRAS, and FLT3) were frequent in both subtypes of CBF-AML. In contrast, mutations in genes that regulate chromatin conformation or encode members of the cohesin complex were observed with high frequencies in t(8;21) AML (42% and 18%, respectively), whereas they were nearly absent in inv(16) AML. High KIT mutant allele ratios defined a group of t(8;21) AML patients with poor prognosis, whereas high N/KRAS mutant allele ratios were associated with the lack of KIT or FLT3 mutations and a favorable outcome. In addition, mutations in epigenetic modifying or cohesin genes were associated with a poor prognosis in patients with tyrosine kinase pathway mutations, suggesting synergic cooperation between these events. These data suggest that diverse cooperating mutations may influence CBF-AML pathophysiology as well as clinical behavior and point to potential unique pathogenesis of t(8;21) vs inv(16) AML. PMID:26980726

  9. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    SciTech Connect

    Loots, G; Ovcharenko, I

    2006-08-08

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. We have created a database of evolutionary conserved regions (ECRs) in vertebrate genomes entitled ECRbase that is constructed from a collection of pairwise vertebrate genome alignments produced by the ECR Browser database. ECRbase features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a collection of promoters in all vertebrate genomes presented in the database. The database also contains a collection of annotated transcription factor binding sites (TFBS) in all ECRs and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and two pufferfish genomes. It is freely accessible at http://ECRbase.dcode.org.

  10. Carbide factor predicts rolling-element bearing fatigue life

    NASA Technical Reports Server (NTRS)

    Chevalier, J. L.; Zaretsky, E. V.

    1973-01-01

    Analysis was made to determine correlation between number and size of carbide particles and rolling-element fatigue. Correlation was established, and carbide factor was derived that can be used to predict fatigue life more effectively than such variables as heat treatment, chemical composition, and hardening mechanism.

  11. Classification of human genomic regions based on experimentally determined binding sites of more than 100 transcription-related factors

    PubMed Central

    2012-01-01

    Background Transcription factors function by binding different classes of regulatory elements. The Encyclopedia of DNA Elements (ENCODE) project has recently produced binding data for more than 100 transcription factors from about 500 ChIP-seq experiments in multiple cell types. While this large amount of data creates a valuable resource, it is nonetheless overwhelmingly complex and simultaneously incomplete since it covers only a small fraction of all human transcription factors. Results As part of the consortium effort in providing a concise abstraction of the data for facilitating various types of downstream analyses, we constructed statistical models that capture the genomic features of three paired types of regions by machine-learning methods: firstly, regions with active or inactive binding; secondly, those with extremely high or low degrees of co-binding, termed HOT and LOT regions; and finally, regulatory modules proximal or distal to genes. From the distal regulatory modules, we developed computational pipelines to identify potential enhancers, many of which were validated experimentally. We further associated the predicted enhancers with potential target transcripts and the transcription factors involved. For HOT regions, we found a significant fraction of transcription factor binding without clear sequence motifs and showed that this observation could be related to strong DNA accessibility of these regions. Conclusions Overall, the three pairs of regions exhibit intricate differences in chromosomal locations, chromatin features, factors that bind them, and cell-type specificity. Our machine learning approach enables us to identify features potentially general to all transcription factors, including those not included in the data. PMID:22950945

  12. A consensus insulin response element is activated by an Ets-related transcription factor.

    PubMed

    Jacob, K K; Ouyang, L; Stanley, F M

    1995-11-17

    Insulin increases expression of somatostatin-chloramphenicol acetyltransferase (CAT) constructs 10-fold and thymidine kinase-CAT constructs 5-fold in GH4 cells. These responses are similar to our previously reported data on insulin-increased prolactin-CAT expression. They are also observed in HeLa cells and are thus not cell type specific. The evidence suggests that the insulin responsiveness of these genes is mediated by an Ets-related transcription factor. First, linker-scanning mutations and/or deletions of the prolactin, somatostatin, and thymidine kinase promoters suggest that their insulin responsiveness is mediated by the sequence CGGA. This sequence is identical with the response element of the Ets-related transcription factors. Second, CGGA-containing sequences placed at -88 in the delta MTV-CAT reporter plasmid conferred insulin responsiveness to the mammary tumor virus promoter. Third, expression of the DNA-binding domain of c-Ets-2, which acts by blocking effects mediated by Ets-related transcription factors, inhibits the response of these promoters to insulin. Finally, the Ets-related proteins Sap and Elk-1 bind to the prolactin, somatostatin, and thymidine kinase insulin-response elements. An Ets-like element was found in all insulin-sensitive promoters examined and may serve a similar function in those promoters. PMID:7499246

  13. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    PubMed

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms. PMID:27281207

  14. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    SciTech Connect

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.; Iyer, VenkyN.; Eisen, Michael B.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  15. Analysis of Genomic Sequence Motifs for Deciphering Transcription Factor Binding and Transcriptional Regulation in Eukaryotic Cells

    PubMed Central

    Boeva, Valentina

    2016-01-01

    Eukaryotic genomes contain a variety of structured patterns: repetitive elements, binding sites of DNA and RNA associated proteins, splice sites, and so on. Often, these structured patterns can be formalized as motifs and described using a proper mathematical model such as position weight matrix and IUPAC consensus. Two key tasks are typically carried out for motifs in the context of the analysis of genomic sequences. These are: identification in a set of DNA regions of over-represented motifs from a particular motif database, and de novo discovery of over-represented motifs. Here we describe existing methodology to perform these two tasks for motifs characterizing transcription factor binding. When applied to the output of ChIP-seq and ChIP-exo experiments, or to promoter regions of co-modulated genes, motif analysis techniques allow for the prediction of transcription factor binding events and enable identification of transcriptional regulators and co-regulators. The usefulness of motif analysis is further exemplified in this review by how motif discovery improves peak calling in ChIP-seq and ChIP-exo experiments and, when coupled with information on gene expression, allows insights into physical mechanisms of transcriptional modulation. PMID:26941778

  16. Analysis of Genomic Sequence Motifs for Deciphering Transcription Factor Binding and Transcriptional Regulation in Eukaryotic Cells.

    PubMed

    Boeva, Valentina

    2016-01-01

    Eukaryotic genomes contain a variety of structured patterns: repetitive elements, binding sites of DNA and RNA associated proteins, splice sites, and so on. Often, these structured patterns can be formalized as motifs and described using a proper mathematical model such as position weight matrix and IUPAC consensus. Two key tasks are typically carried out for motifs in the context of the analysis of genomic sequences. These are: identification in a set of DNA regions of over-represented motifs from a particular motif database, and de novo discovery of over-represented motifs. Here we describe existing methodology to perform these two tasks for motifs characterizing transcription factor binding. When applied to the output of ChIP-seq and ChIP-exo experiments, or to promoter regions of co-modulated genes, motif analysis techniques allow for the prediction of transcription factor binding events and enable identification of transcriptional regulators and co-regulators. The usefulness of motif analysis is further exemplified in this review by how motif discovery improves peak calling in ChIP-seq and ChIP-exo experiments and, when coupled with information on gene expression, allows insights into physical mechanisms of transcriptional modulation. PMID:26941778

  17. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-01

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site. PMID:10037146

  18. Meningococcal factor H-binding protein vaccines with decreased binding to human complement factor H have enhanced immunogenicity in human factor H transgenic mice.

    PubMed

    Rossi, Raffaella; Granoff, Dan M; Beernink, Peter T

    2013-11-01

    Factor H-binding protein (fHbp) is a component of a meningococcal vaccine recently licensed in Europe for prevention of serogroup B disease, and a second vaccine in clinical development. The protein specifically binds human factor H (fH), which down-regulates complement activation and enhances resistance to bactericidal activity. There are conflicting data from studies in human fH transgenic mice on whether binding of human fH to fHbp vaccines decreases immunogenicity, and whether mutant fHbp vaccines with decreased fH binding have enhanced immunogenicity. fHbp can be classified into two sub-families based on sequence divergence and immunologic cross-reactivity. Previous studies of mutant fHbp vaccines with low fH binding were from sub-family B, which account for approximately 60% of serogroup B case isolates. In the present study, we evaluated the immunogenicity of two mutant sub-family A fHbp vaccines containing single substitutions, T221A or D211A, which resulted in 15- or 30-fold lower affinity for human fH, respectively, than the corresponding control wild-type fHbp vaccine. In transgenic mice with high serum concentrations of human fH, both mutant vaccines elicited significantly higher IgG titers and higher serum bactericidal antibody responses than the control fHbp vaccine that bound human fH. Thus, mutations introduced into a sub-family A fHbp antigen to decrease fH binding can increase protective antibody responses in human fH transgenic mice. Collectively the data suggest that mutant fHbp antigens with decreased fH binding will result in superior vaccines in humans. PMID:24035433

  19. A role for basic transcription element-binding protein 1 (BTEB1) in the autoinduction of thyroid hormone receptor beta.

    PubMed

    Bagamasbad, Pia; Howdeshell, Kembra L; Sachs, Laurent M; Demeneix, Barbara A; Denver, Robert J

    2008-01-25

    Thyroid hormone (T(3)) induces gene regulation programs necessary for tadpole metamorphosis. Among the earliest responses to T(3) are the up-regulation of T(3) receptor beta (TRbeta; autoinduction) and BTEB1 (basic transcription element-binding protein 1). BTEB1 is a member of the Krüppel family of transcription factors that bind to GC-rich regions in gene promoters. The proximal promoter of the Xenopus laevis TrbetaA gene has seven GC-rich sequences, which led us to hypothesize that BTEB1 binds to and regulates TrbetaA. In tadpoles and the frog fibroblast-derived cell line XTC-2, T(3) up-regulated Bteb1 mRNA with faster kinetics than TrbetaA, and Bteb1 mRNA correlated with increased BTEB1 protein expression. BTEB1 bound to GC-rich sequences in the proximal TrbetaA promoter in vitro. By using chromatin immunoprecipitation assay, we show that BTEB1 associates with the TrbetaA promoter in vivo in a T(3) and developmental stage-dependent manner. Induced expression of BTEB1 in XTC-2 cells caused accelerated and enhanced autoinduction of the TrbetaA gene. This enhancement was lost in N-terminal truncated mutants of BTEB1. However, point mutations in the zinc fingers of BTEB1 that destroyed DNA binding did not alter the activity of the protein on TrbetaA autoinduction, suggesting that BTEB1 can function in this regard through protein-protein interactions. Our findings support the hypothesis that BTEB1 associates with the TrbetaA promoter in vivo and enhances autoinduction, but this action does not depend on its DNA binding activity. Cooperation among the protein products of immediate early genes may be a common mechanism for driving developmental signaling pathways. PMID:18045867

  20. Nerve growth factor binding domain of the nerve growth factor receptor

    SciTech Connect

    Welcher, A.A.; Bitler, C.M.; Radeke, M.J.; Shooter, E.M. )

    1991-01-01

    A structural analysis of the rat low-affinity nerve growth factor (NGF) receptor was undertaken to define the NGF binding domain. Mutant NGF receptor DNA constructs were expressed in mouse fibroblasts or COS cells, and the ability of the mutant receptors to bind NGF was assayed. In the first mutant, all but 16 amino acid residues of the intracellular domain of the receptor were removed. This receptor bound NGF with a K{sub d} comparable to that of the wild-type receptor. A second mutant contained only the four cysteine-rich sequences from the extracellular portion of the protein. This mutant was expressed in COS cells and the resultant protein was a secreted soluble form of the receptor that was able to bind NGF. Two N-terminal deletions, in which either the first cystein-rich sequence or the first and part of the second cystein-rich sequences were removed, bound NGF. However, a mutant lacking all four cysteine-rich sequences was unable to bind NGF. These results show that the four cysteine-rich sequences of the NGF receptor contain the NGF binding domain.

  1. Production of element correction factors for thermoluminescent dosimeters

    SciTech Connect

    Plato, P.; Miklos, J.

    1985-11-01

    Approximately 80 processors of personal dosimetry in the United States use thermoluminescent dosimeters (TLDs). Recent demands that dosimetry processors be able to measure radiation doses to within +/- 50% of the correct value have focused attention on the reproducibility of the TL elements within each TLD. The phosphors for these TLDs are manufactured by three companies. A dosimetry processor faces three options concerning the quality of the TL elements purchased; trust the supplier's quality control program, screen new TL elements and discard those that are extremely bad, or use element correction factors (ECFs). The first option results in dosimetry processors failing the +/- 50% accuracy requirement due to excessive variability among the TL elements. The second option still permits large precision errors that come close to the +/- 50% accuracy requirement. This paper advocates the third option and presents a 10-step procedure to produce ECFs. The procedure ensures that the ECFs represent only variations among the TL elements and not variations caused by stability problems with the TLD reader. Following is an example of ECF production for 3000 TLDs.

  2. msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding

    PubMed Central

    Gilad, Yoav; Pritchard, Jonathan K.; Stephens, Matthew

    2015-01-01

    Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede. PMID:26406244

  3. msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding.

    PubMed

    Raj, Anil; Shim, Heejung; Gilad, Yoav; Pritchard, Jonathan K; Stephens, Matthew

    2015-01-01

    Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede. PMID:26406244

  4. Pituitary Ets-1 and GABP bind to the growth factor regulatory sites of the rat prolactin promoter.

    PubMed

    Schweppe, R E; Gutierrez-Hartmann, A

    2001-03-01

    Ets factors play a critical role in oncogenic Ras- and growth factor-mediated regulation of the proximal rat prolactin (rPRL) promoter in pituitary cells. The rPRL promoter contains two key functional Ets binding sites (EBS): a composite EBS/Pit-1 element located at -212 and an EBS that co-localizes with the basal transcription element (BTE, or A-site) located at -96. Oncogenic Ras exclusively signals to the -212 site, which we have named the Ras response element (RRE); whereas the response of multiple growth factors (FGFs, EGF, IGF, insulin and TRH) maps to both EBSs. Although Ets-1 and GA binding protein (GABP) have been implicated in the Ras and insulin responses, respectively, the precise identity of the pituitary Ets factors that specifically bind to the RRE and BTE sites remains unknown. In order to identify the Ets factor(s) present in GH4 and GH3 nuclear extracts (GH4NE and GH3NE) that bind to the EBSs contained in the RRE and BTE, we used EBS-RRE and BTE oligonucleotides in electrophoretic mobility shift assays (EMSAs), antibody supershift assays, western blot analysis of partially purified fractions and UV-crosslinking studies. EMSAs, using either the BTE or EBS-RRE probes, identified a specific protein-DNA complex, designated complex A, which contains an Ets factor as determined by oligonucleotide competition studies. Using western blot analysis of GH3 nuclear proteins that bind to heparin-Sepharose, we have shown that Ets-1 and GABP, which are MAP kinase substrates, co-purify with complex A, and supershift analysis with specific antisera revealed that complex A contains Ets-1, GABPalpha and GABPbeta1. In addition, we show that recombinant full-length Ets-1 binds equivalently to BTE and EBS-RRE probes, while recombinant GABPalpha/beta preferentially binds to the BTE probe. Furthermore, comparing the DNA binding of GH4NE containing both Ets-1 and GABP and HeLa nuclear extracts devoid of Ets-1 but containing GABP, we were able to show that the EBS

  5. ZmbZIP91 regulates expression of starch synthesis-related genes by binding to ACTCAT elements in their promoters.

    PubMed

    Chen, Jiang; Yi, Qiang; Cao, Yao; Wei, Bin; Zheng, Lanjie; Xiao, Qianling; Xie, Ying; Gu, Yong; Li, Yangping; Huang, Huanhuan; Wang, Yongbin; Hou, Xianbin; Long, Tiandan; Zhang, Junjie; Liu, Hanmei; Liu, Yinghong; Yu, Guowu; Huang, Yubi

    2016-03-01

    Starch synthesis is a key process that influences crop yield and quality, though little is known about the regulation of this complex metabolic pathway. Here, we present the identification of ZmbZIP91 as a candidate regulator of starch synthesis via co-expression analysis in maize (Zea mays L.). ZmbZIP91 was strongly associated with the expression of starch synthesis genes. Reverse tanscription-PCR (RT-PCR) and RNA in situ hybridization indicated that ZmbZIP91 is highly expressed in maize endosperm, with less expression in leaves. Particle bombardment-mediated transient expression in maize endosperm and leaf protoplasts demonstrated that ZmbZIP91 could positively regulate the expression of starch synthesis genes in both leaves and endosperm. Additionally, the Arabidopsis mutant vip1 carried a mutation in a gene (VIP1) that is homologous to ZmbZIP91, displayed altered growth with less starch in leaves, and ZmbZIP91 was able to complement this phenotype, resulting in normal starch synthesis. A yeast one-hybrid experiment and EMSAs showed that ZmbZIP91 could directly bind to ACTCAT elements in the promoters of starch synthesis genes (pAGPS1, pSSI, pSSIIIa, and pISA1). These results demonstrate that ZmbZIP91 acts as a core regulatory factor in starch synthesis by binding to ACTCAT elements in the promoters of starch synthesis genes. PMID:26689855

  6. Piperine Induces Hepatic Low-Density Lipoprotein Receptor Expression through Proteolytic Activation of Sterol Regulatory Element-Binding Proteins

    PubMed Central

    Ochiai, Ayasa; Miyata, Shingo; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2015-01-01

    Elevated plasma low-density lipoprotein (LDL) cholesterol is considered as a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) uptakes plasma lipoproteins and lowers plasma LDL cholesterol, the activation of LDLR is a promising drug target for atherosclerosis. In the present study, we identified the naturally occurring alkaloid piperine, as an inducer of LDLR gene expression by screening the effectors of human LDLR promoter. The treatment of HepG2 cells with piperine increased LDLR expression at mRNA and protein levels and stimulated LDL uptake. Subsequent luciferase reporter gene assays revealed that the mutation of sterol regulatory element-binding protein (SREBP)-binding element abolished the piperine-mediated induction of LDLR promoter activity. Further, piperine treatments increased mRNA levels of several SREBP targets and mature forms of SREBPs. However, the piperine-mediated induction of the mature forms of SREBPs was not observed in SRD–15 cells, which lack insulin-induced gene–1 (Insig–1) and Insig–2. Finally, the knockdown of SREBPs completely abolished the piperine-meditated induction of LDLR gene expression in HepG2 cells, indicating that piperine stimulates the proteolytic activation of SREBP and subsequent induction of LDLR expression and activity. PMID:26431033

  7. Far Upstream Element Binding Protein Plays a Crucial Role in Embryonic Development, Hematopoiesis, and Stabilizing Myc Expression Levels.

    PubMed

    Zhou, Weixin; Chung, Yang Jo; Parrilla Castellar, Edgardo R; Zheng, Ying; Chung, Hye-Jung; Bandle, Russell; Liu, Juhong; Tessarollo, Lino; Batchelor, Eric; Aplan, Peter D; Levens, David

    2016-03-01

    The transcription factor far upstream element binding protein (FBP) binds and activates the MYC promoter when far upstream element is via TFIIH helicase activity early in the transcription cycle. The fundamental biology and pathology of FBP are complex. In some tumors FBP seems pro-oncogenic, whereas in others it is a tumor suppressor. We generated an FBP knockout (Fubp1(-/-)) mouse to study FBP deficiency. FBP is embryo lethal from embryonic day 10.5 to birth. A spectrum of pathology is associated with FBP loss; besides cerebral hyperplasia and pulmonary hypoplasia, pale livers, hypoplastic spleen, thymus, and bone marrow, cardiac hypertrophy, placental distress, and small size were all indicative of anemia. Immunophenotyping of hematopoietic cells in wild-type versus knockout livers revealed irregular trilineage anemia, with deficits in colony formation. Despite normal numbers of hematopoietic stem cells, transplantation of Fubp1(-/-) hematopoietic stem cells into irradiated mice entirely failed to reconstitute hematopoiesis. In competitive transplantation assays against wild-type donor bone marrow, Fubp1(-/-) hematopoietic stem cells functioned only sporadically at a low level. Although cultures of wild-type mouse embryo fibroblasts set Myc levels precisely, Myc levels of mouse varied wildly between fibroblasts harvested from different Fubp1(-/-) embryos, suggesting that FBP contributes to Myc set point fixation. FBP helps to hold multiple physiologic processes to close tolerances, at least in part by constraining Myc expression. PMID:26774856

  8. Repression of VEGFA by CA-rich element-binding microRNAs is modulated by hnRNP L

    PubMed Central

    Jafarifar, Faegheh; Yao, Peng; Eswarappa, Sandeepa M; Fox, Paul L

    2011-01-01

    Expression of vascular endothelial growth factor-A (VEGFA) by tumour-associated macrophages is critical for tumour progression and metastasis. Hypoxia, a common feature of the neoplastic microenvironment, induces VEGFA expression by increased transcription, translation, and mRNA stabilization. Here, we report a new mechanism of VEGFA regulation by hypoxia that involves reversal of microRNA (miRNA)-mediated silencing of VEGFA expression. We show that the CA-rich element (CARE) in the human VEGFA 3′-UTR is targeted by at least four miRNAs. Among these miRNAs, miR-297 and -299 are endogenously expressed in monocytic cells and negatively regulate VEGFA expression. Unexpectedly, hypoxia completely reverses miRNA-mediated repression of VEGFA expression. We show that heterogeneous nuclear ribonucleoprotein L (hnRNP L), which also binds the VEGFA 3′-UTR CARE, prevents miRNA silencing activity. Hypoxia induces translocation of nuclear hnRNP L to the cytoplasm, which markedly increases hnRNP L binding to VEGFA mRNA thereby inhibiting miRNA activity. In summary, we describe a novel regulatory mechanism in which the interplay between miRNAs and RNA-binding proteins influences expression of a critical hypoxia-inducible angiogenic protein. These studies may contribute to provide miRNA-based anticancer therapeutic tools. PMID:21343907

  9. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P

    1990-01-01

    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  10. Binding of stereognostically designed ligands to trivalent, pentavalent, and hexavalent f-block elements

    SciTech Connect

    Sinkov, Sergey I.; Lumetta, Gregg J.; Warner, Marvin G.; Pittman, Jonathan W.

    2012-03-26

    Stability constants were determined for the complexes formed from two stereognostically designed ligands and the f-block elements Nd(III), Np(V), and Pu(VI). The ligands investigated were tris[3-(2-carboxyphenoxy)propyl]amine (NPB) and tris-N,N',N''-[2-(2-carboxy-4-ethyl-phenoxy)ethyl]-1,4,7-triazacyclononane (EETAC). A stereognostically blind ligand, nitrilotriacetic acid (NTA), was also investigated for comparison. The results suggest that there is no significant stereognostic effect for complexation of NPB or EETAC to Np(V). On the other hand, a modest stereognostic effect is seen for the NPB ligand when complexed to Pu(VI), leading to an approximately 8-fold increase in the binding strength. A more significant effect is observed for the EETAC system in which a 250-fold increase in binding is observed for Pu(VI) versus Nd(III).

  11. Plasma binding proteins for platelet-derived growth factor that inhibit its binding to cell-surface receptors.

    PubMed Central

    Raines, E W; Bowen-Pope, D F; Ross, R

    1984-01-01

    Evidence is presented that the binding of platelet-derived growth factor (PDGF) to plasma constituents inhibits the binding of PDGF to its cell-surface mitogen receptor. Approximately equivalent amounts of PDGF-binding activity were found in plasma from a number of different species known by radioreceptor assay to contain PDGF homologues in their clotted blood. Activation of the coagulation cascade did not significantly alter the PDGF-binding activity of the plasma components. Three molecular weight classes of plasma fractions that inhibit PDGF binding to its cell-surface receptor were defined by gel filtration: approximately equal to 40,000, 150,000, and greater than 500,000. Specific binding of 125I-labeled PDGF to the highest molecular weight plasma fraction could also be demonstrated by gel filtration. The binding of PDGF to these plasma components was reversible under conditions of low pH or with guanidine X HCl, and active PDGF could be recovered from the higher molecular weight fractions. Immunologic and functional evidence is presented that the highest molecular weight plasma fraction may be alpha 2-macroglobulin. A model is proposed in which the activity of PDGF released in vivo may be regulated by association with these plasma binding components and by high-affinity binding to cell-surface PDGF receptors. PMID:6203121

  12. Metal loading effect on rare earth element binding to humic acid: Experimental and modelling evidence

    NASA Astrophysics Data System (ADS)

    Marsac, Rémi; Davranche, Mélanie; Gruau, Gérard; Dia, Aline

    2010-03-01

    The effect of metal loading on the binding of rare earth elements (REE) to humic acid (HA) was studied by combining ultrafiltration and Inductively Coupled Plasma Mass Spectrometry techniques. REE-HA complexation experiments were performed at pH 3 for REE/C molar ratios ranging from ca 4 × 10 -4 to 2.7 × 10 -2. Results show that the relative amount of REE bound to HA strongly increases with decreasing REE/C. A middle-REE (MREE) downward concavity is shown by patterns at high metal loading, whereas patterns at low metal loading display a regular increase from La to Lu. Humic Ion Model VI modelling are close to the experimental data variations, provided that (i) the ΔLK 2 parameter (i.e. the Model VI parameter taken into account the presence of strong but low density binding sites) is allowed to increase regularly from La to Lu (from 1.1 to 2.1) and (ii) the published log KMA values (i.e. the REE-HA binding constants specific to Model VI) are slightly modified, in particular with respect to heavy REE. Modelling approach provided evidence that logKdREE patterns with varying REE/C likely arises because REE binding to HA occurs through two types of binding sites in different density: (i) a few strong sites that preferentially complex the heavy REE and thus control the logKdREE atterns at low REE/C; (ii) a larger amount of weaker binding sites that preferentially complex the middle-REE and thus control the logKdREE pattern at high REE/C. Hence, metal loading exerts a major effect on HA-mediated REE binding, which could explain the diversity of published conditional constants for REE binding with HA. A literature survey suggests that the few strong sites activated at low REE/C could be multidentate carboxylic sites, or perhaps N-, or P-functional groups. Finally, an examination of the literature field data proposed that the described loading effect could account for much of the variation in REE patterns observed in natural organic-rich waters (DOC > 5 mg L -1 and 4

  13. Structure of the DNA-binding and RNA polymerase-binding region of transcription antitermination factor λQ

    PubMed Central

    Vorobiev, Sergey M.; Gensler, Yocheved; Vahedian-Movahed, Hanif; Seetharaman, Jayaraman; Su, Min; Huang, Janet Y.; Xiao, Rong; Kornhaber, Gregory; Montelione, Gaetano T.; Tong, Liang; Ebright, Richard H.; Nickels, Bryce E.

    2014-01-01

    SUMMARY The bacteriophage λ Q protein is a transcription antitermination factor that controls expression of the phage late genes as a stable component of the transcription elongation complex. To join the elongation complex, λQ binds a specific DNA sequence element and interacts with RNA polymerase that is paused during early elongation. λQ’s interaction with the paused early elongation complex involves interactions between λQ and two regions of RNA polymerase: region 4 of the σ70 subunit and the flap domain of the β subunit. We present the 2.1 Å resolution crystal structure of a portion of λQ containing determinants for interaction with DNA, interaction with region 4 of σ70, and interaction with the β flap. The structure provides a framework for interpreting prior genetic and biochemical analysis and sets the stage for future structural studies to elucidate the mechanism by which λQ alters the functional properties of the transcription elongation complex. PMID:24440517

  14. Stem Cell Modeling of Core Binding Factor Acute Myeloid Leukemia

    PubMed Central

    Mosna, Federico

    2016-01-01

    Even though clonally originated from a single cell, acute leukemia loses its homogeneity soon and presents at clinical diagnosis as a hierarchy of cells endowed with different functions, of which only a minority possesses the ability to recapitulate the disease. Due to their analogy to hematopoietic stem cells, these cells have been named “leukemia stem cells,” and are thought to be chiefly responsible for disease relapse and ultimate survival after chemotherapy. Core Binding Factor (CBF) Acute Myeloid Leukemia (AML) is cytogenetically characterized by either the t(8;21) or the inv(16)/t(16;16) chromosomal abnormalities, which, although being pathognomonic, are not sufficient per se to induce overt leukemia but rather determine a preclinical phase of disease when preleukemic subclones compete until the acquisition of clonal dominance by one of them. In this review we summarize the concepts regarding the application of the “leukemia stem cell” theory to the development of CBF AML; we will analyze the studies investigating the leukemogenetic role of t(8;21) and inv(16)/t(16;16), the proposed theories of its clonal evolution, and the role played by the hematopoietic niches in preserving the disease. Finally, we will discuss the clinical implications of stem cell modeling of CBF AML for the therapy of the disease. PMID:26880987

  15. COTRASIF: conservation-aided transcription-factor-binding site finder.

    PubMed

    Tokovenko, Bogdan; Golda, Rostyslav; Protas, Oleksiy; Obolenskaya, Maria; El'skaya, Anna

    2009-04-01

    COTRASIF is a web-based tool for the genome-wide search of evolutionary conserved regulatory regions (transcription factor-binding sites, TFBS) in eukaryotic gene promoters. Predictions are made using either a position-weight matrix search method, or a hidden Markov model search method, depending on the availability of the matrix and actual sequences of the target TFBS. COTRASIF is a fully integrated solution incorporating both a gene promoter database (based on the regular Ensembl genome annotation releases) and both JASPAR and TRANSFAC databases of TFBS matrices. To decrease the false-positives rate an integrated evolutionary conservation filter is available, which allows the selection of only those of the predicted TFBS that are present in the promoters of the related species' orthologous genes. COTRASIF is very easy to use, implements a regularly updated database of promoters and is a powerful solution for genome-wide TFBS searching. COTRASIF is freely available at http://biomed.org.ua/COTRASIF/. PMID:19264796

  16. The latent transforming growth factor beta binding protein (LTBP) family.

    PubMed Central

    Oklü, R; Hesketh, R

    2000-01-01

    The transforming growth factor beta (TGFbeta) cytokines are a multi-functional family that exert a wide variety of effects on both normal and transformed mammalian cells. The secretion and activation of TGFbetas is regulated by their association with latency-associated proteins and latent TGFbeta binding proteins (LTBPs). Over the past few years, three members of the LTBP family have been identified, in addition to the protoype LTBP1 first sequenced in 1990. Three of the LTBP family are expressed in a variety of isoforms as a consequence of alternative splicing. This review summarizes the differences between the isoforms in terms of the effects on domain structure and hence possible function. The close identity between LTBPs and members of the fibrillin family, mutations in which have been linked directly to Marfan's syndrome, suggests that anomalous expression of LTBPs may be associated with disease. Recent data indicating that differential expression of LTBP1 isoforms occurs during the development of coronary heart disease is considered, together with evidence that modulation of LTBP function, and hence of TGFbeta activity, is associated with a variety of cancers. PMID:11104663

  17. The cis-acting elements involved in endonucleolytic cleavage of the 3' UTR of human IGF-II mRNAs bind a 50 kDa protein.

    PubMed

    Scheper, W; Holthuizen, P E; Sussenbach, J S

    1996-03-15

    Site-specific cleavage of human insulin-like growth factor II mRNAs requires two cis-acting elements, I and II, that are both located in the 3' untranslated region and separated by almost 2 kb. These elements can interact and form a stable RNA-RNA stem structure. In this study we have initiated the investigation of transacting factors involved in the cleavage of IGF-II mRNAs. The products of the cleavage reaction accumulate in the cytoplasm, suggesting that cleavage occurs in this cellular compartment. By electrophoretic mobility shift assays, we have identified a cytoplasmic protein with an apparent molecular weight of 48-50 kDa, IGF-II cleavage unit binding protein (ICU-BP), that binds to the stem structure formed by interaction of parts of the cis-acting elements I and II. The binding is resistant to high K+ concentrations and is dependent on Mg2+. In addition, ICU-BP binding is dependent on the cell density and correlates inversely with the IGM-II mRNA levels. In vivo cross-linking data show that this protein is associated with IGF-II mRNAs in vivo. PMID:8604329

  18. Phosphorylation by casein kinase 1 regulates tonicity-induced osmotic response element-binding protein/tonicity enhancer-binding protein nucleocytoplasmic trafficking.

    PubMed

    Xu, SongXiao; Wong, Catherine C L; Tong, Edith H Y; Chung, Stephen S M; Yates, John R; Yin, YiBing; Ko, Ben C B

    2008-06-20

    The osmotic response element-binding protein (OREBP), also known as tonicity enhancer-binding protein (TonEBP) or NFAT5, is the only known osmo-sensitive transcription factor that mediates cellular adaptations to extracellular hypertonic stress. Although it is well documented that the subcellular localization and transactivation activity of OREBP/TonEBP are tightly regulated by extracellular tonicity, the molecular mechanisms involved remain elusive. Here we show that nucleocytoplasmic trafficking of OREBP/TonEBP is regulated by the dual phosphorylation of Ser-155 and Ser-158. Alanine scanning mutagenesis revealed that Ser-155 is an essential residue that regulates OREBP/TonEBP nucleocytoplasmic trafficking. Tandem mass spectrometry revealed that Ser-155 and Ser-158 of OREBP/TonEBP are both phosphorylated in living cells under hypotonic conditions. In vitro phosphorylation assays further suggest that phosphorylation of the two serine residues proceeds in a hierarchical manner with phosphorylation of Ser-155 priming the phosphorylation of Ser-158 and that these phosphorylations are essential for nucleocytoplasmic trafficking of the transcription factor. Finally, we have shown that the pharmacological inhibition of casein kinase 1 (CK1) abolishes the phosphorylation of Ser-158 and impedes OREBP/TonEBP nuclear export and that recombinant CK1 phosphorylates Ser-158. Knockdown of CK1alpha1L, a novel isoform of CK1, inhibits hypotonicity-induced OREBP/TonEBP nuclear export. Together these data highlight the importance of Ser-155 and Ser-158 in the nucleocytoplasmic trafficking of OREBP/TonEBP and indicate that CK1 plays a major role in regulating this process. PMID:18411282

  19. Phosphorylation by Casein Kinase 1 Regulates Tonicity-induced Osmotic Response Element-binding Protein/Tonicity Enhancer-binding Protein Nucleocytoplasmic Trafficking*

    PubMed Central

    Xu, SongXiao; Wong, Catherine C. L.; Tong, Edith H. Y.; Chung, Stephen S. M.; Yates, John R.; Yin, YiBing; Ko, Ben C. B.

