Science.gov

Sample records for element functionally conserved

  1. "Reverse Genomics" Predicts Function of Human Conserved Noncoding Elements.

    PubMed

    Marcovitz, Amir; Jia, Robin; Bejerano, Gill

    2016-05-01

    Evolutionary changes in cis-regulatory elements are thought to play a key role in morphological and physiological diversity across animals. Many conserved noncoding elements (CNEs) function as cis-regulatory elements, controlling gene expression levels in different biological contexts. However, determining specific associations between CNEs and related phenotypes is a challenging task. Here, we present a computational "reverse genomics" approach that predicts the phenotypic functions of human CNEs. We identify thousands of human CNEs that were lost in at least two independent mammalian lineages (IL-CNEs), and match their evolutionary profiles against a diverse set of phenotypes recently annotated across multiple mammalian species. We identify 2,759 compelling associations between human CNEs and a diverse set of mammalian phenotypes. We discuss multiple CNEs, including a predicted ear element near BMP7, a pelvic CNE in FBN1, a brain morphology element in UBE4B, and an aquatic adaptation forelimb CNE near EGR2, and provide a full list of our predictions. As more genomes are sequenced and more traits are annotated across species, we expect our method to facilitate the interpretation of noncoding mutations in human disease and expedite the discovery of individual CNEs that play key roles in human evolution and development. PMID:26744417

  2. Genetic evidence for conserved non-coding element function across species–the ears have it

    PubMed Central

    Turner, Eric E.; Cox, Timothy C.

    2014-01-01

    Comparison of genomic sequences from diverse vertebrate species has revealed numerous highly conserved regions that do not appear to encode proteins or functional RNAs. Often these “conserved non-coding elements,” or CNEs, can direct gene expression to specific tissues in transgenic models, demonstrating they have regulatory function. CNEs are frequently found near “developmental” genes, particularly transcription factors, implying that these elements have essential regulatory roles in development. However, actual examples demonstrating CNE regulatory functions across species have been few, and recent loss-of-function studies of several CNEs in mice have shown relatively minor effects. In this Perspectives article, we discuss new findings in “fancy” rats and Highland cattle demonstrating that function of a CNE near the Hmx1 gene is crucial for normal external ear development and when disrupted can mimic loss-of function Hmx1 coding mutations in mice and humans. These findings provide important support for conserved developmental roles of CNEs in divergent species, and reinforce the concept that CNEs should be examined systematically in the ongoing search for genetic causes of human developmental disorders in the era of genome-scale sequencing. PMID:24478720

  3. Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.

    PubMed

    Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon

    2010-01-15

    Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short. PMID:19895802

  4. Conservation of CD44 exon v3 functional elements in mammals

    PubMed Central

    Vela, Elena; Hilari, Josep M; Delclaux, María; Fernández-Bellon, Hugo; Isamat, Marcos

    2008-01-01

    Background The human CD44 gene contains 10 variable exons (v1 to v10) that can be alternatively spliced to generate hundreds of different CD44 protein isoforms. Human CD44 variable exon v3 inclusion in the final mRNA depends on a multisite bipartite splicing enhancer located within the exon itself, which we have recently described, and provides the protein domain responsible for growth factor binding to CD44. Findings We have analyzed the sequence of CD44v3 in 95 mammalian species to report high conservation levels for both its splicing regulatory elements (the 3' splice site and the exonic splicing enhancer), and the functional glycosaminglycan binding site coded by v3. We also report the functional expression of CD44v3 isoforms in peripheral blood cells of different mammalian taxa with both consensus and variant v3 sequences. Conclusion CD44v3 mammalian sequences maintain all functional splicing regulatory elements as well as the GAG binding site with the same relative positions and sequence identity previously described during alternative splicing of human CD44. The sequence within the GAG attachment site, which in turn contains the Y motif of the exonic splicing enhancer, is more conserved relative to the rest of exon. Amplification of CD44v3 sequence from mammalian species but not from birds, fish or reptiles, may lead to classify CD44v3 as an exclusive mammalian gene trait. PMID:18710510

  5. Evolutionary conservation of the functional modularity of primate and murine LINE-1 elements.

    PubMed

    Wagstaff, Bradley J; Barnerssoi, Miriam; Roy-Engel, Astrid M

    2011-01-01

    LINE-1 (L1) retroelements emerged in mammalian genomes over 80 million years ago with a few dominant subfamilies amplifying over discrete time periods that led to distinct human and mouse L1 lineages. We evaluated the functional conservation of L1 sequences by comparing retrotransposition rates of chimeric human-rodent L1 constructs to their parental L1 counterparts. Although amino acid conservation varies from ∼35% to 63% for the L1 ORF1p and ORF2p, most human and mouse L1 sequences can be functionally exchanged. Replacing either ORF1 or ORF2 to create chimeric human-mouse L1 elements did not adversely affect retrotransposition. The mouse ORF2p retains retrotransposition-competency to support both Alu and L1 mobilization when any of the domain sequences we evaluated were substituted with human counterparts. However, the substitution of portions of the mouse cys-domain into the human ORF2p reduces both L1 retrotransposition and Alu trans-mobilization by 200-1000 fold. The observed loss of ORF2p function is independent of the endonuclease or reverse transcriptase activities of ORF2p and RNA interaction required for reverse transcription. In addition, the loss of function is physically separate from the cysteine-rich motif sequence previously shown to be required for RNP formation. Our data suggest an additional role of the less characterized carboxy-terminus of the L1 ORF2 protein by demonstrating that this domain, in addition to mediating RNP interaction(s), provides an independent and required function for the retroelement amplification process. Our experiments show a functional modularity of most of the LINE sequences. However, divergent evolution of interactions within L1 has led to non-reciprocal incompatibilities between human and mouse ORF2 cys-domain sequences. PMID:21572950

  6. A functionally conserved Polycomb response element from mouse HoxD complex responds to heterochromatin factors

    NASA Astrophysics Data System (ADS)

    Vasanthi, Dasari; Nagabhushan, A.; Matharu, Navneet Kaur; Mishra, Rakesh K.

    2013-10-01

    Anterior-posterior body axis in all bilaterians is determined by the Hox gene clusters that are activated in a spatio-temporal order. This expression pattern of Hox genes is established and maintained by regulatory mechanisms that involve higher order chromatin structure and Polycomb group (PcG) and trithorax group (trxG) proteins. We identified earlier a Polycomb response element (PRE) in the mouse HoxD complex that is functionally conserved in flies. We analyzed the molecular and genetic interactions of mouse PRE using Drosophila melanogaster and vertebrate cell culture as the model systems. We demonstrate that the repressive activity of this PRE depends on PcG/trxG genes as well as the heterochromatin components. Our findings indicate that a wide range of factors interact with the HoxD PRE that can contribute to establishing the expression pattern of homeotic genes in the complex early during development and maintain that pattern at subsequent stages.

  7. Distinct Functional Constraints Partition Sequence Conservation in a cis-Regulatory Element

    PubMed Central

    Ruvinsky, Ilya

    2011-01-01

    Different functional constraints contribute to different evolutionary rates across genomes. To understand why some sequences evolve faster than others in a single cis-regulatory locus, we investigated function and evolutionary dynamics of the promoter of the Caenorhabditis elegans unc-47 gene. We found that this promoter consists of two distinct domains. The proximal promoter is conserved and is largely sufficient to direct appropriate spatial expression. The distal promoter displays little if any conservation between several closely related nematodes. Despite this divergence, sequences from all species confer robustness of expression, arguing that this function does not require substantial sequence conservation. We showed that even unrelated sequences have the ability to promote robust expression. A prominent feature shared by all of these robustness-promoting sequences is an AT-enriched nucleotide composition consistent with nucleosome depletion. Because general sequence composition can be maintained despite sequence turnover, our results explain how different functional constraints can lead to vastly disparate rates of sequence divergence within a promoter. PMID:21655084

  8. Conservation defines functional motifs in the squint/nodal-related 1 RNA dorsal localization element

    PubMed Central

    Gilligan, Patrick C.; Kumari, Pooja; Lim, Shimin; Cheong, Albert; Chang, Alex; Sampath, Karuna

    2011-01-01

    RNA localization is emerging as a general principle of sub-cellular protein localization and cellular organization. However, the sequence and structural requirements in many RNA localization elements remain poorly understood. Whereas transcription factor-binding sites in DNA can be recognized as short degenerate motifs, and consensus binding sites readily inferred, protein-binding sites in RNA often contain structural features, and can be difficult to infer. We previously showed that zebrafish squint/nodal-related 1 (sqt/ndr1) RNA localizes to the future dorsal side of the embryo. Interestingly, mammalian nodal RNA can also localize to dorsal when injected into zebrafish embryos, suggesting that the sequence motif(s) may be conserved, even though the fish and mammal UTRs cannot be aligned. To define potential sequence and structural features, we obtained ndr1 3′-UTR sequences from approximately 50 fishes that are closely, or distantly, related to zebrafish, for high-resolution phylogenetic footprinting. We identify conserved sequence and structural motifs within the zebrafish/carp family and catfish. We find that two novel motifs, a single-stranded AGCAC motif and a small stem-loop, are required for efficient sqt RNA localization. These findings show that comparative sequencing in the zebrafish/carp family is an efficient approach for identifying weak consensus binding sites for RNA regulatory proteins. PMID:21149265

  9. Conservation of Fold and Topology of Functional Elements in Thiamin Pyrophosphate Enzymes

    NASA Technical Reports Server (NTRS)

    Dominiak, P.; Ciszak, E. M.

    2005-01-01

    Thiamin pyrophosphate (TPP)-dependent enzymes are a highly divergent family of proteins binding both TPP and metal ions. They perform decarboxylation-hydroxyaldehydes. Prior -ketoacids and of a common - (O=)C-C(OH)- fragment of to knowledge of three-dimensional structures of these enzmes, the GDGY25-30NN sequence was used to identify these enzymes. Subsequently, a number of structural studies on those enzymes revealed multi-subunit organization and the features of the two duplicate cofactor binding sites. Analyzing the structures of 44 structurally known enzymes, we found that the common structure of these enzymes is reduced to 180-220 amino acid long fragments of two PP and two PYR domains that form the [PP:PYR]2 binding center of two cofactor molecules. The structures of PP and PYR are arranged in a similar fold-sheet with triplets of helices on both sides.Dconsisting of a six-stranded Residues surrounding the cofactors are not strictly conserved, but they provide the same interatomic contacts required for the catalytic functions that these enzymes perform while maintaining interactive structural integrity. These structural and functional amino acids are topological counterparts located in the same positions of the conserved fold of sets of PP and PYR domains. Additional parallels include short fragments of sequences that link these amino acids to the fold and function. This report on the structural commonalities amongst TPP dependent enzymes is thought to contribute new approaches to annotation that may assist in advancing the functional proteomics of TPP dependent enzymes, and trace their complexity within evolutionary context.

  10. Functional conservation of Pax6 regulatory elements in humans and mice demonstrated with a novel transgenic reporter mouse

    PubMed Central

    Tyas, David A; Simpson, T Ian; Carr, Catherine B; Kleinjan, Dirk A; van Heyningen, Veronica; Mason, John O; Price, David J

    2006-01-01

    Background The Pax6 transcription factor is expressed during development in the eyes and in specific CNS regions, where it is essential for normal cell proliferation and differentiation. Mice lacking one or both copies of the Pax6 gene model closely humans with loss-of-function mutations in the PAX6 locus. The sequence of the Pax6/PAX6 protein is identical in mice and humans and previous studies have shown structural conservation of the gene's regulatory regions. Results We generated a transgenic mouse expressing green fluorescent protein (GFP) and neomycin resistance under the control of the entire complement of human PAX6 regulatory elements using a modified yeast artificial chromosome (YAC). Expression of GFP was studied in embryos from 9.5 days on and was confined to cells known to express Pax6. GFP expression was sufficiently strong that expressing cells could be distinguished from non-expressing cells using flow cytometry. Conclusion This work demonstrates the functional conservation of the regulatory elements controlling Pax6/PAX6 expression in mice and humans. The transgene provides an excellent tool for studying the functions of different Pax6/PAX6 regulatory elements in controlling Pax6 expression in animals that are otherwise normal. It will allow the analysis and isolation of cells in which Pax6 is activated, irrespective of the status of the endogenous locus. PMID:16674807

  11. Functional conservation of cis-regulatory elements of heat-shock genes over long evolutionary distances.

    PubMed

    He, Zhengying; Eichel, Kelsie; Ruvinsky, Ilya

    2011-01-01

    Transcriptional control of gene regulation is an intricate process that requires precise orchestration of a number of molecular components. Studying its evolution can serve as a useful model for understanding how complex molecular machines evolve. One way to investigate evolution of transcriptional regulation is to test the functions of cis-elements from one species in a distant relative. Previous results suggested that few, if any, tissue-specific promoters from Drosophila are faithfully expressed in C. elegans. Here we show that, in contrast, promoters of fly and human heat-shock genes are upregulated in C. elegans upon exposure to heat. Inducibility under conditions of heat shock may represent a relatively simple "on-off" response, whereas complex expression patterns require integration of multiple signals. Our results suggest that simpler aspects of regulatory logic may be retained over longer periods of evolutionary time, while more complex ones may be diverging more rapidly. PMID:21799932

  12. Functional conservation of a root hair cell-specific cis-element in angiosperms with different root hair distribution patterns.

    PubMed

    Kim, Dong Wook; Lee, Sang Ho; Choi, Sang-Bong; Won, Su-Kyung; Heo, Yoon-Kyung; Cho, Misuk; Park, Youn-Il; Cho, Hyung-Taeg

    2006-11-01

    Vascular plants develop distinctive root hair distribution patterns in the root epidermis, depending on the taxon. The three patterns, random (Type 1), asymmetrical cell division (Type 2), and positionally cued (Type 3), are controlled by different upstream fate-determining factors that mediate expression of root hair cell-specific genes for hair morphogenesis. Here, we address whether these root hair genes possess a common transcriptional regulatory module (cis-element) determining cell-type specificity despite differences in the final root hair pattern. We identified Arabidopsis thaliana expansinA7 (At EXPA7) orthologous (and paralogous) genes from diverse angiosperm species with different hair distribution patterns. The promoters of these genes contain conserved root hair-specific cis-elements (RHEs) that were functionally verified in the Type-3 Arabidopsis root. The promoter of At EXPA7 (Type-3 pattern) also showed hair cell-specific expression in the Type 2 rice (Oryza sativa) root. Root hair-specific genes other than EXPAs also carry functionally homologous RHEs in their promoters. The RHE core consensus was established by a multiple alignment of functionally characterized RHEs from different species and by high-resolution analysis of At EXPA7 RHE1. Our results suggest that this regulatory module of root hair-specific genes has been conserved across angiosperms despite the divergence of upstream fate-determining machinery. PMID:17098810

  13. Functional analysis of the Arabidopsis PLDZ2 promoter reveals an evolutionarily conserved low-Pi-responsive transcriptional enhancer element

    PubMed Central

    Oropeza-Aburto, Araceli; Cruz-Ramírez, Alfredo; Acevedo-Hernández, Gustavo J.; Pérez-Torres, Claudia-Anahí; Caballero-Pérez, Juan; Herrera-Estrella, Luis

    2012-01-01

    Plants have evolved a plethora of responses to cope with phosphate (Pi) deficiency, including the transcriptional activation of a large set of genes. Among Pi-responsive genes, the expression of the Arabidopsis phospholipase DZ2 (PLDZ2) is activated to participate in the degradation of phospholipids in roots in order to release Pi to support other cellular activities. A deletion analysis was performed to identify the regions determining the strength, tissue-specific expression, and Pi responsiveness of this regulatory region. This study also reports the identification and characterization of a transcriptional enhancer element that is present in the PLDZ2 promoter and able to confer Pi responsiveness to a minimal, inactive 35S promoter. This enhancer also shares the cytokinin and sucrose responsive properties observed for the intact PLDZ2 promoter. The EZ2 element contains two P1BS motifs, each of which is the DNA binding site of transcription factor PHR1. Mutation analysis showed that the P1BS motifs present in EZ2 are necessary but not sufficient for the enhancer function, revealing the importance of adjacent sequences. The structural organization of EZ2 is conserved in the orthologous genes of at least eight families of rosids, suggesting that architectural features such as the distance between the two P1BS motifs are also important for the regulatory properties of this enhancer element. PMID:22210906

  14. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De

    2015-01-01

    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  15. Genome-wide in Silico Identification of New Conserved and Functional Retinoic Acid Receptor Response Elements (Direct Repeats Separated by 5 bp)*

    PubMed Central

    Lalevée, Sébastien; Anno, Yannick N.; Chatagnon, Amandine; Samarut, Eric; Poch, Olivier; Laudet, Vincent; Benoit, Gerard; Lecompte, Odile; Rochette-Egly, Cécile

    2011-01-01

    The nuclear retinoic acid receptors interact with specific retinoic acid (RA) response elements (RAREs) located in the promoters of target genes to orchestrate transcriptional networks involved in cell growth and differentiation. Here we describe a genome-wide in silico analysis of consensus DR5 RAREs based on the recurrent RGKTSA motifs. More than 15,000 DR5 RAREs were identified and analyzed for their localization and conservation in vertebrates. We selected 138 elements located ±10 kb from transcription start sites and gene ends and conserved across more than 6 species. We also validated the functionality of these RAREs by analyzing their ability to bind retinoic acid receptors (ChIP sequencing experiments) as well as the RA regulation of the corresponding genes (RNA sequencing and quantitative real time PCR experiments). Such a strategy provided a global set of high confidence RAREs expanding the known experimentally validated RAREs repertoire associated to a series of new genes involved in cell signaling, development, and tumor suppression. Finally, the present work provides a valuable knowledge base for the analysis of a wider range of RA-target genes in different species. PMID:21803772

  16. Genome-wide in silico identification of new conserved and functional retinoic acid receptor response elements (direct repeats separated by 5 bp).

    PubMed

    Lalevée, Sébastien; Anno, Yannick N; Chatagnon, Amandine; Samarut, Eric; Poch, Olivier; Laudet, Vincent; Benoit, Gerard; Lecompte, Odile; Rochette-Egly, Cécile

    2011-09-23

    The nuclear retinoic acid receptors interact with specific retinoic acid (RA) response elements (RAREs) located in the promoters of target genes to orchestrate transcriptional networks involved in cell growth and differentiation. Here we describe a genome-wide in silico analysis of consensus DR5 RAREs based on the recurrent RGKTSA motifs. More than 15,000 DR5 RAREs were identified and analyzed for their localization and conservation in vertebrates. We selected 138 elements located ±10 kb from transcription start sites and gene ends and conserved across more than 6 species. We also validated the functionality of these RAREs by analyzing their ability to bind retinoic acid receptors (ChIP sequencing experiments) as well as the RA regulation of the corresponding genes (RNA sequencing and quantitative real time PCR experiments). Such a strategy provided a global set of high confidence RAREs expanding the known experimentally validated RAREs repertoire associated to a series of new genes involved in cell signaling, development, and tumor suppression. Finally, the present work provides a valuable knowledge base for the analysis of a wider range of RA-target genes in different species. PMID:21803772

  17. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  18. Implicit Space-Time Conservation Element and Solution Element Schemes

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Himansu, Ananda; Wang, Xiao-Yen

    1999-01-01

    Artificial numerical dissipation is in important issue in large Reynolds number computations. In such computations, the artificial dissipation inherent in traditional numerical schemes can overwhelm the physical dissipation and yield inaccurate results on meshes of practical size. In the present work, the space-time conservation element and solution element method is used to construct new and accurate implicit numerical schemes such that artificial numerical dissipation will not overwhelm physical dissipation. Specifically, these schemes have the property that numerical dissipation vanishes when the physical viscosity goes to zero. These new schemes therefore accurately model the physical dissipation even when it is extremely small. The new schemes presented are two highly accurate implicit solvers for a convection-diffusion equation. The two schemes become identical in the pure convection case, and in the pure diffusion case. The implicit schemes are applicable over the whole Reynolds number range, from purely diffusive equations to convection-dominated equations with very small viscosity. The stability and consistency of the schemes are analysed, and some numerical results are presented. It is shown that, in the inviscid case, the new schemes become explicit and their amplification factors are identical to those of the Leapfrog scheme. On the other hand, in the pure diffusion case, their principal amplification factor becomes the amplification factor of the Crank-Nicolson scheme.

  19. Missense mutations and evolutionary conservation of amino acids: evidence that many of the amino acids in factor IX function as "spacer" elements.

    PubMed Central

    Bottema, C D; Ketterling, R P; Ii, S; Yoon, H S; Phillips, J A; Sommer, S S

    1991-01-01

    We report 31 point mutations in the factor IX gene and explore the relationship between the level of evolutionary conservation of an amino acid and the probability of a mutation causing hemophilia B. From our total sample of 125 hemophiliacs and from those reported by others, we identify 95 independent missense mutations, 94 of which occur at amino acids that are evolutionarily conserved in the available mammalian factor IX sequences. The likelihood of a missense mutation causing hemophilia B depends on whether the residue is also conserved in the factor IX-related proteases: factor VII, factor X, and protein C. Most of the possible missense mutations in generically conserved residues (i.e., those conserved in factor IX and in all the related proteases) should cause disease. In contrast, missense mutations in factor IX-specific residues (i.e., those conserved in human, cow, dog, and mouse factor IX but not in the related proteases) are sixfold less likely to cause disease. Missense mutations at nonconserved residues are 33-fold less likely to cause disease. At least three models are compatible with these observations. A comparison of sequence alignments from four and nine species of factor IX and an examination of the missense mutations occurring at CpG residues suggest a model in which most residues fall on opposite ends of a spectrum. In about 40% of residues, virtually any missense mutation in a minority of the residues will cause disease, while virtually no missense mutations will cause disease in most of the remaining residues. Thus, many of the residues in factor IX are spacers; that is, the main chains are presumably necessary to keep other amino acid interactions in register, but the nature of the side chain is unimportant. PMID:1680287

  20. A 3-dimensional mass conserving element for compressible flows

    NASA Technical Reports Server (NTRS)

    Fix, G.; Suri, M.

    1985-01-01

    A variety of finite element schemes has been used in the numerical approximation of compressible flows particularly in underwater acoustics. In many instances instabilities have been generated due to the lack of mass conservation. Two- and three-dimensional elements are developed which avoid these problems.

  1. New alloys to conserve critical elements

    NASA Technical Reports Server (NTRS)

    Stephens, J. R.

    1978-01-01

    Based on availability of domestic reserves, chromium is one of the most critical elements within the U.S. metal industry. New alloys having reduced chromium contents which offer potential as substitutes for higher chromium containing alloys currently in use are being investigated. This paper focuses primarily on modified Type 304 stainless steels having one-third less chromium, but maintaining comparable oxidation and corrosion properties to that of type 304 stainless steel, the largest single use of chromium. Substitutes for chromium in these modified Type 304 stainless steel alloys include silicon and aluminum plus molybdenum.

  2. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

    PubMed Central

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

    2015-01-01

    Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Contact: Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

  3. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle.

    PubMed

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W; Kozmik, Zbynek; Putnam, Nicholas H; Yu, Jr-Kai; Holland, Linda Z

    2016-01-01

    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120-160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  4. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle

    PubMed Central

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W.; Kozmik, Zbynek; Putnam, Nicholas H.; Yu, Jr-Kai; Holland, Linda Z.

    2016-01-01

    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120–160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  5. A Summary of the Space-Time Conservation Element and Solution Element (CESE) Method

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen J.

    2015-01-01

    The space-time Conservation Element and Solution Element (CESE) method for solving conservation laws is examined for its development motivation and design requirements. The characteristics of the resulting scheme are discussed. The discretization of the Euler equations is presented to show readers how to construct a scheme based on the CESE method. The differences and similarities between the CESE method and other traditional methods are discussed. The strengths and weaknesses of the method are also addressed.

  6. High-Resolution Genuinely Multidimensional Solution of Conservation Laws by the Space-Time Conservation Element and Solution Element Method

    NASA Technical Reports Server (NTRS)

    Himansu, Ananda; Chang, Sin-Chung; Yu, Sheng-Tao; Wang, Xiao-Yen; Loh, Ching-Yuen; Jorgenson, Philip C. E.

    1999-01-01

    In this overview paper, we review the basic principles of the method of space-time conservation element and solution element for solving the conservation laws in one and two spatial dimensions. The present method is developed on the basis of local and global flux conservation in a space-time domain, in which space and time are treated in a unified manner. In contrast to the modern upwind schemes, the approach here does not use the Riemann solver and the reconstruction procedure as the building blocks. The drawbacks of the upwind approach, such as the difficulty of rationally extending the 1D scalar approach to systems of equations and particularly to multiple dimensions is here contrasted with the uniformity and ease of generalization of the Conservation Element and Solution Element (CE/SE) 1D scalar schemes to systems of equations and to multiple spatial dimensions. The assured compatibility with the simplest type of unstructured meshes, and the uniquely simple nonreflecting boundary conditions of the present method are also discussed. The present approach has yielded high-resolution shocks, rarefaction waves, acoustic waves, vortices, ZND detonation waves, and shock/acoustic waves/vortices interactions. Moreover, since no directional splitting is employed, numerical resolution of two-dimensional calculations is comparable to that of the one-dimensional calculations. Some sample applications displaying the strengths and broad applicability of the CE/SE method are reviewed.

  7. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 3 2012-01-01 2012-01-01 false Energy Program Conservation Elements D Appendix D to Part.... 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy conservation programs, certain key elements need to be present. The elements listed below must be...

  8. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 3 2014-01-01 2014-01-01 false Energy Program Conservation Elements D Appendix D to Part.... 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy conservation programs, certain key elements need to be present. The elements listed below must be...

  9. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy Program Conservation Elements D Appendix D to Part.... 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy conservation programs, certain key elements need to be present. The elements listed below must be...

  10. Evolution and Conservation of Plant NLR Functions

    PubMed Central

    Jacob, Florence; Vernaldi, Saskia; Maekawa, Takaki

    2013-01-01

    In plants and animals, nucleotide-binding domain and leucine-rich repeats (NLR)-containing proteins play pivotal roles in innate immunity. Despite their similar biological functions and protein architecture, comparative genome-wide analyses of NLRs and genes encoding NLR-like proteins suggest that plant and animal NLRs have independently arisen in evolution. Furthermore, the demonstration of interfamily transfer of plant NLR functions from their original species to phylogenetically distant species implies evolutionary conservation of the underlying immune principle across plant taxonomy. In this review we discuss plant NLR evolution and summarize recent insights into plant NLR-signaling mechanisms, which might constitute evolutionarily conserved NLR-mediated immune mechanisms. PMID:24093022

  11. Functional conservation of Rel binding sites in drosophilid genomes

    PubMed Central

    Copley, Richard R.; Totrov, Maxim; Linnell, Jane; Field, Simon; Ragoussis, Jiannis; Udalova, Irina A.

    2007-01-01

    Evolutionary constraints on gene regulatory elements are poorly understood: Little is known about how the strength of transcription factor binding correlates with DNA sequence conservation, and whether transcription factor binding sites can evolve rapidly while retaining their function. Here we use the model of the NFKB/Rel-dependent gene regulation in divergent Drosophila species to examine the hypothesis that the functional properties of authentic transcription factor binding sites are under stronger evolutionary constraints than the genomic background. Using molecular modeling we compare tertiary structures of the Drosophila Rel family proteins Dorsal, Dif, and Relish and demonstrate that their DNA-binding and protein dimerization domains undergo distinct rates of evolution. The accumulated amino acid changes, however, are unlikely to affect DNA sequence recognition and affinity. We employ our recently developed microarray-based experimental platform and principal coordinates statistical analysis to quantitatively and systematically profile DNA binding affinities of three Drosophila Rel proteins to 10,368 variants of the NFKB recognition sequences. We then correlate the evolutionary divergence of gene regulatory regions with differences in DNA binding affinities. Genome-wide analyses reveal a significant increase in the number of conserved Rel binding sites in promoters of developmental and immune genes. Significantly, the affinity of Rel proteins to these sites was higher than to less conserved sites and was maintained by the conservation of the DNA binding site sequence (static conservation) or in some cases despite significantly diverged sequences (dynamic conservation). We discuss how two types of conservation may contribute to the stabilization and optimization of a functional gene regulatory code in evolution. PMID:17785540

  12. A characteristic space-time conservation element and solution element method for conservation laws II. Multidimensional extension

    NASA Astrophysics Data System (ADS)

    Shen, Hua; Wen, Chih-Yung

    2016-01-01

    The characteristic space-time conservation element and solution element (CE/SE) schemes proposed by Shen et al. (2015) [15] are straightforward extended to multidimensional schemes on 2D rectangular meshes which strictly follow the space-time conservation law. The schemes for solving both scalar conservation laws and compressible Euler equations with shock waves are developed. They are accurate and robust with CFL widely ranging from 0 to nearly 1. In Euler solvers, the frequently-used Harten, Lax and van Leer (HLL) Riemann solver, contact discontinuity restoring HLLC Riemann solver and Roe Riemann solver are employed to calculate the upwind fluxes as examples. When standard grid-aligned Riemann solvers are employed, the carbuncle phenomena are significantly suppressed when comparing with conventional upwind schemes. If rotated Riemann solvers are employed, nearly carbuncle-free results are obtained. Several well understood numerical examples are carried out to demonstrate that the 2D characteristic CE/SE schemes can simultaneously capture shocks and details of complex flow structures very well.

  13. Parallel, adaptive finite element methods for conservation laws

    NASA Technical Reports Server (NTRS)

    Biswas, Rupak; Devine, Karen D.; Flaherty, Joseph E.

    1994-01-01

    We construct parallel finite element methods for the solution of hyperbolic conservation laws in one and two dimensions. Spatial discretization is performed by a discontinuous Galerkin finite element method using a basis of piecewise Legendre polynomials. Temporal discretization utilizes a Runge-Kutta method. Dissipative fluxes and projection limiting prevent oscillations near solution discontinuities. A posteriori estimates of spatial errors are obtained by a p-refinement technique using superconvergence at Radau points. The resulting method is of high order and may be parallelized efficiently on MIMD computers. We compare results using different limiting schemes and demonstrate parallel efficiency through computations on an NCUBE/2 hypercube. We also present results using adaptive h- and p-refinement to reduce the computational cost of the method.

  14. Interstitial Functionalization in elemental Si

    NASA Astrophysics Data System (ADS)

    Kiefer, Boris; Fohtung, Edwin

    Societies in the 21st century will face many challenges. Materials science and materials design will be essential to address and master some if not all of these challenges. Semiconductors are among the most important technological material classes. Properties such as electrical transport are strongly affected by defects and a central goal continues to be the reduction of defect densities as much as possible in these compounds. Here we present results of interstitial Fe doping in elemental Si using first-principles DFT calculations. The preliminary results show that Fe will only occupy octahedral interstitial sites. The analysis of the electronic structure shows that the compounds are ferromagnetic and that a bandgap opens as interstitial Fe concentrations decrease, with a possible intermittent semi-metallic phase. The formation energy for interstitial Fe is unfavorable, as expected, by ~1.5 eV but becomes favorable as the chemical potential of Fe increases. Therefore, we expect that biasing the system with an external electrical field will lead to the formation of these materials. Thus, our results show that interstitial defects can be beneficial for the design of functionalities that differ significantly from those of the host material.

  15. Functional metamirrors using bianisotropic elements.

    PubMed

    Asadchy, V S; Ra'di, Y; Vehmas, J; Tretyakov, S A

    2015-03-01

    Conventional mirrors obey the simple reflection law that a plane wave is reflected as a plane wave, at the same angle. To engineer spatial distributions of fields reflected from a mirror, one can either shape the reflector or position some phase-correcting elements on top of a mirror surface. Here we show, both theoretically and experimentally, that full-power reflection with general control over the reflected wave phase is possible with a single-layer array of deeply subwavelength inclusions. These proposed artificial surfaces, metamirrors, provide various functions of shaped or nonuniform reflectors without utilizing any mirror. This can be achieved only if the forward and backward scattering of the inclusions in the array can be engineered independently, and we prove that it is possible using electrically and magnetically polarizable inclusions. The proposed subwavelength inclusions possess desired reflecting properties at the operational frequency band, while at other frequencies the array is practically transparent. The metamirror concept leads to a variety of applications over the entire electromagnetic spectrum, such as optically transparent focusing antennas for satellites, multifrequency reflector antennas for radio astronomy, low-profile conformal antennas for telecommunications, and nanoreflectarray antennas for integrated optics. PMID:25793826

  16. Functional Metamirrors Using Bianisotropic Elements

    NASA Astrophysics Data System (ADS)

    Asadchy, V. S.; Ra'di, Y.; Vehmas, J.; Tretyakov, S. A.

    2015-03-01

    Conventional mirrors obey the simple reflection law that a plane wave is reflected as a plane wave, at the same angle. To engineer spatial distributions of fields reflected from a mirror, one can either shape the reflector or position some phase-correcting elements on top of a mirror surface. Here we show, both theoretically and experimentally, that full-power reflection with general control over the reflected wave phase is possible with a single-layer array of deeply subwavelength inclusions. These proposed artificial surfaces, metamirrors, provide various functions of shaped or nonuniform reflectors without utilizing any mirror. This can be achieved only if the forward and backward scattering of the inclusions in the array can be engineered independently, and we prove that it is possible using electrically and magnetically polarizable inclusions. The proposed subwavelength inclusions possess desired reflecting properties at the operational frequency band, while at other frequencies the array is practically transparent. The metamirror concept leads to a variety of applications over the entire electromagnetic spectrum, such as optically transparent focusing antennas for satellites, multifrequency reflector antennas for radio astronomy, low-profile conformal antennas for telecommunications, and nanoreflectarray antennas for integrated optics.

  17. Functions over RDF Language Elements

    NASA Astrophysics Data System (ADS)

    Schandl, Bernhard

    RDF data are usually accessed using one of two methods: either, graphs are rendered in forms perceivable by human users (e.g., in tabular or in graphical form), which are difficult to handle for large data sets. Alternatively, query languages like SPARQL provide means to express information needs in structured form; hence they are targeted towards developers and experts. Inspired by the concept of spreadsheet tools, where users can perform relatively complex calculations by splitting formulas and values across multiple cells, we have investigated mechanisms that allow us to access RDF graphs in a more intuitive and manageable, yet formally grounded manner. In this paper, we make three contributions towards this direction. First, we present RDFunctions, an algebra that consists of mappings between sets of RDF language elements (URIs, blank nodes, and literals) under consideration of the triples contained in a background graph. Second, we define a syntax for expressing RDFunctions, which can be edited, parsed and evaluated. Third, we discuss Tripcel, an implementation of RDFunctions using a spreadsheet metaphor. Using this tool, users can easily edit and execute function expressions and perform analysis tasks on the data stored in an RDF graph.

  18. Finite element solution for energy conservation using a highly stable explicit integration algorithm

    NASA Technical Reports Server (NTRS)

    Baker, A. J.; Manhardt, P. D.

    1972-01-01

    Theoretical derivation of a finite element solution algorithm for the transient energy conservation equation in multidimensional, stationary multi-media continua with irregular solution domain closure is considered. The complete finite element matrix forms for arbitrarily irregular discretizations are established, using natural coordinate function representations. The algorithm is embodied into a user-oriented computer program (COMOC) which obtains transient temperature distributions at the node points of the finite element discretization using a highly stable explicit integration procedure with automatic error control features. The finite element algorithm is shown to posses convergence with discretization for a transient sample problem. The condensed form for the specific heat element matrix is shown to be preferable to the consistent form. Computed results for diverse problems illustrate the versatility of COMOC, and easily prepared output subroutines are shown to allow quick engineering assessment of solution behavior.

  19. Conserved elements in Pax6 intron 7 involved in (auto)regulation and alternative transcription.

    PubMed

    Kleinjan, Dirk A; Seawright, Anne; Childs, Andrew J; van Heyningen, Veronica

    2004-01-15

    Pax6 is a transcription factor with an essential role in eye, central nervous system, and pancreas development. Its expression pattern is restricted to these specific domains within the developing embryo. Here four conserved elements are identified in Pax6 intron 7, showing a high level of sequence conservation between human, mouse, pufferfish, and zebrafish. Three of these are shown to act as cis-regulatory elements, directing expression of a reporter gene to distinct subsets of the Pax6 expression domain. CE1 regulates gene expression in late eye development, CE2 drives expression in the diencephalon and in the developing heart tube where Pax6 is not normally expressed, while CE3 directs expression in rhombencephalon. CE2 is shown to be autoregulated in the diencephalon, responding to absence of Pax6. We identify a highly conserved Pax6 recognition site and demonstrate its ability to bind Pax6 specifically. CE1 is embedded in a CpG island, and we identify a novel Pax6 transcript which initiates from this region. Functional analysis of evolutionary conserved sequences pinpoints novel cis-acting elements that govern the regulation of the complex spatio-temporal and quantitative expression of Pax6. PMID:14732405

  20. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 3 2011-01-01 2011-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  1. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  2. CRISPR Screens to Discover Functional Noncoding Elements.

    PubMed

    Wright, Jason B; Sanjana, Neville E

    2016-09-01

    A major challenge in genomics is to identify functional elements in the noncoding genome. Recently, pooled clustered regularly interspersed palindromic repeat (CRISPR) mutagenesis screens of noncoding regions have emerged as a novel method for finding elements that impact gene expression and phenotype/disease-relevant biological processes. Here we review and compare different approaches for high-throughput dissection of noncoding elements. PMID:27423542

  3. Conservation of glp-1 regulation and function in nematodes.

    PubMed Central

    Rudel, D; Kimble, J

    2001-01-01

    The Caenorhabditis elegans (Ce) glp-1 gene encodes a Notch-like receptor. We have cloned glp-1 from C. briggsae (Cb) and C. remanei (Cr), two Caenorhabditis species that have diverged from C. elegans by roughly 20-40 million years. By sequence analysis, we find that the Cb-GLP-1 and Cr-GLP-1 proteins have retained the same motif architecture as Ce-GLP-1, including number of domains. In addition, two regions (CC-linker and regions flanking the ANK repeats) are as highly conserved as regions previously recognized as essential for signaling (e.g., ANK repeats). Phylogenetic analysis of glp-1 sequences suggests a C. briggsae/C. remanei clade with C. elegans as a sister taxon. Using RNAi to test biological functions, we find that Ce-glp-1, Cb-glp-1, and Cr-glp-1 are all required for proliferation of germline stem cells and for specifying blastomere fates in the embryo. In addition, certain biological roles of Cb-glp-1, e.g., in the vulva, have diverged from those of Ce-glp-1 and Cr-glp-1, suggesting a change in either regulation or function of the Cb-glp-1 gene during evolution. Finally, the regulation of glp-1 mRNA, previously analyzed for Ce-glp-1, is conserved in Cb-glp-1, and we identify conserved 3' UTR sequences that may serve as regulatory elements. PMID:11156985

  4. Conserved Endonuclease Function of Hantavirus L Polymerase.

    PubMed

    Rothenberger, Sylvia; Torriani, Giulia; Johansson, Maria U; Kunz, Stefan; Engler, Olivier

    2016-01-01

    Hantaviruses are important emerging pathogens belonging to the Bunyaviridae family. Like other segmented negative strand RNA viruses, the RNA-dependent RNA polymerase (RdRp) also known as L protein of hantaviruses lacks an intrinsic "capping activity". Hantaviruses therefore employ a "cap snatching" strategy acquiring short 5' RNA sequences bearing 5'cap structures by endonucleolytic cleavage from host cell transcripts. The viral endonuclease activity implicated in cap snatching of hantaviruses has been mapped to the N-terminal domain of the L protein. Using a combination of molecular modeling and structure-function analysis we confirm and extend these findings providing evidence for high conservation of the L endonuclease between Old and New World hantaviruses. Recombinant hantavirus L endonuclease showed catalytic activity and a defined cation preference shared by other viral endonucleases. Based on the previously reported remarkably high activity of hantavirus L endonuclease, we established a cell-based assay for the hantavirus endonuclase function. The robustness of the assay and its high-throughput compatible format makes it suitable for small molecule drug screens to identify novel inhibitors of hantavirus endonuclease. Based on the high degree of similarity to RdRp endonucleases, some candidate inhibitors may be broadly active against hantaviruses and other emerging human pathogenic Bunyaviruses. PMID:27144576

  5. Conserved Endonuclease Function of Hantavirus L Polymerase

    PubMed Central

    Rothenberger, Sylvia; Torriani, Giulia; Johansson, Maria U.; Kunz, Stefan; Engler, Olivier

    2016-01-01

    Hantaviruses are important emerging pathogens belonging to the Bunyaviridae family. Like other segmented negative strand RNA viruses, the RNA-dependent RNA polymerase (RdRp) also known as L protein of hantaviruses lacks an intrinsic “capping activity”. Hantaviruses therefore employ a “cap snatching” strategy acquiring short 5′ RNA sequences bearing 5′cap structures by endonucleolytic cleavage from host cell transcripts. The viral endonuclease activity implicated in cap snatching of hantaviruses has been mapped to the N-terminal domain of the L protein. Using a combination of molecular modeling and structure–function analysis we confirm and extend these findings providing evidence for high conservation of the L endonuclease between Old and New World hantaviruses. Recombinant hantavirus L endonuclease showed catalytic activity and a defined cation preference shared by other viral endonucleases. Based on the previously reported remarkably high activity of hantavirus L endonuclease, we established a cell-based assay for the hantavirus endonuclase function. The robustness of the assay and its high-throughput compatible format makes it suitable for small molecule drug screens to identify novel inhibitors of hantavirus endonuclease. Based on the high degree of similarity to RdRp endonucleases, some candidate inhibitors may be broadly active against hantaviruses and other emerging human pathogenic Bunyaviruses. PMID:27144576

  6. High Resolution Euler Solvers Based on the Space-Time Conservation Element and Solution Element Method

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Chow, Chuen-Yen; Chang, Sin-Chung

    1996-01-01

    The I-D, quasi I-D and 2-D Euler solvers based on the method of space-time conservation element and solution element are used to simulate various flow phenomena including shock waves, Mach stem, contact surface, expansion waves, and their intersections and reflections. Seven test problems are solved to demonstrate the capability of this method for handling unsteady compressible flows in various configurations. Numerical results so obtained are compared with exact solutions and/or numerical solutions obtained by schemes based on other established computational techniques. Comparisons show that the present Euler solvers can generate highly accurate numerical solutions to complex flow problems in a straightforward manner without using any ad hoc techniques in the scheme.

  7. The Conservation/Solution Element (STE) Method for Linear Potential Flow Problems

    NASA Technical Reports Server (NTRS)

    Adeyeye, John O.; Attia, Naguib F.; Jackson, Joy; Hunter, Timothy

    1996-01-01

    The potential equation is discretized on rectangular domains using the Conservation/Solution Element Method (STE) approach. Computational examples with a discussion of numerical experience gained are given.

  8. Finite element method for conserved phase fields: Stress-mediated diffusional phase transformation

    NASA Astrophysics Data System (ADS)

    Zaeem, Mohsen Asle; Mesarovic, Sinisa Dj.

    2010-12-01

    Phase-field models with conserved phase-field variables result in a 4th order evolution partial differential equation (PDE). When coupled with the usual 2nd order thermo-mechanics equations, such problems require special treatment. In the past, the finite element method (FEM) has been successfully applied to non-conserved phase fields, governed by a 2nd order PDE. For higher order equations, the convergence of the standard Galerkin FEM requires that the interpolation functions belong to a higher continuity class. We consider the Cahn-Hilliard phase-field model for diffusion-controlled solid state phase transformation in binary alloys, coupled with elasticity of the solid phases. A Galerkin finite element formulation is developed, with mixed-order interpolation: C 0 interpolation functions for displacements, and C 1 interpolation functions for the phase-field variable. To demonstrate convergence of the mixed interpolation scheme, we first study a one-dimensional problem - nucleation and growth of the intermediate phase in a thin-film diffusion couple with elasticity effects. Then, we study the effects of completeness of C 1 interpolation on parabolic problems in two space dimensions by considering the growth of the intermediate phase in a binary system. Quadratic convergence, expected for conforming elements, is achieved for both one- and two-dimensional systems.

  9. A new numerical framework for solving conservation laws: The method of space-time conservation element and solution element

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; To, Wai-Ming

    1991-01-01

    A new numerical framework for solving conservation laws is being developed. It employs: (1) a nontraditional formulation of the conservation laws in which space and time are treated on the same footing, and (2) a nontraditional use of discrete variables such as numerical marching can be carried out by using a set of relations that represents both local and global flux conservation.

  10. Space-Time Conservation Element and Solution Element Method Being Developed

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Himansu, Ananda; Jorgenson, Philip C. E.; Loh, Ching-Yuen; Wang, Xiao-Yen; Yu, Sheng-Tao

    1999-01-01

    The engineering research and design requirements of today pose great computer-simulation challenges to engineers and scientists who are called on to analyze phenomena in continuum mechanics. The future will bring even more daunting challenges, when increasingly complex phenomena must be analyzed with increased accuracy. Traditionally used numerical simulation methods have evolved to their present state by repeated incremental extensions to broaden their scope. They are reaching the limits of their applicability and will need to be radically revised, at the very least, to meet future simulation challenges. At the NASA Lewis Research Center, researchers have been developing a new numerical framework for solving conservation laws in continuum mechanics, namely, the Space-Time Conservation Element and Solution Element Method, or the CE/SE method. This method has been built from fundamentals and is not a modification of any previously existing method. It has been designed with generality, simplicity, robustness, and accuracy as cornerstones. The CE/SE method has thus far been applied in the fields of computational fluid dynamics, computational aeroacoustics, and computational electromagnetics. Computer programs based on the CE/SE method have been developed for calculating flows in one, two, and three spatial dimensions. Results have been obtained for numerous problems and phenomena, including various shock-tube problems, ZND detonation waves, an implosion and explosion problem, shocks over a forward-facing step, a blast wave discharging from a nozzle, various acoustic waves, and shock/acoustic-wave interactions. The method can clearly resolve shock/acoustic-wave interactions, wherein the difference of the magnitude between the acoustic wave and shock could be up to six orders. In two-dimensional flows, the reflected shock is as crisp as the leading shock. CE/SE schemes are currently being used for advanced applications to jet and fan noise prediction and to chemically

  11. Detecting conserved regulatory elements with the model genome of the Japanese puffer fish, Fugu rubripes.

    PubMed Central

    Aparicio, S; Morrison, A; Gould, A; Gilthorpe, J; Chaudhuri, C; Rigby, P; Krumlauf, R; Brenner, S

    1995-01-01

    Comparative vertebrate genome sequencing offers a powerful method for detecting conserved regulatory sequences. We propose that the compact genome of the teleost Fugu rubripes is well suited for this purpose. The evolutionary distance of teleosts from other vertebrates offers the maximum stringency for such evolutionary comparisons. To illustrate the comparative genome approach for F. rubripes, we use sequence comparisons between mouse and Fugu Hoxb-4 noncoding regions to identify conserved sequence blocks. We have used two approaches to test the function of these conserved blocks. In the first, homologous sequences were deleted from a mouse enhancer, resulting in a tissue-specific loss of activity when assayed in transgenic mice. In the second approach, Fugu DNA sequences showing homology to mouse sequences were tested for enhancer activity in transgenic mice. This strategy identified a neural element that mediates a subset of Hoxb-4 expression that is conserved between mammals and teleosts. The comparison of noncoding vertebrate sequences with those of Fugu, coupled to a transgenic bioassay, represents a general approach suitable for many genome projects. Images Fig. 2 Fig. 3 Fig. 4 PMID:7878040

  12. One-Step Direct Aeroacoustic Simulation Using Space-Time Conservation Element and Solution Element Method

    NASA Astrophysics Data System (ADS)

    Ho, C. Y.; Leung, R. C. K.; Zhou, K.; Lam, G. C. Y.; Jiang, Z.

    2011-09-01

    One-step direct aeroacoustic simulation (DAS) has received attention from aerospace and mechanical high-pressure fluid-moving system manufacturers for quite some time. They aim to simulate the unsteady flow and acoustic field in the duct simultaneously in order to investigate the aeroacoustic generation mechanisms. Because of the large length and energy scale disparities between the acoustic far field and the aerodynamic near field, highly accurate and high-resolution simulation scheme is required. This involves the use of high order compact finite difference and time advancement schemes in simulation. However, in this situation, large buffer zones are always needed to suppress the spurious numerical waves emanating from computational boundaries. This further increases the computational resources to yield accurate results. On the other hand, for such problem as supersonic jet noise, the numerical scheme should be able to resolve both strong shock waves and weak acoustic waves simultaneously. Usually numerical aeroa-coustic scheme that is good for low Mach number flow is not able to give satisfactory simulation results for shock wave. Therefore, the aeroacoustic research community has been looking for a more efficient one-step DAS scheme that has the comparable accuracy to the finite-difference approach with smaller buffer regions, yet is able to give accurate solutions from subsonic to supersonic flows. The conservation element and solution element (CE/SE) scheme is one of the possible schemes satisfying the above requirements. This paper aims to report the development of a CE/SE scheme for one-step DAS and illustrate its robustness and effectiveness with two selected benchmark problems.

  13. Steady and Unsteady Nozzle Simulations Using the Conservation Element and Solution Element Method

    NASA Technical Reports Server (NTRS)

    Friedlander, David Joshua; Wang, Xiao-Yen J.

    2014-01-01

    This paper presents results from computational fluid dynamic (CFD) simulations of a three-stream plug nozzle. Time-accurate, Euler, quasi-1D and 2D-axisymmetric simulations were performed as part of an effort to provide a CFD-based approach to modeling nozzle dynamics. The CFD code used for the simulations is based on the space-time Conservation Element and Solution Element (CESE) method. Steady-state results were validated using the Wind-US code and a code utilizing the MacCormack method while the unsteady results were partially validated via an aeroacoustic benchmark problem. The CESE steady-state flow field solutions showed excellent agreement with solutions derived from the other methods and codes while preliminary unsteady results for the three-stream plug nozzle are also shown. Additionally, a study was performed to explore the sensitivity of gross thrust computations to the control surface definition. The results showed that most of the sensitivity while computing the gross thrust is attributed to the control surface stencil resolution and choice of stencil end points and not to the control surface definition itself.Finally, comparisons between the quasi-1D and 2D-axisymetric solutions were performed in order to gain insight on whether a quasi-1D solution can capture the steady and unsteady nozzle phenomena without the cost of a 2D-axisymmetric simulation. Initial results show that while the quasi-1D solutions are similar to the 2D-axisymmetric solutions, the inability of the quasi-1D simulations to predict two dimensional phenomena limits its accuracy.

  14. Defining functional DNA elements in the human genome

    PubMed Central

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

    2014-01-01

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  15. Effects of species combination on comparative analyses of conserved regulatory elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cross-species DNA sequence comparison is the primary approach to discover regulatory elements by identifying highly conserved sequences due to evolutionary constraints. Previously, we reported that a systematic approach, combining position-specific weight matrixes (JASPAR) and phylogenetic footprint...

  16. Systematic identification of conserved regulatory elements in upstream promoter regions of the cattle genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cross-species DNA sequence comparison is the primary approach to discover regulatory elements by identifying highly conserved sequences due to evolutionary constraints. Previously, we reported that a systematic approach, combining position-specific weight matrixes (JASPAR) and phylogenetic footprint...

  17. Prediction of conserved regulatory elements in promoter regions of the cattle genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cross-species DNA sequence comparison is the primary approach to discover regulatory elements by identifying highly conserved sequences due to evolutionary constraints. Previously, we reported that a systematic approach, combining position-specific weight matrixes (JASPAR) and phylogenetic footprint...

  18. Genome-wide identification of conserved regulatory function in diverged sequences

    PubMed Central

    Taher, Leila; McGaughey, David M.; Maragh, Samantha; Aneas, Ivy; Bessling, Seneca L.; Miller, Webb; Nobrega, Marcelo A.; McCallion, Andrew S.; Ovcharenko, Ivan

    2011-01-01

    Plasticity of gene regulatory encryption can permit DNA sequence divergence without loss of function. Functional information is preserved through conservation of the composition of transcription factor binding sites (TFBS) in a regulatory element. We have developed a method that can accurately identify pairs of functional noncoding orthologs at evolutionarily diverged loci by searching for conserved TFBS arrangements. With an estimated 5% false-positive rate (FPR) in approximately 3000 human and zebrafish syntenic loci, we detected approximately 300 pairs of diverged elements that are likely to share common ancestry and have similar regulatory activity. By analyzing a pool of experimentally validated human enhancers, we demonstrated that 7/8 (88%) of their predicted functional orthologs retained in vivo regulatory control. Moreover, in 5/7 (71%) of assayed enhancer pairs, we observed concordant expression patterns. We argue that TFBS composition is often necessary to retain and sufficient to predict regulatory function in the absence of overt sequence conservation, revealing an entire class of functionally conserved, evolutionarily diverged regulatory elements that we term “covert.” PMID:21628450

  19. Functionally conserved enhancers with divergent sequences in distant vertebrates

    SciTech Connect

    Yang, Song; Oksenberg, Nir; Takayama, Sachiko; Heo, Seok -Jin; Poliakov, Alexander; Ahituv, Nadav; Dubchak, Inna; Boffelli, Dario

    2015-10-30

    To examine the contributions of sequence and function conservation in the evolution of enhancers, we systematically identified enhancers whose sequences are not conserved among distant groups of vertebrate species, but have homologous function and are likely to be derived from a common ancestral sequence. In conclusion, our approach combined comparative genomics and epigenomics to identify potential enhancer sequences in the genomes of three groups of distantly related vertebrate species.

  20. Spectral/HP Element Method With Hierarchical Reconstruction for Solving Hyperbolic Conservation Laws

    SciTech Connect

    Xu, Zhiliang; Lin, Guang

    2009-12-01

    Hierarchical reconstruction (HR) has been successfully applied to prevent oscillations in solutions computed by finite volume, discontinuous Galerkin, spectral volume schemes when solving hyperbolic conservation laws. In this paper, we demonstrate that HR can also be combined with spectral/hp element methods for solving hyperbolic conservation laws. We show that HR preserves the order of accuracy of spectral/hp element methods for smooth solutions and generate essentially non-oscillatory solution profiles for shock wave problems.

  1. Particle conservation in dynamical density functional theory

    NASA Astrophysics Data System (ADS)

    de las Heras, Daniel; Brader, Joseph M.; Fortini, Andrea; Schmidt, Matthias

    2016-06-01

    We present the exact adiabatic theory for the dynamics of the inhomogeneous density distribution of a classical fluid. Erroneous particle number fluctuations of dynamical density functional theory are absent, both for canonical and grand canonical initial conditions. We obtain the canonical free energy functional, which yields the adiabatic interparticle forces of overdamped Brownian motion. Using an exact and one of the most advanced approximate hard core free energy functionals, we obtain excellent agreement with simulations. The theory applies to finite systems in and out of equilibrium.

  2. Particle conservation in dynamical density functional theory.

    PubMed

    de Las Heras, Daniel; Brader, Joseph M; Fortini, Andrea; Schmidt, Matthias

    2016-06-22

    We present the exact adiabatic theory for the dynamics of the inhomogeneous density distribution of a classical fluid. Erroneous particle number fluctuations of dynamical density functional theory are absent, both for canonical and grand canonical initial conditions. We obtain the canonical free energy functional, which yields the adiabatic interparticle forces of overdamped Brownian motion. Using an exact and one of the most advanced approximate hard core free energy functionals, we obtain excellent agreement with simulations. The theory applies to finite systems in and out of equilibrium. PMID:27115673

  3. New alloys to conserve critical elements. [replacing chromium in steels

    NASA Technical Reports Server (NTRS)

    Stephens, J. R.

    1978-01-01

    Previous studies and surveys on availability of domestic reserves have shown that chromium is a most critical element within the U.S. metal industry. More precisely, the bulk of chromium is consumed in the production of stainless steels, specifically Type 304 stainless steel (304SS) which contains 18% Cr. The present paper deals with means of reducing chromium in commercial stainless steels by substituting more abundant or less expensive elements with the intent of maintaining the properties of 304SS. The discussion focuses on some of the oxidation and corrosion properties of new substitute stainless steels with only 12% Cr, which represents a potential saving of 33% of the chromium consumed in the production of 304SS. The alloying elements substituted for Cr in 304SS are selected according to their potential for protective oxide formation during high-temperature oxidation; these are Al, Si, Ti, Y, and misch metal which is 99.7% rare-earth metals containing 50 to 55% cerium. Other alloying elements to impart corrosion resistance are Mn, Mo, and V.

  4. Effective function annotation through catalytic residue conservation.

    PubMed

    George, Richard A; Spriggs, Ruth V; Bartlett, Gail J; Gutteridge, Alex; MacArthur, Malcolm W; Porter, Craig T; Al-Lazikani, Bissan; Thornton, Janet M; Swindells, Mark B

    2005-08-30

    Because of the extreme impact of genome sequencing projects, protein sequences without accompanying experimental data now dominate public databases. Homology searches, by providing an opportunity to transfer functional information between related proteins, have become the de facto way to address this. Although a single, well annotated, close relationship will often facilitate sufficient annotation, this situation is not always the case, particularly if mutations are present in important functional residues. When only distant relationships are available, the transfer of function information is more tenuous, and the likelihood of encountering several well annotated proteins with different functions is increased. The consequence for a researcher is a range of candidate functions with little way of knowing which, if any, are correct. Here, we address the problem directly by introducing a computational approach to accurately identify and segregate related proteins into those with a functional similarity and those where function differs. This approach should find a wide range of applications, including the interpretation of genomics/proteomics data and the prioritization of targets for high-throughput structure determination. The method is generic, but here we concentrate on enzymes and apply high-quality catalytic site data. In addition to providing a series of comprehensive benchmarks to show the overall performance of our approach, we illustrate its utility with specific examples that include the correct identification of haptoglobin as a nonenzymatic relative of trypsin, discrimination of acid-d-amino acid ligases from a much larger ligase pool, and the successful annotation of BioH, a structural genomics target. PMID:16037208

  5. Fractality and entropic scaling in the chromosomal distribution of conserved noncoding elements in the human genome.

    PubMed

    Polychronopoulos, Dimitris; Athanasopoulou, Labrini; Almirantis, Yannis

    2016-06-15

    Conserved non-coding elements (CNEs) are defined using various degrees of sequence identity and thresholds of minimal length. Their conservation frequently exceeds the one observed for protein-coding sequences. We explored the chromosomal distribution of different classes of CNEs in the human genome. We employed two methodologies: the scaling of block entropy and box-counting, with the aim to assess fractal characteristics of different CNE datasets. Both approaches converged to the conclusion that well-developed fractality is characteristic of elements that are either extremely conserved between species or are of ancient origin, i.e. conserved between distant organisms across evolution. Given that CNEs are often clustered around genes, we verified by appropriate gene masking that fractal-like patterns emerge even when elements found in proximity or inside genes are excluded. An evolutionary scenario is proposed, involving genomic events that might account for fractal distribution of CNEs in the human genome as indicated through numerical simulations. PMID:26899868

  6. Local Function Conservation in Sequence and Structure Space

    PubMed Central

    Weinhold, Nils; Sander, Oliver; Domingues, Francisco S.; Lengauer, Thomas; Sommer, Ingolf

    2008-01-01

    We assess the variability of protein function in protein sequence and structure space. Various regions in this space exhibit considerable difference in the local conservation of molecular function. We analyze and capture local function conservation by means of logistic curves. Based on this analysis, we propose a method for predicting molecular function of a query protein with known structure but unknown function. The prediction method is rigorously assessed and compared with a previously published function predictor. Furthermore, we apply the method to 500 functionally unannotated PDB structures and discuss selected examples. The proposed approach provides a simple yet consistent statistical model for the complex relations between protein sequence, structure, and function. The GOdot method is available online (http://godot.bioinf.mpi-inf.mpg.de). PMID:18604264

  7. SMADs and FOXL2 synergistically regulate murine FSHbeta transcription via a conserved proximal promoter element.

    PubMed

    Tran, Stella; Lamba, Pankaj; Wang, Ying; Bernard, Daniel J

    2011-07-01

    Pituitary FSH regulates ovarian and testicular function. Activins stimulate FSHβ subunit (Fshb) gene transcription in gonadotrope cells, the rate-limiting step in mature FSH synthesis. Activin A-induced murine Fshb gene transcription in immortalized gonadotropes is dependent on homolog of Drosophila mothers against decapentaplegic (SMAD) proteins as well as the forkhead transcription factor FOXL2 (FOXL2). Here, we demonstrate that FOXL2 synergizes with SMAD2, SMAD3, and SMAD4 to stimulate murine Fshb promoter-reporter activity in heterologous cells. Moreover, SMAD3-induction of Fshb promoter activity or endogenous mRNA expression is dependent upon endogenous FOXL2 in homologous cells. FOXL2/SMAD synergy requires binding of both FOXL2 and SMAD3 or SMAD4 to DNA. Of three putative forkhead-binding elements identified in the murine Fshb promoter, only the most proximal is absolutely required for activin A induction of reporter activity in homologous cells. Additionally, mutations to the minimal SMAD-binding element adjacent to the proximal forkhead-binding element abrogate activin A or FOXL2/SMAD3 induction of reporter activity. In contrast, a mutation that impairs an adjacent PBX1/PREP1 (pre-B cell leukemia transcription factor 1-PBX/knotted-1 homeobox-1) binding site does not alter activin A-stimulated promoter activity in homologous cells. Collectively, these and previous data suggest a model in which activins stimulate formation of FOXL2-SMAD2/3/4 complexes, which bind to the proximal murine Fshb promoter to stimulate its transcription. Within these complexes, FOXL2 and SMAD3 or SMAD4 bind to adjacent cis-elements, with SMAD3 brokering the physical interaction with FOXL2. Because this composite response element is highly conserved, this suggests a general mechanism whereby activins may regulate and/or modulate Fshb transcription in mammals. PMID:21622537

  8. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 4 2013-10-01 2013-10-01 false Roadway element not functioning properly. 236.526... element not functioning properly. When a roadway element except track circuit of automatic train stop... roadway element shall be caused manually to display its most restrictive aspect until such element...

  9. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 4 2014-10-01 2014-10-01 false Roadway element not functioning properly. 236.526... element not functioning properly. When a roadway element except track circuit of automatic train stop... roadway element shall be caused manually to display its most restrictive aspect until such element...

  10. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 4 2012-10-01 2012-10-01 false Roadway element not functioning properly. 236.526... element not functioning properly. When a roadway element except track circuit of automatic train stop... roadway element shall be caused manually to display its most restrictive aspect until such element...

  11. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 4 2011-10-01 2011-10-01 false Roadway element not functioning properly. 236.526... element not functioning properly. When a roadway element except track circuit of automatic train stop... roadway element shall be caused manually to display its most restrictive aspect until such element...

  12. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Roadway element not functioning properly. 236.526... element not functioning properly. When a roadway element except track circuit of automatic train stop... roadway element shall be caused manually to display its most restrictive aspect until such element...

  13. Functional equivalence of an evolutionarily conserved RNA binding module.

    PubMed

    Wells, Melissa L; Hicks, Stephanie N; Perera, Lalith; Blackshear, Perry J

    2015-10-01

    Members of the tristetraprolin (TTP) family of proteins participate in the regulation of mRNA turnover after initially binding to AU-rich elements in target mRNAs. Related proteins from most groups of eukaryotes contain a conserved tandem zinc finger (TZF) domain consisting of two closely spaced, similar CCCH zinc fingers that form the primary RNA binding domain. There is considerable sequence variation within the TZF domains from different family members within a single organism and from different organisms, raising questions about sequence-specific effects on RNA binding and decay promotion. We hypothesized that TZF domains from evolutionarily distant species are functionally interchangeable. The single family member expressed in the fission yeast Schizosaccharomyces pombe, Zfs1, promotes the turnover of several dozen transcripts, some of which are involved in cell-cell interactions. Using knockin techniques, we replaced the TZF domain of S. pombe Zfs1 with the equivalent domains from human TTP and the single family member proteins expressed in the silkworm Bombyx mori, the pathogenic yeast Candida guilliermondii, and the plant Chromolaena odorata. We found that the TZF domains from these widely disparate species could completely substitute for the native S. pombe TZF domain, as determined by measurement of target transcript levels and the flocculation phenotype characteristic of Zfs1 deletion. Recombinant TZF domain peptides from several of these species bound to an AU-rich RNA oligonucleotide with comparably high affinity. We conclude that the TZF domains from TTP family members in these evolutionarily widely divergent species are functionally interchangeable in mRNA binding and decay. PMID:26292216

  14. Recurrent Modification of a Conserved Cis-Regulatory Element Underlies Fruit Fly Pigmentation Diversity

    PubMed Central

    Rogers, William A.; Salomone, Joseph R.; Tacy, David J.; Camino, Eric M.; Davis, Kristen A.; Rebeiz, Mark; Williams, Thomas M.

    2013-01-01

    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages. PMID:24009528

  15. Conserved Structural Elements in the V3 Crown of HIV-1 gp120

    SciTech Connect

    Jiang, X.; Burke, V; Totrov, M; Williams, C; Cardozo, T; Gorny, M; Zolla-Pazner, S; Kong, X

    2010-01-01

    Binding of the third variable region (V3) of the HIV-1 envelope glycoprotein gp120 to the cell-surface coreceptors CCR5 or CXCR4 during viral entry suggests that there are conserved structural elements in this sequence-variable region. These conserved elements could serve as epitopes to be targeted by a vaccine against HIV-1. Here we perform a systematic structural analysis of representative human anti-V3 monoclonal antibodies in complex with V3 peptides, revealing that the crown of V3 has four conserved structural elements: an arch, a band, a hydrophobic core and the peptide backbone. These are either unaffected by or are subject to minimal sequence variation. As these regions are targeted by cross-clade neutralizing human antibodies, they provide a blueprint for the design of vaccine immunogens that could elicit broadly cross-reactive protective antibodies.

  16. Application of the space-time conservation element and solution element method to shock-tube problem

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Chow, Chuen-Yen; Chang, Sin-Chung

    1994-01-01

    An Euler solver based on the method of space-time conservation element and solution element is in this paper to simulate shock-tube flows involving shock waves, contact discontinuities, expansion waves and their intersections. Seven test problems are considered to examine the capability of this method. The numerical results, when compared with exact solutions and/or numerical solutions by other methods, indicate that the present method can accurately resolve strong shock and contact discontinuities without using any ad hoc techniques which are used only at the neighborhood of a discontinuity.

  17. Application of the space-time conservation element and solution element method to two-dimensional advection-diffusion problems

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Chow, Chuen-Yen; Chang, Sin-Chung

    1995-01-01

    The existing 2-D alpha-mu scheme and alpha-epsilon scheme based on the method of space-time conservation element and solution element, which were constructed for solving the linear 2-D unsteady advection-diffusion equation and unsteady advection equation, respectively, are tested. Also, the alpha-epsilon scheme is modified to become the V-E scheme for solving the nonlinear 2-D inviscid Burgers equation. Numerical solutions of six test problems are presented in comparison with their exact solutions or numerical solutions obtained by traditional finite-difference or finite-element methods. It is demonstrated that the 2-D alpha-mu, alpha-epsilon, and nu-epsilon schemes can be used to obtain numerical results which are more accurate than those based on some of the traditional methods but without using any artificial tuning in the computation. Similar to the previous 1-D test problems, the high accuracy and simplicity features of the space-time conservation element and solution element method have been revealed again in the present 2-D test results.

  18. Similarity in Shape Dictates Signature Intrinsic Dynamics Despite No Functional Conservation in TIM Barrel Enzymes

    PubMed Central

    Tiwari, Sandhya P.; Reuter, Nathalie

    2016-01-01

    The conservation of the intrinsic dynamics of proteins emerges as we attempt to understand the relationship between sequence, structure and functional conservation. We characterise the conservation of such dynamics in a case where the structure is conserved but function differs greatly. The triosephosphate isomerase barrel fold (TBF), renowned for its 8 β-strand-α-helix repeats that close to form a barrel, is one of the most diverse and abundant folds found in known protein structures. Proteins with this fold have diverse enzymatic functions spanning five of six Enzyme Commission classes, and we have picked five different superfamily candidates for our analysis using elastic network models. We find that the overall shape is a large determinant in the similarity of the intrinsic dynamics, regardless of function. In particular, the β-barrel core is highly rigid, while the α-helices that flank the β-strands have greater relative mobility, allowing for the many possibilities for placement of catalytic residues. We find that these elements correlate with each other via the loops that link them, as opposed to being directly correlated. We are also able to analyse the types of motions encoded by the normal mode vectors of the α-helices. We suggest that the global conservation of the intrinsic dynamics in the TBF contributes greatly to its success as an enzymatic scaffold both through evolution and enzyme design. PMID:27015412

  19. Sequence conservation and functional constraint on intergenic spacers in reduced genomes of the obligate symbiont Buchnera.

    PubMed

    Degnan, Patrick H; Ochman, Howard; Moran, Nancy A

    2011-09-01

    Analyses of genome reduction in obligate bacterial symbionts typically focus on the removal and retention of protein-coding regions, which are subject to ongoing inactivation and deletion. However, these same forces operate on intergenic spacers (IGSs) and affect their contents, maintenance, and rates of evolution. IGSs comprise both non-coding, non-functional regions, including decaying pseudogenes at varying stages of recognizability, as well as functional elements, such as genes for sRNAs and regulatory control elements. The genomes of Buchnera and other small genome symbionts display biased nucleotide compositions and high rates of sequence evolution and contain few recognizable regulatory elements. However, IGS lengths are highly correlated across divergent Buchnera genomes, suggesting the presence of functional elements. To identify functional regions within the IGSs, we sequenced two Buchnera genomes (from aphid species Uroleucon ambrosiae and Acyrthosiphon kondoi) and applied a phylogenetic footprinting approach to alignments of orthologous IGSs from a total of eight Buchnera genomes corresponding to six aphid species. Inclusion of these new genomes allowed comparative analyses at intermediate levels of divergence, enabling the detection of both conserved elements and previously unrecognized pseudogenes. Analyses of these genomes revealed that 232 of 336 IGS alignments over 50 nucleotides in length displayed substantial sequence conservation. Conserved alignment blocks within these IGSs encompassed 88 Shine-Dalgarno sequences, 55 transcriptional terminators, 5 Sigma-32 binding sites, and 12 novel small RNAs. Although pseudogene formation, and thus IGS formation, are ongoing processes in these genomes, a large proportion of intergenic spacers contain functional sequences. PMID:21912528

  20. Conservative site-specific and single-copy transgenesis in human LINE-1 elements

    PubMed Central

    Vijaya Chandra, Shree Harsha; Makhija, Harshyaa; Peter, Sabrina; Myint Wai, Cho Mar; Li, Jinming; Zhu, Jindong; Ren, Zhonglu; D'Alcontres, Martina Stagno; Siau, Jia Wei; Chee, Sharon; Ghadessy, Farid John; Dröge, Peter

    2016-01-01

    Genome engineering of human cells plays an important role in biotechnology and molecular medicine. In particular, insertions of functional multi-transgene cassettes into suitable endogenous sequences will lead to novel applications. Although several tools have been exploited in this context, safety issues such as cytotoxicity, insertional mutagenesis and off-target cleavage together with limitations in cargo size/expression often compromise utility. Phage λ integrase (Int) is a transgenesis tool that mediates conservative site-specific integration of 48 kb DNA into a safe harbor site of the bacterial genome. Here, we show that an Int variant precisely recombines large episomes into a sequence, termed attH4X, found in 1000 human Long INterspersed Elements-1 (LINE-1). We demonstrate single-copy transgenesis through attH4X-targeting in various cell lines including hESCs, with the flexibility of selecting clones according to transgene performance and downstream applications. This is exemplified with pluripotency reporter cassettes and constitutively expressed payloads that remain functional in LINE1-targeted hESCs and differentiated progenies. Furthermore, LINE-1 targeting does not induce DNA damage-response or chromosomal aberrations, and neither global nor localized endogenous gene expression is substantially affected. Hence, this simple transgene addition tool should become particularly useful for applications that require engineering of the human genome with multi-transgenes. PMID:26673710

  1. Conservative site-specific and single-copy transgenesis in human LINE-1 elements.

    PubMed

    Vijaya Chandra, Shree Harsha; Makhija, Harshyaa; Peter, Sabrina; Myint Wai, Cho Mar; Li, Jinming; Zhu, Jindong; Ren, Zhonglu; D'Alcontres, Martina Stagno; Siau, Jia Wei; Chee, Sharon; Ghadessy, Farid John; Dröge, Peter

    2016-04-01

    Genome engineering of human cells plays an important role in biotechnology and molecular medicine. In particular, insertions of functional multi-transgene cassettes into suitable endogenous sequences will lead to novel applications. Although several tools have been exploited in this context, safety issues such as cytotoxicity, insertional mutagenesis and off-target cleavage together with limitations in cargo size/expression often compromise utility. Phage λ integrase (Int) is a transgenesis tool that mediates conservative site-specific integration of 48 kb DNA into a safe harbor site of the bacterial genome. Here, we show that an Int variant precisely recombines large episomes into a sequence, termedattH4X, found in 1000 human Long INterspersed Elements-1 (LINE-1). We demonstrate single-copy transgenesis throughattH4X-targeting in various cell lines including hESCs, with the flexibility of selecting clones according to transgene performance and downstream applications. This is exemplified with pluripotency reporter cassettes and constitutively expressed payloads that remain functional inLINE1-targeted hESCs and differentiated progenies. Furthermore,LINE-1targeting does not induce DNA damage-response or chromosomal aberrations, and neither global nor localized endogenous gene expression is substantially affected. Hence, this simple transgene addition tool should become particularly useful for applications that require engineering of the human genome with multi-transgenes. PMID:26673710

  2. Identification of a Conserved Non-Protein-Coding Genomic Element that Plays an Essential Role in Alphabaculovirus Pathogenesis

    PubMed Central

    Kikhno, Irina

    2014-01-01

    Highly homologous sequences 154–157 bp in length grouped under the name of “conserved non-protein-coding element” (CNE) were revealed in all of the sequenced genomes of baculoviruses belonging to the genus Alphabaculovirus. A CNE alignment led to the detection of a set of highly conserved nucleotide clusters that occupy strictly conserved positions in the CNE sequence. The significant length of the CNE and conservation of both its length and cluster architecture were identified as a combination of characteristics that make this CNE different from known viral non-coding functional sequences. The essential role of the CNE in the Alphabaculovirus life cycle was demonstrated through the use of a CNE-knockout Autographa californica multiple nucleopolyhedrovirus (AcMNPV) bacmid. It was shown that the essential function of the CNE was not mediated by the presumed expression activities of the protein- and non-protein-coding genes that overlap the AcMNPV CNE. On the basis of the presented data, the AcMNPV CNE was categorized as a complex-structured, polyfunctional genomic element involved in an essential DNA transaction that is associated with an undefined function of the baculovirus genome. PMID:24740153

  3. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.