    2008-01-01

    The osmotic response element-binding protein (OREBP), also known as tonicity enhancer-binding protein (TonEBP) or NFAT5, is the only known osmo-sensitive transcription factor that mediates cellular adaptations to extracellular hypertonic stress. Although it is well documented that the subcellular localization and transactivation activity of OREBP/TonEBP are tightly regulated by extracellular tonicity, the molecular mechanisms involved remain elusive. Here we show that nucleocytoplasmic trafficking of OREBP/TonEBP is regulated by the dual phosphorylation of Ser-155 and Ser-158. Alanine scanning mutagenesis revealed that Ser-155 is an essential residue that regulates OREBP/TonEBP nucleocytoplasmic trafficking. Tandem mass spectrometry revealed that Ser-155 and Ser-158 of OREBP/TonEBP are both phosphorylated in living cells under hypotonic conditions. In vitro phosphorylation assays further suggest that phosphorylation of the two serine residues proceeds in a hierarchical manner with phosphorylation of Ser-155 priming the phosphorylation of Ser-158 and that these phosphorylations are essential for nucleocytoplasmic trafficking of the transcription factor. Finally, we have shown that the pharmacological inhibition of casein kinase 1 (CK1) abolishes the phosphorylation of Ser-158 and impedes OREBP/TonEBP nuclear export and that recombinant CK1 phosphorylates Ser-158. Knockdown of CK1α1L, a novel isoform of CK1, inhibits hypotonicity-induced OREBP/TonEBP nuclear export. Together these data highlight the importance of Ser-155 and Ser-158 in the nucleocytoplasmic trafficking of OREBP/TonEBP and indicate that CK1 plays a major role in regulating this process. PMID:18411282

  20. T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

    PubMed Central

    Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

    2008-01-01

    Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

  1. Epstein-Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression.

    PubMed

    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G; Sinclair, Alison J

    2015-04-20

    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  2. The functional role of the Meis/Prep-binding elements in Pax6 locus during pancreas and eye development.

    PubMed

    Carbe, Christian; Hertzler-Schaefer, Kristina; Zhang, Xin

    2012-03-01

    Pax6 is an essential transcription factor for lens, lacrimal gland and pancreas development. Previous transgenic analyses have identified several Pax6 regulatory elements, but their functional significance and binding factors remain largely unknown. In this study, we generated two genomic truncations to delete three elements that were previously shown to bind to the Meis/Prep family homeoproteins. One 3.1 kb deletion (Pax6(∆DP/∆DP)) removed two putative pancreatic enhancers and a previously identified ectodermal enhancer, while a 450 bp sub-deletion (Pax6(∆PE/∆PE)) eliminated only the promoter-proximal pancreatic enhancer. Immunohistochemistry and quantitative RT-PCR showed that the Pax6(∆PE/∆PE) pancreata had a significant decrease in Pax6, glucagon, and insulin expression, while no further reductions were observed in the Pax6(∆DP/∆DP) mice, indicating that only the 450 bp region is required for pancreatic development. In contrast, Pax6(∆DP/∆DP), but not Pax6(∆PE/∆PE) mice, developed stunted lacrimal gland and lens hypoplasia which was significantly more severe than that reported when only the ectodermal enhancer was deleted. This result suggested that the ectodermal enhancer must cooperate with its neighboring sequences to regulate the Pax6 ectodermal expression. Finally, we generated conditional knockouts of Prep1 in the lens and pancreas, but surprisingly, did not observe any developmental defects. Together, these results provide functional evidence for the independent and synergistic roles of the Pax6 upstream enhancers, and they suggest the potential redundancy of Meis/Prep protein in Pax6 regulation. PMID:22240097

  3. The functional role of the Meis/Prep-binding elements in Pax6 locus during pancreas and eye development

    PubMed Central

    Carbe, Christian; Hertzler-Schaefer, Kristina; Zhang, Xin

    2012-01-01

    Pax6 is an essential transcription factor for lens, lacrimal gland and pancreas development. Previous transgenic analyses have identified several Pax6 regulatory elements, but their functional significance and binding factors remain largely unknown. In this study, we generated two genomic truncations to delete three elements that were previously shown to bind to the Meis/Prep family homeoproteins. One 3.1 kb deletion (Pax6 ΔDP/ΔDP) removed two putative pancreatic enhancers and a previously identified ectodermal enhancer, while a 450 bp sub-deletion (Pax6ΔPE/ΔPE) eliminated only the promoter-proximal pancreatic enhancer. Immunohistochemistry and quantitative RT-PCR showed that the Pax6ΔPE/ΔPE pancreata had a significant decrease in Pax6, glucagon, and insulin expression, while no further reductions were observed in the Pax6ΔDP/ΔDP mice, indicating that only the 450 bp region is required for pancreatic development. In contrast, Pax6ΔDP/ΔDP, but not Pax6ΔPE/ΔPE mice, developed stunted lacrimal gland and lens hypoplasia which was significantly more severe than that reported when only the ectodermal enhancer was deleted. This result suggested that the ectodermal enhancer must cooperate with its neighboring sequences to regulate the Pax6 ectodermal expression. Finally, we generated conditional knockouts of Prep1 in lens and pancreas, but surprisingly, did not observe any developmental defects. Together, these results provide functional evidence for the independent and synergistic roles of the Pax6 upstream enhancers, and they suggest the potential redundancy of Meis/Prep protein in Pax6 regulation. PMID:22240097

  4. Integration of growth factor signals at the c-fos serum response element.

    PubMed

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription. PMID:8735278

  5. A Repetitive DNA Element Regulates Expression of the Helicobacter pylori Sialic Acid Binding Adhesin by a Rheostat-like Mechanism

    PubMed Central

    Vallström, Anna; Olofsson, Annelie; Öhman, Carina; Rakhimova, Lena; Borén, Thomas; Engstrand, Lars; Brännström, Kristoffer; Arnqvist, Anna

    2014-01-01

    During persistent infection, optimal expression of bacterial factors is required to match the ever-changing host environment. The gastric pathogen Helicobacter pylori has a large set of simple sequence repeats (SSR), which constitute contingency loci. Through a slipped strand mispairing mechanism, the SSRs generate heterogeneous populations that facilitate adaptation. Here, we present a model that explains, in molecular terms, how an intergenically located T-tract, via slipped strand mispairing, operates with a rheostat-like function, to fine-tune activity of the promoter that drives expression of the sialic acid binding adhesin, SabA. Using T-tract variants, in an isogenic strain background, we show that the length of the T-tract generates multiphasic output from the sabA promoter. Consequently, this alters the H. pylori binding to sialyl-Lewis x receptors on gastric mucosa. Fragment length analysis of post-infection isolated clones shows that the T-tract length is a highly variable feature in H. pylori. This mirrors the host-pathogen interplay, where the bacterium generates a set of clones from which the best-fit phenotypes are selected in the host. In silico and functional in vitro analyzes revealed that the length of the T-tract affects the local DNA structure and thereby binding of the RNA polymerase, through shifting of the axial alignment between the core promoter and UP-like elements. We identified additional genes in H. pylori, with T- or A-tracts positioned similar to that of sabA, and show that variations in the tract length likewise acted as rheostats to modulate cognate promoter output. Thus, we propose that this generally applicable mechanism, mediated by promoter-proximal SSRs, provides an alternative mechanism for transcriptional regulation in bacteria, such as H. pylori, which possesses a limited repertoire of classical trans-acting regulatory factors. PMID:24991812

  6. Using protein-binding microarrays to study transcription factor specificity: homologs, isoforms and complexes

    PubMed Central

    Andrilenas, Kellen K.; Penvose, Ashley

    2015-01-01

    Protein–DNA binding is central to specificity in gene regulation, and methods for characterizing transcription factor (TF)–DNA binding remain crucial to studies of regulatory specificity. High-throughput (HT) technologies have revolutionized our ability to characterize protein–DNA binding by significantly increasing the number of binding measurements that can be performed. Protein-binding microarrays (PBMs) are a robust and powerful HT platform for studying DNA-binding specificity of TFs. Analysis of PBM-determined DNA-binding profiles has provided new insight into the scope and mechanisms of TF binding diversity. In this review, we focus specifically on the PBM technique and discuss its application to the study of TF specificity, in particular, the binding diversity of TF homologs and multi-protein complexes. PMID:25431149

  7. Interleukin-2 transcription is regulated in vivo at the level of coordinated binding of both constitutive and regulated factors.

    PubMed Central

    Garrity, P A; Chen, D; Rothenberg, E V; Wold, B J

    1994-01-01

    Interleukin-2 (IL-2) transcription is developmentally restricted to T cells and physiologically dependent on specific stimuli such as antigen recognition. Prior studies have shown that this stringent two-tiered regulation is mediated through a transcriptional promoter/enhancer DNA segment which is composed of diverse recognition elements. Factors binding to some of these elements are present constitutively in many cell types, while others are signal dependent, T cell specific, or both. This raises several questions about the molecular mechanism by which IL-2 expression is regulated. Is the developmental commitment of T cells reflected molecularly by stable interaction between available factors and the IL-2 enhancer prior to signal-dependent induction? At which level, factor binding to DNA or factor activity once bound, are individual regulatory elements within the native enhancer regulated? By what mechanism is developmental and physiological specificity enforced, given the participation of many relatively nonspecific elements? To answer these questions, we have used in vivo footprinting to determine and compare patterns of protein-DNA interactions at the native IL-2 locus in cell environments, including EL4 T-lymphoma cells and 32D clone 5 premast cells, which express differing subsets of IL-2 DNA-binding factors. We also used the immunosuppressant cyclosporin A as a pharmacological agent to further dissect the roles played by cyclosporin A-sensitive factors in the assembly and maintenance of protein-DNA complexes. Occupancy of all site types was observed exclusively in T cells and then only upon excitation of signal transduction pathways. This was true even though partially overlapping subsets of IL-2-binding activities were shown to be present in 32D clone 5 premast cells. This observation was especially striking in 32D cells because, upon signal stimulation, they mobilized a substantial set of IL-2 DNA-binding activities, as measured by in vitro assays using

  8. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt

    2012-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  9. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes.

    PubMed

    Müller, Gerd A; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A; Engeland, Kurt

    2012-02-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G(0)/G(1). It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G(0). Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G(0)/G(1), but also for activation in S, G(2) and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  10. Sterol regulatory element-binding proteins are transcriptional regulators of the thyroglobulin gene in thyroid cells.

    PubMed

    Wen, Gaiping; Eder, Klaus; Ringseis, Robert

    2016-08-01

    The genes encoding sodium/iodide symporter (NIS) and thyroid peroxidase (TPO), both of which are essential for thyroid hormone (TH) synthesis, were shown to be regulated by sterol regulatory element-binding proteins (SREBP)-1c and -2. In the present study we tested the hypothesis that transcription of a further gene essential for TH synthesis, the thyroglobulin (TG) gene, is under the control of SREBP. To test this hypothesis, we studied the influence of inhibition of SREBP maturation and SREBP knockdown on TG expression in FRTL-5 thyrocytes and explored transcriptional regulation of the TG promoter by reporter gene experiments in FRTL-5 and HepG2 cells, gel shift assays and chromatin immunoprecipitation. Inhibition of SREBP maturation by 25-hydroxycholesterol and siRNA-mediated knockdown of either SREBP-1c or SREBP-2 decreased mRNA and protein levels of TG in FRTL-5 thyrocytes. Reporter gene assays with wild-type and mutated TG promoter reporter truncation constructs revealed that the rat TG promoter is transcriptionally activated by nSREBP-1c and nSREBP-2. DNA-binding assays and chromatin immunoprecipitation assays showed that both nSREBP-1c and nSREBP-2 bind to a SREBP binding motif with characteristics of an E-box SRE at position -63 in the rat TG promoter. In connection with recent findings that NIS and TPO are regulated by SREBP in thyrocytes the present findings support the view that SREBP are regulators of essential steps of TH synthesis in the thyroid gland such as iodide uptake, iodide oxidation and iodination of tyrosyl residues of TG. This moreover suggests that SREBP may be molecular targets for pharmacological modulation of TH synthesis. PMID:27321819

  11. Strategy for molecular beacon binding readout: separating molecular recognition element and signal reporter.

    PubMed

    Wang, Yongxiang; Li, Jishan; Jin, Jianyu; Wang, Hao; Tang, Hongxing; Yang, Ronghua; Wang, Kemin

    2009-12-01

    A new strategy for molecular beacon binding readout is proposed by using separation of the molecular recognition element and signal reporter. The signal transduction of the target binding event is based on displacing interaction between the target DNA and a competitor, the signal transducer. The target-free capture DNA is first interacted with the competitor, forming an assembled complex. In the presence of a target DNA that the affinity is stronger than that of the competitor, hybridization between capture DNA and the target disassembles the assembled complex and releases the free competitor to change the readout of the signal reporter. To demonstrate the feasibility of the design, a thymine-rich oligonucleotide was examined as a model system. Hg2+ was selected as the competitor, and mercaptoacetic acid-coated CdTe/ZnS quantum dots served as the fluorescent reporter. Selective binding of Hg2+ between the two thymine bases of the capture DNA forms a hairpin-structure. Hybridization between the capture DNA and target DNA destroys the hairpin-structure, releasing Hg2+ ions to quench the quantum dots fluorescence. Under the optimal conditions, fluorescence intensity of the quantum dots against the concentration of perfect cDNA was linear over the concentration range of 0.1-1.6 microM, with a limit of detection of 25 nM. This new assay method is simple in design, avoiding any oligonucleotide labeling. Furthermore, this strategy is generalizable since any target binding can in principle release the signal transducer and be detected with separated signal reporter. PMID:19899746

  12. Detection and properties of A-factor-binding protein from Streptomyces griseus

    SciTech Connect

    Miyake, K.; Horinouchi, S.; Yoshida, M.; Chiba, N.; Mori, K.; Nogawa, N.; Morikawa, N.; Beppu, T. )

    1989-08-01

    The optically active form of tritium-labeled A-factor (2-isocapryloyl-3R-hydroxymethyl-gamma-butyrolactone), a pleiotropic autoregulator responsible for streptomycin production, streptomycin resistance, and sporulation in Streptomyces griseus, was chemically synthesized. By using the radioactive A-factor, a binding protein for A-factor was detected in the cytoplasmic fraction of this organism. The binding protein had an apparent molecular weight of approximately 26,000, as determined by gel filtration. Scatchard analysis suggested that A-factor bound the protein in the molar ratio of 1:1 with a binding constant, Kd, of 0.7 nM. The number of the binding protein was roughly estimated to be 37 per genome. The inducing material virginiae butanolide C (VB-C), which has a structure very similar to that of A-factor and is essential for virginiamycin production in Streptomyces virginiae, did not inhibit binding. In addition, no protein capable of specifically binding {sup 3}H-labeled VB-C was found in S. griseus. Together with the observation that VB-C had almost no biological activity on the restoration of streptomycin production or sporulation in an A-factor-deficient mutant of S. griseus, these results indicated that the binding protein had a strict ligand specificity. Examination for an A-factor-binding protein in Streptomyces coelicolor A3(2) and Streptomyces lividans showed the absence of any specifically binding protein.

  13. Transcriptome Profiling of Pediatric Core Binding Factor AML

    PubMed Central

    Hsu, Chih-Hao; Nguyen, Cu; Yan, Chunhua; Ries, Rhonda E.; Chen, Qing-Rong; Hu, Ying; Ostronoff, Fabiana; Stirewalt, Derek L.; Komatsoulis, George; Levy, Shawn

    2015-01-01

    The t(8;21) and Inv(16) translocations disrupt the normal function of core binding factors alpha (CBFA) and beta (CBFB), respectively. These translocations represent two of the most common genomic abnormalities in acute myeloid leukemia (AML) patients, occurring in approximately 25% pediatric and 15% of adult with this malignancy. Both translocations are associated with favorable clinical outcomes after intensive chemotherapy, and given the perceived mechanistic similarities, patients with these translocations are frequently referred to as having CBF-AML. It remains uncertain as to whether, collectively, these translocations are mechanistically the same or impact different pathways in subtle ways that have both biological and clinical significance. Therefore, we used transcriptome sequencing (RNA-seq) to investigate the similarities and differences in genes and pathways between these subtypes of pediatric AMLs. Diagnostic RNA from patients with t(8;21) (N = 17), Inv(16) (N = 14), and normal karyotype (NK, N = 33) were subjected to RNA-seq. Analyses compared the transcriptomes across these three cytogenetic subtypes, using the NK cohort as the control. A total of 1291 genes in t(8;21) and 474 genes in Inv(16) were differentially expressed relative to the NK controls, with 198 genes differentially expressed in both subtypes. The majority of these genes (175/198; binomial test p-value < 10−30) are consistent in expression changes among the two subtypes suggesting the expression profiles are more similar between the CBF cohorts than in the NK cohort. Our analysis also revealed alternative splicing events (ASEs) differentially expressed across subtypes, with 337 t(8;21)-specific and 407 Inv(16)-specific ASEs detected, the majority of which were acetylated proteins (p = 1.5x10-51 and p = 1.8x10-54 for the two subsets). In addition to known fusions, we identified and verified 16 de novo fusions in 43 patients, including three fusions involving NUP98 in six patients

  14. Two distinct factors bind to the rabbit uteroglobin TATA-box region and are required for efficient transcription.

    PubMed Central

    Klug, J; Knapp, S; Castro, I; Beato, M

    1994-01-01

    The rabbit uteroglobin gene is expressed in a variety of epithelial cell types like the lung Clara cells and the glandular and luminal epithelial cells of the endometrium. Expression in Clara cells is on a high constitutive level, whereas expression in the rabbit endometrium is under tight hormonal control. One important element of the rabbit uteroglobin gene mediating its efficient transcription in two epithelial cell lines from human endometrium (Ishikawa) and lung (NCI-H441) is its noncanonical TATA box (TACA). Here, we show that two factors (TATA core factor [TCF] and TATA palindrome factor [TPF]) different from the TATA-box binding protein bind to the DNA major groove at two adjacent sites within the uteroglobin TATA-box region and that one of them (TCF) is specifically expressed in cell lines derived from uteroglobin-expressing tissues. The binding sites for TCF and TPF, respectively, are both required for efficient transcription in Ishikawa and NCI-H441 cells. Mutation of the TACA box, which we show is a poor TATA box in functional terms, to a canonical TATA motif does not affect TCF and TPF binding. Therefore, we suggest that the function of the unusual cytosine could be to reduce rabbit uteroglobin expression in cells lacking TCF and that the interaction of TATA-box binding protein with the weak TACA site is facilitated in TCF- and TPF-positive cells. Images PMID:8065353

  15. Dynamics, mechanisms, and functional implications of transcription factor binding evolution in metazoans

    PubMed Central

    Villar, Diego

    2014-01-01

    Synopsis Transcription factor binding differences can contribute to organismal evolution by altering downstream gene expression programmes. Recent genome-wide studies in Drosophila and mammals have revealed common quantitative and combinatorial properties of in vivo DNA-binding, as well as significant differences in the rate and mechanisms of metazoan transcription factor binding evolution. Here, we review the recently-discovered, rapid re-wiring of in vivo transcription factor binding between related metazoan species and summarize general principles underlying the observed patterns of evolution. We then consider what might explain genome evolution differences between metazoan phyla, and outline the conceptual and technological challenges facing the field. PMID:24590227

  16. The metalloendopeptidase nardilysin (NRDc) is potently inhibited by heparin-binding epidermal growth factor-like growth factor (HB-EGF).

    PubMed Central

    Hospital, Véronique; Nishi, Eiichiro; Klagsbrun, Michael; Cohen, Paul; Seidah, Nabil G; Prat, Annik

    2002-01-01

    Nardilysin (N-arginine dibasic convertase, or NRDc) is a cytosolic and cell-surface metalloendopeptidase that, in vitro, cleaves substrates upstream of Arg or Lys in basic pairs. NRDc differs from most of the other members of the M16 family of metalloendopeptidases by a 90 amino acid acidic domain (DAC) inserted close to its active site. At the cell surface, NRDc binds heparin-binding epidermal growth factor-like growth factor (HB-EGF) and enhances HB-EGF-induced cell migration. An active-site mutant of NRDc fulfills this function as well as wild-type NRDc, indicating that the enzyme activity is not required for this process. We now demonstrate that NRDc starts at Met(49). Furthermore, we show that HB-EGF not only binds to NRDc but also potently inhibits its enzymic activity. NRDc-HB-EGF interaction involves the 21 amino acid heparin-binding domain (P21) of the growth factor, the DAC of NRDc and most probably its active site. Only disulphide-bonded P21 dimers are inhibitory. We also show that Ca(2+), via the DAC, regulates both NRDc activity and HB-EGF binding. We conclude that the DAC is thus a key regulatory element for the two distinct functions that NRDc fulfills, i.e. as an HB-EGF modulator and a peptidase. PMID:12095415

  17. Heparin binding to platelet factor-4. An NMR and site-directed mutagenesis study: arginine residues are crucial for binding.

    PubMed Central

    Mayo, K H; Ilyina, E; Roongta, V; Dundas, M; Joseph, J; Lai, C K; Maione, T; Daly, T J

    1995-01-01

    Native platelet factor-4 (PF4) is an asymmetrically associated, homo-tetrameric protein (70 residues/subunit) known for binding polysulphated glycosaminoglycans like heparin. PF4 N-terminal chimeric mutant M2 (PF4-M2), on the other hand, forms symmetric tetramers [Mayo, Roongta, Ilyina, Milius, Barker, Quinlan, La Rosa and Daly (1995) Biochemistry 34, 11399-11409] making NMR studies with this 32 kDa protein tractable. PF4-M2, moreover, binds heparin with a similar affinity to that of native PF4. NMR data presented here indicate that heparin (9000 Da cut-off) binding to PF4-M2, while not perturbing the overall structure of the protein, does perturb specific side-chain proton resonances which map to spatially related residues within a ring of positively charged side chains on the surface of tetrameric PF4-M2. Contrary to PF4-heparin binding models which centre around C-terminal alpha-helix lysines, this study indicates that a loop containing Arg-20, Arg-22, His-23 and Thr-25, as well as Lys-46 and Arg-49, are even more affected by heparin binding. Site-directed mutagenesis and heparin binding data support these NMR findings by indicating that arginines more than C-terminal lysines, are crucial to the heparin binding process. Images Figure 4 PMID:8526843

  18. Trigger factor binds to ribosome–signal-recognition particle (SRP) complexes and is excluded by binding of the SRP receptor

    PubMed Central

    Buskiewicz, Iwona; Deuerling, Elke; Gu, Shan-Qing; Jöckel, Johannes; Rodnina, Marina V.; Bukau, Bernd; Wintermeyer, Wolfgang

    2004-01-01

    Trigger factor (TF) and signal recognition particle (SRP) bind to the bacterial ribosome and are both crosslinked to protein L23 at the peptide exit, where they interact with emerging nascent peptide chains. It is unclear whether TF and SRP exclude one another from their ribosomal binding site(s). Here we show that SRP and TF can bind simultaneously to ribosomes or ribosome nascent-chain complexes exposing a SRP-specific signal sequence. Based on changes of the crosslinking pattern and on results obtained by fluorescence measurements using fluorescence-labeled SRP, TF binding induces structural changes in the ribosome–SRP complex. Furthermore, we show that binding of the SRP receptor, FtsY, to ribosome-bound SRP excludes TF from the ribosome. These results suggest that TF and SRP sample nascent chains on the ribosome in a nonexclusive fashion. The decision for ribosome nascent-chain complexes exposing a signal sequence to enter SRP-dependent membrane targeting seems to be determined by the binding of SRP, which is stabilized by signal sequence recognition, and promoted by the exclusion of TF due to the binding of the SRP receptor to ribosome-bound SRP. PMID:15148364

  19. DNA bending and binding factors of the human. beta. -actin promoter

    SciTech Connect

    Kawamoto, Takeshi; Makino, Kozo; Orita, Satoshi; Nakata, Atsuo; Kakunaga, Takeo )

    1989-01-25

    Transcription of the {beta}-actin gene is rapidly inducible in response to serum stimulation. To determine the regions responsible for serum inducible and basal level expression, the human {beta}-actin promoter was subjected to mutational analysis. Two distinct elements, the CCAAT homology and the {beta}-actin specific conserved sequences, were found by a chloramphenicol acetyltransferase expression assay and sequence comparisons, and then analyzed for possible functions. Using a DNA bend assay, it was shown that the conserved sequences included the core of a sequence-directed bend of DNA. Gel mobility shift and DNase I protection assays revealed that the conserved sequences and the CCAAT homology were recognized by binding factors in HeLa cell extracts.

  20. Regulation of cAMP response element binding protein (CREB) binding in the mammalian clock pacemaker by light but not a circadian clock.

    PubMed

    Kako, K; Banasik, M; Lee, K; Ishida, N

    1997-02-01

    Mammalian circadian rhythms are considered to be regulated by a clock pacemaker located in the suprachiasmatic nuclei (SCN) of the hypothalamus. The molecular mechanism of entrainment and oscillation of circadian rhythm are not well understood but photic induction of immediate-early gene (IEG) expression in the SCN is thought to play a role. Here we show that under 12 h light:12 h dark (LD) condition, the cAMP response element binding protein (CREB) binding to cAMP responsive promoter element (CRE) of NMDAR1/zeta1 promoter region in the SCN is higher during the light than the dark by electro-mobility shift assay (EMSA). When animals are placed in constant dark, CREB DNA binding activity in the SCN is low and does not vary with circadian time when compared with cortex nuclear extract as a control. Most significantly, photic induction of CREB binding activity in the SCN occurs at all circadian times tested, indicating that CREB DNA binding in the SCN is not gated by the endogenous clock. These results implicate the role of CREB in photic neuronal signaling in the SCN and suggest that CREB DNA binding activities may not be regulated by a circadian clock. PMID:9030696

  1. A General Pairwise Interaction Model Provides an Accurate Description of In Vivo Transcription Factor Binding Sites

    PubMed Central

    Santolini, Marc; Mora, Thierry; Hakim, Vincent

    2014-01-01

    The identification of transcription factor binding sites (TFBSs) on genomic DNA is of crucial importance for understanding and predicting regulatory elements in gene networks. TFBS motifs are commonly described by Position Weight Matrices (PWMs), in which each DNA base pair contributes independently to the transcription factor (TF) binding. However, this description ignores correlations between nucleotides at different positions, and is generally inaccurate: analysing fly and mouse in vivo ChIPseq data, we show that in most cases the PWM model fails to reproduce the observed statistics of TFBSs. To overcome this issue, we introduce the pairwise interaction model (PIM), a generalization of the PWM model. The model is based on the principle of maximum entropy and explicitly describes pairwise correlations between nucleotides at different positions, while being otherwise as unconstrained as possible. It is mathematically equivalent to considering a TF-DNA binding energy that depends additively on each nucleotide identity at all positions in the TFBS, like the PWM model, but also additively on pairs of nucleotides. We find that the PIM significantly improves over the PWM model, and even provides an optimal description of TFBS statistics within statistical noise. The PIM generalizes previous approaches to interdependent positions: it accounts for co-variation of two or more base pairs, and predicts secondary motifs, while outperforming multiple-motif models consisting of mixtures of PWMs. We analyse the structure of pairwise interactions between nucleotides, and find that they are sparse and dominantly located between consecutive base pairs in the flanking region of TFBS. Nonetheless, interactions between pairs of non-consecutive nucleotides are found to play a significant role in the obtained accurate description of TFBS statistics. The PIM is computationally tractable, and provides a general framework that should be useful for describing and predicting TFBSs beyond

  2. Phosphatidylserine-induced Factor Xa Dimerization and Binding to Factor Va Are Competing Processes in Solution

    PubMed Central

    Majumder, Rinku; Koklic, Tilen; Rezaie, Alireza R.; Lentz, Barry R.

    2013-01-01

    A soluble, short chain phosphatidylserine, 1,2-dicaproyl-sn-glycero-3-phospho-L-serine (C6PS), binds to discrete sites on FXa, FVa, and prothrombin to alter their conformations, to promote FXa dimerization (Kd ~ 14 nM), and to enhance both the catalytic activity of FXa and the cofactor activity of FVa. In the presence of calcium, C6PS binds to two sites on FXa, one in the epidermal growth factor like (EGF) domain and one in the catalytic domain; the latter interaction is sensitive to Na+ binding and probably represents a protein recognition site. Here we ask whether dimerization of FXa and its binding to FVa in the presence of C6PS are competitive processes. We monitored FXa activity at 5, 20 and 50 nM FXa while titrating with FVa in the presence of 400 µM C6PS and 3 or 5 mM Ca2+ to show that the apparent Kd of FVa-FXa interaction increased with increasing FXa concentration at 5 mM Ca2+, but the Kd was only slightly affected at 3 mM Ca2+. A mixture of 50 nM FXa and 50 nM FVa in the presence of 400 µM C6PS yielded both Xa homodimers and Xa ·Va heterodimers but no FXa dimers bound to FVa. A mutant FXa (R165A) that has reduced prothrombinase activity showed both reduced dimerization (Kd~147 nM) and reduced FVa binding (apparent Kd, = 58, 92 and 128 nM, respectively for 5, 20 and 50 nM R165A FXa). Native gel electrophoresis showed that the GLA-EGFNC fragment of FXa (lacking the catalytic domain) neither dimerized nor formed a complex with FVa in the presence of 400 µM C6PS and 5 mM Ca2+. Our results demonstrate that the dimerization site and FVa binding site are both located in the catalytic domain of FXa and that these sites are linked thermodynamically. PMID:23214401

  3. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation*

    PubMed Central

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2015-01-01

    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome. PMID:26140926

  4. Human Research Program: Space Human Factors and Habitability Element

    NASA Technical Reports Server (NTRS)

    Russo, Dane M.

    2007-01-01

    The three project areas of the Space Human Factors and Habitability Element work together to achieve a working and living environment that will keep crews healthy, safe, and productive throughout all missions -- from Earth orbit to Mars expeditions. The Advanced Environmental Health (AEH) Project develops and evaluates advanced habitability systems and establishes requirements and health standards for exploration missions. The Space Human Factors Engineering (SHFE) Project s goal is to ensure a safe and productive environment for humans in space. With missions using new technologies at an ever-increasing rate, it is imperative that these advances enhance crew performance without increasing stress or risk. The ultimate goal of Advanced Food Technology (AFT) Project is to develop and deliver technologies for human centered spacecraft that will support crews on missions to the moon, Mars, and beyond.

  5. Sterol regulatory element-binding proteins are regulators of the NIS gene in thyroid cells.

    PubMed

    Ringseis, Robert; Rauer, Christine; Rothe, Susanne; Gessner, Denise K; Schütz, Lisa-Marie; Luci, Sebastian; Wen, Gaiping; Eder, Klaus

    2013-05-01

    The uptake of iodide into the thyroid, an essential step in thyroid hormone synthesis, is an active process mediated by the sodium-iodide symporter (NIS). Despite its strong dependence on TSH, the master regulator of the thyroid, the NIS gene was also reported to be regulated by non-TSH signaling pathways. In the present study we provide evidence that the rat NIS gene is subject to regulation by sterol regulatory element-binding proteins (SREBPs), which were initially identified as master transcriptional regulators of lipid biosynthesis and uptake. Studies in FRTL-5 thyrocytes revealed that TSH stimulates expression and maturation of SREBPs and expression of classical SREBP target genes involved in lipid biosynthesis and uptake. Almost identical effects were observed when the cAMP agonist forskolin was used instead of TSH. In TSH receptor-deficient mice, in which TSH/cAMP-dependent gene regulation is blocked, the expression of SREBP isoforms in the thyroid was markedly reduced when compared with wild-type mice. Sterol-mediated inhibition of SREBP maturation and/or RNA interference-mediated knockdown of SREBPs reduced expression of NIS and NIS-specific iodide uptake in FRTL-5 cells. Conversely, overexpression of active SREBPs caused a strong activation of the 5'-flanking region of the rat NIS gene mediated by binding to a functional SREBP binding site located in the 5'-untranslated region of the rat NIS gene. These findings show that TSH acts as a regulator of SREBP expression and maturation in thyroid epithelial cells and that SREBPs are novel transcriptional regulators of NIS. PMID:23542164

  6. The ternary complex factor Net contains two distinct elements that mediate different responses to MAP kinase signalling cascades.

    PubMed

    Ducret, C; Maira, S M; Lutz, Y; Wasylyk, B

    2000-10-19

    The ternary complex factors (TCFs), Elk-1, Sap-1a and Net, are key integrators of the transcriptional response to different signalling pathways. Classically, three MAP kinase pathways, involving ERK, JNK, and p38, transduce various extracellular stimuli to the nucleus. Net is a repressor that is converted into an activator by Ras/ERK signalling. Net is also exported from the nucleus in response to stress stimuli transduced through the JNK pathway, leading to relief from repression. Here we show that ERK and p38 bind to the D box and that binding is required for phosphorylation of the adjacent C-terminally located C-domain. The D box as well as the phosphorylation sites in the C-domain (the DC element) are required for transcription activation by Ras. On the other hand, JNK binds to the J box in the middle of the protein, and binding is required for phosphorylation of the adjacent EXport motif. Both the binding and phosphorylation sites (the JEX element) are important for Net export. In conclusion, specific targeting of Net by MAP kinase pathways involves two different docking sites and phosphorylation of two different domains. These two elements, DC and JEX, mediate two distinct functional responses. PMID:11042694

  7. The endothelial cell binding determinant of human factor IX resides in the. gamma. -carboxyglutamic acid domain

    SciTech Connect

    Toomey, J.R.; Roberts, H.R.; Stafford, D.W. ); Smith, K.J. United Blood Services, Albuquerque, NM )

    1992-02-18

    The blood coagulation factor IX(a) binds specifically to a site on endothelial cells with a K{sub d} of 2.0-3.0 nM. A number of previous studies have attempted to define the region(s) of factor IX(a) that mediate this interaction. These studies suggested that there are two regions of factor IX(a), the {gamma}-carboxyglutamic acid (Gla) domain and the epidermal growth factor like (EGF-like) domains, that mediate high-affinity binding to endothelial cells. Recently, however, the participation of the EGF1 domain has been excluded from the interaction. This indicated that if there was an EGF component of factor IX contributing to the binding affinity, then it must be in the second EGF-like domain. In order to further evaluate this relationship, the authors performed competitive binding experiments between {sup 125}I plasma factor IX and a set of six chimeric proteins composed of portions of factor VII and factor IX. The data suggest that the high-affinity interaction between factor IX and the endothelial cell binding site is mediated by the factor IX Gla domain and that the factor IX EGF domains are not involved in binding specificity.