    2016-01-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  4. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.

    PubMed

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R

    2016-09-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  5. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  6. p53 genes function to restrain mobile elements.

    PubMed

    Wylie, Annika; Jones, Amanda E; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V; Rakheja, Dinesh; Chen, Kenneth S; Hammer, Robert E; Comerford, Sarah A; Amatruda, James F; Abrams, John M

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53(-) germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5' sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  7. Functionally conserved effects of rapamycin exposure on zebrafish.

    PubMed

    Sucularli, Ceren; Shehwana, Huma; Kuscu, Cem; Dungul, Dilay Ciglidag; Ozdag, Hilal; Konu, Ozlen

    2016-05-01

    Mechanistic target of rapamycin (mTOR) is a conserved serine/threonine kinase important in cell proliferation, growth and protein translation. Rapamycin, a well‑known anti‑cancer agent and immunosuppressant drug, inhibits mTOR activity in different taxa including zebrafish. In the present study, the effect of rapamycin exposure on the transcriptome of a zebrafish fibroblast cell line, ZF4, was investigated. Microarray analysis demonstrated that rapamycin treatment modulated a large set of genes with varying functions including protein synthesis, assembly of mitochondrial and proteasomal machinery, cell cycle, metabolism and oxidative phosphorylation in ZF4 cells. A mild however, coordinated reduction in the expression of proteasomal and mitochondrial ribosomal subunits was detected, while the expression of numerous ribosomal subunits increased. Meta‑analysis of heterogeneous mouse rapamycin microarray datasets enabled the comparison of zebrafish and mouse pathways modulated by rapamycin, using Kyoto Encyclopedia of Genes and Genomes and Gene Ontology pathway analysis. The analyses demonstrated a high degree of functional conservation between zebrafish and mice in response to rapamycin. In addition, rapamycin treatment resulted in a marked dose‑dependent reduction in body size and pigmentation in zebrafish embryos. The present study is the first, to the best of our knowledge, to evaluate the conservation of rapamycin‑modulated functional pathways between zebrafish and mice, in addition to the dose‑dependent growth curves of zebrafish embryos upon rapamycin exposure. PMID:27035657

  8. Functional and Structural Analysis of the Conserved EFhd2 Protein

    PubMed Central

    Acosta, Yancy Ferrer; Rodríguez Cruz, Eva N.; Vaquer, Ana del C.; Vega, Irving E.

    2013-01-01

    EFhd2 is a novel protein conserved from C. elegans to H. sapiens. This novel protein was originally identified in cells of the immune and central nervous systems. However, it is most abundant in the central nervous system, where it has been found associated with pathological forms of the microtubule-associated protein tau. The physiological or pathological roles of EFhd2 are poorly understood. In this study, a functional and structural analysis was carried to characterize the molecular requirements for EFhd2’s calcium binding activity. The results showed that mutations of a conserved aspartate on either EF-hand motif disrupted the calcium binding activity, indicating that these motifs work in pair as a functional calcium binding domain. Furthermore, characterization of an identified single-nucleotide polymorphisms (SNP) that introduced a missense mutation indicates the importance of a conserved phenylalanine on EFhd2 calcium binding activity. Structural analysis revealed that EFhd2 is predominantly composed of alpha helix and random coil structures and that this novel protein is thermostable. EFhd2’s thermo stability depends on its N-terminus. In the absence of the N-terminus, calcium binding restored EFhd2’s thermal stability. Overall, these studies contribute to our understanding on EFhd2 functional and structural properties, and introduce it into the family of canonical EF-hand domain containing proteins. PMID:22973849

  9. Functional Constraint Profiling of a Viral Protein Reveals Discordance of Evolutionary Conservation and Functionality

    PubMed Central

    Wu, Nicholas C.; Olson, C. Anders; Du, Yushen; Le, Shuai; Tran, Kevin; Remenyi, Roland; Gong, Danyang; Al-Mawsawi, Laith Q.; Qi, Hangfei; Wu, Ting-Ting; Sun, Ren

    2015-01-01

    Viruses often encode proteins with multiple functions due to their compact genomes. Existing approaches to identify functional residues largely rely on sequence conservation analysis. Inferring functional residues from sequence conservation can produce false positives, in which the conserved residues are functionally silent, or false negatives, where functional residues are not identified since they are species-specific and therefore non-conserved. Furthermore, the tedious process of constructing and analyzing individual mutations limits the number of residues that can be examined in a single study. Here, we developed a systematic approach to identify the functional residues of a viral protein by coupling experimental fitness profiling with protein stability prediction using the influenza virus polymerase PA subunit as the target protein. We identified a significant number of functional residues that were influenza type-specific and were evolutionarily non-conserved among different influenza types. Our results indicate that type-specific functional residues are prevalent and may not otherwise be identified by sequence conservation analysis alone. More importantly, this technique can be adapted to any viral (and potentially non-viral) protein where structural information is available. PMID:26132554

  10. Structure-aided prediction of mammalian transcription factor complexes in conserved non-coding elements.

    PubMed

    Guturu, Harendra; Doxey, Andrew C; Wenger, Aaron M; Bejerano, Gill

    2013-12-19

    Mapping the DNA-binding preferences of transcription factor (TF) complexes is critical for deciphering the functions of cis-regulatory elements. Here, we developed a computational method that compares co-occurring motif spacings in conserved versus unconserved regions of the human genome to detect evolutionarily constrained binding sites of rigid TF complexes. Structural data were used to estimate TF complex physical plausibility, explore overlapping motif arrangements seldom tackled by non-structure-aware methods, and generate and analyse three-dimensional models of the predicted complexes bound to DNA. Using this approach, we predicted 422 physically realistic TF complex motifs at 18% false discovery rate, the majority of which (326, 77%) contain some sequence overlap between binding sites. The set of mostly novel complexes is enriched in known composite motifs, predictive of binding site configurations in TF-TF-DNA crystal structures, and supported by ChIP-seq datasets. Structural modelling revealed three cooperativity mechanisms: direct protein-protein interactions, potentially indirect interactions and 'through-DNA' interactions. Indeed, 38% of the predicted complexes were found to contain four or more bases in which TF pairs appear to synergize through overlapping binding to the same DNA base pairs in opposite grooves or strands. Our TF complex and associated binding site predictions are available as a web resource at http://bejerano.stanford.edu/complex. PMID:24218641

  11. Conserved enhancer and silencer elements responsible for differential Adh transcription in Drosophila cell lines.

    PubMed Central

    Ayer, S; Benyajati, C

    1990-01-01

    The distal promoter of Adh is differentially expressed in Drosophila tissue culture cell lines. After transfection with an exogenous Adh gene, there was a specific increase in distal alcohol dehydrogenase (ADH) transcripts in ADH-expressing (ADH+) cells above the levels observed in transfected ADH-nonexpressing (ADH-) cells. We used deletion mutations and a comparative transient-expression assay to identify the cis-acting elements responsible for enhanced Adh distal transcription in ADH+ cells. DNA sequences controlling high levels of distal transcription were localized to a 15-base-pair (bp) region nearly 500 bp upstream of the distal RNA start site. In addition, a 61-bp negative cis-acting element was found upstream from and adjacent to the enhancer. When this silencer element was deleted, distal transcription increased only in the ADH+ cell line. These distant upstream elements must interact with the promoter elements, the Adf-1-binding site and the TATA box, as they only influenced transcription when at least one of these two positive distal promoter elements was present. Internal deletions targeted to the Adf-1-binding site or the TATA box reduced transcription in both cell types but did not affect the transcription initiation site. Distal transcription in transfected ADH- cells appears to be controlled primarily through these promoter elements and does not involve the upstream regulatory elements. Evolutionary conservation in distantly related Drosophila species suggests the importance of these upstream elements in correct developmental and tissue-specific expression of ADH. Images PMID:1694013

  12. Application of the Space-Time Conservation Element and Solution Element Method to One-Dimensional Advection-Diffusion Problems

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Chow, Chuen-Yen; Chang, Sin-Chung

    1999-01-01

    Test problems are used to examine the performance of several one-dimensional numerical schemes based on the space-time conservation and solution element (CE/SE) method. Investigated in this paper are the CE/SE schemes constructed previously for solving the linear unsteady advection-diffusion equation and the schemes derived here for solving the nonlinear viscous and inviscid Burgers equations. In comparison with the numerical solutions obtained using several traditional finite-difference schemes with similar accuracy, the CE/SE solutions display much lower numerical dissipation and dispersion errors.

  13. Discovery of functional non-coding conserved regions in the α-synuclein gene locus

    PubMed Central

    Sterling, Lori; Walter, Michael; Ting, Dennis; Schüle, Birgitt

    2014-01-01

    Several single nucleotide polymorphisms (SNPs) and the Rep-1 microsatellite marker of the α-synuclein ( SNCA) gene have consistently been shown to be associated with Parkinson’s disease, but the functional relevance is unclear. Based on these findings we hypothesized that conserved cis-regulatory elements in the SNCA genomic region regulate expression of SNCA, and that SNPs in these regions could be functionally modulating the expression of SNCA, thus contributing to neuronal demise and predisposing to Parkinson’s disease. In a pair-wise comparison of a 206kb genomic region encompassing the SNCA gene, we revealed 34 evolutionary conserved DNA sequences between human and mouse. All elements were cloned into reporter vectors and assessed for expression modulation in dual luciferase reporter assays.  We found that 12 out of 34 elements exhibited either an enhancement or reduction of the expression of the reporter gene. Three elements upstream of the SNCA gene displayed an approximately 1.5 fold (p<0.009) increase in expression. Of the intronic regions, three showed a 1.5 fold increase and two others indicated a 2 and 2.5 fold increase in expression (p<0.002). Three elements downstream of the SNCA gene showed 1.5 fold and 2.5 fold increase (p<0.0009). One element downstream of SNCA had a reduced expression of the reporter gene of 0.35 fold (p<0.0009) of normal activity. Our results demonstrate that the SNCA gene contains cis-regulatory regions that might regulate the transcription and expression of SNCA. Further studies in disease-relevant tissue types will be important to understand the functional impact of regulatory regions and specific Parkinson’s disease-associated SNPs and its function in the disease process. PMID:25566351

  14. The Method of Space-time Conservation Element and Solution Element: Development of a New Implicit Solver

    NASA Technical Reports Server (NTRS)

    Chang, S. C.; Wang, X. Y.; Chow, C. Y.; Himansu, A.

    1995-01-01

    The method of space-time conservation element and solution element is a nontraditional numerical method designed from a physicist's perspective, i.e., its development is based more on physics than numerics. It uses only the simplest approximation techniques and yet is capable of generating nearly perfect solutions for a 2-D shock reflection problem used by Helen Yee and others. In addition to providing an overall view of the new method, we introduce a new concept in the design of implicit schemes, and use it to construct a highly accurate solver for a convection-diffusion equation. It is shown that, in the inviscid case, this new scheme becomes explicit and its amplification factors are identical to those of the Leapfrog scheme. On the other hand, in the pure diffusion case, its principal amplification factor becomes the amplification factor of the Crank-Nicolson scheme.

  15. Functional characterization of the eukaryotic SECIS elements which direct selenocysteine insertion at UGA codons.

    PubMed Central

    Berry, M J; Banu, L; Harney, J W; Larsen, P R

    1993-01-01

    We investigated the requirements for selenocysteine insertion at single or multiple UGA codons in eukaryotic selenoproteins. Two functional SECIS elements were identified in the 3' untranslated region of the rat selenoprotein P mRNA, with predicted stem-loops and critical nucleotides similar to those in the SECIS elements in the type I iodothyronine 5' deiodinase (5'DI) and glutathione peroxidase selenoprotein mRNAs. Site-directed mutational analyses of three SECIS elements confirmed that conserved nucleotides in the loop and in unpaired regions of the stem are critical for activity. This indicates that multiple contact sites are required for SECIS function. Stop codon function at any of five out-of-context UGA codons in the 5'DI mRNA was suppressed by SECIS elements from the 5'DI or selenoprotein P genes linked downstream. Thus, the presence of SECIS elements in eukaryotic selenoprotein mRNAs permits complete flexibility in UGA codon position. Images PMID:8344267

  16. Interpolation functions in the immersed boundary and finite element methods

    NASA Astrophysics Data System (ADS)

    Wang, Xingshi; Zhang, Lucy T.

    2010-03-01

    In this paper, we review the existing interpolation functions and introduce a finite element interpolation function to be used in the immersed boundary and finite element methods. This straightforward finite element interpolation function for unstructured grids enables us to obtain a sharper interface that yields more accurate interfacial solutions. The solution accuracy is compared with the existing interpolation functions such as the discretized Dirac delta function and the reproducing kernel interpolation function. The finite element shape function is easy to implement and it naturally satisfies the reproducing condition. They are interpolated through only one element layer instead of smearing to several elements. A pressure jump is clearly captured at the fluid-solid interface. Two example problems are studied and results are compared with other numerical methods. A convergence test is thoroughly conducted for the independent fluid and solid meshes in a fluid-structure interaction system. The required mesh size ratio between the fluid and solid domains is obtained.

  17. Characterization of a conserved extrachromosomal element isolated from the avian malarial parasite Plasmodium gallinaceum.

    PubMed Central

    Joseph, J T; Aldritt, S M; Unnasch, T; Puijalon, O; Wirth, D F

    1989-01-01

    We have identified a conserved, repeated, and highly transcribed DNA element from the avian malarial parasite Plasmodium gallinaceum. The element produced multiple transcripts in both zygotes and asexual blood stages of this parasite. It was found to be highly conserved in all of five malarial species tested and hybridized at reduced stringency to other members of the phylum Apicomplexa, including the genera Babesia, Eimeria, Toxoplasma, and Theileria. The copy number of the element was about 15, and it had a circularly permuted restriction map with a repeat unit length of about 6.2 kilobases. It could be separated from the main genomic DNA by using sucrose gradients and agarose gels, and it migrated separately from the recognized Plasmodium chromosomes on pulse-field gels. In the accompanying paper (S. M. Aldritt, J. T. Joseph, and D. F. Wirth, Mol. Cell. Biol. 9:3614-3620, 1989), evidence is presented that element contains the mitochondrial genes for the protein cytochrome b and a fragment of the large rRNA. We postulate that this element is an episome in the mitochondria of the obligate parasites belonging to the phylum Apicomplexa. Images PMID:2779561

  18. Two evolutionarily conserved sequence elements for Peg3/Usp29 transcription

    PubMed Central

    Kim, Jeong Do; Yu, Sungryul; Choo, Jung Ha; Kim, Joomyeong

    2008-01-01

    Background Two evolutionarily Conserved Sequence Elements, CSE1 and CSE2 (YY1 binding sites), are found within the 3.8-kb CpG island surrounding the bidirectional promoter of two imprinted genes, Peg3 (Paternally expressed gene 3) and Usp29 (Ubiquitin-specific protease 29). This CpG island is a likely ICR (Imprinting Control Region) that controls transcription of the 500-kb genomic region of the Peg3 imprinted domain. Results The current study investigated the functional roles of CSE1 and CSE2 in the transcriptional control of the two genes, Peg3 and Usp29, using cell line-based promoter assays. The mutation of 6 YY1 binding sites (CSE2) reduced the transcriptional activity of the bidirectional promoter in the Peg3 direction in an orientation-dependent manner, suggesting an activator role for CSE2 (YY1 binding sites). However, the activity in the Usp29 direction was not detectable regardless of the presence/absence of YY1 binding sites. In contrast, mutation of CSE1 increased the transcriptional activity of the promoter in both the Peg3 and Usp29 directions, suggesting a potential repressor role for CSE1. The observed repression by CSE1 was also orientation-dependent. Serial mutational analyses further narrowed down two separate 6-bp-long regions within the 42-bp-long CSE1 which are individually responsible for the repression of Peg3 and Usp29. Conclusion CSE2 (YY1 binding sites) functions as an activator for Peg3 transcription, while CSE1 acts as a repressor for the transcription of both Peg3 and Usp29. PMID:19068137

  19. A strongly conservative finite element method for the coupling of Stokes and Darcy flow

    NASA Astrophysics Data System (ADS)

    Kanschat, G.; Rivière, B.

    2010-08-01

    We consider a model of coupled free and porous media flow governed by Stokes and Darcy equations with the Beavers-Joseph-Saffman interface condition. This model is discretized using divergence-conforming finite elements for the velocities in the whole domain. Discontinuous Galerkin techniques and mixed methods are used in the Stokes and Darcy subdomains, respectively. This discretization is strongly conservative in Hdiv( Ω) and we show convergence. Numerical results validate our findings and indicate optimal convergence orders.

  20. A brief description of a new numerical framework for solving conservation laws: The method of space-time conservation element and solution element

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; To, Wai-Ming

    1992-01-01

    A new numerical method for solving conservation laws is being developed. It differs substantially from the well established methods, i.e., finite difference, finite volume, finite element, and spectral methods, in both concept and methodology. It is much simpler than a typical high resolution method. No flux limiter or any technique related to characteristics is involved. No artificial viscosity or smoothing is introduced, and no moving mesh is used. Yet this method is capable of generating highly accurate shock tube solutions. The slight numerical overshoot and/or oscillations generated can be removed if a simple averaging formula initially used is replaced by a weighted formula. This modification has little effect on other parts of the solution. Because of its simplicity, generalization of this new method for multi-dimensional problems is straightforward.

  1. Almost-Killing conserved currents: A general mass function

    NASA Astrophysics Data System (ADS)

    Ruiz, Milton; Palenzuela, Carlos; Bona, Carles

    2014-01-01

    A new class of conserved currents, describing nongravitational energy-momentum density, is presented. The proposed currents do not require the existence of a (timelike) Killing vector, and are not restricted to spherically symmetric spacetimes (or similar ones, in which the Kodama vector can be defined). They are based instead on almost-Killing vectors, which could in principle be defined on generic spacetimes. We provide local arguments, based on energy density profiles in highly simplified (stationary, rigidly rotating) star models, which confirm the physical interest of these almost-Killing currents. A mass function is defined in this way for the spherical case, qualitatively different from the Hernández-Misner mass function. An elliptic equation determining the new mass function is derived for the Tolman-Bondi spherically symmetric dust metrics, including a simple solution for the Oppenheimer-Snyder collapse. The equations for the nonsymmetric case are shown to be of a mixed elliptic-hyperbolic nature.

  2. Does the evolutionary conservation of microsatellite loci imply function?

    SciTech Connect

    Shriver, M.D.; Deka, R.; Ferrell, R.E.

    1994-09-01

    Microsatellites are highly polymorphic tandem arrays of short (1-6 bp) sequence motifs which have been found widely distributed in the genomes of all eukaryotes. We have analyzed allele frequency data on 16 microsatellite loci typed in the great apes (human, chimp, orangutan, and gorilla). The majority of these loci (13) were isolated from human genomic libraries; three were cloned from chimpanzee genomic DNA. Most of these loci are not only present in all apes species, but are polymorphic with comparable levels of heterozygosity and have alleles which overlap in size. The extent of divergence of allele frequencies among these four species were studies using the stepwise-weighted genetic distance (Dsw), which was previously shown to conform to linearity with evolutionary time since divergence for loci where mutations exist in a stepwise fashion. The phylogenetic tree of the great apes constructed from this distance matrix was consistent with the expected topology, with a high bootstrap confidence (82%) for the human/chimp clade. However, the allele frequency distributions of these species are 10 times more similar to each other than expected when they were calibrated with a conservative estimate of the time since separation of humans and the apes. These results are in agreement with sequence-based surveys of microsatellites which have demonstrated that they are highly (90%) conserved over short periods of evolutionary time (< 10 million years) and moderately (30%) conserved over long periods of evolutionary time (> 60-80 million years). This evolutionary conservation has prompted some authors to speculate that there are functional constraints on microsatellite loci. In contrast, the presence of directional bias of mutations with constraints and/or selection against aberrant sized alleles can explain these results.

  3. Highly conserved elements discovered in vertebrates are present in non-syntenic loci of tunicates, act as enhancers and can be transcribed during development

    PubMed Central

    Sanges, Remo; Hadzhiev, Yavor; Gueroult-Bellone, Marion; Roure, Agnes; Ferg, Marco; Meola, Nicola; Amore, Gabriele; Basu, Swaraj; Brown, Euan R.; De Simone, Marco; Petrera, Francesca; Licastro, Danilo; Strähle, Uwe; Banfi, Sandro; Lemaire, Patrick; Birney, Ewan; Müller, Ferenc; Stupka, Elia

    2013-01-01

    Co-option of cis-regulatory modules has been suggested as a mechanism for the evolution of expression sites during development. However, the extent and mechanisms involved in mobilization of cis-regulatory modules remains elusive. To trace the history of non-coding elements, which may represent candidate ancestral cis-regulatory modules affirmed during chordate evolution, we have searched for conserved elements in tunicate and vertebrate (Olfactores) genomes. We identified, for the first time, 183 non-coding sequences that are highly conserved between the two groups. Our results show that all but one element are conserved in non-syntenic regions between vertebrate and tunicate genomes, while being syntenic among vertebrates. Nevertheless, in all the groups, they are significantly associated with transcription factors showing specific functions fundamental to animal development, such as multicellular organism development and sequence-specific DNA binding. The majority of these regions map onto ultraconserved elements and we demonstrate that they can act as functional enhancers within the organism of origin, as well as in cross-transgenesis experiments, and that they are transcribed in extant species of Olfactores. We refer to the elements as ‘Olfactores conserved non-coding elements’. PMID:23393190

  4. The putative role of some conserved water molecules in the structure and function of human transthyretin.

    PubMed

    Banerjee, Avik; Dasgupta, Subrata; Mukhopadhyay, Bishnu P; Sekar, Kanagaraj

    2015-11-01

    Human transthyretin (hTTR) is a multifunctional protein that is involved in several neurodegenerative diseases. Besides the transportation of thyroxin and vitamin A, it is also involved in the proteolysis of apolipoprotein A1 and Aβ peptide. Extensive analyses of 32 high-resolution X-ray and neutron diffraction structures of hTTR followed by molecular-dynamics simulation studies using a set of 15 selected structures affirmed the presence of 44 conserved water molecules in its dimeric structure. They are found to play several important roles in the structure and function of the protein. Eight water molecules stabilize the dimeric structure through an extensive hydrogen-bonding network. The absence of some of these water molecules in highly acidic conditions (pH ≤ 4.0) severely affects the interfacial hydrogen-bond network, which may destabilize the native tetrameric structure, leading to its dissociation. Three pairs of conserved water molecules contribute to maintaining the geometry of the ligand-binding cavities. Some other water molecules control the orientation and dynamics of different structural elements of hTTR. This systematic study of the location, absence, networking and interactions of the conserved water molecules may shed some light on various structural and functional aspects of the protein. The present study may also provide some rational clues about the conserved water-mediated architecture and stability of hTTR. PMID:26527142

  5. Hedgehog signaling pathway function conserved in Tribolium segmentation.

    PubMed

    Farzana, Laila; Brown, Susan J

    2008-04-01

    In Drosophila, maintenance of parasegmental boundaries and formation of segmental grooves depend on interactions between segment polarity genes. Wingless and Engrailed appear to have similar roles in both short and long germ segmentation, but relatively little is known about the extent to which Hedgehog signaling is conserved. In a companion study to the Tribolium genome project, we analyzed the expression and function of hedgehog, smoothened, patched, and cubitus interruptus orthologs during segmentation in Tribolium. Their expression was largely conserved between Drosophila and Tribolium. Parental RNAi analysis of positive regulators of the pathway (Tc-hh, Tc-smo, or Tc-ci) resulted in small spherical cuticles with little or no evidence of segmental grooves. Segmental Engrailed expression in these embryos was initiated but not maintained. Wingless-independent Engrailed expression in the CNS was maintained and became highly compacted during germ band retraction, providing evidence that derivatives from every segment were present in these small spherical embryos. On the other hand, RNAi analysis of a negative regulator (Tc-ptc) resulted in embryos with ectopic segmental grooves visible during germband elongation but not discernible in the first instar larval cuticles. These transient grooves formed adjacent to Engrailed expressing cells that encircled wider than normal wg domains in the Tc-ptc RNAi embryos. These results suggest that the en-wg-hh gene circuit is functionally conserved in the maintenance of segmental boundaries during germ band retraction and groove formation in Tribolium and that the segment polarity genes form a robust genetic regulatory module in the segmentation of this short germ insect. PMID:18392879

  6. Functional conservation of an ancestral Pellino protein in helminth species.

    PubMed

    Cluxton, Christopher D; Caffrey, Brian E; Kinsella, Gemma K; Moynagh, Paul N; Fares, Mario A; Fallon, Padraic G

    2015-01-01

    The immune system of H. sapiens has innate signaling pathways that arose in ancestral species. This is exemplified by the discovery of the Toll-like receptor (TLR) pathway using free-living model organisms such as Drosophila melanogaster. The TLR pathway is ubiquitous and controls sensitivity to pathogen-associated molecular patterns (PAMPs) in eukaryotes. There is, however, a marked absence of this pathway from the plathyhelminthes, with the exception of the Pellino protein family, which is present in a number of species from this phylum. Helminth Pellino proteins are conserved having high similarity, both at the sequence and predicted structural protein level, with that of human Pellino proteins. Pellino from a model helminth, Schistosoma mansoni Pellino (SmPellino), was shown to bind and poly-ubiquitinate human IRAK-1, displaying E3 ligase activity consistent with its human counterparts. When transfected into human cells SmPellino is functional, interacting with signaling proteins and modulating mammalian signaling pathways. Strict conservation of a protein family in species lacking its niche signalling pathway is rare and provides a platform to examine the ancestral functions of Pellino proteins that may translate into novel mechanisms of immune regulation in humans. PMID:26120048

  7. Conservation patterns in different functional sequence categoriesof divergent Drosophila species

    SciTech Connect

    Papatsenko, Dmitri; Kislyuk, Andrey; Levine, Michael; Dubchak, Inna

    2005-10-01

    We have explored the distributions of fully conservedungapped blocks in genome-wide pairwise alignments of recently completedspecies of Drosophila: D.yakuba, D.ananassae, D.pseudoobscura, D.virilisand D.mojavensis. Based on these distributions we have found that nearlyevery functional sequence category possesses its own distinctiveconservation pattern, sometimes independent of the overall sequenceconservation level. In the coding and regulatory regions, the ungappedblocks were longer than in introns, UTRs and non-functional sequences. Atthe same time, the blocks in the coding regions carried 3N+2 signaturecharacteristic to synonymic substitutions in the 3rd codon positions.Larger block sizes in transcription regulatory regions can be explainedby the presence of conserved arrays of binding sites for transcriptionfactors. We also have shown that the longest ungapped blocks, or'ultraconserved' sequences, are associated with specific gene groups,including those encoding ion channels and components of the cytoskeleton.We discussed how restrained conservation patterns may help in mappingfunctional sequence categories and improving genomeannotation.

  8. Conservation of Planar Polarity Pathway Function Across the Animal Kingdom.

    PubMed

    Hale, Rosalind; Strutt, David

    2015-01-01

    Planar polarity is a well-studied phenomenon resulting in the directional coordination of cells in the plane of a tissue. In invertebrates and vertebrates, planar polarity is established and maintained by the largely independent core and Fat/Dachsous/Four-jointed (Ft-Ds-Fj) pathways. Loss of function of these pathways can result in a wide range of developmental or cellular defects, including failure of gastrulation and problems with placement and function of cilia. This review discusses the conservation of these pathways across the animal kingdom. The lack of vital core pathway components in basal metazoans suggests that the core planar polarity pathway evolved shortly after, but not necessarily alongside, the emergence of multicellularity. PMID:26360326

  9. PHYLOGENOMICS - GUIDED VALIDATION OF FUNCTION FOR CONSERVED UNKNOWN GENES

    SciTech Connect

    V, DE CRECY-LAGARD; D, HANSON A

    2012-01-03

    Identifying functions for all gene products in all sequenced organisms is a central challenge of the post-genomic era. However, at least 30-50% of the proteins encoded by any given genome are of unknown function, or wrongly or vaguely annotated. Many of these 'unknown' proteins are common to prokaryotes and plants. We accordingly set out to predict and experimentally test the functions of such proteins. Our approach to functional prediction is integrative, coupling the extensive post-genomic resources available for plants with comparative genomics based on hundreds of microbial genomes, and functional genomic datasets from model microorganisms. The early phase is computer-assisted; later phases incorporate intellectual input from expert plant and microbial biochemists. The approach thus bridges the gap between automated homology-based annotations and the classical gene discovery efforts of experimentalists, and is much more powerful than purely computational approaches to identifying gene-function associations. Among Arabidopsis genes, we focused on those (2,325 in total) that (i) are unique or belong to families with no more than three members, (ii) are conserved between plants and prokaryotes, and (iii) have unknown or poorly known functions. Computer-assisted selection of promising targets for deeper analysis was based on homology .. independent characteristics associated in the SEED database with the prokaryotic members of each family, specifically gene clustering and phyletic spread, as well as availability of functional genomics data, and publications that could link candidate families to general metabolic areas, or to specific functions. In-depth comparative genomic analysis was then performed for about 500 top candidate families, which connected ~55 of them to general areas of metabolism and led to specific functional predictions for a subset of ~25 more. Twenty predicted functions were experimentally tested in at least one prokaryotic organism via reverse

  10. Allele Frequencies of Variants in Ultra Conserved Elements Identify Selective Pressure on Transcription Factor Binding

    PubMed Central

    Silla, Toomas; Kepp, Katrin; Tai, E. Shyong; Goh, Liang; Davila, Sonia; Ivkovic, Tina Catela; Calin, George A.; Voorhoeve, P. Mathijs

    2014-01-01

    Ultra-conserved genes or elements (UCGs/UCEs) in the human genome are extreme examples of conservation. We characterized natural variations in 2884 UCEs and UCGs in two distinct populations; Singaporean Chinese (n = 280) and Italian (n = 501) by using a pooled sample, targeted capture, sequencing approach. We identify, with high confidence, in these regions the abundance of rare SNVs (MAF<0.5%) of which 75% is not present in dbSNP137. UCEs association studies for complex human traits can use this information to model expected background variation and thus necessary power for association studies. By combining our data with 1000 Genome Project data, we show in three independent datasets that prevalent UCE variants (MAF>5%) are more often found in relatively less-conserved nucleotides within UCEs, compared to rare variants. Moreover, prevalent variants are less likely to overlap transcription factor binding site. Using SNPfold we found no significant influence of RNA secondary structure on UCE conservation. All together, these results suggest UCEs are not under selective pressure as a stretch of DNA but are under differential evolutionary pressure on the single nucleotide level. PMID:25369454

  11. A conservative multi-tracer transport scheme for spectral-element spherical grids

    NASA Astrophysics Data System (ADS)

    Erath, Christoph; Nair, Ramachandran D.

    2014-01-01

    Atmospheric models used for practical climate simulation must be capable handling the transport of hundreds of tracers. For computational efficiency conservative multi-tracer semi-Lagrangian type transport schemes are appropriate. Global models based on high-order Galerkin approach employ highly non-uniform spectral-element grids, and semi-Lagrangian transport is a challenge on those grids. A conservative semi-Lagrangian scheme (SPELT - SPectral-Element Lagrangian Transport) employing a multi-moment compact reconstruction procedure is developed for non-uniform quadrilateral grids. The scheme is based on a characteristic semi-Lagrangian method that avoids complex and expensive upstream area computations. The SPELT scheme has been implemented in the High-Order Method Modeling Environment (HOMME), which is based on a cubed-sphere grid with spectral-element spatial discretization. Additionally, we show the (strong) scalability and multi-tracer efficiency using several benchmark tests. The SPELT solution can be made monotonic (positivity preserving) by combining the flux-corrected transport algorithm, which is demonstrated on a uniform resolution grid. In particular, SPELT can be efficiently used for non-uniform grids and provides accurate and stable results for high-resolution meshes.

  12. Reprint of: A conservative multi-tracer transport scheme for spectral-element spherical grids

    NASA Astrophysics Data System (ADS)

    Erath, Christoph; Nair, Ramachandran D.

    2014-08-01

    Atmospheric models used for practical climate simulation must be capable handling the transport of hundreds of tracers. For computational efficiency conservative multi-tracer semi-Lagrangian type transport schemes are appropriate. Global models based on high-order Galerkin approach employ highly non-uniform spectral-element grids, and semi-Lagrangian transport is a challenge on those grids. A conservative semi-Lagrangian scheme (SPELT - SPectral-Element Lagrangian Transport) employing a multi-moment compact reconstruction procedure is developed for non-uniform quadrilateral grids. The scheme is based on a characteristic semi-Lagrangian method that avoids complex and expensive upstream area computations. The SPELT scheme has been implemented in the High-Order Method Modeling Environment (HOMME), which is based on a cubed-sphere grid with spectral-element spatial discretization. Additionally, we show the (strong) scalability and multi-tracer efficiency using several benchmark tests. The SPELT solution can be made monotonic (positivity preserving) by combining the flux-corrected transport algorithm, which is demonstrated on a uniform resolution grid. In particular, SPELT can be efficiently used for non-uniform grids and provides accurate and stable results for high-resolution meshes.

  13. Applications of the Space-Time Conservation Element and Solution Element (CE/SE) Method to Computational Aeroacoustic Benchmark Problems

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Himansu, Ananda; Chang, Sin-Chung; Jorgenson, Philip C. E.

    2000-01-01

    The Internal Propagation problems, Fan Noise problem, and Turbomachinery Noise problems are solved using the space-time conservation element and solution element (CE/SE) method. The problems in internal propagation problems address the propagation of sound waves through a nozzle. Both the nonlinear and linear quasi 1D Euler equations are solved. Numerical solutions are presented and compared with the analytical solution. The fan noise problem concerns the effect of the sweep angle on the acoustic field generated by the interaction of a convected gust with a cascade of 3D flat plates. A parallel version of the 3D CE/SE Euler solver is developed and employed to obtain numerical solutions for a family of swept flat plates. Numerical solutions for sweep angles of 0, 5, 10, and 15 deg are presented. The turbomachinery problems describe the interaction of a 2D vortical gust with a cascade of flat-plate airfoils with/without a downstream moving grid. The 2D nonlinear Euler Equations are solved and the converged numerical solutions are presented and compared with the corresponding analytical solution. All the comparisons demonstrate that the CE/SE method is capable of solving aeroacoustic problems with/without shock waves in a simple and efficient manner. Furthermore, the simple non-reflecting boundary condition used in the CE/SE method which is not based on the characteristic theory works very well in 1D, 2D and 3D problems.

  14. Application of the Space-Time Conservation Element and Solution Element Method to One-Dimensional Convection-Diffusion Problems

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Wang, Xiao-Yen; To, Wai-Ming

    2000-01-01

    In the space-time conservation element and solution element (CE/SE) method, the independent marching variables used comprise not only the mesh value of the physical dependent variables but also, in contrast to it typical numerical method, the Mesh values of the spatial derivatives of the physical variables The use of the extra marching variables results from the need to construct the two-level explicit and nondissipative schemes which are at the core of the CE/SE development. It also results from the need to minimize the stencil while maintaining accuracy. In this paper using the 1D(sub (alpha)-mu) scheme as an example, the effect of this added complication on consistency, accuracy and operation count is assessed. As part of this effort, an equivalent yet more efficient form of the alpha-mu scheme in which the independent marching variables are the local fluxes tied to each mesh point is introduced. Also, the intriguing relations that exist among the alpha-mu. Leapfrog, and DuFort-Frankel schemes are further explored. In addition, the redundance of the Leapfrog, DUFort-Frankel, and Lax scheme and the remedy for this redundance are discussed. This paper is concluded with the construction and evaluation of a CE/SE solver for the inviscid Burger equation.

  15. Applications of the Method of Space-Time Conservation Element and the Solution Element to Unsteady Chemically Reactive Flows

    NASA Technical Reports Server (NTRS)

    Yu, Sheng-Tao

    2001-01-01

    This document reports the conclusion and findings of our research activities for this grant. The goal of the project is the development and application of the method of Space-Time Conservation Element and Solution Element, or the CE/SE method, to simulate chemically reacting flows. The product of this project will be a high-fidelity, time-accurate flow solver analyzing unsteady flow fields advanced propulsion concepts, including the low-emission turbojet engine combustion and flow fields of the Pulse Detonation Engines (PDE). Based on the documents and computer software of the CE/SE method that we have received from the CE/SE working group at NASA Lewis, we have focused our research effort on addressing outstanding technical issues related to the extension of the CE/SE method for unsteady, chemically reactive flows. In particular, we have made progresses in the following three aspects: (1) Derivation of the governing equations for reacting flows; (2) Numerical treatments of stiff source terms; and (3) Detailed simulations of ZND detonation waves.

  16. Elements and modulation of functional dynamics.

    PubMed

    Gibbs, Alan C

    2014-10-01

    The existing structure-function paradigm of drug discovery has been evolving toward the essential incorporation of dynamics data. This new functional dynamics paradigm emphasizes conformational entropy as a driving force of protein function and intermolecular recognition. Conformational dynamics (a proxy of conformational entropy) impacts the degree of protein (dis)order and the constitution of the conformational ensemble, the mechanisms of allostery and drug resistance, and the free energy of ligand binding. Specific protein and ligand conformations facilitate favorable, reciprocal interactions. The number of protein and ligand conformers that exhibit favorable binding interactions will vary from system to system. All binding scenarios can modulate protein dynamics by various levels of enthalpic and entropic contribution, with significant influence on the functional dynamics of the system. Analysis and consideration of resulting changes of activity, signaling, catalysis, and subsequent phenotypic outcome are powerful motivations in the drug design process. PMID:24913411

  17. A locally conservative non-negative finite element formulation for anisotropic advective-diffusive-reactive systems

    NASA Astrophysics Data System (ADS)

    Mudunuru, M. K.; Shabouei, M.; Nakshatrala, K.

    2015-12-01

    Advection-diffusion-reaction (ADR) equations appear in various areas of life sciences, hydrogeological systems, and contaminant transport. Obtaining stable and accurate numerical solutions can be challenging as the underlying equations are coupled, nonlinear, and non-self-adjoint. Currently, there is neither a robust computational framework available nor a reliable commercial package known that can handle various complex situations. Herein, the objective of this poster presentation is to present a novel locally conservative non-negative finite element formulation that preserves the underlying physical and mathematical properties of a general linear transient anisotropic ADR equation. In continuous setting, governing equations for ADR systems possess various important properties. In general, all these properties are not inherited during finite difference, finite volume, and finite element discretizations. The objective of this poster presentation is two fold: First, we analyze whether the existing numerical formulations (such as SUPG and GLS) and commercial packages provide physically meaningful values for the concentration of the chemical species for various realistic benchmark problems. Furthermore, we also quantify the errors incurred in satisfying the local and global species balance for two popular chemical kinetics schemes: CDIMA (chlorine dioxide-iodine-malonic acid) and BZ (Belousov--Zhabotinsky). Based on these numerical simulations, we show that SUPG and GLS produce unphysical values for concentration of chemical species due to the violation of the non-negative constraint, contain spurious node-to-node oscillations, and have large errors in local and global species balance. Second, we proposed a novel finite element formulation to overcome the above difficulties. The proposed locally conservative non-negative computational framework based on low-order least-squares finite elements is able to preserve these underlying physical and mathematical properties

  18. Conservation.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  19. The Human Postsynaptic Density Shares Conserved Elements with Proteomes of Unicellular Eukaryotes and Prokaryotes

    PubMed Central

    Emes, Richard David; Grant, Seth G. N.

    2011-01-01

    The animal nervous system processes information from the environment and mediates learning and memory using molecular signaling pathways in the postsynaptic terminal of synapses. Postsynaptic neurotransmitter receptors assemble to form multiprotein complexes that drive signal transduction pathways to downstream cell biological processes. Studies of mouse and Drosophila postsynaptic proteins have identified key roles in synaptic physiology and behavior for a wide range of proteins including receptors, scaffolds, enzymes, structural, translational, and transcriptional regulators. Comparative proteomic and genomic studies identified components of the postsynaptic proteome conserved in eukaryotes and early metazoans. We extend these studies, and examine the conservation of genes and domains found in the human postsynaptic density with those across the three superkingdoms, archaeal, bacteria, and eukaryota. A conserved set of proteins essential for basic cellular functions were conserved across the three superkingdoms, whereas synaptic structural and many signaling molecules were specific to the eukaryote lineage. Genes involved with metabolism and environmental signaling in Escherichia coli including the chemotactic and ArcAB Two-Component signal transduction systems shared homologous genes in the mammalian postsynaptic proteome. These data suggest conservation between prokaryotes and mammalian synapses of signaling mechanisms from receptors to transcriptional responses, a process essential to learning and memory in vertebrates. A number of human postsynaptic proteins with homologs in prokaryotes are mutated in human genetic diseases with nervous system pathology. These data also indicate that structural and signaling proteins characteristic of postsynaptic complexes arose in the eukaryotic lineage and rapidly expanded following the emergence of the metazoa, and provide an insight into the early evolution of synaptic mechanisms and conserved mechanisms of learning and

  20. Investigating Evolutionary Conservation of Dendritic Cell Subset Identity and Functions

    PubMed Central

    Vu Manh, Thien-Phong; Bertho, Nicolas; Hosmalin, Anne; Schwartz-Cornil, Isabelle; Dalod, Marc

    2015-01-01

    Dendritic cells (DCs) were initially defined as mononuclear phagocytes with a dendritic morphology and an exquisite efficiency for naïve T-cell activation. DC encompass several subsets initially identified by their expression of specific cell surface molecules and later shown to excel in distinct functions and to develop under the instruction of different transcription factors or cytokines. Very few cell surface molecules are expressed in a specific manner on any immune cell type. Hence, to identify cell types, the sole use of a small number of cell surface markers in classical flow cytometry can be deceiving. Moreover, the markers currently used to define mononuclear phagocyte subsets vary depending on the tissue and animal species studied and even between laboratories. This has led to confusion in the definition of DC subset identity and in their attribution of specific functions. There is a strong need to identify a rigorous and consensus way to define mononuclear phagocyte subsets, with precise guidelines potentially applicable throughout tissues and species. We will discuss the advantages, drawbacks, and complementarities of different methodologies: cell surface phenotyping, ontogeny, functional characterization, and molecular profiling. We will advocate that gene expression profiling is a very rigorous, largely unbiased and accessible method to define the identity of mononuclear phagocyte subsets, which strengthens and refines surface phenotyping. It is uniquely powerful to yield new, experimentally testable, hypotheses on the ontogeny or functions of mononuclear phagocyte subsets, their molecular regulation, and their evolutionary conservation. We propose defining cell populations based on a combination of cell surface phenotyping, expression analysis of hallmark genes, and robust functional assays, in order to reach a consensus and integrate faster the huge but scattered knowledge accumulated by different laboratories on different cell types, organs, and

  1. Conservation of lipid functions in cytochrome bc complexes.

    PubMed

    Hasan, S Saif; Yamashita, Eiki; Ryan, Christopher M; Whitelegge, Julian P; Cramer, William A

    2011-11-18

    Lipid binding sites and properties are compared in two sub-families of hetero-oligomeric membrane protein complexes known to have similar functions in order to gain further understanding of the role of lipid in the function, dynamics, and assembly of these complexes. Using the crystal structure information for both complexes, we compared the lipid binding properties of the cytochrome b(6)f and bc(1) complexes that function in photosynthetic and respiratory membrane energy transduction. Comparison of lipid and detergent binding sites in the b(6)f complex with those in bc(1) shows significant conservation of lipid positions. Seven lipid binding sites in the cyanobacterial b(6)f complex overlap three natural sites in the Chlamydomonas reinhardtii algal complex and four sites in the yeast mitochondrial bc(1) complex. The specific identity of lipids is different in b(6)f and bc(1) complexes: b(6)f contains sulfoquinovosyldiacylglycerol, phosphatidylglycerol, phosphatidylcholine, monogalactosyldiacylglycerol, and digalactosyldiacylglycerol, whereas cardiolipin, phosphatidylethanolamine, and phosphatidic acid are present in the yeast bc(1) complex. The lipidic chlorophyll a and β-carotene (β-car) in cyanobacterial b(6)f, as well as eicosane in C. reinhardtii, are unique to the b(6)f complex. Inferences of lipid binding sites and functions were supported by sequence, interatomic distance, and B-factor information on interacting lipid groups and coordinating amino acid residues. The lipid functions inferred in the b(6)f complex are as follows: (i) substitution of a transmembrane helix by a lipid and chlorin ring, (ii) lipid and β-car connection of peripheral and core domains, (iii) stabilization of the iron-sulfur protein transmembrane helix, (iv) n-side charge and polarity compensation, and (v) β-car-mediated super-complex with the photosystem I complex. PMID:21978667

  2. Functional conservation of atonal and Math1 in the CNS and PNS

    NASA Technical Reports Server (NTRS)

    Ben-Arie, N.; Hassan, B. A.; Bermingham, N. A.; Malicki, D. M.; Armstrong, D.; Matzuk, M.; Bellen, H. J.; Zoghbi, H. Y.

    2000-01-01

    To determine the extent to which atonal and its mouse homolog Math1 exhibit functional conservation, we inserted (beta)-galactosidase (lacZ) into the Math1 locus and analyzed its expression, evaluated consequences of loss of Math1 function, and expressed Math1 in atonal mutant flies. lacZ under the control of Math1 regulatory elements duplicated the previously known expression pattern of Math1 in the CNS (i.e., the neural tube, dorsal spinal cord, brainstem, and cerebellar external granule neurons) but also revealed new sites of expression: PNS mechanoreceptors (inner ear hair cells and Merkel cells) and articular chondrocytes. Expressing Math1 induced ectopic chordotonal organs (CHOs) in wild-type flies and partially rescued CHO loss in atonal mutant embryos. These data demonstrate that both the mouse and fly homologs encode lineage identity information and, more interestingly, that some of the cells dependent on this information serve similar mechanoreceptor functions.

  3. [Nutritional content, functional properties and conservation of edible flowers. Review].

    PubMed

    Lara-Cortés, Estrella; Osorio-Díaz, Perla; Jiménez-Aparicio, Antonio; Bautista-Bañios, Silvia

    2013-09-01

    The floriphagia that is the consumption of flowers as a food, is an old practice not widespread among consumers until some decades ago. Edible flowers contribute to increasing the appearance of food. They can provide biologically active substances including vitamin A, C, riboflavins, niacin, minerals such as calcium, phosphorous, iron and potassium that are eventually beneficial to consumers' health. This review includes some examples of edible flowers including roses, violets and nasturtium among others, uses and applications, sensorial characteristics and nutritional values that lead them to be considered as functional food: An important factor that affects the quality of edible flowers is the form in which they are preserved since it may affect their sensorial and nutritional characteristics. However, not all flowers can be eaten as food since there are some of them that can be toxic or even mortal. Finally, although the consumption of flowers is an ancient practice, there is little regulation in this regard. Of the review on edible flowers, it is concluded that there are still numerous aspects about them to evaluate such as nutritional and functional characteristics, conservation and regulation with the aim to extend its consumption. PMID:25362819

  4. Use of a Drosophila Genome-Wide Conserved Sequence Database to Identify Functionally Related cis-Regulatory Enhancers

    PubMed Central

    Brody, Thomas; Yavatkar, Amarendra S; Kuzin, Alexander; Kundu, Mukta; Tyson, Leonard J; Ross, Jermaine; Lin, Tzu-Yang; Lee, Chi-Hon; Awasaki, Takeshi; Lee, Tzumin; Odenwald, Ward F

    2012-01-01

    Background: Phylogenetic footprinting has revealed that cis-regulatory enhancers consist of conserved DNA sequence clusters (CSCs). Currently, there is no systematic approach for enhancer discovery and analysis that takes full-advantage of the sequence information within enhancer CSCs. Results: We have generated a Drosophila genome-wide database of conserved DNA consisting of >100,000 CSCs derived from EvoPrints spanning over 90% of the genome. cis-Decoder database search and alignment algorithms enable the discovery of functionally related enhancers. The program first identifies conserved repeat elements within an input enhancer and then searches the database for CSCs that score highly against the input CSC. Scoring is based on shared repeats as well as uniquely shared matches, and includes measures of the balance of shared elements, a diagnostic that has proven to be useful in predicting cis-regulatory function. To demonstrate the utility of these tools, a temporally-restricted CNS neuroblast enhancer was used to identify other functionally related enhancers and analyze their structural organization. Conclusions: cis-Decoder reveals that co-regulating enhancers consist of combinations of overlapping shared sequence elements, providing insights into the mode of integration of multiple regulating transcription factors. The database and accompanying algorithms should prove useful in the discovery and analysis of enhancers involved in any developmental process. Developmental Dynamics 241:169–189, 2012. © 2011 Wiley Periodicals, Inc. Key findings A genome-wide catalog of Drosophila conserved DNA sequence clusters. cis-Decoder discovers functionally related enhancers. Functionally related enhancers share balanced sequence element copy numbers. Many enhancers function during multiple phases of development. PMID:22174086

  5. Transposable elements in fish functional genomics: technical challenges and perspectives

    PubMed Central

    Parinov, Serguei; Emelyanov, Alexander

    2007-01-01

    The recent introduction of several transposable elements in zebrafish opens new frontiers for genetic manipulation in this important vertebrate model. This review discusses transposable elements as mutagenesis tools for fish functional genomics. We review various mutagenesis strategies that were previously applied in other genetic models, such as Drosophila, Arabidopsis, and mouse, that may be beneficial if applied in fish. We also discuss the forthcoming challenges of high-throughput functional genomics in fish. PMID:18047698

  6. Altered Response Hierarchy and Increased T-Cell Breadth upon HIV-1 Conserved Element DNA Vaccination in Macaques

    PubMed Central

    Kulkarni, Viraj; Valentin, Antonio; Rosati, Margherita; Alicea, Candido; Singh, Ashish K.; Jalah, Rashmi; Broderick, Kate E.; Sardesai, Niranjan Y.; Le Gall, Sylvie; Mothe, Beatriz; Brander, Christian; Rolland, Morgane; Mullins, James I.; Pavlakis, George N.; Felber, Barbara K.

    2014-01-01

    HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24gag elements (CE) induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist. PMID:24465991

  7. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    PubMed

    Kulkarni, Viraj; Valentin, Antonio; Rosati, Margherita; Alicea, Candido; Singh, Ashish K; Jalah, Rashmi; Broderick, Kate E; Sardesai, Niranjan Y; Le Gall, Sylvie; Mothe, Beatriz; Brander, Christian; Rolland, Morgane; Mullins, James I; Pavlakis, George N; Felber, Barbara K

    2014-01-01

    HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag) elements (CE) induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag) increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist. PMID:24465991

  8. Function of a Conserved Checkpoint Recruitment Domain in ATRIP Proteins▿

    PubMed Central

    Ball, Heather L.; Ehrhardt, Mark R.; Mordes, Daniel A.; Glick, Gloria G.; Chazin, Walter J.; Cortez, David

    2007-01-01

    The ATR (ATM and Rad3-related) kinase is essential to maintain genomic integrity. ATR is recruited to DNA lesions in part through its association with ATR-interacting protein (ATRIP), which in turn interacts with the single-stranded DNA binding protein RPA (replication protein A). In this study, a conserved checkpoint protein recruitment domain (CRD) in ATRIP orthologs was identified by biochemical mapping of the RPA binding site in combination with nuclear magnetic resonance, mutagenesis, and computational modeling. Mutations in the CRD of the Saccharomyces cerevisiae ATRIP ortholog Ddc2 disrupt the Ddc2-RPA interaction, prevent proper localization of Ddc2 to DNA breaks, sensitize yeast to DNA-damaging agents, and partially compromise checkpoint signaling. These data demonstrate that the CRD is critical for localization and optimal DNA damage responses. However, the stimulation of ATR kinase activity by binding of topoisomerase binding protein 1 (TopBP1) to ATRIP-ATR can occur independently of the interaction of ATRIP with RPA. Our results support the idea of a multistep model for ATR activation that requires separable localization and activation functions of ATRIP. PMID:17339343

  9. Class IIa Histone Deacetylases Are Conserved Regulators of Circadian Function*

    PubMed Central

    Fogg, Paul C. M.; O'Neill, John S.; Dobrzycki, Tomasz; Calvert, Shaun; Lord, Emma C.; McIntosh, Rebecca L. L.; Elliott, Christopher J. H.; Sweeney, Sean T.; Hastings, Michael H.; Chawla, Sangeeta

    2014-01-01

    Class IIa histone deacetylases (HDACs) regulate the activity of many transcription factors to influence liver gluconeogenesis and the development of specialized cells, including muscle, neurons, and lymphocytes. Here, we describe a conserved role for class IIa HDACs in sustaining robust circadian behavioral rhythms in Drosophila and cellular rhythms in mammalian cells. In mouse fibroblasts, overexpression of HDAC5 severely disrupts transcriptional rhythms of core clock genes. HDAC5 overexpression decreases BMAL1 acetylation on Lys-537 and pharmacological inhibition of class IIa HDACs increases BMAL1 acetylation. Furthermore, we observe cyclical nucleocytoplasmic shuttling of HDAC5 in mouse fibroblasts that is characteristically circadian. Mutation of the Drosophila homolog HDAC4 impairs locomotor activity rhythms of flies and decreases period mRNA levels. RNAi-mediated knockdown of HDAC4 in Drosophila clock cells also dampens circadian function. Given that the localization of class IIa HDACs is signal-regulated and influenced by Ca2+ and cAMP signals, our findings offer a mechanism by which extracellular stimuli that generate these signals can feed into the molecular clock machinery. PMID:25271152

  10. Conserved intron elements repress splicing of a neuron-specific c-src exon in vitro.

    PubMed Central

    Chan, R C; Black, D L

    1995-01-01

    The neuron-specific N1 exon of the mouse c-src transcript is normally skipped in nonneuronal cells. In this study, we examined the sequence requirements for the exclusion of this exon in nonneuronal HeLa cell nuclear extracts. We found that the repression of the N1 exon is mediated by specific intron sequences that flank the N1 exon. Mutagenesis experiments identified conserved CUCUCU elements within these intron regions that are required for the repression of N1 splicing. The addition of an RNA competitor containing the upstream regulatory sequence to the HeLa extract induced splicing of the intron downstream of N1, indicating that the competitor sequence binds to splicing repressor proteins. The similarities between this mechanism for src splicing repression and the repression of other regulated exons point to a common role of exon-spanning interactions in splicing repression. PMID:7565790

  11. Mammalian mitochondrial D-loop region structural analysis: identification of new conserved sequences and their functional and evolutionary implications.

    PubMed

    Sbisà, E; Tanzariello, F; Reyes, A; Pesole, G; Saccone, C

    1997-12-31

    This paper reports the first comprehensive analysis of Displacement loop (D-loop) region sequences from ten different mammalian orders. It represents a systematic evolutionary study at the molecular level on regulatory homologous regions in organisms belonging to a well defined class, mammalia, which radiated about 150 million years ago (Mya). We have aligned and analyzed 26 complete D-loop region sequences available in the literature and the fat dormouse sequence, recently determined in our laboratory. The novelty of our alignment consists of the extensive manual revision of the preliminary output obtained by computer program to optimize sequence similarity, particularly for the two peripheral domains displaying heterogeneity in length and the presence of repeated sequences. The multialignment is available at the WWW site: http://www.ba.cnr.it/dloop.html. Our comparative study has allowed us to identify new conserved sequence blocks present in all the species under consideration and events of insertion/deletion which have important implications in both functional and evolutionary aspects. In particular we have detected two blocks, about 60 bp long, extended termination associated sequences (ETAS1 and ETAS2) conserved in all the organisms considered. Evaluation against experimental work suggests a possible functional role of ETAS1 and ETAS2 in the regulation of replication and transcription and targeted experimental approaches. The analyses on conserved sequence blocks (CSBs) clearly indicate that CSB1 is the only very essential element, common to all mammalian mt genomes, while CSB2 and CSB3 could be involved in different though related functions, probably species specific, and thus more linked to nuclear mitochondrial coevolutionary processes. Our hypothesis on the different functional implications of the conserved elements, CSBs and TASs, reported so far as main regulatory signals, would explain the different conservation of these elements in evolution. Moreover

  12. A higher-order conservation element solution element method for solving hyperbolic differential equations on unstructured meshes

    NASA Astrophysics Data System (ADS)

    Bilyeu, David

    This dissertation presents an extension of the Conservation Element Solution Element (CESE) method from second- to higher-order accuracy. The new method retains the favorable characteristics of the original second-order CESE scheme, including (i) the use of the space-time integral equation for conservation laws, (ii) a compact mesh stencil, (iii) the scheme will remain stable up to a CFL number of unity, (iv) a fully explicit, time-marching integration scheme, (v) true multidimensionality without using directional splitting, and (vi) the ability to handle two- and three-dimensional geometries by using unstructured meshes. This algorithm has been thoroughly tested in one, two and three spatial dimensions and has been shown to obtain the desired order of accuracy for solving both linear and non-linear hyperbolic partial differential equations. The scheme has also shown its ability to accurately resolve discontinuities in the solutions. Higher order unstructured methods such as the Discontinuous Galerkin (DG) method and the Spectral Volume (SV) methods have been developed for one-, two- and three-dimensional application. Although these schemes have seen extensive development and use, certain drawbacks of these methods have been well documented. For example, the explicit versions of these two methods have very stringent stability criteria. This stability criteria requires that the time step be reduced as the order of the solver increases, for a given simulation on a given mesh. The research presented in this dissertation builds upon the work of Chang, who developed a fourth-order CESE scheme to solve a scalar one-dimensional hyperbolic partial differential equation. The completed research has resulted in two key deliverables. The first is a detailed derivation of a high-order CESE methods on unstructured meshes for solving the conservation laws in two- and three-dimensional spaces. The second is the code implementation of these numerical methods in a computer code. For

  13. Algebraic evaluation of matrix elements in the Laguerre function basis

    NASA Astrophysics Data System (ADS)

    McCoy, A. E.; Caprio, M. A.

    2016-02-01

    The Laguerre functions constitute one of the fundamental basis sets for calculations in atomic and molecular electron-structure theory, with applications in hadronic and nuclear theory as well. While similar in form to the Coulomb bound-state eigenfunctions (from the Schrödinger eigenproblem) or the Coulomb-Sturmian functions (from a related Sturm-Liouville problem), the Laguerre functions, unlike these former functions, constitute a complete, discrete, orthonormal set for square-integrable functions in three dimensions. We construct the SU(1, 1) × SO(3) dynamical algebra for the Laguerre functions and apply the ideas of factorization (or supersymmetric quantum mechanics) to derive shift operators for these functions. We use the resulting algebraic framework to derive analytic expressions for matrix elements of several basic radial operators (involving powers of the radial coordinate and radial derivative) in the Laguerre function basis. We illustrate how matrix elements for more general spherical tensor operators in three dimensional space, such as the gradient, may then be constructed from these radial matrix elements.

  14. Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast.

    PubMed

    Chatfield-Reed, Kate; Vachon, Lianne; Kwon, Eun-Joo Gina; Chua, Gordon

    2016-04-01

    Gene regulation in response to intracellular calcium is mediated by the calcineurin-activated transcription factor Prz1 in the fission yeastSchizosaccharomyces pombe Genome-wide studies of theCrz1and CrzA fungal orthologs have uncovered numerous target genes involved in conserved and species-specific cellular processes. In contrast, very few target genes of Prz1 have been published. This article identifies an extensive list of genes using transcriptome and ChIP-chip analyses under inducing conditions of Prz1, including CaCl2and tunicamycin treatment, as well as a∆pmr1genetic background. We identified 165 upregulated putative target genes of Prz1 in which the majority contained a calcium-dependent response element in their promoters, similar to that of theSaccharomyces cerevisiaeorthologCrz1 These genes were functionally enriched forCrz1-conserved processes such as cell-wall biosynthesis. Overexpression ofprz1(+)increased resistance to the cell-wall degradation enzyme zymolyase, likely from upregulation of theO-mannosyltransferase encoding geneomh1(+) Loss ofomh1(+)abrogates this phenotype. We uncovered a novel inhibitory role in flocculation for Prz1. Loss ofprz1(+)resulted in constitutive flocculation and upregulation of genes encoding the flocculins Gsf2 and Pfl3, as well as the transcription factor Cbf12. The constitutive flocculation of the∆prz1strain was abrogated by the loss ofgsf2(+)orcbf12(+) This study reveals that Prz1 functions as a positive and negative transcriptional regulator of genes involved in cell-wall biosynthesis and flocculation, respectively. Moreover, comparison of target genes betweenCrz1/CrzA and Prz1 indicate some conservation in DNA-binding specificity, but also substantial rewiring of the calcineurin-mediated transcriptional regulatory network. PMID:26896331

  15. Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast

    PubMed Central

    Chatfield-Reed, Kate; Vachon, Lianne; Kwon, Eun-Joo Gina; Chua, Gordon

    2016-01-01

    Gene regulation in response to intracellular calcium is mediated by the calcineurin-activated transcription factor Prz1 in the fission yeast Schizosaccharomyces pombe. Genome-wide studies of the Crz1 and CrzA fungal orthologs have uncovered numerous target genes involved in conserved and species-specific cellular processes. In contrast, very few target genes of Prz1 have been published. This article identifies an extensive list of genes using transcriptome and ChIP-chip analyses under inducing conditions of Prz1, including CaCl2 and tunicamycin treatment, as well as a ∆pmr1 genetic background. We identified 165 upregulated putative target genes of Prz1 in which the majority contained a calcium-dependent response element in their promoters, similar to that of the Saccharomyces cerevisiae ortholog Crz1. These genes were functionally enriched for Crz1-conserved processes such as cell-wall biosynthesis. Overexpression of prz1+ increased resistance to the cell-wall degradation enzyme zymolyase, likely from upregulation of the O-mannosyltransferase encoding gene omh1+. Loss of omh1+ abrogates this phenotype. We uncovered a novel inhibitory role in flocculation for Prz1. Loss of prz1+ resulted in constitutive flocculation and upregulation of genes encoding the flocculins Gsf2 and Pfl3, as well as the transcription factor Cbf12. The constitutive flocculation of the ∆prz1 strain was abrogated by the loss of gsf2+ or cbf12+. This study reveals that Prz1 functions as a positive and negative transcriptional regulator of genes involved in cell-wall biosynthesis and flocculation, respectively. Moreover, comparison of target genes between Crz1/CrzA and Prz1 indicate some conservation in DNA-binding specificity, but also substantial rewiring of the calcineurin-mediated transcriptional regulatory network. PMID:26896331

  16. Functional Nanofibers and Colloidal Gels: Key Elements to Enhance Functionality

    NASA Astrophysics Data System (ADS)

    Vogel, Nancy Amanda

    Nanomaterials bridge the gap between bulk materials and molecular structures and are known for their unique material properties and highly functional nature which make them attractive for a variety of potential applications, from energy storage and pollution sensors to agricultural and biomedical products. These potential applications, coupled with advances in nanotechnology, have generated considerable interest in nanostructure research. The work presented in this dissertation focuses on two such nanostructures, electrospun nanofibers and nanodiamond particles, with an overarching goal of tailoring the material behavior for a desired outcome. Our first research theme focuses on realizing the full potential of chitosan electrospinning by understanding the mechanism that enables fiber formation through cyclodextrin complexation as a function of solution properties, solvent types, and cyclodextrin content. We demonstrate that cyclodextrin addition not only enables chitosan fiber formation, but also extends the composition and solvent window for nanofiber synthesis while introducing a variety of mat topologies, including three-dimensional, self-supporting mats. These fiber formation improvements cannot be fully explained by conventional electrospinning parameters, but instead seem to be related to the molecular interactions between chitosan and cyclodextrin. Our second research theme entails the modification of highly water soluble, poly(vinyl alcohol) (PVA) nanofibers dissolution properties via atomic layer deposition (ALD) post treatments. In this work, we demonstrate that applying different thicknesses of aluminum oxide nano-coatings can improve the stability of PVA nanofibers in high humidity conditions and significantly decrease the solubility of electrospun PVA mats in water, from seconds to multiple weeks. Controlling mat dissolution allows for the unique opportunity to modulate small molecule, such as drug, release from nanofibers without altering the core

  17. A conserved MCM single-stranded DNA binding element is essential for replication initiation

    PubMed Central

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J

    2014-01-01

    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI: http://dx.doi.org/10.7554/eLife.01993.001 PMID:24692448

  18. Epigenetic conservation at gene regulatory elements revealed by non-methylated DNA profiling in seven vertebrates.

    PubMed

    Long, Hannah K; Sims, David; Heger, Andreas; Blackledge, Neil P; Kutter, Claudia; Wright, Megan L; Grützner, Frank; Odom, Duncan T; Patient, Roger; Ponting, Chris P; Klose, Robert J

    2013-01-01

    Two-thirds of gene promoters in mammals are associated with regions of non-methylated DNA, called CpG islands (CGIs), which counteract the repressive effects of DNA methylation on chromatin. In cold-blooded vertebrates, computational CGI predictions often reside away from gene promoters, suggesting a major divergence in gene promoter architecture across vertebrates. By experimentally identifying non-methylated DNA in the genomes of seven diverse vertebrates, we instead reveal that non-methylated islands (NMIs) of DNA are a central feature of vertebrate gene promoters. Furthermore, NMIs are present at orthologous genes across vast evolutionary distances, revealing a surprising level of conservation in this epigenetic feature. By profiling NMIs in different tissues and developmental stages we uncover a unifying set of features that are central to the function of NMIs in vertebrates. Together these findings demonstrate an ancient logic for NMI usage at gene promoters and reveal an unprecedented level of epigenetic conservation across vertebrate evolution. DOI:http://dx.doi.org/10.7554/eLife.00348.001. PMID:23467541

  19. Abscisic acid-induced gene expression in the liverwort Marchantia polymorpha is mediated by evolutionarily conserved promoter elements.

    PubMed

    Ghosh, Totan K; Kaneko, Midori; Akter, Khaleda; Murai, Shuhei; Komatsu, Kenji; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2016-04-01

    Abscisic acid (ABA) is a phytohormone widely distributed among members of the land plant lineage (Embryophyta), regulating dormancy, stomata closure and tolerance to environmental stresses. In angiosperms (Magnoliophyta), ABA-induced gene expression is mediated by promoter elements such as the G-box-like ACGT-core motifs recognized by bZIP transcription factors. In contrast, the mode of regulation by ABA of gene expression in liverworts (Marchantiophyta), representing one of the earliest diverging land plant groups, has not been elucidated. In this study, we used promoters of the liverwort Marchantia polymorpha dehydrin and the wheat Em genes fused to the β-glucuronidase (GUS) reporter gene to investigate ABA-induced gene expression in liverworts. Transient assays of cultured cells of Marchantia indicated that ACGT-core motifs proximal to the transcription initiation site play a role in the ABA-induced gene expression. The RY sequence recognized by B3 transcriptional regulators was also shown to be responsible for the ABA-induced gene expression. In transgenic Marchantia plants, ABA treatment elicited an increase in GUS expression in young gemmalings, which was abolished by simultaneous disruption of the ACGT-core and RY elements. ABA-induced GUS expression was less obvious in mature thalli than in young gemmalings, associated with reductions in sensitivity to exogenous ABA during gametophyte growth. In contrast, lunularic acid, which had been suggested to function as an ABA-like substance, had no effect on GUS expression. The results demonstrate the presence of ABA-specific response mechanisms mediated by conserved cis-regulatory elements in liverworts, implying that the mechanisms had been acquired in the common ancestors of embryophytes. PMID:26456006

  20. Telomerase RNA stem terminus element affects template boundary element function, telomere sequence, and shelterin binding

    PubMed Central

    Webb, Christopher J.; Zakian, Virginia A.

    2015-01-01

    The stem terminus element (STE), which was discovered 13 y ago in human telomerase RNA, is required for telomerase activity, yet its mode of action is unknown. We report that the Schizosaccharomyces pombe telomerase RNA, TER1 (telomerase RNA 1), also contains a STE, which is essential for telomere maintenance. Cells expressing a partial loss-of-function TER1 STE allele maintained short stable telomeres by a recombination-independent mechanism. Remarkably, the mutant telomere sequence was different from that of wild-type cells. Generation of the altered sequence is explained by reverse transcription into the template boundary element, demonstrating that the STE helps maintain template boundary element function. The altered telomeres bound less Pot1 (protection of telomeres 1) and Taz1 (telomere-associated in Schizosaccharomyces pombe 1) in vivo. Thus, the S. pombe STE, although distant from the template, ensures proper telomere sequence, which in turn promotes proper assembly of the shelterin complex. PMID:26305931

  1. A novel mosaic protein containing LDL receptor elements is highly conserved in humans and chickens.

    PubMed

    Mörwald, S; Yamazaki, H; Bujo, H; Kusunoki, J; Kanaki, T; Seimiya, K; Morisaki, N; Nimpf, J; Schneider, W J; Saito, Y

    1997-05-01

    Certain receptors belonging to the LDL receptor (LDLR) gene family appear to constitute a newly identified branch whose members are expressed in brain, in addition to other tissues. In support of this concept, we have now discovered the expression and delineated the molecular structures of a representative of this emerging branch from two such diverse species as human and chicken. This membrane receptor, called LR11 and thus far only known to exist in the rabbit, is a complex seven-domain mosaic protein containing, among other structural elements, a cluster of 11 LDLR ligand-binding repeats and a domain with homology to VPS10, a yeast receptor for vacuolar protein sorting. Cytoplasmic signature sequences define the receptor as competent for endocytosis. The most striking properties of LR11s are their (1) high degree of structural conservation (>80% identity among mammals and birds), with 100% identity in the membrane-spanning and cytoplasmic domains of rabbit and human; (2) lack of regulation by cholesterol and estrogen; and (3) expression in brain. The features of LR11 suggest important roles in intercellular and intracellular ligand transport processes, some of which it may share with other brain-specific LDLR family members. PMID:9157966

  2. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio

    2014-01-01

    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  3. A regulon conserved in monocot and dicot plants defines a functional module in antifungal plant immunity

    PubMed Central

    Humphry, Matt; Bednarek, Paweł; Kemmerling, Birgit; Koh, Serry; Stein, Mónica; Göbel, Ulrike; Stüber, Kurt; Piślewska-Bednarek, Mariola; Loraine, Ann; Schulze-Lefert, Paul; Somerville, Shauna; Panstruga, Ralph

    2010-01-01

    At least two components that modulate plant resistance against the fungal powdery mildew disease are ancient and have been conserved since the time of the monocot–dicot split (≈200 Mya). These components are the seven transmembrane domain containing MLO/MLO2 protein and the syntaxin ROR2/PEN1, which act antagonistically and have been identified in the monocot barley (Hordeum vulgare) and the dicot Arabidopsis thaliana, respectively. Additionally, syntaxin-interacting N-ethylmaleimide sensitive factor adaptor protein receptor proteins (VAMP721/722 and SNAP33/34) as well as a myrosinase (PEN2) and an ABC transporter (PEN3) contribute to antifungal resistance in both barley and/or Arabidopsis. Here, we show that these genetically defined defense components share a similar set of coexpressed genes in the two plant species, comprising a statistically significant overrepresentation of gene products involved in regulation of transcription, posttranslational modification, and signaling. Most of the coexpressed Arabidopsis genes possess a common cis-regulatory element that may dictate their coordinated expression. We exploited gene coexpression to uncover numerous components in Arabidopsis involved in antifungal defense. Together, our data provide evidence for an evolutionarily conserved regulon composed of core components and clade/species-specific innovations that functions as a module in plant innate immunity. PMID:21098265

  4. Separation of the PROX1 gene from upstream conserved elements in a complex inversion/translocation patient with hypoplastic left heart.

    PubMed

    Gill, Harinder K; Parsons, Sian R; Spalluto, Cosma; Davies, Angela F; Knorz, Victoria J; Burlinson, Clare E G; Ng, Bee Ling; Carter, Nigel P; Ogilvie, Caroline Mackie; Wilson, David I; Roberts, Roland G

    2009-11-01

    Hypoplastic left heart (HLH) occurs in at least 1 in 10 000 live births but may be more common in utero. Its causes are poorly understood but a number of affected cases are associated with chromosomal abnormalities. We set out to localize the breakpoints in a patient with sporadic HLH and a de novo translocation. Initial studies showed that the apparently simple 1q41;3q27.1 translocation was actually combined with a 4-Mb inversion, also de novo, of material within 1q41. We therefore localized all four breakpoints and found that no known transcription units were disrupted. However we present a case, based on functional considerations, synteny and position of highly conserved non-coding sequence elements, and the heterozygous Prox1(+/-) mouse phenotype (ventricular hypoplasia), for the involvement of dysregulation of the PROX1 gene in the aetiology of HLH in this case. Accordingly, we show that the spatial expression pattern of PROX1 in the developing human heart is consistent with a role in cardiac development. We suggest that dysregulation of PROX1 gene expression due to separation from its conserved upstream elements is likely to have caused the heart defects observed in this patient, and that PROX1 should be considered as a potential candidate gene for other cases of HLH. The relevance of another breakpoint separating the cardiac gene ESRRG from a conserved downstream element is also discussed. PMID:19471316

  5. Understanding the function of conserved variations in the catalytic loops of fungal glycoside hydrolase family 12.

    PubMed

    Damásio, André R L; Rubio, Marcelo V; Oliveira, Leandro C; Segato, Fernando; Dias, Bruno A; Citadini, Ana P; Paixão, Douglas A; Squina, Fabio M

    2014-08-01

    Enzymes that cleave the xyloglucan backbone at unbranched glucose residues have been identified in GH families 5, 7, 12, 16, 44, and 74. Fungi produce enzymes that populate 20 of 22 families that are considered critical for plant biomass deconstruction. We searched for GH12-encoding genes in 27 Eurotiomycetes genomes. After analyzing 50 GH12-related sequences, the conserved variations of the amino acid sequences were examined. Compared to the endoglucanases, the endo-xyloglucanase-associated YSG deletion at the negative subsites of the catalytic cleft with a SST insertion at the reducing end of the substrate-binding crevice is highly conserved. In addition, a highly conserved alanine residue was identified in all xyloglucan-specific enzymes, and this residue is substituted by arginine in more promiscuous glucanases. To understand the basis for the xyloglucan specificity displayed by certain GH12 enzymes, two fungal GH12 endoglucanases were chosen for mutagenesis and functional studies: an endo-xyloglucanase from Aspergillus clavatus (AclaXegA) and an endoglucanase from A. terreus (AtEglD). Comprehensive molecular docking studies and biochemical analyses were performed, revealing that mutations at the entrance of the catalytic cleft in AtEglD result in a wider binding cleft and the alteration of the substrate-cleavage pattern, implying that a trio of residues coordinates the interactions and binding to linear glycans. The loop insertion at the crevice-reducing end of AclaXegA is critical for catalytic efficiency to hydrolyze xyloglucan. The understanding of the structural elements governing endo-xyloglucanase activity on linear and branched glucans will facilitate future enzyme modifications with potential applications in industrial biotechnology. PMID:24578305

  6. Element orbitals for Kohn-Sham density functional theory

    SciTech Connect

    Lin, Lin; Ying, Lexing

    2012-05-08

    We present a method to discretize the Kohn-Sham Hamiltonian matrix in the pseudopotential framework by a small set of basis functions automatically contracted from a uniform basis set such as planewaves. Each basis function is localized around an element, which is a small part of the global domain containing multiple atoms. We demonstrate that the resulting basis set achieves meV accuracy for 3D densely packed systems with a small number of basis functions per atom. The procedure is applicable to insulating and metallic systems.

  7. Cellular interactions during tracheary elements formation and function.

    PubMed

    Ménard, Delphine; Pesquet, Edouard

    2015-02-01

    The survival of higher plant species on land depends on the development and function of an efficient vascular system distributing water and minerals absorbed by roots to all aerial organs. This conduction and distribution of plant sap relies on specialized cells named tracheary elements (TEs). In contrast to many other cell types in plants, TEs are functionalized by cell death that hollows the cell protoplast to make way for the sap. To maintain a stable conducting function during plant development, recovery from vascular damages as well as to adapt to environmental changes, TEs are completely dependent on direct cellular interactions with neighboring xylem parenchyma cells (XPs). PMID:25545993

  8. Quadratic Interaction Functional for General Systems of Conservation Laws

    NASA Astrophysics Data System (ADS)

    Bianchini, Stefano; Modena, Stefano

    2015-09-01

    For the Glimm scheme approximation to the solution of the system of conservation laws in one space dimension with initial data u 0 with small total variation, we prove a quadratic (w.r.t. Tot. Var. ( u 0)) interaction estimate, which has been used in the literature for stability and convergence results. No assumptions on the structure of the flux f are made (apart from smoothness), and this estimate is the natural extension of the Glimm type interaction estimate for genuinely nonlinear systems. More precisely, we obtain the following results: a new analysis of the interaction estimates of simple waves;

  9. Functional overlap between conserved and diverged KH domains in Saccharomyces cerevisiae SCP160

    PubMed Central

    Brykailo, Melissa A.; Corbett, Anita H.; Fridovich-Keil, Judith L.

    2007-01-01

    The K homology (KH) domain is a remarkably versatile and highly conserved RNA-binding motif. Classical KH domains include a characteristic pattern of hydrophobic residues, a Gly-X-X-Gly (GXXG) segment, and a variable loop. KH domains typically occur in clusters, with some retaining their GXXG sequence (conserved), while others do not (diverged). As a first step towards addressing whether GXXG is essential for KH-domain function, we explored the roles of conserved and diverged KH domains in Scp160p, a multiple-KH-domain-containing protein in Saccharomyces cerevisiae. We specifically wanted to know (1) whether diverged KH domains were essential for Scp160p function, and (2) whether diverged KH domains could functionally replace conserved KH domains. To address these questions, we deleted and/or interchanged conserved and diverged KH domains of Scp160p and expressed the mutated alleles in yeast. Our results demonstrated that the answer to each question was yes. Both conserved and diverged KH domains are essential for Scp160p function, and diverged KH domains can function in place of conserved KH domains. These findings challenge the prevailing notions about the requisite features of a KH domain and raise the possibility that there may be more functional KH domains in the proteome than previously appreciated. PMID:17264125

  10. HIV-1 p24(gag) derived conserved element DNA vaccine increases the breadth of immune response in mice.

    PubMed

    Kulkarni, Viraj; Rosati, Margherita; Valentin, Antonio; Ganneru, Brunda; Singh, Ashish K; Yan, Jian; Rolland, Morgane; Alicea, Candido; Beach, Rachel Kelly; Zhang, Gen-Mu; Le Gall, Sylvie; Broderick, Kate E; Sardesai, Niranjan Y; Heckerman, David; Mothe, Beatriz; Brander, Christian; Weiner, David B; Mullins, James I; Pavlakis, George N; Felber, Barbara K

    2013-01-01

    Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag) region according to two principles: the immunogen must (i) include strictly conserved elements of the virus that cannot mutate readily, and (ii) exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag) DNA immunogens that express 7 highly Conserved Elements (CE) of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site'), together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag) DNA induced poor, CD4(+) mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+) and CD8(+) T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag), which recognize the virus encoded p24(gag) protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+) and CD8(+) T cells to additional regions of Gag compared to vaccination with p55(gag) DNA, achieving maximal cross-clade reactive cellular and humoral responses. PMID:23555935

  11. Prediction of functional sites in proteins using conserved functional group analysis.

    PubMed

    Innis, C Axel; Anand, A Prem; Sowdhamini, R

    2004-04-01

    A detailed knowledge of a protein's functional site is an absolute prerequisite for understanding its mode of action at the molecular level. However, the rapid pace at which sequence and structural information is being accumulated for proteins greatly exceeds our ability to determine their biochemical roles experimentally. As a result, computational methods are required which allow for the efficient processing of the evolutionary information contained in this wealth of data, in particular that related to the nature and location of functionally important sites and residues. The method presented here, referred to as conserved functional group (CFG) analysis, relies on a simplified representation of the chemical groups found in amino acid side-chains to identify functional sites from a single protein structure and a number of its sequence homologues. We show that CFG analysis can fully or partially predict the location of functional sites in approximately 96% of the 470 cases tested and that, unlike other methods available, it is able to tolerate wide variations in sequence identity. In addition, we discuss its potential in a structural genomics context, where automation, scalability and efficiency are critical, and an increasing number of protein structures are determined with no prior knowledge of function. This is exemplified by our analysis of the hypothetical protein Ydde_Ecoli, whose structure was recently solved by members of the North East Structural Genomics consortium. Although the proposed active site for this protein needs to be validated experimentally, this example illustrates the scope of CFG analysis as a general tool for the identification of residues likely to play an important role in a protein's biochemical function. Thus, our method offers a convenient solution to rapidly and automatically process the vast amounts of data that are beginning to emerge from structural genomics projects. PMID:15033369

  12. Approximate formula for the escape function for nearly conservative scattering

    NASA Astrophysics Data System (ADS)

    Yanovitskij, E. G.

    2002-02-01

    The escape function u(μ) (i.e., the boundary solution of the Milne problem for a semi-infinite atmosphere) is considered. It is presented in the form u(μ) = u0 (μ ) + √ {1 - λ}u1(μ) + (1-λ)u2(μ) + ldots, where λ is the single-scattering albedo. A rather accurate approximate formula for a the function u0 (μ) is obtained for not highly elongated phase function. An approximate expression for the function u2 (μ) is also derived, it is exact in the case of the most simple anisotropic scattering.

  13. MELK-a conserved kinase: functions, signaling, cancer, and controversy.

    PubMed

    Ganguly, Ranjit; Mohyeldin, Ahmed; Thiel, Jordyn; Kornblum, Harley I; Beullens, Monique; Nakano, Ichiro

    2015-01-01

    Maternal embryonic leucine zipper kinase (MELK) is a highly conserved serine/threonine kinase initially found to be expressed in a wide range of early embryonic cellular stages, and as a result has been implicated in embryogenesis and cell cycle control. Recent evidence has identified a broader spectrum of tissue expression pattern for this kinase than previously appreciated. MELK is expressed in several human cancers and stem cell populations. Unique spatial and temporal patterns of expression within these tissues suggest that MELK plays a prominent role in cell cycle control, cell proliferation, apoptosis, cell migration, cell renewal, embryogenesis, oncogenesis, and cancer treatment resistance and recurrence. These findings have important implications for our understanding of development, disease, and cancer therapeutics. Furthermore understanding MELK signaling may elucidate an added dimension of stem cell control. PMID:25852826

  14. Identification of Weakly Conserved Regulatory Elements in Upstream Promoter Regions of Mammals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several methods have been proposed that identify sequences conserved due to evolutionary constraints by cross-species genome comparison. However, aside from the most prominently conserved transcription factor binding sites (TFBS), there is a general lack of cross reference between in silico predicti...

  15. Sex Differences in the Association of Cerebral Hemispheric Specialization of Spatial Function with Conservation Task Performance.

    ERIC Educational Resources Information Center

    Affleck, Glenn; Joyce, Patricia

    1979-01-01

    The association of locus of cerebral hemispheric specialization of spatial function with identity and equivalence conservation judgments was tested in a group of four- to six-year-old right-handed children (N=31). (Author/MP)

  16. Residue Substitutions Near the Redox Center of Bacillus subtilis Spx Affect RNA Polymerase Interaction, Redox Control, and Spx-DNA Contact at a Conserved cis-Acting Element

    PubMed Central

    Lin, Ann A.; Walthers, Don

    2013-01-01

    Spx, a member of the ArsC protein family, is a regulatory factor that interacts with RNA polymerase (RNAP). It is highly conserved in Gram-positive bacteria and controls transcription on a genome-wide scale in response to oxidative stress. The structural requirements for RNAP interaction and promoter DNA recognition by Spx were examined through mutational analysis. Residues near the CxxC redox disulfide center of Spx functioned in RNAP α subunit interaction and in promoter DNA binding. R60E and C10A mutants were shown previously to confer defects in transcriptional activation, but both were able to interact with RNAP. R92, which is conserved in ArsC-family proteins, is likely involved in redox control of Spx, as the C10A mutation, which blocks disulfide formation, was epistatic to the R92A mutation. The R91A mutation reduced transcriptional activation and repression, suggesting a defect in RNAP interaction, which was confirmed by interaction assays using an epitope-tagged mutant protein. Protein-DNA cross-linking detected contact between RNAP-bound Spx and the AGCA element at −44 that is conserved in Spx-controlled genes. This interaction caused repositioning of the RNAP σA subunit from a −35-like element upstream of the trxB (thioredoxin reductase) promoter to positions −36 and −11 of the core promoter. The study shows that RNAP-bound Spx contacts a conserved upstream promoter sequence element when bound to RNAP. PMID:23813734

  17. Conserved cysteine residues in the pore region are obligatory for human TRPM2 channel function

    PubMed Central

    Mei, Zhu-Zhong; Mao, Hong-Ju; Jiang, Lin-Hua

    2006-01-01

    TRPM2 proteins belong to the melastatin-related transient receptor potential or TRPM subfamily and form Ca2+-permeable cationic channels activated by intracellular adenosine diphosphoribose (ADPR). The TRPM2 channel subunit, like all its close relatives, is structurally homologous to the well-characterized voltage-gated potassium channel subunits, each containing six transmembrane segments and a putative pore loop between the fifth and sixth segments. Nevertheless, the structural elements determining the TRPM2 channel functions are still not well understood. In this study, we investigated the functional role of two conserved cysteine residues (at positions 996 and 1008) in the putative pore region of the human TRPM2 by site-directed mutagenesis combined with electrophysiological and biochemical approaches. Expression of wild type hTRPM2 channels in HEK293 cells resulted in robust ADPR-evoked currents. Substitution of cysteine with alanine or serine generated mutant channels that failed to be activated by ADPR. Furthermore, experiments by Western blotting, immunocytochemistry, biotin labelling, and co-immunoprecipitation techniques showed no obvious changes in protein expression, trafficking or membrane localisation, and the ability of interacting with neighbouring subunits that is required for channel assembly. Co-expression of wild type and mutant subunits significantly reduced the ADPR-evoked currents; for combination of wild type and C996S mutant subunits, the reduction was approximately 95%, indicating that incorporation of one or more non-functional C996S subunits leads to the loss of channel function. These results taken together suggest that the cysteine residues in the pore region are obligatory for TRPM2 channel function. PMID:16822940

  18. A posteriori subcell limiting of the discontinuous Galerkin finite element method for hyperbolic conservation laws

    NASA Astrophysics Data System (ADS)

    Dumbser, Michael; Zanotti, Olindo; Loubère, Raphaël; Diot, Steven

    2014-12-01

    The purpose of this work is to propose a novel a posteriori finite volume subcell limiter technique for the Discontinuous Galerkin finite element method for nonlinear systems of hyperbolic conservation laws in multiple space dimensions that works well for arbitrary high order of accuracy in space and time and that does not destroy the natural subcell resolution properties of the DG method. High order time discretization is achieved via a one-step ADER approach that uses a local space-time discontinuous Galerkin predictor method to evolve the data locally in time within each cell. Our new limiting strategy is based on the so-called MOOD paradigm, which a posteriori verifies the validity of a discrete candidate solution against physical and numerical detection criteria after each time step. Here, we employ a relaxed discrete maximum principle in the sense of piecewise polynomials and the positivity of the numerical solution as detection criteria. Within the DG scheme on the main grid, the discrete solution is represented by piecewise polynomials of degree N. For those troubled cells that need limiting, our new limiter approach recomputes the discrete solution by scattering the DG polynomials at the previous time step onto a set of Ns=2N+1 finite volume subcells per space dimension. A robust but accurate ADER-WENO finite volume scheme then updates the subcell averages of the conservative variables within the detected troubled cells. The recomputed subcell averages are subsequently gathered back into high order cell-centered DG polynomials on the main grid via a subgrid reconstruction operator. The choice of Ns=2N+1 subcells is optimal since it allows to match the maximum admissible time step of the finite volume scheme on the subgrid with the maximum admissible time step of the DG scheme on the main grid, minimizing at the same time also the local truncation error of the subcell finite volume scheme. It furthermore provides an excellent subcell resolution of

  19. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    PubMed

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. PMID:27447986

  20. Combining Comparison Functions and Finite Element Approximations in CFD

    NASA Technical Reports Server (NTRS)

    Baumeister, Kenneth J.; Baumeister, Joseph F.

    1995-01-01

    In a variety of potential flow applications, the modal element method has been shown to significantly reduce the numerical grid, employ a more precise grid termination boundary condition, and give theoretical insight to the flow physics. The method employs eigenfunctions to replace the numerical grid over significant portions of the flow field. Generally, a numerical grid is employed around obstacles with complex geometry while eigenfunctions are applied to regions in the flow field where the boundary conditions can easily be satisfied. To handle a wider class of computational fluid dynamics (CFD) problems, the present paper extends the modal element to include function approximations which do not satisfy the governing differential equation. To accomplish this task, a double modal series approximation and weighted residual constraints are developed to force the comparison functions to satisfy the governing differential equation and to interface properly with the finite element solution. As an example, the method is applied to the problem of potential flow in a channel with two-dimensional cylindrical like obstacles. The calculated flow fields are in excellent agreement with exact analytical solutions.

  1. The splicing regulatory element, UGCAUG, is phylogenetically and spatially conserved in introns that flank tissue-specific alternative exons

    PubMed Central

    Minovitsky, Simon; Gee, Sherry L.; Schokrpur, Shiruyeh; Dubchak, Inna; Conboy, John G.

    2005-01-01

    Previous studies have identified UGCAUG as an intron splicing enhancer that is frequently located adjacent to tissue-specific alternative exons in the human genome. Here, we show that UGCAUG is phylogenetically and spatially conserved in introns that flank brain-enriched alternative exons from fish to man. Analysis of sequence from the mouse, rat, dog, chicken and pufferfish genomes revealed a strongly statistically significant association of UGCAUG with the proximal intron region downstream of brain-enriched alternative exons. The number, position and sequence context of intronic UGCAUG elements were highly conserved among mammals and in chicken, but more divergent in fish. Control datasets, including constitutive exons and non-tissue-specific alternative exons, exhibited a much lower incidence of closely linked UGCAUG elements. We propose that the high sequence specificity of the UGCAUG element, and its unique association with tissue-specific alternative exons, mark it as a critical component of splicing switch mechanism(s) designed to activate a limited repertoire of splicing events in cell type-specific patterns. We further speculate that highly conserved UGCAUG-binding protein(s) related to the recently described Fox-1 splicing factor play a critical role in mediating this specificity. PMID:15691898

  2. Conservation and Innovation of APOBEC3A Restriction Functions during Primate Evolution.

    PubMed

    McLaughlin, Richard N; Gable, Jacob T; Wittkopp, Cristina J; Emerman, Michael; Malik, Harmit S

    2016-08-01

    LINE-1 (long interspersed element-1) retroelements are the only active autonomous endogenous retroelements in human genomes. Their retrotransposition activity has created close to 50% of the current human genome. Due to the apparent costs of this proliferation, host genomes have evolved multiple mechanisms to curb LINE-1 retrotransposition. Here, we investigate the evolution and function of the LINE-1 restriction factor APOBEC3A, a member of the APOBEC3 cytidine deaminase gene family. We find that APOBEC3A genes have evolved rapidly under diversifying selection in primates, suggesting changes in APOBEC3A have been recurrently selected in a host-pathogen "arms race." Nonetheless, in contrast to previous reports, we find that the LINE-1 restriction activity of APOBEC3A proteins has been strictly conserved throughout simian primate evolution in spite of its pervasive diversifying selection. Based on these results, we conclude that LINE-1s have not driven the rapid evolution of APOBEC3A in primates. In contrast to this conserved LINE-1 restriction, we find that a subset of primate APOBEC3A genes have enhanced antiviral restriction. We trace this gain of antiviral restriction in APOBEC3A to the common ancestor of a subset of Old World monkeys. Thus, APOBEC3A has not only maintained its LINE-1 restriction ability, but also evolved a gain of antiviral specificity against other pathogens. Our findings suggest that while APOBEC3A has evolved to restrict additional pathogens, only those adaptive amino acid changes that leave LINE-1 restriction unperturbed have been tolerated. PMID:27189538

  3. High conservation of a 5' element required for RNA editing of a C target in chloroplast psbE transcripts.

    PubMed

    Hayes, Michael L; Hanson, Maureen R

    2008-09-01

    C-to-U editing modifies 30-40 distinct nucleotides within higher-plant chloroplast transcripts. Many C targets are located at the same position in homologous genes from different plants; these either could have emerged independently or could share a common origin. The 5' sequence GCCGUU, required for editing of C214 in tobacco psbE in vitro, is one of the few identified editing cis-elements. We investigated psbE sequences from many plant species to determine in what lineage(s) editing of psbE C214 emerged and whether the cis-element identified in tobacco is conserved in plants with a C214. The GCCGUU sequence is present at a high frequency in plants that carry a C214 in psbE. However, Sciadopitys verticillata (Pinophyta) edits C214 despite the presence of nucleotide differences compared to the conserved cis-element. The C214 site in psbE genes is represented in members of four branches of spermatophytes but not in gnetophytes, resulting in the parsimonious prediction that editing of psbE C214 was present in the ancestor of spermatophytes. Extracts from chloroplasts from a species that has a difference in the motif and lacks the C target are incapable of editing tobacco psbE C214 substrates, implying that the critical trans-acting protein factors were not retained without a C target. Because noncoding sequences are less constrained than coding regions, we analyzed sequences 5' to two C editing targets located within coding regions to search for possible editing-related conserved elements. Putative editing cis-elements were uncovered in the 5' UTRs near editing sites psbL C2 and ndhD C2. PMID:18696032

  4. A Conserved C-terminal Element in the Yeast Doa10 and Human MARCH6 Ubiquitin Ligases Required for Selective Substrate Degradation.

    PubMed

    Zattas, Dimitrios; Berk, Jason M; Kreft, Stefan G; Hochstrasser, Mark

    2016-06-01

    Specific proteins are modified by ubiquitin at the endoplasmic reticulum (ER) and are degraded by the proteasome, a process referred to as ER-associated protein degradation. In Saccharomyces cerevisiae, two principal ER-associated protein degradation ubiquitin ligases (E3s) reside in the ER membrane, Doa10 and Hrd1. The membrane-embedded Doa10 functions in the degradation of substrates in the ER membrane, nuclear envelope, cytoplasm, and nucleoplasm. How most E3 ligases, including Doa10, recognize their protein substrates remains poorly understood. Here we describe a previously unappreciated but highly conserved C-terminal element (CTE) in Doa10; this cytosolically disposed 16-residue motif follows the final transmembrane helix. A conserved CTE asparagine residue is required for ubiquitylation and degradation of a subset of Doa10 substrates. Such selectivity suggests that the Doa10 CTE is involved in substrate discrimination and not general ligase function. Functional conservation of the CTE was investigated in the human ortholog of Doa10, MARCH6 (TEB4), by analyzing MARCH6 autoregulation of its own degradation. Mutation of the conserved Asn residue (N890A) in the MARCH6 CTE stabilized the normally short lived enzyme to the same degree as a catalytically inactivating mutation (C9A). We also report the localization of endogenous MARCH6 to the ER using epitope tagging of the genomic MARCH6 locus by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated genome editing. These localization and CTE analyses support the inference that MARCH6 and Doa10 are functionally similar. Moreover, our results with the yeast enzyme suggest that the CTE is involved in the recognition and/or ubiquitylation of specific protein substrates. PMID:27068744

  5. Enhancer turnover and conserved regulatory function in vertebrate evolution

    PubMed Central

    Domené, Sabina; Bumaschny, Viviana F.; de Souza, Flávio S. J.; Franchini, Lucía F.; Nasif, Sofía; Low, Malcolm J.; Rubinstein, Marcelo

    2013-01-01

    Mutations in regulatory regions including enhancers are an important source of variation and innovation during evolution. Enhancers can evolve by changes in the sequence, arrangement and repertoire of transcription factor binding sites, but whole enhancers can also be lost or gained in certain lineages in a process of turnover. The proopiomelanocortin gene (Pomc), which encodes a prohormone, is expressed in the pituitary and hypothalamus of all jawed vertebrates. We have previously described that hypothalamic Pomc expression in mammals is controlled by two enhancers—nPE1 and nPE2—that are derived from transposable elements and that presumably replaced the ancestral neuronal Pomc regulatory regions. Here, we show that nPE1 and nPE2, even though they are mammalian novelties with no homologous counterpart in other vertebrates, nevertheless can drive gene expression specifically to POMC neurons in the hypothalamus of larval and adult transgenic zebrafish. This indicates that when neuronal Pomc enhancers originated de novo during early mammalian evolution, the newly created cis- and trans-codes were similar to the ancestral ones. We also identify the neuronal regulatory region of zebrafish pomca and confirm that it is not homologous to the mammalian enhancers. Our work sheds light on the process of gene regulatory evolution by showing how a locus can undergo enhancer turnover and nevertheless maintain the ancestral transcriptional output. PMID:24218639

  6. Identification and functional analysis of essential, conserved, housekeeping and duplicated genes.

    PubMed

    Arun, P V Parvati Sai; Miryala, Sravan Kumar; Chattopadhyay, Subhayan; Thiyyagura, Kranthi; Bawa, Payal; Bhattacharjee, Madhuchhanda; Yellaboina, Sailu

    2016-05-01

    Gene conservation, duplication and constitutive expression are intricately linked and strong predictors of essentiality. Here, we introduce metrics based on diversity indices to measure gene conservation, duplication and constitutive expression and validate them by measuring their performance in prediction of essential genes. Conservation and duplication were measured using the diversity indices on the bit score profile of Escherichia coli K12 orthologues, across the genomes, and paralogues, within the genome respectively. Constitutive expression was measured using expression diversity of E. coli K12 genes across different conditions. In addition, we developed a systematic method for enrichment analysis of gene-sets in a given ranked list of genes. The method was used to identify genome-wide functions of essential, conserved, constitutively expressed and duplicated genes. Furthermore, we also ranked various operons, complexes and pathways according to their essentiality, conservation, constitutive expression and duplication. PMID:27129600

  7. Elements of a function analytic approach to probability.

    SciTech Connect

    Ghanem, Roger Georges; Red-Horse, John Robert

    2008-02-01

    We first provide a detailed motivation for using probability theory as a mathematical context in which to analyze engineering and scientific systems that possess uncertainties. We then present introductory notes on the function analytic approach to probabilistic analysis, emphasizing the connections to various classical deterministic mathematical analysis elements. Lastly, we describe how to use the approach as a means to augment deterministic analysis methods in a particular Hilbert space context, and thus enable a rigorous framework for commingling deterministic and probabilistic analysis tools in an application setting.

  8. The method of space-time and conservation element and solution element: A new approach for solving the Navier-Stokes and Euler equations

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung

    1995-01-01

    A new numerical framework for solving conservation laws is being developed. This new framework differs substantially in both concept and methodology from the well-established methods, i.e., finite difference, finite volume, finite element, and spectral methods. It is conceptually simple and designed to overcome several key limitations of the above traditional methods. A two-level scheme for solving the convection-diffusion equation is constructed and used to illuminate the major differences between the present method and those previously mentioned. This explicit scheme, referred to as the a-mu scheme, has two independent marching variables.

  9. From Elements to Metabolism: Linking Organismal Stoichiometry to Ecosystem Function

    NASA Astrophysics Data System (ADS)

    Cohen, M. J.; Nifong, R. L.

    2014-12-01

    Metabolism is an integrative metric of ecosystem function and energetics, synthesizing the relative contributions of multiple inputs, processes, and interactions. Stoichiometry is a framework based on elemental ratios for understanding how organisms interact within ecosystems. Linking the two has the potential to yield fresh insight about how ecosystems utilize elements and energy. We sought to quantify the link between the stoichiometry of ecosystem metabolism, specifically the C:N:P ratios of integrated autotrophic assimilation, and the stoichiometric tissue ratios observed in the dominant autotrophs. Using high frequency in situ nutrient sensors we estimated the assimilatory fluxes of C, N, and P in multiple spring-fed rivers of varying autotrophic species composition. We measured autotroph cover in each spring river, collected composite vegetation samples, and evaluated tissue stoichiometry; as expected, we observed large differences in C:N and N:P between algal and vascular plant taxa. We observed associations between measured tissue stoichiometry and elemental ratios at the ecosystem scale, suggesting that aggregated assimilatory fluxes may be useful for partitioning primary production and linking organismal nutrient content to the stoichiometry of ecosystem metabolism.

  10. Hierarchical partitioning of metazoan protein conservation profiles provides new functional insights.

    PubMed

    Witztum, Jonathan; Persi, Erez; Horn, David; Pasmanik-Chor, Metsada; Chor, Benny

    2014-01-01

    The availability of many complete, annotated proteomes enables the systematic study of the relationships between protein conservation and functionality. We explore this question based solely on the presence or absence of protein homologues (a.k.a. conservation profiles). We study 18 metazoans, from two distinct points of view: the human's and the fly's. Using the GOrilla gene ontology (GO) analysis tool, we explore functional enrichment of the "universal proteins", those with homologues in all 17 other species, and of the "non-universal proteins". A large number of GO terms are strongly enriched in both human and fly universal proteins. Most of these functions are known to be essential. A smaller number of GO terms, exhibiting markedly different properties, are enriched in both human and fly non-universal proteins. We further explore the non-universal proteins, whose conservation profiles are consistent with the "tree of life" (TOL consistent), as well as the TOL inconsistent proteins. Finally, we applied Quantum Clustering to the conservation profiles of the TOL consistent proteins. Each cluster is strongly associated with one or a small number of specific monophyletic clades in the tree of life. The proteins in many of these clusters exhibit strong functional enrichment associated with the "life style" of the related clades. Most previous approaches for studying function and conservation are "bottom up", studying protein families one by one, and separately assessing the conservation of each. By way of contrast, our approach is "top down". We globally partition the set of all proteins hierarchically, as described above, and then identify protein families enriched within different subdivisions. While supporting previous findings, our approach also provides a tool for discovering novel relations between protein conservation profiles, functionality, and evolutionary history as represented by the tree of life. PMID:24594619

  11. A conserved cysteine motif essential for ceramide kinase function.

    PubMed

    Lidome, Emilie; Graf, Christine; Jaritz, Markus; Schanzer, Andrea; Rovina, Philipp; Nikolay, Rainer; Bornancin, Frédéric

    2008-10-01

    Ceramide kinase (CerK) is a sphingolipid metabolizing enzyme very sensitive to oxidation; however, the determinants are unknown. We show here that the thiol-modifying agent N-ethyl-maleimide abrogates CerK activity in vitro and in a cell based assay, implying that important cysteine residues are accessible in purified as well as endogenous CerK. We replaced every 22 residues in human CerK, by an alanine, and measured activity in the resulting mutant proteins. This led to identification of a cluster of cysteines, C(347)XXXC(351)XXC(354), essential for CerK function. These findings are discussed based on homology modeling of the catalytic domain of CerK. PMID:18662741

  12. Functional studies on the ATM intronic splicing processing element

    PubMed Central

    Lewandowska, Marzena A.; Stuani, Cristiana; Parvizpur, Alireza; Baralle, Francisco E.; Pagani, Franco

    2005-01-01

    In disease-associated genes, the understanding of the functional significance of deep intronic nucleotide variants may represent a difficult challenge. We have previously reported a new disease-causing mechanism that involves an intronic splicing processing element (ISPE) in ATM, composed of adjacent consensus 5′ and 3′ splice sites. A GTAA deletion within ISPE maintains potential adjacent splice sites, disrupts a non-canonical U1 snRNP interaction and activates an aberrant exon. In this paper, we demonstrate that binding of U1 snRNA through complementarity within a ∼40 nt window downstream of the ISPE prevents aberrant splicing. By selective mutagenesis at the adjacent consensus ISPE splice sites, we show that this effect is not due to a resplicing process occurring at the ISPE. Functional comparison of the ATM mouse counterpart and evaluation of the pre-mRNA splicing intermediates derived from affected cell lines and hybrid minigene assays indicate that U1 snRNP binding at the ISPE interferes with the cryptic acceptor site. Activation of this site results in a stringent 5′–3′ order of intron sequence removal around the cryptic exon. Artificial U1 snRNA loading by complementarity to heterologous exonic sequences represents a potential therapeutic method to prevent the usage of an aberrant CFTR cryptic exon. Our results suggest that ISPE-like intronic elements binding U1 snRNPs may regulate correct intron processing. PMID:16030351

  13. Applications of step-selection functions in ecology and conservation.

    PubMed

    Thurfjell, Henrik; Ciuti, Simone; Boyce, Mark S

    2014-01-01

    Recent progress in positioning technology facilitates the collection of massive amounts of sequential spatial data on animals. This has led to new opportunities and challenges when investigating animal movement behaviour and habitat selection. Tools like Step Selection Functions (SSFs) are relatively new powerful models for studying resource selection by animals moving through the landscape. SSFs compare environmental attributes of observed steps (the linear segment between two consecutive observations of position) with alternative random steps taken from the same starting point. SSFs have been used to study habitat selection, human-wildlife interactions, movement corridors, and dispersal behaviours in animals. SSFs also have the potential to depict resource selection at multiple spatial and temporal scales. There are several aspects of SSFs where consensus has not yet been reached such as how to analyse the data, when to consider habitat covariates along linear paths between observations rather than at their endpoints, how many random steps should be considered to measure availability, and how to account for individual variation. In this review we aim to address all these issues, as well as to highlight weak features of this modelling approach that should be developed by further research. Finally, we suggest that SSFs could be integrated with state-space models to classify behavioural states when estimating SSFs. PMID:25520815

  14. A geometrically-conservative, synchronized, flux-corrected remap for arbitrary Lagrangian-Eulerian computations with nodal finite elements

    NASA Astrophysics Data System (ADS)

    López Ortega, A.; Scovazzi, G.

    2011-07-01

    This article describes a conservative synchronized remap algorithm applicable to arbitrary Lagrangian-Eulerian computations with nodal finite elements. In the proposed approach, ideas derived from flux-corrected transport (FCT) methods are extended to conservative remap. Unique to the proposed method is the direct incorporation of the geometric conservation law (GCL) in the resulting numerical scheme. It is shown here that the geometric conservation law allows the method to inherit the positivity preserving and local extrema diminishing (LED) properties typical of FCT schemes. The proposed framework is extended to the systems of equations that typically arise in meteorological and compressible flow computations. The proposed algorithm remaps the vector fields associated with these problems by means of a synchronized strategy. The present paper also complements and extends the work of the second author on nodal-based methods for shock hydrodynamics, delivering a fully integrated suite of Lagrangian/remap algorithms for computations of compressible materials under extreme load conditions. Extensive testing in one, two, and three dimensions shows that the method is robust and accurate under typical computational scenarios.

  15. Functional Analysis of Semi-conserved Transit Peptide Motifs and Mechanistic Implications in Precursor Targeting and Recognition.

    PubMed

    Holbrook, Kristen; Subramanian, Chitra; Chotewutmontri, Prakitchai; Reddick, L Evan; Wright, Sarah; Zhang, Huixia; Moncrief, Lily; Bruce, Barry D

    2016-09-01

    Over 95% of plastid proteins are nuclear-encoded as their precursors containing an N-terminal extension known as the transit peptide (TP). Although highly variable, TPs direct the precursors through a conserved, posttranslational mechanism involving translocons in the outer (TOC) and inner envelope (TOC). The organelle import specificity is mediated by one or more components of the Toc complex. However, the high TP diversity creates a paradox on how the sequences can be specifically recognized. An emerging model of TP design is that they contain multiple loosely conserved motifs that are recognized at different steps in the targeting and transport process. Bioinformatics has demonstrated that many TPs contain semi-conserved physicochemical motifs, termed FGLK. In order to characterize FGLK motifs in TP recognition and import, we have analyzed two well-studied TPs from the precursor of RuBisCO small subunit (SStp) and ferredoxin (Fdtp). Both SStp and Fdtp contain two FGLK motifs. Analysis of large set mutations (∼85) in these two motifs using in vitro, in organello, and in vivo approaches support a model in which the FGLK domains mediate interaction with TOC34 and possibly other TOC components. In vivo import analysis suggests that multiple FGLK motifs are functionally redundant. Furthermore, we discuss how FGLK motifs are required for efficient precursor protein import and how these elements may permit a convergent function of this highly variable class of targeting sequences. PMID:27378725

  16. Basis Functions With Divergence Constraints For The Finite Element Method

    NASA Astrophysics Data System (ADS)

    Pinciuc, Christopher Michael

    Maxwell's equations are a system of partial differential equations of vector fields. Imposing the constitutive relations for material properties yields equations for the curl and divergence of the electric and magnetic fields. The curl and divergence equations must be solved simultaneously, which is not the same as solving three separate scalar problems in each component of the vector field. This thesis describes a new method for solving partial differential equations of vector fields using the finite element method. New basis functions are used to solve the curl equation while allowing the divergence to be set as a constraint. The basis functions are defined on a mesh of bricks and the method is applicable for geometries that conform to a Cartesian coordinate system. The basis functions are a combination of cubic Hermite splines and second order Lagrange interpolation polynomials. The method yields a linearly independent set of constraints for the divergence, which is modelled to second order accuracy within each brick. Mesh refinement is accomplished by dividing selected bricks into 2 x 2 x 2 smaller bricks of equal size. The change in the node pattern at an interface where mesh refinement occurs necessitates a modified implementation of the divergence constraints as well as additional constraints for hanging nodes. The mesh can be refined to an arbitrary number of levels. The basis functions can exactly model the discontinuity in the normal component of the field at a planar interface. The method is modified to solve problems with singularities at material boundaries that form 90° edges and corners. The primary test problem of the new basis functions is to obtain the resonant frequencies and fields of three-dimensional cavities. The new basis functions can resolve physical solutions and non-physical, spurious modes. The eigenvalues obtained with the new method are in good agreement with exact solutions and experimental values in cases where they exist. There is

  17. A Space-Time Conservation Element and Solution Element Method for Solving the Two- and Three-Dimensional Unsteady Euler Equations Using Quadrilateral and Hexahedral Meshes

    NASA Technical Reports Server (NTRS)

    Zhang, Zeng-Chan; Yu, S. T. John; Chang, Sin-Chung; Jorgenson, Philip (Technical Monitor)

    2001-01-01

    In this paper, we report a version of the Space-Time Conservation Element and Solution Element (CE/SE) Method in which the 2D and 3D unsteady Euler equations are simulated using structured or unstructured quadrilateral and hexahedral meshes, respectively. In the present method, mesh values of flow variables and their spatial derivatives are treated as independent unknowns to be solved for. At each mesh point, the value of a flow variable is obtained by imposing a flux conservation condition. On the other hand, the spatial derivatives are evaluated using a finite-difference/weighted-average procedure. Note that the present extension retains many key advantages of the original CE/SE method which uses triangular and tetrahedral meshes, respectively, for its 2D and 3D applications. These advantages include efficient parallel computing ease of implementing non-reflecting boundary conditions, high-fidelity resolution of shocks and waves, and a genuinely multidimensional formulation without using a dimensional-splitting approach. In particular, because Riemann solvers, the cornerstones of the Godunov-type upwind schemes, are not needed to capture shocks, the computational logic of the present method is considerably simpler. To demonstrate the capability of the present method, numerical results are presented for several benchmark problems including oblique shock reflection, supersonic flow over a wedge, and a 3D detonation flow.

  18. Identity elements for the aminoacylation of metazoan mitochondrial tRNAArg have been widely conserved throughout evolution and ensure the fidelity of the AGR codon reassignment

    PubMed Central

    Igloi, Gabor L; Leisinger, Anne-Katrin

    2014-01-01

    Eumetazoan mitochondrial tRNAs possess structures (identity elements) that require the specific recognition by their cognate nuclear-encoded aminoacyl-tRNA synthetases. The AGA (arginine) codon of the standard genetic code has been reassigned to serine/glycine/termination in eumetazoan organelles and is translated in some organisms by a mitochondrially encoded tRNASerUCU. One mechanism to prevent mistranslation of the AGA codon as arginine would require a set of tRNA identity elements distinct from those possessed by the cytoplasmic tRNAArg in which the major identity elements permit the arginylation of all 5 encoded isoacceptors. We have performed comparative in vitro aminoacylation using an insect mitochondrial arginyl-tRNA synthetase and tRNAArgUCG structural variants. The established identity elements are sufficient to maintain the fidelity of tRNASerUCU reassignment. tRNAs having a UCU anticodon cannot be arginylated but can be converted to arginine acceptance by identity element transplantation. We have examined the evolutionary distribution and functionality of these tRNA elements within metazoan taxa. We conclude that the identity elements that have evolved for the recognition of mitochondrial tRNAArgUCG by the nuclear encoded mitochondrial arginyl-tRNA synthetases of eumetazoans have been extensively, but not universally conserved, throughout this clade. They ensure that the AGR codon reassignment in eumetazoan mitochondria is not compromised by misaminoacylation. In contrast, in other metazoans, such as Porifera, whose mitochondrial translation is dictated by the universal genetic code, recognition of the 2 encoded tRNAArgUCG/UCU isoacceptors is achieved through structural features that resemble those employed by the yeast cytoplasmic system. PMID:25603118

  19. Conserved Noncoding Elements Follow Power-Law-Like Distributions in Several Genomes as a Result of Genome Dynamics

    PubMed Central

    Polychronopoulos, Dimitris; Sellis, Diamantis; Almirantis, Yannis

    2014-01-01

    Conserved, ultraconserved and other classes of constrained elements (collectively referred as CNEs here), identified by comparative genomics in a wide variety of genomes, are non-randomly distributed across chromosomes. These elements are defined using various degrees of conservation between organisms and several thresholds of minimal length. We here investigate the chromosomal distribution of CNEs by studying the statistical properties of distances between consecutive CNEs. We find widespread power-law-like distributions, i.e. linearity in double logarithmic scale, in the inter-CNE distances, a feature which is connected with fractality and self-similarity. Given that CNEs are often found to be spatially associated with genes, especially with those that regulate developmental processes, we verify by appropriate gene masking that a power-law-like pattern emerges irrespectively of whether elements found close or inside genes are excluded or not. An evolutionary model is put forward for the understanding of these findings that includes segmental or whole genome duplication events and eliminations (loss) of most of the duplicated CNEs. Simulations reproduce the main features of the observed size distributions. Power-law-like patterns in the genomic distributions of CNEs are in accordance with current knowledge about their evolutionary history in several genomes. PMID:24787386

  20. Defining conservation priorities for freshwater fishes according to taxonomic, functional, and phylogenetic diversity

    USGS Publications Warehouse

    Strecker, Angela; Olden, Julian D.; Whittier, Joanna B.; Paukert, Craig P.

    2011-01-01

    To date, the predominant use of systematic conservation planning has been to evaluate and conserve areas of high terrestrial biodiversity. Although studies in freshwater ecosystems have received recent attention, research has rarely considered the potential trade-offs between protecting different dimensions of biodiversity and the ecological processes that maintain diversity. We provide the first systematic prioritization for freshwaters (focusing on the highly threatened and globally distinct fish fauna of the Lower Colorado River Basin, USA) simultaneously considering scenarios of: taxonomic, functional, and phylogenetic diversity; contemporary threats to biodiversity (including interactions with nonnative species); and future climate change and human population growth. There was 75% congruence between areas of highest conservation priority for different aspects of biodiversity, suggesting that conservation efforts can concurrently achieve strong complementarity among all types of diversity. However, sizable fractions of the landscape were incongruent across conservation priorities for different diversity scenarios, underscoring the importance of considering multiple dimensions of biodiversity and highlighting catchments that contribute disproportionately to taxonomic, functional, and phylogenetic diversity in the region. Regions of projected human population growth were not concordant with conservation priorities; however, higher human population abundance will likely have indirect effects on native biodiversity by increasing demand for water. This will come in direct conflict with projected reductions in precipitation and warmer temperatures, which have substantial overlap with regions of high contemporary diversity. Native and endemic fishes in arid ecosystems are critically endangered by both current and future threats, but our results highlight the use of systematic conservation planning for the optimal allocation of limited resources that incorporates

  1. Defining conservation priorities for freshwater fishes according to taxonomic, functional, and phylogenetic diversity

    USGS Publications Warehouse

    Strecker, A.L.; Olden, J.D.; Whittier, Joanna B.; Paukert, C.P.

    2011-01-01

    To date, the predominant use of systematic conservation planning has been to evaluate and conserve areas of high terrestrial biodiversity. Although studies in freshwater ecosystems have received recent attention, research has rarely considered the potential tradeoffs between protecting different dimensions of biodiversity and the ecological processes that maintain diversity. We provide the first systematic prioritization for freshwaters (focusing on the highly threatened and globally distinct fish fauna of the Lower Colorado River Basin, USA) simultaneously considering scenarios of: taxonomic, functional, and phylogenetic diversity;contemporary threats to biodiversity (including interactions with nonnative species);and future climate change and human population growth. There was 75% congruence between areas of highest conservation priority for different aspects of biodiversity, suggesting that conservation efforts can concurrently achieve strong complementarity among all types of diversity. However, sizable fractions of the landscape were incongruent across conservation priorities for different diversity scenarios, underscoring the importance of considering multiple dimensions of biodiversity and highlighting catchments that contribute disproportionately to taxonomic, functional, and phylogenetic diversity in the region. Regions of projected human population growth were not concordant with conservation priorities;however, higher human population abundance will likely have indirect effects on native biodiversity by increasing demand for water. This will come in direct conflict with projected reductions in precipitation and warmer temperatures, which have substantial overlap with regions of high contemporary diversity. Native and endemic fishes in arid ecosystems are critically endangered by both current and future threats, but our results highlight the use of systematic conservation planning for the optimal allocation of limited resources that incorporates multiple

  2. Trace element geochemistry of soils and plants in Kenyan conservation areas and implications for wildlife nutrition.

    PubMed

    Maskall, J; Thornton, I

    1991-06-01

    Trace element concentrations in soils, plants and animals in National Parks and Wildlife Reserves in Kenya are assessed using geochemical mapping techniques. Soil trace element concentrations are shown to be related to soil parent material and possibly to pedological and hydrological factors. At Lake Nakuru National Park, plant trace element concentrations vary with plant species and the geochemical conditions that influence uptake are discussed. Impala at Lake Nakuru National Park and black rhino at Solio Wildlife Reserve are shown to have a lower blood copper status than animals from other areas. The trace element status of wildlife is assessed also with respect to critical concentrations used for domestic ruminants. It is suggested that at Lake Nakuru National Park, the low soil copper content and high molybdenum content of some plants contributes to the low copper status of impala and may also influence the nutrition of other species. PMID:24202842

  3. vanG Element Insertions within a Conserved Chromosomal Site Conferring Vancomycin Resistance to Streptococcus agalactiae and Streptococcus anginosus

    PubMed Central

    Srinivasan, Velusamy; Metcalf, Benjamin J.; Knipe, Kristen M.; Ouattara, Mahamoudou; McGee, Lesley; Shewmaker, Patricia L.; Glennen, Anita; Nichols, Megin; Harris, Carol; Brimmage, Mary; Ostrowsky, Belinda; Park, Connie J.; Schrag, Stephanie J.; Frace, Michael A.; Sammons, Scott A.

    2014-01-01

    ABSTRACT Three vancomycin-resistant streptococcal strains carrying vanG elements (two invasive Streptococcus agalactiae isolates [GBS-NY and GBS-NM, both serotype II and multilocus sequence type 22] and one Streptococcus anginosus [Sa]) were examined. The 45,585-bp elements found within Sa and GBS-NY were nearly identical (together designated vanG-1) and shared near-identity over an ~15-kb overlap with a previously described vanG element from Enterococcus faecalis. Unexpectedly, vanG-1 shared much less homology with the 49,321-bp vanG-2 element from GBS-NM, with widely different levels (50% to 99%) of sequence identity shared among 44 related open reading frames. Immediately adjacent to both vanG-1 and vanG-2 were 44,670-bp and 44,680-bp integrative conjugative element (ICE)-like sequences, designated ICE-r, that were nearly identical in the two group B streptococcal (GBS) strains. The dual vanG and ICE-r elements from both GBS strains were inserted at the same position, between bases 1328 and 1329, within the identical RNA methyltransferase (rumA) genes. A GenBank search revealed that although most GBS strains contained insertions within this specific site, only sequence type 22 (ST22) GBS strains contained highly related ICE-r derivatives. The vanG-1 element in Sa was also inserted within this position corresponding to its rumA homolog adjacent to an ICE-r derivative. vanG-1 insertions were previously reported within the same relative position in the E. faecalis rumA homolog. An ICE-r sequence perfectly conserved with respect to its counterpart in GBS-NY was apparent within the same site of the rumA homolog of a Streptococcus dysgalactiae subsp. equisimilis strain. Additionally, homologous vanG-like elements within the conserved rumA target site were evident in Roseburia intestinalis. PMID:25053786

  4. Multilevel Selection Theory and the Evolutionary Functions of Transposable Elements

    PubMed Central

    Brunet, Tyler D.P.; Doolittle, W. Ford

    2015-01-01

    One of several issues at play in the renewed debate over “junk DNA” is the organizational level at which genomic features might be seen as selected, and thus to exhibit function, as etiologically defined. The intuition frequently expressed by molecular geneticists that junk DNA is functional because it serves to “speed evolution” or as an “evolutionary repository” could be recast as a claim about selection between species (or clades) rather than within them, but this is not often done. Here, we review general arguments for the importance of selection at levels above that of organisms in evolution, and develop them further for a common genomic feature: the carriage of transposable elements (TEs). In many species, not least our own, TEs comprise a large fraction of all nuclear DNA, and whether they individually or collectively contribute to fitness—or are instead junk— is a subject of ongoing contestation. Even if TEs generally owe their origin to selfish selection at the lowest level (that of genomes), their prevalence in extant organisms and the prevalence of extant organisms bearing them must also respond to selection within species (on organismal fitness) and between species (on rates of speciation and extinction). At an even higher level, the persistence of clades may be affected (positively or negatively) by TE carriage. If indeed TEs speed evolution, it is at these higher levels of selection that such a function might best be attributed to them as a class. PMID:26253318

  5. Computation of Schenberg response function by using finite element modelling

    NASA Astrophysics Data System (ADS)

    Frajuca, C.; Bortoli, F. S.; Magalhaes, N. S.

    2016-05-01

    Schenberg is a detector of gravitational waves resonant mass type, with a central frequency of operation of 3200 Hz. Transducers located on the surface of the resonating sphere, according to a distribution half-dodecahedron, are used to monitor a strain amplitude. The development of mechanical impedance matchers that act by increasing the coupling of the transducers with the sphere is a major challenge because of the high frequency and small in size. The objective of this work is to study the Schenberg response function obtained by finite element modeling (FEM). Finnaly, the result is compared with the result of the simplified model for mass spring type system modeling verifying if that is suitable for the determination of sensitivity detector, as the conclusion the both modeling give the same results.

  6. Numerical solution of transonic full stream function equations in conservation form

    NASA Technical Reports Server (NTRS)

    Hafez, M. M.

    1979-01-01

    The stream function equation in conservation form is solved iteratively based on the artificial compressibility method. The density is not a unique function of the mass flux. In order to avoid the ambiguity near the sonic line, the density is updated in terms of the velocity, which is obtained through a simple integration of a first order equation step by step in the flow field. Iteration algorithms and finite difference approximations are discussed and numerical results of both conservative and nonconservative calculations are presented.

  7. Function-based classification of carbohydrate-active enzymes by recognition of short, conserved peptide motifs.

    PubMed

    Busk, Peter Kamp; Lange, Lene

    2013-06-01

    Functional prediction of carbohydrate-active enzymes is difficult due to low sequence identity. However, similar enzymes often share a few short motifs, e.g., around the active site, even when the overall sequences are very different. To exploit this notion for functional prediction of carbohydrate-active enzymes, we developed a simple algorithm, peptide pattern recognition (PPR), that can divide proteins into groups of sequences that share a set of short conserved sequences. When this method was used on 118 glycoside hydrolase 5 proteins with 9% average pairwise identity and representing four characterized enzymatic functions, 97% of the proteins were sorted into groups correlating with their enzymatic activity. Furthermore, we analyzed 8,138 glycoside hydrolase 13 proteins including 204 experimentally characterized enzymes with 28 different functions. There was a 91% correlation between group and enzyme activity. These results indicate that the function of carbohydrate-active enzymes can be predicted with high precision by finding short, conserved motifs in their sequences. The glycoside hydrolase 61 family is important for fungal biomass conversion, but only a few proteins of this family have been functionally characterized. Interestingly, PPR divided 743 glycoside hydrolase 61 proteins into 16 subfamilies useful for targeted investigation of the function of these proteins and pinpointed three conserved motifs with putative importance for enzyme activity. Furthermore, the conserved sequences were useful for cloning of new, subfamily-specific glycoside hydrolase 61 proteins from 14 fungi. In conclusion, identification of conserved sequence motifs is a new approach to sequence analysis that can predict carbohydrate-active enzyme functions with high precision. PMID:23524681

  8. Hoxb-2 transcriptional activation in rhombomeres 3 and 5 requires an evolutionarily conserved cis-acting element in addition to the Krox-20 binding site.

    PubMed Central

    Vesque, C; Maconochie, M; Nonchev, S; Ariza-McNaughton, L; Kuroiwa, A; Charnay, P; Krumlauf, R

    1996-01-01

    Segmentation is a key feature of the development of the vertebrate hindbrain where it involves the generation of repetitive morphological units termed rhombomeres (r). Hox genes are likely to play an essential role in the specification of segmental identity and we have been investigating their regulation. We show here that the mouse and chicken Hoxb-2 genes are dependent for their expression in r3 and r5 on homologous enhancer elements and on binding to this enhancer of the r3/r5-specific transcriptional activator Krox-20. Among the three Krox-20 binding sites of the mouse Hoxb-2 enhancer, only the high-affinity site is absolutely necessary for activity. In contrast, we have identified an additional cis-acting element, Box1, essential for r3/r5 enhancer activity. It is conserved both in sequence and in position respective to the high-affinity Krox-20 binding site within the mouse and chicken enhancers. Furthermore, a short 44 bp sequence spanning the Box1 and Krox-20 sites can act as an r3/r5 enhancer when oligomerized. Box1 may therefore constitute a recognition sequence for another factor cooperating with Krox-20. Taken together, these data demonstrate the conservation of Hox gene regulation and of Krox-20 function during vertebrate evolution. Images PMID:8895582

  9. Identification of conserved regulatory elements in upstream promoter regions of mammals at relaxed thresholds by comparative genomics - a case study using PEPCK

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background Comparative genomics is the primary method to discover regulatory elements by identifying conserved sequences due to evolutionary constraints by cross-species genome comparison. Except for the most conserved and prominent transcription factor binding sites (TFBS), there is a general lack ...

  10. Alu element-containing RNAs maintain nucleolar structure and function.

    PubMed

    Caudron-Herger, Maïwen; Pankert, Teresa; Seiler, Jeanette; Németh, Attila; Voit, Renate; Grummt, Ingrid; Rippe, Karsten

    2015-11-12

    Non-coding RNAs play a key role in organizing the nucleus into functional subcompartments. By combining fluorescence microscopy and RNA deep-sequencing-based analysis, we found that RNA polymerase II transcripts originating from intronic Alu elements (aluRNAs) were enriched in the nucleolus. Antisense-oligo-mediated depletion of aluRNAs or drug-induced inhibition of RNA polymerase II activity disrupted nucleolar structure and impaired RNA polymerase I-dependent transcription of rRNA genes. In contrast, overexpression of a prototypic aluRNA sequence increased both nucleolus size and levels of pre-rRNA, suggesting a functional link between aluRNA, nucleolus integrity and pre-rRNA synthesis. Furthermore, we show that aluRNAs interact with nucleolin and target ectopic genomic loci to the nucleolus. Our study suggests an aluRNA-based mechanism that links RNA polymerase I and II activities and modulates nucleolar structure and rRNA production. PMID:26464461

  11. SLiMPrints: conservation-based discovery of functional motif fingerprints in intrinsically disordered protein regions

    PubMed Central

    Davey, Norman E.; Cowan, Joanne L.; Shields, Denis C.; Gibson, Toby J.; Coldwell, Mark J.; Edwards, Richard J.

    2012-01-01

    Large portions of higher eukaryotic proteomes are intrinsically disordered, and abundant evidence suggests that these unstructured regions of proteins are rich in regulatory interaction interfaces. A major class of disordered interaction interfaces are the compact and degenerate modules known as short linear motifs (SLiMs). As a result of the difficulties associated with the experimental identification and validation of SLiMs, our understanding of these modules is limited, advocating the use of computational methods to focus experimental discovery. This article evaluates the use of evolutionary conservation as a discriminatory technique for motif discovery. A statistical framework is introduced to assess the significance of relatively conserved residues, quantifying the likelihood a residue will have a particular level of conservation given the conservation of the surrounding residues. The framework is expanded to assess the significance of groupings of conserved residues, a metric that forms the basis of SLiMPrints (short linear motif fingerprints), a de novo motif discovery tool. SLiMPrints identifies relatively overconstrained proximal groupings of residues within intrinsically disordered regions, indicative of putatively functional motifs. Finally, the human proteome is analysed to create a set of highly conserved putative motif instances, including a novel site on translation initiation factor eIF2A that may regulate translation through binding of eIF4E. PMID:22977176

  12. Stability of Periodic Solutionsof Conservation Laws with Viscosity:Analysis of the Evans Function

    NASA Astrophysics Data System (ADS)

    Oh, M.; Zumbrun, K.

    We establish instability of periodic traveling waves arising in conservation laws featuring phase transition. The analysis uses the Evans function framework introduced by R.A. Gardner in the periodic case. The main new tool is a periodic generalization of the stability index introduced by Gardner and Zumbrun in the traveling front or pulse case.

  13. Functional conservation analysis and expression modes of grape anthocyanin synthesis genes responsive to low temperature stress.

    PubMed

    Zhang, Cheng; Jia, Haifeng; Wu, Weimin; Wang, Xicheng; Fang, Jinggui; Wang, Chen

    2015-12-10

    In grape cultivation, low temperature generally increases the expression of genes involved in synthesis of anthocyanin. In this study, multi-type structural analysis of the proteins encoded by five anthocyanin biosynthesis genes VvF3H, VvPAL, VvCHS3, VvCHS2 and VvLDOX, in addition to nine of their homologous genes revealed that proteins in grapevine shared a high similarity with that in kiwi, red orange and some other species in which the biosynthesis of anthocyanin significantly influenced by low temperature as proved by previous studies. Low temperature regulatory elements were also found in the promoter region of the grapevine genes VvCHS2, VvPAL and VvF3H. These findings indicate that the functions of anthocyanin biosynthesis genes in grapevine are conservative and might be sensitive to low temperature. In order to identify the specific expression patterns of the five anthocyanin biosynthesis genes and the changes of polyphenols, anthocyanins and flavonoids under low temperature stress. The transcription analysis of the five genes and the content of polyphenols, anthocyanins and flavonoids in grape skins were examined, by using Vitis vinifera L. cv. 'Yongyou 1' and 'Juxing' berries as experimental material and treated at 4°C and 25°C for 24h, 48 h, 72 h and 96 h. The results showed that low temperature greatly enhanced the expression of the five anthocyanin biosynthesis genes. Low temperature greatly slowed down the decomposition of polyphenol, anthocyanin, and flavonoid in grape skins. Our study also found that cv. 'Juxing' responded more sensitively to low temperature than cv. 'Yongyou 1'. All the findings would provide a basis for further study on the mechanism of anthocyanin biosynthesis under environmental stress. PMID:26253159

  14. Comparative functional genomics revealed conservation and diversification of three enhancers of the isl1 gene for motor and sensory neuron-specific expression.

    PubMed

    Uemura, Osamu; Okada, Yohei; Ando, Hideki; Guedj, Mickael; Higashijima, Shin-Ichi; Shimazaki, Takuya; Chino, Naoichi; Okano, Hideyuki; Okamoto, Hitoshi

    2005-02-15

    Islet-1 (Isl1) is a member of the Isl1 family of LIM-homeodomain transcription factors (LIM-HD) that is expressed in a defined subset of motor and sensory neurons during vertebrate embryogenesis. To investigate how this specific expression of isl1 is regulated, we searched for enhancers of the isl1 gene that are conserved in vertebrate evolution. Initially, two enhancer elements, CREST1 and CREST2, were identified downstream of the isl1 locus in the genomes of fugu, chick, mouse, and human by BLAST searching for highly similar elements to those originally identified as motor and sensory neuron-specific enhancers in the zebrafish genome. The combined action of these elements is sufficient for completely recapitulating the subtype-specific expression of the isl1 gene in motor neurons of the mouse spinal cord. Furthermore, by direct comparison of the upstream flanking regions of the zebrafish and human isl1 genes, we identified another highly conserved noncoding element, CREST3, and subsequently C3R, a similar element to CREST3 with two CDP CR1 recognition motifs, in the upstream regions of all other isl1 family members. In mouse and human, CRESTs are located as far as more than 300 kb away from the isl1 locus, while they are much closer to the isl1 locus in zebrafish. Although all of zebrafish CREST2, CREST3, and C3R activate gene expression in the sensory neurons of zebrafish, CREST2 of mouse and human does not have the sequence necessary for sensory neuron-specific expression. Our results revealed both a remarkable conservation of the regulatory elements regulating subtype-specific gene expression in motor and sensory neurons and the dynamic process of reorganization of these elements whereby each element increases the level of cell-type specificity by losing redundant functions with the other elements during vertebrate evolution. PMID:15680372

  15. A stable high-order Spectral Difference method for hyperbolic conservation laws on triangular elements

    NASA Astrophysics Data System (ADS)

    Balan, Aravind; May, Georg; Schöberl, Joachim

    2012-03-01

    Numerical schemes using piecewise polynomial approximation are very popular for high order discretization of conservation laws. While the most widely used numerical scheme under this paradigm appears to be the Discontinuous Galerkin method, the Spectral Difference scheme has often been found attractive as well, because of its simplicity of formulation and implementation. However, recently it has been shown that the scheme is not linearly stable on triangles. In this paper we present an alternate formulation of the scheme, featuring a new flux interpolation technique using Raviart-Thomas spaces, which proves stable under a similar linear analysis in which the standard scheme failed. We demonstrate viability of the concept by showing linear stability both in the semi-discrete sense and for time stepping schemes of the SSP Runge-Kutta type. Furthermore, we present convergence studies, as well as case studies in compressible flow simulation using the Euler equations.

  16. Conserving the functional and phylogenetic trees of life of European tetrapods.

    PubMed

    Thuiller, Wilfried; Maiorano, Luigi; Mazel, Florent; Guilhaumon, François; Ficetola, Gentile Francesco; Lavergne, Sébastien; Renaud, Julien; Roquet, Cristina; Mouillot, David

    2015-02-19

    Protected areas (PAs) are pivotal tools for biodiversity conservation on the Earth. Europe has had an extensive protection system since Natura 2000 areas were created in parallel with traditional parks and reserves. However, the extent to which this system covers not only taxonomic diversity but also other biodiversity facets, such as evolutionary history and functional diversity, has never been evaluated. Using high-resolution distribution data of all European tetrapods together with dated molecular phylogenies and detailed trait information, we first tested whether the existing European protection system effectively covers all species and in particular, those with the highest evolutionary or functional distinctiveness. We then tested the ability of PAs to protect the entire tetrapod phylogenetic and functional trees of life by mapping species' target achievements along the internal branches of these two trees. We found that the current system is adequately representative in terms of the evolutionary history of amphibians while it fails for the rest. However, the most functionally distinct species were better represented than they would be under random conservation efforts. These results imply better protection of the tetrapod functional tree of life, which could help to ensure long-term functioning of the ecosystem, potentially at the expense of conserving evolutionary history. PMID:25561666

  17. Conserving the functional and phylogenetic trees of life of European tetrapods

    PubMed Central

    Thuiller, Wilfried; Maiorano, Luigi; Mazel, Florent; Guilhaumon, François; Ficetola, Gentile Francesco; Lavergne, Sébastien; Renaud, Julien; Roquet, Cristina; Mouillot, David

    2015-01-01

    Protected areas (PAs) are pivotal tools for biodiversity conservation on the Earth. Europe has had an extensive protection system since Natura 2000 areas were created in parallel with traditional parks and reserves. However, the extent to which this system covers not only taxonomic diversity but also other biodiversity facets, such as evolutionary history and functional diversity, has never been evaluated. Using high-resolution distribution data of all European tetrapods together with dated molecular phylogenies and detailed trait information, we first tested whether the existing European protection system effectively covers all species and in particular, those with the highest evolutionary or functional distinctiveness. We then tested the ability of PAs to protect the entire tetrapod phylogenetic and functional trees of life by mapping species' target achievements along the internal branches of these two trees. We found that the current system is adequately representative in terms of the evolutionary history of amphibians while it fails for the rest. However, the most functionally distinct species were better represented than they would be under random conservation efforts. These results imply better protection of the tetrapod functional tree of life, which could help to ensure long-term functioning of the ecosystem, potentially at the expense of conserving evolutionary history. PMID:25561666

  18. The Splicing Factor U2AF Small Subunit Is Functionally Conserved between Fission Yeast and Humans

    PubMed Central

    Webb, Christopher J.; Wise, Jo Ann

    2004-01-01

    The small subunit of U2AF, which functions in 3′ splice site recognition, is more highly conserved than its heterodimeric partner yet is less thoroughly investigated. Remarkably, we find that the small subunit of Schizosaccharomyces pombe U2AF (U2AFSM) can be replaced in vivo by its human counterpart, demonstrating that the conservation extends to function. Precursor mRNAs accumulate in S. pombe following U2AFSM depletion in a time frame consistent with a role in splicing. A comprehensive mutational analysis reveals that all three conserved domains are required for viability. Notably, however, a tryptophan in the pseudo-RNA recognition motif implicated in a key contact with the large subunit by crystallographic data is dispensable whereas amino acids implicated in RNA recognition are critical. Mutagenesis of the two zinc-binding domains demonstrates that they are neither equivalent nor redundant. Finally, two- and three-hybrid analyses indicate that mutations with effects on large-subunit interactions are rare whereas virtually all alleles tested diminished RNA binding by the heterodimer. In addition to demonstrating extraordinary conservation of U2AF small-subunit function, these results provide new insights into the roles of individual domains and residues. PMID:15121844

  19. LINE-1 retrotransposons: from 'parasite' sequences to functional elements.

    PubMed

    Paço, Ana; Adega, Filomena; Chaves, Raquel

    2015-02-01

    Long interspersed nuclear elements-1 (LINE-1) are the most abundant and active retrotransposons in the mammalian genomes. Traditionally, the occurrence of LINE-1 sequences in the genome of mammals has been explained by the selfish DNA hypothesis. Nevertheless, recently, it has also been argued that these sequences could play important roles in these genomes, as in the regulation of gene expression, genome modelling and X-chromosome inactivation. The non-random chromosomal distribution is a striking feature of these retroelements that somehow reflects its functionality. In the present study, we have isolated and analysed a fraction of the open reading frame 2 (ORF2) LINE-1 sequence from three rodent species, Cricetus cricetus, Peromyscus eremicus and Praomys tullbergi. Physical mapping of the isolated sequences revealed an interspersed longitudinal AT pattern of distribution along all the chromosomes of the complement in the three genomes. A detailed analysis shows that these sequences are preferentially located in the euchromatic regions, although some signals could be detected in the heterochromatin. In addition, a coincidence between the location of imprinted gene regions (as Xist and Tsix gene regions) and the LINE-1 retroelements was also observed. According to these results, we propose an involvement of LINE-1 sequences in different genomic events as gene imprinting, X-chromosome inactivation and evolution of repetitive sequences located at the heterochromatic regions (e.g. satellite DNA sequences) of the rodents' genomes analysed. PMID:25106509

  20. The Most Deeply Conserved Noncoding Sequences in Plants Serve Similar Functions to Those in Vertebrates Despite Large Differences in Evolutionary Rates[W

    PubMed Central

    Burgess, Diane; Freeling, Michael

    2014-01-01

    In vertebrates, conserved noncoding elements (CNEs) are functionally constrained sequences that can show striking conservation over >400 million years of evolutionary distance and frequently are located megabases away from target developmental genes. Conserved noncoding sequences (CNSs) in plants are much shorter, and it has been difficult to detect conservation among distantly related genomes. In this article, we show not only that CNS sequences can be detected throughout the eudicot clade of flowering plants, but also that a subset of 37 CNSs can be found in all flowering plants (diverging ∼170 million years ago). These CNSs are functionally similar to vertebrate CNEs, being highly associated with transcription factor and development genes and enriched in transcription factor binding sites. Some of the most highly conserved sequences occur in genes encoding RNA binding proteins, particularly the RNA splicing–associated SR genes. Differences in sequence conservation between plants and animals are likely to reflect differences in the biology of the organisms, with plants being much more able to tolerate genomic deletions and whole-genome duplication events due, in part, to their far greater fecundity compared with vertebrates. PMID:24681619

  1. Evaluation of IRX Genes and Conserved Noncoding Elements in a Region on 5p13.3 Linked to Families with Familial Idiopathic Scoliosis and Kyphosis

    PubMed Central

    Justice, Cristina M.; Bishop, Kevin; Carrington, Blake; Mullikin, Jim C.; Swindle, Kandice; Marosy, Beth; Sood, Raman; Miller, Nancy H.; Wilson, Alexander F.