  8. Cytofluorometric identification of plasmin-sensitive factor XIIIa binding to platelets.

    PubMed

    Kreager, J A; Devine, D V; Greenberg, C S

    1988-08-30

    We have investigated the binding of blood coagulation factor XIIIa to thrombin-stimulated platelets using cytofluorometric analysis. Washed thrombin-stimulated platelets bound exogenously added factor XIIIa in a calcium-dependent reaction. The expression of endogenous platelet factor XIII was also detected on the surface of thrombin-stimulated platelets. When fluorescence analysis was performed based on particle size, factor XIIIa bound to the surface of greater than 95% of particles which contained more than one platelet, but only 50% of single platelets. The binding of factor XIIIa to thrombin-stimulated platelets was inhibited by plasmin. Plasmin also inhibited thrombin-dependent expression of the factor XIIIa binding site on platelets. Experiments in which thrombin-stimulated platelets were incubated with factor XIIIa in the presence of 125I-dimethylcasein or 3H-putrescine demonstrated that platelets bear both glutamyl and lysyl substrates for factor XIIIa. Thrombin increased the expression of factor XIIIa substrates by platelets. Plasmin inhibited both the expression of factor XIIIa substrates and degraded them. The binding of factor XIIIa to thrombin-stimulated platelets and the availability of factor XIIIa substrates on the platelet surface could provide a mechanism by which factor XIIIa stabilizes the hemostatic plug by promoting crosslinking reactions between platelet membrane proteins and adhesive glycoproteins. In contrast, plasmin inhibition of factor XIIIa binding and crosslinking could disrupt hemostasis. PMID:2903577

  9. Core-level binding-energy shifts for the metallic elements

    NASA Astrophysics Data System (ADS)

    Johansson, Börje; Mårtensson, Nils

    1980-05-01

    A general treatment of core-level binding-energy shifts in metals relative to the free atom is introduced and applied to all elemental metals in the Periodic Table. The crucial ingredients of the theoretical description are (a) the assumption of a fully screened final state in the metallic case and (b) the (Z+1) approximation for the screening valence charge distribution around the core-ionized site. This core-ionized site is, furthermore, treated as an impurity in an otherwise perfect metal. The combination of the complete screening picture and the (Z+1) approximation makes it possible to introduce a Born-Haber cycle which connects the initial state with the final state of the core-ionization process. From this cycle it becomes evident that the main contributions to the core-level shift are the cohesive energy difference between the (Z+1) and Z metal and an appropriate ionization energy of the (Z+1) atom (usually the first ionization potential). The appearance of the ionization potential in the shift originates from the assumption of a charge-neutral final state, while the contribution from the cohesive energies essentially describes the change of bonding properties between the initial and final state of the site. The calculated shifts show very good agreement with available experimental values (at present, for 19 elements). For the other elements we have made an effort to combine experimental ionization potentials with theoretical calculations in order to obtain accurate estimates of some of the atomic-core-level binding energies. Such energies together with measured metallic binding energies give "pseudoexperimental" shifts for many elements. Our calculated core-level shifts agree exceedingly well also with these data. For some of the transition elements the core-level shift shows a deviating behavior in comparison with that of neighboring elements. This is shown to be due to a difference in the atomic ground-state configuration, such as, for example, d5s in

  10. ConBind: motif-aware cross-species alignment for the identification of functional transcription factor binding sites.

    PubMed

    Lelieveld, Stefan H; Schütte, Judith; Dijkstra, Maurits J J; Bawono, Punto; Kinston, Sarah J; Göttgens, Berthold; Heringa, Jaap; Bonzanni, Nicola

    2016-05-01

    Eukaryotic gene expression is regulated by transcription factors (TFs) binding to promoter as well as distal enhancers. TFs recognize short, but specific binding sites (TFBSs) that are located within the promoter and enhancer regions. Functionally relevant TFBSs are often highly conserved during evolution leaving a strong phylogenetic signal. While multiple sequence alignment (MSA) is a potent tool to detect the phylogenetic signal, the current MSA implementations are optimized to align the maximum number of identical nucleotides. This approach might result in the omission of conserved motifs that contain interchangeable nucleotides such as the ETS motif (IUPAC code: GGAW). Here, we introduce ConBind, a novel method to enhance alignment of short motifs, even if their mutual sequence similarity is only partial. ConBind improves the identification of conserved TFBSs by improving the alignment accuracy of TFBS families within orthologous DNA sequences. Functional validation of the Gfi1b + 13 enhancer reveals that ConBind identifies additional functionally important ETS binding sites that were missed by all other tested alignment tools. In addition to the analysis of known regulatory regions, our web tool is useful for the analysis of TFBSs on so far unknown DNA regions identified through ChIP-sequencing. PMID:26721389

  11. ConBind: motif-aware cross-species alignment for the identification of functional transcription factor binding sites

    PubMed Central

    Lelieveld, Stefan H.; Schütte, Judith; Dijkstra, Maurits J.J.; Bawono, Punto; Kinston, Sarah J.; Göttgens, Berthold; Heringa, Jaap; Bonzanni, Nicola

    2016-01-01

    Eukaryotic gene expression is regulated by transcription factors (TFs) binding to promoter as well as distal enhancers. TFs recognize short, but specific binding sites (TFBSs) that are located within the promoter and enhancer regions. Functionally relevant TFBSs are often highly conserved during evolution leaving a strong phylogenetic signal. While multiple sequence alignment (MSA) is a potent tool to detect the phylogenetic signal, the current MSA implementations are optimized to align the maximum number of identical nucleotides. This approach might result in the omission of conserved motifs that contain interchangeable nucleotides such as the ETS motif (IUPAC code: GGAW). Here, we introduce ConBind, a novel method to enhance alignment of short motifs, even if their mutual sequence similarity is only partial. ConBind improves the identification of conserved TFBSs by improving the alignment accuracy of TFBS families within orthologous DNA sequences. Functional validation of the Gfi1b + 13 enhancer reveals that ConBind identifies additional functionally important ETS binding sites that were missed by all other tested alignment tools. In addition to the analysis of known regulatory regions, our web tool is useful for the analysis of TFBSs on so far unknown DNA regions identified through ChIP-sequencing. PMID:26721389

  12. Bookmarking by specific and nonspecific binding of FoxA1 pioneer factor to mitotic chromosomes.

    PubMed

    Caravaca, Juan Manuel; Donahue, Greg; Becker, Justin S; He, Ximiao; Vinson, Charles; Zaret, Kenneth S

    2013-02-01

    While most transcription factors exit the chromatin during mitosis and the genome becomes silent, a subset of factors remains and "bookmarks" genes for rapid reactivation as cells progress through the cell cycle. However, it is unknown whether such bookmarking factors bind to chromatin similarly in mitosis and how different binding capacities among them relate to function. We compared a diverse set of transcription factors involved in liver differentiation and found markedly different extents of mitotic chromosome binding. Among them, the pioneer factor FoxA1 exhibits the greatest extent of mitotic chromosome binding. Genomically, ~15% of the FoxA1 interphase target sites are bound in mitosis, including at genes that are important for liver differentiation. Biophysical, genome mapping, and mutagenesis studies of FoxA1 reveals two different modes of binding to mitotic chromatin. Specific binding in mitosis occurs at sites that continue to be bound from interphase. Nonspecific binding in mitosis occurs across the chromosome due to the intrinsic chromatin affinity of FoxA1. Both specific and nonspecific binding contribute to timely reactivation of target genes post-mitosis. These studies reveal an unexpected diversity in the mechanisms by which transcription factors help retain cell identity during mitosis. PMID:23355396

  13. Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha.

    PubMed

    Yuan, Yong; Hilliard, George; Ferguson, Tsuneo; Millhorn, David E

    2003-05-01

    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element. The alpha-subunits of the HIF transcription factors are degraded by proteasomal pathways during normoxia but are stabilized under hypoxic conditions. The von Hippel-Lindau protein (pVHL) mediates the ubiquitination and rapid degradation of HIF-alpha (including HIF-1alpha and HIF-2alpha). Post-translational hydroxylation of a proline residue in the oxygen-dependent degradation (ODD) domain of HIF-alpha is required for the interaction between HIF and VHL. It has previously been established that cobalt mimics hypoxia and causes accumulation of HIF-1alpha and HIF-2alpha. However, little is known about the mechanism by which this occurs. In an earlier study, we demonstrated that cobalt binds directly to the ODD domain of HIF-2alpha. Here we provide the first evidence that cobalt inhibits pVHL binding to HIF-alpha even when HIF-alpha is hydroxylated. Deletion of 17 amino acids within the ODD domain of HIF-2alpha that are required for pVHL binding prevented the binding of cobalt and stabilized HIF-2alpha during normoxia. These findings show that cobalt mimics hypoxia, at least in part, by occupying the VHL-binding domain of HIF-alpha and thereby preventing the degradation of HIF-alpha. PMID:12606543

  14. Binding site of MraZ transcription factor in Mollicutes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Semashko, T A; Arzamasov, A A; Manuvera, V A; Letarov, A V; Govorun, V M

    2016-06-01

    Mollicutes (mycoplasmas) feature a significant loss of known regulators of gene expression. Here, we identified the recognition site of the MraZ-family regulator of Mycoplasma gallisepticum, which is conserved in many species of different clades within class Mollicutes. The MraZ binding site is AAAGTG[T/G], in the promoter of mraZ gene it forms a series of direct repeats with a structure (AAAGTG[T/G]N3)k, where k = 3 most frequently. MraZ binds to a single repeat as an octamer complex. MraZ can also bind a single binding site or a series of repeats with different spacer lengths (2-4 nt); thus, it may play a role in the regulation of multiple operons in Mollicutes. In M. gallisepticum, MraZ acts as a transcriptional activator. The overexpression of MraZ leads to moderate filamentation of cells and the formation of aggregates, likely as a result of incomplete cytokinesis. PMID:26945841

  15. Phosphate binding protein as the biorecognition element in a biosensor for phosphate

    NASA Technical Reports Server (NTRS)

    Salins, Lyndon L E.; Deo, Sapna K.; Daunert, Sylvia

    2004-01-01

    This work explores the potential use of a member of the periplasmic family of binding proteins, the phosphate binding protein (PBP), as the biorecognition element in a sensing scheme for the detection of inorganic phosphate (Pi). The selectivity of this protein originates from its natural role which, in Escherichia coli, is to serve as the initial receptor for the highly specific translocation of Pi to the cytoplasm. The single polypeptide chain of PBP is folded into two similar domains connected by three short peptide linkages that serve as a hinge. The Pi binding site is located deep within the cleft between the two domains. In the presence of the ligand, the two globular domains engulf the former in a hinge-like manner. The resultant conformational change constitutes the basis of the sensor development. A mutant of PBP (MPBP), where an alanine was replaced by a cysteine residue, was prepared by site-directed mutagenesis using the polymerase chain reaction (PCR). The mutant was expressed, from plasmid pSD501, in the periplasmic space of E. coli and purified in a single chromatographic step on a perfusion anion-exchange column. Site-specific labeling was achieved by attaching the fluorophore, N-[2-(1-maleimidyl)ethyl]-7-(diethylamino)coumarin-3-carboxamide (MDCC), to the protein through the sulfhydryl group of the cysteine moiety. Steady-state fluorescence studies of the MPBP-MDCC conjugate showed a change in the intensity of the signal upon addition of Pi. Calibration curves for Pi were constructed by relating the intensity of the fluorescence signal with the amount of analyte present in the sample. The sensing system was first developed and optimized on a spectrofluorometer using ml volumes of sample. It was then adapted to be used on a microtiter plate arrangement with microliter sample volumes. The system's versatility was finally proven by developing a fiber optic fluorescence-based sensor for monitoring Pi. In all three cases the detection limits for the

  16. Structure of a Thyroid Hormone Receptor DNA-Binding Domain Homodimer Bound to an Inverted Palindrome DNA Response Element

    SciTech Connect

    Chen, Yi; Young, Matthew A.

    2010-10-22

    Thyroid hormone receptor (TR), as a member of the nuclear hormone receptor family, can recognize and bind different classes of DNA response element targets as either a monomer, a homooligomer, or a heterooligomer. We report here the first crystal structure of a homodimer TR DNA-binding domain (DBD) in complex with an inverted repeat class of thyroid response element (TRE). The structure shows a nearly symmetric structure of the TR DBD assembled on the F2 TRE where the base recognition contacts in the homodimer DNA complex are conserved relative to the previously published structure of a TR-9-cis-retinoic acid receptor heterodimer DNA complex. The new structure also reveals that the T-box region of the DBD can function as a structural hinge that enables a large degree of flexibility in the position of the C-terminal extension helix that connects the DBD to the ligand-binding domain. Although the isolated TR DBDs exist as monomers in solution, we have measured highly cooperative binding of the two TR DBD subunits onto the inverted repeat DNA sequence. This suggests that elements of the DBD can influence the specific TR oligomerization at target genes, and it is not just interactions between the ligand-binding domains that are responsible for TR oligomerization at target genes. Mutational analysis shows that intersubunit contacts at the DBD C terminus account for some, but not all, of the cooperative homodimer TR binding to the inverted repeat class TRE.

  17. Factor B Is the Second Lipopolysaccharide-binding Protease Zymogen in the Horseshoe Crab Coagulation Cascade.

    PubMed

    Kobayashi, Yuki; Takahashi, Toshiaki; Shibata, Toshio; Ikeda, Shunsuke; Koshiba, Takumi; Mizumura, Hikaru; Oda, Toshio; Kawabata, Shun-ichiro

    2015-07-31

    Factor B is a serine-protease zymogen in the horseshoe crab coagulation cascade, and it is the primary substrate for activated factor C, the LPS-responsive initiator of the cascade. Factor C is autocatalytically activated to α-factor C on LPS and is artificially converted to β-factor C, another activated form, by chymotrypsin. It is not known, however, whether LPS is required for the activation of factor B. Here we found that wild-type factor B expressed in HEK293S cells is activated by α-factor C, but not by β-factor C, in an LPS-dependent manner and that β-factor C loses the LPS binding activity of factor C through additional cleavage by chymotrypsin within the N-terminal LPS-binding region. Surface plasmon resonance and quartz crystal microbalance analyses revealed that wild-type factor B binds to LPS with high affinity comparable with that of factor C, demonstrating that factor B is the second LPS-binding zymogen in the cascade. An LPS-binding site of wild-type factor B was found in the N-terminal clip domain, and the activation rate of a clip domain deletion mutant was considerably slower than that of wild-type factor B. Moreover, in the presence of LPS, Triton X-100 inhibited the activation of wild-type factor B by α-factor C. We conclude that the clip domain of factor B has an important role in localizing factor B to the surface of Gram-negative bacteria or LPS released from bacteria to initiate effective proteolytic activation by α-factor C. PMID:26109069

  18. Factor B Is the Second Lipopolysaccharide-binding Protease Zymogen in the Horseshoe Crab Coagulation Cascade*

    PubMed Central

    Kobayashi, Yuki; Takahashi, Toshiaki; Shibata, Toshio; Ikeda, Shunsuke; Koshiba, Takumi; Mizumura, Hikaru; Oda, Toshio; Kawabata, Shun-ichiro

    2015-01-01

    Factor B is a serine-protease zymogen in the horseshoe crab coagulation cascade, and it is the primary substrate for activated factor C, the LPS-responsive initiator of the cascade. Factor C is autocatalytically activated to α-factor C on LPS and is artificially converted to β-factor C, another activated form, by chymotrypsin. It is not known, however, whether LPS is required for the activation of factor B. Here we found that wild-type factor B expressed in HEK293S cells is activated by α-factor C, but not by β-factor C, in an LPS-dependent manner and that β-factor C loses the LPS binding activity of factor C through additional cleavage by chymotrypsin within the N-terminal LPS-binding region. Surface plasmon resonance and quartz crystal microbalance analyses revealed that wild-type factor B binds to LPS with high affinity comparable with that of factor C, demonstrating that factor B is the second LPS-binding zymogen in the cascade. An LPS-binding site of wild-type factor B was found in the N-terminal clip domain, and the activation rate of a clip domain deletion mutant was considerably slower than that of wild-type factor B. Moreover, in the presence of LPS, Triton X-100 inhibited the activation of wild-type factor B by α-factor C. We conclude that the clip domain of factor B has an important role in localizing factor B to the surface of Gram-negative bacteria or LPS released from bacteria to initiate effective proteolytic activation by α-factor C. PMID:26109069

  19. The Binding of Syndapin SH3 Domain to Dynamin Proline-rich Domain Involves Short and Long Distance Elements.

    PubMed

    Luo, Lin; Xue, Jing; Kwan, Ann; Gamsjaeger, Roland; Wielens, Jerome; von Kleist, Lisa; Cubeddu, Liza; Guo, Zhong; Stow, Jennifer L; Parker, Michael W; Mackay, Joel P; Robinson, Phillip J

    2016-04-29

    Dynamin is a GTPase that mediates vesicle fission during synaptic vesicle endocytosis. Its long C-terminal proline-rich domain contains 13 PXXP motifs, which orchestrate its interactions with multiple proteins. The SH3 domains of syndapin and endophilin bind the PXXP motifs called Site 2 and 3 (Pro-786-Pro-793) at the N-terminal end of the proline-rich domain, whereas the amphiphysin SH3 binds Site 9 (Pro-833-Pro-836) toward the C-terminal end. In some proteins, SH3/peptide interactions also involve short distance elements, which are 5-15 amino acid extensions flanking the central PXXP motif for high affinity binding. Here we found two previously unrecognized elements in the central and the C-terminal end of the dynamin proline-rich domain that account for a significant increase in syndapin binding affinity compared with a previously reported Site 2 and Site 3 PXXP peptide alone. The first new element (Gly-807-Gly-811) is short distance element on the C-terminal side of Site 2 PXXP, which might contact a groove identified under the RT loop of the SH3 domain. The second element (Arg-838-Pro-844) is located about 50 amino acids downstream of Site 2. These two elements provide additional specificity to the syndapin SH3 domain outside of the well described polyproline-binding groove. Thus, the dynamin/syndapin interaction is mediated via a network of multiple contacts outside the core PXXP motif over a previously unrecognized extended region of the proline-rich domain. To our knowledge this is the first example among known SH3 interactions to involve spatially separated and extended long-range elements that combine to provide a higher affinity interaction. PMID:26893375

  20. CCAAT-binding factor NF-Y and RFX are required for in vivo assembly of a nucleoprotein complex that spans 250 base pairs: the invariant chain promoter as a model.

    PubMed Central

    Linhoff, M W; Wright, K L; Ting, J P

    1997-01-01

    The events that lead to promoter accessibility within chromatin are not completely understood. The invariant chain (Ii) promoter was used as a model to determine the contribution of different DNA-binding factors in establishing occupancy of a complex promoter. Gamma interferon induction of the Ii promoter requires the cooperation of multiple cis elements including distal S, X, and Y/CCAAT elements along with proximal GC and Y/CCAAT elements. The heteromeric transcription factor NF-Y binds to both Y/CCAAT elements. Genomic footprinting was used to analyze in vivo protein-DNA contacts for integrated Ii promoters bearing mutations in each element. The results reveal a hierarchy of transcription factor loading with NF-Y binding to the distal Y/CCAAT element being required for establishing protein-DNA interactions over the entire 250 bp analyzed. Mutation of the X box disrupts binding primarily at the adjacent Y/CCAAT element along with a lesser effect on GC box binding. Importantly, this finding is verified with a cell line which lacks a functional X-box-binding factor, RFX, providing physiological validity for the strategy described here. Mutation of both the S element and the GC box results in either no or little effect on transcription factor binding. However, mutation of the proximal Y/CCAAT element disrupts binding to the adjacent GC box and partially reduces binding in the distal S/X/Y domain. The crucial role for NF-Y in establishing promoter occupancy may be related to its histone fold motif, the essential component for assembling nucleosome-like structures. PMID:9234716

  1. Unusually Situated Binding Sites for Bacterial Transcription Factors Can Have Hidden Functionality

    PubMed Central

    Haycocks, James R. J.; Grainger, David C.

    2016-01-01

    A commonly accepted paradigm of molecular biology is that transcription factors control gene expression by binding sites at the 5' end of a gene. However, there is growing evidence that transcription factor targets can occur within genes or between convergent genes. In this work, we have investigated one such target for the cyclic AMP receptor protein (CRP) of enterotoxigenic Escherichia coli. We show that CRP binds between two convergent genes. When bound, CRP regulates transcription of a small open reading frame, which we term aatS, embedded within one of the adjacent genes. Our work demonstrates that non-canonical sites of transcription factor binding can have hidden functionality. PMID:27258043

  2. Functional Analyses of Transcription Factor Binding Sites that Differ between Present-Day and Archaic Humans.

    PubMed

    Weyer, Sven; Pääbo, Svante

    2016-02-01

    We analyze 25 previously identified transcription factor binding sites that carry DNA sequence changes that are present in all or nearly all present-day humans, yet occur in the ancestral state in Neandertals and Denisovans, the closest evolutionary relatives of humans. When the ancestral and derived forms of the transcription factor binding sites are tested using reporter constructs in 3 neuronal cell lines, the activity of 12 of the derived versions of transcription factor binding sites differ from the respective ancestral variants. This suggests that the majority of this class of evolutionary differences between modern humans and Neandertals may affect gene expression in at least some tissue or cell type. PMID:26454764

  3. Functional Analyses of Transcription Factor Binding Sites that Differ between Present-Day and Archaic Humans

    PubMed Central

    Weyer, Sven; Pääbo, Svante

    2016-01-01

    We analyze 25 previously identified transcription factor binding sites that carry DNA sequence changes that are present in all or nearly all present-day humans, yet occur in the ancestral state in Neandertals and Denisovans, the closest evolutionary relatives of humans. When the ancestral and derived forms of the transcription factor binding sites are tested using reporter constructs in 3 neuronal cell lines, the activity of 12 of the derived versions of transcription factor binding sites differ from the respective ancestral variants. This suggests that the majority of this class of evolutionary differences between modern humans and Neandertals may affect gene expression in at least some tissue or cell type. PMID:26454764

  4. Transcription factor interactions: Selectors of positive or negative regulation from a single DNA element

    SciTech Connect

    Diamond, M.I.; Miner, J.N.; Yoshinaga, S.K.; Yamamoto, K.R. )

    1990-09-14

    The mechanism by which a single factor evokes opposite regulatory effects from a specific DNA sequence is not well understood. In this study, a 25-base pair element that resides upstream of the mouse proliferin gene was examined; it conferred on linked promoters either positive or negative glucocorticoid regulation, depending upon physiological context. This sequence, denoted a composite glucocorticoid response element (GRE), was bound selective in vitro both by the glucocorticoid receptor and by c-Jun and c-Fos, components of the phorbol ester-activated AP-1 transcription factor. Indeed, c-Jun and c-Fos served as selectors of hormone responsiveness: the composite GRE was inactive in the absence of c-Jun, whereas it conferred a positive glucocorticoid effect in the presence of c-Jun, and a negative glucocorticoid effect in the presence of c-Jun and relatively high levels of c-Fos. The receptor also interacted selectively with c-Jun in vitro. A general model for composite GRE action is proposed that invokes both DNA binding and protein-protein interactions by receptor and nonreceptor factors.

  5. Transcription Factor Pip Can Enhance DNA Binding by E47, Leading to Transcriptional Synergy Involving Multiple Protein Domains

    PubMed Central

    Nagulapalli, Sujatha; Atchison, Michael L.

    1998-01-01

    The transcription factors E2A (E12/E47) and Pip are both required for normal B-cell development. Each protein binds to regulatory sequences within various immunoglobulin enhancer elements. Activity of E2A proteins can be regulated by interactions with other proteins which influence their DNA binding or activation potential. Similarly, Pip function can be influenced by interaction with the protein PU.1, which can recruit Pip to bind to DNA. We show here that a previously unidentified Pip binding site resides adjacent to the E2A binding site within the immunoglobulin κ 3′ enhancer. Both of these binding sites are crucial for high-level enhancer activity. We found that E47 and Pip can functionally interact to generate a very potent 100-fold transcriptional synergy. Through a series of mutagenesis experiments, we identified the Pip sequences necessary for transcriptional activation and for synergy with E47. Two synergy domains (residues 140 to 207 and 300 to 420) in addition to the Pip DNA binding domain (residues 1 to 134) are required for maximal synergy with E47. We also identified a Pip domain (residues 207 to 300) that appears to mask Pip transactivation potential. Part of the synergy mechanism between E47 and Pip appears to involve the ability of Pip to increase DNA binding by E47, perhaps by inducing a conformational change in the E47 protein. E47 may also induce a conformational change in Pip which unmasks sequences important for transcriptional activity. Based upon our results, we propose a model for E47-Pip transcriptional synergy. PMID:9671474

  6. The factor H binding protein of Neisseria meningitidis interacts with xenosiderophores in vitro.

    PubMed

    Veggi, Daniele; Gentile, Maria A; Cantini, Francesca; Lo Surdo, Paola; Nardi-Dei, Vincenzo; Seib, Kate L; Pizza, Mariagrazia; Rappuoli, Rino; Banci, Lucia; Savino, Silvana; Scarselli, Maria

    2012-11-20

    The factor H binding protein (fHbp) is a key virulence factor of Neisseria meningitidis that confers to the bacterium the ability to resist killing by human serum. The determination of its three-dimensional structure revealed that the carboxyl terminus of the protein folds into an eight-stranded β barrel. The structural similarity of this part of the protein to lipocalins provided the rationale for exploring the ability of fHbp to bind siderophores. We found that fHbp was able to bind in vitro siderophores belonging to the cathecolate family and mapped the interaction site by nuclear magnetic resonance. Our results indicated that the enterobactin binding site was distinct from the site involved in binding to human factor H and stimulates new hypotheses about possible multiple activities of fHbp. PMID:23121397

  7. Structural studies of neuropilin-2 reveal a zinc ion binding site remote from the vascular endothelial growth factor binding pocket.

    PubMed

    Tsai, Yi-Chun Isabella; Fotinou, Constantina; Rana, Rohini; Yelland, Tamas; Frankel, Paul; Zachary, Ian; Djordjevic, Snezana

    2016-05-01

    Neuropilin-2 is a transmembrane receptor involved in lymphangiogenesis and neuronal development. In adults, neuropilin-2 and its homologous protein neuropilin-1 have been implicated in cancers and infection. Molecular determinants of the ligand selectivity of neuropilins are poorly understood. We have identified and structurally characterized a zinc ion binding site on human neuropilin-2. The neuropilin-2-specific zinc ion binding site is located near the interface between domains b1 and b2 in the ectopic region of the protein, remote from the neuropilin binding site for its physiological ligand, i.e. vascular endothelial growth factor. We also present an X-ray crystal structure of the neuropilin-2 b1 domain in a complex with the C-terminal sub-domain of VEGF-A. Zn(2+) binding to neuropilin-2 destabilizes the protein structure but this effect was counteracted by heparin, suggesting that modifications by glycans and zinc in the extracellular matrix may affect functional neuropilin-2 ligand binding and signalling activity. PMID:26991001

  8. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively

    NASA Astrophysics Data System (ADS)

    Clifford, Jacob; Adami, Christoph

    2015-10-01

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  9. Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters

    PubMed Central

    Erb, Ionas; van Nimwegen, Erik

    2011-01-01

    The availability of sequence specificities for a substantial fraction of yeast's transcription factors and comparative genomic algorithms for binding site prediction has made it possible to comprehensively annotate transcription factor binding sites genome-wide. Here we use such a genome-wide annotation for comprehensively studying promoter architecture in yeast, focusing on the distribution of transcription factor binding sites relative to transcription start sites, and the architecture of TATA and TATA-less promoters. For most transcription factors, binding sites are positioned further upstream and vary over a wider range in TATA promoters than in TATA-less promoters. In contrast, a group of ‘proximal promoter motifs’ (GAT1/GLN3/DAL80, FKH1/2, PBF1/2, RPN4, NDT80, and ROX1) occur preferentially in TATA-less promoters and show a strong preference for binding close to the transcription start site in these promoters. We provide evidence that suggests that pre-initiation complexes are recruited at TATA sites in TATA promoters and at the sites of the other proximal promoter motifs in TATA-less promoters. TATA-less promoters can generally be classified by the proximal promoter motif they contain, with different classes of TATA-less promoters showing different patterns of transcription factor binding site positioning and nucleosome coverage. These observations suggest that different modes of regulation of transcription initiation may be operating in the different promoter classes. In addition we show that, across all promoter classes, there is a close match between nucleosome free regions and regions of highest transcription factor binding site density. This close agreement between transcription factor binding site density and nucleosome depletion suggests a direct and general competition between transcription factors and nucleosomes for binding to promoters. PMID:21931670

  10. Examining cooperative binding of Sox2 on DC5 regulatory element upon complex formation with Pax6 through excess electron transfer assay.

    PubMed

    Saha, Abhijit; Kizaki, Seiichiro; De, Debojyoti; Endo, Masayuki; Kim, Kyeong Kyu; Sugiyama, Hiroshi

    2016-08-19

    Functional cooperativity among transcription factors on regulatory genetic elements is pivotal for milestone decision-making in various cellular processes including mammalian development. However, their molecular interaction during the cooperative binding cannot be precisely understood due to lack of efficient tools for the analyses of protein-DNA interaction in the transcription complex. Here, we demonstrate that photoinduced excess electron transfer assay can be used for analysing cooperativity of proteins in transcription complex using cooperative binding of Pax6 to Sox2 on the regulatory DNA element (DC5 enhancer) as an example. In this assay, (Br)U-labelled DC5 was introduced for the efficient detection of transferred electrons from Sox2 and Pax6 to the DNA, and guanine base in the complementary strand was replaced with hypoxanthine (I) to block intra-strand electron transfer at the Sox2-binding site. By examining DNA cleavage occurred as a result of the electron transfer process, from tryptophan residues of Sox2 and Pax6 to DNA after irradiation at 280 nm, we not only confirmed their binding to DNA but also observed their increased occupancy on DC5 with respect to that of Sox2 and Pax6 alone as a result of their cooperative interaction. PMID:27229137

  11. Loss of Interdependent Binding by the FoxO1 and FoxA1/A2 Forkhead Transcription Factors Culminates in Perturbation of Active Chromatin Marks and Binding of Transcriptional Regulators at Insulin-sensitive Genes.

    PubMed

    Yalley, Akua; Schill, Daniel; Hatta, Mitsutoki; Johnson, Nicole; Cirillo, Lisa Ann

    2016-04-15

    FoxO1 binds to insulin response elements located in the promoters of insulin-like growth factor-binding protein 1 (IGFBP1) and glucose-6-phosphatase (G6Pase), activating their expression. Insulin-mediated phosphorylation of FoxO1 promotes cytoplasmic translocation, inhibiting FoxO1-mediated transactivation. We have previously demonstrated that FoxO1 opens and remodels chromatin assembled from the IGFBP1 promoter via a highly conserved winged helix motif. This finding, which established FoxO1 as a "pioneer" factor, suggested a model whereby FoxO1 chromatin remodeling at regulatory targets facilitates binding and recruitment of additional regulatory factors. However, the impact of FoxO1 phosphorylation on its ability to bind chromatin and the effect of FoxO1 loss on recruitment of neighboring transcription factors at its regulatory targets in liver chromatin is unknown. In this study, we demonstrate that an amino acid substitution that mimics insulin-mediated phosphorylation of a serine in the winged helix DNA binding motif curtails FoxO1 nucleosome binding. We also demonstrate that shRNA-mediated loss of FoxO1 binding to the IGFBP1 and G6Pase promoters in HepG2 cells significantly reduces binding of RNA polymerase II and the pioneer factors FoxA1/A2. Knockdown of FoxA1 similarly reduced binding of RNA polymerase II and FoxO1. Reduction in acetylation of histone H3 Lys-27 accompanies loss of FoxO1 and FoxA1/A2 binding. Interdependent binding of FoxO1 and FoxA1/A2 possibly entails cooperative binding because FoxO1 and FoxA1/A2 facilitate one another's binding to IGFPB1 promoter DNA. These results illustrate how transcription factors can nucleate transcriptional events in chromatin in response to signaling events and suggest a model for regulation of hepatic glucose metabolism through interdependent FoxO/FoxA binding. PMID:26929406

  12. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

    PubMed

    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R

    1995-11-01

    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  13. Estrogen-mediated Regulation of Igf1 Transcription and Uterine Growth Involves Direct Binding of Estrogen Receptor α to Estrogen-responsive Elements*

    PubMed Central

    Hewitt, Sylvia C.; Li, Yin; Li, Leping; Korach, Kenneth S.

    2010-01-01

    Estrogen enables uterine proliferation, which depends on synthesis of the IGF1 growth factor. This proliferation and IGF1 synthesis requires the estrogen receptor (ER), which binds directly to target DNA sequences (estrogen-responsive elements or EREs), or interacts with other transcription factors, such as AP1, to impact transcription. We observe neither uterine growth nor an increase in Igf1 transcript in a mouse with a DNA-binding mutated ERα (KIKO), indicating that both Igf1 regulation and uterine proliferation require the DNA binding function of the ER. We identified several potential EREs in the Igf1 gene, and chromatin immunoprecipitation analysis revealed ERα binding to these EREs in wild type but not KIKO chromatin. STAT5 is also reported to regulate Igf1; uterine Stat5a transcript is increased by estradiol (E2), but not in KIKO or αERKO uteri, indicating ERα- and ERE-dependent regulation. ERα binds to a potential Stat5a ERE. We hypothesize that E2 increases Stat5a transcript through ERE binding; that ERα, either alone or together with STAT5, then acts to increase Igf1 transcription; and that the resulting lack of IGF1 impairs KIKO uterine growth. Treatment with exogenous IGF1, alone or in combination with E2, induces proliferation in wild type but not KIKO uteri, indicating that IGF1 replacement does not rescue the KIKO proliferative response. Together, these observations suggest in contrast to previous in vitro studies of IGF-1 regulation involving AP1 motifs that direct ERα-DNA interaction is required to increase Igf1 transcription. Additionally, full ERα function is needed to mediate other cellular signals of the growth factor for uterine growth. PMID:19920132

  14. Electrostatic and Hydrophobic Interactions Mediate Single-Stranded DNA Recognition and Acta2 Repression by Purine-Rich Element-Binding Protein B.