    2016-01-01

    Because of genetic heterogeneity present in idiopathic scoliosis, we previously defined clinical subsets (a priori) from a sample of families with idiopathic scoliosis to find genes involved with spinal curvature. Previous genome-wide linkage analysis of seven families with at least two individuals with kyphoscoliosis found linkage (P-value = 0.002) in a 3.5-Mb region on 5p13.3 containing only three known genes, IRX1, IRX2, and IRX4. In this study, the exons of IRX1, IRX2, and IRX4, the conserved noncoding elements in the region, and the exons of a nonprotein coding RNA, LOC285577, were sequenced. No functional sequence variants were identified. An intrafamilial test of association found several associated noncoding single nucleotide variants. The strongest association was with rs12517904 (P = 0.00004), located 6.5 kb downstream from IRX1. In one family, the genotypes of nine variants differed from the reference allele in all individuals with kyphoscoliosis, and two of three individuals with scoliosis, but did not differ from the reference allele in all other genotyped individuals. One of these variants, rs117273909, was located in a conserved noncoding region that functions as an enhancer in mice. To test whether the variant allele at rs117273909 had an effect on enhancer activity, zebrafish transgenesis was performed with overlapping fragments of 198 and 687 bp containing either the wild type or the variant allele. Our data suggests that this region acts as a regulatory element; however, its size and target gene(s) need to be identified to determine its role in idiopathic scoliosis. PMID:27172222

  2. Evaluation of IRX Genes and Conserved Noncoding Elements in a Region on 5p13.3 Linked to Families with Familial Idiopathic Scoliosis and Kyphosis.

    PubMed

    Justice, Cristina M; Bishop, Kevin; Carrington, Blake; Mullikin, Jim C; Swindle, Kandice; Marosy, Beth; Sood, Raman; Miller, Nancy H; Wilson, Alexander F

    2016-01-01

    Because of genetic heterogeneity present in idiopathic scoliosis, we previously defined clinical subsets (a priori) from a sample of families with idiopathic scoliosis to find genes involved with spinal curvature. Previous genome-wide linkage analysis of seven families with at least two individuals with kyphoscoliosis found linkage (P-value = 0.002) in a 3.5-Mb region on 5p13.3 containing only three known genes, IRX1, IRX2, and IRX4 In this study, the exons of IRX1, IRX2, and IRX4, the conserved noncoding elements in the region, and the exons of a nonprotein coding RNA, LOC285577, were sequenced. No functional sequence variants were identified. An intrafamilial test of association found several associated noncoding single nucleotide variants. The strongest association was with rs12517904 (P = 0.00004), located 6.5 kb downstream from IRX1 In one family, the genotypes of nine variants differed from the reference allele in all individuals with kyphoscoliosis, and two of three individuals with scoliosis, but did not differ from the reference allele in all other genotyped individuals. One of these variants, rs117273909, was located in a conserved noncoding region that functions as an enhancer in mice. To test whether the variant allele at rs117273909 had an effect on enhancer activity, zebrafish transgenesis was performed with overlapping fragments of 198 and 687 bp containing either the wild type or the variant allele. Our data suggests that this region acts as a regulatory element; however, its size and target gene(s) need to be identified to determine its role in idiopathic scoliosis. PMID:27172222

  3. Structural and biophysical characterization of Staphylococcus aureus SaMazF shows conservation of functional dynamics

    PubMed Central

    Zorzini, Valentina; Buts, Lieven; Sleutel, Mike; Garcia-Pino, Abel; Talavera, Ariel; Haesaerts, Sarah; Greve, Henri De; Cheung, Ambrose; van Nuland, Nico A. J.; Loris, Remy

    2014-01-01

    The Staphylococcus aureus genome contains three toxin–antitoxin modules, including one mazEF module, SamazEF. Using an on-column separation protocol we are able to obtain large amounts of wild-type SaMazF toxin. The protein is well-folded and highly resistant against thermal unfolding but aggregates at elevated temperatures. Crystallographic and nuclear magnetic resonance (NMR) solution studies show a well-defined dimer. Differences in structure and dynamics between the X-ray and NMR structural ensembles are found in three loop regions, two of which undergo motions that are of functional relevance. The same segments also show functionally relevant dynamics in the distantly related CcdB family despite divergence of function. NMR chemical shift mapping and analysis of residue conservation in the MazF family suggests a conserved mode for the inhibition of MazF by MazE. PMID:24748664

  4. Structural and biophysical characterization of Staphylococcus aureus SaMazF shows conservation of functional dynamics.

    PubMed

    Zorzini, Valentina; Buts, Lieven; Sleutel, Mike; Garcia-Pino, Abel; Talavera, Ariel; Haesaerts, Sarah; De Greve, Henri; Cheung, Ambrose; van Nuland, Nico A J; Loris, Remy

    2014-06-01

    The Staphylococcus aureus genome contains three toxin-antitoxin modules, including one mazEF module, SamazEF. Using an on-column separation protocol we are able to obtain large amounts of wild-type SaMazF toxin. The protein is well-folded and highly resistant against thermal unfolding but aggregates at elevated temperatures. Crystallographic and nuclear magnetic resonance (NMR) solution studies show a well-defined dimer. Differences in structure and dynamics between the X-ray and NMR structural ensembles are found in three loop regions, two of which undergo motions that are of functional relevance. The same segments also show functionally relevant dynamics in the distantly related CcdB family despite divergence of function. NMR chemical shift mapping and analysis of residue conservation in the MazF family suggests a conserved mode for the inhibition of MazF by MazE. PMID:24748664

  5. Expression and functional role of a transcribed noncoding RNA with an ultraconserved element in hepatocellular carcinoma.

    PubMed

    Braconi, Chiara; Valeri, Nicola; Kogure, Takayuki; Gasparini, Pierluigi; Huang, Nianyuan; Nuovo, Gerard J; Terracciano, Luigi; Croce, Carlo M; Patel, Tushar

    2011-01-11

    Although expression of non-protein-coding RNA (ncRNA) can be altered in human cancers, their functional relevance is unknown. Ultraconserved regions are noncoding genomic segments that are 100% conserved across humans, mice, and rats. Conservation of gene sequences across species may indicate an essential functional role, and therefore we evaluated the expression of ultraconserved RNAs (ucRNA) in hepatocellular cancer (HCC). The global expression of ucRNAs was analyzed with a custom microarray. Expression was verified in cell lines by real-time PCR or in tissues by in situ hybridization using tissue microarrays. Cellular ucRNA expression was modulated with siRNAs, and the effects on global gene expression and growth of human and murine HCC cells were evaluated. Fifty-six ucRNAs were aberrantly expressed in HepG2 cells compared with nonmalignant hepatocytes. Among these ucRNAs, the greatest change was noted for ultraconserved element 338 (uc.338), which was dramatically increased in human HCC compared with noncancerous adjacent tissues. Although uc.338 is partially located within the poly(rC) binding protein 2 (PCBP2) gene, the transcribed ncRNA encoding uc.338 is expressed independently of PCBP2 and was cloned as a 590-bp RNA gene, termed TUC338. Functional gene annotation analysis indicated predominant effects on genes involved in cell growth. These effects were experimentally demonstrated in both human and murine cells. siRNA to TUC338 decreased both anchorage-dependent and anchorage-independent growth of HCC cells. These studies identify a critical role for TUC338 in regulation of transformed cell growth and of transcribed ultraconserved ncRNA as a unique class of genes involved in the pathobiology of HCC. PMID:21187392

  6. Expression and functional role of a transcribed noncoding RNA with an ultraconserved element in hepatocellular carcinoma

    PubMed Central

    Braconi, Chiara; Valeri, Nicola; Kogure, Takayuki; Gasparini, Pierluigi; Huang, Nianyuan; Nuovo, Gerard J.; Terracciano, Luigi; Croce, Carlo M.; Patel, Tushar

    2011-01-01

    Although expression of non–protein-coding RNA (ncRNA) can be altered in human cancers, their functional relevance is unknown. Ultraconserved regions are noncoding genomic segments that are 100% conserved across humans, mice, and rats. Conservation of gene sequences across species may indicate an essential functional role, and therefore we evaluated the expression of ultraconserved RNAs (ucRNA) in hepatocellular cancer (HCC). The global expression of ucRNAs was analyzed with a custom microarray. Expression was verified in cell lines by real-time PCR or in tissues by in situ hybridization using tissue microarrays. Cellular ucRNA expression was modulated with siRNAs, and the effects on global gene expression and growth of human and murine HCC cells were evaluated. Fifty-six ucRNAs were aberrantly expressed in HepG2 cells compared with nonmalignant hepatocytes. Among these ucRNAs, the greatest change was noted for ultraconserved element 338 (uc.338), which was dramatically increased in human HCC compared with noncancerous adjacent tissues. Although uc.338 is partially located within the poly(rC) binding protein 2 (PCBP2) gene, the transcribed ncRNA encoding uc.338 is expressed independently of PCBP2 and was cloned as a 590-bp RNA gene, termed TUC338. Functional gene annotation analysis indicated predominant effects on genes involved in cell growth. These effects were experimentally demonstrated in both human and murine cells. siRNA to TUC338 decreased both anchorage-dependent and anchorage-independent growth of HCC cells. These studies identify a critical role for TUC338 in regulation of transformed cell growth and of transcribed ultraconserved ncRNA as a unique class of genes involved in the pathobiology of HCC. PMID:21187392

  7. Systems biology approach reveals possible evolutionarily conserved moonlighting functions for enolase.

    PubMed

    Paludo, Gabriela Prado; Lorenzatto, Karina Rodrigues; Bonatto, Diego; Ferreira, Henrique Bunselmeyer

    2015-10-01

    Glycolytic enzymes, such as enolase, have been described as multifunctional complex proteins that also display non-glycolytic activities, termed moonlighting functions. Although enolase multifunctionality has been described for several organisms, the conservation of enolase alternative functions through different phyla has not been explored with more details. A useful strategy to investigate moonlighting functions is the use of systems biology tools, which allow the prediction of protein functions/interactions by graph design and analysis. In this work, available information from protein-protein interaction (PPI) databases were used to design enolase PPI networks for four eukaryotic organisms, namely Homo sapiens, Drosophila melanogaster, Caenorhabditis elegans, and Saccharomyces cerevisiae, covering a wide spectrum of this domain of life. PPI networks with number of nodes ranging from 140 to 411 and up to 15,855 connections were generated, and modularity and centrality analyses, and functional enrichment were performed for all of them. The performed analyses showed that enolase is a central node within the networks, and that, in addition to its canonical interactions with proteins related to glycolysis and energetic metabolism, it is also part of protein clusters related to different biological processes, like transcription, development, and apoptosis, among others. Some of these non-glycolytic clusters, are partially conserved between networks, in terms of overall sharing of orthologs, overall cluster structure, and/or at the levels of key regulatory proteins within clusters. Overall, our results provided evidences of enolase multifunctionality and evolutionary conservation of enolase PPIs at all these levels. PMID:25978602

  8. Intracisternal A-particle genes in Mus musculus: A conserved family of retrovirus-like elements

    SciTech Connect

    Kuff, E.L.; Smith, L.A.; Lueders, K.K.

    1981-03-01

    The structural organization of intracisternal A-particle genes has been studied, using isolates from a mouse gene library in lambda phage Charon 4A. The predominant gene form among the isolates was 7.3 kilobases (kb) in length. R-loops between the 7-kb (35S) A-particle genomic ribonucleic acid and several of these genes were colinear, with no visible evidence of intervening deoxyribonucleic acid sequences. Restriction endonuclease fragments encompassing the 5' and 3' regions of one 7.3b gene were separately subcloned into pBR322. Heteroduplexes between the two subclones revealed an approximately 300-base pair segment of terminally redundant sequences. The cloned 3' fragment hybridized with restriction fragments from the 5' end of several other A-particle genes, demonstrating the presence of common (though not necessarily identical) terminally repeated sequences. The relative abundance of restriction site variants was highly conserved in 12 laboratory strains of Mus musculus, in embryonic and adult tissues of a single inbred strain, and in the SC-1 cell line of feral mouse origin, but appeared to differ in a feral Japanese substrain, Mus musculus molossinus. Some evidence suggests that subsets of A-particle genes may have similar flanking sequences. The results are discussed in terms of the evolution of this multigene family.

  9. Divergent and Conserved Elements Comprise the Chemoreceptive Repertoire of the Nonblood-Feeding Mosquito Toxorhynchites amboinensis

    PubMed Central

    Zhou, Xiaofan; Rinker, David C.; Pitts, Ronald Jason; Rokas, Antonis; Zwiebel, Laurence J.

    2014-01-01

    Many mosquito species serve as vectors of diseases such as malaria and yellow fever, wherein pathogen transmission is tightly associated with the reproductive requirement of taking vertebrate blood meals. Toxorhynchites is one of only three known mosquito genera that does not host-seek and initiates egg development in the absence of a blood-derived protein bolus. These remarkable differences make Toxorhynchites an attractive comparative reference for understanding mosquito chemosensation as it pertains to host-seeking. We performed deep transcriptome profiling of adult female Toxorhynchites amboinensis bodies, antennae and maxillary palps, and identified 25,084 protein-coding “genes” in the de novo assembly. Phylogenomic analysis of 4,266 single-copy “genes” from T. amboinensis, Aedes aegypti, Anopheles gambiae, and Culex quinquefasciatus robustly supported Ae. aegypti as the closest relative of T. amboinensis, with the two species diverged approximately 40 Ma. We identified a large number of T. amboinensis chemosensory “genes,” the majority of which have orthologs in other mosquitoes. Finally, cross-species expression analyses indicated that patterns of chemoreceptor transcript abundance were very similar for chemoreceptors that are conserved between T. amboinensis and Ae. aegypti, whereas T. amboinensis appeared deficient in the variety of expressed, lineage-specific chemoreceptors. Our transcriptome assembly of T. amboinensis represents the first comprehensive genomic resource for a nonblood-feeding mosquito and establishes a foundation for future comparative studies of blood-feeding and nonblood-feeding mosquitoes. We hypothesize that chemosensory genes that display discrete patterns of evolution and abundance between T. amboinensis and blood-feeding mosquitoes are likely to play critical roles in host-seeking and hence the vectorial capacity. PMID:25326137

  10. Detecting the limits of regulatory element conservation anddivergence estimation using pairwise and multiple alignments

    SciTech Connect

    Pollard, Daniel A.; Moses, Alan M.; Iyer, Venky N.; Eisen,Michael B.

    2006-08-14

    Background: Molecular evolutionary studies of noncodingsequences rely on multiple alignments. Yet how multiple alignmentaccuracy varies across sequence types, tree topologies, divergences andtools, and further how this variation impacts specific inferences,remains unclear. Results: Here we develop a molecular evolutionsimulation platform, CisEvolver, with models of background noncoding andtranscription factor binding site evolution, and use simulated alignmentsto systematically examine multiple alignment accuracy and its impact ontwo key molecular evolutionary inferences: transcription factor bindingsite conservation and divergence estimation. We find that the accuracy ofmultiple alignments is determined almost exclusively by the pairwisedivergence distance of the two most diverged species and that additionalspecies have a negligible influence on alignment accuracy. Conservedtranscription factor binding sites align better than surroundingnoncoding DNA yet are often found to be misaligned at relatively shortdivergence distances, such that studies of binding site gain and losscould easily be confounded by alignment error. Divergence estimates frommultiple alignments tend to be overestimated at short divergencedistances but reach a tool specific divergence at which they cease toincrease, leading to underestimation at long divergences. Our moststriking finding was that overall alignment accuracy, binding sitealignment accuracy and divergence estimation accuracy vary greatly acrossbranches in a tree and are most accurate for terminal branches connectingsister taxa and least accurate for internal branches connectingsub-alignments. Conclusions: Our results suggest that variation inalignment accuracy can lead to errors in molecular evolutionaryinferences that could be construed as biological variation. Thesefindings have implications for which species to choose for analyses, whatkind of errors would be expected for a given set of species and howmultiple alignment tools and

  11. Quantitative and Functional Characterization of the Hyper-Conserved Protein of Prochlorococcus and Marine Synechococcus

    PubMed Central

    Zorz, Jackie K.; Joy, Andrew P.; Barnett, David A.; Johnson, Milo S.; Zhaxybayeva, Olga; Cockshutt, Amanda M.

    2014-01-01

    A large fraction of any bacterial genome consists of hypothetical protein-coding open reading frames (ORFs). While most of these ORFs are present only in one or a few sequenced genomes, a few are conserved, often across large phylogenetic distances. Such conservation provides clues to likely uncharacterized cellular functions that need to be elucidated. Marine cyanobacteria from the Prochlorococcus/marine Synechococcus clade are dominant bacteria in oceanic waters and are significant contributors to global primary production. A Hyper Conserved Protein (PSHCP) of unknown function is 100% conserved at the amino acid level in genomes of Prochlorococcus/marine Synechococcus, but lacks homologs outside of this clade. In this study we investigated Prochlorococcus marinus strains MED4 and MIT 9313 and Synechococcus sp. strain WH 8102 for the transcription of the PSHCP gene using RT-Q-PCR, for the presence of the protein product through quantitative immunoblotting, and for the protein's binding partners in a pull down assay. Significant transcription of the gene was detected in all strains. The PSHCP protein content varied between 8±1 fmol and 26±9 fmol per ug total protein, depending on the strain. The 50 S ribosomal protein L2, the Photosystem I protein PsaD and the Ycf48-like protein were found associated with the PSHCP protein in all strains and not appreciably or at all in control experiments. We hypothesize that PSHCP is a protein associated with the ribosome, and is possibly involved in photosystem assembly. PMID:25360678

  12. Nicotinic receptors in non-human primates: analysis of genetic and functional conservation with humans

    PubMed Central

    Shorey-Kendrick, Lyndsey E.; Ford, Matthew M.; Allen, Daicia C.; Kuryatov, Alexander; Lindstrom, Jon; Wilhelm, Larry; Grant, Kathleen A.; Spindel, Eliot R.

    2015-01-01

    Nicotinic acetylcholine receptors (nAChRs) are highly conserved between humans and non-human primates. Conservation exists at the level of genomic structure, protein structure and epigenetics. Overall homology of nAChRs at the protein level is 98% in macaques versus 89% in mice, which is highly relevant for evaluating subtype-specific ligands that have different affinities in humans versus rodents. In addition to conservation at the protein level, there is high conservation of genomic structure in terms of intron and exon size and placement of CpG sites that play a key role in epigenetic regulation. Analysis of single nucleotide polymorphisms (SNPs) shows that while the majority of SNPs are not conserved between humans and macaques, some functional polymorphisms are. Most significantly, cynomolgus monkeys express a similar α5 nAChR Asp398Asn polymorphism to the human α5 Asp398Asn polymorphism that has been linked to greater nicotine addiction and smoking related disease. Monkeys can be trained to readily self-administer nicotine, and in an initial study we have demonstrated that cynomolgus monkeys bearing the α5 D398N polymorphism show a reduced behavioral sensitivity to oral nicotine and tend to consume it in a different pattern when compared to wild-type monkeys. Thus the combination of highly homologous nAChR, higher cortical functions and capacity for complex training makes non-human primates a unique model to study in vivo functions of nicotinic receptors. In particular, primate studies on nicotine addiction and evaluation of therapies to prevent or overcome nicotine addiction are likely to be highly predictive of treatment outcomes in humans. PMID:25661700

  13. Concentrations of Elements in Hellbender Blood and Fish Fillets from the Missouri Department of Conservation Monitoring Programs

    USGS Publications Warehouse

    May, Thomas W.; Walther, Mike J.; Brumbaugh, William G.

    2007-01-01

    This report presents the results of contaminant monitoring surveys conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in hellbender (Cryptobranchus alleganiensis) blood and fish. Catfish (Ictalurus furcatus, Ictalurus punctatus, Pylodictis olivaris), redhorse (Moxostoma anisorum, Moxostoma erythrurum), bass (Micropterus salmoides, Micropterus punctulatus, Micropterus Lacepede, Ambloplites rupestris), walleye (Sander vitreus), and sunfish (Lepomis megalotis) were collected from 17 sites as part of the Department's General Contaminant Monitoring Program. Bluegill (Lepomis macrochirus) and other sunfish (Lepomis megalotis, Lepomis cyanellus) were collected from 18 sites as part of the Department's Resource Assessment and Monitoring Program. Blood from hellbenders was collected from seven sites as part of the Department's Hellbender Monitoring Program.

  14. Proton stopping using a full conserving dielectric function in plasmas at any degeneracy

    SciTech Connect

    Barriga-Carrasco, Manuel D.

    2010-10-15

    In this work, we present a dielectric function including the three conservation laws (density, momentum and energy) when we take into account electron-electron collisions in a plasma at any degeneracy. This full conserving dielectric function (FCDF) reproduces the random phase approximation (RPA) and Mermin ones, which confirms this outcome. The FCDF is applied to the determination of the proton stopping power. Differences among diverse dielectric functions in the proton stopping calculation are minimal if the plasma electron collision frequency is not high enough. These discrepancies can rise up to 2% between RPA values and the FCDF ones, and to 8% between the Mermin ones and FCDF ones. The similarity between RPA and FCDF results is not surprising, as all conservation laws are also considered in RPA dielectric function. Even for plasmas with low collision frequencies, those discrepancies follow the same behavior as for plasmas with higher frequencies. Then, discrepancies do not depend on the plasma degeneracy but essentially do on the value of the plasma collision frequency.

  15. Conservation of the primary structure, organization, and function of the human and mouse beta-globin locus-activating regions.

    PubMed Central

    Moon, A M; Ley, T J

    1990-01-01

    DNA sequences located in a region 6-18 kilobases (kb) upstream from the human epsilon-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the beta-like globin gene cluster during erythroid development. The beta-globin LAR activates linked globin genes in transiently or stably transfected erythroleukemia cells and in erythroid cells of transgenic mice. Since the human beta-globin LAR is functional in mice, we reasoned that critical LAR sequence elements might be conserved between mice and humans. We therefore cloned murine genomic sequences homologous to one portion of the human LAR (site II, positions -11,054 to -10,322 with respect to the human epsilon gene). We found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse beta-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of approximately 800 base pairs. Multiple core sequences with greater than 80% identity were present within this region. Transient and stable transfection assays of K562 erythroleukemia cells demonstrated that both human and mouse LAR elements contain enhancer activity and confer hemin inducibility on a linked human gamma-globin promoter. These results suggest that primary structural elements--and the spatial organization of these elements--are important for function of the beta-globin LAR. Images PMID:2217202

  16. FSHB promoter polymorphism within evolutionary conserved element is associated with serum FSH level in men

    PubMed Central

    Grigorova, Marina; Punab, Margus; Ausmees, Kristo; Laan, Maris

    2008-01-01

    BACKGROUND No polymorphisms affecting serum FSH levels have been described in the human FSHB gene. We have identified a potential regulatory single nucleotide polymorphism (SNP, rs10835638; G/T) 211 bp upstream from the FSHB mRNA transcription start-site, located within a highly conserved region among placental mammals. We aimed to determine the correlation of carrier status of rs10835638 alternative alleles with serum FSH level in men, and testicular and hormonal parameters. METHODS A quantitative genetic association study using a cohort of healthy men (n = 554; age 19.2 ± 1.7 years) visiting the Centre of Andrology, Tartu University Hospital, Estonia. RESULTS Rs10835638 (allele frequencies: G 87.6%, T 12.4%) was significantly associated with serum FSH level (analysis of variance: F = 13.0, P = 0.0016, df = 1; regression testing for a linear trend: P = 0.0003). Subjects with the GG genotype exhibited higher FSH levels (3.37 ± 1.79 IU/l, n = 423) compared with heterozygotes (2.84 ± 1.54 IU/l, n = 125) (P = 0.0005), the group of T-allele carriers (GT+TT, 2.78 ± 1.51 IU/l, n = 131) (P = 0.0005) and TT-homozygotes (2.02 ± 0.81 IU/L, n = 6) (P = 0.031). Rs10835638 was also associated with significant (P < 0.05) reduction in free testosterone index and testes volume, but increased semen volume, sex hormone-binding globulin, serum testosterone and estradiol. LH and inhibin-B levels did not differ significantly between groups. CONCLUSIONS The identification of a regulatory SNP in FSHB promoter paves the way to study the effect of constitutively low FSH on male health and fertility. As FSH contributes to follicular development and sex steroid production in women, the role of this FSHB variant in female reproductive success is still to be addressed. PMID:18567894

  17. A Recent Adaptive Transposable Element Insertion Near Highly Conserved Developmental Loci in Drosophila melanogaster

    PubMed Central

    González, Josefa; Macpherson, J. Michael; Petrov, Dmitri A.

    2009-01-01

    A recent genomewide screen identified 13 transposable elements that are likely to have been adaptive during or after the spread of Drosophila melanogaster out of Africa. One of these insertions, Bari-Juvenile hormone epoxy hydrolase (Bari-Jheh), was associated with the selective sweep of its flanking neutral variation and with reduction of expression of one of its neighboring genes: Jheh3. Here, we provide further evidence that Bari-Jheh insertion is adaptive. We delimit the extent of the selective sweep and show that Bari-Jheh is the only mutation linked to the sweep. Bari-Jheh also lowers the expression of its other flanking gene, Jheh2. Subtle consequences of Bari-Jheh insertion on life-history traits are consistent with the effects of reduced expression of the Jheh genes. Finally, we analyze molecular evolution of Jheh genes in both the long- and the short-term and conclude that Bari-Jheh appears to be a very rare adaptive event in the history of these genes. We discuss the implications of these findings for the detection and understanding of adaptation. PMID:19458110

  18. The five elements process: designing optimal landscapes to meet bird conservation objectives

    USGS Publications Warehouse

    Will, T.C.; Ruth, J.M.; Rosenberg, K.V.; Krueper, D.; Hahn, D.; Fitzgerald, J.; Dettmers, R.; Beardmore, C.J.

    2005-01-01

    In February 2004 at Port Aransas, Texas, Partners in Flight (PIF) and representatives from the other NABCI bird initiative met to discuss the process of stepping down PIF continental population objectives (Rich et al. 2004) to regional and local scales. Participants also discussed rolling up local population estimates and targets to assess the feasibility of the landscape changes necessary to meet continental objectives. Since the process of stepping-down/rolling-up population objectives shifts focus from identifying priority species to formulating quantitative estimates of how much habitat was needed, where, and by when the Port Aransas group called the stepping-down/rolling-up process a??stepping forward.a?? Participants agreed that stepping forward objectives was the beginning of an inevitably iterative dialog necessary to evaluate the assumptions of PIF population estimates and objectives as well as the methods used to monitor local implementation. To facilitate the translation of continental population objectives into biologically sound, measurable regional and local population-based habitat targets the Port Aransas group recommended a process no commonly referred to as the Five Elements Processa?|

  19. CPhos: a program to calculate and visualize evolutionarily conserved functional phosphorylation sites.

    PubMed

    Zhao, Boyang; Pisitkun, Trairak; Hoffert, Jason D; Knepper, Mark A; Saeed, Fahad

    2012-11-01

    Profiling using high-throughput MS has discovered an overwhelming number of novel protein phosphorylation sites ("phosphosites"). However, the functional relevance of these sites is not always clear. In light of recent studies on the evolutionary mechanism of phosphorylation, we have developed CPhos, a Java program that can assess the conservation of phosphosites among species using an information theory-based approach. The degree of conservation established using CPhos can be used to assess the functional significance of phosphosites. CPhos has a user friendly graphical user interface and is available both as a web service and as a standalone Java application to assist phosphoproteomic researchers in analyzing and prioritizing lists of phosphosites for further experimental validation. CPhos can be accessed or downloaded at http://helixweb.nih.gov/CPhos/. PMID:23001821

  20. A kinetic equation with kinetic entropy functions for scalar conservation laws

    NASA Technical Reports Server (NTRS)

    Perthame, Benoit; Tadmor, Eitan

    1990-01-01

    A nonlinear kinetic equation is constructed and proved to be well-adapted to describe general multidimensional scalar conservation laws. In particular, it is proved to be well-posed uniformly in epsilon - the microscopic scale. It is also shown that the proposed kinetic equation is equipped with a family of kinetic entropy functions - analogous to Boltzmann's microscopic H-function, such that they recover Krushkov-type entropy inequality on the macroscopic scale. Finally, it is proved by both - BV compactness arguments in the one-dimensional case, that the local density of kinetic particles admits a continuum limit, as it converges strongly with epsilon below 0 to the unique entropy solution of the corresponding conservation law.

  1. Prioritizing conservation effort through the use of biological soil crusts as ecosystem function indicators in an arid region

    USGS Publications Warehouse

    Bowker, M.A.; Miller, M.E.; Belnap, J.; Sisk, T.D.; Johnson, N.C.

    2008-01-01

    Conservation prioritization usually focuses on conservation of rare species or biodiversity, rather than ecological processes. This is partially due to a lack of informative indicators of ecosystem function. Biological soil crusts (BSCs) trap and retain soil and water resources in arid ecosystems and function as major carbon and nitrogen fixers; thus, they may be informative indicators of ecosystem function. We created spatial models of multiple indicators of the diversity and function of BSCs (species richness, evenness, functional diversity, functional redundancy, number of rare species, number of habitat specialists, nitrogen and carbon fixation indices, soil stabilization, and surface roughening) for the 800,000-ha Grand Staircase-Escalante National Monument (Utah, U.S.A.). We then combined the indicators into a single BSC function map and a single BSC biodiversity map (2 alternative types of conservation value) with an unweighted averaging procedure and a weighted procedure derived from validations performance. We also modeled potential degradation with data from a rangeland assessment survey. To determine which areas on the landscape were the highest conservation priorities, we overlaid the function- and diversity-based conservation-value layers on the potential degradation layer. Different methods for ascribing conservation-value and conservation-priority layers all yielded strikingly similar results (r = 0.89-0.99), which suggests that in this case biodiversity and function can be conserved simultaneously. We believe BSCs can be used as indicators of ecosystem function in concert with other indicators (such as plant-community properties) and that such information can be used to prioritize conservation effort in drylands. ?? 2008 Society for Conservation Biology.

  2. Conservation of CFTR codon frequency through primates suggests synonymous mutations could have a functional effect.

    PubMed

    Pizzo, Lucilla; Iriarte, Andrés; Alvarez-Valin, Fernando; Marín, Mónica

    2015-05-01

    Cystic fibrosis is an inherited chronic disease that affects the lungs and digestive system, with a prevalence of about 1:3000 people. Cystic fibrosis is caused by mutations in CFTR gene, which lead to a defective function of the chloride channel, the cystic fibrosis transmembrane conductance regulator (CFTR). Up-to-date, more than 1900 mutations have been reported in CFTR. However for an important proportion of them, their functional effects and the relation to disease are still not understood. Many of these mutations are silent (or synonymous), namely they do not alter the encoded amino acid. These synonymous mutations have been considered as neutral to protein function. However, more recent evidence in bacterial and human proteins has put this concept under revision. With the aim of understanding possible functional effects of synonymous mutations in CFTR, we analyzed human and primates CFTR codon usage and divergence patterns. We report the presence of regions enriched in rare and frequent codons. This spatial pattern of codon preferences is conserved in primates, but this cannot be explained by sequence conservation alone. In sum, the results presented herein suggest a functional implication of these regions of the gene that may be maintained by purifying selection acting to preserve a particular codon usage pattern along the sequence. Overall these results support the idea that several synonymous mutations in CFTR may have functional importance, and could be involved in the disease. PMID:25839760

  3. Conserving approximations for response functions of the Fermi gas in a random potential

    NASA Astrophysics Data System (ADS)

    Janiš, Václav; Kolorenč, Jindřich

    2016-07-01

    One- and two-electron Green functions are simultaneously needed to determine the response functions of the electron gas in a random potential. Reliable approximations must retain consistency between the two types of Green functions expressed via Ward identities so that their output is compliant with macroscopic symmetries and conservation laws. Such a consistency is not directly guaranteed when summing nonlocal corrections to the local (dynamical) mean field. We analyze the reasons for this failure and show how the full Ward identity can generically be implemented in the diagrammatic approach to the vertex functions without breaking the analytic properties of the self-energy. We use the low-energy asymptotics of the conserving two-particle vertex determining the singular part of response and correlation functions to derive an exact representation of the diffusion constant in terms of Green functions of the perturbation theory. We then calculate explicitly the leading vertex corrections to the mean-field diffusion constant due to maximally-crossed diagrams.

  4. Functional analysis of conserved residues in the putative "finger" domain of telomerase reverse transcriptase.

    PubMed

    Bosoy, D; Lue, N F

    2001-12-01

    Telomerase is a ribonucleoprotein reverse transcriptase (RT) responsible for the maintenance of one strand of telomere terminal repeats. The catalytic protein subunit of telomerase, known generically as telomerase reverse transcriptase (TERT), exhibits significant homology to RTs encoded by retroviruses and retroelements. The polymerization mechanisms of telomerase may therefore be similar to those of the "conventional" RTs. In this study, we explored the extent of mechanistic conservation by analyzing mutations of conserved residues within the putative "finger" domain of TERT. Previous analysis has implicated this domain of retroviral RTs in nucleotide and RNA binding and in processivity control. Our results demonstrate that residues conserved between TERT and human immunodeficiency virus-1 RT are more likely than TERT-specific residues to be required for enzyme activity. In addition, residues presumed to make direct contact with either the RNA or nucleotide substrate appear to be functionally more important. Furthermore, distinct biochemical defects can be observed for alterations in the putative RNA- and nucleotide-binding TERT residues in a manner that can be rationalized by their postulated mechanisms of action. This study thus supports a high degree of mechanistic conservation between telomerase and retroviral RTs and underscores the roles of distinct aspects of telomerase biochemistry in telomere length maintenance. PMID:11581271

  5. New developments in the method of space-time conservation element and solution element: Applications to the Euler and Navier-Stokes equations

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung

    1993-01-01

    A new numerical framework for solving conservation laws is being developed. This new approach differs substantially in both concept and methodology from the well-established methods--i.e., finite difference, finite volume, finite element, and spectral methods. It is conceptually simple and designed to avoid several key limitations to the above traditional methods. An explicit model scheme for solving a simple 1-D unsteady convection-diffusion equation is constructed and used to illuminate major differences between the current method and those mentioned above. Unexpectedly, its amplification factors for the pure convection and pure diffusion cases are identical to those of the Leapfrog and the DuFort-Frankel schemes, respectively. Also, this explicit scheme and its Navier-Stokes extension have the unusual property that their stabilities are limited only by the CFL condition. Moreover, despite the fact that it does not use any flux-limiter or slope-limiter, the Navier-Stokes solver is capable of generating highly accurate shock tube solutions with shock discontinuities being resolved within one mesh interval. An accurate Euler solver also is constructed through another extension. It has many unusual properties, e.g., numerical diffusion at all mesh points can be controlled by a set of local parameters.

  6. The roles of evolutionarily conserved functional modules in cilia-related trafficking

    PubMed Central

    Sung, Ching-Hwa; Leroux, Michel R.

    2014-01-01

    Cilia are present across most eukaryotic phyla and have diverse sensory and motility roles in animal physiology, cell signalling and development. Their biogenesis and maintenance depend on vesicular and intraciliary (intraflagellar) trafficking pathways that share conserved structural and functional modules. The functional units of the interconnected pathways, which include proteins involved in membrane coating as well as small GTPases and their accessory factors, were first experimentally associated with canonical vesicular trafficking. These components are, however, ancient, having been co-opted by the ancestral eukaryote to establish the ciliary organelle, and their study can inform us about ciliary biology in higher organisms. PMID:24296415

  7. Functional Advantages of Conserved Intrinsic Disorder in RNA-Binding Proteins

    PubMed Central

    Varadi, Mihaly; Zsolyomi, Fruzsina; Guharoy, Mainak; Tompa, Peter

    2015-01-01

    Proteins form large macromolecular assemblies with RNA that govern essential molecular processes. RNA-binding proteins have often been associated with conformational flexibility, yet the extent and functional implications of their intrinsic disorder have never been fully assessed. Here, through large-scale analysis of comprehensive protein sequence and structure datasets we demonstrate the prevalence of intrinsic structural disorder in RNA-binding proteins and domains. We addressed their functionality through a quantitative description of the evolutionary conservation of disordered segments involved in binding, and investigated the structural implications of flexibility in terms of conformational stability and interface formation. We conclude that the functional role of intrinsically disordered protein segments in RNA-binding is two-fold: first, these regions establish extended, conserved electrostatic interfaces with RNAs via induced fit. Second, conformational flexibility enables them to target different RNA partners, providing multi-functionality, while also ensuring specificity. These findings emphasize the functional importance of intrinsically disordered regions in RNA-binding proteins. PMID:26439842

  8. Correlation functions of main-chain polymer nematics constrained by tensorial and vectorial conservation laws.

    PubMed

    Svenšek, Daniel; Podgornik, Rudolf

    2015-09-21

    We present and analyze correlation functions of a main-chain polymer nematic in a continuum worm-like chain description for two types of constraints formalized by the tensorial and vectorial conservation laws, both originating in the microscopic chain integrity, i.e., the connectivity of the polymer chains. In particular, our aim is to identify the features of the correlation functions that are most susceptible to the differences between the two constraints. Besides the density and director autocorrelations in both the tensorial and vectorial cases, we calculate also the density-director correlation functions, the latter being a direct signature of the presence of a specific constraint. Its amplitude is connected to the strength of the constraint and is zero if none of the constraints are present, i.e., for a standard non-polymeric nematic. Generally, the correlation functions with the constraints differ substantially from the correlation functions in the non-polymeric case, if the constraints are strong which in practice requires long chains. Moreover, for the tensorial conservation law to be well distinguishable from the vectorial one, the chain persistence length should be much smaller than the total length of the chain, so that hairpins (chain backfolding) are numerous and the polar order is small. PMID:26395733

  9. Structural and functional analysis of hypothetical and conserved proteins of Clostridium tetani.

    PubMed

    Enany, Shymaa

    2014-01-01

    The progress in biological technologies has led to rapid accumulation of microbial genomic sequences with a vast number of uncharacterized genes. Proteins encoded by these genes are usually uncharacterized, hypothetical, and/or conserved. In Clostridium tetani (C. tetani), these proteins constitute up to 50% of the expressed proteins. In this regard, understanding the functions and the structures of these proteins is crucially important, particularly in C. tetani, which is a medically important pathogen. Here, we used a variety of bioinformatics tools and databases to analyze 10 hypothetical and conserved proteins in C. tetani. We were able to provide a detailed overview of the functional contributions of some of these proteins in several cellular functions, including (1) evolving antibiotic resistance, (2) interaction with enzymes pathways, and (3) involvement in drug transportation. Among these candidates, we postulated the involvement of one of these hypothetical proteins in the pathogenic activity of tetanus. The structural and functional prediction of these proteins should serve in uncovering and better understanding the function of C. tetani cells to ultimately discover new possible drug targets. PMID:24802661

  10. Correlation functions of main-chain polymer nematics constrained by tensorial and vectorial conservation laws

    NASA Astrophysics Data System (ADS)

    Svenšek, Daniel; Podgornik, Rudolf

    2015-09-01

    We present and analyze correlation functions of a main-chain polymer nematic in a continuum worm-like chain description for two types of constraints formalized by the tensorial and vectorial conservation laws, both originating in the microscopic chain integrity, i.e., the connectivity of the polymer chains. In particular, our aim is to identify the features of the correlation functions that are most susceptible to the differences between the two constraints. Besides the density and director autocorrelations in both the tensorial and vectorial cases, we calculate also the density-director correlation functions, the latter being a direct signature of the presence of a specific constraint. Its amplitude is connected to the strength of the constraint and is zero if none of the constraints are present, i.e., for a standard non-polymeric nematic. Generally, the correlation functions with the constraints differ substantially from the correlation functions in the non-polymeric case, if the constraints are strong which in practice requires long chains. Moreover, for the tensorial conservation law to be well distinguishable from the vectorial one, the chain persistence length should be much smaller than the total length of the chain, so that hairpins (chain backfolding) are numerous and the polar order is small.

  11. Functional phosphorylation sites in cardiac myofilament proteins are evolutionarily conserved in skeletal myofilament proteins.

    PubMed

    Gross, Sean M; Lehman, Steven L

    2016-06-01

    Protein phosphorylation plays an important role in regulating cardiac contractile function, but phosphorylation is not thought to play a regulatory role in skeletal muscle. To examine how myofilament phosphorylation arose in the human heart, we analyzed the amino acid sequences of 25 cardiac phosphorylation sites in animals ranging from fruit flies to humans. These analyses indicated that of the 25 human phosphorylation sites examined, 11 have been conserved across vertebrates and four have been sporadically present in vertebrates. Furthermore, all 11 of the cardiac sites found across vertebrates were present in skeletal muscle isoforms, along with three sites that were sporadically present. Based on the conservation of amino acid sequences between cardiac and skeletal contractile proteins, we tested for phosphorylation in mammalian skeletal muscle using several biochemical techniques and found evidence that multiple myofilament proteins were phosphorylated. Several of these phosphorylation sites were validated using mass spectrometry, including one site that is present in slow- and fast-twitch troponin I (TnI), but was lost in cardiac TnI. Thus, several myofilament phosphorylation sites present in the human heart likely arose in invertebrate muscle, have been evolutionarily conserved in skeletal muscle, and potentially have functional effects in both skeletal and cardiac muscle. PMID:26993364

  12. Evolutionary conservation of physical and functional interactions between phospholipase D and actin.

    PubMed

    Kusner, David J; Barton, James A; Qin, Chunbo; Wang, Xuemin; Iyer, Shankar S

    2003-04-15

    Phospholipase D (PLD) enzymes from bacteria to mammals exhibit a highly conserved core structure and catalytic mechanism, but whether protein-protein interactions exhibit similar commonality is unknown. Our objective was to determine whether the physical and functional interactions of mammalian PLDs with actin are evolutionarily conserved among bacterial and plant PLDs. Highly purified bacterial and plant PLDs cosedimented with mammalian skeletal muscle alpha-actin, indicating direct interaction with F-actin. The binding of bacterial PLD to G-actin exhibited two affinity states, with dissociation constants of 1.13 pM and 0.58 microM. The effects of actin on the activities of bacterial and plant PLDs were polymerization dependent; monomeric G-actin inhibited PLD activity, whereas polymerized F-actin augmented PLD activity. Actin modulation of bacterial and plant PLDs demonstrated kinetic characteristics, efficacies, and potencies similar to those of human PLD1. Thus, physical and functional interactions between PLD and actin in PLD family members from bacteria to mammals are highly conserved throughout evolution. PMID:12667487

  13. Conservative surgery for low rectal carcinoma after high-dose radiation. Functional and oncologic results.

    PubMed Central

    Rouanet, P; Fabre, J M; Dubois, J B; Dravet, F; Saint Aubert, B; Pradel, J; Ychou, M; Solassol, C; Pujol, H

    1995-01-01

    OBJECTIVE: Using a prospective, nonrandomized study, the authors evaluated the morbidity and functional and oncologic results of conservative surgery for cancer of the lower third of the rectum after high-dose radiation. SUMMARY BACKGROUND DATA: Colo-anal anastomosis has made sphincter conservation for low rectal carcinoma technically feasible. The limits to conservative surgery currently are oncologic rather than technical. Adjuvant radiotherapy has proven its benefit in terms of regional control, with a dose relationship. METHODS: Since June 1990, 27 patients with distal rectal adenocarcinoma were treated by preoperative radiotherapy (40 + 20 Gy delivered with three fields) and curative surgery. The mean distance from the anal verge was 47 mm (27-57 mm), and none of the tumors were fixed (15 T2, 12 T3). RESULTS: Mortality and morbidity were not increased by high-dose preoperative radiation. Twenty-one patients underwent conservative surgery (78%-17 total proctectomies and colo-anal anastomoses, 4 trans-anal resections). After colo-anal anastomosis, all patients with colonic pouch had good results; two patients had moderate results and one patient had poor results after straight colo-anal anastomosis. With a mean follow-up of 24 months, the authors noted 1 postoperative death, 2 disease-linked deaths, 1 controlled regional recurrence, 2 evolutive patients with pulmonary metastases, and 21 disease-free patients. CONCLUSIONS: These first results confirm the possibility of conservative surgery for low rectal carcinoma after high-dose radiation. A prospective, randomized trial could be induced to determine the real role of the 20 Gy boost on the sphincter-saving decision. PMID:7826163

  14. Nmf9 Encodes a Highly Conserved Protein Important to Neurological Function in Mice and Flies

    PubMed Central

    Zhang, Shuxiao; Ross, Kevin D.; Seidner, Glen A.; Gorman, Michael R.; Poon, Tiffany H.; Wang, Xiaobo; Keithley, Elizabeth M.; Lee, Patricia N.; Martindale, Mark Q.; Joiner, William J.; Hamilton, Bruce A.

    2015-01-01

    Many protein-coding genes identified by genome sequencing remain without functional annotation or biological context. Here we define a novel protein-coding gene, Nmf9, based on a forward genetic screen for neurological function. ENU-induced and genome-edited null mutations in mice produce deficits in vestibular function, fear learning and circadian behavior, which correlated with Nmf9 expression in inner ear, amygdala, and suprachiasmatic nuclei. Homologous genes from unicellular organisms and invertebrate animals predict interactions with small GTPases, but the corresponding domains are absent in mammalian Nmf9. Intriguingly, homozygotes for null mutations in the Drosophila homolog, CG45058, show profound locomotor defects and premature death, while heterozygotes show striking effects on sleep and activity phenotypes. These results link a novel gene orthology group to discrete neurological functions, and show conserved requirement across wide phylogenetic distance and domain level structural changes. PMID:26131556

  15. Identifying Elements Critical for Functional and Sustainable Professional Learning Communities

    ERIC Educational Resources Information Center

    Richmond, Gail; Manokore, Viola

    2011-01-01

    In this paper, we examined data collected as part of a 5-year project designed to foster reform-based urban science teaching through teachers' communities of inquiry. Drawing upon a distributed leadership framework, we analyzed teacher "talk" during professional learning community (PLC) meetings. This analysis yielded five elements: teacher…

  16. Sorting out relationships among the grouse and ptarmigan using intron, mitochondrial, and ultra-conserved element sequences.

    PubMed

    Persons, Nicholas W; Hosner, Peter A; Meiklejohn, Kelly A; Braun, Edward L; Kimball, Rebecca T

    2016-05-01

    The Holarctic phasianid clade of the grouse and ptarmigan has received substantial attention in areas such as evolution of mating systems, display behavior, and population ecology related to their conservation and management as wild game species. There are multiple molecular phylogenetic studies that focus on grouse and ptarmigan. In spite of this, there is little consensus regarding historical relationships, particularly among genera, which has led to unstable and partial taxonomic revisions. We estimated the phylogeny of all currently recognized species using a combination of novel data from seven nuclear loci (largely intron sequences) and published data from one additional autosomal locus, two W-linked loci, and four mitochondrial regions. To explore relationships among genera and assess paraphyly of one genus more rigorously, we then added over 3000 ultra-conserved element (UCE) loci (over 1.7million bp) gathered using Illumina sequencing. The UCE topology agreed with that of the combined nuclear intron and previously published sequence data with 100% bootstrap support for all relationships. These data strongly support previous studies separating Bonasa from Tetrastes and Dendragapus from Falcipennis. However, the placement of Lagopus differed from previous studies, and we found no support for Falcipennis monophyly. Biogeographic analysis suggests that the ancestors of grouse and ptarmigan were distributed in the New World and subsequently underwent at least four dispersal events between the Old and New Worlds. Divergence time estimates from maternally-inherited and autosomal markers show stark differences across this clade, with divergence time estimates from maternally-inherited markers being nearly half that of the autosomal markers at some nodes, and nearly twice that at other nodes. PMID:26879712

  17. Evolution of TNF-induced apoptosis reveals 550 My of functional conservation.

    PubMed

    Quistad, Steven D; Stotland, Aleksandr; Barott, Katie L; Smurthwaite, Cameron A; Hilton, Brett Jameson; Grasis, Juris A; Wolkowicz, Roland; Rohwer, Forest L

    2014-07-01

    The Precambrian explosion led to the rapid appearance of most major animal phyla alive today. It has been argued that the complexity of life has steadily increased since that event. Here we challenge this hypothesis through the characterization of apoptosis in reef-building corals, representatives of some of the earliest animals. Bioinformatic analysis reveals that all of the major components of the death receptor pathway are present in coral with high-predicted structural conservation with Homo sapiens. The TNF receptor-ligand superfamilies (TNFRSF/TNFSF) are central mediators of the death receptor pathway, and the predicted proteome of Acropora digitifera contains more putative coral TNFRSF members than any organism described thus far, including humans. This high abundance of TNFRSF members, as well as the predicted structural conservation of other death receptor signaling proteins, led us to wonder what would happen if corals were exposed to a member of the human TNFSF (HuTNFα). HuTNFα was found to bind directly to coral cells, increase caspase activity, cause apoptotic blebbing and cell death, and finally induce coral bleaching. Next, immortalized human T cells (Jurkats) expressing a functional death receptor pathway (WT) and a corresponding Fas-associated death domain protein (FADD) KO cell line were exposed to a coral TNFSF member (AdTNF1) identified and purified here. AdTNF1 treatment resulted in significantly higher cell death (P < 0.0001) in WT Jurkats compared with the corresponding FADD KO, demonstrating that coral AdTNF1 activates the H. sapiens death receptor pathway. Taken together, these data show remarkable conservation of the TNF-induced apoptotic response representing 550 My of functional conservation. PMID:24927546

  18. Comparative Analysis of the Conserved Functions of Arabidopsis DRL1 and Yeast KTI12

    PubMed Central

    Jun, Sang Eun; Cho, Kiu-Hyung; Hwang, Ji-Young; Abdel-Fattah, Wael; Hammermeister, Alexander; Schaffrath, Raffael; Bowman, John L.; Kim, Gyung-Tae

    2015-01-01

    Patterning of the polar axis during the early leaf developmental stage is established by cell-to-cell communication between the shoot apical meristem (SAM) and the leaf primordia. In a previous study, we showed that the DRL1 gene, which encodes a homolog of the Elongator-associated protein KTI12 of yeast, acts as a positive regulator of adaxial leaf patterning and shoot meristem activity. To determine the evolutionally conserved functions of DRL1, we performed a comparison of the deduced amino acid sequence of DRL1 and its yeast homolog, KTI12, and found that while overall homology was low, well-conserved domains were presented. DRL1 contained two conserved plant-specific domains. Expression of the DRL1 gene in a yeast KTI12-deficient yeast mutant suppressed the growth retardation phenotype, but did not rescue the caffeine sensitivity, indicating that the role of Arabidopsis Elongator-associated protein is partially conserved with yeast KTI12, but may have changed between yeast and plants in response to caffeine during the course of evolution. In addition, elevated expression of DRL1 gene triggered zymocin sensitivity, while overexpression of KTI12 maintained zymocin resistance, indicating that the function of Arabidopsis DRL1 may not overlap with yeast KTI12 with regards to toxin sensitivity. In this study, expression analysis showed that class-I KNOX genes were downregulated in the shoot apex, and that YAB and KAN were upregulated in leaves of the Arabidopsis drl1-101 mutant. Our results provide insight into the communication network between the SAM and leaf primordia required for the establishment of leaf polarity by mediating histone acetylation or through other mechanisms. PMID:25518926

  19. Role of conserved cis-regulatory elements in the post-transcriptional regulation of the human MECP2 gene involved in autism

    PubMed Central

    2013-01-01

    Background The MECP2 gene codes for methyl CpG binding protein 2 which regulates activities of other genes in the early development of the brain. Mutations in this gene have been associated with Rett syndrome, a form of autism. The purpose of this study was to investigate the role of evolutionarily conserved cis-elements in regulating the post-transcriptional expression of the MECP2 gene and to explore their possible correlations with a mutation that is known to cause mental retardation. Results A bioinformatics approach was used to map evolutionarily conserved cis-regulatory elements in the transcribed regions of the human MECP2 gene and its mammalian orthologs. Cis-regulatory motifs including G-quadruplexes, microRNA target sites, and AU-rich elements have gained significant importance because of their role in key biological processes and as therapeutic targets. We discovered in the 5′-UTR (untranslated region) of MECP2 mRNA a highly conserved G-quadruplex which overlapped a known deletion in Rett syndrome patients with decreased levels of MeCP2 protein. We believe that this 5′-UTR G-quadruplex could be involved in regulating MECP2 translation. We mapped additional evolutionarily conserved G-quadruplexes, microRNA target sites, and AU-rich elements in the key sections of both untranslated regions. Our studies suggest the regulation of translation, mRNA turnover, and development-related alternative MECP2 polyadenylation, putatively involving interactions of conserved cis-regulatory elements with their respective trans factors and complex interactions among the trans factors themselves. We discovered highly conserved G-quadruplex motifs that were more prevalent near alternative splice sites as compared to the constitutive sites of the MECP2 gene. We also identified a pair of overlapping G-quadruplexes at an alternative 5′ splice site that could potentially regulate alternative splicing in a negative as well as a positive way in the MECP2 pre

  20. Functional inactivation of the conserved Sem1p in yeast by intrabodies.

    PubMed

    Reinman, Mirka; Jäntti, Jussi; Alfthan, Kaija; Keränen, Sirkka; Söderlund, Hans; Takkinen, Kristiina

    2003-09-01

    Intrabody technology was applied to characterize the function and intracellular localization of a highly conserved Saccharomyces cerevisiae Sem1 protein. DSS1, the mammalian homologue of Sem1p, is functionally conserved between yeast and mammalian cells, and in mammalian cells physically interacts with the strong tumour supressor BRCA2. Yeast and the generated intrabodies are thus expected to offer a useful system for studies on Sem1p/DSS1 function. Sem1p-specific antibody isolated from a phage display library was expressed intracellularily and targeted to either the cytosol or the nucleus of yeast cells. Analysis of the applicability of different antibody fragments as intrabodies showed that the Fab intrabody was expressed most efficiently. Expression of nuclear-targeted anti-Sem1p Fab intrabodies inhibited the growth of the sigma1278b yeast strain in a manner similar to deletion of the SEM1 gene. This indicates that the Fab intrabodies interact in vivo with Sem1p and result in inactivation of Sem1p. Localization of the Fab intrabody with or without the nuclear localization signal to the nucleus in Sem1p-dependent manner suggests that Sem1p mediates the nuclear transport of the intrabody without any targeting signal. Our results suggest that Sem1p function in yeast cells is in part manifested in the nucleus. PMID:12961755

  1. Functionally conservative substitutions at cardiac troponin I S43/45.

    PubMed

    Lang, Sarah E; Stevenson, Tamara K; Xu, Dongyang; O'Connell, Ryan; Westfall, Margaret V

    2016-07-01

    A phospho-null Ala substitution at protein kinase C (PKC)-targeted cardiac troponin I (cTnI) S43/45 reduces myocyte and cardiac contractile function. The goal of the current study was to test whether cTnIS43/45N is an alternative, functionally conservative substitution in cardiac myocytes. Partial and more extensive endogenous cTnI replacement was similar at 2 and 4 days after gene transfer, respectively, for epitope-tagged cTnI and cTnIS43/45N. This replacement did not significantly change thin filament stoichiometry. In functional studies, there were no significant changes in the amplitude and/or rates of contractile shortening and re-lengthening after this partial (2 days) and extensive (4 days) replacement with cTnIS43/45N. The cTnIS43/45N substitution also was not associated with adaptive changes in the myocyte Ca(2+) transient or in phosphorylation of the protein kinase A and C-targeted cTnIS23/24 site. These results provide evidence that cTnIS43/45N is a functionally conservative substitution, and may be appropriate for use as a phospho-null in rodent models designed for studies on PKC modulation of cardiac performance. PMID:26869200

  2. Evidence of a conserved functional role for DNA methylation in termites.

    PubMed

    Glastad, K M; Hunt, B G; Goodisman, M A D

    2013-04-01

    Many organisms are capable of developing distinct phenotypes from the same genotype. This developmental plasticity is particularly prevalent in insects, which can produce alternate adaptive forms in response to distinct environmental cues. The ability to develop divergent phenotypes from the same genotype often relies on epigenetic information, which affects gene function and is transmitted through cell divisions. One of the most important epigenetic marks, DNA methylation, has been lost in several insect lineages, yet its taxonomic distribution and functional conservation remain uninvestigated in many taxa. In the present study, we demonstrate that the signature of high levels of DNA methylation exists in the expressed genes of two termites, Reticulitermes flavipes and Coptotermes formosanus. Further, we show that DNA methylation is preferentially targeted to genes with ubiquitous expression among morphs. Functional associations of DNA methylation are also similar to those observed in other invertebrate taxa with functional DNA methylation systems. Finally, we demonstrate an association between DNA methylation and the long-term evolutionary conservation of genes. Overall, our findings strongly suggest DNA methylation is present at particularly high levels in termites and may play similar roles to those found in other insects. PMID:23278917

  3. Modern money theory and ecological tax reform: A functional finance approach to energy conservation

    NASA Astrophysics Data System (ADS)

    McConnell, Scott L. B.

    This dissertation contributes to heterodox economics by developing a theoretical and policy-relevant link that will promote the conservation of energy while driving the value of the domestic currency. The analysis relies upon the theoretical foundation of modern money theory and functional finance, which states that "taxes-drive-money" where the value of a sovereign nation's currency is imputed through the acceptance by the sovereign nation of the currency in payment of taxation. This theoretical perspective lends itself to various public policy prescriptions, such as government employment policies or the employer of last resort (ELR), which has been discussed at length elsewhere (Wray 1998; Tcherneva 2007, Forstater 2003). This research contributes to this overall program by arguing that the basis for taxation under modern money theory allows public policy makers various alternatives regarding the make-up of the tax system in place. In particular, following functional finance, taxes do not have the sole purpose of paying for government spending, but rather drive the value of the currency and may be designed to perform other functions as well, such as penalizing socially undesirable behavior. The focus in this dissertation is on the amelioration of pollution and increasing energy conservation. The research question for this dissertation is this: what federally implemented tax would best serve the multiple criteria of 1) driving the value of the currency, 2) promoting energy conservation and 3) ameliorating income and wealth disparities inherent in a monetary production economy? This dissertation provides a suggestion for such a tax that would be part of a much larger overall policy program based upon the tenets of modern money theory and functional finance. Additionally, this research seeks to provide an important theoretical contribution to the emerging Post Keynesian and ecological economics dialog.

  4. New Developments in the Method of Space-Time Conservation Element and Solution Element-Applications to Two-Dimensional Time-Marching Problems

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Wang, Xiao-Yen; Chow, Chuen-Yen

    1994-01-01

    A new numerical discretization method for solving conservation laws is being developed. This new approach differs substantially in both concept and methodology from the well-established methods, i.e., finite difference, finite volume, finite element, and spectral methods. It is motivated by several important physical/numerical considerations and designed to avoid several key limitations of the above traditional methods. As a result of the above considerations, a set of key principles for the design of numerical schemes was put forth in a previous report. These principles were used to construct several numerical schemes that model a 1-D time-dependent convection-diffusion equation. These schemes were then extended to solve the time-dependent Euler and Navier-Stokes equations of a perfect gas. It was shown that the above schemes compared favorably with the traditional schemes in simplicity, generality, and accuracy. In this report, the 2-D versions of the above schemes, except the Navier-Stokes solver, are constructed using the same set of design principles. Their constructions are simplified greatly by the use of a nontraditional space-time mesh. Its use results in the simplest stencil possible, i.e., a tetrahedron in a 3-D space-time with a vertex at the upper time level and other three at the lower time level. Because of the similarity in their design, each of the present 2-D solvers virtually shares with its 1-D counterpart the same fundamental characteristics. Moreover, it is shown that the present Euler solver is capable of generating highly accurate solutions for a famous 2-D shock reflection problem. Specifically, both the incident and the reflected shocks can be resolved by a single data point without the presence of numerical oscillations near the discontinuity.

  5. AthaMap web tools for database-assisted identification of combinatorial cis-regulatory elements and the display of highly conserved transcription factor binding sites in Arabidopsis thaliana.

    PubMed

    Steffens, Nils Ole; Galuschka, Claudia; Schindler, Martin; Bülow, Lorenz; Hehl, Reinhard

    2005-07-01

    The AthaMap database generates a map of cis-regulatory elements for the Arabidopsis thaliana genome. AthaMap contains more than 7.4 x 10(6) putative binding sites for 36 transcription factors (TFs) from 16 different TF families. A newly implemented functionality allows the display of subsets of higher conserved transcription factor binding sites (TFBSs). Furthermore, a web tool was developed that permits a user-defined search for co-localizing cis-regulatory elements. The user can specify individually the level of conservation for each TFBS and a spacer range between them. This web tool was employed for the identification of co-localizing sites of known interacting TFs and TFs containing two DNA-binding domains. More than 1.8 x 10(5) combinatorial elements were annotated in the AthaMap database. These elements can also be used to identify more complex co-localizing elements consisting of up to four TFBSs. The AthaMap database and the connected web tools are a valuable resource for the analysis and the prediction of gene expression regulation at http://www.athamap.de. PMID:15980498

  6. Antigen-specific T cells fully conserve antitumour function following cryopreservation.

    PubMed

    Galeano Niño, Jorge L; Kwan, Rain Yq; Weninger, Wolfgang; Biro, Maté

    2016-04-01

    Immunotherapies based on the autologous adoptive transfer of ex vivo-manipulated T cells are rapidly evolving for the treatment of both metastatic and primary malignancies. However, extended ex vivo culturing reduces the functionality of isolated T cells. Cryopreservation of rapidly expanded T cells for subsequent use throughout an immunotherapeutic regimen is a highly desirable recourse, thus far encumbered by a lack of studies investigating its effects on effector T-cell functionality. Here we directly compare murine tumour-reactive CD8(+) T cells cryopreserved during ex vivo expansion to freshly isolated populations. We show that cryopreservation fully conserves the differentiation potential of effector T cells, secretion of pro-inflammatory cytokines, cytotoxic function and does not impair the three-dimensional scanning motility of T cells or their capacity to infiltrate and reject tumours. PMID:26754453

  7. Antigen-specific T cells fully conserve antitumour function following cryopreservation

    PubMed Central

    Galeano Niño, Jorge L; Kwan, Rain YQ; Weninger, Wolfgang; Biro, Maté

    2016-01-01

    Immunotherapies based on the autologous adoptive transfer of ex vivo-manipulated T cells are rapidly evolving for the treatment of both metastatic and primary malignancies. However, extended ex vivo culturing reduces the functionality of isolated T cells. Cryopreservation of rapidly expanded T cells for subsequent use throughout an immunotherapeutic regimen is a highly desirable recourse, thus far encumbered by a lack of studies investigating its effects on effector T-cell functionality. Here we directly compare murine tumour-reactive CD8+ T cells cryopreserved during ex vivo expansion to freshly isolated populations. We show that cryopreservation fully conserves the differentiation potential of effector T cells, secretion of pro-inflammatory cytokines, cytotoxic function and does not impair the three-dimensional scanning motility of T cells or their capacity to infiltrate and reject tumours. PMID:26754453

  8. Malaria Parasite Survival Depends on Conserved Binding Peptides' Critical Biological Functions.

    PubMed

    Patarroyo, Manuel E; Arevalo-Pinzon, Gabriela; Reyes, Cesar; Moreno-Vranich, Armando; Patarroyo, Manuel A

    2016-01-01

    Biochemical, structural and single amino acid level analysis of 49 Plasmodium falciparum protein regions (13 sporozoite and 36 merozoite proteins) has highlighted the functional role of each conserved high activity binding peptide (cHABP) in cell host-microbe interaction, involving biological functions such as gliding motility, traversal activity, binding invasion, reproduction, nutrient ion transport and the development of severe malaria. Each protein's key function in the malaria parasite's asexual lifecycle (pre-erythrocyte and erythro-cyte) is described in terms of cHABPs; their sequences were located in elegant work published by other groups regarding critical binding regions implicated in malarial parasite invasion. Such cHABPs represent the starting point for developing a logical and rational methodology for selecting an appropriate mixture of modified cHABPs to be used in a completely effective, synthetic antimalarial vaccine. Such methodology could be used for developing vaccines against diseases scourging humanity. PMID:26317369

  9. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki

    2005-01-01

    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  10. Transactivation specificity is conserved among p53 family proteins and depends on a response element sequence code

    PubMed Central

    Ciribilli, Yari; Monti, Paola; Bisio, Alessandra; Nguyen, H. Thien; Ethayathulla, Abdul S.; Ramos, Ana; Foggetti, Giorgia; Menichini, Paola; Menendez, Daniel; Resnick, Michael A.; Viadiu, Hector; Fronza, Gilberto; Inga, Alberto

    2013-01-01

    Structural and biochemical studies have demonstrated that p73, p63 and p53 recognize DNA with identical amino acids and similar binding affinity. Here, measuring transactivation activity for a large number of response elements (REs) in yeast and human cell lines, we show that p53 family proteins also have overlapping transactivation profiles. We identified mutations at conserved amino acids of loops L1 and L3 in the DNA-binding domain that tune the transactivation potential nearly equally in p73, p63 and p53. For example, the mutant S139F in p73 has higher transactivation potential towards selected REs, enhanced DNA-binding cooperativity in vitro and a flexible loop L1 as seen in the crystal structure of the protein–DNA complex. By studying, how variations in the RE sequence affect transactivation specificity, we discovered a RE-transactivation code that predicts enhanced transactivation; this correlation is stronger for promoters of genes associated with apoptosis. PMID:23892287

  11. Identification of human proteins functionally conserved with the yeast putative adaptors ADA2 and GCN5.

    PubMed Central

    Candau, R; Moore, P A; Wang, L; Barlev, N; Ying, C Y; Rosen, C A; Berger, S L

    1996-01-01

    Transcriptional adaptor proteins are required for full function of higher eukaryotic acidic activators in the yeast Saccharomyces cerevisiae, suggesting that this pathway of activation is evolutionarily conserved. Consistent with this view, we have identified possible human homologs of yeast ADA2 (yADA2) and yeast GCN5 (yGCN5), components of a putative adaptor complex. While there is overall sequence similarity between the yeast and human proteins, perhaps more significant is conservation of key sequence features with other known adaptors. We show several functional similarities between the human and yeast adaptors. First, as shown for yADA2 and yGCN5, human ADA2 (hADA2) and human GCN5 (hGCN5) interacted in vivo in a yeast two-hybrid assay. Moreover, hGCN5 interacted with yADA2 in this assay, suggesting that the human proteins form similar complexes. Second, both yADA2 and hADA2 contain cryptic activation domains. Third, hGCN5 and yGCN5 had similar stabilizing effects on yADA2 in vivo. Furthermore, the region of yADA2 that interacted with yGCN5 mapped to the amino terminus of yADA2, which is highly conserved in hADA2. Most striking, is the behavior of the human proteins in human cells. First, GAL4-hADA2 activated transcription in HeLa cells, and second, either hADA2 or hGCN5 augmented GAL4-VP16 activation. These data indicated that the human proteins correspond to functional homologs of the yeast adaptors, suggesting that these cofactors play a key role in transcriptional activation. PMID:8552087

  12. A Conserved Cysteine Motif Is Critical for Rice Ceramide Kinase Activity and Function

    PubMed Central

    Liu, Zhe; Fang, Ce; Li, Jian; Su, Jian-Bin; Greenberg, Jean T.; Wang, Hong-Bin; Yao, Nan

    2011-01-01

    Background Ceramide kinase (CERK) is a key regulator of cell survival in dicotyledonous plants and animals. Much less is known about the roles of CERK and ceramides in mediating cellular processes in monocot plants. Here, we report the characterization of a ceramide kinase, OsCERK, from rice (Oryza sativa spp. Japonica cv. Nipponbare) and investigate the effects of ceramides on rice cell viability. Principal Findings OsCERK can complement the Arabidopsis CERK mutant acd5. Recombinant OsCERK has ceramide kinase activity with Michaelis-Menten kinetics and optimal activity at 7.0 pH and 40°C. Mg2+ activates OsCERK in a concentration-dependent manner. Importantly, a CXXXCXXC motif, conserved in all ceramide kinases and important for the activity of the human enzyme, is critical for OsCERK enzyme activity and in planta function. In a rice protoplast system, inhibition of CERK leads to cell death and the ratio of added ceramide and ceramide-1-phosphate, CERK's substrate and product, respectively, influences cell survival. Ceramide-induced rice cell death has apoptotic features and is an active process that requires both de novo protein synthesis and phosphorylation, respectively. Finally, mitochondria membrane potential loss previously associated with ceramide-induced cell death in Arabidopsis was also found in rice, but it occurred with different timing. Conclusions OsCERK is a bona fide ceramide kinase with a functionally and evolutionarily conserved Cys-rich motif that plays an important role in modulating cell fate in plants. The vital function of the conserved motif in both human and rice CERKs suggests that the biochemical mechanism of CERKs is similar in animals and plants. Furthermore, ceramides induce cell death with similar features in monocot and dicot plants. PMID:21483860

  13. The Double-Edged Sword: Conserved Functions of Extracellular Hsp90 in Wound Healing and Cancer

    PubMed Central

    Hance, Michael W.; Nolan, Krystal D.; Isaacs, Jennifer S.

    2014-01-01

    Heat shock proteins (Hsps) represent a diverse group of chaperones that play a vital role in the protection of cells against numerous environmental stresses. Although our understanding of chaperone biology has deepened over the last decade, the “atypical” extracellular functions of Hsps have remained somewhat enigmatic and comparatively understudied. The heat shock protein 90 (Hsp90) chaperone is a prototypic model for an Hsp family member exhibiting a duality of intracellular and extracellular functions. Intracellular Hsp90 is best known as a master regulator of protein folding. Cancers are particularly adept at exploiting this function of Hsp90, providing the impetus for the robust clinical development of small molecule Hsp90 inhibitors. However, in addition to its maintenance of protein homeostasis, Hsp90 has also been identified as an extracellular protein. Although early reports ascribed immunoregulatory functions to extracellular Hsp90 (eHsp90), recent studies have illuminated expanded functions for eHsp90 in wound healing and cancer. While the intended physiological role of eHsp90 remains enigmatic, its evolutionarily conserved functions in wound healing are easily co-opted during malignancy, a pathology sharing many properties of wounded tissue. This review will highlight the emerging functions of eHsp90 and shed light on its seemingly dichotomous roles as a benevolent facilitator of wound healing and as a sinister effector of tumor progression. PMID:24805867

  14. Annotation of Protein Domains Reveals Remarkable Conservation in the Functional Make up of Proteomes Across Superkingdoms

    PubMed Central

    Nasir, Arshan; Naeem, Aisha; Khan, Muhammad Jawad; Lopez-Nicora, Horacio D.; Caetano-Anollés, Gustavo

    2011-01-01

    The functional repertoire of a cell is largely embodied in its proteome, the collection of proteins encoded in the genome of an organism. The molecular functions of proteins are the direct consequence of their structure and structure can be inferred from sequence using hidden Markov models of structural recognition. Here we analyze the functional annotation of protein domain structures in almost a thousand sequenced genomes, exploring the functional and structural diversity of proteomes. We find there is a remarkable conservation in the distribution of domains with respect to the molecular functions they perform in the three superkingdoms of life. In general, most of the protein repertoire is spent in functions related to metabolic processes but there are significant differences in the usage of domains for regulatory and extra-cellular processes both within and between superkingdoms. Our results support the hypotheses that the proteomes of superkingdom Eukarya evolved via genome expansion mechanisms that were directed towards innovating new domain architectures for regulatory and extra/intracellular process functions needed for example to maintain the integrity of multicellular structure or to interact with environmental biotic and abiotic factors (e.g., cell signaling and adhesion, immune responses, and toxin production). Proteomes of microbial superkingdoms Archaea and Bacteria retained fewer numbers of domains and maintained simple and smaller protein repertoires. Viruses appear to play an important role in the evolution of superkingdoms. We finally identify few genomic outliers that deviate significantly from the conserved functional design. These include Nanoarchaeum equitans, proteobacterial symbionts of insects with extremely reduced genomes, Tenericutes and Guillardia theta. These organisms spend most of their domains on information functions, including translation and transcription, rather than on metabolism and harbor a domain repertoire characteristic of

  15. Functional analysis of the sea urchin-derived arylsulfatase (Ars)-element in mammalian cells.

    PubMed

    Watanabe, Satoshi; Watanabe, Sachiko; Sakamoto, Naoaki; Sato, Masahiro; Akasaka, Koji

    2006-09-01

    An insulator is a DNA sequence that has both enhancer-blocking activity, through its ability to modify the influence of neighboring cis-acting elements, and a barrier function that protects a transgene from being silenced by surrounding chromatin. Previously, we isolated and characterized a 582-bp-long element from the sea urchin arylsulfatase gene (Ars). This Ars-element was effective in sea urchin and Drosophila embryos and in plant cells. To investigate Ars-element activity in mammalian cells, we placed the element between the cytomegalovirus enhancer and a luciferase (luc) expression cassette. In contrast to controls lacking the Ars-element, NIH3T3 and 293T cells transfected with the element-containing construct displayed reduced luciferase activities. The Ars-element therefore acts as an enhancer-blocking element in mammalian cells. We assessed the barrier activity of the Ars-element using vectors in which a luc expression cassette was placed between two elements. Transfection experiments demonstrated that luc activity in these vectors was approximately ten-fold higher than in vectors lacking elements. Luc activities were well maintained even after 12 weeks in culture. Our observations demonstrate that the Ars-element has also a barrier activity. These results indicated that the Ars-element act as an insulator in mammalian cells. PMID:16923122

  16. Analytical finite element matrix elements and global matrix assembly for hierarchical 3-D vector basis functions within the hybrid finite element boundary integral method

    NASA Astrophysics Data System (ADS)

    Li, L.; Wang, K.; Li, H.; Eibert, T. F.