    PubMed

    Rumora, Amy E; Ferris, Lauren A; Wheeler, Tamar R; Kelm, Robert J

    2016-05-17

    Myofibroblast differentiation is characterized by an increased level of expression of cytoskeletal smooth muscle α-actin. In human and murine fibroblasts, the gene encoding smooth muscle α-actin (Acta2) is tightly regulated by a network of transcription factors that either activate or repress the 5' promoter-enhancer in response to environmental cues signaling tissue repair and remodeling. Purine-rich element-binding protein B (Purβ) suppresses the expression of Acta2 by cooperatively interacting with the sense strand of a 5' polypurine sequence containing an inverted MCAT cis element required for gene activation. In this study, we evaluated the chemical basis of nucleoprotein complex formation between the Purβ repressor and the purine-rich strand of the MCAT element in the mouse Acta2 promoter. Quantitative single-stranded DNA (ssDNA) binding assays conducted in the presence of increasing concentrations of monovalent salt or anionic detergent suggested that the assembly of a high-affinity nucleoprotein complex is driven by a combination of electrostatic and hydrophobic interactions. Consistent with the results of pH titration analysis, site-directed mutagenesis revealed several basic amino acid residues in the intermolecular (R267) and intramolecular (K82 and R159) subdomains that are essential for Purβ transcriptional repressor function in Acta2 promoter-reporter assays. In keeping with their diminished Acta2 repressor activity in fibroblasts, purified Purβ variants containing an R267A mutation exhibited reduced binding affinity for purine-rich ssDNA. Moreover, certain double and triple-point mutants were also defective in binding to the Acta2 corepressor protein, Y-box-binding protein 1. Collectively, these findings establish the repertoire of noncovalent interactions that account for the unique structural and functional properties of Purβ. PMID:27064749

  15. Alterations in transcription factor binding in radioresistant human melanoma cells after ionizing radiation

    SciTech Connect

    Sahijdak, W.M.; Yang, Chin-Rang; Zuckerman, J.S.; Meyers, M.; Boothman, D.A.

    1994-04-01

    We analyzed alterations in transcription factor binding to specific, known promoter DNA consensus sequences between irradiated and unirradiated radioresistant human melanoma (U1-Mel) cells. The goal of this study was to begin to investigate which transcription factors and DNA-binding sites are responsible for the induction of specific transcripts and proteins after ionizing radiation. Transcription factor binding was observed using DNA band-shift assays and oligonucleotide competition analyses. Confluence-arrested U1-Mel cells were irradiated (4.5 Gy) and harvested at 4 h. Double-stranded oligonucleotides containing known DNA-binding consensus sites for specific transcription factors were used. Increased DNA binding activity after ionizing radiation was noted with oligonucleotides containing the CREB, NF-kB and Sp1 consensus sites. No changes in protein binding to AP-1, AP-2, AP-3, or CTF/NF1, GRE or Oct-1 consensus sequences were noted. X-ray activation of select transcription factors, which bind certain consensus sites in promoters, may cause specific induction or repression of gene transcription. 22 refs., 2 figs.

  16. Proteinaceous factor(s) in culture supernatant fluids of bifidobacteria which prevents the binding of enterotoxigenic Escherichia coli to gangliotetraosylceramide.

    PubMed Central

    Fujiwara, S; Hashiba, H; Hirota, T; Forstner, J F

    1997-01-01

    We have examined the competitive binding of several species of Bifidobacterium and Escherichia coli Pb176, an enterotoxigenic E. coli (ETEC) strain, to gangliotetraosylceramide (asialo GM1 or GA1), a common bacterium-binding structure, and identified a factor(s) in the Bifidobacterium culture supernatant fluid that inhibits the binding of E. coli Pb176 to GA1. The ETEC strain we used expresses colonization factor antigen (CFA) II, which consists of coli surface-associated antigens CS1 and CS3. Competitive exclusion of ETEC from GA1 molecules by Bifidobacterium cells was found by an in vitro thin-layer chromatography overlay binding suppression assay. However, the ETEC cells were less effective in blocking the adherence of Bifidobacterium cells to GA1. These findings suggest that the two bacterial species recognize different binding sites on the GA1 molecule and that the mechanism of competitive exclusion is not due to specific blockage of a common binding site on the molecule. The neutralized culture supernatant fluids of Bifidobacterium species, including that of Bifidobacterium longum SBT 2928 (BL2928), showed remarkable inhibition of the ETEC binding to GA1. Our results suggest that the binding inhibitor produced by BL2928 is a proteinaceous molecule(s) with a molecular weight around or over 100,000 and a neutral isoelectric point. The binding inhibitor produced by BL2928 and other Bifidobacterium species is estimated to contribute to their normal anti-infectious activities by preventing the binding of pathogenic strains of E. coli to GA1 on the surface of the human intestinal mucosa. PMID:9023929

  17. Position specific variation in the rate of evolution intranscription factor binding sites

    SciTech Connect

    Moses, Alan M.; Chiang, Derek Y.; Kellis, Manolis; Lander, EricS.; Eisen, Michael B.

    2003-08-28

    The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Here we analyze the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikataeto study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artifacts of computational motif finding algorithms. As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative

  18. Characterization of the DNA-binding properties of the Mohawk homeobox transcription factor.

    PubMed

    Anderson, Douglas M; George, Rajani; Noyes, Marcus B; Rowton, Megan; Liu, Wenjin; Jiang, Rulang; Wolfe, Scot A; Wilson-Rawls, Jeanne; Rawls, Alan

    2012-10-12

    The homeobox transcription factor Mohawk (Mkx) is a potent transcriptional repressor expressed in the embryonic precursors of skeletal muscle, cartilage, and bone. MKX has recently been shown to be a critical regulator of musculoskeletal tissue differentiation and gene expression; however, the genetic pathways through which MKX functions and its DNA-binding properties are currently unknown. Using a modified bacterial one-hybrid site selection assay, we determined the core DNA-recognition motif of the mouse monomeric Mkx homeodomain to be A-C-A. Using cell-based assays, we have identified a minimal Mkx-responsive element (MRE) located within the Mkx promoter, which is composed of a highly conserved inverted repeat of the core Mkx recognition motif. Using the minimal MRE sequence, we have further identified conserved MREs within the locus of Sox6, a transcription factor that represses slow fiber gene expression during skeletal muscle differentiation. Real-time PCR and immunostaining of in vitro differentiated muscle satellite cells isolated from Mkx-null mice revealed an increase in the expression of Sox6 and down-regulation of slow fiber structural genes. Together, these data identify the unique DNA-recognition properties of MKX and reveal a novel role for Mkx in promoting slow fiber type specification during skeletal muscle differentiation. PMID:22923612

  19. Modification of an adenovirus major late promoter-binding factor during poliovirus infection.

    PubMed Central

    Lazard, D; Fernández-Tomás, C; Gariglio, P; Weinmann, R

    1989-01-01

    To further characterize the mechanism involved in poliovirus-induced inhibition of HeLa cells mRNA synthesis, in vitro formation of DNA-protein complexes between nuclear upstream stimulatory transcription factor (USF) and the adenovirus type 2 major late promoter upstream promoter element (UPE; located between -45 and -65 base pairs) was studied. Using the gel shift assay, we found differences between the UPE-protein complex formed with partially purified nuclear extracts from poliovirus-infected HeLa cells and that obtained in the presence of mock-infected extracts. Formation of the modified UPE-USF complex coincided with virus-induced inhibition of host cell RNA synthesis in vivo and with a less efficient in vitro transcriptional activity of the nuclear extracts from infected cells. Furthermore, using a cross-linking protocol, we found that the host 46-kilodalton UPE-binding USF factor was severely diminished and that a virus-induced or -modified 50-kilodalton polypeptide appeared to be specifically bound to the UPE template. Images PMID:2474675

  20. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    SciTech Connect

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-04-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol /sup 125/I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function.

  1. The cAMP response element binding protein, CREB, is a potent inhibitor of diverse transcriptional activators.

    PubMed Central

    Lemaigre, F P; Ace, C I; Green, M R

    1993-01-01

    Cyclic AMP response element binding protein (CREB) activates transcription of cAMP response element (CRE)-containing promoters following an elevation of intracellular cAMP. Here we show that CREB and the highly related protein ATF-1 are also potent transcription inhibitors. Strikingly, CREB inhibits transcription of multiple activators, whose DNA-binding domains and activation regions are unrelated to one another. Inhibition requires that the CREB dimerization and DNA-binding domains are intact. However, inhibition is not dependent upon the presence of a CRE in the promoter, and does not involve heterodimer formation between CREB and the activator. The ability of an activator protein to inhibit transcription in such a promiscuous fashion has not been previously reported. Images PMID:8332500

  2. Bioadsorption of rare earth elements through cell surface display of lanthanide binding tags

    DOE PAGESBeta

    Park, Dan M.; Reed, David W.; Yung, Mimi C.; Eslamimanesh, Ali; Lencka, Malgorzata M.; Anderko, Andrzej; Fujita, Yoshiko; Riman, Richard E.; Navrotsky, Alexandra; Jiao, Yongqin

    2016-02-02

    In this study, with the increasing demand for rare earth elements (REEs) in many emerging clean energy technologies, there is an urgent need for the development of new approaches for efficient REE extraction and recovery. As a step toward this goal, we genetically engineered the aerobic bacterium Caulobacter crescentus for REE adsorption through high-density cell surface display of lanthanide binding tags (LBTs) on its S-layer. The LBT-displayed strains exhibited enhanced adsorption of REEs compared to cells lacking LBT, high specificity for REEs, and an adsorption preference for REEs with small atomic radii. Adsorbed Tb3+ could be effectively recovered using citrate,more » consistent with thermodynamic speciation calculations that predicted strong complexation of Tb3+ by citrate. No reduction in Tb3+ adsorption capacity was observed following citrate elution, enabling consecutive adsorption/desorption cycles. The LBT-displayed strain was effective for extracting REEs from the acid leachate of core samples collected at a prospective rare earth mine. Our collective results demonstrate a rapid, efficient, and reversible process for REE adsorption with potential industrial application for REE enrichment and separation.« less

  3. Determining the Structure of a Cytoplasmic Polyadenylation Element Binding Protein via AMBER9

    NASA Astrophysics Data System (ADS)

    Saunders, Alison

    2010-03-01

    The neurons of Aplysia californica contain cytoplasmic polyadenylation element binding protein (CPEB). CPEB shows prion-like properties when expressed in yeast cells. Because prions have misfolded and normally folded forms, prions can code in neurons like binary codes in computers, with ``present'' and ``not present'' signals available. CPEB thus provides a candidate protein for the molecular basis of memory. I attempt to determine CPEB's structure, by first threading the known protein sequence around a β-helical structure. Threading is preformed by hand, and by a program written to minimize the energy cost of building the structure. I then analyze the stability of the thread using the molecular dynamics program AMBER9. I also analyze a protein of only glutamine (PolyQ) in a β-helical structure to substantiate my use of a β-helix with the glutamine-rich CPEB. I found PolyQ to be stable in a left-handed β-helical structure with eighteen residues per turn. A candidate structure for CPEB was located with the same β-helical structure.

  4. Bioadsorption of Rare Earth Elements through Cell Surface Display of Lanthanide Binding Tags.

    PubMed

    Park, Dan M; Reed, David W; Yung, Mimi C; Eslamimanesh, Ali; Lencka, Malgorzata M; Anderko, Andrzej; Fujita, Yoshiko; Riman, Richard E; Navrotsky, Alexandra; Jiao, Yongqin

    2016-03-01

    With the increasing demand for rare earth elements (REEs) in many emerging clean energy technologies, there is an urgent need for the development of new approaches for efficient REE extraction and recovery. As a step toward this goal, we genetically engineered the aerobic bacterium Caulobacter crescentus for REE adsorption through high-density cell surface display of lanthanide binding tags (LBTs) on its S-layer. The LBT-displayed strains exhibited enhanced adsorption of REEs compared to cells lacking LBT, high specificity for REEs, and an adsorption preference for REEs with small atomic radii. Adsorbed Tb(3+) could be effectively recovered using citrate, consistent with thermodynamic speciation calculations that predicted strong complexation of Tb(3+) by citrate. No reduction in Tb(3+) adsorption capacity was observed following citrate elution, enabling consecutive adsorption/desorption cycles. The LBT-displayed strain was effective for extracting REEs from the acid leachate of core samples collected at a prospective rare earth mine. Our collective results demonstrate a rapid, efficient, and reversible process for REE adsorption with potential industrial application for REE enrichment and separation. PMID:26836847

  5. In Caenorhabditis elegans, the RNA-binding domains of the cytoplasmic polyadenylation element binding protein FOG-1 are needed to regulate germ cell fates.

    PubMed Central

    Jin, S W; Arno, N; Cohen, A; Shah, A; Xu, Q; Chen, N; Ellis, R E

    2001-01-01

    FOG-1 controls germ cell fates in the nematode Caenorhabditis elegans. Sequence analyses revealed that FOG-1 is a cytoplasmic polyadenylation element binding (CPEB) protein; similar proteins from other species have been shown to bind messenger RNAs and regulate their translation. Our analyses of fog-1 mutations indicate that each of the three RNA-binding domains of FOG-1 is essential for activity. In addition, biochemical tests show that FOG-1 is capable of binding RNA sequences in the 3'-untranslated region of its own message. Finally, genetic assays reveal that fog-1 functions zygotically, that the small fog-1 transcript has no detectable function, and that missense mutations in fog-1 cause a dominant negative phenotype. This last observation suggests that FOG-1 acts in a complex, or as a multimer, to regulate translation. On the basis of these data, we propose that FOG-1 binds RNA to regulate germ cell fates and that it does so by controlling the translation of its targets. One of these targets might be the fog-1 transcript itself. PMID:11779801

  6. Nuclear Factor 1 and T-Cell Factor/LEF Recognition Elements Regulate Pitx2 Transcription in Pituitary Development▿

    PubMed Central

    Ai, Di; Wang, Jun; Amen, Melanie; Lu, Mei-Fang; Amendt, Brad A.; Martin, James F.

    2007-01-01

    Pitx2, a paired-related homeobox gene that is mutated in Rieger syndrome I, is the earliest known marker of oral ectoderm. Pitx2 was previously shown to be required for tooth, palate, and pituitary development in mice; however, the mechanisms regulating Pitx2 transcription in the oral ectoderm are poorly understood. Here we used an in vivo transgenic approach to investigate the mechanisms regulating Pitx2 transcription. We identified a 7-kb fragment that directs LacZ expression in oral ectoderm and in many of its derivatives. Deletion analysis of transgenic embryos reduced this fragment to a 520-bp region that directed LacZ activity to Rathke's pouch. A comparison of the mouse and human sequences revealed a conserved nuclear factor 1 (NF-1) recognition element near a consensus T-cell factor (TCF)/LEF binding site. The mutation of either site individually abolished LacZ activity in transgenic embryos, identifying Pitx2 as a direct target of Wnt signaling in pituitary development. These findings uncover a requirement for NF-1 and TCF factors in Pitx2 transcriptional regulation in the pituitary and provide insight into the mechanisms controlling region-specific transcription in the oral ectoderm and its derivatives. PMID:17562863

  7. Binding, internalization, and degradation of basic fibroblast growth factor in human microvascular endothelial cells

    SciTech Connect

    Bikfalvi, A.; Dupuy, E.; Inyang, A.L.; Tobelem, G. ); Fayein, N.; Courtois, Y. ); Leseche, G. )

    1989-03-01

    The binding, internalization, and degradation of basic fibroblast growth factor (bFGF) in human omental microvascular endothelial cells (HOME cells) were investigated. Binding studies of bFGF in human endothelial cells have not yet been reported. Basic FGF bound to HOME cells. The number of low-affinity binding sites was found to be variable. Washing the cells with 2 M phosphate-buffered saline removed completely {sup 125}I-bFGF bound to low-affinity binding sites but decreased also the high-affinity binding. The majority of the surface-bound {sup 125}I-bFGF was removed by washing the cells with acetic acid buffer at pH 3. At this temperature, degradation of the internalized ligand was followed after 1 hour by the appearance of three major bands of 15,000 10,000, and 8,000 Da and was inhibited by chloroquine. These results demonstrated two classes of binding sites for bFGF in HOME cells; the number of high-affinity binding sites being larger than the number reported for bovine capillary endothelial cells. The intracellular processing of bFGF in HOME cells seems to be different from that of heparin binding growth factor-1 in murine lung capillary endothelial cells and of eye-derived growth factor-1 in Chinese hamster fibroblasts.

  8. Binding of Protein Factor CTCF within Chicken Genome Alpha-Globin Locus.

    PubMed

    Kotova, E S; Akopov, S B; Didych, D A; Petrova, N V; Iarovaia, O V; Razin, S V; Nikolaev, L G

    2016-01-01

    A systematic search for DNA fragments containing potential CTCF transcription factor binding sites in the chicken alpha-globin domain and its flanking regions was performed by means of the two-dimension electrophoretic mobility shift assay. For the alpha-globin domain fragments selected, the occupancy by the CTCF in erythroid and lymphoid chicken cells was tested by chromatin immunoprecipitation. Only one of 13 DNA fragments capable of CTCF binding in vitro was efficiently bound to this protein in vivo in erythroid cells, and somewhat less efficiently - in lymphoid cells. So, binding of CTCF to the DNA fragment in vitro in most cases does not mean that this fragment will be occupied by CTCF in the cell nucleus. Yet, CTCF binding in vivo, as a rule, is accompanied by the binding of the protein to this DNA region in vitro. During the erythroid differentiation, no significant changes in CTCF binding to the DNA fragments studied were detected. PMID:27099788

  9. Binding of Protein Factor CTCF within Chicken Genome Alpha-Globin Locus

    PubMed Central

    Kotova, E. S.; Akopov, S. B.; Didych, D. A.; Petrova, N. V.; Iarovaia, O. V.; Razin, S. V.; Nikolaev, L. G.

    2016-01-01

    A systematic search for DNA fragments containing potential CTCF transcription factor binding sites in the chicken alpha-globin domain and its flanking regions was performed by means of the two-dimension electrophoretic mobility shift assay. For the alpha-globin domain fragments selected, the occupancy by the CTCF in erythroid and lymphoid chicken cells was tested by chromatin immunoprecipitation. Only one of 13 DNA fragments capable of CTCF binding in vitro was efficiently bound to this protein in vivo in erythroid cells, and somewhat less efficiently – in lymphoid cells. So, binding of CTCF to the DNA fragment in vitro in most cases does not mean that this fragment will be occupied by CTCF in the cell nucleus. Yet, CTCF binding in vivo, as a rule, is accompanied by the binding of the protein to this DNA region in vitro. During the erythroid differentiation, no significant changes in CTCF binding to the DNA fragments studied were detected. PMID:27099788

  10. Structural Basis for Negative Cooperativity in Growth Factor Binding to an EGF Receptor

    SciTech Connect

    Alvarado, Diego; Klein, Daryl E.; Lemmon, Mark A.

    2010-09-27

    Transmembrane signaling by the epidermal growth factor receptor (EGFR) involves ligand-induced dimerization and allosteric regulation of the intracellular tyrosine kinase domain. Crystallographic studies have shown how ligand binding induces dimerization of the EGFR extracellular region but cannot explain the high-affinity and low-affinity classes of cell-surface EGF-binding sites inferred from curved Scatchard plots. From a series of crystal structures of the Drosophila EGFR extracellular region, we show here how Scatchard plot curvature arises from negatively cooperative ligand binding. The first ligand-binding event induces formation of an asymmetric dimer with only one bound ligand. The unoccupied site in this dimer is structurally restrained, leading to reduced affinity for binding of the second ligand, and thus negative cooperativity. Our results explain the cell-surface binding characteristics of EGF receptors and suggest how individual EGFR ligands might stabilize distinct dimeric species with different signaling properties.

  11. Survey of variation in human transcription factors reveals prevalent DNA binding changes.

    PubMed

    Barrera, Luis A; Vedenko, Anastasia; Kurland, Jesse V; Rogers, Julia M; Gisselbrecht, Stephen S; Rossin, Elizabeth J; Woodard, Jaie; Mariani, Luca; Kock, Kian Hong; Inukai, Sachi; Siggers, Trevor; Shokri, Leila; Gordân, Raluca; Sahni, Nidhi; Cotsapas, Chris; Hao, Tong; Yi, Song; Kellis, Manolis; Daly, Mark J; Vidal, Marc; Hill, David E; Bulyk, Martha L

    2016-03-25

    Sequencing of exomes and genomes has revealed abundant genetic variation affecting the coding sequences of human transcription factors (TFs), but the consequences of such variation remain largely unexplored. We developed a computational, structure-based approach to evaluate TF variants for their impact on DNA binding activity and used universal protein-binding microarrays to assay sequence-specific DNA binding activity across 41 reference and 117 variant alleles found in individuals of diverse ancestries and families with Mendelian diseases. We found 77 variants in 28 genes that affect DNA binding affinity or specificity and identified thousands of rare alleles likely to alter the DNA binding activity of human sequence-specific TFs. Our results suggest that most individuals have unique repertoires of TF DNA binding activities, which may contribute to phenotypic variation. PMID:27013732

  12. Turnover of binding sites for transcription factors involved in early Drosophila development.

    PubMed

    Costas, Javier; Casares, Fernando; Vieira, Jorge

    2003-05-22

    Despite the importance of cis-regulatory regions in evolution, little is know about their evolutionary dynamics. In this report, we analyze the process of evolution of binding sites for transcription factors using as a model a well characterized system, the Drosophila early developmental enhancers. We compare the sequences of eight enhancer regions for early developmental genes between Drosophila melanogaster and other two species, Drosophila virilis and Drosophila pseudoobscura, searching for the presence/absence of 104 biochemically verified binding sites from D. melanogaster. We also modeled the binding specificity of each binding site by the use of well-defined positional weight matrices (PWMs). The comparisons showed that turnover of binding sites seems to fit a molecular clock, at an approximate rate of 0.94% of gain/loss of binding sites per million years. This intense turnover affects both high and low affinity binding sites at the same extent. Furthermore, the subset of overlapping binding sites is also subjected to this high turnover. Conserved binding sites seem to be constrained to maintain not only location but also the exact sequence at each particular position. Finally, we detected a significant decrease in mean PWM scores for the D. virilis binding sites in the case of Hunchback. Possible explanations for this fact are discussed. PMID:12801649

  13. Preliminary characterization of a light-rare-earth-element-binding peptide of a natural perennial fern Dicranopteris dichotoma.

    PubMed

    Wang, Haiou; Shan, Xiao-Quan; Zhang, Shuzhen; Wen, Bei

    2003-05-01

    A light-rare-earth-element (LREE)-binding peptide was isolated from LREE hyperaccumulator Dicranopteris dichotomaleaves and characterized in terms of molecular weight and ultraviolet absorption spectrum. The molecular weight of the LREE-binding peptide was determined to be 2208 Da by matrix-assisted laser-desorption ionization-time of flight mass spectrometry (MALDI-TOFMS). The characteristic ultraviolet absorption spectrum of the peptide was observed at 220-300 nm, suggesting that the peptide chain contained aromatic amino acids. Compared to the unique features of the phytochelatins with a low absorption at 280 nm, the LREE-binding peptide is unlikely to be a typical phytochelatin. The present study suggests that the LREE-binding peptide is probably a natural peptide in D. dichotoma, and it may play an important role in hyperaccumulation of LREEs. PMID:12734617

  14. Analysis of Usp DNA binding domain targeting reveals critical determinants of the ecdysone receptor complex interaction with the response element.

    PubMed

    Grad, I; Niedziela-Majka, A; Kochman, M; Ozyhar, A

    2001-07-01

    The steroid hormone, 20-hydroxyecdysone (20E), directs Drosophila metamorphosis via a heterodimeric receptor formed by two members of the nuclear hormone receptors superfamily, the product of the EcR (EcR) and of the ultraspiracle (Usp) genes. Our previous study [Niedziela-Majka, A., Kochman, M., Ozyhar, A. (2000) Eur. J. Biochem. 267, 507-519] on EcR and Usp DNA-binding domains (EcRDBD and UspDBD, respectively) suggested that UspDBD may act as a specific anchor that preferentially binds the 5' half-site of the pseudo-palindromic response element from the hsp27 gene promoter and thus locates the heterocomplex in the defined orientation. Here, we analyzed in detail the determinants of the UspDBD interaction with the hsp27 element. The roles of individual amino acids in the putative DNA recognition alpha helix and the roles of the base pairs of the UspDBD target sequence have been probed by site-directed mutagenesis. The results show how the hsp27 element specifies UspDBD binding and thus the polar assembly of the UspDBD/EcRDBD heterocomplex. It is suggested how possible nucleotide deviations within the 5' half-site of the element may be used for the fine-tuning of the 20E-response element specificity and consequently the physiological response. PMID:11432742

  15. Transcription factor MITF and remodeller BRG1 define chromatin organisation at regulatory elements in melanoma cells

    PubMed Central

    Laurette, Patrick; Strub, Thomas; Koludrovic, Dana; Keime, Céline; Le Gras, Stéphanie; Seberg, Hannah; Van Otterloo, Eric; Imrichova, Hana; Siddaway, Robert; Aerts, Stein; Cornell, Robert A; Mengus, Gabrielle; Davidson, Irwin

    2015-01-01

    Microphthalmia-associated transcription factor (MITF) is the master regulator of the melanocyte lineage. To understand how MITF regulates transcription, we used tandem affinity purification and mass spectrometry to define a comprehensive MITF interactome identifying novel cofactors involved in transcription, DNA replication and repair, and chromatin organisation. We show that MITF interacts with a PBAF chromatin remodelling complex comprising BRG1 and CHD7. BRG1 is essential for melanoma cell proliferation in vitro and for normal melanocyte development in vivo. MITF and SOX10 actively recruit BRG1 to a set of MITF-associated regulatory elements (MAREs) at active enhancers. Combinations of MITF, SOX10, TFAP2A, and YY1 bind between two BRG1-occupied nucleosomes thus defining both a signature of transcription factors essential for the melanocyte lineage and a specific chromatin organisation of the regulatory elements they occupy. BRG1 also regulates the dynamics of MITF genomic occupancy. MITF-BRG1 interplay thus plays an essential role in transcription regulation in melanoma. DOI: http://dx.doi.org/10.7554/eLife.06857.001 PMID:25803486

  16. Characterization of insulin-like growth factor-binding proteins from sheep thyroid cells.

    PubMed

    Bachrach, L K; Liu, F R; Burrow, G N; Eggo, M C

    1989-12-01

    The insulin-like growth factors (IGFs) are bound by specific, high affinity binding proteins. Distinct classes of IGF-binding proteins have been described in human serum, amniotic fluid, cerebrospinal fluid, and conditioned medium from cultured cells. Sheep thyroid cells produce IGF-binding proteins under hormonal regulation. Cells grown without or with standard medium supplements (transferrin, glycyl-histidyl-lysine, hydrocortisone, somatostatin, insulin, and TSH) released binding proteins with apparent mol wt of 23, 29, and 32 kDa on Western ligand blot (nonreduced). Binding proteins from these cells appeared as 21, 26, 34, 36, and 41 kDa bands when cross-linked to [125I]IGF-I under reducing conditions. The addition of epidermal growth factor (EGF) or phorbol esters, thyroid cell mitogens stimulated the production of larger binding proteins with mol wt of 40-44 and 48-52 by ligand blot and cross-linking methods, respectively. Deglycosylation of conditioned medium cross-linked to [125I]IGF-I with endoglycosidase-F did not alter the size of the smaller binding proteins, but reduced EGF-stimulated binding proteins to 36-40 kDa. Similarly, tunicamycin treatment, which inhibits glycosylation, reduced only the size of this larger binding protein species. Polyclonal antisera directed against the human amniotic fluid binding protein (BP-28) immunoprecipitated the 32 kDa sheep thyroid binding protein seen on ligand blot and the cross-linked binding protein at 36-38 kDa. Antibody against the major human serum binding protein (BP-53) recognized only the larger EGF-stimulated binding proteins. In contrast to sheep thyroid cells, rat FRTL5 thyroid cells produced no detectable IGF-binding proteins. We conclude that the predominant binding proteins produced by sheep thyroid cells under standard culture conditions are non-glycosylated and immunoreact with antiserum directed against BP-28. EGF and phorbol esters stimulate production of larger glycosylated binding proteins

  17. Functional Analysis of the Human Antibody Response to Meningococcal Factor H Binding Protein

    PubMed Central

    Beernink, Peter T.; Giuntini, Serena; Costa, Isabella; Lucas, Alexander H.

    2015-01-01

    ABSTRACT Two licensed serogroup B meningococcal vaccines contain factor H binding protein (FHbp). The antigen specifically binds human FH, which downregulates complement. In wild-type mice whose mouse FH does not bind to FHbp vaccines, the serum anti-FHbp antibody response inhibited binding of human FH to FHbp. The inhibition was important for eliciting broad anti-FHbp serum bactericidal activity. In human FH transgenic mice and some nonhuman primates, FHbp was able to form a complex with FH and FHbp vaccination elicited anti-FHbp antibodies that did not inhibit FH binding. To investigate the human anti-FHbp repertoire, we cloned immunoglobulin heavy- and light-chain-variable-region genes of individual B cells from three adults immunized with FHbp vaccines and generated 10 sequence-distinct native anti-FHbp antibody fragments (Fabs). All 10 Fabs bound to live meningococci; only 1 slightly inhibited binding of human FH, while 4 enhanced FH binding. Affinity-purified anti-FHbp antibody from serum of a fourth immunized adult also enhanced binding of human FH to live meningococcal bacteria. Despite the bound FH, the affinity-purified serum anti-FHbp antibodies elicited human complement-mediated bactericidal activity that was amplified by the alternative pathway. The lack of FH inhibition by the human anti-FHbp Fabs and serum antibodies suggests that binding of human FH to the vaccine antigen skews the anti-FHbp antibody repertoire to epitopes outside the FH-binding site. Mutant FHbp vaccines with decreased FH binding may represent a means to redirect the human antibody repertoire to epitopes within the FH binding site, which can inhibit FH binding and, potentially, increase safety and protective activity. PMID:26106082

  18. Myogenin induces the myocyte-specific enhancer binding factor MEF-2 independently of other muscle-specific gene products.

    PubMed Central

    Cserjesi, P; Olson, E N

    1991-01-01

    The myocyte-specific enhancer-binding factor MEF-2 is a nuclear factor that interacts with a conserved element in the muscle creatine kinase and myosin light-chain 1/3 enhancers (L. A. Gossett, D. J. Kelvin, E. A. Sternberg, and E. N. Olson, Mol. Cell. Biol. 9:5022-5033, 1989). We show in this study that MEF-2 is regulated by the myogenic regulatory factor myogenin and that mitogenic signals block this regulatory interaction. Induction of MEF-2 by myogenin occurs in transfected 10T1/2 cells that have been converted to myoblasts by myogenin, as well as in CV-1 kidney cells that do not activate the myogenic program in response to myogenin. Through mutagenesis of the MEF-2 site, we further defined the binding site requirements for MEF-2 and identified potential MEF-2 sites within numerous muscle-specific regulatory regions. The MEF-2 site was also found to bind a ubiquitous nuclear factor whose binding specificity was similar to but distinct from that of MEF-2. Our results reveal that MEF-2 is controlled, either directly or indirectly, by a myogenin-dependent regulatory pathway and suggest that growth factor signals suppress MEF-2 expression through repression of myogenin expression or activity. The ability of myogenin to induce MEF-2 activity in CV-1 cells, which do not activate downstream genes associated with terminal differentiation, also demonstrates that myogenin retains limited function within cell types that are nonpermissive for myogenesis and suggests that MEF-2 is regulated independently of other muscle-specific genes. Images PMID:1656214

  19. Far upstream element binding protein 2 interacts with enterovirus 71 internal ribosomal entry site and negatively regulates viral translation

    PubMed Central

    Lin, Jing-Yi; Li, Mei-Ling; Shih, Shin-Ru

    2009-01-01

    An internal ribosomal entry site (IRES) that directs the initiation of viral protein translation is a potential drug target for enterovirus 71 (EV71). Regulation of internal initiation requires the interaction of IRES trans-acting factors (ITAFs) with the internal ribosomal entry site. Biotinylated RNA-affinity chromatography and proteomic approaches were employed to identify far upstream element (FUSE) binding protein 2 (FBP2) as an ITAF for EV71. The interactions of FBP2 with EV71 IRES were confirmed by competition assay and by mapping the association sites in both viral IRES and FBP2 protein. During EV71 infection, FBP2 was enriched in cytoplasm where viral replication occurs, whereas FBP2 was localized in the nucleus in mock-infected cells. The synthesis of viral proteins increased in FBP2-knockdown cells that were infected by EV71. IRES activity in FBP2-knockdown cells exceeded that in the negative control (NC) siRNA-treated cells. On the other hand, IRES activity decreased when FBP2 was over-expressed in the cells. Results of this study suggest that FBP2 is a novel ITAF that interacts with EV71 IRES and negatively regulates viral translation. PMID:19010963

  20. Involvement of cyclic-nucleotide response element-binding family members in the radiation response of Ramos B lymphoma cells

    PubMed Central

    DI NISIO, CHIARA; SANCILIO, SILVIA; DI GIACOMO, VIVIANA; RAPINO, MONICA; SANCILLO, LAURA; GENOVESI, DOMENICO; DI SIENA, ALESSANDRO; RANA, ROSA ALBA; CATALDI, AMELIA; DI PIETRO, ROBERTA

    2016-01-01

    The aim of the present study was to investigate the role of Cyclic-nucleotide Response Element-Binding (CREB) family members and related nuclear transcription factors in the radiation response of human B lymphoma cell lines (Daudi and Ramos). Unlike the more radiosensitive Daudi cells, Ramos cells demonstrated only a moderate increase in early apoptosis after 3–5 Gy irradiation doses, which was detected with Annexin V/PI staining. Moreover, a significant and dose-dependent G2/M phase accumulation was observed in the same cell line at 24 h after both ionizing radiation (IR) doses. Western blot analysis showed an early increase in CREB protein expression that was still present at 3 h and more evident after 3 Gy IR in Ramos cells, along with the dose-dependent upregulation of p53 and NF-κB. These findings were consistent with real-time RT-PCR analysis that showed an early- and dose-dependent upregulation of NFKB1, IKBKB and XIAP gene expression. Unexpectedly, pre-treatment with SN50 did not increase cell death, but cell viability. Taken together, these findings let us hypothesise that the early induction and activation of NF-κB1 in Ramos cells could mediate necrotic cell death and be linked to other molecules belonging to CREB family and involved in the cell cycle regulation. PMID:26573110

  1. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    SciTech Connect

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li . E-mail: lfang@utmb.edu; Li Junfa . E-mail: junfali@cpums.edu.cn

    2006-02-10

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning.