    2014-11-01

    A hybrid higher-order finite element boundary integral (FE-BI) technique is discussed where the higher-order FE matrix elements are computed by a fully analytical procedure and where the gobal matrix assembly is organized by a self-identifying procedure of the local to global transformation. This assembly procedure applys to both, the FE part as well as the BI part of the algorithm. The geometry is meshed into three-dimensional tetrahedra as finite elements and nearly orthogonal hierarchical basis functions are employed. The boundary conditions are implemented in a strong sense such that the boundary values of the volume basis functions are directly utilized within the BI, either for the tangential electric and magnetic fields or for the asssociated equivalent surface current densities by applying a cross product with the unit surface normals. The self-identified method for the global matrix assembly automatically discerns the global order of the basis functions for generating the matrix elements. Higher order basis functions do need more unknowns for each single FE, however, fewer FEs are needed to achieve the same satisfiable accuracy. This improvement provides a lot more flexibility for meshing and allows the mesh size to raise up to λ/3. The performance of the implemented system is evaluated in terms of computation time, accuracy and memory occupation, where excellent results with respect to precision and computation times of large scale simulations are found.

  17. Test functions for three-dimensional control-volume mixed finite-element methods on irregular grids

    USGS Publications Warehouse

    Naff, R.L.; Russell, T.F.; Wilson, J.D.

    2000-01-01

    Numerical methods based on unstructured grids, with irregular cells, usually require discrete shape functions to approximate the distribution of quantities across cells. For control-volume mixed finite-element methods, vector shape functions are used to approximate the distribution of velocities across cells and vector test functions are used to minimize the error associated with the numerical approximation scheme. For a logically cubic mesh, the lowest-order shape functions are chosen in a natural way to conserve intercell fluxes that vary linearly in logical space. Vector test functions, while somewhat restricted by the mapping into the logical reference cube, admit a wider class of possibilities. Ideally, an error minimization procedure to select the test function from an acceptable class of candidates would be the best procedure. Lacking such a procedure, we first investigate the effect of possible test functions on the pressure distribution over the control volume; specifically, we look for test functions that allow for the elimination of intermediate pressures on cell faces. From these results, we select three forms for the test function for use in a control-volume mixed method code and subject them to an error analysis for different forms of grid irregularity; errors are reported in terms of the discrete L2 norm of the velocity error. Of these three forms, one appears to produce optimal results for most forms of grid irregularity.

  18. Functional dissection of an enhancer-like element located within the second intron of the human U2AF1L4 gene.

    PubMed

    Didych, D A; Smirnov, N A; Kotova, E S; Akopov, S B; Nikolaev, L G; Sverdlov, E D

    2011-08-01

    A detailed functional and evolutionary analysis of an enhancer element of the human genome (enhancer 12) located in the second intron of the U2AF1L4 gene, which we identified earlier, is presented. Overlapping fragments of the studied genome region were analyzed for enhancer activity, and the site responsible for the activity of this element was identified using transient transfections of HeLa cells. Comparison of the enhancer 12 sequence with orthologous sequences from seven primate species revealed the existence of evolutionarily conserved sequences within this element. One of the identified conservative regions is likely responsible for the enhancer activity and is able to specifically interact in vitro with proteins of HeLa cell nuclear extract. The ability of orthologous primate sequences to compete with enhancer 12 for binding with HeLa cell nuclear extract proteins and to enhance the activity of the reporter gene in transient transfection of HeLa cells is demonstrated. PMID:22022969

  19. Conservation of Histone Binding and Transcriptional Repressor Functions in a Schizosaccharomyces pombe Tup1p Homolog

    PubMed Central

    Mukai, Yukio; Matsuo, Eri; Roth, Sharon Y.; Harashima, Satoshi

    1999-01-01

    The Ssn6p-Tup1p corepressor complex is important to the regulation of several diverse genes in Saccharomyces cerevisiae and serves as a model for corepressor functions. To investigate the evolutionary conservation of these functions, sequences homologous to the S. cerevisiae TUP1 gene were cloned from Kluyveromyces lactis (TUP1) and Schizosaccharomyces pombe (tup11+). Interestingly, while the K. lactis TUP1 gene complemented an S. cerevisiae tup1 null mutation, the S. pombe tup11+ gene did not, even when expressed under the control of the S. cerevisiae TUP1 promoter. However, an S. pombe Tup11p-LexA fusion protein repressed transcription of a corresponding reporter gene, indicating that this Tup1p homolog has intrinsic repressor activity. Moreover, a chimeric protein containing the amino-terminal Ssn6p-binding domain of S. cerevisiae Tup1p and 544 amino acids from the C-terminal region of S. pombe Tup11p complemented the S. cerevisiae tup1 mutation. The failure of native S. pombe Tup11p to complement loss of Tup1p functions in S. cerevisiae corresponds to an inability to bind to S. cerevisiae Ssn6p in vitro. Disruption of tup11+ in combination with a disruption of tup12+, another TUP1 homolog gene in S. pombe, causes a defect in glucose repression of fbp1+, suggesting that S. pombe Tup1p homologs function as repressors in S. pombe. Furthermore, Tup11p binds specifically to histones H3 and H4 in vitro, indicating that both the repression and histone binding functions of Tup1p-related proteins are conserved across species. PMID:10567571

  20. Two-dimensional finite element neutron diffusion analysis using hierarchic shape functions

    SciTech Connect

    Carpenter, D.C.

    1997-04-01

    Recent advances have been made in the use of p-type finite element method (FEM) for structural and fluid dynamics problems that hold promise for reactor physics problems. These advances include using hierarchic shape functions, element-by-element iterative solvers and more powerful mapping techniques. Use of the hierarchic shape functions allows greater flexibility and efficiency in implementing energy-dependent flux expansions and incorporating localized refinement of the solution space. The irregular matrices generated by the p-type FEM can be solved efficiently using element-by-element conjugate gradient iterative solvers. These solvers do not require storage of either the global or local stiffness matrices and can be highly vectorized. Mapping techniques based on blending function interpolation allow exact representation of curved boundaries using coarse element grids. These features were implemented in a developmental two-dimensional neutron diffusion program based on the use of hierarchic shape functions (FEM2DH). Several aspects in the effective use of p-type analysis were explored. Two choices of elemental preconditioning were examined--the proper selection of the polynomial shape functions and the proper number of functions to use. Of the five shape function polynomials tested, the integral Legendre functions were the most effective. The serendipity set of functions is preferable over the full tensor product set. Two global preconditioners were also examined--simple diagonal and incomplete Cholesky. The full effectiveness of the finite element methodology was demonstrated on a two-region, two-group cylindrical problem but solved in the x-y coordinate space, using a non-structured element grid. The exact, analytic eigenvalue solution was achieved with FEM2DH using various combinations of element grids and flux expansions.

  1. Conserved functional domains and a novel tertiary interaction near the pseudoknot drive translational activity of hepatitis C virus and hepatitis C virus-like internal ribosome entry sites

    PubMed Central

    Easton, Laura E.; Locker, Nicolas; Lukavsky, Peter J.

    2009-01-01

    The translational activity of the hepatitis C virus (HCV) internal ribosome entry site (IRES) and other HCV-like IRES RNAs depends on structured RNA elements in domains II and III, which serve to recruit the ribosomal 40S subunit, eukaryotic initiation factor (eIF) 3 and the ternary eIF2/Met-tRNAiMet/GTP complex and subsequently domain II assists subunit joining. Porcine teschovirus-1 talfan (PTV-1) is a member of the Picornaviridae family, with a predicted HCV-like secondary structure, but only stem-loops IIId and IIIe in the 40S-binding domain display significant sequence conservation with the HCV IRES. Here, we use chemical probing to show that interaction sites with the 40S subunit and eIF3 are conserved between HCV and HCV-like IRESs. In addition, we reveal the functional role of a strictly conserved co-variation between a purine–purine mismatch near the pseudoknot (A–A/G) and the loop sequence of domain IIIe (GAU/CA). These nucleotides are involved in a tertiary interaction, which serves to stabilize the pseudoknot structure and correlates with translational efficiency in both the PTV-1 and HCV IRES. Our data demonstrate conservation of functional domains in HCV and HCV-like IRESs including a more complex structure surrounding the pseudoknot than previously assumed. PMID:19596815

  2. High-affinity interaction of hnRNP A1 with conserved RNA structural elements is required for translation and replication of enterovirus 71

    PubMed Central

    Levengood, Jeffrey D.; Tolbert, Michele; Li, Mei-Ling; Tolbert, Blanton S.

    2013-01-01

    Human Enterovirus 71 (EV71) is an emerging pathogen of infectious disease and a serious threat to public health. Currently, there are no antivirals or vaccines to slow down or prevent EV71 infections, thus underscoring the urgency to better understand mechanisms of host-enterovirus interactions. EV71 uses a type I internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit via a pathway that requires the cytoplasmic localization of hnRNP A1, which acts as an IRES trans-activating factor. The mechanism of how hnRNP A1 trans activates EV71 RNA translation is unknown, however. Here, we report that the UP1 domain of hnRNP A1 interacts specifically with stem loop II (SLII) of the IRES, via a thermodynamically well-defined biphasic transition that involves conserved bulge 5′-AYAGY-3′ and hairpin 5′-RY(U/A)CCA-3′ loops. Calorimetric titrations of wild-type and mutant SLII constructs reveal these structural elements are essential to form a high-affinity UP1-SLII complex. Mutations that alter the bulge and hairpin primary or secondary structures abrogate the biphasic transition and destabilize the complex. Notably, mutations within the bulge that destabilize the complex correlate with a large reduction in IRES-dependent translational activity and impair EV71 replication. Taken together, this study shows that a conserved SLII structure is necessary to form a functional hnRNP A1-IRES complex, suggesting that small molecules that target this stem loop may have novel antiviral properties. PMID:23727900

  3. Multiple functionally divergent and conserved copies of alpha tubulin in bdelloid rotifers

    PubMed Central

    2012-01-01

    Background Bdelloid rotifers are microscopic animals that have apparently survived without sex for millions of years and are able to survive desiccation at all life stages through a process called anhydrobiosis. Both of these characteristics are believed to have played a role in shaping several unusual features of bdelloid genomes discovered in recent years. Studies into the impact of asexuality and anhydrobiosis on bdelloid genomes have focused on understanding gene copy number. Here we investigate copy number and sequence divergence in alpha tubulin. Alpha tubulin is conserved and normally present in low copy numbers in animals, but multiplication of alpha tubulin copies has occurred in animals adapted to extreme environments, such as cold-adapted Antarctic fish. Using cloning and sequencing we compared alpha tubulin copy variation in four species of bdelloid rotifers and four species of monogonont rotifers, which are facultatively sexual and cannot survive desiccation as adults. Results were verified using transcriptome data from one bdelloid species, Adineta ricciae. Results In common with the typical pattern for animals, monogonont rotifers contain either one or two copies of alpha tubulin, but bdelloid species contain between 11 and 13 different copies, distributed across five classes. Approximately half of the copies form a highly conserved group that vary by only 1.1% amino acid pairwise divergence with each other and with the monogonont copies. The other copies have divergent amino acid sequences that evolved significantly faster between classes than within them, relative to synonymous changes, and vary in predicted biochemical properties. Copies of each class were expressed under the laboratory conditions used to construct the transcriptome. Conclusions Our findings are consistent with recent evidence that bdelloids are degenerate tetraploids and that functional divergence of ancestral copies of genes has occurred, but show how further duplication events

  4. Comparative proteomics reveals a significant bias toward alternative protein isoforms with conserved structure and function.

    PubMed

    Ezkurdia, Iakes; del Pozo, Angela; Frankish, Adam; Rodriguez, Jose Manuel; Harrow, Jennifer; Ashman, Keith; Valencia, Alfonso; Tress, Michael L

    2012-09-01

    Advances in high-throughput mass spectrometry are making proteomics an increasingly important tool in genome annotation projects. Peptides detected in mass spectrometry experiments can be used to validate gene models and verify the translation of putative coding sequences (CDSs). Here, we have identified peptides that cover 35% of the genes annotated by the GENCODE consortium for the human genome as part of a comprehensive analysis of experimental spectra from two large publicly available mass spectrometry databases. We detected the translation to protein of "novel" and "putative" protein-coding transcripts as well as transcripts annotated as pseudogenes and nonsense-mediated decay targets. We provide a detailed overview of the population of alternatively spliced protein isoforms that are detectable by peptide identification methods. We found that 150 genes expressed multiple alternative protein isoforms. This constitutes the largest set of reliably confirmed alternatively spliced proteins yet discovered. Three groups of genes were highly overrepresented. We detected alternative isoforms for 10 of the 25 possible heterogeneous nuclear ribonucleoproteins, proteins with a key role in the splicing process. Alternative isoforms generated from interchangeable homologous exons and from short indels were also significantly enriched, both in human experiments and in parallel analyses of mouse and Drosophila proteomics experiments. Our results show that a surprisingly high proportion (almost 25%) of the detected alternative isoforms are only subtly different from their constitutive counterparts. Many of the alternative splicing events that give rise to these alternative isoforms are conserved in mouse. It was striking that very few of these conserved splicing events broke Pfam functional domains or would damage globular protein structures. This evidence of a strong bias toward subtle differences in CDS and likely conserved cellular function and structure is remarkable and

  5. Assembly and Function of the Major Histocompatibility Complex (MHC) I Peptide-loading Complex Are Conserved Across Higher Vertebrates*

    PubMed Central

    Hinz, Andreas; Jedamzick, Johanna; Herbring, Valentina; Fischbach, Hanna; Hartmann, Jessica; Parcej, David; Koch, Joachim; Tampé, Robert

    2014-01-01

    Antigen presentation to cytotoxic T lymphocytes via major histocompatibility complex class I (MHC I) molecules depends on the heterodimeric transporter associated with antigen processing (TAP). For efficient antigen supply to MHC I molecules in the ER, TAP assembles a macromolecular peptide-loading complex (PLC) by recruiting tapasin. In evolution, TAP appeared together with effector cells of adaptive immunity at the transition from jawless to jawed vertebrates and diversified further within the jawed vertebrates. Here, we compared TAP function and interaction with tapasin of a range of species within two classes of jawed vertebrates. We found that avian and mammalian TAP1 and TAP2 form heterodimeric complexes across taxa. Moreover, the extra N-terminal domain TMD0 of mammalian TAP1 and TAP2 as well as avian TAP2 recruits tapasin. Strikingly, however, only TAP1 and TAP2 from the same taxon can form a functional heterodimeric translocation complex. These data demonstrate that the dimerization interface between TAP1 and TAP2 and the tapasin docking sites for PLC assembly are conserved in evolution, whereas elements of antigen translocation diverged later in evolution and are thus taxon specific. PMID:25320083

  6. Functional Annotation of Putative Regulatory Elements at Cancer Susceptibility Loci

    PubMed Central

    Rosse, Stephanie A; Auer, Paul L; Carlson, Christopher S

    2014-01-01

    Most cancer-associated genetic variants identified from genome-wide association studies (GWAS) do not obviously change protein structure, leading to the hypothesis that the associations are attributable to regulatory polymorphisms. Translating genetic associations into mechanistic insights can be facilitated by knowledge of the causal regulatory variant (or variants) responsible for the statistical signal. Experimental validation of candidate functional variants is onerous, making bioinformatic approaches necessary to prioritize candidates for laboratory analysis. Thus, a systematic approach for recognizing functional (and, therefore, likely causal) variants in noncoding regions is an important step toward interpreting cancer risk loci. This review provides a detailed introduction to current regulatory variant annotations, followed by an overview of how to leverage these resources to prioritize candidate functional polymorphisms in regulatory regions. PMID:25288875

  7. Novel and Conserved Protein Macoilin Is Required for Diverse Neuronal Functions in Caenorhabditis elegans

    PubMed Central

    Miyara, Akiko; Ohta, Akane; Okochi, Yoshifumi; Tsukada, Yuki; Kuhara, Atsushi; Mori, Ikue

    2011-01-01

    Neural signals are processed in nervous systems of animals responding to variable environmental stimuli. This study shows that a novel and highly conserved protein, macoilin (MACO-1), plays an essential role in diverse neural functions in Caenorhabditis elegans. maco-1 mutants showed abnormal behaviors, including defective locomotion, thermotaxis, and chemotaxis. Expression of human macoilin in the C. elegans nervous system weakly rescued the abnormal thermotactic phenotype of the maco-1 mutants, suggesting that macoilin is functionally conserved across species. Abnormal thermotaxis may have been caused by impaired locomotion of maco-1 mutants. However, calcium imaging of AFD thermosensory neurons and AIY postsynaptic interneurons of maco-1 mutants suggest that macoilin is required for appropriate responses of AFD and AIY neurons to thermal stimuli. Studies on localization of MACO-1 showed that C. elegans and human macoilins are localized mainly to the rough endoplasmic reticulum. Our results suggest that macoilin is required for various neural events, such as the regulation of neuronal activity. PMID:21589894

  8. Novel and conserved protein macoilin is required for diverse neuronal functions in Caenorhabditis elegans.

    PubMed

    Miyara, Akiko; Ohta, Akane; Okochi, Yoshifumi; Tsukada, Yuki; Kuhara, Atsushi; Mori, Ikue

    2011-05-01

    Neural signals are processed in nervous systems of animals responding to variable environmental stimuli. This study shows that a novel and highly conserved protein, macoilin (MACO-1), plays an essential role in diverse neural functions in Caenorhabditis elegans. maco-1 mutants showed abnormal behaviors, including defective locomotion, thermotaxis, and chemotaxis. Expression of human macoilin in the C. elegans nervous system weakly rescued the abnormal thermotactic phenotype of the maco-1 mutants, suggesting that macoilin is functionally conserved across species. Abnormal thermotaxis may have been caused by impaired locomotion of maco-1 mutants. However, calcium imaging of AFD thermosensory neurons and AIY postsynaptic interneurons of maco-1 mutants suggest that macoilin is required for appropriate responses of AFD and AIY neurons to thermal stimuli. Studies on localization of MACO-1 showed that C. elegans and human macoilins are localized mainly to the rough endoplasmic reticulum. Our results suggest that macoilin is required for various neural events, such as the regulation of neuronal activity. PMID:21589894

  9. Functional conservation and diversification of the soybean maturity gene E1 and its homologs in legumes

    PubMed Central

    Zhang, Xingzheng; Zhai, Hong; Wang, Yaying; Tian, Xiaojie; Zhang, Yupeng; Wu, Hongyan; Lü, Shixiang; Yang, Guang; Li, Yuqiu; Wang, Lu; Hu, Bo; Bu, Qingyun; Xia, Zhengjun

    2016-01-01

    Gene regulatory networks involved in flowering time and photoperiodic responses in legumes remain unknown. Although the major maturity gene E1 has been successfully deciphered in soybean, knowledge on the functional conservation of this gene is limited to a certain extent to E1 homologs in legumes. The ectopic expression of Phvul.009G204600 (PvE1L), an E1 homolog from common bean, delayed the onset of flowering in soybean. By contrast, the ectopic expression of Medtr2g058520 (MtE1L) from Medicago truncatula did not affect the flowering of soybean. Characterization of the late-flowering mte1l mutant indicated that MtE1L promoted flowering in Medicago truncatula. Moreover, all transgenic E1, PvE1L and MtE1L soybean lines exhibited phenotypic changes in terms of plant height. Transgenic E1 or PvE1L plants were taller than the wild-type, whereas transgenic MtE1L plants produced dwarf phenotype with few nodes and short internode. Thus, functional conservation and diversification of E1 family genes from legumes in the regulation of flowering and plant growth may be associated with lineage specification and genomic duplication. PMID:27405888

  10. Boltzmann-conserving classical dynamics in quantum time-correlation functions: “Matsubara dynamics”

    SciTech Connect

    Hele, Timothy J. H.; Willatt, Michael J.; Muolo, Andrea; Althorpe, Stuart C.

    2015-04-07

    We show that a single change in the derivation of the linearized semiclassical-initial value representation (LSC-IVR or “classical Wigner approximation”) results in a classical dynamics which conserves the quantum Boltzmann distribution. We rederive the (standard) LSC-IVR approach by writing the (exact) quantum time-correlation function in terms of the normal modes of a free ring-polymer (i.e., a discrete imaginary-time Feynman path), taking the limit that the number of polymer beads N → ∞, such that the lowest normal-mode frequencies take their “Matsubara” values. The change we propose is to truncate the quantum Liouvillian, not explicitly in powers of ħ{sup 2} at ħ{sup 0} (which gives back the standard LSC-IVR approximation), but in the normal-mode derivatives corresponding to the lowest Matsubara frequencies. The resulting “Matsubara” dynamics is inherently classical (since all terms O(ħ{sup 2}) disappear from the Matsubara Liouvillian in the limit N → ∞) and conserves the quantum Boltzmann distribution because the Matsubara Hamiltonian is symmetric with respect to imaginary-time translation. Numerical tests show that the Matsubara approximation to the quantum time-correlation function converges with respect to the number of modes and gives better agreement than LSC-IVR with the exact quantum result. Matsubara dynamics is too computationally expensive to be applied to complex systems, but its further approximation may lead to practical methods.

  11. Phosphatidate phosphatase-1 is functionally conserved in lipid synthesis and storage from human to yeast.

    PubMed

    Fang, Zhijia; Wang, Song; Du, Xiuxiu; Shi, Ping; Huang, Zhiwei

    2014-12-01

    Phosphatidate phosphatase-1 (PAP1) enzymes (yeast Pah1p/Smp2p, mammalian lipin1-3) have a key role in lipid homeostasis by controlling the relative proportions of its substrate phosphatidate (PA) and its product diacylglycerol (DAG). Recent investigation shows that mammalian lipin-1 complements phenotypes exhibited by yeast pah1Δ mutant cells, which indicates the functions of PAP1 enzymes are evolutionarily conserved. The observation was confirmed after transformation of human LPIN1 into PAH1-defective yeast, which resulted in human LPIN1-induced accumulation of triacylglycerol (TAG )and lipid droplet formation. In double mutants lacking Tgl3p and Tgl4p, overexpression of PAH1 or LPIN1 induced TAG accumulation and excessive obesity. Furthermore, the obese yeast was used as a model to study the anti-obesity effects of PAP1 activity inhibitors, including propranolol and clenbuterol. The data showed that the inhibitors significantly suppressed TAG accumulation and lipid droplets formation. These findings demonstrate that LPIN1 plays a functional role in lipid synthesis and storage, a role which is highly conserved from human to yeast. Inhibition of TAG synthesis will become an efficacious treatment strategy for obesity and our excessive obesity model will provide a very useful tool for discovery of new anti-obesity drugs in the future. PMID:25475986

  12. Arv1 lipid transporter function is conserved between pathogenic and nonpathogenic fungi

    PubMed Central

    Gallo-Ebert, Christina; McCourt, Paula C.; Donigan, Melissa; Villasmil, Michelle L.; Chen, WeiWei; Pandya, Devanshi; Franco, Judith; Romano, Desiree; Chadwick, Sean; Gygax, Scott; Nickels, Joseph T.

    2011-01-01

    The lipid transporter Arv1 regulates sterol trafficking, and glycosylphosphatidylinositol and sphingolipid biosyntheses in Saccharomyces cerevisiae. ScArv1 contains an Arv1 homology domain (AHD) that is conserved at the amino acid level in the pathogenic fungal species, Candida albicans and Candida glabrata. Here we show S. cerevisiae cells lacking Arv1 are highly susceptible to antifungal drugs. In the presence of drug, Scarv1 cells are unable to induce ERG gene expression, have an altered pleiotrophic drug response, and are defective in multi-drug resistance efflux pump expression. All phenotypes are remediated by ectopic expression of CaARV1 or CgARV1. The AHDs of these pathogenic fungi are required for specific drug tolerance, demonstrating conservation of function. In order to understand how Arv1 regulates antifungal susceptibility, we examined sterol trafficking. CaARV1/CgARV1 expression suppressed the sterol trafficking defect of Scarv1 cells. Finally, we show that C. albicans arv1/arv1 cells are avirulent using a BALB/c disseminated mouse model. We suggest that overall cell survival in response to antifungal treatment requires the lipid transporter function of Arv1. PMID:22142782

  13. A Continuum of Connectivity: Geographically Isolated Wetlands and the Conservation of Landscape Functions

    NASA Astrophysics Data System (ADS)

    Cohen, M. J.; Creed, I. F.; Basu, N. B.; Jawitz, J. W.; Mclaughlin, D. L.; Rains, M. C.

    2014-12-01

    Landscape functions depend on how matter, energy, and organisms exchange between elements in hydrologic and habitat networks. Wetlands are important network elements, providing hydrological, biogeochemical and biological functions that vary along a continuum of connectivity with nearby and downstream waters. Geographically isolated wetlands (GIWs), those surrounded by uplands, occupy the entire connectivity continuum, but generally fall outside US legal protections unless a "significant nexus" to navigable waters is demonstrated. Geographic isolation does not imply hydrological, biogeochemical or biological isolation. Here we show multiple lines of evidence to support the inference that GIWs are integral to the function of navigable waters. Moreover, while GIW hydro-chemical connectivity may be episodic or slow (e.g., via groundwater), and biological connectivity limited by overland dispersal, reducing material or organism exchange is specifically what enables important, sometimes unique, functions. This relational connectivity, wherein precluded exchange creates functionality, may be as important to downstream waters as more obvious connections. Logic and evidence support the presumption that anthropogenic changes to GIW prevalence, condition and connectivity have significant downstream impacts.

  14. EAG2 potassium channel with evolutionarily conserved function as a brain tumor target

    PubMed Central

    Huang, Xi; He, Ye; Dubuc, Adrian M.; Hashizume, Rintaro; Zhang, Wei; Reimand, Jüri; Yang, Huanghe; Wang, Tongfei A.; Stehbens, Samantha J.; Younger, Susan; Barshow, Suzanne; Zhu, Sijun; Cooper, Michael K.; Peacock, John; Ramaswamy, Vijay; Garzia, Livia; Wu, Xiaochong; Remke, Marc; Forester, Craig M.; Kim, Charles C.; Weiss, William A.; James, C. David; Shuman, Marc A.; Bader, Gary D.; Mueller, Sabine; Taylor, Michael D.; Jan, Yuh Nung; Jan, Lily Yeh

    2015-01-01

    Over 20% of the drugs for treating human diseases target ion channels, however, no cancer drug approved by the U.S. Food and Drug Administration (FDA) is intended to target an ion channel. Here, we demonstrate the evolutionarily conserved function of EAG2 potassium channel in promoting brain tumor growth and metastasis, delineate downstream pathways and uncover a mechanism for different potassium channels to functionally corporate and regulate mitotic cell volume and tumor progression. We show that EAG2 potassium channel is enriched at the trailing edge of migrating MB cells to regulate local cell volume dynamics, thereby facilitating cell motility. We identify the FDA-approved antipsychotic drug thioridazine as an EAG2 channel blocker that reduces xenografted MB growth and metastasis, and present a case report of repurposing thioridazine for treating a human patient. Our findings thus illustrate the potential of targeting ion channels in cancer treatment. PMID:26258683

  15. EAG2 potassium channel with evolutionarily conserved function as a brain tumor target.

    PubMed

    Huang, Xi; He, Ye; Dubuc, Adrian M; Hashizume, Rintaro; Zhang, Wei; Reimand, Jüri; Yang, Huanghe; Wang, Tongfei A; Stehbens, Samantha J; Younger, Susan; Barshow, Suzanne; Zhu, Sijun; Cooper, Michael K; Peacock, John; Ramaswamy, Vijay; Garzia, Livia; Wu, Xiaochong; Remke, Marc; Forester, Craig M; Kim, Charles C; Weiss, William A; James, C David; Shuman, Marc A; Bader, Gary D; Mueller, Sabine; Taylor, Michael D; Jan, Yuh Nung; Jan, Lily Yeh

    2015-09-01

    Over 20% of the drugs for treating human diseases target ion channels, but no cancer drug approved by the US Food and Drug Administration (FDA) is intended to target an ion channel. We found that the EAG2 (Ether-a-go-go 2) potassium channel has an evolutionarily conserved function for promoting brain tumor growth and metastasis, delineate downstream pathways, and uncover a mechanism for different potassium channels to functionally cooperate and regulate mitotic cell volume and tumor progression. EAG2 potassium channel was enriched at the trailing edge of migrating medulloblastoma (MB) cells to regulate local cell volume dynamics, thereby facilitating cell motility. We identified the FDA-approved antipsychotic drug thioridazine as an EAG2 channel blocker that reduces xenografted MB growth and metastasis, and present a case report of repurposing thioridazine for treating a human patient. Our findings illustrate the potential of targeting ion channels in cancer treatment. PMID:26258683

  16. LRR Conservation Mapping to Predict Functional Sites within Protein Leucine-Rich Repeat Domains

    PubMed Central

    Helft, Laura; Reddy, Vignyan; Chen, Xiyang; Koller, Teresa; Federici, Luca; Fernández-Recio, Juan; Gupta, Rishabh; Bent, Andrew

    2011-01-01

    Computational prediction of protein functional sites can be a critical first step for analysis of large or complex proteins. Contemporary methods often require several homologous sequences and/or a known protein structure, but these resources are not available for many proteins. Leucine-rich repeats (LRRs) are ligand interaction domains found in numerous proteins across all taxonomic kingdoms, including immune system receptors in plants and animals. We devised Repeat Conservation Mapping (RCM), a computational method that predicts functional sites of LRR domains. RCM utilizes two or more homologous sequences and a generic representation of the LRR structure to identify conserved or diversified patches of amino acids on the predicted surface of the LRR. RCM was validated using solved LRR+ligand structures from multiple taxa, identifying ligand interaction sites. RCM was then used for de novo dissection of two plant microbe-associated molecular pattern (MAMP) receptors, EF-TU RECEPTOR (EFR) and FLAGELLIN-SENSING 2 (FLS2). In vivo testing of Arabidopsis thaliana EFR and FLS2 receptors mutagenized at sites identified by RCM demonstrated previously unknown functional sites. The RCM predictions for EFR, FLS2 and a third plant LRR protein, PGIP, compared favorably to predictions from ODA (optimal docking area), Consurf, and PAML (positive selection) analyses, but RCM also made valid functional site predictions not available from these other bioinformatic approaches. RCM analyses can be conducted with any LRR-containing proteins at www.plantpath.wisc.edu/RCM, and the approach should be modifiable for use with other types of repeat protein domains. PMID:21789174

  17. The CRC orthologue from Pisum sativum shows conserved functions in carpel morphogenesis and vascular development

    PubMed Central

    Fourquin, Chloé; Primo, Amparo; Martínez-Fernández, Irene; Huet-Trujillo, Estefanía; Ferrándiz, Cristina

    2014-01-01

    Background and Aims CRABS CLAW (CRC) is a member of the YABBY family of transcription factors involved in carpel morphogenesis, floral determinacy and nectary specification in arabidopsis. CRC orthologues have been functionally characterized across angiosperms, revealing additional roles in leaf vascular development and carpel identity specification in Poaceae. These studies support an ancestral role of CRC orthologues in carpel development, while roles in vascular development and nectary specification appear to be derived. This study aimed to expand research on CRC functional conservation to the legume family in order to better understand the evolutionary history of CRC orthologues in angiosperms. Methods CRC orthologues from Pisum sativum and Medicago truncatula were identified. RNA in situ hybridization experiments determined the corresponding expression patterns throughout flower development. The phenotypic effects of reduced CRC activity were investigated in P. sativum using virus-induced gene silencing. Key Results CRC orthologues from P. sativum and M. truncatula showed similar expression patterns, mainly restricted to carpels and nectaries. However, these expression patterns differed from those of other core eudicots, most importantly in a lack of abaxial expression in the carpel and in atypical expression associated with the medial vein of the ovary. CRC downregulation in pea caused defects in carpel fusion and style/stigma development, both typically associated with CRC function in eudicots, but also affected vascular development in the carpel. Conclusions The data support the conserved roles of CRC orthologues in carpel fusion, style/stigma development and nectary development. In addition, an intriguing new aspect of CRC function in legumes was the unexpected role in vascular development, which could be shared by other species from widely diverged clades within the angiosperms, suggesting that this role could be ancestral rather than derived, as so far

  18. A conserved helicase processivity factor is needed for conjugation and replication of an integrative and conjugative element.

    PubMed

    Thomas, Jacob; Lee, Catherine A; Grossman, Alan D

    2013-01-01

    Integrative and conjugative elements (ICEs) are agents of horizontal gene transfer and have major roles in evolution and acquisition of new traits, including antibiotic resistances. ICEs are found integrated in a host chromosome and can excise and transfer to recipient bacteria via conjugation. Conjugation involves nicking of the ICE origin of transfer (oriT) by the ICE-encoded relaxase and transfer of the nicked single strand of ICE DNA. For ICEBs1 of Bacillus subtilis, nicking of oriT by the ICEBs1 relaxase NicK also initiates rolling circle replication. This autonomous replication of ICEBs1 is critical for stability of the excised element in growing cells. We found a conserved and previously uncharacterized ICE gene that is required for conjugation and replication of ICEBs1. Our results indicate that this gene, helP (formerly ydcP), encodes a helicase processivity factor that enables the host-encoded helicase PcrA to unwind the double-stranded ICEBs1 DNA. HelP was required for both conjugation and replication of ICEBs1, and HelP and NicK were the only ICEBs1 proteins needed for replication from ICEBs1 oriT. Using chromatin immunoprecipitation, we measured association of HelP, NicK, PcrA, and the host-encoded single-strand DNA binding protein Ssb with ICEBs1. We found that NicK was required for association of HelP and PcrA with ICEBs1 DNA. HelP was required for association of PcrA and Ssb with ICEBs1 regions distal, but not proximal, to oriT, indicating that PcrA needs HelP to progress beyond nicked oriT and unwind ICEBs1. In vitro, HelP directly stimulated the helicase activity of the PcrA homologue UvrD. Our findings demonstrate that HelP is a helicase processivity factor needed for efficient unwinding of ICEBs1 for conjugation and replication. Homologues of HelP and PcrA-type helicases are encoded on many known and putative ICEs. We propose that these factors are essential for ICE conjugation, replication, and genetic stability. PMID:23326247

  19. A Conserved Helicase Processivity Factor Is Needed for Conjugation and Replication of an Integrative and Conjugative Element

    PubMed Central

    Thomas, Jacob; Lee, Catherine A.; Grossman, Alan D.

    2013-01-01

    Integrative and conjugative elements (ICEs) are agents of horizontal gene transfer and have major roles in evolution and acquisition of new traits, including antibiotic resistances. ICEs are found integrated in a host chromosome and can excise and transfer to recipient bacteria via conjugation. Conjugation involves nicking of the ICE origin of transfer (oriT) by the ICE–encoded relaxase and transfer of the nicked single strand of ICE DNA. For ICEBs1 of Bacillus subtilis, nicking of oriT by the ICEBs1 relaxase NicK also initiates rolling circle replication. This autonomous replication of ICEBs1 is critical for stability of the excised element in growing cells. We found a conserved and previously uncharacterized ICE gene that is required for conjugation and replication of ICEBs1. Our results indicate that this gene, helP (formerly ydcP), encodes a helicase processivity factor that enables the host-encoded helicase PcrA to unwind the double-stranded ICEBs1 DNA. HelP was required for both conjugation and replication of ICEBs1, and HelP and NicK were the only ICEBs1 proteins needed for replication from ICEBs1 oriT. Using chromatin immunoprecipitation, we measured association of HelP, NicK, PcrA, and the host-encoded single-strand DNA binding protein Ssb with ICEBs1. We found that NicK was required for association of HelP and PcrA with ICEBs1 DNA. HelP was required for association of PcrA and Ssb with ICEBs1 regions distal, but not proximal, to oriT, indicating that PcrA needs HelP to progress beyond nicked oriT and unwind ICEBs1. In vitro, HelP directly stimulated the helicase activity of the PcrA homologue UvrD. Our findings demonstrate that HelP is a helicase processivity factor needed for efficient unwinding of ICEBs1 for conjugation and replication. Homologues of HelP and PcrA-type helicases are encoded on many known and putative ICEs. We propose that these factors are essential for ICE conjugation, replication, and genetic stability. PMID:23326247

  20. The functional conservation of proteins in evolutionary alleles and the dominant role of enhancers in evolution.

    PubMed Central

    Xue, L; Noll, M

    1996-01-01

    Drosophila paired- embryos can be rescued to viable adults by the evolutionary alleles prd-Gsb and prd-Pax3, which express the Drosophila Gooseberry and mouse Pax3 proteins under the control of the paired cis-regulatory region. As prd-Gsb uncovers a prd function involved in the proper abdominal segmentation of adults, evolutionary alleles, defined and constructed in this manner, may often be weak and thus serve to discover hitherto unknown functions of a gene. Our findings show that the Gooseberry and Pax3 proteins have conserved most or all functions of the related Drosophila Paired protein although their C-terminal halves appear unrelated in sequence but not in 3-D structure essential for function. It follows that the acquisition of new cis-regulatory regions rather than the divergence of the C-terminal coding regions has been the primary device for the functional diversification of the Drosophila genes paired and gooseberry and the mouse Pax3 gene. The operation of this mechanism in insects as well as vertebrates suggests a major role in evolution. Images PMID:8670876

  1. [Analysis of trace elements in limestone for archeological functions

    SciTech Connect

    Blanc, A.; Holmes, L.; Harbottle, G.

    1998-12-31

    Numerous quarries in the Lutetian limestone formations of the Paris Basin provided stone for the building and the decoration of monuments from antiquity to the present. To determine the origin of stone used for masonry and sculptures in these monuments, a team of geologists and archaeologists has investigated 300 quarries and collected 2,300 samples. Petrographic and paleontologic examination of thin sections allows geologists to distinguish Lutetian limestones from Jurassic and Cretaceous limestones. Geologists also seek to formulate hypotheses regarding the origin of Lutetian limestones used for building and sculpture in the Paris region. In the search for the sources of building and sculptural stone, the analytical methods of geologists are limited because often several quarries produce the same lithofacies. A new tool is now available, however, to attack questions of provenance raised by art historians. Because limestones from different sources have distinctive patterns of trace-element concentrations, compositional analysis by neutron activation allows one to compare building or sculptural stone from one monument with stone from quarries or other monuments. This analytical method subjects a powdered limestone sample to standard neutron activation analysis procedures at Brookhaven National Laboratory. With the help of computer programs, the compositional fingerprints of Lutetian limestones can be determined and stored in a database. The limestone database contains data for approximately 2,100 samples from monuments, sculptures and quarries. It is particularly rich in samples from the Paris Basin.

  2. Genome-Wide Gene Expression Profiling Reveals Conserved and Novel Molecular Functions of the Stigma in Rice1[W

    PubMed Central

    Li, Meina; Xu, Wenying; Yang, Wenqiang; Kong, Zhaosheng; Xue, Yongbiao

    2007-01-01

    In angiosperms, the stigma provides initial nutrients and guidance cues for pollen grain germination and tube growth. However, little is known about the genes that regulate these processes in rice (Oryza sativa). Here, we generate rice stigma-specific or -preferential gene expression profiles through comparing genome-wide expression patterns of hand-dissected, unpollinated stigma at anthesis with seven tissues, including seedling shoot, seedling root, mature anther, ovary at anthesis, seeds 5 d after pollination, 10-d-old embryo, 10-d-old endosperm, and suspension-cultured cells by using both 57 K Affymetrix rice whole-genome array and 10 K rice cDNA microarray. A high reproducibility of the microarray results was detected between the two different technology platforms. In total, we identified 548 genes to be expressed specifically or predominantly in the stigma papillar cells of rice. Real-time quantitative reverse transcription-polymerase chain reaction analysis of 34 selected genes all confirmed their stigma-specific expression. The expression of five selected genes was further validated by RNA in situ hybridization. Gene Ontology analysis shows that several auxin-signaling components, transcription, and stress-related genes are significantly overrepresented in the rice stigma gene set. Interestingly, most of them also share several cis-regulatory elements with known stress-responsive genes, supporting the notion of an overlap of genetic programs regulating pollination and stress/defense responses. We also found that genes involved in cell wall metabolism and cellular communication appear to be conserved in the stigma between rice and Arabidopsis (Arabidopsis thaliana). Our results indicate that the stigmas appear to have conserved and novel molecular functions between rice and Arabidopsis. PMID:17556504

  3. Mammalian non-CG methylations are conserved and cell-type specific and may have been involved in the evolution of transposon elements.

    PubMed

    Guo, Weilong; Zhang, Michael Q; Wu, Hong

    2016-01-01

    Although non-CG methylations are abundant in several mammalian cell types, their biological significance is sparsely characterized. We gathered 51 human and mouse DNA methylomes from brain neurons, embryonic stem cells and induced pluripotent stem cells, primordial germ cells and oocytes. We utilized an unbiased sub-motif prediction method and reported CW as the representative non-CG methylation context, which is distinct from CC methylation in terms of sequence context and genomic distribution. A two-dimensional comparison of non-CG methylations across cell types and species was performed. Unambiguous studies of sequence preferences and genomic region enrichment showed that CW methylation is cell-type specific and is also conserved between humans and mice. In brain neurons, it was found that active long interspersed nuclear element-1 (LINE-1) lacked CW methylations but not CG methylations. Coincidentally, both human Alu and mouse B1 elements preferred high CW methylations at specific loci during their respective evolutionary development. Last, the strand-specific distributions of CW methylations in introns and long interspersed nuclear elements are also cell-type specific and conserved. In summary, our results illustrate that CW methylations are highly conserved among species, are dynamically regulated in each cell type, and are potentially involved in the evolution of transposon elements. PMID:27573482

  4. Mammalian non-CG methylations are conserved and cell-type specific and may have been involved in the evolution of transposon elements

    PubMed Central

    Guo, Weilong; Zhang, Michael Q.; Wu, Hong

    2016-01-01

    Although non-CG methylations are abundant in several mammalian cell types, their biological significance is sparsely characterized. We gathered 51 human and mouse DNA methylomes from brain neurons, embryonic stem cells and induced pluripotent stem cells, primordial germ cells and oocytes. We utilized an unbiased sub-motif prediction method and reported CW as the representative non-CG methylation context, which is distinct from CC methylation in terms of sequence context and genomic distribution. A two-dimensional comparison of non-CG methylations across cell types and species was performed. Unambiguous studies of sequence preferences and genomic region enrichment showed that CW methylation is cell-type specific and is also conserved between humans and mice. In brain neurons, it was found that active long interspersed nuclear element-1 (LINE-1) lacked CW methylations but not CG methylations. Coincidentally, both human Alu and mouse B1 elements preferred high CW methylations at specific loci during their respective evolutionary development. Last, the strand-specific distributions of CW methylations in introns and long interspersed nuclear elements are also cell-type specific and conserved. In summary, our results illustrate that CW methylations are highly conserved among species, are dynamically regulated in each cell type, and are potentially involved in the evolution of transposon elements. PMID:27573482

  5. Identification of Plasmodium falciparum DNA Repair Protein Mre11 with an Evolutionarily Conserved Nuclease Function

    PubMed Central

    Badugu, Sugith Babu; Nabi, Shaik Abdul; Vaidyam, Pratap; Laskar, Shyamasree; Bhattacharyya, Sunanda; Bhattacharyya, Mrinal Kanti

    2015-01-01

    The eukaryotic Meiotic Recombination protein 11 (Mre11) plays pivotal roles in the DNA damage response (DDR). Specifically, Mre11 senses and signals DNA double strand breaks (DSB) and facilitates their repair through effector proteins belonging to either homologous recombination (HR) or non-homologous end joining (NHEJ) repair mechanisms. In the human malaria parasite Plasmodium falciparum, HR and alternative-NHEJ have been identified; however, little is known about the upstream factors involved in the DDR of this organism. In this report, we identify a putative ortholog of Mre11 in P. falciparum (PfalMre11) that shares 22% sequence similarity to human Mre11. Homology modeling reveals striking structural resemblance of the predicted PfalMre11 nuclease domain to the nuclease domain of Saccharomyces cerevisiae Mre11 (ScMre11). Complementation analyses reveal functional conservation of PfalMre11 nuclease activity as demonstrated by the ability of the PfalMre11 nuclease domain, in conjunction with the C-terminal domain of ScMre11, to functionally complement an mre11 deficient yeast strain. Functional complementation was virtually abrogated by an amino acid substitution in the PfalMre11 nuclease domain (D398N). PfalMre11 is abundant in the mitotically active trophozoite and schizont stages of P. falciparum and is up-regulated in response to DNA damage, suggesting a role in the DDR. PfalMre11 exhibits physical interaction with PfalRad50. In addition, yeast 2-hybrid studies show that PfalMre11 interacts with ScRad50 and ScXrs2, two important components of the well characterized Mre11-Rad50-Xrs2 complex which is involved in DDR signaling and repair in S. cerevisiae, further supporting a role for PfalMre11 in the DDR. Taken together, these findings provide evidence that PfalMre11 is an evolutionarily conserved component of the DDR in Plasmodium. PMID:25938776

  6. A Conserved Streptococcal Membrane Protein, LsrS, Exhibits a Receptor-Like Function for Lantibiotics

    PubMed Central

    Biswas, Saswati

    2014-01-01

    Streptococcus mutans strain GS-5 produces a two-peptide lantibiotic, Smb, which displays inhibitory activity against a broad spectrum of bacteria, including other streptococci. For inhibition, lantibiotics must recognize specific receptor molecules present on the sensitive bacterial cells. However, so far no such receptor proteins have been identified for any lantibiotics. In this study, using a powerful transposon mutagenesis approach, we have identified in Streptococcus pyogenes a gene that exhibits a receptor-like function for Smb. The protein encoded by that gene, which we named LsrS, is a membrane protein belonging to the CAAX protease family. We also found that nisin, a monopeptide lantibiotic, requires LsrS for its optimum inhibitory activity. However, we found that LsrS is not required for inhibition by haloduracin and galolacticin, both of which are two-peptide lantibiotics closely related to Smb. LsrS appears to be a well-conserved protein that is present in many streptococci, including S. mutans. Inactivation of SMU.662, an LsrS homolog, in S. mutans strains UA159 and V403 rendered the cells refractory to Smb-mediated killing. Furthermore, overexpression of LsrS in S. mutans created cells more susceptible to Smb. Although LsrS and its homolog contain the CAAX protease domain, we demonstrate that inactivation of the putative active sites on the LsrS protein has no effect on its receptor-like function. This is the first report describing a highly conserved membrane protein that displays a receptor-like function for lantibiotics. PMID:24509319

  7. A conserved streptococcal membrane protein, LsrS, exhibits a receptor-like function for lantibiotics.

    PubMed

    Biswas, Saswati; Biswas, Indranil

    2014-04-01

    Streptococcus mutans strain GS-5 produces a two-peptide lantibiotic, Smb, which displays inhibitory activity against a broad spectrum of bacteria, including other streptococci. For inhibition, lantibiotics must recognize specific receptor molecules present on the sensitive bacterial cells. However, so far no such receptor proteins have been identified for any lantibiotics. In this study, using a powerful transposon mutagenesis approach, we have identified in Streptococcus pyogenes a gene that exhibits a receptor-like function for Smb. The protein encoded by that gene, which we named LsrS, is a membrane protein belonging to the CAAX protease family. We also found that nisin, a monopeptide lantibiotic, requires LsrS for its optimum inhibitory activity. However, we found that LsrS is not required for inhibition by haloduracin and galolacticin, both of which are two-peptide lantibiotics closely related to Smb. LsrS appears to be a well-conserved protein that is present in many streptococci, including S. mutans. Inactivation of SMU.662, an LsrS homolog, in S. mutans strains UA159 and V403 rendered the cells refractory to Smb-mediated killing. Furthermore, overexpression of LsrS in S. mutans created cells more susceptible to Smb. Although LsrS and its homolog contain the CAAX protease domain, we demonstrate that inactivation of the putative active sites on the LsrS protein has no effect on its receptor-like function. This is the first report describing a highly conserved membrane protein that displays a receptor-like function for lantibiotics. PMID:24509319

  8. Characterization of "cis"-regulatory elements ("c"RE) associated with mammary gland function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Bos taurus genome assembly has propelled dairy science into a new era; still, most of the information encoded in the genome has not yet been decoded. The human Encyclopedia of DNA Elements (ENCODE) project has spearheaded the identification and annotation of functional genomic elements in the hu...

  9. Characterization of a novel gene adjacent to PAX6, revealing synteny conservation with functional significance.

    PubMed

    Kleinjan, Dirk A; Seawright, Anne; Elgar, Greg; van Heyningen, Veronica

    2002-02-01

    The human eye anomaly aniridia is normally caused by intragenic mutations of PAX6. Several cases of aniridia are, however, associated with chromosomal rearrangements that leave the PAX6 gene intact. We have identified and characterized a novel gene, PAXNEB (C11orf19), downstream (telomeric) of PAX6. Sequence analysis, including interspecies comparisons, show this gene to consist of 10 exons, with an unusually large final intron spanning 134 kb in human and 18 kb in Fugu. This intron is disrupted by each chromosomal rearrangement. The 2-kb PAXNEB transcript, encoding a 424-amino acid protein, is expressed in all cell lines tested. The homologous mouse cDNA is broadly expressed in mouse embryos. PAXNEB is highly conserved from mammals to fish, with some regions of the protein showing conservation to invertebrates, yeast, and plants. The possible role of PAXNEB in aniridia was assessed. Using a transgenic mouse model, we show that the aniridia phenotype of the chromosomal rearrangement cases is not due to the heterozygous loss of PAXNEB function. PMID:11889558

  10. Comparative genomics reveals a functional thyroid-specific element in the far upstream region of the PAX8 gene

    PubMed Central

    2010-01-01

    Background The molecular mechanisms leading to a fully differentiated thyrocite are still object of intense study even if it is well known that thyroglobulin, thyroperoxidase, NIS and TSHr are the marker genes of thyroid differentiation. It is also well known that Pax8, TTF-1, Foxe1 and Hhex are the thyroid-enriched transcription factors responsible for the expression of the above genes, thus are responsible for the differentiated thyroid phenotype. In particular, the role of Pax8 in the fully developed thyroid gland was studied in depth and it was established that it plays a key role in thyroid development and differentiation. However, to date the bases for the thyroid-enriched expression of this transcription factor have not been unraveled yet. Here, we report the identification and characterization of a functional thyroid-specific enhancer element located far upstream of the Pax8 gene. Results We hypothesized that regulatory cis-acting elements are conserved among mammalian genes. Comparison of a genomic region extending for about 100 kb at the 5'-flanking region of the mouse and human Pax8 gene revealed several conserved regions that were tested for enhancer activity in thyroid and non-thyroid cells. Using this approach we identified one putative thyroid-specific regulatory element located 84.6 kb upstream of the Pax8 transcription start site. The in silico data were verified by promoter-reporter assays in thyroid and non-thyroid cells. Interestingly, the identified far upstream element manifested a very high transcriptional activity in the thyroid cell line PC Cl3, but showed no activity in HeLa cells. In addition, the data here reported indicate that the thyroid-enriched transcription factor TTF-1 is able to bind in vitro and in vivo the Pax8 far upstream element, and is capable to activate transcription from it. Conclusions Results of this study reveal the presence of a thyroid-specific regulatory element in the 5' upstream region of the Pax8 gene. The

  11. Structural and Functional Analyses of a Conserved Hydrophobic Pocket of Flavivirus Methyltransferase*

    PubMed Central

    Dong, Hongping; Liu, Lihui; Zou, Gang; Zhao, Yiwei; Li, Zhong; Lim, Siew Pheng; Shi, Pei-Yong; Li, Hongmin

    2010-01-01

    The flavivirus methyltransferase (MTase) sequentially methylates the N7 and 2′-O positions of the viral RNA cap (GpppA-RNA → m7GpppA-RNA → m7GpppAm-RNA), using S-adenosyl-l-methionine (AdoMet) as a methyl donor. We report here that sinefungin (SIN), an AdoMet analog, inhibits several flaviviruses through suppression of viral MTase. The crystal structure of West Nile virus MTase in complex with SIN inhibitor at 2.0-Å resolution revealed a flavivirus-conserved hydrophobic pocket located next to the AdoMet-binding site. The pocket is functionally critical in the viral replication and cap methylations. In addition, the N7 methylation efficiency was found to correlate with the viral replication ability. Thus, SIN analogs with modifications that interact with the hydrophobic pocket are potential specific inhibitors of flavivirus MTase. PMID:20685660

  12. Structural and Functional Analyses of a Conserved Hydrophobic Pocket of Flavivirus Methyltransferase

    SciTech Connect

    H Dong; L Liu; G Zou; Y Zhao; Z Li; S Lim; P Shi; H Li

    2011-12-31

    The flavivirus methyltransferase (MTase) sequentially methylates the N7 and 2'-O positions of the viral RNA cap (GpppA-RNA {yields} m(7)GpppA-RNA {yields} m(7)GpppAm-RNA), using S-adenosyl-l-methionine (AdoMet) as a methyl donor. We report here that sinefungin (SIN), an AdoMet analog, inhibits several flaviviruses through suppression of viral MTase. The crystal structure of West Nile virus MTase in complex with SIN inhibitor at 2.0-{angstrom} resolution revealed a flavivirus-conserved hydrophobic pocket located next to the AdoMet-binding site. The pocket is functionally critical in the viral replication and cap methylations. In addition, the N7 methylation efficiency was found to correlate with the viral replication ability. Thus, SIN analogs with modifications that interact with the hydrophobic pocket are potential specific inhibitors of flavivirus MTase.

  13. PCNA-binding proteins in the archaea: novel functionality beyond the conserved core.

    PubMed

    MacNeill, Stuart A

    2016-08-01

    Sliding clamps play an essential role in coordinating protein activity in DNA metabolism in all three domains of life. In eukaryotes and archaea, the sliding clamp is PCNA (proliferating cell nuclear antigen). Across the diversity of the archaea PCNA interacts with a highly conserved set of proteins with key roles in DNA replication and repair, including DNA polymerases B and D, replication factor C, the Fen1 nuclease and RNAseH2, but this core set of factors is likely to represent a fraction of the PCNA interactome only. Here, I review three recently characterised non-core archaeal PCNA-binding proteins NusS, NreA/NreB and TIP, highlighting what is known of their interactions with PCNA and their functions in vivo and in vitro. Gaining a detailed understanding of the non-core PCNA interactome will provide significant insights into key aspects of chromosome biology in divergent archaeal lineages. PMID:26886233

  14. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  15. Calculation of Thermodynamic Functions of Fluorammonium Complexes of 4 f Elements

    NASA Astrophysics Data System (ADS)

    Malinovskaya, T. D.; Nefedov, R. A.; Sachkov, V. I.

    2013-12-01

    Theoretical estimates are made of the thermodynamic functions of fluorammonium complexes of 4 f elements. Using techniques of statistical thermodynamics, we have obtained the temperature dependences of the basic thermodynamic state functions ( C p , ∆ H, ∆ S, and ∆ G). The decomposition temperatures of the investigated complex fluorides of 4 f elements have been estimated on the basis of an analysis of the obtained dependences.

  16. An actin cytoskeleton with evolutionarily conserved functions in the absence of canonical actin-binding proteins

    PubMed Central

    Paredez, Alexander R.; Assaf, Zoe June; Sept, David; Timofejeva, Ljudmilla; Dawson, Scott C.; Wang, Chung-Ju Rachel; Cande, W. Z.

    2011-01-01

    Giardia intestinalis, a human intestinal parasite and member of what is perhaps the earliest-diverging eukaryotic lineage, contains the most divergent eukaryotic actin identified to date and is the first eukaryote known to lack all canonical actin-binding proteins (ABPs). We sought to investigate the properties and functions of the actin cytoskeleton in Giardia to determine whether Giardia actin (giActin) has reduced or conserved roles in core cellular processes. In vitro polymerization of giActin produced filaments, indicating that this divergent actin is a true filament-forming actin. We generated an anti-giActin antibody to localize giActin throughout the cell cycle. GiActin localized to the cortex, nuclei, internal axonemes, and formed C-shaped filaments along the anterior of the cell and a flagella-bundling helix. These structures were regulated with the cell cycle and in encysting cells giActin was recruited to the Golgi-like cyst wall processing vesicles. Knockdown of giActin demonstrated that giActin functions in cell morphogenesis, membrane trafficking, and cytokinesis. Additionally, Giardia contains a single G protein, giRac, which affects the Giardia actin cytoskeleton independently of known target ABPs. These results imply that there exist ancestral and perhaps conserved roles for actin in core cellular processes that are independent of canonical ABPs. Of medical significance, the divergent giActin cytoskeleton is essential and commonly used actin-disrupting drugs do not depolymerize giActin structures. Therefore, the giActin cytoskeleton is a promising drug target for treating giardiasis, as we predict drugs that interfere with the Giardia actin cytoskeleton will not affect the mammalian host. PMID:21444821

  17. Elements of functional genital asymmetry in the cow.

    PubMed

    Trigal, B; Díez, C; Muñoz, M; Caamaño, J N; Goyache, F; Correia-Alvarez, E; Corrales, F J; Mora, M I; Carrocera, S; Martin, D; Gómez, E

    2014-01-01

    Asymmetry in the cow affects ovarian function and pregnancy. In this work we studied ovarian and uterine asymmetry. Synchronised animals, in which in vitro-produced embryos (n=30-60) had been transferred on Day 5 to the uterine horn ipsilateral to the corpus luteum (CL), were flushed on Day 8. Ovulatory follicle diameter, oestrus response and total protein flushed did not differ between sides. However, a corpus luteum in the right ovary led to plasma progesterone concentrations that were higher than when it was present in the left ovary. Fewer embryos were recovered from the left than the right horn. Among 60 uterine proteins identified by difference gel electrophoresis, relative abundance of nine (acyl-CoA dehydrogenase, very long chain; twinfilin, actin-binding protein, homologue 1; enolase 1; pyruvate kinase isozymes M1/M2 (rabbit); complement factor B Bb fragment ; albumin; fibrinogen gamma-B chain; and ezrin differed (P<0.05) between horns. Glucose concentration was higher, and fructose concentration lower, in the left horn. In a subsequent field trial, pregnancy rates after embryo transfer did not differ between horns (51.0±3.6, right vs 53.2±4.7, left). However, Day 7 blood progesterone concentrations differed (P=0.018) between pregnant and open animals in the left (15.9±1.7 vs 8.3±1.2) but not in the right horn (12.4±1.3 vs 12.4±1.2). Progesterone effects were independent of CL quality (P=0.55). Bilateral genital tract asymmetry in the cow affects progesterone, proteins and hexoses without altering pregnancy rates. PMID:24709319

  18. A Mammalian Conserved Element Derived from SINE Displays Enhancer Properties Recapitulating Satb2 Expression in Early-Born Callosal Projection Neurons

    PubMed Central

    Nakanishi, Akiko; Sasaki, Takeshi; Yan, Kuo; Tarabykin, Victor; Vigier, Lisa; Sumiyama, Kenta; Hirakawa, Mika; Nishihara, Hidenori; Pierani, Alessandra; Okada, Norihiro

    2011-01-01

    Short interspersed repetitive elements (SINEs) are highly repeated sequences that account for a significant proportion of many eukaryotic genomes and are usually considered “junk DNA”. However, we previously discovered that many AmnSINE1 loci are evolutionarily conserved across mammalian genomes, suggesting that they may have acquired significant functions involved in controlling mammalian-specific traits. Notably, we identified the AS021 SINE locus, located 390 kbp upstream of Satb2. Using transgenic mice, we showed that this SINE displays specific enhancer activity in the developing cerebral cortex. The transcription factor Satb2 is expressed by cortical neurons extending axons through the corpus callosum and is a determinant of callosal versus subcortical projection. Mouse mutants reveal a crucial function for Sabt2 in corpus callosum formation. In this study, we compared the enhancer activity of the AS021 locus with Satb2 expression during telencephalic development in the mouse. First, we showed that the AS021 enhancer is specifically activated in early-born Satb2+ neurons. Second, we demonstrated that the activity of the AS021 enhancer recapitulates the expression of Satb2 at later embryonic and postnatal stages in deep-layer but not superficial-layer neurons, suggesting the possibility that the expression of Satb2 in these two subpopulations of cortical neurons is under genetically distinct transcriptional control. Third, we showed that the AS021 enhancer is activated in neurons projecting through the corpus callosum, as described for Satb2+ neurons. Notably, AS021 drives specific expression in axons crossing through the ventral (TAG1−/NPY+) portion of the corpus callosum, confirming that it is active in a subpopulation of callosal neurons. These data suggest that exaptation of the AS021 SINE locus might be involved in enhancement of Satb2 expression, leading to the establishment of interhemispheric communication via the corpus callosum, a eutherian

  19. Using Caenorhabditis elegans to Uncover Conserved Functions of Omega-3 and Omega-6 Fatty Acids

    PubMed Central

    Watts, Jennifer L.

    2016-01-01

    The nematode Caenorhabditis elegans is a powerful model organism to study functions of polyunsaturated fatty acids. The ability to alter fatty acid composition with genetic manipulation and dietary supplementation permits the dissection of the roles of omega-3 and omega-6 fatty acids in many biological process including reproduction, aging and neurobiology. Studies in C. elegans to date have mostly identified overlapping functions of 20-carbon omega-6 and omega-3 fatty acids in reproduction and in neurons, however, specific roles for either omega-3 or omega-6 fatty acids are beginning to emerge. Recent findings with importance to human health include the identification of a conserved Cox-independent prostaglandin synthesis pathway, critical functions for cytochrome P450 derivatives of polyunsaturated fatty acids, the requirements for omega-6 and omega-3 fatty acids in sensory neurons, and the importance of fatty acid desaturation for long lifespan. Furthermore, the ability of C. elegans to interconvert omega-6 to omega-3 fatty acids using the FAT-1 omega-3 desaturase has been exploited in mammalian studies and biotechnology approaches to generate mammals capable of exogenous generation of omega-3 fatty acids. PMID:26848697

  20. Rare earth elements (REEs) in the tropical South Atlantic and quantitative deconvolution of their non-conservative behavior

    NASA Astrophysics Data System (ADS)

    Zheng, Xin-Yuan; Plancherel, Yves; Saito, Mak A.; Scott, Peter M.; Henderson, Gideon M.

    2016-03-01

    This study presents new concentration measurements of dissolved rare earth elements (dREEs) along a full-depth east-west section across the tropical South Atlantic (∼12°S), and uses these data to investigate the oceanic cycling of the REEs. Enrichment of dREEs, associated with the redox cycling of Fe-Mn oxides, is observed in the oxygen minimum zone (OMZ) off the African shelf. For deeper-waters, a multi-parameter mixing model was developed to deconvolve the relative importance of physical transport (i.e., water mass mixing) from biogeochemical controls on the dREE distribution in the deep Atlantic. This approach enables chemical processes involved in REE cycling, not apparent from the measurements alone, to be distinguished and quantified. Results show that the measured dREE concentrations below ∼1000 m are dominantly controlled (>75%) by preformed REE concentrations resulting from water mass mixing. This result indicates that the linear correlation between dREEs and dissolved Si observed in Atlantic deep waters results from the dominantly conservative behavior of these tracers, rather than from similar chemical processes influencing both dREEs and Si. Minor addition of dREEs (∼10% of dNd and ∼5% of dYb) is observed in the deep (>∼4000 m) Brazil Basin, resulting from either remineralization of particles in-situ or along the flow path. Greater addition of dREEs (up to 25% for dNd and 20% for dYb) is found at ∼1500 m and below ∼4000 m in the Angola Basin near the African continental margin. Cerium anomalies suggest that different sources are responsible for these dREE addition plumes. The 1500 m excess is most likely attributed to dREE release from Fe oxides, whereas the 4000 m excess may be due to remineralization of calcite. Higher particulate fluxes and a more sluggish ocean circulation in the Angola Basin may explain why the dREE excesses in this basin are significantly higher than that observed in the Brazil Basin. Hydrothermal venting over the

  1. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

    PubMed

    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R

    1995-11-01

    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  2. The roles of conserved and nonconserved cysteinyl residues in the oligomerization and function of mammalian prestin.

    PubMed

    Currall, Benjamin; Rossino, Danielle; Jensen-Smith, Heather; Hallworth, Richard

    2011-11-01

    The creation of several prestin knockout and knockin mouse lines has demonstrated the importance of the intrinsic outer hair cell membrane protein prestin to mammalian hearing. However, the structure of prestin remains largely unknown, with even its major features in dispute. Several studies have suggested that prestin forms homo-oligomers that may be stabilized by disulfide bonds. Our phylogenetic analysis of prestin sequences across chordate classes suggested that the cysteinyl residues could be divided into three groups, depending on the extent of their conservation between prestin orthologs and paralogs or homologs. An alanine scan functional analysis was performed of all nine cysteinyl positions in mammalian prestin. Prestin function was assayed by measurement of prestin-associated nonlinear capacitance. Of the nine cysteine-alanine substitution mutations, all were properly membrane targeted and all demonstrated nonlinear capacitance. Four mutations (C124A, C192A, C260A, and C415A), all in nonconserved cysteinyl residues, significantly differed in their nonlinear capacitance properties compared with wild-type prestin. In the two most severely disrupted mutations, substitution of the polar residue seryl for cysteinyl restored normal function in one (C415S) but not the other (C124S). We assessed the relationship of prestin oligomerization to cysteine position using fluorescence resonance energy transfer. With one exception, cysteine-alanine substitutions did not significantly alter prestin-prestin interactions. The exception was C415A, one of the two nonconserved cysteinyl residues whose mutation to alanine caused the most disruption in function. We suggest that no disulfide bond is essential for prestin function. However, C415 likely participates by hydrogen bonding in both nonlinear capacitance and oligomerization. PMID:21813750

  3. On trigonometric basis functions for C1 curved beam finite elements

    NASA Astrophysics Data System (ADS)

    Guimaraes, J. E. F.; Heppler, G. R.

    1992-10-01

    The formulation of a finite element model for a thin curved beam which is described by the Winkler beam model is presented. A review and discussion of the literature that pertains to this type of element is included with special attention being paid to the need to be able to recover incremental rigid body motions. Three different C1 trigonometric trial functions that allow the recovery of incremental rigid body motions are investigated. The attributes and deficiencies of the various elements are examined and discussed via several problems which have been designed to evaluate the performance of the element. The 4U4W element is shown to be the best choice of those elements considered here.

  4. An improved method for extracting matrix elements from lattice three-point functions

    SciTech Connect

    C. Aubin, K. Orginos

    2011-12-01

    The extraction of matrix elements from baryon three-point functions is complicated by the fact that the signal-to-noise drops rapidly as a function of time. Using a previously discussed method to improve the signal-to-noise for lattice two-point functions, we use this technique to do so for lattice three-point functions, using electromagnetic form factors for the nucleon and Delta as an example.

  5. spalt encodes an evolutionarily conserved zinc finger protein of novel structure which provides homeotic gene function in the head and tail region of the Drosophila embryo.

    PubMed Central

    Kühnlein, R P; Frommer, G; Friedrich, M; Gonzalez-Gaitan, M; Weber, A; Wagner-Bernholz, J F; Gehring, W J; Jäckle, H; Schuh, R

    1994-01-01

    The region specific homeotic gene spalt (sal) of Drosophila melanogaster promotes the specification of terminal pattern elements as opposed to segments in the trunk. Our results show that the previously reported sal transcription unit was misidentified. Based on P-element mediated germ line transformation and DNA sequence analysis of sal mutant alleles, we identified the transcription unit that carries sal function. sal is located close to the misidentified transcription unit, and it is expressed in similar temporal and spatial patterns during embryogenesis. The sal gene encodes a zinc finger protein of novel structure composed of three widely spaced 'double zinc finger' motifs of internally conserved sequences and a single zinc finger motif of different sequence. Antibodies produced against the sal protein show that sal is first expressed at the blastoderm stage and later in restricted areas of the embryonic nervous system as well as in the developing trachea. The antibodies detect sal homologous proteins in corresponding spatial and temporal patterns in the embryos of related insect species. Sequence analysis of the sal gene of Drosophila virilis, a species which is phylogenetically separated by approximately 60 million years, suggests that the sal function is conserved during evolution, consistent with its proposed role in head formation during arthropod evolution. Images PMID:7905822

  6. Comparison of Percutaneous Mitral Valve Repair Versus Conservative Treatment in Severe Functional Mitral Regurgitation.

    PubMed

    Giannini, Cristina; Fiorelli, Francesca; De Carlo, Marco; Guarracino, Fabio; Faggioni, Michela; Giordano, Paolo; Spontoni, Paolo; Pieroni, Andrea; Petronio, Anna Sonia

    2016-01-15

    Percutaneous mitral valve repair (PMVR) using the MitraClip System is feasible and entails clinical improvement even in patients with high surgical risk and severe functional mitral regurgitation (MR). The aim of this study was to assess survival rates and clinical outcome of patients with severe, functional MR treated with optimal medical therapy (OMT) compared with those who received MitraClip device. Sixty patients treated with OMT were compared with a propensity-matched cohort of 60 patients who underwent PMVR. Baseline demographics and echocardiographic variables were similar between the 2 groups. The mean age of patients was 75 years, and 67% were men. The median logistic EuroSCORE and EuroSCORE II were 17% and 6%, respectively, because of the presence of several co-morbidities. The mechanism of MR was functional in all cases with an ischemic etiology in 52% of patients. Median left ventricle ejection fraction was 34%. All the patients were symptomatic for dyspnea with 63% and 12% in the New York Heart Association class III and IV, respectively. In PMVR group, the procedure was associated with safety and very low incidence of procedural complications with no occurrence of procedural and inhospital mortality. After a median follow-up of 515 days (248 to 828 days), patients treated with PMVR demonstrated overall survival, survival freedom from cardiac death and survival free of readmission due to cardiac disease curves higher than patients treated conservatively (log-rank test p = 0.007, p = 0.002, and p = 0.04, respectively). In conclusion, PMVR offers a valid option for selected patients with high surgical risk and severe, functional MR and entails better survival outcomes compared with OMT. PMID:26651454

  7. Distribution, structure and function of Nordic eelgrass (Zostera marina) ecosystems: implications for coastal management and conservation

    PubMed Central

    Boström, Christoffer; Baden, Susanne; Bockelmann, Anna-Christina; Dromph, Karsten; Fredriksen, Stein; Gustafsson, Camilla; Krause-Jensen, Dorte; Möller, Tiia; Nielsen, Søren Laurentius; Olesen, Birgit; Olsen, Jeanine; Pihl, Leif; Rinde, Eli

    2014-01-01

    This paper focuses on the marine foundation eelgrass species, Zostera marina, along a gradient from the northern Baltic Sea to the north-east Atlantic. This vast region supports a minimum of 1480 km2 eelgrass (maximum >2100 km2), which corresponds to more than four times the previously quantified area of eelgrass in Western Europe.Eelgrass meadows in the low salinity Baltic Sea support the highest diversity (4–6 spp.) of angiosperms overall, but eelgrass productivity is low (<2 g dw m-2 d-1) and meadows are isolated and genetically impoverished. Higher salinity areas support monospecific meadows, with higher productivity (3–10 g dw m-2 d-1) and greater genetic connectivity. The salinity gradient further imposes functional differences in biodiversity and food webs, in particular a decline in number, but increase in biomass of mesograzers in the Baltic.Significant declines in eelgrass depth limits and areal cover are documented, particularly in regions experiencing high human pressure. The failure of eelgrass to re-establish itself in affected areas, despite nutrient reductions and improved water quality, signals complex recovery trajectories and calls for much greater conservation effort to protect existing meadows.The knowledge base for Nordic eelgrass meadows is broad and sufficient to establish monitoring objectives across nine national borders. Nevertheless, ensuring awareness of their vulnerability remains challenging. Given the areal extent of Nordic eelgrass systems and the ecosystem services they provide, it is crucial to further develop incentives for protecting them. © 2014 The Authors. Aquatic Conservation: Marine and Freshwater Ecosystems published by John Wiley & Sons, Ltd. PMID:26167100

  8. A Functionally Conserved Gene Regulatory Network Module Governing Olfactory Neuron Diversity.

    PubMed

    Li, Qingyun; Barish, Scott; Okuwa, Sumie; Maciejewski, Abigail; Brandt, Alicia T; Reinhold, Dominik; Jones, Corbin D; Volkan, Pelin Cayirlioglu

    2016-01-01

    Sensory neuron diversity is required for organisms to decipher complex environmental cues. In Drosophila, the olfactory environment is detected by 50 different olfactory receptor neuron (ORN) classes that are clustered in combinations within distinct sensilla subtypes. Each sensilla subtype houses stereotypically clustered 1-4 ORN identities that arise through asymmetric divisions from a single multipotent sensory organ precursor (SOP). How each class of SOPs acquires a unique differentiation potential that accounts for ORN diversity is unknown. Previously, we reported a critical component of SOP diversification program, Rotund (Rn), increases ORN diversity by generating novel developmental trajectories from existing precursors within each independent sensilla type lineages. Here, we show that Rn, along with BarH1/H2 (Bar), Bric-à-brac (Bab), Apterous (Ap) and Dachshund (Dac), constitutes a transcription factor (TF) network that patterns the developing olfactory tissue. This network was previously shown to pattern the segmentation of the leg, which suggests that this network is functionally conserved. In antennal imaginal discs, precursors with diverse ORN differentiation potentials are selected from concentric rings defined by unique combinations of these TFs along the proximodistal axis of the developing antennal disc. The combinatorial code that demarcates each precursor field is set up by cross-regulatory interactions among different factors within the network. Modifications of this network lead to predictable changes in the diversity of sensilla subtypes and ORN pools. In light of our data, we propose a molecular map that defines each unique SOP fate. Our results highlight the importance of the early prepatterning gene regulatory network as a modulator of SOP and terminally differentiated ORN diversity. Finally, our model illustrates how conserved developmental strategies are used to generate neuronal diversity. PMID:26765103

  9. A Functionally Conserved Gene Regulatory Network Module Governing Olfactory Neuron Diversity

    PubMed Central

    Okuwa, Sumie; Maciejewski, Abigail; Brandt, Alicia T.; Reinhold, Dominik; Jones, Corbin D.; Volkan, Pelin Cayirlioglu

    2016-01-01

    Sensory neuron diversity is required for organisms to decipher complex environmental cues. In Drosophila, the olfactory environment is detected by 50 different olfactory receptor neuron (ORN) classes that are clustered in combinations within distinct sensilla subtypes. Each sensilla subtype houses stereotypically clustered 1–4 ORN identities that arise through asymmetric divisions from a single multipotent sensory organ precursor (SOP). How each class of SOPs acquires a unique differentiation potential that accounts for ORN diversity is unknown. Previously, we reported a critical component of SOP diversification program, Rotund (Rn), increases ORN diversity by generating novel developmental trajectories from existing precursors within each independent sensilla type lineages. Here, we show that Rn, along with BarH1/H2 (Bar), Bric-à-brac (Bab), Apterous (Ap) and Dachshund (Dac), constitutes a transcription factor (TF) network that patterns the developing olfactory tissue. This network was previously shown to pattern the segmentation of the leg, which suggests that this network is functionally conserved. In antennal imaginal discs, precursors with diverse ORN differentiation potentials are selected from concentric rings defined by unique combinations of these TFs along the proximodistal axis of the developing antennal disc. The combinatorial code that demarcates each precursor field is set up by cross-regulatory interactions among different factors within the network. Modifications of this network lead to predictable changes in the diversity of sensilla subtypes and ORN pools. In light of our data, we propose a molecular map that defines each unique SOP fate. Our results highlight the importance of the early prepatterning gene regulatory network as a modulator of SOP and terminally differentiated ORN diversity. Finally, our model illustrates how conserved developmental strategies are used to generate neuronal diversity. PMID:26765103

  10. Identification and function of an evolutionarily conserved signaling intermediate in Toll pathways (ECSIT) from Crassostrea hongkongensis.

    PubMed

    Qu, Fufa; Xiang, Zhiming; Wang, Fuxuan; Zhang, Yang; Li, Jun; Zhang, Yuehuan; Xiao, Shu; Yu, Ziniu

    2015-11-01

    Evolutionarily conserved signaling intermediate in Toll pathways (ECSIT) is a multifunctional adaptor protein that plays a key role in the regulation of the oxidative phosphorylation (OXPHOS) system, bone morphogenetic protein (BMP) pathway and Toll-like receptor (TLR) signaling pathway in mammals. However, the function of ECSIT homologs in mollusks, the second most diverse group of animals, is not well understood. In this study, we identified an ECSIT homolog in the Hong Kong oyster Crassostrea hongkongensis (ChECSIT) and investigated its biological functions. The full-length cDNA of ChECSIT is 1734 bp and includes an open reading frame (ORF) of 1074 bp that encodes a polypeptide of 451 amino acids. The predicted ChECSIT protein shares similar structural characteristics with other known ECSIT family proteins. Quantitative real-time PCR analysis revealed that ChECSIT mRNA is broadly expressed in all of the examined tissues and at different stages of embryonic development; its transcript level could be significantly up-regulated by challenge with microorganisms (Vibrio alginolyticus, Staphylococcus haemolyticus and Saccharomyces cerevisiae). In addition, ChECSIT was found to be located primarily in the cytoplasm, and its overexpression stimulated the transcriptional activity of an NF-κB reporter gene in HEK293T cells. These findings suggest that ChECSIT might be involved in embryogenesis processes and immune responses in C. hongkongensis. PMID:26204814

  11. Evolutionarily conserved sites in yeast tropomyosin function in cell polarity, transport and contractile ring formation

    PubMed Central

    Cranz-Mileva, Susanne; MacTaggart, Brittany; Russell, Jacquelyn; Hitchcock-DeGregori, Sarah E.

    2015-01-01

    ABSTRACT Tropomyosin is a coiled-coil protein that binds and regulates actin filaments. The tropomyosin gene in Schizosaccharomyces pombe, cdc8, is required for formation of actin cables, contractile rings, and polar localization of actin patches. The roles of conserved residues were investigated in gene replacement mutants. The work validates an evolution-based approach to identify tropomyosin functions in living cells and sites of potential interactions with other proteins. A cdc8 mutant with near-normal actin affinity affects patch polarization and vacuole fusion, possibly by affecting Myo52p, a class V myosin, function. The presence of labile residual cell attachments suggests a delay in completion of cell division and redistribution of cell patches following cytokinesis. Another mutant with a mild phenotype is synthetic negative with GFP-fimbrin, inferring involvement of the mutated tropomyosin sites in interaction between the two proteins. Proteins that assemble in the contractile ring region before actin do so in a mutant cdc8 strain that cannot assemble condensed actin rings, yet some cells can divide. Of general significance, LifeAct-GFP negatively affects the actin cytoskeleton, indicating caution in its use as a biomarker for actin filaments. PMID:26187949

  12. N-dimensional switch function for energy conservation in multiprocess reaction dynamics.

    PubMed

    Mogo, César; Brandão, João

    2016-06-15

    The MReaDy program was designed for studying Multiprocess Reactive Dynamic systems, that is, complex chemical systems involving different and concurrent reactions. It builds a global potential energy surface integrating a variety of potential energy surfaces, each one of them representing an elementary reaction expected to play a role in the chemical process. For each elementary reaction, energy continuity problems may happen in the transition between potential energy surfaces due to differences in the functional form for each of the fragments, especially if built by different authors. A N-dimensional switch function is introduced in MReaDy in order to overcome such a problem. As an example, results of a collision trajectory calculation for H2  + OH → H3 O are presented, showing smooth transition in the potential energy, leading to conservation in the total energy. Calculations for a hydrogen combustion system from 1000 K up to 4000 K shows a variation of 0.012% when compared to the total energy of the system. © 2016 Wiley Periodicals, Inc. PMID:26992438

  13. Ancient origin, functional conservation and fast evolution of DNA-dependent RNA polymerase III

    PubMed Central

    Proshkina, Galina M.; Shematorova, Elena K.; Proshkin, Sergey A.; Zaros, Cécile; Thuriaux, Pierre; Shpakovski, George V.

    2006-01-01

    RNA polymerase III contains seventeen subunits in yeasts (Saccharomyces cerevisiae and Schizosaccharomyces pombe) and in human cells. Twelve of them are akin to the core RNA polymerase I or II. The five other are RNA polymerase III-specific and form the functionally distinct groups Rpc31-Rpc34-Rpc82 and Rpc37-Rpc53. Currently sequenced eukaryotic genomes revealed significant homology to these seventeen subunits in Fungi, Animals, Plants and Amoebozoans. Except for subunit Rpc31, this also extended to the much more distantly related genomes of Alveolates and Excavates, indicating that the complex subunit organization of RNA polymerase III emerged at a very early stage of eukaryotic evolution. The Sch.pombe subunits were expressed in S.cerevisiae null mutants and tested for growth. Ten core subunits showed heterospecific complementation, but the two largest catalytic subunits (Rpc1 and Rpc2) and all five RNA polymerase III-specific subunits (Rpc82, Rpc53, Rpc37, Rpc34 and Rpc31) were non-functional. Three highly conserved RNA polymerase III-specific domains were found in the twelve-subunit core structure. They correspond to the Rpc17-Rpc25 dimer, involved in transcription initiation, to an N-terminal domain of the largest subunit Rpc1 important to anchor Rpc31, Rpc34 and Rpc82, and to a C-terminal domain of Rpc1 that presumably holds Rpc37, Rpc53 and their Rpc11 partner. PMID:16877568

  14. Phylogenetic conservation of the regulatory and functional properties of the Vav oncoprotein family

    SciTech Connect

    Couceiro, Jose R.; Martin-Bermudo, Maria D.; Bustelo, Xose R. . E-mail: xbustelo@usal.es

    2005-08-15

    Vav proteins are phosphorylation-dependent GDP/GTP exchange factors for Rho/Rac GTPases. Despite intense characterization of mammalian Vav proteins both biochemically and genetically, there is little information regarding the conservation of their biological properties in lower organisms. To approach this issue, we have performed a characterization of the regulatory, catalytic, and functional properties of the single Vav family member of Drosophila melanogaster. These analyses have shown that the intramolecular mechanisms controlling the enzyme activity of mammalian Vav proteins are already present in Drosophila, suggesting that such properties have been set up before the divergence between protostomes and deuterostomes during evolution. We also show that Drosophila and mammalian Vav proteins have similar catalytic specificities. As a consequence, Drosophila Vav can trigger oncogenic transformation, morphological change, and enhanced cell motility in mammalian cells. Gain-of-function studies using transgenic flies support the implication of this protein in cytoskeletal-dependent processes such as embryonic dorsal closure, myoblast fusion, tracheal development, and the migration/guidance of different cell types. These results highlight the important roles of Vav proteins in the signal transduction pathways regulating cytoskeletal dynamics. Moreover, they indicate that the foundations for the regulatory and enzymatic activities of this protein family have been set up very early during evolution.

  15. Unconditionally convergent nonlinear solver for hyperbolic conservation laws with S-shaped flux functions

    SciTech Connect

    Jenny, Patrick Tchelepi, Hamdi A.; Lee, Seong H.

    2009-11-01

    This paper addresses the convergence properties of implicit numerical solution algorithms for nonlinear hyperbolic transport problems. It is shown that the Newton-Raphson (NR) method converges for any time step size, if the flux function is convex, concave, or linear, which is, in general, the case for CFD problems. In some problems, e.g., multiphase flow in porous media, the nonlinear flux function is S-shaped (not uniformly convex or concave); as a result, a standard NR iteration can diverge for large time steps, even if an implicit discretization scheme is used to solve the nonlinear system of equations. In practice, when such convergence difficulties are encountered, the current time step is cut, previous iterations are discarded, a smaller time step size is tried, and the NR process is repeated. The criteria for time step cutting and selection are usually based on heuristics that limit the allowable change in the solution over a time step and/or NR iteration. Here, we propose a simple modification to the NR iteration scheme for conservation laws with S-shaped flux functions that converges for any time step size. The new scheme allows one to choose the time step size based on accuracy consideration only without worrying about the convergence behavior of the nonlinear solver. The proposed method can be implemented in an existing simulator, e.g., for CO{sub 2} sequestration or reservoir flow modeling, quite easily. The numerical analysis is confirmed with simulation studies using various test cases of nonlinear multiphase transport in porous media. The analysis and numerical experiments demonstrate that the modified scheme allows for the use of arbitrarily large time steps for this class of problems.

  16. Resource Conservation and Recovery Act permit modifications and the functional equivalency demonstration: a case study

    SciTech Connect

    Elsberry, K.; Garcia, P.; Carnes, R.; Kinker, J.; Loehr, C; Lyon, W.

    1996-02-01

    Hazardous waste operating permits issued under the Resource Conservation and Recovery Act (RCRA) often impose requirements that specific components and equipment be used. Consequently, changing these items, may first require that the owner/operator request a potentially time-consuming and costly permit modification. However, the owner/operator may demonstrate that a modification is not required because the planned changes are ``functionally equivalent.`` The Controlled-Air Incinerator at Los Alamos National Laboratory is scheduled for maintenance and improvements. The incinerator`s carbon adsorption unit/high efficiency particulate air filtration system, was redesigned to improve reliability and minimize maintenance. A study was performed to determine whether the redesigned unit would qualify as functionally equivalent to the original component. In performing this study, the following steps were taken: (a) the key performance factors were identified; (b) performance data describing the existing unit were obtained; (c) performance of both the existing and redesigned units was simulated; and (d) the performance data were compared to ascertain whether the components could qualify as functionally equivalent. In this case, the key performance data included gas residence time and distribution of flow over the activated carbon. Because both units were custom designed and fabricated, a simple comparison of manufacturers` specifications was impossible. Therefore, numerical simulation of each unit design was performed using the TEMPEST thermal-hydraulic computer code to model isothermal hydrodynamic performance under steady-state conditions. The results of residence time calculations from the model were coupled with flow proportion and sampled using a Monte Carlo-style simulation to derive distributions that describe the predicted residence times.

  17. Conserved Features of the PB2 627 Domain Impact Influenza Virus Polymerase Function and Replication

    PubMed Central

    Kirui, James; Bucci, Michael D.; Poole, Daniel S.

    2014-01-01

    ABSTRACT Successful replication of influenza virus requires the coordinated expression of viral genes and replication of the genome by the viral polymerase, composed of the subunits PA, PB1, and PB2. Polymerase activity is regulated by both viral and host factors, yet the mechanisms of regulation and how they contribute to viral pathogenicity and tropism are poorly understood. To characterize these processes, we created a series of mutants in the 627 domain of the PB2 subunit. This domain contains a conserved “P[F/P]AAAPP” sequence motif and the well-described amino acid 627, whose identity regulates host range. A lysine present at position 627 in most mammalian viral isolates creates a basic face on the domain surface and confers high-level activity in humans compared to the glutamic acid found at this position in avian isolates. Mutation of the basic face or the P[F/P]AAAPP motif impaired polymerase activity, assembly of replication complexes, and viral replication. Most of these residues are required for general polymerase activity, whereas PB2 K586 and R589 were preferentially required for function in human versus avian cells. Thus, these data identify residues in the 627 domain and other viral proteins that regulate polymerase activity, highlighting the importance of the surface charge and structure of this domain for virus replication and host adaptation. IMPORTANCE Influenza virus faces barriers to transmission across species as it emerges from its natural reservoir in birds to infect mammals. The viral polymerase is an important regulator of this process and undergoes discrete changes to adapt to replication in mammals. Many of these changes occur in the polymerase subunit PB2. Here we describe the systematic analysis of a key region in PB2 that controls species-specific polymerase activity. We report the importance of conserved residues that contribute to the overall charge of the protein as well as those that likely affect protein structure. These

  18. Evaluation of centricity of optical elements by using a point spread function

    SciTech Connect

    Miks, Antonin; Novak, Jiri; Novak, Pavel

    2008-06-20

    Our work describes a technique for testing the centricity of optical systems by using the point spread function. It is shown that a specific position of an axial object point can be found for every optical element, where the spherical aberration is either zero or minimal. If we image such a point with an optical element, then its point spread function will be almost identical to the point spread function of the diffraction-limited optical system. This consequence can be used for testing the centricity of precisely fabricated optical elements, because we can simply detect asymmetry of the point spread function, which is caused by the decentricity of the tested optical element. One can also use this method for testing optical elements in connection with a cementing process. Moreover, a simple formula is also derived for calculation of the coefficient of third-order coma, which is caused by the decentricity of the optical surface due to a tilt of the surface with respect to the optical axis, and a simple method for detecting the asymmetry of the point spread function is proposed.

  19. Evaporation Loss of Light Elements as a Function of Cooling Rate: Logarithmic Law

    NASA Technical Reports Server (NTRS)

    Xiong, Yong-Liang; Hewins, Roger H.

    2003-01-01

    Knowledge about the evaporation loss of light elements is important to our understanding of chondrule formation processes. The evaporative loss of light elements (such as B and Li) as a function of cooling rate is of special interest because recent investigations of the distribution of Li, Be and B in meteoritic chondrules have revealed that Li varies by 25 times, and B and Be varies by about 10 times. Therefore, if we can extrapolate and interpolate with confidence the evaporation loss of B and Li (and other light elements such as K, Na) at a wide range of cooling rates of interest based upon limited experimental data, we would be able to assess the full range of scenarios relating to chondrule formation processes. Here, we propose that evaporation loss of light elements as a function of cooling rate should obey the logarithmic law.

  20. Functional significance of the TATA element major groove in transcription initiation by RNA polymerase II.

    PubMed Central

    Lee, D K; Wang, K C; Roeder, R G

    1997-01-01

    The binding of TFIID to the TATA element initiates assembly of a preinitiation complex and thus represents one of the most important steps for transcriptional regulation. The fact that the TATA binding protein (TBP), a subunit of TFIID, exclusively contacts the minor groove of the TATA element led us to ask whether the major groove of the TATA element plays any role in transcription initiation or its regulation. Our results show that modifications of the major groove of the TATA element in the adenovirus major late promoter have no effect on TFIID binding affinity or on transcription in a cell-free system reconstituted with purified factors. However, major groove modifications do decrease the levels of both basal and activator-mediated transcription in unfractionated nuclear extracts, indicating that the intact structure of the major groove of the TATA element is functionally important for transcription initiation in a more physiological context. PMID:9336466

  1. Measurement of modulation transfer function for four types of imaging elements used in fast cameras

    SciTech Connect

    Estrella, R.M.; Sammons, T.J. . Amador Valley Operations); Thomas, S.W. )

    1991-01-01

    We have measured the modulation transfer function (MTF) of fiber- optic bundles (reducers), minifiers (inverting, electrostatically focused imaging tube reducers), microchannel plate image intensifiers (MCPIs), and streak tubes as part of our ongoing device evaluation program aimed at precise characterization of various imaging elements used in fast cameras. This paper describes our measurement equipment and techniques and shows plots of MTF measurements for each of four types of fast-camera elements tested. 6 refs., 9 figs.

  2. Fold conservation and proteolysis in zebrafish IRBP structure: Clues to possible enzymatic function?

    PubMed

    Ghosh, Debashis; Haswell, Karen M; Sprada, Molly; Gonzalez-Fernandez, Federico

    2016-06-01

    Multiple functions for Interphotoreceptor Retinoid-Binding Protein (IRBP) may explain its localization in the retina, vitreous and pineal gland and association with retinitis pigmentosa and myopia. We have been engaged in uncovering the structure-function relationships of this interesting protein long thought to bind visual-cycle retinoids and fatty acids in the subretinal space. Although hydrophobic domains capable of binding such ligands have now been found, we ask what other structural domains might be present that could predict new functions? Interestingly, IRBP possesses a fold similar to C-terminal processing proteases (CTPases) but is missing the PDZ domain. Here we present structural evidence that this fold may have a role in a recently observed autoproteolytic activity of the two-module zebrafish (z) IRBP (Ghosh et al. Exp. Eye Res., 2015). When the structure of Scenedesmus obliquus D1 CTPase (D1P) is superimposed with the first module of zIRBP (z1), the PDZ domain of D1P occupies roughly the same position in the amino acid sequence as the inter-domain tether in z1, between residues P71 and P85. The catalytic triad K397, S372 and E375 of D1P is located at the inter-domain interfacial cleft, similarly as the tetrad K241, S243, D177 and T179 of z1 residues, presumed to have proteolytic function. Packing of two adjacent symmetry-related molecules within the z1 crystal show that the helix α8 penetrates the interfacial cleft underneath the inter-domain tether, forming a simple intermolecular "knot". The full-length zIRBP is cleaved at or immediately after T309, which is located at the end of α8 and is the ninth residue of the second module z2. We propose that the helix α8 within intact zIRBP bends at P301, away from the improbable knotted fold, and positions the cleavage site T309 near the putative catalytic tetrad of the neighboring zIRBP to be proteolytically cleaved. The conservation of this functional catalytic domain suggests that possible

  3. KCNQ channels show conserved ethanol block and function in ethanol behaviour.

    PubMed

    Cavaliere, Sonia; Gillespie, John M; Hodge, James J L

    2012-01-01

    In humans, KCNQ2/3 channels form an M-current that regulates neuronal excitability, with mutations in these channels causing benign neonatal familial convulsions. The M-current is important in mechanisms of neural plasticity underlying associative memory and in the response to ethanol, with KCNQ controlling the release of dopamine after ethanol exposure. We show that dKCNQ is broadly expressed in the nervous system, with targeted reduction in neuronal KCNQ increasing neural excitability and KCNQ overexpression decreasing excitability and calcium signalling, consistent with KCNQ regulating the resting membrane potential and neural release as in mammalian neurons. We show that the single KCNQ channel in Drosophila (dKCNQ) has similar electrophysiological properties to neuronal KCNQ2/3, including conserved acute sensitivity to ethanol block, with the fly channel (IC(50) = 19.8 mM) being more sensitive than its mammalian ortholog (IC(50) = 42.1 mM). This suggests that the role of KCNQ in alcohol behaviour can be determined for the first time by using Drosophila. We present evidence that loss of KCNQ function in Drosophila increased sensitivity and tolerance to the sedative effects of ethanol. Acute activation of dopaminergic neurons by heat-activated TRP channel or KCNQ-RNAi expression produced ethanol hypersensitivity, suggesting that both act via a common mechanism involving membrane depolarisation and increased dopamine signalling leading to ethanol sedation. PMID:23209695

  4. Conserved and divergent functions of RcrRPQ in Streptococcus gordonii and S. mutans

    PubMed Central

    Shields, Robert C.; Burne, Robert A.

    2015-01-01

    In the dental caries pathogen Streptococcus mutans, an MarR-like transcriptional regulator (RcrR), two ABC efflux pumps (RcrPQ) and two effector peptides encoded in the rcrRPQ operon provide molecular connections between stress tolerance, (p)ppGpp metabolism and genetic competence. Here, we examined the role of RcrRPQ in the oral commensal S. gordonii. Unlike in S. mutans, introduction of polar or non-polar rcrR mutations into S. gordonii elicited no significant changes in transformation efficiency. However, S. gordonii rcrR mutants were markedly impaired in their ability to grow in the presence of hydrogen peroxide, paraquat, low pH or elevated temperature. Sensitivity to paraquat could also be conferred by mutation of cysteine residues that are present in the RcrR protein of S. gordonii, but not in S. mutans RcrR. Thus, stress tolerance is a conserved function of RcrRPQ in a commensal and pathogenic streptococcus, but the study reveals additional differences in regulation of genetic competence development between S. mutans and S. gordonii. PMID:26229070

  5. Conserved and divergent functions of RcrRPQ in Streptococcus gordonii and S. mutans.

    PubMed

    Shields, Robert C; Burne, Robert A

    2015-08-01

    In the dental caries pathogen Streptococcus mutans, an MarR-like transcriptional regulator (RcrR), two ABC efflux pumps (RcrPQ) and two effector peptides encoded in the rcrRPQ operon provide molecular connections between stress tolerance, (p)ppGpp metabolism and genetic competence. Here, we examined the role of RcrRPQ in the oral commensal S. gordonii. Unlike in S. mutans, introduction of polar or non-polar rcrR mutations into S. gordonii elicited no significant changes in transformation efficiency. However, S. gordonii rcrR mutants were markedly impaired in their ability to grow in the presence of hydrogen peroxide, paraquat, low pH or elevated temperature. Sensitivity to paraquat could also be conferred by mutation of cysteine residues that are present in the RcrR protein of S. gordonii, but not in S. mutans RcrR. Thus, stress tolerance is a conserved function of RcrRPQ in a commensal and pathogenic streptococcus, but the study reveals additional differences in regulation of genetic competence development between S. mutans and S. gordonii. PMID:26229070

  6. Structural Conservation and Functional Diversity of the Poxvirus Immune Evasion (PIE) Domain Superfamily

    PubMed Central

    Nelson, Christopher A.; Epperson, Megan L.; Singh, Sukrit; Elliott, Jabari I.; Fremont, Daved H.

    2015-01-01

    Poxviruses encode a broad array of proteins that serve to undermine host immune defenses. Structural analysis of four of these seemingly unrelated proteins revealed the recurrent use of a conserved beta-sandwich fold that has not been observed in any eukaryotic or prokaryotic protein. Herein we propose to call this unique structural scaffolding the PIE (Poxvirus Immune Evasion) domain. PIE domain containing proteins are abundant in chordopoxvirinae, with our analysis identifying 20 likely PIE subfamilies among 33 representative genomes spanning 7 genera. For example, cowpox strain Brighton Red appears to encode 10 different PIEs: vCCI, A41, C8, M2, T4 (CPVX203), and the SECRET proteins CrmB, CrmD, SCP-1, SCP-2, and SCP-3. Characterized PIE proteins all appear to be nonessential for virus replication, and all contain signal peptides for targeting to the secretory pathway. The PIE subfamilies differ primarily in the number, size, and location of structural embellishments to the beta-sandwich core that confer unique functional specificities. Reported ligands include chemokines, GM-CSF, IL-2, MHC class I, and glycosaminoglycans. We expect that the list of ligands and receptors engaged by the PIE domain will grow as we come to better understand how this versatile structural architecture can be tailored to manipulate host responses to infection. PMID:26343707

  7. Conserved cellular function and stress-mediated regulation among members of the proteolipid protein family.

    PubMed

    Fernández, María E; Alfonso, Julieta; Brocco, Marcela A; Frasch, Alberto C

    2010-05-01

    Chronic stress causes morphological alterations in the hippocampus of rodents and tree shrews, including atrophy of CA3 dendrites and loss of synapses. The molecular mechanisms underlying these structural changes remain largely unknown. We have previously identified M6a as a stress responsive gene and shown that M6a is involved in filopodium/spine outgrowth and, likely, synapse formation. M6a belongs to the proteolipid protein (PLP) family, all of their members having four transmembrane domains that allow their localization at the plasma membrane. In the present work, we analyzed other members of this family, the closely related M6b as well as PLP and its splice variant DM20. We found that chronic restraint stress in mice reduces M6b and DM20, but not PLP, mRNA levels in the hippocampus. In addition, M6b and DM20, but again not PLP, induce filopodium formation in primary cultures of hippocampal neurons. Several M6b protein isoforms were studied, all of them having similar effects except for the one lacking the transmembrane domains. Our results reveal a conserved cellular function and a stress-mediated regulation among members of the proteolipid protein family, suggesting an involvement of proteolipid proteins in the stress response. PMID:19937804

  8. Association between adjuvant regional radiotherapy and cognitive function in breast cancer patients treated with conservation therapy

    PubMed Central

    Shibayama, Osamu; Yoshiuchi, Kazuhiro; Inagaki, Masatoshi; Matsuoka, Yutaka; Yoshikawa, Eisho; Sugawara, Yuriko; Akechi, Tatsuo; Wada, Noriaki; Imoto, Shigeru; Murakami, Koji; Ogawa, Asao; Akabayashi, Akira; Uchitomi, Yosuke

    2014-01-01

    Although protracted cognitive impairment has been reported to occur after radiotherapy even when such therapy is not directed to brain areas, the mechanism remains unclear. This study investigated whether breast cancer patients exposed to local radiotherapy showed lower cognitive function mediated by higher plasma interleukin (IL)-6 levels than those unexposed. We performed the Wechsler Memory Scale-Revised (WMS-R) and measured plasma IL-6 levels for 105 breast cancer surgical patients within 1 year after the initial therapy. The group differences in each of the indices of WMS-R were investigated between cancer patients exposed to adjuvant regional radiotherapy (n = 51) and those unexposed (n = 54) using analysis of covariance. We further investigated a mediation effect by plasma IL-6 levels on the relationship between radiotherapy and the indices of WMS-R using the bootstrapping method. The radiotherapy group showed significantly lower Immediate Verbal Memory Index and Delayed Recall Index (P = 0.001, P = 0.008, respectively). Radiotherapy exerted an indirect effect on the lower Delayed Recall Index of WMS-R through elevation of plasma IL-6 levels (bootstrap 95% confidence interval = −2.6626 to −0.0402). This study showed that breast cancer patients exposed to adjuvant regional radiotherapy in conservation therapy might have cognitive impairment even several months after their treatment. The relationship between the therapy and the cognitive impairment could be partially mediated by elevation of plasma IL-6 levels. PMID:24756915

  9. Pan-cancer transcriptome analysis reveals long noncoding RNAs with conserved function

    PubMed Central

    Cabanski, Christopher R; White, Nicole M; Dang, Ha X; Silva-Fisher, Jessica M; Rauck, Corinne E; Cicka, Danielle; Maher, Christopher A

    2015-01-01

    A growing number of gene-centric studies have highlighted the emerging significance of lncRNAs in cancer. However, these studies primarily focus on a single cancer type. Therefore, we conducted a pan-cancer analysis of lncRNAs comparing tumor and matched normal expression levels using RNA-Seq data from ∼ 3,000 patients in 8 solid tumor types. While the majority of differentially expressed lncRNAs display tissue-specific expression we discovered 229 lncRNAs with outlier or differential expression across multiple cancers, which we refer to as 'onco-lncRNAs'. Due to their consistent altered expression, we hypothesize that these onco-lncRNAs may have conserved oncogenic and tumor suppressive functions across cancers. To address this, we associated the onco-lncRNAs in biological processes based on their co-expressed protein coding genes. To validate our predictions, we experimentally confirmed cell growth dependence of 2 novel oncogenic lncRNAs, onco-lncRNA-3 and onco-lncRNA-12, and a previously identified lncRNA CCAT1. Overall, we discovered lncRNAs that may have broad oncogenic and tumor suppressor roles that could significantly advance our understanding of cancer lncRNA biology. PMID:25864709

  10. Obese yeast: triglyceride lipolysis is functionally conserved from mammals to yeast.

    PubMed

    Kurat, Christoph F; Natter, Klaus; Petschnigg, Julia; Wolinski, Heimo; Scheuringer, Kim; Scholz, Harald; Zimmermann, Robert; Leber, Regina; Zechner, Rudolf; Kohlwein, Sepp D

    2006-01-01

    Storage and degradation of triglycerides are essential processes to ensure energy homeostasis and availability of precursors for membrane lipid synthesis. Recent evidence suggests that an emerging class of enzymes containing a conserved patatin domain are centrally important players in lipid degradation. Here we describe the identification and characterization of a major triglyceride lipase of the adipose triglyceride lipase/Brummer family, Tgl4, in the yeast Saccharomyces cerevisiae. Elimination of Tgl4 in a tgl3 background led to fat yeast, rendering growing cells unable to degrade triglycerides. Tgl4 and Tgl3 lipases localized to lipid droplets, independent of each other. Serine 315 in the GXSXG lipase active site consensus sequence of the patatin domain of Tgl4 is essential for catalytic activity. Mouse adipose triglyceride lipase (which also contains a patatin domain but is otherwise highly divergent in primary structure from any yeast protein) localized to lipid droplets when expressed in yeast, and significantly restored triglyceride breakdown in tgl4 mutants in vivo. Our data identify yeast Tgl4 as a functional ortholog of mammalian adipose triglyceride lipase. PMID:16267052

  11. Dissection of the structural and functional role of a conserved hydration site in RNase T1.

    PubMed Central

    Langhorst, U.; Loris, R.; Denisov, V. P.; Doumen, J.; Roose, P.; Maes, D.; Halle, B.; Steyaert, J.

    1999-01-01

    The reoccurrence of water molecules in crystal structures of RNase T1 was investigated. Five waters were found to be invariant in RNase T1 as well as in six other related fungal RNases. The structural, dynamical, and functional characteristics of one of these conserved hydration sites (WAT1) were analyzed by protein engineering, X-ray crystallography, and (17)O and 2H nuclear magnetic relaxation dispersion (NMRD). The position of WAT1 and its surrounding hydrogen bond network are unaffected by deletions of two neighboring side chains. In the mutant Thr93Gln, the Gln93N epsilon2 nitrogen replaces WAT1 and participates in a similar hydrogen bond network involving Cys6, Asn9, Asp76, and Thr91. The ability of WAT1 to form four hydrogen bonds may explain why evolution has preserved a water molecule, rather than a side-chain atom, at the center of this intricate hydrogen bond network. Comparison of the (17)O NMRD profiles from wild-type and Thr93Gln RNase T1 yield a mean residence time of 7 ns at 27 degrees C and an orientational order parameter of 0.45. The effects of mutations around WAT1 on the kinetic parameters of RNase T1 are small but significant and probably relate to the dynamics of the active site. PMID:10211818

  12. Structural and functional studies of conserved nucleotide-binding protein LptB in lipopolysaccharide transport

    SciTech Connect

    Wang, Zhongshan; Xiang, Quanju; Zhu, Xiaofeng; Dong, Haohao; He, Chuan; Wang, Haiyan; Zhang, Yizheng; Wang, Wenjian; Dong, Changjiang

    2014-09-26

    Highlights: • Determination of the structure of the wild-type LptB in complex with ATP and Mg{sup 2+}. • Demonstrated that ATP binding residues are essential for LptB’s ATPase activity and LPS transport. • Dimerization is required for the LptB’s function and LPS transport. • Revealed relationship between activity of the LptB and the vitality of E. coli cells. - Abstract: Lipopolysaccharide (LPS) is the main component of the outer membrane of Gram-negative bacteria, which plays an essential role in protecting the bacteria from harsh conditions and antibiotics. LPS molecules are transported from the inner membrane to the outer membrane by seven LPS transport proteins. LptB is vital in hydrolyzing ATP to provide energy for LPS transport, however this mechanism is not very clear. Here we report wild-type LptB crystal structure in complex with ATP and Mg{sup 2+}, which reveals that its structure is conserved with other nucleotide-binding proteins (NBD). Structural, functional and electron microscopic studies demonstrated that the ATP binding residues, including K42 and T43, are crucial for LptB’s ATPase activity, LPS transport and the vitality of Escherichia coli cells with the exceptions of H195A and Q85A; the H195A mutation does not lower its ATPase activity but impairs LPS transport, and Q85A does not alter ATPase activity but causes cell death. Our data also suggest that two protomers of LptB have to work together for ATP hydrolysis and LPS transport. These results have significant impacts in understanding the LPS transport mechanism and developing new antibiotics.

  13. 3D Functional Elements Deep Inside Silicon with Nonlinear Laser Lithography

    NASA Astrophysics Data System (ADS)

    Tokel, Onur; Turnali, Ahmet; Ergecen, Emre; Pavlov, Ihor; Ilday, Fatih Omer

    Functional optical and electrical elements fabricated on silicon (Si) constitute fundamental building blocks of electronics and Si-photonics. However, since the highly successful established lithography are geared towards surface processing, elements embedded inside Si simply do not exist. Here, we present a novel direct-laser writing method for positioning buried functional elements inside Si wafers. This new phenomenon is distinct from previous work, in that the surface of Si is not modified. By exploiting nonlinear interactions of a focused laser, permanent refractive index changes are induced inside Si. The imprinted index contrast is then used to demonstrate a plethora of functional elements and capabilities embedded inside Si. In particular, we demonstrate the first functional optical element inside Si, the first information-storage capability inside Si, creation of high-resolution subsurface holograms, buried multilevel structures, and complex 3D architectures in Si, none of which is currently possible with other methods. This new approach complements available techniques by taking advantage of the real estate under Si, and therefore can pave the way for creating entirely new multilevel devices through electronic-photonic integration.

  14. Minimal multi-element stochastic collocation for uncertainty quantification of discontinuous functions

    SciTech Connect

    Jakeman, John D.; Narayan, Akil; Xiu, Dongbin

    2013-06-01

    We propose a multi-element stochastic collocation method that can be applied in high-dimensional parameter space for functions with discontinuities lying along manifolds of general geometries. The key feature of the method is that the parameter space is decomposed into multiple elements defined by the discontinuities and thus only the minimal number of elements are utilized. On each of the resulting elements the function is smooth and can be approximated using high-order methods with fast convergence properties. The decomposition strategy is in direct contrast to the traditional multi-element approaches which define the sub-domains by repeated splitting of the axes in the parameter space. Such methods are more prone to the curse-of-dimensionality because of the fast growth of the number of elements caused by the axis based splitting. The present method is a two-step approach. Firstly a discontinuity detector is used to partition parameter space into disjoint elements in each of which the function is smooth. The detector uses an efficient combination of the high-order polynomial annihilation technique along with adaptive sparse grids, and this allows resolution of general discontinuities with a smaller number of points when the discontinuity manifold is low-dimensional. After partitioning, an adaptive technique based on the least orthogonal interpolant is used to construct a generalized Polynomial Chaos surrogate on each element. The adaptive technique reuses all information from the partitioning and is variance-suppressing. We present numerous numerical examples that illustrate the accuracy, efficiency, and generality of the method. When compared against standard locally-adaptive sparse grid methods, the present method uses many fewer number of collocation samples and is more accurate.

  15. Non-Periodic Finite-Element Formulation of Orbital-Free Density Functional Theory

    SciTech Connect

    Gavini, V; Knap, J; Bhattacharya, K; Ortiz, M

    2006-10-06

    We propose an approach to perform orbital-free density functional theory calculations in a non-periodic setting using the finite-element method. We consider this a step towards constructing a seamless multi-scale approach for studying defects like vacancies, dislocations and cracks that require quantum mechanical resolution at the core and are sensitive to long range continuum stresses. In this paper, we describe a local real space variational formulation for orbital-free density functional theory, including the electrostatic terms and prove existence results. We prove the convergence of the finite-element approximation including numerical quadratures for our variational formulation. Finally, we demonstrate our method using examples.

  16. Sequence Evaluation of FGF and FGFR Gene Conserved Non-Coding Elements in Non-Syndromic Cleft Lip and Palate Cases

    PubMed Central

    Riley, Bridget M.; Murray, Jeffrey C.

    2009-01-01

    Non-syndromic cleft lip and palate (NS CLP) is a complex birth defect resulting from multiple genetic and environmental factors. We have previously reported the sequencing of the coding region of genes in the fibroblast growth factor (FGF) signaling pathway, in which missense and non-sense mutations contribute to approximately 5%–6% NS CLP cases. In this article we report the sequencing of conserved non-coding elements (CNEs) in and around 11 of the FGF and FGFR genes, which identified 55 novel variants. Seven of variants are highly conserved among ≥8 species and 31 variants alter transcription factor binding sites, 8 of which are important for craniofacial development. Additionally, 15 NS CLP patients had a combination of coding mutations and CNE variants, suggesting that an accumulation of variants in the FGF signaling pathway may contribute to clefting. PMID:17963255

  17. Concentration of Elements in Whole-body Fish, Fish Fillets, Fish Muscle Plugs, and Fish Eggs from the 2008 Missouri Department of Conservation General Contaminant Monitoring Program

    USGS Publications Warehouse

    May, Thomas W.; Walther, Michael J.; Brumbaugh, William G.; McKee, Michael J.

    2009-01-01

    This report presents the results of a contaminant monitoring survey conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in whole-body fish, fish fillets, fish muscle plugs, and fish eggs. Whole-body, fillet, or egg samples of catfish (Ictalurus punctatus, Ictalurus furcatus, Pylodictis olivaris), largemouth bass (Micropterus salmoides), walleye (Sander vitreus), crappie (Pomoxis annularis, Pomoxis nigromaculatus), shovelnose sturgeon (Scaphirhynchus platorynchus), northern hog sucker (Hypentelium nigricans), and Missouri saddled darter (Etheostoma tetrazonum) were collected from 23 sites as part of the Missouri Department of Conservation's Fish Contaminant Monitoring Program. Fish dorsal muscle plugs also were collected from walleye (Sander vitreus) at one of the sites.

  18. Computational identification of riboswitches based on RNA conserved functional sequences and conformations.

    PubMed

    Chang, Tzu-Hao; Huang, Hsien-Da; Wu, Li-Ching; Yeh, Chi-Ta; Liu, Baw-Jhiune; Horng, Jorng-Tzong

    2009-07-01

    Riboswitches are cis-acting genetic regulatory elements within a specific mRNA that can regulate both transcription and translation by interacting with their corresponding metabolites. Recently, an increasing number of riboswitches have been identified in different species and investigated for their roles in regulatory functions. Both the sequence contexts and structural conformations are important characteristics of riboswitches. None of the previously developed tools, such as covariance models (CMs), Riboswitch finder, and RibEx, provide a web server for efficiently searching homologous instances of known riboswitches or considers two crucial characteristics of each riboswitch, such as the structural conformations and sequence contexts of functional regions. Therefore, we developed a systematic method for identifying 12 kinds of riboswitches. The method is implemented and provided as a web server, RiboSW, to efficiently and conveniently identify riboswitches within messenger RNA sequences. The predictive accuracy of the proposed method is comparable with other previous tools. The efficiency of the proposed method for identifying riboswitches was improved in order to achieve a reasonable computational time required for the prediction, which makes it possible to have an accurate and convenient web server for biologists to obtain the results of their analysis of a given mRNA sequence. RiboSW is now available on the web at http://RiboSW.mbc.nctu.edu.tw/. PMID:19460868

  19. Higher-order adaptive finite-element methods for Kohn–Sham density functional theory

    SciTech Connect

    Motamarri, P.; Nowak, M.R.; Leiter, K.; Knap, J.; Gavini, V.

    2013-11-15

    We present an efficient computational approach to perform real-space electronic structure calculations using an adaptive higher-order finite-element discretization of Kohn–Sham density-functional theory (DFT). To this end, we develop an a priori mesh-adaption technique to construct a close to optimal finite-element discretization of the problem. We further propose an efficient solution strategy for solving the discrete eigenvalue problem by using spectral finite-elements in conjunction with Gauss–Lobatto quadrature, and a Chebyshev acceleration technique for computing the occupied eigenspace. The proposed approach has been observed to provide a staggering 100–200-fold computational advantage over the solution of a generalized eigenvalue problem. Using the proposed solution procedure, we investigate the computational efficiency afforded by higher-order finite-element discretizations of the Kohn–Sham DFT problem. Our studies suggest that staggering computational savings—of the order of 1000-fold—relative to linear finite-elements can be realized, for both all-electron and local pseudopotential calculations, by using higher-order finite-element discretizations. On all the benchmark systems studied, we observe diminishing returns in computational savings beyond the sixth-order for accuracies commensurate with chemical accuracy, suggesting that the hexic spectral-element may be an optimal choice for the finite-element discretization of the Kohn–Sham DFT problem. A comparative study of the computational efficiency of the proposed higher-order finite-element discretizations suggests that the performance of finite-element basis is competing with the plane-wave discretization for non-periodic local pseudopotential calculations, and compares to the Gaussian basis for all-electron calculations to within an order of magnitude. Further, we demonstrate the capability of the proposed approach to compute the electronic structure of a metallic system containing 1688

  20. Higher-order adaptive finite-element methods for Kohn-Sham density functional theory

    NASA Astrophysics Data System (ADS)

    Motamarri, P.; Nowak, M. R.; Leiter, K.; Knap, J.; Gavini, V.

    2013-11-01

    We present an efficient computational approach to perform real-space electronic structure calculations using an adaptive higher-order finite-element discretization of Kohn-Sham density-functional theory (DFT). To this end, we develop an a priori mesh-adaption technique to construct a close to optimal finite-element discretization of the problem. We further propose an efficient solution strategy for solving the discrete eigenvalue problem by using spectral finite-elements in conjunction with Gauss-Lobatto quadrature, and a Chebyshev acceleration technique for computing the occupied eigenspace. The proposed approach has been observed to provide a staggering 100-200-fold computational advantage over the solution of a generalized eigenvalue problem. Using the proposed solution procedure, we investigate the computational efficiency afforded by higher-order finite-element discretizations of the Kohn-Sham DFT problem. Our studies suggest that staggering computational savings-of the order of 1000-fold-relative to linear finite-elements can be realized, for both all-electron and local pseudopotential calculations, by using higher-order finite-element discretizations. On all the benchmark systems studied, we observe diminishing returns in computational savings beyond the sixth-order for accuracies commensurate with chemical accuracy, suggesting that the hexic spectral-element may be an optimal choice for the finite-element discretization of the Kohn-Sham DFT problem. A comparative study of the computational efficiency of the proposed higher-order finite-element discretizations suggests that the performance of finite-element basis is competing with the plane-wave discretization for non-periodic local pseudopotential calculations, and compares to the Gaussian basis for all-electron calculations to within an order of magnitude. Further, we demonstrate the capability of the proposed approach to compute the electronic structure of a metallic system containing 1688 atoms using

  1. Evidence for Conserved Function of γ–Glutamyltranspeptidase in Helicobacter Genus

    PubMed Central

    Revez, Joana; Javed, Sundus; El-Najjar, Nahed; Anderl, Florian; Hyytiäinen, Heidi; Vuorela, Pia; Gerhard, Markus; Hänninen, Marja-Liisa

    2012-01-01

    The confounding consequences of Helicobacter bilis infection in experimental mice populations are well recognized, but the role of this bacterium in human diseases is less known. Limited data are available on virulence determinants of this species. In Helicobacter pylori, γ-glutamyltranspeptidase (γGT) contributes to the colonization of the gastric mucosa and to the pathogenesis of peptic ulcer. The role of γGT in H. bilis infections remains unknown. The annotated genome sequence of H. bilis revealed two putative ggt genes and our aim was to characterize these H. bilis γGT paralogues. We performed a phylogenetic analysis to understand the evolution of Helicobacter γGTs and to predict functional activities of these two genes. In addition, both copies of H. bilis γGTs were expressed as recombinant proteins and their biochemical characteristics were analysed. Functional complementation of Esherichia coli deficient in γGT activity and deletion of γGT in H. bilis were performed. Finally, the inhibitory effect of T-cell and gastric cell proliferation by H. bilis γGT was assessed. Our results indicated that one gene is responsible for γGT activity, while the other showed no γGT activity due to lack of autoprocessing. Although both H. bilis and H. pylori γGTs exhibited a similar affinity to L-Glutamine and γ-Glutamyl-p-nitroanilide, the H. bilis γGT was significantly less active. Nevertheless, H. bilis γGT inhibited T-cell proliferation at a similar level to that observed for H. pylori. Finally, we showed a similar suppressive influence of both H. bilis and H. pylori γGTs on AGS cell proliferation mediated by an apoptosis-independent mechanism. Our data suggest a conserved function of γGT in the Helicobacter genus. Since γGT is present only in a few enterohepatic Helicobacter species, its expression appears not to be essential for colonization of the lower gastrointestinal tract, but it could provide metabolic advantages in colonization capability of

  2. Evidence for conserved function of γ-glutamyltranspeptidase in Helicobacter genus.

    PubMed

    Rossi, Mirko; Bolz, Christian; Revez, Joana; Javed, Sundus; El-Najjar, Nahed; Anderl, Florian; Hyytiäinen, Heidi; Vuorela, Pia; Gerhard, Markus; Hänninen, Marja-Liisa

    2012-01-01

    The confounding consequences of Helicobacter bilis infection in experimental mice populations are well recognized, but the role of this bacterium in human diseases is less known. Limited data are available on virulence determinants of this species. In Helicobacter pylori, γ-glutamyltranspeptidase (γGT) contributes to the colonization of the gastric mucosa and to the pathogenesis of peptic ulcer. The role of γGT in H. bilis infections remains unknown. The annotated genome sequence of H. bilis revealed two putative ggt genes and our aim was to characterize these H. bilis γGT paralogues. We performed a phylogenetic analysis to understand the evolution of Helicobacter γGTs and to predict functional activities of these two genes. In addition, both copies of H. bilis γGTs were expressed as recombinant proteins and their biochemical characteristics were analysed. Functional complementation of Esherichia coli deficient in γGT activity and deletion of γGT in H. bilis were performed. Finally, the inhibitory effect of T-cell and gastric cell proliferation by H. bilis γGT was assessed. Our results indicated that one gene is responsible for γGT activity, while the other showed no γGT activity due to lack of autoprocessing. Although both H. bilis and H. pylori γGTs exhibited a similar affinity to L-Glutamine and γ-Glutamyl-p-nitroanilide, the H. bilis γGT was significantly less active. Nevertheless, H. bilis γGT inhibited T-cell proliferation at a similar level to that observed for H. pylori. Finally, we showed a similar suppressive influence of both H. bilis and H. pylori γGTs on AGS cell proliferation mediated by an apoptosis-independent mechanism. Our data suggest a conserved function of γGT in the Helicobacter genus. Since γGT is present only in a few enterohepatic Helicobacter species, its expression appears not to be essential for colonization of the lower gastrointestinal tract, but it could provide metabolic advantages in colonization capability of

  3. Ground-state properties of third-row elements with nonlocal density functionals

    SciTech Connect

    Bagno, P.; Jepsen, O.; Gunnarsson, O.

    1989-07-15

    The cohesive energy, the lattice parameter, and the bulk modulus of third-row elements are calculated using the Langreth-Mehl-Hu (LMH), the Perdew-Wang (PW), and the gradient expansion functionals. The PW functional is found to give somewhat better results than the LMH functional and both are found to typically remove half the errors in the local-spin-density (LSD) approximation, while the gradient expansion gives worse results than the local-density approximation. For Fe both the LMH and PW functionals correctly predict a ferromagnetic bcc ground state, while the LSD approximation and the gradient expansion predict a nonmagnetic fcc ground state.

  4. Band-limited Green's Functions for Quantitative Evaluation of Acoustic Emission Using the Finite Element Method

    NASA Technical Reports Server (NTRS)

    Leser, William P.; Yuan, Fuh-Gwo; Leser, William P.

    2013-01-01

    A method of numerically estimating dynamic Green's functions using the finite element method is proposed. These Green's functions are accurate in a limited frequency range dependent on the mesh size used to generate them. This range can often match or exceed the frequency sensitivity of the traditional acoustic emission sensors. An algorithm is also developed to characterize an acoustic emission source by obtaining information about its strength and temporal dependence. This information can then be used to reproduce the source in a finite element model for further analysis. Numerical examples are presented that demonstrate the ability of the band-limited Green's functions approach to determine the moment tensor coefficients of several reference signals to within seven percent, as well as accurately reproduce the source-time function.

  5. A Review on the Finite Element Methods for Heat Conduction in Functionally Graded Materials

    NASA Astrophysics Data System (ADS)

    Sharma, R.; Jadon, V. K.; Singh, B.

    2015-01-01

    The review presented in this paper focuses mainly on the application of finite element methods for investigating the effect of heat transfer, variation of temperature and other parameters in the functionally graded materials. Different methods have been investigated for thermal conduction in functionally graded materials. The use of FEM for steady state heat transfer has been addressed in this work. The authors have also discussed the utilization of FEM based shear deformation theories and FEM in combination with other methods for the problems involving complexity of the shape and geometry of functionally graded materials. Finite element methods proved to be effective for the solution of heat transfer problem in functionally graded materials. These methods can be used for steady state heat transfer and as well as for transient state.

  6. The Space-Time Conservation Element and Solution Element Method: A New High-Resolution and Genuinely Multidimensional Paradigm for Solving Conservation Laws. 1; The Two Dimensional Time Marching Schemes

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Wang, Xiao-Yen; Chow, Chuen-Yen

    1998-01-01

    A new high resolution and genuinely multidimensional numerical method for solving conservation laws is being, developed. It was designed to avoid the limitations of the traditional methods. and was built from round zero with extensive physics considerations. Nevertheless, its foundation is mathmatically simple enough that one can build from it a coherent, robust. efficient and accurate numerical framework. Two basic beliefs that set the new method apart from the established methods are at the core of its development. The first belief is that, in order to capture physics more efficiently and realistically, the modeling, focus should be placed on the original integral form of the physical conservation laws, rather than the differential form. The latter form follows from the integral form under the additional assumption that the physical solution is smooth, an assumption that is difficult to realize numerically in a region of rapid chance. such as a boundary layer or a shock. The second belief is that, with proper modeling of the integral and differential forms themselves, the resulting, numerical solution should automatically be consistent with the properties derived front the integral and differential forms, e.g., the jump conditions across a shock and the properties of characteristics. Therefore a much simpler and more robust method can be developed by not using the above derived properties explicitly.

  7. Functional Response of NiTi Elements for Smart Micro-actuation Applications

    NASA Astrophysics Data System (ADS)

    Biffi, C. A.; Nespoli, A.; Previtali, B.; Villa, E.; Tuissi, A.

    2014-07-01

    Shape memory alloys (SMAs) can be considered a good candidate for actuation applications in the current micro-technology field. In the micro-scale, the temporal response of the SMA actuators can be improved, because of faster cooling during the austenite-martensite transformation. One of the most investigated geometries for this purpose has been the snake-like arrangement, which allows high strokes with considerable forces to be obtained. In this work, SMA elements for micro-actuators were patterned by laser machining in a snake-like shape. Subsequent surface chemical etching was adopted to improve the functional properties of the micro-elements. Calorimetric analysis and thermo-mechanical response of 90 μm thick SMA elements were reported for the evaluation of their functional performances. Moreover, the effect of post-thermal treatment and grain orientation were also evaluated on the final performances.

  8. IMPORTANCE OF ACTIVATED CARBON'S OXYGEN SURFACE FUNCTIONAL GROUPS ON ELEMENTAL MERCURY ADSORPTION

    EPA Science Inventory

    The effect of varying physical and chemical properties of activated carbons on adsorption of elemental mercury [Hg(0)] was studied by treating two activated carbons to modify their surface functional groups and pore structures. Heat treatment (1200 K) in nitrogen (N2), air oxidat...

  9. Method for studying the phase function in tunable diffraction optical elements

    SciTech Connect

    Paranin, V D; Tukmakov, K N

    2014-04-28

    A method for studying the phase function in tunable diffraction optical elements is proposed, based on measurement of the transmission of interelectrode gaps. The mathematical description of the method, which is approved experimentally, is developed. The instrumental error effects are analysed. (laser applications and other topics in quantum electronics)

  10. Matrix elements of explicitly correlated Gaussian basis functions with arbitrary angular momentum

    NASA Astrophysics Data System (ADS)

    Joyce, Tennesse; Varga, Kálmán

    2016-05-01

    A new algorithm for calculating the Hamiltonian matrix elements with all-electron explicitly correlated Gaussian functions for quantum-mechanical calculations of atoms with arbitrary angular momentum is presented. The calculations are checked on several excited states of three and four electron systems. The presented formalism can be used as unified framework for high accuracy calculations of properties of small atoms and molecules.

  11. Global functions in global-local finite-element analysis of localized stresses in prismatic structures

    NASA Technical Reports Server (NTRS)

    Dong, Stanley B.

    1989-01-01

    An important consideration in the global local finite-element method (GLFEM) is the availability of global functions for the given problem. The role and mathematical requirements of these global functions in a GLFEM analysis of localized stress states in prismatic structures are discussed. A method is described for determining these global functions. Underlying this method are theorems due to Toupin and Knowles on strain energy decay rates, which are related to a quantitative expression of Saint-Venant's principle. It is mentioned that a mathematically complete set of global functions can be generated, so that any arbitrary interface condition between the finite element and global subregions can be represented. Convergence to the true behavior can be achieved with increasing global functions and finite-element degrees of freedom. Specific attention is devoted to mathematically two-dimensional and three-dimensional prismatic structures. Comments are offered on the GLFEM analysis of NASA flat panel with a discontinuous stiffener. Methods for determining global functions for other effects are also indicated, such as steady-state dynamics and bodies under initial stress.

  12. Two subclasses of odorant-binding proteins in Spodoptera exigua display structural conservation and functional divergence.

    PubMed

    Liu, N-Y; Yang, F; Yang, K; He, P; Niu, X-H; Xu, W; Anderson, A; Dong, S-L

    2015-04-01

    Although many studies on lepidopteran pheromone-binding proteins (PBPs)/ general odorant-binding proteins (GOBPs) have been reported, the functional differentiation within and between the two odorant-binding protein (OBP) subclasses is still elusive. Here we conducted a comparative study on three SexiPBPs and two SexiGOBPs in Spodoptera exigua. Results showed that all five SexiPBP/GOBP genes have the same intron numbers and conserved exon/intron splice sites. Reverse transcription PCR results showed that these five SexiPBP/GOBPs were primarily expressed in antennae of both sexes and some were also detected in other tissues. Further, quantitative real-time PCR showed that five SexiPBP/GOBPs had different sex-biased expression patterns, with PBP1 being highly male-biased (5.96-fold difference) and PBP3 slightly female-biased (2.43-fold difference), while PBP2 and two GOBPs were approximately sex-equivalent (the absolute value<1.90-fold difference). Binding assays showed that all three SexiPBPs could bind all six sex pheromone components, but SexiPBP1 had much higher affinities [dissociation constant (Ki ) <1.10 μM] than did the other two SexiPBPs (Ki  >1.20 μM). Very intriguingly, SexiGOBP2 displayed even stronger binding to five sex pheromone components (Ki  <0.40 μM) than SexiPBP1. In contrast, SexiGOBP1 only exhibited weak binding to three alcohol-pheromone components. Similar results were obtained for tested pheromone analogues. In addition, each of SexiPBP/GOBPs selectively bound some plant odorants with considerable affinities (Ki  <10.0 μM). Taken together, of the three SexiPBPs, SexiPBP1 may play the most important role in female sex pheromone reception, and additionally all three SexiPBPs can detect some plant odorants, while SexiGOBP2 may be involved in the detection of female sex pheromones in addition to plant odorants. The results strongly suggest functional differentiation within and between the two OBP sub-classes. PMID:25345813

  13. Functional conservation between mammalian MGRN1 and plant LOG2 ubiquitin ligases

    PubMed Central

    Guerra, Damian D.; Pratelli, Réjane; Kraft, Edward; Callis, Judy; Pilot, Guillaume

    2014-01-01

    Plant LOSS OF GDU 2 (LOG2) and mammalian MAHOGUNIN RING FINGER 1 (MGRN1) proteins are RING-type E3 ligases sharing similarity N-terminal to the RING domain. Deletion of this region disrupts the interaction of LOG2 with the plant membrane protein GLUTAMINE DUMPER 1 (GDU1). Phylogenetic analysis identified two clades of LOG2/MGRN1-like proteins in vertebrates and plants. The ability of MGRN1 to functionally replace LOG2 was tested. MGRN1 ubiquitylates GDU1 in vitro and can partially substitute for LOG2 in the plant, partially restoring amino acid resistance to a GDU1-myc over-expression, log2-1 background. Altogether, these results suggest a conserved function for the N-terminal domain in evolution. Structured summary of protein interactionsGDU1 physically interactswith rnMGRN1by two hybrid (1, 2)rnMGRN1 binds to GDU1by pull down(View interaction)GDU6 physically interactswith rnMGRN1by two hybrid (1, 2)GDU3 physically interactswith hsMGRN1by two hybrid (1, 2)rnMGRN1 physically interactswith GDU7by two hybrid (1, 2)GDU5 physically interactswith hsMGRN1by two hybrid (1, 2)hsMGRN1 physically interactswith GDU1by two hybrid (1, 2)rnMGRN1 physically interactswith GDU3by two hybrid (1, 2)rnMGRN1 physically interactswith GDU5by two hybrid (1, 2)hsMGRN1 physically interactswith GDU7by two hybrid (1, 2)GDU6 physically interactswith hsMGRN1by two hybrid (1, 2)LOG2 binds to GDU1by pull down (1, 2)hsMGRN1 physically interactswith GDU4by two hybrid (1, 2)rnMGRN1 physically interactswith GDU2by two hybrid (1, 2)GDU4 physically interactswith rnMGRN1by two hybrid (1, 2)LOG2 physically interactswith GDU1by two hybrid (1, 2, 3, 4)GDU2 physically interactswith hsMGRN1by two hybrid (1, 2) PMID:24036454

  14. The method of space-time conservation element and solution element-applications to one-dimensional and two-dimensional time-marching flow problems

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Wang, Xiao-Yen; Chow, Chuen-Yen

    1995-01-01

    A nontraditional numerical method for solving conservation laws is being developed. The new method is designed from a physicist's perspective, i.e., its development is based more on physics than numerics. Even though it uses only the simplest approximation techniques, a 2D time-marching Euler solver developed recently using the new method is capable of generating nearly perfect solutions for a 2D shock reflection problem used by Helen Yee and others. Moreover, a recent application of this solver to computational aeroacoustics (CAA) problems reveals that: (1) accuracy of its results is comparable to that of a 6th order compact difference scheme even though nominally the current solver is only of 2nd-order accuracy; (2) generally, the non-reflecting boundary condition can be implemented in a simple way without involving characteristic variables; and (3) most importantly, the current solver is capable of handling both continuous and discontinuous flows very well and thus provides a unique numerical tool for solving those flow problems where the interactions between sound waves and shocks are important, such as the noise field around a supersonic over- or under-expansion jet.

  15. Communications: Adsorption of element 112 on the gold surface: Many-body wave function versus density functional theory

    NASA Astrophysics Data System (ADS)

    Zaitsevskii, Andréi; van Wüllen, Christoph; Titov, Anatoly V.

    2010-02-01

    The applicability of the relativistic density functional theory (RDFT) with conventional generalized gradient and hybrid exchange-correlation functionals to the description of the interactions of element 112 (Cn) and its lighter homolog Hg with a gold surface is assessed. The comparison of Cn-Au (Hg-Au) bond properties for two simple models of adsorption complexes on Au(111) surface obtained by RDFT and accurate many-body calculations indicates a strong underestimation of binding energies by conventional RDFT schemes. This effect provides a possible explanation of the discrepancies between the RDFT-based theoretical and experimental data concerning the thermochromatographic registration of the α-decay chain element 114→Cn.

  16. Conservation success as a function of good alignment of social and ecological structures and processes.

    PubMed

    Bodin, Orjan; Crona, Beatrice; Thyresson, Matilda; Golz, Anna-Lea; Tengö, Maria

    2014-10-01

    How to create and adjust governing institutions so that they align (fit) with complex ecosystem processes and structures across scales is an issue of increasing concern in conservation. It is argued that lack of such social-ecological fit makes governance and conservation difficult, yet progress in explicitly defining and rigorously testing what constitutes a good fit has been limited. We used a novel modeling approach and data from case studies of fishery and forest conservation to empirically test presumed relationships between conservation outcomes and certain patterns of alignment of social-ecological interdependences. Our approach made it possible to analyze conservation outcome on a systems level while also providing information on how individual actors are positioned in the complex web of social-ecological interdependencies. We found that when actors who shared resources were also socially linked, conservation at the level of the whole social-ecological system was positively affected. When the scales at which individual actors used resources and the scale at which ecological resources were interconnected to other ecological resources were aligned through tightened feedback loops, conservation outcome was better than when they were not aligned. The analysis of individual actors' positions in the web of social-ecological interdependencies was helpful in understanding why a system has a certain level of social-ecological fit. Results of analysis of positions showed that different actors contributed in very different ways to achieve a certain fit and revealed some underlying difference between the actors, for example in terms of actors' varying rights to access and use different ecological resources. PMID:24779516

  17. Structural and functional conservation of key domains in InsP[subscript 3] and ryanodine receptors

    SciTech Connect

    Seo, Min-Duk; Velamakanni, Saroj; Ishiyama, Noboru; Stathopulos, Peter B.; Rossi, Ana M.; Khan, Samir A.; Dale, Philippa; Li, Congmin; Ames, James B.; Ikura, Mitsuhiko; Taylor, Colin W.

    2012-07-11

    Inositol-1,4,5-trisphosphate receptors (InsP{sub 3}Rs) and ryanodine receptors (RyRs) are tetrameric intracellular Ca{sup 2+} channels. In each of these receptor families, the pore, which is formed by carboxy-terminal transmembrane domains, is regulated by signals that are detected by large cytosolic structures. InsP{sub 3}R gating is initiated by InsP{sub 3} binding to the InsP{sub 3}-binding core (IBC, residues 224-604 of InsP{sub 3}R1) and it requires the suppressor domain (SD, residues 1-223 of InsP{sub 3}R1). Here we present structures of the amino-terminal region (NT, residues 1-604) of rat InsP{sub 3}R1 with (3.6 {angstrom}) and without (3.0 {angstrom}) InsP{sub 3} bound. The arrangement of the three NT domains, SD, IBC-{beta} and IBC-{alpha}, identifies two discrete interfaces ({alpha} and {beta}) between the IBC and SD. Similar interfaces occur between equivalent domains (A, B and C) in RyR1 (ref. 9). The orientations of the three domains when docked into a tetrameric structure of InsP{sub 3}R and of the ABC domains docked into RyR are remarkably similar. The importance of the {alpha}-interface for activation of InsP{sub 3}R and RyR is confirmed by mutagenesis and, for RyR, by disease-causing mutations. Binding of InsP{sub 3} causes partial closure of the clam-like IBC, disrupting the {beta}-interface and pulling the SD towards the IBC. This reorients an exposed SD loop ('hotspot' (HS) loop) that is essential for InsP{sub 3}R activation. The loop is conserved in RyR and includes mutations that are associated with malignant hyperthermia and central core disease. The HS loop interacts with an adjacent NT, suggesting that activation re-arranges inter-subunit interactions. The A domain of RyR functionally replaced the SD in full-length InsP{sub 3}R, and an InsP{sub 3}R in which its C-terminal transmembrane region was replaced by that from RyR1 was gated by InsP{sub 3} and blocked by ryanodine. Activation mechanisms are conserved between InsP{sub 3}R and Ry

  18. The conserved proteins CHE-12 and DYF-11 are required for sensory cilium function in Caenorhabditis elegans.

    PubMed

    Bacaj, Taulant; Lu, Yun; Shaham, Shai

    2008-02-01

    Sensory neuron cilia are evolutionarily conserved dendritic appendages that convert environmental stimuli into neuronal activity. Although several cilia components are known, the functions of many remain uncharacterized. Furthermore, the basis of morphological and functional differences between cilia remains largely unexplored. To understand the molecular basis of cilia morphogenesis and function, we studied the Caenorhabditis elegans mutants che-12 and dyf-11. These mutants fail to concentrate lipophilic dyes from their surroundings in sensory neurons and are chemotaxis defective. In che-12 mutants, sensory neuron cilia lack distal segments, while in dyf-11 animals, medial and distal segments are absent. CHE-12 and DYF-11 are conserved ciliary proteins that function cell-autonomously and are continuously required for maintenance of cilium morphology and function. CHE-12, composed primarily of HEAT repeats, may not be part of the intraflagellar transport (IFT) complex and is not required for the localization of some IFT components. DYF-11 undergoes IFT-like movement and may function at an early stage of IFT-B particle assembly. Intriguingly, while DYF-11 is expressed in all C. elegans ciliated neurons, CHE-12 expression is restricted to some amphid sensory neurons, suggesting a specific role in these neurons. Our results provide insight into general and neuron-specific aspects of cilium development and function. PMID:18245347

  19. Structural study of elements of Tetrahymena telomerase RNA stem–loop IV domain important for function

    PubMed Central

    Richards, Rebecca J.; Wu, Haihong; Trantirek, Lukas; O'Connor, Catherine M.; Collins, Kathleen; Feigon, Juli

    2006-01-01

    Tetrahymena telomerase RNA (TER) contains several regions in addition to the template that are important for function. Central among these is the stem–loop IV domain, which is involved in both catalysis and RNP assembly, and includes binding sites for both the holoenzyme assembly protein p65 and telomerase reverse transcriptase (TERT). Stem–loop IV contains two regions with high evolutionary sequence conservation: a central GA bulge between helices, and a terminal loop. We solved the solution structure of loop IV and modeled the structure of the helical region containing the GA bulge, using NMR and residual dipolar couplings. The central GA bulge with flanking C–G base pairs induces a ∼50° semi-rigid bend in the helix. Loop IV is highly structured, and contains a conserved C–U base pair at the top of the helical stem. Analysis of new and previous biochemical data in light of the structure provides a rationale for some of the sequence conservation in this region of TER. The results suggest that during holoenzyme assembly the protein p65 recognizes a bend in stem IV, and this binding to central stem IV helps to position the structured loop IV for interaction with TERT and other region(s) of TER. PMID:16809815

  20. Functions of the conserved thrombospondin carboxy-terminal cassette in cell-extracellular matrix interactions and signaling.

    PubMed

    Adams, Josephine C

    2004-06-01

    Thrombospondins (TSPs) are extracellular, multidomain, calcium-binding glycoproteins that function at cell surfaces, in extracellular matrix (ECM) and as bridging molecules in cell-cell interactions. TSPs are multifunctional and modulate cell behavior during development, wound-healing, immune response, tumor growth and in the homeostasis of adult tissues. TSPs are assembled as oligomers that are composed of homologous polypeptides. In all the TSP polypeptides, the most highly-conserved region is the carboxyl-region, which contains a characteristic set of domains comprising EGF domains, TSP type 3 repeats and a globular carboxy-terminal domain. This large region is termed here the thrombospondin carboxy-terminal cassette (TSP-CTC). The strong conservation of the TSP-CTC suggests that it may mediate ancestral functions that are shared by all TSPs. This review summarizes the current knowledge of the TSP-CTC and areas of future interest. PMID:15094125

  1. Transactivation Function-2 of Estrogen Receptor α Contains Transactivation Function-1-regulating Element*

    PubMed Central

    Arao, Yukitomo; Coons, Laurel A.; Zuercher, William J.; Korach, Kenneth S.