  2. Overexpression of Arabidopsis Dehydration-Responsive Element-Binding protein 2A confers tolerance to salinity stress to transgenic canola.

    PubMed

    Shafeinie, Alireza; Mohammadi, Valiollah; Alizadeh, Houshang; Zali, Abas Ali

    2014-05-01

    Stress responsive transcriptional regulation is an adaptive strategy of plants that alleviates the adverse effects of environmental stresses. The ectopic overexpression of Dehydration-Responsive Element Binding transcription factors (DREBs) either in homologous or in heterologous plants are the classical transcriptional regulators involved in plant responses to drought, salt and cold stresses. To elucidate the transcriptional mechanism associated with the DREB2A gene after removing PEST sequence, which acts as a signal peptide for protein degradation, 34 transgenic T0 canola plants overexpressing DREB2A were developed. The quantitative Real time PCR of transgenic plants showed higher expression of downstream stress-responsive genes including COR14, HSF3, HSP70, PEROX and RD20. The transgenic plants exhibited enhanced tolerance to salt stress. At the high concentration of NaCl the growth of non-transformed plants had been clearly diminished, whereas transgenic line was survived. These results indicated that transformed DREB2A gene might improve the plant response to salinity in transgenic canola plants. PMID:26030994

  3. Lineage-affiliated transcription factors bind the Gata3 Tce1 enhancer to mediate lineage-specific programs

    PubMed Central

    Ohmura, Sakie; Mizuno, Seiya; Oishi, Hisashi; Ku, Chia-Jui; Hermann, Mary; Hosoya, Tomonori; Takahashi, Satoru; Engel, James Douglas

    2016-01-01

    The transcription factor GATA3 is essential for the genesis and maturation of the T cell lineage, and GATA3 dysregulation has pathological consequences. Previous studies have shown that GATA3 function in T cell development is regulated by multiple signaling pathways and that the Notch nuclear effector, RBP-J, binds specifically to the Gata3 promoter. We previously identified a T cell–specific Gata3 enhancer (Tce1) lying 280 kb downstream from the structural gene and demonstrated in transgenic mice that Tce1 promoted T lymphocyte–specific transcription of reporter genes throughout T cell development; however, it was not clear if Tce1 is required for Gata3 transcription in vivo. Here, we determined that the canonical Gata3 promoter is insufficient for Gata3 transcriptional activation in T cells in vivo, precluding the possibility that promoter binding by a host of previously implicated transcription factors alone is responsible for Gata3 expression in T cells. Instead, we demonstrated that multiple lineage-affiliated transcription factors bind to Tce1 and that this enhancer confers T lymphocyte–specific Gata3 activation in vivo, as targeted deletion of Tce1 in a mouse model abrogated critical functions of this T cell–regulatory element. Together, our data show that Tce1 is both necessary and sufficient for critical aspects of Gata3 T cell–specific transcriptional activity. PMID:26808502

  4. Lineage-affiliated transcription factors bind the Gata3 Tce1 enhancer to mediate lineage-specific programs.

    PubMed

    Ohmura, Sakie; Mizuno, Seiya; Oishi, Hisashi; Ku, Chia-Jui; Hermann, Mary; Hosoya, Tomonori; Takahashi, Satoru; Engel, James Douglas

    2016-03-01

    The transcription factor GATA3 is essential for the genesis and maturation of the T cell lineage, and GATA3 dysregulation has pathological consequences. Previous studies have shown that GATA3 function in T cell development is regulated by multiple signaling pathways and that the Notch nuclear effector, RBP-J, binds specifically to the Gata3 promoter. We previously identified a T cell-specific Gata3 enhancer (Tce1) lying 280 kb downstream from the structural gene and demonstrated in transgenic mice that Tce1 promoted T lymphocyte-specific transcription of reporter genes throughout T cell development; however, it was not clear if Tce1 is required for Gata3 transcription in vivo. Here, we determined that the canonical Gata3 promoter is insufficient for Gata3 transcriptional activation in T cells in vivo, precluding the possibility that promoter binding by a host of previously implicated transcription factors alone is responsible for Gata3 expression in T cells. Instead, we demonstrated that multiple lineage-affiliated transcription factors bind to Tce1 and that this enhancer confers T lymphocyte-specific Gata3 activation in vivo, as targeted deletion of Tce1 in a mouse model abrogated critical functions of this T cell-regulatory element. Together, our data show that Tce1 is both necessary and sufficient for critical aspects of Gata3 T cell-specific transcriptional activity. PMID:26808502

  5. Identification of factor-binding sites in the duck hepatitis B virus enhancer and in vivo effects of enhancer mutations.

    PubMed Central

    Liu, C; Mason, W S; Burch, J B

    1994-01-01

    Hepatitis B viruses (hepadnaviruses) can cause chronic, productive infections of hepatocytes. Analyses of the enhancers and promoters of these viruses in cell lines have suggested a requirement of these elements for liver-enriched transcription factors. In this study, a minimum of seven factor-binding sites on the duck hepatitis B virus enhancer were detected by DNase I footprinting using duck liver nuclear extracts. Among the sites that were tentatively identified were one C/EBP-, one HNF1-, and two HNF3-binding sites. Mutations of the HNF1- and HNF3-like sites, which eliminated factor binding, as assessed by both DNase I footprinting and competitive gel shift assays, were evaluated for their effects on enhancer activity. Using a construct in which human growth hormone was expressed from the viral enhancer and core gene promoter, we found that all of the mutations, either alone or in combination, reduced expression two- to fourfold in LMH chicken hepatoma cells. The mutations in the HNF1 site and one of the HNF3 sites, when inserted into the intact viral genome, also suppressed virus RNA synthesis in primary hepatocyte cultures. Virus carrying the latter HNF3 mutation was also examined for its ability to infect and replicate in ducks. No significant inhibition of virus replication was observed in a short-term assay; however, virus with the HNF3 mutation was apparently unable to grow in the pancreas, a second site of duck hepatitis B virus replication in the duck. Images PMID:8139013

  6. Decoupling of evolutionary changes in transcription factor binding and gene expression in mammals

    PubMed Central

    Schmitt, Bianca M.; Stefflova, Klara

    2015-01-01

    To understand the evolutionary dynamics between transcription factor (TF) binding and gene expression in mammals, we compared transcriptional output and the binding intensities for three tissue-specific TFs in livers from four closely related mouse species. For each transcription factor, TF-dependent genes and the TF binding sites most likely to influence mRNA expression were identified by comparing mRNA expression levels between wild-type and TF knockout mice. Independent evolution was observed genome-wide between the rate of change in TF binding and the rate of change in mRNA expression across taxa, with the exception of a small number of TF-dependent genes. We also found that binding intensities are preferentially conserved near genes whose expression is dependent on the TF, and the conservation is shared among binding peaks in close proximity to each other near the TSS. Expression of TF-dependent genes typically showed an increased sensitivity to changes in binding levels as measured by mRNA abundance. Taken together, these results highlight a significant tolerance to evolutionary changes in TF binding intensity in mammalian transcriptional networks and suggest that some TF-dependent genes may be largely regulated by a single TF across evolution. PMID:25394363

  7. An AP-1 binding site in the enhancer/core element of the HIV-1 promoter controls the ability of HIV-1 to establish latent infection.

    PubMed

    Duverger, Alexandra; Wolschendorf, Frank; Zhang, Mingce; Wagner, Fredric; Hatcher, Brandon; Jones, Jennifer; Cron, Randall Q; van der Sluis, Renee M; Jeeninga, Rienk E; Berkhout, Ben; Kutsch, Olaf

    2013-02-01

    Following integration, HIV-1 in most cases produces active infection events; however, in some rare instances, latent infection events are established. The latter have major clinical implications, as latent infection allows the virus to persist despite antiretroviral therapy. Both the cellular factors and the viral elements that potentially determine whether HIV-1 establishes active or latent infection events remain largely elusive. We detail here the contribution of different long terminal repeat (LTR) sequences for the establishment of latent HIV-1 infection. Using a panel of full-length replication-competent virus constructs that reflect naturally occurring differences of HIV-1 subtype-specific LTRs and targeted LTR mutants, we found the primary ability of HIV-1 to establish latent infection in this system to be controlled by a four-nucleotide (nt) AP-1 element just upstream of the NF-κB element in the viral promoter. Deletion of this AP-1 site mostly deprived HIV-1 of the ability to establish latent HIV-1 infection. Extension of this site to a 7-nt AP-1 sequence massively promoted latency establishment, suggesting that this promoter region represents a latency establishment element (LEE). Given that these minimal changes in a transcription factor binding site affect latency establishment to such large extent, our data support the notion that HIV-1 latency is a transcription factor restriction phenomenon. PMID:23236059

  8. An AP-1 Binding Site in the Enhancer/Core Element of the HIV-1 Promoter Controls the Ability of HIV-1 To Establish Latent Infection

    PubMed Central

    Duverger, Alexandra; Wolschendorf, Frank; Zhang, Mingce; Wagner, Fredric; Hatcher, Brandon; Jones, Jennifer; Cron, Randall Q.; van der Sluis, Renee M.; Jeeninga, Rienk E.; Berkhout, Ben

    2013-01-01

    Following integration, HIV-1 in most cases produces active infection events; however, in some rare instances, latent infection events are established. The latter have major clinical implications, as latent infection allows the virus to persist despite antiretroviral therapy. Both the cellular factors and the viral elements that potentially determine whether HIV-1 establishes active or latent infection events remain largely elusive. We detail here the contribution of different long terminal repeat (LTR) sequences for the establishment of latent HIV-1 infection. Using a panel of full-length replication-competent virus constructs that reflect naturally occurring differences of HIV-1 subtype-specific LTRs and targeted LTR mutants, we found the primary ability of HIV-1 to establish latent infection in this system to be controlled by a four-nucleotide (nt) AP-1 element just upstream of the NF-κB element in the viral promoter. Deletion of this AP-1 site mostly deprived HIV-1 of the ability to establish latent HIV-1 infection. Extension of this site to a 7-nt AP-1 sequence massively promoted latency establishment, suggesting that this promoter region represents a latency establishment element (LEE). Given that these minimal changes in a transcription factor binding site affect latency establishment to such large extent, our data support the notion that HIV-1 latency is a transcription factor restriction phenomenon. PMID:23236059

  9. Interferon Regulatory Factor 3 and CREB-Binding Protein/p300 Are Subunits of Double-Stranded RNA-Activated Transcription Factor DRAF1

    PubMed Central

    Weaver, Brian K.; Kumar, K. Prasanna; Reich, Nancy C.

    1998-01-01

    Cells respond to viral infection or double-stranded RNA with the transcriptional induction of a subset of alpha/beta interferon-stimulated genes by a pathway distinct from the interferon signal pathway. The transcriptional induction is mediated through a DNA sequence containing the alpha/beta interferon-stimulated response element (ISRE). We previously identified a novel transcription factor, designated double-stranded RNA-activated factor 1 (DRAF1), that recognizes this response element. The DNA-binding specificity of DRAF1 correlates with transcriptional induction, thereby distinguishing it as a positive regulator of alpha/beta interferon-stimulated genes. Two of the components of DRAF1 have now been identified as interferon regulatory factor 3 (IRF-3) and the transcriptional coactivator CREB-binding protein (CBP)/p300. We demonstrate that IRF-3 preexists in the cytoplasm of uninfected cells and translocates to the nucleus following viral infection. Translocation of IRF-3 is accompanied by an increase in serine and threonine phosphorylation. Coimmunoprecipitation analyses of endogenous proteins demonstrate an association of IRF-3 with the transcriptional coactivators CBP and p300 only subsequent to infection. In addition, antibodies to the IRF-3, CBP, and p300 molecules react with DRAF1 bound to the ISRE target site of induced genes. The cellular response that leads to DRAF1 activation and specific gene expression may serve to increase host survival during viral infection. PMID:9488451

  10. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity

    PubMed Central

    Ronco, Lucienne V.; Karpova, Alla Y.; Vidal, Marc; Howley, Peter M.

    1998-01-01

    Interferon regulatory factor-3 (IRF-3) was found to specifically interact with HPV16 E6 in a yeast two-hybrid screen. IRF-3 is activated by the presence of double-stranded RNA or by virus infection to form a stable complex with other transcriptional regulators that bind to the regulatory elements of the IFNβ promoter. We show that IRF-3 is a potent transcriptional activator and demonstrate that HPV16 E6 can inhibit its transactivation function. The expression of HPV16 E6 in primary human keratinocytes inhibits the induction of IFNβ mRNA following Sendai virus infection. The binding of HPV16 E6 to IRF-3 does not result in its ubiquitination or degradation. We propose that the interaction of E6 with IRF-3 and the inhibition of IRF-3’s transcriptional activity may provide the virus a means to circumvent the normal antiviral response of an HPV16-infected cell. PMID:9649509

  11. Coupling of folding and DNA-binding in the bZIP domains of Jun-Fos heterodimeric transcription factor.

    PubMed

    Seldeen, Kenneth L; McDonald, Caleb B; Deegan, Brian J; Farooq, Amjad

    2008-05-01

    In response to mitogenic stimuli, the heterodimeric transcription factor Jun-Fos binds to the promoters of a diverse array of genes involved in critical cellular responses such as cell growth and proliferation, cell cycle regulation, embryogenic development and cancer. In so doing, Jun-Fos heterodimer regulates gene expression central to physiology and pathology of the cell in a specific and timely manner. Here, using the technique of isothermal titration calorimetry (ITC), we report detailed thermodynamics of the bZIP domains of Jun-Fos heterodimer to synthetic dsDNA oligos containing the TRE and CRE consensus promoter elements. Our data suggest that binding of the bZIP domains to both TRE and CRE is under enthalpic control and accompanied by entropic penalty at physiological temperatures. Although the bZIP domains bind to both TRE and CRE with very similar affinities, the enthalpic contributions to the free energy of binding to CRE are more favorable than TRE, while the entropic penalty to the free energy of binding to TRE is smaller than CRE. Despite such differences in their thermodynamic signatures, enthalpy and entropy of binding of the bZIP domains to both TRE and CRE are highly temperature-dependent and largely compensate each other resulting in negligible effect of temperature on the free energy of binding. From the plot of enthalpy change versus temperature, the magnitude of heat capacity change determined is much larger than that expected from the direct association of bZIP domains with DNA. This observation is interpreted to suggest that the basic regions in the bZIP domains are largely unstructured in the absence of DNA and only become structured upon interaction with DNA in a coupled folding and binding manner. Our new findings are rationalized in the context of 3D structural models of bZIP domains of Jun-Fos heterodimer in complex with dsDNA oligos containing the TRE and CRE consensus sequences. Taken together, our study demonstrates that enthalpy is

  12. A Mutant Library Approach to Identify Improved Meningococcal Factor H Binding Protein Vaccine Antigens

    PubMed Central

    Konar, Monica; Rossi, Raffaella; Walter, Helen; Pajon, Rolando; Beernink, Peter T.

    2015-01-01

    Factor H binding protein (FHbp) is a virulence factor used by meningococci to evade the host complement system. FHbp elicits bactericidal antibodies in humans and is part of two recently licensed vaccines. Using human complement Factor H (FH) transgenic mice, we previously showed that binding of FH decreased the protective antibody responses to FHbp vaccination. Therefore, in the present study we devised a library-based method to identify mutant FHbp antigens with very low binding of FH. Using an FHbp sequence variant in one of the two licensed vaccines, we displayed an error-prone PCR mutant FHbp library on the surface of Escherichia coli. We used fluorescence-activated cell sorting to isolate FHbp mutants with very low binding of human FH and preserved binding of control anti-FHbp monoclonal antibodies. We sequenced the gene encoding FHbp from selected clones and introduced the mutations into a soluble FHbp construct. Using this approach, we identified several new mutant FHbp vaccine antigens that had very low binding of FH as measured by ELISA and surface plasmon resonance. The new mutant FHbp antigens elicited protective antibody responses in human FH transgenic mice that were up to 20-fold higher than those elicited by the wild-type FHbp antigen. This approach offers the potential to discover mutant antigens that might not be predictable even with protein structural information and potentially can be applied to other microbial vaccine antigens that bind host proteins. PMID:26057742

  13. A Mutant Library Approach to Identify Improved Meningococcal Factor H Binding Protein Vaccine Antigens.

    PubMed

    Konar, Monica; Rossi, Raffaella; Walter, Helen; Pajon, Rolando; Beernink, Peter T

    2015-01-01

    Factor H binding protein (FHbp) is a virulence factor used by meningococci to evade the host complement system. FHbp elicits bactericidal antibodies in humans and is part of two recently licensed vaccines. Using human complement Factor H (FH) transgenic mice, we previously showed that binding of FH decreased the protective antibody responses to FHbp vaccination. Therefore, in the present study we devised a library-based method to identify mutant FHbp antigens with very low binding of FH. Using an FHbp sequence variant in one of the two licensed vaccines, we displayed an error-prone PCR mutant FHbp library on the surface of Escherichia coli. We used fluorescence-activated cell sorting to isolate FHbp mutants with very low binding of human FH and preserved binding of control anti-FHbp monoclonal antibodies. We sequenced the gene encoding FHbp from selected clones and introduced the mutations into a soluble FHbp construct. Using this approach, we identified several new mutant FHbp vaccine antigens that had very low binding of FH as measured by ELISA and surface plasmon resonance. The new mutant FHbp antigens elicited protective antibody responses in human FH transgenic mice that were up to 20-fold higher than those elicited by the wild-type FHbp antigen. This approach offers the potential to discover mutant antigens that might not be predictable even with protein structural information and potentially can be applied to other microbial vaccine antigens that bind host proteins. PMID:26057742

  14. Competition between DNA methylation and transcription factors determines binding of NRF1.

    PubMed

    Domcke, Silvia; Bardet, Anaïs Flore; Adrian Ginno, Paul; Hartl, Dominik; Burger, Lukas; Schübeler, Dirk

    2015-12-24

    Eukaryotic transcription factors (TFs) are key determinants of gene activity, yet they bind only a fraction of their corresponding DNA sequence motifs in any given cell type. Chromatin has the potential to restrict accessibility of binding sites; however, in which context chromatin states are instructive for TF binding remains mainly unknown. To explore the contribution of DNA methylation to constrained TF binding, we mapped DNase-I-hypersensitive sites in murine stem cells in the presence and absence of DNA methylation. Methylation-restricted sites are enriched for TF motifs containing CpGs, especially for those of NRF1. In fact, the TF NRF1 occupies several thousand additional sites in the unmethylated genome, resulting in increased transcription. Restoring de novo methyltransferase activity initiates remethylation at these sites and outcompetes NRF1 binding. This suggests that binding of DNA-methylation-sensitive TFs relies on additional determinants to induce local hypomethylation. In support of this model, removal of neighbouring motifs in cis or of a TF in trans causes local hypermethylation and subsequent loss of NRF1 binding. This competition between DNA methylation and TFs in vivo reveals a case of cooperativity between TFs that acts indirectly via DNA methylation. Methylation removal by methylation-insensitive factors enables occupancy of methylation-sensitive factors, a principle that rationalizes hypomethylation of regulatory regions. PMID:26675734

  15. Molecular docking studies in factor XIa binding site

    NASA Astrophysics Data System (ADS)

    Balaji, Govardhan A.; Balaji, Vitukudi N.; Rao, Shashidhar N.

    2016-03-01

    Factor XIa inhibitors have been identified to have potential as anticoagulants with robust efficacy and low bleeding risks. In light of their significance and the availability of their 3-D X-ray data in the PDB, we present molecular docking studies carried out with a view to obtain docking protocols that will successfully reproduce the experimentally observed protein-ligand interactions in the case of various X-ray ligands. In this context, we have specifically investigated the efficacy of various cross-docking protocols in reproducing experimental data. Our studies demonstrate that an ensemble of the three apo proteins is capable of accurately docking a majority of the X-ray ligands accurately without invoking any additional conformational flexibility than that present in their experimental structures. Further, we demonstrate that such an ensemble is successfully able to enrich a collection of known active factor XIa inhibitors embedded in a decoy database of drug-like molecules.

  16. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  17. Methylation-sensitive Regulation of TMS1/ASC by the Ets Factor, GA-binding Protein-α*S⃞

    PubMed Central

    Lucas, Mary E.; Crider, Krista S.; Powell, Doris R.; Kapoor-Vazirani, Priya; Vertino, Paula M.

    2009-01-01

    Epigenetic silencing involving the aberrant DNA methylation of promoter-associated CpG islands is one mechanism leading to the inactivation of tumor suppressor genes in human cancers. However, the molecular mechanisms underlying this event remains poorly understood. TMS1/ASC is a novel proapoptotic signaling factor that is subject to epigenetic silencing in human breast and other cancers. The TMS1 promoter is embedded within a CpG island that is unmethylated in normal cells and is spanned by three DNase I-hypersensitive sites (HS). Silencing of TMS1 in cancer cells is accompanied by local alterations in histone modification, remodeling of the HS, and hypermethylation of DNA. In this study, we probed the functional significance of the CpG island-specific HS. We identified a methylation-sensitive complex that bound a 55-bp intronic element corresponding to HS2. Affinity chromatography and mass spectrometry identified a component of this complex to be the GA-binding protein (GABP) α. Supershift analysis indicated that the GABPα binding partner, GABPβ1, was also present in the complex. The HS2 element conferred a 3-fold enhancement in TMS1 promoter activity, which was dependent on both intact tandem ets binding sites and the presence of GABPα/β1 in trans. GABPα was selectively enriched at HS2 in human cells, and its occupancy was inversely correlated with CpG island methylation. Down-regulation of GABPα led to a concomitant decrease in TMS1 expression. These data indicate that the intronic HS2 element acts in cis to maintain transcriptional competency at the TMS1 locus and that this activity is mediated by the ets transcription factor, GABPα. PMID:19324871

  18. Binding of Transcription Factors Adapts to Resolve Information-Energy Tradeoff

    NASA Astrophysics Data System (ADS)

    Savir, Yonatan; Kagan, Jacob; Tlusty, Tsvi

    2016-03-01

    We examine the binding of transcription factors to DNA in terms of an information transfer problem. The input of the noisy channel is the biophysical signal of a factor bound to a DNA site, and the output is a distribution of probable DNA sequences at this site. This task involves an inherent tradeoff between the information gain and the energetics of the binding interaction—high binding energies provide higher information gain but hinder the dynamics of the system as factors are bound too tightly. We show that adaptation of the binding interaction towards increasing information transfer under a general energy constraint implies that the information gain per specific binding energy at each base-pair is maximized. We analyze hundreds of prokaryote and eukaryote transcription factors from various organisms to evaluate the discrimination energies. We find that, in accordance with our theoretical argument, binding energies nearly maximize the information gain per energy. This work suggests the adaptation of information gain as a generic design principle of molecular recognition systems.

  19. Kit receptor dimerization is driven by bivalent binding of stem cell factor.

    PubMed

    Lemmon, M A; Pinchasi, D; Zhou, M; Lax, I; Schlessinger, J

    1997-03-01

    Most growth factors and cytokines activate their receptors by inducing dimerization upon binding. We have studied binding of the dimeric cytokine stem cell factor (SCF) to the extracellular domain of its receptor Kit, which is a receptor tyrosine kinase similar to the receptors for platelet-derived growth factor and colony-stimulating factor-1. Calorimetric studies show that one SCF dimer binds simultaneously to two molecules of the Kit extracellular domain. Gel filtration and other methods show that this results in Kit dimerization. It has been proposed that SCF-induced Kit dimerization proceeds via a conformational change that exposes a key receptor dimerization site in the fourth of the five immunoglobulin (Ig)-like domains in Kit. We show that a form of Kit containing just the first three Ig domains (Kit-123) binds to SCF with precisely the same thermodynamic parameters as does Kit-12345. Analytical ultracentrifugation, light scattering, and gel filtration show that Kit-123 dimerizes upon SCF binding in a manner indistinguishable from that seen with Kit-12345. These data argue that the fourth Ig-like domain of Kit is not required for SCF-induced receptor dimerization and provide additional support for a model in which bivalent binding of the SCF dimer provides the driving force for Kit dimerization. PMID:9045650

  20. Molecular cloning and expression of the carbohydrate response element binding protein gene and related genes involved in hepatic lipogenesis during post-hatch development of broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Carbohydrate response element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c) are known to be key regulators of glucose metabolism and lipid synthesis in mammals. Responding to changes in the level of glucose (ChREBP) and insulin (SREBP-1c), these two transcripti...

  1. Binding sites for atrial natriuretic factor (ANF) in brain: alterations in Brattleboro rats

    SciTech Connect

    McCarty, R.; Plunkett, L.M.

    1986-12-01

    Binding sites for atrial natriuretic factor (ANF-28) were analyzed in discrete brain areas of Brattleboro rats with hereditary diabetes insipidus and Long-Evans (LE) controls by quantitative autoradiography. The maximum binding capacity (Bmax) and affinity constant (Ka) for /sup 125/I-ANF-28 were elevated significantly in the subfornical organ of Brattleboro rats compared to matched LE controls. In contrast, values for Bmax and Ka for /sup 125/I-ANF-28 binding in choroid plexus and area postrema were similar for rats of the two strains. These findings are consistent with a selective upregulation of ANF-28 binding sites in the subfornical organ of Brattleboro rats which exhibit a profound disturbance in body fluid homeostasis. These alterations in ANF-28 binding sites in the subfornical organ may represent a compensatory response to the absence of vasopressin in the Brattleboro rat.

  2. Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.

    PubMed

    Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

    2015-08-01

    Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

  3. Insulin-like growth factor (IGF) and IGF binding protein gene expression in multicystic renal dysplasia.

    PubMed

    Matsell, D G; Bennett, T; Armstrong, R A; Goodyer, P; Goodyer, C; Han, V K

    1997-01-01

    Multicystic dysplastic kidney disease is the most common form of renal dysplasia that leads to ESRD in children. This study describes the histopathological changes of multicystic dysplasia that occur from early fetal life to the postnatal period. At 14 wk gestation, early cystic enlargement of various segments of the nephron have been identified, in addition to a displaced metanephric blastema adjacent to zones of normal nephrogenesis. At later stages, the predominant features include cyst enlargement with marked fibromuscular collars, architectural disorganization, and replacement of the interstitium with a disarray of mesenchymal tissue. This study investigated the expression of the mRNA encoding the insulin-like growth factors (IGF) and IGF binding proteins (IGFBP) and have demonstrated IGF-II, IGFBP-2, and IGFBP-3 to be altered. Apart from their expression in the displaced metanephric blastema, both IGF-II and IGFBP-2 were overexpressed in abnormal tissue elements in all kidneys from fetal to postnatal life. IGF-II gene expression was localized to mesenchymal tissue, specifically in the periductal fibromuscular collars. IGFBP-2 mRNA was found to be expressed exclusively in the cyst epithelia of all cysts at all ages studied, whereas IGFBP-3 mRNA was absent from these epithelia. This study details the failure of normal IGF expression in the development of multicystic renal dysplasia and suggests a role for the IGF system in the progressive histopathological changes of this disorder. PMID:9013452

  4. A role for the TATA-box-binding protein component of the transcription factor IID complex as a general RNA polymerase III transcription factor.

    PubMed Central

    White, R J; Jackson, S P; Rigby, P W

    1992-01-01

    The major class of vertebrate genes transcribed by RNA polymerase (EC 2.7.7.6) III, which includes 5S rRNA genes, tRNA genes, and the adenovirus VA genes, is characterized by split internal promoters and no absolute dependence upon specific upstream sequences. Fractionation experiments have shown that transcription of such genes requires two general RNA polymerase III-specific factors, TFIIIB and TFIIIC. We now demonstrate that a third general factor is also employed by these genes. This is the TATA-box-binding protein originally identified as being a component of the general RNA polymerase II transcription factor TFIID. This protein is involved in the transcription by RNA polymerase III of every template tested, even though the promoters of VA and most vertebrate tRNA and 5S rRNA genes do not contain recognizable TATA elements. Images PMID:1542692

  5. CHEMOSENSITIZATION BY A NON-APOPTOGENIC HEAT SHOCK PROTEIN 70-BINDING APOPTOSIS INDUCING FACTOR MUTANT

    EPA Science Inventory

    Chemosensitization by a non-apoptogenic heat shock protein 70-binding apoptosis inducing factor mutant

    Abstract
    HSP70 inhibits apoptosis by neutralizing the caspase activator Apaf-1 and by interacting with apoptosis inducing factor (AIF), a mitochondrial flavoprotein wh...

  6. Hoxb-2 transcriptional activation in rhombomeres 3 and 5 requires an evolutionarily conserved cis-acting element in addition to the Krox-20 binding site.

    PubMed Central

    Vesque, C; Maconochie, M; Nonchev, S; Ariza-McNaughton, L; Kuroiwa, A; Charnay, P; Krumlauf, R

    1996-01-01

    Segmentation is a key feature of the development of the vertebrate hindbrain where it involves the generation of repetitive morphological units termed rhombomeres (r). Hox genes are likely to play an essential role in the specification of segmental identity and we have been investigating their regulation. We show here that the mouse and chicken Hoxb-2 genes are dependent for their expression in r3 and r5 on homologous enhancer elements and on binding to this enhancer of the r3/r5-specific transcriptional activator Krox-20. Among the three Krox-20 binding sites of the mouse Hoxb-2 enhancer, only the high-affinity site is absolutely necessary for activity. In contrast, we have identified an additional cis-acting element, Box1, essential for r3/r5 enhancer activity. It is conserved both in sequence and in position respective to the high-affinity Krox-20 binding site within the mouse and chicken enhancers. Furthermore, a short 44 bp sequence spanning the Box1 and Krox-20 sites can act as an r3/r5 enhancer when oligomerized. Box1 may therefore constitute a recognition sequence for another factor cooperating with Krox-20. Taken together, these data demonstrate the conservation of Hox gene regulation and of Krox-20 function during vertebrate evolution. Images PMID:8895582

  7. Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element

    SciTech Connect

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In

    2008-04-01

    Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants.

  8. Escherichia coli integration host factor bends the DNA at the ends of IS1 and in an insertion hotspot with multiple IHF binding sites.

    PubMed Central

    Prentki, P; Chandler, M; Galas, D J

    1987-01-01

    The integration host factor of Escherichia coli (IHF) is a small, histone-like protein which participates in the integration of bacteriophage lambda into the E. coli chromosome and in a number of regulatory processes. Our recent footprinting analysis has shown that IHF binds specifically to the ends of the transposable element IS1, as well as to several sites within a short segment of the plasmid pBR322. We have extended our studies of the binding of the IHF molecule to these sites in vitro using a gel retardation assay. We report here that IHF bends the DNA upon binding, as judged from the strong cyclic dependence of the protein-induced mobility shift on the position of the binding site. Using cloned, synthetic ends of IS1 as substrates, we have found that some mutations within the conserved bases of the IHF consensus binding sequence abolish binding, and that alterations of the flanking sequences can greatly reduce IHF binding. The presence of multiple IHF sites on a single DNA fragment increases binding very little, indicating that IHF does not bind cooperatively in this complex. We discuss the possibility that DNA bending is related to the role IHF plays in forming and stabilizing nucleoprotein complexes, and suggest that bending at the IHF sites may be important to its diverse effects in the cell. Images Fig. 3. Fig. 4. Fig. 5. PMID:2822395

  9. tRNA binding properties of eukaryotic translation initiation factor 2 from Encephalitozoon cuniculi.