    2015-01-01

    ERα has a ligand-dependent transactivation function in the ligand binding domain of ERα C terminus (AF-2) and a ligand-independent activation function in the N terminus (AF-1). It is still not fully understood how AF-1 and AF-2 activities are regulated cooperatively by ligands. To evaluate the AF-1 involvement in the estrogenic activities of various compounds, we analyzed these transactivation functions using AF-1-truncated and AF-2-mutated ERα mutants. AF-2 is composed of two domains with flexible and static regions. We used an AF-2 flexible region mutant and an AF-2 static region mutant. Both mutants have been reported as non-E2 responsive due to disruption of E2-mediated coactivator recruitment to the AF-2. The AF-2 mutants were not activated by agonists, but surprisingly antagonists and selective estrogen receptor modulators (SERMs) activated the AF-2 mutants. This antagonist reversal activity was derived from AF-1. Furthermore, we demonstrated that the AF-2 contains an AF-1 suppression function using C-terminal-truncated ERα mutants. From these findings we hypothesized that the mutation of AF-2 disrupted its ability to suppress AF-1, causing the antagonist reversal. To assess the AF-2-mediated AF-1 suppression, we analyzed the transcription activity of physically separated AF-1 and AF-2 using a novel hybrid reporter assay. We observed that the AF-1 activity was not suppressed by the physically separated AF-2. Furthermore, SERMs did not induce the AF-1-mediated activity from the separated mutant AF-2, which differed from the intact protein. These results imply that SERM activity is dependent on a conformational change of the full-length ERα molecule, which allows for AF-1 activation. PMID:26028650

  2. Efficient uncertainty quantification in stochastic finite element analysis based on functional principal components

    NASA Astrophysics Data System (ADS)

    Bianchini, Ilaria; Argiento, Raffaele; Auricchio, Ferdinando; Lanzarone, Ettore

    2015-09-01

    The great influence of uncertainties on the behavior of physical systems has always drawn attention to the importance of a stochastic approach to engineering problems. Accordingly, in this paper, we address the problem of solving a Finite Element analysis in the presence of uncertain parameters. We consider an approach in which several solutions of the problem are obtained in correspondence of parameters samples, and propose a novel non-intrusive method, which exploits the functional principal component analysis, to get acceptable computational efforts. Indeed, the proposed approach allows constructing an optimal basis of the solutions space and projecting the full Finite Element problem into a smaller space spanned by this basis. Even if solving the problem in this reduced space is computationally convenient, very good approximations are obtained by upper bounding the error between the full Finite Element solution and the reduced one. Finally, we assess the applicability of the proposed approach through different test cases, obtaining satisfactory results.

  3. Micro-optical elements functioning in non-visible spectral range

    NASA Astrophysics Data System (ADS)

    Wang, Qin; Zhang, Andy Z. Z.; Bergström, Andreas; Huo, Vicky Z. J.; Almqvist, Susanne; Kaplan, Wlodek; Andersson, Jan Y.

    2010-05-01

    Nowadays novel micro-fabrication and wafer-based manufacturing approach allows realizing micro-optics in a way scientists have dreamt for generations, in particular, utilizing nano-imprint lithography as fabrication tooling enables greatly accelerating the micro-optics technology to its frontier. In this report, we present wafer-scale fabrication of various types of micro-optical elements based on photoresist, benzocyclobutene, photocurable imprint resist, and semiconductor materials by using thermal reflow, reactive ion etching, and imprint techniques. Especially, several concave or convex 3-dimensional micro-optical structures shaped by imprint method are detailed. These micro-optical elements can be monolithically or hybrid integrated onto optoelectronics devices, such as photodetectors and emitters as optical beam focuser, collimator, filter, or anti-reflectance elements. As application examples, polymer microlenses were integrated directly on the top of UV dual functional devices and quantum dot long wavelength infrared photodetectors, respectively.

  4. Functional and Phylogenetic Analyses of a Conserved Regulatory Program in the Phloem of Minor Veins1[w

    PubMed Central

    Ayre, Brian G.; Blair, Jaime E.; Turgeon, Robert

    2003-01-01

    The minor-vein phloem of mature leaves is developmentally and physiologically distinct from the phloem in the rest of the vascular system. Phloem loading of transport sugars occurs in the minor veins, and consistent with this, galactinol synthase is expressed in the minor veins of melon (Cucumis melo) as part of the symplastic-loading mechanism that operates in this species. A galactinol synthase promoter from melon drives gene expression in the minor-vein companion cells of both transgenic tobacco (Nicotiana tabacum) and Arabidopsis. Neither of these plants use galactinol in the phloem-loading process, implying that the promoter responds to a minor-vein-specific regulatory cascade that is highly conserved across a broad range of eudicotyledons. Detailed analysis of this promoter by truncation and mutagenesis identified three closely coupled sequences that unambiguously modulate tissue specificity. These sequences cooperate in a combinatorial fashion: two promote expression throughout the vascular system of the plant, whereas the third functions to repress expression in the larger bundles. In a complementary approach, phylogenetic footprinting was used to obtain single-nucleotide resolution of conserved sites in orthologous promoters from diverse members of the Cucurbitaceae. This comparative analysis confirmed the importance of the closely coupled sites but also revealed other highly conserved sequences that may modulate promoter strength or contribute to expression patterns outside of the phloem. The conservation of this regulatory design among species that phloem load by different mechanisms supports a model for organismal development in which tissues and cell types are controlled by relatively ancient and conserved paradigms but expression of genes influencing final form and function are relatively plastic. PMID:14526110

  5. Impact of conservation land management practices on soil microbial function in an agricultural watershed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The USDA Conservation Reserve Program (CRP) involves removing agricultural land from production and replanting with native vegetation for the purpose of reducing agriculture’s impact on the environment. In 2002, part of the Beasley Lake watershed in the Mississippi Delta was enrolled in CRP. In ad...

  6. Evolutionarily conserved sequences on human chromosome 21

    SciTech Connect

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila

    2001-09-01

    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  7. Coevolution Pattern and Functional Conservation or Divergence of miR167s and their targets across Diverse Plant Species

    PubMed Central

    Barik, Suvakanta; Kumar, Ashutosh; Sarkar Das, Shabari; Yadav, Sandeep; Gautam, Vibhav; Singh, Archita; Singh, Sharmila; Sarkar, Ananda K.

    2015-01-01

    microRNAs (miRNAs), a class of endogenously produced small non-coding RNAs of 20–21 nt length, processed from precursor miRNAs, regulate many developmental processes by negatively regulating the target genes in both animals and plants. The coevolutionary pattern of a miRNA family and their targets underscores its functional conservation or diversification. The miR167 regulates various aspects of plant development in Arabidopsis by targeting ARF6 and ARF8. The evolutionary conservation or divergence of miR167s and their target genes are poorly understood till now. Here we show the evolutionary relationship among 153 MIR167 genes obtained from 33 diverse plant species. We found that out of the 153 of miR167 sequences retrieved from the “miRBase”, 27 have been annotated to be processed from the 3′ end, and have diverged distinctively from the other miR167s produced from 5′ end. Our analysis reveals that gma-miR167h/i and mdm-miR167a are processed from 3′ end and have evolved separately, diverged most resulting in novel targets other than their known ones, and thus led to functional diversification, especially in apple and soybean. We also show that mostly conserved miR167 sequences and their target AUXIN RESPONSE FACTORS (ARFs) have gone through parallel evolution leading to functional diversification among diverse plant species. PMID:26459056

  8. Poisson Green's function method for increased computational efficiency in numerical calculations of Coulomb coupling elements

    NASA Astrophysics Data System (ADS)

    Zimmermann, Anke; Kuhn, Sandra; Richter, Marten

    2016-01-01

    Often, the calculation of Coulomb coupling elements for quantum dynamical treatments, e.g., in cluster or correlation expansion schemes, requires the evaluation of a six dimensional spatial integral. Therefore, it represents a significant limiting factor in quantum mechanical calculations. If the size or the complexity of the investigated system increases, many coupling elements need to be determined. The resulting computational constraints require an efficient method for a fast numerical calculation of the Coulomb coupling. We present a computational method to reduce the numerical complexity by decreasing the number of spatial integrals for arbitrary geometries. We use a Green's function formulation of the Coulomb coupling and introduce a generalized scalar potential as solution of a generalized Poisson equation with a generalized charge density as the inhomogeneity. That enables a fast calculation of Coulomb coupling elements and, additionally, a straightforward inclusion of boundary conditions and arbitrarily spatially dependent dielectrics through the Coulomb Green's function. Particularly, if many coupling elements are included, the presented method, which is not restricted to specific symmetries of the model, presents a promising approach for increasing the efficiency of numerical calculations of the Coulomb interaction. To demonstrate the wide range of applications, we calculate internanostructure couplings, such as the Förster coupling, and illustrate the inclusion of symmetry considerations in the method for the Coulomb coupling between bound quantum dot states and unbound continuum states.

  9. Investigating the functionality of an OCT4-short response element in human induced pluripotent stem cells

    PubMed Central

    Vega-Crespo, Agustin; Truong, Brian; Hermann, Kip J; Awe, Jason P; Chang, Katherine M; Lee, Patrick C; Schoenberg, Benjamen E; Wu, Lily; Byrne, James A; Lipshutz, Gerald S

    2016-01-01

    Pluripotent stem cells offer great therapeutic promise for personalized treatment platforms for numerous injuries, disorders, and diseases. Octamer-binding transcription factor 4 (OCT4) is a key regulatory gene maintaining pluripotency and self-renewal of mammalian cells. With site-specific integration for gene correction in cellular therapeutics, use of the OCT4 promoter may have advantages when expressing a suicide gene if pluripotency remains. However, the human OCT4 promoter region is 4 kb in size, limiting the capacity of therapeutic genes and other regulatory components for viral vectors, and decreasing the efficiency of homologous recombination. The purpose of this investigation was to characterize the functionality of a novel 967bp OCT4-short response element during pluripotency and to examine the OCT4 titer-dependent response during differentiation to human derivatives not expressing OCT4. Our findings demonstrate that the OCT4-short response element is active in pluripotency and this activity is in high correlation with transgene expression in vitro, and the OCT4-short response element is inactivated when pluripotent cells differentiate. These studies demonstrate that this shortened OCT4 regulatory element is functional and may be useful as part of an optimized safety component in a site-specific gene transferring system that could be used as an efficient and clinically applicable safety platform for gene transfer in cellular therapeutics. PMID:27500178

  10. Using expected allele number as objective function to design between and within breed conservation of farm animal biodiversity.

    PubMed

    Simianer, H

    2005-06-01

    Conservation of genetic diversity in farm animal species can be achieved by preventing extinction of breeds and by reducing genetic drift within breeds. It is suggested to use the expected number of alleles segregating in the species after a given time period as objective function in the design of conservation strategies. A formal approach is presented to predict this quantity based on marker information, accounting for extinction probability of breeds and effective population size within breeds as the major component of genetic drift. Based on this model, relative efficiency of different strategies of diversity conservation can be quantified. Formulas are given to derive the marginal expected number of alleles with respect to genetic drift within population and extinction probability, respectively. The suggested approach is illustrated with an example of 13 European cattle breeds. With the assumed parameters, drift is shown to be the major force leading to loss of alleles, and different breeds are prioritized for activities to reduce risk of extinction and for measures to reduce genetic drift, respectively. Although different aspects of the model need to be further refined, the suggested methodology provides a general and flexible tool to derive the optimum conservation strategy in various scenarios. PMID:16130469

  11. The role of reserves and anthropogenic elements for functional connectivity and resilience of ephemeral habitats

    USGS Publications Warehouse

    Uden, Daniel R.; Hellman, Michelle L.; Angeler, David G.; Allen, Craig R.

    2014-01-01

    Ecological reserves provide important wildlife habitat in many landscapes, and the functional connectivity of reserves and other suitable habitat patches is crucial for the persistence and resilience of spatially structured populations. To maintain or increase connectivity at spatial scales larger than individual patches, conservation actions may focus on creating and maintaining reserves and/or influencing management on non-reserves. Using a graph-theoretic approach, we assessed the functional connectivity and spatial distribution of wetlands in the Rainwater Basin of Nebraska, USA, an intensively cultivated agricultural matrix, at four assumed, but ecologically realistic, anuran dispersal distances. We compared connectivity in the current landscape to the historical landscape and putative future landscapes, and evaluated the importance of individual and aggregated reserve and non-reserve wetlands for maintaining connectivity. Connectivity was greatest in the historical landscape, where wetlands were also the most densely distributed. The construction of irrigation reuse pits for water storage has maintained connectivity in the current landscape by replacing destroyed wetlands, but these pits likely provide suboptimal habitat. Also, because there are fewer total wetlands (i.e., wetlands and irrigation reuse pits) in the current landscape than the historical landscape, and because the distribution of current wetlands is less clustered than that of historical wetlands, larger and longer dispersing, sometimes nonnative species may be favored over smaller, shorter dispersing species of conservation concern. Because of their relatively low number, wetland reserves do not affect connectivity as greatly as non-reserve wetlands or irrigation reuse pits; however, they likely provide the highest quality anuran habitat. To improve future levels of resilience in this wetland habitat network, management could focus on continuing to improve the conservation status of non

  12. All-electron time-dependent density functional theory with finite elements: time-propagation approach.

    PubMed

    Lehtovaara, Lauri; Havu, Ville; Puska, Martti

    2011-10-21

    We present an all-electron method for time-dependent density functional theory which employs hierarchical nonuniform finite-element bases and the time-propagation approach. The method is capable of treating linear and nonlinear response of valence and core electrons to an external field. We also introduce (i) a preconditioner for the propagation equation, (ii) a stable way to implement absorbing boundary conditions, and (iii) a new kind of absorbing boundary condition inspired by perfectly matched layers. PMID:22029294

  13. Genomic leftovers: identifying novel microsatellites, over-represented motifs and functional elements in the human genome.

    PubMed

    Fonville, Natalie C; Velmurugan, Karthik Raja; Tae, Hongseok; Vaksman, Zalman; McIver, Lauren J; Garner, Harold R

    2016-01-01

    The human genome is 99% complete. This study contributes to filling the 1% gap by enriching previously unknown repeat regions called microsatellites (MST). We devised a Global MST Enrichment (GME) kit to enrich and nextgen sequence 2 colorectal cell lines and 16 normal human samples to illustrate its utility in identifying contigs from reads that do not map to the genome reference. The analysis of these samples yielded 790 novel extra-referential concordant contigs that are observed in more than one sample. We searched for evidence of functional elements in the concordant contigs in two ways: (1) BLAST-ing each contig against normal RNA-Seq samples, (2) Checking for predicted functional elements using GlimmerHMM. Of the 790 concordant contigs, 37 had an exact match to at least one RNA-Seq read; 15 aligned to more than 100 RNA-Seq reads. Of the 249 concordant contigs predicted by GlimmerHMM to have functional elements, 6 had at least one exact RNA-Seq match. BLAST-ing these novel contigs against all publically available sequences confirmed that they were found in human and chimpanzee BAC and FOSMID clones sequenced as part of the original human genome project. These extra-referential contigs predominantly contained pentameric repeats, especially two motifs: AATGG and GTGGA. PMID:27278669

  14. Functional characterization of the GDEP promoter and three enhancer elements in retinoblastoma and prostate cell lines.

    PubMed

    Cross, D S; Burmester, J K

    2008-01-01

    GDEP (gene differentially expressed in prostate cancer aka. PCAN1), a newly discovered gene with remarkable tissue specificity, is a promising candidate for regulatory analysis because it exhibits a high level of expression that is limited to two tissues, the retina and the prostate. As these two tissues have different origins and disparate functions it is likely that the regulatory mechanisms responsible for expression are not shared in their entirety. In addition, both the retina and prostate are prime targets for gene therapy. To date there have been no functional studies of the GDEP promoter. Therefore to understand tissue-specific expression of GDEP we constructed promoter expression constructs. To further characterize functional regulatory regions within the GDEP gene, we investigated potential regulatory components for tissue-specific expression in the 40 kb intron of this gene. We have identified a 1.5 kb prostate-specific promoter from the proximal region of the GDEP gene. A smaller 0.5 kb promoter exhibited minimal activity in the retinoblastoma cell line Y79, but not in the prostate cells tested. In addition we have investigated three enhancer elements located in the 40 kb intron of the GDEP gene. We identified two enhancer elements that increase reporter gene expression in prostate cell line LNCaP and one additional enhancer element that increases expression in the Y79 cell line approximately 8-fold making it a strong retinal-specific enhancer. PMID:18188713

  15. Genomic leftovers: identifying novel microsatellites, over-represented motifs and functional elements in the human genome

    PubMed Central

    Fonville, Natalie C.; Velmurugan, Karthik Raja; Tae, Hongseok; Vaksman, Zalman; McIver, Lauren J.; Garner, Harold R.

    2016-01-01

    The human genome is 99% complete. This study contributes to filling the 1% gap by enriching previously unknown repeat regions called microsatellites (MST). We devised a Global MST Enrichment (GME) kit to enrich and nextgen sequence 2 colorectal cell lines and 16 normal human samples to illustrate its utility in identifying contigs from reads that do not map to the genome reference. The analysis of these samples yielded 790 novel extra-referential concordant contigs that are observed in more than one sample. We searched for evidence of functional elements in the concordant contigs in two ways: (1) BLAST-ing each contig against normal RNA-Seq samples, (2) Checking for predicted functional elements using GlimmerHMM. Of the 790 concordant contigs, 37 had an exact match to at least one RNA-Seq read; 15 aligned to more than 100 RNA-Seq reads. Of the 249 concordant contigs predicted by GlimmerHMM to have functional elements, 6 had at least one exact RNA-Seq match. BLAST-ing these novel contigs against all publically available sequences confirmed that they were found in human and chimpanzee BAC and FOSMID clones sequenced as part of the original human genome project. These extra-referential contigs predominantly contained pentameric repeats, especially two motifs: AATGG and GTGGA. PMID:27278669

  16. A Global Interpolation Function (GIF) boundary element code for viscous flows

    NASA Technical Reports Server (NTRS)

    Reddy, D. R.; Lafe, O.; Cheng, A. H-D.

    1995-01-01

    Using global interpolation functions (GIF's), boundary element solutions are obtained for two- and three-dimensional viscous flows. The solution is obtained in the form of a boundary integral plus a series of global basis functions. The unknown coefficients of the GIF's are determined to ensure the satisfaction of the governing equations at selected collocation points. The values of the coefficients involved in the boundary integral equations are determined by enforcing the boundary conditions. Both primitive variable and vorticity-velocity formulations are examined.

  17. pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements.

    PubMed

    Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

    2015-01-01

    Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154

  18. pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements

    PubMed Central

    Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

    2015-01-01

    Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154

  19. Dynamics and function of distal regulatory elements during neurogenesis and neuroplasticity.

    PubMed

    Thakurela, Sudhir; Sahu, Sanjeeb Kumar; Garding, Angela; Tiwari, Vijay K

    2015-09-01

    Gene regulation in mammals involves a complex interplay between promoters and distal regulatory elements that function in concert to drive precise spatiotemporal gene expression programs. However, the dynamics of the distal gene regulatory landscape and its function in the transcriptional reprogramming that underlies neurogenesis and neuronal activity remain largely unknown. Here, we performed a combinatorial analysis of genome-wide data sets for chromatin accessibility (FAIRE-seq) and the enhancer mark H3K27ac, revealing the highly dynamic nature of distal gene regulation during neurogenesis, which gets progressively restricted to distinct genomic regions as neurons acquire a post-mitotic, terminally differentiated state. We further find that the distal accessible and active regions serve as target sites for distinct transcription factors that function in a stage-specific manner to contribute to the transcriptional program underlying neuronal commitment and maturation. Mature neurons respond to a sustained activity of NMDA receptors by epigenetic reprogramming at a large number of distal regulatory regions as well as dramatic reorganization of super-enhancers. Such massive remodeling of the distal regulatory landscape in turn results in a transcriptome that confers a transient loss of neuronal identity and gain of cellular plasticity. Furthermore, NMDA receptor activity also induces many novel prosurvival genes that function in neuroprotective pathways. Taken together, these findings reveal the dynamics of the distal regulatory landscape during neurogenesis and uncover novel regulatory elements that function in concert with epigenetic mechanisms and transcription factors to generate the transcriptome underlying neuronal development and activity. PMID:26170447

  20. Dynamics and function of distal regulatory elements during neurogenesis and neuroplasticity

    PubMed Central

    Thakurela, Sudhir; Sahu, Sanjeeb Kumar; Garding, Angela; Tiwari, Vijay K.

    2015-01-01

    Gene regulation in mammals involves a complex interplay between promoters and distal regulatory elements that function in concert to drive precise spatiotemporal gene expression programs. However, the dynamics of the distal gene regulatory landscape and its function in the transcriptional reprogramming that underlies neurogenesis and neuronal activity remain largely unknown. Here, we performed a combinatorial analysis of genome-wide data sets for chromatin accessibility (FAIRE-seq) and the enhancer mark H3K27ac, revealing the highly dynamic nature of distal gene regulation during neurogenesis, which gets progressively restricted to distinct genomic regions as neurons acquire a post-mitotic, terminally differentiated state. We further find that the distal accessible and active regions serve as target sites for distinct transcription factors that function in a stage-specific manner to contribute to the transcriptional program underlying neuronal commitment and maturation. Mature neurons respond to a sustained activity of NMDA receptors by epigenetic reprogramming at a large number of distal regulatory regions as well as dramatic reorganization of super-enhancers. Such massive remodeling of the distal regulatory landscape in turn results in a transcriptome that confers a transient loss of neuronal identity and gain of cellular plasticity. Furthermore, NMDA receptor activity also induces many novel prosurvival genes that function in neuroprotective pathways. Taken together, these findings reveal the dynamics of the distal regulatory landscape during neurogenesis and uncover novel regulatory elements that function in concert with epigenetic mechanisms and transcription factors to generate the transcriptome underlying neuronal development and activity. PMID:26170447

  1. Essential elements for translation: the germline factor Vasa functions broadly in somatic cells

    PubMed Central

    Yajima, Mamiko; Wessel, Gary M.

    2015-01-01

    ABSTRACT Vasa is a conserved RNA-helicase found in the germ lines of all metazoans tested. Whereas Vasa presence is often indicated as a metric for germline determination in animals, it is also expressed in stem cells of diverse origin. Recent research suggests, however, that Vasa has a much broader function, including a significant role in cell cycle regulation. Results herein indicate that Vasa is utilized widely, and often induced transiently, during development in diverse somatic cells and adult precursor tissues. We identified that Vasa in the sea urchin is essential for: (1) general mRNA translation during embryogenesis, (2) developmental re-programming upon manipulations to the embryo and (3) larval wound healing. We also learned that Vasa interacted with mRNAs in the perinuclear area and at the spindle in an Importin-dependent manner during cell cycle progression. These results suggest that, when present, Vasa functions are essential to contributing to developmental regulation. PMID:25977366

  2. The limitations of Slater's element-dependent exchange functional from analytic density-functional theory

    NASA Astrophysics Data System (ADS)

    Zope, Rajendra R.; Dunlap, Brett I.

    2006-01-01

    Our recent formulation of the analytic and variational Slater-Roothaan (SR) method, which uses Gaussian basis sets to variationally express the molecular orbitals, electron density, and the one-body effective potential of density-functional theory, is reviewed. Variational fitting can be extended to the resolution of identity method, where variationality then refers to the error in each two-electron integral and not to the total energy. However, a Taylor-series analysis shows that all analytic ab initio energies calculated with variational fits to two-electron integrals are stationary. It is proposed that the appropriate fitting functions be charge neutral and that all ab initio energies be evaluated using two-center fits of the two-electron integrals. The SR method has its root in Slater's Xα method and permits an arbitrary scaling of the Slater-Gàspàr-Kohn-Sham exchange-correlation potential around each atom in the system. The scaling factors are Slater's exchange parameters α. Of several ways of choosing these parameters, two most obvious are the Hartree-Fock (HF) αHF values and the exact atomic αEA values. The former are obtained by equating the self-consistent Xα energy and the HF energies, while the latter set reproduces exact atomic energies. In this work, we examine the performance of the SR method for predicting atomization energies, bond distances, and ionization potentials using the two sets of α parameters. The atomization energies are calculated for the extended G2 set of 148 molecules for different basis-set combinations. The mean error (ME) and mean absolute error (MAE) in atomization energies are about 25 and 33kcal /mol, respectively, for the exact atomic αEA values. The HF values of exchange parameters αHF give somewhat better performance for the atomization energies with ME and MAE being about 15 and 26kcal/mol, respectively. While both sets give performance better than the local-density approximation or the HF theory, the errors in

  3. Convergence of Godunov type methods for a conservation law with a spatially varying discontinuous flux function

    NASA Astrophysics Data System (ADS)

    Adimurthi; Mishra, Siddhartha; Gowda, G. D. Veerappa

    2007-09-01

    We deal with single conservation laws with a spatially varying and possibly discontinuous coefficient. This equation includes as a special case single conservation laws with conservative and possibly singular source terms. We extend the framework of optimal entropy solutions for these classes of equations based on a two-step approach. In the first step, an interface connection vector is used to define infinite classes of entropy solutions. We show that each of these classes of solutions is stable in L^1 . This allows for the possibility of choosing one of these classes of solutions based on the physics of the problem. In the second step, we define optimal entropy solutions based on the solution of a certain optimization problem at the discontinuities of the coefficient. This method leads to optimal entropy solutions that are consistent with physically observed solutions in two-phase flows in heterogeneous porous media. Another central aim of this paper is to develop suitable numerical schemes for these equations. We develop and analyze a set of Godunov type finite volume methods that are based on exact solutions of the corresponding Riemann problem. Numerical experiments are shown comparing the performance of these schemes on a set of test problems.

  4. Lineage-specific genomics: Frequent birth and death in the human genome: The human genome contains many lineage-specific elements created by both sequence and functional turnover.

    PubMed

    Young, Robert S

    2016-07-01

    Frequent evolutionary birth and death events have created a large quantity of biologically important, lineage-specific DNA within mammalian genomes. The birth and death of DNA sequences is so frequent that the total number of these insertions and deletions in the human population remains unknown, although there are differences between these groups, e.g. transposable elements contribute predominantly to sequence insertion. Functional turnover - where the activity of a locus is specific to one lineage, but the underlying DNA remains conserved - can also drive birth and death. However, this does not appear to be a major driver of divergent transcriptional regulation. Both sequence and functional turnover have contributed to the birth and death of thousands of functional promoters in the human and mouse genomes. These findings reveal the pervasive nature of evolutionary birth and death and suggest that lineage-specific regions may play an important but previously underappreciated role in human biology and disease. PMID:27231054

  5. Archaeal Haloarcula californiae Icosahedral Virus 1 Highlights Conserved Elements in Icosahedral Membrane-Containing DNA Viruses from Extreme Environments

    PubMed Central

    Demina, Tatiana A.; Pietilä, Maija K.; Svirskaitė, Julija; Ravantti, Janne J.; Atanasova, Nina S.; Bamford, Dennis H.

    2016-01-01

    ABSTRACT Despite their high genomic diversity, all known viruses are structurally constrained to a limited number of virion morphotypes. One morphotype of viruses infecting bacteria, archaea, and eukaryotes is the tailless icosahedral morphotype with an internal membrane. Although it is considered an abundant morphotype in extreme environments, only seven such archaeal viruses are known. Here, we introduce Haloarcula californiae icosahedral virus 1 (HCIV-1), a halophilic euryarchaeal virus originating from salt crystals. HCIV-1 also retains its infectivity under low-salinity conditions, showing that it is able to adapt to environmental changes. The release of progeny virions resulting from cell lysis was evidenced by reduced cellular oxygen consumption, leakage of intracellular ATP, and binding of an indicator ion to ruptured cell membranes. The virion contains at least 12 different protein species, lipids selectively acquired from the host cell membrane, and a 31,314-bp-long linear double-stranded DNA (dsDNA). The overall genome organization and sequence show high similarity to the genomes of archaeal viruses in the Sphaerolipoviridae family. Phylogenetic analysis based on the major conserved components needed for virion assembly—the major capsid proteins and the packaging ATPase—placed HCIV-1 along with the alphasphaerolipoviruses in a distinct, well-supported clade. On the basis of its virion morphology and sequence similarities, most notably, those of its core virion components, we propose that HCIV-1 is a member of the PRD1-adenovirus structure-based lineage together with other sphaerolipoviruses. This addition to the lineage reinforces the notion of the ancient evolutionary links observed between the viruses and further highlights the limits of the choices found in nature for formation of a virion. PMID:27435460

  6. Stress Responses of Small Heat Shock Protein Genes in Lepidoptera Point to Limited Conservation of Function across Phylogeny

    PubMed Central

    Zhang, Bo; Zheng, Jincheng; Peng, Yu; Liu, Xiaoxia; Hoffmann, Ary A.; Ma, Chun-Sen

    2015-01-01

    The small heat shock protein (sHsp) family is thought to play an important role in protein refolding and signal transduction, and thereby protect organisms from stress. However little is known about sHsp function and conservation across phylogenies. In the current study, we provide a comprehensive assessment of small Hsp genes and their stress responses in the oriental fruit moth (OFM), Grapholita molesta. Fourteen small heat shock proteins of OFM clustered with related Hsps in other Lepidoptera despite a high level of variability among them, and in contrast to the highly conserved Hsp11.1. The only known lepidopteran sHsp ortholog (Hsp21.3) was consistently unaffected under thermal stress in Lepidoptera where it has been characterized. However the phylogenetic position of the sHsps within the Lepidoptera was not associated with conservation of induction patterns under thermal extremes or diapause. These findings suggest that the sHsps have evolved rapidly to develop new functions within the Lepidoptera. PMID:26196395

  7. Concentrations of Elements in Fish Fillets, Fish Muscle Plugs, and Crayfish from the 2007 Missouri Department of Conservation General Contaminant Monitoring Program

    USGS Publications Warehouse

    May, Thomas W.; Walther, Michael J.; Brumbaugh, William G.; McKee, Michael J.

    2009-01-01

    This report presents the results of a contaminant monitoring survey conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in fish fillets, fish muscle plugs, and crayfish. Fillets of channel catfish (Ictalurus punctatus), bass (Micropterus salmoides, Micropterus dolomieu, Morone chrysops), walleye (Sander vitreus), common carp (Cyprinus carpio), lake sturgeon (Acipenser fulvescens), northern hog sucker (Hypentelium nigricans), and rainbow trout (Oncorhynchus mykiss) were collected from 21 sites as part of the Department's Fish Contaminant Monitoring Program. Long-pincered crayfish (Orconectes longidigitus) were collected from one site to assess trophic transfer of metals to fish. Fish muscle plugs were collected from smallmouth bass (Micropterus dolomieu) at two different locations from one site.

  8. A Conserved Domain in Type III Secretion Links the Cytoplasmic Domain of InvA to Elements of the Basal Body

    SciTech Connect

    Lilic, M.; Quezada, C; Stebbins, C

    2010-01-01

    Protein type III secretion systems (T3SSs) are organic nanosyringes that achieve an energy-dependent translocation of bacterial proteins through the two membranes of Gram-negative organisms. Examples include the pathogenic systems of animals, plants and symbiotic bacteria that inject factors into eukaryotic cells, and the flagellar export system that secretes flagellin. T3SSs possess a core of several membrane-associated proteins that are conserved across all known bacterial species that use this system. The Salmonella protein InvA is one of the most highly conserved proteins of this core of critical T3SS components. The crystal structure of a C-terminal domain of InvA reveals an unexpected homology to domains that have been repeatedly found as building blocks of other elements of the T3SS apparatus. This suggests the surprising hypothesis that evolution has produced a significant component of the apparatus structure through a series of gene-duplication and gene-rearrangement events.

  9. A conserved domain in type III secretion links the cytoplasmic domain of InvA to elements of the basal body

    SciTech Connect

    Lilic, Mirjana; Quezada, Cindy M.; Stebbins, C. Erec

    2010-06-01

    The cytoplasmic domain of Salmonella InvA shares homology to a recurring scaffold in the membrane-spanning components of the type II and type III secretion systems. Protein type III secretion systems (T3SSs) are organic nanosyringes that achieve an energy-dependent translocation of bacterial proteins through the two membranes of Gram-negative organisms. Examples include the pathogenic systems of animals, plants and symbiotic bacteria that inject factors into eukaryotic cells, and the flagellar export system that secretes flagellin. T3SSs possess a core of several membrane-associated proteins that are conserved across all known bacterial species that use this system. The Salmonella protein InvA is one of the most highly conserved proteins of this core of critical T3SS components. The crystal structure of a C-terminal domain of InvA reveals an unexpected homology to domains that have been repeatedly found as building blocks of other elements of the T3SS apparatus. This suggests the surprising hypothesis that evolution has produced a significant component of the apparatus structure through a series of gene-duplication and gene-rearrangement events.

  10. A conserved domain in type III secretion links the cytoplasmic domain of InvA to elements of the basal body

    PubMed Central

    Lilic, Mirjana; Quezada, Cindy M.; Stebbins, C. Erec

    2010-01-01

    Protein type III secretion systems (T3SSs) are organic nanosyringes that achieve an energy-dependent translocation of bacterial proteins through the two membranes of Gram-negative organisms. Examples include the pathogenic systems of animals, plants and symbiotic bacteria that inject factors into eukaryotic cells, and the flagellar export system that secretes flagellin. T3SSs possess a core of several membrane-associated proteins that are conserved across all known bacterial species that use this system. The Salmonella protein InvA is one of the most highly conserved proteins of this core of critical T3SS components. The crystal structure of a C-­terminal domain of InvA reveals an unexpected homology to domains that have been repeatedly found as building blocks of other elements of the T3SS apparatus. This suggests the surprising hypothesis that evolution has produced a significant component of the apparatus structure through a series of gene-duplication and gene-rearrangement events. PMID:20516623

  11. Regulatory elements required for development of caenorhabditis elegans hermaphrodites are conserved in the tra-2 homologue of C. remanei, a male/female sister species.

    PubMed Central

    Haag, E S; Kimble, J

    2000-01-01

    The Caenorhabditis elegans hermaphrodite is essentially a female that produces sperm. In C. elegans, tra-2 promotes female fates and must be repressed to achieve hermaphrodite spermatogenesis. In an effort to learn how mating systems evolve, we have cloned tra-2 from C. remanei, the closest gonochoristic relative of C. elegans. We found its structure to be similar to that of Ce-tra-2 but its sequence to be divergent. RNA interference demonstrates that Cr-tra-2 promotes female fates. Two sites of tra-2 regulation are required for the onset of hermaphrodite spermatogenesis in C. elegans. One, the MX region of TRA-2, is as well conserved in C. remanei as it is in C. briggsae (another male/hermaphrodite species), suggesting that this control is not unique to hermaphrodites. Another, the DRE/TGE element of the tra-2 3' UTR, was not detected by sequence analysis. However, gel-shift assays demonstrate that a factor in C. remanei can bind specifically to the Cr-tra-2 3' UTR, suggesting that this translational control is also conserved. We propose that both controls are general and do not constitute a novel "switch" that enables sexual mosaicism in hermaphrodites. However, subtle quantitative or qualitative differences in their employment may underlie differences in mating system seen in Caenorhabditis. PMID:10790387

  12. Functional Conservation of the Glide/Gcm Regulatory Network Controlling Glia, Hemocyte, and Tendon Cell Differentiation in Drosophila

    PubMed Central

    Cattenoz, Pierre B.; Popkova, Anna; Southall, Tony D.; Aiello, Giuseppe; Brand, Andrea H.; Giangrande, Angela

    2016-01-01

    High-throughput screens allow us to understand how transcription factors trigger developmental processes, including cell specification. A major challenge is identification of their binding sites because feedback loops and homeostatic interactions may mask the direct impact of those factors in transcriptome analyses. Moreover, this approach dissects the downstream signaling cascades and facilitates identification of conserved transcriptional programs. Here we show the results and the validation of a DNA adenine methyltransferase identification (DamID) genome-wide screen that identifies the direct targets of Glide/Gcm, a potent transcription factor that controls glia, hemocyte, and tendon cell differentiation in Drosophila. The screen identifies many genes that had not been previously associated with Glide/Gcm and highlights three major signaling pathways interacting with Glide/Gcm: Notch, Hedgehog, and JAK/STAT, which all involve feedback loops. Furthermore, the screen identifies effector molecules that are necessary for cell-cell interactions during late developmental processes and/or in ontogeny. Typically, immunoglobulin (Ig) domain–containing proteins control cell adhesion and axonal navigation. This shows that early and transiently expressed fate determinants not only control other transcription factors that, in turn, implement a specific developmental program but also directly affect late developmental events and cell function. Finally, while the mammalian genome contains two orthologous Gcm genes, their function has been demonstrated in vertebrate-specific tissues, placenta, and parathyroid glands, begging questions on the evolutionary conservation of the Gcm cascade in higher organisms. Here we provide the first evidence for the conservation of Gcm direct targets in humans. In sum, this work uncovers novel aspects of cell specification and sets the basis for further understanding of the role of conserved Gcm gene regulatory cascades. PMID:26567182

  13. Functional Conservation of the Glide/Gcm Regulatory Network Controlling Glia, Hemocyte, and Tendon Cell Differentiation in Drosophila.

    PubMed

    Cattenoz, Pierre B; Popkova, Anna; Southall, Tony D; Aiello, Giuseppe; Brand, Andrea H; Giangrande, Angela

    2016-01-01

    High-throughput screens allow us to understand how transcription factors trigger developmental processes, including cell specification. A major challenge is identification of their binding sites because feedback loops and homeostatic interactions may mask the direct impact of those factors in transcriptome analyses. Moreover, this approach dissects the downstream signaling cascades and facilitates identification of conserved transcriptional programs. Here we show the results and the validation of a DNA adenine methyltransferase identification (DamID) genome-wide screen that identifies the direct targets of Glide/Gcm, a potent transcription factor that controls glia, hemocyte, and tendon cell differentiation in Drosophila. The screen identifies many genes that had not been previously associated with Glide/Gcm and highlights three major signaling pathways interacting with Glide/Gcm: Notch, Hedgehog, and JAK/STAT, which all involve feedback loops. Furthermore, the screen identifies effector molecules that are necessary for cell-cell interactions during late developmental processes and/or in ontogeny. Typically, immunoglobulin (Ig) domain-containing proteins control cell adhesion and axonal navigation. This shows that early and transiently expressed fate determinants not only control other transcription factors that, in turn, implement a specific developmental program but also directly affect late developmental events and cell function. Finally, while the mammalian genome contains two orthologous Gcm genes, their function has been demonstrated in vertebrate-specific tissues, placenta, and parathyroid glands, begging questions on the evolutionary conservation of the Gcm cascade in higher organisms. Here we provide the first evidence for the conservation of Gcm direct targets in humans. In sum, this work uncovers novel aspects of cell specification and sets the basis for further understanding of the role of conserved Gcm gene regulatory cascades. PMID:26567182

  14. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central

    2010-01-01

    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  15. Is a system's wave function in one-to-one correspondence with its elements of reality?

    PubMed

    Colbeck, Roger; Renner, Renato

    2012-04-13

    Although quantum mechanics is one of our most successful physical theories, there has been a long-standing debate about the interpretation of the wave function--the central object of the theory. Two prominent views are that (i) it corresponds to an element of reality, i.e., an objective attribute that exists before measurement, and (ii) it is a subjective state of knowledge about some underlying reality. A recent result [M. F. Pusey, J. Barrett, and T. Rudolph, arXiv:1111.3328] has placed the subjective interpretation into doubt, showing that it would contradict certain physically plausible assumptions, in particular, that multiple systems can be prepared such that their elements of reality are uncorrelated. Here we show, based only on the assumption that measurement settings can be chosen freely, that a system's wave function is in one-to-one correspondence with its elements of reality. This also eliminates the possibility that it can be interpreted subjectively. PMID:22587234

  16. Conservation and Covariance in Small Bacterial Phosphoglycosyltransferases Identify the Functional Catalytic Core.

    PubMed

    Lukose, Vinita; Luo, Lingqi; Kozakov, Dima; Vajda, Sandor; Allen, Karen N; Imperiali, Barbara

    2015-12-22

    Phosphoglycosyltransferases (PGTs) catalyze the transfer of a C1'-phosphosugar from a soluble sugar nucleotide diphosphate to a polyprenol phosphate. These enzymes act at the membrane interface, forming the first membrane-associated intermediates in the biosynthesis of cell-surface glycans and glycoconjugates, including glycoproteins, glycolipids, and the peptidoglycan in bacteria. PGTs vary greatly in both their membrane topologies and their substrate preferences. PGTs, such as MraY and WecA, are polytopic, while other families of uniquely prokaryotic enzymes have only a single predicted transmembrane helix. PglC, a PGT involved in the biosynthesis of N-linked glycoproteins in the enteropathogen Campylobacter jejuni, is representative of one of the structurally most simple members of the diverse family of small bacterial PGT enzymes. Herein, we apply bioinformatics and covariance-weighted distance constraints in geometry- and homology-based model building, together with mutational analysis, to investigate monotopic PGTs. The pool of 15000 sequences that are analyzed include the PglC-like enzymes, as well as sequences from two other related PGTs that contain a "PglC-like" domain embedded in their larger structures (namely, the bifunctional PglB family, typified by PglB from Neisseria gonorrheae, and WbaP-like enzymes, typified by WbaP from Salmonella enterica). Including these two subfamilies of PGTs in the analysis highlights key residues conserved across all three families of small bacterial PGTs. Mutagenesis analysis of these conserved residues provides further information about the essentiality of many of these residues in catalysis. Construction of a structural model of the cytosolic globular domain utilizing three-dimensional distance constraints, provided by conservation covariance analysis, provides additional insight into the catalytic core of these families of small bacterial PGT enzymes. PMID:26600273

  17. The value of countryside elements in the conservation of a threatened arboreal marsupial Petaurus norfolcensis in agricultural landscapes of south-eastern Australia--the disproportional value of scattered trees.

    PubMed

    Crane, Mason J; Lindenmayer, David B; Cunningham, Ross B

    2014-01-01

    Human activities, particularly agriculture, have transformed much of the world's terrestrial environment. Within these anthropogenic landscapes, a variety of relictual and semi-natural habitats exist, which we term countryside elements. The habitat value of countryside elements (hereafter termed 'elements') is increasingly recognised. We quantify the relative value of four kinds of such 'elements' (linear roadside remnants, native vegetation patches, scattered trees and tree plantings) used by a threatened Australian arboreal marsupial, the squirrel glider (Petaurus norfolcensis). We examined relationships between home range size and the availability of each 'element' and whether the usage was relative to predicted levels of use. The use of 'elements' by gliders was largely explained by their availability, but there was a preference for native vegetation patches and scattered trees. We found home range size was significantly smaller with increasing area of scattered trees and a contrasting effect with increasing area of linear roadside remnants or native vegetation patches. Our work showed that each 'element' was used and as such had a role in the conservation of the squirrel glider, but their relative value varied. We illustrate the need to assess the conservation value of countryside elements so they can be incorporated into the holistic management of agricultural landscapes. This work demonstrates the disproportional value of scattered trees, underscoring the need to specifically incorporate and/or enhance the protection and recruitment of scattered trees in biodiversity conservation policy and management. PMID:25216045

  18. Conservation of functional features of U6atac and U12 snRNAs between vertebrates and higher plants.

    PubMed

    Shukla, G C; Padgett, R A

    1999-04-01

    Splicing of U12-dependent introns requires the function of U11, U12, U6atac, U4atac, and U5 snRNAs. Recent studies have suggested that U6atac and U12 snRNAs interact extensively with each other, as well as with the pre-mRNA by Watson-Crick base pairing. The overall structure and many of the sequences are very similar to the highly conserved analogous regions of U6 and U2 snRNAs. We have identified the homologs of U6atac and U12 snRNAs in the plant Arabidopsis thaliana. These snRNAs are significantly diverged from human, showing overall identities of 65% for U6atac and 55% for U12 snRNA. However, there is almost complete conservation of the sequences and structures that are implicated in splicing. The sequence of plant U6atac snRNA shows complete conservation of the nucleotides that base pair to the 5' splice site sequences of U12-dependent introns in human. The immediately adjacent AGAGA sequence, which is found in human U6atac and all U6 snRNAs, is also conserved. High conservation is also observed in the sequences of U6atac and U12 that are believed to base pair with each other. The intramolecular U6atac stem-loop structure immediately adjacent to the U12 interaction region differs from the human sequence in 9 out of 21 positions. Most of these differences are in base pairing regions with compensatory changes occurring across the stem. To show that this stem-loop was functional, it was transplanted into a human suppressor U6atac snRNA expression construct. This chimeric snRNA was inactive in vivo but could be rescued by coexpression of a U4atac snRNA expression construct containing compensatory mutations that restored base pairing to the chimeric U6atac snRNA. These data show that base pairing of U4atac snRNA to U6atac snRNA has a required role in vivo and that the plant U6atac intramolecular stem-loop is the functional analog of the human sequence. PMID:10199569

  19. Induction of PPM1D following DNA-damaging treatments through a conserved p53 response element coincides with a shift in the use of transcription initiation sites

    SciTech Connect

    Rossi, M.; Anderson, C.; Demidov, O. N.; Appella, E.; Mazur, S. J.

    2008-12-01

    PPM1D (Wip1), a type PP2C phosphatase, is expressed at low levels in most normal tissues but is overexpressed in several types of cancers. In cells containing wild-type p53, the levels of PPM1D mRNA and protein increase following exposure to genotoxic stress, but the mechanism of regulation by p53 was unknown. PPM1D also has been identified as a CREB-regulated gene due to the presence of a cyclic AMP response element (CRE) in the promoter. Transient transfection and chromatin immunoprecipitation experiments in HCT116 cells were used to characterize a conserved p53 response element located in the 5' untranslated region (UTR) of the PPM1D gene that is required for the p53-dependent induction of transcription from the human PPM1D promoter. CREB binding to the CRE contributes to the regulation of basal expression of PPM1D and directs transcription initiation at upstream sites. Following exposure to ultraviolet (UV) or ionizing radiation, the abundance of transcripts with short 5' UTRs increased in cells containing wild-type p53, indicating increased utilization of downstream transcription initiation sites. In cells containing wild-type p53, exposure to UV resulted in increased PPM1D protein levels even when PPM1D mRNA levels remained constant, indicating post-transcriptional regulation of PPM1D protein levels.

  20. Functional analysis of a highly conserved abundant larval transcript-2 (alt-2) intron 2 repeat region of lymphatic filarial parasites.

    PubMed

    Sakthidevi, Moorthy; Hoti, Sugeerappa Laxmanappa; Kaliraj, Perumal

    2014-06-01

    The filarial-specific protein abundant larval transcript-2 (ALT-2) is expressed exclusively in the infective larval stage (L3) and is a crucial protein for establishing immunopathogenesis in human hosts. The alt-2 gene has a conserved minisatellite repeat (29 or 27bp) in intron 2 (IR2) whose significance within lymphatic filarial species is unknown. Here, we report the role of IR2 in the regulation of alt-2 gene expression using an in vitro model. Using electrophoretic mobility shift assays, we identified the presence of a putative nuclear protein binding region within IR2. Subsequent transient expression experiments in eukaryotic cell lines demonstrated that the IR2 downregulated the expression of a downstream luciferase reporter gene, which was further validated with RT-PCR. We therefore identify IR2 as a suppressor element that regulates L3 stage-specific expression of alt-2. PMID:24681262

  1. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    SciTech Connect

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

    2010-12-22

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  2. Expression of zebrafish pax6b in pancreas is regulated by two enhancers containing highly conserved cis-elements bound by PDX1, PBX and PREP factors

    PubMed Central

    Delporte, François M; Pasque, Vincent; Devos, Nathalie; Manfroid, Isabelle; Voz, Marianne L; Motte, Patrick; Biemar, Frédéric; Martial, Joseph A; Peers, Bernard

    2008-01-01

    Background PAX6 is a transcription factor playing a crucial role in the development of the eye and in the differentiation of the pancreatic endocrine cells as well as of enteroendocrine cells. Studies on the mouse Pax6 gene have shown that sequences upstream from the P0 promoter are required for expression in the lens and the pancreas; but there remain discrepancies regarding the precise location of the pancreatic regulatory elements. Results Due to genome duplication in the evolution of ray-finned fishes, zebrafish has two pax6 genes, pax6a and pax6b. While both zebrafish pax6 genes are expressed in the developing eye and nervous system, only pax6b is expressed in the endocrine cells of the pancreas. To investigate the cause of this differential expression, we used a combination of in silico, in vivo and in vitro approaches. We show that the pax6b P0 promoter targets expression to endocrine pancreatic cells and also to enteroendocrine cells, retinal neurons and the telencephalon of transgenic zebrafish. Deletion analyses indicate that strong pancreatic expression of the pax6b gene relies on the combined action of two conserved regulatory enhancers, called regions A and C. By means of gel shift assays, we detected binding of the homeoproteins PDX1, PBX and PREP to several cis-elements of these regions. In constrast, regions A and C of the zebrafish pax6a gene are not active in the pancreas, this difference being attributable to sequence divergences within two cis-elements binding the pancreatic homeoprotein PDX1. Conclusion Our data indicate a conserved role of enhancers A and C in the pancreatic expression of pax6b and emphasize the importance of the homeoproteins PBX and PREP cooperating with PDX1, in activating pax6b expression in endocrine pancreatic cells. This study also provides a striking example of how adaptative evolution of gene regulatory sequences upon gene duplication progressively leads to subfunctionalization of the paralogous gene pair. PMID

  3. Extensive lysine acetylation occurs in evolutionarily conserved metabolic pathways and parasite-specific functions during Plasmodium falciparum intraerythrocytic development

    PubMed Central

    Miao, Jun; Lawrence, Matthew; Jeffers, Victoria; Zhao, Fangqing; Parker, Daniel; Ge, Ying; Sullivan, William J.; Cui, Liwang

    2013-01-01

    Summary Lysine acetylation has emerged as a major posttranslational modification involved in diverse cellular functions. Using a combination of immunoisolation and liquid chromatography coupled to accurate mass spectrometry, we determined the first acetylome of the human malaria parasite Plasmodium falciparum during its active proliferation in erythrocytes with 421 acetylation sites identified in 230 proteins. Lysine-acetylated proteins are distributed in the nucleus, cytoplasm, mitochondrion, and apicoplast. Whereas occurrence of lysine acetylation in a similarly wide range of cellular functions suggests conservation of lysine acetylation through evolution, the Plasmodium acetylome also revealed significant divergence from those of other eukaryotes and even the closely-related parasite Toxoplasma. This divergence is reflected in the acetylation of a large number of Plasmodium-specific proteins and different acetylation sites in evolutionarily conserved acetylated proteins. A prominent example is the abundant acetylation of proteins in the glycolysis pathway but relatively deficient acetylation of enzymes in the citrate cycle. Using specific transgenic lines and inhibitors, we determined that the acetyltransferase PfMYST and lysine deacetylases play important roles in regulating the dynamics of cytoplasmic protein acetylation. The Plasmodium acetylome provides an exciting start point for further exploration of functions of acetylation in the biology of malaria parasites. PMID:23796209

  4. Dissecting the role of conserved box C/D sRNA sequences in di-sRNP assembly and function

    PubMed Central

    Bleichert, Franziska; Baserga, Susan J.

    2010-01-01

    In all three kingdoms of life, nucleotides in ribosomal RNA (rRNA) are post-transcriptionally modified. One type of chemical modification is 2′-O-ribose methylation, which is, in eukaryotes and archaea, performed by box C/D small ribonucleoproteins (box C/D sRNPs in archaea) and box C/D small nucleolar ribonucleoproteins (box C/D snoRNPs in eukaryotes), respectively. Recently, the first structure of any catalytically active box C/D s(no)RNP determined by electron microscopy and single particle analysis surprisingly demonstrated that they are dimeric RNPs. Mutational analyses of the Nop5 protein interface suggested that di-sRNP formation is also required for the in vitro catalytic activity. We have now analyzed the functional relevance of the second interface, the sRNA interface, within the box C/D di-sRNP. Mutations in conserved sequence elements of the sRNA, which allow sRNP assembly but which severely interfere with the catalytic activity of box C/D sRNPs, prevent formation of the di-sRNP. In addition, we can observe the dimeric box C/D sRNP architecture with a different box C/D sRNP, suggesting that this architecture is conserved. Together, these results provide further support for the functional relevance of the di-sRNP architecture and also provide a structural explanation for the observed defects in catalysis of 2′-O-ribose methylation. PMID:20693534

  5. Equivalent Dynamic Stiffness Mapping technique for identifying nonlinear structural elements from frequency response functions

    NASA Astrophysics Data System (ADS)

    Wang, X.; Zheng, G. T.

    2016-02-01

    A simple and general Equivalent Dynamic Stiffness Mapping technique is proposed for identifying the parameters or the mathematical model of a nonlinear structural element with steady-state primary harmonic frequency response functions (FRFs). The Equivalent Dynamic Stiffness is defined as the complex ratio between the internal force and the displacement response of unknown element. Obtained with the test data of responses' frequencies and amplitudes, the real and imaginary part of Equivalent Dynamic Stiffness are plotted as discrete points in a three dimensional space over the displacement amplitude and the frequency, which are called the real and the imaginary Equivalent Dynamic Stiffness map, respectively. These points will form a repeatable surface as the Equivalent Dynamic stiffness is only a function of the corresponding data as derived in the paper. The mathematical model of the unknown element can then be obtained by surface-fitting these points with special functions selected by priori knowledge of the nonlinear type or with ordinary polynomials if the type of nonlinearity is not pre-known. An important merit of this technique is its capability of dealing with strong nonlinearities owning complicated frequency response behaviors such as jumps and breaks in resonance curves. In addition, this technique could also greatly simplify the test procedure. Besides there is no need to pre-identify the underlying linear parameters, the method uses the measured data of excitation forces and responses without requiring a strict control of the excitation force during the test. The proposed technique is demonstrated and validated with four classical single-degree-of-freedom (SDOF) numerical examples and one experimental example. An application of this technique for identification of nonlinearity from multiple-degree-of-freedom (MDOF) systems is also illustrated.

  6. Functional Characterization of Glycoprotein H Chimeras Composed of Conserved Domains of the Pseudorabies Virus and Herpes Simplex Virus 1 Homologs

    PubMed Central

    Böhm, Sebastian W.; Backovic, Marija; Klupp, Barbara G.; Rey, Felix A.; Fuchs, Walter

    2015-01-01

    ABSTRACT Membrane fusion is indispensable for entry of enveloped viruses into host cells. The conserved core fusion machinery of the Herpesviridae consists of glycoprotein B (gB) and the gH/gL complex. Recently, crystal structures of gH/gL of herpes simplex virus 2 (HSV-2) and Epstein-Barr virus and of a core fragment of pseudorabies virus (PrV) gH identified four structurally conserved gH domains. To investigate functional conservation, chimeric genes encoding combinations of individual domains of PrV and herpes simplex virus 1 (HSV-1) gH were expressed in rabbit kidney cells, and their processing and transport to the cell surface, as well as activity in fusion assays including gB, gD, and gL of PrV or HSV-1, were analyzed. Chimeric gH containing domain I of HSV-1 and domains II to IV of PrV exhibited limited fusion activity in the presence of PrV gB and gD and HSV-1 gL, but not of PrV gL. More strikingly, chimeric gH consisting of PrV domains I to III and HSV-1 domain IV exhibited considerable fusion activity together with PrV gB, gD, and gL. Replacing PrV gB with the HSV-1 protein significantly enhanced this activity. A cell line stably expressing this chimeric gH supported replication of gH-deleted PrV. Our results confirm the specificity of domain I for gL binding, demonstrate functional conservation of domain IV in two alphaherpesviruses from different genera, and indicate species-specific interactions of this domain with gB. They also suggest that gH domains II and III might form a structural and functional unit which does not tolerate major substitutions. IMPORTANCE Envelope glycoprotein H (gH) is essential for herpesvirus-induced membrane fusion, which is required for host cell entry and viral spread. Although gH is structurally conserved within the Herpesviridae, its precise role and its interactions with other components of the viral fusion machinery are not fully understood. Chimeric proteins containing domains of gH proteins from different

  7. The functional outcome of blow-out fractures managed surgically and conservatively: our experience in 100 patients.

    PubMed

    Felding, Ulrik Ascanius; Rasmussen, Janne; Toft, Peter Bjerre; von Buchwald, Christian

    2016-07-01

    The proportion of orbital blow-out fractures (BOFs) which are operated upon varies. The purpose of this study was to determine the treatment pattern of BOFs at our tertiary trauma centre and to evaluate the functional outcomes in patients according to whether they were managed surgically or conservatively. The study design is a retrospective cohort study and the setting is Tertiary care University Hospital. The participants include patients with isolated BOFs admitted to our Trauma Unit from 2010 to 2013. Of the 100 consecutive patients included, 60 had available follow-up data. The presence of diplopia and enophthalmus was determined by reviewing the medical records. Data from the patients' initial consultation and their 3-month follow-up were also collected. Of the 60 patients whose data could be analysed, 36 had been managed surgically and 24 conservatively. Of the patients managed surgically, 25 had diplopia in peripheral gaze before surgery and 12 at 3-month follow-up. Nine had diplopia in primary gaze before surgery and none at 3-month follow-up. Five had enophthalmus before surgery and two at 3-month follow-up. Of the patients managed conservatively, eight had diplopia in peripheral gaze initially and seven at 3-month follow-up. Three had diplopia in primary gaze initially and one at 3-month follow-up. One had enophthalmus initially which was still present at 3-month follow-up. Primary gaze diplopia disappeared while secondary gaze diplopia was present in about a third of patients, whether managed surgically or conservatively at the 3-month follow-up. Standardised follow-up as well as clear indications for and against surgery are warranted. PMID:26935055

  8. Conservation Actions Based on Red Lists Do Not Capture the Functional and Phylogenetic Diversity of Birds in Brazil

    PubMed Central

    Hidasi-Neto, José; Loyola, Rafael Dias; Cianciaruso, Marcus Vinicius

    2013-01-01

    Red Lists of threatened species play a critical role in conservation science and practice. However, policy-making based on Red Lists ignores ecological and evolutionary consequences of losing biodiversity because these lists focus on species alone. To decide if relying on Red Lists alone can help to conserve communities’ functional (FD) and phylogenetic (PD) diversity, it is useful to evaluate whether Red List categories represent species with diverse ecological traits and evolutionary histories. Additionally, local scale analyses using regional Red Lists should represent more realistic pools of co-occurring species and thereby better capture eventual losses of FD and PD. Here, we used 21 life-history traits and a phylogeny for all Brazilian birds to determine whether species assigned under the IUCN global Red List, the Brazilian national, and regional Red Lists capture more FD and PD than expected by chance. We also built local Red Lists and analysed if they capture more FD and PD at the local scale. Further, we investigated whether individual threat categories have species with greater FD and PD than expected by chance. At any given scale, threat categories did not capture greater FD or PD than expected by chance. Indeed, mostly categories captured equal or less FD or PD than expected by chance. These findings would not have great consequences if Red Lists were not often considered as a major decision support tool for policy-making. Our results challenge the practice of investing conservation resources based only on species Red Lists because, from an ecological and evolutionary point of view, this would be the same as protecting similar or random sets of species. Thus, new prioritization methods, such as the EDGE of Existence initiative, should be developed and applied to conserve species’ ecological traits and evolutionary histories at different spatial scales. PMID:24039939

  9. Conservation of structural fluctuations in homologous protein kinases and its implications on functional sites.

    PubMed

    Kalaivani, Raju; de Brevern, Alexandre G; Srinivasan, Narayanaswamy

    2016-07-01

    Our aim is to explore the similarities in structural fluctuations of homologous kinases. Gaussian Network Model based Normal Mode Analysis was performed on 73 active conformation structures in Ser/Thr/Tyr kinase superfamily. Categories of kinases with progressive evolutionary divergence, viz. (i) Same kinase with many crystal structures, (ii) Within-Subfamily, (iii) Within-Family, (iv) Within-Group, and (v) Across-Group, were analyzed. We identified a flexibility signature conserved in all kinases involving residues in and around the catalytic loop with consistent low-magnitude fluctuations. However, the overall structural fluctuation profiles are conserved better in closely related kinases (Within-Subfamily and Within-family) than in distant ones (Within-Group and Across-Group). A substantial 65.4% of variation in flexibility was not accounted by variation in sequences or structures. Interestingly, we identified substructural residue-wise fluctuation patterns characteristic of kinases of different categories. Specifically, we recognized statistically significant fluctuations unique to families of protein kinase A, cyclin-dependent kinases, and nonreceptor tyrosine kinases. These fluctuation signatures localized to sites known to participate in protein-protein interactions typical of these kinase families. We report for the first time that residues characterized by fluctuations unique to the group/family are involved in interactions specific to the group/family. As highlighted for Src family, local regions with differential fluctuations are proposed as attractive targets for drug design. Overall, our study underscores the importance of consideration of fluctuations, over and above sequence and structural features, in understanding the roles of sites characteristic of kinases. Proteins 2016; 84:957-978. © 2016 Wiley Periodicals, Inc. PMID:27028938

  10. Superheavy Element Chemistry by Relativistic Density Functional Theory Electronic Structure Modeling

    NASA Astrophysics Data System (ADS)

    Zaitsevskii, A. V.; Polyaev, A. V.; Demidov, Yu. A.; Mosyagin, N. S.; Lomachuk, Yu. V.; Titov, A. V.

    2015-06-01

    Two-component density functional theory in its non-collinear formulation combined with the accurate relativistic electronic structure model defined by shape-consistent small-core pseudopotentials (PP/RDFT) provides a robust basis of efficient computational schemes for predicting energetic and structural properties of complex polyatomic systems including superheavy elements (SHEs). Because of the exceptional role of thermochromatography in the experiments on the "chemical" identification of SHEs with atomic numbers Z ≥ 112, we focus on the description of the adsorption of single SHE atoms on the surfaces of solids through cluster modeling of adsorption complexes. In some cases our results differ significantly from those of previous theoretical studies. The results of systematic comparative studies on chemical bonding in simple molecules of binary compounds of SHEs and their nearest homologs with most common light elements, obtained at the PP/RDFT level and visualized through the "chemical graphs", provide the understanding of the general chemistry of SHEs which at present cannot be derived from the experimental data. These results are used to discuss the main trends in changing chemical properties of the elements in the given group of the periodic table and demonstrate the specificity of SHEs.

  11. Functional elements in the minimal promoter of the human proton-coupled folate transporter

    SciTech Connect

    Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G.

    2009-10-09

    The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 and AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.

  12. Trace element seasonality in marine macroalgae of different functional-form groups.

    PubMed

    Malea, Paraskevi; Chatziapostolou, Anastasia; Kevrekidis, Theodoros

    2015-02-01

    Novel information on the seasonality of element accumulation in seaweeds is provided. Seasonal patterns of As, Ba, Cd, Co, Cr, Cu, Mn, Mo, Ni, Pb, Se, Sr, U, V and Zn concentrations in macroalgae belonging to different functional-form groups (Ulva intestinalis, Ulva rigida, Codium fragile, Gracilaria gracilis) from the Thessaloniki Gulf, Aegean Sea were determined and compared. Uni- and multivariate data analyses were applied. Element concentrations generally decreased during spring and/or summer, probably due to the growth effect, but a reverse trend, particularly in Ulva species, was also observed. Most elements (Cd, Co, Cr, Cu, Mo, Ni, Pb, Sr) in Ulva species displayed a comparatively low monthly variability, indicating that the extent of seasonal variation is closely related to thallus morphology and growth strategy. In particular, these data suggest that Cd, Co, Cr, Cu, Mo, Ni, Pb and Sr contents in fast-growing, sheet-like macroalgae are less influenced by the season, compared to their contents in coarsely-branched and thick-leathery macroalgae; therefore, sheet-like macroalgae may be more appropriate to be used in biomonitoring of coastal waters. The data presented could be utilized in the development of biomonitoring programmes for the protection of coastal environments. PMID:25460058

  13. Functional magnetic resonance imaging study of Piaget's conservation-of-number task in preschool and school-age children: a neo-Piagetian approach.

    PubMed

    Houdé, Olivier; Pineau, Arlette; Leroux, Gaëlle; Poirel, Nicolas; Perchey, Guy; Lanoë, Céline; Lubin, Amélie; Turbelin, Marie-Renée; Rossi, Sandrine; Simon, Grégory; Delcroix, Nicolas; Lamberton, Franck; Vigneau, Mathieu; Wisniewski, Gabriel; Vicet, Jean-René; Mazoyer, Bernard

    2011-11-01

    Jean Piaget's theory is a central reference point in the study of logico-mathematical development in children. One of the most famous Piagetian tasks is number conservation. Failures and successes in this task reveal two fundamental stages in children's thinking and judgment, shifting at approximately 7 years of age from visuospatial intuition to number conservation. In the current study, preschool children (nonconservers, 5-6 years of age) and school-age children (conservers, 9-10 years of age) were presented with Piaget's conservation-of-number task and monitored by functional magnetic resonance imaging (fMRI). The cognitive change allowing children to access conservation was shown to be related to the neural contribution of a bilateral parietofrontal network involved in numerical and executive functions. These fMRI results highlight how the behavioral and cognitive stages Piaget formulated during the 20th century manifest in the brain with age. PMID:21636095

  14. The catalytic domain CysPc of the DEK1 calpain is functionally conserved in land plants.

    PubMed

    Liang, Zhe; Demko, Viktor; Wilson, Robert C; Johnson, Kenneth A; Ahmad, Rafi; Perroud, Pierre-François; Quatrano, Ralph; Zhao, Sen; Shalchian-Tabrizi, Kamran; Otegui, Marisa S; Olsen, Odd-Arne; Johansen, Wenche

    2013-09-01

    DEK1, the single calpain of land plants, is a member of the ancient membrane bound TML-CysPc-C2L calpain family that dates back 1.5 billion years. Here we show that the CysPc-C2L domains of land plant calpains form a separate sub-clade in the DEK1 clade of the phylogenetic tree of plants. The charophycean alga Mesostigma viride DEK1-like gene is clearly divergent from those in land plants, suggesting that a major evolutionary shift in DEK1 occurred during the transition to land plants. Based on genetic complementation of the Arabidopsis thaliana dek1-3 mutant using CysPc-C2L domains of various origins, we show that these two domains have been functionally conserved within land plants for at least 450 million years. This conclusion is based on the observation that the CysPc-C2L domains of DEK1 from the moss Physcomitrella patens complements the A. thaliana dek1-3 mutant phenotype. In contrast, neither the CysPc-C2L domains from M. viride nor chimeric animal-plant calpains complement this mutant. Co-evolution analysis identified differences in the interactions between the CysPc-C2L residues of DEK1 and classical calpains, supporting the view that the two enzymes are regulated by fundamentally different mechanisms. Using the A. thaliana dek1-3 complementation assay, we show that four conserved amino acid residues of two Ca²⁺-binding sites in the CysPc domain of classical calpains are conserved in land plants and functionally essential in A. thaliana DEK1. PMID:23663131

  15. A novel fragile X syndrome mutation reveals a conserved role for the carboxy-terminus in FMRP localization and function

    PubMed Central

    Okray, Zeynep; de Esch, Celine EF; Van Esch, Hilde; Devriendt, Koen; Claeys, Annelies; Yan, Jiekun; Verbeeck, Jelle; Froyen, Guy; Willemsen, Rob; de Vrij, Femke MS; Hassan, Bassem A

    2015-01-01

    Loss of function of the FMR1 gene leads to fragile X syndrome (FXS), the most common form of intellectual disability. The loss of FMR1 function is usually caused by epigenetic silencing of the FMR1 promoter leading to expansion and subsequent methylation of a CGG repeat in the 5′ untranslated region. Very few coding sequence variations have been experimentally characterized and shown to be causal to the disease. Here, we describe a novel FMR1 mutation and reveal an unexpected nuclear export function for the C-terminus of FMRP. We screened a cohort of patients with typical FXS symptoms who tested negative for CGG repeat expansion in the FMR1 locus. In one patient, we identified a guanine insertion in FMR1 exon 15. This mutation alters the open reading frame creating a short novel C-terminal sequence, followed by a stop codon. We find that this novel peptide encodes a functional nuclear localization signal (NLS) targeting the patient FMRP to the nucleolus in human cells. We also reveal an evolutionarily conserved nuclear export function associated with the endogenous C-terminus of FMRP. In vivo analyses in Drosophila demonstrate that a patient-mimetic mutation alters the localization and function of Dfmrp in neurons, leading to neomorphic neuronal phenotypes. PMID:25693964

  16. Element-wise algorithm for modeling ductile fracture with the Rousselier yield function

    NASA Astrophysics Data System (ADS)

    Areias, P.; Dias-da-Costa, D.; Sargado, J. M.; Rabczuk, T.

    2013-12-01

    Within the theme of ductile fracture in metals, we propose an algorithm for FEM-based computational fracture based on edge rotations and smoothing of complementarity conditions. Rotation axes are the crack front nodes in surface discretizations and each rotated edge affects the position of only one or two nodes. Modified edge positions correspond to the predicted crack path. To represent softening, porous plasticity in the form of the Rousselier yield function is used. The finite strain integration algorithm makes use of a consistent updated Lagrangian formulation which makes use of polar decomposition between each increment. Constitutive updating is based on the implicit integration of a regularized non-smooth problem. The proposed alternative is advantageous when compared with enriched elements that can be significantly different than classical FEM elements and still pose challenges for ductile fracture or large amplitude sliding. For history-dependent materials, there are still some transfer of relevant quantities between meshes. However, diffusion of results is more limited than with tip or full remeshing. To illustrate the advantages of our approach, fracture examples making use of the Rousselier yield function are presented. The Ma-Sutton crack path criterion is employed. Traditional fracture benchmarks and newly proposed verification tests are solved. These were found to be very good in terms of crack path and load/displacement accuracy.

  17. Numerical modeling of wave propagation in functionally graded materials using time-domain spectral Chebyshev elements

    NASA Astrophysics Data System (ADS)

    Hedayatrasa, Saeid; Bui, Tinh Quoc; Zhang, Chuanzeng; Lim, Chee Wah

    2014-02-01

    Numerical modeling of the Lamb wave propagation in functionally graded materials (FGMs) by a two-dimensional time-domain spectral finite element method (SpFEM) is presented. The high-order Chebyshev polynomials as approximation functions are used in the present formulation, which provides the capability to take into account the through thickness variation of the material properties. The efficiency and accuracy of the present model with one and two layers of 5th order spectral elements in modeling wave propagation in FGM plates are analyzed. Different excitation frequencies in a wide range of 28-350 kHz are investigated, and the dispersion properties obtained by the present model are verified by reference results. The through thickness wave structure of two principal Lamb modes are extracted and analyzed by the symmetry and relative amplitude of the vertical and horizontal oscillations. The differences with respect to Lamb modes generated in homogeneous plates are explained. Zero-crossing and wavelet signal processing-spectrum decomposition procedures are implemented to obtain phase and group velocities and their dispersion properties. So it is attested how this approach can be practically employed for simulation, calibration and optimization of Lamb wave based nondestructive evaluation techniques for the FGMs. The capability of modeling stress wave propagation through the thickness of an FGM specimen subjected to impact load is also investigated, which shows that the present method is highly accurate as compared with other existing reference data.

  18. Optimization of a large-scale gene disruption protocol in Dictyostelium and analysis of conserved genes of unknown function

    PubMed Central

    Torija, Patricia; Robles, Alicia; Escalante, Ricardo

    2006-01-01

    Background Development of the post-genomic age in Dictyostelium will require the existence of rapid and reliable methods to disrupt genes that would allow the analysis of entire gene families and perhaps the possibility to undertake the complete knock-out analysis of all the protein-coding genes present in Dictyostelium genome. Results Here we present an optimized protocol based on the previously described construction of gene disruption vectors by in vitro transposition. Our method allows a rapid selection of the construct by a simple PCR approach and subsequent sequencing. Disruption constructs were amplified by PCR and the products were directly transformed in Dictyostelium cells. The selection of homologous recombination events was also performed by PCR. We have constructed 41 disruption vectors to target genes of unknown function, highly conserved between Dictyostelium and human, but absent from the genomes of S. cerevisiae and S. pombe. 28 genes were successfully disrupted. Conclusion This is the first step towards the understanding of the function of these conserved genes and exemplifies the easiness to undertake large-scale disruption analysis in Dictyostelium. PMID:16945142

  19. Structural and Functional Characterizations of SsgB, a Conserved Activator of Developmental Cell Division in Morphologically Complex Actinomycetes

    SciTech Connect

    Xu, Qingping; Traag, Bjørn A.; Willemse, Joost; McMullan, Daniel; Miller, Mitchell D.; Elsliger, Marc-André; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Bakolitsa, Constantina; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chruszcz, Maksymilian; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L.; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Grzechnik, Slawomir K.; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; Minor, Wladek; Mommaas, A. Mieke; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; van den Bedem, Henry; Wang, Shuren; Weekes, Dana; Hodgson, Keith O.; Wooley, John; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.; van Wezel, Gilles P.