    PubMed

    Naveau, Marie; Lazennec-Schurdevin, Christine; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2010-10-12

    A critical consequence of the initiation of translation is the setting of the reading frame for mRNA decoding. In eukaryotic and archaeal cells, heterotrimeric initiation factor e/aIF2, in its GTP form, specifically binds Met-tRNA(i)(Met) throughout the translation initiation process. After start codon recognition, the factor, in its GDP-bound form, loses affinity for Met-tRNA(i)(Met) and eventually dissociates from the initiation complex. The role of each aIF2 subunit in tRNA binding has been extensively studied in archaeal systems. The isolated archaeal γ subunit is able to bind tRNA, but the α subunit is required for strong binding. Until now, difficulties during purification have hampered the study of the role of each of the three subunits of eukaryotic eIF2 in specific binding of the initiator tRNA. Here, we have produced the three subunits of eIF2 from Encephalitozoon cuniculi, isolated or assembled into heterodimers or into the full heterotrimer. Using assays following protection of Met-tRNA(i)(Met) against deacylation, we show that the eukaryotic γ subunit is able to bind by itself the initiator tRNA. However, the two peripheral α and β subunits are required for strong binding and contribute equally to tRNA binding affinity. The core domains of α and β probably act indirectly by stabilizing the tRNA binding site on the γ subunit. These results, together with those previously obtained with archaeal aIF2 and yeast eIF2, show species-specific distributions of the roles of the peripheral subunits of e/aIF2 in tRNA binding. PMID:20822097

  10. A SAM oligomerization domain shapes the genomic binding landscape of the LEAFY transcription factor

    PubMed Central

    Sayou, Camille; Nanao, Max H.; Jamin, Marc; Posé, David; Thévenon, Emmanuel; Grégoire, Laura; Tichtinsky, Gabrielle; Denay, Grégoire; Ott, Felix; Peirats Llobet, Marta; Schmid, Markus; Dumas, Renaud; Parcy, François

    2016-01-01

    Deciphering the mechanisms directing transcription factors (TFs) to specific genome regions is essential to understand and predict transcriptional regulation. TFs recognize short DNA motifs primarily through their DNA-binding domain. Some TFs also possess an oligomerization domain suspected to potentiate DNA binding but for which the genome-wide influence remains poorly understood. Here we focus on the LEAFY transcription factor, a master regulator of flower development in angiosperms. We have determined the crystal structure of its conserved amino-terminal domain, revealing an unanticipated Sterile Alpha Motif oligomerization domain. We show that this domain is essential to LEAFY floral function. Moreover, combined biochemical and genome-wide assays suggest that oligomerization is required for LEAFY to access regions with low-affinity binding sites or closed chromatin. This finding shows that domains that do not directly contact DNA can nevertheless have a profound impact on the DNA binding landscape of a TF. PMID:27097556

  11. A SAM oligomerization domain shapes the genomic binding landscape of the LEAFY transcription factor.

    PubMed

    Sayou, Camille; Nanao, Max H; Jamin, Marc; Posé, David; Thévenon, Emmanuel; Grégoire, Laura; Tichtinsky, Gabrielle; Denay, Grégoire; Ott, Felix; Peirats Llobet, Marta; Schmid, Markus; Dumas, Renaud; Parcy, François

    2016-01-01

    Deciphering the mechanisms directing transcription factors (TFs) to specific genome regions is essential to understand and predict transcriptional regulation. TFs recognize short DNA motifs primarily through their DNA-binding domain. Some TFs also possess an oligomerization domain suspected to potentiate DNA binding but for which the genome-wide influence remains poorly understood. Here we focus on the LEAFY transcription factor, a master regulator of flower development in angiosperms. We have determined the crystal structure of its conserved amino-terminal domain, revealing an unanticipated Sterile Alpha Motif oligomerization domain. We show that this domain is essential to LEAFY floral function. Moreover, combined biochemical and genome-wide assays suggest that oligomerization is required for LEAFY to access regions with low-affinity binding sites or closed chromatin. This finding shows that domains that do not directly contact DNA can nevertheless have a profound impact on the DNA binding landscape of a TF. PMID:27097556

  12. Positive Regulatory Domain I-Binding Factor 1 mediates repression of the MHC Class II Transactivator (CIITA) type IV promoter

    PubMed Central

    Chen, Han; Gilbert, Carolyn A.; Hudson, John A.; Bolick, Sophia C.; Wright, Kenneth L.; Piskurich, Janet F.

    2006-01-01

    MHC class II transactivator (CIITA), a co-activator that controls MHC class II (MHC II) transcription, functions as the master regulator of MHC II expression. Persistent activity of the CIITA type III promoter (pIII), one of the four potential promoters of this gene, is responsible for constitutive expression of MHC II by B lymphocytes. In addition, IFN-γ induces expression of CIITA in these cells through the type IV promoter (pIV). Positive regulatory domain 1-binding factor 1 (PRDI-BF1), called B lymphocyte-induced maturation protein 1 (Blimp-1) in mice, represses the expression of CIITA pIII in plasma and multiple myeloma cells. To investigate regulation of CIITA pIV expression by PRDI-BF1 in the B lymphocyte lineage, protein/DNA binding studies, and functional promoter analyses were performed. PRDI-BF1 bound to the IRF-E site in CIITA pIV. Ectopic expression of either PRDI-BF1 or Blimp-1 repressed this promoter in B lymphocytes. In vitro binding and functional analyses of CIITA pIV demonstrated that the IFN regulatory factor-element (IRF-E) is the target of this repression. In vivo genomic footprint analysis demonstrated protein binding at the IRF-E site of CIITA pIV in U266 myeloma cells, which express PRDI-BF1. PRDI-BF1β, a truncated form of PRDI-BF1 that is co-expressed in myeloma cells, also bound to the IRF-E site and repressed CIITA pIV. These findings demonstrate for the first time that, in addition to silencing expression of CIITA pIII in B lymphocytes, PRDI-BF1 is capable of binding and suppressing CIITA pIV. PMID:16765445

  13. Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

    PubMed Central

    Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

    2013-01-01

    WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

  14. Binding of the polypyrimidine tract-binding protein-associated splicing factor (PSF) to the hepatitis delta virus RNA

    SciTech Connect

    Greco-Stewart, Valerie S.; Thibault, Catherine St-Laurent; Pelchat, Martin . E-mail: mpelchat@uottawa.ca

    2006-12-20

    The hepatitis delta virus (HDV) has a very limited protein coding capacity and must rely on host proteins for its replication. A ribonucleoprotein complex was detected following UV cross-linking between HeLa nuclear proteins and an RNA corresponding to the right terminal stem-loop domain of HDV genomic RNA. Mass spectrometric analysis of the complex revealed the polypyrimidine tract-binding protein-associated splicing factor (PSF) as a novel HDV RNA-interacting protein. Co-immunoprecipitation demonstrated the interaction between HDV RNA and PSF both in vitro in HeLa nuclear extract and in vivo within HeLa cells containing both polarities of the HDV genome. Analysis of the binding of various HDV-derived RNAs to purified, recombinant PSF further confirmed the specificity of the interaction and revealed that PSF directly binds to the terminal stem-loop domains of both polarities of HDV RNA. Our findings provide evidence of the involvement of a host mRNA processing protein in the HDV life cycle.

  15. Sequence and chromatin determinants of cell-type-specific transcription factor binding.

    PubMed

    Arvey, Aaron; Agius, Phaedra; Noble, William Stafford; Leslie, Christina

    2012-09-01

    Gene regulatory programs in distinct cell types are maintained in large part through the cell-type-specific binding of transcription factors (TFs). The determinants of TF binding include direct DNA sequence preferences, DNA sequence preferences of cofactors, and the local cell-dependent chromatin context. To explore the contribution of DNA sequence signal, histone modifications, and DNase accessibility to cell-type-specific binding, we analyzed 286 ChIP-seq experiments performed by the ENCODE Consortium. This analysis included experiments for 67 transcriptional regulators, 15 of which were profiled in both the GM12878 (lymphoblastoid) and K562 (erythroleukemic) human hematopoietic cell lines. To model TF-bound regions, we trained support vector machines (SVMs) that use flexible k-mer patterns to capture DNA sequence signals more accurately than traditional motif approaches. In addition, we trained SVM spatial chromatin signatures to model local histone modifications and DNase accessibility, obtaining significantly more accurate TF occupancy predictions than simpler approaches. Consistent with previous studies, we find that DNase accessibility can explain cell-line-specific binding for many factors. However, we also find that of the 10 factors with prominent cell-type-specific binding patterns, four display distinct cell-type-specific DNA sequence preferences according to our models. Moreover, for two factors we identify cell-specific binding sites that are accessible in both cell types but bound only in one. For these sites, cell-type-specific sequence models, rather than DNase accessibility, are better able to explain differential binding. Our results suggest that using a single motif for each TF and filtering for chromatin accessible loci is not always sufficient to accurately account for cell-type-specific binding profiles. PMID:22955984

  16. Evidence for serotonin binding in vitro by platelet factor 4 and beta-thromboglobulin.

    PubMed

    Heemstra, V L

    1983-02-01

    Evidence is presented for in vitro high affinity binding of serotonin (5-HT) by beta-thromboglobulin (beta TG) and platelet factor 4 (PF4) from human blood. Results include: 1) identification by radioimmunoassay of PF4 in specifically bound material obtained by 5-HT affinity chromatography of human platelet extracts; 2) binding of 72% and 6% of radiolabelled PF4 on 5-HT and control affinity columns, respectively; and 3) binding of approximately 8 moles of 5-HT per mole of purified beta TG in the presence of ferrous ion and heparin in ultrafiltration studies, with Scatchard analysis indicating a dissociation constant of about 4 X 10(-8) M. PMID:6189240

  17. Co-Factor Binding Confers Substrate Specificity to Xylose Reductase from Debaryomyces hansenii

    PubMed Central

    Singh, Appu Kumar; Mondal, Alok K.; Kumaran, S.

    2012-01-01

    Binding of substrates into the active site, often through complementarity of shapes and charges, is central to the specificity of an enzyme. In many cases, substrate binding induces conformational changes in the active site, promoting specific interactions between them. In contrast, non-substrates either fail to bind or do not induce the requisite conformational changes upon binding and thus no catalysis occurs. In principle, both lock and key and induced-fit binding can provide specific interactions between the substrate and the enzyme. In this study, we present an interesting case where cofactor binding pre-tunes the active site geometry to recognize only the cognate substrates. We illustrate this principle by studying the substrate binding and kinetic properties of Xylose Reductase from Debaryomyces hansenii (DhXR), an AKR family enzyme which catalyzes the reduction of carbonyl substrates using NADPH as co-factor. DhXR reduces D-xylose with increased specificity and shows no activity towards “non-substrate” sugars like L-rhamnose. Interestingly, apo-DhXR binds to D-xylose and L-rhamnose with similar affinity (Kd∼5.0–10.0 mM). Crystal structure of apo-DhXR-rhamnose complex shows that L-rhamnose is bound to the active site cavity. L-rhamnose does not bind to holo-DhXR complex and thus, it cannot competitively inhibit D-xylose binding and catalysis even at 4–5 fold molar excess. Comparison of Kd values with Km values reveals that increased specificity for D-xylose is achieved at the cost of moderately reduced affinity. The present work reveals a latent regulatory role for cofactor binding which was previously unknown and suggests that cofactor induced conformational changes may increase the complimentarity between D-xylose and active site similar to specificity achieved through induced-fit mechanism. PMID:23049810

  18. DNA binding and regulatory effects of transcription factors SP1 and USF at the rat amyloid precursor protein gene promoter.

    PubMed Central

    Hoffman, P W; Chernak, J M

    1995-01-01

    Two DNA elements which we have termed SAA and GAG have been shown to control expression of the rat amyloid precursor protein (APP) gene, and the region containing the SAA element has been shown to interact with nuclear proteins [Hoffman and Chernak (1994) Biochem. Biophys. Res. Commun. 201, 610-617]. In this report we study DNA sequences and proteins which influence the activity of the SAA element. An oligonucleotide containing the SAA element is specifically bound by nuclear proteins derived from rat PC12 cells, consistently forming four complexes designated C25, C30, C35 and C40 in electrophoretic mobility shift assays (EMSAs). We demonstrate that the C25, C30 and C40 complexes involve the binding of nuclear proteins to an SP1 consensus sequence located within the SAA element and that the C25 complex contains a protein antigenically related to the human SP1 protein. We establish further that the C35 complex requires a USF recognition site located within the SAA element and contains a protein antigenically related to the human upstream stimulatory factor (USF) protein. Using APP promoter/luciferase reporter gene constructs, we demonstrate that both the SP1 and the USF sites can play a role in the transcriptional activity of the SAA element. Finally, we show that complexes similar to the C25, C30 and C35 complexes are formed by rat cortex nuclear extracts and the SAA element in EMSA experiments, suggesting the relevance of our in vitro observations to the in vivo functioning of the rat APP promoter. Images PMID:7610052

  19. Engineering Synthetic cis-Regulatory Elements for Simultaneous Recognition of Three Transcriptional Factors in Bacteria.

    PubMed

    Amores, Gerardo Ruiz; Guazzaroni, María-Eugenia; Silva-Rocha, Rafael

    2015-12-18

    Recognition of cis-regulatory elements by transcription factors (TF) at target promoters is crucial to gene regulation in bacteria. In this process, binding of TFs to their cognate sequences depends on a set of physical interactions between these proteins and specific nucleotides in the operator region. Previously, we showed that in silico optimization algorithms are able to generate short sequences that are recognized by two different TFs of Escherichia coli, namely, CRP and IHF, thus generating an AND logic gate. Here, we expanded this approach in order to engineer DNA sequences that can be simultaneously recognized by three unrelated TFs (CRP, IHF, and Fis). Using in silico optimization and experimental validation strategies, we were able to obtain a candidate promoter (Plac-CFI1) regulated by only two TFs with an AND logic, thus demonstrating a limitation in the design. Subsequently, we modified the algorithm to allow the optimization of extended sequences, and were able to design two synthetic promoters (PCFI20-1 and PCFI22-5) that were functional in vivo. Expression assays in E. coli mutant strains for each TF revealed that while CRP positively regulates the promoter activities, IHF and Fis are strong repressors of both the promoter variants. Taken together, our results demonstrate the potential of in silico strategies in bacterial synthetic promoter engineering. Furthermore, the study also shows how small modifications in cis-regulatory elements can drastically affect the final logic of the resulting promoter. PMID:26305598

  20. Base-resolution methylation patterns accurately predict transcription factor bindings in vivo

    PubMed Central

    Xu, Tianlei; Li, Ben; Zhao, Meng; Szulwach, Keith E.; Street, R. Craig; Lin, Li; Yao, Bing; Zhang, Feiran; Jin, Peng; Wu, Hao; Qin, Zhaohui S.

    2015-01-01

    Detecting in vivo transcription factor (TF) binding is important for understanding gene regulatory circuitries. ChIP-seq is a powerful technique to empirically define TF binding in vivo. However, the multitude of distinct TFs makes genome-wide profiling for them all labor-intensive and costly. Algorithms for in silico prediction of TF binding have been developed, based mostly on histone modification or DNase I hypersensitivity data in conjunction with DNA motif and other genomic features. However, technical limitations of these methods prevent them from being applied broadly, especially in clinical settings. We conducted a comprehensive survey involving multiple cell lines, TFs, and methylation types and found that there are intimate relationships between TF binding and methylation level changes around the binding sites. Exploiting the connection between DNA methylation and TF binding, we proposed a novel supervised learning approach to predict TF–DNA interaction using data from base-resolution whole-genome methylation sequencing experiments. We devised beta-binomial models to characterize methylation data around TF binding sites and the background. Along with other static genomic features, we adopted a random forest framework to predict TF–DNA interaction. After conducting comprehensive tests, we saw that the proposed method accurately predicts TF binding and performs favorably versus competing methods. PMID:25722376

  1. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    SciTech Connect

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.; Mantyh, P.W. )

    1988-09-01

    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific binding of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.

  2. Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4.

    PubMed

    Viollet, B; Kahn, A; Raymondjean, M

    1997-08-01

    Hepatocyte nuclear factor 4 (HNF4), a liver-enriched transcription factor of the nuclear receptor superfamily, is critical for development and liver-specific gene expression. Here, we demonstrate that its DNA-binding activity is modulated posttranslationally by phosphorylation in vivo, ex vivo, and in vitro. In vivo, HNF4 DNA-binding activity is reduced by fasting and by inducers of intracellular cyclic AMP (cAMP) accumulation. A consensus protein kinase A (PKA) phosphorylation site located within the A box of its DNA-binding domain has been identified, and its role in phosphorylation-dependent inhibition of HNF4 DNA-binding activity has been investigated. Mutants of HNF4 in which two potentially phosphorylatable serines have been replaced by either neutral or charged amino acids were able to bind DNA in vitro with affinity similar to that of the wild-type protein. However, phosphorylation by PKA strongly repressed the binding affinity of the wild-type factor but not that of HNF4 mutants. Accordingly, in transfection assays, expression vectors for the mutated HNF4 proteins activated transcription more efficiently than that for the wild-type protein-when cotransfected with the PKA catalytic subunit expression vector. Therefore, HNF4 is a direct target of PKA which might be involved in the transcriptional inhibition of liver genes by cAMP inducers. PMID:9234678

  3. Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4.

    PubMed Central

    Viollet, B; Kahn, A; Raymondjean, M

    1997-01-01

    Hepatocyte nuclear factor 4 (HNF4), a liver-enriched transcription factor of the nuclear receptor superfamily, is critical for development and liver-specific gene expression. Here, we demonstrate that its DNA-binding activity is modulated posttranslationally by phosphorylation in vivo, ex vivo, and in vitro. In vivo, HNF4 DNA-binding activity is reduced by fasting and by inducers of intracellular cyclic AMP (cAMP) accumulation. A consensus protein kinase A (PKA) phosphorylation site located within the A box of its DNA-binding domain has been identified, and its role in phosphorylation-dependent inhibition of HNF4 DNA-binding activity has been investigated. Mutants of HNF4 in which two potentially phosphorylatable serines have been replaced by either neutral or charged amino acids were able to bind DNA in vitro with affinity similar to that of the wild-type protein. However, phosphorylation by PKA strongly repressed the binding affinity of the wild-type factor but not that of HNF4 mutants. Accordingly, in transfection assays, expression vectors for the mutated HNF4 proteins activated transcription more efficiently than that for the wild-type protein-when cotransfected with the PKA catalytic subunit expression vector. Therefore, HNF4 is a direct target of PKA which might be involved in the transcriptional inhibition of liver genes by cAMP inducers. PMID:9234678

  4. Romulus: robust multi-state identification of transcription factor binding sites from DNase-seq data

    PubMed Central

    Jankowski, Aleksander; Tiuryn, Jerzy; Prabhakar, Shyam

    2016-01-01

    Motivation: Computational prediction of transcription factor (TF) binding sites in the genome remains a challenging task. Here, we present Romulus, a novel computational method for identifying individual TF binding sites from genome sequence information and cell-type–specific experimental data, such as DNase-seq. It combines the strengths of previous approaches, and improves robustness by reducing the number of free parameters in the model by an order of magnitude. Results: We show that Romulus significantly outperforms existing methods across three sources of DNase-seq data, by assessing the performance of these tools against ChIP-seq profiles. The difference was particularly significant when applied to binding site prediction for low-information-content motifs. Our method is capable of inferring multiple binding modes for a single TF, which differ in their DNase I cut profile. Finally, using the model learned by Romulus and ChIP-seq data, we introduce Binding in Closed Chromatin (BCC) as a quantitative measure of TF pioneer factor activity. Uniquely, our measure quantifies a defining feature of pioneer factors, namely their ability to bind closed chromatin. Availability and Implementation: Romulus is freely available as an R package at http://github.com/ajank/Romulus. Contact: ajank@mimuw.edu.pl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27153645

  5. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    SciTech Connect

    Istrate, Monica A.; Nussler, Andreas K.; Eichelbaum, Michel; Burk, Oliver

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  6. An interferon gamma-regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes.

    PubMed Central

    Driggers, P H; Ennist, D L; Gleason, S L; Mak, W H; Marks, M S; Levi, B Z; Flanagan, J R; Appella, E; Ozato, K

    1990-01-01

    Interferons (IFNs) induce transcription of major histocompatibility complex (MHC) class I genes through the conserved IFN consensus sequence (ICS) that contains an IFN response motif shared by many IFN-regulated genes. By screening mouse lambda ZAP expression libraries with the ICS as a probe, we isolated a cDNA clone encoding a protein that binds the ICS, designated ICSBP. Protein blot analysis with labeled oligonucleotide probes showed that ICSBP binds not only the MHC class I ICS but also IFN response motifs of many IFN-regulated genes, as well as a virus-inducible element of the IFN-beta gene. The ICSBP cDNA encodes 424 amino acids and a long 3' untranslated sequence. The N-terminal 115 amino acids correspond to a putative DNA-binding domain and show significant sequence similarity with other cloned IFN response factors (IRF-1 and IRF-2). Because of the structural similarity and shared binding specificity, we conclude that ICSBP is a third member of the IRF gene family, presumably playing a role in IFN- and virus-mediated regulation of many genes. Although IRF-1 and IRF-2 share some similarity in their C-terminal regions, ICSBP shows no similarity to IRF-1 or IRF-2 in this region, suggesting that it is more distantly related. We show that ICSBP mRNA is expressed predominantly in lymphoid tissues and is inducible preferentially by IFN-gamma. The induction by IFN-gamma appears to be predominant in lymphocytes and macrophages, implying that ICSBP plays a regulatory role in cells of the immune system. The presence of multiple factors that bind common IFN response motifs may partly account for the complexity and diversity of IFN action as well as IFN-regulated gene expression. Images PMID:2111015

  7. The Study of Stability of Compression-Loaded Multispan Composite Panel Upon Failure of Elements Binding it to Panel Supports

    NASA Technical Reports Server (NTRS)

    Zamula, G. N.; Ierusalimsky, K. M.; Fomin, V. P.; Grishin, V. I.; Kalmykova, G. S.

    1999-01-01

    The present document is a final technical report carried out within co-operation between United States'NASA Langley RC and Russia's Goskomoboronprom in aeronautics, and continues similar programs, accomplished in 1996, 1997, and 1998, respectively). The report provides results of "The study of stability of compression-loaded multispan composite panels upon failure of elements binding it to panel supports"; these comply with requirements established at TsAGI on 24 March 1998 and at NASA on 15 September 1998.

  8. Poly(A) binding protein abundance regulates eukaryotic translation initiation factor 4F assembly in human cytomegalovirus-infected cells.

    PubMed

    McKinney, Caleb; Perez, Cesar; Mohr, Ian

    2012-04-10

    By commandeering cellular translation initiation factors, or destroying those dispensable for viral mRNA translation, viruses often suppress host protein synthesis. In contrast, cellular protein synthesis proceeds in human cytomegalovirus (HCMV)-infected cells, forcing viral and cellular mRNAs to compete for limiting translation initiation factors. Curiously, inactivating the host translational repressor 4E-BP1 in HCMV-infected cells stimulates synthesis of the cellular poly(A) binding protein (PABP), significantly increasing PABP abundance. Here, we establish that new PABP synthesis is translationally controlled by the HCMV-encoded UL38 mammalian target of rapamycin complex 1-activator. The 5' UTR within the mRNA encoding PABP contains a terminal oligopyrimidine (TOP) element found in mRNAs, the translation of which is stimulated in response to mitogenic, growth, and nutritional stimuli, and proteins encoded by TOP-containing mRNAs accumulated in HCMV-infected cells. Furthermore, UL38 expression was necessary and sufficient to regulate expression of a PABP TOP-containing reporter. Remarkably, preventing the rise in PABP abundance by RNAi impaired eIF4E binding to eIF4G, thereby reducing assembly of the multisubunit initiation factor eIF4F, viral protein production, and replication. This finding demonstrates that viruses can increase host translation initiation factor concentration to foster their replication and defines a unique mechanism whereby control of PABP abundance regulates eIF4F assembly. PMID:22431630

  9. Construction of scFv that bind both fibronectin-binding protein A and clumping factor A of Stapylococcus aureus.

    PubMed

    Wang, Man; Zhang, Yan; Li, Benqiang; Zhu, Jianguo

    2015-06-01

    Bovine mastitis (BM) causes significant losses to the dairy industry. Vaccines against the causative agent of BM, Staphylococcus aureus, do not confer adequate protection. Because passive immunization with antibodies permits disease prevention, we constructed a recombinant single-chain antibody (scFv) against fibronectin-binding protein A (FnBPA) and clumping factor A (ClfA), two important virulence factors in S. aureus infection. The DNA coding sequences of the variable heavy (VH) and variable light (VL) domains of antibodies produced in the peripheral blood lymphocytes of cows with S. aureus-induced mastitis were obtained using reverse transcription and polymerase chain reaction, and the VH and VL cDNAs were assembled in-tandem using a DNA sequence encoding a (Gly4Ser)3 peptide linker. The scFv cDNAs were cloned into the pOPE101 plasmid for the expression of soluble scFv protein in Escherichia coli. The binding of the scFvs to both FnBPA and ClfA was confirmed using an indirect ELISA and Western blotting. The DNA sequences of the framework regions of the VH and VL domains were highly conserved, and the complementarity-determining regions displayed significant diversity, especially in CDR3 of the VH domain. These novel bovine antibody fragments may be useful as a therapeutic candidate for the prevention and treatment of S. aureus-induced bovine mastitis. PMID:25910693

  10. Pigment Epithelium-derived Factor (PEDF) Binds to Cell-surface F1-ATP Synthase

    PubMed Central

    Notari, Luigi; Arakaki, Naokatu; Mueller, David; Meier, Scott; Amaral, Juan; Becerra, S. Patricia

    2010-01-01

    Pigment epithelium-derived factor (PEDF), a potent blocker of angiogenesis in vivo, and of endothelial cell migration and tubule formation, binds with high affinity to a yet unknown protein on the surface of endothelial cells. Given that protein fingerprinting suggested a match of a ~60-kDa PEDF-binding protein in bovine retina to Bos taurus F1-ATP synthase β-subunit, and that F1F0-ATP synthase components have been identified recently as cell-surface receptors, we examined the direct binding of PEDF to F1. Size-exclusion ultrafiltration assays showed that recombinant human PEDF formed a complex with recombinant yeast F1. Real-time binding by surface plasmon resonance demonstrated that yeast F1 interacted specifically and reversibly with human PEDF. Kinetic evaluations revealed high binding affinity for PEDF, in agreement with PEDF affinities for endothelial cell-surfaces. PEDF blocked interactions between F1 and angiostatin, another antiangiogenic factor, suggesting overlapping PEDF- and angiostatin-binding sites on F1. Surfaces of endothelial cells exhibited affinity for PEDF-binding proteins of ~60-kDa. Antibodies to F1 β-subunit specifically captured PEDF-binding components in endothelial plasma membranes. Extracellular ATP synthesis activity of endothelial cells was examined in the presence of PEDF. PEDF significantly inhibited the extracellular ATP produced by endothelial cells, in agreement with direct interactions between cell-surface ATP synthase and PEDF. In addition to demonstrating that PEDF binds to cell-surface F1, these results show that PEDF is a ligand for endothelial cell-surface F1F0-ATP synthase. They suggest that PEDF-mediated inhibition of ATP synthase may be part of the biochemical mechanisms by which PEDF exerts its antiangiogenic activity. PMID:20412062

  11. Binding proteins from fish sera and intrinsic factor compared in vitamin B12 radioassay.

    PubMed

    Ithakissios, D S; Kubiatowicz, D O; Windorski, D C; Wicks, J H

    1977-11-01

    We compare serum proteins from rainbow trout, chinook salmon, coho salmon, and oyster toadfish with intrinsic factor as binding proteins in a simplified radioassay for B12. Regression analysis of B12 values, determined in 21 serum samples, shows good correlation (r greater than .975) between results for the fish sera and intrinsic factor. The accuracy of the five assays, as evaluated by analytical recovery of B12 added to pooled human serum, ranges from 90 to 110%. Intra-assay precision ranges from 2.6% for coho salmon serum to 5.5% for intrinsic factor, Ionic strength and variations in pH influence binding of [57Co]vit B12 to the fish sera. Maximum binding occurs from pH 6 to 10 at an ionic strength of 0.1 for all sera. The sera are stable for longer than two years when stored at -20 degrees C. Important advantages of fish sera are their high binding capacity (typical assay dilutions range from 1500-fold for trout serum to more than 50 000-fold for chinook salmon); high affinity for B12 (K greater than 10(12) liter/mol); their relative constant binding characteristics as compared to commercial intrinsic factor preparations; and the finding that the accuracy of radioassays with use of fish sera is not significantly affected by the amount of B12 or human serum proteins present. PMID:912869

  12. Regulation of genotoxic stress response by homeodomain-interacting protein kinase 2 through phosphorylation of cyclic AMP response element-binding protein at serine 271.

    PubMed

    Sakamoto, Kensuke; Huang, Bo-Wen; Iwasaki, Kenta; Hailemariam, Kiros; Ninomiya-Tsuji, Jun; Tsuji, Yoshiaki

    2010-08-15

    CREB (cyclic AMP response element-binding protein) is a stimulus-induced transcription factor that plays pivotal roles in cell survival and proliferation. The transactivation function of CREB is primarily regulated through Ser-133 phosphorylation by cAMP-dependent protein kinase A (PKA) and related kinases. Here we found that homeodomain-interacting protein kinase 2 (HIPK2), a DNA-damage responsive nuclear kinase, is a new CREB kinase for phosphorylation at Ser-271 but not Ser-133, and activates CREB transactivation function including brain-derived neurotrophic factor (BDNF) mRNA expression. Ser-271 to Glu-271 substitution potentiated the CREB transactivation function. ChIP assays in SH-SY5Y neuroblastoma cells demonstrated that CREB Ser-271 phosphorylation by HIPK2 increased recruitment of a transcriptional coactivator CBP (CREB binding protein) without modulation of CREB binding to the BDNF CRE sequence. HIPK2-/- MEF cells were more susceptible to apoptosis induced by etoposide, a DNA-damaging agent, than HIPK2+/+ cells. Etoposide activated CRE-dependent transcription in HIPK2+/+ MEF cells but not in HIPK2-/- cells. HIPK2 knockdown in SH-SY5Y cells decreased etoposide-induced BDNF mRNA expression. These results demonstrate that HIPK2 is a new CREB kinase that regulates CREB-dependent transcription in genotoxic stress. PMID:20573984

  13. Indirubin derivatives alter DNA binding activity of the transcription factor NF-Y and inhibit MDR1 gene promoter.

    PubMed

    Tanaka, Toru; Ohashi, Sachiyo; Saito, Hiroaki; Higuchi, Takashi; Tabata, Keiichi; Kosuge, Yasuhiro; Suzuki, Takashi; Miyairi, Shinichi; Kobayashi, Shunsuke

    2014-10-15

    Indirubin derivatives exert antitumor activity. However, their effects on the expression of multidrug resistance gene 1 (MDR1) have not been investigated. Here we found three derivatives that inhibit the MDR1 gene promoter. To investigate the effects of indirubins on the DNA binding of NF-Y, a major MDR1 gene transcription factor that recognizes an inverted CCAAT element in the promoter, gel mobility shift assay was performed using the element as a probe with nuclear extracts from NG108-15, MCF7, HepG2, C2C12, and SK-N-SH cells. Among 17 compounds, 5-methoxyindirubin inhibited the DNA binding of NF-Y significantly, whereas indirubin-3'-oxime and 7-methoxyindirubin 3'-oxime increased the binding considerably. After evaluating a suitable concentration of each compound for transcription analysis using living tumor cells, we performed a reporter gene assay using a reporter DNA plasmid containing EGFP cDNA fused to the MDR1 gene promoter region. Indirubin-3'-oxime exerted a significant inhibitory effect on the MDR1 promoter activity in MCF7 and HepG2 cells, and 5-methoxyindirubin inhibited the activity only in MCF7 cells; 7-methoxyindirubin 3'-oxime suppressed the activity in all of the cell lines. We further confirmed that the compounds reduced endogenous MDR1 transcription without any inhibitory effect on NF-Y expression. Moreover, each compound increased the doxorubicin sensitivity of MCF7 cells. These results indicate that each indirubin derivative acts on the DNA binding of NF-Y and represses the MDR1 gene promoter with tumor cell-type specificity. PMID:25066113

  14. Heterogeneity of transcription factor binding specificity models within and across cell lines.

    PubMed

    Sharmin, Mahfuza; Bravo, Héctor Corrada; Hannenhalli, Sridhar

    2016-08-01

    Complex gene expression patterns are mediated by the binding of transcription factors (TFs) to specific genomic loci. The in vivo occupancy of a TF is, in large part, determined by the TF's DNA binding interaction partners, motivating genomic context-based models of TF occupancy. However, approaches thus far have assumed a uniform TF binding model to explain genome-wide cell-type-specific binding sites. Therefore, the cell type heterogeneity of TF occupancy models, as well as the extent to which binding rules underlying a TF's occupancy are shared across cell types, has not been investigated. Here, we develop an ensemble-based approach (TRISECT) to identify the heterogeneous binding rules for cell-type-specific TF occupancy and analyze the inter-cell-type sharing of such rules. Comprehensive analysis of 23 TFs, each with ChIP-seq data in four to 12 different cell types, shows that by explicitly capturing the heterogeneity of binding rules, TRISECT accurately identifies in vivo TF occupancy. Importantly, many of the binding rules derived from individual cell types are shared across cell types and reveal distinct yet functionally coherent putative target genes in different cell types. Closer inspection of the predicted cell-type-specific interaction partners provides insights into the context-specific functional landscape of a TF. Together, our novel ensemble-based approach reveals, for the first time, a widespread heterogeneity of binding rules, comprising the interaction partners within a cell type, many of which nevertheless transcend cell types. Notably, the putative targets of shared binding rules in different cell types, while distinct, exhibit significant functional coherence. PMID:27311443

  15. Divergent Binding and Transactivation by Two Related Steroid Receptors at the Same Response Element.

    PubMed

    Tesikova, Martina; Dezitter, Xavier; Nenseth, Hatice Z; Klokk, Tove I; Mueller, Florian; Hager, Gordon L; Saatcioglu, Fahri

    2016-05-27

    Transcription factor (TF) recruitment to chromatin is central to activation of transcription. TF-chromatin interactions are highly dynamic, which are evaluated by recovery half time (t1/2) in seconds, determined by fluorescence recovery experiments in living cells, and chromatin immunoprecipitation (ChIP) analysis, measured in minutes. These two states are related: the larger the t1/2, the longer the ChIP occupancy resulting in increased transcription. Here we present data showing that this relationship does not always hold. We found that histone deacetylase inhibitors (HDACis) significantly increased t1/2 of green fluorescent protein (GFP) fused androgen receptor (AR) on a tandem array of positive hormone response elements (HREs) in chromatin. This resulted in increased ChIP signal of GFP-AR. Unexpectedly, however, transcription was inhibited. In contrast, the GFP-fused glucocorticoid receptor (GR), acting through the same HREs, displayed a profile consistent with current models. We provide evidence that these differences are mediated, at least in part, by HDACs. Our results provide insight into TF action in living cells and show that very closely related TFs may trigger significantly divergent outcomes at the same REs. PMID:27056330

  16. In vitro binding of the purified hormone-binding subunit of the estrogen receptor to oligonucleotides containing natural or modified sequences of an estrogen-responsive element.

    PubMed

    Medici, N; Nigro, V; Abbondanza, C; Moncharmont, B; Molinari, A M; Puca, G A

    1991-04-01

    Estrogen receptor (ER) was purified from calf uterus by immunoaffinity chromatography in the absence of the ligand. The purified ER consists of a mixture of monomer and homodimer forms of 67-kDa hormone-binding subunit (no 90-kDa heat shock protein is present). The purified ER was incubated with a 32P-labeled 61-basepair oligonucleotide containing the sequence of the estrogen response element (ERE) of the Xenopus laevis A2 vitellogenin gene. DNA mobility shift assays showed formation of specific complexes of the ERE containing oligonucleotide with ER, formation which did not require and was not affected by estradiol or antiestrogenic molecules. Both the monomer and the dimer were equally able to interact with the ERE-containing oligonucleotide. Sucrose gradient experiments showed that only the ER monomer is able to interact with an oligonucleotide in which a single mutation destroyed the dyad symmetry of ERE. Multiple symmetric mutations which did not alter the dyad symmetry of ERE nevertheless totally destroyed the ability of the oligonucleotide to form complexes with either the monomeric or dimeric form of ER. These results suggest that ER is able to bind to ERE independently of the presence of estradiol or other proteins and, therefore, that estradiol does not act by modulating the ability of ER to bind to ERE on DNA. PMID:1922088

  17. A conserved motif N-terminal to the DNA-binding domains of myogenic bHLH transcription factors mediates cooperative DNA binding with pbx-Meis1/Prep1.