    2010-01-20

    SsgA-like proteins (SALPs) are a family of homologous cell division-related proteins that occur exclusively in morphologically complex actinomycetes. We show that SsgB, a subfamily of SALPs, is the archetypal SALP that is functionally conserved in all sporulating actinomycetes. Sporulation-specific cell division of Streptomyces coelicolor ssgB mutants is restored by introduction of distant ssgB orthologues from other actinomycetes. Interestingly, the number of septa (and spores) of the complemented null mutants is dictated by the specific ssgB orthologue that is expressed. The crystal structure of the SsgB from Thermobifida fusca was determined at 2.6 {angstrom} resolution and represents the first structure for this family. The structure revealed similarities to a class of eukaryotic 'whirly' single-stranded DNA/RNA-binding proteins. However, the electro-negative surface of the SALPs suggests that neither SsgB nor any of the other SALPs are likely to interact with nucleotide substrates. Instead, we show that a conserved hydrophobic surface is likely to be important for SALP function and suggest that proteins are the likely binding partners.

  20. Conserved functional antagonism of CELF and MBNL proteins controls stem cell-specific alternative splicing in planarians.

    PubMed

    Solana, Jordi; Irimia, Manuel; Ayoub, Salah; Orejuela, Marta Rodriguez; Zywitza, Vera; Jens, Marvin; Tapial, Javier; Ray, Debashish; Morris, Quaid; Hughes, Timothy R; Blencowe, Benjamin J; Rajewsky, Nikolaus

    2016-01-01

    In contrast to transcriptional regulation, the function of alternative splicing (AS) in stem cells is poorly understood. In mammals, MBNL proteins negatively regulate an exon program specific of embryonic stem cells; however, little is known about the in vivo significance of this regulation. We studied AS in a powerful in vivo model for stem cell biology, the planarian Schmidtea mediterranea. We discover a conserved AS program comprising hundreds of alternative exons, microexons and introns that is differentially regulated in planarian stem cells, and comprehensively identify its regulators. We show that functional antagonism between CELF and MBNL factors directly controls stem cell-specific AS in planarians, placing the origin of this regulatory mechanism at the base of Bilaterians. Knockdown of CELF or MBNL factors lead to abnormal regenerative capacities by affecting self-renewal and differentiation sets of genes, respectively. These results highlight the importance of AS interactions in stem cell regulation across metazoans. PMID:27502555

  1. Secretion of miraculin through the function of a signal peptide conserved in the Kunitz-type soybean trypsin inhibitor family.

    PubMed

    Takai, Ayako; Satoh, Makiko; Matsuyama, Tomomi; Ito, Akane; Nakata, Rieko; Aoyama, Takashi; Inoue, Hiroyasu

    2013-06-19

    Miraculin, a glycoprotein that modifies sour tastes into sweet ones, belongs to the Kunitz-type soybean trypsin inhibitor (STI) family. To clarify the functional relation of miraculin with Kunitz-type STIs, we investigated its subcellular localization and trypsin inhibitory activity. In transgenic Arabidopsis thaliana, miraculin, fused to yellow fluorescent protein, localized to and outside the plasma membrane depending on the putative secretion signal peptide. When transgenic seedlings were cultured in liquid medium, miraculin was present in the supernatant only after cellulase treatment. No trypsin inhibitory activity was detected in native or recombinant miraculin. In conclusion, miraculin is secreted outside the plasma membrane through the function of a signal peptide, conserved in Kunitz-type STIs, whereas its trypsin inhibitory activity may be lost during its evolution. PMID:23660404

  2. Identification of Conserved and Species-Specific Functions of the Listeria monocytogenes PrsA2 Secretion Chaperone.

    PubMed

    Cahoon, Laty A; Freitag, Nancy E

    2015-10-01

    The Gram-positive bacterium Listeria monocytogenes is a facultative intracellular pathogen that relies on the regulated secretion and activity of a variety of proteins that sustain life within diverse environments. PrsA2 has recently been identified as a secreted peptidyl-prolyl cis/trans isomerase and chaperone that is dispensable for bacterial growth in broth culture but essential for L. monocytogenes virulence. Following host infection, PrsA2 contributes to the proper folding and activity of secreted proteins that are required for bacterial replication within the host cytosol and for bacterial spread to adjacent cells. PrsA2 is one member of a family of Gram-positive secretion chaperones that appear to play important roles in bacterial physiology; however, it is not known how these proteins recognize their substrate proteins or the degree to which their function is conserved across diverse Gram-positive species. We therefore examined PrsA proteins encoded by a variety of Gram-positive bacteria for functional complementation of L. monocytogenes mutants lacking prsA2. PrsA homologues encoded by Bacillus subtilis, Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus mutans, Staphylococcus aureus, and Lactococcus lactis were examined for functional complementation of a variety of L. monocytogenes PrsA2-associated phenotypes central to L. monocytogenes pathogenesis and bacterial cell physiology. Our results indicate that while selected aspects of PrsA2 function are broadly conserved among diverse Gram-positive bacteria, PrsA2 exhibits unique specificity for L. monocytogenes target proteins required for pathogenesis. The L. monocytogenes PrsA2 chaperone thus appears evolutionarily optimized for virulence factor secretion within the host cell cytosol while still maintaining aspects of activity relevant to more general features of Gram-positive protein translocation. PMID:26216425

  3. A conserved docking site modulates substrate affinity for calcineurin, signaling output, and in vivo function.

    PubMed

    Roy, Jagoree; Li, Huiming; Hogan, Patrick G; Cyert, Martha S

    2007-03-23

    Calcineurin, the conserved Ca(2+)/calmodulin-regulated protein phosphatase, mediates diverse aspects of Ca(2+)-dependent signaling. We show that substrates bind calcineurin with varying strengths and examine the impact of this affinity on signaling. We altered the calcineurin-docking site, or PxIxIT motif, in Crz1, the calcineurin-regulated transcription factor in S. cerevisiae, to decrease (Crz1(PVIAVN)) or increase (Crz1(PVIVIT)) its affinity for calcineurin. As a result, the Ca(2+)-dependent dephosphorylation and activation of Crz1(PVIAVN) are decreased, whereas Crz1(PVIVIT) is constitutively dephosphorylated and hyperactive. Surprisingly, the physiological consequences of altering calcineurin-Crz1 affinity depend on the growth conditions. Crz1(PVIVIT) improves yeast growth under several environmental stress conditions but causes a growth defect during alkaline stress, most likely by titrating calcineurin away from other substrates or regulators. Thus, calcineurin-substrate affinity determines the Ca(2+) concentration dependence and output of signaling in vivo as well as the balance between different branches of calcineurin signaling in an overall biological response. PMID:17386265

  4. The highly conserved domain of unknown function 1792 has a distinct glycosyltransferase fold

    PubMed Central

    Zhang, Hua; Zhu, Fan; Yang, Tiandi; Ding, Lei; Zhou, Meixian; Li, Jingzhi; Haslam, Stuart M; Dell, Anne; Erlandsen, Heidi; Wu, Hui

    2014-01-01

    More than 33,000 glycosyltransferases have been identified. Structural studies, however, have only revealed two distinct glycosyltransferase (GT) folds, GT-A and GT-B. Here we report a 1.34 Å resolution X-ray crystallographic structure of a previously uncharacterized “domain of unknown function” 1792 (DUF1792) and show that the domain adopts a new fold and is required for glycosylation of a family of serine-rich repeat streptococcal adhesins. Biochemical studies reveal that the domain is a glucosyltransferase, and it catalyzes the transfer of glucose to the branch point of the hexasaccharide O-linked to the serine-rich repeat of the bacterial adhesin, Fap1 of Streptococcus parasanguinis. DUF1792 homologs from both Gram-positive and Gram-negative bacteria also exhibit the activity. Thus DUF1792 represents a new family of glycosyltransferases, so we designate it as a GT-D glycosyltransferase fold. As the domain is highly conserved in bacteria and not found in eukaryotes, it can be explored as a new antibacterial target. PMID:25023666

  5. Conservation and diversity of Foxp2 expression in muroid rodents: functional implications.

    PubMed

    Campbell, Polly; Reep, Roger L; Stoll, Margaret L; Ophir, Alexander G; Phelps, Steven M

    2009-01-01

    FOXP2, the first gene causally linked to a human language disorder, is implicated in song acquisition, production, and perception in oscine songbirds, the evolution of speech and language in hominids, and the evolution of echolocation in bats. Despite the evident relevance of Foxp2 to vertebrate acoustic communication, a comprehensive description of neural expression patterns is currently lacking in mammals. Here we use immunocytochemistry to systematically describe the neural distribution of Foxp2 protein in four species of muroid rodents: Scotinomys teguina and S. xerampelinus ("singing mice"), the deer mouse, Peromyscus maniculatus, and the lab mouse, Mus musculus. While expression patterns were generally highly conserved across brain regions, we identified subtle but consistent interspecific differences in Foxp2 distribution, most notably in the medial amygdala and nucleus accumbens, and in layer V cortex throughout the brain. Throughout the brain, Foxp2 was highly enriched in areas involved in modulation of fine motor output (striatum, mesolimbic dopamine circuit, olivocerebellar system) and in multimodal sensory processing and sensorimotor integration (thalamus, cortex). We propose a generalized model for Foxp2-modulated pathways in the adult brain including, but not limited to, fine motor production and auditory perception. PMID:18972576

  6. Role of Conserved Proline Residues in Human Apolipoprotein A-IV Structure and Function*

    PubMed Central

    Deng, Xiaodi; Walker, Ryan G.; Morris, Jamie; Davidson, W. Sean; Thompson, Thomas B.

    2015-01-01

    Apolipoprotein (apo)A-IV is a lipid emulsifying protein linked to a range of protective roles in obesity, diabetes, and cardiovascular disease. It exists in several states in plasma including lipid-bound in HDL and chylomicrons and as monomeric and dimeric lipid-free/poor forms. Our recent x-ray crystal structure of the central domain of apoA-IV shows that it adopts an elongated helical structure that dimerizes via two long reciprocating helices. A striking feature is the alignment of conserved proline residues across the dimer interface. We speculated that this plays important roles in the structure of the lipid-free protein and its ability to bind lipid. Here we show that the systematic conversion of these prolines to alanine increased the thermodynamic stability of apoA-IV and its propensity to oligomerize. Despite the structural stabilization, we noted an increase in the ability to bind and reorganize lipids and to promote cholesterol efflux from cells. The novel properties of these mutants allowed us to isolate the first trimeric form of an exchangeable apolipoprotein and characterize it by small-angle x-ray scattering and chemical cross-linking. The results suggest that the reciprocating helix interaction is a common feature of all apoA-IV oligomers. We propose a model of how self-association of apoA-IV can result in spherical lipoprotein particles, a model that may have broader applications to other exchangeable apolipoprotein family members. PMID:25733664

  7. Mutational analysis of a prokaryotic recombinational enhancer element with two functions.

    PubMed Central

    Hübner, P; Arber, W

    1989-01-01

    The site-specific DNA inversion system Cin encoded by the bacteriophage P1 consists of a recombinase, two inverted crossing-over sites and a recombinational enhancer. The latter approximately 75 bp long genetic element is bifunctional due to its location within the 5' part of the cin gene encoding the recombinase. In order to determine the essential nucleotides for each of its two biological functions we randomly mutated the recombinational enhancer sequence sis(P1) and analysed both functions of the mutants obtained. Three distinct regions of this sequence were found to be important for the enhancer activity. One of them occupies the middle third of the enhancer sequence and it can suffer a number of functionally neutral base substitutions, while others are detrimental. The other two regions occupy the two flanking thirds of the enhancer. They coincide with binding sites of the host-coded protein FIS (Factor for Inversion Stimulation) needed for efficient DNA inversion in vitro. These sequences appear to be highly evolved allowing only a few mutations without affecting either of the biological functions. Taking the effect of mutations within these FIS binding sites into account a consensus sequence for the interaction with FIS was compiled. This FIS consensus implies a palindromic structure for the recombinational enhancer. This is in line with the orientation independence of enhancer action with respect to the crossing-over sites. Images PMID:2656257

  8. Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF

    PubMed Central

    Rodríguez-Tornos, Fernanda M.; San Aniceto, Iñigo; Cubelos, Beatriz; Nieto, Marta

    2013-01-01

    A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein). Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease. PMID:23382855

  9. Marine reserves lag behind wilderness in the conservation of key functional roles

    PubMed Central

    D'agata, Stéphanie; Mouillot, David; Wantiez, Laurent; Friedlander, Alan M.; Kulbicki, Michel; Vigliola, Laurent

    2016-01-01

    Although marine reserves represent one of the most effective management responses to human impacts, their capacity to sustain the same diversity of species, functional roles and biomass of reef fishes as wilderness areas remains questionable, in particular in regions with deep and long-lasting human footprints. Here we show that fish functional diversity and biomass of top predators are significantly higher on coral reefs located at more than 20 h travel time from the main market compared with even the oldest (38 years old), largest (17,500 ha) and most restrictive (no entry) marine reserve in New Caledonia (South-Western Pacific). We further demonstrate that wilderness areas support unique ecological values with no equivalency as one gets closer to humans, even in large and well-managed marine reserves. Wilderness areas may therefore serve as benchmarks for management effectiveness and act as the last refuges for the most vulnerable functional roles. PMID:27354026

  10. Marine reserves lag behind wilderness in the conservation of key functional roles.

    PubMed

    D'agata, Stéphanie; Mouillot, David; Wantiez, Laurent; Friedlander, Alan M; Kulbicki, Michel; Vigliola, Laurent

    2016-01-01

    Although marine reserves represent one of the most effective management responses to human impacts, their capacity to sustain the same diversity of species, functional roles and biomass of reef fishes as wilderness areas remains questionable, in particular in regions with deep and long-lasting human footprints. Here we show that fish functional diversity and biomass of top predators are significantly higher on coral reefs located at more than 20 h travel time from the main market compared with even the oldest (38 years old), largest (17,500 ha) and most restrictive (no entry) marine reserve in New Caledonia (South-Western Pacific). We further demonstrate that wilderness areas support unique ecological values with no equivalency as one gets closer to humans, even in large and well-managed marine reserves. Wilderness areas may therefore serve as benchmarks for management effectiveness and act as the last refuges for the most vulnerable functional roles. PMID:27354026

  11. Residual stress impairs pump function after surgical ventricular remodeling: A finite element analysis

    PubMed Central

    Pantoja, Joe Luis; Zhang, Zhihong; Tartibi, Mehrzad; Sun, Kay; Macmillan, Warrick; Guccione, Julius M.; Ge, Liang; Ratcliffe, Mark B.

    2016-01-01

    Objectives Surgical ventricular restoration (Dor procedure) is generally thought to reduce left ventricular (LV) myofiber stress (FS) but to adversely affect pump function. However, the underlying mechanism is unclear. The goal of this study was to determine the effect of residual stress (RS) on LV FS and pump function after the Dor procedure. Methods Previously described finite element models of the LV based on MRI data obtained in five sheep 16 weeks after antero-apical myocardial infarction were used. Simulated Dacron patches that were elliptical and 25% of the infarct opening area were implanted using a virtual suture technique (VIRTUAL-DOR). In each case, diastole and systole were simulated and RS, FS, LV volumes, systolic and diastolic function, and pump (Starling) function were calculated. Results VIRTUAL-DOR was associated with significant RS that was tensile (2.89±1.31 kPa) in the remote myocardium and compressive (234.15±65.53 kPa) in the borderzone (BZ). VIRTUAL-DOR+RS (compared to VIRTUAL-DOR-NO-RS) was associated with further reduction in regional diastolic and systolic FS with the greatest change in the BZ (43.5-fold and 7.1-fold respectively, p<0.0001). VIRTUAL-DOR+RS was also associated with further reduction in systolic and diastolic volumes (7.9%, p=0.0606 and 10.6%, p=0.0630, respectively). The resultant effect was a further reduction in pump function after VIRTUAL-DOR+RS. Conclusion Residual stress that occurs after the Dor procedure is positive (tensile) in the remote myocardium and negative (compressive) in the BZ and associated with reductions in fiber stress and LV volumes. The resultant effect is a further reduction in LV pump (Starling) function. PMID:26341601

  12. Morgan’s Legacy: Fruit Flies and the Functional Annotation of Conserved Genes

    PubMed Central

    Bellen, Hugo J.; Yamamoto, Shinya

    2016-01-01

    In 1915, “The Mechanism of Mendelian Heredity” was published by four prominent Drosophila geneticists. They discovered that genes form linkage groups on chromosomes inherited in a Mendelian fashion and laid the genetic foundation that promoted Drosophila as a model organism. Flies continue to offer great opportunities, including studies in the field of functional genomics. PMID:26406362

  13. The Chinese hamster Alu-equivalent sequence: a conserved highly repetitious, interspersed deoxyribonucleic acid sequence in mammals has a structure suggestive of a transposable element.

    PubMed Central

    Haynes, S R; Toomey, T P; Leinwand, L; Jelinek, W R

    1981-01-01

    A consensus sequence has been determined for a major interspersed deoxyribonucleic acid repeat in the genome of Chinese hamster ovary cells (CHO cells). This sequence is extensively homologous to (i) the human Alu sequence (P. L. Deininger et al., J. Mol. Biol., in press), (ii) the mouse B1 interspersed repetitious sequence (Krayev et al., Nucleic Acids Res. 8:1201-1215, 1980) (iii) an interspersed repetitious sequence from African green monkey deoxyribonucleic acid (Dhruva et al., Proc. Natl. Acad. Sci. U.S.A. 77:4514-4518, 1980) and (iv) the CHO and mouse 4.5S ribonucleic acid (this report; F. Harada and N. Kato, Nucleic Acids Res. 8:1273-1285, 1980). Because the CHO consensus sequence shows significant homology to the human Alu sequence it is termed the CHO Alu-equivalent sequence. A conserved structure surrounding CHO Alu-equivalent family members can be recognized. It is similar to that surrounding the human Alu and the mouse B1 sequences, and is represented as follows: direct repeat-CHO-Alu-A-rich sequence-direct repeat. A composite interspersed repetitious sequence has been identified. Its structure is represented as follows: direct repeat-residue 47 to 107 of CHO-Alu-non-Alu repetitious sequence-A-rich sequence-direct repeat. Because the Alu flanking sequences resemble those that flank known transposable elements, we think it likely that the Alu sequence dispersed throughout the mammalian genome by transposition. Images PMID:9279371

  14. Concentrations of elements in fish fillets, fish muscle plugs, and crayfish from the 2011 Missouri Department of Conservation general contaminant monitoring program

    USGS Publications Warehouse

    May, Thomas W.; Walther, Michael J.; Brumbaugh, William G.; McKee, Michael J.

    2013-01-01

    This report presents the results of a contaminant monitoring survey conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in fish fillets, fish muscle plugs, and crayfish. Fillet samples of yellow bullhead (Ameiurus natalis), golden redhorse (Moxostoma erythrurum), longear sunfish (Lepomis megalotis), and channel catfish (Ictalurus punctatus) were collected from six sites as part of the Missouri Department of Conservation’s Fish Contaminant Monitoring Program. Fish dorsal muscle plugs were collected from largemouth bass (Micropterus salmoides) at eight of the sites, and crayfish from two sites. Following preparation and analysis of the samples, highlights of the data were as follows: cadmium and lead residues were most elevated in crayfish tissue samples from the Big River at Cherokee Landing, with 1 to 8 micrograms per gram dry weight and 22 to 45 micrograms per gram dry weight, respectively. Some dorsal muscle plugs from largemouth bass collected from Clearwater Lake, Lake St. Louis, Noblett Lake, Hazel Creek Lake, and Harrison County Lake contained mercury residues (1.7 to 4.7 micrograms per gram dry weight) that exceeded the U.S. Environmental Protection Agency Water Quality Criterion of 1.5 micrograms per gram dry weight of fish tissue (equivalent to 0.30 micrograms per gram wet weight).

  15. Evolutionary conservation and function of the human embryonic stem cell specific miR-302/367 cluster.

    PubMed

    Chen, Liang; Heikkinen, Liisa; Emily Knott, K; Liang, Yanchun; Wong, Garry

    2015-12-01

    miRNA clusters define a group of related miRNAs closely localized in the genome with an evolution that remains poorly understood. The miR-302/367 cluster represents a single polycistronic transcript that produces five precursor miRNAs. The cluster is highly expressed and essential for maintenance of human embryonic stem cells. We found the cluster to be highly conserved and present in most mammals. In primates, seed sequence and miRNA structure are conserved, but inter-precursor sequences are evolving. Insertions of new miRNAs, deletions of individual miRNAs, and a cluster duplication observed in different species suggest an actively evolving cluster. Core transcriptional machinery consisting of NANOG and OCT-4 transcription factors that define stem cells are present upstream of the miR-302/367 cluster. Interestingly, we found the miR-302/367 cluster flanking region to be enriched as a target site of other miRNAs suggesting a mechanism for feedback control. Analysis of miR-302 and miR-367 targets demonstrated concordance of gene set enrichment groups at high gene ontology levels. This cluster also expresses isomiRs providing another means of establishing sequence diversity. Finally, using three different kidney tumor datasets, we observed consistent expression of miR-302 family members in normal tissue while adjacent tumor tissue showed a significant lack of expression. Clustering expression levels of miR-302 validated target genes showed a significant correlation between miR-302/367 cluster miRNAs and a subset of validated gene targets in healthy and adjacent tumor tissues. Taken together, our data show a highly conserved and still evolving miRNA cluster that may have additional unrecognized functions. PMID:26363379

  16. Identification of highly conserved residues involved in inhibition of HIV-1 RNase H function by Diketo acid derivatives.

    PubMed

    Corona, Angela; Di Leva, Francesco Saverio; Thierry, Sylvain; Pescatori, Luca; Cuzzucoli Crucitti, Giuliana; Subra, Frederic; Delelis, Olivier; Esposito, Francesca; Rigogliuso, Giuseppe; Costi, Roberta; Cosconati, Sandro; Novellino, Ettore; Di Santo, Roberto; Tramontano, Enzo

    2014-10-01

    HIV-1 reverse transcriptase (RT)-associated RNase H activity is an essential function in viral genome retrotranscription. RNase H is a promising drug target for which no inhibitor is available for therapy. Diketo acid (DKA) derivatives are active site Mg(2+)-binding inhibitors of both HIV-1 RNase H and integrase (IN) activities. To investigate the DKA binding site of RNase H and the mechanism of action, six couples of ester and acid DKAs, derived from 6-[1-(4-fluorophenyl)methyl-1H-pyrrol-2-yl)]-2,4-dioxo-5-hexenoic acid ethyl ester (RDS1643), were synthesized and tested on both RNase H and IN functions. Most of the ester derivatives showed selectivity for HIV-1 RNase H versus IN, while acids inhibited both functions. Molecular modeling and site-directed mutagenesis studies on the RNase H domain demonstrated different binding poses for ester and acid DKAs and proved that DKAs interact with residues (R448, N474, Q475, Y501, and R557) involved not in the catalytic motif but in highly conserved portions of the RNase H primer grip motif. The ester derivative RDS1759 selectively inhibited RNase H activity and viral replication in the low micromolar range, making contacts with residues Q475, N474, and Y501. Quantitative PCR studies and fluorescence-activated cell sorting (FACS) analyses showed that RDS1759 selectively inhibited reverse transcription in cell-based assays. Overall, we provide the first demonstration that RNase H inhibition by DKAs is due not only to their chelating properties but also to specific interactions with highly conserved amino acid residues in the RNase H domain, leading to effective targeting of HIV retrotranscription in cells and hence offering important insights for the rational design of RNase H inhibitors. PMID:25092689

  17. A bioinformatic survey of distribution, conservation, and probable functions of LuxR solo regulators in bacteria

    PubMed Central

    Subramoni, Sujatha; Florez Salcedo, Diana Vanessa; Suarez-Moreno, Zulma R.

    2015-01-01

    LuxR solo transcriptional regulators contain both an autoinducer binding domain (ABD; N-terminal) and a DNA binding Helix-Turn-Helix domain (HTH; C-terminal), but are not associated with a cognate N-acyl homoserine lactone (AHL) synthase coding gene in the same genome. Although a few LuxR solos have been characterized, their distributions as well as their role in bacterial signal perception and other processes are poorly understood. In this study we have carried out a systematic survey of distribution of all ABD containing LuxR transcriptional regulators (QS domain LuxRs) available in the InterPro database (IPR005143), and identified those lacking a cognate AHL synthase. These LuxR solos were then analyzed regarding their taxonomical distribution, predicted functions of neighboring genes and the presence of complete AHL-QS systems in the genomes that carry them. Our analyses reveal the presence of one or multiple predicted LuxR solos in many proteobacterial genomes carrying QS domain LuxRs, some of them harboring genes for one or more AHL-QS circuits. The presence of LuxR solos in bacteria occupying diverse environments suggests potential ecological functions for these proteins beyond AHL and interkingdom signaling. Based on gene context and the conservation levels of invariant amino acids of ABD, we have classified LuxR solos into functionally meaningful groups or putative orthologs. Surprisingly, putative LuxR solos were also found in a few non-proteobacterial genomes which are not known to carry AHL-QS systems. Multiple predicted LuxR solos in the same genome appeared to have different levels of conservation of invariant amino acid residues of ABD questioning their binding to AHLs. In summary, this study provides a detailed overview of distribution of LuxR solos and their probable roles in bacteria with genome sequence information. PMID:25759807

  18. Ankyrin-repeat containing proteins of microbes: a conserved structure with functional diversity

    PubMed Central

    Al-Khodor, Souhaila; Price, Christopher T.; Kalia, Awdhesh; Kwaik, Yousef Abu

    2009-01-01

    Summary The ankyrin repeat (ANK) is the most common protein-protein interaction motif in nature and predominantly found in eukaryotic proteins. The genome sequencing of various pathogenic or symbiotic bacteria and eukaryotic viruses identified numerous genes encoding ANK-containing proteins that were proposed to have been acquired from eukaryotes by horizontal gene transfer. However, the recent discovery of additional ANK-containing proteins encoded in the genomes of archaea and free-living bacteria suggests either a more ancient origin of the ANK motif or multiple convergent evolution events. Many bacterial pathogens employ various types of secretion systems to deliver ANK-containing proteins into eukaryotic cells where they mimic or manipulate various host functions. Understanding the molecular and biochemical functions of this family of proteins will enhance our understanding of important host-microbe interactions. PMID:19962898

  19. Functional conservation and diversification of APETALA1/FRUITFULL genes in Brachypodium distachyon.

    PubMed

    Li, Qi; Wang, Ye; Wang, Fuxiang; Guo, Yuyu; Duan, Xueqing; Sun, Jinhao; An, Hailong

    2016-08-01

    The duplicated grass APETALA1/FRUITFULL (AP1/FUL) genes have distinct but overlapping patterns of expression, suggesting their discrete roles in transition to flowering, specification of spikelet meristem identity and specification of floral organ identity. In this study, we analyzed the expression patterns and functions of four AP1/FUL paralogs (BdVRN1, BdFUL2, BdFUL3 and BdFUL4) in Brachypodium distachyon, a model plant for the temperate cereals and related grasses. Among the four genes tested, only BdVRN1 could remember the prolonged cold treatment. The recently duplicated BdVRN1 and BdFUL2 genes were expressed in a highly consistent manner and ectopic expressions of them caused similar phenotypes such as extremely early flowering and severe morphological alterations of floral organs, indicating their redundant roles in floral transition, inflorescence development and floral organ identity. In comparison, ectopic expressions of BdFUL3 and BdFUL4 only caused a moderate early flowering phenotype, suggesting their divergent function. In yeast two-hybrid assay, both BdVRN1 and BdFUL2 physically interact with SEP proteins but only BdFUL2 is able to form a homodimer. BdVRN1 also interacts weakly with BdFUL2. Our results indicate that, since the separation of AP1/FUL genes in grasses, the process of sub- or neo-functionalization has occurred and paralogs function redundantly and/or separately in flowering competence and inflorescence development. PMID:26856680

  20. From cyanobacteria to plants: conservation of PII functions during plastid evolution.

    PubMed

    Chellamuthu, Vasuki Ranjani; Alva, Vikram; Forchhammer, Karl

    2013-02-01

    This article reviews the current state-of-the-art concerning the functions of the signal processing protein PII in cyanobacteria and plants, with a special focus on evolutionary aspects. We start out with a general introduction to PII proteins, their distribution, and their evolution. We also discuss PII-like proteins and domains, in particular, the similarity between ATP-phosphoribosyltransferase (ATP-PRT) and its PII-like domain and the complex between N-acetyl-L-glutamate kinase (NAGK) and its PII activator protein from oxygenic phototrophs. The structural basis of the function of PII as an ATP/ADP/2-oxoglutarate signal processor is described for Synechococcus elongatus PII. In both cyanobacteria and plants, a major target of PII regulation is NAGK, which catalyzes the committed step of arginine biosynthesis. The common principles of NAGK regulation by PII are outlined. Based on the observation that PII proteins from cyanobacteria and plants can functionally replace each other, the hypothesis that PII-dependent NAGK control was under selective pressure during the evolution of plastids of Chloroplastida and Rhodophyta is tested by bioinformatics approaches. It is noteworthy that two lineages of heterokont algae, diatoms and brown algae, also possess NAGK, albeit lacking PII; their NAGK however appears to have descended from an alphaproteobacterium and not from a cyanobacterium as in plants. We end this article by coming to the conclusion that during the evolution of plastids, PII lost its function in coordinating gene expression through the PipX-NtcA network but preserved its role in nitrogen (arginine) storage metabolism, and subsequently took over the fine-tuned regulation of carbon (fatty acid) storage metabolism, which is important in certain developmental stages of plants. PMID:23192387

  1. Conserved phosphoprotein interaction motif is functionally interchangeable between ataxin-7 and arrestins.

    PubMed

    Mushegian, A R; Vishnivetskiy, S A; Gurevich, V V

    2000-06-13

    Olivopontocerebellar atrophy with retinal degeneration is a hereditary neurodegenerative disorder that belongs to the subtype II of the autosomal dominant cerebellar ataxias and is characterized by early-onset cerebellar and macular degeneration preceded by diagnostically useful tritan colorblindness. The gene mutated in the disease (SCA7) has been mapped to chromosome 3p12-13.5, and positional cloning identified the cause of the disease as CAG repeat expansion in this gene. The SCA7 gene product, ataxin-7, is an 897 amino acid protein with an expandable polyglutamine tract close to its N-terminus. No clues to ataxin-7 function have been obtained from sequence database searches. Here we report that ataxin-7 has a motif of ca. 50 amino acids, related to the phosphate-binding site of arrestins. To test the relevance of this sequence similarity, we introduced the putative ataxin-7 phosphate-binding site into visual arrestin and beta-arrestin. Both chimeric arrestins retain receptor-binding affinity and show characteristic high selectivity for phosphorylated activated forms of rhodopsin and beta-adrenergic receptor, respectively. Although the insertion of a Gly residue (absent in arrestins but present in the putative phosphate-binding site of ataxin-7) disrupts the function of visual arrestin-ataxin-7 chimera, it enhances the function of beta-arrestin-ataxin-7 chimera. Taken together, our data suggest that the arrestin-like site in the ataxin-7 sequence is a functional phosphate-binding site. The presence of the phosphate-binding site in ataxin-7 suggests that this protein may be involved in phosphorylation-dependent binding to its protein partner(s) in the cell. PMID:10841760

  2. Structure and Function of the SWIRM Domain, a Conserved Protein Module Found in Chromatin Regulatory Complexes

    SciTech Connect

    Da,G.; Lenkart, J.; Zhao, K.; Shiekhattar, R.; Cairns, B.; Marmorstein, R.

    2006-01-01

    The SWIRM domain is a module found in the Swi3 and Rsc8 subunits of SWI/SNF-family chromatin remodeling complexes, and the Ada2 and BHC110/LSD1 subunits of chromatin modification complexes. Here we report the high-resolution crystal structure of the SWIRM domain from Swi3 and characterize the in vitro and in vivo function of the SWIRM domains from Saccharomyces cerevisiae Swi3 and Rsc8. The Swi3 SWIRM forms a four-helix bundle containing a pseudo 2-fold axis and a helix-turn-helix motif commonly found in DNA-binding proteins. We show that the Swi3 SWIRM binds free DNA and mononucleosomes with high and comparable affinity and that a subset of Swi3 substitution mutants that display growth defects in vivo also show impaired DNA-binding activity in vitro, consistent with a nucleosome targeting function of this domain. Genetic and biochemical studies also reveal that the Rsc8 and Swi3 SWIRM domains are essential for the proper assembly and in vivo functions of their respective complexes. Together, these studies identify the SWIRM domain as an essential multifunctional module for the regulation of gene expression.

  3. Fluctuations of Matrix Elements of Regular Functions of Gaussian Random Matrices

    NASA Astrophysics Data System (ADS)

    Lytova, A.; Pastur, L.

    2009-01-01

    We find the limit of the variance and prove the Central Limit Theorem (CLT) for the matrix elements φ jk ( M), j, k=1,…, n of a regular function φ of the Gaussian matrix M (GOE and GUE) as its size n tends to infinity. We show that unlike the linear eigenvalue statistics Tr φ( M), a traditional object of random matrix theory, whose variance is bounded as n→∞ and the CLT is valid for Tr φ( M)- E{Tr φ( M)}, the variance of φ jk ( M) is O(1/ n), and the CLT is valid for sqrt{n}(\\varphi _{jk}(M)-E\\{\\varphi _{jk}(M)\\}) . This shows the role of eigenvectors in the forming of the asymptotic regime of various functions (statistics) of random matrices. Our proof is based on the use of the Fourier transform as a basic characteristic function, unlike the Stieltjes transform and moments, used in majority of works of the field. We also comment on the validity of analogous results for other random matrices.

  4. Finite element analysis on longitudinal and radial functionally graded femoral prosthesis.

    PubMed

    Oshkour, Azim Ataollahi; Abu Osman, N A; Davoodi, M M; Yau, Y H; Tarlochan, F; Wan Abas, W A B; Bayat, M

    2013-12-01

    This study focused on developing a 3D finite element model of functionally graded femoral prostheses to decrease stress shielding and to improve total hip replacement performance. The mechanical properties of the modeled functionally graded femoral prostheses were adjusted in the sagittal and transverse planes by changing the volume fraction gradient exponent. Prostheses with material changes in the sagittal and transverse planes were considered longitudinal and radial prostheses, respectively. The effects of cemented and noncemented implantation methods were also considered in this study. Strain energy and von Mises stresses were determined at the femoral proximal metaphysis and interfaces of the implanted femur components, respectively. Results demonstrated that the strain energy increased proportionally with increasing volume fraction gradient exponent, whereas the interface stresses decreased on the prostheses surfaces. A limited increase was also observed at the surfaces of the bone and cement. The periprosthetic femur with a noncemented prosthesis exhibited higher strain energy than with a cemented prosthesis. Radial prostheses implantation displayed more strain energy than longitudinal prostheses implantation in the femoral proximal part. Functionally graded materials also increased strain energy and exhibited promising potentials as substitutes of conventional materials to decrease stress shielding and to enhance total hip replacement lifespan. PMID:23922316

  5. FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events

    PubMed Central

    Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J. P.; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

    2015-01-01

    Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain–domain interactions, protein–protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist’s mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop ‘novel’ therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE PMID:26384373

  6. Finite element, stream function-vorticity solution of steady laminar natural convection

    NASA Astrophysics Data System (ADS)

    Stevens, W. N. R.

    1982-12-01

    Stream function-vorticity finite element solution of two-dimensional incompressible viscous flow and natural convection is considered. Steady state solutions of the natural convection problem have been obtained for a wide range of the two independent parameters. Use of boundary vorticity formulae or iterative satisfaction of the no-slip boundary condition is avoided by application of the finite element discretization and a displacement of the appropriate discrete equations. Solution is obtained by Newton-Raphson iteration of all equations simultaneously. The method then appears to give a steady solution whenever the flow is physically steady, but it does not give a steady solution when the flow is physically unsteady. In particular, no form of asymmetric differencing is required. The method offers a degree of economy over primitive variable formulations. Physical results are given for the square cavity convection problem. The paper also reports on earlier work in which the most commonly used boundary vorticity formula was found not to satisfy the no-slip condition, and in which segregated solution procedures were attempted with very minimal success.

  7. Effect of duct obstruction on structure, elemental composition, and function of rat submandibular glands

    SciTech Connect

    Sagstroem, S.S.; Sagulin, G.B.; Roomans, G.M. )

    1989-06-01

    Obstruction of salivary glands occurs in association with a number of pathological conditions. It has been suggested that the major changes found in the salivary glands of patients with cystic fibrosis are due to obstruction of the excretory duct by viscous mucus. In the present study, the effect of excretory duct obstruction on structure, elemental composition and function of rat submandibular gland was investigated. Obstruction was effected by infusion of a fast-hardening protein emulsion in the main excretory duct. After 1 week, and more pronounced after 2 weeks of obstruction the number of granular duct cells had decreased in the obstructed gland. X-ray microanalysis showed an increase in Mg, Ca and K, and a decrease in Na levels in the acinar cells, compared to normal glands. The contralateral glands apparently underwent compensatory hypertrophy and showed a similar pattern of changes in elemental composition. The composition of pilocarpine-induced submandibular saliva was neither in the obstructed nor in the contralateral gland significantly different from that in control glands. However, the flow rate was somewhat lower. Hence, increase in cellular Ca levels in submandibular gland acinar cells in cystic fibrosis could be secondary to duct obstruction, but the present study does not support the hypothesis that duct obstruction would result in changes in the composition of saliva.

  8. Conserved function of the lysine-based KXD/E motif in Golgi retention for endomembrane proteins among different organisms.

    PubMed

    Woo, Cheuk Hang; Gao, Caiji; Yu, Ping; Tu, Linna; Meng, Zhaoyue; Banfield, David K; Yao, Xiaoqiang; Jiang, Liwen

    2015-11-15

    We recently identified a new COPI-interacting KXD/E motif in the C-terminal cytosolic tail (CT) of Arabidopsis endomembrane protein 12 (AtEMP12) as being a crucial Golgi retention mechanism for AtEMP12. This KXD/E motif is conserved in CTs of all EMPs found in plants, yeast, and humans and is also present in hundreds of other membrane proteins. Here, by cloning selective EMP isoforms from plants, yeast, and mammals, we study the localizations of EMPs in different expression systems, since there are contradictory reports on the localizations of EMPs. We show that the N-terminal and C-terminal GFP-tagged EMP fusions are localized to Golgi and post-Golgi compartments, respectively, in plant, yeast, and mammalian cells. In vitro pull-down assay further proves the interaction of the KXD/E motif with COPI coatomer in yeast. COPI loss of function in yeast and plants causes mislocalization of EMPs or KXD/E motif-containing proteins to vacuole. Ultrastructural studies further show that RNA interference (RNAi) knockdown of coatomer expression in transgenic Arabidopsis plants causes severe morphological changes in the Golgi. Taken together, our results demonstrate that N-terminal GFP fusions reflect the real localization of EMPs, and KXD/E is a conserved motif in COPI interaction and Golgi retention in eukaryotes. PMID:26378254

  9. [Biological function of some elements and their compounds. IV. Silicon, silicon acids, silicones].

    PubMed

    Puzanowska-Tarasiewicz, Helena; Kuźmicka, Ludmiła; Tarasiewicz, Mirosław

    2009-11-01

    The review is devoted for the occurance, meaning of silicon and their compounds, especially silicon acids and silicones. Silicon participates in biosynthesis of collagen, the basic component of connective tissue. It strengthens and makes the walls of blood vessels more flexible, diminishes capillaries permeability, accelerates healing processes, has a sebostatic activity, strengthens hair and nails. This element has a beneficial effect on phosphorylation of proteins saccharides, and nucleotides. It is also essential for the formation of cytoskeleton and other cellular structures of mechanical or supportive function. Silicon is an initial substrate for obtaining silicones. These are synthetic polymers, in which silicon atoms are bound by oxygen bridges. They are used in almost all kinds of products due to their most convenient physical and chemical properties: moistening and film-forming, giving liquid form increasing solubility. Silicon acids form colloid gel, silica gel, with absorptive abilities, like active carbon. PMID:19999810

  10. Finite elements and the discrete variable representation in nonequilibrium Green's function calculations. Atomic and molecular models

    NASA Astrophysics Data System (ADS)

    Balzer, Karsten; Bauch, Sebastian; Bonitz, Michael

    2010-04-01

    In this contribution, we discuss the finite-element discrete variable representation (FE-DVR) of the nonequilibrium Green's function and its implications on the description of strongly inhomogeneous quantum systems. In detail, we show that the complementary features of FEs and the DVR allow for a notably more efficient solution of the two-time Schwinger/Keldysh/Kadanoff-Baym equations compared to a general basis approach. Particularly, the use of the FE-DVR leads to an essential speedup in computing the self-energies. As atomic and molecular examples we consider the He atom and the linear version of H+3 in one spatial dimension. For these closed-shell models we, in Hartree-Fock and second Born approximation, compute the ground-state properties and compare with the exact findings obtained from the solution of the few-particle time-dependent Schrödinger equation.

  11. Matrix elements of N-particle explicitly correlated Gaussian basis functions with complex exponential parameters.

    PubMed

    Bubin, Sergiy; Adamowicz, Ludwik

    2006-06-14

    In this work we present analytical expressions for Hamiltonian matrix elements with spherically symmetric, explicitly correlated Gaussian basis functions with complex exponential parameters for an arbitrary number of particles. The expressions are derived using the formalism of matrix differential calculus. In addition, we present expressions for the energy gradient that includes derivatives of the Hamiltonian integrals with respect to the exponential parameters. The gradient is used in the variational optimization of the parameters. All the expressions are presented in the matrix form suitable for both numerical implementation and theoretical analysis. The energy and gradient formulas have been programmed and used to calculate ground and excited states of the He atom using an approach that does not involve the Born-Oppenheimer approximation. PMID:16784284

  12. Nanoparticle-Functionalized Porous Polymer Monolith Detection Elements for Surface-Enhanced Raman Scattering

    PubMed Central

    Liu, Jikun; White, Ian; DeVoe, Don L.

    2011-01-01

    The use of porous polymer monoliths functionalized with silver nanoparticles is introduced in this work for high-sensitivity surface-enhanced Raman scattering (SERS) detection. Preparation of the SERS detection elements is a simple process comprising the synthesis of a discrete polymer monolith section within a silica capillary, followed by physically trapping silver nanoparticle aggregates within the monolith matrix. A SERS detection limit of 220 fmol for Rhodamine 6G (R6G) is demonstrated, with excellent signal stability over a 24 h period. The capability of the SERS-active monolith for label-free detection of biomolecules was demonstrated by measurements of bradykinin and cyctochrome c. The SERS-active monoliths can be readily integrated into miniaturized micro-total-analysis systems for on-line and label-free detection for a variety of biosensing, bioanalytical, and biomedical applications. PMID:21322579

  13. Finite-element-method expectation values for correlated two-electron wave functions

    SciTech Connect

    Ackermann, J.

    1995-09-01

    The Schroedinger equation for the ground state of correlated two-electron atoms is treated by an accurate finite-element method (FEM) yielding energy eigenvalues of {minus}2.903 724 377 021 a.u. for the helium atom and {minus}0.527 751 016 532 a.u. for the hydrogen ion H{sup {minus}}. By means of an adaptive multilevel grid refinement the FEM energy eigenvalue is improved to a precision of 1{times}10{sup {minus}11} a.u., which is comparable to results obtained with sophisticated global basis sets. The local and overall precision of the FEM wave function approximation is studied and discussed. Benchmark values for the expectation values {l_angle}{ital r}{sup 2}{r_angle}, {l_angle}{ital r}{r_angle}, {l_angle}1/{ital r}{r_angle}, and {l_angle}1/{ital r}{sub 12}{r_angle} are presented.

  14. Structural and functional characterization of a conserved pair of bacterial cellulose-oxidizing lytic polysaccharide monooxygenases

    PubMed Central

    Forsberg, Zarah; Mackenzie, Alasdair K.; Sørlie, Morten; Røhr, Åsmund K.; Helland, Ronny; Arvai, Andrew S.; Vaaje-Kolstad, Gustav; Eijsink, Vincent G. H.

    2014-01-01

    For decades, the enzymatic conversion of cellulose was thought to rely on the synergistic action of hydrolytic enzymes, but recent work has shown that lytic polysaccharide monooxygenases (LPMOs) are important contributors to this process. We describe the structural and functional characterization of two functionally coupled cellulose-active LPMOs belonging to auxiliary activity family 10 (AA10) that commonly occur in cellulolytic bacteria. One of these LPMOs cleaves glycosidic bonds by oxidation of the C1 carbon, whereas the other can oxidize both C1 and C4. We thus demonstrate that C4 oxidation is not confined to fungal AA9-type LPMOs. X-ray crystallographic structures were obtained for the enzyme pair from Streptomyces coelicolor, solved at 1.3 Å (ScLPMO10B) and 1.5 Å (CelS2 or ScLPMO10C) resolution. Structural comparisons revealed differences in active site architecture that could relate to the ability to oxidize C4 (and that also seem to apply to AA9-type LPMOs). Despite variation in active site architecture, the two enzymes exhibited similar affinities for Cu2+ (12–31 nM), redox potentials (242 and 251 mV), and electron paramagnetic resonance spectra, with only the latter clearly different from those of chitin-active AA10-type LPMOs. We conclude that substrate specificity depends not on copper site architecture, but rather on variation in substrate binding and orientation. During cellulose degradation, the members of this LPMO pair act in synergy, indicating different functional roles and providing a rationale for the abundance of these enzymes in biomass-degrading organisms. PMID:24912171

  15. Conserved form and function of the germinal epithelium through 500 million years of vertebrate evolution.

    PubMed

    Grier, Harry J; Uribe, Mari Carmen; Lo Nostro, Fabiana L; Mims, Steven D; Parenti, Lynne R

    2016-08-01

    The germinal epithelium, i.e., the site of germ cell production in males and females, has maintained a constant form and function throughout 500 million years of vertebrate evolution. The distinguishing characteristic of germinal epithelia among all vertebrates, males, and females, is the presence of germ cells among somatic epithelial cells. The somatic epithelial cells, Sertoli cells in males or follicle (granulosa) cells in females, encompass and isolate germ cells. Morphology of all vertebrate germinal epithelia conforms to the standard definition of an epithelium: epithelial cells are interconnected, border a body surface or lumen, are avascular and are supported by a basement membrane. Variation in morphology of gonads, which develop from the germinal epithelium, is correlated with the evolution of reproductive modes. In hagfishes, lampreys, and elasmobranchs, the germinal epithelia of males produce spermatocysts. A major rearrangement of testis morphology diagnoses osteichthyans: the spermatocysts are arranged in tubules or lobules. In protogynous (female to male) sex reversal in teleost fishes, female germinal epithelial cells (prefollicle cells) and oogonia transform into the first male somatic cells (Sertoli cells) and spermatogonia in the developing testis lobules. This common origin of cell types from the germinal epithelium in fishes with protogynous sex reversal supports the homology of Sertoli cells and follicle cells. Spermatogenesis in amphibians develops within spermatocysts in testis lobules. In amniotes vertebrates, the testis is composed of seminiferous tubules wherein spermatogenesis occurs radially. Emerging research indicates that some mammals do not have lifetime determinate fecundity. The fact emerged that germinal epithelia occur in the gonads of all vertebrates examined herein of both sexes and has the same form and function across all vertebrate taxa. Continued study of the form and function of the germinal epithelium in vertebrates

  16. Structural and functional characterization of a conserved pair of bacterial cellulose-oxidizing lytic polysaccharide monooxygenases.

    PubMed

    Forsberg, Zarah; Mackenzie, Alasdair K; Sørlie, Morten; Røhr, Åsmund K; Helland, Ronny; Arvai, Andrew S; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H

    2014-06-10

    For decades, the enzymatic conversion of cellulose was thought to rely on the synergistic action of hydrolytic enzymes, but recent work has shown that lytic polysaccharide monooxygenases (LPMOs) are important contributors to this process. We describe the structural and functional characterization of two functionally coupled cellulose-active LPMOs belonging to auxiliary activity family 10 (AA10) that commonly occur in cellulolytic bacteria. One of these LPMOs cleaves glycosidic bonds by oxidation of the C1 carbon, whereas the other can oxidize both C1 and C4. We thus demonstrate that C4 oxidation is not confined to fungal AA9-type LPMOs. X-ray crystallographic structures were obtained for the enzyme pair from Streptomyces coelicolor, solved at 1.3 Å (ScLPMO10B) and 1.5 Å (CelS2 or ScLPMO10C) resolution. Structural comparisons revealed differences in active site architecture that could relate to the ability to oxidize C4 (and that also seem to apply to AA9-type LPMOs). Despite variation in active site architecture, the two enzymes exhibited similar affinities for Cu(2+) (12-31 nM), redox potentials (242 and 251 mV), and electron paramagnetic resonance spectra, with only the latter clearly different from those of chitin-active AA10-type LPMOs. We conclude that substrate specificity depends not on copper site architecture, but rather on variation in substrate binding and orientation. During cellulose degradation, the members of this LPMO pair act in synergy, indicating different functional roles and providing a rationale for the abundance of these enzymes in biomass-degrading organisms. PMID:24912171

  17. Conserved elements in the nanos3 3'UTR of olive flounder are responsible for the selective retention of RNA in germ cells.

    PubMed

    Li, Meijie; Tan, Xungang; Sui, Yulei; Jiao, Shuang; Wu, Zhihao; You, Feng

    2016-08-01

    In teleost fish, primordial germ cells (PGCs) are specified very early during embryogenesis and migrate to the site that gonads are formed. A previous study indicated that nanos3 is specifically expressed in PGCs, and the 3' untranslated region (UTR) of nanos3 is responsible for the localization of mRNA in these cells. In this study, we aimed to investigate the functional regions of nanos3 3'UTR in olive flounder using truncated and mutated nanos3 3'UTRs fused to chimeric RNAs and microinjected into fertilized zebrafish eggs. The results indicated that a 68-bp functional element in the nanos3 3'UTR of olive flounder played important roles in the protection and degradation of RNA. Within this element, a U-rich region was identified to be responsible for the protection of RNA in PGCs and two GCAC sites for the degradation of RNA in somatic cells. The first GCAC was located adjacently to the U-rich region and the second GCAC within the U-rich region. Overall, we concluded that the two GCACs were the binding sites of miR-430, a microRNA that suppresses translation, whereas the U-rich region was the binding site of Dnd, a protein that antagonizes the miR-430-mediated silencing of mRNA. PMID:27085583

  18. Physical therapy in conservative (functional) treatment of acute achilles tendon rupture.

    PubMed

    Vavra-Hadziahmetović, N; Hadziahmetović, Z; Smajlović, F

    2000-01-01

    1. All patients returned to their daily working activities. 2. We did not record a single case with complications. 3. With regard to other methods of treatment the functional treatment is apparently without an alternative, but at the same time requires methods that seek full engagement of a surgeon, a radiologist and a physiatrist. 4. In order to avoid compromising and make the treatment successful, it is necessary to keep up with the implementation protocol, to have available adequate coeffective shoes or other means, and to possess certain level of clinical experience. PMID:10934845

  19. Wave interactions and stability of the Riemann solutions for a scalar conservation law with a discontinuous flux function

    NASA Astrophysics Data System (ADS)

    Shen, Chun; Sun, Meina

    2013-08-01

    This paper is devoted to studying the interactions of elementary waves for a model of a scalar conservation law with a flux function involving discontinuous coefficients. In order to cover all the situations completely, we take the initial data as three piecewise constant states and the middle region is regarded as the perturbed region with small distance. It is proved that the Riemann solutions are stable under the local small perturbations of the Riemann initial data by letting the perturbed parameter tend to zero. The proof is based on the detailed analysis of the interactions of stationary wave discontinuities with shock waves and rarefaction waves. Moreover, the global structures and large time asymptotic behaviors of the solutions are constructed and analyzed case by case.

  20. Human Polynucleotide Phosphorylase (hPNPaseold-35): An evolutionary conserved gene with an expanding repertoire of RNA degradation functions

    PubMed Central

    Das, Swadesh K.; Bhutia, Sujit K.; Sokhi, Upneet K.; Dash, Rupesh; Azab, Belal; Sarkar, Devanand; Fisher, Paul B.

    2016-01-01

    Human polynucleotide phosphorylase (hPNPaseold-35) is an evolutionary conserved RNA processing enzyme with expanding roles in regulating cellular physiology. hPNPaseold-35 was cloned using an innovative “overlapping pathway screening” strategy designed to identify genes coordinately regulated during the processes of cellular differentiation and senescence. Although hPNPaseold-35 structurally and biochemically resembles PNPase of other species, overexpression and inhibition studies reveal that hPNPaseold-35 has evolved to serve more specialized and diversified functions in humans. Targeting specific mRNA or non-coding small microRNA (miRNA), hPNPaseold-35 modulates gene expression that in turn plays a pivotal role in regulating normal physiological and pathological processes. In these contexts, targeted overexpression of hPNPaseold-35 represents a novel strategy to selectively downregulate RNA expression and consequently intervene in a variety of pathophysiological conditions. PMID:21151174

  1. The Presence of Fucogalactoxyloglucan and Its Synthesis in Rice Indicates Conserved Functional Importance in Plants1[OPEN

    PubMed Central

    Liu, Lifeng; Paulitz, Jonathan; Pauly, Markus

    2015-01-01

    The predominant structure of the hemicellulose xyloglucan (XyG) found in the cell walls of dicots is a fucogalactoXyG with an XXXG core motif, whereas in the Poaceae (grasses and cereals), the structure of XyG is less xylosylated (XXGGn core motif) and lacks fucosyl residues. However, specialized tissues of rice (Oryza sativa) also contain fucogalactoXyG. Orthologous genes of the fucogalactoXyG biosynthetic machinery of Arabidopsis (Arabidopsis thaliana) are present in the rice genome. Expression of these rice genes, including fucosyl-, galactosyl-, and acetyltransferases, in the corresponding Arabidopsis mutants confirmed their activity and substrate specificity, indicating that plants in the Poaceae family have the ability to synthesize fucogalactoXyG in vivo. The data presented here provide support for a functional conservation of XyG structure in higher plants. PMID:25869654

  2. Honey Bee Allatostatins Target Galanin/Somatostatin-Like Receptors and Modulate Learning: A Conserved Function?

    PubMed Central

    Urlacher, Elodie; Soustelle, Laurent; Parmentier, Marie-Laure; Verlinden, Heleen; Gherardi, Marie-Julie; Fourmy, Daniel; Mercer, Alison R.

    2016-01-01

    Sequencing of the honeybee genome revealed many neuropeptides and putative neuropeptide receptors, yet functional characterization of these peptidic systems is scarce. In this study, we focus on allatostatins, which were first identified as inhibitors of juvenile hormone synthesis, but whose role in the adult honey bee (Apis mellifera) brain remains to be determined. We characterize the bee allatostatin system, represented by two families: allatostatin A (Apime-ASTA) and its receptor (Apime-ASTA-R); and C-type allatostatins (Apime-ASTC and Apime-ASTCC) and their common receptor (Apime-ASTC-R). Apime-ASTA-R and Apime-ASTC-R are the receptors in bees most closely related to vertebrate galanin and somatostatin receptors, respectively. We examine the functional properties of the two honeybee receptors and show that they are transcriptionally expressed in the adult brain, including in brain centers known to be important for learning and memory processes. Thus we investigated the effects of exogenously applied allatostatins on appetitive olfactory learning in the bee. Our results show that allatostatins modulate learning in this insect, and provide important insights into the evolution of somatostatin/allatostatin signaling. PMID:26741132

  3. Sex pheromone desaturase functioning in a primitive Ostrinia moth is cryptically conserved in congeners’ genomes

    PubMed Central

    Fujii, Takeshi; Ito, Katsuhiko; Tatematsu, Mitsuko; Shimada, Toru; Katsuma, Susumu; Ishikawa, Yukio

    2011-01-01

    (E)-11- and (Z)-11-tetradecenyl acetate are the most common female sex pheromone components in Ostrinia moths. The Δ11-desaturase expressed in the pheromone gland (PG) of female moths is a key enzyme that introduces a double bond into pheromone molecules. A single Δ11-desaturase of Ostrinia nubilalis, OnubZ/E11, has been shown to produce an ∼7:3 mixture of (E)-11- and (Z)-11-tetradecenoate from the substrate tetradecanoate. In contrast, the sex pheromone of Ostrinia latipennis, a primitive species of Ostrinia, is (E)-11-tetradecenol. This pheromone is unique in that it is not acetylated, and includes no Z isomer. In the present study, through the cloning and functional analysis of a PG-specific Δ11-desaturase in O. latipennis, we showed that the absence of the Z isomer in the pheromone is attributable to the strict product specificity of the Δ11-desaturase in this species, LATPG1. Phylogenetic analysis revealed that LATPG1 was not closely related to OnubZ/E11. Rather, it was closely related to retroposon-linked cryptic Δ11-desaturases (ezi-Δ11) found in the genomes of O. nubilalis and Ostrinia furnacalis. Taken together, the results showed that an unusual Δ11-desaturase is functionally expressed in O. latipennis, although the genes encoding this enzyme appear to be cryptic in congeners. PMID:21444802

  4. Conserved regulatory mechanism controls the development of cells with rooting functions in land plants

    PubMed Central

    Tam, Thomas Ho Yuen; Catarino, Bruno; Dolan, Liam

    2015-01-01

    Land plants develop filamentous cells—root hairs, rhizoids, and caulonemata—at the interface with the soil. Members of the group XI basic helix–loop–helix (bHLH) transcription factors encoded by LOTUS JAPONICUS ROOTHAIRLESS1-LIKE (LRL) genes positively regulate the development of root hairs in the angiosperms Lotus japonicus, Arabidopsis thaliana, and rice (Oryza sativa). Here we show that auxin promotes rhizoid and caulonema development by positively regulating the expression of PpLRL1 and PpLRL2, the two LRL genes in the Physcomitrella patens genome. Although the group VIII bHLH proteins, AtROOT HAIR DEFECTIVE6 and AtROOT HAIR DEFECTIVE SIX-LIKE1, promote root-hair development by positively regulating the expression of AtLRL3 in A. thaliana, LRL genes promote rhizoid development independently of PpROOT HAIR DEFECTIVE SIX-LIKE1 and PpROOT HAIR DEFECITVE SIX-LIKE2 (PpRSL1 and PpRSL2) gene function in P. patens. Together, these data demonstrate that both LRL and RSL genes are components of an ancient auxin-regulated gene network that controls the development of tip-growing cells with rooting functions among most extant land plants. Although this network has diverged in the moss and the angiosperm lineages, our data demonstrate that the core network acted in the last common ancestor of the mosses and angiosperms that existed sometime before 420 million years ago. PMID:26150509

  5. Scalar conservation laws with discontinuous flux function: II. On the stability of the viscous profiles

    NASA Astrophysics Data System (ADS)

    Diehl, S.; Wallin, N.-O.

    1996-02-01

    The equation{partial u}/{partial t} + partial /{partial x}left( {H(x)f(u) + left( {1 - H(x)} right)g(u)} right) = 0, where H is Heaviside's step function, appears for example in continuous sedimentation of solid particles in a liquid, in two-phase flow, in traffic-flow analysis and in ion etching. The discontinuity of the flux function at x=0 causes a discontinuity of a solution, which is not uniquely determined by the initial data. By a viscous profile of this discontinuity we mean a stationary solution of u t +( F δ) x =ɛ u xx , where F δ is a smooth approximation of the discontinuous flux, i.e., H is smoothed. We present some results on the stability of the viscous profiles, which means that a small disturbance tends to zero uniformly as t→∞. This is done by weighted energy methods, where the weight (depending on f and g) plays a crucial role.

  6. Conserved regulatory mechanism controls the development of cells with rooting functions in land plants.

    PubMed

    Tam, Thomas Ho Yuen; Catarino, Bruno; Dolan, Liam

    2015-07-21

    Land plants develop filamentous cells-root hairs, rhizoids, and caulonemata-at the interface with the soil. Members of the group XI basic helix-loop-helix (bHLH) transcription factors encoded by LOTUS JAPONICUS ROOTHAIRLESS1-LIKE (LRL) genes positively regulate the development of root hairs in the angiosperms Lotus japonicus, Arabidopsis thaliana, and rice (Oryza sativa). Here we show that auxin promotes rhizoid and caulonema development by positively regulating the expression of PpLRL1 and PpLRL2, the two LRL genes in the Physcomitrella patens genome. Although the group VIII bHLH proteins, AtROOT HAIR DEFECTIVE6 and AtROOT HAIR DEFECTIVE SIX-LIKE1, promote root-hair development by positively regulating the expression of AtLRL3 in A. thaliana, LRL genes promote rhizoid development independently of PpROOT HAIR DEFECTIVE SIX-LIKE1 and PpROOT HAIR DEFECITVE SIX-LIKE2 (PpRSL1 and PpRSL2) gene function in P. patens. Together, these data demonstrate that both LRL and RSL genes are components of an ancient auxin-regulated gene network that controls the development of tip-growing cells with rooting functions among most extant land plants. Although this network has diverged in the moss and the angiosperm lineages, our data demonstrate that the core network acted in the last common ancestor of the mosses and angiosperms that existed sometime before 420 million years ago. PMID:26150509

  7. Microscopy-based Saccharomyces cerevisiae complementation model reveals functional conservation and redundancy of N-terminal acetyltransferases.

    PubMed

    Osberg, Camilla; Aksnes, Henriette; Ninzima, Sandra; Marie, Michaël; Arnesen, Thomas

    2016-01-01

    N-terminal acetylation is a highly abundant protein modification catalyzed by N-terminal acetyltransferases (NATs) NatA-NatG. The Saccharomyces cerevisiae protein Arl3 depends on interaction with Sys1 for its localization to the Golgi and this targeting strictly requires NatC-mediated N-terminal acetylation of Arl3. We utilized the Arl3 acetylation-dependent localization phenotype as a model system for assessing the functional conservation and in vivo redundancy of several human NATs. The catalytic subunit of human NatC, hNaa30 (Mak3), restored Arl3 localization in the absence of yNaa30, but only in the presence of either yeast or human Naa35 subunit (Mak10). In contrast, hNaa35 was not able to replace its yeast orthologue without the co-expression of hNaa30, suggesting co-evolution of the two NatC subunits. The most recently discovered and organellar human NAT, NatF/Naa60, restored the Golgi localization of Arl3 in the absence of yNaa30. Interestingly, this was also true for hNaa60 lacking its membrane-binding domain whereas hNaa50 did not complement NatC function. This in vivo redundancy reflects NatC and NatF´s overlapping in vitro substrate specificities. The yeast model presented here provides a robust and rapid readout of NatC and NatF activity in vivo, and revealed evolutionary conservation of the NatC complex and redundancy between NatC and NatF. PMID:27555049

  8. Elucidation of the specific function of the conserved threonine triad responsible for human L-asparaginase autocleavage and substrate hydrolysis*

    PubMed Central

    Nomme, Julian; and, Ying Su; Lavie, Arnon

    2014-01-01

    Our long-term goal is the design of a human L-asparaginase (hASNase3) variant, suitable for use in cancer therapy without the immunogenicity problems associated with the currently used bacterial enzymes. Asparaginases catalyze the hydrolysis of the amino acid asparagine to aspartate and ammonia. The key property allowing for the depletion of blood asparagine by bacterial asparaginases is their low micromolar KM value. In contrast, human enzymes have a millimolar KM for asparagine. Towards the goal of engineering an hASNase3 variant with micromolar KM, we conducted a structure/function analysis of the conserved catalytic threonine triad of this human enzyme. As a member of the N-terminal nucleophile (Ntn) family, to become enzymatically active, hASNase3 must undergo autocleavage between residues Gly167 and Thr168. To determine the individual contribution of each of the three conserved active site threonines (threonine triad, Thr168, Thr186, Thr219) for the enzyme-activating autocleavage and asparaginase reactions, we prepared the T168S, T186V and T219A/V mutants. These mutants were tested for their ability to cleave and to catalyze asparagine hydrolysis, in addition to being examined structurally. We also elucidated the first Ntn plant-type asparaginase structure in the covalent intermediate state. Our studies indicate that while not all the triad threonines are required for the cleavage reaction, all are essential for the asparaginase activity. The increased understanding of hASNase3 function resulting from these studies reveals the key regions that govern cleavage and the asparaginase reaction, which may inform the design of variants that attain a low KM for asparagine. PMID:24768817

  9. The Eps1p Protein Disulfide Isomerase Conserves Classic Thioredoxin Superfamily Amino Acid Motifs but Not Their Functional Geometries

    PubMed Central

    Biran, Shai; Gat, Yair; Fass, Deborah

    2014-01-01

    The widespread thioredoxin superfamily enzymes typically share the following features: a characteristic α-β fold, the presence of a Cys-X-X-Cys (or Cys-X-X-Ser) redox-active motif, and a proline in the cis configuration abutting the redox-active site in the tertiary structure. The Cys-X-X-Cys motif is at the solvent-exposed amino terminus of an α-helix, allowing the first cysteine to engage in nucleophilic attack on substrates, or substrates to attack the Cys-X-X-Cys disulfide, depending on whether the enzyme functions to reduce, isomerize, or oxidize its targets. We report here the X-ray crystal structure of an enzyme that breaks many of our assumptions regarding the sequence-structure relationship of thioredoxin superfamily proteins. The yeast Protein Disulfide Isomerase family member Eps1p has Cys-X-X-Cys motifs and proline residues at the appropriate primary structural positions in its first two predicted thioredoxin-fold domains. However, crystal structures show that the Cys-X-X-Cys of the second domain is buried and that the adjacent proline is in the trans, rather than the cis isomer. In these configurations, neither the “active-site” disulfide nor the backbone carbonyl preceding the proline is available to interact with substrate. The Eps1p structures thus expand the documented diversity of the PDI oxidoreductase family and demonstrate that conserved sequence motifs in common folds do not guarantee structural or functional conservation. PMID:25437863

  10. Spt-Ada-Gcn5-Acetyltransferase (SAGA) Complex in Plants: Genome Wide Identification, Evolutionary Conservation and Functional Determination

    PubMed Central

    Srivastava, Rakesh; Rai, Krishan Mohan; Pandey, Bindu; Singh, Sudhir P.; Sawant, Samir V.

    2015-01-01

    The recruitment of RNA polymerase II on a promoter is assisted by the assembly of basal transcriptional machinery in eukaryotes. The Spt-Ada-Gcn5-Acetyltransferase (SAGA) complex plays an important role in transcription regulation in eukaryotes. However, even in the advent of genome sequencing of various plants, SAGA complex has been poorly defined for their components and roles in plant development and physiological functions. Computational analysis of Arabidopsis thaliana and Oryza sativa genomes for SAGA complex resulted in the identification of 17 to 18 potential candidates for SAGA subunits. We have further classified the SAGA complex based on the conserved domains. Phylogenetic analysis revealed that the SAGA complex proteins are evolutionary conserved between plants, yeast and mammals. Functional annotation showed that they participate not only in chromatin remodeling and gene regulation, but also in different biological processes, which could be indirect and possibly mediated via the regulation of gene expression. The in silico expression analysis of the SAGA components in Arabidopsis and O. sativa clearly indicates that its components have a distinct expression profile at different developmental stages. The co-expression analysis of the SAGA components suggests that many of these subunits co-express at different developmental stages, during hormonal interaction and in response to stress conditions. Quantitative real-time PCR analysis of SAGA component genes further confirmed their expression in different plant tissues and stresses. The expression of representative salt, heat and light inducible genes were affected in mutant lines of SAGA subunits in Arabidopsis. Altogether, the present study reveals expedient evidences of involvement of the SAGA complex in plant gene regulation and stress responses. PMID:26263547

  11. Microscopy-based Saccharomyces cerevisiae complementation model reveals functional conservation and redundancy of N-terminal acetyltransferases

    PubMed Central

    Osberg, Camilla; Aksnes, Henriette; Ninzima, Sandra; Marie, Michaël; Arnesen, Thomas

    2016-01-01

    N-terminal acetylation is a highly abundant protein modification catalyzed by N-terminal acetyltransferases (NATs) NatA-NatG. The Saccharomyces cerevisiae protein Arl3 depends on interaction with Sys1 for its localization to the Golgi and this targeting strictly requires NatC-mediated N-terminal acetylation of Arl3. We utilized the Arl3 acetylation-dependent localization phenotype as a model system for assessing the functional conservation and in vivo redundancy of several human NATs. The catalytic subunit of human NatC, hNaa30 (Mak3), restored Arl3 localization in the absence of yNaa30, but only in the presence of either yeast or human Naa35 subunit (Mak10). In contrast, hNaa35 was not able to replace its yeast orthologue without the co-expression of hNaa30, suggesting co-evolution of the two NatC subunits. The most recently discovered and organellar human NAT, NatF/Naa60, restored the Golgi localization of Arl3 in the absence of yNaa30. Interestingly, this was also true for hNaa60 lacking its membrane-binding domain whereas hNaa50 did not complement NatC function. This in vivo redundancy reflects NatC and NatF´s overlapping in vitro substrate specificities. The yeast model presented here provides a robust and rapid readout of NatC and NatF activity in vivo, and revealed evolutionary conservation of the NatC complex and redundancy between NatC and NatF. PMID:27555049

  12. Local Responses to Participatory Conservation in Annapurna Conservation Area, Nepal

    NASA Astrophysics Data System (ADS)

    Khadka, Damodar; Nepal, Sanjay K.

    2010-02-01

    Biodiversity conservation has undergone a profound change in philosophy, policies and management approaches over the last forty years. The traditional top-down approach to nature protection has been widely criticized for failing to include critical social elements in management practices, and is being gradually replaced by a slew of participatory strategies under the rubric of bottom-up conservation. The new approach recognizes local communities as key partners in wildlife management and seeks their participation in social development and biodiversity conservation. However, every social context is different in its structure and functions, and in the way social groups respond to calls for participation. In order to gain a better understanding of the approach and the barriers encountered in its implementation, a questionnaire survey of 188 households was employed in the communities of the Upper Mustang extension of Annapurna Conservation Area (ACA) in Nepal. The study provides a comparative analysis of community participation and its barriers between Non-Tourist (NT) and Tourist (TV) villages. The results revealed important differences between the two groups in terms of their participation in community programs, barriers to participation, and perception of benefits from participation. Owing to their distinct spatial, demographic and attitudinal differences, the two village groups have their own sets of needs, values and motivation factors which cannot be generalized and treated as such. The research clearly identifies the need for the conservation agency to be creative in devising strategies and initiatives appropriate to specific social groups so as to optimize their input in participatory conservation.

  13. Local responses to participatory conservation in Annapurna conservation area, Nepal.

    PubMed

    Khadka, Damodar; Nepal, Sanjay K

    2010-02-01

    Biodiversity conservation has undergone a profound change in philosophy, policies and management approaches over the last forty years. The traditional top-down approach to nature protection has been widely criticized for failing to include critical social elements in management practices, and is being gradually replaced by a slew of participatory strategies under the rubric of bottom-up conservation. The new approach recognizes local communities as key partners in wildlife management and seeks their participation in social development and biodiversity conservation. However, every social context is different in its structure and functions, and in the way social groups respond to calls for participation. In order to gain a better understanding of the approach and the barriers encountered in its implementation, a questionnaire survey of 188 households was employed in the communities of the Upper Mustang extension of Annapurna Conservation Area (ACA) in Nepal. The study provides a comparative analysis of community participation and it