    PubMed

    Knoepfler, P S; Bergstrom, D A; Uetsuki, T; Dac-Korytko, I; Sun, Y H; Wright, W E; Tapscott, S J; Kamps, M P

    1999-09-15

    The t(1;19) chromosomal translocation of pediatric pre-B cell leukemia produces chimeric oncoprotein E2a-Pbx1, which contains the N-terminal transactivation domain of the basic helix-loop-helix (bHLH) transcription factor, E2a, joined to the majority of the homeodomain protein, Pbx1. There are three Pbx family members, which bind DNA as heterodimers with both broadly expressed Meis/Prep1 homeo-domain proteins and specifically expressed Hox homeodomain proteins. These Pbx heterodimers can augment the function of transcriptional activators bound to adjacent elements. In heterodimers, a conserved tryptophan motif in Hox proteins binds a pocket on the surface of the Pbx homeodomain, while Meis/Prep1 proteins bind an N-terminal Pbx domain, raising the possibility that the tryptophan-interaction pocket of the Pbx component of a Pbx-Meis/Prep1 complex is still available to bind trypto-phan motifs of other transcription factors bound to flanking elements. Here, we report that Pbx-Meis1/Prep1 binds DNA cooperatively with heterodimers of E2a and MyoD, myogenin, Mrf-4 or Myf-5. As with Hox proteins, a highly conserved tryptophan motif N-terminal to the DNA-binding domains of each myogenic bHLH family protein is required for cooperative DNA binding with Pbx-Meis1/Prep1. In vivo, MyoD requires this tryptophan motif to evoke chromatin remodeling in the Myogenin promoter and to activate Myogenin transcription. Pbx-Meis/Prep1 complexes, therefore, have the potential to cooperate with the myogenic bHLH proteins in regulating gene transcription. PMID:10471746

  18. Eukaryotic initiation factor 4B and the poly(A)-binding protein bind eIF4G competitively.

    PubMed

    Cheng, Shijun; Gallie, Daniel R

    2013-01-01

    The eukaryotic translation initiation factor (eIF) 4G functions as a scaffold protein that assembles components of the translation initiation complex required to recruit the 40S ribosomal subunit to an mRNA. Although many eukaryotes express two highly similar eIF4G isoforms, those in plants are highly divergent in size and sequence from one another and are referred to as eIF4G and eIFiso4G. Although the domain organization of eIFiso4G differs substantially from eIF4G orthologs in other species, the domain organization of plant eIF4G is largely unknown despite the fact that it is more similar in size and sequence to eIF4G of other eukaryotes. In this study, we show that eIF4G differs from eIFiso4G in that it contains two distinct interaction domains for the poly(A) binding protein (PABP) and eIF4B but is similar to eIFiso4G in having two eIF4A interaction domains. PABP and eIF4B bind the same N-terminal region of eIF4G as they do to a region C-proximal to the HEAT-1 domain in the middle domain of eIF4G, resulting in competitive binding between eIF4B and PABP to each site. eIF4G also differs from eIFiso4G in that no competitive binding was observed between PABP and eIF4A or between eIF4B and eIF4A to its HEAT-1-containing region. These results demonstrate that despite substantial differences in size, sequence, and domain organization, PABP and eIF4B bind to eIF4G and eIFiso4G competitively. PMID:26824014

  19. In vitro binding capacities of three dietary fibers and their mixture for four toxic elements, cholesterol, and bile acid.

    PubMed

    Zhang, Ning; Huang, Caihuan; Ou, Shiyi

    2011-02-15

    Water-soluble dietary fibers from apple peels and water-insoluble dietary fibers from wheat bran and soybean-seed hull were used to evaluate their binding capacities for four toxic elements (Pb, Hg, Cd, and As), lard, cholesterol, and bile acids. The water-soluble dietary fibers showed a higher binding capacity for three toxic cations, cholesterol, and sodium cholate; and a lower binding capacity for lard, compared to the water-insoluble ones. A mixture of the dietary fibers from all samples - apple peels, wheat bran, and soybean-seed hull - in the ratio 2:4:4 (w/w) significantly increased the binding capacity of water-insoluble dietary fibers for the three toxic cations, cholesterol, and sodium cholate; moreover, the mixture could lower the concentrations of Pb(2+) and Cd(+) in the tested solutions to levels lower than those occurring in rice and vegetables grown in polluted soils. However, all the tested fibers showed a low binding capacity for the toxic anion, AsO(3)(3-). PMID:21095057

  20. Complement factor H in its alternative identity as adrenomedullin-binding protein 1.

    PubMed

    Sim, Robert B; Ferluga, Janez; Al-Rashidi, Hanan; Abbow, Hussein; Schwaeble, Wilhelm; Kishore, Uday

    2015-11-01

    Complement factor H has been extensively studied since its discovery 50 years ago, and its role in the complement system is quite well established. It has another role, however, as a binding protein for the regulatory peptide adrenomedullin. Part of this role appears to be protection of adrenomedullin from proteolytic degradation. The binding interaction is unusual and merits further investigation. Adrenomedullin has potential therapeutic uses in diseases affecting the vasculature, and factor H has been administered with adrenomedullin in some animal models of disease. PMID:26597206

  1. Binding of type II nuclear receptors and estrogen receptor to full and half-site estrogen response elements in vitro.

    PubMed Central

    Klinge, C M; Bodenner, D L; Desai, D; Niles, R M; Traish, A M

    1997-01-01

    The mechanism by which retinoids, thyroid hormone (T3) and estrogens modulate the growth of breast cancer cells is unclear. Since nuclear type II nuclear receptors, including retinoic acid receptor (RAR), retinoid X receptor (RXR) and thyroid hormone receptor (TR), bind direct repeats (DR) of the estrogen response elements (ERE) half-site (5'-AGGTCA-3'), we examined the ability of estrogen receptor (ER) versus type II nuclear receptors, i.e. RARalpha, beta and gamma, RXRbeta, TRalpha and TRbeta, to bind various EREs in vitro . ER bound a consensus ERE, containing a perfectly palindromic 17 bp inverted repeat (IR), as a homodimer. In contrast, ER did not bind to a single ERE half-site. Likewise, ER did not bind two tandem (38 bp apart) half-sites, but low ER binding was detected to three tandem copies of the same half-site. RARalpha,beta or gamma bound both ERE and half-site constructs as a homodimer. RXRbeta did not bind full or half-site EREs, nor did RXRbeta enhance RARalpha binding to a full ERE. However, RARalpha and RXRbeta bound a half-site ERE cooperatively forming a dimeric complex. The RARalpha-RXRbeta heterodimer bound the Xenopus vitellogenin B1 estrogen responsive unit, with two non-consensus EREs, with higher affinity than one or two copies of the full or half-site ERE. Both TRalpha and TRbeta bound the full and the half-site ERE as monomers and homodimers and cooperatively as heterodimers with RXRbeta. We suggest that the cellular concentrations of nuclear receptors and their ligands, and the nature of the ERE or half-site sequence and those of its flanking sequences determine the occupation of EREs in estrogen-regulated genes in vivo . PMID:9115356

  2. Identification of a protein-binding site that mediates transcriptional response of the c-fos gene to serum factors.

    PubMed

    Treisman, R

    1986-08-15

    Transient transcriptional activation of the c-fos gene following serum stimulation of susceptible cells requires a conserved DNA element located 300 bp 5' to the mRNA cap site. A DNA-binding gel electrophoresis assay was used to detect a protein(s) in HeLa cell nuclear extracts that specifically binds to the 5' activating element. The protein recognizes a region of dyad symmetry within the 5' activating element, defined by binding competition, dimethylsulphate (DMS) interference and DNAase I and DMS protection studies. A single 22 bp synthetic copy of the dyad symmetry element will both compete efficiently for protein binding and restore serum regulation to c-fosH genes that lack the 5' activating element. PMID:3524858

  3. Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1.

    PubMed Central

    Zhang, W; Wagner, B J; Ehrenman, K; Schaefer, A W; DeMaria, C T; Crater, D; DeHaven, K; Long, L; Brewer, G

    1993-01-01

    The degradation of some proto-oncogene and lymphokine mRNAs is controlled in part by an AU-rich element (ARE) in the 3' untranslated region. It was shown previously (G. Brewer, Mol. Cell. Biol. 11:2460-2466, 1991) that two polypeptides (37 and 40 kDa) copurified with fractions of a 130,000 x g postribosomal supernatant (S130) from K562 cells that selectively accelerated degradation of c-myc mRNA in a cell-free decay system. These polypeptides bound specifically to the c-myc and granulocyte-macrophage colony-stimulating factor 3' UTRs, suggesting they are in part responsible for selective mRNA degradation. In the present work, we have purified the RNA-binding component of this mRNA degradation activity, which we refer to as AUF1. Using antisera specific for these polypeptides, we demonstrate that the 37- and 40-kDa polypeptides are immunologically cross-reactive and that both polypeptides are phosphorylated and can be found in a complex(s) with other polypeptides. Immunologically related polypeptides are found in both the nucleus and the cytoplasm. The antibodies were also used to clone a cDNA for the 37-kDa polypeptide. This cDNA contains an open reading frame predicted to produce a protein with several features, including two RNA recognition motifs and domains that potentially mediate protein-protein interactions. These results provide further support for a role of this protein in mediating ARE-directed mRNA degradation. Images PMID:8246982

  4. DNA-binding specificity changes in the evolution of forkhead transcription factors

    PubMed Central

    Nakagawa, So; Gisselbrecht, Stephen S.; Rogers, Julia M.; Hartl, Daniel L.; Bulyk, Martha L.

    2013-01-01

    The evolution of transcriptional regulatory networks entails the expansion and diversification of transcription factor (TF) families. The forkhead family of TFs, defined by a highly conserved winged helix DNA-binding domain (DBD), has diverged into dozens of subfamilies in animals, fungi, and related protists. We have used a combination of maximum-likelihood phylogenetic inference and independent, comprehensive functional assays of DNA-binding capacity to explore the evolution of DNA-binding specificity within the forkhead family. We present converging evidence that similar alternative sequence preferences have arisen repeatedly and independently in the course of forkhead evolution. The vast majority of DNA-binding specificity changes we observed are not explained by alterations in the known DNA-contacting amino acid residues conferring specificity for canonical forkhead binding sites. Intriguingly, we have found forkhead DBDs that retain the ability to bind very specifically to two completely distinct DNA sequence motifs. We propose an alternate specificity-determining mechanism whereby conformational rearrangements of the DBD broaden the spectrum of sequence motifs that a TF can recognize. DNA-binding bispecificity suggests a previously undescribed source of modularity and flexibility in gene regulation and may play an important role in the evolution of transcriptional regulatory networks. PMID:23836653

  5. Functional transcription factor target discovery via compendia of binding and expression profiles

    PubMed Central

    Banks, Christopher J.; Joshi, Anagha; Michoel, Tom

    2016-01-01

    Genome-wide experiments to map the DNA-binding locations of transcription-associated factors (TFs) have shown that the number of genes bound by a TF far exceeds the number of possible direct target genes. Distinguishing functional from non-functional binding is therefore a major challenge in the study of transcriptional regulation. We hypothesized that functional targets can be discovered by correlating binding and expression profiles across multiple experimental conditions. To test this hypothesis, we obtained ChIP-seq and RNA-seq data from matching cell types from the human ENCODE resource, considered promoter-proximal and distal cumulative regulatory models to map binding sites to genes, and used a combination of linear and non-linear measures to correlate binding and expression data. We found that a high degree of correlation between a gene’s TF-binding and expression profiles was significantly more predictive of the gene being differentially expressed upon knockdown of that TF, compared to using binding sites in the cell type of interest only. Remarkably, TF targets predicted from correlation across a compendium of cell types were also predictive of functional targets in other cell types. Finally, correlation across a time course of ChIP-seq and RNA-seq experiments was also predictive of functional TF targets in that tissue. PMID:26857150

  6. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family

    PubMed Central

    Dai, Qi; Ren, Aiming; Westholm, Jakub O.; Duan, Hong; Patel, Dinshaw J.

    2015-01-01

    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain (“BEN-solo” factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional

  7. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family.

    PubMed

    Dai, Qi; Ren, Aiming; Westholm, Jakub O; Duan, Hong; Patel, Dinshaw J; Lai, Eric C

    2015-01-01

    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain ("BEN-solo" factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional

  8. Interaction of the Dr1 inhibitory factor with the TATA binding protein is disrupted by adenovirus E1A.

    PubMed Central

    Kraus, V B; Inostroza, J A; Yeung, K; Reinberg, D; Nevins, J R

    1994-01-01

    Past experiments have shown that the adenovirus E1A12S product activates the hsp70 promoter, dependent on the TATA element and dependent on N-terminal E1A sequences. Other experiments have identified a factor termed Dr1 that interacts with and inhibits the transcriptional activity of the TATA-binding protein (TBP). We now find that the E1A12S protein can disrupt the interaction of the Dr1 factor with the TATA-specific TBP factor, allowing the productive interaction of TBP with TFIIA. This E1A-mediated disruption is dependent on N-terminal sequences that are also essential for the TATA-dependent trans-activation of the hsp70 promoter. Moreover, we also find that Dr1 expression in transfected cells can inhibit transcription from the hsp70 promoter and that this can be overcome by coexpression of the wild-type E1A protein, dependent on N-terminal sequences. We conclude that the activation of hsp70 through the TATA element may be mechanistically similar to the activation of the E2 promoter via E2F, in each case involving a release of a transcription factor from an inactive complex. Images PMID:8022773

  9. Decreased Transcription Factor Binding Levels Nearby Primate Pseudogenes Suggest Regulatory Degeneration.

    PubMed

    Douglas, Gavin M; Wilson, Michael D; Moses, Alan M

    2016-06-01

    Characteristics of pseudogene degeneration at the coding level are well-known, such as a shift toward neutral rates of nonsynonymous substitutions and gain of frameshift mutations. In contrast, degeneration of pseudogene transcriptional regulation is not well understood. Here, we test two predictions of regulatory degeneration along a pseudogenized lineage: 1) Decreased transcription factor (TF) binding and 2) accelerated evolution in putative cis-regulatory regions.We find evidence for decreased TF binding levels nearby two primate pseudogenes compared with functional liver genes. However, the majority of TF-bound sequences nearby pseudogenes do not show evidence for lineage-specific accelerated rates of evolution. We conclude that decreases in TF binding level could be a marker for regulatory degeneration, while sequence degeneration in primate cis-regulatory modules may be obscured by background rates of TF binding site turnover. PMID:26882985

  10. Decreased Transcription Factor Binding Levels Nearby Primate Pseudogenes Suggest Regulatory Degeneration

    PubMed Central

    Douglas, Gavin M.; Wilson, Michael D.; Moses, Alan M.

    2016-01-01

    Characteristics of pseudogene degeneration at the coding level are well-known, such as a shift toward neutral rates of nonsynonymous substitutions and gain of frameshift mutations. In contrast, degeneration of pseudogene transcriptional regulation is not well understood. Here, we test two predictions of regulatory degeneration along a pseudogenized lineage: 1) Decreased transcription factor (TF) binding and 2) accelerated evolution in putative cis-regulatory regions. We find evidence for decreased TF binding levels nearby two primate pseudogenes compared with functional liver genes. However, the majority of TF-bound sequences nearby pseudogenes do not show evidence for lineage-specific accelerated rates of evolution. We conclude that decreases in TF binding level could be a marker for regulatory degeneration, while sequence degeneration in primate cis-regulatory modules may be obscured by background rates of TF binding site turnover. PMID:26882985

  11. Statistical Mechanics of Transcription-Factor Binding Site Discovery Using Hidden Markov Models

    PubMed Central

    Mehta, Pankaj; Schwab, David J.; Sengupta, Anirvan M.

    2011-01-01

    Hidden Markov Models (HMMs) are a commonly used tool for inference of transcription factor (TF) binding sites from DNA sequence data. We exploit the mathematical equivalence between HMMs for TF binding and the “inverse” statistical mechanics of hard rods in a one-dimensional disordered potential to investigate learning in HMMs. We derive analytic expressions for the Fisher information, a commonly employed measure of confidence in learned parameters, in the biologically relevant limit where the density of binding sites is low. We then use techniques from statistical mechanics to derive a scaling principle relating the specificity (binding energy) of a TF to the minimum amount of training data necessary to learn it. PMID:22851788

  12. Competitive binding of viral E2 protein and mammalian core-binding factor to transcriptional control sequences of human papillomavirus type 8 and bovine papillomavirus type 1.

    PubMed Central

    Schmidt, H M; Steger, G; Pfister, H

    1997-01-01

    The promoter P7535 of human papillomavirus type 8 and the promoter P7185 of bovine papillomavirus type 1 are negatively regulated by viral E2 proteins via the promoter proximal binding sites P2 and BS1, respectively. Mutations of these E2 binding sites can reduce basal promoter activity. This suggests binding of a transcription-stimulating factor and may indicate that repression by E2 is due to competitive binding of viral and cellular proteins. A computer search revealed putative binding sites for core-binding factor (CBF; also referred to as PEA2, PEBP2, or AML), overlapping with P2 and BS1. Binding of recombinant CBF proteins to these sites was confirmed by band shift analysis. Competition of CBF and E2 protein for DNA binding was shown for both human papillomavirus type 8 and bovine papillomavirus type 1. The importance of CBF-E2 competition in E2-mediated repression could be demonstrated by comparing the E2 effect on P7185 activity in two cell lines containing different amounts of endogenous CBF. In cells with large amounts of CBF, E2 repressed P7185 wild-type constructs to the basal promoter activity of a mutant (50%) that could not bind this protein any more. In contrast, in a cell line containing small amounts of CBF, the promoter activities of constructs with wild-type and mutated CBF binding sites hardly differed and specific repression by E2 was not detectable. PMID:9311900

  13. Somatomedin-1 binding protein-3: insulin-like growth factor-1 binding protein-3, insulin-like growth factor-1 carrier protein.

    PubMed

    2003-01-01

    Somatomedin-1 binding protein-3 [insulin-like growth factor-1 binding protein-3, SomatoKine] is a recombinant complex of insulin-like growth factor-1 (rhIGF-1) and binding protein-3 (IGFBP-3), which is the major circulating somatomedin (insulin-like growth factor) binding protein; binding protein-3 regulates the delivery of somatomedin-1 to target tissues. Somatomedin-1 binding protein-3 has potential as replacement therapy for somatomedin-1 which may become depleted in indications such as major surgery, organ damage/failure and traumatic injury, resulting in catabolism. It also has potential for the treatment of osteoporosis; diseases associated with protein wasting including chronic renal failure, cachexia and severe trauma; and to attenuate cardiac dysfunction in a variety of disease states, including after severe burn trauma. Combined therapy with somatomedin-1 and somatomedin-1 binding protein-3 would prolong the duration of action of somatomedin-1 and would reduce or eliminate some of the undesirable effects associated with somatomedin-1 monotherapy. Somatomedin-1 is usually linked to binding protein-3 in the normal state of the body, and particular proteases clip them apart in response to stresses and release somatomedin-1 as needed. Therefore, somatomedin-1 binding protein-3 is a self-dosing system and SomatoKine would augment the natural supply of these linked compounds. Somatomedin-1 binding protein-3 was developed by Celtrix using its proprietary recombinant protein production technology. Subsequently, Celtrix was acquired by Insmed Pharmaceuticals on June 1 2000. Insmed and Avecia, UK, have signed an agreement for the manufacturing of SomatoKine and its components, IGF-1 and binding protein-3. CGMP clinical production of SomatoKine and its components will be done in Avecia's Advanced Biologics Centre, Billingham, UK, which manufactures recombinant-based medicines and vaccines with a capacity of up to 1000 litres. In 2003, manufacturing of SomatoKine is

  14. Contribution of a Nuclear Factor-κB Binding Site to Human Angiotensinogen Promoter Activity in Renal Proximal Tubular Cells

    PubMed Central

    Acres, Omar W.; Satou, Ryousuke; Navar, L. Gabriel; Kobori, Hiroyuki

    2011-01-01

    Intrarenal angiotensinogen (AGT) is expressed highly in renal proximal tubular cells (RPTCs) and contributes to the regulation of intrarenal angiotensin II levels. Inhibition of nuclear factor (NF)-κB suppressed human (h)AGT expression in human RPTCs. However, the presence and localization of an NF-κB binding site in the hAGT promoter region have not been determined. Therefore, this study was performed to demonstrate that an NF-κB binding site in the hAGT promoter region contributes to hAGT promoter activity in human RPTCs. The hAGT promoter region was cloned from −4358 to +122 and deletion analysis was performed. A possible NF-κB binding site was removed from the hAGT promoter region (M1) and mutated (M2). Human RPTCs were transfected, and hAGT promoter activity was determined by luciferase assay. The identity of DNA binding proteins from binding assays were determined by Western blot. Progressive 5′-end deletions demonstrated removal of a distal promoter element in hAGT_−2414/+122 reduced promoter activity (0.61±0.12, ratio to hAGT_−4358/+122). Inhibition of NF-κB suppressed promoter activity in hAGT_−4358/+122 (0.51±0.14, ratio to control) and hAGT_−3681/+122 (0.48±0.06, ratio to control) but not in the construct without the NF-κB binding site. Promoter activity was reduced in the domain mutants M1 (0.57±0.08, ratio to hAGT_−4358/+122) and M2 (0.61±0.16, ratio to hAGT_−4358/+122). DNA binding levels of NF-κB protein were reduced in M1. These data demonstrate the functional importance of an NF-κB binding site in the hAGT promoter region, which contributes to hAGT promoter activity in human RPTCs. PMID:21282554

  15. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  16. The Role of Genome Accessibility in Transcription Factor Binding in Bacteria.

    PubMed

    Gomes, Antonio L C; Wang, Harris H

    2016-04-01

    ChIP-seq enables genome-scale identification of regulatory regions that govern gene expression. However, the biological insights generated from ChIP-seq analysis have been limited to predictions of binding sites and cooperative interactions. Furthermore, ChIP-seq data often poorly correlate with in vitro measurements or predicted motifs, highlighting that binding affinity alone is insufficient to explain transcription factor (TF)-binding in vivo. One possibility is that binding sites are not equally accessible across the genome. A more comprehensive biophysical representation of TF-binding is required to improve our ability to understand, predict, and alter gene expression. Here, we show that genome accessibility is a key parameter that impacts TF-binding in bacteria. We developed a thermodynamic model that parameterizes ChIP-seq coverage in terms of genome accessibility and binding affinity. The role of genome accessibility is validated using a large-scale ChIP-seq dataset of the M. tuberculosis regulatory network. We find that accounting for genome accessibility led to a model that explains 63% of the ChIP-seq profile variance, while a model based in motif score alone explains only 35% of the variance. Moreover, our framework enables de novo ChIP-seq peak prediction and is useful for inferring TF-binding peaks in new experimental conditions by reducing the need for additional experiments. We observe that the genome is more accessible in intergenic regions, and that increased accessibility is positively correlated with gene expression and anti-correlated with distance to the origin of replication. Our biophysically motivated model provides a more comprehensive description of TF-binding in vivo from first principles towards a better representation of gene regulation in silico, with promising applications in systems biology. PMID:27104615

  17. The Role of Genome Accessibility in Transcription Factor Binding in Bacteria

    PubMed Central

    Wang, Harris H.

    2016-01-01

    ChIP-seq enables genome-scale identification of regulatory regions that govern gene expression. However, the biological insights generated from ChIP-seq analysis have been limited to predictions of binding sites and cooperative interactions. Furthermore, ChIP-seq data often poorly correlate with in vitro measurements or predicted motifs, highlighting that binding affinity alone is insufficient to explain transcription factor (TF)-binding in vivo. One possibility is that binding sites are not equally accessible across the genome. A more comprehensive biophysical representation of TF-binding is required to improve our ability to understand, predict, and alter gene expression. Here, we show that genome accessibility is a key parameter that impacts TF-binding in bacteria. We developed a thermodynamic model that parameterizes ChIP-seq coverage in terms of genome accessibility and binding affinity. The role of genome accessibility is validated using a large-scale ChIP-seq dataset of the M. tuberculosis regulatory network. We find that accounting for genome accessibility led to a model that explains 63% of the ChIP-seq profile variance, while a model based in motif score alone explains only 35% of the variance. Moreover, our framework enables de novo ChIP-seq peak prediction and is useful for inferring TF-binding peaks in new experimental conditions by reducing the need for additional experiments. We observe that the genome is more accessible in intergenic regions, and that increased accessibility is positively correlated with gene expression and anti-correlated with distance to the origin of replication. Our biophysically motivated model provides a more comprehensive description of TF-binding in vivo from first principles towards a better representation of gene regulation in silico, with promising applications in systems biology. PMID:27104615

  18. DNA-binding site for two skeletal actin promoter factors is important for expression in muscle cells

    SciTech Connect

    Walsh, K.; Schimmel, P.

    1988-04-01

    Two nuclear factors bind to the same site in the chicken skeletal actin promoter. Mutations in the footprint sequence which eliminate detectable binding decrease expression in transfected skeletal muscle cells by a factor of 25 to 50 and do not elevate the flow expression in nonmuscle cells. These results show that the factor-binding site contributes to the activation of expression in muscle cells and that it alone does not contribute significantly to repress expression in nonmuscle cells.

  19. Jasmonate regulates the inducer of cbf expression-C-repeat binding factor/DRE binding factor1 cascade and freezing tolerance in Arabidopsis.

    PubMed

    Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu

    2013-08-01

    The inducer of cbf expression (ICE)-C-repeat binding factor/DRE binding factor1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several jasmonate ZIM-domain (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance. PMID:23933884

  20. Jasmonate Regulates the INDUCER OF CBF EXPRESSION–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 Cascade and Freezing Tolerance in Arabidopsis[W

    PubMed Central

    Hu, Yanru; Jiang, Liqun; Wang, Fang; Yu, Diqiu

    2013-01-01

    The INDUCER OF CBF EXPRESSION (ICE)–C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 (CBF/DREB1) transcriptional pathway plays a critical role in modulating cold stress responses in Arabidopsis thaliana. Dissecting crucial upstream regulatory signals or components of the ICE-CBF/DREB1 cascade will enhance our understanding of plant cold-tolerance mechanisms. Here, we show that jasmonate positively regulates plant responses to freezing stress in Arabidopsis. Exogenous application of jasmonate significantly enhanced plant freezing tolerance with or without cold acclimation. By contrast, blocking endogenous jasmonate biosynthesis and signaling rendered plants hypersensitive to freezing stress. Consistent with the positive role of jasmonate in freezing stress, production of endogenous jasmonate was triggered by cold treatment. In addition, cold induction of genes acting in the CBF/DREB1 signaling pathway was upregulated by jasmonate. Further investigation revealed that several JASMONATE ZIM-DOMAIN (JAZ) proteins, the repressors of jasmonate signaling, physically interact with ICE1 and ICE2 transcription factors. JAZ1 and JAZ4 repress the transcriptional function of ICE1, thereby attenuating the expression of its regulon. Consistent with this, overexpression of JAZ1 or JAZ4 represses freezing stress responses of Arabidopsis. Taken together, our study provides evidence that jasmonate functions as a critical upstream signal of the ICE-CBF/DREB1 pathway to positively regulate Arabidopsis freezing tolerance. PMID:23933884

  1. A 3'UTR pumilio-binding element directs translational activation in olfactory sensory neurons.

    PubMed

    Kaye, Julia A; Rose, Natalie C; Goldsworthy, Brett; Goga, Andrei; L'Etoile, Noelle D

    2009-01-15

    Prolonged stimulation leads to specific and stable changes in an animal's behavior. In interneurons, this plasticity requires spatial and temporal control of neuronal protein synthesis. Whether such translational control occurs in sensory neurons is not known. Adaptation of the AWC olfactory sensory neurons of C. elegans requires the cGMP-dependent protein kinase EGL-4. Here, we show that the RNA-binding PUF protein FBF-1 is required in the adult AWC for adaptation. In the odor-adapted animal, it increases translation via binding to the egl-4 3' UTR. Further, the PUF protein may localize translation near the sensory cilia and cell body. Although the RNA-binding PUF proteins have been shown to promote plasticity in development by temporally and spatially repressing translation, this work reveals that in the adult nervous system, they can work in a different way to promote experience-dependent plasticity by activating translation in response to environmental stimulation. PMID:19146813

  2. Factorbook.org: a Wiki-based database for transcription factor-binding data generated by the ENCODE consortium.

    PubMed

    Wang, Jie; Zhuang, Jiali; Iyer, Sowmya; Lin, Xin-Ying; Greven, Melissa C; Kim, Bong-Hyun; Moore, Jill; Pierce, Brian G; Dong, Xianjun; Virgil, Daniel; Birney, Ewan; Hung, Jui-Hung; Weng, Zhiping

    2013-01-01

    The Encyclopedia of DNA Elements (ENCODE) consortium aims to identify all functional elements in the human genome including transcripts, transcriptional regulatory regions, along with their chromatin states and DNA methylation patterns. The ENCODE project generates data utilizing a variety of techniques that can enrich for regulatory regions, such as chromatin immunoprecipitation (ChIP), micrococcal nuclease (MNase) digestion and DNase I digestion, followed by deeply sequencing the resulting DNA. As part of the ENCODE project, we have developed a Web-accessible repository accessible at http://factorbook.org. In Wiki format, factorbook is a transcription factor (TF)-centric repository of all ENCODE ChIP-seq datasets on TF-binding regions, as well as the rich analysis results of these data. In the first release, factorbook contains 457 ChIP-seq datasets on 119 TFs in a number of human cell lines, the average profiles of histone modifications and nucleosome positioning around the TF-binding regions, sequence motifs enriched in the regions and the distance and orientation preferences between motif sites. PMID:23203885

  3. Transcriptional regulation of the human H ferritin-encoding gene (FERH) in G418-treated cells: role of the B-box-binding factor.

    PubMed

    Bevilacqua, M A; Faniello, M C; Russo, T; Cimino, F; Costanzo, F

    1994-04-20

    We have analysed the molecular basis underlying the increase in ferritin heavy-chain mRNA (FERH) levels in cells exposed to the antibiotic Geneticin (G418). Transient transfection experiments demonstrate that this increase is paralleled by an enhanced transcription driven by the promoter (pFERH) for the human FERH gene, in which the most proximal promoter element (B-box) appears to play a key role. This region is conserved in human and rat, and binds an unknown factor. The DNA-protein complex composed of B-box-binding factor and its cis-element becomes more abundant in the G418-treated cells, as compared with the untreated ones. PMID:8163204

  4. Coordinated Action of Two Double-Stranded RNA Binding Motifs and an RGG Motif Enables Nuclear Factor 90 To Flexibly Target Different RNA Substrates.

    PubMed

    Schmidt, Tobias; Knick, Paul; Lilie, Hauke; Friedrich, Susann; Golbik, Ralph Peter; Behrens, Sven-Erik

    2016-02-16

    The mechanisms of how RNA binding proteins (RBP) bind to and distinguish different RNA molecules are yet uncertain. Here, we performed a comprehensive analysis of the RNA binding properties of multidomain RBP nuclear factor 90 (NF90) by investigating specifically the functional activities of two double-stranded RNA binding motifs (dsRBM) and an RGG motif in the protein's unstructured C-terminus. By comparison of the RNA binding affinities of several NF90 variants and their modes of binding to a set of defined RNA molecules, the activities of the motifs turned out to be very different. While dsRBM1 contributes little to RNA binding, dsRBM2 is essential for effective binding of double-stranded RNA. The protein's immediate C-terminus, including the RGG motif, is indispensable for interactions of the protein with single-stranded RNA, and the RGG motif decisively contributes to NF90's overall RNA binding properties. Conformational studies, which compared wild-type NF90 with a variant that contains a pseudophosphorylated residue in the RGG motif, suggest that the NF90 C-terminus is involved in conformational changes in the protein after RNA binding, with the RGG motif acting as a central regulatory element. In summary, our data propose a concerted action of all RNA binding motifs within the frame of the full-length protein, which may be controlled by regulation of the activity of the RGG motif, e.g., by phosphorylation. This multidomain interplay enables the RBP NF90 to discriminate RNA features by dynamic and adaptable interactions. PMID:26795062

  5. Interaction of the DNA-binding domain of Drosophila heat shock factor with its cognate DNA site: a thermodynamic analysis using analytical ultracentrifugation.

    PubMed Central

    Kim, S. J.; Tsukiyama, T.; Lewis, M. S.; Wu, C.

    1994-01-01

    Heat shock transcription factor (HSF) mediates the activation of heat shock genes by binding to its cognate sites with high affinity and specificity. The high-affinity binding of HSF is dependent on the formation of an HSF homotrimer, which interacts specifically with the heat shock response element (HSE), comprised of 3 inverted repeats of the 5-bp sequence NGAAN. In order to investigate the thermodynamic basis of the interaction between HSF and HSE, we have overexpressed and purified a polypeptide (dHSF(33-163)) encompassing only the DNA-binding domain of HSF from Drosophila and analyzed its binding to DNA by equilibrium analytical ultracentrifugation using a multiwavelength scan technique. We demonstrate that dHSF(33-163) can bind as a monomer with 1:1 stoichiometry to a synthetic 13-bp DNA containing a single NGAAN sequence. The values of the thermodynamic parameters obtained from the temperature dependence of the equilibrium binding constants indicate that the changes of free energy for the binding of dHSF(33-163) to the wild-type site and a mutant DNA site are predominantly characterized by substantial negative changes of enthalpy. Binding to the wild-type DNA is characterized by a significant positive change of entropy, whereas binding to the mutant DNA is distinguished by a negative change of entropy of comparable magnitude. The binding to the mutant DNA was also highly sensitive to increasing salt concentrations, indicating a dominance of ionic interactions. The sequence-specific, 1:1 binding of dHSF(33-163) to the NGAAN sequence provides a basis for the analysis of higher order interactions between HSF trimers and the HSE. PMID:7920249

  6. Nuclear factor 90 uses an ADAR2-like binding mode to recognize specific bases in dsRNA

    PubMed Central

    Jayachandran, Uma; Grey, Heather; Cook, Atlanta G.

    2016-01-01

    Nuclear factors 90 and 45 (NF90 and NF45) form a protein complex involved in the post-transcriptional control of many genes in vertebrates. NF90 is a member of the dsRNA binding domain (dsRBD) family of proteins. RNA binding partners identified so far include elements in 3′ untranslated regions of specific mRNAs and several non-coding RNAs. In NF90, a tandem pair of dsRBDs separated by a natively unstructured segment confers dsRNA binding activity. We determined a crystal structure of the tandem dsRBDs of NF90 in complex with a synthetic dsRNA. This complex shows surprising similarity to the tandem dsRBDs from an adenosine-to-inosine editing enzyme, ADAR2 in complex with a substrate RNA. Residues involved in unusual base-specific recognition in the minor groove of dsRNA are conserved between NF90 and ADAR2. These data suggest that, like ADAR2, underlying sequences in dsRNA may influence how NF90 recognizes its target RNAs. PMID:26712564

  7. Nuclear factor 90 uses an ADAR2-like binding mode to recognize specific bases in dsRNA.

    PubMed

    Jayachandran, Uma; Grey, Heather; Cook, Atlanta G

    2016-02-29

    Nuclear factors 90 and 45 (NF90 and NF45) form a protein complex involved in the post-transcriptional control of many genes in vertebrates. NF90 is a member of the dsRNA binding domain (dsRBD) family of proteins. RNA binding partners identified so far include elements in 3' untranslated regions of specific mRNAs and several non-coding RNAs. In NF90, a tandem pair of dsRBDs separated by a natively unstructured segment confers dsRNA binding activity. We determined a crystal structure of the tandem dsRBDs of NF90 in complex with a synthetic dsRNA. This complex shows surprising similarity to the tandem dsRBDs from an adenosine-to-inosine editing enzyme, ADAR2 in complex with a substrate RNA. Residues involved in unusual base-specific recognition in the minor groove of dsRNA are conserved between NF90 and ADAR2. These data suggest that, like ADAR2, underlying sequences in dsRNA may influence how NF90 recognizes its target RNAs. PMID:26712564

  8. Binding of the Covalent Flavin Assembly Factor to the Flavoprotein Subunit of Complex II.

    PubMed

    Maklashina, Elena; Rajagukguk, Sany; Starbird, Chrystal A; McDonald, W Hayes; Koganitsky, Anna; Eisenbach, Michael; Iverson, Tina M; Cecchini, Gary

    2016-02-01

    Escherichia coli harbors two highly conserved homologs of the essential mitochondrial respiratory complex II (succinate:ubiquinone oxidoreductase). Aerobically the bacterium synthesizes succinate:quinone reductase as part of its respiratory chain, whereas under microaerophilic conditions, the quinol:fumarate reductase can be utilized. All complex II enzymes harbor a covalently bound FAD co-factor that is essential for their ability to oxidize succinate. In eukaryotes and many bacteria, assembly of the covalent flavin linkage is facilitated by a small protein assembly factor, termed SdhE in E. coli. How SdhE assists with formation of the covalent flavin bond and how it binds the flavoprotein subunit of complex II remain unknown. Using photo-cross-linking, we report the interaction site between the flavoprotein of complex II and the SdhE assembly factor. These data indicate that SdhE binds to the flavoprotein between two independently folded domains and that this binding mode likely influences the interdomain orientation. In so doing, SdhE likely orients amino acid residues near the dicarboxylate and FAD binding site, which facilitates formation of the covalent flavin linkage. These studies identify how the conserved SdhE assembly factor and its homologs participate in complex II maturation. PMID:26644464

  9. Identification of candidate transcription factor binding sites in the cattle genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A resource that provides candidate transcription factor binding sites does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future 'omics studies to develop transcriptional regulation hypotheses. In order to generate this resour...

  10. Cyclin-dependent Kinase 1-dependent Phosphorylation of cAMP Response Element-binding Protein Decreases Chromatin Occupancy*

    PubMed Central

    Trinh, Anthony T.; Kim, Sang Hwa; Chang, Hae-yoon; Mastrocola, Adam S.; Tibbetts, Randal S.

    2013-01-01

    The cyclic AMP response element-binding protein (CREB) initiates transcriptional responses to a wide variety of stimuli. CREB activation involves its phosphorylation on Ser-133, which promotes interaction between the CREB kinase-inducible domain (KID) and the KID-interacting domain of the transcriptional coactivator, CREB-binding protein (CBP). The KID also contains a highly conserved phosphorylation cluster, termed the ATM/CK cluster, which is processively phosphorylated in response to DNA damage by the coordinated actions of ataxia-telangiectasia-mutated (ATM) and casein kinases (CKs) 1 and 2. The ATM/CK cluster phosphorylation attenuates CBP binding and CREB transcriptional activity. Paradoxically, it was recently reported that DNA damage activates CREB through homeodomain-interacting protein kinase 2-dependent phosphorylation of Ser-271 near the CREB bZIP DNA binding domain. In this study we sought to further clarify DNA damage-dependent CREB phosphorylation as well as to explore the possibility that the ATM/CK cluster and Ser-271 synergistically or antagonistically modulate CREB activity. We show that, rather than being induced by DNA damage, Ser-270 and Ser-271 of CREB cophosphorylated in a CDK1-dependent manner during G2/M phase. Functionally, we show that phosphorylation of CREB on Ser-270/Ser-271 during mitosis correlated with reduced CREB chromatin occupancy. Furthermore, CDK1-dependent phosphorylation of CREB in vitro inhibited its DNA binding activity. The combined results suggest that CDK1-dependent phosphorylation of CREB on Ser-270/Ser-271 facilitates its dissociation from chromatin during mitosis by reducing its intrinsic DNA binding potential. PMID:23814058

  11. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation.

    PubMed

    Hajibeigi, Asghar; Dioum, Elhadji M; Guo, Jianfei; Öz, Orhan K

    2015-09-25

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23 nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the -36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance. PMID:26260319

  12. A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus.

    PubMed

    Liu, Lijun; Ramsay, Trevor; Zinkgraf, Matthew; Sundell, David; Street, Nathaniel Robert; Filkov, Vladimir; Groover, Andrew

    2015-06-01

    Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors expressed during secondary growth and wood formation. Software code (programs and scripts) for processing the Populus ChIP-seq data are provided within a publically available iPlant image, including tools for ChIP-seq data quality control and evaluation adapted from the human Encyclopedia of DNA Elements (ENCODE) project. Basic information for each transcription factor (including members of Class I KNOX, Class III HD ZIP, BEL1-like families) binding are summarized, including the number and location of binding regions, distribution of binding regions relative to gene features, associated putative target genes, and enriched functional categories of putative target genes. These ChIP-seq data have been integrated within the Populus Genome Integrative Explorer (PopGenIE) where they can be analyzed using a variety of web-based tools. We present an example analysis that shows preferential binding of transcription factor ARBORKNOX1 to the nearest neighbor genes in a pre-calculated co-expression network module, and enrichment for meristem-related genes within this module including multiple orthologs of Arabidopsis KNOTTED-like Arabidopsis 2/6. PMID:25903933

  13. Pyrazole-based cathepsin S inhibitors with arylalkynes as P1 binding elements

    SciTech Connect

    Ameriks, Michael K.; Axe, Frank U.; Bembenek, Scott D.; Edwards, James P.; Gu, Yin; Karlsson, Lars; Randal, Mike; Sun, Siquan; Thurmond, Robin L.; Zhu, Jian

    2010-01-12

    A crystal structure of 1 bound to a Cys25Ser mutant of cathepsin S helped to elucidate the binding mode of a previously disclosed series of pyrazole-based CatS inhibitors and facilitated the design of a new class of arylalkyne analogs. Optimization of the alkyne and tetrahydropyridine portions of the pharmacophore provided potent CatS inhibitors (IC{sub 50} = 40-300 nM), and an X-ray structure of 32 revealed that the arylalkyne moiety binds in the S1 pocket of the enzyme.

  14. Cyclic AMP response element-binding protein in post-mortem brain of teenage suicide victims: specific decrease in the prefrontal cortex but not the hippocampus.

    PubMed

    Pandey, Ghanshyam N; Dwivedi, Yogesh; Ren, Xinguo; Rizavi, Hooriyah S; Roberts, Rosalinda C; Conley, Robert R

    2007-10-01

    Abnormalities in both adenylyl cyclase (AC) and phosphoinositide (PI) signalling systems have been observed in the post-mortem brain of suicide victims. Cyclic AMP response element-binding protein (CREB) is a transcription factor that is activated by phosphorylating enzymes such as protein kinase A (PKA) and protein kinase C (PKC), which suggests that both AC and PI signalling systems converge at the level of CREB. CREB is involved in the transcription of many neuronally expressed genes that have been implicated in the pathophysiology of depression and suicide. Since we observed abnormalities of both PKA and PKC in the post-mortem brain of teenage suicide victims, we examined if these abnormalities are also associated with abnormalities of CREB, which is activated by these phosphorylating enzymes. We determined CRE-DNA binding using the gel shift assay, as well as protein expression of CREB using the Western blot technique, and the mRNA expression of CREB using a quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) technique in the prefrontal cortex (PFC), and hippocampus obtained from 17 teenage suicide victims and 17 matched normal control subjects. We observed that the CRE-DNA binding and the protein expression of CREB were significantly decreased in the PFC of teenage suicide victims compared with controls. There was also a significant decrease in mRNA expression of CREB in the PFC of teenage suicide victims compared with control subjects. However, there were no significant differences in CRE-DNA binding or the protein and mRNA expression of CREB in the hippocampus of teenage suicide victims compared with control subjects. These results suggest that the abnormalities of PKA, and of PKC, observed in teenage suicide victims are also associated with abnormalities of the transcription factor CREB, and that this may also cause alterations of important neuronally expressed genes, and provide further support of the signal transduction of abnormalities

  15. Importance of Inhibition of Binding of Complement Factor H for Serum Bactericidal Antibody Responses to Meningococcal Factor H-binding Protein Vaccines

    PubMed Central

    Konar, Monica; Granoff, Dan M.; Beernink, Peter T.

    2013-01-01

    Background. Factor H (fH) binding protein (fHbp) is part of vaccines developed for prevention of meningococcal serogroup B disease. More than 610 fHbp amino acid sequence variants have been identified, which can be classified into 2 subfamilies. The extent of cross-protection within a subfamily has been difficult to assess because of strain variation in fHbp expression. Methods. Using isogenic mutant strains, we compared cross-protective serum antibody responses of mice immunized with 7 divergent fHbp variants in subfamily B, including identification numbers (ID) 1 and 55, which were chosen for vaccine development. Results and Conclusions. In the presence of the human complement downregulator fH, the ability of the anti-fHbp antibodies to deposit sufficient complement C3b on the bacterial surface to elicit bactericidal activity required inhibition of binding of fH by the anti-fHbp antibodies. With less bound fH, the bacteria became more susceptible to complement-mediated bactericidal activity. Among the different fHbp sequence variants, those more central in a phylogenic network than ID 1 or 55 elicited anti-fHbp antibodies with broader inhibition of fH binding and broader bactericidal activity. Thus, the more central variants show promise of extending protection to strains with divergent fHbp sequences that are covered poorly by fHbp variants in clinical development. PMID:23715659

  16. Evidence that the primary binding site of von Willebrand factor that mediates platelet adhesion on subendothelium is not collagen.

    PubMed Central

    de Groot, P G; Ottenhof-Rovers, M; van Mourik, J A; Sixma, J J

    1988-01-01

    We have studied the binding of von Willebrand factor to extracellular matrices of endothelial cells and to the vessel wall of human umbilical arteries in relation to its function in supporting platelet adhesion. CLB-RAg 201, an MAb against von Willebrand factor, completely inhibits the binding of von Willebrand factor to collagen type I and type III. CLB-RAg 201 does not inhibit the binding of 125I-von Willebrand factor to extracellular matrices of endothelial cells, to smooth muscle cells, or to the subendothelium. CLB-RAg 201 partly inhibits platelet adhesion to these surfaces, but this directly affects the interaction between von Willebrand factor and platelets and is not due to inhibition of binding of von Willebrand factor to these surfaces. Another MAb, CLB-RAg 38, does not inhibit the binding of von Willebrand factor to collagen. CLB-RAg 38 completely inhibits the binding of von Willebrand factor to extracellular matrices. CLB-RAg 38 inhibits platelet adhesion to cellular matrices completely insofar as it is dependent on plasma von Willebrand factor. CLB-RAg 38 does not inhibit the total binding of von Willebrand factor to subendothelium, as there are too many different binding sites, but it completely inhibits the functional binding sites for von Willebrand factor that support platelet adhesion. The epitopes for CLB-RAg 38 and 201 on the von Willebrand factor molecule are located on different fragments of the molecule. These results indicate that von Willebrand factor binds to subendothelium and matrices of cultured cells by a mechanism that is different from that by which it binds to collagen. Images PMID:2839553

  17. Arsenic Directly Binds to and Activates the Yeast AP-1-Like Transcription Factor Yap8

    PubMed Central

    Kumar, Nallani Vijay; Yang, Jianbo; Pillai, Jitesh K.; Rawat, Swati; Solano, Carlos; Kumar, Abhay; Grøtli, Morten; Stemmler, Timothy L.; Rosen, Barry P.

    2015-01-01

    The AP-1-like transcription factor Yap8 is critical for arsenic tolerance in the yeast Saccharomyces cerevisiae. However, the mechanism by which Yap8 senses the presence of arsenic and activates transcription of detoxification genes is unknown. Here we demonstrate that Yap8 directly binds to trivalent arsenite [As(III)] in vitro and in vivo and that approximately one As(III) molecule is bound per molecule of Yap8. As(III) is coordinated by three sulfur atoms in purified Yap8, and our genetic and biochemical data identify the cysteine residues that form the binding site as Cys132, Cys137, and Cys274. As(III) binding by Yap8 does not require an additional yeast protein, and Yap8 is regulated neither at the level of localization nor at the level of DNA binding. Instead, our data are consistent with a model in which a DNA-bound form of Yap8 acts directly as an As(III) sensor. Binding of As(III) to Yap8 triggers a conformational change that in turn brings about a transcriptional response. Thus, As(III) binding to Yap8 acts as a molecular switch that converts inactive Yap8 into an active transcriptional regulator. This is the first report to demonstrate how a eukaryotic protein couples arsenic sensing to transcriptional activation. PMID:26711267

  18. Binding of the growth factor glycyl-L-histidyl-L-lysine by heparin.

    PubMed

    Rabenstein, D L; Robert, J M; Hari, S

    1995-12-01

    Evidence is presented that the growth factor glycyl-histidyl-lysine (GHK) binds to heparin, and the interaction has been characterized by [1H]NMR spectroscopy. 1H chemical shifts indicate that GHK interacts with both the carboxylic acid and the carboxylate forms of heparin. The chemical shift data are consistent with a weak delocalized binding of the triprotonated (ImH+, GlyNH3+, LysNH3+) form of GHK by the carboxylic acid form of heparin. As the pD is increased and the carboxylic acid groups are titrated, chemical shift data indicate that ammonium groups of GHK are hydrogen bonded to heparin carboxylate groups, while the histidyl imidazolium ring occupies the imidazolium-binding site of heparin. Evidence for site-specific binding includes displacement of chemical shift titration curves for heparin to lower pD, increased shielding of specific heparin protons by the imidazolium ring current and displacement of chemical shift titration curves for GHK to higher pD. Specific binding constants were determined for binding of the (ImH+, GlyNH3+), LysNH3+) forms of GHK by the carboxylate form of heparin from chemical shift vs. pD titration data. PMID:7498545

  19. Novel Bioluminescent Binding Assays for Ligand–Receptor Interaction Studies of the Fibroblast Growth Factor Family

    PubMed Central

    Song, Ge; Shao, Xiao-Xia; Wu, Qing-Ping; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun

    2016-01-01

    We recently developed novel bioluminescent binding assays for several protein/peptide hormones to study their interactions with receptors using the so far brightest NanoLuc reporter. To validate the novel bioluminescent binding assay using a variety of protein/peptide hormones, in the present work we applied it to the fibroblast growth factor (FGF) family using the prototype member FGF2 as an example. A fully active recombinant FGF2 retaining a unique exposed cysteine (Cys) residue was chemically conjugated with an engineered NanoLuc carrying a unique exposed Cys residue at the C-terminus via formation of an intermolecular disulfide linkage. The NanoLuc-conjugated FGF2 (FGF2-Luc) retained high binding affinity to the overexpressed FGFR1 and the endogenous FGF receptor with the calculated dissociation constants of 161 ± 21 pM (n = 3) and 25 ± 4 pM (n = 3), respectively. In competition binding assays using FGF2-Luc as a tracer, receptor-binding potencies of wild-type or mutant FGF2s were accurately quantified. Thus, FGF2-Luc represents a novel non-radioactive tracer for the quantitative measurement of ligand–receptor interactions in the FGF family. These data suggest that the novel bioluminescent binding assay can be applied to a variety of protein/peptide hormones for ligand–receptor interaction studies. PMID:27414797

  20. Novel Bioluminescent Binding Assays for Ligand-Receptor Interaction Studies of the Fibroblast Growth Factor Family.

    PubMed

    Song, Ge; Shao, Xiao-Xia; Wu, Qing-Ping; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun

    2016-01-01

    We recently developed novel bioluminescent binding assays for several protein/peptide hormones to study their interactions with receptors using the so far brightest NanoLuc reporter. To validate the novel bioluminescent binding assay using a variety of protein/peptide hormones, in the present work we applied it to the fibroblast growth factor (FGF) family using the prototype member FGF2 as an example. A fully active recombinant FGF2 retaining a unique exposed cysteine (Cys) residue was chemically conjugated with an engineered NanoLuc carrying a unique exposed Cys residue at the C-terminus via formation of an intermolecular disulfide linkage. The NanoLuc-conjugated FGF2 (FGF2-Luc) retained high binding affinity to the overexpressed FGFR1 and the endogenous FGF receptor with the calculated dissociation constants of 161 ± 21 pM (n = 3) and 25 ± 4 pM (n = 3), respectively. In competition binding assays using FGF2-Luc as a tracer, receptor-binding potencies of wild-type or mutant FGF2s were accurately quantified. Thus, FGF2-Luc represents a novel non-radioactive tracer for the quantitative measurement of ligand-receptor interactions in the FGF family. These data suggest that the novel bioluminescent binding assay can be applied to a variety of protein/peptide hormones for ligand-receptor interaction studies. PMID:27414797

  1. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  2. Binding and translocation of termination factor rho studied at the single-molecule level.

    PubMed

    Koslover, Daniel J; Fazal, Furqan M; Mooney, Rachel A; Landick, Robert; Block, Steven M

    2012-11-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20-50% of all mRNA synthesis in Escherichia coli. We used single-molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho utilization site of the λtR1 terminator. Our results are consistent with Rho complexes adopting two states: one that binds 57 ± 2nt of RNA across all six of the Rho primary binding sites, and another that binds 85 ± 2nt at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5'→3' toward RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the Rho utilization site and RNAP. These findings lead to a general model for Rho binding and translocation and establish a novel experimental approach that should facilitate additional single-molecule studies of RNA-binding proteins. PMID:22885804

  3. Polysomes of Trypanosoma brucei: Association with Initiation Factors and RNA-Binding Proteins

    PubMed Central

    Klein, Cornelia; Terrao, Monica; Inchaustegui Gil, Diana; Clayton, Christine

    2015-01-01

    We report here the results of experiments designed to identify RNA-binding proteins that might be associated with Trypanosoma brucei polysomes. After some preliminary mass spectrometry of polysomal fractions, we investigated the distributions of selected tagged proteins using sucrose gradients and immunofluorescence. As expected, the polysomal fractions contained nearly all annotated ribosomal proteins, the translation-associated protein folding complex, and many translation factors, but also many other abundant proteins. Results suggested that cap-binding proteins EIF4E3 and EIF4E4 were associated with both free and membrane-bound polysomes. The EIF4E binding partners EIF4G4 and EIF4G3 were present but the other EIF4E and EIF4G paralogues were not detected. The dominant EIF4E in the polysomal fraction is EIF4E4 and very few polysomal mRNAs are associated with EIF4G. Thirteen potential mRNA-binding proteins were detected in the polysomes, including the known polysome-associated protein RBP42. The locations of two of the other proteins were tested after epitope tagging: RBP29 was in the nucleus and ZC3H29 was in the cytoplasm. Quantitative analyses showed that specific association of an RNA-binding protein with the polysome fraction in sucrose gradients will not be detected if the protein is in more than 25-fold molar excess over its target binding sites. PMID:26287607

  4. Propagation of pSC101 plasmids defective in binding of integration host factor.

    PubMed Central

    Biek, D P; Cohen, S N

    1992-01-01

    Integration host factor (IHF), a multifunctional protein of E. coli, normally is required for the replication of plasmid pSC101. T. T. Stenzel, P. Patel, and D. Bastia (Cell 49:709-717, 1987) have reported that IHF binds to a DNA locus near the pSC101 replication origin and enhances a static bend present in this region; mutation of the IHF binding site affects the plasmid's ability to replicate. We report here studies indicating that the requirement for IHF binding near the pSC101 replication origin is circumvented partially or completely by (i) mutation of the plasmid-encoded repA (replicase) gene or the chromosomally encoded topA gene, (ii) the presence on the plasmid of the pSC101 partition (par) locus, or (iii) replacement of the par locus by a strong transcriptional promoter. With the exception of the repA mutation, the factors that substitute for a functional origin region IHF binding site are known to alter plasmid topology by increasing negative DNA supercoiling, as does IHF itself. These results are consistent with the proposal that IHF binding near the pSC101 replication origin promotes plasmid replication by inducing a conformational change leading to formation of a repA-dependent DNA-protein complex. A variety of IHF-independent mechanisms can facilitate formation of the putative replication-initiation complex. PMID:1310092

  5. Binding of neurotrophin-3 to its neuronal receptors and interactions with nerve growth factor and brain-derived neurotrophic factor.

    PubMed Central

    Rodríguez-Tébar, A; Dechant, G; Götz, R; Barde, Y A

    1992-01-01

    Neurotrophin-3 (NT-3) has low-affinity (Kd = 8 x 10(-10) M), as well as high-affinity receptors (Kd = 1.8 x 10(-11) M) on embryonic chick sensory neurons, the latter in surprisingly high numbers. Like the structurally related proteins nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF), NT-3 also binds to the low-affinity NGF receptor, a molecule that we suggest to designate low-affinity neurotrophin receptor (LANR). NT-3 dissociates from the LANR much more rapidly than BDNF, and more slowly than NGF. The binding of labelled NT-3 to the LANR can be reduced by half using a concentration of BDNF corresponding to the Kd of BDNF to the LANR. In contrast, the binding of NT-3 to its high-affinity neuronal receptors can only be prevented by BDNF or NGF when used at concentrations several thousand-fold higher than those corresponding to their Kd to their high-affinity neuronal receptors. Thus, specific high-affinity NT-3 receptors exist on sensory neurons that can readily discriminate between three structurally related ligands. These findings, including the remarkable property of the LANR to bind three related ligands with similar affinity, but different rate constants, are discussed. PMID:1547788

  6. A factor stimulating transcription of the testis-specific Pgk-2 gene recognizes a sequence similar to the binding site for a transcription inhibitor of the somatic-type Pgk-1 gene.

    PubMed

    Goto, M; Masamune, Y; Nakanishi, Y

    1993-01-25

    The glycolytic enzyme phosphoglycerate kinase (PGK) consists of two isozymes, somatic-type PGK-1 and testis-specific PGK-2. The isozyme switch from PGK-1 to PGK-2 occurs during spermatogenesis at the mRNA level. The distal upstream region of the gene encoding mouse PGK-2 (Pgk-2) possesses a silencer-like negative cis element. In the present study, a positive cis element located in the proximal upstream region and factor(s) bound to it were analyzed in vitro. Cell-free transcription using nuclear extracts of rat organs demonstrated that the region between nucleotide positions -82 and -64, relative to the most distal transcription initiation site at +1, stimulates transcription in testis extracts. The cis element did not act on the promoter of the thymidine kinase gene, suggesting that it stimulates Pgk-2 transcription in a promoter-specific manner. The cis element bound a nuclear factor(s), which we designated TAP-1. Introducing various base substitutions within the cis element revealed that TAP-1-binding to the element requires the sequence 5'-GGAA-3', which is the binding motif for Ets oncoproteins. We previously reported that TIN-1, a transcription inhibitor of Pgk-1, binds to a sequence similar to the Ets-binding site. The addition of an oligo DNA containing the TIN-1-binding sequence of Pgk-1 prevented TAP-1 from binding to the Pgk-2 cis element, and vice versa. These results suggest that both TIN-1 and TAP-1, which are presumably involved in transcription regulation of the two Pgk genes, recognize DNA sequences related to the Ets-binding motif. PMID:8441629

  7. Effects of class I heparin binding growth factor and fibronectin on platelet adhesion and aggregation

    SciTech Connect

    Greisler, H.P.; Klosak, J.J.; Steinam, S.J.; Lam, T.M.; Burgess, W.H.; Kim, D.U. )

    1990-05-01

    Fibronectin and heparin binding growth factor-type 1 have been affixed to vascular graft surfaces to enhance the attachment and the proliferation of transplanted endothelial cells, respectively. The current study examines the effect of fibronectin and heparin binding growth factor-type 1 on platelet adhesion and activation in vivo and on platelet aggregation in vitro. Expanded polytetrafluoroethylene prostheses (5 cm x 4 mm internal diameter) were treated either with fibronectin (n = 9), fibronectin/heparin/heparin binding growth factor-type 1/heparin (n = 12), or neither (n = 13) and were interposed into canine aortoiliac systems bilaterally. Autogenous radiolabeled (Indium 111 oxine, 650 microCi) platelets were injected intravenously before reestablishment of circulation. Perfusion was maintained for 30 minutes, and prostheses were removed with segments of native aorta and distal iliac arteries bilaterally. Specimens were examined for thrombus-free surface area, by gamma well counting for adherent radiolabeled platelets, and by light microscopy and transmission and scanning electron microscopic techniques. Results showed that both the fibronectin and fibronectin/heparin/heparin binding growth factor-type 1/heparin pretreated prostheses contained significantly greater numbers of platelets and adherent radioactivity than did control graft segments when normalized to their ipsilateral iliac arteries. Fibronectin/heparin/heparin binding growth factor-type 1/heparin pretreated prostheses contained 27 +/- 16 times more radioactivity per square millimeter than ipsilateral iliac arteries, fibronectin pretreated prostheses had 13 +/- 8 times more radioactivity per square millimeter than ipsilateral iliac arteries, and untreated expanded polytetrafluoroethylene had 4 +/- 3 times more radioactivity per square millimeter than ipsilateral iliac arteries.

  8. An Essential Role of cAMP Response Element Binding Protein in Ginsenoside Rg1-Mediated Inhibition of Na+/Glucose Cotransporter 1 Gene Expression.

    PubMed

    Wang, Chun-Wen; Su, Shih-Chieh; Huang, Shu-Fen; Huang, Yu-Chuan; Chan, Fang-Na; Kuo, Yu-Han; Hung, Mei-Whey; Lin, Hang-Chin; Chang, Wen-Liang; Chang, Tsu-Chung

    2015-12-01

    The Na(+)/glucose cotransporter 1 (SGLT1) is responsible for glucose uptake in intestinal epithelial cells. It has been shown that the intestinal SGLT1 level is significantly increased in diabetic individuals and positively correlated with the pathogenesis of diabetes. The development of targeted therapeutics that can reduce the intestinal SGLT1 expression level is, therefore, important. In this study, we showed that ginsenoside Rg1 effectively decreased intestinal glucose uptake through inhibition of SGLT1 gene expression in vivo and in vitro. Transient transfection analysis of the SGLT1 promoter revealed an essential cAMP response element (CRE) that confers the Rg1-mediated inhibition of SGLT1 gene expression. Chromatin immunoprecipitation assay and targeted CRE-binding protein (CREB) silencing demonstrated that Rg1 reduced the promoter binding of CREB and CREB binding protein associated with an inactivated chromatin status. In addition, further studies showed that the epidermal growth factor receptor (EGFR) signaling pathway also plays an essential role in the inhibitory effect of Rg1; taken together, our study demonstrates the involvement of the EGFR-CREB signaling pathway in the Rg1-mediated downregulation of SGLT1 expression, which offers a potential strategy in the development of antihyperglycemic and antidiabetic treatments. PMID:26429938

  9. Characterization of the Escherichia coli F factor traY gene product and its binding sites.

    PubMed Central

    Nelson, W C; Morton, B S; Lahue, E E; Matson, S W

    1993-01-01

    The traY gene product (TraYp) from the Escherichia coli F factor has previously been purified and shown to bind a DNA fragment containing the F plasmid oriT region (E. E. Lahue and S. W. Matson, J. Bacteriol. 172:1385-1391, 1990). To determine the precise nucleotide sequence bound by TraYp, DNase I footprinting was performed. The TraYp-binding site is near, but not coincident with, the site that is nicked to initiate conjugative DNA transfer. In addition, a second TraYp binding site, which is coincident with the mRNA start site at the traYI promoter, is described. The Kd for each binding site was determined by a gel mobility shift assay. TraYp exhibits a fivefold higher affinity for the oriT binding site compared with the traYI promoter binding site. Hydrodynamic studies were performed to show that TraYp is a monomer in solution under the conditions used in DNA binding assays. Early genetic experiments implicated the traY gene product in the site- and strand-specific endonuclease activity that nicks at oriT (R. Everett and N. Willetts, J. Mol. Biol. 136:129-150, 1980; S. McIntire and N. Willetts, Mol. Gen. Genet. 178:165-172, 1980). As this activity has recently been ascribed to helicase I, it was of interest to see whether TraYp had any effect on this reaction. Addition of TraYp to nicking reactions catalyzed by helicase I showed no effect on the rate or efficiency of oriT nicking. Roles for TraYp in conjugative DNA transfer and a possible mode of binding to DNA are discussed. Images PMID:8468282

  10. DNA-binding specificity of NGFI-A and related zinc finger transcription factors.

    PubMed Central

    Swirnoff, A H; Milbrandt, J

    1995-01-01

    NGFI-A is the prototypic member of a family of immediate-early gene-encoded transcription factors which includes NGFI-C, Egr3, and Krox20. These proteins possess highly homologous DNA-binding domains, composed of three Cys2-His2 zinc fingers, and all bind to and activate transcription from the sequence GCGGGGGCG. We used a PCR-mediated random site selection protocol to determine whether other sites could be bound by these proteins and the extent to which their binding site preferences are similar or different. The high-affinity consensus sites generated from the selection data are similar, and the combined consensus sequence is T-G-C-G-T/g-G/A-G-G-C/a/t-G-G/T (lowercase letters indicate bases selected less frequently). Using gel shift assays, we found that sequences that diverge from the consensus were bound by NGFI-A, confirming that there is greater variability in binding sites than has generally been acknowledged. We also provide evidence that protein-DNA interactions not noted, or whose importance was not apparent from the X-ray cocrystal structure of the NGFI-A zinc fingers complexed with DNA, contribute significantly to the binding energy of these proteins and confirm that an optimal site is at least 10 instead of 9 nucleotides in length. In contrast to the similarities in binding specificity among these proteins we found that while NGFI-A, Egr3, and Krox20 have comparable DNA binding affinities and kinetics of dissociation, the affinity of NGFI-C is more than threefold lower. This could result in differential regulation of target genes in cells where NGFI-C and the other proteins are coexpressed. Furthermore, we show that this affinity difference is a property not of the zinc fingers themselves but rather of the protein context of the DNA-binding domain. PMID:7891721

  11. 2',3'-Cyclic nucleotide 3'-phosphodiesterase binds to actin-based cytoskeletal elements in an isoprenylation-independent manner.

    PubMed

    De Angelis, D A; Braun, P E

    1996-09-01

    2',3'-Cyclic nucleotide 3'-phosphodiesterase (CNP) is an isoprenylated protein enriched in myelin and oligodendrocytes but also present in several other tissues at low levels. CNP binds avidly to membranes and in addition possesses several characteristics of cytoskeletal proteins. The role of isoprenylation in the association of CNP with the cytoskeleton was analyzed by ectopic expression in L cells of epitope-tagged CNP1 and a non-isoprenylated mutant CNP1. Using nonionic detergent extraction, drug-mediated cytoskeletal disruption, and coimmunoprecipitation with an anti-actin antibody, we show that CNP1 is associated with actin-based cytoskeletal elements independently of its isoprenylation status. A control protein, p21c-H-ras, which is also modified by isoprenylation at its carboxyl-terminus, does not bind to cytoskeletal structures as judged by the same criteria. We present a model that accounts for the association of CNP1 with membranes and the cytoskeleton. PMID:8752099

  12. Estimating binding free energy of a putative growth factors EGF-VEGF complex - a computational bioanalytical study.

    PubMed

    Lin, Meng-Han; Chang, C Allen; Fischer, Wolfgang B

    2016-08-01

    Epidermal growth factor (EGF) and homodimeric vascular endothelial growth factor (VEGF) bind to cell surface receptors. They are responsible for cell growth and angiogenesis, respectively. Docking of the individual proteins as monomeric units using ZDOCK 2.3.2 reveals a partial blocking of the receptor binding site of VEGF by EGF. The receptor binding site of EGF is not affected by VEGF. The calculated binding energy is found to be intermediate between the binding energies calculated for Alzheimer's Aß42 and the barnase/barstar complex. PMID:26338536

  13. Impact of detector-element active-area shape and fill factor on super-resolution

    NASA Astrophysics Data System (ADS)

    Hardie, Russell; Droege, Douglas; Dapore, Alexander; Greiner, Mark

    2015-05-01

    In many undersampled imaging systems, spatial integration from the individual detector elements is the dominant component of the system point spread function (PSF). Conventional focal plane arrays (FPAs) utilize square detector elements with a nearly 100% fill factor, where fill fac